WO2014164399A1 - Root-preferred promoter and methods of use - Google Patents
Root-preferred promoter and methods of use Download PDFInfo
- Publication number
- WO2014164399A1 WO2014164399A1 PCT/US2014/022310 US2014022310W WO2014164399A1 WO 2014164399 A1 WO2014164399 A1 WO 2014164399A1 US 2014022310 W US2014022310 W US 2014022310W WO 2014164399 A1 WO2014164399 A1 WO 2014164399A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- seq
- sequence
- promoter
- expression
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/822—Reducing position variability, e.g. by the use of scaffold attachment region/matrix attachment region (SAR/MAR); Use of SAR/MAR to regulate gene expression
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present disclosure relates to the field of plant molecular biology, more particularly to regulation of gene expression in plants.
- heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed. Where expression in specific tissues or organs is desired, tissue-preferred promoters may be used. Where gene expression in response to a stimulus is desired, inducible promoters are the regulatory element of choice. In contrast, where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilized. Additional regulatory sequences upstream and/or downstream from the core promoter sequence may be included in the expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a transgenic plant.
- a DNA sequence in particular tissues or organs of a plant.
- increased resistance of a plant to infection by soil- and air-borne pathogens might be accomplished by genetic manipulation of the plant's genome to comprise a tissue-preferred promoter operably linked to a heterologous pathogen-resistance gene such that pathogen-resistance proteins are produced in the desired plant tissue.
- RNA transcript that interferes with translation of the mRNA of the native DNA sequence.
- tissue-preferred, particularly root-preferred, promoters that can serve as regulatory regions for expression of heterologous nucleotide sequences of interest in a tissue-preferred manner are needed for genetic manipulation of plants.
- compositions and methods for regulating expression of a heterologous nucleotide sequence of interest in a plant or plant cell comprise novel nucleotide sequences for promoters that initiate transcription.
- Embodiments of the disclosure comprise the nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ I D NO: 4, or a complement thereof, a nucleotide sequence comprising at least 20 contiguous nucleotides of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, wherein said sequence initiates transcription in a plant cell, and a nucleotide sequence comprising a sequence having at least 85% sequence identity to the sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, wherein said sequence initiates transcription in the plant cell.
- a method for expressing a heterologous nucleotide sequence in a plant or plant cell comprises introducing into a plant or a plant cell an expression cassette comprising a heterologous nucleotide sequence of interest operably linked to one of the promoters of the present disclosure.
- the promoter sequences are useful for controlling the expression of the operably linked heterologous gene sequence.
- the heterologous gene sequence of interest is expressed in a root-preferred manner.
- the method comprises introducing into a plant cell an expression cassette comprising a promoter of the disclosure operably linked to a heterologous gene sequence of interest.
- heterologous gene sequence of interest can provide for modification of the phenotype of the plant. Such modification includes modulating the production of an endogenous product, as to amount, relative distribution or the like or production of an exogenous expression product to provide for a novel function or product in the plant.
- the heterologous gene sequence of interest comprises a gene product that confers herbicide resistance, pathogen resistance, insect resistance, and/or altered tolerance to salt, cold or drought.
- Expression cassettes comprising the promoter sequences of the disclosure operably linked to a heterologous gene sequence of interest are provided. Additionally provided are transformed plant cells, plant tissues, seeds, and plants.
- compositions and methods drawn to plant promoters and methods of their use comprise nucleotide sequences for the promoter region of a sorghum (Sorghum bicolor) gene with strong similarity to pLTP, which is expressed in a root specific manner.
- compositions further comprise DNA constructs comprising a nucleotide sequence for the promoter region of the sorghum pLTP gene operably linked to a heterologous gene sequence of interest.
- the promoter set forth in SEQ ID NO: 1 was given the identifying name "Sb-pLTP promoter.”
- the present disclosure provides for isolated nucleic acid molecules comprising the nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO: 4.
- the Sb-pLTP promoter sequences of the present disclosure include nucleotide constructs that allow initiation of transcription in a plant.
- the Sb- pLTP promoter sequence allows initiation of transcription in a tissue-preferred, more particularly in a root-preferred manner.
- Such constructs of the disclosure comprise regulated transcription initiation regions associated with plant developmental regulation.
- the compositions of the present disclosure include DNA constructs comprising a gene sequence of interest operably linked to the Sb-pLTP promoter sequence.
- the sequence for the Sb-pLTP promoter region is set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.
- a putative TATA box is located from positions 1280-1287 and a putative transcription start site is located at position 1315 of SEQ ID NO: 1.
- Compositions of the disclosure include the nucleotide sequences for the Sb-pLTP promoter (SEQ ID NO: 1 ) and fragments and variants thereof, including but not limited to SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.
- the promoter sequences of the disclosure are useful for expressing sequences of interest in a tissue- preferred, particularly a root-preferred manner.
- the nucleotide sequences of the disclosure also find use in the construction of expression vectors for subsequent expression of a heterologous gene sequence in a plant of interest or as probes for the isolation of other Sb-pLTP-like promoters.
- the disclosure encompasses isolated or substantially purified nucleic acid compositions.
- An “isolated” or “purified” nucleic acid molecule or biologically active portion thereof is substantially free of other cellular material or culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when chemically synthesized.
- An “isolated” nucleic acid is free of sequences (optimally protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- the Sb-pLTP promoter sequences of the disclosure may be isolated from the 5' untranslated region flanking their respective transcription initiation sites.
- fragments and variants of the disclosed promoter nucleotide sequences are also encompassed by the present disclosure.
- fragments and variants of the Sb- PLTP promoter sequence of SEQ ID NO: 1 including but not limited to SEQ ID NO: 2, SEQ ID NO 3 and SEQ ID NO: 4, may be used in the DNA constructs of the disclosure.
- the term "fragment” refers to a portion of the nucleic acid sequence. Fragments of an Sb-pLTP promoter sequence may retain the biological activity of initiating transcription, more particularly driving transcription in a root-preferred manner. Alternatively, fragments of a nucleotide sequence which are useful as hybridization probes may not necessarily retain biological activity.
- Fragments of a nucleotide sequence for the promoter region of the Sb-pLTP gene may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence of the disclosure for the promoter region of the gene.
- a biologically active portion of an Sb-pLTP promoter can be prepared by isolating a portion of the Sb-pLTP promoter sequence of the disclosure, and assessing the promoter activity of the portion.
- Nucleic acid molecules that are fragments of an Sb-pLTP promoter nucleotide sequence comprise at least about 16, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1 100, 1200 or 1300, nucleotides or up to the number of nucleotides present in a full-length Sb-pLTP promoter sequence disclosed herein (for example, 1397 nucleotides for SEQ ID NO: 1 ).
- variants means substantially similar sequences.
- naturally occurring variants can be identified with the use of well- known molecular biology techniques, such as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined herein.
- PCR polymerase chain reaction
- a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide.
- a "native" nucleotide sequence comprises a naturally occurring nucleotide sequence.
- naturally occurring variants can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below.
- Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis.
- variants of a particular nucleotide sequence of the disclosure will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular nucleotide sequence as determined by sequence alignment programs and parameters described elsewhere herein.
- a biologically active variant of a nucleotide sequence of the disclosure may differ from that sequence by as few as 1 -15 nucleic acid residues, as few as 1 -10, such as 6-10, as few as 5, as few as 4, 3, 2 or even 1 nucleic acid residue.
- the nucleic acid sequence has at least 50%, 55%, 60%,
- Variant nucleotide sequences also encompass sequences derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, Sb-pLTP nucleotide sequences can be manipulated to create a new Sb-pLTP promoter. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci.
- nucleotide sequences of the disclosure can be used to isolate corresponding sequences from other organisms, particularly other plants, more particularly other monocots. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire Sb-pLTP sequence set forth herein or to fragments thereof are encompassed by the present disclosure.
- oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from genomic DNA extracted from any plant of interest.
- Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), hereinafter Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds.
- PCR PCR Strategies
- nested primers single specific primers
- degenerate primers gene-specific primers
- vector-specific primers partially-mismatched primers
- hybridization techniques all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a chosen organism.
- the hybridization probes may be labeled with a detectable group such as 32 P or any other detectable marker.
- probes for hybridization can be made by labeling synthetic oligonucleotides based on the Sb-pLTP promoter sequence of the disclosure.
- the entire Sb-pLTP promoter sequence disclosed herein or one or more portions thereof may be used as a probe capable of specifically hybridizing to corresponding Sb-pLTP promote sequences and messenger RNAs.
- probes include sequences that are unique among Sb-pLTP promoter sequence and are at least about 10 nucleotides in length or at least about 20 nucleotides in length.
- Such probes may be used to amplify corresponding Sb-pLTP promoter sequence from a chosen plant by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism.
- Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook.
- Hybridization of such sequences may be carried out under stringent conditions.
- stringent conditions or “stringent hybridization conditions” are intended to mean conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background).
- Stringent conditions are sequence-dependent and will be different in different circumstances.
- target sequences that are 100% complementary to the probe can be identified (homologous probing).
- stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
- a probe is less than about 1000 nucleotides in length, optimally less than 500 nucleotides in length.
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1 .0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCI, 1 % SDS at 37 °C, and a wash in 0.5X to 1X SSC at 55 to 60 °C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1 % SDS at 37 °C, and a final wash in 0.1 X SSC at 60 to 65 °C for a duration of at least 30 minutes. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
- T m thermal melting point
- M the molarity of monovalent cations
- %GC the percentage of guanosine and cytosine nucleotides in the DNA
- % form the percentage of formamide in the hybridization solution
- L the length of the hybrid in base pairs.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1 °C for each 1 % of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10 °C. Generally, stringent conditions are selected to be about 5 °C lower than the T m for the specific sequence and its complement at a defined ionic strength and pH.
- isolated sequences that have root-preferred promoter activity and which hybridize under stringent conditions to the Sb-pLTP promoter sequences disclosed herein or to fragments thereof, are encompassed by the present disclosure.
- sequence relationships between two or more nucleic acids or polynucleotides are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence”, (b) “comparison window”, (c) “sequence identity”, (d) “percentage of sequence identity”, and (e) “substantial identity”.
- reference sequence is a defined sequence used as a basis for sequence comparison.
- a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence or the complete cDNA or gene sequence.
- comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100 or longer.
- Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA). Alignments using these programs can be performed using the default parameters.
- CLUSTAL program is well described by Higgins et al. (1988) Gene 73:237-244 (1988); Higgins et al.
- Gapped BLAST in BLAST 2.0
- PSI-BLAST in BLAST 2.0
- PSI-BLAST in BLAST 2.0
- sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof.
- An "equivalent program” is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
- GAP uses the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443- 453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty.
- gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively.
- the default gap creation penalty is 50 while the default gap extension penalty is 3.
- the gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200.
- the gap creation and gap extension penalties can be 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
- GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity.
- the Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment.
- Percent Identity is the percent of the symbols that actually match.
- Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored.
- a similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold.
- the scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
- sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
- percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
- sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
- Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity”. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
- percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
- polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70% sequence identity, optimally at least 80%, more optimally at least 90%, and most optimally at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters.
- stringent conditions are selected to be about 5 °C lower than the T m for the specific sequence at a defined ionic strength and pH.
- stringent conditions encompass temperatures in the range of about 1 °C to about 20 °C lower than the T m , depending upon the desired degree of stringency as otherwise qualified herein.
- the term plant includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like.
- Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species.
- Progeny, variants, and mutants of the regenerated plants are also included within the scope of the disclosure, provided that these parts comprise the introduced polynucleotides.
- the promoters of present disclosure may be used for transformation of any plant species, including, but not limited to, monocots and dicots.
- plant species include corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B.
- juncea particularly those Brassica species useful as sources of seed oil, alfalfa ⁇ Medicago sativa), rice ⁇ Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot
- Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans ⁇ Phaseolus vulgaris), lima beans ⁇ Phaseolus limensis), peas ⁇ Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- tomatoes Locopersicon esculentum
- lettuce e.g., Lactuca sativa
- green beans ⁇ Phaseolus vulgaris lima beans ⁇ Phaseolus limensis
- members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- Ornamentals include azalea ⁇ Rhododendron spp.), hydrangea ⁇ Macrophylla hydrangea), hibiscus ⁇ Hibiscus rosasanensis), roses ⁇ Rosa spp.), tulips ⁇ Tulipa spp.), daffodils ⁇ Narcissus spp.), petunias ⁇ Petunia hybrida), carnation ⁇ Dianthus caryophyllus), poinsettia ⁇ Euphorbia pulcherrima), and chrysanthemum.
- Conifers that may be employed in practicing the present disclosure include, for example, pines such as loblolly pine ⁇ Pinus taeda), slash pine ⁇ Pinus elliotii), ponderosa pine ⁇ Pinus ponderosa), lodgepole pine ⁇ Pinus contorta), and Monterey pine ⁇ Pinus radiata); Douglas-fir ⁇ Pseudotsuga menziesii); Western hemlock ⁇ Tsuga canadensis); Sitka spruce ⁇ Picea glauca); redwood ⁇ Sequoia sempervirens); true firs such as silver fir ⁇ Abies amabilis) and balsam fir ⁇ Abies balsamea); and cedars such as Western red cedar ⁇ Thuja plicata) and Alaska yellow-cedar ⁇ Chamaecyparis nootkatensis).
- pines such as loblolly pine ⁇ Pin
- plants of the present disclosure are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.).
- corn and soybean plants are optimal, and in yet other embodiments corn plants are optimal.
- plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants.
- Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc.
- Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
- Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mung bean, lima bean, fava bean, lentils, chickpea, etc.
- Heterologous coding sequences expressed by the Sb-pLTP promoters of the disclosure may be used for varying the phenotype of a plant.
- Various changes in phenotype are of interest including modifying expression of a gene in a plant root, altering a plant's pathogen or insect defense mechanism, increasing the plants tolerance to herbicides in a plant, altering root development to respond to environmental stress, modulating the plant's response to salt, temperature (hot and cold), drought, and the like.
- These results can be achieved by the expression of a heterologous gene sequence of interest comprising an appropriate gene product.
- the heterologous gene sequence of interest is an endogenous plant sequence whose expression level is increased in the plant or plant part.
- the results can be achieved by providing for a reduction of expression of one or more endogenous gene products, particularly enzymes, transporters or cofactors or by affecting nutrient uptake in the plant.
- endogenous gene products particularly enzymes, transporters or cofactors
- These changes result in a change in phenotype of the transformed plant.
- General categories of nucleotide sequences of interest for the present disclosure include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
- More specific categories of transgenes include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, and environmental stress resistance (altered tolerance to cold, salt, drought, etc). It is recognized that any gene of interest can be operably linked to the promoter of the disclosure and expressed in the plant.
- Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European corn borer, and the like.
- Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S. Patent Nos. 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881 ; and Geiser et al. (1986) Gene 48:109); and the like.
- Genes encoding disease resistance traits include detoxification genes, such as those which detoxify fumonisin (U.S. Patent No. 5,792,931 ); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science
- Herbicide resistance traits may include genes coding for resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonylurea- type herbicides (e.g., the acetolactate synthase (ALS) gene containing mutations leading to such resistance, in particular the S4 and/or Hra mutations), genes coding for resistance to herbicides that act to inhibit action of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene), glyphosate (e.g., the EPSPS gene and the GAT gene; see, for example, U.S. Publication No.
- ALS acetolactate synthase
- ALS sulfonylurea- type herbicides
- glutamine synthase such as phosphinothricin or basta
- glyphosate e.g., the EPSPS gene and the GAT gene; see
- the bar gene encodes resistance to the herbicide basta
- the nptll gene encodes resistance to the antibiotics kanamycin and geneticin
- the ALS-gene mutants encode resistance to the herbicide chlorsulfuron.
- Glyphosate resistance is imparted by mutant 5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes.
- EPEP 5-enolpyruvl-3-phosphikimate synthase
- aroA aroA genes.
- U.S. Patent No. 4,940,835 to Shah et al. discloses the nucleotide sequence of a form of EPSPS which can confer glyphosate resistance.
- U.S. Patent No. 5,627,061 to Barry et al. also describes genes encoding EPSPS enzymes. See also U.S. Patent Nos. 6,248,876 B1 ; 6,040,497;
- Glyphosate resistance is also imparted to plants that express a gene that encodes a glyphosate oxido-reductase enzyme as described more fully in U.S. Patent Nos. 5,776,760 and 5,463,175, which are incorporated herein by reference for this purpose.
- glyphosate resistance can be imparted to plants by the over expression of genes encoding glyphosate N-acetyltransferase. See, for example, U.S. Patent 7,714,188 and 7,462,481 .
- Exogenous products include plant enzymes and products as well as those from other sources including prokaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
- genes and their associated phenotype examples include the gene which encodes viral coat protein and/or RNA or other viral or plant genes that confer viral resistance; genes that confer fungal resistance; genes that promote yield improvement; and genes that provide for resistance to stress, such as cold, dehydration resulting from drought, heat and salinity, toxic metal or trace elements or the like.
- heterologous gene sequence operably linked to the Sb-pLTP promoter disclosed herein may be an antisense sequence for a targeted gene.
- promoter sequences disclosed herein may be operably linked to antisense DNA sequences to reduce or inhibit expression of a native protein in the plant root.
- RNAi refers to a series of related techniques to reduce the expression of genes (See for example U.S. Patent No. 6,506,559). Older techniques referred to by other names are now thought to rely on the same mechanism, but are given different names in the literature. These include “antisense inhibition,” the production of antisense RNA transcripts capable of suppressing the expression of the target protein, and “co- suppression” or “sense-suppression,” which refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Patent No. 5,231 ,020, incorporated herein by reference).
- Sb-pLTP promoter of the embodiments may be used to drive expression of constructs that will result in RNA interference including microRNAs and siRNAs.
- promoter or “transcriptional initiation region” mean a regulatory region of DNA usually comprising a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular coding sequence.
- a promoter may additionally comprise other recognition sequences generally positioned upstream or 5' to the TATA box, referred to as upstream promoter elements, which influence the transcription initiation rate. It is recognized that having identified the nucleotide sequences for the promoter regions disclosed herein, it is within the state of the art to isolate and identify further regulatory elements in the 5' untranslated region upstream from the particular promoter regions identified herein. Additionally, chimeric promoters may be provided.
- Such chimeras include portions of the promoter sequence fused to fragments and/or variants of heterologous transcriptional regulatory regions.
- the promoter regions disclosed herein can comprise upstream regulatory elements such as, those responsible for tissue and temporal expression of the coding sequence, enhancers and the like.
- the promoter elements, which enable expression in the desired tissue such as the root can be identified, isolated and used with other core promoters to confer root-preferred expression.
- core promoter is intended to mean a promoter without promoter elements.
- regulatory element also refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which includes sequences which control the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site.
- a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element.
- a promoter element comprises a core promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as discussed elsewhere in this application) that modify gene expression.
- nucleotide sequences, located within introns or 3' of the coding region sequence may also contribute to the regulation of expression of a coding region of interest.
- suitable introns include, but are not limited to, the maize IVS6 intron or the maize actin intron.
- a regulatory element may also include those elements located downstream (3') to the site of transcription initiation or within transcribed regions or both.
- a post-transcriptional regulatory element may include elements that are active following transcription initiation, for example translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants.
- the regulatory elements or variants or fragments thereof, of the present disclosure may be operatively associated with heterologous regulatory elements or promoters in order to modulate the activity of the heterologous regulatory element. Such modulation includes enhancing or repressing transcriptional activity of the heterologous regulatory element, modulating post-transcriptional events or either enhancing or repressing transcriptional activity of the heterologous regulatory element and modulating post- transcriptional events.
- one or more regulatory elements or fragments thereof, of the present disclosure may be operatively associated with constitutive, inducible or tissue specific promoters or fragment thereof, to modulate the activity of such promoters within desired tissues in plant cells.
- the regulatory sequences of the present disclosure or variants or fragments thereof, when operably linked to a heterologous gene sequence of interest can drive root- preferred expression of the heterologous gene sequence in the root (or root part) of the plant expressing this construct.
- root-preferred means that expression of the heterologous gene sequence is most abundant in the root or a root part, including, for example, the root cap, apical meristem, protoderm, ground meristem, procambium, endodermis, cortex, vascular cortex, epidermis, and the like. While some level of expression of the heterologous gene sequence may occur in other plant tissue types, expression occurs most abundantly in the root or root part, including primary, lateral and adventitious roots.
- heterologous gene sequence is a sequence that is not naturally occurring with the promoter sequence of the disclosure. While this gene sequence is heterologous to the promoter sequence, it may be homologous or native or heterologous or foreign, to the plant host.
- the isolated promoter sequences of the present disclosure can be modified to provide for a range of expression levels of the heterologous gene sequence. Thus, less than the entire promoter region may be utilized and the ability to drive expression of the nucleotide sequence of interest retained. It is recognized that expression levels of the mRNA may be altered in different ways with deletions of portions of the promoter sequences. The mRNA expression levels may be decreased or alternatively, expression may be increased as a result of promoter deletions if, for example, there is a negative regulatory element (for a repressor) that is removed during the truncation process. Generally, at least about 20 nucleotides of an isolated promoter sequence will be used to drive expression of a nucleotide sequence.
- Enhancers are nucleotide sequences that act to increase the expression of a promoter region. Enhancers are known in the art and include the SV40 enhancer region, the 35S enhancer element, and the like. Some enhancers are also known to alter normal promoter expression patterns, for example, by causing a promoter to be expressed constitutively when without the enhancer, the same promoter is expressed only in one specific tissue or a few specific tissues. Modifications of the isolated promoter sequences of the present disclosure can provide for a range of expression of the heterologous gene sequence. Thus, they may be modified to be weak promoters or strong promoters.
- a "weak promoter” means a promoter that drives expression of a coding sequence at a low level.
- a "low level” of expression is intended to mean expression at levels of about 1/10,000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts.
- a strong promoter drives expression of a coding sequence at a high level or at about 1/10 transcripts to about 1/100 transcripts to about 1/1 ,000 transcripts.
- promoters of the disclosure may be used with their native Sb-pLTP coding sequences to increase or decrease expression, thereby resulting in a change in phenotype of the transformed plant. This phenotypic change could further affect an increase or decrease in levels of metal ions in tissues of the transformed plant.
- the nucleotide sequences disclosed in the present disclosure are useful in the genetic manipulation of any plant.
- the Sb-pLTP promoter sequence is useful in this aspect when operably linked with a heterologous gene sequence whose expression is to be controlled to achieve a desired phenotypic response.
- operably linked means that the transcription or translation of the heterologous gene sequence is under the influence of the promoter sequence.
- the nucleotide sequences for the promoters of the disclosure may be provided in expression cassettes along with heterologous gene sequences of interest for expression in the plant of interest, more particularly for expression in the root of the plant.
- Such expression cassettes will comprise a transcriptional initiation region comprising one of the promoter nucleotide sequences of the present disclosure or variants or fragments thereof, operably linked to the heterologous gene sequence.
- Such an expression cassette can be provided with a plurality of restriction sites for insertion of the nucleotide sequence to be under the transcriptional regulation of the regulatory regions.
- the expression cassette may additionally contain selectable marker genes as well as 3' termination regions.
- the expression cassette can include, in the 5'-3' direction of transcription, a transcriptional initiation region (i.e., a promoter or variant or fragment thereof, of the disclosure), a translational initiation region, a heterologous gene sequence of interest, a translational termination region and, optionally, a transcriptional termination region functional in the host organism.
- the regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide of the embodiments may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide of the embodiments may be heterologous to the host cell or to each other.
- heterologous in reference to a sequence is a sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
- a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus or the promoter is not the native promoter for the operably linked polynucleotide.
- the native sequences may be expressed. Such constructs would change expression levels of the Sb-pLTP protein in the plant or plant cell. Thus, the phenotype of the plant or plant cell is altered.
- the termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the DNA sequence being expressed, the plant host or any combination thereof).
- Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991 ) Mol. Gen. Genet. 262:141-144; Proudfoot (1991 ) Cell 64:671-674; Sanfacon et al. (1991 ) Genes Dev.
- the expression cassette comprising the sequences of the present disclosure may also contain at least one additional nucleotide sequence for a gene to be cotransformed into the organism.
- the additional sequence(s) can be provided on another expression cassette.
- nucleotide sequences whose expression is to be under the control of the root-preferred promoter sequence of the present disclosure and any additional nucleotide sequence(s) may be optimized for increased expression in the transformed plant. That is, these nucleotide sequences can be synthesized using plant preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-1 1 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831 , 5,436,391 , and Murray et al. (1989) Nucleic Acids Res.
- Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well- characterized sequences that may be deleterious to gene expression.
- the G-C content of the heterologous gene sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
- the expression cassettes may additionally contain 5' leader sequences.
- leader sequences can act to enhance translation.
- Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Nat. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Allison et al. (1986) Virology 154:9-20); MDMV leader (Maize Dwarf Mosaic Virus); human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al.
- EMCV leader Engelphalomyocarditis 5' noncoding region
- potyvirus leaders for example, TEV leader (Tobacco Etch Virus) (Allison et al. (1986) Virology 154:9-20)
- MDMV leader Maize Dwarf Mosaic
- introns such as the maize Ubiquitin intron (Christensen and Quail (1996) Transgenic Res. 5:213-218; Christensen et al. (1992) Plant Molecular Biology 18:675-689) or the maize Adhl intron (Kyozuka et al. (1991 ) Mol. Gen. Genet. 228:40-48; Kyozuka et al. (1990) Maydica 35:353-357), and the like.
- introns such as the maize Ubiquitin intron (Christensen and Quail (1996) Transgenic Res. 5:213-218; Christensen et al. (1992) Plant Molecular Biology 18:675-689) or the maize Adhl intron (Kyozuka et al. (1991 ) Mol. Gen. Genet. 228:40-48; Kyozuka et al. (1990) Maydica 35:353-357), and the like.
- the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
- adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like.
- in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, for example, transitions and transversions may be involved.
- Reporter genes or selectable marker genes may be included in the expression cassettes.
- suitable reporter genes known in the art can be found in, for example, Jefferson et al. (1991 ) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic Publishers), pp. 1-33; DeWet et al. (1987) Mol. Cell. Biol. 7:725-737; Goff et al. (1990) EMBO J. 9:2517-2522; Kain et al. (1995) BioTechniques 19:650-655; and Chiu et al. (1996) Current Biology 6:325-330.
- Selectable marker genes for selection of transformed cells or tissues can include genes that confer antibiotic resistance or resistance to herbicides.
- selectable marker genes include, but are not limited to, genes encoding resistance to chloramphenicol (Herrera Estrella et al. (1983) EMBO J. 2:987-992); methotrexate (Herrera Estrella et al. (1983) Nature 303:209-213; Meijer et al. (1991 ) Plant Mol. Biol. 76:807-820); hygromycin (Waldron et al. (1985) Plant Mol. Biol. 5:103-108; and Zhijian et al. (1995) Plant Science 708:219-227); streptomycin (Jones et al. (1987) Mol. Gen. Genet.
- genes that could serve utility in the recovery of transgenic events but might not be required in the final product would include, but are not limited to, examples such as GUS (beta-glucuronidase; Jefferson (1987) Plant Mol. Biol. Rep. 5:387), GFP (green fluorescence protein; Chalfie et al. (1994) Science 263:802), luciferase (Riggs et al. (1987) Nucleic Acids Res. 75(79j:81 15 and Luehrsen et al. (1992) Methods Enzymol. 276:397-414) and the maize genes encoding for anthocyanin production (Ludwig et al. (1990) Science 247:449).
- the expression cassette comprising the Sb-pLTP promoter of the present disclosure operably linked to a nucleotide sequence of interest can be used to transform any plant. In this manner, genetically modified plants, plant cells, plant tissue, seed, root, and the like can be obtained.
- the methods of the disclosure involve introducing a polypeptide or polynucleotide into a plant.
- "Introducing" is intended to mean presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant.
- the methods of the disclosure do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant.
- Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.
- “Stable transformation” is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof.
- “Transient transformation” is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
- Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al. , U.S. Patent Nos. 5,563,055 and Zhao et al.
- Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.
- the DNA constructs comprising the promoter sequences of the disclosure can be provided to a plant using a variety of transient transformation methods.
- transient transformation methods include, but are not limited to, viral vector systems and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA.
- the transcription from the particle-bound DNA can occur, but the frequency with which it is released to become integrated into the genome is greatly reduced.
- Such methods include the use particles coated with polyethylimine (PEI; Sigma #P3143).
- the polynucleotide of the disclosure may be introduced into plants by contacting plants with a virus or viral nucleic acids.
- such methods involve incorporating a nucleotide construct of the disclosure within a viral DNA or RNA molecule.
- Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules are known in the art. See, for example, U.S. Patent Nos. 5,889,191 , 5,889,190, 5,866,785, 5,589,367, 5,316,931 , and Porta et al. (1996) Molecular Biotechnology 5:209-221 ; herein incorporated by reference.
- the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system. See, for example, W099/25821 , W099/25854, WO99/25840, W099/25855, and W099/25853, all of which are herein incorporated by reference.
- the polynucleotide of the disclosure can be contained in transfer cassette flanked by two non-identical recombination sites.
- the transfer cassette is introduced into a plant have stably incorporated into its genome a target site which is flanked by two non- identical recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.
- the cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81- 84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present disclosure provides transformed seed (also referred to as "transgenic seed") having a nucleotide construct of the disclosure, for example, an expression cassette of the disclosure, stably incorporated into its genome.
- the article "a” and “an” are used herein to refer to one or more than one (i.e., to at least one) of the grammatical object of the article.
- an element means one or more element.
- the Sb-pLTP gene was identified through a search of expression profiling data obtained from the sorghum elite inbred line BTX623. Tissue from greenhouse grown plants was sampled from each of the major organs at a 6 leaf vegetative stage and in late bloom stage (just prior to pollen shed). Tissue from reproductive organs was also collected. Three replicates were taken for each sample, with each replicate consisting of nine plants. RNA was isolated from each of the replicates; reverse transcribed, and sequenced using Solexa DNA sequencing technology (lllumina). Sequence "tags" were aligned with publically available genomic sequence to identify the gene. A comparison of expression for each gene across all the samples identified those genes with root- preferred expression.
- the Sb-pLTP promoter was isolated by PCR, using genomic DNA extracted from BTX623 sorghum leaf tissue as a template.
- the primers used had restriction enzyme sites added to the ends to facilitate downstream cloning: Notl to the forward primer and BamHI to the reverse primer.
- the sequence of the forward primer was
- GCGGCCGCCAAACTCAGTTTATCACCAAAGAC (SEQ ID NO: 5) and the reverse primer was GGATCCGGCGATCGAGCTGATTGCACAC (SEQ ID NO: 6).
- PCR was conducted using High Fidelity PCR Master kit (Roche #12140314001 ) according to manufacturer's protocol. The PCR product was isolated via agarose gel electrophoresis and cloned into a PCR cloning plasmid. The promoter was isolated by restriction digestion with Notl and BamHI and cloned into maize expression vectors, where it was sequenced. Analysis of the sequence for motifs revealed a putative TATA box approximately 1 10 bp from the 3'end of the sequence and a putative transcription start site approximately 82 bp from the 3' end.
- Example 4 to allow characterization of the Sb-pLTP promoter (SEQ ID NO: 1 ).
- the promoter was operably linked to the Adh1 intron (intron 1 ) and the B-glucuronidase (GUS) gene (abbreviated as Sb-pLTP:ADH:GUS) to understand the expression pattern directed by the promoter in maize.
- the promoter was also operably linked to an insecticidal gene, IG1 , with and without the Adh1 intron (intron 1 ) (abbreviated as Sb-pLTP:ADH:IG1 and Sb-pLTP:IG1 , respectively).
- IG1 was used to quantitate expression levels directed by the promoter.
- the ADH intron was included for the purpose of potentially increasing expression.
- Vegetative growth stages are determined by the number of collared leaves on the plant. Therefore, a plant at V6 stage has 6 fully collared leaves. Leaf and root tissue were sampled from each plant at this stage. The plants were then allowed to grow to early R1 stage, a point just prior to pollen shed, where silk, stalk, and tassel tissue were collected. Finally, pollen was collected when the plants started shedding.
- results from Sb-pLTP:ADH:GUS plants showed that the Sb-pLTP promoter drove expression in maize roots. Expression was detected in the meristematic region, as well as in the elongation and mature regions of several events. Expression was not detected in the region of the meristem closest to the root cap and not in the root cap of any event. Expression was not detected in leaf, stalk, tassel or silk tissues. It also was not detected in pollen. Table 1 : Maize Expression Results 1 for Sb-pLTP:ADH:GUS
- Histochemical staining data is represented on a 0-3 scale with the well characterized maize Ubi-1 promoter serving as a reference point.
- the Ubi-1 promoter is a strong constitutive promoter in nearly all tissues of maize.
- Histochemical staining data is represented on a 0-3 scale with the well characterized maize Ubi-1 promoter serving as a reference point.
- the Ubi-1 promoter is a strong constitutive promoter in nearly all tissues of maize.
- Promoters are a collection of sequence motifs that work together to bind transcription factors that result in the spatial, temporal, and quantitative expression characteristics of a promoter. Understanding the architecture and the positioning of these motifs enhances knowledge pertaining to the promoter. Segmental deletion analysis is a tool that can be used to begin to identify regions of a promoter. The removal of segments from the 5' end may change the spatial, temporal, and/or quantitative expression patterns of the promoter. Those regions that result in a change can then be studied more closely to evaluate motifs and their interaction with cis and trans factors. The deletion process may also identify the core promoter.
- the restriction endonuclease recognition sites, Seal, Bglll, and Xmnl were used to remove three sequence regions from the 5' end of Sb-pLTP (SEQ ID NO: 1 ), ranging in size from -120 to 360bp.
- the three truncations are referred to as TR1 (SEQ ID NO: 2), TR2 (SEQ I D NO: 3), and TR3 (SEQ ID NO: 4) with TR3 comprising the shortest fragment.
- TR1 SEQ ID NO: 2
- TR2 SEQ I D NO: 3
- TR3 SEQ ID NO: 4
- TR1 SEQ ID NO: 2
- TR2 SEQ ID NO: 3
- TR3 SEQ I D NO: 4
- Sb-pLTP promoter SEQ ID NO: 1
- GUS expression was detected in the meristematic region of the root tip and in the elongation region. Several events also had expression extending into the mature region of the root. Expression was not detected in the area of the meristem closest to the root cap or in the root cap of any event.
- TR1 SEQ ID NO: 2
- TR2 SEQ ID NO: 3
- TR3 SEQ ID NO: 4
- quantitative analysis showed that all the truncations resulted in similar expression levels in the root tip and in the mature region of the root.
- the expression levels were also comparable to the Sb-pLTP promoter (SEQ ID NO: 1 ) in both root regions.
- TR1 SEQ ID NO: 2
- TR2 SEQ ID NO: 3
- TR3 SEQ ID NO: 4
- Agrobacterium were grown on a master plate of 800 medium and cultured at 28 °C in the dark for 3 days, and thereafter stored at 4 °C for up to one month.
- Working plates of Agrobacterium were grown on 810 medium plates and incubated in the dark at 28 °C for one to two days.
- embryos were dissected from fresh, sterilized corn ears and kept in 561 Q medium until all required embryos were collected. Embryos were then contacted with an Agrobacterium suspension prepared from the working plate, in which the Agrobacterium contained a plasmid comprising the promoter sequence of the embodiments. The embryos were co-cultivated with the Agrobacterium on 562P plates, with the embryos placed axis down on the plates, as per the '840 patent protocol.
- 562P medium After one week on 562P medium, the embryos were transferred to 5630 medium. The embryos were subcultured on fresh 5630 medium at 2 week intervals and incubation was continued under the same conditions. Callus events began to appear after 6 to 8 weeks on selection.
- the calli were cultured on regeneration (288W) medium and kept in the dark for 2-3 weeks to initiate plant regeneration.
- somatic embryo maturation well-developed somatic embryos were transferred to medium for germination (272V) and transferred to a lighted culture room.
- medium for germination (272V)
- developing plantlets were transferred to 272V hormone-free medium in tubes for 7-10 days until plantlets were well established.
- Plants were then transferred to inserts in flats (equivalent to 2.5" pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1 -2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity.
- 561 Q medium comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000x SIGMA-151 1 ), 0.5 mg/L thiamine HCI, 68.5 g/L sucrose, 36.0 g/L glucose, 1.5 mg/L 2,4-D, and 0.69 g/L L-proline (brought to volume with dl H 2 0 following adjustment to pH 5.2 with KOH); 2.0 g/L GelriteTM (added after bringing to volume with dl H 2 0); and 8.5 mg/L silver nitrate (added after sterilizing the medium and cooling to room temperature).
- 800 medium comprises 50.0 mL/L stock solution A and 850 mL dl H 2 0, and brought to volume minus 100 mL/L with dl H 2 0, after which is added 9.0 g of phytagar.
- 50.0 mL/L BAstock solution B is added, along with 5.0 g of glucose and 2.0 mL of a 50 mg/mL stock solution of spectinomycin.
- Stock solution A comprises 60.0 g of dibasic K 2 HP0 4 and 20.0 g of monobasic sodium phosphate, dissolved in 950 mL of water, adjusted to pH 7.0 with KOH, and brought to 1 .0 L volume with dl H 2 0.
- Stock solution B comprises 20.0 g NH 4 CI, 6.0 g MgS0 4 « 7H 2 0, 3.0 g potassium chloride, 0.2 g CaCI 2 , and 0.05 g of FeS0 4 « 7H 2 0, all brought to volume with dl H 2 0, sterilized, and cooled.
- 810 medium comprises 5.0 g yeast extract (Difco), 10.0 g peptone (Difco), 5.0 g NaCI, dissolved in dl H 2 0, and brought to volume after adjusting pH to 6.8. 15.0 g of bacto-agar is then added, the solution is sterilized and cooled, and 1 .0 mL of a 50 mg/mL stock solution of spectinomycin is added.
- 562P medium comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000x SIGMA-151 1 ), 0.5 mg/L thiamine HCI, 30.0 g/L sucrose, and 2.0 mg/L 2,4-D (brought to volume with dl H 2 0 following adjustment to pH 5.8 with KOH); 3.0 g/L GelriteTM (added after bringing to volume with dl H 2 0); and 0.85 mg/L silver nitrate and 1.0 mL of a 100mM stock of acetosyringone (both added after sterilizing the medium and cooling to room temperature).
- 5630 medium comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000x SIGMA-151 1 ), 0.5 mg/L thiamine HCI, 30.0 g/L sucrose, 1.5 mg/L 2,4-D, 0.69 g L-proline, and 0.5 g MES buffer (brought to volume with dl H 2 0 following adjustment to pH 5.8 with KOH). Then, 6.0 g/L UltrapureTM agar-agar (EM Science) is added and the medium is sterilized and cooled. Subsequently, 0.85 mg/L silver nitrate, 3.0 mL of a 1 mg/mL stock of Bialaphos, and 2.0 mL of a 50 mg/mL stock of carbenicillin are added.
- 288 W comprises 4.3 g/L MS salts (GIBCO 1 1 1 17-074), 5.0 mL/L MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/L thiamine HCI, 0.10 g/L pyridoxine HCI, and 0.40 g/L Glycine brought to volume with polished D-l H 2 0) (Murashige and Skoog (1962) Physiol. Plant. 15:473), 100 mg/L myo-inositol, 0.5 mg/L zeatin, and 60 g/L sucrose, which is then brought to volume with polished D-l H 2 0 after adjusting to pH 5.6.
- Hormone-free medium comprises 4.3 g/L MS salts (GIBCO 1 1 1 17-074), 5.0 mL/L MS vitamins stock solution (0.100 g/L nicotinic acid, 0.02 g/L thiamine HCI, 0.10 g/L pyridoxine HCL, and 0.40 g/L glycine brought to volume with polished D-l H 2 0), 0.1 g/L myo-inositol, and 40.0 g/L sucrose (brought to volume with polished D-l H 2 0 after adjusting pH to 5.6); and 6 g/L bacto-agar (added after bringing to volume with polished D-l H 2 0), sterilized and cooled to 60 °C.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pest Control & Pesticides (AREA)
- Insects & Arthropods (AREA)
- Virology (AREA)
- Physiology (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BR112015021562A BR112015021562A2 (en) | 2013-03-12 | 2014-03-10 | isolated nucleic acid molecule, expression cassette, vector, plant cell, transgenic plant, transgenic seed, method for expressing a nucleotide sequence in a plant or a plant cell, method for expressing a gene sequence preferably for root in a plant |
EP14778864.0A EP2966991B1 (en) | 2013-03-12 | 2014-03-10 | Root-preferred promoter and methods of use |
CA2903093A CA2903093C (en) | 2013-03-12 | 2014-03-10 | Root-preferred promoter and methods of use |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/795,118 US9273322B2 (en) | 2013-03-12 | 2013-03-12 | Root-preferred promoter and methods of use |
US13/795,118 | 2013-03-12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2014164399A1 true WO2014164399A1 (en) | 2014-10-09 |
Family
ID=51535224
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2014/022310 WO2014164399A1 (en) | 2013-03-12 | 2014-03-10 | Root-preferred promoter and methods of use |
Country Status (5)
Country | Link |
---|---|
US (2) | US9273322B2 (en) |
EP (1) | EP2966991B1 (en) |
BR (1) | BR112015021562A2 (en) |
CA (1) | CA2903093C (en) |
WO (1) | WO2014164399A1 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017222821A2 (en) | 2016-06-24 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
WO2019226508A1 (en) | 2018-05-22 | 2019-11-28 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
US10844390B2 (en) | 2015-08-07 | 2020-11-24 | Basf Agricultural Solutions Seed, Us Llc | Root-preferential and stress inducible promoter and uses thereof |
WO2022035649A1 (en) | 2020-08-10 | 2022-02-17 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017192560A1 (en) | 2016-05-04 | 2017-11-09 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
Citations (55)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4535060A (en) | 1983-01-05 | 1985-08-13 | Calgene, Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use |
US4940835A (en) | 1985-10-29 | 1990-07-10 | Monsanto Company | Glyphosate-resistant plants |
US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
US4971908A (en) | 1987-05-26 | 1990-11-20 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
US5145783A (en) | 1987-05-26 | 1992-09-08 | Monsanto Company | Glyphosate-tolerant 5-endolpyruvyl-3-phosphoshikimate synthase |
US5188642A (en) | 1985-08-07 | 1993-02-23 | Monsanto Company | Glyphosate-resistant plants |
US5231020A (en) | 1989-03-30 | 1993-07-27 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
US5310667A (en) | 1989-07-17 | 1994-05-10 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
US5312910A (en) | 1987-05-26 | 1994-05-17 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
US5380831A (en) | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
US5436391A (en) | 1991-11-29 | 1995-07-25 | Mitsubishi Corporation | Synthetic insecticidal gene, plants of the genus oryza transformed with the gene, and production thereof |
US5463175A (en) | 1990-06-25 | 1995-10-31 | Monsanto Company | Glyphosate tolerant plants |
US5491288A (en) | 1991-03-05 | 1996-02-13 | Rhone Poulenc Agrochimie | Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants |
US5510471A (en) | 1991-03-05 | 1996-04-23 | Rhone-Poulenc Agrochimie | Chimeric gene for the transformation of plants |
US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
WO1997004114A2 (en) | 1995-07-19 | 1997-02-06 | Rhone Poulenc Agrochimie | Isolated dna sequence for use as a regulator region in a chimeric gene useful for transforming plants |
WO1997004103A2 (en) | 1995-07-19 | 1997-02-06 | Rhone-Poulenc Agrochimie | Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene |
US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
US5627061A (en) | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
US5736514A (en) | 1994-10-14 | 1998-04-07 | Nissan Chemical Industries, Ltd. | Bacillus strain and harmful organism controlling agents |
US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
WO1998032326A2 (en) | 1997-01-24 | 1998-07-30 | Pioneer Hi-Bred International, Inc. | Methods for $i(agrobacterium)-mediated transformation |
US5792931A (en) | 1994-08-12 | 1998-08-11 | Pioneer Hi-Bred International, Inc. | Fumonisin detoxification compositions and methods |
US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US5866775A (en) | 1990-09-28 | 1999-02-02 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
WO1999025840A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | A novel method for the integration of foreign dna into eukaryoticgenomes |
WO1999025855A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Mobilization of viral genomes from t-dna using site-specific recombination systems |
WO1999025821A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Compositions and methods for genetic modification of plants |
WO1999025853A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Targeted manipulation of herbicide-resistance genes in plants |
US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
USRE36449E (en) | 1991-03-05 | 1999-12-14 | Rhone-Poulenc Agro | Chimeric gene for the transformation of plants |
US6040497A (en) | 1997-04-03 | 2000-03-21 | Dekalb Genetics Corporation | Glyphosate resistant maize lines |
WO2000028058A2 (en) | 1998-11-09 | 2000-05-18 | Pioneer Hi-Bred International, Inc. | Transcriptional activator lec1 nucleic acids, polypeptides and their uses |
US6130366A (en) | 1984-12-28 | 2000-10-10 | Plant Genetic Systems | Chimaeric gene coding for a transit peptide and a heterologous polypeptide |
WO2000066746A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2000066748A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2000066747A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2001066704A2 (en) | 2000-03-09 | 2001-09-13 | Monsanto Technology Llc | Methods for making plants tolerant to glyphosate and compositions thereof |
US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
US20030083480A1 (en) | 2000-10-30 | 2003-05-01 | Maxygen, Inc. | Novel glyphosate N-acetyl transferase (GAT) genes |
WO2003092360A2 (en) | 2002-04-30 | 2003-11-13 | Verdia, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
US20040082770A1 (en) | 2000-10-30 | 2004-04-29 | Verdia, Inc. | Novel glyphosate N-acetyltransferase (GAT) genes |
WO2008076987A2 (en) * | 2006-12-15 | 2008-06-26 | The United States Of America, As Represented By The Secretary Of Agriculture | Genes encoding fatty acid desaturases from sorghum bicolor |
US20100058496A1 (en) * | 2007-02-21 | 2010-03-04 | Nagarjuna Energy Private Limited | Transgenic sweet sorghum with altered lignin composition and process of preparation thereof |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007049275A2 (en) * | 2005-10-24 | 2007-05-03 | Evogene Ltd. | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US7750207B2 (en) * | 2004-09-01 | 2010-07-06 | Monsanto Technology Llc | Zea mays ribulose bisphosphate carboxylase activase promoter |
EP1817420A2 (en) * | 2004-11-16 | 2007-08-15 | Pioneer Hi-Bred International, Inc. | Maize cr1bio gene promoter and its use to direct root-preferred transgene expression in plants |
CA2783005A1 (en) * | 2009-12-17 | 2011-06-23 | Syngenta Participations Ag | Promoter for regulation of gene expression in plant roots |
US8916377B2 (en) * | 2011-02-15 | 2014-12-23 | Pioneer Hi Bred International Inc | Root-preferred promoter and methods of use |
-
2013
- 2013-03-12 US US13/795,118 patent/US9273322B2/en active Active
-
2014
- 2014-03-10 BR BR112015021562A patent/BR112015021562A2/en active Search and Examination
- 2014-03-10 WO PCT/US2014/022310 patent/WO2014164399A1/en active Application Filing
- 2014-03-10 CA CA2903093A patent/CA2903093C/en active Active
- 2014-03-10 EP EP14778864.0A patent/EP2966991B1/en active Active
-
2016
- 2016-02-01 US US15/012,590 patent/US10010037B2/en active Active
Patent Citations (70)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4769061A (en) | 1983-01-05 | 1988-09-06 | Calgene Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use |
US4535060A (en) | 1983-01-05 | 1985-08-13 | Calgene, Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use |
US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
US6130366A (en) | 1984-12-28 | 2000-10-10 | Plant Genetic Systems | Chimaeric gene coding for a transit peptide and a heterologous polypeptide |
US5188642A (en) | 1985-08-07 | 1993-02-23 | Monsanto Company | Glyphosate-resistant plants |
US4940835A (en) | 1985-10-29 | 1990-07-10 | Monsanto Company | Glyphosate-resistant plants |
US5380831A (en) | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
US5145783A (en) | 1987-05-26 | 1992-09-08 | Monsanto Company | Glyphosate-tolerant 5-endolpyruvyl-3-phosphoshikimate synthase |
US5312910A (en) | 1987-05-26 | 1994-05-17 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
US4971908A (en) | 1987-05-26 | 1990-11-20 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
US5866785A (en) | 1988-02-26 | 1999-02-02 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
US5889190A (en) | 1988-02-26 | 1999-03-30 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
US5589367A (en) | 1988-02-26 | 1996-12-31 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
US5231020A (en) | 1989-03-30 | 1993-07-27 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
US5310667A (en) | 1989-07-17 | 1994-05-10 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
US5776760A (en) | 1990-06-25 | 1998-07-07 | Monsanto Company | Glyphosate tolerant plants |
US5463175A (en) | 1990-06-25 | 1995-10-31 | Monsanto Company | Glyphosate tolerant plants |
US6248876B1 (en) | 1990-08-31 | 2001-06-19 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
US5804425A (en) | 1990-08-31 | 1998-09-08 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
US5627061A (en) | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
US5633435A (en) | 1990-08-31 | 1997-05-27 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
US5866775A (en) | 1990-09-28 | 1999-02-02 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
US6225114B1 (en) | 1990-09-28 | 2001-05-01 | Monsanto Company | Modified gene encoding glyphosate-tolerant 5-enolpruvyl-3-phosphoshikimate synthase |
US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
USRE36449E (en) | 1991-03-05 | 1999-12-14 | Rhone-Poulenc Agro | Chimeric gene for the transformation of plants |
US5633448A (en) | 1991-03-05 | 1997-05-27 | Rhone-Poulenc Agrochimie | Chimeric gene for the transformation of plants |
USRE37287E1 (en) | 1991-03-05 | 2001-07-17 | Aventis Cropscience S.A. | Chimeric gene for the transformation of plants |
US5510471A (en) | 1991-03-05 | 1996-04-23 | Rhone-Poulenc Agrochimie | Chimeric gene for the transformation of plants |
US5491288A (en) | 1991-03-05 | 1996-02-13 | Rhone Poulenc Agrochimie | Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants |
US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
US5436391A (en) | 1991-11-29 | 1995-07-25 | Mitsubishi Corporation | Synthetic insecticidal gene, plants of the genus oryza transformed with the gene, and production thereof |
US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
US5792931A (en) | 1994-08-12 | 1998-08-11 | Pioneer Hi-Bred International, Inc. | Fumonisin detoxification compositions and methods |
US5736514A (en) | 1994-10-14 | 1998-04-07 | Nissan Chemical Industries, Ltd. | Bacillus strain and harmful organism controlling agents |
WO1997004114A2 (en) | 1995-07-19 | 1997-02-06 | Rhone Poulenc Agrochimie | Isolated dna sequence for use as a regulator region in a chimeric gene useful for transforming plants |
WO1997004103A2 (en) | 1995-07-19 | 1997-02-06 | Rhone-Poulenc Agrochimie | Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene |
WO1998032326A2 (en) | 1997-01-24 | 1998-07-30 | Pioneer Hi-Bred International, Inc. | Methods for $i(agrobacterium)-mediated transformation |
US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
US6040497A (en) | 1997-04-03 | 2000-03-21 | Dekalb Genetics Corporation | Glyphosate resistant maize lines |
WO1999025853A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Targeted manipulation of herbicide-resistance genes in plants |
WO1999025840A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | A novel method for the integration of foreign dna into eukaryoticgenomes |
WO1999025821A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Compositions and methods for genetic modification of plants |
WO1999025854A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | A method for directional stable transformation of eukaryotic cells |
WO1999025855A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Mobilization of viral genomes from t-dna using site-specific recombination systems |
US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
WO2000028058A2 (en) | 1998-11-09 | 2000-05-18 | Pioneer Hi-Bred International, Inc. | Transcriptional activator lec1 nucleic acids, polypeptides and their uses |
WO2000066748A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2000066747A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2000066746A1 (en) | 1999-04-29 | 2000-11-09 | Syngenta Limited | Herbicide resistant plants |
WO2001066704A2 (en) | 2000-03-09 | 2001-09-13 | Monsanto Technology Llc | Methods for making plants tolerant to glyphosate and compositions thereof |
US20030083480A1 (en) | 2000-10-30 | 2003-05-01 | Maxygen, Inc. | Novel glyphosate N-acetyl transferase (GAT) genes |
US20040082770A1 (en) | 2000-10-30 | 2004-04-29 | Verdia, Inc. | Novel glyphosate N-acetyltransferase (GAT) genes |
US7462481B2 (en) | 2000-10-30 | 2008-12-09 | Verdia, Inc. | Glyphosate N-acetyltransferase (GAT) genes |
US7714188B2 (en) | 2000-10-30 | 2010-05-11 | Pioneer Hi-Bred Int'l., Inc. | Glyphosate-N-acetyltransferase (GAT) genes |
WO2003092360A2 (en) | 2002-04-30 | 2003-11-13 | Verdia, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
WO2008076987A2 (en) * | 2006-12-15 | 2008-06-26 | The United States Of America, As Represented By The Secretary Of Agriculture | Genes encoding fatty acid desaturases from sorghum bicolor |
US20100058496A1 (en) * | 2007-02-21 | 2010-03-04 | Nagarjuna Energy Private Limited | Transgenic sweet sorghum with altered lignin composition and process of preparation thereof |
Non-Patent Citations (104)
Title |
---|
ALLISON ET AL., VIROLOGY, vol. 154, 1986, pages 9 - 20 |
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 |
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 |
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995, GREENE PUBLISHING AND WILEY-LNTERSCIENCE, article "chapter 2" |
BALLAS ET AL., NUCLEIC ACIDS RES., vol. 17, 1989, pages 7891 - 7903 |
BEDELL, J ET AL.: "Sorghum Genome Sequencing By Methylation Filtration.", PLOS BIOLOGY., vol. 3, no. 1, January 2005 (2005-01-01), pages 103 - 115, XP003003845, DOI: doi:10.1371/journal.pbio.0030013 * |
BRETAGNE-SAGNARD ET AL., TRANSGENIC RES., vol. 5, 1996, pages 131 - 137 |
BYTEBIER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 5345 - 5349 |
CALLIS ET AL., GENES AND DEVELOPMENT, vol. 1, 1987, pages 1183 - 1200 |
CAMPBELL; GOWRI, PLANT PHYSIOL., vol. 92, 1990, pages 1 - 11 |
CHALFIE ET AL., SCIENCE, vol. 263, 1994, pages 802 |
CHIU ET AL., CURRENT BIOLOGY, vol. 6, 1996, pages 325 - 330 |
CHRISTENSEN ET AL., PLANT MOLECULAR BIOLOGY, vol. 18, 1992, pages 675 - 689 |
CHRISTENSEN; QUAIL, TRANSGENIC RES., vol. 5, 1996, pages 213 - 218 |
CHRISTOU ET AL., PLANT PHYSIOL., vol. 87, 1988, pages 671 - 674 |
CHRISTOU; FORD: "Annals of Botany", vol. 75, 1995, pages: 407 - 413 |
CORPET ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 10881 - 90 |
CRAMERI ET AL., NATURE BIOTECH, vol. 15, 1997, pages 436 - 438 |
CRAMERI ET AL., NATURE, vol. 391, 1998, pages 288 - 291 |
CROSSWAY ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 320 - 334 |
DATTA ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 736 - 740 |
DE WET ET AL.: "The Experimental Manipulation of Ovule Tissues", 1985, LONGMAN, pages: 197 - 209 |
DEBLOCK ET AL., EMBO J., vol. 6, 1987, pages 2513 - 2518 |
DELLA-CIOPPA ET AL., PLANT PHYSIOLOGY, vol. 84, 1987, pages 965 - 968 |
DEWET ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 725 - 737 |
D'HALLUIN ET AL., PLANT CELL, vol. 4, 1992, pages 1495 - 1505 |
ELROY-STEIN ET AL., PROC. NAT. ACAD. SCI. USA, vol. 86, 1989, pages 6126 - 6130 |
FINER; MCMULLEN, IN VITRO CELL DEV. BIOL., vol. 27P, 1991, pages 175 - 182 |
FROMM ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 833 - 839 |
GALLIE ET AL., MOLECULAR BIOLOGY OF RNA, 1989, pages 237 - 256 |
GEISER ET AL., GENE, vol. 48, 1986, pages 109 |
GOFF ET AL., EMBO J., vol. 9, 1990, pages 2517 - 2522 |
GUERINEAU ET AL., MOL. GEN. GENET., vol. 262, 1991, pages 141 - 144 |
GUERINEAU ET AL., PLANT MOL. BIOL., vol. 15, 1990, pages 127 - 186 |
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
HERRERA ESTRELLA ET AL., EMBO J., vol. 2, 1983, pages 987 - 992 |
HERRERA ESTRELLA ET AL., NATURE, vol. 303, 1983, pages 209 - 213 |
HIGGINS ET AL., CABIOS, vol. 5, 1989, pages 151 - 153 |
HIGGINS ET AL., GENE, vol. 73, 1988, pages 237 - 244 |
HILLE ET AL., PLANT MOL. BIOL., vol. 7, 1990, pages 171 - 176 |
HOOYKAAS-VAN SLOGTEREN ET AL., NATURE (LONDON), vol. 311, 1984, pages 763 - 764 |
HUANG ET AL., CABIOS, vol. 8, 1992, pages 155 - 65 |
INNIS AND GELFAND: "PCR Methods Manual", 1999, ACADEMIC PRESS |
INNIS AND GELFAND: "PCR Strategies", 1995, ACADEMIC PRESS |
INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS |
JEFFERSON ET AL.: "Plant Molecular Biology Manual", 1991, KLUWER ACADEMIC PUBLISHERS, pages: 1 - 33 |
JEFFERSON, PLANT MOL. BIOL. REP., vol. 5, 1987, pages 387 |
JOBLING ET AL., NATURE, vol. 325, 1987, pages 622 - 625 |
JONES ET AL., MOL. GEN. GENET., vol. 210, 1987, pages 86 - 91 |
JONES ET AL., SCIENCE, vol. 266, 1994, pages 789 |
JOSHI ET AL., NUCLEIC ACID RES., vol. 15, 1987, pages 9627 - 9639 |
KAEPPLER ET AL., PLANT CELL REPORTS, vol. 9, 1990, pages 415 - 418 |
KAEPPLER ET AL., THEOR. APPL. GENET, vol. 84, 1992, pages 560 - 566 |
KAIN ET AL., BIOTECHNIQUES, vol. 19, 1995, pages 650 - 655 |
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, 1990, pages 872264 |
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877 |
KLEIN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 559 - 563 |
KLEIN ET AL., PLANT PHYSIOL., vol. 91, 1988, pages 440 - 444 |
KLEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 4305 - 4309 |
KYOZUKA ET AL., MAYDICA, vol. 35, 1990, pages 353 - 357 |
KYOZUKA ET AL., MOL. GEN. GENET., vol. 228, 1991, pages 40 - 48 |
LI ET AL., PLANT CELL REPORTS, vol. 12, 1993, pages 250 - 255 |
LOMMEL ET AL., VIROLOGY, vol. 81, 1991, pages 382 - 385 |
LUDWIG ET AL., SCIENCE, vol. 247, 1990, pages 449 |
LUEHRSEN ET AL., METHODS ENZYMOL., vol. 216, 1992, pages 397 - 414 |
MACEJAK ET AL., NATURE, vol. 353, 1991, pages 90 - 94 |
MARTIN ET AL., SCIENCE, vol. 262, 1993, pages 1432 |
MCCABE ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 923 - 923 |
MCCABE ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 923 - 92Q |
MCCORMICK ET AL., PLANT CELL REPORTS, vol. 5, 1986, pages 81 - 84 |
MEIJER ET AL., PLANT MOL. BIOL., vol. 16, 1991, pages 807 - 820 |
MEINKOTH; WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
MINDRINOS ET AL., CELL, vol. 78, 1994, pages 1089 |
MOGEN ET AL., PLANT CELL, vol. 2, 1990, pages 1261 - 1272 |
MOORE ET AL., J. MOL. BIOL., vol. 272, 1997, pages 336 - 347 |
MUNROE ET AL., GENE, vol. 91, 1990, pages 151 - 158 |
MURASHIGE; SKOOG, PHYSIOL. PLANT., vol. 15, 1962, pages 473 |
MURRAY ET AL., NUCLEIC ACIDS RES., vol. 17, 1989, pages 477 - 498 |
MYERS; MILLER, CABIOS, vol. 4, 1988, pages 11 - 17 |
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
OSJODA ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 745 - 750 |
PASZKOWSKI ET AL., EMBO J., vol. 3, 1984, pages 2717 - 2722 |
PEARSON ET AL., METH. MOL. BIOL., vol. 24, 1994, pages 307 - 331 |
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 2444 - 2448 |
PORTA ET AL., MOLECULAR BIOTECHNOLOGY, vol. 5, 1996, pages 209 - 221 |
PROUDFOOT, CELL, vol. 64, 1991, pages 671 - 674 |
RIGGS ET AL., NUCLEIC ACIDS RES., vol. 15, no. 19, 1987, pages 8115 |
RIGGS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 5602 - 5606 |
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", 1989, COLD SPRING HARBOR LABORATORY PRESS |
SANFACON ET AL., GENES DEV, vol. 5, 1991, pages 141 - 149 |
SANFORD ET AL., PARTICULATE SCIENCE AND TECHNOLOGY, vol. 5, 1987, pages 27 - 37 |
See also references of EP2966991A4 |
SHAW ET AL., SCIENCE, vol. 233, 1986, pages 478 - 481 |
SINGH ET AL., THEOR. APPL. GENET., vol. 96, 1998, pages 319 - 324 |
SMITH ET AL., ADV. APPL. MATH., vol. 2, 1981, pages 482 |
STALKER ET AL., SCIENCE, vol. 242, 1988, pages 419 - 423 |
STEMMER, NATURE, vol. 370, 1994, pages 389 - 391 |
STEMMER, PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 10747 - 10751 |
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "chapter 2" |
TOMES ET AL.: "Plant Cell, Tissue, and Organ Culture: Fundamental Methods", 1995, SPRINGER-VERLAG |
WALDRON ET AL., PLANT MOL. BIOL., vol. 5, 1985, pages 103 - 108 |
WEISSINGER ET AL., ANN. REV. GENET., vol. 22, 1988, pages 421 - 477 |
ZHANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 4504 - 4509 |
ZHIJIAN ET AL., PLANT SCIENCE, vol. 108, 1995, pages 219 - 227 |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10844390B2 (en) | 2015-08-07 | 2020-11-24 | Basf Agricultural Solutions Seed, Us Llc | Root-preferential and stress inducible promoter and uses thereof |
WO2017222821A2 (en) | 2016-06-24 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
EP4083215A1 (en) | 2016-06-24 | 2022-11-02 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
WO2019226508A1 (en) | 2018-05-22 | 2019-11-28 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
WO2022035649A1 (en) | 2020-08-10 | 2022-02-17 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
Also Published As
Publication number | Publication date |
---|---|
CA2903093C (en) | 2019-12-17 |
US9273322B2 (en) | 2016-03-01 |
BR112015021562A2 (en) | 2017-10-10 |
EP2966991B1 (en) | 2017-08-30 |
CA2903093A1 (en) | 2014-10-09 |
EP2966991A1 (en) | 2016-01-20 |
US20160145634A1 (en) | 2016-05-26 |
EP2966991A4 (en) | 2016-07-27 |
US20140283206A1 (en) | 2014-09-18 |
US10010037B2 (en) | 2018-07-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7214854B2 (en) | Maize metallothionein promoter | |
US8916377B2 (en) | Root-preferred promoter and methods of use | |
US10221424B2 (en) | Root-preferred promoter and methods of use | |
US10010037B2 (en) | Root-preferred promoter and methods of use | |
US8338662B2 (en) | Viral promoter, truncations thereof, and methods of use | |
US8395022B2 (en) | Viral promoter, truncations thereof, and methods of use | |
WO2010141185A1 (en) | Viral promoter, truncations thereof, and methods of use | |
US20060005275A1 (en) | Maize metallothionein promoter | |
US20060005274A1 (en) | Maize metallothionein 2 promoter and methods of use | |
US20100313306A1 (en) | Viral Promoter, Truncations Thereof, and Methods of Use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14778864 Country of ref document: EP Kind code of ref document: A1 |
|
REEP | Request for entry into the european phase |
Ref document number: 2014778864 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2014778864 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2903093 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015021562 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 112015021562 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150903 |