WO2014153069A2 - Compositions and methods for reprogramming hematopoietic stem cell lineages - Google Patents
Compositions and methods for reprogramming hematopoietic stem cell lineages Download PDFInfo
- Publication number
- WO2014153069A2 WO2014153069A2 PCT/US2014/028932 US2014028932W WO2014153069A2 WO 2014153069 A2 WO2014153069 A2 WO 2014153069A2 US 2014028932 W US2014028932 W US 2014028932W WO 2014153069 A2 WO2014153069 A2 WO 2014153069A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence encoding
- mrna sequence
- modified mrna
- cells
- modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/11—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1307—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/00041—Use of virus, viral particle or viral elements as a vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
- C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
Definitions
- the present invention relates to compositions, methods, and kits for reprogramming hematopoietic lineages and inducing hematopoietic stem cells.
- HSCs Hematopoietic stem cells
- Hematopoietic stem cells give rise to all the blood or immune cell types, including monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells, T-cells, B-cells, NKT-cells, and NK-cells.
- Hematopoietic tissues contain cells with long-term and short-term regeneration capacities, and committed multipotent, oligopotent, and unipotent progenitors.
- hematopoietic stem cells have become the standard of care for many patients with defined congenital or acquired disorders of the hematopoietic system or with chemo- radio- or, immuno- sensitive malignancies. Over the last two decades, HSCT has seen rapid expansion and a constant evolution in technology use. (Gratmple A, et al., (2010). Hematopoietic stem cell transplantation A Global Perspective. JAMA. 303(16): 1617-24).
- the inventors have identified key transcription factors that can surprisingly reprogram committed cells and blood cells back into hematopoietic stem cells.
- HSCs Hematopoietic stem cells
- HSC transplantation remains a high-risk procedure, with the number of stem cells available for transplantation being the strongest predictor of transplantation success.
- One of the central clinical challenges of HSC transplantation arises from the fact that HSCs are exceedingly rare cells, occurring at a frequency of only 1/20,000 bone marrow cells and obtaining enough cells for transplant is challenging.
- the embodiments of the invention provide multiple applications, including kits for research use and methods for generation of cells useful for conducting small molecule screens for blood diseases.
- the invention provides commercially and medically useful methods to produce autologous hematopoietic stem cells and give them back to a patient in need, with or without genome editing. Transplant of hematopoietic stem cells is a critically important procedure that is currently limited for a variety of reasons.
- compositions, methods, and kits for hematopoietic stem cell induction or for reprogramming cells to the multipotent state of hematopoietic stem cells based, in part, on the discoveries described herein of novel combinations of transcription factors that permit dedifferentiation and reprogramming of more differentiated cells to the hematopoietic stem cell state.
- Such compositions, nucleic acid constructs, methods and kits can be used for inducing hematopoietic stem cells in vitro, ex vivo, or in vivo, as described herein, and these induced hematopoietic stem cells can be used in regenerative medicine applications and therapies.
- the methods described herein can be used to produce HSC cells for treat diseases including leukemia, lymphomas, solid tumors, aplastic anemia, congenital bone marrow failure syndromes, immune deficiencies, sickle cell disease, thalassemia and metabolic/storage diseases, such as amyloidosis.
- diseases including leukemia, lymphomas, solid tumors, aplastic anemia, congenital bone marrow failure syndromes, immune deficiencies, sickle cell disease, thalassemia and metabolic/storage diseases, such as amyloidosis.
- HSC hematopoietic stem cell inducing composition
- HSC inducing composition comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFIIB, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467,
- HSC inducing factors
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- NKX2-3 i. a nucleic acid sequence encoding NKX2-3
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- nucleic acid sequence encoding ZFP467 a nucleic acid sequence encoding ZFP467; and e. a nucleic acid sequence encoding ZFP521.
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- the one or more expression vectors are retroviral vectors.
- the one or more expression vectors are lentiviral vectors.
- the lentiviral vectors are inducible lentiviral vectors.
- HSC hematopoietic stem cell inducing compositions comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521,
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- NKX2-3 i. a modified mRNA sequence encoding ; NKX2-3;
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
- the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl -uridine, 1 -propynyl-pseudouridine, 5- taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl -uridine, 1 -methyl -pseudouridine, 4-thio-l -methyl- pseudouridine, 2-thio-l -
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding
- LM02 a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter;
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16 a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- iHSC induced hematopoietic stem cell
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
- hematopoietic stem cell from a somatic cell comprising:
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBXl ; and a nucleic acid sequence encoding KLF4.
- the somatic cell is a fibroblast cell.
- the somatic cell is a hematopoietic lineage cell.
- the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing megakaryocytes, platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes, multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors.
- the hematopoietic lineage cell is selected from a multi-potent progenitor cell (MPP), common myeloid progenitor cell (CMP), granulocyte-monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte-erythrocyte progenitor cell.
- MPP multi-potent progenitor cell
- CMP common myeloid progenitor cell
- GMP granulocyte-monocyte progenitor cells
- CLP common lymphoid progenitor cell
- pre -megakaryocyte-erythrocyte progenitor cell pre -megakaryocyte-erythrocyte progenitor cell.
- the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro- dendritic cell (pro-DC), pre-granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro-mast cell (ProMC).
- MEP megakaryocyte-erythrocyte progenitor cell
- ProB cell a ProB cell
- PreB cell PreB cell
- PreProB cell a PreProB cell
- ProT cell a double-negative T cell
- pro-NK cell a pro- dendritic cell
- pre-granulocyte/macrophage cell pre-granulocyte/macrophage progenitor (GMP) cell
- GMP granulocyte/m
- methods of promoting transdifferentiation of a ProPreB cell to the myeloid lineage comprising:
- transducing a ProPreB cellwith one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced ProPreB cell in a cell media that supports growth of myeloid lineage cells, thereby transdifferentiating the ProPreB cell to the myeloid lineage.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- methods of increasing survival and/or proliferation of ProPreB cells comprising:
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
- isolated induced hematopoietic stem cells are provided herein, in some aspects, are isolated induced hematopoietic stem cells
- iHSCs produced using any of the HSC inducing compositions or methods described herein.
- cell clones comprising a plurality of the induced hematopoietic stem cells (iHSCs) produced using any of the HSC inducing compositions or methods described herein.
- the cell clones further comprise a pharmaceutically acceptable carrier.
- kits for making induced hematopoietic stem cells comprising any of the HSC inducing compositions comprising one or more expression vector components described herein.
- kits for making induced hematopoietic stem cells comprising any of the HSC inducing compositions comprising modified mRNA sequence components described herein.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, and MEIS1
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBX1, and LM02.
- HSC hematopoietic stem cell
- HSC hematopoietic stem cell
- the one or more expression vectors are lentiviral vectors.
- the lentiviral vectors are inducible lentiviral vectors.
- the lentiviral vectors are polycistronic inducible lentiviral vectors.
- the polycistronic inducible lentiviral vectors express three or more nucleic acid sequences. In some embodiments, each of the nucleic acid sequences of the polycistronic inducible lentiviral vectors are separated by 2A peptide sequences.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, and MEIS1.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBX1, and LM02.
- hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNX1T1 ; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding PBX1 ; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM5; a modified mRNA sequence encoding MEIS1 ; and a modified mRNA sequence encoding MYCN; wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- iHSC induced hematopoietic stem cell
- iHSC induced hematopoietic stem cell
- RUNXITI a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- polycistronic viral expression systems can increase the in vivo reprogramming efficiency of somatic cells to iHSCs.
- a polycistronic lentiviral vector is used.
- sequences encoding two or more of the HSC inducing factors described herein are expressed from a single promoter, as a polycistronic transcript.
- We used 2A peptide strategy to make polycistronic vectors see, e.g., Expert Opin Biol Ther. 2005 May;5(5):627-38).
- IRES elements internal ribosome entry sites
- IRES elements are able to bypass the ribosome scanning model of 5'-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988).
- IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, thus creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message. See, for example, U.S. Pat. Nos.
- HSC inducing factor refers to a developmental potential altering factor, as that term is defined herein, such as a protein, RNA, or small molecule, the expression of which contributes to the reprogramming of a cell, e.g. a somatic cell, to the HSC state.
- An HSC inducing factor can be, for example, transcription factors that can reprogram cells to the HSC state, such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, and the like, including any gene, protein, RNA or small molecule that can substitute for one or more of these factors in a method of making iHSCs in vitro.
- exogenous expression of an HSC inducing factor induces endogenous expression of one or more HSC inducing factors, such that exogenous expression of the one or more HSC inducing factor is no longer required for stable maintenance of the cell in the iHSC state.
- developmental potential or “developmental potency” refer to the total of all developmental cell fates or cell types that can be achieved by a given cell upon differentiation. Thus, a cell with greater or higher developmental potential can differentiate into a greater variety of different cell types than a cell having a lower or decreased developmental potential.
- the developmental potential of a cell can range from the highest developmental potential of a totipotent cell, which, in addition to being able to give rise to all the cells of an organism, can give rise to extra-embryonic tissues; to a "unipotent cell,” which has the capacity to differentiate into only one type of tissue or cell type, but has the property of self-renewal, as described herein; to a "terminally differentiated cell,” which has the lowest developmental potential.
- developmental potential refers to a cell having the developmental potential of the parent cell that gave rise to it.
- multipotent when used in reference to a “multipotent cell” refers to a cell that has the developmental potential to differentiate into cells of one or more germ layers, but not all three. Thus, a multipotent cell can also be termed a “partially differentiated cell.” Multipotent cells are well known in the art, and examples of multipotent cells include adult stem cells, such as for example, hematopoietic stem cells and neural stem cells. “Multipotent” indicates that a cell may form many types of cells in a given lineage, but not cells of other lineages. For example, a multipotent hematopoietic cell can form all of the many different types of blood cells (red, white, platelets, etc.), but it cannot form neurons.
- multipotency refers to a state of a cell with a degree of developmental potential that is less than totipotent and pluripotent.
- stem cell or “undifferentiated cell” as used herein, refer to a cell in an undifferentiated or partially differentiated state that has the property of self-renewal and has the developmental potential to differentiate into multiple cell types, without a specific implied meaning regarding developmental potential (i.e., totipotent, pluripotent, multipotent, etc.).
- a stem cell is capable of proliferation and giving rise to more such stem cells while maintaining its developmental potential. In theory, self-renewal can occur by either of two major mechanisms.
- Stem cells can divide asymmetrically, which is known as obligatory asymmetrical differentiation, with one daughter cell retaining the developmental potential of the parent stem cell and the other daughter cell expressing some distinct other specific function, phenotype and/or developmental potential from the parent cell.
- the daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential.
- a differentiated cell may derive from a multipotent cell, which itself is derived from a multipotent cell, and so on. While each of these multipotent cells can be considered stem cells, the range of cell types each such stem cell can give rise to, i.e., their developmental potential, can vary considerably.
- stem cell refers to any subset of cells that have the developmental potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retain the capacity, under certain circumstances, to proliferate without substantially differentiating.
- stem cell refers generally to a naturally occurring parent cell whose descendants (progeny cells) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues.
- differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. Cells that begin as stem cells might proceed toward a differentiated phenotype, but then can be induced to "reverse” and re-express the stem cell phenotype, a term often referred to as “dedifferentiation” or "reprogramming” or
- the term “differentiate”, or “differentiating” is a relative term that refers to a developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell.
- a developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell is a relative term that refers to a developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell.
- reprogrammed cell as the term is defined herein, can differentiate to a lineage-restricted precursor cell (such as a common lymphoid progenitor), which in turn can differentiate into other types of precursor cells further down the pathway (such as a ProBPreB cell, for example), and then to an end-stage differentiated cells, which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
- a lineage-restricted precursor cell such as a common lymphoid progenitor
- ProBPreB cell for example
- Transdifferentiation refers to a process by which the phenotype of a cell can be switched to that of another cell type, without the formation of a multipotent intermediate cell.
- transdifferentiation methods it is not required that the cell first be dedifferentiated (or reprogrammed) to a multipotent cell and then differentiated to another hematopoietic lineage cell; rather the cell type is merely "switched" from one cell type to another without first forming a multipotent iHSC phenotype, for example.
- the term "without the formation of a multipotent or pluripotent intermediate cell” refers to the transdifferentiation of one cell type to another cell type, preferably, in one step; thus a method that modifies the differentiated phenotype or developmental potential of a cell without the formation of a multipotent or pluripotent intermediate cell does not require that the cell be first dedifferentiated (or reprogrammed) to a multipotent state and then differentiated to another cell type.
- RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene.
- an expression product is transcribed from a sequence that does not encode a polypeptide, such as a microRNA.
- transcription factor refers to a protein that binds to specific parts of DNA using DNA binding domains and is part of the system that controls the transcription of genetic information from DNA to RNA.
- small molecule refers to a chemical agent which can include, but is not limited to, a peptide, a peptidomimetic, an amino acid, an amino acid analog, a polynucleotide, a polynucleotide analog, an aptamer, a nucleotide, a nucleotide analog, an organic or inorganic compound (e.g., including heterorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1 ,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
- organic or inorganic compound e.g., including heterorganic and organometallic compounds
- exogenous refers to a nucleic acid (e.g., a synthetic, modified RNA encoding a transcription factor), or a protein (e.g. , a transcription factor) that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is not normally found, or in which it is found in lower amounts.
- a factor e.g. a synthetic, modified RNA encoding a transcription factor, or a protein, e.g. , a polypeptide
- exogenous is considered exogenous if it is introduced into an immediate precursor cell or a progeny cell that inherits the substance.
- endogenous refers to a factor or expression product that is native to the biological system or cell (e.g., endogenous expression of a gene, such as, e.g., HLF refers to production of an HLF polypeptide by the endogenous gene in a cell).
- isolated refers, in the case of a nucleic acid or polypeptide, to a nucleic acid or polypeptide separated from at least one other component (e.g. , nucleic acid or polypeptide) that is present with the nucleic acid or polypeptide as found in its natural source and/or that would be present with the nucleic acid or polypeptide when expressed by a cell, or secreted in the case of secreted polypeptides.
- a chemically synthesized nucleic acid or polypeptide or one synthesized using in vitro transcription/translation is considered “isolated”.
- isolated cell refers to a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell.
- the cell has been cultured in vitro, e.g., in the presence of other cells.
- the cell is later introduced into a second organism or re-introduced into the organism from which it (or the cell or population of cells from which it descended) was isolated.
- isolated population refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells.
- an isolated population is a "substantially pure” population of cells as compared to the heterogeneous population from which the cells were isolated or enriched.
- the isolated population is an isolated population of multipotent cells which comprise a substantially pure population of multipotent cells as compared to a heterogeneous population of somatic cells from which the multipotent cells were derived.
- immediate precursor cell is used herein to refer to a parental cell from which a daughter cell has arisen by cell division.
- contacting or "contact” as used herein in connection with contacting a cell with one or more constructs, viral vectors, or synthetic, modified RNAs, includes subjecting a cell to a culture medium which comprises one or more constructs, viral vectors, or synthetic, modified RNAs at least one time, or a plurality of times, or to a method whereby such constructs, viral vectors, or synthetic, modified RNAs are forced to contact a cell at least one time, or a plurality of times, i.e., a transduction or a transfection system.
- contacting the cell with a construct, viral vector, or synthetic, modified RNA includes administering the construct(s), viral vector(s), or synthetic, modified RNA(s) in a composition, such as a pharmaceutical composition, to a subject via an appropriate administration route, such that the compound contacts the cell in vivo.
- transfection refers the use of methods, such as chemical methods, to introduce exogenous nucleic acids, such as synthetic, modified RNAs, into a cell, preferably a eukaryotic cell.
- exogenous nucleic acids such as synthetic, modified RNAs
- transfection does not encompass viral-based methods of introducing exogenous nucleic acids into a cell.
- Methods of transfection include physical treatments (electroporation, nanoparticles, magnetofection), and chemical-based transfection methods.
- Chemical-based transfection methods include, but are not limited to, cyclodextrin, polymers, liposomes, and nanoparticles.
- cationic lipids or mixtures thereof can be used to transfect the synthetic, modified RNAs described herein, into a cell, such as DOPA, Lipofectamine and UptiFectin.
- cationic polymers such as DEAE-dextran or polyethylenimine, can be used to transfect a synthetic, modified RNAs described herein.
- transduction refers to the use of viral particles or viruses to introduce exogenous nucleic acids, such as nucleic acid sequences encoding HSC inducing factors, into a cell.
- the term "transfection reagent” refers to any agent that induces uptake of a nucleic acid into a host cell. Also encompassed are agents that enhance uptake e.g., by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 500-fold, at least 100-fold, at least 1000-fold, or more, compared to a nucleic acid sequence administered in the absence of such a reagent.
- a cationic or non- cationic lipid molecule useful for preparing a composition or for co-administration with a synthetic, modified RNA is used as a transfection reagent.
- the synthetic, modified RNA comprises a chemical linkage to attach e.g. , a ligand, a peptide group, a lipophillic group, a targeting moiety etc.
- the transfection reagent comprises a charged lipid, an emulsion, a liposome, a cationic or non-cationic lipid, an anionic lipid, or a penetration enhancer as known in the art or described herein.
- the term “repeated transfections” refers to repeated transfection of the same cell culture with a nucleic acid, such as a synthetic, modified RNA, a plurality of times ⁇ e.g., more than once or at least twice).
- the cell culture is transfected at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times at least 18 times, at least 19 times, at least 20 times, at least 25 times, at least 30 times, at least 35 times, at least 40 times, at least 45 times, at least 50 times or more.
- the transfections can be repeated until a desired phenotype of the cell is achieved.
- the time between each repeated transfection is referred to herein as the "frequency of transfection.”
- the frequency of transfection occurs every 6h, every 12h, every 24 h, every 36h, every 48h, every 60h, every 72h, every 96h, every 108h, every 5 days, every 7days, every 10 days, every 14 days, every 3 weeks, or more during a given time period in any
- the frequency can also vary, such that the interval between each dose is different (e.g., first interval 36h, second interval 48h, third interval 72h etc). It should be understood depending upon the schedule and duration of repeated transfections, it will often be necessary to split or passage cells or change or replace the media during the transfection regimen to prevent overgrowth and replace nutrients. For the purposes of the methods described herein, transfections of a culture resulting from passaging an earlier transfected culture is considered
- nucleic acid generally refer to any polyribonucleotide or poly-deoxyribonucleotide, and includes unmodified RNA, unmodified DNA, modified RNA, and modified DNA.
- Polynucleotides include, without limitation, single- and double-stranded DNA and RNA polynucleotides.
- polynucleotide as it is used herein, embraces chemically, enzymatically or metabolically modified forms of
- polynucleotides as well as the naturally occurring chemical forms of DNA and RNA found in or characteristic of viruses and cells, including for example, simple (prokaryotic) and complex
- a nucleic acid polynucleotide or oligonucleotide as described herein retains the ability to hybridize to its cognate complimentary strand.
- nucleic acid As used herein, the terms “nucleic acid,” “polynucleotide,” and
- oligonucleotide also encompass primers and probes, as well as oligonucleotide fragments, and is generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides
- oligonucleotide refers only to the primary structure of the molecule.
- An oligonucleotide is not necessarily physically derived from any existing or natural sequence, but can be generated in any manner, including chemical synthesis, DNA replication, DNA amplification, in vitro transcription, reverse transcription or any combination thereof
- nucleotide or “mononucleotide,” as used herein, refer to a phosphate ester of a nucleoside, e.g., mono-, di-, tri-, and tetraphosphate esters, wherein the most common site of esterification is the hydroxyl group attached to the C-5 position of the pentose (or equivalent position of a non-pentose "sugar moiety").
- nucleotide includes both a conventional nucleotide and a non-conventional nucleotide which includes, but is not limited to, phosphorothioate, phosphite, ring atom modified derivatives, and the like.
- conventional nucleotide refers to one of the "naturally occurring" deoxynucleotides (dNTPs), including dATP, dTTP (or TTP), dCTP, dGTP, dUTP, and dITP.
- dNTPs deoxynucleotides
- non-conventional nucleotide refers to a nucleotide that is not a naturally occurring nucleotide.
- naturally occurring refers to a nucleotide that exists in nature without human intervention.
- non-conventional nucleotide refers to a nucleotide that exists only with human intervention, i.e., an "artificial nucleotide.”
- a "non- conventional nucleotide” can include a nucleotide in which the pentose sugar and/or one or more of the phosphate esters is replaced with a respective analog.
- Exemplary phosphate ester analogs include, but are not limited to, alkylphosphonates, methylphosphonates, phosphoramidates, phosphotriesters, phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates,
- a non-conventional nucleotide can show a preference of base pairing with another non-conventional or "artificial" nucleotide over a conventional nucleotide (e.g., as described in Ohtsuki et al. 2001, Proc. Natl. Acad. Sci., 98: 4922-4925, hereby incorporated by reference).
- the base pairing ability may be measured by the T7 transcription assay as described in Ohtsuki et al. (supra).
- non-conventional or “artificial” nucleotides can be found in Lutz et al. (1998) Bioorg. Med. Chem. Lett., 8: 1149-1152); Voegel and Benner (1996) Helv. Chim. Acta 76, 1863-1880; Horlacher et al. (1995) Proc. Natl. Acad. Sci., 92: 6329- 6333; Switzer et al. (1993), Biochemistry 32: 10489-10496; Tor and Dervan (1993) J. Am. Chem. Soc. 115: 4461-4467; Piccirilli et al. (1991) Biochemistry 30: 10350-10356; Switzer et al.
- non-conventional nucleotide can also be a degenerate nucleotide or an intrinsically fluorescent nucleotide.
- modified ribonucleoside refers to a ribonucleoside that encompasses modification(s) relative to the standard guanine (G), adenine (A), cytosine (C), and uracil (U) nucleosides.
- modifications can include, for example, modifications normally introduced post-transcriptionally to mammalian cell mRNA, and artificial chemical modifications, as known to one of skill in the art.
- the terms "synthetic, modified RNA” or “modified RNA” or “modified mRNA” refer to an RNA molecule produced in vitro which comprises at least one modified nucleoside as that term is defined herein below.
- the modified mRNAs do not encompass mRNAs that are isolated from natural sources such as cells, tissue, organs etc., having those modifications, but rather only synthetic, modified RNAs that are synthesized using in vitro techniques, as described herein.
- composition encompasses a plurality of different synthetic, modified RNA molecules ⁇ e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 90, at least 100 synthetic, modified RNA molecules or more).
- a synthetic, modified RNA composition can further comprise other agents ⁇ e.g., an inhibitor of interferon expression or activity, a transfection reagent, etc.).
- Such a plurality can include synthetic, modified RNA of different sequences ⁇ e.g., coding for different polypeptides), synthetic, modified RNAs of the same sequence with differing modifications, or any combination thereof.
- modified nucleoside refers to a ribonucleoside that encompasses modification(s) relative to the standard guanine (G), adenine (A), cytidine (C), and uridine (U) nucleosides.
- modifications can include, for example, modifications normally introduced post-transcriptionally to mammalian cell mRNA, and artificial chemical modifications, as known to one of skill in the art.
- polypeptide refers to a polymer of amino acids comprising at least 2 amino acids ⁇ e.g., at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, at least 275, at least 300, at least 350, at least 400, at least 450, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 amino acids or more).
- protein and “polypeptide” are used interchangeably herein.
- peptide refers to a relatively short polypeptide, typically between about 2 and 60 amino acids in length.
- Fig. 1 depicts a schematic of hematopoietic differentiation showing populations
- HSCs for which microarray data has been generated. Data generated herein is shown in thin-line boxes, and by other groups in thick-line boxes. Whereas hematopoietic differentiation normally proceeds from HSCs to differentiated blood effector cells, the results described herein aim to utilize HSC-enriched transcription factors to reprogram committed hematopoietic cells back to HSCs (large arrow).
- HSCs are purified by stringent cell surface criteria (e.g., ckit + Sca iineage " CD48 " flk2 CD150 + CD34 ), as well as for fetal liver HSCs (e.g., ckit + Scal + lineage- CD48 " CD150 + Macl low ).
- Fig. 2 depicts an overview of the approaches described herein for identifying factors capable of reprogramming committed hematopoietic cells back to HSCs.
- Fig. 3 depicts gene discovery using the hematopoietic expression database. Heat map of expression of genes enriched in 6 different hematopoietic populations. Each column reflects microarray data from a hematopoietic subset (40 populations represented). Erythroid progenitors include MEP, pre-CFU-E and CFU-E. Expressed was visualized as red; Not expressed was visualized as blue. * Asterisk denotes genes with known roles in specifying the fate and/or function of the indicated cell type.
- Figs. 4A-4B depict an overview of experimental approaches and experimental populations.
- Fig. 4A depicts experimental approaches for screening induced HSCs (iHSCs) through expression of multiple critical HSC-enriched transcription factors by in vitro and in vivo methods.
- CD45.2 transgenic (rtTA) mice are used to identify congenic donor cells in transplant experiments using recipient CD45.1 host mice.
- Common myeloid progenitors (CMPs) and Pro/Pre B Cells were sorted out of the bone marrow of CD45.2 transgenic mice. Sorted cells were incubated for 14 hours with ZsGreen control (VC) or a viral cocktail of HSC-specific factors.
- ZsGr+ cells were resorted two days post doxycycline addition.
- Resorted ZsGr+ CMPs and ProPreB Cells were put into a CFC myeloid colony forming assays (scored for colony numbers and morphology 20 days later) or transplanted into conditioned IR CD45.1+ recipient mice.
- Peripheral bleeds were performed up to 16 weeks as to define the short and long term reconstitution potential of cells. Mice identified with adequate multi-lineage reconstitution were euthanized and donor derived cells sorted from the bone marrow to be transplanted into conditioned secondary CD45.1 recipients; also full analysis of the bone marrow, spleen and thymus was performed.
- Figs. 5A-5C depict heat maps of HSC-enriched transcription factors.
- the Rossi Lab and others put together a detailed database including mRNA expression profiles for over 248 defined progenitor and effector sub populations.
- Fig. 5A depicts an expression profile heat map for 37 HSC- enriched reprogramming factors. Columns represent microarray data for 40 distinct FACs sorted populations. *Denotes factors chosen because of their developmental importance. Expressed was visualized as red; Not expressed was visualized as blue.
- Fig. 5B shows that all HSC-enriched factors were placed into a doxycycline inducible tet-on system based in the pHAGE2 lentiviral vector.
- a CMV promoter is used in the systems described herein.
- Heat Map of expanded set of identified HSC-enriched Transcription Factors Fig. 5C depicts an expression profile heat map for 46 HSC-enriched putative reprogramming factors. Columns represent microarray data for 40 distinct FACs sorted populations. * Expressed was visualized as red; Not expressed was visualized as blue.
- Figs. 6A-6D depict isolation strategies for Pro and Pre B cells.
- Fig. 6A shows ProPre
- Fig. 6B depicts a orting strategy to obtain ProPreB Cells that is demonstrated by flow histograms.
- Fig. 6C shows overall purity for each of the following samples: overall B220 enriched (top panel), reanalyzed sorted Pro B cells (Middle panel) and reanalyzed sorted Pre B cells (Bottom Panel).
- Fig. 6D depicts overall sort purity of Pre B cells and Pro B Cells in each of the populations collected; indicating proficient sorting of ProPre B Cells (RT stands for the B220 " run through from the column).
- Figs. 7A-7B depict an isolation strategy for CMPs.
- Fig. 7A shows CMP cells that are sorted from the bone marrow by placing total bone marrow through a magnetic c-kit enrichment column.
- the indicated gating strategy isolated singlet, live, lineage negative, hematopoietic progenitors.
- Fig. 7B shows that enrichment increases CMP levels and furthermore that using aria cell sorting, a purity of 99-100%) is achieved.
- Figs. 8A-8C demonstrate transduction and inducible expression of HSC-enriched transcription factors (TFs) in hematopoietic progenitors.
- Fig.8A shows transduction of multi-potent progenitors (MPPs) with lentiviruses bearing 8 different TFs (LV1-LV-8). Cells were cultured in the presence of doxycycline (Dox) for 5 days followed by flow cytometry.
- Fig. 8B shows peripheral blood of a recipient transplanted with TF -transduced MPPs and maintained on Dox for 4 weeks (left panel), followed by 2 weeks Dox-off (right panel).
- Fig. 8C shows viral mediated expression of putative reprogramming factors in vitro.
- Quantitative RT-PCR for the indicated genes showing their relative expression within primary hematopoietic stem cells (HSCs) or multi-potent progenitors (MPPs), and in primary cells that were transduced with LV encoding the indicated factor and cultured for 1 week.
- HSCs primary hematopoietic stem cells
- MPPs multi-potent progenitors
- the mRNA levels in overexpressing cells was calculated by dividing to the expression levels in primary HSCs,. Results show Hlf at 8-fold, Nap 113 at 110-fold, Rbpms at 20-fold and Runxl' at 40-fold above endogenous levels.
- Figs. 9A-9C demonstrate that Pro/Pre B Cells and CMPs can be transduced with doxycycline inducible viral cocktails.
- Fig. 9A shows B220+ CD 19+ B Cells that were sorted from the bone marrow; cells were incubated for 14 hours with nothing (non trans), control ZsGr Virus (VC) or a viral cocktail that express 28 HSC-enriched factors (VM). Doxycycline (dox) was added for 24 hours. An increase in ZsGr+ cells is observed when the VM is used on cells in comparison to non transduced cells.
- Fig. 9B shows B220+ CD 19+ B cells that were further analyzed in the presence and absence of dox in three independent trials.
- Fig. 9C shows pre B Cells, Pro B Cells, and CMPs that were sorted out of the bone marrow and incubated for 14 hours with VC or VM and left with Dox for two days before analysis.
- ProPreBCells and CMPs can be transduced with the viral cocktail to express HSC-enriched factors.
- Figs. 10A-10D demonstrate that combinatorial TF expression increases ProPreB and
- ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail (VM) for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20. Fig.
- FIG. 10A shows examples of types of cells observed during determination of colony morphology.
- Fig. 10B depicts representative pictures that were taken of the Transduced ProPreB ZsGreen control (VC) and Viral mixture of 37 factors (VM) CFC plates.
- Fig. IOC shows increasing number of cells that were plated to find an effective plating density of both ProPreBCells and CMPs. 2X10 5 ProPre B Cells and lxlO 4 CMPs were used in further experiments. Experiments were repeated in two individual trials.
- Fig. 10D shows colony number and composition that were determined and noted for all colonies. Increased colony number is observed when ProPreB Cells and CMPs were transduced with the cocktail of 37 factors as compared to the ZsGreen control (VC). Experiments were done in duplicates for four trials.
- Fig. 11 demonstrates that exposure to 18 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo.
- Fig. 12 demonstrates that exposure to 9 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo.
- MPPs from CD45.2 or congenic CD45.1 donors were sorted as LSKCD34+flk2+ and equal numbers of cells were transduced with either control virus (into CD45.1 cells) of a lentiviral mix containing 9 factors, including Evi-1, Glis2, HoxB5, HoxA9, HLF, Meisl, MycN, Prdml6, Runxl (CD45.2 cells).
- Figs. 13A-13B demonstrate long-term multi-lineage reconstitution of multi-potent progenitors (MPPs) transduced with HSC-enriched transcription factors (TFs).
- Fig. 13A Flow cytometry of peripheral blood of a recipient transplanted with MPPs (ckit+Scal+lineage-CD150- flk2+CD34+) transduced with control virus (top panel), or a cocktail of 17 different TFs (lower panel), 20 weeks post-transplant. Equal numbers of MPPs from the same initial sort were
- Fig. 14 demonstrates that exposure to 8 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo.
- Peripheral-blood chimerism is indicated at 16 weeks post-transplant showing that exposure to these factors led to long-term donor multi-lineage engraftment (bottom panel) in contrast to control transdued cells (top panel). Doxycline was maintined on for 2 weeks post-transplant followed by dox-removal.
- FIG. 15 depicts using peripheral bleeds to test donor derived chimerism. Shown here is an example gating strategy on a peripheral bleeds done at 8 weeks on a transplanted mouse with ProPreB cells transduced with a cocktail of viruses that individually encode for expression of 37 transcription factors.
- Figs. 16A-16C demonstrate that ProPreB Cell transplantation confers multi-lineage peripheral reconstitution when factors are expressed combinatorially.
- CD45.2+ ProPreB cells and CMPs transduced with control or VM were transplanted competitively into IR CD45.1+ recipients.
- Peripheral bleeds were performed at 4, 8, 12, and 16 weeks.
- Fig. 16A Flow histograms show 16 week peripheral bleeds for controls (VC- top panels) and cells expressing the mix of 37 factors (VM-bottom panels); demonstrated for ProPreB (Left) and CMP (Right).
- Fig. 16B Quantitative results for each of the peripheral bleeds are shown for ProPreB Cells and CMPs.
- Fig. 17 demonstrates that peripheral lymphoid organ and bone marrow reconstitution is observed from CMPs and ProPreB Cells expressing combinatorial factors.
- the bone marrow, spleen, and thymus were harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a viral cocktail (VM).
- Representative histograms of three ProPre B Cell transplanted mice (VC, VM4, VM14) and two CMP transplanted mice (VC and VM6) - VM#s are the same observed in Fig. 15. Varying degrees of donor derived chimerism can be observed in each lymphoid compartment; consistently VM expressing cells had higher reconstitution in all lymphoid
- Figs. 18A-18D demonstrate that multi-lineage reconstitution is observed in peripheral lymphoid organs upon transplantation with combinatorial factor expression.
- Fig. 18A The bone marrow, spleen, and thymus were harvested from mice that were transplanted with transduced ProPre B cells and CMPs. Quantitation of the data is graphically summarized. In all ProPreB cells transplanted mice with >1.0% peripheral blood chimerism, donor derived chimerism above control levels were observed in all lymphoid compartments analyzed.
- Figs. 18B-18D Composition of the bone marrow, spleen, and thymus for all control mice or experimental mice analyzed with > 1% peripheral blood chimerism.
- Figs. 19A-19D demonstrate that ProPreB Cells and CMPs expressing a cocktail of factors give rise to primitive hematopoietic progenitors.
- Fig. 19A Flow plots have been previously gated on myeloid progenitors (top panel) or primitive hematopoietic progenitors (LSK (Lin " Sca + c- kit + ) cells) (bottom panel). Only mice that received cells transduced with the viral cocktail give rise to donor (CD45.2+) derived cells hematopoietic progenitors or myeloid progenitors.
- FIG. 19B Quantitation of the overall numbers of myeloid progenitors and hematopoietic progenitor cells in each of the transplanted VC (average of five mice) and VM mice with peripheral chimerism above 1.0%. In all cases there is increased numbers of cells with respect to controls.
- Figs. 19C-19D Composition of the compartments was analyzed and quantified. Each bar represents one mouse and the respective composition of the myeloid progenitor compartment (Fig. 19C) or the hematopoietic progenitor compartment (Fig. 19D).
- Figs. 20A-20C demonstrate that ProPre B Cells and CMPs have serial transplant potential only when factors in combination are expressed.
- 1000 LSK CD45.2+ Cells were sorted and transplanted competitively with 2X105 CD45.1+ Competitors into competent CD45.1+ hosts.
- Fig. 20A At 4 weeks all the secondary transplants had distinguishable donor derived multi-lineage populations. Flow graphs representing each of those secondary transplants are shown.
- Fig. 20B Quantitation of these results was calculated and reported here as the % CD45.2+ of total peripheral blood. Only ProPre B Cell VM # 14 had sustainable (>.1%) long-term multi-lineage reconstitution even at 16 weeks.
- Fig. 20C The composition of the peripheral blood for all the mice referred to above at four weeks and at 16 weeks for PPBC#14. Multi-lineage reconstitution is observed for all bleeds.
- Figs. 21A-21B PCR based strategies can be used to identify VDJ rearrangements in
- B-cell progenitors B-cell progenitors.
- Fig. 21A B cells progenitors can be isolated based on the phenotypic markers shown in this schematic.
- Fig. 21B Fraction A, B, C and D and IgM positive mature B cells were sorted and subjected to PCR for V-D-J recombination of heavy and light chain. Heavy chain rearrangement begins as early as fraction B and continues to occur through Fraction C. Lambda and kappa light chain and rearrangement can occur as early as Fraction C and proceed through mature B cells. CD45.2 was used as a PCR loading control across all the samples.
- Figs. 22A-22C demonstrate VDJ rearrangement confirms the B-lineage origin of reprogrammed cells. To determine if cell populations and colonies originated from a VDJ recombined cell we assayed for recombinational events using PCR. Fig. 22A.
- B cells (B220+), hematopoietic progenitor (Live, Lin-, c-kit+, Sca+) , and myeloid progenitor (Live, Lin-, c-kit+, Sea-) bone marrow cells were FACs cell sorted and analyzed by PCR for heavy chain VDJ recombination. These populations provide a positive and two negative controls. Colonies arising from ProPreB cells expressing a mix of TFs were tested (GEMM colony); A myeloid colony taken from the control plate. Fig. 22B. CD45.2+ donor and CD45.1+ recipient Macl+ cells were FACs sorted.
- PCR was performed to test heavy chain (JHSSS), kappa light chain (JLk), lambda light chain (JL1); genomic CD45 as a loading control.
- JHSSS heavy chain
- JLk kappa light chain
- JL1 lambda light chain
- genomic CD45 genomic CD45 as a loading control.
- This demonstrates rearrangement in Mac+ cells isolated from a mouse transplanted with ProPreB Cells transduced with the viral cocktail (ProPreB #4).
- Fig. 22C Recombination analysis was performed and is summarized in table format for mice with CD45.2+ chimerism > 1.0%. All mice with donor derived chimerism and transplanted with ProPre B Cells transduced with the viral cocktail had evidence of reprogramming on the heavy chain loci; a majority had either lambda or kappa light chain rearrangement. All recombinational events appear to be polyclonal and therefore reconstitution occurred from multiple clones.
- Figs. 23A-23B demonstrate that VDJ Rearrangement confirms the origin of the reprogrammed cells. Although summarized in Fig. 22C, further per testing of recombinational events in the peripheral blood of mice reconstituted by ProPreB Cells transduced with the viral cocktail.
- Fig. 23 A Rearrangement PCR testing Macl+ cells isolated from mice reconstituted with reprogrammed Pre/Pro B-cells ( mice #'s 3, 7, 14) by a viral cocktail. B220+ cells are used as the positive control and primitive hematopoietic progenitors (unrearranged LSK cells) as the negative control.
- a mixed myeloid lineage CFC colony (GEMM) that was tested for both heavy and light chain rearrangement.
- Fig. 23B Rearrangement of Macl+ cells sorted from the peripheral blood of a mouse reconstituted with reprogrammed Pre/Pro B-cells (VM#5). B220+ cells isolated from the bone marrow (BM) and peripheral blood (PB) are used as the positive control; primitive hematopoietic progenitors (unrearranged LSK+ cells) as the negative control.
- a mixed myeloid lineage CFC colony (GEMM) that was tested for both heavy and light chain rearrangement.
- Fig. 24 demonstrates that VDJ Rearrangement confirms the origins of peripheral blood cells. Although rearrangement was observed in Mac+ positive cells from the peripheral blood, further analysis was performed on other populations from mice reconstituted from transplanted ProPre B cells transduced with the viral cocktail (#3 and #4). From these two mice the following donor (CD45.2+) populations were sorted: CD4/8+ T cells (T), B220+ B Cells (B), Macl+ Myeloid cells (M), and all other cells with none of those markers (N). Each population displayed evidence of B cell recombinational events.
- Figs. 25A-25D demonstrates that VDJ rearrangement confirms the origins of peripheral lymphoid cells and bone marrow populations. Tracking of VDJ B cell rearrangement in mice partially reconstituted by the proposed iHSC cells was taken one step further.
- mice When bone marrow of mice reconstituted from ProPreB cells transduced with the viral cocktail, aliquots of 50 cells were taken of donor derived hematopoietic progenitors [CD45.2+ LSK cells (LSK)], B cells [B220+ (B Cell)], myeloid cells [Macl+ (Mac)], Myeloid progenitors [Lin-Sca-c-kit+ (MylPro)] and T cells [CD4+/8+/3+ T Cels (T cell)] . DNA was extracted from the samples and PCR performed to assay for recombination.
- Fig. 25A PCR recombination testing of mouse (#4) reconstituted from ProPreB Cells transduced with the viral mix.
- PCR testing was performed for heavy chain (J HSSS ), kappa light chain (J k ), and lambda light chain (Ji).
- Fig. 25B PCR recombination testing of mouse (#3) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (J HSSS ).
- Fig. 25C PCR recombination testing of mouse (#14 and #7) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (JH588). For mouse #14 that had high donor derived chimerism additional analysis was performed on the same populations from the spleen. Recipient CD45.1+ cells were included as a negative control.
- Fig. 25D PCR testing was performed for heavy chain (J HSSS ), kappa light chain (J k ), and lambda light chain (Ji).
- PCR recombination testing of mouse (#7) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (J H 58s)- Analysis of CD3/CD4/CD8+ T cells from the thymus. The left lane is CD45.1+ control T cells and the right is CD45.2+ donor cells. Only donor cells expressed B cell recombinational events.
- Fig. 26 demonstrates a strategy for reverse cloning of reprogramming factors that allows for distinction between endogenous loci (top panel) and integrated reprogramming factors. Primers were designed to straddle intron/exon boundries such that PCR identification of virally introduced transcription factors could readily be resolved from the endogenous genes - with the reprogramming factors yielding a smaller PCR product in all cases. See Table 5 for primer sequences used for reverse cloning of all reprogramming factors.
- Fig. 27 demonstrates reverse cloning identification of transcription factors.
- VC ZsGr control virus
- Only Vector A single virus listed
- VM-Vector a viral mix of 37 different factors minus that listed virus
- VM the viral cocktail of 37 factors
- Fig. 28 shows reverse cloning identification of transcription factors.
- ProPreB Cells were sorted and transduced for 14 hours with ZsGr control virus (VC), A single virus listed (Only Vector), a viral mix of 37 different factors minus that listed virus (VM-Vector) or the viral cocktail of 37 factors (VM). Doxycycline was added for 24 hours and then cells were harvested, DNA isolated, and PCR analysis performed using the indicated primers.
- VC ZsGr control virus
- Only Vector A single virus listed
- VM-Vector a viral mix of 37 different factors minus that listed virus
- VM-Vector a viral cocktail of 37 factors
- Fig. 29 shows reverse cloning of reprogramming factors from myeloid (macrophage and granulocyte) colonies derived from reprogrammed pre/pro B cells. Examples of Gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
- Fig. 30 shows reverse cloning of reprogramming factors from myeloid (GEMM and
- Fig. 31 shows reverse cloning of reprogramming factors from myeloid (BFU) colonies derived from reprogrammed pre/pro B cells. Examples of Gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
- Fig. 32 shows frequency determination in which transcription factor combinations were reverse cloned in reprogrammed cells both intro (CFC colonies) and in vivo (donor-derived meyloid cells).
- integration primers were developed. ProPreB cells that gave rise to B cell (B cell), Macrophage (Mac), Granulocyte (Gran), Granulocyte-Macrophage (GM), Blast Forming Unit (BFU), GEMM, and those colonies not morphologically defined (Not Det) were collected and tested in the indicated n number.
- peripheral blood populations B cell, macrophage, T cell, and other cells were tested for integration and grouped into the in vivo column. Results are summarized in a heat map. High prevalence in the population tested was visualized as red and low prevalence in the population was visualized as blue.
- Fig. 33 shows reverse cloning of reprogramming factors from peripheral blood of mice reconstituted from ProPreB Cells expressing a combination of factors.
- Donor derived peripheral blood from the indicated mice (#4 and #5) reconstituted from ProPre B cells expressing a combination of factors was sorted and PCR analysis performed on the isolated DNA. Examples of two gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen.
- White squares emphasize products that are at the correct size indicating integration of the factor listed.
- Figs. 34A-34C demonstrate identity of factor combinations that are integrated into peripheral blood populations from a mouse reconstituted with ProPre B cells and CMPs transduced with the viral cocktail. For three of the transplanted mice (two originating from a transformed ProPre B cell and one from a CMP) that had peripheral chimerism >1.0% the peripheral blood was further sorted into B220+ (B cells), Mac+ (Mac) and CD3+ (T cells).
- Fig. 34A Every peripheral bleed of donor derived cells originating from a reprogrammed ProPre B Cell or CMP contained Hlf, Zfp37, Runxltl, Pbxl and Lmo2.
- Fig. 34B Additional factors identified in those populations are listed here.
- Fig. 34C Peripheral blood populations (B cell, macrophage, T cell, and other cells were tested for integration and grouped into the in vivo column for the n number of samples. Results are summarized in a heat map. High prevalence in the population tested was visualized as red and low prevalence in the population was visualized as blue.
- Fig. 35 shows transcription factor combination lists. Six combinations (C1-C6) of 4-6 factors were put together based on the integration testing (>75% prevalence). To each combination the additional factors that were 50% - 75% prevalent in the samples were added as additional factors (++). Each combination was derived from a specific colony or population. CI : ProPreB to
- Figs. 36A-36B show combinatorial expression of factors in ProPre B Cells increases colony formation.
- ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3).
- ZsGr control virus VC
- IL-12 In the case of ProPreB Cells, IL-7 and Flk3
- Dox was added for 24 hours and cells were resorted for ZsGr+ cells.
- ZsGr+ cells were placed into methylcellulose media in
- Fig. 36A To ensure that all factors in the combinations were required; factors were singly subtracted out of the combination. Representative pictures of the wells are shown.
- Fig. 36B Quantitation of the data is demonstrated here. The ZsGreen control (VC) and the all the combination groups were performed in duplicates four independent experiments.
- Figs. 37A-37B demonstrate defined combinations of transcription factors can reprogram cells to different fates.
- ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3).
- Fig. 37A The morphology of each of the combinations is shown here. This again is an average of duplicate samples in four independent experiments.
- Fig. 37B Representative pictures of transduced ProPreB cell CFC wells for combinations and controls are shown with composition break downs in pie charts for each combination (average of four experiments). Notice that CI a myeloid promoting combination gave rise to predominantly myeloid cells. Which a B Cell promoting combination (C3) promoted predominantly B cell colonies.
- Fig. 38 shows factor combination minus one experiments to determine the requirement of individual factors for reprogramming.
- ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3).
- VC ZsGr control virus
- IL-12 In the case of ProPreB Cells, IL-7 and Flk3
- Dox was added for 24 hours and cells were resorted for ZsGr+ cells.
- ZsGr+ cells were placed into methylcellulose media in a 6
- Colony forming potential was assayed on day 20. To ensure that all factors in the combinations were required; factors were singly subtracted out of the combination. For each combination listed in bold the factors were subtracted out singularly. As a control Pbxl (a factor not in the required combination was included as a control, as expected this additional factor was not a required factor in C2). Consistently all other combinations appeared to have been narrowed down to only required factors. Singular factor controls are listed in the last Figure. Bars represent averages of double samples performed in duplicate experiments.
- Fig. 39 demonstrates that a defined set of factors identified to give rise to in vivo reprogramming and GEMM formation in myeloid colony forming assays can increase colony formation and alter the lineage potential of both ProPre B cells and CMPs.
- ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or the defined combination C7 (C7) for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20.
- ZsGr control virus VC
- C7 defined
- Figs. 40A-40B demonstrate that combination 6 leads to reprogramming of Pre-ProB cells into cells capable of giving rise to multi-lineage donor derived chimerism in vivo.
- ProPreB Cells and CMPs were sorted from CD45.2 rtTA transgenic bone marrow. Cells were then incubated with the indicated combination of factor expression viruses in equal concentrations. 10,000 Cells were then transplanted into congenic CD45.1+ mice. Mice were then bleed at 4, 8, 12, and 16 weeks. Only Combination 6 showed donor derived chimerism > 1.0% in preliminary trials.
- Figs. 41A-41C demonstrate donor derived multi-lineage reconstitution from ProPre B
- Fig. 41A The gating strategy of mice transplanted with ProPre B Cells transduced with C6 and bleed at 4, 8, and 12 weeks. Donor-derived cells are observed over control level each bleed and are multi-lineage.
- Fig. 41B Quantitations for all the bleeds for ProPreB cells are demonstrated. No benefit of the additional factors was observed.
- Fig. 41C Cellular composition of the 12 week bleeds are shown in the graphs for ProPreB cells.
- Fig. 42 demonstrates multi-lineage potential of reprogrammed B Cell progenitors by a defined set of factors (C6) is confirmed to have undergone recombination events and derived from B Cell origins.
- ProPreB cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC).
- VC ZsGr Control
- Cells were transplanted competitively into mice and to demonstrate that the reconstitution was due to a cell that originated from a B cell, PCR analysis was performed on peripheral blood from the mouse that had long-term reconstitution in the peripheral blood.
- CD45.2+ donor Macl+ cells had evidence of recombination events but recipient (CD45.1+) Macl+ cells nor Fraction A B cells (B Cell Prog) had evidence of reprogramming.
- Fig. 43 demonstrates a defined set of factors (C6) is expressed in peripheral blood derived from a reprogrammed ProPre B Cell.
- ProPreB cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and peripheral bleeds performed at 16 weeks. All the factors that were present in the viral mix were found to have integrated into the donor derived peripheral blood.
- Figs. 44A-44C demonstrate donor derived multi-lineage reconstitution from CMPs expressing a defined set of factors.
- Fig. 44A.CMP cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and peripheral bleeds performed at 4, 8 and 12 weeks. Lineage break down is shown by flow diagrams below for each mouse.
- Fig. 44B Quantitation for all the bleeds for both CMPs derived reconstituting mice are demonstrated. No benefit of the additional factors was observed.
- Fig. 44C Cellular composition of the 12 week bleeds are shown in the graphs for ProPreB cells.
- Fig. 45 shows that reverse cloning confirms that donor derived peripheral blood originating from reprogrammed CMPs by C6 contains factors in Combination 6.
- CMP cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and a peripheral bleeds performed at 12 weeks.
- Peripheral blood was taken from both CMP originating iHSC reconstituting mice was taken and integration studies performed on the population. One mouse contained all factors used in the viral mix and the other was only missing Hlf.
- Figs. 46A-46C demonstrate a defined set of factors give rise to multi-lineage reconstitution from reprogrammed B Cells. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1 ⁇ 10 ⁇ 5 whole bone marrow cells into CD45.1+ recipients. Bleeds were performed at 4, 8, 12, and 16 weeks. Fig. 46A.
- Flow plots are shown for both VC and C7 transduced and transplanted recipients at 8 weeks.
- Fig. 46B Quantitation of peripheral bleeds for the B220 enriched cells transduced with ZsGr control (VC) or C7 at 4, 8, 12 and 16 weeks. Excluding one outlier all C7 transduced and transplanted mice are over VC transduced and transplanted cells.
- Fig. 46C The average composition of peripheral blood at 4, 8, 12, and 16 weeks.
- Fig. 47 shows multi-lineage reconstitution by reprogrammed B220 enriched cells has evidence of B cell recombination in 2/5 mice. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1 ⁇ 10 ⁇ 5 whole bone marrow cells into CD45.1+ recipients. Bleed was performed at 16 weeks.
- ZsGr control VC
- mice were found to have peripheral chimerism due to a transformed B cell. Those mice are shown in FIG. 40A by highlighting them in orange.
- Fig. 48 shows that reverse cloning confirms that donor derived peripheral blood originating from reprogrammed CMPs by C7 contains factors in combination 7. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1X10 ⁇ 5 whole bone marrow cells into CD45.1+ recipients. Bleed was performed at 16 weeks.
- ZsGr control VC
- Figs. 49A-49D show that peripheral lymphoid organ and bone marrow reconstitution is observed from CMPs and ProPreB Cells expressing a defined set of factors, combination 6.
- Fig. 49A The bone marrow, spleen, and thymus were harvested from mice that were transplanted with C6 transduced ProPre B cells and CMPs. Quantitation of the data is graphically summarized. In all ProPreB cells transplanted mice with >1.0% peripheral blood chimerism, donor derived chimerism above control levels were observed in all lymphoid compartments analyzed.
- Figs. 49B-49D In all ProPreB cells transplanted mice with >1.0% peripheral blood chimerism, donor derived chimerism above control levels were observed in all lymphoid compartments analyzed.
- Fig. 50 demonstrates bone marrow reconstitution of the hematopoietic progenitor and myeloid progenitor compartments is observed when CMPs and ProPreB Cells expressing a defined set of factors, combination 6, are transplanted.
- the bone marrow was harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a defined viral cocktail (C6).
- Representative histograms are shown of populations reprogrammed with C6: two CMP transplanted mice (CMP1 and CMP2) and one ProPre B Cell transplanted mouse (ProPreB 1). Cells have been previously gated for singlets, live, lineage negative cells. Varying degrees of donor derived chimerism can be observed.
- the c-kit and sea graphs show that there is donor derived hematopoietic progenitors (LSK; c- kit+Sca+) and myeloid progenitors (Myl Pro; c-kit+Sca-).
- Figs. 51A-51C demonstrate that ProPreB Cells and CMPs expressing a defined set of factors (C6) give rise to primitive hematopoietic progenitors.
- the bone marrow was harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a defined viral cocktail (C6).
- Representative histograms are shown of populations reprogrammed with C6: two CMP transplanted mice (CMP1 and CMP2) and one ProPre B Cell transplanted mouse (ProPreBl).
- Graphs represent donor (CD45.2+) derived hematopoietic progenitors (LSK; c-kit+Sca+) and myeloid progenitors (Myl Pro; c-kit+Sca-).
- Fig. 51A Quantitation of the overall numbers of myeloid progenitors and hematopoietic progenitor cells in each of the transplanted VC (average of five mice) and C6 mice with peripheral chimerism above 1.0%. In all cases there is increased numbers of cells with respect to controls.
- Figs. 51B-51C Composition of the compartments was analyzed and quantified. Each bar represents one mouse and the respective composition of the myeloid progenitor compartment (Fig. 51B) or the hematopoietic progenitor compartment (Fig. 51C).
- Fig. 52 demonstrates that reprogrammed CMPs by defined factors have serial transplantation potential. 16 weeks bone marrow analysis was performed and secondary transplants set up. The two CMP derived mice with donor derived chimerism underwent full bone marrow transplant of 5 million donor cells into five mice each. In the case of the mouse having donor derived chimerism originating from a ProPre B cell transduced with C6, 1 million whole donor bone marrow cells were competitively transplanted with 2 ⁇ 10 ⁇ 5 CD45.1+ whole bone marrow cells into two mice. Flow graphs of donor derived cells from each of these mice are shown. Donor cells are observed at 4 weeks.
- Figs. 53A-53C demonstrate that reprogrammed CMPs by defined factors have serial long-term transplantation potential. 16 weeks bone marrow analysis was performed and secondary transplants set up. The two CMP derived mice with donor derived chimerism underwent full bone marrow transplant of 5 million donor cells into five mice each. In the case of the mouse having donor derived chimerism originating from a ProPre B cell transduced with C6, 1 million whole donor bone marrow cells were competitively transplanted with 2x10 ⁇ 5 CD45.1+ whole bone marrow cells into two mice. Flow graphs of donor derived cells from each of these mice are shown. Donor cells are observed at 4 weeks. Fig. 53A.
- FIG. 53B Quantitation of CD45.2+ donor contributions in peripheral blood at 4 and 8 weeks. CMPs transduced with C6 gave rise to multilineage chimerism in primary recipients and in secondary transplants all the mice had donor cells.
- Fig. 53C Quantitation of the composition of peripheral blood cells in secondary recipients.
- Fig. 54 demonstrates that peripheral blood derived from CMP C6 reconstituted mice can be reprogrammed to give rise to in vitro colony forming potential.
- Peripheral blood from serially transplanted C6 transduced CMP cells was collected.
- B220+ and CD3+ and Macl+ cells were sorted and incubated for 48 hours with doxycycline. Cells were then put into methylcellulose media containing SCF, TPO, IL-12, Flk3, and IL-7. Colonies in the CFCs assays were counted and morphology characterized 20 days later. Control sorted cells from primary VC recipients were blank but colonies were observed when cells were derived from CMPs previously transduced with C6.
- Fig. 55 demonstrates that peripheral blood derived from reconstituted mice having been transplanted with B220 enriched cells expressing C7 mice can undergo secondary reprogrammed to give rise to in vitro colony forming potential.
- Peripheral blood from mice transplanted with B220 enriched cells expressing combination C7 was collected at 16 weeks.
- B220+ and CD3+ and Macl+ cells were sorted and incubated for 48 hours with doxycycline. Cells were then put into
- methylcellulose media containing SCF, TPO, IL-12, Flk3, and IL-7 Colonies in the CFCs assays were counted and morphology characterized 20 days later. Control sorted cells from primary VC recipients were blank but colonies were observed when cells were derived from the peripheral blood of either mouse reconstituted from reprogrammed B220 enriched cells expressing C7.
- Figs. 56A-56C demonstrate that expression of defined factors in various populations can promote colony formation and altered lineage commitment in vitro.
- Various indicated populations were sorted from the bone marrow (Fig. 56A), spleen (Fig. 56B), thymus (Fig. 56C), and peripheral blood (Fig. 56C) of mice.
- Populations include: B220+ (B); Macl+/Gr-1+ (M/G); CD3+/CD4+/CD8+ (T); NK1.1+ (NK); ProPreBCells as a control.
- B, T, and M/G was all sorted into one population.
- Figs. 57A-57C demonstrate that expression of defined factors in human Jurkat cells can promote colony formation and altered lineage commitment in vitro.
- Fig. 57A Human Jurkat cells were cultured and left untransduced, transduced with ZsGr control virus (VC) or with C6 for 14 hours. Doxycycline was added for 24 hours and cells were put in CFC assays. Colonies were counted and morphology determined on day 20. Only Jurkat cells transduced with C6 gave rise to colonies.
- Fig. 57B Colonies that Jurkat cells transduced with C6 gave rise too are pictured. They included an erythroid like colony, granulocytes, and monocytes.
- Fig. 57C Colonies that Jurkat cells transduced with C6 gave rise too are pictured. They included an erythroid like colony, granulocytes, and monocytes.
- Fig. 57C Colonies that Jurkat cells transduced with C6 gave rise too are
- phenotypic markers including Terl 19, Macl, CD71, and Grl was performed on freshly cultured Jurkat cells and the Jurkat cell colonies observed when transduced with C6.
- Jurkat colonies that were transduced with C6 had apparent increases in immature erythroid cells (CD71+ Terl 19-), Granulocyte (Grl+ Macl+) and monocyte (Macl+) populations.
- Figs. 58A-58E show identification of factors capable of imparting alternative lineage potential in vitro.
- FIG. 58A Heat map showing relative expression (green;high, to purple;low) of 36 regulatory genes identified as HSC-specific in the indicated cell types.
- FIG. 58B Schematic representation of lentivirus transgene expression cassette (top), and flow cytometry plots showing reporter cassette (ZsGr) expression in Pro/Pre B-cells +/- doxycycline induction (48 hours post).
- Fig. 58C Schematic representation of in vitro screening strategy for cell fate conversion.
- FIG. 58D Representative images of wells showing colonies arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 36-factor cocktail.
- FIG. 58E Colony number and type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 36-factor cocktail. Four independent experiments are shown and each condition performed in triplicate.
- Figs. 59A-59G show identification of factors capable of imparting multi-lineage engraftment potential onto committed progenitors in vivo.
- FIG. 59A Schematic of experimental strategy to identify factors capable of imparting multi-lineage engraftment potential on committed progenitors in vivo.
- FIG. 59B Representative flow cytometry plots showing donor (CD45.2) reconstitution of mice transplanted with control (ZsGr) or 36-factor transduced Pro/Pre B cells or CMPs 16-weeks post-transplant.
- Fig. 59C Donor reconstitution of mice transplanted with ZsGr or 36-factor transduced Pro/Pre B cells or CMPs at indicated time points post-transplantation.
- Fig. 59D Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor.
- FIG. 59E PCR analysis of immunoglobulin rearrangement showing heavy (J H ), and light chain (J L 3 ⁇ 4., J Lk ) in bone marrow (BM) cells including B-cells (B220+), stem/progenitor (LSK) cells, myeloid progenitors (Myl Pro), and peripheral blood (PB) cells including B-cells (B220+), recipient myeloid cells (Macl+ Rec), and donor myeloid cells (Macl+ Donor) originating from Pro/Pre B cell;36-factor experiment. Loading control; genomic PCR for CD45.
- FIG. 59F PCR-based strategy to identify virally integrated factors and discriminate from endogenous genes.
- FIG. 59G Summary of data showing presence (gray) or absence (black) of each of the indicated factors in donor B-, T-, and myeloid cells in each of the reconstituted mice shown in (Fig. 59C).
- Figs. 60A-60G show transient ectopic expression of six transcription factors in committed progenitors is sufficient to alter lineage potential in vitro and impart long-term engraftment potential on committed progenitors in vivo.
- Fig. 60A Representative images of wells showing colonies arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 6-TF cocktail.
- Fig. 60B Colony number and indicated colony type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 6-TF cocktail. 3 independent experiments are shown with each condition performed in triplicate.
- FIG. 60C Colony number and type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr, 6-TF cocktail, or 6-TF minus the indicated factor. Each condition performed in triplicate.
- Fig. 60D Donor reconstitution of mice transplanted with ZsGr or 6-TF transduced Pro/Pre B cells or CMPs at indicated time points post-transplantation. Only mice with >1% donor chimerism (dotted line) were considered reconstituted. Recipients transplanted;
- FIG. 60F Representative flow cytometry plots showing donor reconstitution and lineage composition of mice transplanted with control (ZsGr) or 6-TF transduced Pro/Pre B cells or CMPs 16-weeks post- transplant. Lineage contribution to Macl+ myeloid cells, B220+ B-cells, and CD3/4/8+ T-cells is shown.
- FIG. 60F Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor.
- FIG. 60G PCR analysis of immunoglobulin heavy (JH) chain rearrangement in recipient myeloid cells (Macl+ Rec), and donor myeloid cells (Macl+ Donor) originating from Pro/Pre B cell;6-TF experiment.
- Figs. 61A-61E show inclusion of Meisl and Mycn and use of polycistronic viruses improves in vivo reprogramming efficiency.
- Fig. 61A Schematic representation of RHL (Runxtltl, Hlf, Lmo2) and PZP (Pbxl, Zfp37, Prdm5) polycistronic, and Meisl and Mycn single factor viral constructs.
- Fig. 61 C Representative flow cytometry plots showing donor reconstitution and lineage contribution of mice transplanted with control (ZsGr), 8-TF, or 8TFPoly transduced Pro/Pre B cells 16-weeks post- transplant.
- FIG. 61D Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor.
- FIG. 61E PCR analysis of immunoglobulin heavy (JH) chain rearrangement in recipient (Recip), and donor (Donor) myeloid cells. Loading control; genomic PCR for CD45.
- Figs. 62A-62I shows reprogrammed cells engraft secondary hematopoietic organs, bone marrow progenitor compartments and reconstitute secondary recipients.
- Fig. 62A Donor reconstitution of peripheral blood (PB), bone marrow (BM), spleen, and thymus of mice transplanted with 8-TF, or 8-TFPoly transduced Pro/Pre B cells 18-20 weeks post-transplantation.
- Fig. 62B PCR analysis of immunoglobulin heavy (J H ) chain rearrangement in recipient (R), and donor (D) cells.
- FIG. 62C Representative bone marrow stem and progenitor analysis of a recipient transplanted with 8-TFPoly transduced Pro/Pre B cells 18-weeks post-transplantation showing donor-reconstitution of myeloid progenitors (Myl Pro),
- megarkaryocyte/erythrocyte progenitors MEP
- granulocyte/monocyte progenitors GMP
- common myeloid progenitors CMP
- megakaryocyte progenitors MkP
- erythroid progenitors EP
- common lymphoid progenitors CLP
- Lineage -negative Seal +ckit+ multipotent progenitors LSK
- MPPl MPP2
- HSC hematopoietic stem cells
- FIG. 62A Reconstitution of the indicated myeloid progenitor (E) and primitive multi-potent and stem cell (F) populations in mice analyzed in (A) presented as percentage of donor.
- FIG. 62G PCR analysis of immunoglobulin heavy (JH) chain rearrangement in the indicated recipient and donor populations. Loading control; genomic PCR for CD45.
- FIG. 621) Reconstitution of indicated peripheral blood cell lineages of individual recipients presented as % of donor.
- Figs. 63A-63H show transient expression of defined transcription factors in myeloid effector cells is sufficient instill them with progenitor activity in vitro, and long-term multi-lineage transplantation potential in vivo.
- FIG. 63A Schematic representation of experimental strategy for assaying the colony forming potential of 8-TF transduced peripheral blood cells.
- FIG. 63B Colony number and type arising in methylcellulose from peripheral blood cells from recipient (left-most lanes) or donor cells derived from a recipient transplanted with Pro/Pre B cells transduced with 8-TF or 8-TFPoly cocktail, plus (+) or minus (-) exposure to doxycycline. Results from individual mouse performed in triplicate are shown.
- Fig. 63C Colony number and type arising in methylcellulose from plated granulocytes, macrophages/monocytes (Myl), B-cells, and T-cells purified from the peripheral blood of cells pooled recipients transplanted with Pro/Pre B cells transduced with 8-TF Poly cocktail plus (+) or minus (-) exposure to doxycycline.
- Fig. 63D Representative colony types and cytospins stained with May Grunwald of colonies derived in (Fig. 63C).
- Fig. 63E Donor reconstitution of mice transplanted with ZsGr, 6-TF Poly , 8-TF or 8-TF Poly transduced Macl+cKit- myeloid effector cells at indicated time points post-transplantation.
- Fig. 63F Reconstitution of indicated peripheral blood cell lineages of mice showing >1% donor chimerism presented as % of donor.
- Figs. 64A-64D shows iHSCs reprogrammed via 8 transcription factors closely resemble endogenous HSCs at the molecular level.
- Fig. 64A shows phenotypic HSCs (doublet discriminated, live, lineage negative, c-kit+, Scal+, CD34-,flk2-and CD 150+) were FACS sorted from the bone marrow of mice reconstituted with Pro/Pre B cells transduced with 8-TF (Mouse # 1) and 8-TF POLY (Mouse # 10) viral cocktails. Cells were single cell sorted into 96 well plates and analyzed by qPCR for an array of transcription factors. Expression levels of individual cells were projected onto a three-dimensional space using principle component analysis.
- Recipient HSCs HSC Host
- iHSC 8-TF Pro/Pre B cells transduced with 8-TF
- iHSC 8-TF Poly iHSC 8-TF Poly
- Each leaf of the dendrogram represents a single cell as indicated in the legend in panel A.
- Fig. 64D shows analysis of indicated genes are shown for: phenotypic control HSCs (HSC), transplanted host HSCs (HSC host), iHSCs derived from Pro/Pre B Cells transduced with 8-TF (iHSC 8-TF) and 8-TF POLY (iHSC 8-TFPoly) and control Pro/Pre B Cells. Heat maps for expression levels in the indicated cell types are shown (high expression was visualized as red; low expression was visualized as blue). Violin plots show distribution patterns of each of the above transcription factors in one cell type. Expression level is on the y-axis.
- Figs. 65A-65B show a sorting strategy for Pro/Pre B cells (Fig. 65A) and CMPs (Fig.
- Fig. 65B shows doublet discriminated and PI negative cells were pre-gated and CMPs were gated as indicated: Lineage negative (Grl-, Macl-, B220-, CD3-, CD4-, CD8-, Terl l9-), c-kit+, Seal-, FcDR3MID, and CD34+.
- Fig. 66 shows Pro/Pre B cells and CMPs were transduced with the viral cocktail of
- Fig. 67 shows Macl+ bone marrow cells were isolated from transgenic rtTA mice.
- Figs. 68A-68D show Macl+ bone marrow cells were FACS sorted, transduced with
- Fig. 68A Transplantation was done as indicated and 18 weeks post transplantation bone marrow, spleen, thymus, and peripheral blood was harvested from mice with peripheral blood reconstitution > 5.0%. Donor contributions are shown graphically in the peripheral blood (PB), bone marrow (BM), spleen and thymus for a 6-TF POLY mouse, 8-TF mouse and four 8-TF POLY mice. The y-axis break marks 1.0 % donor reconstitution.
- Fig. 68B shows the composition break down for donor-derived cells in the bone marrow, spleen, and thymus.
- Fig. 68C shows the % donor of each of the progenitor compartments was calculated by gating as previously shown but last through donor. Quantitation of these results is shown for mice reconstituted from Macl+ bone marrow cells transduced with 6-TF POLY (1 mouse), 8-TF (1 mouse) and 8-TF POLY (4 mice). A break indicates a 1.0% donor composition.
- 68D shows compositional breakdown of the Hematopoietic progenitor compartment for each mouse reconstituted from Macl+ bone marrow cells transduced with 6-TF POLY (1 mouse), 8-TF (1 mouse) and 8-TF POLY (4 mice). Populations were gated first by donor and then by previously defined phenotypic markers.
- Fig. 69 shows phenotypic HSCs (doublet discriminated, live, lineage negative, c-kit+,
- a heat map displays transcription factor expression (columns) for indicated cell types (rows), including: previously profiled and phenotypically sorted progenitor control cell types (HSC, MPP, MEP, CMP, GMP, CLP), control Pro/Pre B cells, recipient derived HSCs (Host HSC), and iHSC cells isolated from mice reconstituted from Pro/Pre B Cells transduced with viral mixtures of 8-TF (iHSC 8-TF) and 8-TF POLY (iHSC 8-TF POLY). High expression was visualized as red; Low Expression was visualized as blue.
- Figs. 70A-70H shows reprogramming terminally differentiated myeloid cells to engraftable HSC-like cells.
- Fig. 70A Schematic for secondary reprograming experiments.
- mice reconstituted with ProPre B Cells transduced with the viral cocktail 8-TF or 8-TF POLY were bled at 16-20 weeks and CD45.1+ (donor) and CD45.2+ (Recipient) cells were FACS sorted (8-TF) or unsorted (8-TF POLY), plated into F12 media in the presence/absence of dox for 3 days, transferred into methylcellulose, and counted/scored on day 20. Quantitation of the colony number and composition is shown for cells in the presence and absence of dox. Each column represents one or three replicates per mouse. A representative GEMM colony and GM (Granulocyte- Myeloid) colony are shown to the right for donor sorted cells in the presence of dox. (Fig.
- FIG. 70D Representative 1 Ox views of colonies [GEMM, GM, Granulocyte (G) and Myeloid (M)] derived from donor cells are shown. Cytospins were performed on each colony and showen to the right with prominent cell types labeled.
- FIG. 70E Macl+ bone marrow cells were isolated from transgenic rtTA mice. Cells were transduced for 16 hours with RHL + PZP (6-TF POLY), Runxltl + Hlf + Lmo2 + Pbxl + Zfp37 + Prdm5 + Mycn + Meisl (8-TF) and RHL + PZP + Mycn + Meisl (8-TF POLY).
- Fig. 70F Composition of mice reconstituted over 1% are shown and broken into B cell, myeloid, granulocyte, and T cell as previously defined.
- Fig. 70G Secondary transplantation was performed by euthanizing and harvesting bone marrow from primary mice with donor reconstitutions over 5%.
- Figs. 71A-71B show donor-derived bone marrow, originating from transformed
- B-Cells were isolated from two primary reconstituting animals and one secondary animal.
- B220+ (B-Cells), CD3+ (T-Cells), Macl+Grl- (Myeloid) and Macl+Grl+ (Gran) cells were FACS sorted.
- VDJ analysis was performed on each of the lineages, similar size bands were selected and individual VDJ amplicons were sequenced to obtain information on individual recombination events in each of the lineages. Sequence data is show for each of the indicated donors/cell types.
- VDJ ID VDJ recombinational events were identified (VDJ ID) and listed according to the VH, DH or JH segment to which the sequence corresponds.
- VDJ ID VDJ recombinational events were identified (VDJ ID) and listed according to the VH, DH or JH segment to which the sequence corresponds.
- Fig. 71A Sequences for Donor P-l are disclosed as SEQ ID NOS 168-169, 168-169, 176, 176, 176, 176, 181, 181, 181 and 181 read from columns left to right.
- Sequences for Donor l°-8 are disclosed as SEQ ID NOS 170, 170, 170, 170, 170, 177, 177, 177, 182, 182, 182 and 182 read from columns left to right.
- Figs. 72A-72C Donor-derived MEP cells (Live, Lin-, c-kit+, Seal-, CD34-, FcgR3-) were FACS sorted from the bone marrow of a primary recipient reconstituted from a transformed Pro/Pre B-Cell (Mouse ID 6). MEP cells were transplanted into three irradiated recipients (50,000 cells/recipient). Controls were irradiated but not transplanted. (Fig. 72A) The survival of these mice is indicated graphically over time post transplant. At day 20 post transplant the peripheral blood of the remaining mice was tested for red blood cell counts (RBC Counts, Fig. 72B) and platelet numbers (Platelet Counts, Fig. 72C).
- compositions, nucleic acid constructs, methods and kits thereof for hematopoietic stem cell induction or reprogramming cells to the hematopoietic stem cell multipotent state based, in part, on the discoveries described herein of novel combinations of transcription factors that permit dedifferentiation and reprogramming of more differentiated cells the hematopoietic stem cell state.
- Such compositions, nucleic acid constructs, methods and kits can be used for inducing hematopoietic stem cells in vitro, ex vivo, or in vivo, and these induced
- hematopoietic stem cell can be used in regenerative medicine applications.
- HSCs Hematopoietic stem cells
- Fig. 1 Hematopoietic stem cells
- HSC transplantation Allogeneic and autologous HSC transplantation are routinely used in the treatment of patients with a variety of life-threatening disorders. Despite wide clinical use, HSC transplantation remains a high-risk procedure, with the number of stem cells available for transplantation being the strongest predictor of transplantation success. Although stem cell mobilization with G-CSF alone, or in combination with other drugs, increases the yield of hematopoietic stem cells for transplantation, an ability to induce, expand, or generate patient-specific HSCs de novo, as described herein, could be useful in a number of clinical settings, or be used to model hematopoietic diseases ex vivo or in xenotransplantation models.
- HSCs Differentiation of HSCs to fully differentiated blood cells is believed to be an irreversible process under normal physiological conditions.
- Hematopoietic lineage specification takes place within the bounds of strict lineal relationships: for example, megakaryocyte progenitors give rise to megakaryocytes and ultimately platelets, but not to any other blood lineages.
- HSCs the most clinically useful cell type to strive to generate by reprogramming are HSCs, as they are the only cells which possess the potential to generate all blood cell types over a lifetime, and transplantation protocols for their clinical use are already established.
- transplantation protocols for their clinical use are already established.
- no reports describing the generation of HSCs by reprogramming have been published because the the factor(s) needed to reprogram to HSCs have not yet been determined.
- This point is central to the experimental rationale and strategies described herein, which were designed to first identify and clone transcriptional activators important for specifying HSC fate and function, and then utilize such factors to reprogram committed blood cells back to an induced HSC fate (Fig. 2), as demonstrated herein.
- Hematopoietic tissues contain cells with long-term and short-term regeneration capacities, and committed multipotent, oligopotent, and unipotent progenitors.
- Endogenous HSCs can be can be found in a variety of tissue sources, such as the bone marrow of adults, which includes femurs, hip, ribs, sternum, and other bones, as well as umbilical cord blood and placenta, and mobilized peripheral blood.
- Endogenous HSCs can be obtained directly by removal from, for example, the hip, using a needle and syringe, or from the blood following pre-treatment with cytokines, such as G-CSF (granulocyte colony-stimulating factors), that induce cells to be released from the bone marrow compartment.
- cytokines such as G-CSF (granulocyte colony-stimulating factors)
- G-CSF granulocyte colony-stimulating factors
- hematopoietic stem cells encompass all multipotent cells capable of differentiating into all the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T-cells, B-cells, NKT-cells, NK-cells), and which have multi-lineage
- stem cells refer to cells that retain the ability to renew themselves through mitotic cell division and can differentiate into a diverse range of specialized cell types.
- the two broad types of mammalian stem cells are: embryonic stem (ES) cells that are found in blastocysts, and adult stem cells that are found in adult tissues.
- ES embryonic stem
- stem cells can differentiate into all of the specialized embryonic tissues.
- progenitor cells act as a repair system for the body, replenishing specialized cells, but also maintain the normal turnover of regenerative organs, such as blood, skin or intestinal tissues.
- Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.
- Stem cells are generally classified by their developmental potential as: (1)
- pluripotent meaning able to give rise to all embryonic cell types
- multipotent meaning able to give rise to a subset of cell lineages, but all within a particular tissue, organ, or physiological system
- HSCs hematopoietic stem cells
- oligopotent meaning able to give rise to a more restricted subset of cell lineages than multipotent stem cells
- unipotent meaning able to give rise to a single cell lineage (e.g., spermatogenic stem cells).
- Self-renewal refers to the ability of a cell to divide and generate at least one daughter cell with the identical (e.g., self-renewing) characteristics of the parent cell.
- the second daughter cell may commit to a particular differentiation pathway.
- a self-renewing hematopoietic stem cell divides and forms one daughter stem cell and another daughter cell committed to differentiation in the myeloid or lymphoid pathway.
- a committed progenitor cell has typically lost the self-renewal capacity, and upon cell division produces two daughter cells that display a more differentiated (i.e., restricted) phenotype.
- True hematopoietic stem cells have the ability to regenerate long term multi-lineage hematopoiesis (e.g., "long-term engraftment") in individuals receiving a bone marrow or umbilical cord blood transplant, as described herein.
- long-term engraftment long term multi-lineage hematopoiesis
- Hematopoietic stem cells are traditionally identified as being lineage marker negative,
- HSCs give rise to "multipotent progenitor cells” or "hematopoietic progenitor cells,” which, as the terms are used herein, refer to a more differentiated subset of multipotent stem cells that while committed to the hematopoietic cell lineage generally do not self-renew.
- multipotent progenitor cells or "hematopoietic progenitor cells,” which, as the terms are used herein, refer to a more differentiated subset of multipotent stem cells that while committed to the hematopoietic cell lineage generally do not self-renew.
- hematopoietic progenitor cells or “multi-potent progenitor cells” (MPPs) encompass short term hematopoietic stem cells (also known as ST-HSCs, which are lineage marker negative, Seal -positive, cKit-positive, CD34-positive, and Flk2 -negative); common myeloid progenitor cells (CMPs);
- LMPPs lymphoid-primed progenitor cells
- GMPs granulocyte-monocyte progenitor cells
- MPPs granulocyte-monocyte progenitor cells
- MEPs megakaryocyte-erythrocyte progenitor cells
- HSCs long-term multi-lineage repopulating and self-renewing hematopoietic stem cells
- HSCs long-term multi-lineage repopulating and self-renewing hematopoietic stem cells
- HSCs long-term multi-lineage repopulating and self-renewing hematopoietic stem cells
- HSCs long-term multi-lineage repopulating and self-renewing hematopoietic stem cells
- LRPs lineage-restricted progenitor cells
- CMP common myeloid progenitor cells
- compositions, constructs, methods, and kits comprising the
- induced hematopoietic stem cells or iHSCs can be generated that are multipotent and capable of differentiating into all the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells
- T -cells megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T -cells, B-cells, NKT-cells, NK- cells), and which have multi-lineage hematopoietic differentiation potential and sustained self-renewal activity.
- cells are dedifferentiated into one or more other hematopoietic progenitor cells types, such as short term hematopoietic stem cells, common myeloid progenitor cells, common lymphoid progenitor cells, lymphoid-primed progenitor cells, granulocyte -monocyte progenitor cells, and megakaryocyte-erythrocyte progenitor cells.
- hematopoietic progenitor cells types such as short term hematopoietic stem cells, common myeloid progenitor cells, common lymphoid progenitor cells, lymphoid-primed progenitor cells, granulocyte -monocyte progenitor cells, and megakaryocyte-erythrocyte progenitor cells.
- HSC inducing factors capable of reprogramming committed blood cells to induced HSCs can advance our basic understanding of HSC biology in a number of ways.
- HSCs are the most well characterized tissue-specific stem cells, surprisingly little is known about the molecular mechanisms involved in regulating their central properties of self-renewal and multi-potency.
- Identification of factors capable of imparting self-renewal and multi-lineage potential onto otherwise non-self-renewing, lineage- restricted cells, as described herein, provide important insights into the molecular basis of these fundamental attributes and provide strategies on how best to therapeutically manipulate HSCs.
- HSCs homeostatic control mechanisms
- identification of regulators responsible for specifying HSC function can also provide important insights into how homeostasis is regulated by stem cells, and in turn, how deregulation of such processes manifest in disease.
- Functional conservation of reprogramming factors between species is well-documented indicating that it the methods and compositions described herein are applicable for reprogramming human blood cells to induced HSCs, using homologues of the murine reprogramming factors described herein.
- HSC inducing factors or HSC reprogramming factors able to mediate the reprogramming of committed cells back to an induced hematopoietic stem cell (iHSC) state.
- HSCs are the only cells in the hematopoietic system capable of giving rise to long-term (>4 months) multi- lineage reconstitution in transplantation assays, whereas committed progenitors reconstitute recipient mice only transiently with restricted lineage potential depending upon their stage of differentiation . Only progenitors that have been successfully reprogrammed to an induced hematopoietic stem cell state are able to give rise to long-term multi-lineage reconstitution in transplant recipients, using the compositions, methods, and kits described herein.
- HSCs are fluorescence activated cell sorted (FACS) purified by stringent cell surface phenotype, and defined through functional criteria (Figs. 1-2).
- FACS fluorescence activated cell sorted
- Figs. 1-2 46 expression profiles for HSCs were generated, which lends enormous statistical power to the analyses described herein.
- 248 expression profiles of hematopoietic populations have been generated and normalized into a single database (referred to as the "hematopoietic expression database" (Fig. 3).
- TFs transcriptional factors
- HSC inducing factors can be used as HSC inducing factors, even though they do not exhibit particularly HSC-specific expression in the adult.
- HSC inducing factors over 40 TFs that can be used in various combinations as "HSC inducing factors," as the term is used herein, have been identified and the expression profiles of each have been confirmed by qRT-PCR.
- HSC inducing factors genes identified herein as "HSC inducing factors" into an adult, somatic cell, preferably, in some embodiments, a more differentiated cell of the hematopoietic lineage.
- nucleic acids encoding the HSC inducing factors e.g., DNA or RNA, or constructs thereof, are introduced into a cell, using viral vectors or without viral vectors, via one or repeated transfections, and the expression of the gene products and/or translation of the RNA molecules result in cells that are morphologically, biochemically, and functionally similar to HSCs, as described herein.
- reprogramming refers to a process of driving a cell to a state with higher developmental potential, i.e., backwards, to a less differentiated state.
- reprogramming encompasses a complete or partial reversion of the differentiation state to that of a cell having a multipotent state.
- reprogramming encompasses a complete or partial reversion of the differentiation state to that of a cell having the state of a hematopoietic progenitor cell, such as a CMP, a CLP, etc.
- compositions comprising amino acid or nucleic acid sequences or expression vectors thereof encoding these HSC inducing factors are referred to herein as "HSC inducing compositions.”
- HSC inducing factors As demonstrated herein, over 40 transcription factors were identified that can be introduced into a cell in various combinations as "HSC inducing factors" to generate induced hematopoietic stem cells or iHSCs that are multipotent and capable of differentiating into all or a majority the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T -cells, B-cells, NKT-cells, NK- cells), and which have multi-lineage hematopoietic differentiation potential and sustained self-renewal activity.
- HSC inducing factors and combinations thereof comprising the genes listed in Table 1 , which also provides exemplary sequences for making the identified proteins: Table 1: HSC Inducing Factor
- polypeptide variants or family members having the same or a similar activity as the reference polypeptide encoded by the sequences provided in Table 1 can be used in the compositions, methods, and kits described herein.
- variants of a particular polypeptide encoding a HSC inducing factor for use in the compositions, methods, and kits described herein will have at least about 75%, at least about 80%, at least about 85%, at least about 90%>, at least about 91%), at least about 92%, at least about 93%, at least about 94%, at least about 95%>,at least about 96%), at least about 97%, at least about 98%, at least about 99% or more sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
- the HSC inducing factors for use in the compositions, methods, and kits described herein are selected from the group consisting of:
- the HSC inducing factors are selected from: HLF, MYCN, MEIS1, IRF6, CDKN1C, NFIX, DNMT3B, ZFP612, PRDM5, HOXB4, LM02, NKX2-3, RARB, NDN, NAP1L3, RUNX1T1, ZFP467, and ZFP532.
- Another grouping is a core 6 factors (Runxltl, HLF, PRDM5, PBX1, LM02, and ZFP37), and 8 factors (the 6 factors plus MEIS1, MYCN).
- the HSC inducing factors are selected from: HLF, MYCN, MEIS1, IRF6, NFIX, DNMT3B, ZFP612, PRDM5, HOXB4, LM02, NKX2-3, RARB, NDN, NAP1L3, RUNX1T1, ZFP467, and ZFP532.
- the HSC inducing factors are selected from: EVI-1, GLIS2, HOXB5, HOXA9, HLF, MEIS1, MYCN, PRDM16, and RUNX1.
- the HSC inducing factors are selected from: RUNX1T1, HLF, ZFP467, RBPMS, HOXB5, NAP1L3, MSI2, and IRF6.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- HLF HLF
- RUNX1T1T1 HLF
- PBXl PBXl
- LM02 LM02
- PRDM5 ZFP37
- MYCN MSI2, NKX2-3, MEIS1, and RBPMS.
- RBPMS RBPMS.
- the use of these 11 HSC inducing factors together also referred to herein as "Combination 7" or "C7”
- this combination was shown to have serial long-term transplantation potential in vivo.
- the HSC inducing factors are selected from HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5.
- HLF HLF
- RUNX1T1 HLF
- ZFP37 ZFP37
- PBXl PBXl
- LM02 LM02
- PRDM5 PRDM5
- the HSC inducing factors are selected from HLF, ZFP37, RUNX1T1, PBXl, LM02, and PRDM5.
- the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors PRDM16, ZFP467, and VDR.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of ZFP467, PBXl, HOXB4, and MSI2.
- the use of these HSC inducing factors together also referred herein as "Combination 1" or "CI,” was able to reprogram ProPreB cells to myeloid cells.
- the HSC inducing factors are selected from ZFP467, PBXl, HOXB4, and MSI2.
- the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors HLF, LM02, PRDM16, and ZFP37.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of MYCN, MSI2, NKX2-3, and RUNX1T1.
- the use of these HSC inducing factors together also referred herein as "Combination 2" or "C2,” was able to reprogram ProPreB cells to iHSCs.
- the HSC inducing factors are selected from MYCN, MSI2, NKX2-3, and RUNX1T1.
- compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors HOBX5, HLF, ZFP467, HOXB3, LM02, PBX1, ZFP37, and ZFP521.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HOXB4, PBX1, LM02, ZFP612, and ZFP521.
- the use of these HSC inducing factors together also referred herein as "Combination 3" or "C3,” was able to promote the proliferation and survival of ProPreB cells.
- the HSC inducing factors are selected from HOXB4, PBX1, LM02, ZFP612, and ZFP521.
- the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors KLF12, HLF, and EGR1.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of MEISI, RBPMS, ZFP37, RUNXITI, and LM02.
- the use of these HSC inducing factors together also referred herein as "Combination 4" or "C4," was able to reprogram CMP cells to iHSCs.
- the HSC inducing factors are selected from MEISI, RBPMS, ZFP37, RUNXITI, and LM02.
- the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors KLF12 and HLF.
- the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of ZFP37, HOXB4, LM02, and HLF.
- the use of these HSC inducing factors together also referred herein as "Combination 5" or "C5,” was able to reprogram the fates of CMP and ProPreB cells.
- the HSC inducing factors are selected from ZFP37, HOXB4, LM02, and HLF.
- the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors MYCN, ZFP467, NKX2-3, PBX1, and KLF12ZFP37.
- the number of HSC inducing factors used or selected to generate iHSCs from a starting somatic cell, such as a fibroblast cell or hematopoietic lineage cell is at least three. In some embodiments, the number of HSC inducing factors used or selected is at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, or more.
- isolated amino acid sequences, and isolated DNA or RNA nucleic acid sequences encoding one or more HSC inducing factors for use in making iHSCS are also provided herein, in various aspects of the compositions, methods, and kits.
- the nucleic acid sequence or construct encoding the HSC inducing factor(s), such as HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS is inserted or operably linked into a suitable expression vector for transfection of cells using standard molecular biology techniques.
- a "vector" refers to a nucleic acid molecule, such as a dsDNA molecule that provides a useful biological or biochemical property to an inserted nucleotide sequence, such as the nucleic acid constructs or replacement cassettes described herein.
- a vector can have one or more restriction
- Vectors can also comprise one or more recombination sites that permit exchange of nucleic acid sequences between two nucleic acid molecules.
- Vectors can further provide primer sites, e.g., for PCR, transcriptional and/or translational initiation and/or regulation sites, recombination signals, replicons, additional selectable markers, etc.
- a vector can further comprise one or more selectable markers suitable for use in the identification of cells transformed with the vector.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
- the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding PRDM16; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
- HLF hematopoietic stem cell
- HSC hematopoietic stem cell inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2.
- the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- the HSC inducing composition further comprises a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
- the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
- the HSC inducing composition further comprises one or more of a sequence encoding KLF12; and a sequence encoding HLF.
- the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding KLF4.
- the expression vector is a viral vector.
- Some viral-mediated expression methods employ retrovirus, adenovirus, lentivirus, herpes virus, pox virus, and adeno-associated virus (AAV) vectors, and such expression methods have been used in gene delivery and are well known in the art.
- the viral vector is a retrovirus.
- Retroviruses provide a convenient platform for gene delivery. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to target cells of the subject either in vivo or ex vivo. A number of retroviral systems have been described. See, e.g., U.S. Pat. No.
- the retrovirus is replication deficient.
- Retroviral vector systems exploit the fact that a minimal vector containing the 5 ' and 3 ' LTRs and the packaging signal are sufficient to allow vector packaging, infection and integration into target cells, provided that the viral structural proteins are supplied in trans in the packaging cell line. Fundamental advantages of retroviral vectors for gene transfer include efficient infection and gene expression in most cell types, precise single copy vector integration into target cell chromosomal DNA and ease of manipulation of the retroviral genome.
- the viral vector is an adenovirus-based expression vector.
- adenoviruses persist extrachromosomally, thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham (1986) J. Virol. 57:267-74; Bett et al. (1993) J. Virol. 67:5911-21 ; Mittereder et al. (1994) Human Gene Therapy 5:717-29; Seth et al. (1994) J. Virol. 68:933-40; Barr et al.
- Adenoviral vectors infect a wide variety of cells, have a broad host-range, exhibit high efficiencies of infectivity, direct expression of heterologous genes at high levels, and achieve long-term expression of those genes in vivo.
- the virus is fully infective as a cell-free virion so injection of producer cell lines is not necessary.
- adenovirus is not associated with severe human pathology, and the recombinant vectors derived from the virus can be rendered replication defective by deletions in the early-region 1 ("El") of the viral genome.
- Adenovirus can also be produced in large quantities with relative ease.
- Adenoviral vectors for use in the compositions, methods, and kits described herein can be derived from any of the various adenoviral serotypes, including, without limitation, any of the over 40 serotype strains of adenovirus, such as serotypes 2, 5, 12, 40, and 41.
- the adenoviral vectors used herein are preferably replication-deficient and contain the HSC inducing factor of interest operably linked to a suitable promoter.
- the nucleic acid sequences encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEISI, and RBPMS are introduced or delivered using one or more inducible lentiviral vectors.
- Control of expression of HSC inducing factors delivered using one or more inducible lentiviral vectors can be achieved, in some embodiments, by contacting a cell having at least one HSC inducing factor in an expression vector under the control of or operably linked to an inducible promoter, with a regulatory agent (e.g., doxycycline) or other inducing agent.
- a regulatory agent e.g., doxycycline
- contacting such a cell with an inducing agent induces expression of the HSC inducing factors, while withdrawal of the regulatory agent inhibits expression.
- the presence of the regulatory agent inhibits expression, while removal of the regulatory agent permits expression.
- induction of expression refers to the expression of a gene, such as an HSC inducing factor encoded by an inducible viral vector, in the presence of an inducing agent, for example, or in the presence of one or more agents or factors that cause endogenous expression of the gene in a cell.
- a doxycycline (Dox) inducible lentiviral system is used. Unlike retroviruses, lentivirases are able to transduce quiescent cells making them amenable for transducing a wider variety of hematopoietic cell types. For example, the pHAGE2 lentivirus system has been shown to transduce primary hematopoietic progenitor cells with high efficiency. This vector also carries a reporter cassette (IRES Zs-Green) that enables evaluation of viral transduction efficiencies and purification of transduced cells by FACS.
- IVS Zs-Green reporter cassette
- the nucleic acid sequences encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS are introduced or delivered using a non-integrating vector (e.g., adenovirus).
- a non-integrating vector e.g., adenovirus
- integrating vectors such as retroviral vectors, incorporate into the host cell genome and can potentially disrupt normal gene function
- non-integrating vectors control expression of a gene product by extra-chromosomal transcription. Since non-integrating vectors do not become part of the host genome, non-integrating vectors tend to express a nucleic acid transiently in a cell population.
- non-integrating vectors have several advantages over retroviral vectors including, but not limited to: (1) no disruption of the host genome, and (2) transient expression, and (3) no remaining viral integration products.
- Some non-limiting examples of non-integrating vectors for use with the methods described herein include adenovirus, baculoviras, alphaviras, picornaviras, and vaccinia virus.
- the non-integrating viral vector is an adenovirus.
- advantages of non-integrating viral vectors include the ability to produce them in high titers, their stability in vivo, and their efficient infection of host cells.
- phrases "operably linked,” “operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” indicate that a nucleic acid sequence, such as a sequence encoding an HSC inducing factor, is in a correct functional location and/or orientation in relation to a promoter and/or endogenous regulatory sequences, such that the promoter and/or endogenous regulatory sequences controls transcriptional initiation and/or expression of that sequence.
- promoter refers to a nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving RNA polymerase- mediated transcription of the nucleic acid sequence, which can be a heterologous target gene, such as a sequence encoding an HSC inducing factor.
- a promoter is a control region of a nucleic acid sequence at which initiation and rate of transcription of the remainder of a nucleic acid sequence are controlled.
- a promoter can also contain one or more genetic elements at which regulatory proteins and molecules can bind. Such regulatory proteins include RNA polymerase and other transcription factors. Accordingly, a promoter can be said to "drive expression” or “drive transcription” of the nucleic acid sequence that it regulates, such as a sequence encoding an HSC inducing factor.
- Nucleic acid constructs and vectors for use in generating iHSCs in the compositions, methods, and kits described herein can further comprise, in some embodiments, one or more sequences encoding selection markers for positive and negative selection of cells.
- selection marker sequences can typically provide properties of resistance or sensitivity to antibiotics that are not normally found in the cells in the absence of introduction of the nucleic acid construct.
- a selectable marker can be used in conjunction with a selection agent, such as an antibiotic, to select in culture for cells expressing the inserted nucleic acid construct.
- Sequences encoding positive selection markers typically provide antibiotic resistance, i.e., when the positive selection marker sequence is present in the genome of a cell, the cell is sensitive to the antibiotic or agent.
- Sequences encoding negative selection markers typically provide sensitivity to an antibiotic or agent, i.e., when the negative selection marker is present in the genome of a cell, the cell is sensitive to the antibiotic or agent.
- Nucleic acid constructs and vectors for use in making iHSCs in the compositions, methods, and kits thereof described herein can further comprise, in some embodiments, other nucleic acid elements for the regulation, expression, stabilization of the construct or of other vector genetic elements, for example, promoters, enhancers, TATA-box, ribosome binding sites, IRES, as known to one of ordinary skill in the art.
- other nucleic acid elements for the regulation, expression, stabilization of the construct or of other vector genetic elements for example, promoters, enhancers, TATA-box, ribosome binding sites, IRES, as known to one of ordinary skill in the art.
- HSC inducing factor(s) such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are provided as synthetic, modified RNAs, or introduced or delivered into a cell as a synthetic, modified RNA, as described in US Patent Publication 2012-0046346-Al, the contents of which are herein incorporated by reference in their entireties.
- the methods can involve repeated contacting of the cells or involve repeated transfections of the synthetic, modified RNAs encoding HSC inducing factors, such as for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, or more transfections.
- modified mRNAs for use in the compositions, methods, and kits described herein can comprise any additional modifications known to one of skill in the art and as described in US Patent Publications 2012-0046346-A1 and
- Such other components include, for example, a 5' cap (e.g., the Anti-Reverse Cap Analog (ARCA) cap, which contains a 5'-5'- triphosphate guanine-guanine linkage where one guanine contains an N7 methyl group as well as a 3'- O-methyl group; caps created using recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-0-methyltransferase enzyme, which can create a canonical 5'-5'-triphosphate linkage between the 5'-most nucleotide of an mRNA and a guanine nucleotide where the guanine contains an N7 methylation and the ultimate 5'-nucleotide contains a 2'-0-methyl generating the Capl structure); a poly(A) tail (e.g., a poly-A tail greater than 30 nucleotides in length, greater
- the modified mRNAs for use in the compositions, methods, and kits described herein can further comprise an internal ribosome entry site (IRES).
- IRES can act as the sole ribosome binding site, or can serve as one of multiple ribosome binding sites of an mRNA.
- An mRNA containing more than one functional ribosome binding site can encode several peptides or polypeptides, such as the HSC inducing factors described herein, that are translated independently by the ribosomes ("multicistronic mRNA").
- multicistronic mRNA When nucleic acids are provided with an IRES, further optionally provided is a second translatable region.
- IRES sequences that can be used according to the invention include without limitation, those from picornaviruses (e.g. FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).
- the synthetic, modified RNA molecule comprises at least one modified nucleoside.
- the synthetic, modified RNA molecule comprises at least two modified nucleosides.
- the modified nucleosides are selected from the group consisting of 5-methylcytosine (5mC), N6- methyladenosine (m6A), 3,2'-0-dimethyluridine (m4U), 2-thiouridine (s2U), 2' fluorouridine, pseudouridine, 2'-0-methyluridine (Um), 2 'deoxy uridine (2' dU), 4-thiouridine (s4U), 5- methyluridine (m5U), 2'-0-methyladenosine (m6A), N6,2'-0-dimethyladenosine (m6Am), N6,N6,2'- O-trimethyladenosine (m62Am), 2'-0-methylcytidine (Cm), 7-methylguanosine (m7G), 2'-0- methylguanosine (Gm), N2,7-dimethylguanosine (m2,7G), N2, N2, 7
- Modified mRNAs need not be uniformly modified along the entire length of the molecule.
- Different nucleotide modifications and/or backbone structures can exist at various positions in the nucleic acid.
- the nucleotide analogs or other modification(s) can be located at any position(s) of a nucleic acid such that the function of the nucleic acid is not substantially decreased.
- a modification can also be a 5' or 3' terminal modification.
- the nucleic acids can contain at a minimum one and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 50% modified nucleotides, at least 80%> modified nucleotides, or at least 90%> modified nucleotides.
- each occurrence of a given nucleoside in a molecule is modified (e.g., each cytosine is a modified cytosine e.g., 5-methylcytosine, each uracil is a modified uracil, e.g., pseudouracil, etc.).
- the modified mRNAs can comprise a modified pyrimidine such as uracil or cytosine.
- at least 25%>, at least 50%>, at least 80%>, at least 90%> or 100%) of the uracil in the nucleic acid are replaced with a modified uracil.
- modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
- at least 25%>, at least 50%>, at least 80%>, at least 90%> or 100%) of the cytosine in the nucleic acid may be replaced with a modified cytosine.
- the modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures) (e.g., some cytosines modified as 5mC, others modified as 2'-0-methylcytosine or other cytosine analog).
- Such multi- modified synthetic RNA molecules can be produced by using a ribonucleoside blend or mixture comprising all the desired modified nucleosides, such that when the RNA molecules are being synthesized, only the desired modified nucleosides are incorporated into the resulting RNA molecule encoding the HSC inducing factor.
- nucleosides or nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleosides include other synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 2-(halo)adenine, 2-(alkyl)adenine, 2- (propyl)adenine, 2 (amino)adenine, 2-(aminoalkyll)adenine, 2 (aminopropyl)adenine, 2 (methylthio) N6 (isopentenyl)adenine, 6 (alkyl)adenine, 6 (methyl)adenine, 7 (deaza)adenine, 8 (alkenyl)adenine, 8-(alkyl)adenine, 8 (alkynyl)adenine, 8 (amino)adenine, 8-(halo)adenine, 8-(hydroxyl)adenine, 8 (thioalkyl)adenine, 8-(thiol)adenine, N6-
- pseudouracil 2 (thio)pseudouracil,4 (thio)pseudouracil,2,4- (dithio)psuedouracil,5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)-2-(thio)pseudouracil, 5- (methyl)-2-(thio)pseudouracil, 5-(alkyl)-4 (thio)pseudouracil, 5-(methyl)-4 (thio)pseudouracil, 5- (alkyl)-2,4 (dithio)pseudouracil, 5-(methyl)-2,4 (dithio)pseudouracil, 1 substituted pseudouracil, 1 substituted 2(thio)-pseudouracil, 1 substituted 4 (thio)pseudouracil, 1 substituted 2,4- (d
- mtrobenzimidazolyl nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isocarbostyrilyl, 5- (methyl)isocarbostyrilyl, 3-(methyl)-7-(propynyl)isocarbostyrilyl, 7-(aza)indolyl, 6-(methyl)-7- (aza)indolyl, imidizopyridinyl, 9-(methyl)-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7- (propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6- (dimethyl)indolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl,
- modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1 -methyl -pseudoisocytidine, pyrrolo- cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-
- modified nucleosides include 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza- 2- aminopurine, 7-deaza-2,6-diaminopurine, 7- deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threony
- modified nucleosides include inosine, 1 -methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7- deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 - methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8- oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine,
- modified nucleic acid introduced into the cell, for example if precise timing of protein production is desired.
- modified nucleic acids comprising a degradation domain, which is capable of being acted on in a directed manner within a cell.
- Modified nucleosides also include natural bases that comprise conjugated moieties, e.g. a ligand.
- the RNA containing the modified nucleosides must be translatable in a host cell (i.e., does not prevent translation of the polypeptide encoded by the modified RNA).
- transcripts containing s2U and m6A are translated poorly in rabbit reticulocyte lysates, while pseudouridine, m5U, and m5C are compatible with efficient translation.
- 2'-fluoro-modified bases useful for increasing nuclease resistance of a transcript leads to very inefficient translation. Translation can be assayed by one of ordinary skill in the art using e.g., a rabbit reticulocyte lysate translation assay.
- HSC hematopoietic stem cell inducing composition
- HSC inducing composition comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seve, eight or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP
- HSC inducing factors selected
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5
- the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding PRDM16; a modified mRNA sequence encoding ZFP467; and a modified mRNA sequence encoding VDR; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM16; and a modified mRNA sequence encoding ZFP37, wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding HOXB5; a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding ZFP467; a modified mRNA sequence encoding HOXB3; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding ZFP37; and a modified mRNA sequence encoding ZFP521 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding KLF12; a modified mRNA sequence encoding HLF; and a modified mRNA sequence encoding EGR; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding KLF12; and a modified mRNA sequence encoding HLF; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the HSC inducing composition further comprises one or more of: a modified mRNA encoding MYCN; a modified mRNA encoding ZFP467; a modified mRNA encoding NKX2-3; a modified mRNA encoding PBX1 ; and a modified mRNA encoding KLF4; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
- the modified cytosine is 5-methylcytosine and the modified uracil is pseudouridine.
- modified mRNAs encoding HSC inducing factors described herein can be synthesized and/or modified by methods well established in the art, such as those described in "Current Protocols in Nucleic Acid Chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference in its entirety.
- the modified mRNAs encoding the HSC inducing factor(s), such as HLF, RUNXITI, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS are generated using the IVT templates and constructs, and methods thereof for rapidly and efficiently generating synthetic RNAs described in PCT Application No.: PCT/US 12/64359, filed November 9, 2012, and as described in US 20120251618 Al, the contents of each of which are herein incorporated by reference in their entireties.
- the HSC inducing factor(s) such as HLF, RUNXITI, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS
- the synthetic, modified RNAs encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS are delivered and formulated as described in US 20120251618 Al .
- a synthetic, modified RNA can be administered at a frequency and dose that permit a desired level of expression of the polypeptide.
- Each different modified mRNA can be administered at its own dose and frequency to permit appropriate expression.
- the modified RNAs administered to the cell are transient in nature (i.e., are degraded over time) one of skill in the art can easily remove or stop expression of a modified RNA by halting further
- modified RNAs will degrade in a manner similar to cellular mRNAs.
- a plurality of synthetic, modified RNAs encoding HSC inducing factors can be contacted with, or introduced to, a cell, population of cells, or cell culture simultaneously.
- the plurality of synthetic, modified RNAs encoding HSC inducing factors can be contacted with, or introduced to, a cell, population of cells, or cell culture separately.
- each modified RNA encoding an HSC inducing factor can be administered according to its own dosage regime.
- a modified RNA encoding an HSC inducing factor can be introduced into target cells by transfection or lipofection.
- Suitable agents for transfection or lipofection include, for example, calcium phosphate, DEAE dextran, lipofectin, lipofectamine, DIMRIE CTM, SuperfectTM, and EffectinTM (QiagenTM), unifectinTM, maxifectinTM, DOTMA, DOGSTM (Transfectam; dioctadecylamidoglycylspermine), DOPE (l,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOTAP (l,2-dioleoyl-3-trimethylammonium propane), DDAB (dimethyl dioctadecylammonium bromide), DHDEAB (N,N-di-n-hexadecyl-N,N- dihydroxyethyl
- a modified RNA can be transfected into target cells as a complex with cationic lipid carriers (e.g., OLIGOFECTAMINETM) or non-cationic lipid-based carriers (e.g., Transit-TKOTMTM, Mirus Bio LLC, Madison, WI).
- cationic lipid carriers e.g., OLIGOFECTAMINETM
- non-cationic lipid-based carriers e.g., Transit-TKOTMTM, Mirus Bio LLC, Madison, WI.
- the synthetic, modified RNA is introduced into a cell using a transfection reagent.
- transfection reagents include, for example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731). Examples of commercially available transfection reagents are known to those of ordinary skill in the art.
- highly branched organic compounds termed “dendrimers,” can be used to bind the exogenous nucleic acid, such as the synthetic, modified RNAs described herein, and introduce it into the cell.
- non-chemical methods of transfection include, but are not limited to, electroporation, sono- poration, the use of a gene gun, magnetofection, and impalefection, and others, as known to those of ordinary skill in the art.
- Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols, such as ethylene glycol and propylene glycol, pyrrols such as 2- pyrrol, azones, and terpenes, such as limonene and menthone.
- a modified RNA encoding an HSC inducing factor is formulated in conjunction with one or more penetration enhancers, surfactants and/or chelators.
- Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
- combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts.
- One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
- RNA encoding an HSC inducing factor is formulated into any of many possible
- formulations comprising a plurality of different synthetic, modified RNAs encoding HSC inducing factors are prepared by first mixing all members of a plurality of different synthetic, modified RNAs, and then complexing the mixture comprising the plurality of different synthetic, modified RNAs with a desired ligand or targeting moiety, such as a lipid.
- the compositions can be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension can also contain stabilizers.
- compositions described herein can be prepared and formulated as emulsions for the delivery of synthetic, modified RNAs.
- Emulsions can contain further components in addition to the dispersed phases, and the active drug (i.e., synthetic, modified RNA) which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
- Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed.
- Emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
- Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
- a modified RNA encoding an HSC inducing factor can be encapsulated in a nanoparticle.
- Methods for nanoparticle packaging are well known in the art, and are described, for example, in Bose S, et al (Role of Nucleolin in Human Parainfluenza Virus Type 3 Infection of Human Lung Epithelial Cells. J. Virol. 78:8146. 2004); Dong Y et al. Poly(d,l-lactide-co-glycolide)/montmorillonite nanoparticles for oral delivery of anticancer drugs. Biomaterials 26:6068. 2005); Lobenberg R. et al (Improved body distribution of 14C-labelled AZT bound to nanoparticles in rats determined by
- iHSCs can be generated by delivery of HSC inducing factors in the form of nucleic acid (DNA or RNA) or amino acid sequences
- iHSC induction can be induced using other methods, such as, for example, by treatment of cells with an agent, such as a small molecule or cocktail of small molecules, that induce expression one or more of the HSC inducing factors.
- agent means any compound or substance such as, but not limited to, a small molecule, nucleic acid, polypeptide, peptide, drug, ion, etc.
- An “agent” can be any chemical, entity or moiety, including without limitation synthetic and naturally-occurring proteinaceous and non-proteinaceous entities.
- an agent is nucleic acid, nucleic acid analogues, proteins, antibodies, peptides, aptamers, oligomer of nucleic acids, amino acids, or carbohydrates including without limitation proteins, oligonucleotides, ribozymes, DNAzymes, glycoproteins, siRNAs, lipoproteins, aptamers, and modifications and combinations thereof etc.
- the nucleic acid is DNA or RNA, and nucleic acid analogues, for example can be PNA, pcPNA and LNA.
- a nucleic acid may be single or double stranded, and can be selected from a group comprising; nucleic acid encoding a protein of interest, oligonucleotides, PNA, etc.
- Such nucleic acid sequences include, for example, but not limited to, nucleic acid sequence encoding proteins that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.
- a protein and/or peptide agent or fragment thereof can be any protein of interest, for example, but not limited to; mutated proteins; therapeutic proteins; truncated proteins, wherein the protein is normally absent or expressed at lower levels in the cell.
- Proteins of interest can be selected from a group comprising; mutated proteins, genetically engineered proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins, antibodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof.
- HSC inducing factors described herein such as at least one, two, three, four, five, six, seven, eight, or more of the HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, R
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNX1T1; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- b culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBXl ; and a nucleic acid sequence encoding
- iHSC induced hematopoietic stem cell
- b culturing the transfected somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5.
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: PRDM16; ZFP467; and VDR.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF; RUNX1T1 ; PBXl ; LM02; PRDM5; ZFP37; MYCN; MSI2; NKX2-3; MEIS1; and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are ZFP467; PBXl ; HOXB4; and MSI2.
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: HLF; LM02; PRDM16; and ZFP37.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are MYCN; MSI2; NKX2-3; and RUNX1T1.
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: HOXB5; HLF; ZFP467; HOXB3; LM02; PBXl ; ZFP37; and ZFP521.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are HOXB4; PBXl ; LM02;
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: KLF12; HLF; and EGR.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are MEIS1 ; RBPMS; ZFP37;
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: KLF12; and HLF.
- the at least one, two, three, four, or more HSC inducing factors of step (a) are ZFP37; HOXB4; LM02; and HLF.
- the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: MYCN; ZFP467; NKX2-3; PBX1 ; and KLF4.
- Detection of expression of HSC inducing factors introduced into cells or induced in a cell population using the compositions, methods, and kits described herein, can be achieved by any of several techniques known to those of skill in the art including, for example, Western blot analysis, immunocytochemistry, and fluorescence-mediated detection.
- one or more HSC activities or parameters can be measured, such as, in some embodiments, differential expression of surface antigens.
- the generation of induced HSCs using the compositions, methods, and kits described herein preferably causes the appearance of the cell surface phenotype characteristic of endogenous HSCs, such as lineage marker negative, Seal -positive, cKit-positive (or LSK cells), CD34-negative, Flk2 -negative, CD48 -negative, and CD150-positive or as CD150+CD48-CD244-, for example.
- HSCs are most reliably distinguished from committed progenitors by their functional behavior.
- Functional aspects of HSC phenotypes, or hematopoietic stem cell activities, such as the ability of an HSC to give rise to long-term, multi-lineage reconstitution in a recipient, can be easily determined by one of skill in the art using routine methods known in the art, and as described herein, for example, in the Examples and the Drawings, i.e., FIGS. 1- 57C.
- functional assays to identify reprogramming factors can be used.
- Colony forming cell (CFC) activity in methylcellulose can be used to confirm multi-lineage (granulocytes, macrophages, megakaryocytes and erythrocytes) potential of iHSCs generated using the compositions, methods, and kits thereof.
- Serial plating can be used to confirm self-renewal potential of iHSCs generated using the compositions, methods, and kits described herein.
- Lymphoid potential of iHSCs generated using the compositions, methods, and kits described herein can be evaluated by culturing transduced cells on OP9 and OP9delta stromal cells, followed by immunostaining on day 14 for B- and T- cells, respectively.
- cellular parameter refers to measureable components or qualities of endogenous or natural HSCs, particularly components that can be accurately measured.
- a cellular parameter can be any measurable parameter related to a phenotype, function, or behavior of a cell.
- Such cellular parameters include, changes in characteristics and markers of an HSC or HSC population, including but not limited to changes in viability, cell growth, expression of one or more or a combination of markers, such as cell surface determinants, such as receptors, proteins, including conformational or posttranslational modification thereof, lipids, carbohydrates, organic or inorganic molecules, nucleic acids, e.g. m NA, DNA, global gene expression patterns, etc.
- Such cellular parameters can be measured using any of a variety of assays known to one of skill in the art. For example, viability and cell growth can be measured by assays such as Trypan blue exclusion, CFSE dilution, and 3 H incorporation. Expression of protein or polyeptide markers can be measured, for example, using flow cytometric assays, Western blot techniques, or microscopy methods. Gene expression profiles can be assayed, for example, using microarray methodologies and quantitative or semi-quantitative real-time PCR assays. A cellular parameter can also refer to a functional parameter or functional activity. While most cellular parameters will provide a quantitative readout, in some instances a semi-quantitative or qualitative result can be acceptable.
- Readouts can include a single determined value, or can include mean, median value or the variance, etc. Characteristically a range of parameter readout values can be obtained for each parameter from a multiplicity of the same assays. Variability is expected and a range of values for each of the set of test parameters will be obtained using standard statistical methods with a common statistical method used to provide single values.
- compositions, methods, and kits described herein additional factors can be used to enhance HSC reprogramming.
- agents that modify epigenetic pathways can be used to facilitate reprogramming into iHSCs.
- any primary somatic cell type can be used for producing iHSCs or reprogramming somatic cells to iHSCs according to the presently described compositions, methods, and kits.
- Such primary somatic cell types also include other stem cell types, including pluripotent stem cells, such as induced pluripotent stem cells (iPS cells); other multipotent stem cells; oligopotent stem cells; and (5) unipotent stem cells.
- pluripotent stem cells such as induced pluripotent stem cells (iPS cells); other multipotent stem cells; oligopotent stem cells; and (5) unipotent stem cells.
- primary somatic cells useful in the various aspects and embodiments of the methods described herein include, but are not limited to, fibroblast, epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, hematopoietic or immune cells, hepatic, splenic, lung, circulating blood cells, gastrointestinal, renal, bone marrow, and pancreatic cells, as well as stem cells from which those cells are derived.
- the cell can be a primary cell isolated from any somatic tissue including, but not limited to, spleen, bone marrow, blood, brain, liver, lung, gut, stomach, intestine, fat, muscle, uterus, skin, spleen, endocrine organ, bone, etc.
- somatic cell further encompasses, in some embodiments, primary cells grown in culture, provided that the somatic cells are not immortalized. Where the cell is maintained under in vitro conditions, conventional tissue culture conditions and methods can be used, and are known to those of skill in the art. Isolation and culture methods for various primary somatic cells are well within the abilities of one skilled in the art.
- a somatic cell to be reprogrammed or made into an iHSC cell is a cell of hematopoietic origin.
- hematopoietic-derived cell hematopoietic-derived differentiated cell
- hematopoietic lineage cell and “cell of hematopoietic origin” refer to cells derived or differentiated from a multipotent hematopoietic stem cell (HSC).
- HSC multipotent hematopoietic stem cell
- hematopoietic lineage cells for use with the compositions, methods, and kits described herein include multipotent, oligopotent, and lineage-restricted hematopoietic progenitor cells, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), thrombocytes (e.g., megakaryoblasts, platelet producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, and lymphocytes (e.g., T-lymphocytes
- hematopoietic progenitor cells refer to multipotent, oligopotent, and lineage-restricted hematopoietic cells capable of differentiating into two or more cell types of the hematopoietic system, including, but not limited to, granulocytes, monocytes, erythrocytes, megakaryocytes, and lymphocytes B-cells and T-cells.
- Hematopoietic progenitor cells encompass multi-potent progenitor cells (MPPs), common myeloid progenitor cells (CMPs), common lymphoid progenitor cells (CLPs), granulocyte-monocyte progenitor cells (GMPs), and pre-megakaryocyte-erythrocyte progenitor cell.
- MPPs multi-potent progenitor cells
- CMPs common myeloid progenitor cells
- CLPs common lymphoid progenitor cells
- GFPs granulocyte-monocyte progenitor cells
- pre-megakaryocyte-erythrocyte progenitor cell pre-megakaryocyte-erythrocyte progenitor cell.
- Lineage -restricted hematopoieticprogenitor cells include megakaryocyte-erythrocyte progenitor cells (MEP), roB cells, PreB cells, PreProB cells, ProT cells, double-negative T cells, pro-NK cells, pro-dendritic cells (pro-DCs), pre- granulocyte/macrophage cells, granulocyte/macrophage progenitor (GMP) cells, and pro-mast cells (ProMCs).
- MEP megakaryocyte-erythrocyte progenitor cells
- PreB cells PreB cells
- PreProB cells ProT cells
- double-negative T cells pro-negative T cells
- pro-NK cells pro-dendritic cells
- pre- granulocyte/macrophage cells pre- granulocyte/macrophage progenitor (GMP) cells
- pro-mast cells ProMCs
- Cells of hematopoietic origin for use in the compositions, methods, and kits described herein can be obtained from any source known to comprise these cells, such as fetal tissues, umbilical cord blood, bone marrow, peripheral blood, mobilized peripheral blood, spleen, liver, thymus, lymph, etc. Cells obtained from these sources can be expanded ex vivo using any method acceptable to those skilled in the art prior to use in with the compositions, methods, and kits for making iHCSs described herein. For example, cells can be sorted, fractionated, treated to remove specific cell types, or otherwise manipulated to obtain a population of cells for use in the methods described herein using any procedure acceptable to those skilled in the art.
- Mononuclear lymphocytes may be collected, for example, by repeated lymphocytophereses using a continuous flow cell separator as described in U.S. Pat. No. 4,690,915, or isolated using an affinity purification step ocommon lymphoid progenitor cell (CLP)r method, such as flow-cytometry using a cytometer, magnetic separation, using antibody or protein coated beads, affinity chromatography, or solid-support affinity separation where cells are retained on a substrate according to their expression or lack of expression of a specific protein or type of protein, or batch purification using one or more antibodies against one or more surface antigens specifically expressed by the cell type of interest.
- CLP ocommon lymphoid progenitor cell
- the subject Prior to harvest of the cells from peripheral blood, the subject can be treated with a cytokine, such as e.g., granulocyte -colony stimulating factor, to promote cell migration from the bone marrow to the blood compartment and/or promote activation and/or proliferation of the population of interest.
- a cytokine such as e.g., granulocyte -colony stimulating factor
- Any method suitable for identifying surface proteins can be employed to isolate cells of hematopoietic origin from a heterogenous population.
- a clonal population of cells of hematopoietic origin such as lymphocytes, is obtained.
- the cells of hematopoietic origin are not a clonal population.
- a somatic cell can be obtained from any mammalian species, with non-limiting examples including a murine, bovine, simian, porcine, equine, ovine, or human cell.
- the somatic cell is a human cell.
- the cell is from a non- human organism, such as a non-human mammal.
- the methods for making iHSCs described herein involve culturing or expanding somatic cells, such as cells of hematopoietic origin, in any culture medium that is available and well-known to one of ordinary skill in the art.
- somatic cells such as cells of hematopoietic origin
- Such media include, but are not limited to, Dulbecco's Modified Eagle's Medium® (DMEM), DMEM F12 Medium®, Eagle's Minimum Essential Medium®, F-12K Medium®, Iscove's Modified Dulbecco's Medium®, RPMI-1640 Medium®, and serum-free medium for culture and expansion of progenitor cells SFEM®.
- DMEM Dulbecco's Modified Eagle's Medium
- DMEM F12 Medium Eagle's Minimum Essential Medium®
- F-12K Medium Iscove's Modified Dulbecco's Medium®
- RPMI-1640 Medium® Iscove's Modified Dulbecco's Medium
- the medium used with the methods described herein can, in some embodiments, be supplemented with one or more growth factors.
- growth factors include, but are not limited to, bone morphogenic protein, basic fibroblast growth factor, platelet-derived growth factor and epidermal growth factor, Stem cell factor, and thrombopoietin. See, for example, U.S. Pat. Nos. 7,169,610; 7,109,032; 7,037,721 ;
- Doxycycline induction can be maintained for 2 weeks post- transplant, in some embodiments.
- the inducing agent such as doxycycline
- the inducing agent can be maintained for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days or a week, at least 10 days, at least 2 weeks, or more, following transplantation of a induced iHSC population into a subject.
- Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components or plating on feeder cells, for example.
- a solid support such as extracellular matrix components or plating on feeder cells, for example.
- Cells being used in the methods described herein can require additional factors that encourage their attachment to a solid support, in some embodiments, such as type I and type II collagen, chondroitin sulfate, fibronectin, "superfibronectin” and fibronectin-like polymers, gelatin, poly-D and poly-L-lysine, thrombospondin and vitronectin.
- the cells are suitable for growth in suspension cultures.
- Suspension-competent host cells are generally monodisperse or grow in loose aggregates without substantial aggregation.
- Suspension-competent host cells include cells that are suitable for suspension culture without adaptation or manipulation (e.g., cells of hematopoietic origin, such as lymphoid cells) and cells that have been made suspension-competent by modification or adaptation of attachment- dependent cells (e.g., epithelial cells, fibroblasts).
- isolated induced hematopoietic stem cells are provided herein, in some aspects, are isolated induced hematopoietic stem cells
- iHSCs produced using any of the HSC inducing compositions or methods of preparing iHSCs described herein.
- cell clones comprising a plurality of the induced hematopoietic stem cell (iHSCs) produced using any of the HSC inducing compositions or methods of preparing iHSCs described herein.
- iHSCs induced hematopoietic stem cell
- the isolated induced hematopoietic stem cells (iHSCs) or cell clones thereof further comprise a pharmaceutically acceptable carrier for administration to a subject in need.
- kits for treating a subject in need of treatment for a disease or disorder in which one or more hematopoietic cell lineages are deficient or defective using the HSC inducing compositions and methods of preparing iHSCs described herein, or using the isolated induced hematopoietic stem cells (iHSCs) and cell clones thereof produced using any of the combinations of HSC inducing factors, HSC inducing compositions, or methods of preparing iHSCs described herein.
- somatic cells such as fibroblast cells or hematopoietic lineage cells
- somatic cells can first be isolated from the subject, and the isolated cells transduced or transfected, as described herein with an HSC inducing composition comprising expression vectors or synthetic mRNAs, respectively.
- HSC inducing composition comprising expression vectors or synthetic mRNAs, respectively.
- the isolated induced hematopoietic stem cells (iHSCs) and cell clones thereof produced using any of the combinations of HSC inducing factors, HSC inducing compositions, or methods of preparing iHSCs described herein, can then be administered to the subject, such as via systemic injection of the iHSCs to the subject.
- the reprogrammed iHSCs generated using the compositions, methods, and kits described herein can, in some embodiments of the methods of treatment described herein, be used directly or administered to subjects in need of cellular therapies or regenerative medicine applications or, in other embodiments, redifferentiated to other hematopoietic cell types for use in or
- various embodiments of the methods described herein involve administration of an effective amount of an iHSC or a population of iHSCs, generated using any of the compositions, methods, and kits described herein, to an individual or subject in need of a cellular therapy.
- the cell or population of cells being administered can be an autologous population, or be derived from one or more heterologous sources.
- iHSCs or differentiated cells from iHSCs can be administered in a manner that permits them to graft to the intended tissue site and reconstitute or regenerate the functionally deficient area.
- iHSCs can be introduced to a scaffold or other structure to generate, for example, a tissue ex vivo, that can then be introduced to a patient.
- a variety of means for administering cells to subjects are known to those of skill in the art. Such methods can include systemic injection, for example, i.v. injection, or implantation of cells into a target site in a subject.
- Cells may be inserted into a delivery device which facilitates introduction by injection or implantation into the subject.
- delivery devices can include tubes, e.g., catheters, for injecting cells and fluids into the body of a recipient subject.
- the tubes additionally have a needle, e.g. , through which the cells can be introduced into the subject at a desired location.
- the cells can be prepared for delivery in a variety of different forms. For example, the cells can be suspended in a solution or gel or embedded in a support matrix when contained in such a delivery device. Cells can be mixed with a pharmaceutically acceptable carrier or diluent in which the cells remain viable.
- the cells produced by the methods described herein can be used to prepare cells to treat or alleviate at least the following diseases and conditions wherein hematopoietic stem cell transplants have proven to be one effective method of treatment: leukemia such as acute myeloid leukemia, acute lymphoblastic leukemia, myelodysplastic/myeloproliferative syndromes, chronic myeloid leukemia, chronic lymphocytic leukemia, and other leukemia; lymphoproliferative disorders such as plasma cell disorders, Hodgkin disease, non-Hodgkin lymphoma, and other lymphoma; solid tumors such as neuroblastoma, germinal cancer, breast cancer, and Ewing sarcoma; Nonmalignant disorders such as bone marroe failures, hemoglobinopathies, immune deficiencies, inherited diseases of metabolism, and autoimmune disorders.
- leukemia such as acute myeloid leukemia, acute lymphoblastic leukemia, myelodysplastic/myeloproliferative syndromes, chronic my
- the methods of the invention can be used for the treatment of the following diseases and conditions: Angiogenic Myeloid Metaplasia (Myelofibrosis); Aplastic Anemia; Acquired Pure Red Cell Aplasia; Aspartylglucosaminuria; Ataxia Telangiectasia;
- Choriocarcinoma Chronic Lymphocytic Leukemia (CLL); Chronic Myelogenous Leukemia (CML); Common Variable Immunodeficiency; Chronic Pulmonary Obstructive Disease; Desmoplastic small round cell tumor; Diamond-Blackfan anemia; DiGeorge syndrome; Essential Thrombocythemia; Haematologica Ewing's Sarcoma; Fucosidosis; Gaucher disease; Griscelli syndrome;
- HHL Hemophagocytic lymphohistiocytosis
- HBV Human Immunodeficiency Virus
- HTLV Human T-lymphotropic Virus
- MRS II iduronidase sulfate deficiency
- Hurler syndrome MPS I H, a-L-iduronidase deficiency
- Infantile neuronal ceroid lipofuscinosis INCL, Santavuori disease
- Jansky-Bielschowsky disease late infantile neuronal ceroid lipofuscinosis
- JMML Juvenile Myelomonocytic Leukemia
- JMML Juvenile Myelomonocytic Leukemia
- JMML Juvenile Myelomonocytic Leukemia
- JMML Juvenile Myelomonocytic Leukemia
- MPS VI Metachromatic leukodystrophy
- Morquio syndrome MS IV
- Mucolipidosis II I-cell
- Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media.
- the use of such carriers and diluents is well known in the art.
- the solution is preferably sterile and fluid.
- the solution prior to the introduction of cells, the solution is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- the mode of cell administration is relatively non-invasive, for example by intravenous injection, pulmonary delivery through inhalation, topical, or intranasal administration.
- the route of cell administration will depend on the tissue to be treated and may include implantation. Methods for cell delivery are known to those of skill in the art and can be extrapolated by one skilled in the art of medicine for use with the methods and compositions described herein.
- Direct injection techniques for cellular administration of iHSCs can also be used to stimulate transmigration of cells through the entire vasculature, or to the vasculature of a particular organ. This includes non-specific targeting of the vasculature.
- the injection can be performed systemically into any vein in the body. This method is useful for enhancing stem cell numbers in aging patients.
- the cells can function to populate vacant stem cell niches or create new stem cells to replenish those lost through, for example, chemotherapy or radiation treatments, for example.
- a mammal or subject can be pre -treated with an agent, for example an agent is administered to enhance cell targeting to a tissue (e.g. , a homing factor) and can be placed at that site to encourage cells to target the desired tissue.
- a tissue e.g. , a homing factor
- direct injection of homing factors into a tissue can be performed prior to systemic delivery of ligand-targeted cells.
- compositions and methods comprising iHSCs for use in cellular therapies, such as stem cell therapies.
- Non-limiting examples of conditions or disorders that can be treated using the compositions and methods described herein include aplastic anemia, Fanconi anemia, paroxysmal nocturnal hemoglobinuria (PNH); acute leukemias, including acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), acute biphenotypic leukemia and acute undifferentiated leukemia; chronic leukemias, including chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), juvenile chronic myelogenous leukemia (JCML) and juvenile myelomonocytic leukemia (JMML); myeloproliferative disorders, including acute myelofibrosis, angiogenic myeloid metaplasia (myelofibrosis), polycythemia vera and essential thrombocythemia; inherited platelet abnormalities, including amegakaryocytosis/congenital thrombocytopenia; plasma cell disorders,
- Efficacy of treatment is determined by a statistically significant change in one or more indicia of the targeted disease or disorder, as known to one of ordinary skill in the art.
- whole blood of a subject being treated with iHSCs generated using the compositions, methods, and kits described herein can be analyzed using a complete blood count (CBC).
- CBC test can comprise one or more of the following:
- WBC count A count of the actual number of white blood cells per volume of blood.
- neutrophils neutrophils, lymphocytes, monocytes, eosinophils, and basophils.
- Red blood cell (RBC) count A count of the actual number of red blood cells per volume of blood.
- Hemoglobin level A measure of the amount of oxygen-carrying protein in the blood.
- Hematocrit level A measures of the percentage of red blood cells in a given volume of whole blood.
- Platelet count A count of the number of platelets in a given volume of blood.
- MPV Mean platelet volume
- MCV Mean corpuscular volume
- MCH Mean corpuscular hemoglobin
- MCHC Mean corpuscular hemoglobin concentration
- Red cell distribution width A calculation of the variation in the size of RBCs ⁇ e.g. amount of variation (anisocytosis) in RBC size and/or variation in shape (poikilocytosis) may cause an increase in the RDW).
- additional factors can be used to enhance treatment methods using the iHSCs described herein, such as G-CSF, e.g. as described in U.S. Patent No. 5,582,823; AMD3100 (l,l[l,4-phenylene- bis(methylene)]-bis-l,4,8,ll-tetraazacyclotetradecane) , granulocyte -macrophage colony stimulating factor (GM-CSF), Interleukin- 1 (IL-I), Interleukin-3 (IL-3), Interleukin-8 (IL-8), PIXY-321 (GM- CSF/IL-3 fusion protein), macrophage inflammatory protein, stem cell factor (SCF), thrombopoietin, flt3, myelopoietin, anti-VLA-4 antibody, anti-VCAM-1 and growth related oncogene (GRO).
- G-CSF granulocyte -macrophage colony stimulating factor
- IL-I Interleukin-
- HSC hematopoietic stem cell
- composition comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521,
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEISI, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, and MEISI .
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, and LM02.
- HSC hematopoietic stem cell
- HSC hematopoietic stem cell
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- nucleic acid sequence encoding HLF [00410] a nucleic acid sequence encoding HLF; [00411] a nucleic acid sequence encoding LM02;
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- HSC hematopoietic stem cell
- composition further comprises one or more expression vectors comprising:
- the one or more expression vectors are retroviral vectors.
- the one or more expression vectors are lentiviral vectors.
- the lentiviral vectors are inducible lentiviral vectors.
- the lentiviral vectors are polycistronic inducible lentiviral vectors.
- the polycistronic inducible lentiviral vectors express three or more nucleic acid sequences. In some embodiments, each of the nucleic acid sequences of the polycistronic inducible lentiviral vectors are separated by 2A peptide sequences.
- HSC hematopoietic stem cell inducing compositions comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP52
- HSC inducing factors selected from: CDKNIC,
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, and MEIS1.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, and LM02.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- HSC hematopoietic stem cell
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- composition further comprises one or more of:
- each cytosine of each said modified mRNA sequence is a modified cytosine
- each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
- the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
- the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl -uridine, 1 -propynyl-pseudouridine, 5- taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl -uridine, 1 -methyl -pseudouridine, 4-thio-l-methyl- pseudouridine, 2-thio-l -
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding MYCN, wherein each said nucleic acid sequence is operably linked to a promoter; and
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16 a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEISl ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNXITI; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
- iHSC induced hematopoietic stem cell
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
- hematopoietic stem cell from a somatic cell comprising:
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNXITI ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and [00601] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- hematopoietic stem cell from a somatic cell comprising:
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
- hematopoietic stem cell from a somatic cell comprising:
- transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding KLF4.
- the somatic cell is a fibroblast cell.
- the somatic cell is a hematopoietic lineage cell.
- the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing
- megakaryocytes platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes, multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors.
- the hematopoietic lineage cell is selected from a multi-potent progenitor cell (MPP), common myeloid progenitor cell (CMP), granulocyte-monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte-erythrocyte progenitor cell.
- MPP multi-potent progenitor cell
- CMP common myeloid progenitor cell
- GMP granulocyte-monocyte progenitor cells
- CLP common lymphoid progenitor cell
- pre -megakaryocyte-erythrocyte progenitor cell pre -megakaryocyte-erythrocyte progenitor cell.
- the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro- dendritic cell (pro-DC), pre-granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro-mast cell (ProMC).
- MEP megakaryocyte-erythrocyte progenitor cell
- ProB cell a ProB cell
- PreB cell PreB cell
- PreProB cell a PreProB cell
- ProT cell a double-negative T cell
- pro-NK cell a pro- dendritic cell
- pre-granulocyte/macrophage cell pre-granulocyte/macrophage progenitor (GMP) cell
- GMP granulocyte/m
- Also provided herein, in some aspects, are methods of promoting transdifferentiation of a ProPreB cell to the myeloid lineage comprising:
- transducing a ProPreB cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
- methods of increasing survival and/or proliferation of ProPreB cells comprising:
- transducing a ProPreB cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and [00622] culturing the transduced ProPreB cell in a cell media that supports growth of ProPreB cells, thereby increasing survival and/or proliferation of ProPreB cells.
- the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGRl .
- iHSCs produced using any of the HSC inducing compositions or methods described herein.
- cell clones comprising a plurality of the induced hematopoietic stem cells (iHSCs) produced using any of the HSC inducing compositions or methods described herein.
- the cell clones further comprise a pharmaceutically acceptable carrier.
- kits for making induced hematopoietic stem cells comprising any of the HSC inducing compositions comprising one or more expression vector components described herein.
- kits for making induced hematopoietic stem cells comprising any of the HSC inducing compositions comprising modified mRNA sequence components described herein.
- kits comprising one or more of the HSC inducing factors described herein as components for the methods of making the induced
- hematopoietic stem cells described herein.
- kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVll, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP4
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
- the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5.
- kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5; and (b) packaging and instructions therefor.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Developmental Biology & Embryology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Diabetes (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
Provided herein are compositions, methods, and kits for hematopoietic stem cell induction or for reprogramming cells to the multipotent state of hematopoietic stem cells. In some embodiments, the compositions comprise at least one HSC inducing factor. Such compositions, methods and kits can be used for inducing hematopoietic stem cells in vitro, ex vivo, or in vivo, as described herein, and these induced hematopoietic stem cells can be used in regenerative medicine applications and therapies.
Description
COMPOSITIONS AND METHODS FOR REPROGRAMMING HEMATOPOIETIC STEM
CELL LINEAGES
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional
Application No. 61/782,037 filed March 14, 2013, the content of which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 14, 2014, is named 701039-076172-PCT2_SL.txt and is 506,202 bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions, methods, and kits for reprogramming hematopoietic lineages and inducing hematopoietic stem cells.
BACKGROUND
[0004] Hematopoietic stem cells (HSCs) are a subset of multipotent stem cells that are responsible for the ability to sustain lifelong hematopoiesis, and continuously generate myriad and various blood cell types, while maintaining adequate number of stem cells in the bone marrow.
Hematopoietic stem cells give rise to all the blood or immune cell types, including monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells, T-cells, B-cells, NKT-cells, and NK-cells. Hematopoietic tissues contain cells with long-term and short-term regeneration capacities, and committed multipotent, oligopotent, and unipotent progenitors.
[0005] Transplantation of hematopoietic stem cells (HSCT) has become the standard of care for many patients with defined congenital or acquired disorders of the hematopoietic system or with chemo- radio- or, immuno- sensitive malignancies. Over the last two decades, HSCT has seen rapid expansion and a constant evolution in technology use. (Gratwohl A, et al., (2010). Hematopoietic stem cell transplantation A Global Perspective. JAMA. 303(16): 1617-24).
SUMMARY
[0006] The inventors have identified key transcription factors that can surprisingly reprogram committed cells and blood cells back into hematopoietic stem cells.
[0007] Hematopoietic stem cells (HSCs) are the best-characterized tissue-specific stem cells, yet the experimental study of HSCs remains challenging, due to the fact that they are exceedingly rare
and methods to purify them are cumbersome, and vary between different laboratories. Moreover, genetic tools for specifically addressing issues related to HSC biology are lacking. In spite of wide clinical use, HSC transplantation remains a high-risk procedure, with the number of stem cells available for transplantation being the strongest predictor of transplantation success. One of the central clinical challenges of HSC transplantation arises from the fact that HSCs are exceedingly rare cells, occurring at a frequency of only 1/20,000 bone marrow cells and obtaining enough cells for transplant is challenging. Thus, an ability to expand HSC numbers prior to transplantation could overcome the problem of limited HSC numbers. Efforts to expand HSCs prior to transplant by ex vivo culturing have proven challenging and such efforts have not yet translated to the clinic. Thus, there remains a clinical need to find alternative strategies for either expanding the numbers of existing HSCs, or generating HSCs de novo from more abundant cell types.
[0008] The embodiments of the invention provide multiple applications, including kits for research use and methods for generation of cells useful for conducting small molecule screens for blood diseases. In addition, the invention provides commercially and medically useful methods to produce autologous hematopoietic stem cells and give them back to a patient in need, with or without genome editing. Transplant of hematopoietic stem cells is a critically important procedure that is currently limited for a variety of reasons.
[0009] Provided herein are compositions, methods, and kits for hematopoietic stem cell induction or for reprogramming cells to the multipotent state of hematopoietic stem cells, based, in part, on the discoveries described herein of novel combinations of transcription factors that permit dedifferentiation and reprogramming of more differentiated cells to the hematopoietic stem cell state. Such compositions, nucleic acid constructs, methods and kits can be used for inducing hematopoietic stem cells in vitro, ex vivo, or in vivo, as described herein, and these induced hematopoietic stem cells can be used in regenerative medicine applications and therapies.
[0010] For example, the methods described herein can be used to produce HSC cells for treat diseases including leukemia, lymphomas, solid tumors, aplastic anemia, congenital bone marrow failure syndromes, immune deficiencies, sickle cell disease, thalassemia and metabolic/storage diseases, such as amyloidosis.
[0011] Accordingly, provided herein, in some aspects are hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFIIB, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN,
NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
[0012] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[0013] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
[0014] Also provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding RUNXITI ;
c. a nucleic acid sequence encoding ZFP37;
d. a nucleic acid sequence encoding PBXl ;
e. a nucleic acid sequence encoding LM02; and
f. a nucleic acid sequence encoding PRDM5.
[0015] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a nucleic acid sequence encoding PRDM16;
b. a nucleic acid sequence encoding ZFP467; and
c. a nucleic acid sequence encoding VDR.
[0016] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding RUNXITI ;
c. a nucleic acid sequence encoding PBXl ;
d. a nucleic acid sequence encoding LM02;
e. a nucleic acid sequence encoding PRDM5
f. a nucleic acid sequence encoding ZFP37;
g- a nucleic acid sequence encoding I MYCN;
h. a nucleic acid sequence encoding MSI2;
i. a nucleic acid sequence encoding NKX2-3;
j- a nucleic acid sequence encoding MEIS1 ; and
k. a nucleic acid sequence encoding RBPMS.
[0017] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding ZFP467;
b. a nucleic acid sequence encoding PBX1 ;
c. a nucleic acid sequence encoding HOXB4; and
d. a nucleic acid sequence encoding MSI2.
[0018] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding LM02;
c. a nucleic acid sequence encoding PRDM16; and
d. a nucleic acid sequence encoding ZFP37.
[0019] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding MYCN;
b. a nucleic acid sequence encoding MSI2;
c. a nucleic acid sequence encoding NKX2-3; and
d. a nucleic acid sequence encoding RUNX 1 T 1.
[0020] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a nucleic acid sequence encoding HOXB5;
b. a nucleic acid sequence encoding HLF;
c. a nucleic acid sequence encoding ZFP467;
d. a nucleic acid sequence encoding HOXB3;
e. a nucleic acid sequence encoding LM02;
f. a nucleic acid sequence encoding PBX1 ;
g. a nucleic acid sequence encoding ZFP37; and
h. a nucleic acid sequence encoding ZFP521.
[0021] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding HOXB4;
b. a nucleic acid sequence encoding PBX1 ;
c. a nucleic acid sequence encoding LM02;
d. a nucleic acid sequence encoding ZFP467; and
e. a nucleic acid sequence encoding ZFP521.
[0022] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a nucleic acid sequence encoding KLF12;
b. a nucleic acid sequence encoding HLF; and
c. a nucleic acid sequence encoding EGR1.
[0023] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding MEIS 1 ;
b. a nucleic acid sequence encoding RBPMS;
c. a nucleic acid sequence encoding ZFP37;
d. a nucleic acid sequence encoding RUNX1T1 ; and
e. a nucleic acid sequence encoding LM02.
[0024] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a sequence encoding KLF12; and
b. a sequence encoding HLF;
[0025] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding ZFP37;
b. a nucleic acid sequence encoding HOXB4;
c. a nucleic acid sequence encoding LM02; and
d. a nucleic acid sequence encoding HLF.
[0026] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
a. a nucleic acid sequence encoding MYCN;
b. a nucleic acid sequence encoding ZFP467;
c. a nucleic acid sequence encoding NKX2-3
d. a nucleic acid sequence encoding PBX1 ; and
e. a nucleic acid sequence encoding KLF4.
[0027] In some embodiments of these aspects and all such aspects described herein, the one or more expression vectors are retroviral vectors.
[0028] In some embodiments of these aspects and all such aspects described herein, the one or more expression vectors are lentiviral vectors. In some embodiments, the lentiviral vectors are inducible lentiviral vectors.
[0029] Also provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612, wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0030] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[0031] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
[0032] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding RUNXITI ;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding PBXl ;
e. a modified mRNA sequence encoding LM02; and
f. a modified mRNA sequence encoding PRDM5;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0033] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA sequence encoding PRDMl 6;
b. a modified mRNA sequence encoding ZFP467; and
c. a modified mRNA sequence encoding VDR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0034] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding ; HLF;
b. a modified mRNA sequence encoding ; RU X1T1 ;
c. a modified mRNA sequence encoding ; PBX1;
d. a modified mRNA sequence encoding ; LM02;
e. a modified mRNA sequence encoding ; PRDM5
f. a modified mRNA sequence encoding ; ZFP37;
g- a modified mRNA sequence encoding ; MYCN;
h. a modified mRNA sequence encoding ; MSI2;
i. a modified mRNA sequence encoding ; NKX2-3;
j- a modified mRNA sequence encoding ; MEIS1 ; and
k. a modified mRNA sequence encoding ; RBPMS;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0035] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding ZFP467;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding HOXB4; and
d. a modified mRNA sequence encoding MSI2;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0036] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding LM02;
c. a modified mRNA sequence encoding PRDM16; and
d. a modified mRNA sequence encoding ZFP37.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0037] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding MYCN;
b. a modified mRNA sequence encoding MSI2;
c. a modified mRNA sequence encoding NKX2-3; and
d. a modified mRNA sequence encoding RUNX1T1 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0038] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA sequence encoding HOXB5;
b. a modified mRNA sequence encoding HLF;
c. a modified mRNA sequence encoding ZFP467;
d. a modified mRNA sequence encoding HOXB3;
e. a modified mRNA sequence encoding LM02;
f a modified mRNA sequence encoding PBX1;
g- a modified mRNA sequence encoding ZFP37; and
h. a modified mRNA sequence encoding ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0039] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding HOXB4;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding LM02;
d. a modified mRNA sequence encoding ZFP467; and
e. a modified mRNA sequence encoding ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0040] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA sequence encoding KLF12;
b. a modified mRNA sequence encoding HLF; and
c. a modified mRNA sequence encoding EGR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0041] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding MEIS 1 ;
b. a modified mRNA sequence encoding RBPMS;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding RUNX1T1 ; and
e. a modified mRNA sequence encoding LM02.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0042] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA sequence encoding KLF12; and
b. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0043] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
a. a modified mRNA sequence encoding ZFP37;
b. a modified mRNA sequence encoding HOXB4;
c. a modified mRNA sequence encoding LM02; and
d. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0044] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
a. a modified mRNA encoding MYCN;
b. a modified mRNA encoding ZFP467;
c. a modified mRNA encoding NKX2-3
d. a modified mRNA encoding PBX1 ; and
e. a modified mRNA encoding KLF4;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0045] In some embodiments of these aspects and all such aspects described herein, the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
[0046] In some embodiments of these aspects and all such aspects described herein, the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl -uridine, 1 -propynyl-pseudouridine, 5- taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl -uridine, 1 -methyl -pseudouridine, 4-thio-l -methyl- pseudouridine, 2-thio-l -methyl-pseudouridine, 1 -methyl- 1 -deaza-pseudouridine, 2-thio-l -methyl- 1 - deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4- acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl- cytidine, 4-thio-pseudoisocytidine, 4-thio-l -methyl -pseudoisocytidine, 4-thio-l -methyl- 1-deaza- pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5 -aza-2-thio -zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl- cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl -pseudoisocytidine, 2-aminopurine, 2,6- diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2- aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6- methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio- N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1 - methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl- guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2-methylguanosine, N2,N2- dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine, and combinations thereof.
[0047] Also provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; , a nucleic acid sequence
encoding ZFP37; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding
LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0048] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16 a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
[0049] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0050] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0051] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[0052] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNX1T1; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0053] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
[0054] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0055] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[0056] Provided herein, in some aspects, are methods for preparing an induced
hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0057] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[0058] Provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0059] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[0060] Provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0061] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBXl ; and a nucleic acid sequence encoding KLF4.
[0062] In some embodiments of these aspects and all such aspects described herein, the somatic cell is a fibroblast cell.
[0063] In some embodiments of these aspects and all such aspects described herein, the somatic cell is a hematopoietic lineage cell.
[0064] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing
megakaryocytes, platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes, multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors.
[0065] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from a multi-potent progenitor cell (MPP), common myeloid progenitor cell (CMP), granulocyte-monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte-erythrocyte progenitor cell.
[0066] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro- dendritic cell (pro-DC), pre-granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro-mast cell (ProMC).
[0067] Also provided herein, in some aspects, are methods of promoting transdifferentiation of a ProPreB cell to the myeloid lineage comprising:
a. transducing a ProPreB cellwith one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced ProPreB cell in a cell media that supports growth of myeloid lineage cells, thereby transdifferentiating the ProPreB cell to the myeloid lineage.
[0068] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[0069] Also provided herein, in some aspects, are methods of increasing survival and/or proliferation of ProPreB cells, comprising:
a. transducing a ProPreB cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced ProPreB cell in a cell media that supports growth of ProPreB cells, thereby increasing survival and/or proliferation of ProPreB cells.
[0070] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic
acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[0071] Also provided herein, in some aspects, are isolated induced hematopoietic stem cells
(iHSCs) produced using any of the HSC inducing compositions or methods described herein.
[0072] In some aspects, provided herein are cell clones comprising a plurality of the induced hematopoietic stem cells (iHSCs) produced using any of the HSC inducing compositions or methods described herein. In some embodiments of these aspects and all such aspects described herein, the cell clones further comprise a pharmaceutically acceptable carrier.
[0073] Also provided herein, in some aspects, are kits for making induced hematopoietic stem cells (iHSCs), the kits comprising any of the HSC inducing compositions comprising one or more expression vector components described herein.
[0074] Provided herein, in some aspects, are kits for making induced hematopoietic stem cells (iHSCs), the kits comprising any of the HSC inducing compositions comprising modified mRNA sequence components described herein.
[0075] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, and MEIS1
[0076] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBX1, and LM02.
[0077] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[0078] a nucleic acid sequence encoding HLF;
[0079] a nucleic acid sequence encoding RUNX1T1 ;
[0080] a nucleic acid sequence encoding ZFP37;
[0081] a nucleic acid sequence encoding PBX1 ;
[0082] a nucleic acid sequence encoding LM02;
[0083] a nucleic acid sequence encoding PRDM5;
[0084] a nucleic acid sequence encoding MYCN; and
[0085] a nucleic acid sequence encoding MEIS1.
[0086] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducin compositions comprising one or more expression vectors comprising:
[0087] a nucleic acid sequence encoding HLF;
[0088] a nucleic acid sequence encoding RUNX1T1 ;
[0089] a nucleic acid sequence encoding ZFP37;
[0090] a nucleic acid sequence encoding PBX1 ; and
[0091] a nucleic acid sequence encoding LM02;
[0092] In some embodiments of these aspects and all such aspects described herein, the one or more expression vectors are lentiviral vectors. In some embodiments, the lentiviral vectors are inducible lentiviral vectors. In some embodiments, the lentiviral vectors are polycistronic inducible lentiviral vectors. In some embodiments, the polycistronic inducible lentiviral vectors express three or more nucleic acid sequences. In some embodiments, each of the nucleic acid sequences of the polycistronic inducible lentiviral vectors are separated by 2A peptide sequences.
[0093] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, and MEIS1.
[0094] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBX1, and LM02.
[0095] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNX1T1 ; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding PBX1 ; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM5; a modified mRNA sequence encoding MEIS1 ; and a modified mRNA sequence encoding MYCN; wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0096] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNX1T1 ; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding PBX1 ; and a modified mRNA sequence encoding LM02; wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[0097] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising: transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5; a nucleic acid
sequence encoding MEIS 1 ; and a nucleic acid sequence encoding MYCN, wherein each said nucleic acid sequence is operably linked to a promoter; and
culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0098] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising: transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding
RUNXITI ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[0099] As demonstrated herein, the use of polycistronic viral expression systems can increase the in vivo reprogramming efficiency of somatic cells to iHSCs. Accordingly, in some embodiments of the aspects described herein, a polycistronic lentiviral vector is used. In such embodiments, sequences encoding two or more of the HSC inducing factors described herein, are expressed from a single promoter, as a polycistronic transcript. We used 2A peptide strategy to make polycistronic vectors (see, e.g., Expert Opin Biol Ther. 2005 May;5(5):627-38). Polycistronic expression vector systemscan also use internal ribosome entry sites (IRES) elements to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5'-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, thus creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message. See, for example, U.S. Pat. Nos. 4,980,285; 5,925,565 ; 5,631,150; 5,707,828; 5,759,828; 5,888,783; 5,919,670; and 5,935,819; and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press (1989).
Definitions
[00100] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing
particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[00101] The term "HSC inducing factor," as used herein, refers to a developmental potential altering factor, as that term is defined herein, such as a protein, RNA, or small molecule, the expression of which contributes to the reprogramming of a cell, e.g. a somatic cell, to the HSC state. An HSC inducing factor can be, for example, transcription factors that can reprogram cells to the HSC state, such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, and the like, including any gene, protein, RNA or small molecule that can substitute for one or more of these factors in a method of making iHSCs in vitro. In some embodiments, exogenous expression of an HSC inducing factor induces endogenous expression of one or more HSC inducing factors, such that exogenous expression of the one or more HSC inducing factor is no longer required for stable maintenance of the cell in the iHSC state.
[00102] As used herein, the terms "developmental potential" or "developmental potency" refer to the total of all developmental cell fates or cell types that can be achieved by a given cell upon differentiation. Thus, a cell with greater or higher developmental potential can differentiate into a greater variety of different cell types than a cell having a lower or decreased developmental potential. The developmental potential of a cell can range from the highest developmental potential of a totipotent cell, which, in addition to being able to give rise to all the cells of an organism, can give rise to extra-embryonic tissues; to a "unipotent cell," which has the capacity to differentiate into only one type of tissue or cell type, but has the property of self-renewal, as described herein; to a "terminally differentiated cell," which has the lowest developmental potential. A cell with "parental
developmental potential" refers to a cell having the developmental potential of the parent cell that gave rise to it.
[00103] The term "multipotent" when used in reference to a "multipotent cell" refers to a cell that has the developmental potential to differentiate into cells of one or more germ layers, but not all three. Thus, a multipotent cell can also be termed a "partially differentiated cell." Multipotent cells are well known in the art, and examples of multipotent cells include adult stem cells, such as for example, hematopoietic stem cells and neural stem cells. "Multipotent" indicates that a cell may form many types of cells in a given lineage, but not cells of other lineages. For example, a multipotent hematopoietic cell can form all of the many different types of blood cells (red, white, platelets, etc.), but it cannot form neurons. Accordingly, the term "multipotency" refers to a state of a cell with a degree of developmental potential that is less than totipotent and pluripotent.
[00104] The terms "stem cell" or "undifferentiated cell" as used herein, refer to a cell in an undifferentiated or partially differentiated state that has the property of self-renewal and has the developmental potential to differentiate into multiple cell types, without a specific implied meaning regarding developmental potential (i.e., totipotent, pluripotent, multipotent, etc.). A stem cell is capable of proliferation and giving rise to more such stem cells while maintaining its developmental potential. In theory, self-renewal can occur by either of two major mechanisms. Stem cells can divide asymmetrically, which is known as obligatory asymmetrical differentiation, with one daughter cell retaining the developmental potential of the parent stem cell and the other daughter cell expressing some distinct other specific function, phenotype and/or developmental potential from the parent cell. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. A differentiated cell may derive from a multipotent cell, which itself is derived from a multipotent cell, and so on. While each of these multipotent cells can be considered stem cells, the range of cell types each such stem cell can give rise to, i.e., their developmental potential, can vary considerably. Alternatively, some of the stem cells in a population can divide symmetrically into two stem cells, known as stochastic differentiation, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only. Accordingly, the term "stem cell" refers to any subset of cells that have the developmental potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retain the capacity, under certain circumstances, to proliferate without substantially differentiating. In some embodiments, the term stem cell refers generally to a naturally occurring parent cell whose descendants (progeny cells) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. Cells that begin as stem cells might proceed toward a differentiated phenotype, but then can be induced to "reverse" and re-express the stem cell phenotype, a term often referred to as "dedifferentiation" or "reprogramming" or
"retrodifferentiation" by persons of ordinary skill in the art, and as used herein.
[00105] In the context of cell ontogeny, the term "differentiate", or "differentiating" is a relative term that refers to a developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell. Thus in some embodiments, a
reprogrammed cell as the term is defined herein, can differentiate to a lineage-restricted precursor cell (such as a common lymphoid progenitor), which in turn can differentiate into other types of precursor
cells further down the pathway (such as a ProBPreB cell, for example), and then to an end-stage differentiated cells, which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
[00106] "Transdifferentiation," as used herein refers to a process by which the phenotype of a cell can be switched to that of another cell type, without the formation of a multipotent intermediate cell. Thus, when transdifferentiation methods are employed, it is not required that the cell first be dedifferentiated (or reprogrammed) to a multipotent cell and then differentiated to another hematopoietic lineage cell; rather the cell type is merely "switched" from one cell type to another without first forming a multipotent iHSC phenotype, for example.
[00107] As used herein, the term "without the formation of a multipotent or pluripotent intermediate cell" refers to the transdifferentiation of one cell type to another cell type, preferably, in one step; thus a method that modifies the differentiated phenotype or developmental potential of a cell without the formation of a multipotent or pluripotent intermediate cell does not require that the cell be first dedifferentiated (or reprogrammed) to a multipotent state and then differentiated to another cell type.
[00108] The term "expression" refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, translation, folding, modification and processing. "Expression products" include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene. In some embodiments, an expression product is transcribed from a sequence that does not encode a polypeptide, such as a microRNA.
[00109] As used herein, the term "transcription factor" or "TF" refers to a protein that binds to specific parts of DNA using DNA binding domains and is part of the system that controls the transcription of genetic information from DNA to RNA.
[00110] As used herein, the term "small molecule" refers to a chemical agent which can include, but is not limited to, a peptide, a peptidomimetic, an amino acid, an amino acid analog, a polynucleotide, a polynucleotide analog, an aptamer, a nucleotide, a nucleotide analog, an organic or inorganic compound (e.g., including heterorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1 ,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
[00111] The term "exogenous" as used herein refers to a nucleic acid (e.g., a synthetic, modified RNA encoding a transcription factor), or a protein (e.g. , a transcription factor) that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is not normally found, or in which it is found in lower amounts. A factor (e.g. a synthetic, modified RNA encoding a transcription factor, or a protein, e.g. , a polypeptide) is considered exogenous if it is introduced into an immediate precursor cell or a progeny cell that inherits the substance. In contrast, the term "endogenous" refers to a factor or expression product that is native to the biological system or cell (e.g., endogenous expression of a gene, such as, e.g., HLF refers to production of an HLF polypeptide by the endogenous gene in a cell).
[00112] The term "isolated" or "partially purified" as used herein refers, in the case of a nucleic acid or polypeptide, to a nucleic acid or polypeptide separated from at least one other component (e.g. , nucleic acid or polypeptide) that is present with the nucleic acid or polypeptide as found in its natural source and/or that would be present with the nucleic acid or polypeptide when expressed by a cell, or secreted in the case of secreted polypeptides. A chemically synthesized nucleic acid or polypeptide or one synthesized using in vitro transcription/translation is considered "isolated".
[00113] The term "isolated cell" as used herein refers to a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell. Optionally the cell has been cultured in vitro, e.g., in the presence of other cells. Optionally, the cell is later introduced into a second organism or re-introduced into the organism from which it (or the cell or population of cells from which it descended) was isolated.
[00114] The term "isolated population" with respect to an isolated population of cells as used herein refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some embodiments, an isolated population is a "substantially pure" population of cells as compared to the heterogeneous population from which the cells were isolated or enriched. In some embodiments, the isolated population is an isolated population of multipotent cells which comprise a substantially pure population of multipotent cells as compared to a heterogeneous population of somatic cells from which the multipotent cells were derived.
[00115] The term "immediate precursor cell" is used herein to refer to a parental cell from which a daughter cell has arisen by cell division.
[00116] The term "contacting" or "contact" as used herein in connection with contacting a cell with one or more constructs, viral vectors, or synthetic, modified RNAs, includes subjecting a cell to a culture medium which comprises one or more constructs, viral vectors, or synthetic, modified RNAs at least one time, or a plurality of times, or to a method whereby such constructs, viral vectors, or synthetic, modified RNAs are forced to contact a cell at least one time, or a plurality of times, i.e., a
transduction or a transfection system. Where such a cell is in vivo, contacting the cell with a construct, viral vector, or synthetic, modified RNA includes administering the construct(s), viral vector(s), or synthetic, modified RNA(s) in a composition, such as a pharmaceutical composition, to a subject via an appropriate administration route, such that the compound contacts the cell in vivo.
[00117] The term "transfection" as used herein refers the use of methods, such as chemical methods, to introduce exogenous nucleic acids, such as synthetic, modified RNAs, into a cell, preferably a eukaryotic cell. As used herein, the term transfection does not encompass viral-based methods of introducing exogenous nucleic acids into a cell. Methods of transfection include physical treatments (electroporation, nanoparticles, magnetofection), and chemical-based transfection methods. Chemical-based transfection methods include, but are not limited to, cyclodextrin, polymers, liposomes, and nanoparticles. In some embodiments, cationic lipids or mixtures thereof can be used to transfect the synthetic, modified RNAs described herein, into a cell, such as DOPA, Lipofectamine and UptiFectin. In some embodiments, cationic polymers such as DEAE-dextran or polyethylenimine, can be used to transfect a synthetic, modified RNAs described herein.
[00118] The term "transduction" as used herein refers to the use of viral particles or viruses to introduce exogenous nucleic acids, such as nucleic acid sequences encoding HSC inducing factors, into a cell.
[00119] As used herein, the term "transfection reagent" refers to any agent that induces uptake of a nucleic acid into a host cell. Also encompassed are agents that enhance uptake e.g., by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 500-fold, at least 100-fold, at least 1000-fold, or more, compared to a nucleic acid sequence administered in the absence of such a reagent. In some embodiments, a cationic or non- cationic lipid molecule useful for preparing a composition or for co-administration with a synthetic, modified RNA is used as a transfection reagent. In other embodiments, the synthetic, modified RNA comprises a chemical linkage to attach e.g. , a ligand, a peptide group, a lipophillic group, a targeting moiety etc. In other embodiments, the transfection reagent comprises a charged lipid, an emulsion, a liposome, a cationic or non-cationic lipid, an anionic lipid, or a penetration enhancer as known in the art or described herein.
[00120] As used herein, the term "repeated transfections" refers to repeated transfection of the same cell culture with a nucleic acid, such as a synthetic, modified RNA, a plurality of times {e.g., more than once or at least twice). In some embodiments, the cell culture is transfected at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times,
at least 15 times, at least 16 times, at least 17 times at least 18 times, at least 19 times, at least 20 times, at least 25 times, at least 30 times, at least 35 times, at least 40 times, at least 45 times, at least 50 times or more. The transfections can be repeated until a desired phenotype of the cell is achieved.
[00121] The time between each repeated transfection is referred to herein as the "frequency of transfection." In some embodiments, the frequency of transfection occurs every 6h, every 12h, every 24 h, every 36h, every 48h, every 60h, every 72h, every 96h, every 108h, every 5 days, every 7days, every 10 days, every 14 days, every 3 weeks, or more during a given time period in any
developmental potential altering regimen,. The frequency can also vary, such that the interval between each dose is different (e.g., first interval 36h, second interval 48h, third interval 72h etc). It should be understood depending upon the schedule and duration of repeated transfections, it will often be necessary to split or passage cells or change or replace the media during the transfection regimen to prevent overgrowth and replace nutrients. For the purposes of the methods described herein, transfections of a culture resulting from passaging an earlier transfected culture is considered
"repeated transfection," "repeated contacting" or "contacting a plurality of times," unless specifically indicated otherwise.
[00122] As used herein, the terms "nucleic acid," "polynucleotide," and "oligonucleotide" generally refer to any polyribonucleotide or poly-deoxyribonucleotide, and includes unmodified RNA, unmodified DNA, modified RNA, and modified DNA. Polynucleotides include, without limitation, single- and double-stranded DNA and RNA polynucleotides. The term polynucleotide, as it is used herein, embraces chemically, enzymatically or metabolically modified forms of
polynucleotides, as well as the naturally occurring chemical forms of DNA and RNA found in or characteristic of viruses and cells, including for example, simple (prokaryotic) and complex
(eukaryotic) cells. A nucleic acid polynucleotide or oligonucleotide as described herein retains the ability to hybridize to its cognate complimentary strand.
[00123] Accordingly, as used herein, the terms "nucleic acid," "polynucleotide," and
"oligonucleotide" also encompass primers and probes, as well as oligonucleotide fragments, and is generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides
(containing D-ribose), and to any other type of polynucleotide which is an N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases (including, but not limited to, abasic sites). There is no intended distinction in length between the term "nucleic acid," "polynucleotide," and "oligonucleotide," and these terms are used interchangeably. These terms refer only to the primary structure of the molecule. An oligonucleotide is not necessarily physically derived from any existing or natural sequence, but can be generated in any manner, including chemical synthesis, DNA
replication, DNA amplification, in vitro transcription, reverse transcription or any combination thereof
[00124] The terms "nucleotide" or "mononucleotide," as used herein, refer to a phosphate ester of a nucleoside, e.g., mono-, di-, tri-, and tetraphosphate esters, wherein the most common site of esterification is the hydroxyl group attached to the C-5 position of the pentose (or equivalent position of a non-pentose "sugar moiety"). The term "nucleotide" includes both a conventional nucleotide and a non-conventional nucleotide which includes, but is not limited to, phosphorothioate, phosphite, ring atom modified derivatives, and the like.
[00125] As used herein, the term "conventional nucleotide" refers to one of the "naturally occurring" deoxynucleotides (dNTPs), including dATP, dTTP (or TTP), dCTP, dGTP, dUTP, and dITP.
[00126] As used herein, the term "non-conventional nucleotide" refers to a nucleotide that is not a naturally occurring nucleotide. The term "naturally occurring" refers to a nucleotide that exists in nature without human intervention. In contradistinction, the term "non-conventional nucleotide" refers to a nucleotide that exists only with human intervention, i.e., an "artificial nucleotide." A "non- conventional nucleotide" can include a nucleotide in which the pentose sugar and/or one or more of the phosphate esters is replaced with a respective analog. Exemplary phosphate ester analogs include, but are not limited to, alkylphosphonates, methylphosphonates, phosphoramidates, phosphotriesters, phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates,
phosphoroanilothioates, phosphoroanilidates, phosphoroamidates, boronophosphates, etc., including any associated counterions, if present. A non-conventional nucleotide can show a preference of base pairing with another non-conventional or "artificial" nucleotide over a conventional nucleotide (e.g., as described in Ohtsuki et al. 2001, Proc. Natl. Acad. Sci., 98: 4922-4925, hereby incorporated by reference). The base pairing ability may be measured by the T7 transcription assay as described in Ohtsuki et al. (supra). Other non-limiting examples of "non-conventional" or "artificial" nucleotides can be found in Lutz et al. (1998) Bioorg. Med. Chem. Lett., 8: 1149-1152); Voegel and Benner (1996) Helv. Chim. Acta 76, 1863-1880; Horlacher et al. (1995) Proc. Natl. Acad. Sci., 92: 6329- 6333; Switzer et al. (1993), Biochemistry 32: 10489-10496; Tor and Dervan (1993) J. Am. Chem. Soc. 115: 4461-4467; Piccirilli et al. (1991) Biochemistry 30: 10350-10356; Switzer et al. (1989) J. Am. Chem. Soc. I l l : 8322-8323, all of which are hereby incorporated by reference. A "non-conventional nucleotide" can also be a degenerate nucleotide or an intrinsically fluorescent nucleotide.
[00127] As used herein the term "modified ribonucleoside" refers to a ribonucleoside that encompasses modification(s) relative to the standard guanine (G), adenine (A), cytosine (C), and uracil (U) nucleosides. Such modifications can include, for example, modifications normally
introduced post-transcriptionally to mammalian cell mRNA, and artificial chemical modifications, as known to one of skill in the art.
[00128] As used herein, the terms "synthetic, modified RNA" or "modified RNA" or "modified mRNA" refer to an RNA molecule produced in vitro which comprises at least one modified nucleoside as that term is defined herein below. The modified mRNAs do not encompass mRNAs that are isolated from natural sources such as cells, tissue, organs etc., having those modifications, but rather only synthetic, modified RNAs that are synthesized using in vitro techniques, as described herein. The term "composition," as applied to the terms "synthetic, modified RNA" or "modified RNA," encompasses a plurality of different synthetic, modified RNA molecules {e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 90, at least 100 synthetic, modified RNA molecules or more). In some embodiments, a synthetic, modified RNA composition can further comprise other agents {e.g., an inhibitor of interferon expression or activity, a transfection reagent, etc.). Such a plurality can include synthetic, modified RNA of different sequences {e.g., coding for different polypeptides), synthetic, modified RNAs of the same sequence with differing modifications, or any combination thereof.
[00129] As used herein the term "modified nucleoside" refers to a ribonucleoside that encompasses modification(s) relative to the standard guanine (G), adenine (A), cytidine (C), and uridine (U) nucleosides. Such modifications can include, for example, modifications normally introduced post-transcriptionally to mammalian cell mRNA, and artificial chemical modifications, as known to one of skill in the art.
[00130] As used herein, the term " polypeptide " refers to a polymer of amino acids comprising at least 2 amino acids {e.g., at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, at least 275, at least 300, at least 350, at least 400, at least 450, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 amino acids or more). The terms "protein" and "polypeptide" are used interchangeably herein. As used herein, the term "peptide" refers to a relatively short polypeptide, typically between about 2 and 60 amino acids in length.
BRIEF DESCRIPTION OF THE DRAWINGS
[00131] Fig. 1 depicts a schematic of hematopoietic differentiation showing populations
(boxes) for which microarray data has been generated. Data generated herein is shown in thin-line
boxes, and by other groups in thick-line boxes. Whereas hematopoietic differentiation normally proceeds from HSCs to differentiated blood effector cells, the results described herein aim to utilize HSC-enriched transcription factors to reprogram committed hematopoietic cells back to HSCs (large arrow). Throughout this proposal HSCs are purified by stringent cell surface criteria (e.g., ckit+Sca iineage"CD48"flk2 CD150+CD34 ), as well as for fetal liver HSCs (e.g., ckit+Scal+lineage- CD48"CD150+Macllow).
[00132] Fig. 2 depicts an overview of the approaches described herein for identifying factors capable of reprogramming committed hematopoietic cells back to HSCs.
[00133] Fig. 3 depicts gene discovery using the hematopoietic expression database. Heat map of expression of genes enriched in 6 different hematopoietic populations. Each column reflects microarray data from a hematopoietic subset (40 populations represented). Erythroid progenitors include MEP, pre-CFU-E and CFU-E. Expressed was visualized as red; Not expressed was visualized as blue. * Asterisk denotes genes with known roles in specifying the fate and/or function of the indicated cell type.
[00134] Figs. 4A-4B depict an overview of experimental approaches and experimental populations. Fig. 4A depicts experimental approaches for screening induced HSCs (iHSCs) through expression of multiple critical HSC-enriched transcription factors by in vitro and in vivo methods. CD45.2 transgenic (rtTA) mice are used to identify congenic donor cells in transplant experiments using recipient CD45.1 host mice. Common myeloid progenitors (CMPs) and Pro/Pre B Cells were sorted out of the bone marrow of CD45.2 transgenic mice. Sorted cells were incubated for 14 hours with ZsGreen control (VC) or a viral cocktail of HSC-specific factors. ZsGr+ cells were resorted two days post doxycycline addition. Resorted ZsGr+ CMPs and ProPreB Cells were put into a CFC myeloid colony forming assays (scored for colony numbers and morphology 20 days later) or transplanted into conditioned IR CD45.1+ recipient mice. Peripheral bleeds were performed up to 16 weeks as to define the short and long term reconstitution potential of cells. Mice identified with adequate multi-lineage reconstitution were euthanized and donor derived cells sorted from the bone marrow to be transplanted into conditioned secondary CD45.1 recipients; also full analysis of the bone marrow, spleen and thymus was performed. Fig. 4B depict CMPs and PrePro B cells that were predominately chosen as our starting populations so that we could demonstrate experimental reprogramming from the first defined committed blood cells in BOTH the B cell lineage and the myeloid lineage. These cell populations were identified using the phenotypic markers listed.
[00135] Figs. 5A-5C depict heat maps of HSC-enriched transcription factors. The Rossi Lab and others put together a detailed database including mRNA expression profiles for over 248 defined progenitor and effector sub populations. Fig. 5A depicts an expression profile heat map for 37 HSC-
enriched reprogramming factors. Columns represent microarray data for 40 distinct FACs sorted populations. *Denotes factors chosen because of their developmental importance. Expressed was visualized as red; Not expressed was visualized as blue. Fig. 5B shows that all HSC-enriched factors were placed into a doxycycline inducible tet-on system based in the pHAGE2 lentiviral vector. Only exception to this vector map from addgene is that a CMV promoter is used in the systems described herein. Heat Map of expanded set of identified HSC-enriched Transcription Factors. Fig. 5C depicts an expression profile heat map for 46 HSC-enriched putative reprogramming factors. Columns represent microarray data for 40 distinct FACs sorted populations. * Expressed was visualized as red; Not expressed was visualized as blue.
[00136] Figs. 6A-6D depict isolation strategies for Pro and Pre B cells. Fig. 6A shows ProPre
B cells that are sorted from the bone marrow by placing total bone marrow through a magnetic B220 enrichment column. Enrichment increases B220 CD19+ B cells from 15% to 85% in their respective populations; through Aria cell sorting the purity of the sample increases further to 99-100%). (RT stands for the B220- run through from the column). Fig. 6B depicts a orting strategy to obtain ProPreB Cells that is demonstrated by flow histograms. Fig. 6C shows overall purity for each of the following samples: overall B220 enriched (top panel), reanalyzed sorted Pro B cells (Middle panel) and reanalyzed sorted Pre B cells (Bottom Panel). By showing CD25 expression vs. B220 expression we demonstrate not only that Pro and Pre B cells can be effectively sorted but can also be
distinguished via phenotypic markers and sorting. Fig. 6D depicts overall sort purity of Pre B cells and Pro B Cells in each of the populations collected; indicating proficient sorting of ProPre B Cells (RT stands for the B220" run through from the column).
[00137] Figs. 7A-7B depict an isolation strategy for CMPs. Fig. 7A shows CMP cells that are sorted from the bone marrow by placing total bone marrow through a magnetic c-kit enrichment column. The indicated gating strategy isolated singlet, live, lineage negative, hematopoietic progenitors. Fig. 7B shows that enrichment increases CMP levels and furthermore that using aria cell sorting, a purity of 99-100%) is achieved.
[00138] Figs. 8A-8C demonstrate transduction and inducible expression of HSC-enriched transcription factors (TFs) in hematopoietic progenitors. Fig.8A shows transduction of multi-potent progenitors (MPPs) with lentiviruses bearing 8 different TFs (LV1-LV-8). Cells were cultured in the presence of doxycycline (Dox) for 5 days followed by flow cytometry. Fig. 8B shows peripheral blood of a recipient transplanted with TF -transduced MPPs and maintained on Dox for 4 weeks (left panel), followed by 2 weeks Dox-off (right panel). Fig. 8C shows viral mediated expression of putative reprogramming factors in vitro. Quantitative RT-PCR for the indicated genes showing their relative expression within primary hematopoietic stem cells (HSCs) or multi-potent progenitors
(MPPs), and in primary cells that were transduced with LV encoding the indicated factor and cultured for 1 week. The mRNA levels in overexpressing cells was calculated by dividing to the expression levels in primary HSCs,. Results show Hlf at 8-fold, Nap 113 at 110-fold, Rbpms at 20-fold and Runxl' at 40-fold above endogenous levels.
[00139] Figs. 9A-9C demonstrate that Pro/Pre B Cells and CMPs can be transduced with doxycycline inducible viral cocktails. Fig. 9A shows B220+ CD 19+ B Cells that were sorted from the bone marrow; cells were incubated for 14 hours with nothing (non trans), control ZsGr Virus (VC) or a viral cocktail that express 28 HSC-enriched factors (VM). Doxycycline (dox) was added for 24 hours. An increase in ZsGr+ cells is observed when the VM is used on cells in comparison to non transduced cells. Fig. 9B shows B220+ CD 19+ B cells that were further analyzed in the presence and absence of dox in three independent trials. In the absence of Dox few ZsGr+ cells are observed however regardless of using VC or VM the addition of Dox increases ZsGr expression in the population. Addition of dox tightly regulates ZsGr expression and therein gene expression. Fig. 9C shows pre B Cells, Pro B Cells, and CMPs that were sorted out of the bone marrow and incubated for 14 hours with VC or VM and left with Dox for two days before analysis. ProPreBCells and CMPs can be transduced with the viral cocktail to express HSC-enriched factors.
[00140] Figs. 10A-10D demonstrate that combinatorial TF expression increases ProPreB and
CMP CFC colony number and alters lineage potential. ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail (VM) for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20. Fig. 10A shows examples of types of cells observed during determination of colony morphology. Fig. 10B depicts representative pictures that were taken of the Transduced ProPreB ZsGreen control (VC) and Viral mixture of 37 factors (VM) CFC plates. Fig. IOC shows increasing number of cells that were plated to find an effective plating density of both ProPreBCells and CMPs. 2X105 ProPre B Cells and lxlO4 CMPs were used in further experiments. Experiments were repeated in two individual trials. Fig. 10D shows colony number and composition that were determined and noted for all colonies. Increased colony number is observed when ProPreB Cells and CMPs were transduced with the cocktail of 37 factors as compared to the ZsGreen control (VC). Experiments were done in duplicates for four trials.
[00141] Fig. 11 demonstrates that exposure to 18 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo. Multi-
potent progenitors ( MPP=Lineage~Scal ckit CD 150") were sorted and transduced with with either control virus of a lentiviral mix containing Hlf, MycN, Meisl, Irf6, Cdknlc, Nfix, Dnmt3b, Zfp612, Prdm5, HoxB4, Lmo2, Nkx2-3, RarB, Ndn, Nap 113, Runxltl, Zfp467, Zfp532. Transduced cells were transplanted into iradiated congenic recipients along with competitive WBM. Peripheral-blood chimerism is indicated at timepoints post-transplant showing that exposure to these factors greatly improved long-term donor engraftment.
[00142] Fig. 12 demonstrates that exposure to 9 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo. MPPs from CD45.2 or congenic CD45.1 donors were sorted as LSKCD34+flk2+ and equal numbers of cells were transduced with either control virus (into CD45.1 cells) of a lentiviral mix containing 9 factors, including Evi-1, Glis2, HoxB5, HoxA9, HLF, Meisl, MycN, Prdml6, Runxl (CD45.2 cells). Cells were transplanted into irradiated CD45.1/CD45.2 Fl recipients along with CD45.1/CD45.2 competitor bone marrow (2e5 cells). Transgene-expression was sustained with doxycycline (dox-on) for 18 weeks (upper panel) followed by removal of Doxycycline for the remainder of the experiment (dox-off) . Peripheral blood chimerism was measured at 20 and 25 weeks (lower panel) showing that in contrast to control transduced MPPs (CD45.1), 9-factor transduced MPPS retained rebust long-term repopulating activity. Panel on lower right: Engraftment from 9-factor transduction is multi-lineage. Donor-derived cells were stained for Macl, Gr-1, CD3, CD8 and B220 revealing the presasence of donor-derived, macophage/monocytes, granulocytes, T-cells and B-cells.
[00143] Figs. 13A-13B demonstrate long-term multi-lineage reconstitution of multi-potent progenitors (MPPs) transduced with HSC-enriched transcription factors (TFs). Fig. 13A. Flow cytometry of peripheral blood of a recipient transplanted with MPPs (ckit+Scal+lineage-CD150- flk2+CD34+) transduced with control virus (top panel), or a cocktail of 17 different TFs (lower panel), 20 weeks post-transplant. Equal numbers of MPPs from the same initial sort were
transplanted. Fig. 13B. Donor chimerism 20 weeks post-transplant of mice described in (FIG. 13A). Results show that only the TF -transduced MPPs yielded long-term multi-lineage reconstitution of T- cells, B-cells and myeloid cells, whereas control cells only gave rise to lymphoid cells as expected. All recipients receiving TF-transduced cells were multi-lineage reconstituted suggesting that reprogramming was not a rare event. n=4 recipients for each control and 17-TF. 17 factors in this experiment included: Hlf, MycN, Meisl, Irf6, Nfix, Dnmt3b, Zfp612, Prdm5, HoxB4, Lmo2, Nkx2-3, RarB, Ndn, Nap 113, Runxltl, Zfp467, Zfp532.
[00144] Fig. 14 demonstrates that exposure to 8 putative reprogramming factors embues multi-potent progenitors with robust long-term multi-lineage engraftment potential in vivo. Multi- potent progenitors (MPP=Lineage"Scal+ckit+CD150"flk2+CD34+) were sorted and transduced with
with either control virus of a lentiviral mix containing Runxltl, HLF Zfp467 Rbpms hoxb5 napll3 msi2 Irf6 . Transduced cells were transplanted into iradiated congenic recipients along with competitive WBM. Peripheral-blood chimerism is indicated at 16 weeks post-transplant showing that exposure to these factors led to long-term donor multi-lineage engraftment (bottom panel) in contrast to control transdued cells (top panel). Doxycline was maintined on for 2 weeks post-transplant followed by dox-removal.
[00145] Fig. 15 depicts using peripheral bleeds to test donor derived chimerism. Shown here is an example gating strategy on a peripheral bleeds done at 8 weeks on a transplanted mouse with ProPreB cells transduced with a cocktail of viruses that individually encode for expression of 37 transcription factors.
[00146] Figs. 16A-16C demonstrate that ProPreB Cell transplantation confers multi-lineage peripheral reconstitution when factors are expressed combinatorially. CD45.2+ ProPreB cells and CMPs transduced with control or VM were transplanted competitively into IR CD45.1+ recipients. Peripheral bleeds were performed at 4, 8, 12, and 16 weeks. Fig. 16A. Flow histograms show 16 week peripheral bleeds for controls (VC- top panels) and cells expressing the mix of 37 factors (VM-bottom panels); demonstrated for ProPreB (Left) and CMP (Right). Fig. 16B. Quantitative results for each of the peripheral bleeds are shown for ProPreB Cells and CMPs. Chimerism above 1.0% was observed in 5/14 mice transplanted with ProPreB and 3/8 mice transplanted with CMP. Fig. 16C. Cellular composition of the peripheral bleeds of mice with chimerism over 1.0% is shown for mice transplanted with ProPreB Cells and CMPs.
[00147] Fig. 17 demonstrates that peripheral lymphoid organ and bone marrow reconstitution is observed from CMPs and ProPreB Cells expressing combinatorial factors. The bone marrow, spleen, and thymus were harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a viral cocktail (VM). Representative histograms of three ProPre B Cell transplanted mice (VC, VM4, VM14) and two CMP transplanted mice (VC and VM6) - VM#s are the same observed in Fig. 15. Varying degrees of donor derived chimerism can be observed in each lymphoid compartment; consistently VM expressing cells had higher reconstitution in all lymphoid
compartments in comparison to controls.
[00148] Figs. 18A-18D demonstrate that multi-lineage reconstitution is observed in peripheral lymphoid organs upon transplantation with combinatorial factor expression. Fig. 18A. The bone marrow, spleen, and thymus were harvested from mice that were transplanted with transduced ProPre B cells and CMPs. Quantitation of the data is graphically summarized. In all ProPreB cells transplanted mice with >1.0% peripheral blood chimerism, donor derived chimerism above control levels were observed in all lymphoid compartments analyzed. Figs. 18B-18D. Composition of the
bone marrow, spleen, and thymus for all control mice or experimental mice analyzed with > 1% peripheral blood chimerism.
[00149] Figs. 19A-19D demonstrate that ProPreB Cells and CMPs expressing a cocktail of factors give rise to primitive hematopoietic progenitors. Fig. 19A. Flow plots have been previously gated on myeloid progenitors (top panel) or primitive hematopoietic progenitors (LSK (Lin"Sca+ c- kit+) cells) (bottom panel). Only mice that received cells transduced with the viral cocktail give rise to donor (CD45.2+) derived cells hematopoietic progenitors or myeloid progenitors. Further break down of the myeloid progenitor gate (top panel) and hematopoietic progenitor (bottom panel) gates reveal a diversity of progenitor populations. Fig. 19B. Quantitation of the overall numbers of myeloid progenitors and hematopoietic progenitor cells in each of the transplanted VC (average of five mice) and VM mice with peripheral chimerism above 1.0%. In all cases there is increased numbers of cells with respect to controls. Figs. 19C-19D. Composition of the compartments was analyzed and quantified. Each bar represents one mouse and the respective composition of the myeloid progenitor compartment (Fig. 19C) or the hematopoietic progenitor compartment (Fig. 19D).
[00150] Figs. 20A-20C demonstrate that ProPre B Cells and CMPs have serial transplant potential only when factors in combination are expressed. 1000 LSK CD45.2+ Cells were sorted and transplanted competitively with 2X105 CD45.1+ Competitors into competent CD45.1+ hosts. Fig. 20A. At 4 weeks all the secondary transplants had distinguishable donor derived multi-lineage populations. Flow graphs representing each of those secondary transplants are shown. Fig. 20B. Quantitation of these results was calculated and reported here as the % CD45.2+ of total peripheral blood. Only ProPre B Cell VM # 14 had sustainable (>.1%) long-term multi-lineage reconstitution even at 16 weeks. Fig. 20C. The composition of the peripheral blood for all the mice referred to above at four weeks and at 16 weeks for PPBC#14. Multi-lineage reconstitution is observed for all bleeds.
[00151] Figs. 21A-21B. PCR based strategies can be used to identify VDJ rearrangements in
B-cell progenitors. Fig. 21A. B cells progenitors can be isolated based on the phenotypic markers shown in this schematic. Fig. 21B. Fraction A, B, C and D and IgM positive mature B cells were sorted and subjected to PCR for V-D-J recombination of heavy and light chain. Heavy chain rearrangement begins as early as fraction B and continues to occur through Fraction C. Lambda and kappa light chain and rearrangement can occur as early as Fraction C and proceed through mature B cells. CD45.2 was used as a PCR loading control across all the samples. The experiments described herein demonstrate that we can effectively detect rearrangements in ProPreB Cells (Fractions B-D) in our system by PCR detection of rearrangement. Primers were adapted primers from Cobaleda et al. Nature 2007.
[00152] Figs. 22A-22C demonstrate VDJ rearrangement confirms the B-lineage origin of reprogrammed cells. To determine if cell populations and colonies originated from a VDJ recombined cell we assayed for recombinational events using PCR. Fig. 22A. B cells (B220+), hematopoietic progenitor (Live, Lin-, c-kit+, Sca+) , and myeloid progenitor (Live, Lin-, c-kit+, Sea-) bone marrow cells were FACs cell sorted and analyzed by PCR for heavy chain VDJ recombination. These populations provide a positive and two negative controls. Colonies arising from ProPreB cells expressing a mix of TFs were tested (GEMM colony); A myeloid colony taken from the control plate. Fig. 22B. CD45.2+ donor and CD45.1+ recipient Macl+ cells were FACs sorted. PCR was performed to test heavy chain (JHSSS), kappa light chain (JLk), lambda light chain (JL1); genomic CD45 as a loading control. This demonstrates rearrangement in Mac+ cells isolated from a mouse transplanted with ProPreB Cells transduced with the viral cocktail (ProPreB #4). Fig. 22C. Recombination analysis was performed and is summarized in table format for mice with CD45.2+ chimerism > 1.0%. All mice with donor derived chimerism and transplanted with ProPre B Cells transduced with the viral cocktail had evidence of reprogramming on the heavy chain loci; a majority had either lambda or kappa light chain rearrangement. All recombinational events appear to be polyclonal and therefore reconstitution occurred from multiple clones.
[00153] Figs. 23A-23B demonstrate that VDJ Rearrangement confirms the origin of the reprogrammed cells. Although summarized in Fig. 22C, further per testing of recombinational events in the peripheral blood of mice reconstituted by ProPreB Cells transduced with the viral cocktail. Fig. 23 A. Rearrangement PCR testing Macl+ cells isolated from mice reconstituted with reprogrammed Pre/Pro B-cells ( mice #'s 3, 7, 14) by a viral cocktail. B220+ cells are used as the positive control and primitive hematopoietic progenitors (unrearranged LSK cells) as the negative control. In the last lane is a mixed myeloid lineage CFC colony (GEMM) that was tested for both heavy and light chain rearrangement. Fig. 23B. Rearrangement of Macl+ cells sorted from the peripheral blood of a mouse reconstituted with reprogrammed Pre/Pro B-cells (VM#5). B220+ cells isolated from the bone marrow (BM) and peripheral blood (PB) are used as the positive control; primitive hematopoietic progenitors (unrearranged LSK+ cells) as the negative control. In the last lane is a mixed myeloid lineage CFC colony (GEMM) that was tested for both heavy and light chain rearrangement.
[00154] Fig. 24 demonstrates that VDJ Rearrangement confirms the origins of peripheral blood cells. Although rearrangement was observed in Mac+ positive cells from the peripheral blood, further analysis was performed on other populations from mice reconstituted from transplanted ProPre B cells transduced with the viral cocktail (#3 and #4). From these two mice the following donor (CD45.2+) populations were sorted: CD4/8+ T cells (T), B220+ B Cells (B), Macl+ Myeloid cells
(M), and all other cells with none of those markers (N). Each population displayed evidence of B cell recombinational events.
[00155] Figs. 25A-25D demonstrates that VDJ rearrangement confirms the origins of peripheral lymphoid cells and bone marrow populations. Tracking of VDJ B cell rearrangement in mice partially reconstituted by the proposed iHSC cells was taken one step further. When bone marrow of mice reconstituted from ProPreB cells transduced with the viral cocktail, aliquots of 50 cells were taken of donor derived hematopoietic progenitors [CD45.2+ LSK cells (LSK)], B cells [B220+ (B Cell)], myeloid cells [Macl+ (Mac)], Myeloid progenitors [Lin-Sca-c-kit+ (MylPro)] and T cells [CD4+/8+/3+ T Cels (T cell)] . DNA was extracted from the samples and PCR performed to assay for recombination. Fig. 25A. PCR recombination testing of mouse (#4) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (JHSSS), kappa light chain (Jk), and lambda light chain (Ji). Fig. 25B. PCR recombination testing of mouse (#3) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (JHSSS). Fig. 25C. PCR recombination testing of mouse (#14 and #7) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (JH588). For mouse #14 that had high donor derived chimerism additional analysis was performed on the same populations from the spleen. Recipient CD45.1+ cells were included as a negative control. Fig. 25D. PCR recombination testing of mouse (#7) reconstituted from ProPreB Cells transduced with the viral mix. PCR testing was performed for heavy chain (JH58s)- Analysis of CD3/CD4/CD8+ T cells from the thymus. The left lane is CD45.1+ control T cells and the right is CD45.2+ donor cells. Only donor cells expressed B cell recombinational events.
[00156] Fig. 26 demonstrates a strategy for reverse cloning of reprogramming factors that allows for distinction between endogenous loci (top panel) and integrated reprogramming factors. Primers were designed to straddle intron/exon boundries such that PCR identification of virally introduced transcription factors could readily be resolved from the endogenous genes - with the reprogramming factors yielding a smaller PCR product in all cases. See Table 5 for primer sequences used for reverse cloning of all reprogramming factors.
[00157] Fig. 27 demonstrates reverse cloning identification of transcription factors. ProPreB
Cells were sorted and transduced for 14 hours with ZsGr control virus (VC), A single virus listed (Only Vector), a viral mix of 37 different factors minus that listed virus (VM-Vector) or the viral cocktail of 37 factors (VM). Doxycycline was added for 24 hours and then cells were harvested, DNA isolated, and PCR analysis performed using the indicated primers.
[00158] Fig. 28 shows reverse cloning identification of transcription factors. ProPreB Cells were sorted and transduced for 14 hours with ZsGr control virus (VC), A single virus listed (Only
Vector), a viral mix of 37 different factors minus that listed virus (VM-Vector) or the viral cocktail of 37 factors (VM). Doxycycline was added for 24 hours and then cells were harvested, DNA isolated, and PCR analysis performed using the indicated primers.
[00159] Fig. 29 shows reverse cloning of reprogramming factors from myeloid (macrophage and granulocyte) colonies derived from reprogrammed pre/pro B cells. Examples of Gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
[00160] Fig. 30 shows reverse cloning of reprogramming factors from myeloid (GEMM and
B cell) colonies derived from reprogrammed pre/pro B cells. Examples of Gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
[00161] Fig. 31 shows reverse cloning of reprogramming factors from myeloid (BFU) colonies derived from reprogrammed pre/pro B cells. Examples of Gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl, Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
[00162] Fig. 32 shows frequency determination in which transcription factor combinations were reverse cloned in reprogrammed cells both intro (CFC colonies) and in vivo (donor-derived meyloid cells). To determine the individual factors contributing to the effects of the TF mix, integration primers were developed. ProPreB cells that gave rise to B cell (B cell), Macrophage (Mac), Granulocyte (Gran), Granulocyte-Macrophage (GM), Blast Forming Unit (BFU), GEMM, and those colonies not morphologically defined (Not Det) were collected and tested in the indicated n number. Similarly peripheral blood populations (B cell, macrophage, T cell, and other cells were tested for integration and grouped into the in vivo column. Results are summarized in a heat map. High prevalence in the population tested was visualized as red and low prevalence in the population was visualized as blue.
[00163] Fig. 33 shows reverse cloning of reprogramming factors from peripheral blood of mice reconstituted from ProPreB Cells expressing a combination of factors. Donor derived peripheral blood from the indicated mice (#4 and #5) reconstituted from ProPre B cells expressing a combination of factors was sorted and PCR analysis performed on the isolated DNA. Examples of two gels run looking at 30 of the 37 different factors present in the cocktail. Notice that Evil, Msi2, Ruxltl,
Hoxb3, and Pbxl all have endogenous gene products present in every screen. White squares emphasize products that are at the correct size indicating integration of the factor listed.
[00164] Figs. 34A-34C demonstrate identity of factor combinations that are integrated into peripheral blood populations from a mouse reconstituted with ProPre B cells and CMPs transduced with the viral cocktail. For three of the transplanted mice (two originating from a transformed ProPre B cell and one from a CMP) that had peripheral chimerism >1.0% the peripheral blood was further sorted into B220+ (B cells), Mac+ (Mac) and CD3+ (T cells). Fig. 34A. Every peripheral bleed of donor derived cells originating from a reprogrammed ProPre B Cell or CMP contained Hlf, Zfp37, Runxltl, Pbxl and Lmo2. Fig. 34B. Additional factors identified in those populations are listed here. Notice that Prdm5 is present in all samples except those collect from the Macl+ cells. Glis2 on the other hand was only found in Mac+ populations. Fig. 34C. Peripheral blood populations (B cell, macrophage, T cell, and other cells were tested for integration and grouped into the in vivo column for the n number of samples. Results are summarized in a heat map. High prevalence in the population tested was visualized as red and low prevalence in the population was visualized as blue.
[00165] Fig. 35 shows transcription factor combination lists. Six combinations (C1-C6) of 4-6 factors were put together based on the integration testing (>75% prevalence). To each combination the additional factors that were 50% - 75% prevalent in the samples were added as additional factors (++). Each combination was derived from a specific colony or population. CI : ProPreB to
Mac/Gran/GM; C2: ProPreB to GEMM/BFU, C3: ProPreB to BCell; C4: CMP toGEMM; C5:
Overall In vitro; C6: Overall In vivo.
[00166] Figs. 36A-36B show combinatorial expression of factors in ProPre B Cells increases colony formation. ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20. Fig. 36A. To ensure that all factors in the combinations were required; factors were singly subtracted out of the combination. Representative pictures of the wells are shown. Fig. 36B. Quantitation of the data is demonstrated here. The ZsGreen control (VC) and the all the combination groups were performed in duplicates four independent experiments.
[00167] Figs. 37A-37B demonstrate defined combinations of transcription factors can reprogram cells to different fates. ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox
was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20. Fig. 37A. The morphology of each of the combinations is shown here. This again is an average of duplicate samples in four independent experiments. Fig. 37B. Representative pictures of transduced ProPreB cell CFC wells for combinations and controls are shown with composition break downs in pie charts for each combination (average of four experiments). Notice that CI a myeloid promoting combination gave rise to predominantly myeloid cells. Which a B Cell promoting combination (C3) promoted predominantly B cell colonies.
[00168] Fig. 38 shows factor combination minus one experiments to determine the requirement of individual factors for reprogramming. ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or a viral cocktail for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20. To ensure that all factors in the combinations were required; factors were singly subtracted out of the combination. For each combination listed in bold the factors were subtracted out singularly. As a control Pbxl (a factor not in the required combination was included as a control, as expected this additional factor was not a required factor in C2). Consistently all other combinations appeared to have been narrowed down to only required factors. Singular factor controls are listed in the last Figure. Bars represent averages of double samples performed in duplicate experiments.
[00169] Fig. 39 demonstrates that a defined set of factors identified to give rise to in vivo reprogramming and GEMM formation in myeloid colony forming assays can increase colony formation and alter the lineage potential of both ProPre B cells and CMPs.ProPre B Cells and CMPs were sorted using phenotypic markers on the Aria Sorter. Cells were incubated with ZsGr control virus (VC) or the defined combination C7 (C7) for 14 hours in S-clone media containing SCF, TPO and IL-12 (In the case of ProPreB Cells, IL-7 and Flk3). Dox was added for 24 hours and cells were resorted for ZsGr+ cells. ZsGr+ cells were placed into methylcellulose media in a 6 well plate format containing SCF, TPO and IL-12 (For ProPreB Cells IL-7 and Flk3). Colony forming potential was assayed on day 20.
[00170] Figs. 40A-40B demonstrate that combination 6 leads to reprogramming of Pre-ProB cells into cells capable of giving rise to multi-lineage donor derived chimerism in vivo. ProPreB Cells and CMPs were sorted from CD45.2 rtTA transgenic bone marrow. Cells were then incubated with
the indicated combination of factor expression viruses in equal concentrations. 10,000 Cells were then transplanted into congenic CD45.1+ mice. Mice were then bleed at 4, 8, 12, and 16 weeks. Only Combination 6 showed donor derived chimerism > 1.0% in preliminary trials.
[00171] Figs. 41A-41C demonstrate donor derived multi-lineage reconstitution from ProPre B
Cells expressing a defined set of factors. ProPreB cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and peripheral bleeds performed at 4, 8 and 12 weeks. Fig. 41A.The gating strategy of mice transplanted with ProPre B Cells transduced with C6 and bleed at 4, 8, and 12 weeks. Donor-derived cells are observed over control level each bleed and are multi-lineage. Fig. 41B. Quantitations for all the bleeds for ProPreB cells are demonstrated. No benefit of the additional factors was observed. Fig. 41C. Cellular composition of the 12 week bleeds are shown in the graphs for ProPreB cells.
[00172] Fig. 42 demonstrates multi-lineage potential of reprogrammed B Cell progenitors by a defined set of factors (C6) is confirmed to have undergone recombination events and derived from B Cell origins. ProPreB cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and to demonstrate that the reconstitution was due to a cell that originated from a B cell, PCR analysis was performed on peripheral blood from the mouse that had long-term reconstitution in the peripheral blood. CD45.2+ donor Macl+ cells had evidence of recombination events but recipient (CD45.1+) Macl+ cells nor Fraction A B cells (B Cell Prog) had evidence of reprogramming.
[00173] Fig. 43 demonstrates a defined set of factors (C6) is expressed in peripheral blood derived from a reprogrammed ProPre B Cell. ProPreB cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and peripheral bleeds performed at 16 weeks. All the factors that were present in the viral mix were found to have integrated into the donor derived peripheral blood.
[00174] Figs. 44A-44C demonstrate donor derived multi-lineage reconstitution from CMPs expressing a defined set of factors. Fig. 44A.CMP cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were transplanted competitively into mice and peripheral bleeds performed at 4, 8 and 12 weeks. Lineage break down is shown by flow diagrams below for each mouse. Fig. 44B. Quantitation for all the bleeds for both CMPs derived reconstituting mice are demonstrated. No benefit of the additional factors was observed. Fig. 44C. Cellular composition of the 12 week bleeds are shown in the graphs for ProPreB cells.
[00175] Fig. 45 shows that reverse cloning confirms that donor derived peripheral blood originating from reprogrammed CMPs by C6 contains factors in Combination 6. CMP cells were transduced to express C6, C6 and the additional factors identified, ZsGr Control (VC). Cells were
transplanted competitively into mice and a peripheral bleeds performed at 12 weeks. Peripheral blood was taken from both CMP originating iHSC reconstituting mice was taken and integration studies performed on the population. One mouse contained all factors used in the viral mix and the other was only missing Hlf.
[00176] Figs. 46A-46C demonstrate a defined set of factors give rise to multi-lineage reconstitution from reprogrammed B Cells. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1Χ10Λ5 whole bone marrow cells into CD45.1+ recipients. Bleeds were performed at 4, 8, 12, and 16 weeks. Fig. 46A. Flow plots are shown for both VC and C7 transduced and transplanted recipients at 8 weeks. Fig. 46B. Quantitation of peripheral bleeds for the B220 enriched cells transduced with ZsGr control (VC) or C7 at 4, 8, 12 and 16 weeks. Excluding one outlier all C7 transduced and transplanted mice are over VC transduced and transplanted cells. Fig. 46C. The average composition of peripheral blood at 4, 8, 12, and 16 weeks.
[00177] Fig. 47 shows multi-lineage reconstitution by reprogrammed B220 enriched cells has evidence of B cell recombination in 2/5 mice. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1Χ10Λ5 whole bone marrow cells into CD45.1+ recipients. Bleed was performed at 16 weeks. To determine what reconstituted animals were derived from a B cell origin, peripheral blood was isolated, Macl+ cells sorted, and tested by per analysis for B cell recombination. Two mice were found to have peripheral chimerism due to a transformed B cell. Those mice are shown in FIG. 40A by highlighting them in orange.
[00178] Fig. 48 shows that reverse cloning confirms that donor derived peripheral blood originating from reprogrammed CMPs by C7 contains factors in combination 7. Five additional factors were added to C6 that gave rise to GEMM colonies from either ProPre B cells or CMPs. This combination was coined C7. B220 enriched cells were magnetically separated from the bone marrow of CD45.2 rtTA mice. Cells were transduced with ZsGr control (VC) or C7 for 14 hours, kept for 24 hours with doxycycline and then transplanted competitively with 1X10Λ5 whole bone marrow cells into CD45.1+ recipients. Bleed was performed at 16 weeks. Peripheral blood from the two B cell recombined mice was isolated and tested by per analysis for the integration of the factors in C7. Rbpms and Msi2 was missing from both analysis.
[00179] Figs. 49A-49D show that peripheral lymphoid organ and bone marrow reconstitution is observed from CMPs and ProPreB Cells expressing a defined set of factors, combination 6. Fig. 49A. The bone marrow, spleen, and thymus were harvested from mice that were transplanted with C6 transduced ProPre B cells and CMPs. Quantitation of the data is graphically summarized. In all ProPreB cells transplanted mice with >1.0% peripheral blood chimerism, donor derived chimerism above control levels were observed in all lymphoid compartments analyzed. Figs. 49B-49D.
Composition of the bone marrow, spleen, and thymus for all control mice or experimental mice analyzed with > 1% peripheral blood chimerism.
[00180] Fig. 50 demonstrates bone marrow reconstitution of the hematopoietic progenitor and myeloid progenitor compartments is observed when CMPs and ProPreB Cells expressing a defined set of factors, combination 6, are transplanted. The bone marrow was harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a defined viral cocktail (C6). Representative histograms are shown of populations reprogrammed with C6: two CMP transplanted mice (CMP1 and CMP2) and one ProPre B Cell transplanted mouse (ProPreB 1). Cells have been previously gated for singlets, live, lineage negative cells. Varying degrees of donor derived chimerism can be observed. The c-kit and sea graphs show that there is donor derived hematopoietic progenitors (LSK; c- kit+Sca+) and myeloid progenitors (Myl Pro; c-kit+Sca-).
[00181] Figs. 51A-51C demonstrate that ProPreB Cells and CMPs expressing a defined set of factors (C6) give rise to primitive hematopoietic progenitors. The bone marrow was harvested from mice transplanted with ProPreB Cells/CMPs transduced with control (VC) a defined viral cocktail (C6). Representative histograms are shown of populations reprogrammed with C6: two CMP transplanted mice (CMP1 and CMP2) and one ProPre B Cell transplanted mouse (ProPreBl).
Graphs represent donor (CD45.2+) derived hematopoietic progenitors (LSK; c-kit+Sca+) and myeloid progenitors (Myl Pro; c-kit+Sca-). Fig. 51A. Quantitation of the overall numbers of myeloid progenitors and hematopoietic progenitor cells in each of the transplanted VC (average of five mice) and C6 mice with peripheral chimerism above 1.0%. In all cases there is increased numbers of cells with respect to controls. Figs. 51B-51C. Composition of the compartments was analyzed and quantified. Each bar represents one mouse and the respective composition of the myeloid progenitor compartment (Fig. 51B) or the hematopoietic progenitor compartment (Fig. 51C).
[00182] Fig. 52 demonstrates that reprogrammed CMPs by defined factors have serial transplantation potential. 16 weeks bone marrow analysis was performed and secondary transplants set up. The two CMP derived mice with donor derived chimerism underwent full bone marrow transplant of 5 million donor cells into five mice each. In the case of the mouse having donor derived chimerism originating from a ProPre B cell transduced with C6, 1 million whole donor bone marrow
cells were competitively transplanted with 2χ10Λ5 CD45.1+ whole bone marrow cells into two mice. Flow graphs of donor derived cells from each of these mice are shown. Donor cells are observed at 4 weeks.
[00183] Figs. 53A-53C demonstrate that reprogrammed CMPs by defined factors have serial long-term transplantation potential. 16 weeks bone marrow analysis was performed and secondary transplants set up. The two CMP derived mice with donor derived chimerism underwent full bone marrow transplant of 5 million donor cells into five mice each. In the case of the mouse having donor derived chimerism originating from a ProPre B cell transduced with C6, 1 million whole donor bone marrow cells were competitively transplanted with 2x10Λ5 CD45.1+ whole bone marrow cells into two mice. Flow graphs of donor derived cells from each of these mice are shown. Donor cells are observed at 4 weeks. Fig. 53A. An example of multilineage donor chimerism at 4 weeks in the peripheral blood of secondary transplants. Fig. 53B. Quantitation of CD45.2+ donor contributions in peripheral blood at 4 and 8 weeks. CMPs transduced with C6 gave rise to multilineage chimerism in primary recipients and in secondary transplants all the mice had donor cells. Fig. 53C. Quantitation of the composition of peripheral blood cells in secondary recipients.
[00184] Fig. 54 demonstrates that peripheral blood derived from CMP C6 reconstituted mice can be reprogrammed to give rise to in vitro colony forming potential. Peripheral blood from serially transplanted C6 transduced CMP cells was collected. B220+ and CD3+ and Macl+ cells were sorted and incubated for 48 hours with doxycycline. Cells were then put into methylcellulose media containing SCF, TPO, IL-12, Flk3, and IL-7. Colonies in the CFCs assays were counted and morphology characterized 20 days later. Control sorted cells from primary VC recipients were blank but colonies were observed when cells were derived from CMPs previously transduced with C6.
[00185] Fig. 55 demonstrates that peripheral blood derived from reconstituted mice having been transplanted with B220 enriched cells expressing C7 mice can undergo secondary reprogrammed to give rise to in vitro colony forming potential. Peripheral blood from mice transplanted with B220 enriched cells expressing combination C7 was collected at 16 weeks. B220+ and CD3+ and Macl+ cells were sorted and incubated for 48 hours with doxycycline. Cells were then put into
methylcellulose media containing SCF, TPO, IL-12, Flk3, and IL-7. Colonies in the CFCs assays were counted and morphology characterized 20 days later. Control sorted cells from primary VC recipients were blank but colonies were observed when cells were derived from the peripheral blood of either mouse reconstituted from reprogrammed B220 enriched cells expressing C7.
[00186] Figs. 56A-56C demonstrate that expression of defined factors in various populations can promote colony formation and altered lineage commitment in vitro. Various indicated populations were sorted from the bone marrow (Fig. 56A), spleen (Fig. 56B), thymus (Fig. 56C), and peripheral
blood (Fig. 56C) of mice. Populations include: B220+ (B); Macl+/Gr-1+ (M/G); CD3+/CD4+/CD8+ (T); NK1.1+ (NK); ProPreBCells as a control. In the case of peripheral blood (PB) B, T, and M/G was all sorted into one population. These populations were transduced with control (VC) or C7 viruses for 14 hours, dox added for 24 hours and then put into a CFC assay. Colonies were counted and morphology determined on day 20. Colony numbers with more than control levels in almost all cases. Indicating that transformation of committed blood cells into iHSC like cells could occur from multiple compartments and in multiple cell types.
[00187] Figs. 57A-57C demonstrate that expression of defined factors in human Jurkat cells can promote colony formation and altered lineage commitment in vitro. Fig. 57A. Human Jurkat cells were cultured and left untransduced, transduced with ZsGr control virus (VC) or with C6 for 14 hours. Doxycycline was added for 24 hours and cells were put in CFC assays. Colonies were counted and morphology determined on day 20. Only Jurkat cells transduced with C6 gave rise to colonies. Fig. 57B. Colonies that Jurkat cells transduced with C6 gave rise too are pictured. They included an erythroid like colony, granulocytes, and monocytes. Fig. 57C. To further distinguish the transformed cells, flow analysis for phenotypic markers including Terl 19, Macl, CD71, and Grl was performed on freshly cultured Jurkat cells and the Jurkat cell colonies observed when transduced with C6. Jurkat colonies that were transduced with C6 had apparent increases in immature erythroid cells (CD71+ Terl 19-), Granulocyte (Grl+ Macl+) and monocyte (Macl+) populations.
[00188] Figs. 58A-58E show identification of factors capable of imparting alternative lineage potential in vitro. (Fig. 58A) Heat map showing relative expression (green;high, to purple;low) of 36 regulatory genes identified as HSC-specific in the indicated cell types. (Fig. 58B) Schematic representation of lentivirus transgene expression cassette (top), and flow cytometry plots showing reporter cassette (ZsGr) expression in Pro/Pre B-cells +/- doxycycline induction (48 hours post). (Fig. 58C) Schematic representation of in vitro screening strategy for cell fate conversion. (Fig. 58D) Representative images of wells showing colonies arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 36-factor cocktail. (Fig. 58E) Colony number and type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 36-factor cocktail. Four independent experiments are shown and each condition performed in triplicate.
[00189] Figs. 59A-59G show identification of factors capable of imparting multi-lineage engraftment potential onto committed progenitors in vivo. (Fig. 59A) Schematic of experimental strategy to identify factors capable of imparting multi-lineage engraftment potential on committed progenitors in vivo. (Fig. 59B) Representative flow cytometry plots showing donor (CD45.2) reconstitution of mice transplanted with control (ZsGr) or 36-factor transduced Pro/Pre B cells or CMPs 16-weeks post-transplant. (Fig. 59C) Donor reconstitution of mice transplanted with ZsGr or
36-factor transduced Pro/Pre B cells or CMPs at indicated time points post-transplantation. Only mice with >1% donor chimerism (dotted line) were considered reconstituted. Recipients transplanted; Pro/PreB;ZsGr n=15, Pro/PreB;36-factor n=15, CMP;ZsGr n=8, and CMP;36-factor n=8. (Fig. 59D) Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor. (Fig. 59E) PCR analysis of immunoglobulin rearrangement showing heavy (JH), and light chain (JL¾., JLk) in bone marrow (BM) cells including B-cells (B220+), stem/progenitor (LSK) cells, myeloid progenitors (Myl Pro), and peripheral blood (PB) cells including B-cells (B220+), recipient myeloid cells (Macl+ Rec), and donor myeloid cells (Macl+ Donor) originating from Pro/Pre B cell;36-factor experiment. Loading control; genomic PCR for CD45. (Fig. 59F) PCR-based strategy to identify virally integrated factors and discriminate from endogenous genes. (Fig. 59G) Summary of data showing presence (gray) or absence (black) of each of the indicated factors in donor B-, T-, and myeloid cells in each of the reconstituted mice shown in (Fig. 59C).
[00190] Figs. 60A-60G show transient ectopic expression of six transcription factors in committed progenitors is sufficient to alter lineage potential in vitro and impart long-term engraftment potential on committed progenitors in vivo. (Fig. 60A) Representative images of wells showing colonies arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 6-TF cocktail. (Fig. 60B) Colony number and indicated colony type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr or 6-TF cocktail. 3 independent experiments are shown with each condition performed in triplicate. (Fig. 60C) Colony number and type arising in methylcellulose from Pro/Pre B cells transduced with ZsGr, 6-TF cocktail, or 6-TF minus the indicated factor. Each condition performed in triplicate. (Fig. 60D) Donor reconstitution of mice transplanted with ZsGr or 6-TF transduced Pro/Pre B cells or CMPs at indicated time points post-transplantation. Only mice with >1% donor chimerism (dotted line) were considered reconstituted. Recipients transplanted;
Pro/PreB;ZsGr n=10, Pro/PreB;6-TF n=12, CMP;ZsGr n=9, and CMP;6-TF n=9. (Fig. 60E)
Representative flow cytometry plots showing donor reconstitution and lineage composition of mice transplanted with control (ZsGr) or 6-TF transduced Pro/Pre B cells or CMPs 16-weeks post- transplant. Lineage contribution to Macl+ myeloid cells, B220+ B-cells, and CD3/4/8+ T-cells is shown. (Fig. 60F) Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor. (Fig. 60G) PCR analysis of immunoglobulin heavy (JH) chain rearrangement in recipient myeloid cells (Macl+ Rec), and donor myeloid cells (Macl+ Donor) originating from Pro/Pre B cell;6-TF experiment. Loading control; genomic PCR for CD45.
[00191] Figs. 61A-61E show inclusion of Meisl and Mycn and use of polycistronic viruses improves in vivo reprogramming efficiency. (Fig. 61A) Schematic representation of RHL (Runxtltl, Hlf, Lmo2) and PZP (Pbxl, Zfp37, Prdm5) polycistronic, and Meisl and Mycn single factor viral constructs. (Fig. 61B) Donor reconstitution of mice transplanted with ZsGr, 8-TF (8 single factor viruses), or 8-TFPoly (RHL, PZP polycistronic viruses plus Meisl and Mycn viruses), transduced Pro/Pre B cells at indicated time points post-transplantation. Only mice with >1% donor chimerism were considered reconstituted. Recipients transplanted; ZsGr; n=12, 8-TF; n=6, 8TFPoly; n=14. (Fig. 61 C) Representative flow cytometry plots showing donor reconstitution and lineage contribution of mice transplanted with control (ZsGr), 8-TF, or 8TFPoly transduced Pro/Pre B cells 16-weeks post- transplant. Lineage contribution to Macl+GRl- myeloid cells, Mac+GR1+ granulocytes, B220+ B- cells, and CD3/4/8+ T-cells is shown. (Fig. 61D) Reconstitution of indicated peripheral blood cell lineages of individual recipients showing >1% donor chimerism presented as % of donor. (Fig. 61E) PCR analysis of immunoglobulin heavy (JH) chain rearrangement in recipient (Recip), and donor (Donor) myeloid cells. Loading control; genomic PCR for CD45.
[00192] Figs. 62A-62I shows reprogrammed cells engraft secondary hematopoietic organs, bone marrow progenitor compartments and reconstitute secondary recipients. (Fig. 62A) Donor reconstitution of peripheral blood (PB), bone marrow (BM), spleen, and thymus of mice transplanted with 8-TF, or 8-TFPoly transduced Pro/Pre B cells 18-20 weeks post-transplantation. (Fig. 62B) PCR analysis of immunoglobulin heavy (JH) chain rearrangement in recipient (R), and donor (D) cells. Cell types analyzed include Macl+ myeloid cells (M), Macl+GR1+ granulocytes (G), and T-cells (T). Loading control; genomic PCR for CD45. (Fig. 62C) Representative bone marrow stem and progenitor analysis of a recipient transplanted with 8-TFPoly transduced Pro/Pre B cells 18-weeks post-transplantation showing donor-reconstitution of myeloid progenitors (Myl Pro),
megarkaryocyte/erythrocyte progenitors (MEP), granulocyte/monocyte progenitors (GMP), common myeloid progenitors (CMP), megakaryocyte progenitors (MkP), erythroid progenitors (EP), common lymphoid progenitors (CLP), Lineage -negative Seal +ckit+ multipotent progenitors (LSK), multipotent progenitors (MPPl, MPP2), and hematopoietic stem cells (HSC). All cells were pre -gated through doublet-discriminated, live (propidium iodide negative), and lineage negative cells. (Fig. 62D) Total donor reconstitution of the indicated populations in mice analyzed in (Fig. 62A). (Figs. 62E-62F) Reconstitution of the indicated myeloid progenitor (E) and primitive multi-potent and stem cell (F) populations in mice analyzed in (A) presented as percentage of donor. (Fig. 62G) PCR analysis of immunoglobulin heavy (JH) chain rearrangement in the indicated recipient and donor populations. Loading control; genomic PCR for CD45. (Fig. 62H) Donor reconstitution of secondary recipient mice transplanted with whole bone marrow (WBM) or c-Kit positive bone marrow cells
derived from primary transplants of 8-TF transduced Pro/Pre B cells analyzed at 12 and 8 weeks respectively. Number of recipients transplanted; WBM; n=5, c-Kit+; n=4. (Fig. 621) Reconstitution of indicated peripheral blood cell lineages of individual recipients presented as % of donor.
[00193] Figs. 63A-63H show transient expression of defined transcription factors in myeloid effector cells is sufficient instill them with progenitor activity in vitro, and long-term multi-lineage transplantation potential in vivo. (Fig. 63A) Schematic representation of experimental strategy for assaying the colony forming potential of 8-TF transduced peripheral blood cells. (Fig. 63B) Colony number and type arising in methylcellulose from peripheral blood cells from recipient (left-most lanes) or donor cells derived from a recipient transplanted with Pro/Pre B cells transduced with 8-TF or 8-TFPoly cocktail, plus (+) or minus (-) exposure to doxycycline. Results from individual mouse performed in triplicate are shown. (Fig. 63C) Colony number and type arising in methylcellulose from plated granulocytes, macrophages/monocytes (Myl), B-cells, and T-cells purified from the peripheral blood of cells pooled recipients transplanted with Pro/Pre B cells transduced with 8-TFPoly cocktail plus (+) or minus (-) exposure to doxycycline. (Fig. 63D) Representative colony types and cytospins stained with May Grunwald of colonies derived in (Fig. 63C). (Fig. 63E) Donor reconstitution of mice transplanted with ZsGr, 6-TFPoly, 8-TF or 8-TFPoly transduced Macl+cKit- myeloid effector cells at indicated time points post-transplantation. Only mice with >1% donor chimerism were considered reconstituted. Recipients transplanted; ZsGr; n=6, 6-TFPoly; n=7, 8-TF; n=6, and 8-TFPoly; n=8. (Fig. 63F) Reconstitution of indicated peripheral blood cell lineages of mice showing >1% donor chimerism presented as % of donor. (Fig. 63G) Donor reconstitution 12 weeks post-transplant of secondary recipient mice transplanted non-competitively with 5x106 donor-derived (CD45.2+) bone marrow cells derived from primary recipients of 6-TFPoly, 8-TF or 8-TFPoly transduced Macl+cKit- myeloid effector cells. Cells from individual primary donor mice (indicated by ID) were transplanted into N=5 secondary recipients each. (Fig. 63H) Average reconstitution of indicated peripheral blood cell lineages presented as % of donor. N=5 recipients per group.
[00194] Figs. 64A-64D shows iHSCs reprogrammed via 8 transcription factors closely resemble endogenous HSCs at the molecular level. Fig. 64A shows phenotypic HSCs (doublet discriminated, live, lineage negative, c-kit+, Scal+, CD34-,flk2-and CD 150+) were FACS sorted from the bone marrow of mice reconstituted with Pro/Pre B cells transduced with 8-TF (Mouse # 1) and 8-TF POLY (Mouse # 10) viral cocktails. Cells were single cell sorted into 96 well plates and analyzed by qPCR for an array of transcription factors. Expression levels of individual cells were projected onto a three-dimensional space using principle component analysis. Recipient HSCs (HSC Host) and iHSCs derived from Pro/Pre B cells transduced with 8-TF (iHSC 8-TF) or 8-TF Poly (iHSC 8-TF Poly) were displayed with previously profiled and phenotypically characterized progenitor cells:
HSC, MPP, CMP, GMP, MEP and CLP. Additionally, Pro/Pre B Cells were added as a control cell type. Figs. 64B-C shows phenotypic HSCs isolated from bone marrow reconstituted from Pro/Pre B cells transduced with 8-TF (iHSC 8-TF) and 8-TFPoly (iHSC 8-TFPoly) were then hierarchally clustered with respect to the qPCR transcription factor array. Each leaf of the dendrogram represents a single cell as indicated in the legend in panel A. Fig. 64D shows analysis of indicated genes are shown for: phenotypic control HSCs (HSC), transplanted host HSCs (HSC host), iHSCs derived from Pro/Pre B Cells transduced with 8-TF (iHSC 8-TF) and 8-TF POLY (iHSC 8-TFPoly) and control Pro/Pre B Cells. Heat maps for expression levels in the indicated cell types are shown (high expression was visualized as red; low expression was visualized as blue). Violin plots show distribution patterns of each of the above transcription factors in one cell type. Expression level is on the y-axis.
[00195] Figs. 65A-65B show a sorting strategy for Pro/Pre B cells (Fig. 65A) and CMPs (Fig.
65B) from the bone marrow of rtTA transgenic mice. Doublet discriminated and PI negative cells were pre-gated and Pro/Pre B Cells were gated as indicated: B220+ CD19+, AA4.1+ and IgM-. Fig. 65B shows doublet discriminated and PI negative cells were pre-gated and CMPs were gated as indicated: Lineage negative (Grl-, Macl-, B220-, CD3-, CD4-, CD8-, Terl l9-), c-kit+, Seal-, FcDR3MID, and CD34+.
[00196] Fig. 66 shows Pro/Pre B cells and CMPs were transduced with the viral cocktail of
36-TFs. Dox is added after 16hours for a period of 48 hours before cells were transferred to methylcellulose. 20 days later colonies were counted and characterized by morphology as indicated in Figs. 59A-59G. Colonies were collected and DNA isolated. Identification of plasmid integration was performed as indicated in Figs. 60A-60G for each of the 36 factors listed. Expression of the factors was clustered by the highest expression in GEMMs.
[00197] Fig. 67 shows Macl+ bone marrow cells were isolated from transgenic rtTA mice.
Cells were transduced for 16 hours with RHL + PZP (6-TF POLY), Runxltl + Hlf + Lmo2 + Pbxl + Zfp37 + Prdm5 + Mycn + Meisl (8-TF) and RHL + PZP + Mycn + Meisl (8-TF POLY). Dox was added in culture for 24 hours and 5.0 x 106 cells were transplanted into conditioned hosts with lxlO5 Seal depleted support cells. Peripheral blood analysis was performed at 6 weeks. Representative flow demonstrating CD45.1+ (donor) gating from peripheral bleeds at 16 weeks is shown for each group.
[00198] Figs. 68A-68D show Macl+ bone marrow cells were FACS sorted, transduced with
ZsGr control, 6-TF, 8-TF, or 8-TF POLY viruses. (Fig. 68A) Transplantation was done as indicated and 18 weeks post transplantation bone marrow, spleen, thymus, and peripheral blood was harvested from mice with peripheral blood reconstitution > 5.0%. Donor contributions are shown graphically in the peripheral blood (PB), bone marrow (BM), spleen and thymus for a 6-TF POLY mouse, 8-TF mouse and four 8-TF POLY mice. The y-axis break marks 1.0 % donor reconstitution. Fig. 68B
shows the composition break down for donor-derived cells in the bone marrow, spleen, and thymus. B cells (B), Granulocytes (G), Myeloid (M) and T Cells (T) were phenotypically defined as previously described. Fig. 68C shows the % donor of each of the progenitor compartments was calculated by gating as previously shown but last through donor. Quantitation of these results is shown for mice reconstituted from Macl+ bone marrow cells transduced with 6-TF POLY (1 mouse), 8-TF (1 mouse) and 8-TF POLY (4 mice). A break indicates a 1.0% donor composition. Fig. 68D shows compositional breakdown of the Hematopoietic progenitor compartment for each mouse reconstituted from Macl+ bone marrow cells transduced with 6-TF POLY (1 mouse), 8-TF (1 mouse) and 8-TF POLY (4 mice). Populations were gated first by donor and then by previously defined phenotypic markers.
[00199] Fig. 69 shows phenotypic HSCs (doublet discriminated, live, lineage negative, c-kit+,
Scal+, CD34-,flk2-and CD 150+) were FACS sorted from the bone marrow of mice reconstituted with Pro/Pre B cells transduced with 8-TF and 8-TF POLY viral cocktails. Cells were single cell sorted into 96 well plates and analyzed by qPCR for an array of transcription factors. A heat map displays transcription factor expression (columns) for indicated cell types (rows), including: previously profiled and phenotypically sorted progenitor control cell types (HSC, MPP, MEP, CMP, GMP, CLP), control Pro/Pre B cells, recipient derived HSCs (Host HSC), and iHSC cells isolated from mice reconstituted from Pro/Pre B Cells transduced with viral mixtures of 8-TF (iHSC 8-TF) and 8-TF POLY (iHSC 8-TF POLY). High expression was visualized as red; Low Expression was visualized as blue.
[00200] Figs. 70A-70H shows reprogramming terminally differentiated myeloid cells to engraftable HSC-like cells. (Fig. 70A) Schematic for secondary reprograming experiments.
Peripheral blood post 16 weeks from mice reconstituted from ProPre B Cells transduced with viral mixes of 8-TFs were isolated. Peripheral blood cells, FACS sorted CD45.1+ (donor) or further purified on magnetic columns for B220+ (B Cells), Macl+ (Myl), Gran (Macl+ Grl+) and T cells (CD3+). Cells were then plated into F12 media in the presence or absence of dox. Three days post dox administration, cells are transferred into methylcellulose. Colonies are counted and scored 20 days later. (Fig. 70B) Mice reconstituted with ProPre B Cells transduced with the viral cocktail 8-TF or 8-TF POLY were bled at 16-20 weeks and CD45.1+ (donor) and CD45.2+ (Recipient) cells were FACS sorted (8-TF) or unsorted (8-TF POLY), plated into F12 media in the presence/absence of dox for 3 days, transferred into methylcellulose, and counted/scored on day 20. Quantitation of the colony number and composition is shown for cells in the presence and absence of dox. Each column represents one or three replicates per mouse. A representative GEMM colony and GM (Granulocyte- Myeloid) colony are shown to the right for donor sorted cells in the presence of dox. (Fig. 70C) Mice
reconstituted with ProPre B Cells transduced with 8-TF POLY were bled at 16 weeks and CD45.1+ (donor) and CD45.2+ (recipient) cells were pooled, further enriched using magnentic columns for B220+ (B Cells), Macl+ (Myl), Macl+ Grl+ (Gran) and CD3+ (T Cells). Cell populations were plated into F12 media in the presence/absence of dox for 3 days, transferred to methylcellulose, and counted/scored on day 20. Quantitation of the colony number and composition is shown for cells in the presence and absence of dox. (Fig. 70D) Representative 1 Ox views of colonies [GEMM, GM, Granulocyte (G) and Myeloid (M)] derived from donor cells are shown. Cytospins were performed on each colony and showen to the right with prominent cell types labeled. (Fig. 70E) Macl+ bone marrow cells were isolated from transgenic rtTA mice. Cells were transduced for 16 hours with RHL + PZP (6-TF POLY), Runxltl + Hlf + Lmo2 + Pbxl + Zfp37 + Prdm5 + Mycn + Meisl (8-TF) and RHL + PZP + Mycn + Meisl (8-TF POLY). Dox was added in culture for 24 hours and 5.0 x 106 cells were transplanted into conditioned hosts with lxlO5 Seal depleted support cells. Peripheral blood analysis was performed at 4, 8,12 and 16 weeks; donor contributions are summarized in the graph. Each circle represents a mouse and the 1% donor chimerism mark is represented by an axis break. (Fig. 70F) Composition of mice reconstituted over 1% are shown and broken into B cell, myeloid, granulocyte, and T cell as previously defined. (Fig. 70G) Secondary transplantation was performed by euthanizing and harvesting bone marrow from primary mice with donor reconstitutions over 5%. Five million FACS sorted donor (CD45.2+) whole bone marrow cells were transplanted non-competitively into five recipient pre-conditioned mice. Peripheral blood chimerism at 16 weeks is shown for each secondary recipient (each circle). (Fig. 70H) The average composition of the donor- derived cells in the secondary transplant was calculated and graphically represented for 16 week bleed data.
[00201] Figs. 71A-71B show donor-derived bone marrow, originating from transformed
Pro/Pre B-Cells, was isolated from two primary reconstituting animals and one secondary animal. B220+ (B-Cells), CD3+ (T-Cells), Macl+Grl- (Myeloid) and Macl+Grl+ (Gran) cells were FACS sorted. VDJ analysis was performed on each of the lineages, similar size bands were selected and individual VDJ amplicons were sequenced to obtain information on individual recombination events in each of the lineages. Sequence data is show for each of the indicated donors/cell types. Using IgBlast (http://www.ncbi.nlm.nih.gov/igblast/) VDJ recombinational events were identified (VDJ ID) and listed according to the VH, DH or JH segment to which the sequence corresponds. (Fig. 71A) Sequences for Donor P-l are disclosed as SEQ ID NOS 168-169, 168-169, 176, 176, 176, 176, 181, 181, 181 and 181 read from columns left to right. Sequences for Donor l°-8 are disclosed as SEQ ID NOS 170, 170, 170, 170, 177, 177, 177, 177, 182, 182, 182 and 182 read from columns left to right.
(Fig. 71B) Sequences for Donor 2°-l are disclosed as SEQ ID NOS 168, 168, 168, 171-175, 176, 176, 176, 178-180, 180, 183, 183, 183-185, 185-186 and 186 read from columns left to right.
[00202] Figs. 72A-72C Donor-derived MEP cells (Live, Lin-, c-kit+, Seal-, CD34-, FcgR3-) were FACS sorted from the bone marrow of a primary recipient reconstituted from a transformed Pro/Pre B-Cell (Mouse ID 6). MEP cells were transplanted into three irradiated recipients (50,000 cells/recipient). Controls were irradiated but not transplanted. (Fig. 72A) The survival of these mice is indicated graphically over time post transplant. At day 20 post transplant the peripheral blood of the remaining mice was tested for red blood cell counts (RBC Counts, Fig. 72B) and platelet numbers (Platelet Counts, Fig. 72C).
DETAILED DESCRIPTION
[00203] Provided herein are compositions, nucleic acid constructs, methods and kits thereof for hematopoietic stem cell induction or reprogramming cells to the hematopoietic stem cell multipotent state, based, in part, on the discoveries described herein of novel combinations of transcription factors that permit dedifferentiation and reprogramming of more differentiated cells the hematopoietic stem cell state. Such compositions, nucleic acid constructs, methods and kits can be used for inducing hematopoietic stem cells in vitro, ex vivo, or in vivo, and these induced
hematopoietic stem cell can be used in regenerative medicine applications.
[00204] Hematopoietic stem cells (HSCs) are among the best-characterized and most experimentally tractable tissue-specific stem cells. HSCs reside at the top of hematopoietic hierarchy and give rise to a large repertoire of highly specialized effector cells by differentiating through a succession of increasingly committed downstream progenitor cells (Fig. 1). HSCs are the only cells in the hematopoietic system that possess the ability to both differentiate to all blood lineages and to self- renew for life. These properties, along with the ability of HSCs to engraft conditioned recipients upon intravenous transplantation, have established the clinical paradigm for stem cell use in regenerative medicine. Allogeneic and autologous HSC transplantation are routinely used in the treatment of patients with a variety of life-threatening disorders. Despite wide clinical use, HSC transplantation remains a high-risk procedure, with the number of stem cells available for transplantation being the strongest predictor of transplantation success. Although stem cell mobilization with G-CSF alone, or in combination with other drugs, increases the yield of hematopoietic stem cells for transplantation, an ability to induce, expand, or generate patient-specific HSCs de novo, as described herein, could be useful in a number of clinical settings, or be used to model hematopoietic diseases ex vivo or in xenotransplantation models.
[00205] The developmental process by which differentiated cell types arise from more primitive progenitor cells is guided in part by progressive epigenetic changes. In general, lineage
specification is unidirectional and irreversible with differentiated cell types, and even intermediate progenitors, being remarkably fixed with respect to their cellular identity and developmental potential. Studies by Gurdon and others have demonstrated that the process of differentiation can be reversed in experiments that showed that the nuclei of differentiated cell types could be reprogrammed to totipotency when exposed to the primitive cellular milieu of enucleated oocytes. This process, known as "somatic cell nuclear transfer," was subsequently shown to be capable of reprogramming nuclei from differentiated mammalian cells back to pluripotency. That ectopic expression of defined transcription factors was sufficient to convert cell fate was first shown in 1987 with the demonstration that enforced expression of MyoD could reprogram fibroblasts to the myogenic lineage. Enormous progress in this field has been made over the past 40 years culminating with the striking
demonstration by Yamanaka and colleagues that ectopic expression of four transcription factors (c- Myc, Oct4, Klf4, Sox2, the so-called "Yamanaka factors") also described in e.g., US7964401 ;
US8048999; US8058065; US8129187; US8211697, can reprogram adult fibroblasts from mice and man into cells, termed iPS (induced pluripotent stem) cells, that possess the developmental potential of embryonic stem (ES) cells. These discoveries opened the possibility of generating patient-specific pluripotent cells from abundant somatic cells that could be used to model disease, or for autologous cell replacement therapies.
[00206] However, these factors do not replicate this process if the starting cell is a cell from hematopoietic lineage.
[00207] Despite their enormous promise, significant hurdles must be overcome before iPS- based cell therapies enter the clinic. It must also be recognized that iPS cells cannot be directly used clinically, since - as is the case with ES cells - useful cell types must first be generated by directed differentiation.
[00208] Thus, alternative approaches, in which abundant cell types are directly reprogrammed to alternative fates without first returning to a pluripotent state, as described herein for making induced HSCs, can be a more direct and efficient way to generate clinically useful cell types. For example, a recent report using OCT4 in combination with hematopoietic cytokines also showed that it was possible to generate myeloid lineage hematopoietic cells (though not HSCs) from human fibroblasts.
[00209] Differentiation of HSCs to fully differentiated blood cells is believed to be an irreversible process under normal physiological conditions. Hematopoietic lineage specification takes place within the bounds of strict lineal relationships: for example, megakaryocyte progenitors give rise to megakaryocytes and ultimately platelets, but not to any other blood lineages. Some studies,
however, have demonstrated that hematopoietic cells are amenable to reprogramming to alternative fates under experimental manipulation.
[00210] Within the hematopoietic system, the most clinically useful cell type to strive to generate by reprogramming are HSCs, as they are the only cells which possess the potential to generate all blood cell types over a lifetime, and transplantation protocols for their clinical use are already established. To date, no reports describing the generation of HSCs by reprogramming have been published because the the factor(s) needed to reprogram to HSCs have not yet been determined. This point is central to the experimental rationale and strategies described herein, which were designed to first identify and clone transcriptional activators important for specifying HSC fate and function, and then utilize such factors to reprogram committed blood cells back to an induced HSC fate (Fig. 2), as demonstrated herein.
[00211] Hematopoietic tissues contain cells with long-term and short-term regeneration capacities, and committed multipotent, oligopotent, and unipotent progenitors. Endogenous HSCs can be can be found in a variety of tissue sources, such as the bone marrow of adults, which includes femurs, hip, ribs, sternum, and other bones, as well as umbilical cord blood and placenta, and mobilized peripheral blood. Endogenous HSCs can be obtained directly by removal from, for example, the hip, using a needle and syringe, or from the blood following pre-treatment with cytokines, such as G-CSF (granulocyte colony-stimulating factors), that induce cells to be released from the bone marrow compartment. However, such methods yield varying amounts of HSCs, which are oftentimes not enough for use in treatment options.
[00212] Accordingly, "hematopoietic stem cells," or "HSCs," as the terms are used herein, encompass all multipotent cells capable of differentiating into all the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T-cells, B-cells, NKT-cells, NK-cells), and which have multi-lineage
hematopoietic differentiation potential and sustained self-renewal activity.
[00213] The term "stem cells," as used herein, refer to cells that retain the ability to renew themselves through mitotic cell division and can differentiate into a diverse range of specialized cell types. The two broad types of mammalian stem cells are: embryonic stem (ES) cells that are found in blastocysts, and adult stem cells that are found in adult tissues. In a developing embryo, stem cells can differentiate into all of the specialized embryonic tissues. In adult organisms, stem cells and progenitor cells act as a repair system for the body, replenishing specialized cells, but also maintain the normal turnover of regenerative organs, such as blood, skin or intestinal tissues. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.
[00214] Stem cells are generally classified by their developmental potential as: (1)
"totipotent," meaning able to give rise to all embryonic and extraembryonic cell types; (2)
"pluripotent," meaning able to give rise to all embryonic cell types; (3) "multipotent," meaning able to give rise to a subset of cell lineages, but all within a particular tissue, organ, or physiological system (for example, hematopoietic stem cells (HSCs) can produce progeny that include HSCs (self- renewal), blood cell restricted oligopotent progenitors and the cell types and elements (e.g., platelets) that are normal components of the blood); (4) "oligopotent," meaning able to give rise to a more restricted subset of cell lineages than multipotent stem cells; and (5) "unipotent," meaning able to give rise to a single cell lineage (e.g., spermatogenic stem cells).
[00215] "Self-renewal" refers to the ability of a cell to divide and generate at least one daughter cell with the identical (e.g., self-renewing) characteristics of the parent cell. The second daughter cell may commit to a particular differentiation pathway. For example, a self-renewing hematopoietic stem cell divides and forms one daughter stem cell and another daughter cell committed to differentiation in the myeloid or lymphoid pathway. In contrast, a committed progenitor cell has typically lost the self-renewal capacity, and upon cell division produces two daughter cells that display a more differentiated (i.e., restricted) phenotype. True hematopoietic stem cells have the ability to regenerate long term multi-lineage hematopoiesis (e.g., "long-term engraftment") in individuals receiving a bone marrow or umbilical cord blood transplant, as described herein.
[00216] Hematopoietic stem cells are traditionally identified as being lineage marker negative,
Seal -positive, cKit-positive (or LSK cells), CD34-negative, Flk2 -negative, CD48 -negative, and CD 150 positive. HSCs give rise to "multipotent progenitor cells" or "hematopoietic progenitor cells," which, as the terms are used herein, refer to a more differentiated subset of multipotent stem cells that while committed to the hematopoietic cell lineage generally do not self-renew. The terms
"hematopoietic progenitor cells" or "multi-potent progenitor cells" (MPPs) encompass short term hematopoietic stem cells (also known as ST-HSCs, which are lineage marker negative, Seal -positive, cKit-positive, CD34-positive, and Flk2 -negative); common myeloid progenitor cells (CMPs);
lymphoid-primed progenitor cells (LMPPs), granulocyte-monocyte progenitor cells (GMPs), and megakaryocyte-erythrocyte progenitor cells (MEPs). Hematopoietic stem cells subsets are sometimes also identified and discriminated on the basis of additional cell-surface marker phenotypes, such as by using combinations of members of the SLAM family, or the "SLAM phenotype," such as, long-term multi-lineage repopulating and self-renewing hematopoietic stem cells (HSCs): CD150 CD48 CD244" ; MPPs : CD150 CD48 CD244+; lineage-restricted progenitor cells (LRPs) : CD150 CD48+CD244+; common myeloid progenitor cells (CMP): lm SCA-l~c-kit+CD34+CD16/32mid; granulocyte-
macrophage progenitor (GMP): lin SCA-l c-kit CD34 CD16/32 and megakaryocyte-erythroid progenitor (MEP): lm SCA-l c-kit+CD34+CD16/32low.
[00217] Accordingly, using the compositions, constructs, methods, and kits comprising the
HSC reprogramming factors or HSC inducing factors described herein, induced hematopoietic stem cells or iHSCs can be generated that are multipotent and capable of differentiating into all the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells
(monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes,
megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T -cells, B-cells, NKT-cells, NK- cells), and which have multi-lineage hematopoietic differentiation potential and sustained self-renewal activity. In some embodiments of the compositions, constructs, methods, and kits comprising the HSC reprogramming factors or HSC inducing factors described herein, cells are dedifferentiated into one or more other hematopoietic progenitor cells types, such as short term hematopoietic stem cells, common myeloid progenitor cells, common lymphoid progenitor cells, lymphoid-primed progenitor cells, granulocyte -monocyte progenitor cells, and megakaryocyte-erythrocyte progenitor cells.
[00218] The successful identification of HSC inducing factors capable of reprogramming committed blood cells to induced HSCs, as described herein, can advance our basic understanding of HSC biology in a number of ways. Despite the fact that HSCs are the most well characterized tissue- specific stem cells, surprisingly little is known about the molecular mechanisms involved in regulating their central properties of self-renewal and multi-potency. Identification of factors capable of imparting self-renewal and multi-lineage potential onto otherwise non-self-renewing, lineage- restricted cells, as described herein, provide important insights into the molecular basis of these fundamental attributes and provide strategies on how best to therapeutically manipulate HSCs.
Further, mature blood cell production is an ongoing process requiring profound homeostatic control mechanisms— the primary level of which resides with HSCs. Since hematopoietic malignancies arise through deregulation of homeostatic control mechanisms, identification of regulators responsible for specifying HSC function, such as the HSC inducing factors described herein, can also provide important insights into how homeostasis is regulated by stem cells, and in turn, how deregulation of such processes manifest in disease. Functional conservation of reprogramming factors between species is well-documented indicating that it the methods and compositions described herein are applicable for reprogramming human blood cells to induced HSCs, using homologues of the murine reprogramming factors described herein. The ability to derive functional human induced HSCs in such a manner represents a new experimental paradigm for deriving these important cells that can be translated clinically, or used to model hematopoietic diseases. Because one mechanism in which lineage specification has been shown to occur is by the active suppression of alternative fates, by
identifying factors involved in re-establishing core HSC properties, factors that function by suppressing differentiation programs can also be identified. If so, identification of such factors could provide fundamental insights into hematopoietic lineage specification. Transcription factors play a critical role in the specification of all cell types during development. The success of reprogramming strategies using transcription factor-mediated de-differentiation of cells indicates that it is equally plausible to direct the differentiation of pluripotent ES/iPS cells to specific fates using such factors. Accordingly, using the HSC inducing factors identified herein, directed differentiation of ES/iPS cells to a definitive HSC fate by expression of the HSC-enriched transcription factors can be achieved.
[00219] The combinatorial introduction of HSC-enriched TFs into downstream progenitors and screening for the introduction of stem cell properties onto these committed cells in vivo has identified a core set of TFs, referred to herein as "HSC inducing factors" or "HSC reprogramming factors" able to mediate the reprogramming of committed cells back to an induced hematopoietic stem cell (iHSC) state. With the approaches described herein, advantage can be taken of the fact that HSCs are the only cells in the hematopoietic system capable of giving rise to long-term (>4 months) multi- lineage reconstitution in transplantation assays, whereas committed progenitors reconstitute recipient mice only transiently with restricted lineage potential depending upon their stage of differentiation . Only progenitors that have been successfully reprogrammed to an induced hematopoietic stem cell state are able to give rise to long-term multi-lineage reconstitution in transplant recipients, using the compositions, methods, and kits described herein.
[00220] To realize the goal of identifying transcription factors specifically expressed in HSCs within the hematopoietic system, a comprehensive system-wide approach was undertaken in which expression profiles of 40 FACS purified hematopoietic cell types, representing the vast majority of hematopoietic stem, progenitor and effector cells, were generated and compiled (Fig. 1). Since the success of the results described herein require a detailed knowledge of the molecular attributes of HSCs, the focus has been on defining these by expression profiling of purified HSCs from diverse settings ranging from steady state hematopoiesis through different stages of ontogeny (fetal development through to old age). Throughout the work described herein, HSCs are fluorescence activated cell sorted (FACS) purified by stringent cell surface phenotype, and defined through functional criteria (Figs. 1-2). In total, 46 expression profiles for HSCs were generated, which lends enormous statistical power to the analyses described herein. In total, 248 expression profiles of hematopoietic populations have been generated and normalized into a single database (referred to as the "hematopoietic expression database") (Fig. 3).
[00221] Using the databases described herein, transcriptional factors (TFs) with HSC-enriched expression have been identified. In some embodiments of the aspects described herein, in addition to
the factors with strict HSC-enriched expression, TFs involved in specifying hematopoietic fate during fetal development such as SCL/TAL1, RUNX1, HOXB4, and LM02, can be used as HSC inducing factors, even though they do not exhibit particularly HSC-specific expression in the adult. In total, as described herein, over 40 TFs that can be used in various combinations as "HSC inducing factors," as the term is used herein, have been identified and the expression profiles of each have been confirmed by qRT-PCR.
[00222] The production of cells having an increased developmental potential (e.g., iHSCs) is generally achieved by the introduction of nucleic acid sequences encoding genes identified herein as "HSC inducing factors" into an adult, somatic cell, preferably, in some embodiments, a more differentiated cell of the hematopoietic lineage. Typically, nucleic acids encoding the HSC inducing factors, e.g., DNA or RNA, or constructs thereof, are introduced into a cell, using viral vectors or without viral vectors, via one or repeated transfections, and the expression of the gene products and/or translation of the RNA molecules result in cells that are morphologically, biochemically, and functionally similar to HSCs, as described herein. As used herein, "reprogramming" refers to a process of driving a cell to a state with higher developmental potential, i.e., backwards, to a less differentiated state. In some embodiments of the compositions, methods, and kits described herein, reprogramming encompasses a complete or partial reversion of the differentiation state to that of a cell having a multipotent state. In some embodiments of the compositions, methods, and kits described herein, reprogramming encompasses a complete or partial reversion of the differentiation state to that of a cell having the state of a hematopoietic progenitor cell, such as a CMP, a CLP, etc. The hematopoietic stem cells induced by the compositions, methods, and kits described herein are termed herein as "induced hematopoietic stem cells," "iHS cells," or "iHSCs." Compositions comprising amino acid or nucleic acid sequences or expression vectors thereof encoding these HSC inducing factors are referred to herein as "HSC inducing compositions."
[00223] As demonstrated herein, over 40 transcription factors were identified that can be introduced into a cell in various combinations as "HSC inducing factors" to generate induced hematopoietic stem cells or iHSCs that are multipotent and capable of differentiating into all or a majority the blood or immune cell types of the hematopoietic system, including, but not limited to, myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T -cells, B-cells, NKT-cells, NK- cells), and which have multi-lineage hematopoietic differentiation potential and sustained self-renewal activity. Thus, provided herein, in some aspects, are HSC inducing factors and combinations thereof comprising the genes listed in Table 1 , which also provides exemplary sequences for making the identified proteins:
Table 1: HSC Inducing Factors
NDN NM 004538.5 SEQ ID NO: 26 NM 010882.3 SEQ ID NO: 72
NFIX NM 001271044. SEQ ID NO: 27 SEQ ID NO: 73
NM 001081981.1
1
NKX2-3 NM 145285.2 SEQ ID NO: 28 NM 008699.2 SEQ ID NO: 74
NR3C2 NM 000901.4 SEQ ID NO: 29 NM 001083906.1 SEQ ID NO: 75
PBX1 NM 001204961. SEQ ID NO: 30 SEQ ID NO: 76
NM 008783.2
1
PRDM16 NM 199454.2 SEQ ID NO: 31 NM 001177995.1 SEQ ID NO: 77
PRDM5 NM 018699.2 SEQ ID NO: 32 NM 027547.2 SEQ ID NO: 78
RARB NM 000965.3 SEQ ID NO: 33 NM 01 1243.1 SEQ ID NO: 79
RBBP6 NM 006910.4 SEQ ID NO: 34 NM 011247.2 SEQ ID NO: 80
RBPMS NM 001008712. SEQ ID NO: 35 SEQ ID NO: 81
NM 019733.2
I
RUNX1 NM 001001890. SEQ ID NO: 36 SEQ ID NO: 82
NM 0011 1 1021.1
?
RUNX1T NM 001198625. SEQ ID NO: 37 SEQ ID NO: 83
NM 009822.2
1 I
SMAD6 NM 001142861. SEQ ID NO: 38 SEQ ID NO: 84
NM 008542.3
2
TALI NM 003189.2 SEQ ID NO: 39 NM 011527.2 SEQ ID NO: 85
TCF15 NM 004609.3 SEQ ID NO: 40 NM 009328.2 SEQ ID NO: 86
VDR NM 000376.2 SEQ ID NO: 41 NM 009504.4 SEQ ID NO: 87
ZFP37 NM 003408.1 SEQ ID NO: 42 NM 009554.3 SEQ ID NO: 88
ZFP467 NM 207336.1 SEQ ID NO: 43 NM 001085415.1 SEQ ID NO: 89
ZFP521 NM 015461.2 SEQ ID NO: 44 NM 145492.4 SEQ ID NO: 90
ZFP532 NM 018181.4 SEQ ID NO: 45 NM 207255.2 SEQ ID NO: 91
ZFP612 NM 145911.1 SEQ ID NO: 46 NM 175480.4 SEQ ID NO: 92
[00224] In some embodiments, polypeptide variants or family members having the same or a similar activity as the reference polypeptide encoded by the sequences provided in Table 1 can be used in the compositions, methods, and kits described herein. Generally, variants of a particular polypeptide encoding a HSC inducing factor for use in the compositions, methods, and kits described
herein will have at least about 75%, at least about 80%, at least about 85%, at least about 90%>, at least about 91%), at least about 92%, at least about 93%, at least about 94%, at least about 95%>,at least about 96%), at least about 97%, at least about 98%, at least about 99% or more sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
[00225] Accordingly, in some embodiments, the HSC inducing factors for use in the compositions, methods, and kits described herein, are selected from the group consisting of:
CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBX1, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612 (SEQ ID NOs: 1-46).
[00226] As demonstrated herein, for example at Fig. 11 , exposure to 18 transcription factors from the genes listed in Table 1 provided MPP cells with robust long-term, multi-lineage engraftment properties, characteristic of HSCs, in vivo. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from: HLF, MYCN, MEIS1, IRF6, CDKN1C, NFIX, DNMT3B, ZFP612, PRDM5, HOXB4, LM02, NKX2-3, RARB, NDN, NAP1L3, RUNX1T1, ZFP467, and ZFP532. Another grouping is a core 6 factors (Runxltl, HLF, PRDM5, PBX1, LM02, and ZFP37), and 8 factors (the 6 factors plus MEIS1, MYCN).
[00227] As demonstrated herein, for example at Figs. 13A-13B, exposure to 17 transcription factors from the genes listed in Table 1 provided MPP cells with robust long-term, multi-lineage engraftment properties, characteristic of HSCs, in vivo. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from: HLF, MYCN, MEIS1, IRF6, NFIX, DNMT3B, ZFP612, PRDM5, HOXB4, LM02, NKX2-3, RARB, NDN, NAP1L3, RUNX1T1, ZFP467, and ZFP532.
[00228] As demonstrated herein, for example at Fig. 12, exposure to 9 transcription factors from the genes listed in Table 1 provided MPP cells with robust long-term, multi-lineage engraftment properties, characteristic of HSCs, in vivo. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from: EVI-1, GLIS2, HOXB5, HOXA9, HLF, MEIS1, MYCN, PRDM16, and RUNX1.
[00229] As demonstrated herein, for example at Fig. 14, exposure to 8 transcription factors from the genes listed in Table 1 provided MPP cells with robust long-term, multi-lineage engraftment properties, characteristic of HSCs, in vivo. In some embodiments of the compositions, methods, and
kits described herein, the HSC inducing factors are selected from: RUNX1T1, HLF, ZFP467, RBPMS, HOXB5, NAP1L3, MSI2, and IRF6.
[00230] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS. As demonstrated herein, the use of these 11 HSC inducing factors together, also referred to herein as "Combination 7" or "C7," resulted in increased colony formation, altered lineage potential, and multi- lineage reconstitution in vivo, from CMP cells or ProPreB cells. In addition, this combination was shown to have serial long-term transplantation potential in vivo. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00231] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5. As demonstrated herein, the use of these 6 HSC inducing factors together, also referred herein as "Combination 6" or "C6," was able to reprogram ProPreB or CMP cells into cells capable of giving rise to multi-lineage reconstitution in vivo.
Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from HLF, ZFP37, RUNX1T1, PBXl, LM02, and PRDM5. In some embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors PRDM16, ZFP467, and VDR.
[00232] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of ZFP467, PBXl, HOXB4, and MSI2. As demonstrated herein, the use of these HSC inducing factors together, also referred herein as "Combination 1" or "CI," was able to reprogram ProPreB cells to myeloid cells. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from ZFP467, PBXl, HOXB4, and MSI2. In some embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors HLF, LM02, PRDM16, and ZFP37.
[00233] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of MYCN, MSI2, NKX2-3, and RUNX1T1. As demonstrated herein, the use of these HSC inducing factors together, also referred herein as "Combination 2" or "C2," was able to reprogram ProPreB cells to iHSCs. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from MYCN, MSI2, NKX2-3, and RUNX1T1. In some
embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors HOBX5, HLF, ZFP467, HOXB3, LM02, PBX1, ZFP37, and ZFP521.
[00234] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of HOXB4, PBX1, LM02, ZFP612, and ZFP521. As demonstrated herein, the use of these HSC inducing factors together, also referred herein as "Combination 3" or "C3," was able to promote the proliferation and survival of ProPreB cells. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from HOXB4, PBX1, LM02, ZFP612, and ZFP521. In some embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors KLF12, HLF, and EGR1.
[00235] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of MEISI, RBPMS, ZFP37, RUNXITI, and LM02. As demonstrated herein, the use of these HSC inducing factors together, also referred herein as "Combination 4" or "C4," was able to reprogram CMP cells to iHSCs. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from MEISI, RBPMS, ZFP37, RUNXITI, and LM02. In some embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors KLF12 and HLF.
[00236] In some embodiments of the aspects described herein, the HSC inducing factors for use with the compositions, methods, and kits comprise, consist essentially of, or consist of ZFP37, HOXB4, LM02, and HLF. As demonstrated herein, the use of these HSC inducing factors together, also referred herein as "Combination 5" or "C5," was able to reprogram the fates of CMP and ProPreB cells. Accordingly, in some embodiments of the compositions, methods, and kits described herein, the HSC inducing factors are selected from ZFP37, HOXB4, LM02, and HLF. In some embodiments, the compositions, methods, and kits described herein can further comprise one or more of the HSC inducing factors MYCN, ZFP467, NKX2-3, PBX1, and KLF12ZFP37.
[00237] In some embodiments of the compositions, methods, and kids provided herein, the number of HSC inducing factors used or selected to generate iHSCs from a starting somatic cell, such as a fibroblast cell or hematopoietic lineage cell, is at least three. In some embodiments, the number of HSC inducing factors used or selected is at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, or more.
[00238] Also provided herein, in various aspects of the compositions, methods, and kits, are isolated amino acid sequences, and isolated DNA or RNA nucleic acid sequences encoding one or more HSC inducing factors for use in making iHSCS.
[00239] In some embodiments of the compositions, methods, and kits described herein, the nucleic acid sequence or construct encoding the HSC inducing factor(s), such as HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, is inserted or operably linked into a suitable expression vector for transfection of cells using standard molecular biology techniques. As used herein, a "vector" refers to a nucleic acid molecule, such as a dsDNA molecule that provides a useful biological or biochemical property to an inserted nucleotide sequence, such as the nucleic acid constructs or replacement cassettes described herein. Examples include plasmids, phages, autonomously replicating sequences (ARS), centromeres, and other sequences that are able to replicate or be replicated in vitro or in a host cell, or to convey a desired nucleic acid segment to a desired location within a host cell. A vector can have one or more restriction
endonuclease recognition sites (whether type I, II or lis) at which the sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a nucleic acid fragment can be spliced or inserted in order to bring about its replication and cloning. Vectors can also comprise one or more recombination sites that permit exchange of nucleic acid sequences between two nucleic acid molecules. Vectors can further provide primer sites, e.g., for PCR, transcriptional and/or translational initiation and/or regulation sites, recombination signals, replicons, additional selectable markers, etc. A vector can further comprise one or more selectable markers suitable for use in the identification of cells transformed with the vector.
[00240] Accordingly, in some aspects, provided herein are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
[00241] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00242] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
[00243] Also provided herein in some aspects are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5.
[00244] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding PRDM16; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
[00245] Also provided herein in some aspects are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS.
[00246] In some aspects, provided herein are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2.
[00247] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[00248] Also provided herein in some aspects are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2- 3; and a nucleic acid sequence encoding RUNX1T1.
[00249] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
[00250] In other aspects, provided herein are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors composition comprising: a nucleic acid
sequence encoding HOXB4; a nucleic acid sequence encoding PBX1; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521.
[00251] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[00252] Also provided herein in some aspects are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02.
[00253] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of a sequence encoding KLF12; and a sequence encoding HLF.
[00254] Also provided herein in some aspects are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising: a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF.
[00255] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding KLF4.
[00256] In some embodiments of the compositions, methods, and kits described herein, the expression vector is a viral vector. Some viral-mediated expression methods employ retrovirus, adenovirus, lentivirus, herpes virus, pox virus, and adeno-associated virus (AAV) vectors, and such expression methods have been used in gene delivery and are well known in the art.
[00257] In some embodiments of the compositions, methods, and kits described herein, the viral vector is a retrovirus. Retroviruses provide a convenient platform for gene delivery. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to target cells of the subject either in vivo or ex vivo. A number of retroviral systems have been described. See, e.g., U.S. Pat. No.
5,219,740; Miller and Rosman (1989) BioTechniques 7:980-90; Miller, A. D. (1990) Human Gene Therapy 1 :5-14; Scarpa et al. (1991) Virology 180:849-52; Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-37; Boris-Lawrie and Temin (1993) Curr. Opin. Genet. Develop. 3:102-09. In some embodiments of the compositions, methods, and kits described herein, the retrovirus is replication
deficient. Retroviral vector systems exploit the fact that a minimal vector containing the 5 ' and 3 ' LTRs and the packaging signal are sufficient to allow vector packaging, infection and integration into target cells, provided that the viral structural proteins are supplied in trans in the packaging cell line. Fundamental advantages of retroviral vectors for gene transfer include efficient infection and gene expression in most cell types, precise single copy vector integration into target cell chromosomal DNA and ease of manipulation of the retroviral genome.
[00258] In some embodiments of the compositions, methods, and kits described herein, the viral vector is an adenovirus-based expression vector. Unlike retroviruses, which integrate into the host genome, adenoviruses persist extrachromosomally, thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham (1986) J. Virol. 57:267-74; Bett et al. (1993) J. Virol. 67:5911-21 ; Mittereder et al. (1994) Human Gene Therapy 5:717-29; Seth et al. (1994) J. Virol. 68:933-40; Barr et al. (1994) Gene Therapy 1 :51-58; Berkner, K. L. (1988) BioTechniques 6:616-29; and Rich et al. (1993) Human Gene Therapy 4:461-76). Adenoviral vectors infect a wide variety of cells, have a broad host-range, exhibit high efficiencies of infectivity, direct expression of heterologous genes at high levels, and achieve long-term expression of those genes in vivo. The virus is fully infective as a cell-free virion so injection of producer cell lines is not necessary. With regard to safety, adenovirus is not associated with severe human pathology, and the recombinant vectors derived from the virus can be rendered replication defective by deletions in the early-region 1 ("El") of the viral genome. Adenovirus can also be produced in large quantities with relative ease.
Adenoviral vectors for use in the compositions, methods, and kits described herein can be derived from any of the various adenoviral serotypes, including, without limitation, any of the over 40 serotype strains of adenovirus, such as serotypes 2, 5, 12, 40, and 41. The adenoviral vectors used herein are preferably replication-deficient and contain the HSC inducing factor of interest operably linked to a suitable promoter.
[00259] In some embodiments of the compositions, methods, and kits described herein, the nucleic acid sequences encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEISI, and RBPMS, are introduced or delivered using one or more inducible lentiviral vectors. Control of expression of HSC inducing factors delivered using one or more inducible lentiviral vectors can be achieved, in some embodiments, by contacting a cell having at least one HSC inducing factor in an expression vector under the control of or operably linked to an inducible promoter, with a regulatory agent (e.g., doxycycline) or other inducing agent. When using some types of inducible lentiviral vectors, contacting such a cell with an inducing agent induces expression of the HSC inducing factors, while withdrawal of the regulatory agent inhibits expression. When using other types of inducible lentiviral vectors, the presence of the
regulatory agent inhibits expression, while removal of the regulatory agent permits expression. As used herein, the term "induction of expression" refers to the expression of a gene, such as an HSC inducing factor encoded by an inducible viral vector, in the presence of an inducing agent, for example, or in the presence of one or more agents or factors that cause endogenous expression of the gene in a cell.
[00260] In some embodiments of the aspects described herein, a doxycycline (Dox) inducible lentiviral system is used. Unlike retroviruses, lentivirases are able to transduce quiescent cells making them amenable for transducing a wider variety of hematopoietic cell types. For example, the pHAGE2 lentivirus system has been shown to transduce primary hematopoietic progenitor cells with high efficiency. This vector also carries a reporter cassette (IRES Zs-Green) that enables evaluation of viral transduction efficiencies and purification of transduced cells by FACS. The ability to inducibly turn off introduced transcription factors, as demonstrated herein, is important since the HSC-enriched expression pattern of these TFs indicates their continued enforced expression in induced HSCs can impair differentiation to all lineages. Having an inducible system also allows ascertainment of the stability of the reprogrammed state and assess the establishment and fidelity of HSC transcriptional programs and epigenetic marks once enforced expression of reprogramming factors is lifted.
[00261] In some embodiments of the methods described herein, the nucleic acid sequences encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are introduced or delivered using a non-integrating vector (e.g., adenovirus). While integrating vectors, such as retroviral vectors, incorporate into the host cell genome and can potentially disrupt normal gene function, non-integrating vectors control expression of a gene product by extra-chromosomal transcription. Since non-integrating vectors do not become part of the host genome, non-integrating vectors tend to express a nucleic acid transiently in a cell population. This is due in part to the fact that the non-integrating vectors are often rendered replication deficient. Thus, non-integrating vectors have several advantages over retroviral vectors including, but not limited to: (1) no disruption of the host genome, and (2) transient expression, and (3) no remaining viral integration products. Some non-limiting examples of non-integrating vectors for use with the methods described herein include adenovirus, baculoviras, alphaviras, picornaviras, and vaccinia virus. In some embodiments of the methods described herein, the non-integrating viral vector is an adenovirus. Other advantages of non-integrating viral vectors include the ability to produce them in high titers, their stability in vivo, and their efficient infection of host cells.
[00262] The phrases "operably linked," "operatively positioned," "operatively linked," "under control," and "under transcriptional control" indicate that a nucleic acid sequence, such as a sequence encoding an HSC inducing factor, is in a correct functional location and/or orientation in relation to a
promoter and/or endogenous regulatory sequences, such that the promoter and/or endogenous regulatory sequences controls transcriptional initiation and/or expression of that sequence.
[00263] The terms "promoter" or "promoter sequence," as used herein, refer to a nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving RNA polymerase- mediated transcription of the nucleic acid sequence, which can be a heterologous target gene, such as a sequence encoding an HSC inducing factor. A promoter is a control region of a nucleic acid sequence at which initiation and rate of transcription of the remainder of a nucleic acid sequence are controlled. A promoter can also contain one or more genetic elements at which regulatory proteins and molecules can bind. Such regulatory proteins include RNA polymerase and other transcription factors. Accordingly, a promoter can be said to "drive expression" or "drive transcription" of the nucleic acid sequence that it regulates, such as a sequence encoding an HSC inducing factor.
[00264] Nucleic acid constructs and vectors for use in generating iHSCs in the compositions, methods, and kits described herein can further comprise, in some embodiments, one or more sequences encoding selection markers for positive and negative selection of cells. Such selection marker sequences can typically provide properties of resistance or sensitivity to antibiotics that are not normally found in the cells in the absence of introduction of the nucleic acid construct. A selectable marker can be used in conjunction with a selection agent, such as an antibiotic, to select in culture for cells expressing the inserted nucleic acid construct. Sequences encoding positive selection markers typically provide antibiotic resistance, i.e., when the positive selection marker sequence is present in the genome of a cell, the cell is sensitive to the antibiotic or agent. Sequences encoding negative selection markers typically provide sensitivity to an antibiotic or agent, i.e., when the negative selection marker is present in the genome of a cell, the cell is sensitive to the antibiotic or agent.
[00265] Nucleic acid constructs and vectors for use in making iHSCs in the compositions, methods, and kits thereof described herein can further comprise, in some embodiments, other nucleic acid elements for the regulation, expression, stabilization of the construct or of other vector genetic elements, for example, promoters, enhancers, TATA-box, ribosome binding sites, IRES, as known to one of ordinary skill in the art.
[00266] In some embodiments of the compositions, methods, and kits described herein, the
HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are provided as synthetic, modified RNAs, or introduced or delivered into a cell as a synthetic, modified RNA, as described in US Patent Publication 2012-0046346-Al, the contents of which are herein incorporated by reference in their entireties. In those embodiments where synthetic, modified RNAs are used to reprogram cells to iHSCs according to the methods described herein, the methods can involve repeated contacting of the cells or involve repeated transfections of
the synthetic, modified RNAs encoding HSC inducing factors, such as for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, or more transfections.
[00267] In addition to one or more modified nucleosides, the modified mRNAs for use in the compositions, methods, and kits described herein can comprise any additional modifications known to one of skill in the art and as described in US Patent Publications 2012-0046346-A1 and
20120251618A1, and PCT Publication WO 2012/019168. Such other components include, for example, a 5' cap (e.g., the Anti-Reverse Cap Analog (ARCA) cap, which contains a 5'-5'- triphosphate guanine-guanine linkage where one guanine contains an N7 methyl group as well as a 3'- O-methyl group; caps created using recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-0-methyltransferase enzyme, which can create a canonical 5'-5'-triphosphate linkage between the 5'-most nucleotide of an mRNA and a guanine nucleotide where the guanine contains an N7 methylation and the ultimate 5'-nucleotide contains a 2'-0-methyl generating the Capl structure); a poly(A) tail (e.g., a poly-A tail greater than 30 nucleotides in length, greater than 35 nucleotides in length, at least 40 nucleotides, at least 45 nucleotides, at least 55 nucleotides, at least 60 nucleotide, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, or more) (SEQ ID NO: 93); a Kozak sequence; a 3' untranslated region (3' UTR); a 5' untranslated region (5' UTR); one or more intronic nucleotide sequences capable of being excised from the nucleic acid, or any combination thereof.
[00268] The modified mRNAs for use in the compositions, methods, and kits described herein can further comprise an internal ribosome entry site (IRES). An IRES can act as the sole ribosome binding site, or can serve as one of multiple ribosome binding sites of an mRNA. An mRNA containing more than one functional ribosome binding site can encode several peptides or polypeptides, such as the HSC inducing factors described herein, that are translated independently by the ribosomes ("multicistronic mRNA"). When nucleic acids are provided with an IRES, further optionally provided is a second translatable region. Examples of IRES sequences that can be used according to the invention include without limitation, those from picornaviruses (e.g. FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).
[00269] In some embodiments of the compositions, methods, and kits described herein, the synthetic, modified RNA molecule comprises at least one modified nucleoside. In some embodiments of the compositions, methods, and kits described herein, the synthetic, modified RNA molecule comprises at least two modified nucleosides.
[00270] In some embodiments of the compositions, methods, and kits described herein, the modified nucleosides are selected from the group consisting of 5-methylcytosine (5mC), N6- methyladenosine (m6A), 3,2'-0-dimethyluridine (m4U), 2-thiouridine (s2U), 2' fluorouridine, pseudouridine, 2'-0-methyluridine (Um), 2 'deoxy uridine (2' dU), 4-thiouridine (s4U), 5- methyluridine (m5U), 2'-0-methyladenosine (m6A), N6,2'-0-dimethyladenosine (m6Am), N6,N6,2'- O-trimethyladenosine (m62Am), 2'-0-methylcytidine (Cm), 7-methylguanosine (m7G), 2'-0- methylguanosine (Gm), N2,7-dimethylguanosine (m2,7G), N2, N2, 7-trimethylguanosine (m2,2,7G), and inosine (I). In some embodiments, the modified nucleosides are 5-methylcytosine (5mC), pseudouracil, or a combination thereof.
[00271] Modified mRNAs need not be uniformly modified along the entire length of the molecule. Different nucleotide modifications and/or backbone structures can exist at various positions in the nucleic acid. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) can be located at any position(s) of a nucleic acid such that the function of the nucleic acid is not substantially decreased. A modification can also be a 5' or 3' terminal modification. The nucleic acids can contain at a minimum one and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 50% modified nucleotides, at least 80%> modified nucleotides, or at least 90%> modified nucleotides.
[00272] In some embodiments, it is preferred, but not absolutely necessary, that each occurrence of a given nucleoside in a molecule is modified (e.g., each cytosine is a modified cytosine e.g., 5-methylcytosine, each uracil is a modified uracil, e.g., pseudouracil, etc.). For example, the modified mRNAs can comprise a modified pyrimidine such as uracil or cytosine. In some embodiments, at least 25%>, at least 50%>, at least 80%>, at least 90%> or 100%) of the uracil in the nucleic acid are replaced with a modified uracil. It is also contemplated that different occurrences of the same nucleoside can be modified in a different way in a given synthetic, modified RNA molecule.The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 25%>, at least 50%>, at least 80%>, at least 90%> or 100%) of the cytosine in the nucleic acid may be replaced with a modified cytosine. The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures) (e.g., some cytosines
modified as 5mC, others modified as 2'-0-methylcytosine or other cytosine analog). Such multi- modified synthetic RNA molecules can be produced by using a ribonucleoside blend or mixture comprising all the desired modified nucleosides, such that when the RNA molecules are being synthesized, only the desired modified nucleosides are incorporated into the resulting RNA molecule encoding the HSC inducing factor.
[00273] As used herein, "unmodified" or "natural" nucleosides or nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleosides include other synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 2-(halo)adenine, 2-(alkyl)adenine, 2- (propyl)adenine, 2 (amino)adenine, 2-(aminoalkyll)adenine, 2 (aminopropyl)adenine, 2 (methylthio) N6 (isopentenyl)adenine, 6 (alkyl)adenine, 6 (methyl)adenine, 7 (deaza)adenine, 8 (alkenyl)adenine, 8-(alkyl)adenine, 8 (alkynyl)adenine, 8 (amino)adenine, 8-(halo)adenine, 8-(hydroxyl)adenine, 8 (thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6 (methyl) adenine, N6, N6
(dimethyl) adenine, 2-(alkyl)guanine,2 (propyl)guanine, 6-(alkyl)guanine, 6 (methyl)guanine, 7 (alkyl)guanine, 7 (methyl)guanine, 7 (deaza)guanine, 8 (alkyl)guanine, 8-(alkenyl)guanine, 8 (alkynyl)guanine, 8-(amino)guanine, 8 (halo)guanine, 8-(hydroxyl)guanine, 8 (thioalkyl)guanine, 8- (thiol) guanine, N (methyl)guanine, 2-(thio)cytosine, 3 (deaza) 5 (aza)cytosine, 3-(alkyl)cytosine, 3 (methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5 (halo)cytosine, 5 (methyl)cytosine, 5 (propynyl)cytosine, 5 (propynyl)cytosine, 5 (trifluoromethyl)cytosine, 6-(azo)cytosine, N4
(acetyl)cytosine, 3 (3 amino-3 carboxypropyl)uracil, 2-(thio)uracil, 5 (methyl) 2 (thio)uracil, 5 (methylaminomethyl)-2 (thio)uracil, 4-(thio)uracil, 5 (methyl) 4 (thio)uracil, 5 (methylaminomethyl)- 4 (thio)uracil, 5 (methyl) 2,4 (dithio)uracil, 5 (methylaminomethyl)-2,4 (dithio)uracil, 5 (2- aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5 (aminoallyl)uracil, 5 (aminoalkyl)uracil, 5 (guanidiniumalkyl)uracil, 5 (l ,3-diazole-l -alkyl)uracil, 5-(cyanoalkyl)uracil, 5- (dialkylaminoalkyl)uracil, 5 (dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil, uracil-5 oxyacetic acid, 5 (methoxycarbonylmethyl)-2-(thio)uracil, 5 (methoxycarbonyl-methyl)uracil, 5 (propynyl)uracil, 5 (propynyl)uracil, 5 (trifluoromethyl)uracil, 6 (azo)uracil, dihydrouracil, N3 (methyl)uracil, 5-uracil (i.e. , pseudouracil), 2 (thio)pseudouracil,4 (thio)pseudouracil,2,4- (dithio)psuedouracil,5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)-2-(thio)pseudouracil, 5- (methyl)-2-(thio)pseudouracil, 5-(alkyl)-4 (thio)pseudouracil, 5-(methyl)-4 (thio)pseudouracil, 5- (alkyl)-2,4 (dithio)pseudouracil, 5-(methyl)-2,4 (dithio)pseudouracil, 1 substituted pseudouracil, 1 substituted 2(thio)-pseudouracil, 1 substituted 4 (thio)pseudouracil, 1 substituted 2,4- (dithio)pseudouracil, 1 (aminocarbonylethylenyl)-pseudouracil, 1 (aminocarbonylethylenyl)-2(thio)- pseudouracil, 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil, 1 (aminocarbonylethylenyl)-2,4-
(dithio)pseudouracil, 1 (aminoalkylaminocarbonylethylenyl)-pseudouracil, 1 (aminoalkylamino- carbonylethylenyl)-2(thio)-pseudouracil, 1 (aminoalkylaminocarbonylethylenyl)-4 (thio)pseudouracil, 1 (aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1 ,3-(diaza)-2-(oxo)-phenoxazin-l -yl, 1 -(aza)-2-(thio)-3-(aza)-phenoxazin-l -yl, 1 ,3-(diaza)-2-(oxo)-phenthiazin-l -yl, 1 -(aza)-2-(thio)-3- (aza)-phenthiazin-l -yl, 7-substituted l,3-(diaza)-2-(oxo)-phenoxazin-l -yl, 7-substituted l-(aza)-2- (thio)-3-(aza)-phenoxazin-l-yl, 7-substituted l,3-(diaza)-2-(oxo)-phenthiazin-l-yl, 7-substituted 1- (aza)-2-(thio)-3-(aza)-phenthiazin-l -yl, 7-(aminoalkylhydroxy)-l,3-(diaza)-2-(oxo)-phenoxazin-l-yl, 7-(aminoalkylhydroxy)-l -(aza)-2-(thio)-3-(aza)-phenoxazin-l -yl, 7-(aminoalkylhydroxy)-l,3-(diaza)- 2-(oxo)-phenthiazin-l -yl, 7-(aminoalkylhydroxy)-l -(aza)-2-(thio)-3-(aza)-phenthiazin-l-yl, 7- (guanidiniumalkylhydroxy)-l,3-(diaza)-2-(oxo)-phenoxazin-l -yl, 7-(guanidiniumalkylhydroxy)-l- (aza)-2-(thio)-3-(aza)-phenoxazin-l -yl, 7-(guanidiniumalkyl -hydroxy)- 1,3 -(diaza)-2-(oxo)- phenthiazin- 1 -yl, 7-(guanidiniumalkylhydroxy)- 1 -(aza)-2-(thio)-3 -(aza)-phenthiazin- 1 -yl, 1,3,5- (triaza)-2,6-(dioxa)-naphthalene, inosine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, inosinyl, 2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl,
mtrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isocarbostyrilyl, 5- (methyl)isocarbostyrilyl, 3-(methyl)-7-(propynyl)isocarbostyrilyl, 7-(aza)indolyl, 6-(methyl)-7- (aza)indolyl, imidizopyridinyl, 9-(methyl)-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7- (propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6- (dimethyl)indolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6- (azo)thymine, 2-pyridinone, 5 nitroindole, 3 nitropyrrole, 6-(aza)pyrimidine, 2 (amino)purine, 2,6- (diamino)purine, 5 substituted pyrimidines, N2-substituted purines, N6-substituted purines, 06- substituted purines, substituted 1 ,2,4-triazoles, pyrrolo-pyrimidin-2-on-3-yl, 6-phenyl-pyrrolo- pyrimidin-2-on-3-yl, para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, ortho-substituted-6- phenyl-pyrrolo-pyrimidin-2-on-3 -yl, bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3 -yl, para-(aminoalkylhydroxy)- 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, ortho-(aminoalkylhydroxy)- 6- phenyl-pyrrolo-pyrimidin-2-on-3-yl, bis-ortho— (aminoalkylhydroxy)- 6-phenyl-pyrrolo-pyrimidin-2- on-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidine-3-yl, or any O-alkylated or N-alkylated derivatives thereof.
[00274] In some embodiments of the compositions, methods, and kits described herein, modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1 -methyl -pseudoisocytidine, pyrrolo- cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine,
1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2- thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, and 4-methoxy- 1 -methyl -pseudoisocytidine.
[00275] In other embodiments of the compositions, methods, and kits described herein, modified nucleosides include 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza- 2- aminopurine, 7-deaza-2,6-diaminopurine, 7- deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2- methoxy-adenine.
[00276] In other embodiments of the compositions, methods, and kits described herein, modified nucleosides include inosine, 1 -methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7- deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 - methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8- oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine.
[00277] In certain embodiments it is desirable to intracellularly degrade a modified nucleic acid introduced into the cell, for example if precise timing of protein production is desired.Thus, in some embodiments of the compositions, methods, and kits described herein, provided herein are modified nucleic acids comprising a degradation domain, which is capable of being acted on in a directed manner within a cell.
[00278] Modified nucleosides also include natural bases that comprise conjugated moieties, e.g. a ligand. As discussed herein above, the RNA containing the modified nucleosides must be translatable in a host cell (i.e., does not prevent translation of the polypeptide encoded by the modified RNA). For example, transcripts containing s2U and m6A are translated poorly in rabbit reticulocyte lysates, while pseudouridine, m5U, and m5C are compatible with efficient translation. In addition, it is known in the art that 2'-fluoro-modified bases useful for increasing nuclease resistance of a transcript, leads to very inefficient translation. Translation can be assayed by one of ordinary skill in the art using e.g., a rabbit reticulocyte lysate translation assay.
[00279] Accordingly, provided herein, in some aspects are hematopoietic stem cell (HSC) inducing composition comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seve, eight or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1,
ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612, wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00280] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00281] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5
[00282] Also provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNXITI ; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding LM02; and a modified mRNA sequence encoding PRDM5; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00283] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding PRDM16; a modified mRNA sequence encoding ZFP467; and a modified mRNA sequence encoding VDR; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00284] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNXITI ; a modified mRNA sequence encoding PBXl; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM5; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding MYCN; a modified mRNA sequence encoding MSI2; a modified mRNA sequence encoding NKX2-3; a modified mRNA sequence encoding MEIS1 ; and a modified mRNA sequence encoding RBPMS; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00285] Also provided herein are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding ZFP467; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding HOXB4; and a modified mRNA sequence encoding MSI2; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00286] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM16; and a modified mRNA sequence encoding ZFP37, wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00287] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding MYCN; a modified mRNA sequence encoding MSI2; a modified mRNA sequence encoding NKX2-3; and a modified mRNA sequence encoding RUNX1T1 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00288] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding HOXB5; a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding ZFP467; a modified mRNA sequence encoding HOXB3; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding ZFP37; and a modified mRNA sequence encoding ZFP521 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00289] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding HOXB4; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding ZFP467; and a modified mRNA sequence encoding ZFP521 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00290] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding KLF12;a modified mRNA sequence encoding HLF; and a modified mRNA sequence encoding EGR;
wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00291] Also provided herein are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding MEIS1 ; a modified mRNA sequence encoding RBPMS; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding RUNXITI ; and a modified mRNA sequence encoding LM02; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00292] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA sequence encoding KLF12; and a modified mRNA sequence encoding HLF; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00293] Also provided herein are hematopoietic stem cell (HSC) inducing compositions comprising: a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding HOXB4; a modified mRNA sequence encoding LM02; and a modified mRNA sequence encoding HLF; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00294] In some embodiments of these aspects and all such aspects described herein, the HSC inducing composition further comprises one or more of: a modified mRNA encoding MYCN; a modified mRNA encoding ZFP467; a modified mRNA encoding NKX2-3; a modified mRNA encoding PBX1 ; and a modified mRNA encoding KLF4; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00295] In some embodiments of these aspects and all such aspects described herein, the modified cytosine is 5-methylcytosine and the modified uracil is pseudouridine.
[00296] The modified mRNAs encoding HSC inducing factors described herein can be synthesized and/or modified by methods well established in the art, such as those described in "Current Protocols in Nucleic Acid Chemistry," Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference in its entirety. In some embodiments of the compositions, methods, and kits described herein, the modified mRNAs encoding the HSC inducing factor(s), such as HLF, RUNXITI, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are generated using the IVT templates and constructs, and methods thereof for rapidly and efficiently generating synthetic RNAs described in PCT Application
No.: PCT/US 12/64359, filed November 9, 2012, and as described in US 20120251618 Al, the contents of each of which are herein incorporated by reference in their entireties. In some
embodiments of the compositions, methods, and kits described herein, the synthetic, modified RNAs encoding the HSC inducing factor(s), such as HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are delivered and formulated as described in US 20120251618 Al .
[00297] One of skill in the art can easily monitor the expression level of the polypeptide encoded by a synthetic, modified RNA using e.g., Western blotting techniques or
immunocytochemistry techniques. A synthetic, modified RNA can be administered at a frequency and dose that permit a desired level of expression of the polypeptide. Each different modified mRNA can be administered at its own dose and frequency to permit appropriate expression. In addition, since the modified RNAs administered to the cell are transient in nature (i.e., are degraded over time) one of skill in the art can easily remove or stop expression of a modified RNA by halting further
transfections and permitting the cell to degrade the modified RNA over time. The modified RNAs will degrade in a manner similar to cellular mRNAs.
[00298] Accordingly, in some embodiments of the compositions, methods, and kits described herein, a plurality of synthetic, modified RNAs encoding HSC inducing factors can be contacted with, or introduced to, a cell, population of cells, or cell culture simultaneously. In other embodiments, the plurality of synthetic, modified RNAs encoding HSC inducing factors can be contacted with, or introduced to, a cell, population of cells, or cell culture separately. In addition, each modified RNA encoding an HSC inducing factor can be administered according to its own dosage regime.
[00299] In some embodiments of the compositions, methods, and kits described herein, a modified RNA encoding an HSC inducing factor can be introduced into target cells by transfection or lipofection. Suitable agents for transfection or lipofection include, for example, calcium phosphate, DEAE dextran, lipofectin, lipofectamine, DIMRIE C™, Superfect™, and Effectin™ (Qiagen™), unifectin™, maxifectin™, DOTMA, DOGS™ (Transfectam; dioctadecylamidoglycylspermine), DOPE (l,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOTAP (l,2-dioleoyl-3-trimethylammonium propane), DDAB (dimethyl dioctadecylammonium bromide), DHDEAB (N,N-di-n-hexadecyl-N,N- dihydroxyethyl ammonium bromide), HDEAB (N-n-hexadecyl-N,N-dihydroxyethylammonium bromide), polybrene, poly(ethylenimine) (PEI), and the like. (See, e.g., Banerjee et al., Med. Chem. 42:4292-99 (1999); Godbey et al., Gene Ther. 6: 1380-88 (1999); Kichler et al., Gene Ther. 5:855-60 (1998); Birchaa et al., J. Pharm. 183: 195-207 (1999)).
[00300] In some embodiments, a modified RNA can be transfected into target cells as a complex with cationic lipid carriers (e.g., OLIGOFECTAMINE™) or non-cationic lipid-based carriers (e.g., Transit-TKOTM™, Mirus Bio LLC, Madison, WI).
[00301] In some embodiments of the aspects described herein, the synthetic, modified RNA is introduced into a cell using a transfection reagent. Some exemplary transfection reagents include, for example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731). Examples of commercially available transfection reagents are known to those of ordinary skill in the art.
[00302] In other embodiments, highly branched organic compounds, termed "dendrimers," can be used to bind the exogenous nucleic acid, such as the synthetic, modified RNAs described herein, and introduce it into the cell.
[00303] In other embodiments of the aspects described herein, non-chemical methods of transfection are contemplated. Such methods include, but are not limited to, electroporation, sono- poration, the use of a gene gun, magnetofection, and impalefection, and others, as known to those of ordinary skill in the art. Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols, such as ethylene glycol and propylene glycol, pyrrols such as 2- pyrrol, azones, and terpenes, such as limonene and menthone.
[00304] In some embodiments of the compositions, methods, and kits described herein, a modified RNA encoding an HSC inducing factor is formulated in conjunction with one or more penetration enhancers, surfactants and/or chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
[00305] In some embodiments of the compositions, methods, and kits described herein, a modified RNA encoding an HSC inducing factor is formulated into any of many possible
administration forms, including a sustained release form. In some embodiments of the compositions, methods, and kits described herein, formulations comprising a plurality of different synthetic, modified RNAs encoding HSC inducing factors are prepared by first mixing all members of a plurality of different synthetic, modified RNAs, and then complexing the mixture comprising the plurality of different synthetic, modified RNAs with a desired ligand or targeting moiety, such as a lipid. The compositions can be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
[00306] The compositions described herein can be prepared and formulated as emulsions for the delivery of synthetic, modified RNAs. Emulsions can contain further components in addition to the dispersed phases, and the active drug (i.e., synthetic, modified RNA) which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[00307] In some embodiments of the compositions, methods, and kits described herein, a modified RNA encoding an HSC inducing factor can be encapsulated in a nanoparticle. Methods for nanoparticle packaging are well known in the art, and are described, for example, in Bose S, et al (Role of Nucleolin in Human Parainfluenza Virus Type 3 Infection of Human Lung Epithelial Cells. J. Virol. 78:8146. 2004); Dong Y et al. Poly(d,l-lactide-co-glycolide)/montmorillonite nanoparticles for oral delivery of anticancer drugs. Biomaterials 26:6068. 2005); Lobenberg R. et al (Improved body distribution of 14C-labelled AZT bound to nanoparticles in rats determined by
radioluminography. J Drug Target 5: 171.1998); Sakuma S R et al (Mucoadhesion of polystyrene nanoparticles having surface hydrophilic polymeric chains in the gastrointestinal tract. Int J Pharm 177: 161. 1999); Virovic L et al. Novel delivery methods for treatment of viral hepatitis: an update. Expert Opin Drug Deliv 2:707.2005); and Zimmermann E et al, Electrolyte- and pH-stabilities of aqueous solid lipid nanoparticle (SLN) dispersions in artificial gastrointestinal media. Eur J Pharm Biopharm 52:203. 2001), the contents of which are herein incoporated in their entireties by reference.
[00308] While it is understood that iHSCs can be generated by delivery of HSC inducing factors in the form of nucleic acid (DNA or RNA) or amino acid sequences, in some embodiments of the compositions, methods, and kits described herein, iHSC induction can be induced using other methods, such as, for example, by treatment of cells with an agent, such as a small molecule or cocktail of small molecules, that induce expression one or more of the HSC inducing factors.
[00309] The term "agent" as used herein means any compound or substance such as, but not limited to, a small molecule, nucleic acid, polypeptide, peptide, drug, ion, etc. An "agent" can be any
chemical, entity or moiety, including without limitation synthetic and naturally-occurring proteinaceous and non-proteinaceous entities. In some embodiments, an agent is nucleic acid, nucleic acid analogues, proteins, antibodies, peptides, aptamers, oligomer of nucleic acids, amino acids, or carbohydrates including without limitation proteins, oligonucleotides, ribozymes, DNAzymes, glycoproteins, siRNAs, lipoproteins, aptamers, and modifications and combinations thereof etc. In some embodiments, the nucleic acid is DNA or RNA, and nucleic acid analogues, for example can be PNA, pcPNA and LNA. A nucleic acid may be single or double stranded, and can be selected from a group comprising; nucleic acid encoding a protein of interest, oligonucleotides, PNA, etc. Such nucleic acid sequences include, for example, but not limited to, nucleic acid sequence encoding proteins that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc. A protein and/or peptide agent or fragment thereof, can be any protein of interest, for example, but not limited to; mutated proteins; therapeutic proteins; truncated proteins, wherein the protein is normally absent or expressed at lower levels in the cell. Proteins of interest can be selected from a group comprising; mutated proteins, genetically engineered proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins, antibodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof.
[00310] Also provided herein, in some aspects, are methods of making, preparing, or generating induced hematopoietic stem cells using one or more expression vectors or one or more modified mRNA sequences encoding specific combinations of the HSC inducing factors described herein, such as at least one, two, three, four, five, six, seven, eight, or more of the HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
[00311] Accordingly, provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00312] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
[00313] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00314] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00315] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[00316] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding
NKX2-3; and a nucleic acid sequence encoding RUNX1T1; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00317] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
[00318] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00319] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[00320] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00321] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[00322] Provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00323] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[00324] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00325] In some embodiments of these methods and all such method described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBXl ; and a nucleic acid sequence encoding
KLF.
[00326] Also provided herein, in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. repeatedly transfecting a somatic cell with one or more modified mRNA sequences encoding at least one, two, three, four, five, six, seve, eight, or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612, wherein each cytosine of each of the
modified m NA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof,
b. culturing the transfected somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00327] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF, RUNX1T1, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00328] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: PRDM16; ZFP467; and VDR.
[00329] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are HLF; RUNX1T1 ; PBXl ; LM02; PRDM5; ZFP37; MYCN; MSI2; NKX2-3; MEIS1; and RBPMS.
[00330] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are ZFP467; PBXl ; HOXB4; and MSI2. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: HLF; LM02; PRDM16; and ZFP37.
[00331] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are MYCN; MSI2; NKX2-3; and RUNX1T1. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: HOXB5; HLF; ZFP467; HOXB3; LM02; PBXl ; ZFP37; and ZFP521.
[00332] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are HOXB4; PBXl ; LM02;
ZFP467; and ZFP521. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: KLF12; HLF; and EGR.
[00333] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are MEIS1 ; RBPMS; ZFP37;
RUNX1T1 ; and LM02. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: KLF12; and HLF.
[00334] In some embodiments of these methods and all such methods described herein, the at least one, two, three, four, or more HSC inducing factors of step (a) are ZFP37; HOXB4; LM02; and
HLF. In some such embodiments, the at least one, two, three, four, or more HSC inducing factors of step (a) further comprise one or more of: MYCN; ZFP467; NKX2-3; PBX1 ; and KLF4.
[00335] Detection of expression of HSC inducing factors introduced into cells or induced in a cell population using the compositions, methods, and kits described herein, can be achieved by any of several techniques known to those of skill in the art including, for example, Western blot analysis, immunocytochemistry, and fluorescence-mediated detection.
[00336] In order to distinguish whether a given combination of HSC inducing factors has generated iHSCs or other committed progenitors, one or more HSC activities or parameters can be measured, such as, in some embodiments, differential expression of surface antigens. The generation of induced HSCs using the compositions, methods, and kits described herein preferably causes the appearance of the cell surface phenotype characteristic of endogenous HSCs, such as lineage marker negative, Seal -positive, cKit-positive (or LSK cells), CD34-negative, Flk2 -negative, CD48 -negative, and CD150-positive or as CD150+CD48-CD244-, for example.
[00337] HSCs are most reliably distinguished from committed progenitors by their functional behavior. Functional aspects of HSC phenotypes, or hematopoietic stem cell activities, such as the ability of an HSC to give rise to long-term, multi-lineage reconstitution in a recipient, can be easily determined by one of skill in the art using routine methods known in the art, and as described herein, for example, in the Examples and the Drawings, i.e., FIGS. 1- 57C. In some embodiments of the aspects described herein, functional assays to identify reprogramming factors can be used. For example, in some embodiments, Colony forming cell (CFC) activity in methylcellulose can be used to confirm multi-lineage (granulocytes, macrophages, megakaryocytes and erythrocytes) potential of iHSCs generated using the compositions, methods, and kits thereof. Serial plating can be used to confirm self-renewal potential of iHSCs generated using the compositions, methods, and kits described herein. Lymphoid potential of iHSCs generated using the compositions, methods, and kits described herein can be evaluated by culturing transduced cells on OP9 and OP9delta stromal cells, followed by immunostaining on day 14 for B- and T- cells, respectively.
[00338] As used herein, "cellular parameter," "HSC parameter," or "hematopoietic stem cell activity" refer to measureable components or qualities of endogenous or natural HSCs, particularly components that can be accurately measured. A cellular parameter can be any measurable parameter related to a phenotype, function, or behavior of a cell. Such cellular parameters include, changes in characteristics and markers of an HSC or HSC population, including but not limited to changes in viability, cell growth, expression of one or more or a combination of markers, such as cell surface determinants, such as receptors, proteins, including conformational or posttranslational modification thereof, lipids, carbohydrates, organic or inorganic molecules, nucleic acids, e.g. m NA, DNA, global
gene expression patterns, etc. Such cellular parameters can be measured using any of a variety of assays known to one of skill in the art. For example, viability and cell growth can be measured by assays such as Trypan blue exclusion, CFSE dilution, and 3H incorporation. Expression of protein or polyeptide markers can be measured, for example, using flow cytometric assays, Western blot techniques, or microscopy methods. Gene expression profiles can be assayed, for example, using microarray methodologies and quantitative or semi-quantitative real-time PCR assays. A cellular parameter can also refer to a functional parameter or functional activity. While most cellular parameters will provide a quantitative readout, in some instances a semi-quantitative or qualitative result can be acceptable. Readouts can include a single determined value, or can include mean, median value or the variance, etc. Characteristically a range of parameter readout values can be obtained for each parameter from a multiplicity of the same assays. Variability is expected and a range of values for each of the set of test parameters will be obtained using standard statistical methods with a common statistical method used to provide single values.
[00339] In some embodiments of the compositions, methods, and kits described herein, additional factors can be used to enhance HSC reprogramming. For example, agents that modify epigenetic pathways can be used to facilitate reprogramming into iHSCs.
[00340] Essentially any primary somatic cell type can be used for producing iHSCs or reprogramming somatic cells to iHSCs according to the presently described compositions, methods, and kits. Such primary somatic cell types also include other stem cell types, including pluripotent stem cells, such as induced pluripotent stem cells (iPS cells); other multipotent stem cells; oligopotent stem cells; and (5) unipotent stem cells. Some non-limiting examples of primary somatic cells useful in the various aspects and embodiments of the methods described herein include, but are not limited to, fibroblast, epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, hematopoietic or immune cells, hepatic, splenic, lung, circulating blood cells, gastrointestinal, renal, bone marrow, and pancreatic cells, as well as stem cells from which those cells are derived. The cell can be a primary cell isolated from any somatic tissue including, but not limited to, spleen, bone marrow, blood, brain, liver, lung, gut, stomach, intestine, fat, muscle, uterus, skin, spleen, endocrine organ, bone, etc. The term "somatic cell" further encompasses, in some embodiments, primary cells grown in culture, provided that the somatic cells are not immortalized. Where the cell is maintained under in vitro conditions, conventional tissue culture conditions and methods can be used, and are known to those of skill in the art. Isolation and culture methods for various primary somatic cells are well within the abilities of one skilled in the art.
[00341] In some embodiments of the compositions, methods, and kits described herein, a somatic cell to be reprogrammed or made into an iHSC cell is a cell of hematopoietic origin. As used
herein, the terms "hematopoietic-derived cell," "hematopoietic-derived differentiated cell,"
"hematopoietic lineage cell," and "cell of hematopoietic origin" refer to cells derived or differentiated from a multipotent hematopoietic stem cell (HSC). Accordingly, hematopoietic lineage cells for use with the compositions, methods, and kits described herein include multipotent, oligopotent, and lineage-restricted hematopoietic progenitor cells, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), thrombocytes (e.g., megakaryoblasts, platelet producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, and lymphocytes (e.g., T-lymphocytes, which carry T-cell receptors (TCRs), B-lymphocytes or B cells, which express immunoglobulin and produce antibodies, NK cells, NKT cells, and innate lymphocytes). As used herein, the term "hematopoietic progenitor cells" refer to multipotent, oligopotent, and lineage-restricted hematopoietic cells capable of differentiating into two or more cell types of the hematopoietic system, including, but not limited to, granulocytes, monocytes, erythrocytes, megakaryocytes, and lymphocytes B-cells and T-cells. Hematopoietic progenitor cells encompass multi-potent progenitor cells (MPPs), common myeloid progenitor cells (CMPs), common lymphoid progenitor cells (CLPs), granulocyte-monocyte progenitor cells (GMPs), and pre-megakaryocyte-erythrocyte progenitor cell. Lineage -restricted hematopoieticprogenitor cells include megakaryocyte-erythrocyte progenitor cells (MEP), roB cells, PreB cells, PreProB cells, ProT cells, double-negative T cells, pro-NK cells, pro-dendritic cells (pro-DCs), pre- granulocyte/macrophage cells, granulocyte/macrophage progenitor (GMP) cells, and pro-mast cells (ProMCs). A differentiation chart of the hematopoietic lineage is provided at FIG. 1
[00342] Cells of hematopoietic origin for use in the compositions, methods, and kits described herein can be obtained from any source known to comprise these cells, such as fetal tissues, umbilical cord blood, bone marrow, peripheral blood, mobilized peripheral blood, spleen, liver, thymus, lymph, etc. Cells obtained from these sources can be expanded ex vivo using any method acceptable to those skilled in the art prior to use in with the compositions, methods, and kits for making iHCSs described herein. For example, cells can be sorted, fractionated, treated to remove specific cell types, or otherwise manipulated to obtain a population of cells for use in the methods described herein using any procedure acceptable to those skilled in the art. Mononuclear lymphocytes may be collected, for example, by repeated lymphocytophereses using a continuous flow cell separator as described in U.S. Pat. No. 4,690,915, or isolated using an affinity purification step ocommon lymphoid progenitor cell (CLP)r method, such as flow-cytometry using a cytometer, magnetic separation, using antibody or protein coated beads, affinity chromatography, or solid-support affinity separation where cells are retained on a substrate according to their expression or lack of expression of a specific protein or type of protein, or batch purification using one or more antibodies against one or more surface antigens
specifically expressed by the cell type of interest. Cells of hematopoietic origin can also be obtained from peripheral blood. Prior to harvest of the cells from peripheral blood, the subject can be treated with a cytokine, such as e.g., granulocyte -colony stimulating factor, to promote cell migration from the bone marrow to the blood compartment and/or promote activation and/or proliferation of the population of interest. Any method suitable for identifying surface proteins, for example, can be employed to isolate cells of hematopoietic origin from a heterogenous population. In some embodiments, a clonal population of cells of hematopoietic origin, such as lymphocytes, is obtained. In some embodiments, the cells of hematopoietic origin are not a clonal population.
[00343] Further, in regard to the various aspects and embodiments of the compositions, methods, and kits described herein, a somatic cell can be obtained from any mammalian species, with non-limiting examples including a murine, bovine, simian, porcine, equine, ovine, or human cell. In some embodiments, the somatic cell is a human cell. In some embodiments, the cell is from a non- human organism, such as a non-human mammal.
[00344] In general, the methods for making iHSCs described herein involve culturing or expanding somatic cells, such as cells of hematopoietic origin, in any culture medium that is available and well-known to one of ordinary skill in the art. Such media include, but are not limited to, Dulbecco's Modified Eagle's Medium® (DMEM), DMEM F12 Medium®, Eagle's Minimum Essential Medium®, F-12K Medium®, Iscove's Modified Dulbecco's Medium®, RPMI-1640 Medium®, and serum-free medium for culture and expansion of progenitor cells SFEM®. Many media are also available as low-glucose formulations, with or without sodium. The medium used with the methods described herein can, in some embodiments, be supplemented with one or more growth factors. Commonly used growth factors include, but are not limited to, bone morphogenic protein, basic fibroblast growth factor, platelet-derived growth factor and epidermal growth factor, Stem cell factor, and thrombopoietin. See, for example, U.S. Pat. Nos. 7,169,610; 7,109,032; 7,037,721 ;
6,617,161; 6,617,159; 6,372,210; 6,224,860; 6,037,174; 5,908,782; 5,766,951 ; 5,397,706; and 4,657,866; all incorporated by reference herein in their entireties for teaching growing cells in serum- free medium.
[00345] For example, as described herein, primary cultures of mouse hematopoietic cells were kept a total of three days ex vivo during the transduction process. Cells were maintained in minimal growth S-clone media supplemented with 20ng^L IL-12, TPO, SCF, 5ng^L IL-7, 2 ng/μΕ FLK-3, and lOOng/ml Penicillin/streptomycin in a 5% C02 37°C incubator. Transduction with concentrated and titered viruses was performed for 16 hours, in some embodiments, and then a24 hour incubation with doxycycline, in some embodiments. At this time ZsGr+ cells were re-sorted and put into CFCs assays or in vivo transplantation. Doxycycline induction can be maintained for 2 weeks post-
transplant, in some embodiments. In some embodiments, when using an inducible expression vector, the inducing agent, such as doxycycline, can be maintained for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days or a week, at least 10 days, at least 2 weeks, or more, following transplantation of a induced iHSC population into a subject.
[00346] Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components or plating on feeder cells, for example. Cells being used in the methods described herein can require additional factors that encourage their attachment to a solid support, in some embodiments, such as type I and type II collagen, chondroitin sulfate, fibronectin, "superfibronectin" and fibronectin-like polymers, gelatin, poly-D and poly-L-lysine, thrombospondin and vitronectin. In some embodiments, the cells are suitable for growth in suspension cultures.
Suspension-competent host cells are generally monodisperse or grow in loose aggregates without substantial aggregation. Suspension-competent host cells include cells that are suitable for suspension culture without adaptation or manipulation (e.g., cells of hematopoietic origin, such as lymphoid cells) and cells that have been made suspension-competent by modification or adaptation of attachment- dependent cells (e.g., epithelial cells, fibroblasts).
[00347] Also provided herein, in some aspects, are isolated induced hematopoietic stem cells
(iHSCs) produced using any of the HSC inducing compositions or methods of preparing iHSCs described herein.
[00348] Also provided herein, in some aspects, are cell clones comprising a plurality of the induced hematopoietic stem cell (iHSCs) produced using any of the HSC inducing compositions or methods of preparing iHSCs described herein.
[00349] In some embodiments of these aspects and all such aspects described herein, the isolated induced hematopoietic stem cells (iHSCs) or cell clones thereof further comprise a pharmaceutically acceptable carrier for administration to a subject in need.
[00350] Also provided herein, in some aspects, are methods of treating a subject in need of treatment for a disease or disorder in which one or more hematopoietic cell lineages are deficient or defective using the HSC inducing compositions and methods of preparing iHSCs described herein, or using the isolated induced hematopoietic stem cells (iHSCs) and cell clones thereof produced using any of the combinations of HSC inducing factors, HSC inducing compositions, or methods of preparing iHSCs described herein. In such methods of treatment, somatic cells, such as fibroblast cells or hematopoietic lineage cells, can first be isolated from the subject, and the isolated cells transduced or transfected, as described herein with an HSC inducing composition comprising expression vectors or synthetic mRNAs, respectively. The isolated induced hematopoietic stem cells (iHSCs) and cell clones thereof produced using any of the combinations of HSC inducing factors, HSC inducing
compositions, or methods of preparing iHSCs described herein, can then be administered to the subject, such as via systemic injection of the iHSCs to the subject.
[00351] The reprogrammed iHSCs generated using the compositions, methods, and kits described herein can, in some embodiments of the methods of treatment described herein, be used directly or administered to subjects in need of cellular therapies or regenerative medicine applications or, in other embodiments, redifferentiated to other hematopoietic cell types for use in or
administration to subjects in need of cellular therapies or regenerative medicine applications.
Accordingly, various embodiments of the methods described herein involve administration of an effective amount of an iHSC or a population of iHSCs, generated using any of the compositions, methods, and kits described herein, to an individual or subject in need of a cellular therapy. The cell or population of cells being administered can be an autologous population, or be derived from one or more heterologous sources. Further, such iHSCs or differentiated cells from iHSCs can be administered in a manner that permits them to graft to the intended tissue site and reconstitute or regenerate the functionally deficient area. In some such embodiments, iHSCs can be introduced to a scaffold or other structure to generate, for example, a tissue ex vivo, that can then be introduced to a patient.
[00352] A variety of means for administering cells to subjects are known to those of skill in the art. Such methods can include systemic injection, for example, i.v. injection, or implantation of cells into a target site in a subject. Cells may be inserted into a delivery device which facilitates introduction by injection or implantation into the subject. Such delivery devices can include tubes, e.g., catheters, for injecting cells and fluids into the body of a recipient subject. In one preferred embodiment, the tubes additionally have a needle, e.g. , through which the cells can be introduced into the subject at a desired location. The cells can be prepared for delivery in a variety of different forms. For example, the cells can be suspended in a solution or gel or embedded in a support matrix when contained in such a delivery device. Cells can be mixed with a pharmaceutically acceptable carrier or diluent in which the cells remain viable.
[00353] Accordingly, the cells produced by the methods described herein can be used to prepare cells to treat or alleviate at least the following diseases and conditions wherein hematopoietic stem cell transplants have proven to be one effective method of treatment: leukemia such as acute myeloid leukemia, acute lymphoblastic leukemia, myelodysplastic/myeloproliferative syndromes, chronic myeloid leukemia, chronic lymphocytic leukemia, and other leukemia; lymphoproliferative disorders such as plasma cell disorders, Hodgkin disease, non-Hodgkin lymphoma, and other lymphoma; solid tumors such as neuroblastoma, germinal cancer, breast cancer, and Ewing sarcoma;
Nonmalignant disorders such as bone marroe failures, hemoglobinopathies, immune deficiencies, inherited diseases of metabolism, and autoimmune disorders.
[00354] In addition to the above, the methods of the invention can be used for the treatment of the following diseases and conditions: Angiogenic Myeloid Metaplasia (Myelofibrosis); Aplastic Anemia; Acquired Pure Red Cell Aplasia; Aspartylglucosaminuria; Ataxia Telangiectasia;
Choriocarcinoma; Chronic Lymphocytic Leukemia (CLL); Chronic Myelogenous Leukemia (CML); Common Variable Immunodeficiency; Chronic Pulmonary Obstructive Disease; Desmoplastic small round cell tumor; Diamond-Blackfan anemia; DiGeorge syndrome; Essential Thrombocythemia; Haematologica Ewing's Sarcoma; Fucosidosis; Gaucher disease; Griscelli syndrome;
Hemophagocytic lymphohistiocytosis (HLH); Hodgkin's Disease; Human Immunodeficiency Virus (HIV); Human T-lymphotropic Virus (HTLV); Hunter syndrome (MPS II, iduronidase sulfate deficiency); Hurler syndrome (MPS I H, a-L-iduronidase deficiency); Infantile neuronal ceroid lipofuscinosis (INCL, Santavuori disease); Jansky-Bielschowsky disease (late infantile neuronal ceroid lipofuscinosis); Juvenile Myelomonocytic Leukemia (JMML); Kostmann syndrome; Krabbe disease (globoid cell leukodystrophy); Maroteaux-Lamy syndrome (MPS VI); Metachromatic leukodystrophy; Morquio syndrome (MPS IV); Mucolipidosis II (I-cell disease); Multiple Myeloma; Myelodysplasia; Neuroblastoma; NF-Kappa-B Essential Modulator (NEMO) deficiency; Niemann- Pick disease; Non-Hodgkin's Lymphoma; paroxysmal nocturnal hemoglobinuria (PNH); Plasma Cell Leukemia; Polycythemia Vera; Radiation Poisoning; Sanfilippo syndrome (MPS III); Severe combined immunodeficiency (SCID), all types; Shwachman-Diamond syndrome; Sickle cell disease; Sly syndrome (MPS VII); Thalassemia; Wilm's tumors; Wiskott-Aldrich syndrome; Wolman disease (acid lipase deficiency); and X- linked lymphoproliferative disorder
[00355] Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents is well known in the art. The solution is preferably sterile and fluid. Preferably, prior to the introduction of cells, the solution is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
[00356] It is preferred that the mode of cell administration is relatively non-invasive, for example by intravenous injection, pulmonary delivery through inhalation, topical, or intranasal administration. However, the route of cell administration will depend on the tissue to be treated and may include implantation. Methods for cell delivery are known to those of skill in the art and can be extrapolated by one skilled in the art of medicine for use with the methods and compositions described herein.
[00357] Direct injection techniques for cellular administration of iHSCs can also be used to stimulate transmigration of cells through the entire vasculature, or to the vasculature of a particular organ. This includes non-specific targeting of the vasculature. One can target any organ by selecting a specific injection site, e.g., a liver portal vein. Alternatively, the injection can be performed systemically into any vein in the body. This method is useful for enhancing stem cell numbers in aging patients. In addition, the cells can function to populate vacant stem cell niches or create new stem cells to replenish those lost through, for example, chemotherapy or radiation treatments, for example. If so desired, a mammal or subject can be pre -treated with an agent, for example an agent is administered to enhance cell targeting to a tissue (e.g. , a homing factor) and can be placed at that site to encourage cells to target the desired tissue. For example, direct injection of homing factors into a tissue can be performed prior to systemic delivery of ligand-targeted cells.
[00358] A wide range of diseases in which one or more blood cell populations are deficient or defective are recognized as being treatable with HSCs Accordingly, also provided herein are compositions and methods comprising iHSCs for use in cellular therapies, such as stem cell therapies. Non-limiting examples of conditions or disorders that can be treated using the compositions and methods described herein include aplastic anemia, Fanconi anemia, paroxysmal nocturnal hemoglobinuria (PNH); acute leukemias, including acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), acute biphenotypic leukemia and acute undifferentiated leukemia; chronic leukemias, including chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), juvenile chronic myelogenous leukemia (JCML) and juvenile myelomonocytic leukemia (JMML); myeloproliferative disorders, including acute myelofibrosis, angiogenic myeloid metaplasia (myelofibrosis), polycythemia vera and essential thrombocythemia; inherited platelet abnormalities, including amegakaryocytosis/congenital thrombocytopenia; plasma cell disorders, including multiple myeloma, plasma cell leukemia, and Waldenstrom's macroglobulinemia; lung disorders, including COPD and bronchial asthma; congenital immune disorders, including ataxia- telangiectasia, Kostmann syndrome, leukocyte adhesion deficiency, DiGeorge syndrome, bare lymphocyte syndrome, Omenn's syndrome, severe combined immunodeficiency (SCID), SCID with adenosine deaminase deficiency, absence of T & B cells SCID, absence of T cells, normal B cell SCID, common variable immunodeficiency and X-linked lymphoproliferative disorder, and HIV (human immunodeficiency virus) and AIDS (acquired immune deficiency syndrome).
[00359] Efficacy of treatment is determined by a statistically significant change in one or more indicia of the targeted disease or disorder, as known to one of ordinary skill in the art. For example, whole blood of a subject being treated with iHSCs generated using the compositions,
methods, and kits described herein can be analyzed using a complete blood count (CBC). A CBC test can comprise one or more of the following:
a. White blood cell (WBC) count: A count of the actual number of white blood cells per volume of blood.
b. White blood cell differential: Acount of the types of white blood cells present in the blood:
neutrophils, lymphocytes, monocytes, eosinophils, and basophils.
c. Red blood cell (RBC) count: A count of the actual number of red blood cells per volume of blood. d. Hemoglobin level: A measure of the amount of oxygen-carrying protein in the blood.
e. Hematocrit level: A measures of the percentage of red blood cells in a given volume of whole blood.
f. Platelet count: A count of the number of platelets in a given volume of blood.
g. Mean platelet volume (MPV): A measurement of the average size of platelets. Newly produced platelets are larger and an increased MPV occurs when increased numbers of platelets are being produced in the bone marrow.
h. Mean corpuscular volume (MCV): A measurement of the average size of RBCs (e.g. whether RBCs are larger than normal (macrocytic) or RBCs are smaller than normal (microcytic)).
i. Mean corpuscular hemoglobin (MCH): A calculation of the average amount of oxygen- carrying hemoglobin inside a red blood cell.
j. Mean corpuscular hemoglobin concentration (MCHC): A calculation of the average concentration of hemoglobin inside a red cell (e.g. decreased MCHC values (hypochromia) or increased MCHC values (hyperchromia)),
k. Red cell distribution width (RDW): A calculation of the variation in the size of RBCs {e.g. amount of variation (anisocytosis) in RBC size and/or variation in shape (poikilocytosis) may cause an increase in the RDW).
[00360] In some embodiments of the compositions, methods, and kits described herein, additional factors can be used to enhance treatment methods using the iHSCs described herein, such as G-CSF, e.g. as described in U.S. Patent No. 5,582,823; AMD3100 (l,l[l,4-phenylene- bis(methylene)]-bis-l,4,8,ll-tetraazacyclotetradecane) , granulocyte -macrophage colony stimulating factor (GM-CSF), Interleukin- 1 (IL-I), Interleukin-3 (IL-3), Interleukin-8 (IL-8), PIXY-321 (GM- CSF/IL-3 fusion protein), macrophage inflammatory protein, stem cell factor (SCF), thrombopoietin, flt3, myelopoietin, anti-VLA-4 antibody, anti-VCAM-1 and growth related oncogene (GRO).
[00361] Provided herein, in some aspects are hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKN1C, DNMT3B, EGR1, ETV6,
EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISI, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
[00362] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEISI, and RBPMS.
[00363] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, and MEISI .
[00364] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
[00365] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, and LM02.
[00366] Also provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00367] a nucleic acid sequence encoding HLF;
[00368] a nucleic acid sequence encoding RUNXITI ;
[00369] a nucleic acid sequence encoding ZFP37;
[00370] a nucleic acid sequence encoding PBXl ;
[00371] a nucleic acid sequence encoding LM02; and
[00372] a nucleic acid sequence encoding PRDM5.
[00373] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducin compositions comprising one or more expression vectors comprising:
[00374] a nucleic acid sequence encoding HLF;
[00375] a nucleic acid sequence encoding RUNXITI ;
[00376] a nucleic acid sequence encoding ZFP37;
[00377] a nucleic acid sequence encoding PBXl ;
[00378] a nucleic acid sequence encoding LM02;
[00379] a nucleic acid sequence encoding PRDM5;
[00380] a nucleic acid sequence encoding MYCN; and
[00381] a nucleic acid sequence encoding MEISI .
[00382] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00383] a nucleic acid sequence encoding HLF;
[00384] a nucleic acid sequence encoding RUNX1T1 ;
[00385] a nucleic acid sequence encoding ZFP37;
[00386] a nucleic acid sequence encoding PBX1 ; and
[00387] a nucleic acid sequence encoding LM02;
[00388] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00389] a nucleic acid sequence encoding PRDM16;
[00390] a nucleic acid sequence encoding ZFP467; and
[00391] a nucleic acid sequence encoding VDR.
[00392] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00393] a nucleic acid sequence encoding HLF;
[00394] a nucleic acid sequence encoding RUNX1T1 ;
[00395] a nucleic acid sequence encoding PBX1 ;
[00396] a nucleic acid sequence encoding LM02;
[00397] a nucleic acid sequence encoding PRDM5
[00398] a nucleic acid sequence encoding ZFP37;
[00399] a nucleic acid sequence encoding I MYCN;
[00400] a nucleic acid sequence encoding MSI2;
[00401] a nucleic acid sequence encoding NKX2-3;
[00402] a nucleic acid sequence encoding MEIS1 ; and
[00403] a nucleic acid sequence encoding RBPMS.
[00404] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00405] a nucleic acid sequence encoding ZFP467;
[00406] a nucleic acid sequence encoding PBX1 ;
[00407] a nucleic acid sequence encoding HOXB4; and
[00408] a nucleic acid sequence encoding MSI2.
[00409] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00410] a nucleic acid sequence encoding HLF;
[00411] a nucleic acid sequence encoding LM02;
[00412] a nucleic acid sequence encoding PRDM16; and
[00413] a nucleic acid sequence encoding ZFP37.
[00414] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00415] a nucleic acid sequence encoding MYCN;
[00416] a nucleic acid sequence encoding MSI2;
[00417] a nucleic acid sequence encoding NKX2-3; and
[00418] a nucleic acid sequence encoding RUNX1T1.
[00419] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00420] a nucleic acid sequence encoding HOXB5;
[00421] a nucleic acid sequence encoding HLF;
[00422] a nucleic acid sequence encoding ZFP467;
[00423] a nucleic acid sequence encoding HOXB3;
[00424] a nucleic acid sequence encoding LM02;
[00425] a nucleic acid sequence encoding PBX1 ;
[00426] a nucleic acid sequence encoding ZFP37; and
[00427] a nucleic acid sequence encoding ZFP521.
[00428] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducin compositions comprising one or more expression vectors comprising:
[00429] a nucleic acid sequence encoding HOXB4;
[00430] a nucleic acid sequence encoding PBX1 ;
[00431] a nucleic acid sequence encoding LM02;
[00432] a nucleic acid sequence encoding ZFP467; and
[00433] a nucleic acid sequence encoding ZFP521.
[00434] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00435] a nucleic acid sequence encoding KLF12;
[00436] a nucleic acid sequence encoding HLF; and
[00437] a nucleic acid sequence encoding EGR1.
[00438] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00439] a nucleic acid sequence encoding MEIS 1 ;
[00440] a nucleic acid sequence encoding RBPMS;
[00441] a nucleic acid sequence encoding ZFP37;
[00442] a nucleic acid sequence encoding RUNX1T1 ; and
[00443] a nucleic acid sequence encoding LM02.
[00444] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00445] a sequence encoding KLF12; and
[00446] a sequence encoding HLF;
[00447] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising one or more expression vectors comprising:
[00448] a nucleic acid sequence encoding ZFP37;
[00449] a nucleic acid sequence encoding HOXB4;
[00450] a nucleic acid sequence encoding LM02; and
[00451] a nucleic acid sequence encoding HLF.
[00452] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more expression vectors comprising:
[00453] a nucleic acid sequence encoding MYCN;
[00454] a nucleic acid sequence encoding ZFP467;
[00455] a nucleic acid sequence encoding NKX2-3
[00456] a nucleic acid sequence encoding PBX1 ; and
[00457] a nucleic acid sequence encoding KLF4.
[00458] In some embodiments of these aspects and all such aspects described herein, the one or more expression vectors are retroviral vectors.
[00459] In some embodiments of these aspects and all such aspects described herein, the one or more expression vectors are lentiviral vectors. In some embodiments, the lentiviral vectors are inducible lentiviral vectors. In some embodiments, the lentiviral vectors are polycistronic inducible lentiviral vectors. In some embodiments, the polycistronic inducible lentiviral vectors express three or more nucleic acid sequences. In some embodiments, each of the nucleic acid sequences of the polycistronic inducible lentiviral vectors are separated by 2A peptide sequences.
[00460] Also provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising modified mRNA sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVIl, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3,
NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, ZFP612, and ZFP467, wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00461] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00462] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, and MEIS1.
[00463] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5.
[00464] In some embodiments of these aspects and all such aspects described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, and LM02.
[00465] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00466] a modified mRNA sequence encoding HLF;
[00467] a modified mRNA sequence encoding RUNXITI ;
[00468] a modified mRNA sequence encoding ZFP37;
[00469] a modified mRNA sequence encoding PBXl ;
[00470] a modified mRNA sequence encoding LM02; and
[00471] a modified mRNA sequence encoding PRDM5;
[00472] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00473] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00474] a modified mRNA sequence encoding HLF;
[00475] a modified mRNA sequence encoding RUNXITI ;
[00476] a modified mRNA sequence encoding ZFP37;
[00477] a modified mRNA sequence encoding PBXl ;
[00478] a modified mRNA sequence encoding LM02;
[00479] a modified mRNA sequence encoding PRDM5;
[00480] a modified mRNA sequence encoding MEIS1 ; and
[00481] a modified mRNA sequence encoding MYCN;
[00482] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00483] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00484] a modified mRNA sequence encoding HLF;
[00485] a modified mRNA sequence encoding RUNX1T1 ;
[00486] a modified mRNA sequence encoding ZFP37;
[00487] a modified mRNA sequence encoding PBX1 ; and
[00488] a modified mRNA sequence encoding LM02;
[00489] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00490] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00491] a modified mRNA sequence encoding PRDM16;
[00492] a modified mRNA sequence encoding ZFP467; and
[00493] a modified mRNA sequence encoding VDR;
[00494] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00495] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00496] a modified mRNA sequence encoding ! HLF;
[00497] a modified mRNA sequence encoding ; RU X1T1 ;
[00498] a modified mRNA sequence encoding ; PBX1;
[00499] a modified mRNA sequence encoding ; LM02;
[00500] a modified mRNA sequence encoding ; PRDM5
[00501] a modified mRNA sequence encoding ; ZFP37;
[00502] a modified mRNA sequence encoding ; MYCN;
[00503] a modified mRNA sequence encoding ; MSI2;
[00504] a modified mRNA sequence encoding ; NKX2-3;
[00505] a modified mRNA sequence encoding ; MEIS1 ; and
[00506] a modified mRNA sequence encoding ; RBPMS;
[00507] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00508] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00509] a modified mRNA sequence encoding ZFP467;
[00510] a modified mRNA sequence encoding PBX1 ;
[00511] a modified mRNA sequence encoding HOXB4; and
[00512] a modified mRNA sequence encoding MSI2;
[00513] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00514] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00515] a modified mRNA sequence encoding HLF;
[00516] a modified mRNA sequence encoding LM02;
[00517] a modified mRNA sequence encoding PRDMl 6; and
[00518] a modified mRNA sequence encoding ZFP37.
[00519] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00520] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00521] a modified mRNA sequence encoding MYCN;
[00522] a modified mRNA sequence encoding MSI2;
[00523] a modified mRNA sequence encoding NKX2-3; and
[00524] a modified mRNA sequence encoding RUNX1T1 ;
[00525] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00526] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00527] a modified mRNA sequence encoding HOXB5;
[00528] a modified mRNA sequence encoding HLF;
[00529] a modified mRNA sequence encoding ZFP467;
[00530] a modified mRNA sequence encoding HOXB3;
[00531] a modified mRNA sequence encoding LM02;
[00532] a modified mRNA sequence encoding PBX1 ;
[00533] a modified mRNA sequence encoding ZFP37; and
[00534] a modified mRNA sequence encoding ZFP521 ;
[00535] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00536] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00537] a modified mRNA sequence encoding HOXB4;
[00538] a modified mRNA sequence encoding PBX1 ;
[00539] a modified mRNA sequence encoding LM02;
[00540] a modified mRNA sequence encoding ZFP467; and
[00541] a modified mRNA sequence encoding ZFP521 ;
[00542] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00543] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00544] a modified mRNA sequence encoding KLF12;
[00545] a modified mRNA sequence encoding HLF; and
[00546] a modified mRNA sequence encoding EGR;
[00547] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00548] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00549] a modified mRNA sequence encoding MEIS 1 ;
[00550] a modified mRNA sequence encoding RBPMS;
[00551] a modified mRNA sequence encoding ZFP37;
[00552] a modified mRNA sequence encoding RUNX1T1 ; and
[00553] a modified mRNA sequence encoding LM02.
[00554] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00555] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00556] a modified mRNA sequence encoding KLF12; and
[00557] a modified mRNA sequence encoding HLF;
[00558] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00559] Provided herein, in some aspects, are hematopoietic stem cell (HSC) inducing compositions comprising
[00560] a modified mRNA sequence encoding ZFP37;
[00561] a modified mRNA sequence encoding HOXB4;
[00562] a modified mRNA sequence encoding LM02; and
[00563] a modified mRNA sequence encoding HLF;
[00564] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00565] In some embodiments of these aspects and all such aspects described herein, the composition further comprises one or more of:
[00566] a modified mRNA encoding MYCN;
[00567] a modified mRNA encoding ZFP467;
[00568] a modified mRNA encoding NKX2-3
[00569] a modified mRNA encoding PBX1 ; and
[00570] a modified mRNA encoding KLF4;
[00571] wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
[00572] In some embodiments of these aspects and all such aspects described herein, the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
[00573] In some embodiments of these aspects and all such aspects described herein, the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl -uridine, 1 -propynyl-pseudouridine, 5- taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl -uridine, 1 -methyl -pseudouridine, 4-thio-l-methyl- pseudouridine, 2-thio-l -methyl-pseudouridine, 1 -methyl- 1 -deaza-pseudouridine, 2-thio-l -methyl- 1 - deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4- acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-
cytidine, 4-thio-pseudoisocytidine, 4-thio-l -methyl -pseudoisocytidine, 4-thio-l -methyl- 1-deaza- pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5 -aza-2-thio -zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl- cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl -pseudoisocytidine, 2-aminopurine, 2,6- diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2- aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6- methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio- N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1 - methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl- guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2-methylguanosine, N2,N2- dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine, and combinations thereof.
[00574] Also provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00575] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
[00576] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00577] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00578] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding MYCN, wherein each said nucleic acid sequence is operably linked to a promoter; and
[00579] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00580] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00581] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and
[00582] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00583] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16 a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
[00584] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00585] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEISl ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00586] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00587] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00588] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00589] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00590] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic
acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[00591] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00592] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNXITI; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00593] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00594] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
[00595] Provided herein in some aspects, are methods for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00596] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00597] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00598] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[00599] Provided herein, in some aspects, are methods for preparing an induced
hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00600] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNXITI ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00601] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00602] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[00603] Provided herein, in some aspects, are methods for preparing an induced
hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00604] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00605] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00606] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
[00607] Provided herein, in some aspects, are methods for preparing an induced
hematopoietic stem cell (iHSC) from a somatic cell comprising:
[00608] transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00609] culturing the transduced somatic cell in a cell media that supports growth of hematopoietic stem cells, thereby preparing an iHSC.
[00610] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding KLF4.
[00611] In some embodiments of these aspects and all such aspects described herein, the somatic cell is a fibroblast cell.
[00612] In some embodiments of these aspects and all such aspects described herein, the somatic cell is a hematopoietic lineage cell.
[00613] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing
megakaryocytes, platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes, multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors.
[00614] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from a multi-potent progenitor cell (MPP), common myeloid progenitor cell (CMP), granulocyte-monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte-erythrocyte progenitor cell.
[00615] In some embodiments of these aspects and all such aspects described herein, the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro- dendritic cell (pro-DC), pre-granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro-mast cell (ProMC).
[00616] Also provided herein, in some aspects, are methods of promoting transdifferentiation of a ProPreB cell to the myeloid lineage comprising:
[00617] transducing a ProPreB cellwith one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00618] culturing the transduced ProPreB cell in a cell media that supports growth of myeloid lineage cells, thereby transdifferentiating the ProPreB cell to the myeloid lineage.
[00619] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[00620] Also provided herein, in some aspects, are methods of increasing survival and/or proliferation of ProPreB cells, comprising:
[00621] transducing a ProPreB cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and
[00622] culturing the transduced ProPreB cell in a cell media that supports growth of ProPreB cells, thereby increasing survival and/or proliferation of ProPreB cells.
[00623] In some embodiments of these aspects and all such aspects described herein, the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGRl .
[00624] Also provided herein, in some aspects, are isolated induced hematopoietic stem cells
(iHSCs) produced using any of the HSC inducing compositions or methods described herein.
[00625] In some aspects, provided herein are cell clones comprising a plurality of the induced hematopoietic stem cells (iHSCs) produced using any of the HSC inducing compositions or methods described herein. In some embodiments of these aspects and all such aspects described herein, the cell clones further comprise a pharmaceutically acceptable carrier.
[00626] Also provided herein, in some aspects, are kits for making induced hematopoietic stem cells (iHSCs), the kits comprising any of the HSC inducing compositions comprising one or more expression vector components described herein.
[00627] Provided herein, in some aspects, are kits for making induced hematopoietic stem cells (iHSCs), the kits comprising any of the HSC inducing compositions comprising modified mRNA sequence components described herein.
[00628]
[00629] Also provided herein, in some aspects, are kits comprising one or more of the HSC inducing factors described herein as components for the methods of making the induced
hematopoietic stem cells described herein.
[00630] Accordingly, in some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKNIC, DNMT3B, EGRl, ETV6, EVll, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, ZFP612, and ZFP467; and (b) packaging and instructions therefor.
[00631] In some embodiments of these kits and all such kits described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
[00632] In some embodiments of these kits and all such kits described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBXl, LM02, and PRDM5.
[00633] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5; and (b) packaging and instructions therefor.
[00634] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a nucleic acid sequence encoding PRDM16; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
[00635] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; and (b) packaging and instructions therefor.
[00636] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding PBXl ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; and (b) packaging and instructions therefor.
[00637] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a nucleic acid sequence encoding HLF; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
[00638] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNX1T1 ; and (b) packaging and instructions therefor.
[00639] In some embodiments of these kits and all such kits described herein, the kit further comprises a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF; a
nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBXl; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521.
[00640] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors composition comprising: a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBXl; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; and (b) packaging and instructions therefor.
[00641] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1.
[00642] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNXITI ; and a nucleic acid sequence encoding LM02; and (b) packaging and instructions therefor.
[00643] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of a sequence encoding KLF12; and a sequence encoding HLF.
[00644] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) one or more expression vectors comprising: a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; and (b) packaging and instructions therefor.
[00645] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBXl ; and a nucleic acid sequence encoding KLF4.
[00646] In some embodiments of these kits, the expression vector is a viral vector. In some embodiments of these kits, the viral vector is a retroviral vector, adenoviral vector, lentiviral vector, herpes virus vector, pox virus vector, or an adeno-associated virus (AAV) vector. In some embodiments, the expression vector is inducible.
[00647] Also provided herein, in some aspects, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) modified mRNA sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDKN1C,
DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEISl, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612, wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00648] In some embodiments of these kits and all such kits described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEISl, and RBPMS.
[00649] In some embodiments of these kits and all such kits described herein, the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5
[00650] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNXITI ; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding LM02; and a modified mRNA sequence encoding PRDM5; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00651] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA sequence encoding PRDM16; a modified mRNA sequence encoding ZFP467; and a modified mRNA sequence encoding VDR; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00652] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding RUNXITI ; a modified mRNA sequence encoding PBXl; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM5; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding MYCN; a modified mRNA sequence encoding MSI2; a modified mRNA sequence encoding NKX2-3; a modified mRNA sequence encoding MEISl ; and a modified mRNA sequence encoding RBPMS; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00653] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding ZFP467; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding HOXB4; and a modified mRNA sequence encoding MSI2; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00654] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PRDM16; and a modified mRNA sequence encoding ZFP37, wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00655] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding MYCN; a modified mRNA sequence encoding MSI2; a modified mRNA sequence encoding NKX2-3; and a modified mRNA sequence encoding RUNX1T1 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00656] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA sequence encoding HOXB5; a modified mRNA sequence encoding HLF; a modified mRNA sequence encoding ZFP467; a modified mRNA sequence encoding HOXB3; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding ZFP37; and a modified mRNA sequence encoding ZFP521 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00657] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding HOXB4; a modified mRNA sequence encoding PBXl ; a modified mRNA sequence encoding LM02; a modified mRNA sequence encoding ZFP467; and a modified mRNA sequence encoding ZFP521 ; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00658] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA sequence encoding KLF12;a modified mRNA sequence encoding HLF; and a modified mRNA sequence encoding EGR; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00659] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding MEIS1 ; a modified mRNA sequence encoding RBPMS; a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding RUNX1T1 ; and a modified mRNA sequence encoding LM02; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00660] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA sequence encoding KLF12; and a modified mRNA sequence encoding HLF; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00661] In some aspects, provided herein, are kits for preparing induced hematopoietic stem cells comprising the following components: (a) a modified mRNA sequence encoding ZFP37; a modified mRNA sequence encoding HOXB4; a modified mRNA sequence encoding LM02; and a modified mRNA sequence encoding HLF; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof; and (b) packaging and instructions therefor.
[00662] In some embodiments of these kits and all such kits described herein, the kit further comprises one or more of: a modified mRNA encoding MYCN; a modified mRNA encoding ZFP467; a modified mRNA encoding NKX2-3; a modified mRNA encoding PBX1 ; and a modified mRNA encoding KLF4; wherein each cytosine of each of the modified mRNA sequences is a modified cytosine, each uracil of each of the modified mRNA sequences is a modified uracil, or a combination thereof.
[00663] In some embodiments of these kits and all such kits described herein, the modified cytosine is 5-methylcytosine and the modified uracil is pseudouridine.
[00664] In some embodiments of these kits and all such kits described herein, one or more of the synthetic, modified mRNAs can further comprise one or more of a poly(A) tail, a Kozak sequence, a 3' untranslated region, a 5' untranslated regions, and a 5' cap, such as 5' cap analog, such as e.g., a
5' diguanosine cap, tetraphosphate cap analogs having a methylene -bis(phosphonate) moiety , cap analogs having a sulfur substitution for a non-bridging oxygen, N7-benzylated dinucleoside tetraphosphate analogs, or anti-reverse cap analogs. The kits can also comprise a 5' cap analog. The kit can also comprise a phosphatase enzyme (e.g., Calf intestinal phosphatase) to remove the 5' triphosphate during the RNA modification procedure. Optionally, the kit can comprise one or more control synthetic mRNAs, such as a synthetic, modified RNA encoding green fluorescent protein (GFP) or other marker molecule.
[00665] In other embodiments, the kit can further comprise materials for further reducing the innate immune response of a cell. For example, the kit can further comprise a soluble interferon receptor, such as B 18R. In some embodiments, the kit can comprise a plurality of different synthetic, modified RNA molecules.
[00666] The kits described herein can also comprise, in some aspects, one or more linear
DNA templates for the generation of synthetic mRNAs encoding the HSC inducing factors described herein.
[00667] The kits described herein, in some embodiments, can further provide the synthetic mRNAs or the one or more expression vectors encoding HSC inducing factors in an admixture or as separate aliquots.
[00668] In some embodiments, the kits can further comprise an agent to enhance efficiency of reprogramming. In some embodiments, the kits can further comprise one or more antibodies or primer reagents to detect a cell-type specific marker to identify cells induced to the hematopoietic stem cell state.
[00669] In some embodiments, the kits can further comprise a buffer. In some such embodiments, the buffer is RNase-free TE buffer at pH 7.0. In some embodiments, the kit further comprises a container with cell culture medium.
[00670] All kits described herein can further comprise a buffer, a cell culture medium, a transduction or transfection medium and/or a media supplement. In preferred embodiments, the buffers, cell culture mediums, transfection mediums, and/or media supplements are DNAse and RNase-free. In some embodiments, the synthetic, modified RNAs provided in the kits can be in a non- solution form of specific quantity or mass, e.g., 20 μg, such as a lyophilized powder form, such that the end-user adds a suitable amount of buffer or medium to bring the components to a desired concentration, e.g., 100 ng/μΐ.
[00671] All kits described herein can further comprise devices to facilitate single- administration or repeated or frequent infusions of the cells generated using the kits components described herein, such as a non-implantable delivery device, e.g., needle, syringe, pen device, or an
implantatable delivery device, e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir. In some such embodiments, the delivery device can include a mechanism to dispense a unit dose of a pharmaceutical composition comprising the iHSC clone. In some embodiments, the device releases the composition continuously, e.g., by diffusion. In some embodiments, the device can include a sensor that monitors a parameter within a subject. For example, the device can include pump, e.g., and, optionally, associated electronics.
[00672] The induced hematopoietic stem cells in some aspects of all the embodiments of the invention, while similar in functional characteristics, differ significantly in their gene expression or methylation pattern from the naturally occurring endogenous hematopoietic stem cells. For example, compared to the endogenous HSC gene expression pattern, exemplary genes of which are shown in Tables 2 and 3, the induced hematopoietic stem cells differ by showing about 1-5%, 5-10%, 5-15%, or 5-20%) increased expression of about 1-5%, 2-5%, 3-5%, up to 50%, up to 40%, up to 30%, up to 25%), up to 20%), up to 15%), or up to 10% of the genes in endogenous HSCs, for example, those set forth in Tables 2 and 3. Specifically, the expression in the iHSCs of genes the expression of which is reduced or insignificant in the naturally occurring HSCs (see, selected examples in Table 2), is increased or the expression of the genes the expression of which is significant in the naturally occurring HSCs (see, selected examples of highly expressed genes in isolated HSCs in Table 3) is decreased in iHSCs.
[00673] In some aspects of all the embodiments of the invention, while similar in functional characteristics, the induced pluripotent stem cells differ significantly in their methylation pattern from the naturally occurring or endogenous HSCs. For example, compared to the endogenous methylation pattern of genes as exemplified in Table 4, the iHSCs differ by showing about 1 -5%, in some aspects 1-10%), in some aspects 5-10% difference in the methylation of at about 1-5%, 1-10%, 5-10%, up to 50%), up to 40%), up to 30%), up to 25%, up to 20%, up to 15%, or up to 10% of the methylation sites of naturally occurring HSCs, which are exemplified in Table 4. The difference may be increased or decreased methylation compared to endogenous HSCs. In some aspects, some methylation sites are methylated and some unmethylated in iHSCs compared to the endogenous HSCs methylation sites as exemplified in Table 4.
[00674] Table 4 includes 35 exemplary profiles from each chromosome (1-19, x and y) as profiled in naturally occurring or endogenous HSCs. The screening was done by randomizing the most and least methylated sites (i.e. the top/bottom 20%) where 100 were taken from each group (except the Y chromosome which had a very small number of sites and only 35 random sites were selected). Of the mid (20-80%) percentiles, 3000 methylation sites were randomly selected. From this pool of 3000 sites, 35 methylation sites were randomly selected. These examples were selected to
represent the methylation status of the entire chromosome but enrich for those mid-range sites of methylation which, without wishing to be bound by theory, may be more characteristic of the naturally occurring HSC.
HSC expression analysis
[00675] Genome -wide gene expression analysis was performed on purified LSKCD34-Flk2- using the Affymetrix GeneChip Mouse Genome 430 2.0 Array platform. RNA was isolated using TRIzol (Life Technologies) and purified RNA was amplified, labeled, hybridized, and scanned according to Affymetrix's. Raw data was normalized using gcRMA together with 383 other hematopoietic cell types. These data were log transformed and average of the four biological replicates of are presented as expression levels.
DNA methylation analysis of HSCs
[00676] RRBS libraries for DNA methylation analysis were prepared from 30 ng input DNA per biological replicate of LSKCD34-FLk2- HSCs following a published protocol (Gu et al Nat. Protoc, 6 (2011), pp. 468-481) and sequenced by the Broad Institute's Genome Sequencing Platform on Illumina Genome Analyzer II or HiSeq 2000 machines. Bioinformatic data processing and quality control were performed as described in Bock et al (Cell, 144 (2011), pp. 439-452). The raw sequencing reads were aligned using Maq's bisulfite alignment mode and DNA methylation calling was performed using custom software (Gu et al, Nat Methods 7(2010) 133-136). DNA methylation levels were calculated for 1-kilobase tiling regions throughout the genome as coverage-weighted means of the DNA methylation levels of individual CpGs. Only regions with at least two CpGs with at least 5 independent DNA methylation measurements per CpG were retained, giving rise to a list of genomic regions with high-confidence DNA methylation measurements. In the initial filtering step, all 1-kb tiles of DNA methylation were excluded for which the two biological replicates were not sufficiently consistent with each other. Any measurement was excluded if the absolute divergence between biological replicates exceeded 0.2 and if the relative divergence between biological replicates exceeded 0.05. These absolute thresholds were selected based on our previous experience with RRBS data analysis, and the relative thresholds were calculated such that the absolute and relative thresholds became equivalent for values close to the center of the spectrum, i.e. around 0.5. Identification of significant differentially methylated regions were based on the average DNA methylation difference between the biological replicates of two cell types, requiring a minimum absolute difference of 0.1 for 1-kb tiles, and a more stringent threshold of 0.2 for single CpGs. The relative difference thresholds were calculated from the absolute difference thresholds as described above. The combined use of
relative and absolute difference thresholds resulted in robust identification of relevant differences across the spectrum of genes and genomic regions with high, medium and low DNA methylation.
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1425808_a_at 4.65 Myocd
1425798_a_at 4.65 Recql
1425800_at 4.65 Rad9b
1425801_x_at 4.65 Cotll
1425802_a_at 4.65 Fcrla
1425803_a_at 4.65 Mbd2
1425804_at 4.65 Hmx2
1425806_a_at 4.65 Med21
1425807_at 4.65 BC021891
1425809_at 4.65 Fabp4
1425810_a_at 4.65 Csrpl
142581 l a at 4.65 Csrpl
1425812_a_at 4.65 Cacnalb
1425813_at 4.65 Pign
1425814_a_at 4.65 Calcrl
1425815_a_at 4.65 Hiram
1425816_at 4.65 Zfp287
1425817_a_at 4.65 Slc8al
1425818_at 4.65 4930520O04Rik
1425819_at 4.65 Zbtb7c
1425820_x_at 4.65 Gpatch4
1425821_at 4.65 Clcn7
1425822_a_at 4.65 Dtxl
1426032_at 4.65 Nfatc2
1425823_at 4.65 Cfhr2
1425825_at 4.65 Eml6
1425826_a_at 4.65 Sorbs 1
1425827_at 4.65 Nkx2-3
1425828_at 4.65 Nkx6-1
1425829_a_at 4.65 Steap4
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1425830_a_at 4.65 Cinp /// LOC640972
142583 l_at 4.65 ZfplOl
1425832_a_at 4.65 Cxcr6
1425833_a_at 4.65 Hpca
1425834_a_at 4.65 Gpam
1425835_a_at 4.65 Bbx
1425836_a_at 4.65 Limkl
1425837_a_at 4.65 Ccrn41
1425838_at 4.65 Atp9a
1425839_at 4.65 Fkbpl l
1425840_a_at 4.65 Sema3f
1425842_at 4.65 Edil3
1425843_at 4.65 Mrpl33
1425845_a_at 4.65 Shoc2
1425846_a_at 4.65 Calnl
1425848_a_at 4.65 Dusp26
1425849_at 4.65 Chrnb4
1425850_a_at 4.65 Nek6
1425851_a_at 4.65 Amigol
1425852_at 4.65 Catspergl
1425855_a_at 4.65 Crk
1425857_at 4.65 Fbxw9
1425858_at 4.65 Ube2m
1425859_a_at 4.65 Psmd4
1425861_x_at 4.65 Cacna2dl
1425863_a_at 4.65 Ptpro
1425864_a_at 4.65 Sores 1
1425865_a_at 4.65 Lig3
1425866_a_at 4.65 Plekha4
1425867_at 4.65 Plekha4
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1425868_at 4.65 Hist2h2bb
1425869_a_at 4.65 Psen2
1425870_a_at 4.65 Kcnip2
1425871_a_at 4.65 Igk-V28
1425874_at 4.65 Hoxcl3
1425875_a_at 4.65 Lepr
1425876_a_at 4.65 Glee
1425877_at 4.65 Hyal3
1425878_at 4.65 Cabp4
1425879_at 4.65 Zfp352
1425880_x_at 4.65 Zfp352
1425881_at 4.65 Psg28
1425882_at 4.65 Gdf2
1425883_at 4.65 Smg6
1425884_at 4.65 Rpf2
1425885_a_at 4.65 Kcnab2
1425888_at 4.65 Klral7
1425889_at 4.65 Wnt9a
1425890_at 4.65 Ly6i
1425891_a_at 4.65 Grtpl
1425893_a_at 4.65 Fhit
1425895_a_at 4.65 Idl
1425897_at 4.65 —
1425898_x_at 4.65 01fm3
1425899_a_at 4.65 Itsnl
1425901_at 4.65 Nfatc2
1425903_at 4.65 Sema6a
1425904_at 4.65 Satb2
1425905_at 4.65 —
1425906_a_at 4.65 Sema3e
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1425907_s_at 4.65 Amot
1425908_at 4.65 Gnbl
1425910_at 4.65 Dnajc2
142591 l a at 4.65 Fgfrl
1425912_at 4.65 Cepl64
1425913_a_at 4.65 Spats21
1425914_a_at 4.65 Armcxl
1425915_at 4.65 Slc26a8
1425916_at 4.65 Capn8
1425917_at 4.65 H28
1425918_at 4.65 —
1425919_at 4.65 Ndufal2
1425920_at 4.65 Cuedcl
1425921_a_at 4.65 1810055G02Rik
1425922_a_at 4.65 Mycn
1425923_at 4.65 Mycn
1425925_at 4.65 Fcamr
1425926_a_at 4.65 Otx2
1425927_a_at 4.65 Atf5
1425928_at 4.65 Xkr6
1425929_a_at 4.65 Rnfl4
142593 l a at 4.65 Arntl2
1425932_a_at 4.65 Celfl
1425934_a_at 4.65 B4galt4
1425935_at 4.65 Hspbl l
1425936_a_at 4.65 Ankmy2
1425937_a_at 4.65 Heximl
1425939_at 4.65 Rad50
1425940_a_at 4.65 Ssbp3
1425941_a_at 4.65 Fanci
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1425942_a_at 4.65 Gpm6b
1425943_at 4.65 Nmur2
1425944_a_at 4.65 Rad5113
1425945_at 4.65 Zfp626
1425946_at 4.65 Gstm7
1425947_at 4.65 Ifng
1425949_at 4.65 Slc25a30
1425950_at 4.65 Slcl7a9
1425951_a_at 4.65 Clec4n
1425952_a_at 4.65 Gcg
1425953_at 4.65 —
1425954_a_at 4.65 Apex2
1425955_at 4.65 Cav2
1425958_at 4.65 Illf9
1425959_x_at 4.65 Klral6
1425960_s_at 4.65 Pax6
1425962_at 4.65 Klrblf
1425963_at 4.65 Cabp7
1425964_x_at 4.65 Hspbl
1425965_at 4.65 Ubc
1425966_x_at 4.65 Ubc
1425967_a_at 4.65 Mcpt4
1425968_s_at 4.65 Speg
1425969_a_at 4.65 Htt
1425970_a_at 4.65 Rosl
1425971_at 4.65 Naip3
1425972_a_at 4.65 Zfx
1425973_at 4.65 Lyst
1425975_a_at 4.65 Mapk8ip3
1426023_a_at 4.65 Rabepl
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1426024_a_at 4.65 Dbnl
1426025_s_at 4.65 Laptm5
1425976_x_at 4.65 Zfp353
1425977_a_at 4.65 Slk
1425979_a_at 4.65 Fbfl
1425980_at 4.65 Wdr54
1425981_a_at 4.65 Rbl2
1425983_x_at 4.65 Hipk2
1425985_s_at 4.65 Maspl
1425986_a_at 4.65 Dcunldl
1425987_a_at 4.65 Kcnmal
1425988_a_at 4.65 Hipkl
1425989_a_at 4.65 Eya3
1425990_a_at 4.65 Nfatc2
1425991_a_at 4.65 Kank2
1425992_at 4.65 Slc6a5
1425994_a_at 4.65 Asah2
1425995_s_at 4.65 Wtl
1425996_a_at 4.65 Hltf
1425997_a_at 4.65 Pign
1425998_at 4.65 Sytl4
1426001 at 4.65 Eomes
1426004_a_at 4.65 Tgm2
1426005_at 4.65 Dmpl
1426006_at 4.65 Kcnq2
1426008_a_at 4.65 Slc7a2
1426009_a_at 4.65 Pip5kla
1426010_a_at 4.65 Epb4.113
142601 l a at 4.65 Ggnbp2
1426012_a_at 4.65 2610301G19Rik
Table 2. Examples of transcripts showing reduced/insignificant expression in endogenous HSCs
Probeset Expression (Average of 4 Gene Symbol
datasets of purified HSCs)
1426013_s_at 4.65 Plekha4
1426014_a_at 4.65 Cdhr5
1426017_a_at 4.65 061001 lL14Rik
1426018_a_at 4.65 Sox6
1426019_at 4.65 Plaa
142602 l a at 4.65 Cdc7
1426022_a_at 4.65 Vill
1426026_at 4.65 Prpf6
1426027_a_at 4.65 ArhgaplO
1426028_a_at 4.65 Cit
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1422398_at 58720.84 Histlhle
1421896_at 58579.47 Elkl
1423355_at 57569.64 Snap29
1420529_at 57554.85 Dpfl
1423240_at 57379.26 Src
142141 O a at 56489.03 Pstpip2
1421584_at 54335.88 Opn4
1420202_at 54182.06 —
1422376_at 54014.33 Vmnlr50
1423848_at 53959.70 Mphosph6
1422416_s_at 53943.95 Vprebl /// Vpreb2
1423907_a_at 53750.78 Ndufs8
1419015_at 52526.85 Wisp2
1422702_at 52048.42 Azinl
1423817_s_at 51920.82 Usel
1422664_at 51789.77 RablO
1421988_at 51730.79 Papss2
1420092_at 51443.43 Morc3
1419919_at 50903.42 —
1423493_a_at 50864.75 Nfix
1420517_at 49770.55 Chmp4c
1422490_at 49492.67 Bnip2
1423805_at 49225.38 Dab2
1421893_a_at 49082.98 Tpp2
1422607_at 48373.32 Etvl
1422808_s_at 48260.89 Dock2
1423728_at 47793.86 Eif31
1422634_a_at 47057.45 Vsig2
1423415_at 46829.97 Gpr83
1423774_a_at 46597.55 Prcl
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1421205_at 46410.24 Atm
1422725_at 46373.82 Mak
1422876_at 46000.03 Capn9
1420030_at 45773.96 Slu7
1423082_at 45717.01 Derll
1424369_at 45609.09 Psmfl
1424432_at 45430.90 Ubtdl
1421578_at 45382.12 Ccl4
1422729_at 45325.62 Pcdhbl O
1424004_x_at 45166.17 4930444A02Rik
1419676_at 45159.39 Mx2
1422946_a_at 45067.84 Dnmtl
1420200_at 44965.21 —
1421868_a_at 44891.20 Pnlip
1420217_x_at 44808.32 —
1419864_x_at 44771.30 Tnpol
1432675_at 44721.78 Mdnl
2310003F16Rik ///
1423206_s_at 44538.34
Serf2
1423402_at 44427.28 Crebl
1420539_a_at 43572.89 Chrdl2
1423072_at 43569.21 6720475J19Rik
1423348_at 43334.95 Fzd8
1422152_at 43301.54 Hmxl
1420955_at 42958.08 Vsnll
1422534_at 42719.81 Cyp51
1421514_a_at 42690.03 Scml2
1420573_at 42424.32 Hoxdl
1422139_at 42321.56 Plau
1423193_at 42255.15 Pspcl
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1422949_at 41969.65 Nosl
1422585_at 41579.30 Odfl
1421685_at 41540.59 Clec4bl
1421144_at 41368.55 Rpgripl
1422038_a_at 41364.86 Tnfrsf22
1425165_at 41318.16 Gzmn
1425101_a_at 41263.26 Fkbp6
1421858_at 40782.82 Adaml7
1424361 at 40305.18 Tti2
1432026_a_at 39842.37 Herc6
1421877_at 39450.73 Mapk9
1424168_a_at 39344.00 Capzb
1423746_at 39125.86 Txndc5
1421784_a_at 39087.91 Efna4
1422216_at 38969.12 Mid2
1437495_at 38891.23 Mbtps2 /// Yy2
1422193_at 38621.58 Gucy2e
1424209_at 38397.04 Rars2
1421734_at 38265.53 Cxcr2
1422764_at 38046.45 Maprel
1422461 at 37752.66 Atad3a
1422319_at 37656.70 —
1421828_at 37384.32 Kpna3
1422947_at 37379.83 Histlh4a
1417187_at 37147.52 Ube2k
1420237_at 37138.69 —
1421111_at 37129.17 Rybp
1421762_at 36844.59 Kcnj5
1425001_at 36814.72 Rnfl46
1422763_at 36738.09 Gipcl
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1421198_at 36633.80 Itgav
1423022_at 36619.85 Adra2a
1425460_at 36318.33 Mtmr2
1423718_at 35541.24 Ak3
1424746_at 35456.02 Kiflc
142279 l_at 35371.28 Pafahlb2
1443492_at 35208.55 —
1422154_at 35197.92 Gpr27
1423232_at 35156.06 Etv4
1434987_at 34983.28 Aldh2
1421928_at 34894.19 Epha4
1421276_a_at 34783.78 Dst
1418807_at 34723.24 3110070M22Rik
1421357_at 34509.96 Gtf2al
1420450_at 33787.26 Mm lO
1425562_s_at 33760.26 Trntl
1422137_at 33732.68 Duoxa2
1420882_a_at 33268.28 Acd
1420792_at 32727.55 4930433N12Rik
1428618_at 32608.49 Hcfc2
1423324_at 32498.13 Pnn
1421066_at 32380.36 Jak2
1421767_at 32357.95 Adk
1423465_at 32223.80 Frrsl
1420412_at 32006.60 TnfsflO
1422403_at 31627.13 Gml2597
1420644_a_at 31555.81 Sec61a2
1424157_at 31355.35 Ehd2
1425678_a_at 31211.98 Snrk
1419171_at 30993.36 Faml74a
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1424059_at 30975.22 Suv420h2
1423390_at 30941.65 Siahla
1430244_at 30636.46 4921509J17Rik
1424356_a_at 30596.60 Metrnl
1422035_at 30526.30 Serpinb9c
1424763_at 30455.13 Rsph9
1420242_at 30259.70 —
1423292_a_at 30255.63 Prx
1425719_a_at 30011.99 Nmi
1422891_at 29811.27 H2-Ea-ps
1433073_at 29755.02 4933425E08Rik
1424874_a_at 29586.89 Ptbpl
1421795_s_at 29485.47 Klrc2 /// Klrc3
1424781_at 29441.10 Reep3
1420106_at 29316.87 Siahla
1423735_a_at 29115.24 Wdr36
1421132_at 28979.38 Pvrl3
1423440_at 28884.32 Fam33a
1424619_at 28807.35 Sf3b4
1420359_at 28678.72 Sva
1422121_at 28666.64 Oprdl
1424773_at 28663.97 Faml25a
1422217_a_at 28522.13 Cyplal
1419908_at 28487.43 Fcrla
1416576_at 27695.03 Socs3
1422574_at 27639.56 Mxd4
Gemin4 /// Glod4
1433622_at 27471.80
/// Gm6330
1438263_at 27434.33 9430020K01Rik
1425220_x_at 27306.78 LOC100038937
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1422454_at 27268.17 Krtl3
1422240_s_at 26926.68 Sprr2h
1433942_at 26894.49 Myo6
1437613_s_at 26870.76 Ptpdcl
1418969_at 26582.64 Skp2
1421818_at 26510.49 Bcl6
1422017_s_at 26492.47 4833439L19Rik
1422088_at 26321.36 Mycll
142491 l a at 26252.42 Lyzl4
1415812_at 26042.95 Gsn
1422592_at 25974.74 Ctnnd2
1421422_at 25602.36 503341 lD12Rik
142251 l a at 25483.54 Ogfr
1432823_at 25438.68 Sypl2
142121 l a at 25380.22 Ciita
1416578_at 25267.25 Gm9840 /// Rbxl
1425535_at 25144.30 Repinl
1420466_at 25061.79 Mucll
1437720_at 24921.64 Eif2d
1422435_at 24867.70 2210010C04Rik
1420648_at 24760.09 Triml2a
1421382_at 24658.48 Prlr
1416404_s_at 24652.70 Rpsl6
1424118_a_at 24646.84 Spc25
1425180_at 24391.49 Sgipl
142262 l_at 24276.19 Ranbp2
1421265_a_at 24108.68 Rbm38
1423590_at 23955.37 Napsa
1431842_at 23948.99 4930422C21Rik
1428567_at 23851.44 Hspbapl
Table 3. Examples of transcripts showing expression/significant expression in endogenous HSCs
Expression (Average of 4 datasets of purified
Probeset Gene Symbol
HSCs)
1424928_at 23715.06 2210018Ml lRik
1421894_a_at 23697.49 Tpp2
1420489_at 23628.96 Mrpsl4
1425406_at 23574.24 Clec4a2
1419907_s_at 23407.93 Fcrla
1421139_a_at 23222.94 Zfp386
1420219_at 23098.02 Dnajc21
1420714_at 23021.11 Lbx2
1419571_at 23014.90 Slc28a3
1424501_at 22942.41 Utp6
1423777_at 22813.47 Usp20
1424712_at 22776.38 Ahctfl
1421693_a_at 22651.12 Gpr98
1437991_x_at 22601.85 Ruscl
1418666_at 22593.56 Ptx3
1420348_at 22525.87 Lhx5
1422735_at 22457.19 Foxql
1424455_at 22297.49 Gpraspl
1420446_at 22176.11 Odf3
1420207_at 22023.74 —
1421363_at 21974.00 Cyp2c39
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl 38011000 38012000 34914 Lyg2 ENSMUSG00000061584 0.612 chrl 36290000 36291000 33193 Hs6stl ENSMUSG00000045216 0.522 chrl 91946000 91947000 86834 Asbl 8 ENSMUSG00000067081 0.576 chrl 91825000 91826000 86713 Aga l ENSMUSG00000055013 0.365 chrl 12966000 12967000 9967 Sulfl ENSMUSG00000016918 0.596 chrl 191714000 191715000 186062 Ptpnl4 ENSMUSG00000026604 0.994 chrl 94962000 94963000 89850 Aqpl2 ENSMUSG00000045091 0.604 chrl 36355000 36356000 33258 Neurl3 ENSMUSG00000047180 0.539 chrl 34593000 34594000 31496 Cfcl ENSMUSG00000026124 0.211 chrl 185803000 185804000 180151 Tlr5 ENSMUSG00000079164 0.213 chrl 74195000 74196000 71098 Rufy4 ENSMUSG00000061815 0.610 chrl 90736000 90737000 85624 Arl4c ENSMUSG00000049866 0.653 chrl 191658000 191659000 186006 Ptpnl4 ENSMUSG00000026604 0.974 chrl 191661000 191662000 186009 Ptpnl4 ENSMUSG00000026604 0.968 chrl 38579000 38580000 35482 Revl ENSMUSG00000026082 0.969 chrl 127809000 127810000 122697 Lypdl ENSMUSG00000026344 0.213 chrl 25234000 25235000 22137 Lmbrdl ENSMUSG00000073725 0.550 chrl 191952000 191953000 186300 Smyd2 ENSMUSG00000026603 0.658 chrl 91954000 91955000 86842 Asbl 8 ENSMUSG00000067081 0.980 chrl 188658000 188659000 183006 Rrpl5 ENSMUSG00000001305 0.000 chrl 34308000 34309000 31211 Dst ENSMUSG00000026131 0.365 chrl 137815000 137816000 132703 Pkpl ENSMUSG00000026413 0.035 chrl 191583000 191584000 185931 Ptpnl4 ENSMUSG00000026604 0.979 chrl 14812000 14813000 11813 Msc ENSMUSG00000025930 0.587 chrl 94547000 94548000 89435 Otos ENSMUSG00000044055 0.795 chrl 36327000 36328000 33230 Uggtl ENSMUSG00000037470 0.150 chrl 90701000 90702000 85589 Arl4c ENSMUSG00000049866 0.893 chrl 40212000 40213000 37115 Illr2 ENSMUSG00000026073 0.970 chrl 140473000 140474000 135361 Atp6vlg3 ENSMUSG00000026394 0.599 chrl 90565000 90566000 85453 Glrpl ENSMUSG00000062310 0.564
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl 51516000 51517000 48419 Sdpr ENSMUSG00000045954 0.707 chr2 163597000 163598000 351938 Ada ENSMUSG00000017697 0.588 chr2 29297000 29298000 217736 Med27 ENSMUSG00000026799 0.969 chr2 170120000 170121000 358461 ENSMUSG00000084013 0.640 chr2 170332000 170333000 358673 Cyp24al ENSMUSG00000038567 0.553 chr2 63809000 63810000 252199 ENSMUSG00000065837 0.612 chr2 143610000 143611000 331951 Pcsk2 ENSMUSG00000027419 0.894 chr2 163321000 163322000 351662 R3hdml ENSMUSG00000078949 0.795 chr2 147874000 147875000 336215 Foxa2 ENSMUSG00000037025 0.030 chr2 151719000 151720000 340060 Rspo4 ENSMUSG00000032852 0.482 chr2 170107000 170108000 358448 Zfp217 ENSMUSG00000052056 0.650 chr2 101484000 101485000 289874 ENSMUSG00000027165 0.969 chr2 157964000 157965000 346305 Rprdlb ENSMUSG00000027651 0.974 chr2 162773000 162774000 351114 L3mbtl ENSMUSG00000035576 0.573 chr2 82981000 82982000 271371 ENSMUSG00000075248 0.640 chr2 165999000 166000000 354340 Sulf2 ENSMUSG00000006800 0.795 chr2 29061000 29062000 217500 Setx ENSMUSG00000043535 0.622 chr2 173161000 173162000 361500 Pmepal ENSMUSG00000038400 0.036 chr2 92582000 92583000 280972 Chstl ENSMUSG00000027221 0.381 chr2 160803000 160804000 349144 Emilin3 ENSMUSG00000050700 0.976 chr2 57034000 57035000 245473 Nr4a2 ENSMUSG00000026826 0.002 chr2 153116000 153117000 341457 Pofutl ENSMUSG00000046020 0.510 chr2 37898000 37899000 226337 Crb2 ENSMUSG00000035403 0.971 chr2 78788000 78789000 267178 Ube2e3 ENSMUSG00000027011 0.640 chr2 152737000 152738000 341078 Mylk2 ENSMUSG00000027470 0.465 chr2 127978000 127979000 316319 Bcl2111 ENSMUSG00000027381 0.532 chr2 34060000 34061000 222499 Faml25b ENSMUSG00000038740 0.990 chr2 38079000 38080000 226518 Crb2 ENSMUSG00000035403 0.621 chr2 152831000 152832000 341172 Ttll9 ENSMUSG00000074673 0.971 chr2 151272000 151273000 339613 ENSMUSG00000083391 0.645
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr2 32730000 32731000 221169 Stxb l ENSMUSG00000026797 0.115 chr2 35302000 35303000 223741 Ggtal ENSMUSG00000035778 0.402 chr2 173251000 173252000 361590 Pmepal ENSMUSG00000038400 0.643 chr2 26338000 26339000 214777 Secl6a ENSMUSG00000026924 0.530 chr2 131778000 131779000 320119 Prnd ENSMUSG00000027338 0.131 chr2 26436000 26437000 214875 Egfl7 ENSMUSG00000026921 0.641 chr3 102264000 102265000 469052 Vangll ENSMUSG00000027860 0.600 chr3 149018000 149019000 515708 Gm5149 ENSMUSG00000069803 0.894 chr3 98205000 98206000 464993 Zfp697 ENSMUSG00000050064 0.830 chr3 130829000 130830000 497568 Lefl ENSMUSG00000027985 0.973
ENSMUSG00000078549, chr3 99341000 99342000 466129 M6pr-ps ENSMUSG00000080832 0.648 chr3 154140000 154141000 520830 Lhx8 ENSMUSG00000028201 0.489 chr3 68330000 68331000 435118 Schipl ENSMUSG00000027777 0.540 chr3 50817000 50818000 417605 Slc7al l ENSMUSG00000027737 0.973 chr3 152572000 152573000 519262 Pigk ENSMUSG00000039047 0.655 chr3 159417000 159418000 526107 Rpe65 ENSMUSG00000028174 0.887 chr3 96723000 96724000 463511 Gpr89 ENSMUSG00000028096 0.780 chr3 97116000 97117000 463904 Bcl9 ENSMUSG00000038256 0.519 chr3 38101000 38102000 404942 ENSMUSG00000064315 0.211 chr3 149189000 149190000 515879 Gm5149 ENSMUSG00000069803 0.979 chr3 45185000 45186000 412022 PcdhlO ENSMUSG00000049100 0.035 chr3 102460000 102461000 469248 Ngf ENSMUSG00000027859 0.781 chr3 51629000 51630000 418417 Maml3 ENSMUSG00000061143 0.978 chr3 96493000 96494000 463281 Ankrd35 ENSMUSG00000038354 0.385 chr3 129255000 129256000 495994 Elovl6 ENSMUSG00000041220 0.201 chr3 44165000 44166000 411002 D3Ertd751e A,ENSMUSG00000025766 0.990 chr3 130507000 130508000 497246 Rpl34 ENSMUSG00000062006 0.366 chr3 130921000 130922000 497660 Lefl ENSMUSG00000027985 0.380 chr3 153483000 153484000 520173 ENSMUSG00000062046 0.968
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr3 96332000 96333000 463120 Hfe2 ENSMUSG00000038403 0.566 chr3 41372000 41373000 408209 Phfl7 ENSMUSG00000025764 0.980 chr3 68780000 68781000 435568 ENSMUSG00000046999 0.969 chr3 63843000 63844000 430631 Gmps ENSMUSG00000027823 0.061 chr3 41391000 41392000 408228 Phfl7 ENSMUSG00000025764 0.096 chr3 68524000 68525000 435312 1112a ENSMUSG00000027776 0.614 chr3 8717000 8718000 375607 Heyl ENSMUSG00000040289 0.114 chr3 43890000 43891000 410727 D3Ertd751e A,ENSMUSG00000025766 0.975 chr3 53171000 53172000 419959 Lhfp ENSMUSG00000048332 0.781 chr3 51163000 51164000 417951 Elf2 ENSMUSG00000037174 0.124 chr3 51001000 51002000 417789 Slc7al l ENSMUSG00000027737 0.578 chr3 102264000 102265000 469052 Vangll ENSMUSG00000027860 0.600 chr4 109103000 109104000 632057 Ttc39a ENSMUSG00000028555 0.531
ENSMUSG00000061903, chr4 71043000 71044000 594086 ENSMUSG00000083914 1.000 chr4 62267000 62268000 585310 Rgs3 ENSMUSG00000059810 0.536 chr4 116947000 116948000 639901 Tmem53 ENSMUSG00000048772 0.968 chr4 82154000 82155000 605197 Nfib ENSMUSG00000008575 0.614 chr4 47445000 47446000 570636 Tgfbrl ENSMUSG00000007613 0.968
ENSMUSG00000047675, chr4 116828000 116829000 639782 Rps8 ENSMUSG00000064457 0.077 chr4 113690000 113691000 636644 Skint5 ENSMUSG00000078598 0.655 chr4 138656000 138657000 661461 Nbll ENSMUSG00000041120 0.982 chr4 137949000 137950000 660754 Cda ENSMUSG00000028755 0.707 chr4 47398000 47399000 570589 Tgfbrl ENSMUSG00000007613 0.977
ENSMUSG00000028617, chr4 106926000 106927000 629880 Hspbl l ENSMUSG00000063172 0.031 chr4 154374000 154375000 676931 Pank4 ENSMUSG00000029056 0.640 chr4 116976000 116977000 639930 Rnf220 ENSMUSG00000028677 0.473 chr4 137307000 137308000 660112 Rap 1 gap ENSMUSG00000041351 0.347
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr4 116951000 116952000 639905 Tmem53 ENSMUSG00000048772 0.893 chr4 138649000 138650000 661454 Nbll ENSMUSG00000041120 0.474 chr4 115825000 115826000 638779 Pomgntl ENSMUSG00000028700 0.984 chr4 149287000 149288000 671844 Spsbl ENSMUSG00000039911 0.584 chr4 47014000 47015000 570205 Gabbr2 ENSMUSG00000039809 0.492 chr4 153893000 153894000 676450 Arhgefl6 ENSMUSG00000029032 0.043 chr4 116985000 116986000 639939 Rnf220 ENSMUSG00000028677 0.602 chr4 62847000 62848000 585890 Kifl2 ENSMUSG00000028357 0.105 chr4 141376000 141377000 664181 Casp9 ENSMUSG00000028914 0.976 chr4 119963000 119964000 642917 Foxo6 ENSMUSG00000052135 0.492 chr4 52456000 52457000 575647 Smc2 ENSMUSG00000028312 0.971 chr4 137218000 137219000 660023 Usp48 ENSMUSG00000043411 0.593 chr4 46837000 46838000 570028 Gabbr2 ENSMUSG00000039809 0.344 chr4 140221000 140222000 663026 ArhgeflOl ENSMUSG00000040964 0.582 chr4 150263000 150264000 672820 Errfil ENSMUSG00000028967 0.589 chr4 46606000 46607000 569797 Coro2a ENSMUSG00000028337 0.654 chr4 138060000 138061000 660865 Camk2nl ENSMUSG00000046447 0.536 chr4 155029000 155030000 677586 Mmp23 ENSMUSG00000029061 0.178 chr4 107243000 107244000 630197 Glisl ENSMUSG00000034762 0.548 chr4 150514000 150515000 673071 Camtal ENSMUSGOOOOOO 14592 0.114 chr5 44595000 44596000 718679 Proml ENSMUSG00000029086 0.606 chr5 66887000 66888000 740971 Apbb2 ENSMUSG00000029207 0.972 chr5 122493000 122494000 796432 ENSMUSG00000072641 0.994 chr5 116454000 116455000 790393 Cit ENSMUSG00000029516 0.706 chr5 116427000 116428000 790366 Cit ENSMUSG00000029516 0.614 chr5 110977000 110978000 784951 Galnt9 ENSMUSG00000033316 0.519 chr5 110987000 110988000 784961 Galnt9 ENSMUSG00000033316 0.106 chr5 146283000 146284000 819726 Cyp3al6 ENSMUSG00000038656 0.781 chr5 140407000 140408000 814100 Elfhl ENSMUSG00000048988 0.517 chr5 151234000 151235000 824622 Fry ENSMUSG00000056602 0.975
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr5 66886000 66887000 740970 Apbb2 ENSMUSG00000029207 0.613 chr5 24096000 24097000 699235 Chpf2 ENSMUSG00000038181 0.538 chr5 140986000 140987000 814679 Chstl2 ENSMUSG00000036599 0.516 chr5 140449000 140450000 814142 Elfhl ENSMUSG00000048988 0.514 chr5 74283000 74284000 748367 Spatal 8 ENSMUSG00000029155 0.598 chr5 38746000 38747000 712830 Drd5 ENSMUSG00000039358 0.975 chr5 125772000 125773000 799620 Ncor2 ENSMUSG00000029478 0.968 chr5 75642000 75643000 749715 Pdgfra ENSMUSG00000029231 0.974 chr5 75356000 75357000 749429 Gm6116 ENSMUSG00000072874 0.380 chr5 66444000 66445000 740528 ENSMUSG00000054598 0.975 chr5 66141000 66142000 740225 Pds5a ENSMUSG00000029202 0.968 chr5 128822000 128823000 802670 Gltldl ENSMUSG00000049971 0.707 chr5 75544000 75545000 749617 Gsx2 ENSMUSG00000035946 0.089 chr5 29591000 29592000 703830 Rnf32 ENSMUSG00000029130 0.968 chr5 148458000 148459000 821851 Pan3 ENSMUSG00000029647 0.117 chr5 135031000 135032000 808854 Clip2 ENSMUSG00000063146 0.027 chr5 147572000 147573000 820965 Gprl2 ENSMUSG00000041468 0.971 chr5 125751000 125752000 799599 Ncor2 ENSMUSG00000029478 0.592 chr5 112852000 112853000 786826 Asphd2 ENSMUSG00000029348 0.516 chr5 116048000 116049000 789987 Gcnlll ENSMUSG00000041638 0.980 chr5 71808000 71809000 745892 Gabra2 ENSMUSG00000000560 0.894 chr5 129288000 129289000 803130 Piwill ENSMUSG00000029423 0.657 chr5 74256000 74257000 748340 Spatal 8 ENSMUSG00000029155 0.571 chr5 8930000 8931000 684118 Abcb4 ENSMUSG00000042476 0.970 chr5 36741000 36742000 710905 Sorcs2 ENSMUSG00000029093 0.129 chr6 113592000 113593000 936418 Irak2 ENSMUSG00000060477 0.612 chr6 35312000 35313000 858188 Faml 80a ENSMUSG00000047420 0.645 chr6 113622000 113623000 936448 Irak2 ENSMUSG00000060477 0.646 chr6 93644000 93645000 916470 ENSMUSG00000077180 0.984 chr6 71485000 71486000 894311 Rnfl03 ENSMUSG00000052656 0.976
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr6 56967000 56968000 879793 Vlrc20 ENSMUSG00000058923 0.646 chr6 114459000 114460000 937285 Hrhl ENSMUSG00000053004 0.606 chr6 52152000 52153000 874978 Hoxa3 ENSMUSG00000079560 0.894 chr6 114167000 114168000 936993 Slc6al l ENSMUSG00000030307 0.506 chr6 52140000 52141000 874966 Hoxa3 ENSMUSG00000079560 0.575 chr6 120083000 120084000 942909 Ninj2 ENSMUSG00000041377 0.981 chr6 114576000 114577000 937402 Hrhl ENSMUSG00000053004 0.655 chr6 91642000 91643000 914468 Slc6a6 ENSMUSG00000030096 0.974 chr6 113892000 113893000 936718 Atp2b2 ENSMUSG00000030302 0.619 chr6 115569000 115570000 938395 Mkrn2 ENSMUSG00000000439 0.147 chr6 88868000 88869000 911694 Tpral ENSMUSG00000002871 0.538 chr6 121007000 121008000 943833 ENSMUSG00000052437 0.984 chr6 93016000 93017000 915842 Adamts9 ENSMUSG00000030022 0.184 chr6 55531000 55532000 878357 Adcya lrl ENSMUSG00000029778 0.659 chr6 120015000 120016000 942841 Wnkl ENSMUSG00000045962 0.612 chr6 121857000 121858000 944683 Mugl ENSMUSG00000059908 0.641 chr6 120062000 120063000 942888 Ninj2 ENSMUSG00000041377 0.089 chr6 71930000 71931000 894756 Polrla ENSMUSG00000049553 0.581 chr6 113233000 113234000 936059 Cpne9 ENSMUSG00000030270 0.055 chr6 119270000 119271000 942096 Cacna2d4 ENSMUSG00000041460 0.509 chr6 95698000 95699000 918524 Suclg2 ENSMUSG00000061838 0.968 chr6 119076000 119077000 941902 Cacnalc ENSMUSG00000051331 0.980 chr6 114478000 114479000 937304 Hrhl ENSMUSG00000053004 0.595 chr6 120922000 120923000 943748 Bid ENSMUSG00000004446 0.970 chr6 90569000 90570000 913395 Slc41a3 ENSMUSG00000030089 0.536 chr6 37476000 37477000 860352 Creb312 ENSMUSG00000038648 0.567 chr6 92560000 92561000 915386 Prickle2 ENSMUSG00000030020 0.622 chr6 133994000 133995000 956820 Etv6 ENSMUSG00000030199 0.275 chr6 97236000 97237000 920062 Lmod3 ENSMUSG00000044086 0.970 chr6 114568000 114569000 937394 Hrhl ENSMUSG00000053004 0.587
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr7 63706000 63707000 1025546 Oca2 ENSMUSG00000030450 0.578 chr7 148203000 148204000 1109860 Ifitm6 ENSMUSG00000059108 0.255 chr7 80664000 80665000 1042454 Chd2 ENSMUSG00000025788 0.973 chr7 29529000 29530000 998369 Sars2 ENSMUSG00000070699 0.977 chr7 150661000 150662000 1112279 Slc22al 8 ENSMUSG00000000154 0.559 chr7 28261000 28262000 997101 Sertad3 ENSMUSG00000055200 0.978 chr7 138081000 138082000 1099817 Htral ENSMUSG00000006205 0.487 chr7 86133000 86134000 1047923 Isg20 ENSMUSG00000039236 0.977 chr7 25919000 25920000 994759 Pou2f2 ENSMUSG00000008496 0.512 chr7 135532000 135533000 1097268 BC017158 ENSMUSG00000030780 0.575 chr7 139909000 139910000 1101595 Lhpp ENSMUSG00000030946 0.566 chr7 64394000 64395000 1026234 Gabrg3 ENSMUSG00000055026 0.653 chr7 31251000 31252000 1000091 Nphsl ENSMUSG00000006649 0.115 chr7 137155000 137156000 1098891 Brwd2 ENSMUSG00000042055 0.564 chr7 30000000 30001000 998840 Catspergl ENSMUSG00000049676 0.539 chr7 30010000 30011000 998850 Catspergl ENSMUSG00000049676 0.579 chr7 52120000 52121000 1013960 Pnkp ENSMUSG00000002963 0.510 chr7 134528000 134529000 1096264 Zfp747 ENSMUSG00000054381 0.968 chr7 29957000 29958000 998797 Ggn ENSMUSG00000031493 0.652 chr7 118165000 118166000 1079901 Mrvil ENSMUSG00000005611 0.556 chr7 80522000 80523000 1042312 Rgma ENSMUSG00000070509 0.541 chr7 142677000 142678000 1104363 Foxi2 ENSMUSG00000048377 0.104 chr7 26388000 26389000 995228 Ceacam2 ENSMUSG00000054385 0.968 chr7 53048000 53049000 1014888 Lmtk3 ENSMUSG00000062044 0.658 chr7 52679000 52680000 1014519 Lhb ENSMUSG00000038194 0.968 chr7 25941000 25942000 994781 ENSMUSG00000074274 0.489 chr7 127450000 127451000 1089186 Abcal4 ENSMUSG00000062017 0.969 chr7 148124000 148125000 1109781 Nlrp6 ENSMUSG00000038745 0.579 chr7 148031000 148032000 1109688 Scgblcl ENSMUSG00000038801 0.362 chr7 72838000 72839000 1034628 Tm2d3 ENSMUSG00000078681 0.031
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr7 36472000 36473000 1005312 Pdcd5 ENSMUSG00000030417 0.213 chr7 52615000 52616000 1014455 Ppfia3 ENSMUSG00000003863 0.525 chr7 30719000 30720000 999559 Zfp27 ENSMUSG00000062040 0.981 chr7 52128000 52129000 1013968 Ptovl ENSMUSG00000038502 0.585 chr7 92172000 92173000 1053957 Vmn2r66 ENSMUSG00000072241 0.893 chr8 119062000 119063000 1226266 Dynlrb2 ENSMUSG00000034467 0.591 chr8 24265000 24266000 1133309 Nkx6-3 ENSMUSG00000063672 0.582 chr8 119147000 119148000 1226351 Cdyl2 ENSMUSG00000031758 0.969 chr8 18034000 18035000 1129177 Csmdl ENSMUSG00000060924 0.781 chr8 116490000 116491000 1223694 Adamtsl 8 ENSMUSG00000053399 0.609 chr8 119154000 119155000 1226358 Cdyl2 ENSMUSG00000031758 0.496 chr8 107998000 107999000 1215202 Tppp3 ENSMUSG00000014846 0.554 chr8 25462000 25463000 1134506 ENSMUSG00000053979 0.186 chr8 11605000 11606000 1122748 Ingl ENSMUSG00000045969 0.969 chr8 109135000 109136000 1216339 Cdhl ENSMUSG00000000303 0.596 chr8 117689000 117690000 1224893 Wwox ENSMUSG00000004637 0.077 chr8 109576000 109577000 1216780 Pdf ENSMUSG00000078931 0.971 chr8 11476000 11477000 1122619 Col4a2 ENSMUSG00000031503 0.048 chr8 28267000 28268000 1137311 Brf2 ENSMUSG00000031487 0.969 chr8 8319000 8320000 1119462 ENSMUSG00000077378 0.979 chr8 109363000 109364000 1216567 Tmco7 ENSMUSG00000041949 0.581 chr8 117268000 117269000 1224472 Wwox ENSMUSG00000004637 0.496 chr8 16794000 16795000 1127937 Csmdl ENSMUSG00000060924 0.980 chr8 109034000 109035000 1216238 Cdh3 ENSMUSG00000061048 0.036 chr8 26081000 26082000 1135125 Adam32 ENSMUSG00000037437 0.974 chr8 117123000 117124000 1224327 Wwox ENSMUSG00000004637 0.645 chr8 124847000 124848000 1232051 Zfpml ENSMUSG00000049577 0.641 chr8 117231000 117232000 1224435 Wwox ENSMUSG00000004637 0.344 chr8 109202000 109203000 1216406 Cdhl ENSMUSG00000000303 0.106 chr8 15029000 15030000 1126172 Kbtbdl l ENSMUSG00000055675 0.510
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr8 18751000 18752000 1129894 Angpt2 ENSMUSG00000031465 0.978 chr8 11464000 11465000 1122607 Col4a2 ENSMUSG00000031503 0.591 chr8 11421000 11422000 1122564 Col4a2 ENSMUSG00000031503 0.646 chr8 114534000 114535000 1221738 Kars ENSMUSG00000031948 0.000 chr8 119606000 119607000 1226810 Pkdll2 ENSMUSG00000034416 0.647 chr8 19090000 19091000 1130233 Defb39 ENSMUSG00000061847 0.795 chr8 12467000 12468000 1123610 Gm5607 ENSMUSG00000047935 0.532 chr8 108693000 108694000 1215897 Slc7a6 ENSMUSG00000031904 0.043 chr8 124579000 124580000 1231783 Banp ENSMUSG00000025316 0.662 chr8 125039000 125040000 1232243 Fam38a ENSMUSG00000014444 0.973 chr9 64478000 64479000 1300320 Megfl l ENSMUSG00000036466 0.780 chr9 5029000 5030000 1240972 Gria4 ENSMUSG00000025892 0.993 chr9 30371000 30372000 1266263 Snxl9 ENSMUSG00000031993 0.616 chr9 14477000 14478000 1250369 Amotll ENSMUSG00000013076 0.830 chr9 20712000 20713000 1256604 Eifig ENSMUSG00000070319 0.969 chr9 20548000 20549000 1256440 01fm2 ENSMUSG00000032172 0.183 chr9 78369000 78370000 1314211 Eeflal ENSMUSG00000037742 0.060 chr9 71465000 71466000 1307307 Gcoml ENSMUSG00000041361 0.588 chr9 98765000 98766000 1334495 ENSMUSG00000032460 0.488 chr9 54281000 54282000 1290123 Dmxl2 ENSMUSG00000041268 0.697 chr9 119542000 119543000 1355198 Scn5a ENSMUSG00000032511 0.533 chr9 26749000 26750000 1262641 Gml l lO ENSMUSG00000079644 0.548 chr9 27108000 27109000 1263000 Igsffib ENSMUSG00000034275 0.037 chr9 100740000 100741000 1336470 Stagl ENSMUSG00000037286 0.648 chr9 3199000 3200000 1239142 ENSMUSG00000042360 0.337 chr9 87134000 87135000 1322886 ENSMUSG00000056919 0.970 chr9 46251000 46252000 1282142 ENSMUSG00000056617 0.035 chr9 107803000 107804000 1343525 Monla ENSMUSG00000032583 0.242 chr9 119441000 119442000 1355097 Exog ENSMUSG00000042787 0.659 chr9 23786000 23787000 1259678 Bmper ENSMUSG00000031963 0.780
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chr9 99010000 99011000 1334740 Gml l23 ENSMUSG00000044860 0.602 chr9 119469000 119470000 1355125 Exog ENSMUSG00000042787 0.610 chr9 63818000 63819000 1299660 Smad3 ENSMUSG00000032402 0.546 chr9 21905000 21906000 1257797 Cnnl ENSMUSG00000001349 0.547 chr9 86648000 86649000 1322401 Prss35 ENSMUSG00000033491 0.968 chr9 60719000 60720000 1296561 ENSMUSG00000052143 0.980 chr9 59450000 59451000 1295292 Brunol6 ENSMUSG00000032297 0.365 chr9 57505000 57506000 1293347 Cyplal ENSMUSG00000032315 0.661 chr9 121210000 121211000 1356866 Trakl ENSMUSG00000032536 0.662 chr9 11634000 11635000 1247577 ENSMUSG00000077550 0.975 chr9 49014000 49015000 1284905 Tmprss5 ENSMUSG00000032268 0.391 chr9 17002000 17003000 1252894 Fat3 ENSMUSG00000074505 0.602 chr9 119508000 119509000 1355164 Scn5a ENSMUSG00000032511 0.411 chr9 99371000 99372000 1335101 ENSMUSG00000046242 0.581 chr9 76105000 76106000 1311947 Gfral ENSMUSG00000059383 0.556 chr 10 85249000 85250000 1441793 Btbdl 1 ENSMUSG00000020042 0.655 chr 10 75416000 75417000 1431960 Vpreb3 ENSMUSG00000000903 0.616 chr 10 51662000 51663000 1408296 ENSMUSG00000062224 0.894 chr 10 115215000 115216000 1471759 Lgr5 ENSMUSG00000020140 0.363 chr 10 83855000 83856000 1440399 Appl2 ENSMUSG00000020263 0.254 chr 10 90735000 90736000 1447279 Tmpo ENSMUSG00000019961 0.548 chr 10 117325000 117326000 1473869 Rap lb ENSMUSG00000052681 0.573 chr 10 75345000 75346000 1431889 Mif ENSMUSG00000033307 0.549 chr 10 85194000 85195000 1441738 Btbdl 1 ENSMUSG00000020042 0.619 chr 10 44176000 44177000 1400810 Atg5 ENSMUSG00000038160 0.476 chr 10 76133000 76134000 1432677 Col6a2 ENSMUSG00000020241 0.588 chr 10 92841000 92842000 1449385 Elk3 ENSMUSG00000008398 0.975 chr 10 94048000 94049000 1450592 Tmcc3 ENSMUSG00000020023 0.970 chr 10 84220000 84221000 1440764 Rfx4 ENSMUSG00000020037 0.211 chr 10 118113000 118114000 1474657 Ifng ENSMUSG00000055170 0.600
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrlO 45400000 45401000 1402034 Hacel ENSMUSG00000038822 0.977 chr 10 111079000 111080000 1467623 Phldal ENSMUSG00000020205 0.973 chr 10 92739000 92740000 1449283 Cdkl7 ENSMUSG00000020015 0.385 chr 10 82467000 82468000 1439011 Chstl 1 ENSMUSG00000034612 0.107 chr 10 93294000 93295000 1449838 Usp44 ENSMUSG00000020020 0.341 chr 10 80415000 80416000 1436959 Gadd45b ENSMUSG00000015312 0.644 chr 10 92997000 92998000 1449541 Hal ENSMUSG00000020017 0.055 chr 10 83995000 83996000 1440539 ENSMUSG00000020033 0.337 chr 10 42742000 42743000 1399376 Scml4 ENSMUSG00000044770 0.181 chr 10 76421000 76422000 1432965 Col6al ENSMUSGOOOOOOO 1119,E 0.975
NSMUSG00000078445
chr 10 70862000 70863000 1427406 Ipmk ENSMUSG00000060733 0.404 chr 10 44149000 44150000 1400783 Atg5 ENSMUSG00000038160 0.187 chr 10 6199000 6200000 1362882 Akapl2 ENSMUSG00000038587 0.973 chr 10 115629000 115630000 1472173 Ptprr ENSMUSG00000020151 0.604 chr 10 80291000 80292000 1436835 Oazl ENSMUSG00000035242 0.547 chr 10 42639000 42640000 1399273 Scml4 ENSMUSG00000044770 0.972 chr 10 83854000 83855000 1440398 Appl2 ENSMUSG00000020263 0.366 chr 10 93508000 93509000 1450052 Fgd6 ENSMUSG00000020021 0.969 chr 10 59002000 59003000 1415551 Cede 109a ENSMUSG00000009647 0.574 chr 10 58540000 58541000 1415089 Sh3rf3 ENSMUSG00000037990 0.572 chrl l 4029000 4030000 1487567 Secl412 ENSMUSG00000003585 0.968 chrl l 45926000 45927000 1529414 Adaml9 ENSMUSG00000011256 0.981 chrl l 106891000 106892000 1590329 ENSMUSG00000078607 0.494 chrl l 117984000 117985000 1601422 Dnahcl7 ENSMUSG00000033987 0.649 chrl l 48650000 48651000 1532138 Trim7 ENSMUSG00000040350 0.502 chrl l 66988000 66989000 1550476 Myh2 ENSMUSG00000033196 0.986 chrl l 75765000 75766000 1559253 Rph3al ENSMUSG00000020847 0.969 chrl l 75450000 75451000 1558938 Inpp5k ENSMUSG00000006127 0.214 chrl l 69666000 69667000 1553154 Plscr3 ENSMUSG00000019461 0.780
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl 1 65271000 65272000 1548759 Myocd ENSMUSG00000020542 0.978 chrl 1 61115000 61116000 1544603 Aldh3a2 ENSMUSG00000010025 0.524 chrl 1 67489000 67490000 1550977 Gas7 ENSMUSG00000033066 0.278 chrl 1 68767000 68768000 1552255 Arhgefl5 ENSMUSG00000052921 0.201 chrl 1 3404000 3405000 1486942 Inpp5j ENSMUSG00000034570 0.591 chrl 1 69218000 69219000 1552706 Tmem88 ENSMUSG00000045377 0.968 chrl 1 45870000 45871000 1529358 Adaml9 ENSMUSG00000011256 0.043 chrl 1 48982000 48983000 1532470 01frl394 ENSMUSG00000048378 0.088 chrl 1 61166000 61167000 1544654 Slc47a2 ENSMUSG00000069855 0.650 chrl 1 3578000 3579000 1487116 Morc2a ENSMUSG00000034543 0.977 chrl 1 96207000 96208000 1579645 Hoxb3 ENSMUSG00000048763 0.655 chrl 1 121247000 121248000 1604685 Wdr451 ENSMUSG00000025173 0.591 chrl 1 32129000 32130000 1515667 Mpg ENSMUSG00000020287 0.985 chrl 1 70029000 70030000 1553517 Slcl6al l ENSMUSG00000040938 0.473 chrl 1 69831000 69832000 1553319 Dlg4 ENSMUSG00000020886 0.516 chrl 1 67611000 67612000 1551099 Dhrs7c ENSMUSG00000033044 0.707 chrl 1 61891000 61892000 1545379 Cytsb ENSMUSG00000042331 0.027 chrl 1 65240000 65241000 1548728 Myocd ENSMUSG00000020542 0.983 chrl 1 115195000 115196000 1598633 Otop2 ENSMUSG00000050201 0.143 chrl 1 73078000 73079000 1556566 Trpvl ENSMUSG00000005952 0.655 chrl 1 77698000 77699000 1561186 Myol 8a ENSMUSG00000000631 0.615 chrl 1 17184000 17185000 1500722 Cld ENSMUSG00000000581 0.561 chrl 1 85104000 85105000 1568592 Appbp2 ENSMUSG00000018481 0.970 chrl 1 58948000 58949000 1542436 Obscn ENSMUSG00000061462 0.043 chrl 1 32168000 32169000 1515706 Mare ENSMUSG00000020289 0.610 chrl 1 117062000 117063000 1600500 Sept9 ENSMUSG00000059248 0.546 chr 12 110498000 110499000 1711988 Begain ENSMUSG00000040867 0.970 chr 12 110272000 110273000 1711762 Wdr25 ENSMUSG00000040877 0.616 chr 12 29768000 29769000 1631742 Tsscl ENSMUSG00000036613 0.577 chr 12 32516000 32517000 1634490 Gpr22 ENSMUSG00000044067 0.983
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl2 27219000 27220000 1629193 Cmpk2 ENSMUSG00000020638 0.510 chr 12 106915000 106916000 1708405 Bdkrbl ENSMUSG00000041347 0.985 chr 12 109577000 109578000 1711067 Cyp46al ENSMUSG00000021259 0.554 chr 12 71553000 71554000 1673143 Trim9 ENSMUSG00000021071 0.002 chr 12 109209000 109210000 1710699 ENSMUSG00000060375 0.565 chr 12 77414000 77415000 1679004 Mthfdl ENSMUSG00000021048 0.984 chr 12 3366000 3367000 1605648 Kific ENSMUSG00000020668 0.362 chr 12 16075000 16076000 1618348 Trib2 ENSMUSG00000020601 0.973 chr 12 70859000 70860000 1672449 Atp5s ENSMUSG00000054894 0.105 chr 12 77317000 77318000 1678907 Esr2 ENSMUSG00000021055 0.516 chr 12 106372000 106373000 1707862 Glrx5 ENSMUSG00000021102 0.211 chr 12 111900000 111901000 1713390 Dyne 1 hi ENSMUSG00000018707 0.987 chr 12 120161000 120162000 1721651 Sp8 ENSMUSG00000048562 0.612 chr 12 12558000 12559000 1614831 Fam49a ENSMUSG00000020589 0.554 chr 12 110309000 110310000 1711799 Begain ENSMUSG00000040867 0.132 chr 12 29483000 29484000 1631457 Tsscl ENSMUSG00000036613 0.610 chr 12 25412000 25413000 1627386 Rrm2 ENSMUSG00000020649 0.585 chr 12 25595000 25596000 1627569 Mboat2 ENSMUSG00000020646 0.984 chr 12 22990000 22991000 1625063 ENSMUSG00000073164 0.117 chr 12 41126000 41127000 1643097 Ifrdl ENSMUSG00000001627 0.979 chr 12 105456000 105457000 1706946 Serpina3f ENSMUSG00000066363 0.795 chr 12 70858000 70859000 1672448 Atp5s ENSMUSG00000054894 0.160 chr 12 109189000 109190000 1710679 ENSMUSG00000060375 0.527 chr 12 53846000 53847000 1655436 Akap6 ENSMUSG00000061603 0.521 chr 12 4880000 4881000 1607153 ENSMUSG00000051721 0.539 chr 12 72398000 72399000 1673988 ENSMUSG00000034601 0.609 chr 12 109856000 109857000 1711346 Evl ENSMUSG00000021262 0.551 chr 12 71368000 71369000 1672958 Pygl ENSMUSG00000021069 0.477 chr 12 74638000 74639000 1676228 ENSMUSG00000056359 0.588 chr 12 35345000 35346000 1637319 Hdac9 ENSMUSG00000004698 0.510
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl2 59370000 59371000 1660960 Clecl4a ENSMUSG00000045930 0.575 chr 13 59765000 59766000 1779334 Naa35 ENSMUSG00000021555 0.979 chr 13 76000000 76001000 1795520 Glrx ENSMUSG00000021591 0.781 chr 13 38751000 38752000 1758369 Eeflel ENSMUSG00000001707 0.343 chr 13 40990000 40991000 1760572 Gcnt2 ENSMUSG00000021360 0.658 chr 13 77139000 77140000 1796659 Mct l ENSMUSG00000021596 0.604 chr 13 49415000 49416000 1768997 Fgd3 ENSMUSG00000037946 0.346 chr 13 56077000 56078000 1775646 Pitxl ENSMUSG00000021506 0.830 chr 13 82225000 82226000 1801745 Cetn3 ENSMUSG00000021537 0.599 chr 13 55020000 55021000 1774589 Tspanl7 ENSMUSG00000025875 0.510 chr 13 43483000 43484000 1763065 Sirt5 ENSMUSG00000054021 0.969 chr 13 54894000 54895000 1774463 Tspanl7 ENSMUSG00000025875 0.131 chr 13 95993000 95994000 1814860 Pde8b ENSMUSG00000021684 0.061 chr 13 56101000 56102000 1775670 Pitxl ENSMUSG00000021506 0.664 chr 13 86771000 86772000 1806291 Cox7c A,ENSMUSG00000017778 0.920 chr 13 53330000 53331000 1772912 Nfil3 ENSMUSG00000056749 0.489 chr 13 48812000 48813000 1768394 Barxl ENSMUSG00000021381 0.697 chr 13 73397000 73398000 1792917 Irx4 ENSMUSG00000021604 0.036 chr 13 96324000 96325000 1815191 F2rll ENSMUSG00000021678 0.550 chr 13 54940000 54941000 1774509 Tspanl7 ENSMUSG00000025875 0.279 chr 13 86554000 86555000 1806074 Cox7c A,ENSMUSG00000017778 0.920 chr 13 54925000 54926000 1774494 Tspanl7 ENSMUSG00000025875 0.116 chr 13 55274000 55275000 1774843 Fgfr4 ENSMUSG00000005320 0.576 chr 13 55709000 55710000 1775278 B4galt7 ENSMUSG00000021504 0.980 chr 13 100412000 100413000 1819279 Mtaplb ENSMUSG00000052727 0.485 chr 13 73653000 73654000 1793173 Lpcatl ENSMUSG00000021608 0.970 chr 13 52665000 52666000 1772247 Diras2 ENSMUSG00000047842 0.978 chr 13 117104000 117105000 1835951 Isll ENSMUSG00000042258 0.030 chr 13 24788000 24789000 1744406 Fam65b ENSMUSG00000036006 0.657 chr 13 47211000 47212000 1766793 Dek ENSMUSG00000021377 0.977
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl3 108636000 108637000 1827483 Zswim6 ENSMUSG00000032846 0.178 chr 13 61026000 61027000 1780595 Tpbpb ENSMUSG00000062705 0.830 chr 13 102732000 102733000 1821599 Pik3rl ENSMUSG00000041417 0.968 chr 13 24954000 24955000 1744572 ENSMUSG00000006711 0.619 chr 13 114100000 114101000 1832947 Gzmk ENSMUSG00000042385 0.971 chr 13 51526000 51527000 1771108 Sl r3 ENSMUSG00000067586 0.550 chr 14 57183000 57184000 1892761 Rnfl7 ENSMUSG00000000365 0.978 chr 14 106319000 106320000 1941897 Spry2 ENSMUSG00000022114 0.123 chr 14 105999000 106000000 1941577 ENSMUSG00000022116 0.981 chr 14 56719000 56720000 1892297 Mcpt8 ENSMUSG00000022157 0.795 chr 14 60590000 60591000 1896168 Shisa2 ENSMUSG00000044461 0.974 chr 14 111264000 111265000 1946842 Slitrk6 ENSMUSG00000045871 0.580 chr 14 81960000 81961000 1917538 01fin4 A,ENSMUSG00000022026 0.620 chr 14 70216000 70217000 1905794 Rhobtb2 ENSMUSG00000022075 0.583 chr 14 57752000 57753000 1893330 Gjb6 ENSMUSG00000040055 0.035 chr 14 32114000 32115000 1867841 Bapl ENSMUSG00000021901 0.968 chr 14 122033000 122034000 1957611 Slcl5al ENSMUSG00000025557 0.603 chr 14 121197000 121198000 1956775 Rap2a ENSMUSG00000051615 0.618 chr 14 33421000 33422000 1869148 Prrxll ENSMUSG00000041730 0.662 chr 14 81245000 81246000 1916823 01fm4 A,ENSMUSG00000022026 0.620 chr 14 120198000 120199000 1955776 Hs6st3 ENSMUSG00000053465 0.974 chr 14 73245000 73246000 1908823 Fndc3a ENSMUSG00000033487 0.489 chr 14 119647000 119648000 1955225 Hs6st3 ENSMUSG00000053465 0.657 chr 14 49199000 49200000 1884777 ENSMUSG00000036339 0.663 chr 14 70567000 70568000 1906145 ENSMUSG00000044551 0.492 chr 14 32461000 32462000 1868188 Btd ENSMUSG00000021900 0.969 chr 14 121311000 121312000 1956889 Ipo5 ENSMUSG00000030662 0.000 chr 14 32930000 32931000 1868657 Oxnadl ENSMUSG00000021906 0.254 chr 14 56445000 56446000 1892023 Nfatc4 ENSMUSG00000023411 0.650 chr 14 80124000 80125000 1915702 Lectl ENSMUSG00000022025 0.545
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl4 122785000 122786000 1958363 Clybl ENSMUSG00000025545 0.970 chr 14 84828000 84829000 1920406 01fin4 ENSMUSG00000022026 0.781 chr 14 58417000 58418000 1893995 Sap 18 ENSMUSG00000021963 0.097 chr 14 47600000 47601000 1883178 Samd4 ENSMUSG00000021838 0.566 chr 14 47833000 47834000 1883411 Gchl ENSMUSG00000037580 0.646 chr 14 121037000 121038000 1956615 Rap2a ENSMUSG00000051615 0.507 chr 14 104872000 104873000 1940450 Pou4fl ENSMUSG00000048349 0.035 chr 14 121905000 121906000 1957483 Slcl5al ENSMUSG00000025557 0.357 chr 14 57183000 57184000 1892761 Rnfl7 ENSMUSG00000000365 0.978 chr 14 106319000 106320000 1941897 Spry2 ENSMUSG00000022114 0.123 chr 14 105999000 106000000 1941577 ENSMUSG00000022116 0.981 chr 14 56719000 56720000 1892297 Mcpt8 ENSMUSG00000022157 0.795 chr 15 8666000 8667000 1966439 Slcla3 ENSMUSG00000005360 0.031 chr 15 5586000 5587000 1963359 Ptger4 ENSMUSG00000039942 0.985 chr 15 89152000 89153000 2046871 Sbfl ENSMUSG00000036529 0.617 chr 15 93058000 93059000 2050777 Pdzrn4 ENSMUSG00000036218 0.612 chr 15 12613000 12614000 1970382 Pdzd2 ENSMUSG00000022197 0.894 chr 15 11848000 11849000 1969617 Npr3 ENSMUSG00000022206 0.706 chr 15 92836000 92837000 2050555 Pdzrn4 ENSMUSG00000036218 0.591 chr 15 93229000 93230000 2050948 Pphlnl ENSMUSG00000036167 0.077 chr 15 84494000 84495000 2042213 Ldocll ENSMUSG00000055745 0.391 chr 15 64125000 64126000 2021844 ENSMUSG00000078299 0.979 chr 15 10965000 10966000 1968734 Slc45a2 ENSMUSG00000022243 0.620 chr 15 100962000 100963000 2058681 Acvrll ENSMUSG00000000530 0.567 chr 15 89231000 89232000 2046950 Odfib ENSMUSG00000047394 0.480 chr 15 62051000 62052000 2019770 H2afy3 ENSMUSG00000056590 0.535 chr 15 76363000 76364000 2034082 Scrtl ENSMUSG00000048385 0.585 chr 15 89194000 89195000 2046913 Ncaph2 ENSMUSG00000008690 0.975 chr 15 35232000 35233000 1993001 Osr2 ENSMUSG00000022330 0.097 chr 15 55228000 55229000 2012947 Coll4al ENSMUSG00000022371 0.781
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl5 12305000 12306000 1970074 Golph3 ENSMUSG00000022200 0.150 chr 15 103014000 103015000 2060733 Smugl ENSMUSG00000036061 0.147 chr 15 92920000 92921000 2050639 Pdzrn4 ENSMUSG00000036218 0.214 chr 15 102996000 102997000 2060715 Smugl ENSMUSG00000036061 0.000 chr 15 76468000 76469000 2034187 Vps28 ENSMUSG00000062381 0.970 chr 15 96238000 96239000 2053957 Arid2 ENSMUSG00000033237 0.970 chr 15 103145000 103146000 2060864 Gpr84 ENSMUSG00000063234 0.578 chr 15 81531000 81532000 2039250 Chadl ENSMUSG00000063765 0.794 chr 15 80282000 80283000 2038001 Cacnali ENSMUSG00000022416 0.502 chr 15 100304000 100305000 2058023 Letmdl ENSMUSG00000037353 0.969 chr 15 60989000 60990000 2018708 Albg ENSMUSG00000022347 0.574 chr 15 62397000 62398000 2020116 H2afy3 ENSMUSG00000056590 0.500 chr 15 86070000 86071000 2043789 Tbcld22a ENSMUSG00000051864 0.610 chr 15 35317000 35318000 1993086 Vpsl3b ENSMUSG00000037646 0.972 chr 15 84189000 84190000 2041908 Parvg ENSMUSG00000022439 0.340 chr 15 98957000 98958000 2056676 Spats2 ENSMUSG00000051934 0.036 chr 15 96201000 96202000 2053920 Arid2 ENSMUSG00000033237 0.972 chr 16 72990000 72991000 2131115 Robol ENSMUSG00000022883 0.970 chr 16 46495000 46496000 2104660 Pvrl3 ENSMUSG00000022656 0.069 chr 16 44680000 44681000 2102845 Boc ENSMUSG00000022687 0.646 chr 16 69797000 69798000 2127922 Cadm2 ENSMUSG00000064115 0.580 chr 16 70668000 70669000 2128793 ENSMUSG00000062087 0.894 chr 16 44795000 44796000 2102960 Cd200rl ENSMUSG00000022667 0.569 chr 16 37957000 37958000 2096122 Gprl56 ENSMUSG00000046961 0.657 chr 16 70376000 70377000 2128501 Gbel ENSMUSG00000022707 0.973 chr 16 35185000 35186000 2093350 Adcy5 ENSMUSG00000022840 0.969 chr 16 69612000 69613000 2127737 Cadm2 ENSMUSG00000064115 0.980 chr 16 48993000 48994000 2107158 Dzip3 ENSMUSG00000064061 0.037 chr 16 28517000 28518000 2086682 Fgfl2 ENSMUSG00000022523 0.557 chr 16 94552000 94553000 2152456 Ripply3 ENSMUSG00000022941 0.980
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl6 88506000 88507000 2146631 Grikl ENSMUSG00000022935 0.970 chr 16 37078000 37079000 2095243 Polq ENSMUSG00000034206 0.971 chr 16 38432000 38433000 2096597 Popdc2 ENSMUSG00000022803 0.650 chr 16 44632000 44633000 2102797 Boc ENSMUSG00000022687 0.060 chr 16 37684000 37685000 2095849 Ndufb4 ENSMUSG00000022820 0.185 chr 16 93116000 93117000 2151241 Runxl ENSMUSG00000022952 0.971 chr 16 77115000 77116000 2135240 Usp25 ENSMUSG00000022867 0.980 chr 16 36199000 36200000 2094364 Gm5483 ENSMUSG00000079597 0.390 chr 16 35230000 35231000 2093395 Adcy5 ENSMUSG00000022840 0.574 chr 16 65629000 65630000 2123754 Chmp2b ENSMUSG00000004843 0.516 chr 16 95680000 95681000 2153584 Erg ENSMUSG00000040732 0.000 chr 16 44099000 44100000 2102264 Gramdlc ENSMUSG00000036292 0.969 chr 16 91321000 91322000 2149446 Oligl ENSMUSG00000046160 0.780 chr 16 94342000 94343000 2152246 Sim2 ENSMUSG00000062713 0.642 chr 16 96621000 96622000 2154525 Pcp4 ENSMUSG00000000159 0.608 chr 16 87843000 87844000 2145968 ENSMUSG00000055972 0.393 chr 16 91248000 91249000 2149373 01ig2 ENSMUSG00000039830 0.656 chr 16 44308000 44309000 2102473 Gm608 ENSMUSG00000068284 0.482 chr 16 35156000 35157000 2093321 Adcy5 ENSMUSG00000022840 0.043 chr 16 95822000 95823000 2153726 Erg ENSMUSG00000040732 0.655 chr 16 77077000 77078000 2135202 Usp25 ENSMUSG00000022867 0.972 chr 16 48449000 48450000 2106614 Morel ENSMUSG00000022652 0.970 chr 17 87535000 87536000 2240396 Socs5 ENSMUSG00000037104 0.982 chr 17 14106000 14107000 2167126 Gm7168 ENSMUSG00000067941 0.894 chr 17 73266000 73267000 2226176 Ypel5 ENSMUSG00000039770 0.001 chr 17 25014000 25015000 2178031 Hagh ENSMUSG00000024158 0.589 chr 17 49153000 49154000 2202162 Lrfn2 ENSMUSG00000040490 0.654 chr 17 24950000 24951000 2177967 Hs3st6 ENSMUSG00000039628 0.524 chr 17 64898000 64899000 2217808 Pja2 ENSMUSG00000024083 0.519 chr 17 27336000 27337000 2180353 Ip6k3 ENSMUSG00000024210 0.522
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl7 56616000 56617000 2209625 Ptprs ENSMUSG00000013236 0.588 chr 17 87778000 87779000 2240639 Ttc7 ENSMUSG00000036918 0.621 chr 17 8201000 8202000 2161321 Rsph3a ENSMUSG00000073471 0.658 chr 17 29571000 29572000 2182588 Fgd2 ENSMUSG00000024013 0.985 chr 17 71600000 71601000 2224510 Lpin2 ENSMUSG00000024052 0.215 chr 17 25366000 25367000 2178383 Unkl ENSMUSG00000015127 0.655 chr 17 40678000 40679000 2193695 Crisp 1 ENSMUSG00000025431 0.781 chr 17 76215000 76216000 2229076 Fam98a ENSMUSG00000002017 0.595 chr 17 32967000 32968000 2185984 Zfp799 ENSMUSG00000059000 0.000 chr 17 86656000 86657000 2239517 Prkce ENSMUSG00000045038 0.660 chr 17 68263000 68264000 2221173 Lamal ENSMUSG00000032796 0.587 chr 17 32541000 32542000 2185558 Rasal3 ENSMUSG00000052142 0.968 chr 17 86148000 86149000 2239009 Six2 ENSMUSG00000024134 0.645 chr 17 86663000 86664000 2239524 Prkce ENSMUSG00000045038 0.986 chr 17 27338000 27339000 2180355 Ip6k3 ENSMUSG00000024210 0.531 chr 17 86702000 86703000 2239563 Prkce ENSMUSG00000045038 0.507 chr 17 31418000 31419000 2184435 Rsphl ENSMUSG00000024033 0.607 chr 17 88122000 88123000 2240983 Msh2 ENSMUSG00000024151 0.968 chr 17 69736000 69737000 2222646 Zfpl61 ENSMUSG00000049672 0.970 chr 17 86358000 86359000 2239219 Six2 ENSMUSG00000024134 0.361 chr 17 87846000 87847000 2240707 Calm2 ENSMUSG00000036438 0.002 chr 17 29497000 29498000 2182514 Fgd2 ENSMUSG00000024013 0.035 chr 17 28669000 28670000 2181686 ENSMUSG00000024223 0.601 chr 17 8453000 8454000 2161573 Ccr6 ENSMUSG00000040899 0.530 chr 17 15929000 15930000 2168949 Chdl ENSMUSG00000023852 0.893 chr 17 43106000 43107000 2196123 Cd2ap ENSMUSG00000061665 0.659 chr 17 6988000 6989000 2160163 Ezr ENSMUSG00000052397 0.510 chrl 8 6345000 6346000 2251479 ENSMUSG00000073640 0.981 chrl 8 64653000 64654000 2309787 Fech ENSMUSG00000024588 0.592 chrl 8 7719000 7720000 2252853 Mpp7 ENSMUSG00000057440 0.493
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl 8 82658000 82659000 2327623 Mbp ENSMUSG00000041607 0.608 chrl 8 56728000 56729000 2301862 Aldh7al ENSMUSG00000053644 0.184 chrl 8 57189000 57190000 2302323 ENSMUSG00000024592 0.498 chrl 8 66564000 66565000 2311698 Ccbel ENSMUSG00000046318 0.132 chrl 8 81827000 81828000 2326824 Sall3 ENSMUSG00000024565 0.989 chrl 8 24166000 24167000 2269300 Zfp35 ENSMUSG00000063281 0.992 chrl 8 37646000 37647000 2282780 Pcdhbl7 ENSMUSG00000046387 0.620 chrl 8 53553000 53554000 2298687 Snx24 ENSMUSG00000024535 0.968 chrl 8 67296000 67297000 2312430 Gnal ENSMUSG00000024524 0.657 chrl 8 39029000 39030000 2284163 Fgfl ENSMUSG00000036585 0.781 chrl 8 11424000 11425000 2256558 Gata6 ENSMUSG00000005836 0.795 chrl 8 46970000 46971000 2292104 Ap3sl ENSMUSG00000024480 0.969 chrl 8 62149000 62150000 2307283 Sh3tc2 ENSMUSG00000045629 0.980 chrl 8 56754000 56755000 2301888 ENSMUSG00000032900 0.642 chrl 8 78134000 78135000 2323131 Pstpip2 ENSMUSG00000025429 0.178 chrl 8 36124000 36125000 2281258 Psd2 ENSMUSG00000024347 0.035 chrl 8 9472000 9473000 2254606 Ccny ENSMUSG00000024286 0.972 chrl 8 11169000 11170000 2256303 Gata6 ENSMUSG00000005836 0.558 chrl 8 77108000 77109000 2322112 Smad2 ENSMUSG00000024563 0.660 chrl 8 56618000 56619000 2301752 Gramd3 ENSMUSG00000001700 0.384 chrl 8 66627000 66628000 2311761 Pmaipl ENSMUSG00000024521 0.603 chrl 8 12706000 12707000 2257840 Lama3 ENSMUSG00000024421 0.887 chrl 8 11905000 11906000 2257039 Rbbp8 ENSMUSG00000041238 0.969 chrl 8 67438000 67439000 2312572 Mppel ENSMUSG00000062526 0.202 chrl 8 10324000 10325000 2255458 Rockl ENSMUSG00000024290 0.487 chrl 8 70663000 70664000 2315797 Stard6 ENSMUSG00000079608 0.582 chrl 8 13223000 13224000 2258357 Hrh4 ENSMUSG00000037346 0.490 chrl 8 80559000 80560000 2325556 Kcng2 ENSMUSG00000059852 0.036 chrl 8 57380000 57381000 2302514 MegflO ENSMUSG00000024593 0.978 chrl 8 37424000 37425000 2282558 Pcdhbl ENSMUSG00000051663 0.132
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl 8 12631000 12632000 2257765 Lama3 ENSMUSG00000024421 0.664 chrl 8 61534000 61535000 2306668 ENSMUSG00000069367 0.992 chr 19 32517000 32518000 2365055 Sgmsl ENSMUSG00000040451 0.978 chr 19 19316000 19317000 2351854 Rorb ENSMUSG00000036192 0.780 chr 19 28813000 28814000 2361351 Glis3 ENSMUSG00000052942 0.780 chr 19 26228000 26229000 2358766 Dmrt2 ENSMUSG00000048138 0.609 chr 19 53632000 53633000 2386170 Dusp5 ENSMUSG00000034765 0.255 chr 19 53728000 53729000 2386266 Smc3 ENSMUSG00000024974 0.593 chr 19 53403000 53404000 2385941 Mxil ENSMUSG00000025025 0.001 chr 19 30525000 30526000 2363063 Mbl2 ENSMUSG00000024863 0.659 chr 19 47520000 47521000 2380058 Gm5098 ENSMUSG00000078104 0.551 chr 19 53067000 53068000 2385605 Insl ENSMUSG00000035804 0.522 chr 19 53914000 53915000 2386452 Rbm20 ENSMUSG00000043639 0.974 chr 19 18952000 18953000 2351490 Trpm6 ENSMUSG00000024727 0.642 chr 19 8912000 8913000 2341450 Hnrnpul2 ENSMUSG00000071659 0.061 chr 19 45107000 45108000 2377645 Pdzd7 ENSMUSG00000074818 0.652 chr 19 41372000 41373000 2373910 Tm9sf3 ENSMUSG00000025016 1.000 chr 19 25488000 25489000 2358026 Kankl ENSMUSG00000032702 0.571 chr 19 58750000 58751000 2391288 Pnlip ENSMUSG00000046008 0.974 chr 19 53756000 53757000 2386294 Rbm20 ENSMUSG00000043639 0.339 chr 19 46835000 46836000 2379373 As3mt ENSMUSG00000003559 0.000 chr 19 55585000 55586000 2388123 Vtila ENSMUSG00000024983 0.974 chr 19 17507000 17508000 2350045 Rfk ENSMUSG00000024712 0.978 chr 19 10366000 10367000 2342904 Gm98 ENSMUSG00000036098 0.482 chr 19 55149000 55150000 2387687 Adra2a ENSMUSG00000033717 0.970 chr 19 47857000 47858000 2380395 ENSMUSG00000044948 0.593 chr 19 36132000 36133000 2368670 Htr7 ENSMUSG00000024798 0.130 chr 19 41675000 41676000 2374213 AI606181 ENSMUSG00000074873 0.570 chr 19 30565000 30566000 2363103 Mbl2 ENSMUSG00000024863 0.211 chr 19 9018000 9019000 2341556 ENSMUSG00000072030 0.089
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrl9 45891000 45892000 2378429 Kcnip2 ENSMUSG00000025221 0.565 chr 19 16673000 16674000 2349211 Gnal4 ENSMUSG00000024697 0.403 chr 19 53895000 53896000 2386433 Rbm20 ENSMUSG00000043639 0.617 chr 19 46545000 46546000 2379083 Sufu ENSMUSG00000025231 0.664 chr 19 37765000 37766000 2370303 Cyp26cl ENSMUSG00000062432 0.535 chr 19 46399000 46400000 2378937 Psd ENSMUSG00000037126 0.600 chr 19 33836000 33837000 2366374 AI747699 ENSMUSG00000024766 0.077 chrX 49967000 49968000 2439805 Gpc3 ENSMUSG00000055653 0.030 chrX 78812000 78813000 2468491 ENSMUSG00000060673 0.590 chrX 6577000 6578000 2397159 Dgkk ENSMUSG00000062393 0.893 chrX 35994000 35995000 2425832 Clgaltlcl ENSMUSG00000048970 0.584 chrX 87250000 87251000 2476929 ENSMUSG00000035387 0.660 chrX 72445000 72446000 2462124 ENSMUSG00000073094 0.893 chrX 96789000 96790000 2486468 Pjal ENSMUSG00000034403 0.104 chrX 73119000 73120000 2462798 Pls3 ENSMUSG00000016382 0.160 chrX 46065000 46066000 2435903 Pvbmx2 ENSMUSG00000031107 0.971 chrX 83469000 83470000 2473148 NrObl ENSMUSG00000025056 0.920 chrX 153966000 153967000 2543397 Sms ENSMUSG00000071708 0.617 chrX 7721000 7722000 2398303 Wdrl3 ENSMUSG00000031166 0.420 chrX 45948000 45949000 2435786 Zfp280c ENSMUSG00000036916 0.571 chrX 71527000 71528000 2461206 Dnaselll ENSMUSG00000019088 0.000 chrX 50266000 50267000 2440104 Phf6 ENSMUSG00000025626 0.000 chrX 35838000 35839000 2425676 Lamp2 ENSMUSG00000016534 0.561 chrX 159421000 159422000 2548852 Ctps2 ENSMUSG00000031360 0.972 chrX 35953000 35954000 2425791 Mctsl ENSMUSG00000000355 0.001 chrX 39260000 39261000 2429098 ENSMUSG00000081918 0.980 chrX 7650000 7651000 2398232 ENSMUSG00000082572 0.000 chrX 37253000 37254000 2427091 Cyptl4 ENSMUSG00000079618 0.780 chrX 49033000 49034000 2438871 ENSMUSG00000082968 0.031 chrX 11069000 11070000 2401651 Gm4906 ENSMUSG00000069038 0.185
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrX 48194000 48195000 2438032 ENSMUSG00000031112 0.002 chrX 54306000 54307000 2443994 Htatsfl ENSMUSG00000067873 0.002 chrX 7459000 7460000 2398041 Pim2 ENSMUSG00000031155 0.972 chrX 68810000 68811000 2458489 Hmgb3 ENSMUSG00000015217 0.043 chrX 6356000 6357000 2396988 Dgkk ENSMUSG00000062393 0.043 chrX 136406000 136407000 2525887 Morc4 ENSMUSG00000031434 0.037 chrX 133634000 133635000 2523115 ENSMUSG00000080718 0.083 chrX 12410000 12411000 2402992 Medl4 ENSMUSG00000064127 0.344 chrX 91367000 91368000 2481046 ENSMUSG00000081055 0.117 chrX 97016000 97017000 2486695 Tmem28 ENSMUSG00000071719 0.069 chrX 46847000 46848000 2436685 ENSMUSG00000036198 0.069 chrX 39421000 39422000 2429259 Xiap ENSMUSG00000025860 0.031 chrY 293000 294000 2556276 Kdm5d ENSMUSG00000056673 0.826 chrY 325000 326000 2556308 Kdm5d ENSMUSG00000056673 0.784 chrY 334000 335000 2556317 ENSMUSG00000075874 0.851 chrY 335000 336000 2556318 ENSMUSG00000075874 0.778 chrY 456000 457000 2556439 Eif2s3y ENSMUSG00000069049 0.818 chrY 699000 700000 2556682 ENSMUSG00000077793 0.959 chrY 817000 818000 2556800 Usp9y ENSMUSG00000069044 0.767 chrY 818000 819000 2556801 Usp9y ENSMUSG00000069044 0.878 chrY 917000 918000 2556900 Usp9y ENSMUSG00000069044 0.626 chrY 936000 937000 2556919 Usp9y ENSMUSG00000069044 0.940 chrY 948000 949000 2556931 Usp9y ENSMUSG00000069044 0.820 chrY 956000 957000 2556939 Usp9y ENSMUSG00000069044 0.870 chrY 961000 962000 2556944 Usp9y ENSMUSG00000069044 0.859 chrY 1109000 1110000 2557092 Usp9y ENSMUSG00000069044 0.870 chrY 1126000 1127000 2557109 Usp9y ENSMUSG00000069044 0.915 chrY 1146000 1147000 2557129 Usp9y ENSMUSG00000069044 0.925 chrY 1156000 1157000 2557139 Usp9y ENSMUSG00000069044 0.725 chrY 1310000 1311000 2557293 Usp9y ENSMUSG00000069044 0.910
Table 4. Exemplary methylation sites in isolated/endogenous HSCs
Chr. Chr. Start Chr. End Name Gene Name Ensemblld HSC chrY 1420000 1421000 2557403 Usp9y ENSMUSG00000069044 0.910 chrY 1454000 1455000 2557437 Zfy2 ENSMUSG00000000103 0.945 chrY 1460000 1461000 2557443 Zfy2 ENSMUSG00000000103 0.785 chrY 1464000 1465000 2557447 Zfy2 ENSMUSG00000000103 0.865 chrY 1537000 1538000 2557520 Zfy2 ENSMUSG00000000103 0.850 chrY 1617000 1618000 2557600 Zfy2 ENSMUSG00000000103 0.905 chrY 1618000 1619000 2557601 Zfy2 ENSMUSG00000000103 0.870 chrY 1664000 1665000 2557647 Zfy2 ENSMUSG00000000103 0.830 chrY 1779000 1780000 2557762 Zfy2 ENSMUSG00000000103 0.865 chrY 1801000 1802000 2557784 Zfy2 ENSMUSG00000000103 0.945 chrY 1839000 1840000 2557822 Zfy2 ENSMUSG00000000103 0.900 chrY 1840000 1841000 2557823 Zfy2 ENSMUSG00000000103 0.910 chrY 1858000 1859000 2557841 Zfy2 ENSMUSG00000000103 0.920 chrY 1875000 1876000 2557858 Zfy2 ENSMUSG00000000103 0.875 chrY 1973000 1974000 2557956 Sry ENSMUSG00000069036 0.915 chrY 2016000 2017000 2557999 Sry ENSMUSG00000069036 0.835 chrY 2035000 2036000 2558018 Sry ENSMUSG00000069036 0.935
[00677] Induced hematopoietic stem cells are made by the hand of man by, e.g., modifying the gene expression of at least one of the factors disclosed herein of a somatic cell, a pluripotent cell, a progenitor cell or a stem cell, or by exposing any one of these cell types to at least one protein or RNA that produces at least one protein as disclosed herein. The cells can further be made by
exposing them to small molecules that turn on at least one of the factors disclosed herein. In some aspects at least two, three, four, five, six, seven, or eight factors are used to make the induced
hematopoietic stem cells.
[00678] The induced hematopoietic stem cells as described herein differ from naturally occurring hematopoietic stem cells by both their posttranslational modification signatures and their gene expression signatures. These differences are passed along to their progeny. Therefore, also their progeny, whether clonal or differentiated, differs from the naturally occurring differentiated cells.
[00679] Induced hematopoietic stem cell as it is defined in some aspects of all the
embodiments of the invention comprise, consist essentially of or consist of cells that are functionally
capable of copying themselves as well as differentiating into various cells of hematopoietic lineage. In other words, they can be defined as having multilineage potential.
[00680] Induced hematopoietic stem cell is also defined as comprising a gene expression signature that differs from naturally occurring hematopoietic stem cells. One can experimentally show the difference by comparing the gene expression pattern of a naturally occurring hematopoietic stem cell to that of the induced hematopoietic stem cells. For example, the gene expression signature can differ in regard to the genes as shown in Tables 2 or 3. Therefore, in some aspects of all the embodiments of the invention, the induced hematopoietic stem cells comprise an expression signature that is about 1-5%, 5-10%, 5-15%, or 5-20% different from the expression signature of about 1-5%, 2- 5%, 3-5%, up to 50%, up to 40%, up to 30%, up to 25%, up to 20%, up to 15%, or up to 10% of the genes of Tables 2 or 3.
[00681] Induced hematopoietic stem cell is further defined as comprising a posttranslational modification signature that differs from naturally occurring hematopoietic stem cells. In some embodiments, the posttranslational modification is methylation. For example, the methylation pattern of the induced hematopoietic stem cells is in some aspects about 1-5%, in some aspects 1-10%, in some aspects 5-10% different from the methylation pattern at about 1-5%, 1-10%, 5-10%, up to 50%, up to 40%), up to 30%), up to 25%, up to 20%, up to 15%, or up to 10% of the methylation sites shown in Table 4. In some aspects, the amount of methylation in the iHSC differs from the isolated or endogenous HSCs by no more than 1%, 2%, 3%, 4% or no more than 5%, for example as compared to the amount of methylation in the example loci listed in Table 4. Other methylation sites can naturally be used as well in any comparison for differentiating the iHSCs from HSCs.
[00682] It should be understood that this invention is not limited to the particular
methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[00683] As used herein and in the claims, the singular forms include the plural reference and vice versa unless the context clearly indicates otherwise. The term "or" is inclusive unless modified, for example, by "either." Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about."
[00684] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this
regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[00685] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains. Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are described herein.
[00686] Some embodiments of the invention are listed in the following paragraphs:
1. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDK 1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBX1, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
2. The HSC inducing composition of paragraph 1, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
3. The HSC inducing composition of paragraph 1, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNX1T1, ZFP37, PBX1, LM02, and PRDM5.
4. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding RUNX1T1 ;
c. a nucleic acid sequence encoding ZFP37;
d. a nucleic acid sequence encoding PBX1 ;
e. a nucleic acid sequence encoding LM02; and
f. a nucleic acid sequence encoding PRDM5.
5. The HSC inducing composition of paragraph 4, further comprising one or more of:
a. a nucleic acid sequence encoding PRDM16;
b. a nucleic acid sequence encoding ZFP467; and
c. a nucleic acid sequence encoding VDR. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding RUNX1T1 ;
c. a nucleic acid sequence encoding PBX1 ;
d. a nucleic acid sequence encoding LM02;
e. a nucleic acid sequence encoding PRDM5
f. a nucleic acid sequence encoding ZFP37;
g- a nucleic acid sequence encoding I MYCN;
h. a nucleic acid sequence encoding MSI2;
i. a nucleic acid sequence encoding NKX2-3;
j- a nucleic acid sequence encoding MEIS1 ; and
k. a nucleic acid sequence encoding RBPMS. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding ZFP467;
b. a nucleic acid sequence encoding PBX1 ;
c. a nucleic acid sequence encoding HOXB4; and
d. a nucleic acid sequence encoding MSI2. The HSC inducing composition of paragraph 7, further comprising one or more of:
a. a nucleic acid sequence encoding HLF;
b. a nucleic acid sequence encoding LM02;
c. a nucleic acid sequence encoding PRDM16; and
d. a nucleic acid sequence encoding ZFP37. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding MYCN;
b. a nucleic acid sequence encoding MSI2;
c. a nucleic acid sequence encoding NKX2-3; and
d. a nucleic acid sequence encoding RUNX 1 T 1. The HSC inducing composition of paragraph 9, further comprising one or more of:
a. a nucleic acid sequence encoding HOXB5;
b. a nucleic acid sequence encoding HLF;
c. a nucleic acid sequence encoding ZFP467;
d. a nucleic acid sequence encoding HOXB3;
e. a nucleic acid sequence encoding LM02;
f. a nucleic acid sequence encoding PBX1 ;
g- a nucleic acid sequence encoding ZFP37; and
h. a nucleic acid sequence encoding ZFP521. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors composition comprising:
a. a nucleic acid sequence encoding HOXB4;
b. a nucleic acid sequence encoding PBX1 ;
c. a nucleic acid sequence encoding LM02;
d. a nucleic acid sequence encoding ZFP467; and
e. a nucleic acid sequence encoding ZFP521. The HSC inducing composition of paragraph 11, further comprising one or more of: a. a nucleic acid sequence encoding KLF12;
b. a nucleic acid sequence encoding HLF; and
c. a nucleic acid sequence encoding EGR1. A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding MEIS1 ;
b. a nucleic acid sequence encoding RBPMS;
c. a nucleic acid sequence encoding ZFP37;
d. a nucleic acid sequence encoding RUNX1T1 ; and
e. a nucleic acid sequence encoding LM02. The HSC inducing composition of paragraph 13, further comprising one or more of: a. a sequence encoding KLF12; and
b. a sequence encoding HLF;
A hematopoietic stem cell (HSC) inducing composition comprising one or more expression vectors comprising:
a. a nucleic acid sequence encoding ZFP37;
b. a nucleic acid sequence encoding HOXB4;
c. a nucleic acid sequence encoding LM02; and
d. a nucleic acid sequence encoding HLF. The HSC inducing composition of paragraph 15, further comprising one or more of:
a. a nucleic acid sequence encoding MYCN;
b. a nucleic acid sequence encoding ZFP467;
c. a nucleic acid sequence encoding NKX2-3
d. a nucleic acid sequence encoding PBX1 ; and
e. a nucleic acid sequence encoding KLF4. The HSC inducing compositions of any one of paragraphs 4-16, wherein the one or more expression vectors are retroviral vectors. The HSC inducing compositions of any one of paragraphs 4-16, wherein the one or more expression vectors are lentiviral vectors. The HSC inducing composition of paragraph 18, wherein the lentiviral vectors are inducible lentiviral vectors.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; , a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding PRDM5, wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC.
The method of paragraph 20, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding PRDM16 a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding VDR.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding RUNX1T1 ; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM5; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding MEIS1 ; and a nucleic acid sequence encoding RBPMS; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC. The method of paragraph 23, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding MSI2, a nucleic acid sequence encoding NKX2-3; and a nucleic acid sequence encoding RUNX1T1; wherein each said nucleic acid sequence is operably linked to a promoter; and b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC.
The method of paragraph 25, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HOXB5; a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding HOXB3; a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding ZFP37; and a nucleic acid sequence encoding ZFP521. A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC. The method of paragraph 27, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1. A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding MEIS1 ; a nucleic acid sequence encoding RBPMS; a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding RUNX1T1 ; and a nucleic acid sequence encoding LM02; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC. The method of paragraph 29, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC. The method of paragraph 31, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; and a nucleic acid sequence encoding HLF.
A method for preparing an induced hematopoietic stem cell (iHSC) from a somatic cell comprising:
a. transducing the somatic cell with one or more vectors comprising a nucleic acid sequence encoding ZFP37; a nucleic acid sequence encoding HOXB4; a nucleic acid sequence encoding LM02; and a nucleic acid sequence encoding HLF; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced somatic cell in a cell media that supports growth of
hematopoietic stem cells, thereby preparing an iHSC. The method of paragraph 33, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding MYCN; a nucleic acid sequence encoding ZFP467; a nucleic acid sequence encoding NKX2-3; a nucleic acid sequence encoding PBX1 ; and a nucleic acid sequence encoding KLF4. The method of any one of paragraphs 20-34, wherein the somatic cell is a fibroblast cell. The method of any one of paragraphs 20-34, wherein the somatic cell is a hematopoietic lineage cell. The method of paragraph 36, wherein the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing megakaryocytes, platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes,
multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors. The method of paragraph 36, wherein the hematopoietic lineage cell is selected from a multi- potent progenitor cell (MPP), common myeloid progenitor cell (CMP), granulocyte-monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte- erythrocyte progenitor cell. The method of paragraph 36, wherein the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro-dendritic cell (pro-DC), pre- granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro- mast cell (ProMC).
A method of promoting transdifferentiation of a ProPreB cell to the myeloid lineage comprising:
a. transducing a ProPreB cellwith one or more vectors comprising a nucleic acid
sequence encoding ZFP467, a nucleic acid sequence encoding PBX1 ; a nucleic acid sequence encoding HOXB4; and a nucleic acid sequence encoding MSI2; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced ProPreB cell in a cell media that supports growth of myeloid lineage cells, thereby transdifferentiating the ProPreB cell to the myeloid lineage. The method of paragraph 40, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding HLF, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding PRDM16; and a nucleic acid sequence encoding ZFP37. A method of increasing survival and/or proliferation of ProPreB cells, comprising:
a. transducing a ProPreB cell with one or more vectors comprising a nucleic acid
sequence encoding HOXB4; a nucleic acid sequence encoding PBX1, a nucleic acid sequence encoding LM02; a nucleic acid sequence encoding ZFP467; and a nucleic acid sequence encoding ZFP521 ; wherein each said nucleic acid sequence is operably linked to a promoter; and
b. culturing the transduced ProPreB cell in a cell media that supports growth of ProPreB cells, thereby increasing survival and/or proliferation of ProPreB cells.
The method of paragraph 42, wherein the transducing of step (a) further comprises one or more vectors comprising one or more of: a nucleic acid sequence encoding KLF12; a nucleic acid sequence encoding HLF; and a nucleic acid sequence encoding EGR1. An isolated induced hematopoietic stem cell (iHSC) produced by the method of any one of paragraphs 20-39. A cell clone comprising a plurality of the induced hematopoietic stem cells (iHSCs) of paragraph 44. The cell clone of paragraph 45, further comprising a pharmaceutically acceptable carrier. A kit for making induced hematopoietic stem cells (iHSCs) comprising the HSC inducing compositions comprising one or more expression vector components of any one of paragraphs 1-19.
An induced pluripotent stem cell.
An induced hematopoietic stem cell induced by contacting a somatic cell, a pluripotent cell, a progenitor cell or a stem cell with at least one of the factors selected from the group consisting of nucleic acid encoding a gene encoding CDK 1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBX1, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612 or a protein encoded by such gene.
The induced hematopoietic stem cell of paragraph 49, wherein the at least one factor is selected from the group consisting of HLF, RUNX1T1, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
The induced hematopoietic stem cell of paragraph 49, wherein the at least one factor is selected from the group consisting of HLF, RUNX1T1, ZFP37, PBX1, LM02, and PRDM5. The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least two of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least three of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least three of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least four of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least five of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least six of the factors. The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least seven of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-51, wherein the somatic cell, the pluripotent cell, the progenitor cell or the stem cell is contacted with at least eight of the factors.
The induced hematopoietic stem cell of any of paragraphs 49-59, comprising at least one vector.
The induced hematopoietic stem cell of paragraph 60, wherein the vector is integrated in the genome of the stem cell.
The induced hematopoietic stem cell of any of paragraphs 49-61, wherein the somatic cell is a fibroblast cell.
The induced hematopoietic stem cell of any of paragraphs 49-61, wherein the somatic cell is a hematopoietic lineage cell.
The induced hematopoietic stem cell of paragraph 63, wherein the hematopoietic lineage cell is selected from promyelocytes, neutrophils, eosinophils, basophils, reticulocytes, erythrocytes, mast cells, osteoclasts, megakaryoblasts, platelet producing megakaryocytes, platelets, monocytes, macrophages, dendritic cells, lymphocytes, NK cells, NKT cells, innate lymphocytes, multipotent hematopoietic progenitor cells, oligopotent hematopoietic progenitor cells, and lineage restricted hematopoietic progenitors.
The induced hematopoietic stem cell of paragraph 63, wherein the hematopoietic lineage cell is selected from a multi-potent progenitor cell (MPP), common myeloid progenitor cell
(CMP), granulocyte -monocyte progenitor cells (GMP), common lymphoid progenitor cell (CLP), and pre -megakaryocyte-erythrocyte progenitor cell.
66. The induced hematopoietic stem cell of paragraph 63, wherein the hematopoietic lineage cell is selected from a megakaryocyte-erythrocyte progenitor cell (MEP), a ProB cell, a PreB cell, a PreProB cell, a ProT cell, a double-negative T cell, a pro-NK cell, a pro-dendritic cell (pro- DC), pre -granulocyte/macrophage cell, a granulocyte/macrophage progenitor (GMP) cell, and a pro-mast cell (ProMC).
67. The induced hematopoietic cell of any of paragraphs 49-61, wherein the stem cell is an
embryonic stem cell or a progeny thereof.
68. The induced hematopoietic cell of any of paragraphs 49-61, wherein the stem cell is an
induced pluripotent stem cell or a progeny thereof.
69. An induced hematopoietic stem cell induced by increasing or inducing in a somatic cell, a pluripotent cell, a progenitor cell or a stem cell the expression of at least one of the factors selected from the group consisting of nucleic acid encoding a gene encoding CDK 1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBX1, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612.
70. The induced hematopoietic stem cell of paragraph 69, wherein the increasing or inducing is performed by contacting the somatic cell, the pluripotent cell, the progenitor cell or the stem cell with at least one small molecule capable of increasing or inducing the expression of at least one of the factors of paragraph 69.
71. An induced hematopoietic stem cell made by any one of the methods of paragraphs 20-43.
72. A clone or progeny of any of the induced hematopoietic stem cells of paragraphs 48-71.
73. A differentiated progeny cell differentiated from any of the induced hematopoietic stem cells of paragraphs 48-72.
74. A hematopoietic stem cell (HSC) inducing composition comprising modified mRNA
sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDK 1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBX1, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNX1, RUNX1T1, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, and ZFP612, wherein each cytosine
of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
75. The HSC inducing composition of paragraph 74, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
76. The HSC inducing composition of paragraph 74, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5
77. A hematopoietic stem cell (HSC) inducing composition comprising :
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding RUNXITI ;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding PBXl ;
e. a modified mRNA sequence encoding LM02; and
f. a modified mRNA sequence encoding PRDM5;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
78. The HSC inducing composition of paragraph 77, further comprising one or more of:
a. a modified mRNA sequence encoding PRDM16;
b. a modified mRNA sequence encoding ZFP467; and
c. a modified mRNA sequence encoding VDR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
79. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding RUNXITI ;
c. a modified mRNA sequence encoding PBXl ;
d. a modified mRNA sequence encoding LM02;
e. a modified mRNA sequence encoding PRDM5
f. a modified mRNA sequence encoding ZFP37;
g. a modified mRNA sequence encoding MYCN;
h. a modified mRNA sequence encoding MSI2;
i. a modified mRNA sequence encoding NKX2-3 ;
j . a modified mRNA sequence encoding MEIS 1 ; and
k. a modified mRNA sequence encoding RBPMS;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
80. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding ZFP467;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding HOXB4; and
d. a modified mRNA sequence encoding MSI2;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
81. The HSC inducing composition of paragraph 80, further comprising one or more of:
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding LM02;
c. a modified mRNA sequence encoding PRDM16; and
d. a modified mRNA sequence encoding ZFP37.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
82. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding MYCN;
b. a modified mRNA sequence encoding MSI2;
c. a modified mRNA sequence encoding NKX2-3; and
d. a modified mRNA sequence encoding RUNX1T1 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
83. The HSC inducing composition of paragraph 82, further comprising one or more of:
a. a modified mRNA sequence encoding HOXB5;
b. a modified mRNA sequence encoding HLF;
c. a modified mRNA sequence encoding ZFP467;
d. a modified mRNA sequence encoding HOXB3;
e. a modified mRNA sequence encoding LM02;
f. a modified mRNA sequence encoding PBX1 ;
g. a modified mRNA sequence encoding ZFP37; and
h. a modified mRNA sequence encoding ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
84. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding HOXB4;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding LM02;
d. a modified mRNA sequence encoding ZFP467; and
e. a modified mRNA sequence encoding ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
85. The HSC inducing composition of paragraph 84, further comprising one or more of:
a. a modified mRNA sequence encoding KLF12;
b. a modified mRNA sequence encoding HLF; and
c. a modified mRNA sequence encoding EGR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
86. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding MEIS 1 ;
b. a modified mRNA sequence encoding RBPMS;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding RUNX1T1 ; and
e. a modified mRNA sequence encoding LM02.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
87. The HSC inducing composition of paragraph 86, further comprising one or more of:
a. a modified mRNA sequence encoding KLF12; and
b. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
88. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding ZFP37;
b. a modified mRNA sequence encoding HOXB4;
c. a modified mRNA sequence encoding LM02; and
d. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
89. The HSC inducing composition of paragraph 88, further comprising one or more of:
a. a modified mRNA encoding MYCN;
b. a modified mRNA encoding ZFP467;
c. a modified mRNA encoding NKX2-3
d. a modified mRNA encoding PBX1 ; and
e. a modified mRNA encoding KLF4;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
90. The HSC inducing compositions of any one of paragraphs 74-89, wherein the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
91. The HSC inducing compositions of any one of paragraphs 74-90, wherein the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl- pseudouridine, 5-taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2- thio-uridine, 1 -taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1 -methyl-pseudouridine, 4- thio- 1 -methyl-pseudouridine, 2-thio- 1 -methyl-pseudouridine, 1 -methyl- 1 -deaza- pseudouridine, 2-thio- 1 -methyl- 1 -deaza-pseudouridine, dihydrouridine,
dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5- formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1 -methyl -pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-
pseudoisocytidine, 4-thio-l -methyl -pseudoisocytidine, 4-thio-l -methyl-l-deaza- pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5- methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2- methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy- 1 -methyl- pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1 -methyl -inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine, and combinations thereof.
92. A kit for making induced hematopoietic stem cells (iHSCs) comprising the HSC inducing compositions comprising modified mRNA sequence components of any one of paragraphs 74-91.
EXAMPLES
[00687] HSC reprogramming necessitates imparting both self-renewal potential and multi- lineage capacity onto otherwise non-self-renewing, lineage -restricted cells. Induced HSCs must also be able to interact with the stem cell niche in order to sustain productive hematopoiesis, and be able to regulate long periods of dormancy (quiescence) and yet retain the capacity to generate downstream progenitors when called into cycle. The approaches described herein permit transducing committed cells with cocktails of lentiviruses bearing multiple transcriptional factors and permit efficient combinatorial screening of thousands of combinations of these factors. Moreover, the in vivo transplantation approaches described herein, in which stem cell functional potential to be imparted onto downstream progenitors is screened, allows even rare reprogramming events to be identified due to the inherent self-selecting nature of the assay system: only cells reprogrammed to functional HSCs will be able to contribute to long-term multi-lineage reconstitution, whereas cells that are not
reprogrammed will only contribute to transient reconstitution of specific lineages upon transplantation (depending upon which progenitor is used). It has been recognized that one of the challenges to reprogramming mature cells is that they are inherently stable. This is, however, not necessarily true of the populations we will first attempt to reprogram which include multi-potent, oligo-potent, and lineage-restricted progenitors in the process of differentiation. Moreover, progenitors that are developmentally proximal to HSCs are likely to be more epigenetically related and therefore more permissive to reprogramming to an induced stem cell fate. At the same time clinical translation of blood cell reprogramming to HSCs may benefit most from an ability to reprogram differentiated cell types that can be readily obtained from the peripheral blood of patients.
[00688] Identification of candidate genes that mediate HSC reprogramming necessitates a detailed knowledge not only of the gene expression profile of HSCs, but also of all downstream hematopoietic progenitor and effector cells. Towards this, we have undertaken a microarray expression profiling approach in which we compared expression profiles of highly purified HSCs to the majority of downstream cell types involved in hematopoietic differentiation (Fig. 1). Microarray analysis was performed as previously described. In total, 248 expression profiles from 40 populations were generated and compiled including unpublished and published data, in addition to datasets carefully curated from available databases (Fig. 1). All datasets were subjected to stringent quality control using the ArrayQualityMetrics package of R/Bioconductor, and data not meeting these standards were discarded. Unsupervised hierarchical clustering analysis of normalized data showed that lineal relationships and the hierarchical structure of the hematopoietic hierarchy could be recapitulated confirming the biological robustness of the data.
[00689] Although expression datasets of selected hematopoietic populations have been published, the dataset we have generated, and described herein, represents the most comprehensive database of the molecular attributes of hematopoiesis from stem cells through to effector cells available. Using this database we are readily able to identify genes specifically expressed in any hematopoietic cell type (Fig. 3). Analysis of such cell type-specific gene lists indicates that functionally important genes can be identified.
[00690] To clone HSC-enriched TFs, a cDNA library we generated from FACS purified
HSCs is used, which allow cloning of splice variants that uniquely operate in HSCs. Consistent with this we have cloned splice variants for Nkx2-3, Msi2, Runxl, and Prdml6 and Zfp467 that are either minor variants, or have not been previously reported. To date, we have successfully cloned these TFs and confirmed their integrity by sequencing.
[00691] To test the viability of the approaches described herein for identifying HSC reprogramming factors, experiments were conducted in which progenitors were transduced with 22
individual TFs and evaluated by the phenotypic and functional assays detailed above. To show one example, enforced expression of HLF in MPPs (ckit+Sca iin"flk2+CD34+CD150"CD48+) or myeloid progenitors (ckit+Sca iin"CD150"CD48 ) was able to endow a significant fraction of the transduced cells with a primitive CD150 1in" surface phenotype (consistent with primitive stem/progenitor cells) over a time course of ex vivo culturing. After 30 days in culture in the presence of Dox, the cells were cytospun and stained, which revealed that the HLF-transduced cultures contained multiple cell types including megakaryocytes, macrophages, granulocytes and progenitor cells, whereas control cultures contained only macrophages. Functional evaluation in serial CFC assays showed that HLF conferred extensive self-renewal potential onto all progenitors tested. Examination of colony composition at each successive plating revealed that HLF expression led to diverse colony types including primitive CFU-GEMM. Importantly, withdrawal of Dox led to loss of both self-renewal and multi-lineage potential indicating that HLF (not insertional mutagenesis) was responsible for functional activity. Multiple independent experiments have confirmed these results. In vivo assays were then performed that demonstrated that HLF was able to endow long-term multi-lineage potential onto otherwise short- term reconstituting MPPs in transplantation assays.
[00692] FACS sorted progenitors from Rosa26-rtTA donors are transduced with cocktails of
TF -bearing lentiviruses at multiplicities of infection intended to deliver multiple different viruses to individual cells. Assuming equivalence of viral titers, independence of infection, and viral titers sufficient for infecting 20% of the cells by each virus, we have calculated that to be reasonably confident of transducing each cell with at least 3 different viruses (3,276 permutations for 28 factor transductions) requires transduction of 4x104 cells. This calculation does not take into account cells that are infected with more than 3 viruses, although cells transduced with more viruses can occur and may be required for reprogramming. Since tens or even hundreds of thousands of downstream hematopoietic progenitors can readily be sorted from a single donor mouse, high numbers of cells can be transduced in order to maximize the chance that one or more cells is transduced with a combination of factors capable of re-establishing the stem cell state.
[00693] Different progenitor populations can be more or less amenable to reprogramming depending upon their epigenetic state and developmental proximity to HSCs. To account for this and to maximize our chances of success, FACS purified multi-potent, oligo-potent and lineage-restricted progenitors from all branches of the hematopoietic hierarchy including MPPflk2", MPPflk2+, CLPs, Pro-B cells, Pro-T cells, CMPs, MEPs, and GMPs have been used in different experiments.
Transduced progenitors (CD45.2) are transplanted into irradiated congenic (CD45.1) recipients along with a radio-protective dose of CD45.1 marrow cells to ensure survival of recipients. As noted, the lentiviral system being used is Dox-inducible, and doxycycline is administered to transplanted mice
for a period of 1 -4 weeks post-transplant as this should be long enough to reprogram even the most distal blood cells to HSCs. In contrast, reprogramming of blood cells to induced pluripotency takes 3 to 4 weeks.
[00694] Transplant recipients were evaluated at 4-week intervals for 24 weeks by peripheral blood analysis staining for donor-derived B-cells, T-cells and granulocytes/monocytes. Control transduced or unsuccessfully reprogrammed progenitor cells are expected to transiently reconstitute specific lineages, whereas cells successfully reprogrammed to an induced stem cell state are identified by their ability to support long-term multi-lineage reconstitution in primary recipients. In this way, the approaches described herein have a strong selection criteria for identifying reprogramming factors. Importantly, if the induced HSCs generated using the compositions and methods described herein function as endogenous HSCs do, then even the presence of a small number of induced HSCs should read out in this assay system as single HSCs can read out and be detected in transplantation assays. Thus, even if the efficiency of reprogramming is low, induced HSCs can still be identified.
[00695] To control for unintentional transplantation of contaminating HSCs from our progenitor sorts being identified as false positives, sorted progenitors were transduced with control virus and transplanted alongside test recipients. Definitive demonstration that downstream cells can be reprogrammed to HSCs can achieved when progenitors that have undergone V(D)J recombination such as Pro-B cells are used as the starting cell type, as described herein, since all blood cells derived from such induced HSCs will have, and can be screened for the recombined locus, and this can serve as a "bar code" for identifying iHSCs.
[00696] The in vivo strategies described herein are designed to screen the potential of thousands of combinations of TFs for the ability to affect reprogramming. However, since cells transfected with multiple viruses are being screened, additional steps are necessary to determine which TFs mediated activity in successful reprogramming experiments. To achieve this, donor- derived granulocytes from recipients exhibiting stable long-term multi-lineage reconstitution can be FACS sorted, DNA extracted, and TFs cloned out by factor specific PCR, as demonstrated herein. Granulocytes are used since they are short-lived and their continued production results from ongoing stem cell activity. Primer pairs for each TF have been designed and tested, as described herein.
[00697] Experiments were performed to determine the minimum complement of TFs required for reprogramming, as described herein. Removing individual TFs from subsequent
transduction/transplantation experiments and then assaying for loss of reprogramming ability achieves this, as shown herein. Once a minimal set of TFs capable of reprogramming a given progenitor was determined, whether the same set of factors is also able to mediate reprogramming of different blood lineages can be tested, as described herein. Experiments have been carried out using different oligo-
potent progenitor cells, and depending upon the success of these experiments, terminal effector blood cells including B-cells, T-cells, and monocyte/macrophages are tested.
[00698] A key issue related to all reprogramming studies is the efficiency with which reprogramming can be affected. To determine this, limited dilution transplantation experiments were performed with blood cells transduced with validated reprogramming factors. To do this effectively, a polycistromc lentivirus containing the core complement of reprogramming factors is constructed. Use of such a polycistromc virus is important to ensure that all cells are transduced with all factors thereby allowing an accurate determination of limit dilution frequency, and by extension, reprogramming efficiency. Primary purified HSCs are used as a control in these experiments.
[00699] In some embodiments of the compositions, methods, and kits described herein, the nucleic acid sequences encoding the HSC inducing factor(s), such as HLF, RUNXITI, PBX1, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS, are introduced or delivered using one or more inducible lentiviral vectors. Control of expression of HSC inducing factors delivered using one or more inducible lentiviral vectors can be achieved, in some embodiments, by contacting a cell having at least one HSC inducing factor in an expression vector under the control of or operably linked to an inducible promoter, with a regulatory agent (e.g., doxycycline) or other inducing agent. When using some types of inducible lentiviral vectors, contacting such a cell with an inducing agent induces expression of the HSC inducing factors, while withdrawal of the regulatory agent inhibits expression. When using other types of inducible lentiviral vectors, the presence of the regulatory agent inhibits expression, while removal of the regulatory agent permits expression. As used herein, the term "induction of expression" refers to the expression of a gene, such as an HSC inducing factor encoded by an inducible viral vector, in the presence of an inducing agent, for example, or in the presence of one or more agents or factors that cause endogenous expression of the gene in a cell.
[00700] In some embodiments of the aspects described herein, a doxycycline (Dox) inducible lentiviral system is used. Unlike retroviruses, lentiviruses are able to transduce quiescent cells making them amenable for transducing a wider variety of hematopoietic cell types. For example, the pHAGE2 lentivirus system has been shown to transduce primary hematopoietic progenitor cells with high efficiency. This vector also carries a reporter cassette (IRES Zs-Green) that enables evaluation of viral transduction efficiencies and purification of transduced cells by FACS. The ability to inducibly turn off introduced transcription factors, as demonstrated herein, is important since the HSC-enriched expression pattern of these TFs indicates their continued enforced expression in induced HSCs can impair differentiation to all lineages. Having an inducible system also allows ascertainment of the
stability of the reprogrammed state and assess the establishment and fidelity of HSC transcriptional programs and epigenetic marks once enforced expression of reprogramming factors is lifted.
[00701] As demonstrated herein, the use of polycistronic viral expression systems can increase the in vivo reprogramming efficiency of somatic cells to iHSCs. Accordingly, in some embodiments of the aspects described herein, a polycistronic lentiviral vector is used. In such embodiments, sequences encoding two or more of the HSC inducing factors described herein, are expressed from a single promoter, as a polycistronic transcript. Polycistronic expression vector systems use internal ribosome entry sites (IRES) elements to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5'-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, thus creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation.
Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message. See, for example, U.S. Pat. Nos. 4,980,285; 5,925,565 ; 5,631,150; 5,707,828; 5,759,828; 5,888,783; 5,919,670; and 5,935,819; and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press (1989).
[00702] The experiments described herein indicate that the approaches described herein are a viable approach to affect HSC reprogramming. As described herein, purified MPPs (ckit+Scal+lin- flk2+CD34+CD150-) transduced with control, or a pool of 17 different TF viruses were transplanted into irradiated congenic recipients. As expected, MPPs transduced with control virus gave rise to long-lived B- and T-cells but their myeloid lineage potential was quickly extinguished by 8 weeks post-transplant consistent with the fact that MPPs do not self-renew. MPPs transduced with the 17- factor cocktail however gave rise to long-term myeloid, B- and T-cell reconstitution in recipient mice, indicating successful reprogramming of these progenitors to an induced HSC fate. The fact that all transplant recipients in this experiment were multi-lineage reconstituted indicates that reprogramming was not a rare event.
[00703] To rigorously test multi-potency and self-renewal, induced HSCs are FACS purified from the bone marrow (BM) of primary transplant recipients 4 months post-transplant by stringent cell surface criteria, as described herein. These cells are serially transplanted at varying doses (10, 50, 250 cells) into secondary (2°) recipients (along with radio-protective BM cells), to gauge their functional potential in comparison to endogenous, unmanipulated HSCs. Peripheral blood analysis of recipients is performed at monthly intervals for 4 months to evaluate multi-potency and long-term-self renewal. In addition, 3° and 4° transplants can be performed to establish the absolute replicative
capacity of induced HSCs. BM analysis 4 months post-transplant of 1° and 2° recipients is done to determine the extent to which induced HSCs reconstitute the primitive stem cell compartment. At the same time, donor-derived myeloid, thrombo-erythroid, and lymphoid progenitor compartments are quantified to evaluate the ability of induced HSCs to give rise to different progenitor compartments.
[00704] Single HSCs that are rigorously purified are able to reconstitute irradiated recipients at a frequency of about 40% of transplant recipients. To clonally evaluate induced HSCs, single reprogrammed HSCs are sorted from the BM of primary recipients and transplanted into irradiated secondary recipients along with radio-protective BM cells, as described herein. Peripheral blood analysis of donor-chimerism is done as described above to evaluate the functional capacity of individual clones. CFC activity in methylcellulose is also used to assess clonal ability of induced HSCs. Purified unmanipulated HSCs are used as controls in these assays.
[00705] To examine the fidelity of reprogramming at the molecular level, donor-derived induced HSCs can be FACS purified from the BM of recipient mice 4 months post-transplant, as described herein, and RNA extracted, and microarray analysis performed as described. Resulting data is normalized to our hematopoietic expression database and unsupervised hierarchical clustering analysis is performed to determine the extent to which induced HSCs recapitulate the molecular signature of endogenous HSCs, as described herein. qRT-PCR analysis is performed to confirm the integrity of the microarray data as described.
[00706] Finally, stringent evaluation of reprogramming at the molecular level is best achieved by determining how faithfully epigenetic marks are re-established. To examine this, sorted induced HSCs and endogenous HSCs are subjected to genome-wide methylation analysis using reduced representation bi-sulfite deep sequencing, which provides nucleotide level resolution of CpG methylation status at genome scale.
[00707] As described herein, we have employed doxycycline to achieve relatively high levels of expression of individual TFs as measured by qRT-PCR, and reporter activity. However, successful reprogramming can require expression levels to be within a certain range. In consideration of this, doxycycline can be titred to achieve different levels of expression. Lentiviral integration can inadvertently activate genes contributing to reprogramming and in such a way confound
interpretations regarding the reprogramming activity of introduced TFs. Subsequent validation experiments however can be designed to control for this.
[00708] An important consideration for the compositions and methods described herein is that induced HSCs must be capable of homing to and occupying a suitable niche to mediate long-term multi-lineage reconstitution. Transplanting transduced progenitors cells into lethally irradiated recipients can enable this homing, since irradiation acts, at least in part, to clear endogenous HSCs
from their bone marrow niche facilitating occupancy by transplanted HSCs. Further, since HSCs have the ability to exit their niches, circulate, and then re -home to niches in the normal course of their biology, induced HSCs should be capable of homing to, and establishing residency in a productive niche. However, should induced HSCs fail to properly engraft within the bone marrow, alternative strategies of direct intra- femoral injection can be applied to to directly deposit transduced progenitors into the bone marrow of irradiated recipients. Alternatively, co-transduction with Cxcr4, a critical HSC homing receptor can be used to facilitate proper homing of induced HSCs.
[00709] The inducible TF expression in the systems described herein require the presence of doxycycline (Dox) and the tet-transactivator, rtTA. Towards this, an rtTA lentivirus has been cloned that can be co-transduced with the TF containing viruses. We have also obtained a transgenic strain in which rtTA is constitutively expressed from the Rosa26 locus. Using cells isolated from these mice obviates the need for rtTA co-transduction. All viruses are titered using Jurkat cells. Experiments show that high titer viruses can be generated that routinely transduce purified hematopoietic progenitors with high efficiency (50-90%), and that the system is tightly Dox-inducible in vivo.
[00710] HSC inducing factors capable of reprogramming progenitors to an HSC state can be capable of introducing phenotypic properties of HSCs onto transduced progenitors through continued enforced expression. To evaluate this, TF -transduced progenitors were monitored for markers associated with HSCs by flow cytometry during ex vivo culturing. Experiments can first be conducted using single TF-transductions, followed by experiments in which TFs are co-transduced. For these experiments FACS purified progenitors are transduced for 2 days with virus followed by resorting the transduced cells (Zs-Green positive). 200-500 cells are seeded into wells for culturing in an HSC supportive media. Flow cytometry is performed at weekly intervals for a month. Immunostaining of cells can be performed with antibodies for CD 150, and lineage markers (cocktail of antibodies against differentiated cells) since these have been shown to be reliable for HSC identification under diverse conditions. Transcription factors scoring positively with these markers can be examined using additional HSC markers including Seal, CD48, CD105 and CD20127. On day 30, cultures are cytospinned, stained (May-Grunwald), and cell types scored.
[00711] Depending upon which starting cell is being reprogrammed, in some embodiments, it can be required to knockdown lineage specific factors to convert downstream progenitors back to an induced HSC fate, such as, for example when using B-lineage committed cells.
Table 5: Primer Sequences Used For Reverse Cloning of HSC Inducing Factors
CCTGTCCTCGCCCGAGTCCCT CGTCGCCGCCGGGTCAGG 465
Hoxb5 94 131
GCC TAGCGATTG
CTCGTCCCGAGCCCACCATC GCAAAGGTGAACACAAG 696
Rarb 95 132
TCCACTTCCTCC GTCAGTCAGAGG
CAACAACCGTATGCCCATGA CATCCTCTTCTGGTCCTTC 275
Ndn 96 133
CAGG ACCAAC
GGAGGTGGGATGGAGGGAA CAATTTCATCGGGAACAG 313
Evil 97 134
TCCTTG CAACCATG
Napll GGGAAATTGAAGTCCAGCCA CTGCACCCGATTTCTTACG 100
98 135
3 AGAGTG GCTTG 0
CCCGGTGAACAAGCGAGAGT GTTGACGCTCCAGGATGT 385
Mycn 99 136
CGGCGTC TGTGGTTG
GCATGGGTTCCTCGGTCAAT GTCCTTATCAGGGTCATC 622
Meisl 100 137
GACG ATCGTC
GCGCCCTCGGTCATGGATCT CCATGTTGTTCTTTCTGCG 354
Hlf 101 138
CAGC CCTCGCCC
Rbpm GACCCTATTTGTCAGCGGTC GAAAGCGGCAGGAGGAG 432
102 139 s TGCCTC GAAGAGC
CTCCAGAGGCTTCGGTTTCG CTGCCATAGGTTGCCACA 503
Msi2 103 140
TCAC AAGTTG
GTGGAGACCGGAAAGTACCA GTTTGCCCATACTCCTTCC 535
Irf6 104 141
GGAAGG CACGATAC
Prdm GGAGGCCGACTTTGGATGGG CTTCTCGTTGGTGATATGC 510
105 142
16 AGCAG TCTGGACCTG
Zfp46 GGATGGGTTCAGTAATGCCC CCACCCGGACAGCGCGAT 375
106 143
7 AGGAGAAG TCCACC
CAGGTTTAGATGGAGTACGG GCAAGGCCCAAGACAGCA 506
Zfp37 107 144
CAGTGTG GGAACAAG
CATCACCAAGGACAACCGGC CAGCATGGAGAGCGGAG 465
Vdr 108 145
GACAC ACAGGTC
Nkx2- CGAGGAAGAAGAGGGAGAG CTGCCGCTGTCTCTTGCAC 432
109 146
3 AAACTGTC TTGTACC
Zfp61 GGTGACCTTTGAGGACGTGG GACTAAACAAACACCCTT 433
110 147
2 CTGTG CCACAGAGC
Runxl CAACGGGCCTTCTTCTTCCTC CATTATTTGGACTGTACC 533
1 1 1 148 tl TTCCTC GCTGGCCTGG
CTGCTCCGTGCTACCCACTC GAGGCTGAGGGTTAAAGG 496
Runxl 1 12 149
ACTG CAGTGGAG
CGATTACCTACCCAGCGACC CGTCAGGTAGCGATTGTA 483
Hoxb4 1 13 150
ACTC GTGAAACTCC
CCAACACTTGAGTTCCTTTCC GCAGGACAGTTCTTTCTC 405
Nr3c2 1 14 151
GCCTGTC CGAATC
CCGAAAGCTGTCTAAGATCG CTGCCCCCCAGGTCACGA 331
Tcfl5 1 15 152
AGACG CGGCTGC
GGCAGCACCCACATCAGCAG CGCCGAAGAAGGATCGAA 291
Hoxa5 1 16 153
CAGAG ATAGCTC
CTGGATGAAAGAGTCGAGGC GGTAGTTGGAAGGCAGCG 318
Hoxb3 1 17 154
AAAC CGTAGGC
GAGTTTGGATGAAGCGCAGG GATGCCGCACTTCTTGGC 433
Pbxl 1 18 155
CCAG TAACTC
CAAGGGTCTCCAAACGTCCA GTCACATTTGGCAGGTCA 605
Klf2 1 19 156
CAAC TCATCG
GCCATCGAAAGGAAGAGCCT CCACTCGTAGATGTCTTGT 443
Lmo2 120 157
GGAC TCACACAC
GAGCAGAGATGACGTAGCCC GTGGTTGTTCTCCTGCTGT 507
Etv6 121 158
AGTG AGCCTGG
CGCTCTCCTTCGCGGGCTTAC GTGGAGCGAGCATGTAGC 239
Hoxa9 122 159
CCTCC CAGTTGG
Igf2B GAACTGGGCCATCCGCGCCA CTTCAGGTTTCTGCCTTCT 703
123 160
P2 TCGAGAC TTGCCAATC
GTCTTCTTCAACCATCTCGAC GGTATCGGGTGGTGTGTT 574
Gata2 124 161
TCGCAGG GCAGGCTGGG
Zfp52 GGGTTTCGTTGTGTGGTGTGT GAACAAACACTGTGAAAC 406
125 162
1 ATGCAG AGACGGG
CGGCAGCGGGAAGGTGAAC GCACAGGGTGAGGAGGA 488
Glis2 126 163
GGGAGCTAC GGCTGAAGAG
Zfp53 CGGTCCCGGCAGACCAGATG CTCCTCCTCCTCATCGTTG 518
127 164
2 ATAGTTC GTAACATC
GCACGAGAAGCGGATGTCAA CACATCATCTACTGGACT 723
Nfix 128 165
AGGACGAG CTCCATCTC
Prdm CTGATGTGGGAGGTACGTGG CAGGCAAAGTCCTCTTCA 314
129 166
5 GAGCAAG CAGCCAAGG
GAGCGAGGACCAGTCACTAT CCATATTCTTTCACCGCCC 416
Egrl 130 167
TTGAG ACTCC
[00712] Homo sapiens hepatic leukemia factor (HLF), mRNA (SEQ ID NO: 9) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00713] Homo sapiens LIM domain only 2 (rhombotin-like 1) (LM02), transcript variant 1 , mRNA (SEQ ID NO: 21) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein..
[00714] Homo sapiens Meis homeobox 1 (MEIS 1), mRNA (SEQ ID NO: 22) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00715] Homo sapiens musashi RNA-binding protein 2 (MSI2), transcript variant 1 , mRNA
(SEQ ID NO: 23) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00716] Homo sapiens v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) (MYCN), mRNA (SEQ ID NO: 24) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00717] Homo sapiens NK2 homeobox 3 (NKX2-3), mRNA (SEQ ID NO: 28) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00718] Homo sapiens pre-B-cell leukemia homeobox 1 (PBX1), transcript variant 2, mRNA
(SEQ ID NO: 30) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00719] Homo sapiens PR domain containing 5 (PRDM5), mRNA (SEQ ID NO: 32) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00720] Homo sapiens RNA binding protein with multiple splicing (RBPMS), transcript variant 3, mRNA (SEQ ID NO: 35) and a codon optimized, or different codons encoding the same
amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00721] Homo sapiens runt-related transcription factor 1 ; translocated to, 1 (cyclin D-related)
(RUNX1T1), transcript variant 5, mRNA (SEQ ID NO: 37) and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
[00722] Homo sapiens ZFP37 zinc finger protein (ZFP37), mRNA (SEQ ID NO: 42)and a codon optimized, or different codons encoding the same amino acids, are naturally also contemplated to be covered by the reference to the nucleic acid as set forth herein.
Example 2
[00723] Identification of factors capable of imparting alternative lineage potential in vitro and multi-lineage engraftment potential on committed progenitors in vivo
[00724] Experimental strategies for reprogramming diverse cell types generally rely on the action of one or more genes able to impart the cellular and molecular properties of one cell type onto a different cell type. We hypothesized that regulatory factors with relatively restricted expression in HSCs in relation to their downstream hematopoietic progeny are likely to be involved in defining the functional identity of HSCs through regulation of the gene networks underlying their fundamental properties which include self-renewal and multi-lineage differentiation potential. We reasoned that transient ectopic expression of such factors in committed blood cells might therefore instill them with the functional properties of HSCs and potentially stably reprogram them back to an HSC-like state. To identify such factors we analyzed microarray data of 40 different purified hematopoietic cell types that we and others have generated that comprise the vast majority of hematopoietic progenitor and effector cells in addition to HSCs. These datasets (142 arrays in total) were normalized together into a single database providing a comprehensive molecular overview of hematopoiesis from stem cells through to effector cells. Using this database we identified 36 regulatory factors with relatively restricted expression in HSCs in relation to their downstream progeny. These included 33 genes encoding transcription factors, and 3 genes encoding translational regulators (Fig. 58A). Consistent with our hypothesis, multiple genes with known roles in regulating the core properties of HSCs were identified which included Ndn (Kubota et al., 2009), Evil (Yuasa et al., 2005), Meisl (Hisa et al., 2004), HLF (Gazit et al.), Egrl (Min et al., 2008) and others. We also identified multiple regulatory proteins that remain unstudied in HSC biology. Each of the 36 factors was then cloned into doxycycline-inducible lentiviruses bearing a reporter cassette (Zs-Green) (Mostoslavsky et al., 2005) and high-titer viruses were produced (Fig. 58B).
[00725] It has been recognized that one of the challenges to reprogramming mature cells is that they are inherently stable (Zhou and Melton, 2008). This is not necessarily true of oligo-potent and lineage -committed hematopoietic progenitors, which are transient cell types in the process of differentiation. Moreover, since progenitor cells proximal to HSCs are more epigenetically related to HSCs (Bock et al., 2012), we reasoned that these might be more amenable to reprogramming back to an HSC-like state. Thus we first sought to determine if we could impart alternative lineage potentials onto lineage-restricted progenitors by assaying the ability of the 36 factors to instill myeloid lineage potential onto otherwise B-cell restricted progenitors in colony forming assays. We purified Pro/Pre B-cells (CD19+B220+AA4.1+IgM-) from mice expressing the reverse tetracycline-controlled transactivator (rtTA) from the Rosa26 locus (Rosa26rtTA) (Fig. 65), and transduced them with control virus (Zs-green), or the 36-factor viral cocktail. Transduced cells were then exposed to doxycycline followed by plating into methylcellulose in the presence of myeloid promoting cytokines (Fig. 58C). These experiments showed that whereas control-transduced Pro/Pre B-cells were unable to form myeloid colonies as expected, cells transduced with the 36-factor cocktail readily gave rise to colonies bearing diverse myeloid lineages including granulocytes, erythrocytes, megakaryocytes and macrophages (Fig. 58D-E).
[00726] We next determined if transient ectopic expression of the 36-factor cocktail imparted
HSC-like potential onto lineage-restricted lymphoid or myeloid progenitors in vivo. We took advantage of the fact that HSCs are the only hematopoietic cells capable of long-term multi-lineage reconstitution in myeloablated recipients upon transplantation, whereas downstream progenitors only transiently reconstitute recipient mice with restricted lineage potential depending upon their stage of differentiation (Fig. 59A). Moreover, we reasoned that the sensitivity of the transplantation assay, in which even a single HSC can give rise to detectable multi-lineage engraftment, would permit detection of even rare reprogramming events. Thus, only progenitors transduced with a combination of factors capable of instilling them with long-term reconstitution potential would be read out in this assay. Towards this we purified Pro/Pre B-cells or common myeloid progenitors (CMPs: lin-c- kit+Scal-FcC]rlowCD34+) from Rosa26rtTA mice (CD45.2) and following a 2-day transduction protocol with control (Zs-green) or viruses bearing the 36-factors in the presence of doxycycline, we transplanted them into lethally irradiated congenic recipients (CD45.1) along with radio-protective bone marrow cells (CD45.1) (Fig. 59A). Doxycycline was maintained in the drinking water for 2 weeks post-transplant to maintain ectopic expression of the introduced factors, followed by doxycycline withdrawal. Peripheral blood analysis of the reconstituted mice over the 16-week course of the experiment revealed that, as expected, control-transduced Pro/Pre B-cells or CMPs did not give rise to donor-derived long-term engraftment (Fig. 59B-C). By contrast, a few of the recipients
transplanted with the 36-factor transduced B-cell progenitors (3/15) or CMPs (2/8) exhibited long- term donor-derived reconstitution (Fig. 59B-C). All but one of the reconstituted mice showed multi- lineage engraftment of B-, T- and myeloid cells though the degree of engraftment of each lineage varied amongst the different recipients (Fig. 59D). Analysis of V(D)J recombination of sorted donor- derived myeloid cells from the Pro/Pre B-cell arm of the experiment confirmed the B-lineage origin of the reconstituting cells as evidenced by recombination of the heavy chain of the IG locus (Fig. 59E). The observation of multiple heavy chain bands in the gel indicated that the reconstituting cells were polyclonal.
[00727] These experiments indicated that one or more factors from the 36-factor cocktail could imbue long-term multi-lineage reconstituting potential onto otherwise committed lymphoid and myeloid progenitors. To determine which factors might be involved in conferring this potential, we sorted donor-derived myeloid, B-cells and T-cells to test for the presence of each of the 36 factors using a PCR-based strategy (Fig. 59F, Table 5). This analysis revealed that whereas multiple factors could be identified in the donor-derived cells from each of the reconstituted mice, 6 transcription factors, Hlf, Runxltl, Pbxl, Lmo2, Zfp37, and Prdm5 were consistently detected in all of the reconstituted recipients in multiple lineages (Fig. 59G).
[00728] Six transcription factors (Hlf, Runxltl, Pbxl, Lmo2, Zfp37, and Prdm5) are sufficient to reprogram progenitor potential in vitro and impart long-term multi-lineage engraftment potential in vivo.
[00729] We next assessed if the 6 transcription factors we had identified in our in vivo screen were sufficient to confer myeloid colony forming potential onto Pro/Pre B-cells in methylcellulose. As we had observed with the 36-factor cocktail (Fig. 58D-E), transduction with the viral combination of Hlf, Runxltl, Pbxl, Lmo2, Zfp37, and Prdm5 was able to imbue lineage -restricted B-cell progenitors with myeloid lineage potential in these assays (Fig. 60A-B). To test the requirement for each of the 6 transcription factors (6-TF) we employed "N minus 1" experiments in which each of the factors was sequentially omitted from the transduction cocktail (Fig. 60C). These experiments revealed that whereas Hlf, Runxltl, Pbxl, Lmo2, and Zfp37 were all required for instilling myeloid colony forming potential onto Pro/Pre B-cells in vitro, the 5-factor cocktail minus Prdm5 still gave rise to myeloid colonies albeit at lower numbers than the 6-TF combination (Fig. 60C).
[00730] We next tested whether the 6-TF cocktail was sufficient to impart long-term multi- lineage reconstituting potential onto committed myeloid or B-cell progenitors in transplantation assays. Purified Pro/Pre B-cells (CD45.2) were transduced with control (Zs-green) virus or the 6-TF cocktail followed by transplantation into congenic recipients (CD45.1). In contrast to control- transduced cells, long-term multi-lineage reconstitution was observed in 1/13 and 2/12 recipients
transplanted with 6-TF transduced Pro/Pre cells or CMPs cells, respectively (Fig. 60D). Peripheral blood analysis of recipient mice throughout the course of the experiment revealed that in all cases, donor-derived cells from the reconstituted recipients showed multi-lineage engraftment (Fig. 60D-F). Heavy chain rearrangement was observed in donor-derived myeloid cells sorted from the Pro/Pre B- cell reconstituted mouse confirming the B-cell origin of the reconstituting cells (Fig. 60G). These results indicate that transient ectopic expression of Hlf, Runxltl, Pbxl, Lmo2, and Zfp37, and Prdm5 is sufficient to impart long-term, multi-lineage transplantation potential onto otherwise committed myeloid and lymphoid progenitors.
[00731] Inclusion of Meisl and Mycn and use of polycistronic viruses improves in vivo reprogramming efficiency.
[00732] The absence of donor-derived reconstitution in many of the recipient mice in our 6-
TF transplantation experiments (Fig. 60D) suggested that the efficiency of imparting this long-term multi-lineage potential onto committed progenitors was low. To try to improve this we developed polycistronic doxycycline-inducible lentiviruses bearing three transcription factors each separated by 2A peptide sequences (RunxlTl ,Hlf«Lmo2 (RHL), Pbxl ,Zfp37,Prdm5 (PZP)). We also included two additional transcription factors (Mycn and Meisl) that we had repeatedly identified from primitive colonies generated in in vitro colony forming experiments (Figs. 61 A, 66, and data not shown). To test the utility of these strategies we transduced purified Pro/Pre B-cells with control virus, or the 8- transcription factor cocktail as individual viruses (8-TF), or using the RHL and PZP polycistronic viruses along with viruses bearing Mycn, and Meisl (8-TFPoly), and transplanted them into irradiated congenic recipients at greater numbers than in previous experiments. Peripheral blood analysis of transplanted mice over the course of 16 weeks revealed that in contrast to the control-transduced cells that showed no donor-derived chimerism (0/12), multiple recipients transplanted with either the 8-TF (3/6) or the 8-TFPoly (9/14) transduced cells exhibited donor-derived chimerism (Fig. 61B). All recipients showed multi-lineage reconstitution 18-22 weeks post-transplant though again the degree of B-cell, T-cell and myeloid chimerism varied amongst recipients (Fig. 61C-D). The B-cell origin of the reconstituting cells was confirmed through evidence of IG heavy chain rearrangement in donor- derived myeloid cells, with the presence of many bands indicating that the reconstituting cells were polyclonal (Fig. 6 IE).
[00733] Reprogrammed cells engraft bone marrow progenitor compartments and can reconstitute secondary recipients.
[00734] In addition to reconstituting the peripheral blood, HSCs efficiently engraft secondary hematopoietic organs and bone marrow progenitor cell compartments upon transplantation. To determine if the B-cell progenitors transduced with the 8-TF or 8-TFPoly cocktails possessed this
ability, reconstituted mice were sacrificed and analyzed 18-20 weeks post-transplant, which showed that all the mice had donor-derived chimerism of the bone marrow, spleen and thymus though the level of varied between recipients as we had observed in the periphery (Figs. 62A). The Pro/Pre B-cell origin of the engrafting cells was confirmed through analysis of IG rearrangement from DNA isolated from granulocytes and myeloid cells purified from the bone marrow and spleen, and T-cells derived from the thymus (Fig. 62B). Immunophenotyping of bone marrow cells revealed donor contribution to common lymphoid progenitors (CLPs: lin-Flk2+IL7RD+ckitlowScallow), CMPs,
granulocyte/monocyte progenitors (GMPs: lin-ckit+Scal-Fc[ ]rhighCD34+),
megarkaryocyte/erythrocyte progenitors (MEPs: lin-ckit+Scal-Fc[ ]r-CD34-), and primitive LSK progenitors (lin-Scal+ckit+) (Figs. 62C-F). Importantly, we also observed donor contribution to megakaryocyte progenitors (MkPs: lin-c-kit+Scal-CD41+), and erythroid progenitors (EPs: lin- ckit+Scal -Endoglin+) suggesting that the reconstituting cells were able of give rise to precursor cells of platelets and erythrocytes, lineages which we could not track in the peripheral blood in the congenic CD45-based transplantation system we used. Subfractionation of the LSK compartment revealed donor-derived reconstitution of the multi-potent progenitor (MPP1 : lin- ckit+Scal+CD34+Flk2-, MPP2: lin-c-kit+Scal+CD34+Flk2+) and HSC (lin-c-kit+Scal+CD34-Flk2- ) compartments (Figs. 62C-62F). Donor-marked progenitors and HSCs were found to be heavy chain rearranged confirming their B-cell origin (Fig. 62G).
[00735] A defining property of HSCs is their ability to self-renewal, a potential that can be evidenced by an ability to reconstitute secondary recipients upon serial transplantation. To test if the cells generated in our experiments possessed this potential we sacrificed primary recipient mice 18 weeks post-transplant and transplanted whole bone marrow or donor-derived c-kit+ cells into irradiated secondary congenic recipients. Peripheral blood analysis at 4, 8 and 12 weeks post- transplant reveled robust donor reconstitution of B-, T- and myeloid cells in all secondary recipient mice (Figs. 62H-I). Taken together, these results indicate that transient ectopic expression of 8 transcription factors imparts multi-lineage reconstituting potential, reconstitutes bone marrow progenitor compartments, and enables long-term self-renewal potential - the functional hallmarks of HSCs - onto lineage-restricted B-cell progenitors.
Reprogramming terminally differentiated myeloid cells to transplantable HSC-like cells.
[00736] Eventual clinical translation of blood cell reprogramming to derive HSCs would likely benefit from an ability to reprogram cell types that can be readily and non-invasively obtained from the peripheral blood. We therefore sought to determine if multi-lineage progenitor activity could be conferred onto terminally differentiated blood cells using the transcription factors we identified. Recipient and donor-derived peripheral blood was sorted from mice engrafted with Pro/Pre B-cells
transduced with the 8-factor cocktail (8-TF or 8TFPoly) 16-22 weeks post-transplant (ie. 14-20 weeks post-doxycycline induction). Sorted cells were then cultured in the absence or presence of doxycycline - with the latter condition intended to lead to re-expression of the transduced factors - followed by plating the cells in methylcellulose (Fig. 63 A). As expected, neither the recipient-marked cells, nor the donor-derived cells cultured and plated in the absence of doxycycline gave rise to colonies, consistent with low-level progenitor activity in the peripheral blood of mice (Fig. 63B). By contrast, plates seeded with donor cells that had seen reactivation of the 8 transcription factors by exposure to doxycycline gave rise to mixed myeloid lineage colonies that included primitive GEMM colonies (Fig. 63B). To determine which lineage(s) in the peripheral blood had the potential to give rise to these colonies upon re-expression of the transcription factors, we sorted donor-derived B-cells, T-cells, myeloid cells and granulocytes from the 8-TF reconstituted mice, and tested their colony forming potential following culturing and plating in the absence or presence of doxycycline. These experiments revealed that essentially all colony-forming potential originated from the myeloid and granulocyte cell fractions (Fig. 63C-63D). Interestingly, the colonies generated from the sorted myeloid cells were much larger than those derived from granulocytes though a greater number of colonies arose from the latter.
[00737] Encouraged by these results we next determined if the transcription factors we identified impart multi-lineage reconstituting potential onto terminally differentiated myeloid cells in transplantation assays. We sorted Macl+c-kit- myeloid effector cells from Rosa26rtTA mice and transduced them with either 6-factor (6-TFPoly), or 8-factor cocktails (8-TF and 8-TFPoly) and transplanted them into irradiated congenic recipients. Peripheral blood analysis at monthly intervals revealed that, whereas none of mice transplanted with cells transduced with control virus were reconstituted, multiple recipients transplanted with cells transduced with 6-TFPoly (4/7), 8-TF (3/6), and 8-TFPoly (7/8) exhibited long-term donor-derived engraftment (Fig. 63F, 66). Lineage analysis of the reconstituted mice revealed donor-derived contribution to B-cell, T-cell, myeloid, and granulocyte lineages with the contribution to each lineage varying between recipients (Fig. 63F). Donor-derived contribution to secondary hematopoietic organs, and bone marrow progenitor cell compartments was observed in mice sacrificed and analyzed 20 weeks post-transplant (Figs. 68A-D). Serial
transplantation of donor-derived bone marrow cells demonstrated that the 6-TF or 8-TF transduced myeloid effectors could engraft secondary recipients in all lineages to 12 weeks post-transplant (Fig. 63G-63H).
[00738] Based on the functional data presented in Figs. 58-63, we conclude that transient ectopic expression of 6 (Hlf, Runxltl, Pbxl, Lmo2, Zfp37, and Prdm5) or 8 (Hlf, Runxltl, Pbxl, Lmo2, and Zfp37, Prdm5, Mycn, and Meisl) transcription factors reprograms differentiated
hematopoietic progenitors and effector cells to cells that possess the functional properties of HSCs. We term these reprogrammed cells induced-HSCs (iHSCs).
[00739] Single cell expression profiling of iHSCs reveals evidence of partial and full reprogramming.
[00740] To assess the extent to which reprogrammed iHSCs recapitulate the molecular properties of endogenous HSCs, we employed a recently developed single cell gene expression profiling methodology that accurately defines hematopoietic stem and progenitor identity through the simultaneous quantification of expression of 152 lineage-specific transcription factors, epigenetic modifiers, cell surface molecules, and cell-cycle regulators (Guo et al., 2013). We sorted and analyzed donor-derived iHSCs by immunophenotype (CD45.2+lineage-ckit+Scal+Fk2-CD34-/lowCD150+) from two different experiments in which Pro/Pre B cells had been transduced with the 8-TF cocktail as single viruses (8-TF), or with polycistronic viruses (8-TFPoly) (Fig. 61). In both settings mice exhibiting long-term multi-lineage donor-derived reconstitution were sacrificed at 18 weeks posttransplantation. We also sorted and analyzed host-derived HSCs (CD45.1+lineage-ckit+Scal+Fk2- CD34-/lowCD150+) from the same mice to serve as controls. Single cell expression data generated from iHSCs and host HSCs was then analyzed in comparison to data generated from Pro/Pre B-cells (the starting cell type), and also to data previously generated from HSCs, MPPs, CLPs, CMPs, GMPs, and MEPs purified at steady-state (Guo et al., 2013). Analysis of the raw data revealed high correlation between gene expression for the vast majority of the control and test cell types (Fig. 69, Tables 6-8). To further interrogate the transcriptional relationships amongst all the cell types analyzed, we performed principal component analysis (PCA) to define the transcriptional distances between the cells. As expected, steady-state HSCs and progenitor cells were largely positioned in agreement with established lineal relationships where HSCs forming a clearly defined cluster, with MPPs positioned proximal, and oligopotent progenitors (MEPs, GMPs, CLPs) positioned more distal to HSCs (Fig. 64A). Pro/Pre B-cells positioned closely to CLPs consistent with the lineal relationship between these cell types, while the host-derived HSCs were positioned within the steady-state HSC cluster as expected (Fig. 64A). Interestingly, iHSCs derived from the two experiments (8-TF or 8- TFPoly) exhibited very distinct patterns of expression with the iHSCs derived from the 8-TF single virus experiment being more heterogeneous than the iHSCs derived from the 8-TFPoly transduced cells (Figs. 64A, 69, Tables 6-8). As a result, PCA analysis of these cells showed that whereas some of the iHSCs 8-TF positioned closely or within the HSC cluster, others mapped closer to MPPs while others yet positioned closely to the Pro/Pre B cluster (Fig. 64A). By contrast, all of the iHSCs derived using the polycistronic viruses (iHSC 8-TFPoly) homogenously clustered within the HSC node (Fig. 64A). Unsupervised hierarchical clustering analysis confirmed that whereas approximately equal
numbers of iHSCs derived using single viruses mapped closely to HSCs (7/23), others mapped closely to MPPs (7/23), while the remainder mapped more closely to Pro/Pre B cells (10/23) (Fig. 64B). In contrast, all of the iHSCs derived using the polycistronic approach showed very high similarity to host and control HSCs (35/35).
[00741] The inclusion of five (Mycn, Hlf, Lmo2, Meisl and Pbxl) of the eight
reprogramming factors amongst the 152 genes analyzed in these experiments allowed us to address how endogenous levels of these factors was reestablished in iHSCs post-reprogramming. Consistent with their known roles in regulating HSCs, high levels of each of MycN, Hlf, Lmo2, and Meisl were observed in steady-state HSCs, which contrasted the low levels observed in Pro/Pre B cells (Fig. 64D). Pbxl expression was lower in the majority of HSCs and absent in Pro/Pre B cells. Conversely, Ebfl and Pax5, which are critical transcription factors for B-cell development were expressed at high levels in Pro/Pre B cells and negligible levels in HSCs. Analysis of the expression of these genes in iHSCs again revealed distinct differences depending upon whether or not single or polycistronic viruses were used for their derivation. Whereas high levels of endogenous MycN, Hlf, Lmo2, Meisl and moderate levels of Pbxl was reestablished in many of the iHSCs derived using single viruses, low levels of these genes and high levels of Ebfl and Pax5 were still observed in a significant fraction of the cells (Fig. 64D). By contrast, the expression of each of these genes in iHSCs derived using the polycistronic viruses fully recapitulated the expression patterns observed in the control HSCs (Fig. 64D), as was the expression of all other genes analyzed known to be critical for HSCs function including the transcription factors Gfilb, Gata2, and Ndn, and the cytokine receptors Mpl, and c-kit (Fig. 64D, Tables 6-8). Taken together, these results demonstrate that 8-TF reprogramming of Pro/Pre B using single viruses generates iHSCs with transcriptional properties consistent with either full or partial reprogramming, whereas iHSCs derived under optimal polycistronic viral conditions exhibit an expression profile synonymous with HSCs.
DISCUSSION
[00742] Within the hematopoietic system, HSCs are the only cells with the functional capacity to differentiate to all blood lineages, and to self-renew for life. These properties, in combination with the ability of HSCs to engraft conditioned recipients upon transplantation, have established the paradigm for stem cell use in regenerative medicine. Allogeneic and autologous HSC transplantation is used in the treatment of -50,000 patients/year for congenital and acquired hematopoietic diseases and other malignancies (Gratwohl et al., 2010). Current challenges to transplantation therapies include the availability of histocompatible donor cells and associated graft versus host disease. De novo generation of isogenic HSCs from patient derived cells would obviate these issues, and extend transplantation to all patients as opposed to those for whom a histocompatible donor can be identified.
Deriving HSCs from alternative cell types has thus has been a long sought after goal in regenerative medicine. Here we report the generation of induced-HSCs via reprogramming from committed hematopoietic progenitor and effector cells. Through identification and functional screening of 36 HSC-enriched factors, we identified 6 transcription factors Hlf, Runxltl , Pbxl , Lmo2, Zfp37, and Prdm5 whose transient ectopic expression was sufficient to impart HSC functional potential onto committed blood cells. Inclusion of two additional transcription factors, Mycn, and Meisl , and the use of polycistronic viruses increased reprogramming efficacy. These findings demonstrate that ectopic expression of a small number of defined transcription factors in committed blood cells is sufficient to activate the gene regulatory networks governing HSC functional identity. The derivation of iHSCs therefore represents a novel cell-based system for exploring the mechanisms underlying the establishment and maintenance of fundamental HSC properties such as self-renewal and multi-lineage differentiation potential. Moreover, our results demonstrate that blood cell reprogramming is a viable strategy for the derivation of transplantable stem cells that could serve as a paradigm for eventual clinical application.
[00743] Despite the fact that HSCs are the most well characterized tissue-specific stem cells, surprisingly little is known about the molecular mechanisms involved in regulating their central properties. The identification of a defined set of transcription factors capable of stably imparting self-renewal and multi-lineage differentiation potential onto otherwise non-self-renewing, lineage-restricted cells, demonstrates that these factors are critically involved in regulating the transcriptional networks underlying HSC functional identity. Consistent with this, several of the factors that we identified have previously been shown to be important for regulating diverse aspects of HSC biology. For example, PBX1 and MEIS 1 , which interact and can form heterodimeric and heterotrimeric complexes with HOX proteins, have both been shown to regulate HSC self-renewal by maintaining HSC quiescence (Ficara et al., 2008; Kocabas et al., 2012; Unnisa et al., 2012). LM02 is required for hematopoiesis and in its absence, neither primitive or definitive blood cells form (Warren et al., 1994; Yamada et al., 1998). And while MYCN is dispensable for HSC activity due to the functional redundancy of MYC, combined ablation of both Myc and MycN severely disrupts HSC self-renewal and differentiation potential (Laurenti et al., 2008). In contrast to these well- characterized genes, Prdm5 and Zfp37 remain unstudied in HSC biology, and though the role of RUNX1T1 (as known as ETO) as a fusion partner with RUNX1 in acute myeloid leukemia is well established, its role in normal hematopoiesis remains unclear. Defining the roles that each of the reprogramming factors play in normal HSC biology will be critical for understanding their function in blood cell reprogramming.
[00744] Going forward it will also be important to elucidate how the reprogramming factors activate and maintain the transcriptional networks underlying HSC functional identity in other cell types during reprogramming. Given that 6 of the 8 factors we identified, Hlf (Inaba et al., 1992), Meisl (Moskow et al., 1995), Lmo2 (Boehm et al., 1991), Mycn (Brodeur et al., 1984; Marx, 1984), Pbxl (Kamps et al., 1991), and Runxltl (Erickson et al., 1992) are proto-oncogenes, suggests that blood cell reprogramming to iHSC likely involves the activation and/or repression of gene networks that are common to stem cells and transformed cells. This is also consistent with the finding that virtually all the transcription factors required for HSC formation, maintenance, or lineage commitment are targeted by somatic mutation or translocation in heme malignancy {Orkin, 2008 #5327} . Some insights into how the individual reprogramming factors mediate their activity has been provided by recent studies. For example, LM02 overexpression in committed T-cell progenitors led to a preleukemic state characterized by sustained self-renewal activity yet without blocking T-cell differentiation potential, and this was associated with upregulation of a cadre of genes normally expressed by primitive hematopoietic stem and progenitor cells (HSPCs) (McCormack et al., 2010). Similarly, ectopic expression of HLF in downstream multi-potent and oligo-potent myeloid progenitors imbued them with potent self-renewal activity ex vivo without blocking their
differentiation potential, which was associated with expression of CD 150, and sustained repression of lineage commitment markers, phenotypes consistent with HSCs (Gazit et al.). HLF expression alone was nonetheless insufficient to impart HSC transplantation potential onto downstream progenitors (RG, BG, DJR unpublished). These studies show that while ectopic expression of HLF or LM02 can instill at least some of the functional and molecular properties of HSCs onto committed blood cells, alone they cannot access the full repertoire of transcriptional programs needed to establish and maintain HSC function. In these regards, it is interesting that whereas iHSCs generated using polycistronic viruses all exhibited expression profiles that were indistinguishable from control HSCs, iHSCs generated using monocistronic viruses were heterogeneous at the molecular level with many of the cells analyzed showing clear evidence of partial reprogramming. That some of these partially reprogrammed cells clustered closely to the Pro/Pre B cells from which they were derived suggests that these cells retained an epigenetic memory of their cell of origin despite being purified by an immunophenotype consistent with HSCs. It is likely that the partially reprogrammed iHSCs in the 8- TF single virus experiments did not receive the full complement of reprogramming factors. If so, further study of fully reprogrammed versus partially reprogrammed cells may provide mechanistic insights into how the reprogramming factors collaborate to activate the gene regulatory networks underlying HSC functional identity.
[00745] Although the transcriptional properties of iHSCs derived under optimal 8-TF polycistronic conditions were indistinguishable from endogenous HSCs, further analysis will be required to determine if the epigenetic landscape of these cells is fully reset to that of HSCs. In this regard, it was interesting that the lineage potential observed in our experiments in mice reconstituted with iHSCs sometimes, though not always, evolved over time post-transplantation, with donor- derived chimerism showing lineage skewing at early time points post-transplant, and more balanced output at later time points. These results suggest that iHSCs may need time to fully reset their epigenetic landscape to achieve balanced HSC potential, in a manner similar to the erasure of epigenetic memory observed with continued passage of iPS cells (Polo et al., 2010). Whether or not cell passage influences epigenetic resetting during iHSC derivation is at this point unclear. It is plausible that iHSCs may require a period of "maturation" in the stem cell niche to achieve full HSC potential. It is notable that some of the partially reprogrammed iHSCs we analyzed had not appropriately upregulated the MPL or KIT receptors suggesting an inability to transduce signals in response to TPO or SCF emanating from the niche.
[00746] Transcription factors play a critical role in the specification of different lineages during development, and as such the discovery of a set of transcription factors capable of activating the gene regulatory networks underlying HSC functional identity suggests that it may be possible to use these factors on cells derived from pluripotent stem cells to facilitate the generation of definitive HSCs. Along these lines, a recent study showed that expression of 5 transcription factors HOXA9, RORA, ERG, SOX4, and MYB was able to impart transient myeloerythroid engraftment potential onto iPS-derived blood cell progenitors, though these factors were unable to instill HSC potential onto the cells (Doulatov et al., 2013). It will also be important to test if the reprogramming factors we identified can be used to convert cell types outside of the hematopoietic system to an iHSC fate in a manner similar to the ability of the Yamanaka factors to bestow pluripotency onto cells of diverse lineages, though it remains possible that iHSCs derivation using the factors we defined will be limited to the blood system. Nonetheless, the generation of iHSCs via blood cell reprogramming represents a powerful new experimental paradigm for studying the fundamental mechanisms underlying HSC identity that might eventually be lead to the derivation of transplantable stem cells with clinical potential.
Materials and Methods
[00747] Microarray: Microarray data was generated on the Affymetrix 430 2.0 platform and included previously published data generated in our lab in addition to datasets that were curated from GEO. Overall the database consists of 142 expression profiles from 40 FACs purified hematopoietic cell populations based on known cell surface phenotypes. All datasets were subjected to quality
control (QC) measures provided in the ArrayQualityMetrics package of R/Bioconductor (http://www.bioconductor.org). Datasets were normalized (gcRMA) using R bioconductor. To identify potential regulators of HSCs, we applied a filter in which the ratio of expression in HSCs to all others had to be greater than 2.5-fold. The list of potential regulators was finalized by cross- referencing the literature to identify factors with known transcriptional/translation regulatory roles.
[00748] Mice: B6.SJL-Ptprca/BoyAiTacl (Taconic Farms; Hudson, NY) and C57BL/6N
(Charles River Laboratories; Cambridge, MA) recipient mice and
B6.CgGt(ROSA)26Sortml(rtTA*M2)Jae/J donor mice (Jackson, Bar Harbor, ME) were used. For some experiments, B6.CgGt(ROSA)26Sortml(rtTA*M2)Jae/J mice crossed to the CD45.1 background were used. All mice were maintained according to protocols approved by Harvard Medical School Animal Facility and all procedures were performed with consent from the local ethics committees.
[00749] Pro/pre B-cell, CMP and HSC purification: Antibodies used in FACs purification included: CD34, Seal, c-kit, AA4.1 from eBioscience (San Diego, CA); FcQR from BD Bioscience (San Jose, CA); IgM Sigma Aldrich (St. Louis, MO); IL-7RD, Terl 19, CD45.1, CD45.2, Macl, CD3, CD4, CD8, Grl, CD150, CD19, CD25 and B220 from BioLegend (San Diego, CA). 6-12 week old B6 CD45.2+ rtTA heterozygous mice were sacrificed and the bone marrow harvested as previously described (Rossi et al. PNAS 2005). To obtain Pro/Pre B cells, a B220 enrichment was performed using biotin B220 (BD Bioscience), streptavidin magnetic beads and a magnetic column (Milteny Biotec). Enrichment was performed according to published protocols. To obtain CMPs, a c- kit enrichment using directly conjugated magnetic beads (BD Bioscience) was performed on whole bone marrow cells. Cells were sorted directly into sample media containing 2% FBS. All cells were sorted on a FACS Aria II (Becton Dickinson).
[00750] Virus Production: Factors were cloned into the pHage2 dox inducible system under the TRE reporter using restriction site directional (Notl and BamHl) cloning as previously described (Gazit et al. 2013). Importantly, a number of these constructs were cloned out of a cDNA library created from FACS sorted HSCs. All constructs were checked by restriction diagnostics and fully sequenced. Constructs (Fig. 58B) include an IRES that enables ZsGr reporter expression.
Polycistronics (Fig. 61 A) combined individual viruses to create RHL and PZP. Individual factors (RUNX1T1, HLF and LM02) and (PBX1, ZFP37 and PRDM5) were linked using non directional cloning and stepwise insertion into the respective restriction sites Sail, Spel, BamHl separated by 2A sequences. All constructs were checked by restriction digest diagnostics and sequenced. Viruses for all the 36 factors were produced according to a previously established protocol (Mostoslavsky et al., 2005). All viruses are titred on Jurkat cells to an approximated working MOI -5.0.
[00751] Pro/PreB and CMP CFC assays: Sorted Pro/Pre B cells and CMPs were isolated from rtTA transgenic CD45.2+ and when indicated CD45.1+ donors. 60,000 cells/ 200 uL media are incubated with the indicated viruses for 16 hours. Media used is Sclone supplemented with 10 ng/mL SCF, 10 ng/ml IL-12, lOng/ml TPO, 5 ng/mL Flk-3, and 5 ng/mL IL-7. After transduction, 1.0 mg/ml Doxacycline is added for 48 hours and then transferred to methylcellulose or transplanted. In the case of Figs. 4-6, a 24 hour ex vivo dox induction was implemented because more cells appeared viable at this time point.
[00752] In CFC assays, 10,000 Pro/PreB or 1 ,000 CMP cells were transferred from the dox containing media to be diluted and mixed with 1.75 mL per well of M3630 methylcellulose (Stem Cell Technology) and plated into a 6 well dish. 20 days later the colonies were counted and characterized by morphology.
[00753] CFC secondary reprogramming ex vivo was accomplished by plating 60,000 donor- derived FACS sorted cells into a 12 well plate with 500 uL of F12 media supplemented with 10 ng/mL SCF, 10 ng/ml IL-12, lOng/ml TPO, 5 ng/mL Flk-3, and 5 ng/mL IL-7. When indicated 1.0 mg/ml dox was added for 72 hours. 10,000 cells were then directly transferred to 1.0 mL of methylcellulose in a 12 well format. 20 days later colonies were counted and characterized by classically defined morphologies.
[00754] Pro/Pre B cell Transplantation: Transplants were performed by combining 10,000
ZsGr+ resorted cells or 2.0 x 106 unsorted Pro/Pre B / CMP cells with 2 X 105 B6 CD45.1+ competitor cells and transplanted intravenously into IR B6 CD45.1+ recipients. Alternatively, sorted and transduced Pro/Pre B cells and CMPs were injected non competitively with 2 X 105 Seal depleted bone marrow cells (depletion performed with the Macs magnetic depletion columns previously described according to manufactures instructions). Peripheral bleeds were performed at 4, 8, 12, and 16 weeks. Post 16 weeks, the same analysis as peripheral blood was performed on the bone marrow, spleen, and thymus.
[00755] Serial transplantation was performed by isolating bone marrow from primary mice with reconstitution from either CD45.1+ Pro/Pre B cells (>1.0%) or CD45.2+ Macl+ bone marrow cells (>5.0%). In the case of Pro/Pre B cells, whole bone marrow was counted and 107 cells were noncompetitively transplanted into CD45.2+ recipients. Alternatively (c-kit secondary), 10,000 FACS sorted doublet discriminated, live, lineage negative, c-kit+ donor CD45.1+ cells were transplanted non-competitive ly with 2 X 105 Seal depleted cells into IR and conditioned recipients. Macl+ bone marrow reconstituted whole bone marrow cells were FACS sorted on donor (CD45.2+). Generally, 5.0 x 106 donor-derived FACs sorted cells were transplanted noncompetitively into conditioned and IR recipients. Peripheral bleeds were performed at 4, 8 and 12 weeks.
[00756] Peripheral Blood Analysis and Bone Marrow Analysis: Flk2, CD34, c-kit and Seal antibodies were purchased from eBioscience (San Diego, CA). FcgR3 (CD16) was purchased from BD Bioscience (San Jose, CA). IL-7RO, SLAM (CD150), Terl 19, CD45.1, CD45.2, B220, Macl, CD3, CD4, CD8, Grl(Ly-6G/Ly-6C) were purchased from Biolegend (San Diego, CA)
[00757] Staining for both the peripheral blood and the progenitor compartments was done as previously described (Beerman, Rossi, Bryder). Examples of cell stains and gating strategies are described for peripheral blood (Figs. 59B, 60E, 61C and 63G) and bone marrow analysis (Figs. 62A- 621 and 67). In general, peripheral blood populations include: B cells (B220+), Myeloid cells (Macl+ and Grl-), Granulocyte (Macl+ and Grl+), T Cells (CD3+ / CD4+ / CD8+).
[00758] Progenitor populations are defined as such: All are doublet discriminated, live (PI negative) and lineage negative (Grl-, Macl-, B220-, CD3-, CD4-, CD8-, Terl 19-). Hematopoietic progenitors (HSC, MPP1, and MPP2) were gated c-kit+Scal+ then defined by flk2 and CD34 expression. Common lymphoid progenitors (CLPs) were gated flk2+ IL-7R+ then defined by c-kit and Seal status. Myeloid Progenitors (GMP, CMP, and MEP) were gated c-kit+Scal - and defined by FcC]R3 and CD34 expression. Erythroid progenitors (EP) and Megakaryocyte Precursors (MkP) were both gated c-kit+Scal - but defined respectively by Endoglin and CD41 expression.
[00759] VDJ Rearrangement - Heavy and light chain (kappa and lambda) recombinational events were tested using a PCR based assay established by Brisco et al. (British Journal of
Hematology 1990; 75: 163-167) and Busslinger et al. (Nature 2007; 449:473-481). In overview, the strategy spans the region from VH2 to JH4, Therefore, covering the predominant recombinational events of heavy chain rearrangement. All PCR based strategies were confirmed on both bone marrow and peripheral blood positive and negative controls.
[00760] Transcription Factor Integration - To test for viral integration of the factor to be expressed primers were designed to generate products over intron-exon barriers (Fig. 59F).
Endogenous products are eliminated by their larger size or that the primers will not extend over the intron. Rigorous controls were performed to ensure that false positives would not be detected. All primers proved negative when they singly were subtracted from the 36 factor mix and when ZsGr control virus is used, only when the factor is present does the band appear. Primers are listed in the Supplementary Table 1. PCR conditions were performed according to manufactures instructions (Kappa Biosystems).
[00761] High throughput single cell qPCR and computational analysis: Individual primer sets were pooled to a final concentration of 0.1 μΜ for each primer. Individual cells were sorted directly into 96 well PCR plates loaded with 5μΕ RT-PCR master mix (2.5μΕ CellsDirect reaction mix, Invitrogen; 0.5μΕ primer pool; 0.1 μΕ RT/Taq enzyme, Invitrogen; 1.9μΕ nuclease free water) in each
well. Sorted plates were immediately frozen on dry ice. After brief centrifugation at 4°C, the plates were immediately placed on PCR machine. Cell lyses and sequence-specific reverse transcription were performed at 50°C for 60 minutes. Then reverse transcriptase inactivation and Taq polymerase activation was achieved by heating to 95°C for 3 min. Subsequently, in the same tube, cDNA went through 20 cycles of sequence-specific amplification by denaturing at 95°C for 15 sec, annealing and elongation at 60°C for 15 min. After preamplification, PCR plates were stored at -80°C to avoid evaporation. Pre-amplified products were diluted 5-fold prior to analysis. Amplified single cell samples were analyzed with Universal PCR Master Mix (Applied Biosystems), EvaGreen Binding Dye (Biotium) and individual qPCR primers using 96.96 Dynamic Arrays on a BioMark System (Fluidigm). Ct values were calculated using the BioMark Real-Time PCR Analysis software
(Fluidigm).
[00762] Gene expression levels were estimated by subtracting the background level of 28 by the Ct level, which approximately represent the Log2 gene expression levels. Principal component analysis (PCA) was performed in Matlab to project all the control and experimental cells onto a three dimensional space to aid visualization. An unsupervised hierarchical clustering was used to cluster representative control cells and all the iHSC 8-TF or iHSC 8-TFPoly cells. The analysis was done with R using the average linkage method and a correlation-based distance. The representative control cells were selected as those whose expression levels were closest to the median based on Euclidean distance. Eight HSC cells, eight HSC Host cells, all six Pro/Pre B-cells, and four from each of the remaining control cell types were selected. The dendrogram branches were color-coded by cell type, as in the PCA analysis. Violin plots and the correlation heatmaps were generated with Matlab. The master heatmap of all the raw data (Supplement to Figs. 64A-64D) was generated with
MultiExperiment Viewer (MeV) program (http://www.tm4.org/mev.html) using the default setting.
Table 6-1. Single cell expression data (reduced list)— Control
Factor HSC-Hostl HSC-Host2 HSC-Host3 HSC-Host4 HSC-Host5 HSC-Host6
Actb 13.2775869 14.168841 13.9178852 14.0751018 14.3746391 14.7443427
Aebp2 6.28419787 6.32255813 7.19444936 5.65953541 6.95783404 7.26360494
Ahr 0 7.57209355 0 0 0 0
Aktl 9.4500759 0 10.0765631 9.94327921 10.6548673 10.0745346
Akt2 6.22818312 0 6.70532413 0.8889789 6.47748177 5.95383663
Akt3 7.51547845 0 6.07943514 6.17938762 6.4222982 7.17078745
APC 7.79584916 0 6.19688147 0 0 0
Bad 0 0 0 0 0 0
Bax 8.2648093 9.18808438 6.51775922 9.27759397 6.43362681 9.23990229
Bell la 0 3.15885611 0 5.12533276 4.04738876 0
Bell lb 0 0 0 0 0 0
Bcl2 6.98611579 5.59253753 5.86437743 5.82350133 5.38565841 6.25071983
Table 6-1. Single cell expression data (reduced list)— Control
Factor HSC-Hostl HSC-Host2 HSC-Host3 HSC-Host4 HSC-Host5 HSC-Host6
Bcl211 6.3386176 7.46201946 5.95513383 7.54053745 8.78325414 9.89410694
Bcl2111 0 0 6.94600503 6.87358216 4.32552584 7.85341182
Bmil 6.84030124 7.45817288 8.3898639 8.30544124 8.55457965 9.47756119
Brd3 7.90377097 0 7.95461448 5.59030834 9.00631299 9.052141
Cas 8 7.51030052 8.02616926 4.9493906 8.5494905 8.91073923 7.93953605
Casp9 0 0 8.5609996 1.67117364 4.0331817 9.80298865
Cbx2 2.56416415 5.63988167 5.00035293 0 7.4548439 5.99738299
Cbx8 0 0 0 0 0 0
Ccnc 0 7.05018411 6.61535219 7.14719604 0 0
Ccndl 9.03626766 0 10.6728171 9.38229874 9.65405424 11.2577639
Ccne2 6.17995523 0 0 7.11543157 3.58571536 6.20681303
CD34 9.47324504 4.55399303 0 6.67982887 8.80998961 8.42129488
CD41 6.83783924 0 0 7.46208028 5.97956704 7.65198306
CD48 0 5.56947557 0 0 0 0
CD52 3.35679477 11.0232754 4.14631098 2.71474755 0 0
CD53 8.20861996 9.55294311 10.642603 0 10.0045947 8.2383003
CD55 5.73982206 7.34724526 0 8.36090066 0 6.70252191
CD63 7.99968851 3.87874565 8.90775134 6.61989086 7.62771038 8.83849433
CD9 7.44138139 6.21616714 6.50446133 8.246429 7.64906334 8.63028596
Cdc42 12.1710731 11.0591526 12.4549519 11.9800985 12.2018552 11.6731426
Cdkl 0 0 0 6.25722026 8.10356032 0
Cdk4 7.18574541 0 8.80614599 8.60901532 8.72742091 8.91034066
Cdkn2b 0 3.88923712 0 0 3.6614691 0
Cebpa 0 0 0 0 2.11474663 0
Csflr 0 0 0 0 0 0
Ctnnbl 6.77574215 5.35561197 8.53644908 6.17550579 8.17135019 8.90801971
Cycs 9.45352333 8.28562581 9.69867329 9.15788233 8.5747268 11.0355392
Dachl 10.8615494 0 9.31769339 9.02821771 8.02501106 10.7915469
Dnmtl 7.9760193 7.79001706 9.59934161 9.46537455 10.1834542 9.73235565
Dnmt3a 9.17213793 6.74216981 10.3864007 8.88588303 10.0903643 9.57095471
Dnmt3b 7.6743627 0 8.58221524 8.13192866 6.41659753 10.5256969
Dtxl 0 3.41522411 2.46078468 0 0 0
Dtx4 0 0 8.6835801 0 2.66840805 0
Ebfl 0 6.662193 0 0 0 0
Ep300 9.71487536 9.16729643 9.43974794 9.62406494 8.10311513 8.26149733
Epor 8.68447169 7.68763276 7.25429274 7.04722818 8.24346493 6.54478382
Erg 9.20284562 0 8.87410211 11.3197691 11.1784466 10.0567225
Esrl 8.43503126 0 9.11129812 10.8937654 8.57545747 8.3892723
ETS1 0 7.93156712 8.24336392 8.54381125 0 7.97895885
ETS2 7.69340598 10.4359154 7.88475206 9.15565609 9.36749687 9.44827774
Etv3 0 4.64796195 0 4.71186206 6.09191076 4.93626547
Etv6 10.9918334 8.3432591 12.062043 10.4969697 11.0891387 10.5930954
Ezh2 0 0 6.2199413 0 7.2175748 0
Fas 0 0 0 0 0 6.34199177
Fcgr2b 7.06819715 6.31957073 0 0 6.89220045 0
Fcgr3 3.08395665 0 5.1508941 0 5.42301679 4.43817889
Flil 10.9830573 8.55863827 11.2140047 10.3178185 11.6619233 12.1483502
Table 6-2. Single cell expression data (reduced list)— Control
Factor HSC-Host7 HSC-Host8 HSC-Host9 HSC- CLP1 CLP2
HostlO
Actb 14.6718473 13.3708842 14.0765648 14.5363732 15.5720296 15.6020418
Aebp2 6.934218 5.38858023 6.92870369 6.83990914 6.91310458 6.13397519
Ahr 6.67106288 0 0 0 0 0
Aktl 8.78938258 10.6910195 9.8127768 10.8956807 10.5882487 9.71594698
Akt2 6.75253581 3.62756205 0 6.81240671 0 5.50111064
Akt3 8.32305076 5.46246892 6.80790868 6.46650561 8.93439362 7.9618537
APC 0 6.36004551 0 6.14208966 3.44926722 0
Bad 0 0 0 0 0 0
Bax 0 8.20505106 7.76032108 10.25022 10.2921476 8.60030468
Bell la 7.92077667 3.60167833 0 0 0 0
Bell lb 0 0 0 0 0 0
Bcl2 4.96817114 5.18391882 5.86834513 4.77451604 0 0
Bcl211 10.2036955 9.4735452 9.29507619 9.23047931 10.060975 7.87502531
Bcl2111 0 0 0 8.25557161 0 0
Bmil 9.60604305 6.56999362 7.5702476 8.14038399 7.42571732 7.00110773
Brd3 2.43074124 7.93247983 5.487038 7.62759044 11.1411249 9.66763681
Cas 8 8.13383235 8.73409 8.17193114 9.06003622 9.92872956 9.74113972
Casp9 8.4257186 7.57293558 7.8464349 7.80792483 8.37487536 0
Cbx2 7.07511053 4.48424451 5.84700109 6.23176944 0 6.13244563
Cbx8 0 0 0 4.43331023 2.09486638 0
Ccnc 0 6.2797398 0 6.38691873 6.07677146 7.90773679
Ccndl 10.0212014 0 9.34071635 0 8.62709974 0
Ccne2 0 6.53512964 6.54945811 6.0438482 7.34684561 6.25723346
CD34 0.01674269 7.67391972 0 10.7870089 0 0
CD41 0 0 0 8.09312343 0 0
CD48 0 0 0 8.10107986 10.5431066 4.18270305
CD52 0 3.64518416 0 0 5.65535037 8.4769989
CD53 8.91469588 0 10.1863121 10.1806135 11.1188968 10.5349358
CD55 7.2980864 7.31878302 0 6.29391433 1.43412606 6.99636364
CD63 8.51246386 6.54126666 7.37134704 6.37418902 0 0
CD9 8.74271831 0 8.72127967 8.8170788 0 0
Cdc42 11.9094394 11.5894082 11.1126665 12.1006451 13.0861829 12.2864927
Cdkl 2.68752057 0 0 11.8397661 11.3123555 0
Cdk4 8.12335302 7.87079584 7.5720236 9.24576955 10.3762179 10.4600518
Cdkn2b 0 0 0 0.35740427 0 0
Cebpa 0 0 5.63552878 0 0 0
Csflr 0 0 0 0 6.27133994 5.26584779
Ctnnbl 6.79339335 7.40629301 6.87918414 8.36101904 5.95935578 8.05082722
Cycs 10.0442638 7.54030732 9.0344585 10.6654921 11.2529958 11.2582352
Dachl 0 9.84505342 7.97799952 11.9672696 0 0
Dnmtl 8.50686835 7.570001 3.23481103 10.5464652 12.6178625 12.0559888
Dnmt3a 10.0573123 9.34977288 8.47634202 10.5147996 8.06454655 9.25761414
Dnmt3b 8.08236706 7.77693525 7.43902731 6.35981456 8.61270517 0
Dtxl 0 1.20990211 0 2.35858319 0 0
Dtx4 0 0.84530668 0 8.42626641 0 0
Factor HSC-Host7 HSC-Host8 HSC-Host9 HSC- CLP1 CLP2
HostlO
Meisl 7.80771805 6.57260088 8.3801574 6.64771096 0 5.32655256
Mllt3 5.27987488 4.98216842 0 4.98006428 0 0.43104733
Mpl 9.95026098 9.29878047 10.5382189 8.92503515 0 0
Mucl3 9.58693895 5.98850625 10.5817646 10.34105 0 0
Myb 11.9113929 11.3263068 9.38747922 12.0083232 13.2716596 13.3551636
Myc 0 7.55865639 5.71326556 9.60742235 0 7.03978632
Mycn 9.2475789 11.2225067 12.0059366 9.17037192 0 0
Ndn 9.34022589 8.94700354 8.72830108 7.25627641 0 0
Nfat5 10.9266838 10.3886042 10.2456748 9.51279929 3.18257792 0
Nfia 9.8356555 8.60236457 8.92289712 10.0014286 8.2885559 0
Nfkbl 0 0 4.48890776 0 3.74973604 0
Notchl 7.66102275 0 6.91201627 8.32291131 7.91814495 7.36965349
Pax4 0 0 0 0 0 0
Pax5 0 0 0 0 9.67689902 11.6203933
Pax9 0 0 0 0.57036927 4.48973549 0
Pbxl 5.69269047 0 5.43069763 0 0 0
PIk3ca 0 7.18092062 7.27208139 9.05710063 9.40185149 9.55052543
PIk3R2 0 0 7.5160141 8.56807024 9.73539407 0
Plagl 7.73898932 7.96365738 8.07352148 0 0 0
Prfl 0 0 0 0 0 0
Pten 10.1342741 9.78469549 9.33811703 11.1785408 10.1894192 10.4359312
Rbl 9.29604621 9.27765839 7.51678183 8.27880038 11.9054276 10.9424567
Rora 6.10890584 7.3877893 8.15836998 5.4939429 0 0
Runxl 0 7.76888704 8.78603048 7.67062362 8.305547 0
Runx2 0 3.79386494 3.6008219 5.35557258 0 0
Satbl 0 0 0 8.99400379 10.1837922 8.39346313
Sdpr 5.78136407 4.21076733 0 0.82691288 0 0
Sell 0 0 1.61946707 0 0 0
Sfpil 10.0042663 9.37371199 9.15518065 9.65832452 0 9.26882608
Slamfl 7.81411202 6.8594725 7.95128279 0 0 0
Smarca4 10.3380905 7.42905599 9.2510329 11.5218685 14.4938783 13.4081997
Sosl 0 0 6.5261554 6.79179662 0 5.43289492
Statl 1.71494059 0 0 3.42562416 5.64062199 0
Stat3 10.7412032 8.92068828 8.96113036 10.4989945 8.68504508 8.21020662
Stat4 9.21395012 9.36252836 9.57705104 8.5317536 0 0.65364229
Stat6 8.27498229 8.51520973 8.34381559 8.60680209 10.1139186 9.61023286
Suzl2 8.36186765 7.85222591 8.01568165 9.19083991 12.1912291 10.7847116
Tall 1.22646608 0 0 0.85919234 8.29002547 0
Tcf3 0 10.0641005 0 0 10.2329064 9.57044442
Tcf4 10.3945958 8.86390901 9.93214915 10.6432336 11.5584564 11.0576929
Tcf7 1.59196764 0 0.92915579 0 0 5.45500333
Tek 0 0 0 7.77878275 0 0
Tfrc 4.90970417 8.02894875 7.93433882 7.81882114 10.1158882 10.2735536
Tgfbl 0 3.32919416 5.90260252 3.25808206 3.7705399 0
Tgfb2 0 0 0 3.22432655 0 3.37538454
Tgfb3 0 6.69135338 1.40782238 3.95650619 0 0
Table 6-2. Single cell expression data (reduced list)— Control
Factor HSC-Host7 HSC-Host8 HSC-Host9 HSC- CLP1 CLP2
HostlO
Tnfrsf 1 a 9.92981833 7.3738534 8.64338251 8.24251812 0 0
Tnfrsflb 8.93673702 9.48765082 9.5506678 6.21083423 3.78885776 3.73572941
Tnfrsf21 4.89969433 0 6.93921933 7.10963898 0 0
TnfsflO 7.10728827 0 0 1.58582089 7.14613579 8.05630727
Tnfsfl2 3.38261217 0 2.19082075 0 0 0
Tobl 0 5.20593174 0 0 0 0 vWF 4.95948597 6.28053967 5.43694051 0 0 0
Zbtb20 9.61893778 9.81916761 9.00655347 7.72955135 0 0
Zbtb38 9.10026874 6.185996 7.56423848 6.82663886 7.73312626 3.84361329
Zfp532 0 0 0 0 0.10416971 0
Zfp612 5.28324577 6.48139199 8.74136356 5.56744079 0 6.50143494
Zfpml 8.58664951 6.0911617 8.1830324 0 6.44606012 5.62364305
Zhx2 7.56629134 7.63051187 0 5.24483627 0 0
Table 6-3. Single cell expression data (reduced list)— Control
Factor CLP3 CLP4 CLP5 CLP6 CLP7 CLP8
Actb 13.4721085 15.2351724 15.2719547 16.31177 16.919695 17.0516789
Aebp2 4.45141147 4.38441532 7.10616819 6.49378333 7.1531144 5.6116867
Ahr 0 0 7.00481198 0 0 0
Aktl 7.3884758 9.17609503 9.55146467 10.0057847 10.2031478 11.1623017
Akt2 1.87065597 0 0 0 7.27787365 0
Akt3 7.14641592 0 0 8.91809255 8.53101085 8.95553865
APC 0 0 7.27741159 0 9.72461612 0
Bad 0 0 0 0 0 0
Bax 5.64368167 7.7793443 7.96170511 9.7217077 11.9875259 11.9783765
Bell la 0 0 0 0 8.6331668 9.1297033
Bell lb 0 0 0 8.64946621 0 0
Bcl2 0 0 0 4.47644651 4.63608396 0
Bcl211 4.6189348 0 10.2286999 10.9686351 10.604158 11.3030776
Bcl2111 4.8989012 0 8.32168555 0 0 0
Bmil 3.17094341 6.36759845 5.13831255 6.9969786 8.36369633 7.04410175
Brd3 6.59116273 8.85891039 10.3417165 10.3202288 11.5288449 11.1568732
Casp8 9.02211423 8.05947856 9.77788318 10.1196359 11.9218075 10.3568659
Casp9 5.06149028 0 0 0 8.30557433 9.75192608
Cbx2 4.42759599 7.57182896 2.65329776 8.35205791 6.1484868 7.77479327
Cbx8 0 0 0 7.10684953 0 0
Ccnc 3.70061852 7.15959988 8.92627786 8.61131431 9.6072497 9.48325249
Ccndl 0 2.93758213 0 0 10.6400803 0
Ccne2 5.21666008 7.17885114 11.5186474 0 9.77794018 10.5222899
CD34 0 0 0 0 0 0
CD41 6.34043371 0 0 0 0 0
CD48 0 7.57200005 9.20489806 9.11301325 12.225357 9.60365514
CD52 7.65018871 7.48017023 7.43352856 0 12.104936 12.1008653
CD53 10.1411695 7.84826499 9.96783218 10.4527685 10.929522 11.4800078
Table 6-4. Single cell expression data (reduced list)— Control
Factor CLP9 CLP10 CMP1 CMP2 CMP3 CMP4
Actb 16.7472085 16.8352612 16.8602626 16.1110931 14.4827986 15.0603357
Aebp2 5.10557045 3.3120632 5.90217636 5.99828664 4.16296449 5.95408203
Ahr 7.89043699 0 0 0 0 0
Aktl 8.18148335 8.76665238 9.82206378 10.7068971 8.0750109 9.71182542
Akt2 0 0 4.73623383 5.90460679 0 5.31671466
Akt3 7.62109377 8.60100117 10.3161486 9.89323892 7.25420238 7.89506854
APC 0 0 0 6.42364613 0 1.66166347
Bad 0 0 0 0 0 0
Bax 9.29238441 8.3822507 9.02204677 9.89324281 0 8.05690985
Bell la 10.3227685 0 0 0 0 0
Bell lb 4.17625304 3.92709271 0 0 0 6.87178744
Bcl2 5.16525658 0 0 0 0 7.99225602
Bcl211 8.3489033 9.55544552 0 8.39669119 0 0
Bcl2111 0 4.95609125 9.99775747 9.90050891 8.99255245 2.85336974
Bmil 7.02747752 7.05328898 6.44377861 6.35815343 0 5.61256235
Table 6-4. Single cell expression data (reduced list)— Control
Factor CLP9 CLP10 CMP1 CMP2 CMP3 CMP4
Brd3 10.4902324 10.3566216 9.01263098 11.3736884 9.51822117 10.0173723
Cas 8 10.3220679 10.7369556 9.56591918 12.353426 10.3690709 10.4324467
Casp9 0 0 0 8.91438552 0 9.50719509
Cbx2 5.63357469 5.32126348 0 6.26420923 0 4.88635048
Cbx8 0 4.8985443 0 0 0 0
Ccnc 9.44462333 10.6012883 8.71922383 8.09587133 7.39164169 7.88535554
Ccndl 13.1309938 8.71442109 10.4720419 7.63908907 0 7.37626749
Ccne2 0 8.35161245 0 7.74541722 0 0
CD34 0 0 0 11.0938464 0 10.9563356
CD41 0 0 0 10.8578571 10.6626378 0
CD48 10.1531953 9.61840884 11.7599349 12.6456392 7.70003657 10.4526615
CD52 11.7226951 10.1559179 12.0658796 10.3906592 0 7.66859187
CD53 12.8012579 11.5337875 11.257362 13.1982289 0 11.0963127
CD55 0 0 0 0 8.8819203 0
CD63 0 0 6.94398394 9.24084619 0 6.92519888
CD9 7.17538049 0 8.11834259 0 0 7.63859446
Cdc42 12.9539909 13.4145126 14.1395004 13.5734692 12.5791339 12.8894502
Cdkl 11.2702793 11.3939722 0.20875207 11.1428913 0 0
Cdk4 8.41570405 11.076971 6.87263164 10.9598136 9.6088668 10.5827767
Cdkn2b 0 0 0 0 0 0
Cebpa 0.89723358 0 10.2311173 13.4808053 8.18762349 11.6632459
Csflr 0.68220487 0 8.91048376 8.52043829 7.87011519 9.68797102
Ctnnbl 6.632855 7.60076967 4.83416648 8.15260001 5.67395641 6.9102424
Cycs 10.3257774 11.5926 11.9196287 13.2793334 7.61714986 10.435771
Dachl 0 0 0 11.8661392 9.79500635 0
Dnmtl 10.9639197 10.9779133 9.7927147 13.2742978 6.43285115 11.5344213
Dnmt3a 10.1312258 10.6116941 0.01680684 11.2120611 10.1685075 9.93533932
Dnmt3b 6.02587145 0 0.28023125 10.9143614 8.14598611 11.5847104
Dtxl 0 0 1.92305529 0 0 2.30151059
Dtx4 9.68534196 5.647952 0 4.77885166 0 0
Ebfl 0 0 0 0 0 6.27167952
Ep300 10.430224 10.5649677 10.9844624 11.2861422 10.0900532 10.0078637
Epor 6.0607173 5.65375289 6.31948929 5.15194981 4.40969335 2.82619662
Erg 0 0 0 12.0363518 10.0931312 10.5218299
Esrl 10.9412325 8.69857347 0 8.23822017 0 8.23908889
ETS1 12.3373625 12.1142197 0 0 0 0
ETS2 6.29583632 0 0 0.68650314 0 6.35073519
Etv3 4.3355231 4.42802306 5.32393809 5.87942342 0 3.92981296
Etv6 8.83941501 0 8.61360798 12.0360378 10.3250242 10.9028847
Ezh2 8.85028888 10.0605202 7.27389146 9.32121342 7.38296829 10.0425905
Fas 0 0 0 4.30798527 7.17965527 0
Fcgr2b 0 0 7.77302706 7.68233416 0 0
Fcgr3 0 0 2.16280252 7.43345552 0 0
Flil 10.3126762 11.0853737 8.11430154 9.84452071 11.0778188 10.5409282
Flt3 10.8733788 11.8851759 10.4953795 8.72900327 0 11.9407693
Fosll 0 0 0 0 0 0
Table 6-5. Single cell expression data (reduced list)— Control
Factor CMP 5 CMP6 CMP7 CMP8 CMP9 CMP10
Actb 17.3394053 14.6706888 15.3006859 15.6706136 16.2161296 16.2031528
Table 6-5. Single cell expression data (reduced list)— Control
Factor CMP 5 CMP6 CMP7 CMP8 CMP9 CMP10
Aebp2 7.48010576 4.52217501 4.85718391 6.22489648 6.15542349 6.65750054
Ahr 0 0 0 0 8.48248567 0
Aktl 11.0295746 9.13888127 8.50202567 9.48522978 9.83325343 10.1423732
Akt2 5.6982268 6.43649925 0 6.54782485 5.67097403 6.91885001
Akt3 10.7535896 5.05597233 8.96329552 9.39938997 8.41514892 8.63112027
APC 0 0 5.85738488 0 0 8.00067699
Bad 0 0 0 0 0 0
Bax 10.7709938 7.60268797 9.74661453 9.46994606 10.0956302 9.66835081
Bell la 7.25102747 0 3.44256113 0 0 0
Bell lb 0 0 0 0 0 0
Bcl2 0 0 5.71221572 8.46600782 4.51709175 7.63420792
Bcl211 0 0 8.642915 9.8449129 9.83242806 11.727409
Bcl2111 4.94361446 6.96342995 0 8.82547082 7.49063229 0
Bmil 8.04079881 6.47044397 6.99413119 7.02301797 5.66629178 7.29852135
Brd3 11.7497296 9.48652042 10.2279983 10.7336706 9.99622743 10.5589239
Cas 8 11.4458868 9.37414266 10.730553 11.5737089 10.042092 11.3341723
Casp9 8.60157869 0.43486175 8.11116214 8.49830047 8.46979801 0
Cbx2 8.14298572 5.42369511 0 2.02852747 6.14976979 0
Cbx8 0 0 0 0 0 6.5352377
Ccnc 9.337732 0 0 0 8.74862406 8.05461177
Ccndl 12.3424395 0 0 5.08950715 10.3980334 9.67251383
Ccne2 10.6836164 0 0 8.88454106 7.76036683 0
CD34 13.0466336 0 10.0606452 11.7867314 8.70281995 11.9349176
CD41 7.22234749 9.88958898 0 8.74031169 13.4959806 11.1372918
CD48 12.0992452 10.568177 7.88392396 10.8210925 8.89620358 11.2734612
CD52 11.0838001 0 5.49447739 8.00130213 7.2008291 7.95395412
CD53 12.7670824 0 10.9959227 11.3777197 0 0
CD55 0 8.42133148 0 0 9.29531826 0
CD63 9.14519387 0 7.74259128 9.32290779 9.53162102 7.281967
CD9 0 0 0 0 9.68777068 0
Cdc42 14.6585333 12.6841565 13.4268211 13.5192656 13.4441459 13.1256535
Cdkl 10.9097239 6.60224216 0 9.60826336 9.2659687 11.8683968
Cdk4 12.2911932 9.86090165 7.8025631 11.0577815 11.3768742 11.0385295
Cdkn2b 0 0 0 0 0 0
Cebpa 12.8418824 0 10.2324455 13.6075773 8.81482957 11.9755884
Csflr 11.0511238 0 0 10.585565 7.27360003 3.88021025
Ctnnbl 8.35670072 4.81362741 5.97188813 5.22508782 8.07136491 8.28703889
Cycs 14.5377046 11.2691463 10.1789357 13.0405966 12.4297442 13.3283287
Dachl 4.97803655 4.14474045 10.5451334 8.59226416 11.9267309 13.5465833
Dnmtl 12.8726368 10.4919004 0 12.5203344 12.4834927 12.7064491
Dnmt3a 11.0265538 11.1062288 10.9186344 5.45624458 10.3948879 8.98758434
Dnmt3b 10.5790239 0 8.38337161 9.97828774 10.4507647 10.9212224
Dtxl 4.3790403 0 0 0.78348056 4.24129098 0
Dtx4 11.1502546 0 10.8469873 8.96806057 8.43544431 0
Ebfl 0 0 0 0 0 0
Ep300 10.4632229 10.6518923 9.84642833 10.2654483 11.2467128 10.6061578
Epor 3.12221538 5.0756706 5.30043509 0.65533034 5.10260705 2.33815245
Table 6-5. Single cell expression data (reduced list)— Control
Factor CMP 5 CMP6 CMP7 CMP8 CMP9 CMP10
Tnfsfl2 0 0 4.92147767 0 0 6.45276939
Tobl 0 0 4.87096526 0 0 0 vWF 0 0 0 0 0.92959921 0
Zbtb20 8.91468776 7.47378037 8.65801097 6.07085525 7.77205018 9.83080899
Zbtb38 7.61532556 8.16188767 7.21002151 9.37139278 9.52940602 7.19300308
Zfp532 0 4.20413936 0 0 0 2.33025492
Zfp612 6.36251023 0 0 5.89338537 5.72389563 0
Zfpml 0 7.38814478 0 6.75057183 4.81492174 0
Zhx2 0 10.0153129 0 10.0672844 0 0
Table 6-6. Single cell expression data (reduced list)— Control
Factor GMP1 GMP2 GMP3 GMP4 GMP5 GMP6
Actb 17.1489215 17.1987952 17.0261935 17.386841 16.8304269 16.7489209
Aebp2 7.38412472 7.37000886 7.67068492 8.3165713 5.4136843 7.57713129
Ahr 0 0 0 0 8.2586416 2.48178389
Aktl 11.235626 11.370018 11.2228314 11.4580108 9.35433585 11.3917982
Akt2 0 5.65369871 6.60168541 7.30834154 7.09194507 7.27954511
Akt3 9.2040554 6.42589774 7.76683642 10.3335 0 0
APC 0 0 10.3835517 0 8.371236 0
Bad 0 0 0 0 0 0
Bax 12.3982935 11.548933 11.7457261 12.5304908 9.63819013 9.58757022
Bell la 0 4.8496745 5.5277101 0 0 0
Bell lb 2.47388586 0 0 3.3676317 4.51519907 0
Bcl2 8.67205883 4.74052395 7.4793676 9.81638057 0 0
Bcl211 11.2985207 10.9107736 8.31831953 10.0601684 7.45200039 0
Bcl2111 9.91590871 8.18472841 7.91574582 8.84722554 10.1748095 6.43500489
Bmil 7.65085777 4.83187475 9.02271832 6.18509638 7.09454308 7.56761362
Brd3 12.2200241 8.5222524 12.5897181 12.3613327 12.0766338 11.4340477
Casp8 11.9935864 12.4728177 11.2081299 11.7931878 10.6330727 9.95275872
Casp9 9.85784236 9.2795417 10.4608042 9.30079864 8.68972348 8.67710004
Cbx2 8.13468181 6.26338723 4.15904155 2.80402938 0 4.90815454
Cbx8 0 0 0 0 0 0
Ccnc 6.54457096 7.80869339 10.2612515 10.5944974 9.89068237 8.39273481
Ccndl 8.58525018 9.07320206 0.44602581 11.6985658 0 8.4714389
Ccne2 10.2847235 10.3613222 10.2263111 7.68162663 7.00126105 7.38398862
CD34 9.76737788 11.3493653 12.3762338 12.665751 0.7308249 0
CD41 0 0 9.92285908 10.1379171 0 0
CD48 11.1755703 12.3720324 11.2216769 13.1172131 8.98467946 11.1712268
CD52 12.214887 11.4843836 6.92750614 10.055469 9.88050006 9.66769309
CD53 13.734581 12.9470142 11.5566919 12.0795346 11.4796107 11.6332867
CD55 0 0 0 0 0 1.98400237
CD63 5.83669083 10.6791061 11.1660619 9.5002936 11.8417986 11.5674632
CD9 7.33502006 0 10.0478265 0 9.8535396 9.37192294
Cdc42 15.071603 14.9063997 14.4251672 15.2700451 14.1058059 14.2812027
Cdkl 11.1089539 12.565398 10.0640308 12.9451584 8.92252913 10.3979323
Table 6-7. Single cell expression data (reduced list)— Control
Factor GMP7 GMP8 GMP9 GMP10 HSC1 HSC2
Actb 16.9514796 17.399739 17.2637454 16.9850638 14.2167236 14.6194148
Aebp2 7.35505455 4.38592355 5.1807596 7.51562781 2.42975426 4.97605754
Ahr 0 8.88485487 10.3510122 0 0 0
Aktl 12.2492506 10.7788814 9.09878888 11.5407814 8.96092519 8.92881088
Akt2 7.07125847 6.57841965 5.05613909 8.09120983 0 5.44823903
Akt3 9.84112573 10.6234887 8.79800603 10.3335926 0 9.31021549
APC 0 0 8.16762557 8.43918267 0 0
Bad 0 0 0 0 0 0
Bax 11.0109809 11.0453066 9.34116544 11.9634436 7.34390449 8.34746535
Bell la 0 9.41212409 0 0 8.75277008 0
Bell lb 0 0 0 1.88740222 0 0
Bcl2 0 0 0 8.52796043 5.87135064 0
Bcl211 9.44244435 10.1472452 0 11.1322976 8.66094346 9.94832245
Bcl2111 10.1673298 0 0 0 0 8.69198824
Bmil 8.07353481 7.72482902 4.98516188 8.47434036 6.82657462 7.46085956
Brd3 12.6394847 11.2028078 7.11480939 11.8951694 9.33404025 8.63333449
Casp8 11.8613695 9.99564976 9.21248114 11.5898934 0 8.6154989
Casp9 8.59054116 8.91150088 8.46508701 8.65641125 8.2106278 0
Cbx2 4.51981855 0 0 0 0 0
Cbx8 7.59923933 0 0 5.95563266 4.01892229 0
Table 6-7. Single cell expression data (reduced list)— Control
Factor GMP7 GMP8 GMP9 GMP10 HSC1 HSC2
Ccnc 5.81056153 1.75012419 6.70114967 7.82322872 0 7.8085882
Ccndl 11.5505776 0 10.1157016 9.71290948 0 8.62150748
Ccne2 11.303028 9.04842269 0 9.50031357 0 4.39863781
CD34 12.2237971 0 8.89631259 13.6407341 9.50379181 9.06540049
CD41 0 0 0 0 0 0
CD48 11.4659003 9.71355517 10.4133748 11.4910927 0 0
CD52 9.60985547 9.93196311 12.5022437 10.7028269 0 0
CD53 12.1131339 12.7875274 11.5957042 12.2029543 0 0
CD55 0 0 0 0 6.89471557 7.36408685
CD63 8.93841954 12.146554 0 5.48306679 9.19375582 7.65368115
CD9 0 10.1324772 7.67704046 0 7.8387743 0
Cdc42 14.4664142 14.2907989 14.0122499 15.0649621 11.9634665 12.0459978
Cdkl 11.3777802 8.11959637 0 12.7269855 0 0
Cdk4 12.784903 10.8753402 6.80400834 12.6121689 9.62020787 8.49447754
Cdkn2b 0 0.00701553 0 0 0 0
Cebpa 13.8746339 13.8824666 0 14.641417 0 8.06551113
Csflr 11.5330216 3.88795501 7.38801037 12.5028245 0.17278247 0
Ctnnbl 8.77284547 8.15585683 7.63240721 9.49085314 7.84991528 6.63261919
Cycs 14.9720652 13.8929845 11.7488184 14.6315404 9.69074953 9.01652869
Dachl 10.0139282 11.094158 0 0 0 9.34452255
Dnmtl 13.8203577 13.062377 8.93180003 12.6151647 8.13040287 8.73259462
Dnmt3a 11.5907989 10.5082482 8.16704073 12.2259286 0 9.03600947
Dnmt3b 10.3460639 8.40852444 0 11.6532099 8.08118305 9.0180945
Dtxl 0 0 0 0 0 0
Dtx4 12.3828586 12.8400604 9.87791515 12.95339 0 0
Ebfl 0 0 0 0 0 0
Ep300 9.94498424 10.2010752 9.23583811 10.6282941 10.4403515 8.59444295
Epor 5.16793546 5.09166176 6.07340251 5.10546348 0 2.7151266
Erg 11.0543498 8.41211355 0 12.089156 10.1146713 11.7537883
Esrl 11.6199962 10.7508391 0 10.3804934 10.0633516 0
ETS1 0 11.8060427 0 2.87560829 10.507867 0
ETS2 0 8.07791161 2.28329408 0.76338635 0 8.47008891
Etv3 5.74740043 7.36604372 0 5.34860303 4.23394023 5.05619729
Etv6 12.9684077 11.0021541 9.73755797 13.9096409 3.98851235 10.7091763
Ezh2 11.2994093 9.96948763 8.77091516 11.243305 0 9.25661058
Fas 0 0 0 0 0 0
Fcgr2b 9.44038194 9.26444191 8.49671511 0 0 7.5507537
Fcgr3 8.9878976 11.2705376 0 7.10105394 0 2.57719687
Flil 12.3237708 12.3248589 9.73909286 12.1105145 10.3593911 9.96450923
Flt3 12.2416095 0 12.2385762 12.4225757 0 7.96248373
Fosll 0 0 0 8.07129215 0 0
Foxol 11.0340434 9.06969139 10.1546488 12.3061817 9.40775249 10.5472402
Foxo3 9.90987077 7.70047424 0 11.2129013 10.4052826 9.57989143
Gapdh 14.3410656 13.3216214 6.17605235 13.0958987 9.71964182 8.2639086
Gatal 0 1.6059749 0 0 0 0
Gata2 4.56581362 0 0 3.24897579 5.55356347 6.52542185
Table 6-8. Single cell expression data (reduced list)— Control
Factor HSC3 HSC4 HSC5 HSC6 HSC7 HSC8
Actb 13.577974 14.0296483 14.1103469 15.5819895 15.4017467 14.5186085
Aebp2 6.10559528 5.88912085 4.6132596 6.72522268 6.54183737 6.53821191
Ahr 0 8.48413666 0 8.64794663 0 0
Aktl 5.7101674 8.39335711 8.11021366 10.2087847 8.77360611 9.23696389
Akt2 0 0 0 5.73394549 4.95527812 5.5482851
Akt3 8.79551486 1.55468933 8.24574153 9.13533117 9.22444783 8.23443739
Table 6-8. Single cell expression data (reduced list)— Control
Factor HSC3 HSC4 HSC5 HSC6 HSC7 HSC8
APC 0 0 0 9.1544444 8.26372086 0
Bad 0 0 0 0 0 0
Bax 10.4587872 7.84637341 8.21704944 10.5910972 9.05419378 8.1433208
Bell la 0 0 0 0 0 8.71685996
Bell lb 0 0 0 0 0 0
Bcl2 0 0 0 6.60286713 0 0
Bcl211 0 8.15463837 0 8.81750986 9.51798174 9.26348136
Bcl2111 0 7.08014318 0 0 8.80771493 0
Bmil 6.37303271 6.75760763 6.40723471 8.78539598 6.73467101 0
Brd3 8.10648223 9.12195615 0 10.313197 9.04032119 8.4172914
Cas 8 8.60911844 8.67718647 8.08973581 8.8351678 8.29348209 10.4887846
Casp9 8.50198655 0 0 8.0906086 8.93408591 0
Cbx2 2.12580066 0 1.37858473 0 6.38626502 3.95391221
Cbx8 0 0 0 0 0 0
Ccnc 8.0612119 7.75585225 0 8.0425277 7.97210372 4.50082307
Ccndl 0 9.44185728 0 10.806783 0 9.84865359
Ccne2 0 0 0 0 0 0
CD34 8.17751775 5.00363076 7.74656357 7.72536834 7.31850948 0
CD41 0 0 0 10.2838042 0 10.3942665
CD48 0 0 0 0 0 0
CD52 0 8.30090194 0 0 0 0
CD53 0 0 0 0 0 0
CD55 7.69179367 4.79347239 6.9936477 9.05205329 0 8.21658095
CD63 8.84869188 9.80818054 8.85251987 10.377284 8.91902336 8.99037439
CD9 7.96692234 7.15928214 7.1345801 8.5320473 3.5188154 8.2765401
Cdc42 11.8342425 11.274525 11.5477464 12.9667945 11.216272 12.9992851
Cdkl 0 0 1.70469042 9.19399937 0 8.58515514
Cdk4 6.80715808 7.17264944 2.02643408 11.1452163 9.41268282 6.45109978
Cdkn2b 0 0 0 0 0 0
Cebpa 8.66392034 0 8.58072977 6.63194812 0 0
Csflr 0 0 8.74066681 1.70542256 7.47370204 0
Ctnnbl 6.45093961 6.80576451 7.03105301 8.66585445 4.63621377 6.42492055
Cycs 7.76931122 8.17385953 9.1062029 11.5938916 10.2963567 10.5610571
Dachl 8.32689948 9.6993744 0 10.5160163 11.5555411 12.1784951
Dnmtl 0 0 0 11.5088913 0 10.870094
Dnmt3a 10.0217648 11.1560578 9.24043447 10.2575566 10.2648603 12.1222467
Dnmt3b 0 0 0 8.90491552 0 9.12251996
Dtxl 3.63908589 0.2314944 3.28281301 0 0 1.84006193
Dtx4 0 0 0 0 1.19632544 0
Ebfl 0 0 0 0 0 0
Ep300 11.0845039 8.98243523 10.7104073 9.62872537 9.96024059 9.41340549
Epor 4.04169265 5.05457514 6.15980606 4.89038806 5.63286624 5.89050554
Erg 11.8077154 11.2396194 11.3083977 11.0154674 10.8697562 10.0863194
Esrl 8.38535842 0 9.45876416 0 8.20146951 9.59278249
ETS1 7.78767496 8.3813926 8.32316912 0 0 0
ETS2 0 5.54640271 0 9.236687 0 10.2058893
Etv3 1.54998505 6.21266641 4.23572008 6.55515366 0 3.67608709
Table 6-8. Single cell expression data (reduced list)— Control
Factor HSC3 HSC4 HSC5 HSC6 HSC7 HSC8
Zfp532 0 4.08592807 3.77146991 4.36860224 0 2.64992417
Zfp612 5.04540623 1.29781735 6.43562895 1.81941986 0 5.71057878
Zfpml 0 0 0 0 7.43302501 0
Zhx2 0 3.17433055 0 0 0 10.2241584
Table 6-9. Single cell expression data (reduced list)— Control
Factor HSC9 HSC10 MEP1 MEP2 MEP3 MEP4
Actb 14.9725561 15.5430056 16.6739018 17.1798405 16.7754755 16.9120965
Aebp2 5.34272666 2.46759537 7.60291615 5.68775766 8.40647947 8.15032471
Ahr 0 0 0 0 0 0
Aktl 8.71552396 9.04361278 10.8964237 10.6593665 10.5554637 10.4625715
Akt2 1.6860339 0 5.40370098 7.79517803 7.18806974 6.57237902
Akt3 9.27378957 9.16410517 0 7.90778801 7.25351311 8.6899408
APC 0 0 0 0 0 8.92917564
Bad 0 0 0 0 0 0
Bax 9.57334173 9.01870701 13.1654553 12.6147597 11.6763189 11.8499785
Bell la 0 6.38030957 8.61622865 0 0 6.50601386
Bell lb 0 0 0 3.99048372 0 0
Bcl2 6.53694296 5.97214969 0 0 0 0
Bcl211 10.5706275 2.81256542 0 9.90189687 7.93964747 0
Bcl2111 0 0 11.4930521 9.68858479 11.1719166 11.744598
Bmil 8.0356025 5.71483882 8.52931514 8.55595556 10.0673986 8.43810889
Brd3 11.4628865 8.46832128 11.0280089 11.2582907 10.1577315 11.3931352
Casp8 9.80815784 10.7239994 8.89508957 6.21772996 7.84127145 10.4709266
Casp9 0 0 5.82312549 10.5005325 10.3674251 10.8167842
Cbx2 2.20378454 5.19558249 5.96803494 4.9871259 0 1.36472366
Cbx8 0 0 0 0 0 0
Ccnc 7.14555417 9.54460991 9.10840098 7.7775943 9.69822219 10.7463612
Ccndl 10.3147623 8.43483043 12.5806504 10.1616065 0 9.50499479
Ccne2 2.11634283 0 12.3632828 11.5458361 7.65370744 11.8196672
CD34 8.7300738 7.56097552 0 0 0 0
CD41 9.90770066 10.2820486 0 0 0 0
CD48 0 0 8.8519551 0 0 10.2839816
CD52 0 0 0 0 0 0
CD53 0 0 0 0 0 0
CD55 0 0 9.35100587 9.53334636 6.17916642 8.52837797
CD63 9.95525539 9.13287496 0 0 0 0
CD9 8.19006868 8.93484354 0 0 0 0
Cdc42 12.8484097 12.3557558 14.0139592 14.5300457 13.7188884 14.3827631
Cdkl 8.40315409 0 10.2066902 12.0503625 11.856245 10.4737341
Cdk4 9.36174345 9.55697505 12.4311347 12.9555662 12.0600059 13.2462207
Cdkn2b 0 0 0 7.13192772 0 0
Cebpa 0 0 4.83137386 0 6.06861889 0
Csflr 0.78905294 5.76347829 7.35935898 0 0 0.43693507
Ctnnbl 6.91786038 7.30835446 9.09223561 9.17717471 8.27674053 9.66975154
Cycs 9.20845458 9.97537598 14.4833117 14.8868575 14.3632329 14.6822205
Table 6-9. Single cell expression data (reduced list)— Control
Factor HSC9 HSC10 MEP1 MEP2 MEP3 MEP4
Ldbl 12.4178652 11.01075 13.0390188 13.7874605 13.1564759 13.2168482
Lin28a 3.82329997 6.81496961 7.33729444 6.61281699 0 6.08888311
Lmo2 11.5637423 9.92019304 11.5030529 11.9384772 12.6434079 10.6947974
Ly6a 7.06884075 8.44508253 0 0 0 0
Lyll 8.88014622 8.35784347 6.95117372 9.77435583 0 9.20859202
Mbd2 9.13439987 8.56907105 13.0509809 13.9543519 12.6665248 13.1243311
Meisl 9.80331618 8.1571184 0 0 0 0
Mllt3 4.15938546 0 4.12160509 7.79510244 4.48253793 0
Mpl 10.996255 9.44406546 0 0 0 0
Mucl3 6.82422246 7.13195827 0 0 5.01336678 1.81337571
Myb 11.5244445 12.4461891 13.2111197 12.8071283 12.9764179 13.9759288
Myc 0 10.9160751 11.9866355 11.2429304 12.3999539 13.9029694
Mycn 14.4756491 11.6026038 0 0 0 0
Ndn 11.2837686 10.4369415 0 0 0 0
Nfat5 9.61855366 6.82014528 6.59682409 7.27479713 0 8.74499807
Nfia 9.41329393 10.6171397 13.5009826 14.0902354 12.9714138 13.0254549
Nfkbl 0 2.2519501 3.25804287 2.4908206 0 5.47964873
Notchl 8.12991025 0 0 0 0 0
Pax4 6.1516811 0 4.85665083 0 0 3.3619616
Pax5 0 0 0 0 0 0
Pax9 0 0 0 0 0 0
Pbxl 0 0 0 0 0 0
PIk3ca 9.25738741 8.96174345 10.7256565 10.8683249 9.65150968 11.2464339
PIk3R2 9.30544358 0 12.2128948 12.2784314 11.0187609 12.287832
Plagl 8.64324095 0 9.06569451 0 0 0
Prfl 0 0 0 6.84326582 0 0
Pten 9.60478178 9.6731031 10.2929626 10.3569939 10.4823987 9.95159857
Rbl 10.2970029 8.60735432 12.6978008 13.4211639 10.6504251 12.7561166
Rora 0 0 0 0 0 0
Runxl 10.1584718 9.33038616 10.7805682 8.07026179 0 9.37272993
Runx2 4.28423467 4.26402635 0 0 0 0
Satbl 0 0 0 0 0 0
Sdpr 4.32744503 1.7057899 0 0 0 0
Sell 0 0 0 0 0 0
Sfpil 6.83682861 11.0545418 0 5.45218154 2.04252139 0
Slamfl 9.49023226 0 0 0 0 0
Smarca4 12.2973535 11.2507486 13.5426414 13.619892 12.1620756 12.8704926
Sosl 8.06475892 6.27720781 9.19936975 7.36566754 6.8048466 9.35683189
Statl 4.52662558 0.99719233 2.64761229 4.45186216 3.7746722 7.81972053
Stat3 11.0439439 11.5366037 8.88331309 0 9.64846927 9.55859823
Stat4 9.34715798 6.79032745 6.31260327 0 0 0
Stat6 11.0298664 7.72102603 11.0611639 8.69939135 9.35073565 2.30375272
Suzl2 9.21902863 9.76884858 13.4162816 13.3069763 12.1189393 12.8721225
Tall 3.5749488 2.63840682 5.48831658 5.90135703 5.14302435 6.08051416
Tcf3 8.19970314 7.80579899 10.3443653 9.82695879 7.84599927 11.004031
Tcf4 11.8040378 9.82961636 10.260851 11.3188496 11.2508544 11.653967
Table 6-10. Single cell expression data (reduced list)— Control
Factor MEP5 MEP6 MEP7 MEP8 MEP9 MEP10
Actb 17.2576396 17.1978808 15.5072422 17.1016623 17.0883469 16.1373068
Aebp2 8.8914175 8.24109539 5.927731 8.12926334 6.58436041 7.2192823
Ahr 0 0 0 0 0 7.10578696
Aktl 11.6018488 11.5146864 4.42998334 11.601648 10.7522773 10.3129742
Akt2 7.900821 1.74602406 4.64739684 7.50740455 6.69059007 7.16770014
Akt3 0 7.96018226 0 7.35315614 2.17729258 7.80192128
APC 8.39335253 8.06797773 0 1.75142305 1.8927044 0
Bad 0 0 0 0 0 0
Bax 13.6760247 13.3176728 10.1228648 12.4537506 12.065459 11.730697
Bell la 0 0 0 0 2.71314006 0
Bell lb 0 0 0 0 0 0
Bcl2 0 0 0 5.96566948 0 0
Bcl211 8.42050716 8.5397273 8.24768464 7.86215744 7.9016606 7.95497919
Bcl2111 12.229686 10.1662961 8.73177655 9.85270326 8.51815048 10.7405021
Bmil 10.2387084 9.31396694 6.36310467 6.09634272 7.60876135 5.56419831
Brd3 12.1884423 11.3821336 9.16931971 11.5847665 10.3403875 11.440292
Casp8 9.45558864 9.60183486 0 8.96045034 9.60483639 9.81855927
Casp9 10.983114 11.2997749 4.1377792 3.19674834 10.6397827 5.83890378
Cbx2 3.91898214 6.93850275 2.68444976 5.77648185 4.81078818 5.84443483
Cbx8 0 0 0 0 0 0
Ccnc 10.1627738 9.76965727 1.35355046 10.8327556 10.2251453 8.87207477
Ccndl 9.06711014 9.78697864 3.39014804 7.92433606 3.63100877 1.61547934
Ccne2 10.0835116 11.319821 3.31015618 11.1288883 10.1332622 10.1575498
CD34 0 0 0 0 2.43527288 0
Table 6-11. Single cell expression data (reduced list)— Control
Factor MPP1 MPP2 MPP3 MPP4 MPP5 MPP6
Actb 15.9338457 15.4232208 16.2711873 14.6823 14.2918152 15.8659118
Aebp2 7.21100476 5.2867401 6.93025793 5.90925673 5.25462477 9.18427092
Ahr 0 0 8.34801326 0 0 0
Aktl 10.720231 9.40876898 11.0220046 9.04411511 9.0996424 11.2217446
Akt2 2.21487307 5.4868309 0 0 5.35510644 0
Akt3 8.87303458 8.64995993 8.90809022 8.03436457 0 10.0275887
APC 9.11114608 0 8.0871966 1.98598274 8.73132197 4.78295182
Bad 0 0 0 0 0 8.89131665
Bax 8.98329445 10.498022 9.02157645 9.45119586 0 9.14566934
Bell la 0 0 0 8.89978638 0 8.82676654
Bell lb 0 0 0 0 0 0
Table 6-11. Single cell expression data (reduced list)— Control
Factor MPP1 MPP2 MPP3 MPP4 MPP5 MPP6
Bcl2 5.4456877 6.76850037 8.56326925 0 0 6.41872246
Bcl211 8.77442328 9.4903021 8.32482213 8.37825811 0 9.68984903
Bcl2111 8.65261883 0 8.55329576 0 0 0
Bmil 7.92005647 8.96348283 7.6988806 5.99607904 8.09101102 10.2547476
Brd3 11.0992941 10.6513546 9.61291134 9.43861553 6.3757271 10.8237539
Cas 8 11.3348993 11.0515753 10.9825524 9.29875931 8.5871616 10.8985747
Casp9 8.73428375 10.0497654 0 0 0 2.43946663
Cbx2 7.57992406 6.71714066 0 0 0 0.6708544
Cbx8 0 0 0 0 0 0
Ccnc 8.35164492 0 6.07511496 9.13555725 0 7.33770601
Ccndl 8.60823223 0 9.93021361 0 9.80132789 8.95924036
Ccne2 7.6057764 10.4324496 10.1697513 7.75985448 0 10.6399418
CD34 11.1537947 12.1750274 11.4199898 10.0501247 10.5540352 11.3151543
CD41 0 5.28178356 0 0 0 0
CD48 9.48857003 11.0978106 11.3892976 8.80517983 0 9.56184962
CD52 9.67070973 9.66597181 10.8936843 7.05264794 7.44343937 10.2105126
CD53 11.1467937 11.241697 10.1035022 11.4194355 0 11.4433546
CD55 0 0 0 0 0 0
CD63 6.93667918 10.6830361 7.91059718 7.48471238 4.0814483 0
CD9 0 0 0 9.13917551 0 0
Cdc42 13.4222253 12.5348596 13.56969 12.3378718 11.7636509 12.8887671
Cdkl 10.9643801 11.4007291 9.70754751 0 0 10.4661432
Cdk4 11.8074379 10.3164272 12.5018024 9.48804452 6.81583478 11.7800185
Cdkn2b 0 0 2.77346992 0 0 0
Cebpa 9.22772932 10.0275028 11.2952199 11.0642013 9.09418965 10.4493234
Csflr 0 8.45310432 8.99182682 7.91613811 10.0723015 0
Ctnnbl 8.32067527 5.00574303 8.39061689 8.19898063 4.79592084 8.46222031
Cycs 13.0347923 12.4656213 14.3162078 9.98439188 9.65986044 12.6497946
Dachl 0 13.3892767 0 7.3947807 9.10470453 0
Dnmtl 12.8259216 12.6055461 12.7124172 10.1043631 0 12.0574902
Dnmt3a 11.5381376 7.80820219 11.1160495 10.4359516 9.17576912 10.796858
Dnmt3b 10.7508563 11.1492963 9.71848489 10.1049899 8.03011401 10.8681675
Dtxl 0 0 0.31107154 0 0 0
Dtx4 11.1069971 7.43011153 12.4091038 0 0 0
Ebfl 0 0 0 0 0 0
Ep300 8.75076257 8.59075653 9.62468843 9.68032474 9.58816102 8.39625294
Epor 4.91252317 3.1681373 2.6614969 0 3.60216649 0
Erg 9.15107944 12.1140199 10.0602319 8.05974652 9.1838276 7.70552462
Esrl 11.9774405 8.93512079 9.30574164 10.8765411 0 10.0872926
ETS1 10.5968066 10.5087649 0 8.1786786 0 10.9157853
ETS2 8.80623923 5.91625835 6.07444663 8.44682963 1.07952469 8.81372256
Etv3 5.042175 0 6.17334389 5.48927278 0 4.47456273
Etv6 11.2690271 11.8468993 10.1410346 10.3082532 10.7932873 11.5654449
Ezh2 10.9805883 10.1182621 9.56833692 8.93691074 5.75295828 11.0075626
Fas 0 0 0 0 0 0
Fcgr2b 0 0 7.59523747 0 0 0
Table 7-1. Single cell expression data (reduced list)— iHSC-8-TF
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF1 TF2 TF3 TF4 TF5 TF6
Actb 15.3406135 15.3198955 12.6214841 13.9265913 14.907027 15.0828458
Aebp2 5.851253 6.91015329 6.18045816 6.13677942 6.31619136 6.55729075
Ahr 0 0 0 0 0 0
Aktl 10.3432926 10.2118447 8.44749976 8.43295768 11.0465135 11.5937761
Akt2 3.80481193 4.13073296 3.84759163 4.37730874 4.24877633 0
Akt3 6.26062374 5.80767709 0 6.66877618 0 7.28666292
APC 7.75143555 0 0 0 6.70926589 6.91997434
Bad 0 0 0 0 0 0
Bax 10.0841523 8.99852595 8.53670881 7.1491247 9.41403376 10.0713208
Bell la 0 3.57733258 0 0 0 0
Bell lb 0 0 0 5.03025421 0 0
Bcl2 3.78836066 7.35286615 6.11642851 5.60720562 0 4.75013415
Bcl211 6.11017227 0 0 8.25842512 8.41053397 10.5350727
Bcl2111 7.53158421 0 0 5.97717038 6.54979563 7.23702656
Bmil 8.99154721 8.57213633 1.00536134 7.1259908 7.77630502 9.13913696
Brd3 9.63555762 6.68960269 5.68713764 7.26905043 7.53751543 8.54151772
Casp8 8.69580853 7.82250438 7.27391311 7.12647247 8.13689545 8.33966066
Casp9 7.50634956 7.89665585 8.78122572 8.22640477 0 0
Cbx2 7.63597293 0 0 2.88451144 6.55755634 7.70632981
Cbx8 0 0 0 0 6.58332722 1.23705272
Ccnc 7.07744906 7.39096581 7.05379006 0 8.19654082 8.46919791
Ccndl 7.17456113 0 3.67561661 9.15556129 0 0
Ccne2 8.84703835 6.74398849 0 0 0 0
CD34 7.76800322 10.2510414 2.42976374 6.94679739 7.33591375 0
CD41 0 7.75482846 0 0 8.70769069 0
CD48 0 7.17814996 8.01816633 0 0 9.55567614
CD52 10.0135314 0 11.8982735 8.81778186 7.57773901 11.0136116
CD53 10.0270236 10.1725729 10.2462871 7.3567463 0 10.7604721
CD55 4.54836488 6.25337777 0 6.26516647 4.55684724 5.44238382
CD63 5.17005936 7.47563153 3.07832198 6.44407765 5.26499364 5.17350267
CD9 0 9.46828366 8.37563384 6.77430086 9.39342697 0
Cdc42 11.4639526 11.5821246 9.83848584 11.2577485 10.7756615 12.9047404
Table 7-1. Single cell expression data (reduced list)— iHSC-8-TF
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF1 TF2 TF3 TF4 TF5 TF6
I17R 0 0 0 0 0 2.82350147
Irf4 6.24028863 0 11.2249245 0 0 0
Irf6 3.86697265 4.68374949 0 0 2.8135202 0
Irf8 8.6858537 4.6101286 8.99498491 0 4.89636707 9.36420702
Kdr 0 0 0 0 0 0
Kit 8.06121617 11.9083565 7.88520732 10.3475565 11.5383331 7.96739286
Klfl 1.36227074 7.02627962 0 0 0 0
Klfl2 0 3.7799555 3.59391415 6.64529932 0 0
Ldbl 8.95380125 8.26779513 6.67202901 7.76543805 8.512649 10.3751947
Lin28a 5.97666173 0 0 7.2842936 4.1303577 4.23775192
Lmo2 0 9.90783707 4.1601552 8.76750141 9.49745795 6.40470448
Ly6a 6.49157656 9.20829801 11.7720222 8.78675489 6.61460984 8.7967369
Lyll 3.47100366 8.3783465 0 0 0 0
Mbd2 10.1353897 9.91842346 7.76162024 8.01621694 8.98629969 11.7384075
Meisl 0 7.58467677 4.18043129 6.15361674 7.3922156 0
Mllt3 0 0 0 0 0 0
Mpl 0 7.78365781 0 7.84750206 9.14807149 0
Mucl3 1.28725247 10.3687609 0 8.47827528 8.95782857 6.65183597
Myb 11.2938204 11.7723867 0 10.7012638 10.0192772 12.3107218
Myc 6.57202892 9.18538633 0 8.83016864 9.14318076 10.0463899
Mycn 0 7.76977355 5.06288392 6.8514822 10.8400837 0
Ndn 8.3289328 7.37671042 0 5.16705845 7.20854243 7.11546949
Nfat5 9.5189948 10.536889 9.07919517 9.36357896 8.84740478 8.99109512
Nfia 7.94744233 7.71267144 0 8.18008257 5.13480173 8.01727058
Nfkbl 4.49309052 0 0 3.48186805 0.74786804 0
Notchl 0 7.53698774 7.22766077 0 0 0
Pax4 0 0 0 0.90906537 0 0
Pax5 10.5019087 0 0 0 0 10.127363
Pax9 0 0 0 0 0 0
Pbxl 0 0 0 0 0 0
PIk3ca 8.87496334 9.59446253 8.38080955 7.92496672 7.19725366 8.34649914
PIk3R2 0 9.01075671 7.65058108 0 0 8.8251932
Plagl 6.21437664 0 0 0 0 0
Prfl 5.13052494 0 0 5.10255205 1.86255408 0
Pten 10.4209011 9.40062124 8.96322075 9.10909358 9.71271677 11.3745533
Rbl 11.498329 7.96524059 9.94840657 8.51800071 8.72633492 10.2612969
Rora 4.6565537 4.45455454 4.29766187 0 6.78445169 0
Runxl 0 3.59548673 0 0 8.70903268 8.69444499
Runx2 0 4.8737639 0 2.43317885 2.69308191 0
Satbl 9.58445099 0 0 0 0 10.0568223
Sdpr 0 0 0 3.31280029 5.62934476 0
Sell 0 9.75709978 0 6.9298617 0 8.38589128
Sfpil 7.63770596 10.0783626 7.41813664 9.49550468 7.19133526 0
Slamfl 0 0 0 6.06097964 6.25642952 0
Smarca4 13.0953186 10.9600388 9.46765173 9.90759459 9.19212961 12.8606875
Table 7-2. Single cell expression data (reduced list)— iHSC-8-TF
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF7 TF8 TF9 TF10 TF11 TF12
Actb 14.1168122 14.2687572 15.8641756 14.4381106 14.3257382 14.6272225
Aebp2 6.58743305 5.66417136 5.22379812 5.95905614 7.01711608 6.02218741
Ahr 0 0 0 0 0 0
Aktl 10.4975255 8.19356615 10.0511812 9.94944796 10.0904307 9.78983507
Akt2 0 5.90204274 5.55935143 0 0 0
Akt3 4.44707058 0 5.01641454 5.89301145 6.31601984 2.88783769
APC 0 0 6.72226741 7.01362759 0 0
Bad 0 0 0 0 0 0
Bax 9.21290548 10.3301544 9.28539174 6.90668957 8.43007045 7.04487576
Bell la 0 0 7.05226632 6.95413316 0 0
Bell lb 0 6.70827939 0 0 2.52118042 0
Bcl2 0 6.16765619 5.32242768 3.97203709 4.00080172 6.6941012
Bcl211 8.66402847 0 9.00530066 8.98651494 9.26985486 0
Bcl2111 0 0 3.75189301 7.10582142 6.50890906 7.33360294
Table 7-3. Single cell expression data (reduced list)— iHSC-8-TF
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF13 TF14 TF15 TF16 TF17 TF18
Actb 15.4534796 15.0457213 14.7547847 15.7050081 14.3181958 15.2330791
Aebp2 6.93704471 4.91542799 7.05506882 6.86348616 6.24968398 5.62877356
Ahr 0 6.43180668 0 0 0 0
Aktl 9.16365108 9.30008467 10.763603 10.9936127 9.4294317 0
Akt2 6.73569225 0 6.4766602 0 4.80553304 0
Akt3 6.11863003 6.64875353 5.17305023 0 0 0
APC 0 0 0 0 0 0
Bad 0 0 0 0 0 0
Bax 10.2213052 9.11498692 0 9.44119327 7.49341326 8.82070706
Bell la 0 0 6.11771712 0 0 0
Bell lb 0 0 0 0 0 0
Bcl2 7.93705313 5.59605449 6.02070196 4.81608191 6.50918987 6.69771435
Bcl211 9.7231417 8.58128508 10.0362848 10.2067064 0 11.066282
Bcl2111 7.37172881 7.69830505 7.17734172 9.34606481 0 6.72034529
Bmil 7.34695691 7.21167775 6.05530861 8.46478884 8.08106641 7.75522788
Brd3 8.02785515 5.00010534 8.51144277 9.52747453 6.80545653 0
Cas 8 8.37321188 7.75230575 8.13985014 8.57969582 8.23333205 8.00637905
Casp9 7.68090941 2.32375499 0 6.320208 8.96183861 0
Cbx2 6.504426 1.54049084 7.04621731 7.72437829 2.30499009 0.11481278
Cbx8 0 0 0 0 0 0
Ccnc 0 0 7.36621375 6.70170152 6.00327617 6.24461652
Ccndl 6.62265505 7.4467213 7.52700713 6.9456186 9.35651788 0
Ccne2 8.90201474 0 9.03686227 8.45653951 4.11742928 0
CD34 8.79163706 9.8829815 0 0 7.5325444 0.57823047
CD41 10.2235313 0 10.1703794 0 0 0
CD48 7.97202788 8.9224792 8.76089598 9.39765892 0 8.03809749
CD52 0 9.99964113 10.2992003 9.8539851 8.86491007 12.4913694
CD53 0 10.8351065 0 10.056315 9.14134727 10.1859346
CD55 5.74807313 0 6.03533722 4.24146883 0 0
CD63 7.74519483 7.00827947 6.94140733 5.72566979 7.10413036 4.56443151
CD9 8.90957851 7.49731749 8.92034488 0 8.64862026 5.6361667
Cdc42 10.9823548 11.4094614 11.4173435 12.0104029 10.8763938 12.158319
Cdkl 10.1932253 0 10.4913805 0 0 0
Cdk4 8.9755164 8.35943257 8.53085097 8.9627628 8.36068234 5.6036139
Cdkn2b 0 0 1.36381366 0 0 0
Cebpa 5.893276 9.70964699 8.88909053 0 8.03529285 0
Csflr 0 0 0 1.44879467 3.67785521 0
Ctnnbl 7.48981199 8.1336946 9.20156778 8.61320717 7.43105241 7.17682577
Cycs 10.8157891 10.720996 11.7664034 12.1637591 8.54219495 10.5592201
Dachl 8.37404548 11.5809914 10.0147913 0 0 0
Dnmtl 12.1405773 8.76320326 11.4721676 10.43018 8.16086858 8.31332046
Dnmt3a 8.03355106 10.3047393 10.4905211 7.34945749 9.69684484 8.09559308
Dnmt3b 7.76598102 7.12399038 7.7635638 5.62611906 0 0
Dtxl 0 0 0 3.00328203 3.57731956 0
Dtx4 0 0 3.31637812 0 2.0047145 0
Table 7-4. Single cell expression data (reduced list)— iHSC-8-TF
Factor iHSC-8-TF19 iHSC-8-TF20 iHSC-8- iHSC-8-TF22 iHSC-8- TF21 TF23
Actb 15.5949722 14.7271674 14.9192297 14.8524722 13.742072
Aebp2 6.02657711 6.46555858 0 6.77047 5.81780576
Ahr 0 0 0 0 0
Aktl 11.1358482 10.4380466 1.18490888 10.7142832 7.65650276
Akt2 3.53699864 6.27657983 0 0 4.99455434
Akt3 4.67734217 6.17450015 4.49098184 7.31178082 1.69186959
APC 0 6.39404584 0 8.12096298 0
Bad 0 7.94551754 0 0 0
Bax 9.7269672 9.53189139 9.22347188 8.98116411 8.92650111
Bell la 2.68677282 0 7.45791631 4.52048937 0
Bell lb 0 0 0 5.10896278 0
Bcl2 6.32982374 5.73745116 6.26778953 4.96019175 4.06183255
Bcl211 8.58581684 8.25950033 0 8.61267991 8.15193143
Bcl2111 4.23328455 0 0 8.33934299 6.38428587
Bmil 8.09215612 6.82056434 7.88053812 9.25859235 7.3067493
Brd3 6.26049404 8.40584215 7.39130082 8.74987977 6.56313183
Casp8 8.55881676 9.01946362 8.89797827 7.89925135 7.36966954
Casp9 5.69785323 6.80005229 0 0 0
Cbx2 4.25975897 4.50344312 0 7.05085087 7.3652097
Cbx8 0 3.10519482 0 0 0
Ccnc 5.68144375 7.04800476 0 7.33402583 6.47052476
Ccndl 7.32501662 0 9.14379317 7.80790367 8.06188774
Ccne2 6.81736138 6.12179616 4.01589047 9.60114654 7.32828462
CD34 9.10085124 10.8245974 8.030799 0 9.90933084
CD41 9.18976923 8.06311742 6.29822743 0 8.58124579
CD48 9.66357797 8.92273252 0 8.22498968 9.97655942
CD52 9.55607491 9.32703404 0 11.1238367 10.7706642
Table 8-1. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl TF-Poly2 TF-Poly3 TF-Poly4 TF-Poly5 TF-Poly6
Actb 14.4017745 14.2732193 15.1526286 13.8643652 13.9815065 14.3047991
Aebp2 5.95955683 6.89726869 6.24332431 6.30280532 6.9095424 7.47978946
Ahr 9.54980521 8.51756005 7.1706196 0 0 0
Aktl 9.2199823 10.5771332 10.3125839 10.115699 8.64780047 8.65031952
Akt2 5.38910968 4.02386518 4.9461932 0 5.38465875 0
Akt3 7.03433438 6.15943216 7.67195681 7.81890549 9.32598867 7.96268327
APC 0 6.92782146 6.85867754 0 0 7.94220629
Bad 0 0 0 0 0 0
Bax 9.05413463 10.0987868 10.8354331 9.74710118 7.76338529 8.52100861
Bell la 7.41102372 0 7.15076275 8.58322415 8.20030062 0
Table 8-1. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl TF-Poly2 TF-Poly3 TF-Poly4 TF-Poly5 TF-Poly6
Bell lb 7.64367926 0 3.66716509 0 1.93636742 0
Bcl2 3.57531389 5.85403867 0 3.16043824 5.61646233 5.76077245
Bcl211 9.07993883 8.03643261 9.87966794 0.83585263 8.58326585 8.40210943
Bcl2111 0 0 7.06374493 8.39612427 0 8.4773465
Bmil 9.07560792 8.22518209 8.42569938 0 9.40851644 7.96975432
Brd3 6.95890888 6.24785555 7.56579491 6.62403459 6.88629365 7.85394619
Cas 8 7.8559411 8.60926927 8.8582654 6.01680512 9.44420835 8.42884993
Casp9 0 8.33784339 7.33820605 8.25717213 8.44629053 8.27100862
Cbx2 5.65213624 0 0 2.18365236 7.0766812 3.66755176
Cbx8 0 0 0 0 0 0
Ccnc 7.23528126 7.86231075 0 7.38487279 8.84791023 0
Ccndl 0 9.72602652 7.48420059 8.30654599 11.8053072 11.1237592
Ccne2 0 4.88759578 7.32135738 6.93922401 0 6.77972753
CD34 0 8.05101797 3.40774581 8.23829804 0 0
CD41 5.41030089 9.39327537 7.15100623 8.76650086 7.87007098 8.71774229
CD48 0 0 0 0 0 0
CD52 0 0 0 0 0 0
CD53 9.89133699 0 0 8.96185069 0 0
CD55 8.79899388 7.63015791 5.88277643 7.59780097 7.37088799 7.76280542
CD63 8.65376387 8.79228248 9.15870494 6.99196008 7.38940631 9.44747605
CD9 8.16707472 7.77311627 9.13626418 7.43428177 6.47201397 6.79388862
Cdc42 10.6693066 12.1804797 11.8620482 10.497805 11.8021081 11.9762404
Cdkl 0 8.11620358 7.60561917 0 0 2.42017354
Cdk4 8.95820807 9.15744736 11.0338829 8.57125161 9.69513549 10.0356562
Cdkn2b 0.46087622 0 0 0 0 0
Cebpa 0 0 0 0 0 0
Csflr 0 0 0 6.04286637 0 0
Ctnnbl 8.44935695 10.0514987 0 9.05018407 7.94648144 9.18714944
Cycs 6.68979802 10.8213383 10.6404742 9.78073283 10.3505161 9.81337298
Dachl 9.47386037 8.81206403 7.5999307 6.57582267 6.70986766 7.32706794
Dnmtl 10.1960231 7.65655217 8.31004681 8.92673119 9.2261255 9.71151883
Dnmt3a 4.24750121 7.63469215 9.34742168 10.0524941 10.4262419 9.47291437
Dnmt3b 9.14843642 7.69961419 7.21411913 0 8.70429266 0
Dtxl 0 0 0 5.01837469 4.02137797 0
Dtx4 2.30088686 7.91425669 4.17934489 7.92978791 0 7.80407419
Ebfl 0 0 0 0 0 0
Ep300 8.42978448 8.16009533 8.11371035 8.59805316 7.6395129 8.21791669
Epor 6.2878854 6.64044771 6.75920564 8.02055392 7.93934358 6.20584516
Erg 8.62942227 10.521998 10.168764 9.83912345 9.13177011 8.6111314
Esrl 9.06471078 9.18829675 6.19515636 11.4378777 9.44975997 10.8199014
ETS1 0 8.87124698 0 8.10142716 7.23106564 6.79930712
ETS2 5.11680482 8.0568843 8.65044922 9.01833153 8.46467898 7.94602145
Etv3 0 0 0 0 4.82743292 0
Etv6 9.79251329 9.35978258 0 10.0075324 11.5885534 10.1921514
Ezh2 5.41817556 7.64667858 6.75543645 0 6.4159182 6.97011891
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl TF-Poly2 TF-Poly3 TF-Poly4 TF-Poly5 TF-Poly6
Nfkbl 4.446709 0 6.6481504 0 2.89270377 3.94764604
Notchl 0 0 8.69218776 9.10479408 0 6.95197356
Pax4 0 0 0 1.44235065 0 0
Pax5 0 0 0 0 6.66633311 0
Pax9 0 5.03638998 3.19142852 0 0 0
Pbxl 5.79433853 2.40166484 0 6.25602965 0 0
PIk3ca 0 8.94646056 8.24915927 9.68680408 8.07553724 9.42366483
PIk3R2 7.86660372 7.73972411 7.38377942 8.09713775 8.00818253 8.75992262
Plagl 0 7.49123813 5.82502843 7.76160342 1.23953556 9.47539828
Prfl 2.80996555 0 0 1.55094842 0 0
Pten 10.4165886 9.60432119 10.2437146 9.90287857 10.8245223 9.89550714
Rbl 9.09620227 10.2509564 7.03917768 10.0166256 9.88895181 10.011227
Rora 5.67210945 8.16786484 8.22163059 8.40806013 8.20332033 4.82153142
Runxl 10.0392064 9.36216612 0 10.0169963 7.55675639 1.95995368
Runx2 3.02975474 0 0 4.00168042 4.49363883 3.39036905
Satbl 0 0 6.72850441 0 0 0
Sdpr 6.47855527 7.37567768 5.18752317 5.78827462 4.5789996 7.14989941
Sell 0 0 0 0 0 0
Sfpil 7.93492701 1.16071284 8.97426329 9.01058427 8.8542142 8.64133779
Slamfl 7.5910261 8.53583734 7.18007615 8.00938404 7.5562505 8.6742552
Smarca4 9.2280708 10.369666 8.2235885 10.7058201 10.261829 10.5475105
Sosl 2.79113487 5.88655824 7.60011468 6.41704302 6.34226658 5.65496301
Statl 2.30720619 2.35055788 6.29759725 3.85091293 5.28729455 2.53753709
Stat3 10.5102227 11.654284 7.98961351 9.69221977 10.9831963 9.46455273
Stat4 9.73148085 9.19610287 8.40332968 9.9249724 8.15997772 9.14000192
Stat6 8.08137592 8.26948638 7.50391096 0 10.2215169 8.55245944
Suzl2 9.3961376 9.96724283 7.37908318 9.47883474 9.42011558 8.32573094
Tall 1.72237282 0 6.69073047 3.11164048 1.32936699 0.00662202
Tcf3 8.96333241 9.31481932 0 0 9.07224108 10.1220054
Tcf4 8.80005664 9.41908139 10.3132992 8.69843764 8.97235944 9.3667886
Tcf7 0 0 2.25026637 0 3.89585347 4.39562419
Tek 4.43072212 0 0 0 0 8.57224426
Tfrc 0 8.54731767 6.89401888 9.74317989 5.81615029 0
Tgfbl 0 0 0 0 0 0
Tgfb2 0 0 6.42618862 0 0 8.02240011
Tgfb3 7.17263032 0 6.69764691 8.16263704 7.62575941 3.60618469
Tnfrsf 1 a 9.12239254 9.94871547 10.5626763 8.3415255 8.80960043 8.44697988
Tnfrsflb 7.57265388 2.1044987 5.61187541 9.91624698 7.9098197 8.62491508
Tnfrsf21 4.87454812 3.46004955 0 4.70959999 4.73578778 4.96266939
TnfsflO 0 6.11608237 7.18551286 8.23570855 7.29990668 6.85883769
Tnfsfl2 0 0 0 0 0 0
Tobl 0 0 0 7.63203105 5.15771067 0 vWF 7.28131553 7.6135713 8.13113957 7.42453844 8.00520062 8.84927559
Zbtb20 9.1393088 8.47880681 7.90821765 8.9457529 8.12571437 10.22509
Zbtb38 7.37904176 9.35075276 7.06713579 8.59650634 6.5271098 7.65089916
Zfp532 0 0 7.67157289 0 0 0
Table 8-1. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl TF-Poly2 TF-Poly3 TF-Poly4 TF-Poly5 TF-Poly6
Zfp612 3.43885333 8.66672996 0 6.73462534 0 5.03501087
Zfpml 0 0 7.24131733 0 0 0
Zhx2 1.94879631 0 7.81335591 8.46235816 8.2166298 0
Table 8-2. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Poly7 TF-Poly8 TF-Poly9 TF-PolylO TF-Polyll TF-Polyl2
Actb 14.5566982 13.615687 13.2557353 13.9045548 13.625207 13.6632976
Aebp2 7.46754461 6.09082663 7.88599221 3.70216827 6.20483355 6.71566468
Ahr 7.777933 8.74434412 8.10667368 7.49909044 7.20337973 0
Aktl 10.2515898 10.0377805 10.6829232 9.27077113 10.266825 10.5734114
Akt2 5.61051736 0 5.3893609 5.11237848 5.46400025 5.08512838
Akt3 6.93473018 6.61452163 7.44026837 7.77588506 7.14760449 5.28506516
APC 8.24864591 7.30804883 6.70709773 0 0 2.08510464
Bad 0 7.83220622 0 0 0 0
Bax 9.48202132 8.9969831 10.9826718 9.37331185 9.48416241 8.8896616
Bell la 5.55206094 0 9.30842622 0 0 8.16251064
Bell lb 0 0 4.04933387 0 6.56686767 0
Bcl2 5.48513078 5.01756113 7.17323639 4.60865583 6.53959776 6.15098683
Bcl211 8.40580553 2.85422793 8.83253241 9.37360231 8.97631666 7.51350228
Bcl2111 7.06672118 0 0 7.28322794 6.13979045 2.83394681
Bmil 10.1062229 8.64380505 8.99015684 7.21992126 8.87436353 0
Brd3 7.25721075 0 7.0965374 0 7.48140966 7.08332896
Cas 8 7.10606382 7.11213334 9.13994663 8.261719 7.95659871 4.65164926
Casp9 0 8.75571495 0 1.70805493 0 2.58327705
Cbx2 2.75579197 0 4.17954883 2.44741358 4.393594 5.87793163
Cbx8 0 0 0 0 0 0
Ccnc 7.23061803 9.11473694 7.78622312 2.54536069 6.92719273 6.83659195
Ccndl 10.6653784 8.89949686 9.37926846 9.10837155 10.9590543 9.95508055
Ccne2 0 0 6.67129745 0 6.26507974 7.44075399
CD34 7.84002032 6.14401226 2.96413812 0 0 7.08263627
CD41 0 0 0 6.79226229 1.8891056 7.90833057
CD48 0 0 0 0 0 0
CD52 0 0 0 0 0 0
CD53 10.2116886 10.7187208 7.08173192 0 7.86597872 9.01398982
CD55 6.98771698 2.38132592 7.08507818 7.89992021 7.15246355 6.12899081
CD63 9.35889467 8.34609702 7.4525258 8.40948734 8.52745636 9.28338595
CD9 0 0 0 0 0 7.73063553
Cdc42 11.5785879 10.5894656 10.8671101 11.1168037 11.7063764 11.8716066
Cdkl 0 7.59230634 4.57373649 8.26530963 0 2.79902594
Cdk4 10.4501041 9.38183794 9.45444547 9.17523295 8.69628583 10.0283801
Cdkn2b 0 0 0 0 0 2.20414523
Cebpa 7.67068515 0 0 3.00431304 0 0
Csflr 0 0 0 0 0 0
Ctnnbl 8.98595118 8.61438975 8.0072686 8.55085327 8.3102969 8.76868574
Table 8-2. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Poly7 TF-Poly8 TF-Poly9 TF-PolylO TF-Polyll TF-Polyl2
Klfl 0 0 0 0 0 2.66895857
Klfl2 7.83284751 1.79551807 8.02838739 8.41667992 7.31689315 8.22947494
Ldbl 10.8649416 11.0311014 10.2531103 9.96867512 9.44479733 10.237399
Lin28a 0.07648021 5.44206338 2.28808923 0 4.26911442 7.49478468
Lmo2 10.3300198 11.4044966 10.8122837 12.0024401 10.8122958 11.5354295
Ly6a 11.0261252 9.19365169 0 11.2822375 10.9680129 10.2245897
Lyll 0 0 0 0 8.1627394 6.9405754
Mbd2 9.778048 7.88381457 9.85411747 8.93004612 9.84729194 9.50047741
Meisl 9.79079972 9.26553519 9.47724048 9.11875429 7.83230069 9.28003396
Mllt3 4.95820732 6.82834374 3.31729194 4.78671361 5.72656509 5.03058026
Mpl 10.5885966 10.2036925 10.3769602 9.29493118 10.1733655 10.194539
Mucl3 6.47555273 4.0744404 0.74602045 9.11384586 9.74461615 9.05918759
Myb 10.7442288 9.96147288 10.993789 10.1482872 11.1603183 11.6769893
Myc 7.89827193 9.71889144 8.37756333 6.2345676 8.71491271 9.57514794
Mycn 13.0888737 11.9671485 14.0143762 12.1914809 11.9099683 12.4213923
Ndn 8.94858448 10.4219509 7.73679165 7.97014772 9.18715689 9.75918486
Nfat5 10.3527976 9.84044429 9.78500077 9.69671217 9.49142498 10.0570506
Nfia 8.77963768 9.1388192 9.92274441 7.88222414 8.46281343 10.5459452
Nfkbl 4.42634987 0 4.92034792 4.79418239 5.49712885 5.77034407
Notchl 7.75076794 0 0 0 9.00866938 7.22412965
Pax4 0 0 0 0 0 0
Pax5 0 5.51060272 0 0 0 0
Pax9 0 0 0 0 0 0
Pbxl 0 0 5.27140189 0 5.62172032 6.67462266
PIk3ca 9.62050132 9.28712078 9.2982715 8.72600436 8.2306778 6.59758348
PIk3R2 6.02135145 0 0 0 0 7.90960372
Plagl 0 6.72260382 7.03486336 7.18387794 4.17261924 6.64273979
Prfl 0 3.90415649 0 0 0.63556078 0
Pten 9.26090346 10.2405116 10.3794127 9.50933483 10.4712953 8.8938414
Rbl 9.66749617 7.6292368 8.71116734 8.9432676 4.68235943 9.80937685
Rora 0 4.97514677 7.9587669 7.68976191 4.34907105 5.02881742
Runxl 10.1268518 0 7.85747808 5.75506403 9.96928817 8.24404878
Runx2 5.5286143 0 3.79093014 4.65939933 4.88754632 0
Satbl 0 8.4748954 0 0 0 0
Sdpr 5.27902633 6.32635852 6.5332166 0 7.17059601 4.59848613
Sell 0 0 0 0 0 0
Sfpil 9.46010411 7.75399359 7.72602312 9.76515629 9.72539923 7.02277564
Slamfl 8.20190825 8.19833438 0 5.55930467 0 0
Smarca4 9.4413014 10.1563545 8.79018319 8.8549291 10.3361654 11.228265
Sosl 4.54939546 6.56343031 5.6282784 3.49839747 6.033343 7.34548491
Statl 1.6954329 2.46606654 4.59411276 3.22835285 3.56380291 2.65186982
Stat3 9.7980754 9.90644603 10.0618227 10.0057991 9.46974309 11.2477057
Stat4 10.1144294 8.47352328 8.70582293 8.52494598 8.72233963 8.2171884
Stat6 7.86406378 0 0 8.26236445 9.0629236 7.69535411
Suzl2 8.39719356 7.93784732 8.38043045 8.85608556 9.42803983 9.28167431
Table 8-3. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl3 TF-Polyl4 TF-Polyl5 TF-Polyl6 TF-Polyl7 TF-Polyl8
Actb 14.2727767 12.7280483 14.0956291 13.7082256 13.0574175 13.8899065
Aebp2 6.11070016 7.67413704 5.4199737 5.67517041 6.12979862 6.39309702
Ahr 0 7.60162142 8.68953508 7.22521443 0 7.80170326
Aktl 10.5537808 10.2359843 10.1876416 10.2045296 9.32528266 11.2037137
Akt2 6.04771205 5.46968411 4.61114177 0.36361906 5.15470193 6.76905664
Akt3 7.46685201 8.87527885 6.41367312 6.57064203 7.42714251 8.82945036
APC 5.47404929 0 0 3.30240815 0 0
Bad 0 0 0 8.25308495 0 0
Bax 9.58600628 7.72059484 8.90118521 9.0595556 8.89711711 10.2420317
Bell la 0 7.2152692 0 9.99754542 8.21413322 8.37765853
Bell lb 0 0 0 0 0 5.9803208
Bcl2 6.3930411 6.07276828 6.16216896 7.49388797 5.68656739 0
Bcl211 8.95652025 7.10261013 9.81018845 5.27192178 8.28376117 7.94107304
Bcl2111 6.33813274 0 0 5.92621331 0 0
Bmil 8.66147977 8.96414419 8.75077682 8.37533133 8.69114053 9.23230416
Brd3 8.28803382 6.3971659 6.25298854 7.15381467 7.6478676 8.17779551
Casp8 8.45968253 8.1712985 7.71775573 7.76600997 8.57602393 7.87394894
Casp9 4.45260333 0 0 0 4.29714485 0
Cbx2 2.07247445 4.80091864 2.61905814 0 1.54064757 4.53169391
Cbx8 0 0 0 0 0 0.67434266
Table 8-3. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl3 TF-Polyl4 TF-Polyl5 TF-Polyl6 TF-Polyl7 TF-Polyl8
Ccnc 0 8.28176951 8.20203458 0.20286217 7.36331044 7.27287576
Ccndl 11.3129135 10.4797236 8.88976756 7.2170424 8.33377627 9.15479719
Ccne2 0 0 1.50040192 0 0 0
CD34 8.22979468 0 0 6.91091458 8.44625303 7.87973307
CD41 0 7.16278626 0 7.18437958 0 0
CD48 0 0 0 0 0 0
CD52 0 0 0 0 0 0
CD53 0 8.91427674 8.44378297 9.13656802 0 9.74428678
CD55 6.01147624 5.07787524 7.69978384 2.8938614 7.50395162 8.09488889
CD63 9.97144686 8.71949217 8.16499862 8.98186831 6.4416781 9.43079454
CD9 9.65832099 5.7460499 8.59279056 7.41372418 8.48726798 7.98386084
Cdc42 12.0879567 10.9317607 11.4005236 11.0823193 10.9521574 11.5405133
Cdkl 0 2.72753967 0 2.05216916 0 0
Cdk4 8.5419578 8.78105981 9.25298713 7.52696871 8.30059711 9.43641662
Cdkn2b 0 0 0 0 0 5.12306489
Cebpa 0 0 0 0 8.64186061 0
Csflr 0 0 0 0 0 0
Ctnnbl 8.20473117 8.50969794 8.69357555 9.73103801 5.608402 9.62623328
Cycs 10.355627 8.70346871 9.62459322 8.44123772 8.67759939 9.25455509
Dachl 9.82088619 7.86150494 9.96350332 8.99831455 0 10.570503
Dnmtl 8.77747907 7.53562918 0 7.44505386 8.60952809 10.0209151
Dnmt3a 10.9895968 8.80508017 9.0263749 9.03931586 9.52116455 9.94330249
Dnmt3b 9.0938017 1.17472267 3.10327969 0 2.84001275 8.34532121
Dtxl 0 0 0 0 0 0
Dtx4 4.43088049 3.87028229 4.43041562 7.35767066 0 5.6117422
Ebfl 0 0 0 0 0 0
Ep300 9.017599 6.78903265 7.43151301 7.60373336 8.45575033 7.95781099
Epor 5.61905305 6.57651712 6.697122 7.72336468 7.6721107 7.16092395
Erg 11.2267843 11.2338502 8.98943025 8.67311388 10.5300473 10.3920801
Esrl 9.88779417 9.5988785 10.7077127 9.32817858 9.04585226 0
ETS1 7.00604522 8.10866426 8.03570905 7.99879785 4.90118407 7.96807866
ETS2 9.43655065 7.58250039 8.78658622 7.59607589 7.77738844 8.52035769
Etv3 6.23826064 3.83649683 5.71839126 3.62372678 5.97641387 4.51702701
Etv6 11.5745983 9.67915008 11.1480528 9.02130654 10.2698644 11.1857554
Ezh2 5.31268746 0 4.20179525 6.18588773 0 6.62582331
Fas 0 0 0 0 1.51519502 0
Fcgr2b 6.48856047 4.94876599 0 0 0 0
Fcgr3 3.61683637 0.44366131 0 0 0 0
Flil 11.8751419 11.3361252 12.1903114 11.2030884 11.240247 11.2863366
Flt3 0 0 0 0 0 0
Fosll 9.57090972 0 7.58226569 0 0 7.82360513
Foxol 10.3871499 9.3667248 10.4078656 9.09496896 10.2176456 10.0456512
Foxo3 8.47876623 9.50744661 9.2592793 7.51365588 7.19553746 9.10509162
Gapdh 9.38324817 7.33400257 8.80742103 7.06433381 7.70747783 9.59697776
Gatal 5.31073843 0 0 0 1.26264701 7.26109145
Table 8-4. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl9 TF-Poly20 TF-Poly21 TF-Poly22 TF-Poly23 TF-Poly24
Actb 14.0222957 14.9852165 14.7231936 13.0780412 13.1822769 14.7520851
Aebp2 6.09276785 5.91339645 7.15748106 7.15006465 6.44734708 7.56825651
Table 8-4. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl9 TF-Poly20 TF-Poly21 TF-Poly22 TF-Poly23 TF-Poly24
Ahr 0 7.35656431 0 0 7.39042048 0
Aktl 10.1537514 9.0396397 10.8518586 10.0130998 9.0677075 10.2965742
Akt2 5.37628872 5.62239369 4.54633859 4.9627968 0 6.55702093
Akt3 6.43567703 0 8.32809947 7.77517295 7.00340875 6.69568826
APC 0 6.02993274 7.1076109 0 0 7.41151949
Bad 0 7.95577502 0 0 0 0
Bax 9.62042258 10.1007541 9.93762446 10.5704358 8.58778402 9.82062487
Bell la 8.25024263 0 6.13142565 8.06182977 0 0
Bell lb 0 0 0 0 0 0
Bcl2 5.80097299 6.96327952 5.50955358 6.14344881 6.33146119 8.64834323
Bcl211 7.19137797 9.09460414 8.68585536 8.37559007 7.91961022 9.1222599
Bcl2111 7.10099787 0 0 8.66530941 7.92945207 7.29055975
Bmil 0 8.89333432 8.82500517 8.04845917 7.27905634 7.66241462
Brd3 7.81963512 6.53346079 8.46718639 6.63970649 3.58678146 8.79527153
Cas 8 8.16002179 7.41674663 9.68556501 8.98596978 7.82524756 8.16507587
Casp9 8.12191839 0 0 8.20184923 6.86433721 0
Cbx2 5.83990951 7.17824899 1.13974563 0 1.69623499 5.47697139
Cbx8 0 0.94186577 4.35885212 0.62378639 0 0
Ccnc 6.44758404 7.56469246 7.28657546 0 3.55530815 7.0627638
Ccndl 10.2579337 10.3894912 10.1044493 9.85934264 7.70190072 10.2600958
Ccne2 4.05061191 7.82199556 0 0 0 0
CD34 5.35839334 1.30106581 7.35425184 6.61374857 6.44471518 1.61234414
CD41 5.77643219 0 10.4393533 0 0 10.3495091
CD48 0 0 0 0 0 0
CD52 0 0 0 3.01619125 0 0
CD53 8.03999469 0 0 7.50341317 10.1028594 0
CD55 7.33579923 5.27016862 7.79008222 7.56180434 6.90429703 7.62824401
CD63 8.37023042 8.80391232 9.66493806 8.10475976 6.51700946 8.24520437
CD9 7.12446184 0 7.78614293 0 8.48314556 7.50038252
Cdc42 11.193945 11.5997344 12.2211899 11.14451 9.02347781 11.8346973
Cdkl 3.82114993 0 0 0 0 8.8707332
Cdk4 8.72490443 9.2366055 9.21810563 8.92536239 7.92269766 9.0715251
Cdkn2b 0 0 0 0 0 0
Cebpa 0 0.92340397 0 0 1.00115542 3.07355052
Csflr 0 0 0 0 0 4.67306388
Ctnnbl 9.02013289 8.1995723 8.88842654 7.35118018 7.79633098 9.06433317
Cycs 4.40114607 10.7395371 9.31670975 9.50564127 8.73967132 10.179991
Dachl 9.36485262 8.82201919 0 8.05339981 0 10.8270759
Dnmtl 0 9.58140407 10.0497632 8.2793687 6.63806785 8.17811462
Dnmt3a 10.9905048 9.19877847 7.56408268 9.58520501 8.76598997 11.0073815
Dnmt3b 6.12321822 5.91369116 6.74621053 8.79572673 0 8.46193889
Dtxl 0 0 4.45860491 0 4.40787301 2.92452083
Dtx4 0 0 0 0 0 4.65526374
Ebfl 0 0 0 0 0 0
Ep300 8.31116148 9.22743592 7.7293946 8.80009368 7.48345043 9.03015668
Epor 6.59886102 8.36411013 6.46843364 7.45226452 6.61055385 8.51394952
Table 8-4. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Polyl9 TF-Poly20 TF-Poly21 TF-Poly22 TF-Poly23 TF-Poly24
Tnfrsf21 3.20614275 6.19102698 5.06049798 3.05259086 3.46771395 6.05459577
TnfsflO 0 0 5.97171916 0 7.59819331 7.31664485
Tnfsfl2 0 0 0 0 0 0
Tobl 6.69079448 6.00223918 0 3.73540562 0 5.02457741 vWF 7.03390478 7.00183766 6.76991781 7.90167655 7.3503261 8.19082768
Zbtb20 8.75751032 8.56608423 7.87546645 9.54728999 9.08834794 8.98417896
Zbtb38 8.42709931 6.65368752 8.31325825 7.64612461 5.85086359 7.6993122
Zfp532 0 2.57549982 0 0 0 0
Zfp612 7.39496006 9.86263779 8.6174037 6.07547603 7.44714339 7.42549287
Zfpml 0 0 7.32419209 0 0 7.09081266
Zhx2 5.14338261 7.9453336 7.54993366 7.52150615 0 0
Table 8-5. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Poly25 TF-Poly26 TF-Poly27 TF-Poly28 TF-Poly29 TF-Poly30
Actb 15.1467264 15.0603057 14.7898411 13.7224541 13.1728469 12.9889544
Aebp2 7.22454633 8.054577 6.2934136 5.40380392 6.94511987 6.23324236
Ahr 0 0 0 8.0387708 6.82981017 0
Aktl 10.4393078 11.2053361 10.3315581 9.52591131 8.93069445 9.8447304
Akt2 5.46798025 4.36096146 0 0 6.22509388 5.58121685
Akt3 8.54577868 9.10928289 6.11061488 5.23070804 7.20403999 7.48254296
APC 7.54219167 8.23602617 0 3.26916842 7.12783167 7.33873364
Bad 0 0 0 0 0 0
Bax 9.50825239 10.7263374 10.1709333 8.9480305 7.02132481 9.08482722
Bell la 0 0 0 0 5.41177469 5.64855342
Bell lb 0 0 4.08334085 0 0 0
Bcl2 3.68995409 7.32318474 7.06144794 6.58939055 3.18869428 4.94548147
Bcl211 6.81430281 9.83800287 9.83067128 9.33405878 1.18529944 0
Bcl2111 9.18689234 4.87995875 2.32073334 7.05754987 7.15679605 0
Bmil 9.41703263 10.590967 8.13517912 8.21207019 7.89416001 8.36530966
Brd3 7.40062986 8.45229557 7.37805192 6.73549941 6.38937753 0
Casp8 9.06859401 9.89552232 7.64299925 9.08071818 6.57464487 8.31311348
Casp9 3.44991217 6.93448309 0 9.05103431 7.48305696 8.79567172
Cbx2 5.65665485 4.81978051 5.01321494 7.38009168 6.31186522 7.25681223
Cbx8 7.51395854 5.26741788 0 0 0 0
Ccnc 3.40126563 7.17806544 7.78283799 8.63152446 8.813967 6.58765669
Ccndl 10.8599552 11.4320536 11.3331975 7.53991341 0 9.29046471
Ccne2 7.83759047 8.65858417 0 0 3.32687121 0
CD34 6.63187034 9.7565564 7.40591115 8.39371742 6.77659879 5.99841538
CD41 2.14023125 8.47542727 6.69580828 4.98782898 0 0
CD48 0 0 0 0 0 0
CD52 7.91998753 8.98451985 0 4.94138545 0 5.93717087
CD53 6.94204489 10.5301752 0 7.40829181 6.96255155 9.16158967
CD55 2.67695364 7.24868997 0 6.8723678 6.65669014 0
CD63 7.9251335 9.70346434 8.76574443 8.18049221 7.4946542 8.16601991
Table 8-5. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8- iHSC-8-
TF-Poly25 TF-Poly26 TF-Poly27 TF-Poly28 TF-Poly29 TF-Poly30
Ikzfl 9.27873989 10.4587279 5.91103149 7.22522005 7.63638395 7.21841248
IkzG 8.55691698 9.00296885 0 10.0127515 7.05646755 7.55750237
I17R 0 0 0 0 0 0
Irf4 0 0 0 0 0 3.13466963
Irf6 0 4.45135084 2.0970079 4.45935177 2.34298554 3.11901816
Irf8 8.36267886 0 8.28087448 0 0 0
Kdr 0 0 0 7.11467704 0 0
Kit 7.33440621 11.676319 12.0482852 10.3613984 10.8447689 9.71837065
Klfl 4.6113579 0 0 7.07231232 0 0
Klfl2 7.16079482 7.39809865 7.38280606 7.94577018 8.65600956 7.11655703
Ldbl 11.0650833 10.7394902 9.391079 9.69631695 9.34063818 8.23556142
Lin28a 8.59487815 7.9674739 8.97421223 4.11702404 8.12470644 8.71804793
Lmo2 10.8175242 11.0371363 9.96662941 10.9024038 10.303006 9.67048273
Ly6a 11.3320064 10.8896747 11.6269362 10.7750255 8.734268 8.94138397
Lyll 0 8.45036073 8.31542245 7.1453941 6.78867557 0
Mbd2 9.82815303 7.77519918 9.72316715 8.71004644 0 8.71389867
Meisl 8.72386921 9.27416327 7.7021466 8.50453784 8.4108095 7.11187223
Mllt3 1.20911588 2.90532993 3.24157892 6.04227027 3.56250704 3.41569762
Mpl 8.16713987 11.1382076 8.84138738 9.51523532 6.45757591 9.14051092
Mucl3 3.84864206 10.6660629 10.1548311 7.8264378 7.56339286 8.44043237
Myb 11.9506659 12.679687 12.354001 11.6763394 11.1472311 10.8315677
Myc 0 10.0093188 8.34807296 9.25839322 7.84577514 7.52780084
Mycn 10.870635 12.9395207 12.3151591 12.053502 12.6255533 9.68590773
Ndn 6.69958267 11.2092172 8.79795885 10.1009021 4.07328976 8.99463446
Nfat5 10.4275502 11.0533765 9.97984923 10.6782945 9.95523149 10.2518547
Nfia 8.76693228 11.1506945 10.3677089 9.02919232 7.97805043 7.23689606
Nfkbl 4.92161927 7.85783734 0 5.31107579 0 5.41888462
Notchl 0 6.97371909 6.50677693 8.20930046 7.14314591 8.77749162
Pax4 0 0.41579145 0 0 1.78594162 0
Pax5 0 0 0 0 0 0
Pax9 0 1.29709712 5.34825344 0 0 0
Pbxl 0 0 4.99498393 0 4.3948675 0
PIk3ca 7.29512319 5.10151123 9.26701666 8.77108696 7.8137764 8.06874559
PIk3R2 0 9.54668408 0 4.03560663 7.63724867 8.09289398
Plagl 4.05714178 7.17110365 7.47615183 6.78269553 6.68706596 8.11285307
Prfl 0 0 0 0 1.76277593 0
Pten 9.67233193 10.8750291 11.2752335 9.07906849 9.619202 9.54758043
Rbl 2.4815274 9.83858258 9.93875591 8.12503051 0 9.56415776
Rora 6.2784063 7.96217943 8.97191919 5.69747967 6.69619858 0
Runxl 7.72158429 11.5617806 8.0209297 0 7.34188594 9.3066077
Runx2 6.44168173 6.47921853 4.05939813 0 4.52343132 0
Satbl 0 0 0 0 0 0
Sdpr 3.14060766 4.67747404 0 5.13849374 4.35123979 0
Sell 0 7.82142452 0 0 0 0
Sfpil 9.44004137 10.6112564 9.57177198 9.73952896 7.67485892 9.1636508
Table 8-6. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8-TF- iHSC-8-TF- iHSC-8-TF-
TF-Poly31 TF-Poly32 Poly33 Poly34 Poly35
Actb 14.2069371 13.8470594 13.8401959 13.917789 15.1280325
Aebp2 5.98889731 6.37700771 7.03385188 7.32807418 5.967507558
Ahr 0 7.35587653 7.14024783 0 7.726173885
Aktl 9.63022936 9.79043235 8.92541514 10.255464 10.06829133
Akt2 4.7739806 6.20050837 0 6.6173956 6.266455938
Akt3 7.83294768 7.93223254 7.33454157 7.96075903 7.609211364
APC 7.03824303 2.01225823 7.3738631 6.86740225 0
Bad 0 0 0 0 0
Bax 7.92377163 9.35241369 8.79541456 10.1556033 9.298454044
Bell la 6.79087658 9.42268001 0 5.94056 9.650354382
Bell lb 0 7.91342229 0 0 0
Bcl2 7.71843033 4.37394315 3.67661636 6.48782736 6.12384282
Table 8-6. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8-TF- iHSC-8-TF- iHSC-8-TF-
TF-Poly31 TF-Poly32 Poly33 Poly34 Poly35
Bcl211 7.32275084 8.01987482 8.88727066 10.3391458 5.482050078
Bcl2111 5.79196834 7.61927617 0 0 7.954405054
Bmil 8.81392639 9.20924156 9.08236893 0 8.889304656
Brd3 7.23409493 7.45401462 5.51991989 8.04268652 7.389789509
Cas 8 7.67563079 8.20820007 6.55654411 7.54337459 8.32215887
Casp9 0 0 8.99779312 4.59384186 5.848587768
Cbx2 1.44235903 5.10087886 3.11514136 4.33721335 7.198562206
Cbx8 0 0 0 0 0
Ccnc 6.39235909 2.98958517 6.90788079 8.33600559 0
Ccndl 9.85365523 9.35220323 10.3423931 10.596546 10.3258133
Ccne2 0 0 0 0 0
CD34 8.18588751 7.74906415 7.26970785 0 7.499624637
CD41 9.13809414 0 2.48229859 9.03163232 2.624405589
CD48 0 0 0 0 0
CD52 0 0 0 0 0
CD53 9.41977885 9.65013579 7.29556871 0 7.157577428
CD55 8.06965354 6.20993378 0 0 8.314622092
CD63 8.2891293 8.70844929 8.28276973 7.95614666 7.974507291
CD9 5.61055111 8.76259165 7.38090105 9.05799841 7.984779418
Cdc42 11.6414373 11.5413516 11.8105407 12.0218361 12.15037822
Cdkl 0 0 5.92738978 6.4822881 0
Cdk4 9.11192333 8.53731642 7.38211559 9.25948872 8.7744804
Cdkn2b 0 2.02544167 0 0 0
Cebpa 0 0 0 1.76275336 0
Csflr 0 0 0 0 0
Ctnnbl 8.53778061 8.99449917 8.50354705 8.54550946 8.150621469
Cycs 8.74992664 9.3211739 7.56416714 11.6306877 9.73444361
Dachl 10.2255054 8.13381132 9.01635767 9.67564058 9.403674066
Dnmtl 7.06488647 8.20709121 5.48806315 10.7511069 9.291062883
Dnmt3a 9.34089662 10.5431275 9.68146699 9.67721509 9.574078858
Dnmt3b 7.10396864 7.14264453 0 8.67608269 8.398086808
Dtxl 0 3.92664652 0 0 1.079050232
Dtx4 0 0 6.49224019 0 7.288080256
Ebfl 0 0 0 0 0
Ep300 8.96510963 9.64835081 9.30091348 8.39112866 8.866505918
Epor 7.23361451 8.89683938 8.61954912 7.62063998 8.194140038
Erg 9.8355606 10.6000491 9.47258834 9.6821144 10.01801557
Esrl 6.30347997 5.64608692 9.59441989 0 7.287947864
ETS1 6.09111489 6.98717296 7.45969571 6.50362082 5.966052941
ETS2 8.21354447 9.19096881 1.88892339 8.82189923 7.475011402
Etv3 2.96178532 5.48992927 4.14441284 0 2.046570736
Etv6 10.858902 10.7925323 9.17798475 10.4215528 8.441479121
Ezh2 0 0 0 5.45401289 5.720754812
Fas 0 0 0 0 0
Fcgr2b 6.88075674 5.54617113 7.14891342 0 5.207646663
Fcgr3 0 7.00826514 2.35530291 0 0
Table 8-6. Single cell expression data (reduced list)— iHSC-8-TF-Poly
Factor iHSC-8- iHSC-8- iHSC-8-TF- iHSC-8-TF- iHSC-8-TF- TF-Poly31 TF-Poly32 Poly33 Poly34 Poly35
Zhx2 8.5972312 0 8.15875098 0 7.312382961
Refereces for Example 2
[00763] Bock, C, Beerman, I., Lien, W.H., Smith, Z.D., Gu, H., Boyle, P., Gnirke, A., Fuchs,
E., Rossi, D.J., and Meissner, A. (2012). Mol Cell 47, 633-647.
[00764] Boehm, T., Foroni, L., Kaneko, Y., Perutz, M.F., and Rabbitts, T.H. (1991). Proc Natl
Acad Sci U S A 88, 4367-4371.
[00765] Briggs, R., and King, T.J. (1952). Proc Natl Acad Sci U S A 38, 455-463.
[00766] Brodeur, G.M., Seeger, R.C., Schwab, M., Varmus, H.E., and Bishop, J.M. (1984).
Science 224, 1121-1124.
[00767] Campbell, K.H., McWhir, J., Ritchie, W.A., and Wilmut, I. (1996). Nature 380, 64-
66.
[00768] Choi, J., Costa, M.L., Mermelstein, C.S., Chagas, C, Holtzer, S., and Holtzer, H.
(1990). Proc Natl Acad Sci U S A 87, 7988-7992.
[00769] Choi, K.D., Vodyanik, M.A., and Slukvin, II (2009). J Clin Invest 119, 2818-2829.
[00770] Cobaleda, C, Jochum, W., and Busslinger, M. (2007). Nature 449, 473-477.
[00771] Copelan, E.A. (2006). N Engl J Med 354, 1813-1826.
[00772] Davis, R.L., Weintraub, FL, and Lassar, A.B. (1987). Cell 51, 987-1000.
[00773] Doulatov, S., Vo, L.T., Chou, S.S., Kim, P.G., Arora, N., Li, FL, Hadland, B.K.,
Bernstein, ID., Collins, J.J., Zon, L.I., et al. (2013) Cell Stem Cell 13, 459-470.
[00774] Erickson, P., Gao, J., Chang, K.S., Look, T., Whisenant, E., Raimondi, S., Lasher, R.,
Trujillo, J., Rowley, J., and Drabkin, H. (1992). Blood 80, 1825-1831.
[00775] Ficara, F., Murphy, M.J., Lin, M., and Cleary, M.L. (2008). Cell Stem Cell 2, 484-
496.
[00776] Garcon, L., Ge, J., Manjunath, S.H., Mills, J.A., Apicella, M., Parikh, S., Sullivan,
L.M., Podsakoff, G.M., Gadue, P., French, D.L., et al. (2013). Blood 122, 912-921.
[00777] Gazit, R., Garrison, B.S., Rao, T.N., Shay, T., Costello, J.F., Erikson, J., Collins, J.J.,
Regev, A., Wagers, A., and Rossi, D.J. (2013) Stem Cell Reports Vol. 1, issue 3, 266-280.
[00778] Gratwohl, A., Baldomero, FL, Aljurf, M., Pasquini, M.C., Bouzas, L.F., Yoshimi, A.,
Szer, J., Lipton, J., Schwendener, A., Gratwohl, M., et al. (2010). JAMA 303, 1617-1624.
[00779] Guo, G., Luc, S., Marco, E., Lin, T.W., Peng, C, Kerenyi, M.A., Beyaz, S., Kim, W.,
Xu, J., Das, P.P., et al. (2013). Cell Stem Cell.
[00780] Gurdon, J.B., and Uehlinger, V. (1966). Nature 210, 1240-1241.
[00781] Hanna, J., Markoulaki, S., Schorderet, P., Carey, B.W., Beard, C, Wernig, M.,
Creyghton, M.P., Steine, E.J., Cassady, J.P., Foreman, R., et al. (2008). Cell 133, 250-264.
[00782] Hisa, T., Spence, S.E., Rachel, R.A., Fujita, M., Nakamura, T., Ward, J.M., Devor-
Henneman, D.E., Saiki, Y., Kutsuna, H., Tessarollo, L., et al. (2004). Embo J 23, 450-459.
[00783] Ieda, M., Fu, J.D., Delgado-Olguin, P., Vedantham, V., Hayashi, Y., Bruneau, B.G., and Srivastava, D. (2010). Cell 142, 375-386.
[00784] Inaba, T., Roberts, W.M., Shapiro, L.H., Jolly, K.W., Raimondi, S.C., Smith, S.D., and Look, A.T. (1992). Science 257, 531-534.
[00785] Iwasaki, H., Mizuno, S., Arinobu, Y., Ozawa, H., Mori, Y., Shigematsu, H., Takatsu,
K., Tenen, D.G., and Akashi, K. (2006). Genes Dev 20, 3010-3021.
[00786] Kamps, M.P., Look, A.T., and Baltimore, D. (1991). Genes Dev 5, 358-368.
[00787] Kennedy, M., Awong, G., Sturgeon, CM., Ditadi, A., LaMotte-Mohs, R., Zuniga-
Pflucker, J.C., and Keller, G. (2012). Cell reports 2, 1722-1735.
[00788] Kocabas, F., Zheng, J., Thet, S., Copeland, N.G., Jenkins, N.A., Deberardinis, R.J.,
Zhang, C, and Sadek, H.A. (2012). Blood.
[00789] Kondo, M., Scherer, D.C., Miyamoto, T., King, A.G., Akashi, K., Sugamura, K., and
Weissman, I.L. (2000). Nature 407, 383-386.
[00790] Kubota, Y., Osawa, M., Jakt, L.M., Yoshikawa, K., and Nishikawa, S. (2009). Blood
114, 4383-4392.
[00791] Laiosa, C.V., Stadtfeld, M., Xie, PL, de Andres-Aguayo, L., and Graf, T. (2006).
Immunity 25, 731-744.
[00792] Laurenti, E., Varnum-Finney, B., Wilson, A., Ferrero, I., Blanco-Bose, W.E.,
Ehninger, A., Knoepfler, P.S., Cheng, P.F., et al. (2008). Cell Stem Cell 3, 611-624.
[00793] Mali, P., Ye, Z., Hommond, H.H., Yu, X., Lin, J., Chen, G., Zou, J., and Cheng, L.
(2008). Stem Cells 26, 1998-2005.
[00794] Marx, J.L. (1984). The N-myc oncogene in neural tumors. Science 224, 1088.
[00795] McCormack, M.P., Young, L.F., Vasudevan, S., de Graaf, C.A., Codrington, R.,
Rabbitts, T.H., Jane, S.M., and Curtis, D.J. (2010). Science 327, 879-883.
[00796] Min, I.M., Pietramaggiori, G., Kim, F.S., Passegue, E., Stevenson, K.E., and Wagers,
A.J. (2008). Cell Stem Cell 2, 380-391.
[00797] Moskow, J.J., Bullrich, F., Huebner, K., Daar, I.O., and Buchberg, A.M. (1995). Mol
Cell Biol 15, 5434-5443.
[00798] Mostoslavsky, G., Kotton, D.N., Fabian, A.J., Gray, J.T., Lee, J.S., and Mulligan,
R.C. (2005). Mol Ther 11, 932-940.
[00799] Muller, L.U., Milsom, M.D., Harris, C.E., Vyas, R., Brumme, K.M., Parmar, K.,
Moreau, L.A., Schambach, A., Park, I.H., London, W.B., et al. (2012). Blood 119, 5449-5457.
[00800] Najm, F.J., Lager, A.M., Zaremba, A., Wyatt, K., Caprariello, A.V., Factor, D.C.,
Karl, R.T., Maeda, T., Miller, R.H., and Tesar, P.J. (2013). Nat Biotechnol 31, 426-433.
[00801] Niu, W., Zang, T., Zou, Y., Fang, S., Smith, D.K., Bachoo, R., and Zhang, C.L.
(2013). Nat Cell Biol 15, 1164-1175.
[00802] Okita, K., Ichisaka, T., and Yamanaka, S. (2007Nature 448, 313-317.
[00803] Orkin, S.H., and Zon, L.I. (2008). Cell 132, 631 -644.
[00804] Pang, Z.P., Yang, N., Vierbuchen, T., Ostermeier, A., Fuentes, D.R., Yang, T.Q.,
Citri, A., Sebastiano, V., Marro, S., Sudhof, T.C., et al. (2011). Nature 476, 220-223.
[00805] Pereira, C.F., Chang, B., Qiu, J., Niu, X., Papatsenko, D., Hendry, C.E., Clark, N.R.,
Nomura-Kitabayashi, A., Kovacic, J.C., Ma'ayan, A., et al. (2013). Cell Stem Cell.
[00806] Polo, J.M., Liu, S., Figueroa, M.E., Kulalert, W., Eminli, S., Tan, K.Y., Apostolou,
E., Stadtfeld, M., Li, Y., Shioda, T., et al. (2010Nat Biotechnol 28, 848-855.
[00807] Qian, L., Huang, Y., Spencer, C.L, Foley, A., Vedantham, V., Liu, L., Conway, S.J.,
Fu, J.D., and Srivastava, D. (2012). Nature 485, 593-598.
[00808] Song, K., Nam, Y.J., Luo, X., Qi, X., Tan, W., Huang, G.N., Acharya, A., Smith,
C.L., Tallquist, M.D., Neilson, E.G., et al. (2012). Nature 485, 599-604.
[00809] Sturgeon, CM., Ditadi, A., Clarke, R.L., and Keller, G. (2013). Nat Biotechnol 31,
416-418.
[00810] Szabo, E., Rampalli, S., Risueno, R.M., Schnerch, A., Mitchell, R., Fiebig-Comyn,
A., Levadoux-Martin, M., and Bhatia, M. (2010). Nature 468, 521-526.
[00811] Taghon, T., Yui, M.A., and Rothenberg, E.V. (2007). Nat Immunol 8, 845-855.
[00812] Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and
Yamanaka, S. (2007). Cell 131, 861-872.
[00813] Takahashi, K., and Yamanaka, S. (2006). Cell 126, 663-676.
[00814] Tulpule, A., Kelley, J.M., Lensch, M.W., McPherson, J., Park, I.H., Hartung, O.,
Nakamura, T., Schlaeger, T.M., Shimamura, A., and Daley, G.Q. (2013). Cell Stem Cell 12, 727-736.
[00815] Unnisa, Z., Clark, J.P., Roychoudhury, J., Thomas, E., Tessarollo, L., Copeland,
N.G., Jenkins, N.A., Grimes, H.L., and Kumar, A.R. (2012). Blood 120, 4973-4981.
[00816] Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y., Sudhof, T.C., and Wernig,
M. (2010). Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035-1041.
[00817] Warren, A.J., Colledge, W.H., Carlton, M.B., Evans, M.J., Smith, A.J., and Rabbitts,
T.H. (1994). Cell 78, 45-57.
[00818] Winkler, T., Hong, S.G., Decker, J.E., Morgan, M.J., Wu, C, Hughes, W.M.t, Yang,
Y., Wangsa, D., Padilla-Nash, H.M., Ried, T., et al. (2013). J Clin Invest 123, 1952-1963.
[00819] Xie, H., Ye, M., Feng, R., and Graf, T. (2004). Cell 117, 663-676.
[00820] Yamada, Y., Warren, A.J., Dobson, C, Forster, A., Pannell, R., and Rabbitts, T.H.
(1998). Proc Natl Acad Sci U S A 95, 3890-3895.
[00821] Yang, N., Zuchero, J.B., Ahlenius, H., Marro, S., Ng, Y.H., Vierbuchen, T., Hawkins,
J.S., Geissler, R., Barres, B.A., and Wernig, M. (2013). Nat Biotechnol 31, 434-439.
[00822] Ye, L., Chang, J.C., Lin, C, Sun, X., Yu, J., and Kan, Y.W. (2009). Proc Natl Acad
Sci U S A 106, 9826-9830.
[00823] Yuasa, H., Oike, Y., Iwama, A., Nishikata, I., Sugiyama, D., Perkins, A., Mucenski,
M ., Suda, T., and Morishita, K. (2005). Embo J 24, 1976-1987.
[00824] Zhou, Q., et al. (2008). Nature 455, 627-632.
[00825] Zhou, Q., and Melton, D.A. (2008).Cell Stem Cell 3, 382-388.
Example 3
[00826] Radioprotection transplantation assays performed using donor-derived MEPs (Na
Nakorn, J Clin Invest. 2002, 109(12), 1579-85) confirmed a robust ability to give rise to platelets and red blood cells in vivo (Figs. 72B-C).
[00827] In addition to sustained self-renewal potential, a hallmark property of HSCs is their ability to give rise to multi-lineage differentiation at the clonal level. Although we had observed clonal multi-lineage differentiation potential in vitro after induction of our factors (Figs. 60B-C), our in vivo transplantation experiments, which were done at the population level, precluded us from concluding clonal differentiation potential in vivo. We reasoned that Ig heavy chain rearrangements arising in Pro/Pre B-cells could be used as a lineage-tracing tool, and that the presence of common V(D)J rearrangements in different donor-derived lineages in our transplantation experiments could provide evidence of clonal multi-lineage differentiation potential. We therefore isolated DNA from sorted donor-derived B- and T-cells, granulocytes, and macrophage/monocytes from primary recipients exhibiting long-term multi-lineage reconstitution derived from Pro/Pre B-cells transduced with the 8-TFPoly viral cocktail. Ig heavy chain-specific PCR spanning the V(D)J junction was then
performed and selected products common in size to all lineages were gel purified, cloned and sequenced. This analysis revealed the presence of V(D)J rearrangements common to all of the donor- derived lineages we analyzed from two independent experiments, indicating multi-lineage differentiation potential from clonal reprogrammed Pro/Pre B-cells (Fig. 71A). That single reprogrammed cells possessed multi-lineage differentiation potential in vivo was further confirmed using a LAM-PCR-based approach, which revealed common viral integration sites in sorted donor- derived B-, T-, and myeloid cells (not shown). To test if reprogrammed cells sustained multi-lineage differentiation capacity during serial transplantation, we analyzed V(D)J junctions and viral integration via LAM-PCR on sorted donor-derived B-, T- and myeloid cells from secondary recipients transplanted with reprogrammed cells from mice that had been analyzed by these approaches during primary transplantation. These experiments revealed that both shared V(D)J rearrangements and common viral integration sites could be identified in multiple lineages in both primary and secondary recipients (Figs. 71B-71C), indicating that single reprogrammed cells possessed both multi-lineage differentiation, and long-term self-renewal potential.
[00828] To determine which lineage(s) in the peripheral blood had the potential to give rise to these colonies upon re-expression of the transcription factors, we purified B-cells, T-cells, myeloid cells and granulocytes from the 8-TFPoly reconstituted mice, and tested their colony forming potential following culturing and plating in the absence or presence of doxycycline. These experiments revealed that cells from each of these lineages were imbued with progenitor activity upon factor re- induction. Of these, granulocytes gave rise to the fewest colonies whereas Macl+
macrophages/monocytes yielded the largest number of colonies and the greatest number of primitive GEMM colonies (Figs. 70C-D).
[00829] We focused on differentiated myeloid cells because unlike differentiated lymphoid cells that have rearranged TCR (T-cells) or IG (B-cells) loci, multi-lineage reconstituting cells derived via reprogramming of myeloid cells would be expected to have the potential to give rise to full repertoires of lymphoid effector cells upon differentiation.
Claims
1. A hematopoietic stem cell (HSC) inducing composition comprising modified mRNA
sequences encoding at least one, two, three, four, five, six, seven, eight, or more HSC inducing factors selected from: CDK 1C, DNMT3B, EGR1, ETV6, EVI1, GATA2, GFI1B, GLIS2, HLF, HMGA2, HOXA5, HOXA9, HOXB3, HOXB4, HOXB5, IGF2BP2, IKZF2, KLF12, KLF4, KLF9, LM02, MEIS1, MSI2, MYCN, NAP1L3, NDN, NFIX, NKX2-3, NR3C2, PBXl, PRDM16, PRDM5, RARB, RBBP6, RBPMS, RUNXl, RUNXITI, SMAD6, TALI, TCF15, VDR, ZFP37, ZFP467, ZFP521, ZFP532, ZFP612, and ZPF467, wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
2. The HSC inducing composition of claim 1, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, PBXl, LM02, PRDM5, ZFP37, MYCN, MSI2, NKX2-3, MEIS1, and RBPMS.
3. The HSC inducing composition of claim 1, wherein the at least one, two, three, four, or more HSC inducing factors are HLF, RUNXITI, ZFP37, PBXl, LM02, and PRDM5
4. A hematopoietic stem cell (HSC) inducing composition comprising :
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding RUNXITI ;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding PBXl ;
e. a modified mRNA sequence encoding LM02; and
f. a modified mRNA sequence encoding PRDM5;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
5. The HSC inducing composition of claim 4, further comprising one or more of:
a. a modified mRNA sequence encoding PRDM16;
b. a modified mRNA sequence encoding ZFP467; and
c. a modified mRNA sequence encoding VDR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
6. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding ; HLF;
b. a modified mRNA sequence encoding ; RU X1T1 ;
c. a modified mRNA sequence encoding ; PBX1;
d. a modified mRNA sequence encoding ; LM02;
e. a modified mRNA sequence encoding ; PRDM5
f. a modified mRNA sequence encoding ; ZFP37;
g- a modified mRNA sequence encoding ; MYCN;
h. a modified mRNA sequence encoding ; MSI2;
i. a modified mRNA sequence encoding ; NKX2-3;
j- a modified mRNA sequence encoding ; MEIS1 ; and
k. a modified mRNA sequence encoding ; RBPMS;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
7. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding ZFP467;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding HOXB4; and
d. a modified mRNA sequence encoding MSI2;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
8. The HSC inducing composition of claim 7, further comprising one or more of:
a. a modified mRNA sequence encoding HLF;
b. a modified mRNA sequence encoding LM02;
c. a modified mRNA sequence encoding PRDM16; and
d. a modified mRNA sequence encoding ZFP37.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
9. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding MYCN;
b. a modified mRNA sequence encoding MSI2;
c. a modified mRNA sequence encoding NKX2-3; and
d. a modified mRNA sequence encoding RUNX1T1 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
10. The HSC inducing composition of claim 9, further comprising one or more of:
a. a modified mRNA sequence encoding ; HOXB5;
b. a modified mRNA sequence encoding ; HLF;
c. a modified mRNA sequence encoding ; ZFP467;
d. a modified mRNA sequence encoding ; HOXB3;
e. a modified mRNA sequence encoding ; LM02;
f. a modified mRNA sequence encoding ; PBX1;
g- a modified mRNA sequence encoding ; ZFP37; and
h. a modified mRNA sequence encoding ; ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
11. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding HOXB4;
b. a modified mRNA sequence encoding PBX1 ;
c. a modified mRNA sequence encoding LM02;
d. a modified mRNA sequence encoding ZFP467; and
e. a modified mRNA sequence encoding ZFP521 ;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
12. The HSC inducing composition of claim 11, further comprising one or more of:
a. a modified mRNA sequence encoding KLF12;
b. a modified mRNA sequence encoding HLF; and
c. a modified mRNA sequence encoding EGR;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
13. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding MEIS 1 ;
b. a modified mRNA sequence encoding RBPMS;
c. a modified mRNA sequence encoding ZFP37;
d. a modified mRNA sequence encoding RUNX1T1 ; and
e. a modified mRNA sequence encoding LM02.
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
14. The HSC inducing composition of claim 13, further comprising one or more of:
a. a modified mRNA sequence encoding KLF12; and
b. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
15. A hematopoietic stem cell (HSC) inducing composition comprising:
a. a modified mRNA sequence encoding ZFP37;
b. a modified mRNA sequence encoding HOXB4;
c. a modified mRNA sequence encoding LM02; and
d. a modified mRNA sequence encoding HLF;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
16. The HSC inducing composition of claim 15, further comprising one or more of:
a. a modified mRNA encoding MYCN;
b. a modified mRNA encoding ZPF467;
c. a modified mRNA encoding NKX2-3
d. a modified mRNA encoding PBX1 ; and
e. a modified mRNA encoding KLF4;
wherein each cytosine of each said modified mRNA sequence is a modified cytosine, each uracil of each said modified mRNA sequence is a modified uracil, or a combination thereof.
17. The HSC inducing compositions of any one of claims 1-16, wherein the modified cytosine is 5-methylcytosine and the modified uracil is pseudouracil.
18. The HSC inducing compositions of any one of claims 1-17, wherein the modified mRNA sequences comprise one or more nucleoside modifications selected from the group consisting
of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl- uridine, 1-carboxymethyl-pseudouridine, 5-propynyl -uridine, 1 -propynyl-pseudouridine, 5- taurinomethyluridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl -uridine, 1 -methyl -pseudouridine, 4-thio-l-methyl- pseudouridine, 2-thio-l-methyl-pseudouridine, 1 -methyl- 1 -deaza-pseudouridine, 2-thio-l- methyl-l-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl- cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1 -methyl -pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2- thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-l -methyl -pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl- pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1 -methyl -inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine, and combinations thereof.
19. A kit for making induced hematopoietic stem cells (iHSCs) comprising the HSC inducing compositions comprising modified mRNA sequence components of any one of claims 1-18.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361782037P | 2013-03-14 | 2013-03-14 | |
| US61/782,037 | 2013-03-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014153069A2 true WO2014153069A2 (en) | 2014-09-25 |
| WO2014153069A3 WO2014153069A3 (en) | 2014-12-04 |
Family
ID=51581764
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/029144 Ceased WO2014153115A2 (en) | 2013-03-14 | 2014-03-14 | Compositions and methods for reprogramming hematopoietic stem cell lineages |
| PCT/US2014/028932 Ceased WO2014153069A2 (en) | 2013-03-14 | 2014-03-14 | Compositions and methods for reprogramming hematopoietic stem cell lineages |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/029144 Ceased WO2014153115A2 (en) | 2013-03-14 | 2014-03-14 | Compositions and methods for reprogramming hematopoietic stem cell lineages |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20160032317A1 (en) |
| EP (1) | EP2970881A4 (en) |
| JP (1) | JP2016513974A (en) |
| AU (1) | AU2014236285A1 (en) |
| CA (1) | CA2906752A1 (en) |
| WO (2) | WO2014153115A2 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017070333A1 (en) * | 2015-10-20 | 2017-04-27 | Cellular Dynamics International, Inc. | Multi-lineage hematopoietic precursor cell production by genetic programming |
| WO2017161001A1 (en) * | 2016-03-15 | 2017-09-21 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion |
| EP3394250A4 (en) * | 2015-12-23 | 2019-11-27 | Monash University | CELL REPROGRAMMING |
| US10669528B2 (en) | 2015-06-25 | 2020-06-02 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance |
| US11162070B2 (en) | 2015-09-08 | 2021-11-02 | FUJIFILM Cellular Dynamics, Inc. | MACS-based purification of stem cell-derived retinal pigment epithelium |
| EP3802790A4 (en) * | 2018-06-07 | 2022-03-23 | The Brigham and Women's Hospital, Inc. | METHODS FOR GENERATION OF HEMATOPOIETIC STEM CELLS |
| US12065671B2 (en) | 2015-09-08 | 2024-08-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for reproducible differentiation of clinical-grade retinal pigment epithelium cells |
| US12163155B2 (en) | 2017-04-18 | 2024-12-10 | FUJIFILM Cellular Dynamics, Inc. | Antigen-specific immune effector cells |
Families Citing this family (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9453205B2 (en) | 2009-10-31 | 2016-09-27 | Genesis Technologies Limited | Methods for reprogramming cells and uses thereof |
| DK2494039T3 (en) | 2009-10-31 | 2019-08-19 | Genesis Tech Limited | PROCEDURES FOR REPROGRAMMING CELLS AND APPLICATIONS THEREOF |
| US20140038291A1 (en) * | 2009-10-31 | 2014-02-06 | New World Laboratories Inc. | Methods for reprogramming cells and uses thereof |
| JP2016522679A (en) | 2013-04-04 | 2016-08-04 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing with the CRISPR / Cas system |
| JP2016528890A (en) * | 2013-07-09 | 2016-09-23 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing using the CRISPR / Cas system |
| EP3215623A4 (en) | 2014-11-06 | 2018-09-26 | President and Fellows of Harvard College | Cells lacking b2m surface expression and methods for allogeneic administration of such cells |
| CA2988854A1 (en) | 2015-05-08 | 2016-11-17 | President And Fellows Of Harvard College | Universal donor stem cells and related methods |
| HK1248762A1 (en) * | 2015-06-16 | 2018-10-19 | 国立大学法人京都大学 | High-performance platelet manufacturing method |
| US11286454B2 (en) * | 2015-08-31 | 2022-03-29 | I Peace, Inc. | Pluripotent stem cell manufacturing system and method for producing induced pluripotent stem cells |
| CN106795496B (en) | 2016-12-28 | 2019-01-18 | 中国科学院广州生物医药与健康研究院 | A kind of method and application obtaining T cell |
| KR101970764B1 (en) | 2017-05-19 | 2019-04-22 | 아주대학교산학협력단 | COTL1 Protein Involved in Maintaining Homeostasis of Hematopoietic Stem Cells and Use Thereof |
| TWI793151B (en) | 2017-08-23 | 2023-02-21 | 瑞士商諾華公司 | 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof |
| CN108220243B (en) | 2017-12-30 | 2019-05-28 | 中国科学院广州生物医药与健康研究院 | A kind of multipotential stem cell and its T cell and application of differentiation |
| CU20210002A7 (en) | 2018-07-10 | 2021-08-06 | Novartis Ag | DERIVATIVES OF 3- (5-HYDROXY-1-OXOISOINDOLIN-2-IL) PIPERIDINE-2,6-DIONA AND THEIR USE IN THE TREATMENT OF PROTEIN-DEPENDENT DISORDERS WITH ZINC 2 FINGERS OF THE IKAROS FAMILY (IKZF2) |
| AR116109A1 (en) | 2018-07-10 | 2021-03-31 | Novartis Ag | DERIVATIVES OF 3- (5-AMINO-1-OXOISOINDOLIN-2-IL) PIPERIDINE-2,6-DIONA AND USES OF THE SAME |
| US12564645B2 (en) * | 2018-09-14 | 2026-03-03 | Translate Bio, Inc. | Methods for treatment of methylmalonic acidemia |
| CA3127593A1 (en) * | 2019-01-22 | 2020-07-30 | Washington University | Compositions and methods for generating hematopoietic stem cells (hscs) |
| WO2020219543A1 (en) * | 2019-04-26 | 2020-10-29 | The Regents Of The University Of California | Cells for enhanced production of adeno-associated virus |
| US20220401489A1 (en) * | 2019-11-06 | 2022-12-22 | Syros Pharmaceuticals, Inc. | Compositions and methods for treating sickle cell disease |
| US20230041065A1 (en) * | 2019-12-09 | 2023-02-09 | The Brigham And Women`S Hospital, Inc. | Methods for generating hematopoietic stem cells |
| US20240002864A1 (en) * | 2020-05-11 | 2024-01-04 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and Methods for Enhancing Gene Expression |
| WO2022242359A1 (en) * | 2021-05-20 | 2022-11-24 | 中国科学院广州生物医药与健康研究院 | Method for regenerating humoral immunity system and use thereof |
| CA3233095A1 (en) * | 2021-09-23 | 2023-03-30 | Q-State Biosciences, Inc. | Therapeutics for haploinsufficiency conditions |
| CN115976228B (en) * | 2022-12-01 | 2025-06-27 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | A cell surface marker for distinguishing a new subpopulation of human multipotent progenitor cells with lineage bias and its application |
| CN119220484B (en) * | 2024-11-08 | 2025-04-25 | 中国人民解放军联勤保障部队第九二〇医院 | Application of Smad6 gene in promoting reprogramming of fibroblasts into stem cells |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6749847B2 (en) * | 2000-03-30 | 2004-06-15 | The University Of Connecticut | Hybrid cytokine of IL-7 and β-chain of hepatocyte growth factor |
| US9012219B2 (en) * | 2005-08-23 | 2015-04-21 | The Trustees Of The University Of Pennsylvania | RNA preparations comprising purified modified RNA for reprogramming cells |
| EP1941890A4 (en) * | 2005-09-16 | 2009-08-05 | Kenji Yoshida | Hematopoietic stem cell proliferator |
| ES2324435B1 (en) * | 2005-10-27 | 2010-05-31 | Fundacion Para El Estudio De La Hematologia Y Hemoterapia De Aragon (Fehha) | PROCEDURE AND DEVICE OF IN VITRO MRNA ANALYSIS OF GENES INVOLVED IN HEMATOLOGICAL NEOPLASIAS. |
| WO2010037134A2 (en) * | 2008-09-29 | 2010-04-01 | Stemlifeline, Inc. | Multi-stage stem cell carcinogenesis |
| DK2494039T3 (en) * | 2009-10-31 | 2019-08-19 | Genesis Tech Limited | PROCEDURES FOR REPROGRAMMING CELLS AND APPLICATIONS THEREOF |
| EP3072961A1 (en) * | 2010-04-16 | 2016-09-28 | Children's Medical Center Corporation | Sustained polypeptide expression from synthetic, modified rnas and uses thereof |
| EP2603227B1 (en) * | 2010-08-12 | 2017-10-04 | Fate Therapeutics, Inc. | Improved hematopoietic stem and progenitor cell therapy |
| JP5794510B2 (en) * | 2010-08-31 | 2015-10-14 | 国立大学法人 千葉大学 | Efficient induction and amplification method of hematopoietic stem cells |
| WO2012109208A2 (en) * | 2011-02-08 | 2012-08-16 | Cellular Dynamics International, Inc. | Hematopoietic precursor cell production by programming |
| WO2013116307A1 (en) * | 2012-01-30 | 2013-08-08 | Mount Sinai School Of Medicine | Method for programming differentiated cells into hematopoietic stem cells |
-
2014
- 2014-03-14 AU AU2014236285A patent/AU2014236285A1/en not_active Abandoned
- 2014-03-14 WO PCT/US2014/029144 patent/WO2014153115A2/en not_active Ceased
- 2014-03-14 WO PCT/US2014/028932 patent/WO2014153069A2/en not_active Ceased
- 2014-03-14 CA CA2906752A patent/CA2906752A1/en not_active Abandoned
- 2014-03-14 US US14/774,785 patent/US20160032317A1/en not_active Abandoned
- 2014-03-14 EP EP14767919.5A patent/EP2970881A4/en not_active Withdrawn
- 2014-03-14 JP JP2016502993A patent/JP2016513974A/en active Pending
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10669528B2 (en) | 2015-06-25 | 2020-06-02 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance |
| US11891625B2 (en) | 2015-06-25 | 2024-02-06 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance |
| US12241083B2 (en) | 2015-09-08 | 2025-03-04 | FUJIFILM Cellular Dynamics, Inc. | Macs-based purification of stem cell-derived retinal pigment epithelium |
| US12065671B2 (en) | 2015-09-08 | 2024-08-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for reproducible differentiation of clinical-grade retinal pigment epithelium cells |
| US11162070B2 (en) | 2015-09-08 | 2021-11-02 | FUJIFILM Cellular Dynamics, Inc. | MACS-based purification of stem cell-derived retinal pigment epithelium |
| JP2018531020A (en) * | 2015-10-20 | 2018-10-25 | フジフィルム セルラー ダイナミクス,インコーポレイテッド | Generation of multilineage hematopoietic progenitor cells by genetic programming |
| US10865381B2 (en) | 2015-10-20 | 2020-12-15 | FUJIFILM Cellular Dynamics, Inc. | Multi-lineage hematopoietic precursor cell production by genetic programming |
| US10947502B2 (en) | 2015-10-20 | 2021-03-16 | FUJIFILM Cellular Dynamics, Inc. | Methods for directed differentiation of pluripotent stem cells to immune cells |
| JP2021151254A (en) * | 2015-10-20 | 2021-09-30 | フジフィルム セルラー ダイナミクス,インコーポレイテッド | Multi-lineage hematopoietic precursor cell production by genetic programming |
| WO2017070333A1 (en) * | 2015-10-20 | 2017-04-27 | Cellular Dynamics International, Inc. | Multi-lineage hematopoietic precursor cell production by genetic programming |
| US12129486B2 (en) | 2015-10-20 | 2024-10-29 | FUJIFILM Cellular Dynamics, Inc. | Methods for directed differentiation of pluripotent stem cells to immune cells |
| JP7212722B2 (en) | 2015-10-20 | 2023-01-25 | フジフィルム セルラー ダイナミクス,インコーポレイテッド | Generation of multilineage hematopoietic progenitor cells by genetic programming |
| CN108431211A (en) * | 2015-10-20 | 2018-08-21 | 富士胶片细胞动力公司 | It is generated by multispectral system's hemopoietic forebody cell of genetic programming |
| EP3394250A4 (en) * | 2015-12-23 | 2019-11-27 | Monash University | CELL REPROGRAMMING |
| WO2017161001A1 (en) * | 2016-03-15 | 2017-09-21 | Children's Medical Center Corporation | Methods and compositions relating to hematopoietic stem cell expansion |
| US12163155B2 (en) | 2017-04-18 | 2024-12-10 | FUJIFILM Cellular Dynamics, Inc. | Antigen-specific immune effector cells |
| US11597913B2 (en) | 2018-06-07 | 2023-03-07 | The Brigham And Women's Hospital, Inc. | Methods for generating hematopoietic stem cells |
| EP3802790A4 (en) * | 2018-06-07 | 2022-03-23 | The Brigham and Women's Hospital, Inc. | METHODS FOR GENERATION OF HEMATOPOIETIC STEM CELLS |
| US12286643B2 (en) | 2018-06-07 | 2025-04-29 | The Brigham And Women's Hospital, Inc. | Methods for generating hematopoietic stem cells |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160032317A1 (en) | 2016-02-04 |
| WO2014153069A3 (en) | 2014-12-04 |
| WO2014153115A3 (en) | 2014-12-24 |
| JP2016513974A (en) | 2016-05-19 |
| CA2906752A1 (en) | 2014-09-25 |
| EP2970881A4 (en) | 2017-01-25 |
| AU2014236285A1 (en) | 2015-11-05 |
| EP2970881A2 (en) | 2016-01-20 |
| WO2014153115A2 (en) | 2014-09-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20160032317A1 (en) | Compositions and methods for reprogramming hematopoietic stem cell lineages | |
| JP7078673B2 (en) | Conditions for producing and using conditionally immortalized long-term stem cells as well as such cells. | |
| Antoniou et al. | Base-editing-mediated dissection of a γ-globin cis-regulatory element for the therapeutic reactivation of fetal hemoglobin expression | |
| JP2022180510A (en) | Method for increasing fetal hemoglobin expression | |
| US20240293543A1 (en) | Engineered cells for therapy | |
| US20150164952A1 (en) | Methods of Ex Vivo Expansion of Blood Progenitor Cells, and Generation of Composite Grafts | |
| EP3310932A1 (en) | Crispr/cas9 complex for genomic editing | |
| KR20160075676A (en) | Method | |
| Yang et al. | In situ correction of various β-thalassemia mutations in human hematopoietic stem cells | |
| Almaghrabi et al. | A heterozygous CEBPA mutation disrupting the bZIP domain in a RUNX1 and SRSF2 mutational background causes MDS disease progression | |
| Hu et al. | Large-scale generation of iNK and CAR-iNK cells from CD34+ haematopoietic stem and progenitor cells for adoptive immunotherapy | |
| WO2024102860A1 (en) | Engineered cells for therapy | |
| Field | Optimising CRISPR for targeting of primary haematopoietic stem cells | |
| JP7860579B2 (en) | Hematopoietic stem cell-containing composition | |
| Shafiq | Investigating the Transcriptional Networks Involved in Blood Lineage Commitment | |
| Cypris et al. | DNA methylation changes during hematopoietic differentiation of human induced pluripotent stem cells | |
| Sun | Unraveling human T-cell leukemogenesis: insights from combinatorial oncogene interactions | |
| Abuhantash | Targeting HOXA in engineered iPSCs and pre-clinical leukaemia models | |
| Porras | Deriving induced pluripotent stem cells from acute myeloid leukemia patients towards applications of autologous therapies and disease modeling | |
| Huang | Retention of RUNX1-Insufficient CD41+ Platelet-Biased Hematopoietic Stem Cells in Niche by Additional Genetic Mutations Facilitates Myeloid Leukemogenesis | |
| WO2024152926A1 (en) | Identification and use of lineage of hematopoietic progenitor cell and fate determination gene thereof | |
| KR20250128352A (en) | Composition for treating genetic diseases and use thereof | |
| CN120843605A (en) | A PD-1 genome knockout allogeneic double-negative T cell and its preparation method and application | |
| Ihme | Characterization of the Leukemia Initiating Cell in Human Acute Myeloid Leukemia | |
| Maglitto | Role of Gpr56 in mammalian haematopoiesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14769767 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14769767 Country of ref document: EP Kind code of ref document: A2 |






















































