WO2014152364A2 - Methods for detecting brugada syndrome - Google Patents

Methods for detecting brugada syndrome Download PDF

Info

Publication number
WO2014152364A2
WO2014152364A2 PCT/US2014/027257 US2014027257W WO2014152364A2 WO 2014152364 A2 WO2014152364 A2 WO 2014152364A2 US 2014027257 W US2014027257 W US 2014027257W WO 2014152364 A2 WO2014152364 A2 WO 2014152364A2
Authority
WO
WIPO (PCT)
Prior art keywords
mrna
level
biological sample
scn5a
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/027257
Other languages
French (fr)
Other versions
WO2014152364A3 (en
Inventor
Samuel Dudley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Illinois at Urbana Champaign
University of Illinois System
Original Assignee
University of Illinois at Urbana Champaign
University of Illinois System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Illinois at Urbana Champaign, University of Illinois System filed Critical University of Illinois at Urbana Champaign
Publication of WO2014152364A2 publication Critical patent/WO2014152364A2/en
Publication of WO2014152364A3 publication Critical patent/WO2014152364A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • Brugada Syndrome (Phenotype MIM #601144; also known as BRGDA1, Right Bundle Branch Block, ST Segment Elevation, Sudden Death Syndrome, Sudden Unexplained Nocturnal Death Syndrome; SUNDS) is an inherited sudden death condition caused mostly by reductions in cardiac sodium current. According to OMIM, it is characterized by an ST- segment elevation in the right precordial electrocardiogram leads (so-called type 1 ECG) and a high incidence of sudden death in patients with structurally normal hearts.
  • Brugada syndrome typically manifests during adulthood, with a mean age of sudden death of 41 +/- 15 years, but occurs in infants and children (summary by Antzelevitch et al., Circulation 111: 659-670 (2005)).
  • the exact prevalence of Brugada syndrome is unknown, although it is estimated to affect 5 in 10,000 people worldwide and approximately 155,000 people in the United States. While relatively rare, Brugada Syndrome is a major cause of sudden unexplained death syndrome (SUDS) and is the most common cause of sudden death in young men without known underlying cardiac disease. This condition occurs much more frequently in people of Asian ancestry, particularly in Japanese and Southeast Asian populations.
  • SUDS sudden unexplained death syndrome
  • Brugada syndrome is usually diagnosed by an electrocardiogram (ECG) and physical examination.
  • ECG electrocardiogram
  • Antzelevitch et al. (2005), supra stated that a definitive diagnosis can be made when a type 1 ST-segment elevation is observed in greater than 1 right precordial lead (VI to V3) in the presence or absence of a sodium channel-blocking agent, and in conjunction with one of the following: documented ventricular fibrillation (VF), polymorphic ventricular tachycardia (VT), a family history of sudden cardiac death at less than 45 years of age, coved-type ECGs in family members, inducibility of VT with programmed electrical stimulation, syncope, or nocturnal agonal respiration.
  • VF documented ventricular fibrillation
  • VT polymorphic ventricular tachycardia
  • VT polymorphic ventricular tachycardia
  • confounding factors that could account for the ECG abnormality or syncope, including arrhythmogenic right ventricular dysplasia should
  • Brugada syndrome- 1 (BRGDA1) is caused by heterozygous mutation in the SCN5A gene on chromosome 3p22.
  • Related syndromes are also caused by mutations but in genes other than the SCN5A gene.
  • Brugada syndrome-2 (Phenotype MIM #611777) is caused by mutation in the GPD1L gene.
  • Brugada syndrome-3 (Phenotype MIM #611875)
  • Brugada syndrome-4 Phenotype MIM #611876), the phenotypes of which include a shortened QT interval on ECG, are caused by mutation in the CACNA1C and CACNB2 genes, respectively.
  • Brugada syndrome-5 (Phenotype MIM #612838) is caused by mutation in the SCN1B gene.
  • Brugada syndrome-6 (Phenotype MIM #613119) is caused by mutation in the KCNE3 gene.
  • Brugada syndrome-7 (Phenotypte MIM #613120) is caused by mutation in the SCN3B gene.
  • Brugada syndrome-8 (Phenotype MIM #613123) is caused by mutation in the HCN4 gene. Accordingly, genetic testing may be used to confirm a clinical diagnosis of Brugada Syndrome.
  • mRNA messenger RNA
  • SCN5A splice variant mRNA e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein.
  • SCN5A splicing factor genes and a decreased level of mRNA encoded by a gene of a major component of the unfolded protein response (UPR) were also observed in the blood samples of the Brugada Syndrome patients.
  • URR unfolded protein response
  • the invention provides a method of identifying a presence of Brugada Syndrome in a subject.
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased,
  • mRNA messenger RNA
  • the invention also provides a method of determining a subject's need for therapy for Brugada Syndrome (BS).
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
  • mRNA messenger RNA
  • UTR unfolded protein response
  • the subject is one which has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • mRNA messenger RNA
  • SCN5A splice variant e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein
  • UTR unfolded protein response
  • a biological sample obtained from the subject was analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • mRNA messenger RNA
  • SCN5A splice variant e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein
  • UTR unfolded protein response
  • the method comprises the step of providing a therapy for Brugada Syndrome to the subject exhibiting a reduced level of (a), (b), and/or (d), relative to a control level, and/or an increased level of (c), relative to a control level.
  • Undiagnosed and/or untreated Brugada Syndrome can lead to syncope and sudden cardiac death.
  • the invention furthermore provides a method of reducing risk for syncope and/or sudden cardiac death in a subject.
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full- length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (
  • URR unfold
  • the subject is one which has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • mRNA messenger RNA
  • UTR unfolded protein response
  • a biological sample obtained from the subject was analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • mRNA messenger RNA
  • SCN5A splice variant e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein
  • UTR unfolded protein response
  • the method comprises the step of providing a therapy for Brugada Syndrome to the subject exhibiting a reduced level of (a), (b), and/or (d), relative to a control level, and/or an increased level of (c), relative to a control level.
  • the invention additionally provides a method for monitoring progression or regression of Brugada Syndrome in a subject diagnosed with Brugada Syndrome.
  • the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA
  • UTR unfolded
  • the invention furthermore provides methods of monitoring a subject's risk for syncope and/or sudden cardiac death.
  • the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full- length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5
  • UTR unfolded
  • the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein) (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an S
  • UTR unfolded protein response
  • the kit comprises a binding agent which binds to a gene product encoded by the PERK gene, a binding agent which binds to a full-length a gene product encoded by the SCN5A gene, a binding agent which binds to a gene product encoded by the Luc7A gene, a binding agent which binds to a gene product encoded by the RBM25 gene, a binding agent which binds to a gene product encoded by the PRP40 gene, a binding agent which binds to an SCN5A E28C splice variant mRNA transcript, or a protein product encoded thereby, and/or a binding agent which binds to an SCN5A E28D splice variant mRNA transcript, or a protein product encoded thereby.
  • the gene product is an mRNA and the binding agent is a nucleic acid probe.
  • the gene product is an mRNA and the binding agent is a nucleic acid probe.
  • the gene product is an mRNA and
  • Figure 1 is a schematic representation of the splice variants identified in the 5' end of the human SCN5A gene.
  • the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the three exon 1 isoforms are identified.
  • Figure 2 provides cDNA sequences for E1A , E1B1, E1B2, E1B3, E1B4, E2A, E2B1 and E2B2.
  • Figure 3 is a schematic representation of the splice variants identified in the 3' end of the human SCN5A gene. Above the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the four exon 28 isoforms are identified.
  • Figure 4 provides cDNA sequences for E28A (Figure 4A and 4B), E28B (Figure 4C), E28C (Figure 4D), and E28D (Figure 4E).
  • Figures 5 and 6 demonstrate a correlation of cardiac tissue and WBC mRNA abundances of SCN5A variants VC and VD.
  • Figure 5 shows tissue levels of the variant VC as a function of WBC levels measured in the same patient.
  • Figure 6 shows tissue levels of the variant VD as a function of WBC levels measured in the same patient. The best-fit linear regression is displayed as a solid black line. Grey lines represent the 95% confidence intervals.
  • Figures 7 to 13 represent a collection of graphs depicting the relative level of full- length mRNA encoded by the SCN5A gene ( Figure 7), mRNA encoded by the SCN5A Variant E28C ( Figure 8), mRNA encoded by the SCN5A Variant E28D ( Figure 9), mRNA encoded by the RBM25 gene ( Figure 10), mRNA encoded by the Luc7A gene ( Figure 11), mRNA encoded by the PRP40 gene ( Figure 12), and mRNA encoded by the PERK gene ( Figure 13) of blood samples obtained from patients diagnosed with Brugada Syndrome as described in Example 2. Each control level was set to 1 and the level of mRNA was relative to the control level.
  • Figure 14 is a schematic of an exemplary embodiment 101 of a system 100 for assessing a subject's need for an implanted cardiac defibrillator (ICD).
  • ICD implanted cardiac defibrillator
  • Figure 15 represents a flow chart depicting an exemplary computer-readable method resulting in an output diagnosis of Brugada Syndrome.
  • the invention provides a method of identifying a presence of Brugada Syndrome in a subject.
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to
  • UTR unfolded protein
  • the invention also provides a method of determining a subject's need for therapy for Brugada Syndrome (BS).
  • the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is
  • the invention additionally provides a method for monitoring progression or regression of Brugada Syndrome in a subject diagnosed with Brugada Syndrome.
  • the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA
  • UTR unfolded
  • the invention additionally provides a method for monitoring a subject's risk for Brugada Syndrome.
  • the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A s
  • UTR unfolded
  • the methods of the invention comprise analyzing a biological sample obtained from a subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • mRNA messenger RNA
  • UTR unfolded protein response
  • the biological sample is analyzed for (a), (b), (c), and/or (d) by measuring the level, concentration or amount of said mRNA in the biological sample.
  • the methods of the invention may comprise measuring (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) of the biological sample.
  • UTR unfolded protein response
  • Levels of mRNA may be measured by any technique known in the art, including but not limited to northern blotting or reverse transcription followed by real-time quantitative PCR (RT-qPCR).
  • RT-qPCR real-time quantitative PCR
  • tags based technologies such as Serial analysis of gene expression (SAGE) and RNA-Seq, may be carried out to provide a relative measure of the cellular concentration of different mRNAs.
  • the biological sample is analyzed for (a), (b), (c), and/or (d) by measuring the level, concentration or amount of the protein product encoded by the mRNA in the biological sample.
  • the methods of the invention may comprise analyzing a biological sample obtained from a subject for (a) a level of a protein product encoded by a full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of a protein product encoded by an mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of a protein product encoded by mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of a protein product encoded by mRNA encoded by a gene of the unfolded protein response (UPR).
  • UTR unfolded protein response
  • the level, concentration or amount of protein product is determined by an immunoassay, e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), an immunohistochemical assay, which methods are known in the art.
  • an immunoassay e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), an immunohistochemical assay, which methods are known in the art.
  • the level of protein product is represented by a level of the protein product's biological activity, e.g., enzymatic activity.
  • the protein level is reflected by the levels of the substrate or product of the enzymatic reaction catalyzed by the protein product. Methods of assaying for the level of biological activity, e.g., enzymatic activity, are known in the art.
  • the protein level is represented by the level of biological activity of a related protein, e.g., a protein which acts upstream or downstream of the marker.
  • a related protein e.g., a protein which acts upstream or downstream of the marker.
  • the marker level is represented by the activity level of the kinase which phosphorylates the marker.
  • the marker level is represented by the expression levels of the gene activated by the marker.
  • the splice variants include Exon 1 splice variants: ElB l (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), and E1B4 (SEQ ID NO. 4), and also include Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6), and furthermore include Exon 28 splice variants E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
  • ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 splice variants are from the 5' region, the locations of which in the SCN5A gene and mRNA are depicted in FIG. 1.
  • the nucleic acid sequences for ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 are shown in FIG. 2.
  • E1A (SEQ ID NO. 10) is the wild-type (or full-length) isoform in and/or near the 5'UTR of exon 1, while ElBl, E1B2, E1B3, E1B4 are its various spliced (or truncated) variants.
  • E2A (SEQ ID NO. 11) is the wild- type (full-length) isoform in and/or near the 5'UTR of exon 2, while E2B1, and E2B2 are its various variants.
  • E28B, E28C, or E28D splice variants are from or near the 3' untranslated region, the locations of which in the SCN5A mRNA are depicted in FIG. 3.
  • the nucleic acid sequences for E28B, E28C, and E28D are set forth in SEQ ID NOs: 7-9, respectively.
  • Each of E28B, E28C, and E28D is a truncated splice variant encoding shortened, dysfunctional channels. Both E28B and E28C contains untranslated and translated regions while E28D contains only translated region of exon 28.
  • E28B, E28C and E28D splice variants The physiological significance of the E28B, E28C and E28D splice variants is supported by a premature stop codon in exon 28 of one of the two SCN5A alleles, resulting in an 86% reduction in the Na + current (Shang et al., Circ. Res., 101: 1146-1154, 2007).
  • the E28A splice variant is another isoform of the 3' region of SCN5A Exon 28.
  • E28A-S E28A-short
  • E28A-L E28A-long
  • Both isoforms of E28A contains 1239 base pairs in the translated region.
  • E28-L and E28-S resides in the UTR where E28A- L contains 2295 base pairs of the 3'UTR, while E28A-S contains 834 base pairs of the 3'UTR.
  • E28A-S contains only the first 834 base pairs of the 3'UTR.
  • E28A-L represents the wild-type (WT) isoform.
  • WT wild-type
  • the term "truncated SCN5A Exon 28 transcript” refers to a transcript comprising a shortened or truncated translated region of Exon 28 of the SCN5A gene.
  • the truncated SCN5A Exon 28 transcript is a transcript comprising an E28B transcript, E28C transcript, or E28D transcript, which may be referred to herein as "E28B,” “E28C,” and “E28D,” respectively.
  • the truncated SCN5A Exon 28 transcript is a transcript comprising one of an E28C transcript or E28D transcript.
  • full length SCN5A Exon 28 transcript refers to a transcript comprising the full length translated region of Exon 28 of the SCN5A gene.
  • the full length SCN5A Exon 28 transcript is a WT SCN5A Exon 28 transcript.
  • the full length SCN5A Exon 28 transcript is a spliced transcript which is shortened or truncated, as compared to WT SCN5A Exon 28 transcript, yet the spliced transcript still comprises the full length translated region of SCN5A Exon 28.
  • the full length SCN5A Exon 28 transcript is a transcript comprising an E28A transcript (E28A-S).
  • the biological sample is analyzed by measuring the level, concentration or amount of full length mRNA in the biological sample wherein the full length mRNA are encoded by the SCN5A gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of an SCN5A splice variant, (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein).
  • the SCN5A splice variant can be any of those taught herein.
  • the SCN5A splice variant may be any of Exon 1 splice variants: E1B1 (SEQ ID NO.
  • the SCN5A splice variant may be any of Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6).
  • the SCN5A splice variant may be any of Exon 28 splice variants: E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
  • the biological sample is analyzed by measuring the level, concentration or amount of E28A-S and/or E28A-L.
  • the biological sample is analyzed by measuring the level, concentration or amount of a truncated SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of all transcripts encoded by either a full length mRNA encoded by the SCN5A gene or by an SCN5A splice variant. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a truncated SCN5A Exon 28 transcript and/or a full length SCN5A Exon 28 transcript.
  • the biological sample is analyzed by measuring the level, concentration or amount of the SCN5A Exon 28 splice variant, E28C and/or E28D, each of which encode a truncated SCN5A protein.
  • the biological sample is analyzed by measuring all mRNA, including both full- length and truncated mRNA, encoded by the SCN5A gene.
  • Suitable methods of determining expression levels of nucleic acids are known in the art and include quantitative polymerase chain reaction (qPCR), including, but not limited to, real time PCR, Northern blotting and Southern blotting. See, e.g., U.S. Patent Application Publication No.
  • the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the full length mRNA in the biological sample wherein the full length mRNA are encoded by the SCN5A gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by an SCN5A splice variant, (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein).
  • the SCN5A splice variant can be any of those taught herein.
  • the SCN5A splice variant may be any of Exon 1 splice variants: E1B1 (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), and E1B4 (SEQ ID NO. 4).
  • the SCN5A splice variant may be any of Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6).
  • the SCN5A splice variant may be any of Exon 28 splice variants: E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
  • the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the E28A-S and/or E28A-L. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by a truncated SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of all the protein products encoded by all the transcripts encoded by either a full length mRNA encoded by the SCN5A gene or by an SCN5A splice variant.
  • the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the a truncated SCN5A Exon 28 transcript and/or a full length SCN5A Exon 28 transcript.
  • the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the SCN5A Exon 28 splice variant, E28C and/or E28D, each of which encode a truncated SCN5A protein.
  • the biological sample is analyzed by measuring all protein products encoded by SCN5A mRNA, including both full-length and truncated mRNA.
  • the level in exemplary aspects is determined by measuring a first level using a first antibody which specifically binds to the full length SCN5A protein product wherein the antibody binds to an epitope within the C-terminal portion of the full length SCN5A protein product, which epitope is not present in the truncated SCN5A protein product, by measuring a second level using a second antibody which binds to an epitope within the N-terminal portion of the full length SCN5A protein product, which epitope is present in the truncated SCN5A protein product, and substracting the first level from the second level in order to determine the level of the truncated Exon 28 splice variant.
  • Suitable methods of determining expression levels of protein products include immunoassays (e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), and immunohistochemical assay. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101: 1146-1154 (2007); and International Patent Application Publication Nos.
  • immunoassays e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), and immunohistochemical assay.
  • the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR).
  • the splicing factor gene is hLuc7A, PRP40, or RBM25.
  • the gene of the UPR is a transducer of the UPR, for example, PERK. Accordingly, the methods may comprises measuring mRNA of splicing factor hLuc7a, splicing factor PRP40, splicing factor RBM25 and/or PERK.
  • the methods may additionally or alternatively comprise measuring the protein product(s) encoded by one or more of the mRNA of splicing factor hLuc7a, splicing factor PRP40, splicing factor RBM25 and/or PERK Accordingly, in exemplary aspects, the methods described herein may comprise measuring a level of splicing factor hLuc7a protein, splicing factor PRP40 protein, splicing factor RBM25 protein and/or PERK protein or, a splicing factor hLuc7a mRNA, splicing factor PRP40 mRNA, splicing factor RBM25 mRNA and/or PERK mRNA.
  • Luc7A (NCBI Gene ID No. 51747) is also known as LUC7L3; LUC7-like 3; CRA; CROP; LUC7A; hLuc7A; CREAP-1; and OA48-18.
  • Exemplary mRNA sequences of hLuc7A are set forth herein as SEQ ID NOs: 34 and 35 but may also found in the NCBI's nucleotide database as Accession No. NM_006107.3 and as Accession No. NM_016424.4.
  • Exemplary amino acid sequences of hLuc7A are set forth herein as SEQ ID NOs: 36 and 37 but may also be found in the NCBI's Protein database as Accession No. NP_006098.2 and as Accesssion No. NP_057508.2.
  • PRP40 (NCBI Gene ID No. 55660) is also known as PRP40A, PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae), HYP A; FBP11; FLAF1; FNBP3; HIP10; Prp40; FBP-11; HIP-10; and NY-REN- 6.
  • An exemplary mRNA sequence of PRP40 is set forth herein as SEQ ID NO: 663 but may be found in the NCBI's nucleotide database as Accession No. NM_017892.
  • An exemplary amino acid sequence of RBM25 is set forth herein as SEQ ID NO: 664 but may be found in the NCBI's Protein database as Accession No. NP_060362.
  • RBM25 (NCBI Gene ID No. 58517) is also known as RNA binding motif protein 25; S164; NET52; RNPC7; Snu71; RED120; fSAP94; MGC105088; and MGC117168.
  • An exemplary mRNA sequence of RBM25 is set forth herein as SEQ ID NO: 38 but may be found in the NCBI's nucleotide database as Accession No. NM_021239.2.
  • An exemplary amino acid sequence of RBM25 is set forth herein as SEQ ID NO: 39 but may be found in the NCBI's Protein database as Accession No. NP_067062.1.
  • PERK (NCBI Gene ID No. 9451) is also known as eukaryotic translation initiation factor 2-alpha kinase 3, EIF2AK3, protein kinase R-like endoplasmic reticulum kinase, PKR- like ER kinase; PEK; WRS; and DKFZp781H1925.
  • An exemplary mRNA sequence of PERK is set forth herein as SEQ ID NO: 40 but may also be found on the NCBI's nucleotide database as Accession No. NM_004836.5.
  • An exemplary amino acid sequence of PERK is set forth herein as SEQ ID NO: 41 but may also be found on the NCBI's Protein database as Accession No. NP_004827.4.
  • the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR)
  • the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the SCN5A splicing factor gene or by the gene of the UPR in the biological sample.
  • the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, or the PERK gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene, in addition to measuring the level, concentration or amount of mRNA encoded by the SCN5A gene (e.g., but not limited to the full length mRNA encoded by the SCN5A gene and/or SCN5A splice variant mRNA encoding a truncated protein product (e.g., but not limited to E28C
  • Suitable methods of determining expression levels of nucleic acids are known in the art and include quantitative polymerase chain reaction (qPCR), including, but not limited to, real time PCR, Northern blotting and Southern blotting. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101: 1146-1154 (2007); and International Patent Application Publication Nos. WO/2012/094651 and WO/2010/129964. An exemplary method is described herein the EXAMPLES.
  • qPCR quantitative polymerase chain reaction
  • the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR)
  • the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the SCN5A splicing factor gene or by the gene of the UPR in the biological sample.
  • the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, or the PERK gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene.
  • the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene, in addition to measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the SCN5A gene (e.g., but not limited to the full length mRNA encoded by the SCN5A gene and/or SCN5A splice variant mRNA encoding a truncated protein product (e.g., but not limited to E28C andE28D)).
  • SCN5A gene e.g., but not limited to the full length mRNA encoded by the SCN5A gene and/or SCN5
  • Suitable methods of determining expression levels of protein products include immunoassays (e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), and immunohistochemical assay. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101:
  • the methods of the invention comprise a further step wherein the presence of Brugada Syndrome in the subject is identified, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
  • the methods of the invention comprise a further step of determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
  • the methods further comprise determining the subject has having an increased risk for Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining the subject as having a decreased risk for Brugada Syndrome, when the level of
  • the level that is determined may an increased level.
  • the term "increased" with respect to level refers to any % increase above a control level.
  • the increased level may be at least or about a 10% increase, at least or about a 15% increase, at least or about a 20% increase, at least or about a 25% increase, at least or about a 30% increase, at least or about a 35% increase, at least or about a 40% increase, at least or about a 45% increase, at least or about a 50% increase, at least or about a 55% increase, at least or about a 60% increase, at least or about a 65% increase, at least or about a 70% increase, at least or about a 75% increase, at least or about a 80% increase, at least or about a 85% increase, at least or about a 90% increase, at least or about a 95% increase, relative to a control level.
  • the level that is determined may a decreased level.
  • the term "decreased" with respect to level refers to any % decrease below a control level.
  • the decreased level may be at least or about a 10% decrease, at least or about a 15% decrease, at least or about a 20% decrease, at least or about a 25% decrease, at least or about a 30% decrease, at least or about a 35% decrease, at least or about a 40% decrease, at least or about a 45% decrease, at least or about a 50% decrease, at least or about a 55% decrease, at least or about a 60% decrease, at least or about a 65% decrease, at least or about a 70% decrease, at least or about a 75% decrease, at least or about a 80% decrease, at least or about a 85% decrease, at least or about a 90% decrease, at least or about a 95% decrease, relative to a control level.
  • each of the decreased level may be at least or about a 10% decrease, at least or about a 15% decrease, at least or about a
  • the methods may include additional steps.
  • the method may include repeating one or more of the recited step(s) of the method.
  • the method comprises reanalyzing the subject for (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • UTR unfolded protein response
  • the method comprises re-analyzing the subject every 6 to 12 months, wherein the analysis is based on a different biological sample obtained from the same subject.
  • the method comprises obtaining a biological sample from the subject every 6 to 12 months and determining the level of (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); of each biological sample obtained.
  • mRNA messenger RNA
  • UTR unfolded protein response
  • the method comprises analyzing the biological sample for (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) in more than one way.
  • the method in some aspects comprises analyzing the biological sample for both mRNA levels and protein products.
  • the method comprises analyzing the biological sample for only one of: (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
  • the method comprises analyzing the biological sample for only one of: (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded
  • the method comprises analyzing the biological sample for only (a) a level of full length mRNA encoded by the SCN5A gene and
  • the method comprises analyzing all levels of mRNA of the SCN5A gene. In exemplary aspects, the method comprises analyzing all levels of mRNA of the SCN5A gene and the biological sample is blood, or a fraction thereof.
  • the method comprises analyzing the biological sample for all of (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) in more than one way.
  • an SCN5A splice variant e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein
  • UTR unfolded protein response
  • the method comprises analyzing the biological sample for either mRNA or the protein product encoded thereby of only the SCN5A gene, an SCN5A splicing factor gene and/or a gene of the UPR, and the method does not include analyzing the biological sample for mRNA or a protein product encoded thereby of any other gene.
  • the method comprises further steps for diagnosing Brugada Syndrome in a subject. Diagnostic criteria for Brugada Syndrome are described in Wilde et al., Eur Heart J. 23: 1648-1654 (2002); Antzelevitch et al., Circulation 111: 659- 670 (2005); and Richter et al., Eur Heart J 31: 1357-1364 (2010).
  • the method further comprises performing an electrocardiogram on the subject.
  • the method further comprises examining the subject for a structural defect of the heart.
  • the method in exemplary aspects, includes analyzing the subject's medical record and/or medical history.
  • the subject's medical record is analyzed for any occurrence of aborted sudden cardiac death, treatment for sudden death, recent occurrences or frequest occurrences of unexplained syncope (i.e., loss of consciousness) or dizziness.
  • the subject's medical history is analyzed for any family member dying due to sudden cardiac death and/or any family member being diagnosed with Brugada Syndrome.
  • the method further comprises performing a genetic test on the subject, whereupon the presence or absence of one or more of the known genetic mutations associated with Brugada Syndrome is determined. Genetic mutations associated with Brugada Syndrome are described below.
  • the method further comprises administering a therapeutic agent or device once the need therefor or a risk has been determined.
  • the methods described herein may optionally comprise a step of providing an appropriate therapy (administering a pharmaceutical agent or implementing a standard of care) to the subject determined to have a need therefor.
  • the methods of the invention comprise one or more steps related to providing the appropriate therapy.
  • the methods may, for example, comprise a step of implanting an ICD into a subject, or administering to the subject an agent which increases sodium channel current.
  • the agent which increases sodium channel current may be any one known in the art, some of which are described herein.
  • the agent which increases sodium channel current may be administered to the subject by any suitable route of administration known in the art, some routes of which are described herein below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method of identifying a presence of Brugada Syndrome in a subject. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.

Description

METHODS FOR DETECTING BRUGADA SYNDROME
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Application No. 61/786,882, filed March 15, 2013, the contents of which are incorporated herein by reference in its entirety.
STATEMENT OF U.S. GOVERNMENTAL INTEREST
[0002] This invention was made with U.S. government support under National Institutes of Health (NIH) Grant No. R01 HL085558, R01 HL072742, R01 HL106592, R01 HL104025, R01 HL 085369, R32 HL072742, and P01 HL058000. The government has certain rights in this invention.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
[0003] Incorporated by reference in its entirety is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: 2 megabytes ASCII (Text) file named "47508A_SeqListing.txt," created on March 11, 2014."
BACKGROUND
[0004] Brugada Syndrome (Phenotype MIM #601144; also known as BRGDA1, Right Bundle Branch Block, ST Segment Elevation, Sudden Death Syndrome, Sudden Unexplained Nocturnal Death Syndrome; SUNDS) is an inherited sudden death condition caused mostly by reductions in cardiac sodium current. According to OMIM, it is characterized by an ST- segment elevation in the right precordial electrocardiogram leads (so-called type 1 ECG) and a high incidence of sudden death in patients with structurally normal hearts. The syndrome typically manifests during adulthood, with a mean age of sudden death of 41 +/- 15 years, but occurs in infants and children (summary by Antzelevitch et al., Circulation 111: 659-670 (2005)). The exact prevalence of Brugada syndrome is unknown, although it is estimated to affect 5 in 10,000 people worldwide and approximately 155,000 people in the United States. While relatively rare, Brugada Syndrome is a major cause of sudden unexplained death syndrome (SUDS) and is the most common cause of sudden death in young men without known underlying cardiac disease. This condition occurs much more frequently in people of Asian ancestry, particularly in Japanese and Southeast Asian populations.
Although Brugada syndrome affects both men and women, the condition appears to be 8 to 10 times more common in men. Researchers suspect that testosterone, a sex hormone present at much higher levels in men, may be responsible for this difference.
[0005] Brugada syndrome is usually diagnosed by an electrocardiogram (ECG) and physical examination. In a report from the second consensus conference on Brugada syndrome, Antzelevitch et al. (2005), supra stated that a definitive diagnosis can be made when a type 1 ST-segment elevation is observed in greater than 1 right precordial lead (VI to V3) in the presence or absence of a sodium channel-blocking agent, and in conjunction with one of the following: documented ventricular fibrillation (VF), polymorphic ventricular tachycardia (VT), a family history of sudden cardiac death at less than 45 years of age, coved-type ECGs in family members, inducibility of VT with programmed electrical stimulation, syncope, or nocturnal agonal respiration. They noted that confounding factors that could account for the ECG abnormality or syncope, including arrhythmogenic right ventricular dysplasia should be excluded.
[0006] Evidence shows that Brugada syndrome- 1 (BRGDA1) is caused by heterozygous mutation in the SCN5A gene on chromosome 3p22. Related syndromes are also caused by mutations but in genes other than the SCN5A gene. For example, Brugada syndrome-2 (Phenotype MIM #611777) is caused by mutation in the GPD1L gene. Brugada syndrome-3 (Phenotype MIM #611875) and Brugada syndrome-4 (Phenotype MIM #611876), the phenotypes of which include a shortened QT interval on ECG, are caused by mutation in the CACNA1C and CACNB2 genes, respectively. Brugada syndrome-5 (Phenotype MIM #612838) is caused by mutation in the SCN1B gene. Brugada syndrome-6 (Phenotype MIM #613119) is caused by mutation in the KCNE3 gene. Brugada syndrome-7 (Phenotypte MIM #613120) is caused by mutation in the SCN3B gene. Brugada syndrome-8 (Phenotype MIM #613123) is caused by mutation in the HCN4 gene. Accordingly, genetic testing may be used to confirm a clinical diagnosis of Brugada Syndrome.
[0007] However, approximately 80% of patients with Brugada Syndrome do not have a mutation in one of the genes known to cause Brugada Syndrome. Even for the -20% who can be diagnosed through genetic testing, the cost of the test is about $4000. In view of the foregoing, there is a need for a more time-, energy-, and cost-efficient means for diagnosing Brugada Syndrome. SUMMARY
[0008] Based at least in part on the data presented herein for the first time, blood samples obtained from patients diagnosed with Brugada Syndrome exhibited a decreased level of SCN5A messenger RNA (mRNA), including full-length SCN5A mRNA and SCN5A splice variant mRNA (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). An increased level of mRNA encoded by SCN5A splicing factor genes and a decreased level of mRNA encoded by a gene of a major component of the unfolded protein response (UPR) were also observed in the blood samples of the Brugada Syndrome patients.
[0009] Accordingly, the invention provides a method of identifying a presence of Brugada Syndrome in a subject. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0010] The invention also provides a method of determining a subject's need for therapy for Brugada Syndrome (BS). In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0011] Further provided is a method of treating a subject for Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0012] In exemplary embodiments of the method of treating a subject for Brugada
Syndrome, the subject is one which has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In exemplary aspects, a biological sample obtained from the subject was analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In such embodiments, the method comprises the step of providing a therapy for Brugada Syndrome to the subject exhibiting a reduced level of (a), (b), and/or (d), relative to a control level, and/or an increased level of (c), relative to a control level.
[0013] Undiagnosed and/or untreated Brugada Syndrome can lead to syncope and sudden cardiac death. The invention furthermore provides a method of reducing risk for syncope and/or sudden cardiac death in a subject. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full- length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level. In exemplary embodiments, the subject is one which has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In exemplary aspects, a biological sample obtained from the subject was analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In such embodiments, the method comprises the step of providing a therapy for Brugada Syndrome to the subject exhibiting a reduced level of (a), (b), and/or (d), relative to a control level, and/or an increased level of (c), relative to a control level.
[0014] The invention additionally provides a method for monitoring progression or regression of Brugada Syndrome in a subject diagnosed with Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject at a timepoint occurring before the time at which the second biological sample is obtained from the subject, and (iii) determining progression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining regression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0015] The invention furthermore provides methods of monitoring a subject's risk for syncope and/or sudden cardiac death. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full- length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject at a timepoint occurring before the time at which the second biological sample is obtained from the subject, and (iii) determining an increased risk for syncope and/or sudden cardiac death in the subject, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining a decreased risk for syncope and/or sudden cardiac death in the subject, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0016] Further provided are methods of determining the efficacy of a test compound or test therapy for treating Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein) (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject before administration of the test compound or test therapy and the second biological sample is obtained from the subject after administration of the test compound or test therapy, and (iii) determining the test compound or test therapy as ineffective for treating Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining the test compound or test therapy as effective for treating Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0017] The invention provides related kits for diagnosing Brugada Syndrome. In exemplary embodiments, the kit comprises a binding agent which binds to a gene product encoded by the PERK gene, a binding agent which binds to a full-length a gene product encoded by the SCN5A gene, a binding agent which binds to a gene product encoded by the Luc7A gene, a binding agent which binds to a gene product encoded by the RBM25 gene, a binding agent which binds to a gene product encoded by the PRP40 gene, a binding agent which binds to an SCN5A E28C splice variant mRNA transcript, or a protein product encoded thereby, and/or a binding agent which binds to an SCN5A E28D splice variant mRNA transcript, or a protein product encoded thereby. In exemplary aspects, the gene product is an mRNA and the binding agent is a nucleic acid probe. In exemplary aspects, the gene product is protein and the binding agent is an antibody or an antigen-binding fragment thereof.
[0018] Also provided are systems, computer-readable storage media, and methods implemented by a computer processor which can be used in methods described herein. In exemplary aspects, the inventive systems, computer-readable storage media, methods implemented by a processor in a computer, kits, or a combination thereof, each of which described below, may be utilized in any of the methods of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is a schematic representation of the splice variants identified in the 5' end of the human SCN5A gene. The map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the three exon 1 isoforms are identified. [0020] Figure 2 provides cDNA sequences for E1A , E1B1, E1B2, E1B3, E1B4, E2A, E2B1 and E2B2.
[0021] Figure 3 is a schematic representation of the splice variants identified in the 3' end of the human SCN5A gene. Above the map shows the genomic structure of SCN5A with untranslated (open bars) or translated (closed bars) transcribed sequences and nontranscribed sequences (lines). Splicing patterns for each of the four exon 28 isoforms are identified.
[0022] Figure 4 provides cDNA sequences for E28A (Figure 4A and 4B), E28B (Figure 4C), E28C (Figure 4D), and E28D (Figure 4E).
[0023] Figures 5 and 6 demonstrate a correlation of cardiac tissue and WBC mRNA abundances of SCN5A variants VC and VD. Figure 5 shows tissue levels of the variant VC as a function of WBC levels measured in the same patient. Figure 6 shows tissue levels of the variant VD as a function of WBC levels measured in the same patient. The best-fit linear regression is displayed as a solid black line. Grey lines represent the 95% confidence intervals.
[0024] Figures 7 to 13 represent a collection of graphs depicting the relative level of full- length mRNA encoded by the SCN5A gene (Figure 7), mRNA encoded by the SCN5A Variant E28C (Figure 8), mRNA encoded by the SCN5A Variant E28D (Figure 9), mRNA encoded by the RBM25 gene (Figure 10), mRNA encoded by the Luc7A gene (Figure 11), mRNA encoded by the PRP40 gene (Figure 12), and mRNA encoded by the PERK gene (Figure 13) of blood samples obtained from patients diagnosed with Brugada Syndrome as described in Example 2. Each control level was set to 1 and the level of mRNA was relative to the control level.
[0025] Figure 14 is a schematic of an exemplary embodiment 101 of a system 100 for assessing a subject's need for an implanted cardiac defibrillator (ICD).
[0026] Figure 15 represents a flow chart depicting an exemplary computer-readable method resulting in an output diagnosis of Brugada Syndrome.
DETAILED DESCRIPTION
[0027] Method of identifying presence of Brugada Syndrome
[0028] The invention provides a method of identifying a presence of Brugada Syndrome in a subject. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0029] Method of determining need for therapy for Brugada Syndrome
[0030] The invention also provides a method of determining a subject's need for therapy for Brugada Syndrome (BS). In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0031] Method of monitoring Brugada Syndrome
[0032] The invention additionally provides a method for monitoring progression or regression of Brugada Syndrome in a subject diagnosed with Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject at a timepoint occurring before the time at which the second biological sample is obtained from the subject, and (iii) determining progression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining regression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0033] The invention additionally provides a method for monitoring a subject's risk for Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject at a timepoint occurring before the time at which the second biological sample is obtained from the subject, and (iii) determining the subject has having an increased risk for Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining the subject as having a decreased risk for Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0034] Analysis of biological samples
[0035] In exemplary embodiments, the methods of the invention comprise analyzing a biological sample obtained from a subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR).
[0036] In exemplary aspects, the biological sample is analyzed for (a), (b), (c), and/or (d) by measuring the level, concentration or amount of said mRNA in the biological sample. In this regard, the methods of the invention may comprise measuring (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) of the biological sample. Levels of mRNA may be measured by any technique known in the art, including but not limited to northern blotting or reverse transcription followed by real-time quantitative PCR (RT-qPCR). Alternatively, "tag based" technologies, such as Serial analysis of gene expression (SAGE) and RNA-Seq, may be carried out to provide a relative measure of the cellular concentration of different mRNAs.
[0037] In alternative or additional aspects, the biological sample is analyzed for (a), (b), (c), and/or (d) by measuring the level, concentration or amount of the protein product encoded by the mRNA in the biological sample. In this regard, the methods of the invention may comprise analyzing a biological sample obtained from a subject for (a) a level of a protein product encoded by a full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of a protein product encoded by an mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of a protein product encoded by mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of a protein product encoded by mRNA encoded by a gene of the unfolded protein response (UPR). In some aspects, the level, concentration or amount of protein product is determined by an immunoassay, e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), an immunohistochemical assay, which methods are known in the art.
[0038] In some aspects, the level of protein product is represented by a level of the protein product's biological activity, e.g., enzymatic activity. In exemplary aspects, the protein level is reflected by the levels of the substrate or product of the enzymatic reaction catalyzed by the protein product. Methods of assaying for the level of biological activity, e.g., enzymatic activity, are known in the art.
[0039] In some aspects, the protein level is represented by the level of biological activity of a related protein, e.g., a protein which acts upstream or downstream of the marker. For example, if the marker is a phosphorylated protein in the active state, then, in some embodiments, the marker level is represented by the activity level of the kinase which phosphorylates the marker. In other aspects, if the marker is a transcription factor which activates expression of a gene, then, in some embodiments, the marker level is represented by the expression levels of the gene activated by the marker.
[0040] SCN5A transcripts
[0041] As described herein and in the art (e.g., U.S. Application Publication No.
2007/0212723 AI), analysis in or near the promoter and 5' and 3' untranslated regions (UTRs) of the SCN5A gene led to identification of multiple specific 5' and 3' mRNA splice variants. As shown in Figures 1 to 4, the splice variants include Exon 1 splice variants: ElB l (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), and E1B4 (SEQ ID NO. 4), and also include Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6), and furthermore include Exon 28 splice variants E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9).
[0042] The ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 splice variants are from the 5' region, the locations of which in the SCN5A gene and mRNA are depicted in FIG. 1. The nucleic acid sequences for ElBl, E1B2, E1B3, E1B4, E2B1, and E2B2 are shown in FIG. 2. E1A (SEQ ID NO. 10) is the wild-type (or full-length) isoform in and/or near the 5'UTR of exon 1, while ElBl, E1B2, E1B3, E1B4 are its various spliced (or truncated) variants.
Similarly, E2A (SEQ ID NO. 11) is the wild- type (full-length) isoform in and/or near the 5'UTR of exon 2, while E2B1, and E2B2 are its various variants.
[0043] The E28B, E28C, or E28D splice variants are from or near the 3' untranslated region, the locations of which in the SCN5A mRNA are depicted in FIG. 3. The nucleic acid sequences for E28B, E28C, and E28D are set forth in SEQ ID NOs: 7-9, respectively. Each of E28B, E28C, and E28D is a truncated splice variant encoding shortened, dysfunctional channels. Both E28B and E28C contains untranslated and translated regions while E28D contains only translated region of exon 28. The physiological significance of the E28B, E28C and E28D splice variants is supported by a premature stop codon in exon 28 of one of the two SCN5A alleles, resulting in an 86% reduction in the Na+ current (Shang et al., Circ. Res., 101: 1146-1154, 2007).
[0044] The E28A splice variant is another isoform of the 3' region of SCN5A Exon 28. There are two isoforms of the E28A: E28A-short (E28A-S) (SEQ ID NO. 12) and E28A-long (E28A-L) (SEQ ID NO. 13). Both isoforms of E28A contains 1239 base pairs in the translated region. The difference between E28-L and E28-S resides in the UTR where E28A- L contains 2295 base pairs of the 3'UTR, while E28A-S contains 834 base pairs of the 3'UTR. E28A-S contains only the first 834 base pairs of the 3'UTR. E28A-L represents the wild-type (WT) isoform. For purposes herein, outside of this paragraph, recitation of "E28A" refers to E28A-S, and E28A-L will be referred to as wild-type or WT.
[0045] As used herein, the term "truncated SCN5A Exon 28 transcript" refers to a transcript comprising a shortened or truncated translated region of Exon 28 of the SCN5A gene. In exemplary aspects, the truncated SCN5A Exon 28 transcript is a transcript comprising an E28B transcript, E28C transcript, or E28D transcript, which may be referred to herein as "E28B," "E28C," and "E28D," respectively. In exemplary aspects, the truncated SCN5A Exon 28 transcript is a transcript comprising one of an E28C transcript or E28D transcript.
[0046] As used herein, the term "full length SCN5A Exon 28 transcript" refers to a transcript comprising the full length translated region of Exon 28 of the SCN5A gene. In exemplary aspects, the full length SCN5A Exon 28 transcript is a WT SCN5A Exon 28 transcript. In exemplary aspects, the full length SCN5A Exon 28 transcript is a spliced transcript which is shortened or truncated, as compared to WT SCN5A Exon 28 transcript, yet the spliced transcript still comprises the full length translated region of SCN5A Exon 28. In exemplary aspects, the full length SCN5A Exon 28 transcript is a transcript comprising an E28A transcript (E28A-S).
[0047] In exemplary aspects of the methods of the invention, the biological sample is analyzed by measuring the level, concentration or amount of full length mRNA in the biological sample wherein the full length mRNA are encoded by the SCN5A gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of an SCN5A splice variant, (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). The SCN5A splice variant can be any of those taught herein. For example, the SCN5A splice variant may be any of Exon 1 splice variants: E1B1 (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), and E1B4 (SEQ ID NO. 4). For example, the SCN5A splice variant may be any of Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6). For example, the SCN5A splice variant may be any of Exon 28 splice variants: E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9). In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of E28A-S and/or E28A-L. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a truncated SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of all transcripts encoded by either a full length mRNA encoded by the SCN5A gene or by an SCN5A splice variant. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a truncated SCN5A Exon 28 transcript and/or a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the SCN5A Exon 28 splice variant, E28C and/or E28D, each of which encode a truncated SCN5A protein. In exemplary aspects of the invention, the biological sample is analyzed by measuring all mRNA, including both full- length and truncated mRNA, encoded by the SCN5A gene. Suitable methods of determining expression levels of nucleic acids (e.g., mRNA) are known in the art and include quantitative polymerase chain reaction (qPCR), including, but not limited to, real time PCR, Northern blotting and Southern blotting. See, e.g., U.S. Patent Application Publication No.
2007/0212723 Al, Shang et al., Circulation Research 101: 1146-1154 (2007); and
International Patent Application Publication Nos. WO/2012/094651 and WO/2010/129964. An exemplary method is described herein the EXAMPLES.
[0048] In exemplary aspects of the methods of the invention, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the full length mRNA in the biological sample wherein the full length mRNA are encoded by the SCN5A gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by an SCN5A splice variant, (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). The SCN5A splice variant can be any of those taught herein. For example, the SCN5A splice variant may be any of Exon 1 splice variants: E1B1 (SEQ ID NO. 1), E1B2 (SEQ ID NO. 2), E1B3 (SEQ ID NO. 3), and E1B4 (SEQ ID NO. 4). For example, the SCN5A splice variant may be any of Exon 2 splice variants: E2B1 (SEQ ID NO. 5), E2B2 (SEQ ID NO. 6). For example, the SCN5A splice variant may be any of Exon 28 splice variants: E28B (SEQ ID NO. 7), E28C (SEQ ID NO. 8), or E28D (SEQ ID NO. 9). In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the E28A-S and/or E28A-L. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by a truncated SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of all the protein products encoded by all the transcripts encoded by either a full length mRNA encoded by the SCN5A gene or by an SCN5A splice variant. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the a truncated SCN5A Exon 28 transcript and/or a full length SCN5A Exon 28 transcript. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of the protein product encoded by the SCN5A Exon 28 splice variant, E28C and/or E28D, each of which encode a truncated SCN5A protein. In exemplary aspects of the invention, the biological sample is analyzed by measuring all protein products encoded by SCN5A mRNA, including both full-length and truncated mRNA.
[0049] In aspects, wherein the level of a protein product encoded by a truncated SCN5A Exon 28 splice variant is analyzed, the level in exemplary aspects, is determined by measuring a first level using a first antibody which specifically binds to the full length SCN5A protein product wherein the antibody binds to an epitope within the C-terminal portion of the full length SCN5A protein product, which epitope is not present in the truncated SCN5A protein product, by measuring a second level using a second antibody which binds to an epitope within the N-terminal portion of the full length SCN5A protein product, which epitope is present in the truncated SCN5A protein product, and substracting the first level from the second level in order to determine the level of the truncated Exon 28 splice variant.
[0050] Suitable methods of determining expression levels of protein products are known in the art and include immunoassays (e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), and immunohistochemical assay. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101: 1146-1154 (2007); and International Patent Application Publication Nos.
WO/2012/094651 and WO/2010/129964.
[0051] Splicing Factors and Components Related the Unfolded Protein Response (UPR)
[0052] In exemplary aspects of the methods of the invention, the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR). In exemplary aspects, the splicing factor gene is hLuc7A, PRP40, or RBM25. In exemplary aspects, the gene of the UPR is a transducer of the UPR, for example, PERK. Accordingly, the methods may comprises measuring mRNA of splicing factor hLuc7a, splicing factor PRP40, splicing factor RBM25 and/or PERK. The methods may additionally or alternatively comprise measuring the protein product(s) encoded by one or more of the mRNA of splicing factor hLuc7a, splicing factor PRP40, splicing factor RBM25 and/or PERK Accordingly, in exemplary aspects, the methods described herein may comprise measuring a level of splicing factor hLuc7a protein, splicing factor PRP40 protein, splicing factor RBM25 protein and/or PERK protein or, a splicing factor hLuc7a mRNA, splicing factor PRP40 mRNA, splicing factor RBM25 mRNA and/or PERK mRNA.
[0053] Luc7A (NCBI Gene ID No. 51747) is also known as LUC7L3; LUC7-like 3; CRA; CROP; LUC7A; hLuc7A; CREAP-1; and OA48-18. Exemplary mRNA sequences of hLuc7A are set forth herein as SEQ ID NOs: 34 and 35 but may also found in the NCBI's nucleotide database as Accession No. NM_006107.3 and as Accession No. NM_016424.4. Exemplary amino acid sequences of hLuc7A are set forth herein as SEQ ID NOs: 36 and 37 but may also be found in the NCBI's Protein database as Accession No. NP_006098.2 and as Accesssion No. NP_057508.2.
[0054] PRP40 (NCBI Gene ID No. 55660) is also known as PRP40A, PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae), HYP A; FBP11; FLAF1; FNBP3; HIP10; Prp40; FBP-11; HIP-10; and NY-REN- 6. An exemplary mRNA sequence of PRP40 is set forth herein as SEQ ID NO: 663 but may be found in the NCBI's nucleotide database as Accession No. NM_017892. An exemplary amino acid sequence of RBM25 is set forth herein as SEQ ID NO: 664 but may be found in the NCBI's Protein database as Accession No. NP_060362.
[0055] RBM25 (NCBI Gene ID No. 58517) is also known as RNA binding motif protein 25; S164; NET52; RNPC7; Snu71; RED120; fSAP94; MGC105088; and MGC117168. An exemplary mRNA sequence of RBM25 is set forth herein as SEQ ID NO: 38 but may be found in the NCBI's nucleotide database as Accession No. NM_021239.2. An exemplary amino acid sequence of RBM25 is set forth herein as SEQ ID NO: 39 but may be found in the NCBI's Protein database as Accession No. NP_067062.1.
[0056] PERK (NCBI Gene ID No. 9451) is also known as eukaryotic translation initiation factor 2-alpha kinase 3, EIF2AK3, protein kinase R-like endoplasmic reticulum kinase, PKR- like ER kinase; PEK; WRS; and DKFZp781H1925. An exemplary mRNA sequence of PERK is set forth herein as SEQ ID NO: 40 but may also be found on the NCBI's nucleotide database as Accession No. NM_004836.5. An exemplary amino acid sequence of PERK is set forth herein as SEQ ID NO: 41 but may also be found on the NCBI's Protein database as Accession No. NP_004827.4.
[0057] In exemplary aspects, wherein the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR), the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the SCN5A splicing factor gene or by the gene of the UPR in the biological sample. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, or the PERK gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene, in addition to measuring the level, concentration or amount of mRNA encoded by the SCN5A gene (e.g., but not limited to the full length mRNA encoded by the SCN5A gene and/or SCN5A splice variant mRNA encoding a truncated protein product (e.g., but not limited to E28C
andE28D)). Suitable methods of determining expression levels of nucleic acids (e.g., mRNA) are known in the art and include quantitative polymerase chain reaction (qPCR), including, but not limited to, real time PCR, Northern blotting and Southern blotting. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101: 1146-1154 (2007); and International Patent Application Publication Nos. WO/2012/094651 and WO/2010/129964. An exemplary method is described herein the EXAMPLES.
[0058] In exemplary aspects, wherein the biological sample is analyzed for a level of mRNA encoded by a SCN5A splicing factor gene or by a gene of the unfolded protein response (UPR), the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the SCN5A splicing factor gene or by the gene of the UPR in the biological sample. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, or the PERK gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene. In exemplary aspects, the biological sample is analyzed by measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the RBM25 gene, the Luc7A gene, the PRP40, gene, and the PERK gene, in addition to measuring the level, concentration or amount of a protein product encoded by an mRNA encoded by the SCN5A gene (e.g., but not limited to the full length mRNA encoded by the SCN5A gene and/or SCN5A splice variant mRNA encoding a truncated protein product (e.g., but not limited to E28C andE28D)).
Suitable methods of determining expression levels of protein products are known in the art and include immunoassays (e.g., Western blotting, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), and immunohistochemical assay. See, e.g., U.S. Patent Application Publication No. 2007/0212723 Al, Shang et al., Circulation Research 101:
1146-1154 (2007); and International Patent Application Publication Nos. WO/2012/094651 and WO/2010/129964.
[0059] Interpretation of Biological Sample Analysis
[0060] The methods of the invention comprise a further step wherein the presence of Brugada Syndrome in the subject is identified, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level. In a related aspect, the methods of the invention comprise a further step of determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0061] With regard to the above-monitoring methods, the methods further comprise determining the subject has having an increased risk for Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining the subject as having a decreased risk for Brugada Syndrome, when the level of
(a) , (b), and/or (d) of the second biological sample is increased, relative to the level of (a),
(b) , and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample, or determining progression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining regression of the Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[0062] Relative to a control level or the level of the first biological sample, the level that is determined may an increased level. As used herein, the term "increased" with respect to level refers to any % increase above a control level. The increased level may be at least or about a 10% increase, at least or about a 15% increase, at least or about a 20% increase, at least or about a 25% increase, at least or about a 30% increase, at least or about a 35% increase, at least or about a 40% increase, at least or about a 45% increase, at least or about a 50% increase, at least or about a 55% increase, at least or about a 60% increase, at least or about a 65% increase, at least or about a 70% increase, at least or about a 75% increase, at least or about a 80% increase, at least or about a 85% increase, at least or about a 90% increase, at least or about a 95% increase, relative to a control level.
[0063] Relative to a control level or the level of the first biological sample, the level that is determined may a decreased level. As used herein, the term "decreased" with respect to level refers to any % decrease below a control level. The decreased level may be at least or about a 10% decrease, at least or about a 15% decrease, at least or about a 20% decrease, at least or about a 25% decrease, at least or about a 30% decrease, at least or about a 35% decrease, at least or about a 40% decrease, at least or about a 45% decrease, at least or about a 50% decrease, at least or about a 55% decrease, at least or about a 60% decrease, at least or about a 65% decrease, at least or about a 70% decrease, at least or about a 75% decrease, at least or about a 80% decrease, at least or about a 85% decrease, at least or about a 90% decrease, at least or about a 95% decrease, relative to a control level. [0064] In exemplary aspects, each of the referenced levels is normalized to a housekeeping gene, such as, the β-actin gene. The levels may be normalized to another housekeeping gene, such as any of those described herein.
[0065] Additional Steps
[0066] With regard to any of the methods of the invention, the methods may include additional steps. For example, the method may include repeating one or more of the recited step(s) of the method. Accordingly, in exemplary aspects, the method comprises reanalyzing the subject for (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In exemplary aspects, the method comprises re-analyzing the subject every 6 to 12 months, wherein the analysis is based on a different biological sample obtained from the same subject. In some aspects, the method comprises obtaining a biological sample from the subject every 6 to 12 months and determining the level of (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); of each biological sample obtained.
[0067] In exemplary aspects, the method comprises analyzing the biological sample for (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) in more than one way. For example, the method in some aspects comprises analyzing the biological sample for both mRNA levels and protein products.
[0068] In exemplary aspects, the method comprises analyzing the biological sample for only one of: (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). In exemplary aspects, the method comprises analyzing the biological sample for only
(a) a level of full length mRNA encoded by the SCN5A gene and (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, the method comprises analyzing the biological sample for only (a) a level of full length mRNA encoded by the SCN5A gene and
(b) a level of mRNA of the SCN5A splice variant E28C and/or E28D. In exemplary aspects, the method comprises analyzing all levels of mRNA of the SCN5A gene. In exemplary aspects, the method comprises analyzing all levels of mRNA of the SCN5A gene and the biological sample is blood, or a fraction thereof. In exemplary aspects, the method comprises analyzing the biological sample for all of (a) a level of full length mRNA encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR) in more than one way. In exemplary aspects, the method comprises analyzing the biological sample for either mRNA or the protein product encoded thereby of only the SCN5A gene, an SCN5A splicing factor gene and/or a gene of the UPR, and the method does not include analyzing the biological sample for mRNA or a protein product encoded thereby of any other gene.
[0069] In exemplary embodiments, the method comprises further steps for diagnosing Brugada Syndrome in a subject. Diagnostic criteria for Brugada Syndrome are described in Wilde et al., Eur Heart J. 23: 1648-1654 (2002); Antzelevitch et al., Circulation 111: 659- 670 (2005); and Richter et al., Eur Heart J 31: 1357-1364 (2010). For instance, the method further comprises performing an electrocardiogram on the subject. In exemplary
embodiments, the method further comprises examining the subject for a structural defect of the heart. The method in exemplary aspects, includes analyzing the subject's medical record and/or medical history. In exemplary aspects, the subject's medical record is analyzed for any occurrence of aborted sudden cardiac death, treatment for sudden death, recent occurrences or frequest occurrences of unexplained syncope (i.e., loss of consciousness) or dizziness. In exemplary aspects, the subject's medical history is analyzed for any family member dying due to sudden cardiac death and/or any family member being diagnosed with Brugada Syndrome. In additional or alternative aspects, the method further comprises performing a genetic test on the subject, whereupon the presence or absence of one or more of the known genetic mutations associated with Brugada Syndrome is determined. Genetic mutations associated with Brugada Syndrome are described below.
[0070] In exemplary aspects, the method further comprises administering a therapeutic agent or device once the need therefor or a risk has been determined. For example, the methods described herein may optionally comprise a step of providing an appropriate therapy (administering a pharmaceutical agent or implementing a standard of care) to the subject determined to have a need therefor. In exemplary aspects, the methods of the invention comprise one or more steps related to providing the appropriate therapy. The methods may, for example, comprise a step of implanting an ICD into a subject, or administering to the subject an agent which increases sodium channel current. The agent which increases sodium channel current may be any one known in the art, some of which are described herein. The agent which increases sodium channel current may be administered to the subject by any suitable route of administration known in the art, some routes of which are described herein below.
[0071] Any and all possible combinations of the steps described herein are contemplated for purposes of the inventive methods.
[0072] Genetic Screening
[0073] Genetic mutations associated with Brugada Syndrome are known in the art and are catalogued at the website maintained by the Molecular Cardiology Laboratories IRCCS Fondazione Salvatore Maugeri having the URL htt p :/7ww w . fsm.it/cardmoc . According to this website, the mutations associated with Brugada Syndrome 1 occur in the SCN5A gene and include those shown in Table 1:
TABLE 1
Figure imgf000023_0001
Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
In-frame N- Kapplinger et
191_193delTGC L64del BrS
deletion term al. 2010
N- Kapplinger et
T210G N70K Missense BrS
term al. 2010
N- Kapplinger et
C217T Q73X Nonsense BrS
term al. 2010
N- Kapplinger et
G250A D84N Missense BrS
term al. 2010
Levy-
BrS Nissenmaum
N-
G253A G35S Missense (footnote et al, Genet term
1) Test 5(4): 331- 334 ( 2001)
N- Kapplinger et
T278C F93S Missense BrS
term al. 2010
N- Kapplinger et
T281G I94S Missense BrS
term al. 2010
N- Linag et al.
G283 V95I Missense BrS
term 2006
N- Kapplinger et
C310T 104W Missense BrS
term al. 2010
N- Kapplinger et
G311A R1040Q Missense BrS
term al. 2010
N- Kapplinger et
C327A N109K Missense BrS
term al. 2010
N- Kapplinger et
C361T R121W Missense BrS
term al. 2010
N- Kapplinger et
G362A R121Q Missense BrS
term al. 2010
N- Kapplinger et
A376G K126E Missense BrS
term al. 2010
Kapplinger et
381dupT L128SfsX44 Frame Shift Dl-Sl BrS
al. 2010
Kapplinger et
C393 -5A * - Splice Site Dl-Sl BrS
al. 2010
Kapplinger et
T407C L136P Missense Dl-Sl BrS
al. 2010
In-frame Kapplinger et
410_418dupTCATGTGCA H37_C139dup Dl-Sl BrS
insertion al. 2010
Kapplinger et
G436A V146M Missense Dl-Sl BrS
al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Levy-
N-
G461A 104Q Missense BrS(l) Nissenmaum term
2001
Dl- Kapplinger et
G468A W156X Nonsense BrS
S1/S2 al. 2010
Kapplinger et
T477A Y159X Nonsense DI-S2 BrS
al. 2010
Kapplinger et
G481C E161Q Missense DI-S2 BrS
al. 2010
Kapplinger et
G481A E161K Missense DI-S2 BrS
al. 2010
Kapplinger et
486delC Y162XfsXl Frame shift DI-S2 BrS
al. 2010
Vatta et al.
- K126E Missense Dl/Sl BrS
2002
E161K (see Dl/Sl- Smits et al. n.a. Missense BrS
also) S2 2002
Kapplinger et
G525C K175N Missense DI-S2 BrS
al. 2010
Kapplinger et
C533G A178G Missense DI-S2 BrS
al. 2010
Dl- Kapplinger et
C535T R179X Nonsense BrS
S2/S3 al. 2010
Dl- Kapplinger et
T544C C182R Missense BrS
S2/S3 al. 2010
Dl- Kapplinger et
C554T A185V Missense BrS
S2/S3 al. 2010
Makiyama et
C559T T187I Missense BrS+SSS
al. 2005
Kapplinger et
G579A W193X Nonsense DI-S3 BrS
al. 2010
Kapplinger et
C611T A204V Missense DI-S3 BrS
al. 2010
Kapplinger et
G611+1A* - Slice site DI-S3 BrS
al. 2010
Kapplinger et
611+3_611+4dupAA - Splice site DI-S3 BrS
al. 2010
Kapplinger et
A612 -2G* - Splice site DI-S3 BrS
al. 2010
Dl- Kapplinger et
T635A L212Q Missense BrS
S3/S4 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DI/S3- Atrial Makita et al
T635C L212P Missense
S4 standstill 2005
Kapplinger et
656_657insATTCA T220FfsX10 Frame shift DI-S4 BrS
al. 2010
Kapplinger et
C659T T220I Missense DI-S4 BrS -DCM
al. 2010
Kapplinger et
C664T 222X Nonsense DI-S4 BrS
al. 2010
Kapplinger et
G665A R222Q Missense DI-S4 BrS
al. 2010
Kapplinger et
G667C V223L Missense DI-S4 BrS
al. 2010
Kapplinger et
C673T R225W Missense DI-S4 BrS
al. 2010
Priori et al
C677T A226V Missense DI/S4 BrS
2002
Priori et al
A688G 1230V Missense DI/S4 BrS
2002
Kapplinger et
G694A V232I Missense DI-S4 BrS
al. 2010
DI/S5- Chen et al.
Ins AAint 7 IVS7DS+4 Splice error BrS
S6 1998
Dl- Kapplinger et
G718A V240M Missense BrS
S4/S5 al. 2010
Dl- Kapplinger et
A745T K249X Nonsense BrS
S4/S5 al. 2010
Kapplinger et
C808A Q270K Missense DI-S5 BrS
al. 2010
Kapplinger et
T827A L276Q Missense DI-S5 BrS
al. 2010
Dl- Kapplinger et
C832G H278D Missense BrS
S5/S6 al. 2010
Dl- Kapplinger et
C844T R282C Missense BrS
S5/S6 al. 2010
Priori et al
DI/S5-
G845A R282H Missense BrS 2002; Itoh et
S6
al 2005
DI/S5- Niimura et al
G874A G292S Missense BrS
S6 2004
DI/S5- Priori et al
G880A V294M Missense BrS
S6 2002 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Dl- Kapplinger et
G898A V300I Missense BrS
S5/S6 al. 2010
DI/S5-
- K317N Missense BrS Yi et al. 2003
S6
Dl- Kapplinger et
G934+1A* - Splice site BrS
S5/S6 al. 2010
Dl- Kapplinger et
C934+4T* - Splice site BrS
S5/S6 al. 2010
Dl- Kapplinger et
T944C L315P Missense BrS
S5/S6 al. 2010
Dl- Kapplinger et
C959A T320N Missense BrS
S5/S6 al. 2010
DI/S5- Priori et
G995A G319S Missense BrS
S6 al.2000
Dl- Kapplinger et
G998+1A* - Splice site BrS
S5/S6 al. 2010
DI/S5- Cordeiro et al.
C1007T P336L(8) Missense BrS
S6 2006
DI/S5- Keller et al
T974G L325 Missense BrS
S6 2005
Dl- Kapplinger et
G1036T E346X Nonsense BrS
S5/S6 al. 2010
Dl- Kapplinger et
G 1052 A G351D Missense BrS
S5/S6 al. 2010
- (G1052T? in Kapplinger et DI/S5- Vatta et al.
G351V Missense BrS
al) S6 2002
DI/S5- Pfahnl et al.
C1058T T353I Missense BrS
S6 2007
DI/S5- Makiyama et
G1066A D356N Missense BrS+CCD
S6 al. 2005
Dl- Kapplinger et
C1099T R367C Missense BrS
S5/S6 al. 2010
SUNDS/BrS Vatta et al.
DI/S5- /Atrial 2002;
G1100A R367H Missense
S6 standstill (2' Takehara et al,
2004
Dl- Kapplinger et
GllOOT R367L Missense BrS
S5/S6 al. 2010
Dl- Kapplinger et
T1106A M369K Missense BrS
S5/S6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Dl- Kapplinger et
T1120G W374G Missense BrS
S5/S6 al. 2010
DI/S5- Smits et al. n.a. 367C Missense BrS + ARVC
S6 2002
DI/S5- Smits et al. n.a. M369K Missense BrS
S6 2002
Rossenbacker
DI/S5- et al 2004;
G1127A R376H Missense BrS
S6 Frustaci et al
2005
Dl- Kapplinger et
G1156A G386R Missense BrS
S5/S6 al. 2010
Dl- Kapplinger et
G1157A G386E Missense Brs
S5/S6 al. 2010
Priori et al
1177-1179del 393delF Deletion DI/S6 BrS
2002
Kapplinger et
G1186C V396L Missense DI-S6 BrS
al. 2010
Kapplinger et
T1187C V396A Missense DI-S6 BrS
al. 2010
A1217G N406S Missense DI/S6 BrS Itoh H 2005
Kapplinger et
C1255T Q419X Nonsense DI-DII BrS
al. 2010
Kapplinger et
G1315A E439K Missense DI-DII BrS
al. 2010
Kapplinger et
T1338+2A * - Splice site DI-DII BrS
al. 2010
Kapplinger et
1428_1431delCAAG S476RfsX30 Frame shift DI-DII BrS
al. 2010
Smits et al.
1479del K493 Deletion DI-DII BrS
2002
Kapplinger et
A1502G D501G Missense DI-DII BrS
al. 2010
Kapplinger et
1537delC R513VfsX8 Frame shift DI-DII BrS
al. 2010
Kapplinger et
1562delA K521SfsX102 Frame shift DI-DII BrS
al. 2010
Kapplinger et
G1577A R526H Missense DI-DII BrS
al. 2010
Kapplinger et
T1595G F532C Missense DI-DII BrS
al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Kapplinger et
C7603T 535X Nonsense DI-DII BrS
al. 2010
Kapplinger et
T1629A F543L Missense DI-DII BrS
al. 2010
G 1651 A A551T Missense DI-DII BrS Lai et al. 2005
Kapplinger et
G 1654 A G552R Missense DI-DII BrS
al. 2010
Smits et al. n.a. R535X Nonsense DI-DII BrS
2002
Takahata et al.
G 1663 A E555K Missense DI-DII BrS
2003
Priori et al.
T1700A L567Q Missense DI-DII BrS-SIDS(4)
2000
Kapplinger et
C1717T Q573X Nonsense DI-DII BrS
al. 2010
Kapplinger et
1721delG G574DfsX49 Frame shift DI-DII BrS
al. 2010
Arnestad et al n.a. del AL 586-587 Deletion DI-DII SIDS
2007
Kapplinger et
G1844A G615E Missense DI-DII BrS
al. 2010
Kapplinger et
C1855T L619F Missense DI-DII BrS
al. 2010
Kapplinger et
C1858T R620C Missense DI-DII BrS
al. 2010
Silent/Splice Kapplinger et
G1890A T630T DI-DII BrS
site al. 2010
Kapplinger et
G1890+5A * - Splice site DI-DII BrS
al. 2010
Kapplinger et
CI 895 T T632M Missense DI-DII BrS
al. 2010
Kapplinger et
C1918G P640A Missense DI-DII BrS
al. 2010
Kapplinger et
1936delC Q646RfsX5 Frame shift DI-DII BrS
al. 2010
Kapplinger et
C1940A A647D Missense DI-DII BrS
al. 2010
Kapplinger et
C1943T P648L Missense DI-DII BrS
al. 2010
Kapplinger et
1950_1953delAGAT D651AfsX25 Frame shift DI-DII BrS
al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Kapplinger et
C1981 T 661W Missense DI-DII BrS
al. 2010
1983_1993dupGGCCCTCAG Kapplinger et
A665GfsX16 Frame shift DI-DII BrS
CG al. 2010
Frame Kapplinger et
2024_2025delAG E675VfsX45 DI-DII BrS
shift/splice al. 2010
Priori et al
A2042C H681P Missense DI-DII BrS
2002
Kapplinger et
T2047G C683G Missense DI-DII BrS
al. 2010
Kapplinger et
G2092T E698X Nonsense DI-DII BrS
al. 2010
Kapplinger et
C2102T P701L Missense DI-DII BrS
al. 2010
Kapplinger et
C2150T P717L Missense Dll-Sl BrS
al. 2010
Kapplinger et
2201dupT M734lfsXll Frame shift Dll-Sl BrS
al. 2010
Vatta et al. n.a. A735V Missense Dl/Sl SUNDS(3)
2002
Kapplinger et
C2204T A735V Missense Dll-Sl
al. 2010
Priori et
C2204A A735E Missense Dl/Sl BrS
al.2000
Dll- Kapplinger et
G2236A E746K Missense BrS
S1/S2 al. 2010
Kapplinger et
G2254A G752R Missense DII-S2 BrS
al. 2010
Kapplinger et
G2273A G758E Missense DII-S2 BrS
al. 2010
Kapplinger et
2274delG l759FfsX6 Frame shift DII-S2 BrS
al. 2010
Kapplinger et
T2291G M764 Missense DII-S2 BrS
al. 2010
Dll- Kapplinger et
G 2314 A D772N Missense BrS
S2/S3 al. 2010
Dll- Kapplinger et
C2317T P773S Missense BrS
S2/S3 al. 2010
Dll- Kapplinger et
2320delT Y774TfsX28 Frame shift BrS
S2/S3 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Priori et al
IVS14-1G>C Splice Error DII/S2 BrS
2000
Smits et al. n.a. G752 Missense DII/S2 BrS
2002
In-frame Dll- Kapplinger et
2326_2328delTAC Y776del BrS
deletion S2/S3 al. 2010
Kapplinger et
G2365A V789I Missense DII-S3 BrS
al. 2010
Kapplinger et
G2423C R808P Missense DII-S4 BrS
al. 2010
2435_2436+3delTGGTAins Indel/splice Kapplinger et
L812P DII-S4 BrS
CGCCT site al. 2010
Kapplinger et
G2465A W822X Nonsense DII-S4 BrS
al. 2010
Keller et al
G2466A W822X Missense DII/S4 BrS
2005
DII/S4 Niimura et al
C2504T S835L Missense BrS
-S5 2004
Dll- Kapplinger et
T2516C L839P Missense BrS
S4/S5 al. 2010
Kapplinger et
2533delG V845CfsX2 Frame shift DII-S5 BrS
al. 2010
Kapplinger et
2549_2550insTG F851GfsX19 Frame shift DII-S5 BrS
al. 2010
Kapplinger et
2550_2551dupGT F851CfsX19 Frame shift DII-S5 BrS
al. 2010
Dlll/S Priori et al
T2552C F851L Missense BrS
5 2002
Kapplinger et
C2553A F851L Missense DII-S5 BrS
al. 2010
Dlll/S Schulze-Bahr
2581-2582delTT F861fs951X Frameshift BrS+CCD
5 2003
Kapplinger et
2582_2583delTT F861WfxX90 Frame shift DII-S5 BrS
al. 2010
Dll- Kapplinger et
G2599C E867Q Missense BrS
S5/S6 al. 2010
Smits et al.
Dlll/S
2602delC L867X Nonsense BrS+CCD 2002; Schulze- 5
Bahr 2003
Dll- Kapplinger et
2602delC L868X Frame shift BrS
S5/S6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DM l/S Priori et al
2613delC S871fs+9X Frameshift BrS
5-S6 2002
Dll- Kapplinger et
C2632T 878C Missense BrS
S5/S6 al. 2010
Dll- Kapplinger et
G2633A R878H Missense BrS
S5/S6 al. 2010
Dll- Kapplinger et
A2657C H886P Missense BrS
S5/S6 al. 2010
DII/S5 Priori et
T2674A F891I Missense BrS
-S6 al.2000
Dll- Kapplinger et
C2677T R893C Missense BrS
S5/S6 al. 2010
Dll- Kapplinger et
G2678A R893H Missense BrS
S5/S6 al. 2010
DM l/S Priori et al
T2686A C896S Missense BrS
5-S6 2002
DM- Kapplinger et
G2701A E901K Missense BrS
S5/S6 al. 2010
DM l/S Priori et al
C2729T S910L Missense BrS
5-S6 2002
Kapplinger et
T2743C C915R Missense DII-S6 BrS
al. 2010
Kapplinger et
T2750G L917R Missense DII-S6 BrS
al. 2010
Kapplinger et
A2780G N927S Missense DII-S6 BrS
al. 2010
Kapplinger et
T2783C L928P Missense DII-S6 BrS
al. 2010
Kapplinger et
T2804C L935P Missense DII-S6 BrS
al. 2010
DM/DM Kapplinger et
2850delT D951MfsX6 Frame shift BrS
1 al. 2010
Dll- Smits et al n.a. D951X Nonsense BrS
Dlll 2002
Dll- Priori et
C2893T R965C Missense BrS
Dlll al.2000
DM/DM Kapplinger et
G2894A R965H Missense BrS
1 al. 2010
DM/DM Kapplinger et
2914_2923delTTTGTCAA GC F972GfsX170 Frame shift BrS
1 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DM/DM Kapplinger et
G2989A A997T Missense BrS
1 al. 2010
DM/DM Kapplinger et
3140_3141dupTG P1048CfsX98 Frame shift BrS
1 al. 2010
Dll- Priori et
G3157A E1053K Missense BrS
Dlll al.2000
Dll- Kapplinger et
A3164G D1055G Missense BrS
Dlll al. 2010
Insertion/delet DM/DM Kapplinger et
3171_3172delTGinsA D1057EfsX88 BrS
ion 1 al. 2010
DM/DM Kapplinger et
3228+2delT* - Splice site BrS
1 al. 2010
DM/DM Kapplinger et
C3236A S1079Y Missense BrS
1 al. 2010
Dll- BrS and Splawski et al.;
G3340A D1114N Missense
Dlll RW(5) Priori et al.;
DM/DM Kapplinger et
C3338T A1113V Missense BrS
1 al. 2010
DM/DM Kapplinger et
G3345A W1115X Nonsense BrS
1 al. 2010
Dll- Priori et al
C3352T Q1118X Nonsense BrS
Dlll 2002
Dll- Frustaci et al
G3068A 1023H Missense BrS+ ARVC
Dlll 2005
Dll- Kapplinger et
G3419C S1140T Missense BrS
Dlll al. 2010
Dll- Kapplinger et
3553_3554delCA Q1185GfsX55 Frame Shift BrS
Dlll al. 2010
Dll- Shin et al,
G3573A W1191X Nonsense RrS
Dlll 2006
Dll- Kapplinger et
G3576A W1192X Nonsense BrS
Dlll al. 2010
Kapplinger et
G3622T E1208X Nonsense DIM-SI BrS
al. 2010
Kapplinger et
3634_3636delATC I1212del In-frame del DIM-SI BrS
al. 2010
Kapplinger et
G3656A S1219N Missense DIM-SI BrS
al. 2010
Frame Kapplinger et
3666delG A1223PfsX7 DIM-SI BrS
shift/splice al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
Dlll- Kapplinger et
G3673A E1225K Missense BrS
S1/S2 al. 2010
BrS+CCD Smits et al.
Dlll/S
G3676A E1225K Missense (see also 2002; Schulze- 1
here) Bahr 2003
Dlll- Kapplinger et
T3682C Y1228H Missense BrS
S1/S2 al. 2010
Dlll- Kapplinger et
C3694T 1232W Missense BrS
S1/S2 al. 2010
Dlll/S Chen et al.
- R1232W Missense BrS
1-S2 1998
Dlll- Kapplinger et
G3695A R1232Q Missense BrS
S1/S2 al. 2010
Dlll/S Priori et al
G3708T K1236N Missense BrS
1-S2 2002
Dlll/S Kapplinger et
T3716C L1239P Missense BrS
2 al. 2010
Dlll/S Priori et al
G3718C E1240Q Missense BrS
2 2002
Dlll/S Kapplinger et
G3727A D1243N Missense BrS
2 al. 2010
Dlll/S Kapplinger et
T3746A V1249D Missense BrS
2 al. 2010
Dlll/S Kapplinger et
A3758G E1253G Missense BrS
2 al. 2010
Dlll/S Kapplinger et
G3784A G1262S Missense BrS
2 al. 2010
Dlll/S Kapplinger et
G3813C W1271C Missense BrS
3 al. 2010
Dlll/S Smits et al. delG3816 n.a. Frameshift BrS
2 2002
Dlll/S Kapplinger et
G3823A D1275N Missense BrS -DCM
3 al. 2010
Dlll/S Kapplinger et
G3840+1A - Splice Site BrS
3 al. 2010
Dlll/S Kapplinger et
C3863G A1288G Missense BrS
3 al. 2010
Dlll/S Kapplinger et
3894delC H299SfsX13 Frame Shift BrS
4 al. 2010
Dlll/S Kapplinger et
T3932C L1311P Missense BrS
4 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DM l/S
G3934A G1262S Missense BrS Shin et al 2004
2
DM l/S Priori et al
T3878C F1293S Missense BrS
3-S4 2002
DM l/S Kapplinger et
G3956T G1319V Missense BrS
4-S5 al. 2010
DM l/S Smits et al. n.a. G1319V Missense BrS
4-S5 2002
DM l/S Kapplinger et
A3963+4G* - Splice Site BrS
4-S5 al. 2010
DM l/S Kapplinger et
T3963+2C - Splice Site BrS
4-S5 al. 2010
DM l/S Kapplinger et
T3968G V1323G Missense BrS
4-S5 al. 2010
DM l/S Kapplinger et
C3995T P1332L Missense BrS
4-S5 al. 2010
DM l/S Kapplinger et
G4018A V1340I Missense BrS
5 al. 2010
DM l/S Kapplinger et
T4030C F1344L Missense BrS
5 al. 2010
DM l/S Keller et al
T4031C F1344S Missense BrS
5 2006
DM l/S Kapplinger et
C4036A L1346I Missense BrS
5 al. 2010
DM l/S Kapplinger et
T4037C L1346P Missense BrS
5 al. 2010
DM l/S Kapplinger et
T4052G M1351 Missense BrS
5 al. 2010
DM l/S Kapplinger et
G4057A V1353M Missense BrS
5 al. 2010
DM l/S Kapplinger et
G4072T G1358W Missense BrS
5 al. 2010
DM l/S Kapplinger et
G4077T K1359N Missense BrS
5 al. 2010
DM l/S Smits et al. n.a. S1382I Missense BrS
5-S6 2002
DM l/S Kapplinger et
T4079G F1360C Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4088A C1363Y Missense BrS
5-S6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DM l/S Kapplinger et
T4118A L1373X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4145T S1382I Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
C4147T Q1383X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
T4178A L1393X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
C4182G Y1394X Nonsense BrS
5-S6 al. 2010
DM l/S Glatter KA
4189delT n.a. Frameshift BrS
5-S6 2004
DM l/S Chen et al. del A4190 V1398X Nonsense BrS
5-S6 1998
DM l/S Kapplinger et del A4190 K1397 fsX2 Frame Shift BrS
5-S6 al. 2010
DM l/S Smits et al. n.a. V1405L Missense BrS
5-S6 2002
DM l/S Kapplinger et
G4213A V1405M Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4213C V4105L Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4216C G1406R Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4217A G1406E Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4222A G1408R Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
A4226G Y1409C Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
C4227G Y1409X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
C4234T L1412F Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
A4255G K1419E Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4258C G1420R Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4279T A1427S Missense BrS
5-S6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DM l/S Kapplinger et
C4283T A1428V Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
A4294G 1432G Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4296C R1432S Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4298T G1433V Missense BrS
5-S6 al. 2010
Silent/Splice DM l/S Kapplinger et
G4299A G1433G BrS
site 5-S6 al. 2010
DM l/S Kapplinger et
G4299+1T* - Splice site BrS
5-S6 al. 2010
DM l/S Kapplinger et
4299+ Id el G* - Splice Site BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4300-1A * - Splice site BrS
5-S6 al. 2010
DM l/S Kapplinger et
T4302G Y1434X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
C4313T P1438L Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4320A W1440X Nonsense BrS
5-S6 al. 2010
DM l/S Kapplinger et
G4321C E1441Q Missense BrS
5-S6 al. 2010
DM l/S Kapplinger et
A4342C I1448L Missense BrS
6 al. 2010
DM l/S Kapplinger et
T4343C I1448T Missense BrS
6 al. 2010
DM l/S Kapplinger et
A4346G Y1449C Missense BrS
6 al. 2010
DM l/S Kapplinger et
T4352A V1451D Missense BrS
6 al. 2010
DM l/S BrS+CCD(6 Kindt et al.
G4372T G1406R(6) Missense
5-S6 ) 2001
DM l/S Kapplinger et
4376_4379delTCTT F1459SfsX3 Frame shift BrS
6 al. 2010
DM l/S Kapplinger et
A4387T N1463Y Missense BrS
6 al. 2010
DM l/S Kapplinger et
4389_4396delCCTCTTTA L1464WfsX5 Frame shift BrS
6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DIIIS5- Deschennes et
A1294G 1432G Missense BrS
S6 al. 2000
DM l/S Kapplinger et
G4402T V1468F Missense BrS
6 al. 2010
DM l/S Priori et al
4402-4406del G1467fs+13X Frameshift BrS
6 2002
DIII/DI Kapplinger et
C4426T Q1476X Nonsense BrS
V al. 2010
Smits et al
Dlll-
4435-4437delAAG K1479del Deletion BrS 2002; Schulze- DIV
Bahr 2003
DIII/DI Kapplinger et
G4437+5A * - Splice site BrS
V al. 2010
DIII/DI Kapplinger et
4477_4479delAAG K1493del In-frame del BrS
V al. 2010
DIII/DI Kapplinger et
A4477T K1493X Nonsense BrS
V al. 2010
DIII/DI
- Y1494N Missense BrS Tian et al 2007
V
Dlll- BrS+RW+C Priori et al
4498-4500del K1500del Deletion
DIV CD 2002
DIII/DI Kapplinger et
C4501G L1501V Missense BrS
V al. 2010
Dlll- Smits et al. n.a. G1502S Missense BrS
DIV 2002
Dlll- Deschennes et
C4534T R1512W Missense BrS
DIV al. 2000
DIII/DI Kapplinger et
T4562A I1521K Missense BrS
V al. 2010
DIV/S Kapplinger et
G4573A V1525M Missense BrS
1 al. 2010
Dlll- Yokoi et al.
A4580G K1527R(7) Missense BrS
DIV 2005
DIV/S Kapplinger et
G4642A E1548K Missense BrS
1-S2 al. 2010
DIV/S Yokoi et al.
G4705C A1569P(7) Missense BrS
1 2005
In-frame DIV/S Kapplinger et
4708_4710dupATC I1570dup BrS
insertion 2 al. 2010
DIV/S Kapplinger et
T4712G F1571C Missense BrS
2 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DIV/S Kapplinger et
G4720A E1574K Missense BrS
2 al. 2010
DIV/S Makiyama et
4729ins aa K1578fs+52X Frameshift BrS+SSS
2 al. 2005
DIV/S Kapplinger et
T4745C L1582P Missense BrS
2 al. 2010
DIV/S Kapplinger et
C4747T 1583C Missense BrS
2-S3 al. 2010
DIV/S Kapplinger et
G4748A R1583H Missense BrS
2-S3 al. 2010
DIV/S Kapplinger et
G4773A W1591X Nonsense BrS
3 al. 2010
DIV/S Olson E et al.
G4783C D1595H Missense DCM
3 2005
DIV/S Kapplinger et
G4810A V1604M Missense BrS
3 al. 2010
DIV/S Rossenbacker c.4810+3_4810+6dupGGGT - Splice error BrS
3-S4 et al. 2005
DIV/S Hong K et al
4813+5insTGGG V1604sp Splice error BrS
3-S4 2005
DIV/S Kapplinger et
4813+2_4813+5dup TGGG - Splice site BrS
3 al. 2010
DIV/S Kapplinger et
A4838T Q1613L Missense BrS
3-S4 al. 2010
DIV/S Kapplinger et
C4845A Y1615X Nonsense BrS
3-S4 al. 2010
DIV/S Linag et al.
4849delTCT F1617del Deletion BrS
3-S4 2006
DIV/S Kapplinger et
4856delC P1619RfsX12 Frame shift BrS
3-S4 al. 2010
DIV/S Chen et al.
C4858T T1620M Missense
3-S4 1998
DIV/S Kapplinger et
C4859T T1620M Missense BrS
3-S4 al. 2010
DIV/S Makiyama et
C4864T R1623X Nonesense BrS+SSS
4 al. 2005
DIV/S Kapplinger et
C4867T R1623X Nonsense BrS
4 al. 2010
DIV/S Kapplinger et
G4868A R1623Q Missense BrS
4 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DIV/S Kapplinger et
C4885T 1629X Nonsense BrS
4 al. 2010
DIV/S Kapplinger et
G4886A R1629Q Missense BrS
4 al. 2010
DIV/S Kapplinger et
C4912T R1638X Nonsense BrS
4 al. 2010
DIV/S Kapplinger et
G4925A G1642E Missense BrS
4 al. 2010
DIVS4 Linag et al.
C4946A A1649V Mssense BrS
-/S5 2006
DIV/S BrS+AVblo Cordeiro et al.
A4975G I1660V(8) Missense
5 ck 2006
DIV/S Kapplinger et
A4978G 11660V Missense BrS
5 al. 2010
DIV/S Kapplinger et
G4981A G1661R Missense BrS
5 al. 2010
DIV/S Kapplinger et
G4981C G1661R Missense BrS
5 al. 2010
DIV/S Kapplinger et
G4999A V1667I Missense BrS
5 al. 2010
DIV/S Kapplinger et
C5015A S1672Y Missense BrS
5 al. 2010
DIV/S Kapplinger et
G5038A A1680T Missense BrS
5 al. 2010
DIV/S Kapplinger et
5068_5070delGA D1690HfsX98 Frame shift BrS
5-S6 al. 2010
DIV/S Kapplinger et
C5083T Q1695X Nonsense BrS
5-S6 al. 2010
DIV/S Kapplinger et
G5092A A1698T Missense BrS
5-S6 al. 2010
DIV/S
- S1710L Missense IVF(9) Akai et al.2000
5-S6
DIV/S Kapplinger et
5124_5126delCAC T1709del In-frame del BrS
5-S6 al. 2010
DIV/S Kapplinger et
C5126T T1709M Missense BrS
5-S6 al. 2010
DIV/S Kapplinger et
C5126G T1709R Missense BrS
5-S6 al. 2010
DIV/S Kapplinger et
G5134A G1712S Missense BrS
5-S6 al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
DIV/S Amin et al
A5141G D1714G Missense BrS
5-S6 2005
DIV/S Kapplinger et
5157delC H720SfsX67 Frame shift BrS
5-S6 al. 2010
DIV/S Kapplinger et
A5165G N1722D Missense BrS
5-S6 al. 2010
DIV/S Kapplinger et
T5182C C1728 Missense BrS
5-S6 al. 2010
DIV/S Kapplinger et
C5184G C1728W Missense BrS
5-S6 al. 2010
Smits et al.
IVS21+1G>A - Splice error BrS
2002
DIV/S Priori et al
G5218A G1740R Missense BrS
5-S6 2002
DIV/S Smits et al. n.a. G1743E Missense BrS
6 2002
DIV/S Takahata et al.
G5227A G1743R Missense BrS
6 2003
DIV/S Kapplinger et
G5228A G1743E Missense BrS
5-S6 al. 2010
DIV/S Kapplinger et
5290delG V1764SfsX23 Frame shift BrS
6 al. 2010
DIV/S Kapplinger et
G5290T V1764F Missense BrS
6 al. 2010 c- Kapplinger et
C5336T T1779M Missense BrS
term al. 2010 c- Priori et al
G5350A E1784K Missense BrS
term 2002 c- Kapplinger et
5356_5357delCT L1786EfsX2 Frame shift BrS
term al. 2010 c- Kapplinger et
5387_5388insTGA 1795_1796insD In-frame ins BrS
term al. 2010 c- Kapplinger et
5420dupA F1808lfsX3 Frame shift BrS
term al. 2010 c- Kapplinger et
C5435A S1812X Nonsense BrS
term al. 2010 c- Kapplinger et
5464_5467delTCTG E1823HfsX10 Frame shift BrS
term al. 2010 c- Kapplinger et
C5494G Q1832E Missense BrS
term al. 2010 Aminoacid Regio
Nucleotide Change Mutation Type Phenotype Reference
Change n
c- BrS + Bezzina et al.
Ins TGA 5537 1795 insD Insertion
term RW(10) 1999 c- Kapplinger et
5577_5578dipAA 1860KfsX13 Frame shift BrS
term al. 2010 c- Kapplinger et
G5581A V1861I Missense BrS
term al. 2010
Priori et al.
T5383C Y1795H Missense c-tem BrS
2000 c- Schulze-Bahr
C5425A S1812X Nonsense BrS+CCD
term 2003 c- Smits et al. n.a. A1924T Missense BrS
term 2002 c- Kapplinger et
G5616C K1872N Missense BrS
term al. 2010 c- Kapplinger et
G5707C S1904L Missense BrS
term al. 2010 c- Kapplinger et
G5770A A1924T Missense BrS
term al. 2010 c- Kapplinger et
G5803A G1935S Missense BrS
term al. 2010 c- Kapplinger et
G 5812 A E1938K Missense BrS
term al. 2010 c- Kapplinger et
6010_6012dupTTC F2004dup In-frame ins BrS
term al. 2010 c- Kapplinger et
T6010G F2004V Missense BrS
term al. 2010 c- Arnestad et al
- V1951L Missense SIDS
term 2007
Amino acid numbering in "Amino Acid Change" is based on Gene Bank cDNA:
NM_000335 (which is provided herein as SEQ ID NO: 659) n.a. = not available; ARVC= arrhythmogenic right ventricular cardiomyopathy; SSS= sinus node disease; CCD= Cardiac Conduction Defect; RW = Romano-Ward (long QT) phenotype
References of Table 1 :
1. Akai et al., FEBS Lett 479(1-2): 29-34 (2000)
2. Amin et al., Acta Physiol Scand 185(4): 291-301 (2005)
3. Arnestad et al., Circulation 115(3): 361-367 (2007)
4. Bezzina et al., Circ Res 85(12): 1206-1213 (1999)
5. Chen et al., Nature 392(6673): 293-296 (1998) 6. Cordeiro et al., Circulation 114(19): 2026-2033 (2006);
7. Deschenes et al., Cardiovasc Res 46(1): 55-65 (2000);
8. Frustaci et al., Circulation 112(24): 3680-3687 (2005)
9. Glatter et al., Am J Cardiol 93(10): 1320-1322 (2004)
10. Hong et al., J Mol Cell Cardiol 38(4): 555-560 (2004)
11. Itoh et al., J Cardiovasc Electrophysiol 16(4): 378-383 (2005)
12. Kaplinger et al., Heart Rhythm 7(1): 33-46 (2010)
13. Keller et al., Cardiovasc Res 67(3): 510-519 (2005)
14. Keller et al., Cardiovasc Res 70(3): 521-529 (2006)
15. Kindt et al., Circulation 104(25): 3081-3086 (2001)
16. Lai et al., J Hum Genet 50(9): 490-496 (2005)
17. Levy-Nissenmaum et al., Genet Test.5(4) 33\-4 (2001)
18. Liang et al., Circulation 114(19): 2026-2033 (2006)
19. Makita et al., Heart Rhythm 2(10): 1128-1134 (2005)
20. Makiyama et al., J Am Coll Cardiol 46(11): 2100-2106 (2005)
21. Nimura et al., Circ J 68(8): 740-746 (2004)
22. Olson et al., JAMA 293: 447-454 (2005)
23. Pfahnl et al., Heart Rhythm 4(1): 46-53 (2006)
24. Priori et al., Circulation 102(20): 2509-2015 (2000)
25. Priori et al., Circulation. 105(11): 1342-7 (2002)
26. Rossenbacker et al., J Med Genet 42(5): e29 (2005)
27. Rossenbacker et al., Heart Rhythm 1(5): 610-615 (2004)
28. Schulze-Bahr et al., Hum Mutat 21(6): 651-652 (2003)
29. Shin et al., J Hum Genet 49(10): 573-578 (2004)
30. Shin et al., Life Sci 80(8): 716-724 (2007)
31. Smits et al., J Am Coll Cardiol 40(2): 350-356 (2002)
32. Splawski et al., Circulation 102(10): 1178-1185 (2000)
33. Takahata et al., Life Sci 72(21): 2391-2399 (2003)
34. Takehara et al., J Intern Med 255(1): 137-142 (2004)
35. Tian et al., Zhonghua Xin Xue Guan Bing Za Zhi 35(12): 1122-1125 (2007)
36. Vatta et al., Mol Genet Metab 75(4): 317-324 (2002)
37. Yi et al., Di Yi Jun Yi Da Xue Xue Bao 23(11): 1139-1142 (2003)
38. Yokoi et al., Heart Rhythm 2(3): 285-292 (2005)
Footnotes of Table 1 :
(1) This mutation was associated with mild phenotype and low penetrance; expression studies were not performed
(2) Atrial standstill occurred during procainamide administration ans was associated with a Brugada syndrome phenotype (Takehara et al, 2004).
(3) SUNDS = Sudden Unexplained Nocturnal Death Syndrome, alternativa name for Brugada syndrome described in far east countries.
(4) SIDS=Sudden Infant Death Syndrome;
(5) BrS phenotype reported by Priori et al; RW phenotype reported by Splawski et al;
(6) CCD= Cardiac Conduction Defect; The nucleotide and amino acid coding of G1406R has been reported as described in the paper.
(7) K1527R and A1569P were found on the same allele an asymptomatic subject with BrS pattern.
(8) This mutation was found as compund heterozygous with P336L. (9) Idiopathic Ventricular Fibrillation in the absence of the typical Brugada syndrome pattern;
(10) BS + RW (Romano Ward)=Brugada Syndrome and Long QT syndrome is present in the same family.
[0074] Also, according to this website, the mutations associated with Brugada Syndrome 4 occur in the CACNAlc gene and include those shown in Table 2:
TABLE 2
Figure imgf000044_0001
Figure imgf000045_0001
Reference sequence in Burashnikov et al: NM_000219, NM_201590, NM_000722.2 which are provided herein as SEQ ID NOs: 660-662, respectively. Burashnikov et al., Heart Rhythm 7(12): 1872-1882 (2010); Antzelevitch et al., Circulation 115(4): 442-449 (2007); Splawski et al., PNAS 102(23): 8089-8096 (2005); Splawski et al., Cell 119(1): 19-31 (2004)
[0075] Biological Samples
[0076] With regard to the methods disclosed herein, in some embodiments, the biological sample obtained from the subject comprises a bodily fluid, including, but not limited to, blood, plasma, serum, lymph, breast milk, saliva, mucous, semen, vaginal secretions, cellular extracts, inflammatory fluids, cerebrospinal fluid, feces, vitreous humor, or urine obtained from the subject. In some aspects, the sample is a composite panel of at least two of the foregoing biological samples. In some aspects, the biological sample is a composite panel of at least two of a blood sample, a plasma sample, a serum sample, and a urine sample. In exemplary aspects, the biological sample comprises blood or a fraction thereof (e.g., plasma, serum, fraction obtained via leukopheresis). In exemplary aspects, the biological sample comprises white blood cells obtained from the subject. In exemplary aspects, the biological sample comprises only white blood cells. In exemplary aspects, the biological sample is muscle tissue (e.g., skeletal muscle tissue). In exemplary aspects, the biological sample is cardiac tissue (e.g., cardiac muscle tissue).
[0077] Subjects
[0078] With regard to the methods disclosed herein, the subject in exemplary aspects is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits, mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order
Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). In some aspects, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In some aspects, the mammal is a human.
[0079] In exemplary embodiments, the subject is a male human. In exemplary
embodiments, the subject is about 40 years old or younger. In exemplary aspects, the subject is about 39 years old or younger, about 38 years old or younger, about 37 years old or younger, about 36 years old or younger, about 35 years old or younger, about 34 years old or younger about 33 years old or younger, about 32 years old or younger, about 31 years old or younger, about 30 years old or younger, about 29 years old or younger, about 28 years old or younger, about 27 years old or younger, about 26 years old or younger, about 25 years old or younger, about 24 years old or younger, about 23 years old or younger, about 22 years old or younger, about 21 years old or younger, or about 20 years old or younger.
[0080] In exemplary aspects, the subject's medical record is analyzed for any occurrence of aborted sudden cardiac death or treatment for sudden death. In exemplary embodiments, the subject has a medical record including a recent (e.g., but not limited to, within the last 30- 60 days) or frequest occurrences of syncope or dizziness. In exemplary embodiments, the subject has a medical history of a family member dying due to sudden cardiac death and/or any family member being diagnosed with Brugada Syndrome. In additional or alternative aspects, the subject is one who has been screened for genetic mutations associated with Brugada Syndrome. In exemplary aspects, the subject does not have a genetic mutation in the open reading frame of the SCN5A gene. In exemplary aspects, the subject does not have a genetic mutation in the CACNAlc gene or in the GPD1-L gene. In exemplary aspects, the subject does not have any of the genetic mutations listed in Table 1 or 2.
[0081] In exemplary embodiments, the subject does not have a structural defect of the heart or a structural heart disease. By "structural heart disease" is meant any disease that affects the heart muscle or changes the architecture of the heart, and is synonymous with "structural defect of the heart." In some aspects, the structural defect of the heart is ischemic heart disease, chronic stable angina, or chronic angina. In some aspects, the structural defect of the heart is hypertrophic cardiomyopathy, ischemia, ischemia-reperfusion or coronary artery occlusion-reperfusion, ischemic heart disease, myocardial injury, myocardial toxicity, myocardial infarction, congenital heart lesion, valvular stenosis or valvular regurgitation, coronary artery disease, chronic angina, chronic stable angina, arrhythmias. In some aspects, the structural defect of the heart is a myocardial trauma or a myocardial toxicity.
[0082] In exemplary embodiments, the subject is not exhibiting any signs or symptoms of heart failure and/or is not experiencing heart failure. In exemplary embodiments, the subject is not exhibiting any of dyspnea, fatigue, exercise intolerance, jugular venous distension, pulmonary rales, peripheral edema, pulmonary vascular redistribution, interstitial edema, and pleural effusions.
[0083] Controls
[0084] In the methods described herein, the level that is determined (e.g., the level of full- length mRNA encoded by the SCN5A gene, the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), the level of mRNA encoded by a SCN5A splicing factor gene, and/or the level of mRNA encoded by a gene of the UPR) may be the same as a control level or a cut off level or a threshold level, or may be increased or decreased relative to a control level or a cut off level or a threshold level. In some aspects, the control subject is a matched control of the same species, gender, ethnicity, age group, smoking status, BMI, current therapeutic regimen status, medical history, or a combination thereof, but differs from the subject being diagnosed in that the control does not suffer from Brugada Syndrome and/or is not at risk for Brugada Syndrome and/or is not or has not been clinically diagnosed for Brugada Syndrome and/or does not have a medical history including a family member who has been diagnosed with Brugada Syndrome. In exemplary aspects, the control subject does not have a medical history including syncope and/or dizziness. In exemplary aspects, the control subject has not been treated for sudden cardiac death or does not have a family history of sudden cardiac death. In exemplary aspects, the control, does not have a structural defect of the heart, is not suffering from or has not had heart failure or arrhythmias. In exemplary embodiments, the control subject is not exhibiting any signs or symptoms of heart failure and/or is not experiencing heart failure. In exemplary aspects, the control subject does not have an ICD.
[0085] Housekeeping Genes
[0086] In the methods described herein, the level that is determined (e.g., the level of full- length mRNA encoded by the SCN5A gene, the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), the level of mRNA encoded by a SCN5A splicing factor gene, and/or the level of mRNA encoded by a gene of the UPR) may benormalized or calibrated to a level of a housekeeping gene. The housekeeping gene in some aspects is β-actin or GAPDH. In exemplary aspects, the housekeeping gene is any one of those set forth in the sequence listing as SEQ ID NOs: 60-635 or any one of those set forth in Table 3 below.
TABLE 3
Accession Name SEQ No. ID NO
NM 001 101 Actin, beta (ACTB) 60
NM 000034 aldolase A, fructose-bisphosphate (ALDOA) 61
NM 002046 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 62
NM 000291 Phosphoglycerate kinase 1 (PGK1 ) 63
NM 005566 Lactate dehydrogenase A (LDHA), 64
NM 002954 Ribosomal protein S27a (RPS27A) 65
NM 000981 Ribosomal protein L19 (RPL19) 66
NM 000975 Ribosomal protein L1 1 (RPL1 1 ) 67
NM 007363 Non-POU domain containing, octamer-binding (NONO) 68
NM 004309 Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA) 69
NM 000994 Ribosomal protein L32 (RPL32) 70
NM 022551 Ribosomal protein S18 (RPS18), 71
NM 007355 heat shock protein 90kDa alpha (cytosolic), class B member 1 (HSP90AB1 ) 72
NM 004515 Interleukin enhancer binding factor 2, 45kDa (ILF2) 73
NM 004651 Ubiquitin specific peptidase 1 1 (USP1 1 ) 74
NM 004888 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 (ATP6V1 G1 ) 75
NM 003334 Ubiquitin-like modifier activating enzyme 1 (UBA1 ) 76
NM 001320 Casein kinase 2, beta polypeptide (CSNK2B) 77
NM 003915 Copine I (CPNE1 ) 78
NM 001250 CD40 molecule, TNF receptor superfamily member 5 (CD40) 79
NM 001904 Catenin (cadherin-associated protein), beta 1 , 88kDa (CTNNB1 ) 80
NM 003753 Eukaryotic translation initiation factor 3, subunit D (EI F3D) 81
NM 004541 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 , 7.5kDa (NDUFA1 ) 82
NM 001654 V-raf murine sarcoma 361 1 viral oncogene homolog (ARAF) 83
NM 002967 Scaffold attachment factor B (SAFB) 84
NM 001 183 H+ transporting, lysosomal accessory protein 1 (ATP6AP1 ) 85
NM 003526 Histone cluster 1 , H2bc (HIST1 H2BC) 86
NM 004718 Cytochrome c oxidase subunit Vila polypeptide 2 like (COX7A2L) 87
NM 004436 Endosulfine alpha (ENSA) 88
Figure imgf000049_0001
Accession Name SEQ No. ID NO
NM 001687 ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit (ATP5D) 148
NM 004197 Serine/threonine kinase 19 (STK19) 149
NM 001028 Ribosomal protein S25 (RPS25) 150
NM 001022 Ribosomal protein S19 (RPS19) 151
NM 004759 Mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2) 152
NM 001623 Allograft inflammatory factor 1 (AIF1 ) 153
NM 004894 Chromosome 14 open reading frame 2 (C14orf2) 154
NM 002375 Microtubule-associated protein 4 (MAP4) 155
NM 001013 Ribosomal protein S9 (RPS9) 156
NM 003779 UDP-Gal:betaGlcNAc beta 1 ,4- galactosyltransferase, polypeptide 3 (B4GALT3) 157
NM 001296 Chemokine binding protein 2 (CCBP2) 158
NM 001009 Ribosomal protein S5 (RPS5) 159
NM 003021 Small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha (SGTA) 160
NM 004285 Hexose-6-phosphate dehydrogenase (glucose 1 -dehydrogenase) (H6PD), 161
NM 004142 Matrix metallopeptidase-like 1 (MMPL1 ) 162
NM 001950 E2F transcription factor 4, p107/p130-binding (E2F4) 163
NM 003815 ADAM metallopeptidase domain 15 (ADAM15) 164
NM 001 1 19 Adducin 1 (alpha) (ADD1 ) 165
NM 001 1 1 1 Adenosine deaminase, RNA-specific (ADAR) 166
NM 003466 Paired box 8 (PAX8) 167
NM 001 155 Annexin A6 (ANXA6) 168
NM 003465 Chitinase 1 (chitotriosidase) (CHIT1 ) 169
NM 003186 Transgelin (TAGLN) 170
NM 000802 Folate receptor 1 (adult) (FOLR1 ), 171
NM 004924 Actinin, alpha 4 (ACTN4) 172
NM 002931 Ring finger protein 1 (RING1 ) 173
NM 000020 Activin A receptor type ll-like 1 (ACVRL1 ), 174
NM 001785 Cytidine deaminase (CDA) 175
NM 004339 Pituitary tumor-transforming 1 interacting protein (PTTG1 IP) 176
NM 003860 Barrier to autointegration factor 1 (BANF1 ) 177
NM 000214 Jagged 1 (JAG1 ) 178
NM 002167 Inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (I D3) 179
NM 001664 Ras homolog gene family, member A (RHOA) 180
NM 003166 Sulfotransferase family, cytosolic, 1 A, phenol-preferring, member 3 (SULT1 A3) 181
NM 001746 Calnexin (CANX) 182
NM 001662 ADP-ribosylation factor 5 (ARF5) 183
NM 001660 ADP-ribosylation factor 4 (ARF4) 184
NM 001658 ADP-ribosylation factor 1 (ARF1 ) 185
NM 003313 Tissue specific transplantation antigen P35B (TSTA3) 186
NM 001494 GDP dissociation inhibitor 2 (GDI2) 187
NM 003145 Signal sequence receptor, beta (translocon-associated protein beta) (SSR2) 188
NM 001619 Adrenergic, beta, receptor kinase 1 (ADRBK1 ) 189
NM 001420 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (ELAVL3) 190
NM 004930 Capping protein (actin filament) muscle Z-line, beta (CAPZB) 191
NM 004596 Small nuclear ribonucleoprotein polypeptide A (SNRPA) 192
NM 004168 Succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (SDHA) 193
NM 004156 Protein phosphatase 2 (formerly 2A) 194
NM 004910 Phosphatidylinositol transfer protein, membrane-associated 1 (PITPNM1 ) 195
NM 004517 Integrin-linked kinase (ILK) 196
NM 004494 Hepatoma-derived growth factor (HDGF) 197
NM 004121 Gamma-glutamyltransferase 5 (GGT5) 198
NM 004404 Septin 2 (SEPT2) 199
NM 004394 Death-associated protein (DAP) 200
NM 004383 c-src tyrosine kinase (CSK) 201
NM 004074 Cytochrome c oxidase subunit VINA (ubiquitous) (COX8A) 202
NM 004039 Annexin A2 (ANXA2) 203
NM 001053 Somatostatin receptor 5 (SSTR5) 204
NM 001328 C-terminal binding protein 1 (CTBP1 ) 205
NM 001273 Chromodomain helicase DNA binding protein 4 (CHD4) 206
NM 003430 Zinc finger protein 91 (ZNF91 ) 207
NM 003314 Tetratricopeptide repeat domain 1 (TTC1 ) 208
NM 003217 Transmembrane BAX inhibitor motif containing 6 (TMBIM6) 209
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
Accession Name SEQ No. ID NO
NM 015646 RAP1 B, member of RAS oncogene family (RAP1 B) 385
NM 016532 Inositol polyphosphate-5-phosphatase K (INPP5K) 386
NM 015292 extended synaptotagmin-like protein 1 (ESYT1 ) 387
NM 005870 Sin3A-associated protein, 18kDa (SAP18) 388
NM 006833 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) 389
NM 005718 Actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4) 390
NM 005719 Actin related protein 2/3 complex, subunit 3, 21 kDa (ARPC3) 391
NM 006372 Synaptotagmin binding, cytoplasmic RNA interacting protein (SYNCRI P) 392
NM 005180 BMI1 polycomb ring finger oncogene (BMI 1 ) 393
NM 018975 Telomeric repeat binding factor 2, interacting protein (TERF2IP) 394
NM 005731 Actin related protein 2/3 complex, subunit 2, 34kDa (ARPC2) 395
NM 020151 StAR-related lipid transfer (START) domain containing 7 (STARD7) 396
NM 005103 Fasciculation and elongation protein zeta 1 (zygin I) (FEZ1 ) 397
NM 012179 F-box protein 7 (FBX07) 398
NM 020360 phospholipid scramblase 3 (PLSCR3) 399
NM 014891 PDGFA associated protein 1 (PDAP1 ) 400
NM 005745 B-cell receptor-associated protein 31 (BCAP31 ) 401
NM 005418 suppression of tumorigenicity 5 (ST5) 402
NM 006262 Peripherin (PRPH) 403
NM 133476 Zinc finger protein 384 (ZNF384) 404
NM 006570 Ras-related GTP binding A (RRAGA) 405
NM 006333 C1 D nuclear receptor corepressor (C1 D) 406
NM 007285 GABA(A) receptor-associated protein-like 2 (GABARAPL2) 407
NM 006354 Transcriptional adaptor 3 (TADA3) 408
NM 014302 Sec61 gamma subunit (SEC61 G) 409
NM 0061 18 HCLS1 associated protein X-1 (HAX1 ) 410
NM 012100 Aspartyl aminopeptidase (DNPEP) 41 1
NM 015680 Cyclin Pas1 /PHO80 domain containing 1 (CNPPD1 ) 412
NM 030796 Vesicular, overexpressed in cancer, prosurvival protein 1 (VOPP1 ) 413
NM 024069 KxDL motif containing 1 (KXD1 ) 414
NM 013234 Eukaryotic translation initiation factor 3, subunit K (EI F3K) 415
NM 013310 Chromosome 2 open reading frame 27A (C2orf27A) 416
NM 018507 Hypothetical protein PR01843 (PR01843) 417
NM 017670 OTU domain, ubiquitin aldehyde binding 1 (OTUB1 ) 418
NM 016292 TNF receptor-associated protein 1 (TRAP1 ) 419
NM 014916 Lemur tyrosine kinase 2 (LMTK2) 420
NM 014696 G protein regulated inducer of neurite outgrowth 2 (GPRIN2) 421
NM 014630 Zinc finger protein 592 (ZNF592) 422
NM 014761 Increased sodium tolerance 1 homolog (yeast) (IST1 ) 423
NM 007286 Synaptopodin (SYNPO) 424
NM 007263 Coatomer protein complex, subunit epsilon (COPE) 425
NM 006349 Zinc finger, HIT-type containing 1 (ZNHIT1 ) 426
NM 006004 Ubiquinol-cytochrome c reductase hinge protein (UQCRH) 427
NM_005787 Asparagine-linked glycosylation 3, alpha-1 ,3- mannosyltransferase homolog (S. 428 cerevisiae) (ALG3)
NM 012412 H2A histone family, member V (H2AFV) 429
NM 012401 Plexin B2 (PLXNB2) 430
NM 007262 Parkinson protein 7 (PARK7) 431
NM 007273 Prohibitin 2 (PHB2) 432
NM 021009 Ubiquitin C (UBC) 433
NM 023009 MARCKS-like 1 (MARCKSL1 ) 434
NM 015456 Cofactor of BRCA1 (COBRA1 ) 435
NM 005053 RAD23 homolog A (S. cerevisiae) (RAD23A) 436
NM 006830 Ubiquinol-cytochrome c reductase, complex I II subunit XI (UQCR1 1 ), 437
NM 005682 G protein-coupled receptor 56 (GPR56) 438
NM 012102 Arginine-glutamic acid dipeptide (RE) repeats (RERE) 439
NM 005550 Kinesin family member C3 (KIFC3) 440
NM 021960 Myeloid cell leukemia sequence 1 (BCL2-related) (MCL1 ) 441
NM 021959 Protein phosphatase 1 , regulatory (inhibitor) subunit 1 1 (PPP1 R1 1 ) 442
NM 014730 Malectin (MLEC) 443
NM 014402 Ubiquinol-cytochrome c reductase, complex I II subunit VI I, 9.5kDa (UQCRQ) 444
NM 007067 K(lysine) acetyltransferase 7 (KAT7) 445
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
[0087] Treatment ofBrugada Syndrome
[0088] Further provided herein is a method of treating a subject for Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0089] The invention additionally provides a method of treating a subject for Brugada Syndrome wherein the subject is one who has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). The method comprises the step of providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[0090] With regards to the methods of treatment, the therapy may be any therapy for Brugada Syndrome. In some aspects, the therapy is an implanted cardiac defibrillator (ICD). As used herein, the term "Implanted Cardiac Defibrillator" or "ICD" is synonymous with "implantable cardiac defibrillator" or "implanted cardiac device" or "implantable cardiac device" or "implantable cardioverter-defibrillator device" and refers to a small battery- powered electrical impulse generator that is programmed to deliver a jolt of electricity, when a cardiac arrhythmia is detected.
[0091] The therapy may be an agent which increases sodium current (e.g., sodium channel current). The therapy may be a mitochondrially-targeted antioxidant (e.g., but not limited to MitoQ) , a mitochondria electron transport re-coupling agent, a Protein Kinase A Activator (e.g., but not limited to NAD+), a Protein Kinase C Inhibitor, a c-Src Inhibitor (e.g., but not limited to, 4-amino-5-(4-methylphenyl)-7-(t-butyl)pyrazolo-d-3,4-pyrimidine (PP1)), an anion transporter inhibitor, e.g., but not limited to 4,4'-Di-isothiocyanatostilbene-2,2'- disulfonic acid (DIDS), an inner-membrane anion channels (IMAC) modulator (e.g., but not limited to, N-butan-2-yl- l-(2-chlorophenyl)-N-methylisoquinoline-3-carboxamide
(PK11195)), an NADPH oxidase inhibitor (e.g., but not limited to apocynin, a.k.a., acetovanillone), a Protein Kinase G Activator (e.g., but not limited to 8-Bromoguanosine 3',5'-cyclic monophosphate (8-Br-cGMP)). Mitochondrially-targeted antioxidants are discussed in Smith and Murphy, Discovery Medicine 11(57): 106-114 (2011) and
International Patent Application Publication No. WO/1999/056954. In exemplary aspects, the therapy for Brugada Syndrome is nicotinamide adenine dinucleotide (NAD+), PP1, pelargonidin, forskolin, chelerythrine, deltaVl-1, superoxide dismutase (SOD), mitoTEMPO, malonate, DIDS, PK11195, 4-CD, apocynin applied intracellularly (not extracellularly), adenylyl imidodiphosphate (AMPPNP), KT5823 (CAS Number 126643-37-6), or 8-Br- cGMP. Additional agents that increase sodium current include, but are not limited to, nerve growth factor (NGF), nitric oxide, isoprenaline, apelin, aldosterone, and brevetoxin 3.
Alternatively, the therapy is selected from tedisamil, isoproterenol, orciprenaline, or cilostazol.
[0092] c-Src Inhibitors
[0093] In exemplary embodiments of any of the methods of the invention, the c-Src inhibitor is a compound which inhibits c-Src from binding to another protein. In exemplary aspects, the c-Src inhibitor is a compound which inhibits a protein binding to c-Src via the SH2 domain of c-Src, the SH3 domain of c-Src, or the substrate binding domain of c-Src.
[0094] In exemplary embodiments of any of the methods of the invention, the c-Src inhibitor is a compound which inhibits c-Src tyrosine kinase activity. In exemplary aspects, the c-Src inhibitor exhibits an IC50 which is about 100 μΜ or less, e.g., about 50 μΜ or less , about 25 μΜ or less, about 20 μΜ or less, about 15 μΜ or less, about 10 μΜ or less, about 5 μΜ or less, about 2 μΜ or less, about 1 μΜ or less. In exemplary aspects, the c-Src inhibitor exhibits an IC50 which is about 100 nM or less, e.g., about 50 nM or less , about 25 nM or less, about 20 nM or less, about 15 nM or less, about 10 nM or less, about 5 nM or less, about 2 nM or less, about 1 nM or less.
[0095] In exemplary aspects, the c-Src inhibitor is a heterocyclic adenosine triphospate (ATP) analog. In exemplary aspects, the c-Src inhibitor is selected from the group consisting of: (i) a pyrazolo-[2,3-d]pyrimidine, (ii) pyrrolo-[2,3-d] pyrimidine, (iii), pyrido-[2,3- d]pyrimidine, (iv) quinoline carbonitrile, or (v) olomucine. In exemplary aspects, the c-Src inhibitor comprises a structure of Formula I:
Figure imgf000060_0001
[Formula I] wherein (i) A is a nitrogen atom and B is a carbon atom; (ii) A is a carbon atom and B is a nitrogen atom; or (iii) each of A and B is a carbon atom, wherein, when B is a carbon atom, B is attached to H, a C1-C4 alkyl, aryl, or a substituted aryl, and R3 is H; wherein, when B is a nitrogen atom, R3 is -NHR4, wherein R4 is a C1-C6 alcohol; wherein Ri is a -NH2 or -NHR5; wherein R5 is aryl or substituted aryl; and wherein R2 is an H, alkyl, aryl, or a substituted aryl.
[0096] In exemplary aspects, each of A and B is a carbon atom, B is attached to a substituted aryl, Ri is a -NH2, R2 is a substituted aryl, and R3 is H. In exemplary aspects, B is attached to a substituted aryl of Structure A or B:
Figure imgf000060_0002
[Structure A] or
Figure imgf000061_0001
n [Structure B] wherein "Halogen" is selected from a group consisting of CI, F, I, and Br. In exemplary aspects, the halogen is F. In exemplary aspects, R2 is a substituted aryl of Structure C or D:
Figure imgf000061_0002
[Structure C]
Figure imgf000061_0003
[Structure D]. [0097] In exemplary aspects, A is a nitrogen atom, B is a carbon atom attached to an aryl, Ri is -NH2, R2 is C(CH2)3, and R3 is H.
[0098] In exemplary aspects, A is a carbon atom, B is a nitrogen atom, Rl is NHR5; wherein R5 is a substituted aryl, R2 is -CH2CH3, and R3 is -NHR4, wherein R4 is a C1-C6 alcohol. In exemplary aspects, R5 is a substituted aryl of Structure D or E:
Figure imgf000062_0001
gen)3 [Structure E] wherein "Halogen" is selected from a group consisting of CI, F, I, and Br. In exemplary aspects, the halogen is F. In exemplary aspects, R4 is an alcohol of Structure F or G:
Figure imgf000062_0002
[Structure F]
Figure imgf000062_0003
[Structure G].
[0099] In exemplary aspects, the c-Src inhibitor comprises a structure of Formula II:
Figure imgf000063_0001
[Formula II] wherein each of X and Y is independently a carbon atom or a nitrogen atom, wherein: when X is a nitrogen atom, R6 is absent, when X is a carbon atom, R6 is H, a C1-C4 alkyl, or -0(C1-C4alkyl); when Y is a nitrogen atom, R4 is absent, when Y is a carbon atom, R4 is H, C1-C4 alkyl, or -0(C1-C4alkyl); wherein represents a single or double bond, wherein: when Rl is H, represents a double bond, when Rl is a double bonded oxygen atom, represents a single bond; and wherein:
R2 is -CN or a substituted aryl,
R3 is H or -(CH2)0_4 aryl, or -(NH)aryl, optionally, wherein "aryl" is a substituted aryl,
R5 is -NHR8 or a substituted alkoxyl,
R7 is absent, H or a C1-C4 alkyl, and
R8 is a substituted aryl.
[00100] In exemplary aspects, each of X and Y is a nitrogen atom. In exemplary aspects, Rl is a double bonded oxygen atom, R2 is a substituted aryl, R3 is H, each of R4 and R6 is absent, R5 is NHR8, and R7 is a C1-C4 alkyl. In exemplary aspects, R2 is a substituted aryl of Structure H:
Figure imgf000064_0001
a ogen [Structure H], wherein each "Halogen" is as defined herein. In exemplary aspects, each "Halogen" is a chlorine atom. In exemplary aspects, R8 is a substituted aryl of Structure I:
Figure imgf000064_0002
[Structure I] .
[00101] In exemplary aspects, each of X and Y is a carbon atom. In exemplary aspects, Rl is H, R2 is -CN, R3 is -(CH2)aryl or -(NH)aryl, wherein "aryl" is a substituted aryl, R4 is -0(C1-C4alkyl), R5 is a substituted alkoxyl, R6 is H, and R7 is absent. In exemplary aspects, R3 comprises Structure J:
Figure imgf000064_0003
[Structure J], wherein each "Halogen" is as defined herein and X is -(CH2)0_4 or -NH. In exemplary aspects, each "Halogen" is a chlorine atom. In exemplary aspects, R4 is -OCH3. In exemplary aspects, R5 is a substituted alkoxyl comprising the structure of Structure K:
Figure imgf000065_0001
[Structure K].
[00102] In exemplary embodiments, the c-Src inhibitor comprises a structure of Formula III:
Figure imgf000065_0002
[Formula III] wherein A is an aryl or a substituted aryl, B is a substituted aryl in which at least one of the substitutions comprises (i) a moiety comprising a structure of Structure L:
Figure imgf000065_0003
[Structure L] wherein R' is an alkyl or alkoxy, e.g., a C1-C4 alkyl or C1-C4 alkoxy, or (ii) a moiety comprising a structure of Structure M:
Figure imgf000066_0001
[Structure M] wherein R" is an alkyl or alkoxy, e.g., a C1-C4 alkyl or C1-C4 alkoxy.
[00103] In exemplary embodiments, A of Formula III is a substituted aryl comprising the structure of Structure N:
Figure imgf000066_0002
[Structure N] wherein R' is a C1-C4 alkyl and "halogen" is as described herein. In exemplary embodiments, the halogen is a chlorine atom.
[00104] In alternative embodiments, A of Formula III is a substituted aryl comprising Structure O
Figure imgf000066_0003
[Structure O] wherein G is -(CH2)0-4CH3.
[00105] In exemplary aspects, B of Formula III is a substituted aryl comprising the structure of Structure P:
Figure imgf000067_0001
[Structure P] wherein X is -(CH2)0-4OH and Y is -(CH2)0-4CH3.
[00106] In exemplary aspects, B of Formula III is a substituted aryl comprising the structure of Structure Q:
Figure imgf000067_0002
[Structure Q] wherein X is -(CH2)0_4CH3
[00107] In exemplary aspects, B of Formula III is a substituted aryl comprising the structure of Structure R:
Figure imgf000067_0003
[Structure R] wherein "Hal" is a halogen as described herein and X is X is -(CH2)0-4CH3. In exemplary aspects, each "Hal" of Structure R is a fluorine atom. [00108] In exemplary embodiments, the c-Src inhibitor comprising a structure of Formula III is selected from the group consisting of imatinib, dasatinib, and nilotinib.
[00109] In exemplary aspects, the c-Src inhibitor comprises a structure of Formula IV:
Figure imgf000068_0001
[Formula IV] wherein X is (CH2)o-4CH3 and "Halogen" is as described herein, e.g., a chlorine atom. In exemplary aspects, the c-Src inhibitor comprising a structure of Formula IV is saracatinib.
[00110] In exemplary aspects, the c-Src inhibitor is selected from the group consisting of: PP1, PP2, CGP76030, CGP77675, PD166285, PD173955, PD180970, SKI606, NVP- AAK980, CDP79883, AZD0530, S135, S140, AZM475271, AP23464, AP23451, AP22408, AP23236, dasatinib, bosutinib, and saracatinib.
[00111] In exemplary aspects, the c-Src inhibitor is not a compound selected from the group consisting of: PP2, herbimycin A, Src siRNA, 4-amino-5-(4-chlorophenyl)-7(-(t-butyl) pyraxolo[3,4-D]pyrimidine.
[00112] The term "treat" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment. Rather, there are varying degrees of treatment of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment in a subject. Furthermore, the treatment can include treatment or prevention of one or more conditions or symptoms of the disease being treated. Also, for purposes herein, "treatment" can encompass prophylactic treatment, wherein the onset of the disease, or a symptom or condition thereof, is delayed. [00113] Syncope and Sudden Cardiac Death and Methods Relating Thereto
[00114] Sudden cardiac death (SCD) accounts for approximately 325,000 deaths per year in the United States, which number is higher than the number of deaths attributed to lung cancer, breast cancer, or acquired immune deficiency syndrome (AIDS). SCD is responsible for about 50% of deaths from heart failure and often is the first expression of coronary disease. See, Sovari et al., "Sudden Cardiac Death," e-medicine Cardiology, article 151907, updated November 4, 2010; and Zheng et al., Circulation 104: 2158-2163 (2001). A common cause of SCD is ventricular arrhythmia, including, for example, ventricular tachycardia (VT), in which the resting heart rate is faster than normal, ventricular fibrillation (VF), in which there is uncoordinated contraction of the cardiac muscle of the ventricles in the heart, making the muscles quiver rather than contract properly, or an arrhythmic condition in which both VT and VF are present. See, Wedro, B., "Sudden Cardiac Arrest (Sudden Cardiac Death)," medicine.net, Kulick and Soppier, eds. Current methods of treating ventricular fibrillation include defibrillation via an electrical defibrillator or a precordial thump.
[00115] As used herein the term "syncope" refers to the transiet loss of consciousness and postural tone, characterized by rapid onset, short duration, and spontaneous recovery due to global cerebral hypoperfusion (low blood flow to the brain) that most often results from hypotension (low blood pressure. Syncope is distinct from epileptic seizures, concussion, cerbrovascular accident, and coma. In exemplary aspects, the syncope is preceded by a prodomal state that may include one or more of dizziness, loss of vision, loss of hearing, loss of pain and feeling, nausea, abdominal discomfort, weakness, sweating, a feeling of heat, palpitations. There are three types of syncope: cardiogenic, reflex, and orthostatic hypotension. In exemplary aspects, the syncope referenced herein means cardiogenic syncope. In exemplary aspects, the syncope is neither vasovagal syncope nor deglutition syncope.
[00116] Undiagnosed and/or untreated Brugada Syndrome may lead to sudden cardiac death and/or syncope. The invention also provides methods of reducing a subject's risk for syncope or sudden cardiac death. In exemplary embodiments, the method comprises the steps of (i) analyzing a biological sample obtained from the subject for (a) a level of full- length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[00117] The invention additionally provides methods of reducing a subject's risk for syncope or sudden cardiac death, and the subject is one who has been analyzed for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR). The method comprises the step of providing a therapy for Brugada Syndrome to the subject when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
[00118] The invention provides methods of monitoring a subject's risk for syncope and/or sudden cardiac death. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject at a timepoint occurring before the time at which the second biological sample is obtained from the subject, and (iii) determining an increased risk for syncope and/or sudden cardiac death in the subject, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining a decreased risk for syncope and/or sudden cardiac death in the subject, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[00119] Screening Methods for new Brugada Syndrome Therapy
[00120] Further provided are methods of determining the efficacy of a test compound or test therapy for treating Brugada Syndrome. In exemplary embodiments, the method comprises the steps of (i) analyzing a first biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR); (ii) analyzing a second biological sample obtained from the subject for (a) a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, (b) a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), (c) a level of mRNA encoded by a SCN5A splicing factor gene, and/or (d) a level of mRNA encoded by a gene of the unfolded protein response (UPR), wherein the first biological sample is obtained from the subject before administration of the test compound or test therapy and the second biological sample is obtained from the subject after administration of the test compound or test therapy, and (iii) determining the test compound or test therapy as ineffective for treating Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is reduced, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is increased, relative to the level of (c) of the first biological sample; or determining the test compound or test therapy as effective for treating Brugada Syndrome, when the level of (a), (b), and/or (d) of the second biological sample is increased, relative to the level of (a), (b), and/or (d) of the first biological sample, and/or when the level of (c) of the second biological sample is reduced, relative to the level of (c) of the first biological sample.
[00121] Routes of Administration
[00122] With regard to the methods comprising providing therapy for Brugada Syndrome, the therapy may be administered through any suitable means. The following discussion on routes of administration is merely provided to illustrate exemplary embodiments and should not be construed as limiting the scope in any way. [00123] Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the therapy dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions. Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant. Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients. Lozenge forms can comprise the therapy in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the therapy in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
[00124] The therapy, alone or in combination with other suitable components, can be delivered via pulmonary administration and can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer. Such spray formulations also may be used to spray mucosa. In some embodiments, the therapy is formulated into a powder blend or into microparticles or nanoparticles. Suitable pulmonary formulations are known in the art. See, e.g., Qian et al., Int J Pharm 366: 218-220 (2009); Adjei and Garren, Pharmaceutical Research, 7(6): 565-569 (1990); Kawashima et al., J Controlled Release 62(1-2): 279-287 (1999); Liu et al., Pharm Res 10(2): 228-232 (1993); International Patent Application Publication Nos. WO
2007/133747 and WO 2007/141411.
[00125] Formulations suitable for parenteral administration include aqueous and nonaqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The term, "parenteral" means not through the alimentary canal but by some other route such as subcutaneous, intramuscular, intraspinal, or intravenous. The therapy can be administered with a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulf oxide, glycerol, ketals such as 2,2- dimethyl- 1,3-dioxolane- 4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
[00126] Oils, which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
[00127] Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-P-aminopropionates, and 2-alkyl -imidazoline quaternary ammonium salts, and (e) mixtures thereof.
[00128] The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the therapy in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
[00129] Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J. B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)).
[00130] Additionally, the therapy can be made into suppositories for rectal administration by mixing with a variety of bases, such as emulsifying bases or water-soluble bases.
Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
[00131] It will be appreciated by one of skill in the art that, in addition to the above- described pharmaceutical compositions, the therapy can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
[00132] Kits
[00133] The invention provides related kits for diagnosing Brugada Syndrome. In exemplary embodiments, the kit comprises a binding agent which binds to a gene product encoded by the PERK gene, a binding agent which binds to a full-length gene product encoded by the SCN5A gene, a binding agent which binds to a gene product encoded by the Luc7A gene, a binding agent which binds to a gene product encoded by the RBM25 gene, a binding agent which binds to a gene product encoded by the PRP40 gene, a binding agent which binds to an SCN5A E28C splice variant mRNA transcript, or a protein product encoded thereby, and/or a binding agent which binds to an SCN5A E28D splice variant mRNA transcript, or a protein product encoded thereby. In exemplary aspects, the gene product is an mRNA and the binding agent is a nucleic acid probe. In exemplary aspects, the gene product is protein and the binding agent is an antibody or an antigen-binding fragment thereof. [00134] In exemplary aspects, the only binding agents in the kit are binding agents which bind to full-length gene products encoded by the SCN5A gene and binding agents which bind to truncated gene products encoded by the SCN5A gene and the use of the kit achieves a measurement of all SCN5A gene products in a biological sample. In exemplary aspects, the binding agents are nucleic acid probes. In exemplary aspects, the bindings agents are antibodies or antigen binding fragments thereof. In exemplary aspects, the kit comprises both nucleic acid probes and antibodies, or antigen binding fragements thereof, which bind to SCN5A mRNA (truncated or full-length) or SCN5A protein products encoded thereby. In exemplary aspects, the biological sample is a blood sample and the kit comprises a container suitable for holding a blood sample. In exemplary aspects, the kit comprises a vial, a tube, a microtiter plate, a dish, a flask, or the like. In exemplary aspects, the container holds about 5 mL of fluid, or less. In exemplary aspects, the kit comprises heparin to prevent the blood from clotting. In exemplary aspects, the kit comprises a skin pricking device, e.g., a finger- prick device. In exemplary aspects, the kit comprises a filter or a paper onto which blood is absorped. In exemplary aspects, the kit comprises reagents suitable for isolating white blood cells from the blood sample. In exemplary aspects, the kit comprises reagents suitable for isolating RNA or proteins from white blood cells. In exemplary aspects, the kit comprises reagents suitable for reverse transcribing the RNA into complimentary DNA (cDNA) and for amplification of the cDNA.
[00135] In some aspects, the kits further comprise instructions for use, e.g., instructions for diagnosing Brugada Syndrome. In some aspects, the instructions are provided as a paper copy of instructions, an electronic copy of instructions, e.g., a compact disc, a flash drive, or other electronic medium. In some aspects, the instructions are provided by way of providing directions to an internet site at which the instructions may be accessed by the user.
[00136] In exemplary aspects, the kits further comprise information relating to a control level, wherein the control level is the comparator against which the level of the subject is compared. In exemplary aspects, the kits further comprise directions to or the address of an internet site at which the user may access the information relating to the control level. In exemplary aspects, the kits further comprise directions to or the address of an internet site at which the user is prompted to enter the level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), level of mRNA encoded by a SCN5A splicing factor gene, and/or level of mRNA encoded by a gene of the UPR. Input of this information results in a comparison of the level to a control level and the display of an output relating to the presence or absence of Brugada Syndrome. In exemplary aspects, the input of the level of full-length messenger RNA (mRNA) encoded by the SCN5A gene and/or the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), must be at least or about 1.5-fold reduced relative to the control level, in order to have an output of the presence of Brugada Syndrome displayed. In exemplary aspects, the input of the level of full length mRNA encoded by the SCN5A gene and the level of SCN5A splice variants must be at least or about 1.5-fold reduced relative to the control level, in order to have an output of the presence of Brugada Syndrome displayed.
[00137] Systems, Computer-Readable Storage Media, and Methods Implemented by a Computer Processor
[00138] Fig. 34 illustrates an exemplary embodiment 101 of a system 100 for detecting the presence of Brugada Syndrome for a subject. Generally, the system 100 may include one or more client devices 102, a network 104, and a database 108. Each client device 102 may be communicatively coupled to the network 104 by one or more wired or wireless network connections 112, which may be, for example, a connection complying with a standard such as one of the IEEE 802.11 standards ("Wi-Fi"), the Ethernet standard, or any other appropriate network connection. Similarly, the database 108 may be communicatively coupled to the network 104 via one or more connections 114. (Of course, the database could alternatively be internal to one or more of the client devices 102.) The database 108 may store data related to the determination of the presense of Brugada Syndrome in a subject including, but not limited to, data of a biological sample obtained from the subject, data of a biological sample obtained from a control or test population, etc. The data of the biological samples may be, for example, related to one or more of a level of a full-length mRNA encoded by the SCN5A gene, a level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein), a level of a truncated SCN5A Exon 28 transcript, a level of a full length SCN5A Exon 28 transcript, a level of multiple SCN5A Exon 28 transcripts, a level of mRNA encoded by a SCN5A splicing factor gene (e.g., but not limited to, RBM25, PRP40, Luc7A), a level of mRNA encoded by a gene of the UPR (e.g., but not limited to PERK), etc., as described in greater detail below.
[00139] As will be understood, the network 104 may be a local area network (LAN) or a wide-area network (WAN). That is, network 104 may include only local (e.g., intra- organization) connections or, alternatively, the network 104 may include connections extending beyond the organization and onto one or more public networks (e.g., the Internet). In some embodiments, for example, the client device 102 and the database 108 may be within the network operated by a single company (Company A). In other embodiments, for example, the client device(s) 102 may be on a network operated by Company A, while the database 108 may be on a network operated by a second company (Company B), and the networks of Company A and Company B may be coupled by a third network such as, for example, the Internet.
[00140] Referring still to Fig. 34, the client device 102 includes a processor 128 (CPU), a RAM 130, and a non- volatile memory 132. The non-volatile memory 132 may be any appropriate memory device including, by way of example and not limitation, a magnetic disk (e.g., a hard disk drive), a solid state drive (e.g., a flash memory), etc. Additionally, it will be understood that, at least with regard to Fig. 34, the database 108 need not be separate from the client device 102. Instead, in some embodiments, the database 108 is part of the nonvolatile memory 132 and the data 122, 124, 126 may be stored as data within the memory 132. For example, the data 122 may be included as data in a spreadsheet file stored in the memory 132, instead of as data in the database 108. In addition to storing the records of the database 108 (in some embodiments), the memory 132 stores program data and other data necessary to analyze data of one or more sample and/or control populations, determine a mean of the data, determine a threshold against which data of the subject may be compared, and/or determine the presence of Brugada Syndrome for a subject. For example, in an embodiment, the memory 132 stores a first routine 134, a second routine 136, and a third routine 138. The first routine 134 may receive data values related to one or more sample and/or control populations, and determine a mean of the data values received by the routine 134. The second routine 136 may compute one or more statistical parameters of the data collected by the first routine 134, such as determining a mean value, a standard deviation value, etc. Additionally and/or alternatively, the second routine 136 may set a first threshold against which data from one or more subjects may be compared in order to determine the presence of Brugada Syndrome for a subject. The third routine 138 may, for example, receive data for one or more subjects, compare the data of the one or more subjects to the threshold value(s) determined by the second routine 136, and/or determine the presence of Brugada Syndrome for a subject according to the comparison of the subject's data to the threshold value. Regardless, each of the routines is executable by the processor 128 and comprises a series of compiled or compilable machine-readable instructions stored in the memory 132. Additionally, the memory 132 may store generated reports or records of data output by one of the routines 134 or 136. Alternatively, the reports or records may be output to the database 108. One or more display/output devices 140 (e.g., printer, display, etc.) and one or more input devices 142 (e.g., mouse, keyboard, tablet, touch- sensitive interface, etc.) may also be coupled to the client device 102, as is generally known.
[00141] As will be understood, although individual operations of one or more methods are illustrated and described as separate operations, one or more of the individual operations may be performed concurrently, and nothing requires that the operations be performed in the order illustrated. Structures and functionality presented as separate components in example configurations may be implemented as a combined structure or component. Similarly, structures and functionality presented as a single component may be implemented as separate components. These and other variations, modifications, additions, and improvements fall within the scope of the subject matter herein.
[00142] For example, the network 104 may include but is not limited to any combination of a LAN, a MAN, a WAN, a mobile, a wired or wireless network, a private network, or a virtual private network. Moreover, while only two clients 102 are illustrated in Fig. 34 to simplify and clarify the description, it is understood that any number of client computers are supported and can be in communication with one or more servers (not shown).
[00143] Fig. 35 depicts an exemplary embodiment of a Brugada Syndrome detection method 200 that may be utilized for any appropriate gene, such as SCN5A mRNA, PERK mRNA, RBM25 mRNA, Luc7A mRNA, PRP40 mRNA, etc implemented by the system 100. Generally speaking, the detection method 200 includes determining whether a mean value, μ, is a predetermined value (block 205). If the system 100 determines that μ is predetermined, then the system 100 transfers control to a block 220 (discussed below.) If the system 100 determines that μ is not predetermined, then the system 100 receives a plurality of data values relating to a control level of a gene (e.g., SCN5A mRNA) from a biological sample from a test subject (block 210). Using these received data values, the system 100 determines a mean value, μ, (block 215), and receives a specific data value, a, (e.g., ( ) relating to a test level of the gene from the biological sample from the test subject. Moreoever, the method 200 includes determining whether a is less than or equal to (μ-(0.5μ)) (block 225) and displaying the diagnosis of Brugada Syndrome in the case that a is less than or equal to (μ-(0.5μ)) (block 230). If a is not less than or equal to (μ-(0.5μ)), the system 100 may transfer control back to the block 205.
[00144] Additionally, certain embodiments are described herein as including logic or a number of routines. Routines may constitute either software routines (e.g., code embodied on a machine-readable medium or in a transmission signal) or hardware routines. A hardware routine is tangible unit capable of performing certain operations and may be configured or arranged in a certain manner. In example embodiments, one or more computer systems (e.g., a standalone, client or server computer system) or one or more hardware routines of a computer system (e.g., a processor or a group of processors) may be configured by software (e.g., an application or application portion) as a hardware routine that operates to perform certain operations as described herein.
[00145] Similarly, the methods or routines described herein may be at least partially processor-implemented. For example, at least some of the operations of a method may be performed by one or processors or processor-implemented hardware modules. The performance of certain of the operations may be distributed among the one or more processors, not only residing within a single machine, but deployed across a number of machines. In some example embodiments, the processor or processors may be located in a single location (e.g., within a home environment, an office environment or as a server farm), while in other embodiments the processors may be distributed across a number of locations.
[00146] The performance of certain of the operations may be distributed among the one or more processors, not only residing within a single machine, but deployed across a number of machines. In some example embodiments, the one or more processors or processor- implemented modules may be located in a single geographic location (e.g., within a home environment, an office environment, or a server farm). In other example embodiments, the one or more processors or processor-implemented modules may be distributed across a number of geographic locations.
[00147] Some embodiments may be described using the expression "coupled" and
"connected" along with their derivatives. For example, some embodiments may be described using the term "coupled" to indicate that two or more elements are in direct physical or electrical contact. The term "coupled," however, may also mean that two or more elements are not in direct contact with each other, but yet still co-operate or interact with each other. The embodiments are not limited in this context. [00148] As used herein, the terms "comprises," "comprising," "includes," "including," "has," "having" or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Further, unless expressly stated to the contrary, "or" refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
[00149] In addition, use of the "a" or "an" are employed to describe elements and components of the embodiments herein. This is done merely for convenience and to give a general sense of the description. This description should be read to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise.
[00150] The invention provides systems comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device. In exemplary embodiments, the machine readable instructions that, when executed by the processor, cause the processor to (i) receive a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject, (ii) determine a mean value, μ, of the data values of (i), (iii) receive a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject, (iv) display an output diagnosis relating to Brugada Syndrome, when a is less than or equal to a threshold, T, which is (μ-(Χμ)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00151] In exemplary embodiments, the machine readable instructions that, when executed by the processor, cause the processor to (i) receive a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject and (ii) display an output diagnosis relating to Brugada
Syndrome, when a is less than or equal to a threshold, T, which is (μ-(Χμ)), wherein X is a number between 0.35 and 0.75 and μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00152] In exemplary aspects of the systems herein, a is the level of full length mRNA encoded by the SCN5A gene or the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the level of full length SCN5A Exon 28 mRNA or the level of a truncated SCN5A Exon28 mRNA. In exemplary aspects, a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA. In any of these aspects, the truncated SCN5A Exon28 mRNA may be the mRNA of SCN5A Exon 28 Variant C (E28C) or the mRNA of SCN5A Exon 28 Variant D (E28D). In exemplary aspects, the truncated SCN5A Exon28 mRNA may be a sum of the mRNA of E28C and the mRNA of E28D.
[00153] In exemplary aspects, the output diagnosis is (a) an identification of the presence of Brugada Syndrome, (b) a determination of the subject needing therapy for Brugada Syndrome, (c) a determination of progression of Brugada Syndrome, (d) a determination of an increased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as ineffective as a therapy for Brugada Syndrome. In exemplary aspects, the system comprises additional machine readable instructions. For instance, the system may comprise instructions that, when executed by the processor, cause the processor to display a negative output diagnosis relating to Brugada Syndrome, when a is greater than (μ-(Χμ)), wherein the negative output diagnosis is (a) an identification of the absence of Brugada Syndrome, (b) a determination of the subject not needing therapy for Brugada Syndrome, (c) a determination of regression of Brugada Syndrome, (d) a determination of a decreased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as effective as a therapy for Brugada Syndrome.
[00154] In additional or alternative embodiments, the system comprises machine readable instructions that, when executed by the processor, cause the processor to (i) receive a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, (ii) determine a mean value, μρΕΐικ, for the PERK mRNA received in (i), (iii) receive a data value, ( , relating to a test level of the PERK mRNA from a biological sample obtained from a test subject, (iv) display an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to a threshold TPERK, which is (μρΕκκ-(ΧμρΕκκ)Χ wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00155] In exemplary aspects, the system comprises machine readable instructions that, when executed by the processor, cause the processor to(i) receive a data value, ( PERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and (ii) display an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to a threshold TPERK, which is (μρΕκκ-(ΧμρΕκκ) wherein μpERκ is a predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject and wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00156] In additional or alternative embodiments, the system comprises machine readable instructions that, when executed by the processor, cause the processor to (i) receive a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, (ii) determine a mean value, μRBM25, for the RBM25 mRNA received in (i), (iii) receive a data value, ( RBM25, relating to a test level of the RBM25 mRNA from a biological sample obtained from a test subject, (iv) display an output diagnosis relating to Brugada Syndrome, when ( RBM25 is greater than or equal to a threshold TRBM25, which is (μκΒΜ25+(Χ κΒΜ25) wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00157] In exemplary aspects, the system comprises machine readable instructions that, when executed by the processor, cause the processor to(i) receive a data value, ( RBM25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject and (ii) display an output diagnosis relating to Brugada Syndrome, when ( RBM25 is greater than or equal to a threshold TRBM25, which is (μRBM25+(XμRBM25)), wherein μRBM25 is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00158] In additional or alternative embodiments, the system comprises machine readable instructions that, when executed by the processor, cause the processor to (i) receive a plurality of data values relating to a control level of Luc7A mRNA from a biological sample obtained from a control subject, (ii) determine a mean value, μυιοΐΑ, for the Luc7A mRNA received in (i), (iii) receive a data value, ( LUC7A, relating to a test level of the Luc7A mRNA from a biological sample obtained from a test subject, (iv) display an output diagnosis relating to Brugada Syndrome, when ( LUC7A is greater than or equal to a threshold TLUC7A, which is (μιυο7Α+( ιυο7Α)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00159] In exemplary aspects, the system comprises machine readable instructions that, when executed by the processor, cause the processor to (i) receive a data value, ( LUC7A, relating to a test level of Luc7A mRNA from a biological sample obtained from a test subject and (ii) display an output diagnosis relating to Brugada Syndrome, when ( LUC7A is greater than or equal to a threshold TLuc7A, which is ^LUC7A+^LUC7A)), wherein μιυο7Α is a predetermined mean value of a plurality of data values relating to a control level of Luc7A mRNA from a biological sample obtained from a control subject and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00160] In additional or alternative embodiments, the system comprises machine readable instructions that, when executed by the processor, cause the processor to (i) receive a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, (ii) determine a mean value, μρρα>4ο, for the PRP40 mRNA received in (i), (iii) receive a data value, ( PRP4O, relating to a test level of the PRP40 mRNA from a biological sample obtained from a test subject, (iv) display an output diagnosis relating to Brugada Syndrome, when pRp40 is greater than or equal to a threshold TPRP4O, which is (μρκρ4ο+(Χμρκρ40)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00161] In exemplary aspects, the system comprises machine readable instructions that, when executed by the processor, cause the processor to(i) receive a data value, pRp40, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and (ii) display an output diagnosis relating to Brugada Syndrome, when pRp4o is greater than or equal to a threshold TpRp40, which is
Figure imgf000084_0001
wherein μρρα>4ο is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00162] Also provided herein are computer-readable storage media having stored thereon machine-readable instructions executable by a processor. In exemplary embodiments, the instructions comprise: (i) instructions for causing the processor to receive a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject, (ii) instructions for causing the processor to determine a mean value, μ, of the data values of (i), (iii) instructions for causing the processor to receive a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject, and (iv) instructions for causing the processor to display an output diagnosis relating to Brugada Syndrome, when a is less than or equal to a threshold T, which is (μ-(Χμ)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00163] In exemplary aspects, the instructions comprise (i) instructions for receiving a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject and (ii) instructions for displaying an output diagnosis relating to Brugada Syndrome, when a is less than or equal to a threshold T, which is (μ-(Χμ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00164] In exemplary aspects of the storage media herein, a is the level of full length mRNA encoded by the SCN5A gene or the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the level of full length SCN5A Exon 28 mRNA or the level of a truncated SCN5A Exon28 mRNA. In exemplary aspects, a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA. In any of these aspects, the truncated SCN5A Exon28 mRNA may be the mRNA of SCN5A Exon 28 Variant C (E28C) or the mRNA of SCN5A Exon 28 Variant D (E28D). In exemplary aspects, the truncated SCN5A Exon28 mRNA may be a sum of the mRNA of E28C and the mRNA of E28D.
[00165] In exemplary aspects, the output diagnosis is (a) an identification of the presence of Brugada Syndrome, (b) a determination of the subject needing therapy for Brugada Syndrome, (c) a determination of progression of Brugada Syndrome, (d) a determination of an increased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as ineffective as a therapy for Brugada Syndrome. In exemplary aspects, the system comprises additional machine readable instructions. For instance, the system may comprise instructions that, when executed by the processor, cause the processor to display a negative output diagnosis relating to Brugada Syndrome, when a is greater than (μ-(Χμ)), wherein the negative output diagnosis is (a) an identification of the absence of Brugada Syndrome, (b) a determination of the subject not needing therapy for Brugada Syndrome, (c) a determination of regression of Brugada Syndrome, (d) a determination of a decreased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as effective as a therapy for Brugada Syndrome.
[00166] In additional or alternative embodiments, the instructions comprise: (i) instructions for causing the processor to receive a plurality of data values relating to a control level of mRNA encoded by the PERK gene from a biological sample obtained from a control subject, (ii) instructions for causing the processor to determine a mean value, μρΕΐικ, of the data values of (i), (iii) instructions for causing the processor to receive a data value, ( PERK, relating to a test level of mRNA encoded by the PERK gene from a biological sample obtained from a test subject, and (iv) instructions for causing the processor to display an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to a threshold TPERK, which is ^PERK-(XH ERK)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00167] In exemplary aspects, the instructions comprise (i) instructions for receiving a data value, ( PERK, relating to a test level of mRNA encoded by the PERK gene from a biological sample obtained from a test subject and (ii) instructions for displaying an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to a threshold
TPERK, which is (μρΕκκ-(ΧμρΕκκ) wherein PERK is a predetermined mean value of a plurality of data values relating to a control level of mRNA encoded by the PERK gene from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00168] In additional or alternative embodiments, the instructions comprise: (i) instructions for causing the processor to receive a plurality of data values relating to a control level of mRNA encoded by the RBM25 gene from a biological sample obtained from a control subject, (ii) instructions for causing the processor to determine a mean value, URBMIS? of the data values of (i), (iii) instructions for causing the processor to receive a data value, ctRBM25, relating to a test level of mRNA encoded by the RBM25 gene from a biological sample obtained from a test subject, and (iv) instructions for causing the processor to display an output diagnosis relating to Brugada Syndrome, when ( RBM25 is greater than or equal to a threshold TRBM25, which is
Figure imgf000086_0001
wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00169] In exemplary aspects, the instructions comprise (i) instructions for receiving a data value, ( RBM25, relating to a test level of mRNA encoded by the RBM25 gene from a biological sample obtained from a test subject and (ii) instructions for displaying an output diagnosis relating to Brugada Syndrome, when ( RBM25 is greater than or equal to a threshold TRBM25, which is
Figure imgf000086_0002
wherein μRBM25 is a predetermined mean value of a plurality of data values relating to a control level of mRNA encoded by the RBM25 gene from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00170] In additional or alternative embodiments, the instructions comprise: (i) instructions for causing the processor to receive a plurality of data values relating to a control level of mRNA encoded by the LUC7A gene from a biological sample obtained from a control subject, (ii) instructions for causing the processor to determine a mean value, μυχ:7Α, of the data values of (i), (iii) instructions for causing the processor to receive a data value,
7 , relating to a test level of mRNA encoded by the LUC7A gene from a biological sample obtained from a test subject, and (iv) instructions for causing the processor to display an output diagnosis relating to Brugada Syndrome, when ( 7 is greater than or equal to a threshold TLuc7A, which is
Figure imgf000087_0001
wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00171] In exemplary aspects, the instructions comprise (i) instructions for receiving a data value, ( 7 , relating to a test level of mRNA encoded by the LUC7A gene from a biological sample obtained from a test subject and (ii) instructions for displaying an output diagnosis relating to Brugada Syndrome, when ( 7 is greater than or equal to a threshold T 7 , which is
Figure imgf000087_0002
wherein μυχ:7Α is a predetermined mean value of a plurality of data values relating to a control level of mRNA encoded by the LUC7A gene from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00172] In additional or alternative embodiments, the instructions comprise: (i) instructions for causing the processor to receive a plurality of data values relating to a control level of mRNA encoded by the PRP40 gene from a biological sample obtained from a control subject, (ii) instructions for causing the processor to determine a mean value, μρρα>4ο, of the data values of (i), (iii) instructions for causing the processor to receive a data value, pRp40, relating to a test level of mRNA encoded by the PRP40 gene from a biological sample obtained from a test subject, and (iv) instructions for causing the processor to display an output diagnosis relating to Brugada Syndrome, when apRp4o is greater than or equal to a threshold T , which is
Figure imgf000087_0003
wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00173] In exemplary aspects, the instructions comprise (i) instructions for receiving a data value, pRp4o, relating to a test level of mRNA encoded by the PRP40 gene from a biological sample obtained from a test subject and (ii) instructions for displaying an output diagnosis relating to Brugada Syndrome, when pRp40 is greater than or equal to a threshold TPPJ O, which is (μρκρ4ο+(Χμριΐρ4ο)Χ wherein μρρα>4ο is a predetermined mean value of a plurality of data values relating to a control level of mRNA encoded by the PRP40 gene from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00174] Further provided herein are methods implemented by a processor in a computer. In exemplary embodiments, the method comprises the steps of: (i) receiving a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject, (ii) determining a mean value, μ, of the data values received in (i), (iii) receiving a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject, (iv) displaying an output diagnosis relating to Brugada Syndrome, when a is less than or equal to a threshold T, which is (μ-(Χμ)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00175] In exemplary embodiments, the method comprises the steps of (i) receiving a data value, a, relating to a test level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a test subject and (ii) displaying an output diagnosis relating to Brugada Syndrome, when a is less than or equal to a threshold T, which is (μ-(Χμ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA (either or both full length mRNA or truncated) from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00176] In exemplary aspects of the methods herein, a is the level of full length mRNA encoded by the SCN5A gene or the level of mRNA of an SCN5A splice variant (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA (e.g., but not limited to a SCN5A splice variant which encodes a truncated SCN5A protein). In exemplary aspects, a is the level of full length SCN5A Exon 28 mRNA or the level of a truncated SCN5A Exon28 mRNA. In exemplary aspects, a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA. In any of these aspects, the truncated SCN5A Exon28 mRNA may be the mRNA of SCN5A Exon 28 Variant C (E28C) or the mRNA of SCN5A Exon 28 Variant D (E28D). In exemplary aspects, the truncated SCN5A Exon28 mRNA may be a sum of the mRNA of E28C and the mRNA of E28D.
[00177] In exemplary aspects, the output diagnosis is (a) an identification of the presence of Brugada Syndrome, (b) a determination of the subject needing therapy for Brugada Syndrome, (c) a determination of progression of Brugada Syndrome, (d) a determination of an increased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as ineffective as a therapy for Brugada Syndrome. In exemplary aspects, the system comprises additional machine readable instructions. For instance, the system may comprise instructions that, when executed by the processor, cause the processor to display a negative output diagnosis relating to Brugada Syndrome, when a is greater than (μ-(Χμ)), wherein the negative output diagnosis is (a) an identification of the absence of Brugada Syndrome, (b) a determination of the subject not needing therapy for Brugada Syndrome, (c) a determination of regression of Brugada Syndrome, (d) a determination of a decreased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as effective as a therapy for Brugada Syndrome.
[00178] In additional or alternative embodiments, the method comprises the steps of (i) receiving a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, (ii) determining a mean value, μρΕΐικ, for the PERK mRNA received in (i), (iii) receiving a data value, ( , relating to a test level of the PERK mRNA from a biological sample obtained from a test subject, (iv) displaying an output diagnosis relatin to Brugada Syndrome, when ( is less than or equal to a threshold T , which is ^ -(XH )), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00179] In exemplary aspects, the method comprises steps of (i) receiving a data value, ctpERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and (ii) displaying an output diagnosis relating to Brugada Syndrome, when (XPERK is less than or equal to a threshold TPERK, which is (μpERκ-( μpERκ)), wherein UPERK is a predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject and wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00180] In additional or alternative embodiments, the method comprises the steps of (i) receiving a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, (ii) determining a mean value, URBM25} for the RBM25 mRNA received in (i), (iii) receiving a data value, ( RBM25, relating to a test level of the RBM25 mRNA from a biological sample obtained from a test subject, (iv) displaying an output diagnosis relating to Brugada Syndrome, when ( RBM25 is greater than or equal to a threshold TRBM25, which is (μRBM25+(X RBM25)), wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00181] In exemplary aspects, the method comprises the steps of (i) receiving a data value, ( RBM25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject and (ii) displaying an output diagnosis relating to Brugada Syndrome, when ctRBM25 is greater than or equal to a threshold TRBM25, which is (μRBM25+(XμRBM25), wherein μRBM25 is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00182] In additional or alternative embodiments, the method comprises the step of (i) receiving a plurality of data values relating to a control level of Luc7A mRNA from a biological sample obtained from a control subject, (ii) determining a mean value, μΕυο7Α, for the Luc7A mRNA received in (i), (iii) receiving a data value, (XLUC7A, relating to a test level of the Luc7A mRNA from a biological sample obtained from a test subject, (iv) displaying an output diagnosis relating to Brugada Syndrome, when ( LUC7A is greater than or equal to a threshold TLuc7A which is (μιυο7Α+(Χμιυο7Α)Χ wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00183] In exemplary aspects, the method comprises the steps of (i) receiving a data value, ctLuc7A, relating to a test level of Luc7A mRNA from a biological sample obtained from a test subject and (ii) displaying an output diagnosis of Brugada Syndrome, when ( LUC7A is greater than or equal to a threshold TLUC7A which is ^LUC7A+^LUC7A)), wherein μ^7Α is a predetermined mean value of a plurality of data values relating to a control level of Luc7A mRNA from a biological sample obtained from a control subject and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50..
[00184] In additional or alternative embodiments, the method comprises the steps of (i) receiving a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, (ii) determining a mean value, μρρα ο, for the PRP40 mRNA received in (i), (iii) receiving a data value, pRp4o, relating to a test level of the PRP40 mRNA from a biological sample obtained from a test subject, (iv) displaying an output diagnosis relating to Brugada Syndrome, when ο¾¾ρ40 is greater than or equal to a threshold TPRP40 which is
Figure imgf000091_0001
wherein X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50.
[00185] In exemplary aspects, the method comprises the steps of (i) receiving a data value, apRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and (ii) displaying an output diagnosis relating to Brugada Syndrome, when ( PRP4O is greater than or equal to a threshold TPRP4O which is (μpRp4o+(XμpRp4o), wherein μpRp4o is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject and X is a number between 0.35 and 0.75. In exemplary aspects, X of the threshold is a number between 0.40 and 0.60. In exemplary aspects, X is a number between 0.45 and 0.55. In exemplary aspects, X is about 0.50. [00186] In exemplary aspects, the output diagnosis is (a) an identification of the presence of Brugada Syndrome, (b) a determination of the subject needing therapy for Brugada Syndrome, (c) a determination of progression of Brugada Syndrome, (d) a determination of an increased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as ineffective as a therapy for Brugada Syndrome. In exemplary aspects, the system comprises additional machine readable instructions. For instance, the system may comprise instructions that, when executed by the processor, cause the processor to display a negative output diagnosis relating to Brugada Syndrome, when ( is greater than (μρΕΐικ- (ΧμρΕκκ)) or ( is less than (μ -(ΧμκΒΜ25)) or aLuc7A is less than ^ 7 7 or apRP4o is less than (μρκρ4ο-(ΧμριΐΡ4ο)) or, wherein the negative output diagnosis is (a) an identification of the absence of Brugada Syndrome, (b) a determination of the subject not needing therapy for Brugada Syndrome, (c) a determination of regression of Brugada Syndrome, (d) a determination of a decreased risk for syncope or sudden cardiac death, or (e) a determination of a test compound as effective as a therapy for Brugada Syndrome.
[00187] The following examples serve only to illustrate the invention or provide background information relating to the invention. The following examples are not intended to limit the scope of the invention in any way.
EXAMPLES EXAMPLE 1
[00188] This example demonstrates a correlation of cardiac tissue and blood abundances of SCN5A Exon 28 Variant C (E28C)and SCN5A Exon 28 Variant D (E28D).
[00189] In order to show that white blood cell (WBC) SCN5A variants might be an acceptable surrogate for the physiologically relevant levels of variants in heart, we designed paired analysis of WBC and ventricular tissue variants from the same patient. A total 14 paired blood and heart tissue samples were collected. More specifically, heart tissue samples were obtained from residual cores removed after left ventricular assist device (LVAD) placement at our affiliate, Christ Advocate Hospital. Eligible patients were over 18 years of age, had a LVEF of <35 documented in the last year, and had a need for LVAD
implantation. Paired blood samples were collected simultaneously from patients undergoing LVAD placement. The blood samples were collected in PAX tubes (Fisher Scientific, Pittsburgh, PA) following the manufacturer's procedure. Samples were stored for up to three days at room temperature or five days at 2-8 °C. [00190] Total RNA from blood samples was isolated using the PAXgene Blood RNA isolation kit. Total RNA was isolated from WBCs and human heart tissue with the RNeasy Mini and RNeasy Lipid Tissue Mini Kits, respectively (Qiagen, Valencia, CA) and then converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Qiagen). Quantitative RT-PCR was done using iQ™ SYBR® Green Supermix. The primer sequences used were as shown in Table 4:
TABLE 4
Figure imgf000093_0001
[00191] Quantitative reverse transcription polymerase chain reaction (qRT-PCR) thermal cycling conditions were an initial uracil-N-glycosylase incubation at 50°C for two minutes. iTaq™ DNA polymerase was activated with an initial denaturation step at 95 °C for five minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, and annealing and extension at 60°C for one minute. Each sample was measured for the target gene SCN5A, E28C, E28D, and β-actin. Variants levels were expressed as a percentage of the variant with respect to the total Na+ channel mRNA to correct for differences in WBC SCN5A expression between subjects. [00192] The correlation between blood and tissue variants levels is shown for E28C and E28D in Figure 5 and 6, respectively. The coefficients of determination, r , were 0.60 and 0.57 and the correlation coefficients, r, were 0.78 and 0.75 for variants E28C and E28D, respectively, demonstrating the high degree of correlation of tissue and blood SCN5A variants.
EXAMPLE 2
[00193] This example demonstrates that decreased mRNA transcript levels of SCN5A (including full length transcripts and variant transcripts (e.g., E28C and E28D)), relative to control levels, correlate with the presence of Brugada Syndrome.
[00194] Peripheral blood samples from patients diagnosed with Brugada Syndrome were obtained from the Molecular Cardiology IRCCS Fondazione Maugeri (Pavia, Italy). The diagnosis of Brugada Syndrome in the patients was based on the presence of a "spontaneous" or of a "Class IC antiarrhythmic drug induced" type I ECG pattern. The DNA of each patient was screened for mutations in the opening reading frame of the SCN5A gene and no mutations were identified in any of the patients. The peripheral blood samples (3 ml per sample) were stored in PAXgene™ Blood RNA tubes (Qiagen) as essentially described in Example 1.
[00195] Total RNA was extracted from the white blood cells of the peripheral blood using the Trizol reagent (Invitrogen, Carlsbad, CA) and/or the PAXgene blood kit. RNA was then converted into cDNA using the High Capacity cDNA Reverse Transcription Kit (Qiagen). Quantitative RT-PCR was done using iQ™ SYBR® Green Supermix under the following conditions: a holding stage of 95°C for 20 min and 40 cycles at 95°C for 30 s and 60°C for 60 s. The primer sequences used were as shown in Table 5:
TABLE 5
Figure imgf000094_0001
E28C 673)
Reverse: 5'-TCTCTTCTCCCCTCCTGCTGGTCA-3' (SEQ ID NO: 674)
SCN5A variant Forward: 5'-TTACGCACCTTCCGAGTCCTCC-3' (SEQ ID NO: E28D 675)
Reverse: 5 'GG A AG AGCGTCGGGG AG A AG A AGTA- 3 ' (SEQ ID NO: 676)
PERK Forward: 5'-
AGTCTCTGCTGGAGTCTTCATGACACTGTGTCTCAGACTCTT
(SEQ ID NO: 677)
Reverse: TGACACTGTGTCTCAGACTCTT (SEQ ID NO: 678)
RBM25 Forward: 5'-TGTCTTTTCCACCTCATTTGAATCG-3' (SEQ ID
NO: 679)
Reverse: 5 '- ATTGGT AC AGG A ATC ATTGGGGT- 3 ' (SEQ ID NO: 680)
LUC7L3 Forward: 5'-GGACCAAGATCAGAACGTGTATTTG-3' (SEQ ID
NO: 681)
Reverse: 5'-CAGTTGTTGGATGAGTTAATGGGC-3' (SEQ ID NO: 682)
PRP40 Forward:GACAGCGATCAGAGTCTCGTTC (SEQ ID NO: 683) Reverse : TCGCTC AGC ATCGG ATTCTGG A (SEQ ID NO: 684) β- actin Forward: 5 -GGATCGGCGGCTCCAT (SEQ ID NO: 685) Reverse: 5 'C ATACTCCTGCTTGCTG ATCC A (SEQ ID NO: 686)
[00196] Data were analyzed using the threshold cycle (CT) relative quantification method and normalized to beta actin. For each transcript, the normalized values were then expressed relative to the mean of the control.
[00197] Full-length SCN5A mRNA transcripts were reduced in 17 of 20 patients. In those with reduced SCN5A mRNA prevalence, the reduction was 47 + 9% of control (p<0.001), suggesting that reduced transcription, rather than point mutations, causes Brugada Syndrome in a majority of patients.
[00198] As shown in Figures 8 and 9, the level of SCN5A E28C mRNA transcripts and the level of SCN5A E28D mRNA transcripts decreased (relative to control levels) in 80% of the patients tested. The mRNA transcript levels of splicing factor genes, RBM25, Luc7A, and PRP40, increased (relative to control). See, Figures 10-12. Also, the level of PERK, a major component of the unfolded protein response (UPR), decreased, relative to control (Figure 13).
[00199] There was evidence of SCN5A transcription dysregulation in most patients with Brugada Syndrome and no defined gene defect. These data suggest that the levels of SCN5A mRNA transcripts (full length SCN5A, E28C and E28D) in white blood cells may be a useful tool to determine the presence of Brugada Syndrome in patients. These data also suggest that increased mRNA transcript levels of splicing factor genes correlate with the presence of Brugada Syndrome. These data furthermore suggest that decreased mRNA transcript levels of a major component of the UPR correlate with the presence of Brugada Syndrome.
EXAMPLE 3
[00200] This example demonstrates a clinical validation study.
[00201] Peripheral blood samples from patients diagnosed with Brugada Syndrome based on clinical criteria (see, e.g., Wilde et al., Eur Heart J. 23: 1648-1654 (2002); Antzelevitch et al., Circulation 111: 659-670 (2005); and Richter et al., Eur Heart J 31: 1357-1364 (2010)) are obtained from the Molecular Cardiology IRCCS Fondazione Maugeri (Pavia, Italy). The diagnosis of Brugada Syndrome in the patients was based on the presence of a "spontaneous" or of a "Class IC antiarrhythmic drug induced" type I ECG pattern. Peripheral blood samples from healthy control patients not diagnosed with Brugada Syndrome are obtained from a blood bank. The peripheral blood samples (3 ml per sample) are stored in PAXgene™ Blood RNA tubes (Qiagen) as essentially described in Example 1. Total RNA is extracted from the white blood cells of the peripheral blood and then converted into cDNA using the High Capacity cDNA Reverse Transcription Kit (Qiagen), as essentially described in Example 2. Quantitative RT-PCR is carried out using iQ™ SYBR® Green Supermix under the following conditions: a holding stage of 95°C for 20 min and 40 cycles at 95°C for 30 s and 60°C for 60 s. The primer sequences used are those shown in Table 5. [00202] The levels of mRNA encoded by the SCN5A gene, PERK gene, RBM25 gene, PRP40 gene, and the Luc7A gene are determined. It is expected that the full length and truncated mRNA of the SCN5A gene and the mRNA of the PERK gene are decreased in blood samples obtained from Brugada Syndrome patients, relative to those obtained from healthy control patients. It is also expected that the mRNA of the RBM25 gene, PRP40 gene, and Luc7A gene are increased in blood samples obtained from Brugada Syndrome patients, relative to those obtained from healthy control patients.
[00203] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[00204] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and
"containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted.
[00205] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range and each endpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein.
[00206] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[00207] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED:
1. A method of identifying a presence of Brugada Syndrome in a subject, comprising (i) analyzing a biological sample obtained from the subject for a. a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, b. a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, c. a level of mRNA encoded by a SCN5A splicing factor gene, and/or d. a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) identifying the presence of Brugada Syndrome in the subject, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
2. The method of claim 1, comprising analyzing the biological sample obtained from the subject for a full length SCN5A Exon 28 transcript and/or a truncated SCN5A Exon 28 transcript.
3. The method of claim 1 or 2, wherein the SCN5A splice variant is SCN5A Exon 28 Splice Variant C (E28C) or SCN5A Exon 28 Splice Variant D (E28D).
4. The method of claim 3, comprising analyzing the biological sample for both the level of mRNA of the E28C SCN5A splice variant and the level of mRNA of the E28D SCN5A splice variant.
5. The method of any one of claims 1 to 4, comprising analyzing the biological sample for (a).
6. The method of any one of claims 1 to 5, wherein the SCN5A splicing factor gene is RBM25, Luc7A, PRP40, or.
7. The method of claim 6, comprising analyzing the biological sample for the level of mRNA encoded by two or all of RBM25, Luc7A, and PRP40.
8. The method of any one of claims 1 to 7, wherein gene of the UPR is
PERK.
9. The method of any one of claims 1 to 8, wherein each of the level of mRNA and the control level is normalized to the level of mRNA encoded by a housekeeping gene of the biological sample.
10. The method of claim 9, wherein the housekeeping gene is the β-actin gene.
11. The method of any one of the preceding claims, wherein the level of mRNA is determined by real-time RT-PCR analysis.
12. The method of any one of the preceding claims, wherein the level of full-length mRNA encoded by the SCN5A gene is reduced by at least 50%, relative to a control level.
13. The method of any one of claims 1 to 12, wherein the biological sample comprises heart cells or white blood cells.
14. The method of claim 13, wherein the biological sample comprises white blood cells.
15. The method of claim 14, wherein the biological sample is blood or a fraction thereof.
16. The method of any one of the preceding claims, wherein the subject is male.
17. The method of any one of claims 1 to 16, wherein the subject is about 40 years old or younger.
18. The method of any one of claims 1 to 17, wherein the subject has a medical history including syncope and/or dizziness.
19. The subject of any one of claims 1 to 18, wherein the subject has been treated for and survived sudden cardiac death or has a family history of sudden cardiac death.
20. The method of any one of claims 1 to 19, wherein the subject does not have any structural defect of the heart.
21. The method of any one of claims 1 to 20, further comprising performing a genetic test on the subject, optionally, wherein the genetic test analyzes the sequence of the SCN5A gene, the CACNAlc gene, and/or the GPD1-L gene.
22. The method of any one of claims 1 to 21, wherein the subject does not have a genetic mutation in the open reading frame of SCN5A gene.
23. The method of any one of claims 1 to 22, wherein the subject does not have a genetic mutation in the CACNAlc gene or in the GPD1-L gene.
24. The method of any one of claims 1 to 23, wherein the subject does not have any of the mutations listed in Table 1 or Table 2.
25. The method of any one of claims 1 to 24, further comprising performing an electrocardiogram on the subject.
26. The method of any one of the preceding claims, further comprising providing to the subject a therapy for Brugada Syndrome, when the presence of Brugada Syndrome has been identified in the subject.
27. The method of claim 26, wherein the therapy comprises an implantable cardioverter-defibrillator (ICD).
28. The method of claim 26 or 27, wherein the therapy comprises nicotinamide adenine dinucleotide (NAD+).
29. A method of determining a subject's need for therapy for Brugada Syndrome (BS), comprising the step of (i) analyzing a biological sample obtained from the subject for a. a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, b. a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, c. a level of mRNA encoded by a SCN5A splicing factor gene, and/or d. a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) determining the subject as needing therapy for Brugada Syndrome, when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
30. The method of claim 29, wherein the therapy is an ICD, a mitochondrially-targeted antioxidant , a mitochondria electron transport re-coupling agent, a Protein Kinase A Activator, a Protein Kinase C Inhibitor, a c-Src Inhibitor, an anion transporter inhibitor, an inner-membrane anion channels (IMAC) modulator, an NADPH oxidase inhibitor, ora Protein Kinase G Activator.
31. The method of claim 30, wherein the therapy is an ICD and wherein the level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein is not a level relative to the level of full-length messenger RNA (mRNA) encoded by the SCN5A gene.
32. The method of any one of claims 29 to 31, comprising analyzing the biological sample obtained from the subject for a full length SCN5A Exon 28 transcript and/or a truncated SCN5A Exon 28 transcript.
33. The method of any one of claims 29 to 32, wherein the SCN5A splice variant is SCN5A Exon 28 Splice Variant C (E28C) or SCN5A Exon 28 Splice Variant D (E28D).
34. The method of claim 33, comprising analyzing the biological sample for both the level of mRNA of the E28C SCN5A splice variant and the level of mRNA of the E28D SCN5A splice variant.
35. The method of any one of claims 29 to 34, comprising analyzing the biological sample for (a) and/or (b).
36. The method of any one of claims 29 to 35, wherein the SCN5A splicing factor gene is RBM25, Luc7A, PRP40, or.
37. The method of claim 36, comprising analyzing the biological sample for the level of mRNA encoded by two or all of RBM25, Luc7A, and PRP40.
38. The method of any one of claims 29 to 38, wherein gene of the UPR is
PERK.
39. The method of any one of claims 29 to 38, wherein each of the level of mRNA and the control level is normalized to the level of mRNA encoded by a housekeeping gene of the biological sample.
40. The method of claim 39, wherein the housekeeping gene is the β-actin gene.
41. The method of any one of claims 29 to 40, wherein the level of mRNA is determined by real-time RT-PCR analysis.
42. The method of any one of claims 29 to 41, wherein the level of full- length mRNA encoded by the SCN5A gene is reduced by at least 50%, relative to a control level.
43. The method of any one of claims 29 to 42, wherein the biological sample comprises heart cells or white blood cells.
44. The method of claim 43, wherein the biological sample comprises white blood cells.
45. The method of claim 44, wherein the biological sample is blood or a fraction thereof.
46. The method of any one of claims 29 to 45, wherein the subject is male.
47. The method of any one of claims 29 to 46, wherein the subject is about 40 years old or younger.
48. The method of any one of claims 29 to 47, wherein the subject has a medical history including syncope and/or dizziness.
49. The subject of any one of claims 29 to 48, wherein the subject has been treated for and survived sudden cardiac death or has a family history of sudden cardiac death.
50. The method of any one of claims 29 to 49, wherein the subject does not have any structural defect of the heart.
51. The method of any one of claims 29 to 50, further comprising performing a genetic test on the subject, optionally, wherein the genetic test analyzes the sequence of the SCN5A gene, the CACNAlc gene, and/or the GPDl-L gene.
52. The method of any one of claims 29 to 51, wherein the subject does not have a genetic mutation in the open reading frame of SCN5A gene.
53. The method of any one of claims 29 to 52, wherein the subject does not have a genetic mutation in the CACNAlc gene or in the GPDl-L gene.
54. The method of any one of claims 29 to 53, wherein the subject does not have any of the mutations listed in Table 1 or Table 2.
55. A method of treating a subject for Brugada Syndrome, comprising the step of (i) analyzing a biological sample obtained from the subject for a. a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, b. a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, c. a level of mRNA encoded by a SCN5A splicing factor gene, and/or d. a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing to the subject a therapy for Brugada Syndrome when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
56. A method of reducing risk for syncope and/or sudden cardiac death by ventricular fibrillation in a subject, comprising the step of (i) analyzing a biological sample obtained from the subject for a. a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, b. a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, c. a level of mRNA encoded by a SCN5A splicing factor gene, and/or d. a level of mRNA encoded by a gene of the unfolded protein response (UPR); and (ii) providing to the subject a therapy for Brugada Syndrome when the level of (a), (b), and/or (d) are reduced, relative to a control level, and/or when the level of (c) is increased, relative to a control level.
57. A method of treating Brugada Syndrome in a subject from which a biological sample was obtained and the biological sample was analyzed for a. a level of full-length messenger RNA (mRNA) encoded by the SCN5A gene, b. a level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein, c. a level of mRNA encoded by a SCN5A splicing factor gene, and/or d. a level of mRNA encoded by a gene of the unfolded protein response (UPR); comprising the step of providing to the subject a therapy for Brugada Syndrome in an amount effective to treat the Brugada Syndrome.
58. The method of any one of the preceding claims wherein the level of mRNA is determined by measuring the level of protein encoded by the mRNA transcripts.
59. The method of claim 58, wherein the level of protein is measured by an immunoassay.
60. The method of claim 58 or 59, wherein the level of protein is normalized to the protein level encoded by a housekeeping gene, optionally, wherein the housekeeping gene is β-actin.
61. The method of any one of claims 55 to 60, wherein the therapy is an ICD, a mitochondrially-targeted antioxidant , a mitochondria electron transport re-coupling agent, a Protein Kinase A Activator, a Protein Kinase C Inhibitor, a c-Src Inhibitor, an anion transporter inhibitor, an inner-membrane anion channels (IMAC) modulator, an NADPH oxidase inhibitor, or a Protein Kinase G Activator.
62. The method of claim 61, wherein the therapy is an ICD and wherein the level of mRNA of an SCN5A splice variant which encodes a truncated SCN5A protein is not a level relative to the level of full-length messenger RNA (mRNA) encoded by the SCN5A gene.
63. The method of any one of claims 55 to 62, wherein the method comprises analyzing the biological sample obtained from the subject for a full length SCN5A Exon 28 transcript and/or a truncated SCN5A Exon 28 transcript, or wherein the subject has been analyzed for a full length SCN5A Exon 28 transcript and/or a truncated SCN5A Exon 28 transcript.
64. The method of any one of claims 55 to 63, wherein the SCN5A splice variant is SCN5A Exon 28 Splice Variant C (E28C) or SCN5A Exon 28 Splice Variant D (E28D).
65. The method of claim 64, wherein the method comprises analyzing the biological sample for both the level of mRNA of the E28C SCN5A splice variant and the level of mRNA of the E28D SCN5A splice variant, or wherein the subject has been analyzed for both the level of mRNA of the E28C SCN5A splice variant and the level of mRNA of the E28D SCN5A splice variant.
66. The method of any one of claims 55 to 65, wherein the method comprises analyzing the biological sample for (a) and/or (b) or wherein the subject has been analyzed for (a) and/or (b).
67. The method of any one of claims 55 to 66, wherein the SCN5A splicing factor gene is RBM25, Luc7A, or PRP40.
68. The method of claim 67, wherein the method comprises analyzing the biological sample for the level of mRNA encoded by two or all of RBM25, Luc7A, and PRP40 or the subject has been analyzed for the level of mRNA encoded by two or all of RBM25, Luc7A, and PRP40.
69. The method of any one of claims 55 to 68, wherein the gene of the UPR is PERK.
70. The method of any one of claims 55 to 69, wherein each of the level of mRNA and the control level is or was normalized to the level of mRNA encoded by a housekeeping gene of the biological sample.
71. The method of claim 70, wherein the housekeeping gene is the β-actin gene.
72. The method of any one of claims 55 to 71, wherein the level of mRNA is or was determined by real-time RT-PCR analysis.
73. The method of any one of claims 55 to 72, wherein the level of full- length mRNA encoded by the SCN5A gene is or was reduced by at least 50%, relative to a control level.
74. The method of any one of claims 55 to 73, wherein the biological sample comprises or comprised heart cells or white blood cells.
75. The method of claim 74, wherein the biological sample comprises or comprised white blood cells.
76. The method of claim 75, wherein the biological sample is or was blood or a fraction thereof.
77. The method of any one of claims 55 to 76, wherein the subject is male.
78. The method of any one of claims 55 to 77, wherein the subject is about 40 years old or younger.
79. The method of any one of claims 55 to 78, wherein the subject has a medical history including syncope and/or dizziness.
80. The subject of any one of claims 55 to 79, wherein the subject has been treated for and survived sudden cardiac death or has a family history of sudden cardiac death.
81. The method of any one of claims 55 to 80, wherein the subject does not have any structural defect of the heart.
82. The method of any one of claims 55 to 81, wherein the method further comprises performing a genetic test on the subject, optionally, wherein the genetic test analyzes the sequence of the SCN5A gene, the CACNAlc gene, and/or the GPDl-L gene.
83. The method of any one of claims 55 to 82, wherein the subject does not have a genetic mutation in the open reading frame of SCN5A gene.
84. The method of any one of claims 55 to 83, wherein the subject does not have a genetic mutation in the CACNAlc gene or in the GPDl-L gene.
85. The method of any one of claims 55 to 84, wherein the subject does not have any of the mutations listed in Table 1 or Table 2.
86. A Brugada Syndrome diagnostic kit comprising (i) a binding agent which binds to a full-length mRNA transcript encoded by the SCN5A gene or a protein product encoded by the full-length mRNA transcript, (ii) a binding agent which binds to an mRNA of an SCN5A splice variant or to a protein product encoded by the SCN5A splice variant, (iii) a binding agent which binds to an mRNA encoded by a gene of the UPR or a protein product encoded by the gene of the UPR, (iv) a binding agent which binds to an mRNA encoded by a SCN5A splicing factor gene or a protein product encoded by the SCN5A splicing factor gene.
87. The Brugada Syndrome diagnostic kit of claim 86, wherein the gene of the UPR is PERK.
88. The Brugada Syndrome diagnostic kit of claim 86 or 87, wherein the SCN5A splicing factor gene is RBM25, Luc7A, or FRF 40.
89. The Brugada Syndrome diagnostic kit of any one of claims 86 to 88, comprising a binding agent which binds to a full length SCN5A Exon 28 transcript and/or a truncated SCN5A Exon 28 transcript, and/or a protein product encoded by the full length SCN5A Exon 28 transcript and/or the truncated SCN5A Exon 28 transcript.
90. The Brugada Syndrome diagnostic kit of claim 89, wherein the truncated SCN5A Exon 28 transcript is E28C or E28D.
91. The Brugada Syndrome diagnostic kit of any one of claims 86 to 90, wherein the kit is intended for use in a method of any one of claims 1 to 85.
92. The Brugada Syndrome diagnostic kit of any one of claims 86 to 91, comprising a nucleic acid probe.
93. The Brugada Syndrome diagnostic kit of claim 92, wherein the nucleic acid probe comprises the sequence of any one of SEQ ID NOs: 665-686.
94. The Brugada Syndrome diagnostic kit of any one of claims 86 to 93, comprising an antibody which specifically binds to the protein product of (i), (ii), (iii), or (iv).
95. The Brugaday Syndrom diagnostic kit of claim 94, comprising an antibody which specifically binds to a full length or truncated SCN5A protein product, a PERK protein product, an RBM25 protein product, a LUC7A protein product, a PRP40 protein product.
96. The Brugada Syndrome diagnostic kit of claim 95, wherein the antibody which specifically binds to the full length SCN5A protein product binds to an epitope within the C-terminal portion of the full length SCN5A protein product, which epitope is not present in the truncated SCN5A protein product.
97. The Brugada Syndrome diagnostic kit of claim 95, wherein the antibody binds to an epitope within the N-terminal portion of the full length SCN5A protein product, which epitope is present in the truncated SCN5A protein product.
98. The Brugada Syndrome diagnostic kit of any one of claims 86 to 97, comprising a container suitable for collecting blood.
99. The Brugada Syndrome diagnostic kit of claim 98, wherein the container comprises heparin.
100. The Brugada Syndrome diagnostic kit of any one of claims 86 to 99, comprising a skin pricking device, optionally, a finger prick device.
101. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject;
ii. determine a mean value, μ, of the data values of (i);
iii. receive a data value, a, relating to a test level of SCN5A
mRNA from a biological sample obtained from a test subject; and
iv. display an output diagnosis relating to Brugada Syndrome, when a is less than or equal to (μ-(Ο.Χμ)), wherein X is 0.35- 0.75.
102. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a data value, a, relating to a test level of SCN5A
mRNA from a biological sample obtained from a test subject and
ii. display an output diagnosis relating to Brugada Syndrome, when a is less than or equal to (μ-(0.5μ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject.
103. The system of claim 101 or 102, wherein a is the level of full length mRNA encoded by the SCN5A gene.
104. The system of claim 101 or 102, wherein a is the level of mRNA of an SCN5A splice variant.
105. The system of claim 104, wherein the SCN5A splice variant encodes a truncated SCN5A protein product.
106. The system of claim 101 or 102, wherein a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA which encodes a truncated protein.
107. The system of claim 101 or 102, wherein a is the level of full length SCN5A Exon 28 mRNA.
108. The system of claim 101 or 102, wherein a is the level of a truncated SCN5A Exon28 mRNA.
109. The system of claim 101 or 102, wherein a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA.
110. The system of claim 109, wherein the truncated SCN5A Exon28 mRNA is (a) the mRNA of SCN5A Exon 28 Variant C, (b) the mRNA of SCN5A Exon 28 Variant D, or both (a) and (b).
111. The system of any one of claims 101 to 110, wherein X is 0.4 to 0.6.
112. The system of claim 111, wherein X is 0.45 to 0.55.
113. The system of claim 112, wherein X is about 0.50.
114. The system of any one of claims 101 to 113, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μρΕΐικ, of the data values of (i); iii. receive a data value, (XPERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to (μρΕκκ-(Ο.ΧμρΕκκ) wherein X is 0.35-0.75.
115. The system of any one of claims 101 to 114, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject; ii. determine a mean value, URBM25} of the data values of (i); iii. receive a data value, (XRBM25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to
Figure imgf000112_0001
wherein X is 0.35-0.75.
116. The system of any one of claims 101 to 115, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μΕυο7Α, of the data values of (i); iii. receive a data value, ( LUC7A, relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
(XLUX7A is greater than or equal to
Figure imgf000113_0001
wherein X is 0.35-0.75.
117. The system of any one of claims 101 to 116, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μρκρ40, of the data values of (i); iii. receive a data value, ο¾¾ρ40, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ( PRP4O is greater than or equal to (μρκρ4ο+(0.Χμρκρ4ο)), wherein X is 0.35- 0.75.
118. The system of any one of claims 101 to 117, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, ( PERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when (XPERK is less than or equal to ^PERK-(XH ERK)), wherein μ is a
predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
119. The system of any one of claims 101 to 118, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, ( 25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to (μκΒΜ25+( μκΒΜ25)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
120. The system of any one of claims 101 to 119, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, ( 7 , relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
aLuc7A is greater than or equal to ^ 7 7 )), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
121. The system of any one of claims 101 to 120, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, apRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when pRp4o is greater than or equal to (μρκρ4ο+(Χμρκρ4ο)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
122. A computer-readable storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising: i. instructions for receiving a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject;
ii. instructions for determining a mean value, μ, of the data values of (i);
iii. instructions for receiving a data value, a, relating to a test level of SCN5A mRNA from a biological sample obtained from a test subject; and
iv. instructions for displaying an output diagnosis relating to
Brugada Syndrome, when a is less than or equal to (μ-(Ο.Χμ)), wherein X is 0.35-0.75.
123. A computer-readable storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising: iii. instructions for receiving a data value, a, relating to a test level of SCN5A mRNA from a biological sample obtained from a test subject and
iv. instructions for displaying an output diagnosis relating to
Brugada Syndrome, when a is less than or equal to (μ-(0.5μ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject.
124. The computer-readable storage medium of claim 122 or 123, wherein a is the level of full length mRNA encoded by the SCN5A gene.
125. The computer-readable storage medium of claim 122 or 123, wherein a is the level of mRNA of an SCN5A splice variant.
126. The computer-readable storage medium of claim 125, wherein the
SCN5A splice variant encodes a truncated SCN5A protein product.
127. The computer-readable storage medium of claim 122 or 123, wherein a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA which encodes a truncated protein.
128. The computer-readable storage medium of claim 122 or 123, wherein a is the level of full length SCN5A Exon 28 mRNA.
129. The computer-readable storage medium of claim 122 or 123, wherein a is the level of a truncated SCN5A Exon28 mRNA.
130. The computer-readable storage medium of claim 122 or 123, wherein a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA.
131. The computer-readable storage medium of claim 130, wherein the truncated SCN5A Exon28 mRNA is (a) the mRNA of SCN5A Exon 28 Variant C, (b) the mRNA of SCN5A Exon 28 Variant D, or both (a) and (b).
132. The computer-readable storage medium of any one of claims 122 to 123, wherein X is 0.4 to 0.6.
133. The computer-readable storage medium of claim 132, wherein X is
0.45 to 0.55.
134. The computer-readable storage medium of claim 133, wherein X is about 0.50.
135. The computer-readable storage medium of any one of claims 122 to 134, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μρΕΐικ, of the data values of (i); iii. receive a data value, ( PERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ( pERK is less than or equal to (μρΕκκ-(Ο.ΧμρΕΐικ)Χ wherein X is 0.35-0.75.
136. The computer-readable storage medium of any one of claims 122 to
135, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject; ii. determine a mean value, URBM25? of the data values of (i); iii. receive a data value, ( RBM25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to
Figure imgf000117_0001
wherein X is 0.35-0.75.
137. The computer-readable storage medium of any one of claims 122 to
136, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μΕυο7Α, of the data values of (i); iii. receive a data value, (XLUC7A, relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
aLux7A is greater than or equal to
Figure imgf000118_0001
wherein X is 0.35-0.75.
138. The computer-readable storage medium of any one of claims 122 to
137, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μρκρ40, of the data values of (i); iii. receive a data value, ( , relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ο¾¾ρ40 is greater than or equal to (μρκρ4ο+(0.Χμρκρ4ο)), wherein X is 0.35- 0.75.
139. The computer-readable storage medium of any one of claims 122 to
138, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, ( , relating to a test level of PERK mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when ( is less than or equal to (μρΕκκ-(ΧμρΕκκ) wherein μ is a
predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
140. The computer-readable storage medium of any one of claims 122 to
139, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, 25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to (μκΒΜ25+( μκΒΜ25)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
141. The computer-readable storage medium of any one of claims 122 to
140, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, , relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
is greater than or equal to ^ )), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
142. The computer-readable storage medium of any one of claims 122 to
141, comprising machine readable instructions that, when executed by the processor, cause the processor to i. receive a data value, apRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when pRp4o is greater than or equal to ^ +( M ) wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
143. A computer-implemented method relating to Brugada Syndrome comprising: receiving a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject;
determining a mean value, μ, of the data values of (i);
receiving a data value, a, relating to a test level of SCN5A mRNA from a biological sample obtained from a test subject; and
displaying an output diagnosis relating to Brugada Syndrome, when a is less than or equal to (μ-(Ο.Χμ)), wherein X is 0.35- 0.75.
144. A computer-implemented method relating to Brugada Syndrome comprising: i. receiving a data value, a, relating to a test level of SCN5A mRNA from a biological sample obtained from a test subject and
ii. displaying an output diagnosis relating to Brugada Syndrome, when a is less than or equal to (μ-(0.5μ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of SCN5A mRNA from a biological sample obtained from a control subject.
145. The computer- implemented method of claim 143 or 144, wherein a is the level of full length mRNA encoded by the SCN5A gene.
146. The computer- implemented method of claim 143 or 144, wherein a is the level of mRNA of an SCN5A splice variant.
147. The computer-implemented method of claim 146, wherein the SCN5A splice variant encodes a truncated SCN5A protein product.
148. The computer- implemented method of claim 143 or 144, wherein a is the sum of the level of full length mRNA encoded by the SCN5A gene and the level of the SCN5A splice variant mRNA which encodes a truncated protein.
149. The computer- implemented method of claim 143 or 144, wherein a is the level of full length SCN5A Exon 28 mRNA.
150. The computer-implemented method of claim 143 or 144, wherein a is the level of a truncated SCN5A Exon28 mRNA.
151. The computer- implemented method of claim 143 or 144, wherein a is the sum of the level of full length SCN5A Exon 28 mRNA and the level of a truncated SCN5A Exon28 mRNA.
152. The computer- implemented method of claim 151, wherein the truncated SCN5A Exon28 mRNA is (a) the mRNA of SCN5A Exon 28 Variant C, (b) the mRNA of SCN5A Exon 28 Variant D, or both (a) and (b).
153. The computer-implemented method of any one of claims 143 to 144, wherein X is 0.4 to 0.6.
154. The computer-implemented method of claim 153, wherein X is 0.45 to
0.55.
155. The computer- implemented method of claim 154, wherein X is about
0.50.
156. The computer-implemented method of any one of claims 143 to 155, comprising i. receiving a plurality of data values relating to a control level of
PERK mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μρΕΐικ, of the data values of (i); iii. receiving a data value, ( PERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when ( pERK is less than or equal to (μρΕκκ-(Ο.ΧμρΕκκ) wherein X is 0.35-0.75.
157. The computer-implemented method of any one of claims 143 to 156, comprising i receiving a plurality of data values relating to a control level of
RBM25 mRNA from a biological sample obtained from a control subject; ii determining a mean value, URBM25 } of the data values of (i); iii receiving a data value, ( RBM25, relating to a test level of RBM25
mRNA from a biological sample obtained from a test subject; and iv displaying an output diagnosis relating to Brugada Syndrome, when (XRBM25 is greater than or equal to
Figure imgf000122_0001
wherein X is 0.35-0.75.
158. The computer- implemented method of any one of claims 143 to 157, comprising i receiving a plurality of data values relating to a control level of
LUC7A mRNA from a biological sample obtained from a control subject; ii determining a mean value, μΕυο7Α, of the data values of (i); iii receiving a data value, (XLUC7A, relating to a test level of LUC7A
mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when aLux7A is greater than or equal to
Figure imgf000123_0001
wherein X is 0.35-0.75.
159. The computer-implemented method of any one of claims 143 to 158, comprising i. receiving a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μρρα ο, of the data values of (i); iii. receiving a data value, cippj o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when ctpRP4o is greater than or equal to (μρρα ο- Ο.Χμρρα ο)), wherein X is 0.35-0.75.
160. The computer-implemented method of any one of claims 143 to 159, comprising i. receiving a data value, (XPERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when
(XPERK is less than or equal to ^PERK-(XM ERK)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
161. The computer-implemented method of any one of claims 143 to 160, comprising i. receiving a data value, ( RBM25, relating to a test level of RBM25
mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when (XRBM25 is greater than or equal to (μΚΒΜ25+( μκΒΜ25)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
162. The computer-implemented method of any one of claims 143 to 161, comprising i. receiving a data value, , relating to a test level of LUC7A
mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when is greater than or equal to ^ )), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
163. The computer-readable storage medium of any one of claims 143 to 162, comprising i. receiving a data value, appj o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when ctpRP4o is greater than or equal to ^ +(XM ) wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
164. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a plurality of data values relating to a control level of
PERK niRNA from a biological sample obtained from a control subject; ii. determine a mean value, μρΕΐικ, of the data values of (i); iii. receive a data value, ( PERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ( pERK is less than or equal to (μρΕκκ-(Ο.ΧμρΕκκ) wherein X is 0.35-0.75.
165. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject; ii. determine a mean value, URBM25} of the data values of (i); iii. receive a data value, ( RBM25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to
Figure imgf000125_0001
wherein X is 0.35-0.75.
166. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject; ii. determine a mean value, μΕυο7Α, of the data values of (i); iii. receive a data value, ( LUC7A, relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when
(XLUX7A is greater than or equal to
Figure imgf000126_0001
wherein X is 0.35-0.75.
167. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. determine a mean value,
Figure imgf000126_0002
of the data values of (i); iii. receive a data value, pRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject; and iv. display an output diagnosis relating to Brugada Syndrome, when ( PRP4O is greater than or equal to (μρκρ4ο+(0.Χμρκρ4ο)), wherein X is 0.35- 0.75.
168. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a data value, (XPERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when ( PERK is less than or equal to ^PERK-(XM ERK)), wherein μ is a
predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
169. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a data value, ( 25, relating to a test level of RBM25 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to (μκΒΜ25+( μκΒΜ25)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
170. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a data value, ( 7 , relating to a test level of LUC7A mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when
aLuc7A is greater than or equal to ^ 7 7 )), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
171. A system comprising: a processor; a memory device coupled to the processor, and machine readable instructions stored on the memory device, wherein the machine readable instructions, when executed by the processor, cause the processor to: i. receive a data value, pRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and ii. display an output diagnosis relating to Brugada Syndrome, when pRp40 is greater than or equal to ^ +( M ) wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
172. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject; ii. instructions for determining a mean value, μρΕΐικ, of the data values of (i); iii. instructions for receiving a data value, ( , relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. instructions for displaying an output diagnosis relating to
Brugada Syndrome, when ( is less than or equal to (μρΕκκ-(Ο.ΧμρΕκκ) wherein X is 0.35-0.75.
173. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject; ii. instructions for determining a mean value, of the data values of
(i); iii. instructions for receiving a data value, ( relating to a test level of
RBM25 mRNA from a biological sample obtained from a test subject; and iv. instructions for displaying an output diagnosis relating to Brugada Syndrome, when ( 25 is greater than or equal to
(μκΒΜ25+(0.ΧμκΒΜ25)), wherein X is 0.35-0.75.
174. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject; ii. instructions for determining a mean value, μυχ Α, of the data values of
(i); iii. instructions for receiving a data value, ( 7 , relating to a test level of
LUC7A mRNA from a biological sample obtained from a test subject; and iv. instructions for displaying an output diagnosis relating to Brugada
Syndrome, when ( 7 is greater than or equal to
(μιυο7Α+(0.Χμιυο7Α)), wherein X is 0.35-0.75.
175. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. instructions for determining a mean value, μρρα ο, of the data values of
(i); iii. instructions for receiving a data value, pRp40, relating to a test level of
PRP40 mRNA from a biological sample obtained from a test subject; and iv. instructions for displaying an output diagnosis relating to Brugada Syndrome, when pRp4o is greater than or equal to
(μριΐρ4ο+(0.Χμρκρ4ο)), wherein X is 0.35-0.75.
176. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a data value, ( , relating to a test level of
PERK mRNA from a biological sample obtained from a test subject and ii. instructions for displaying an output diagnosis relating to Brugada
Syndrome, when a is less than or equal to (μρΕΐικ-(Χ ρΕκκ) wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
177. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a data value, ( 25, relating to a test level of
RBM25 mRNA from a biological sample obtained from a test subject and ii. instructions for displaying an output diagnosis relating to Brugada
Syndrome, when ( 25 is greater than or equal to
( κΒΜ25+(Χ ιΐΒΜ25) wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
178. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a data value, ( 7 , relating to a test level of
LUC7A mRNA from a biological sample obtained from a test subject and ii. instructions for displaying an output diagnosis relating to Brugada
Syndrome, when ( 7 is greater than or equal to
(μ∑υο7Α+(Χμ∑υο7Α)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
179. A computer-readale storage medium having stored thereon a set of instructions, executable by a processor, the instructions comprising i. instructions for receiving a data value, apRp4o, relating to a test level of
PRP40 mRNA from a biological sample obtained from a test subject and ii. instructions for displaying an output diagnosis relating to Brugada
Syndrome, when ( is greater than or equal to (μΡκρ4ο+(Χμρκρ4ο)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
180. A computer-implemented method, comprising i. receiving a plurality of data values relating to a control level of
PERK mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μρΕΐικ, of the data values of (i); iii. receiving a data value, ( , relating to a test level of PERK mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when ( pERK is less than or equal to (μρΕκκ-(Ο.ΧμρΕΐικ)Χ wherein X is 0.35-0.75.
181. A computer-implemented method comprising i. receiving a plurality of data values relating to a control level of
RBM25 mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μκΒΜ25, of the data values of (i); iii. receiving a data value, ( 25, relating to a test level of RBM25
mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to (μκΒΜ25+(0.ΧμκΒΜ25)), wherein X is 0.35-0.75.
182. A computer-implemented method comprising i. receiving a plurality of data values relating to a control level of
LUC7A mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μΕυο7Α, of the data values of (i); iii. receiving a data value, ( , relating to a test level of LUC7A
mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when aLux7A is greater than or equal to
Figure imgf000132_0001
wherein X is 0.35-0.75.
183. A computer-implemented method comprising i. receiving a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject; ii. determining a mean value, μρρα ο, of the data values of (i); iii. receiving a data value, ( PRP4O, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject; and iv. displaying an output diagnosis relating to Brugada Syndrome, when ctpRP4o is greater than or equal to (μρκρ4ο+(Ο.ΧμΡκρ 0)), wherein X is 0.35-0.75.
184. A computer-implemented method comprising i. receiving a data value, (XPERK, relating to a test level of PERK mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when
(XPERK is less than or equal to ^PERK-(XM ERK)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PERK mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
185. A computer-implemented method comprising i. receiving a data value, ( RBM25, relating to a test level of RBM25
mRNA from a biological sample obtained from a test subject and ii. displaying an output diagnosis relating to Brugada Syndrome, when
(XRBM25 is greater than or equal to (μκΒΜ25+(ΧμκΒΜ25)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of RBM25 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
186. A computer-implemented method comprising i. receiving a data value, ( LUC7A, relating to a test level of LUC7A
mRNA from a biological sample obtained from a test subject and i. displaying an output diagnosis relating to Brugada Syndrome, when aLuc7A is greater than or equal to ^LUC7A+^LUC7A)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of LUC7A mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75. A computer-readable storage medium comprising i. receiving a data value, apRp4o, relating to a test level of PRP40 mRNA from a biological sample obtained from a test subject and i. displaying an output diagnosis relating to Brugada Syndrome, when ctpRP4o is greater than or equal to (μΡκρ ο+(ΧμρκΡ4θ)), wherein μ is a predetermined mean value of a plurality of data values relating to a control level of PRP40 mRNA from a biological sample obtained from a control subject, wherein X is a number between 0.35 and 0.75.
PCT/US2014/027257 2013-03-15 2014-03-14 Methods for detecting brugada syndrome Ceased WO2014152364A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361786882P 2013-03-15 2013-03-15
US61/786,882 2013-03-15

Publications (2)

Publication Number Publication Date
WO2014152364A2 true WO2014152364A2 (en) 2014-09-25
WO2014152364A3 WO2014152364A3 (en) 2015-01-15

Family

ID=51023013

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/027257 Ceased WO2014152364A2 (en) 2013-03-15 2014-03-14 Methods for detecting brugada syndrome

Country Status (1)

Country Link
WO (1) WO2014152364A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017031342A1 (en) * 2015-08-20 2017-02-23 Rhode Island Hospital Circulating biomarker for brugada syndrome
EP3865591A1 (en) 2020-02-14 2021-08-18 Cardiomix S.r.l. Set of biomarkers for the diagnosis of brugada syndrome
CN113584156A (en) * 2021-08-09 2021-11-02 百世诺(北京)医疗科技有限公司 HCN4 mutant gene, mutant and Brugada syndrome detection kit
CN113637739A (en) * 2021-08-09 2021-11-12 百世诺(北京)医疗科技有限公司 A kind of SCN5A mutant gene, application and Brugada syndrome detection kit
LU506463B1 (en) * 2024-02-26 2025-08-28 Governing Council Univ Toronto Methods and compositions for endogenous exon splicing using dcas13-rbm25 fusions

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999056954A1 (en) 1998-05-06 1999-11-11 Caliper Technologies Corp. Methods of fabricating polymeric structures incorporating microscale fluidic elements
US20070212723A1 (en) 2006-02-17 2007-09-13 Dudley Samuel C Human sodium channel isoforms
WO2007133747A2 (en) 2006-05-15 2007-11-22 Wisconsin Alumni Research Foundation PULMONARY DELIVERY OF 1α,25-DIHYDROXYVITAMIN D3 AND CO-ADMINISTRATION OF PARATHYROID HORMONE OR CALCITONIN
WO2007141411A1 (en) 2006-06-07 2007-12-13 Sapelem Load handling device
WO2010129964A1 (en) 2009-05-08 2010-11-11 The Board Of Trustees Of The University Of Illinois Drug targets for prevention of arrhythmia in heart disease
WO2012094651A2 (en) 2011-01-06 2012-07-12 The Board Of Trustees Of The University Of Illiois Scn5a splice variants for use in methods relating to sudden cardiac death and need for implanted cadiac defibrillators

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007014244A (en) * 2005-07-06 2007-01-25 Japan Health Science Foundation Method for testing genetic predisposition to ventricular conduction disorder or ventricular fibrillation, and reagent therefor
US20120129179A1 (en) * 2009-05-08 2012-05-24 The Board Of Trustees Of The University Of Illinois Scn5a splicing factors and splice variants for use in diagnostic and prognostic methods

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999056954A1 (en) 1998-05-06 1999-11-11 Caliper Technologies Corp. Methods of fabricating polymeric structures incorporating microscale fluidic elements
US20070212723A1 (en) 2006-02-17 2007-09-13 Dudley Samuel C Human sodium channel isoforms
WO2007133747A2 (en) 2006-05-15 2007-11-22 Wisconsin Alumni Research Foundation PULMONARY DELIVERY OF 1α,25-DIHYDROXYVITAMIN D3 AND CO-ADMINISTRATION OF PARATHYROID HORMONE OR CALCITONIN
WO2007141411A1 (en) 2006-06-07 2007-12-13 Sapelem Load handling device
WO2010129964A1 (en) 2009-05-08 2010-11-11 The Board Of Trustees Of The University Of Illinois Drug targets for prevention of arrhythmia in heart disease
WO2012094651A2 (en) 2011-01-06 2012-07-12 The Board Of Trustees Of The University Of Illiois Scn5a splice variants for use in methods relating to sudden cardiac death and need for implanted cadiac defibrillators

Non-Patent Citations (52)

* Cited by examiner, † Cited by third party
Title
"ASHP Handbook on Injectable Drugs, 4TH ED.", 1986, pages: 622 - 630
ADJEI; GARREN, PHARMACEUTICAL RESEARCH, vol. 7, no. 6, 1990, pages 565 - 569
AKAI ET AL., FEBS LETT, vol. 479, no. 1-2, 2000, pages 29 - 34
AMIN ET AL., ACTA PHYSIOL SCAND, vol. 185, no. 4, 2005, pages 291 - 301
ANTZELEVITCH ET AL., CIRCULATION, vol. 111, 2005, pages 659 - 670
ARNESTAD ET AL., CIRCULATION, vol. 115, no. 3, 2007, pages 361 - 367
BANKER AND CHALMERS: "Pharmaceutics and Pharmacy Practice", 1982, J. B. LIPPINCOTT COMPANY, pages: 238 - 250
BEZZINA ET AL., CIRC RES, vol. 85, no. 12, 1999, pages 1206 - 1213
CHEN ET AL., NATURE, vol. 392, no. 6673, 1998, pages 293 - 296
CORDEIRO ET AL., CIRCULATION, vol. 114, no. 19, 2006, pages 2026 - 2033
DESCHENES ET AL., CARDIOVASC RES, vol. 46, no. 1, 2000, pages 55 - 65
FRUSTACI ET AL., CIRCULATION, vol. 112, no. 24, 2005, pages 3680 - 3687
GLATTER ET AL., AM J CARDIOL, vol. 93, no. 10, 2004, pages 1320 - 1322
HONG ET AL., JMOL CELL CARDIOL, vol. 38, no. 4, 2004, pages 555 - 560
ITOH ET AL., J CARDIOVASC ELECTROPHYSIOL, vol. 16, no. 4, 2005, pages 378 - 383
KAPLINGER ET AL., HEART RHYTHM, vol. 7, no. 1, 2010, pages 33 - 46
KAWASHIMA ET AL., J CONTROLLED RELEASE, vol. 62, no. 1-2, 1999, pages 279 - 287
KELLER ET AL., CARDIOVASC RES, vol. 67, no. 3, 2005, pages 510 - 519
KELLER ET AL., CARDIOVASC RES, vol. 70, no. 3, 2006, pages 521 - 529
KINDT ET AL., CIRCULATION, vol. 104, no. 25, 2001, pages 3081 - 3086
KULICK AND SOPPLER: "medicine.net", article WEDRO, B.: "Sudden Cardiac Arrest (Sudden Cardiac Death"
LAI ET AL., J HUM GENET, vol. 50, no. 9, 2005, pages 490 - 496
LEVY-NISSENMAUM ET AL., GENET TEST., vol. 5, no. 4, 2001, pages 33 1 - 4
LIANG ET AL., CIRCULATION, vol. 114, no. 19, 2006, pages 2026 - 2033
LIU ET AL., PHARM RES, vol. 10, no. 2, 1993, pages 228 - 232
MAKITA ET AL., HEART RHYTHM, vol. 2, no. 10, 2005, pages 1128 - 1134
MAKIYAMA ET AL., JAM COLL CARDIOL, vol. 46, no. 11, 2005, pages 2100 - 2106
NIMURA ET AL., CIRC J, vol. 68, no. 8, 2004, pages 740 - 746
OLSON ET AL., JAMA, vol. 293, 2005, pages 447 - 454
PFAHNL ET AL., HEART RHYTHM, vol. 4, no. 1, 2006, pages 46 - 53
PRIORI ET AL., CIRCULATION, vol. 102, no. 20, 2000, pages 2509 - 2015
PRIORI ET AL., CIRCULATION, vol. 105, no. 11, 2002, pages 1342 - 7
QIAN ET AL., INT J PHARM, vol. 366, 2009, pages 218 - 220
RICHTER ET AL., EUR HEART J, vol. 31, 2010, pages 1357 - 1364
ROSSENBACKER ET AL., HEART RHYTHM, vol. 1, no. 5, 2004, pages 610 - 615
ROSSENBACKER ET AL., J MED GENET, vol. 42, no. 5, 2005, pages E29
SCHULZE-BAHR ET AL., HUM MUTAT, vol. 21, no. 6, 2003, pages 651 - 652
SHANG ET AL., CIRCULATION RESEARCH, vol. 101, 2007, pages 1146 - 1154
SHIN ET AL., J HUM GENET, vol. 49, no. 10, 2004, pages 573 - 578
SHIN ET AL., LIFE SCI, vol. 80, no. 8, 2007, pages 716 - 724
SMITH; MURPHY, DISCOVERY MEDICINE, vol. 11, no. 57, 2011, pages 106 - 114
SMITS ET AL., JAM COLL CARDIOL, vol. 40, no. 2, 2002, pages 350 - 356
SOVARI ET AL.: "Sudden Cardiac Death", E-MEDICINE CARDIOLOGY, 4 November 2010 (2010-11-04)
SPLAWSKI ET AL., CIRCULATION, vol. 102, no. 10, 2000, pages 1178 - 1185
TAKAHATA ET AL., LIFE SCI, vol. 72, no. 21, 2003, pages 2391 - 2399
TAKEHARA ET AL., J INTERN MED, vol. 255, no. 1, 2004, pages 137 - 142
TIAN ET AL., ZHONGHUA XIN XUE GUAN BING ZA ZHI, vol. 35, no. 12, 2007, pages 1122 - 1125
VATTA ET AL., MOL GENET METAB, vol. 75, no. 4, 2002, pages 317 - 324
WILDE ET AL., EUR HEART J., vol. 23, 2002, pages 1648 - 1654
YI ET AL., DI YI JUN YI DA XUE XUE BAO, vol. 23, no. 11, 2003, pages 1139 - 1142
YOKOI ET AL., HEART RHYTHM, vol. 2, no. 3, 2005, pages 285 - 292
ZHENG ET AL., CIRCULATION, vol. 104, 2001, pages 2158 - 2163

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017031342A1 (en) * 2015-08-20 2017-02-23 Rhode Island Hospital Circulating biomarker for brugada syndrome
EP3865591A1 (en) 2020-02-14 2021-08-18 Cardiomix S.r.l. Set of biomarkers for the diagnosis of brugada syndrome
WO2021161208A1 (en) 2020-02-14 2021-08-19 Cardiomix S.R.L. Set of biomarkers for the diagnosis of brugada syndrome
CN115485393A (en) * 2020-02-14 2022-12-16 卡迪奥米克斯有限责任公司 Set of biomarkers for diagnosing brugada syndrome
JP2023514292A (en) * 2020-02-14 2023-04-05 カーディオミックス エス.アール.エル. A biomarker set for the diagnosis of Brugada syndrome
CN113584156A (en) * 2021-08-09 2021-11-02 百世诺(北京)医疗科技有限公司 HCN4 mutant gene, mutant and Brugada syndrome detection kit
CN113637739A (en) * 2021-08-09 2021-11-12 百世诺(北京)医疗科技有限公司 A kind of SCN5A mutant gene, application and Brugada syndrome detection kit
CN113637739B (en) * 2021-08-09 2022-02-01 百世诺(北京)医疗科技有限公司 SCN5A mutant gene, application and Brugada syndrome detection kit
CN113584156B (en) * 2021-08-09 2022-02-18 百世诺(北京)医疗科技有限公司 A kind of HCN4 mutant gene and mutant, and Brugada syndrome detection kit
LU506463B1 (en) * 2024-02-26 2025-08-28 Governing Council Univ Toronto Methods and compositions for endogenous exon splicing using dcas13-rbm25 fusions

Also Published As

Publication number Publication date
WO2014152364A3 (en) 2015-01-15

Similar Documents

Publication Publication Date Title
Tiret et al. Lack of association between polymorphisms of eight candidate genes and idiopathic dilated cardiomyopathy: the CARDIGENE study
Biagini et al. Significance of sarcomere gene mutations analysis in the end-stage phase of hypertrophic cardiomyopathy
Kirwin et al. Tafazzin splice variants and mutations in Barth syndrome
JP6116485B2 (en) SCN5A splice variant for use in methods associated with sudden cardiac death
CN111868237A (en) Use of p38 inhibitors to reduce DUX4 expression
JP2013524809A (en) Means and methods for determining risk of cardiovascular disease
Tseng et al. Association of TGFBR2 polymorphism with risk of sudden cardiac arrest in patients with coronary artery disease
WO2015127517A1 (en) Oxidative stress and cardiovascular disease events
Pavel et al. A titin missense variant drives atrial electrical remodeling and is associated with atrial fibrillation
US20130189690A1 (en) SCN5A Splice Variants for Use in Methods Relating to Sudden Cardiac Death and Need for Implanted Cardiac Defibrillators
Allegue et al. Prevalence of HCM and long QT syndrome mutations in young sudden cardiac death-related cases
US10100363B2 (en) Biomarkers and treatments for heart failure
Kubo et al. Genetic screening and double mutation in Japanese patients with hypertrophic cardiomyopathy
CN116585308B (en) Methods and compositions for treating atrial fibrillation with Bucindolol
Zhang et al. Mechanisms of pathogenicity in the hypertrophic cardiomyopathy-associated TNNI3 c. 235C> T variant
JP2006520587A (en) Use of a novel polymorphism in the hsgk1 gene to diagnose hypertension and use of the sgk gene family to diagnose and treat long QT syndrome
Li et al. Comparison of the stage-dependent mitochondrial changes in response to pressure overload between the diseased right and left ventricle in the rat
Flanagan et al. Microarray analysis of liver gene expression in iron overloaded patients with sickle cell anemia and beta‐thalassemia
WO2017189951A1 (en) Methods for screening and diagnosing glaucoma
WO2017174421A1 (en) Biomarkers for the diagnosis of inflammation-related diseases
RU2762958C1 (en) Method for predicting the risk of developing coronary heart disease based on genetic testing data
Chawla et al. Genetic variants of Abo blood group and coronary artery disease
EP1673474B1 (en) C1ckb mutation as a diagnostic and therapeutical target
Acton Heart Failure: New Insights for the Healthcare Professional: 2011 Edition
Wijdeveld et al. The devil is in the details: Metabolomics to characterise the stages of atrial fibrillation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14733746

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14733746

Country of ref document: EP

Kind code of ref document: A2