WO2014151736A1 - Activation of bioluminescence by structural complementation - Google Patents

Activation of bioluminescence by structural complementation Download PDF

Info

Publication number
WO2014151736A1
WO2014151736A1 PCT/US2014/026354 US2014026354W WO2014151736A1 WO 2014151736 A1 WO2014151736 A1 WO 2014151736A1 US 2014026354 W US2014026354 W US 2014026354W WO 2014151736 A1 WO2014151736 A1 WO 2014151736A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
polypeptide
acid sequence
met
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/026354
Other languages
French (fr)
Inventor
Andrew S. DIXON
Lance Encell
Mary Hall
Keith Wood
Monika Wood
Marie SCHWINN
Brock F. Binkowski
Hicham Zegzouti
Nidhi Nath
Subhanjan Mondal
Said Goueli
Poncho Meisenheimer
Thomas Kirkland
James Unch
Dileep K. PULUKKUNAT
Matthew Robers
Melanie Dart
Thomas Machleidt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Promega Corp
Original Assignee
Promega Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL286816A priority Critical patent/IL286816B/en
Priority to SG11201507306VA priority patent/SG11201507306VA/en
Priority to DK14769752.8T priority patent/DK2970412T5/en
Priority to EP22182344.6A priority patent/EP4177261A1/en
Priority to KR1020157024687A priority patent/KR20150129721A/en
Priority to CN202310649630.0A priority patent/CN117024548A/en
Priority to KR1020237017712A priority patent/KR20230079494A/en
Priority to PL14769752.8T priority patent/PL2970412T3/en
Priority to AU2014236949A priority patent/AU2014236949C1/en
Priority to CA2906063A priority patent/CA2906063C/en
Priority to KR1020217008951A priority patent/KR102675860B1/en
Priority to ES14769752T priority patent/ES2926463T3/en
Priority to EP14769752.8A priority patent/EP2970412B1/en
Application filed by Promega Corp filed Critical Promega Corp
Priority to JP2016502113A priority patent/JP6654557B2/en
Priority to EP20197758.4A priority patent/EP3783011B1/en
Priority to EP22196592.4A priority patent/EP4169935A1/en
Priority to CN201480015213.XA priority patent/CN105143249A/en
Priority to BR112015023394A priority patent/BR112015023394B8/en
Publication of WO2014151736A1 publication Critical patent/WO2014151736A1/en
Priority to IL240985A priority patent/IL240985B/en
Anticipated expiration legal-status Critical
Priority to AU2018256548A priority patent/AU2018256548B2/en
Priority to IL273989A priority patent/IL273989B/en
Priority to AU2020213288A priority patent/AU2020213288B2/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531Production of immunochemical test materials
    • G01N33/532Production of labelled immunochemicals
    • G01N33/533Production of labelled immunochemicals with fluorescent label
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43509Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from crustaceans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/02Linear peptides containing at least one abnormal peptide link
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/66Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/581Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06QINFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
    • G06Q30/00Commerce
    • G06Q30/02Marketing; Price estimation or determination; Fundraising
    • G06Q30/0283Price estimation or determination
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06QINFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
    • G06Q30/00Commerce
    • G06Q30/06Buying, selling or leasing transactions
    • G06Q30/0601Electronic shopping [e-shopping]
    • G06Q30/0631Recommending goods or services
    • HELECTRICITY
    • H04ELECTRIC COMMUNICATION TECHNIQUE
    • H04WWIRELESS COMMUNICATION NETWORKS
    • H04W4/00Services specially adapted for wireless communication networks; Facilities therefor
    • H04W4/02Services making use of location information
    • HELECTRICITY
    • H04ELECTRIC COMMUNICATION TECHNIQUE
    • H04WWIRELESS COMMUNICATION NETWORKS
    • H04W4/00Services specially adapted for wireless communication networks; Facilities therefor
    • H04W4/30Services specially adapted for particular environments, situations or purposes
    • H04W4/35Services specially adapted for particular environments, situations or purposes for the management of goods or merchandise
    • HELECTRICITY
    • H04ELECTRIC COMMUNICATION TECHNIQUE
    • H04WWIRELESS COMMUNICATION NETWORKS
    • H04W4/00Services specially adapted for wireless communication networks; Facilities therefor
    • H04W4/30Services specially adapted for particular environments, situations or purposes
    • H04W4/38Services specially adapted for particular environments, situations or purposes for collecting sensor information
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent (e.g., substantially non-luminescent) peptide and/or polypeptide units are provided herein.
  • bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with another, complementary non-luminescent peptide.
  • the present invention relates to compositions comprising complementary non- luminescent amino acid chains (e.g., substantially non-luminescent peptides and/or polypeptides that are not fragments of a preexisting protein), complexes thereof, and methods of generating an optically detectable bioluminescent signal upon association of the non-luminescent amino acid chains (e.g., peptides and/or polypeptides).
  • the present invention provides two or more non-luminescent, or substantially non-luminescent peptides and/or polypeptides, that, when brought together, assemble into a bioluminescent complex.
  • a pair of substantially non-luminescent peptide and/or polypeptide units assembles into a bioluminescent complex.
  • three or more substantially non-luminescent peptide and/or polypeptide units assemble into a bioluminescent complex (e.g., ternary complex, tertiary complex, etc.).
  • a bioluminescent complex e.g., ternary complex, tertiary complex, etc.
  • the assembled pair catalyzes a chemical reaction of an appropriate substrate into a high energy state, and light is emitted.
  • a bioluminescent complex exhibits luminescence in the presence of substrate (e.g., coelenterazine, furimazine, etc.).
  • the embodiments described herein relating to luminescence should be viewed as applying to complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides that are not fragments of a preexisting protein) that separately lack a specified detectable activity (e.g., enzymatic activity) or substantially non-enzymatically active subunits of a polypeptide, complexes thereof, and methods of generating the detectable activity (e.g., an enzymatic activity) upon association of the complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides).
  • embodiments described herein that refer to non-luminescent peptides and/or polypeptides are applied, in some embodiments, to substantially non-luminescent peptides and/or polypeptides.
  • the invention is further directed to assays for the detection of molecular interactions between molecules of interest by linking the interaction of a pair of non-luminescent
  • a pair of a non-luminescent elements are tethered (e.g., fused) to molecules of interest and assembly of the bioluminescent complex is operated by the molecular interaction of the molecules of interest. If the molecules of interest engage in a sufficiently stable interaction, the bioluminescent complex forms, and a bioluminescent signal is generated. If the molecules of interest fail to engage in a sufficiently stable interaction, the bioluminescent complex will not form or only form weakly, and a bioluminescent signal is not detectable or is substantially reduced (e.g., substantially
  • the magnitude of the detectable bioluminescent signal is proportional (e.g., directly proportional) to the amount, strength, favorability, and/or stability of the molecular interactions between the molecules of interest.
  • the present invention provides peptides comprising an amino acid sequence having less than 100% (e.g., 20%... 30%... 40%... 50%... 60%... 70%... 80%, or more) sequence identity with SEQ ID NO: 2, wherein a detectable bio luminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440.
  • the present invention provides peptides comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440.
  • 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%
  • a detectable bioluminescent signal is produced when the peptide contacts a polypeptide having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440.
  • the detectable bioluminescent signal is produced, or is substantially increased, when the peptide associates with the polypeptide comprising or consisting of SEQ ID NO: 440, or a portion thereof.
  • the peptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 2, wherein the traits are selected from: affinity for the polypeptide consisting of SEQ ID NO: 440, expression, intracellular solubility, intracellular stability and bioluminescent activity when combined with the polypeptide consisting of SEQ ID NO: 440.
  • the peptide amino acid sequence may be selected from amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365.
  • fusion polypeptides comprise: (a) an above described peptide, and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
  • bioluminescent complexes comprise: (a) a first fusion polypeptide described above and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement polypeptide that emits a detectable bioluminescent signal when associated with the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2; wherein the first fusion polypeptide and second fusion polypeptide are associated; and wherein the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2 and the complement polypeptide are associated.
  • the present invention provides polypeptides comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2.
  • the present invention provides polypeptides comprising an amino acid sequence having less than 100%) and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein a detectable bio luminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2.
  • a detectable bioluminescent signal is produced when the polypeptide contacts a peptide having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2.
  • the polypeptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 440, wherein the traits are selected from: affinity for the peptide consisting of SEQ ID NO: 2, expression, intracellular solubility, intracellular stability, and bioluminescent activity when combined with the peptide consisting of SEQ ID NO: 2.
  • the polypeptide amino acid sequence may be selected from one of the amino acid sequences of SEQ ID NOS: 441-2156.
  • the detectable bioluminescent signal is produced when the polypeptide associates with the peptide consisting of SEQ ID NO: 2.
  • a fusion polypeptide is provided that comprises: (a) a polypeptide described above and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
  • a bioluminescent complex comprises: (a) a first fusion polypeptide described above; and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement peptide that causes the polypeptide comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440 to emit a detectable
  • the present invention provides nucleic acids (e.g., DNA, RNA, etc.), oligonucleotides, vectors, etc., that code for any of the peptides, polypeptides, fusion proteins, etc., described herein.
  • a nucleic acid comprising or consisting of one of the nucleic acid sequences of SEQ ID NOS : 3-438 and 2162-2365 (coding for non- luminescent peptides) and/or SEQ ID NOS 441-2156 (coding for non-luminescent polypeptides) are provided.
  • other nucleic acid sequences coding for amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 and/or SEQ ID NOS 441-2156 are provided.
  • the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% sequence identity (e.g., >99%, ⁇ 95%, ⁇ 90%, ⁇ 80%, ⁇ 70%, ⁇ 60%, ⁇ 50%, etc.) with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence.
  • a peptide comprising a peptide amino acid sequence having less than 100% sequence identity e.g., >99%, ⁇ 95%, ⁇ 90%, ⁇ 80%, ⁇ 70%, ⁇ 60%,
  • the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence.
  • the peptide amino acid sequence is selected from one of the amino acid sequences
  • bioluminescent complexes comprise: (a) a first amino acid sequence that is not a fragment of a preexisting protein; and (b) a second amino acid sequence that is not a fragment of a preexisting protein, wherein the bioluminescent complex exhibits detectable luminescence, wherein the first amino acid sequence and the second amino acid sequence are associated.
  • Some such bioluminescent complexes further comprise: (c) a third amino acid sequence comprising a first member of an interaction pair, wherein the third amino acid sequence is covalently attached to the first amino acid sequence; and (d) a fourth amino acid sequence comprising a second member of an interaction pair, wherein the fourth amino acid sequence is covalently attached to the second amino acid sequence.
  • interactions e.g., non-covalent interactions (e.g., hydrogen bonds, ionic bonds, van der Waals forces, hydrophobic interactions, etc.) covalent interactions (e.g., disulfide bonds), etc.) between the first amino acid sequence and the second amino acid sequence do not significantly associate the first amino acid sequence and the second amino acid sequence in the absence of the interactions between the first member and the second member of the interaction pair.
  • a first polypeptide chain comprises the first amino acid sequence and the third amino acid sequence
  • a second polypeptide chain comprises the second amino acid sequence and the fourth amino acid sequence.
  • the first polypeptide chain and the second polypeptide chain are expressed within a cell.
  • the present invention provides a bioluminescent complex comprising: (a) a pair of non-luminescent elements, wherein each non-luminescent element is not a fragment of a preexisting protein; (b) an interaction pair, wherein each interaction element of the interaction pair is covalently attached to one of the non- luminescent elements.
  • Various embodiments described herein provide methods of detecting an interaction between a first amino acid sequence and a second amino acid sequence comprising, for example, the steps of: (a) attaching the first amino acid sequence to a third amino acid sequence and attaching the second amino acid sequence to a fourth amino acid sequence, wherein the third and fourth amino acid sequences are not fragments of a preexisting protein, wherein a complex of the third and fourth amino acid sequences emits a detectable bioluminescent signal (e.g.,
  • attaching the first amino acid sequence to the third amino acid sequence and the second amino acid sequence to the fourth amino acid sequence comprises forming a first fusion protein comprising the first amino acid sequence and the third amino acid sequence and forming a second fusion protein comprising the second amino acid sequence and the fourth amino acid sequence.
  • the first fusion protein and the second fusion protein further comprise linkers between said first and third amino acid sequences and said second and fourth amino acid sequences, respectively.
  • the first fusion protein is expressed from a first nucleic acid sequence coding for the first and third amino acid sequences
  • the second fusion protein is expressed from a second nucleic acid sequence coding for the second and fourth amino acid sequences.
  • a single vector comprises the first nucleic acid sequence and the second nucleic acid sequence.
  • the first nucleic acid sequence and the second nucleic acid sequence are on separate vectors.
  • the steps of (a) "attaching” and (b) "placing” comprise expressing the first and second fusion proteins within a cell.
  • methods of creating, producing, generating, and/or optimizing a pair of non-luminescent elements comprising: (a) aligning the sequences of three or more related proteins; (b) determining a consensus sequence for the related proteins; (c) providing first and second fragments of a protein related to three or more proteins (or providing first and second fragments of one of the three or more proteins), wherein the fragments are individually substantially non-luminescent but exhibit luminescence upon interaction of the fragments; (d) mutating the first and second fragments at one or more positions each, wherein the mutations alter the sequences of the fragments to be more similar to a corresponding portion of the consensus sequence (e.g., wherein the mutating results in a pair of non-luminescent elements that are not fragments of a preexisting protein), and (e) testing the pair of non-luminescent elements for the absence (e.g., essential absence, substantial absence, etc.) of luminescence when unassociated, and luminescence upon association of the non-
  • the non-luminescent elements exhibit enhancement of one or more traits compared to the first and second fragments, wherein the traits are selected from: increased reconstitution affinity, decreased reconstitution affinity, enhanced expression, increased intracellular solubility, increased intracellular stability, and increased intensity of reconstituted luminescence.
  • the present invention provides detection reagents comprising: (a) a polypeptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2, and (b) a substrate for a bioluminescent complex produced by the polypeptide and a peptide consisting of SEQ ID NO: 2.
  • the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440.
  • the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440.
  • GVTGWRLCKRISA (SEQ ID NO: 236) peptide on luminescence resulting from
  • Figure 2 shows a graph depicting the effect of various mutations of the SEQ ID NO: 440 polypeptide on luminescence resulting from complementation with GVTGWRLCKRISA (SEQ ID NO: 236) or GVTGWRLFKRISA (SEQ ID NO: 108) peptides.
  • Figure 3 A shows the luminescence (RLUs) detected in each non-luminescent polypeptide (NLpoly) mutant containing a single glycine to alanine substitution.
  • Figure 3B shows the fold increase in luminescence over wild-type.
  • Figure 4A show the luminescence (RLUs) detected in each NLpoly mutant containing a composite of glycine to alanine substitutions.
  • Figure 4B shows the fold increase in luminescence over wild-type.
  • Figure 5 shows a graph depicting the luminescence (RLUs) detected in HT-NLpeptide fusions.
  • Figure 6 shows a graph depicting the luminescence (RLUs) detected in HT-NLpep fusions.
  • Figure 7 shows a graph depicting the luminescence (RLUs) detected in NLpeptide-HT fusions.
  • Figure 8 shows the luminescence (RLUs) generated by a luminescent complex after freeze-thaw cycles of non- luminescent peptide (NLpep).
  • Figure 9 shows concentration normalized activity of peptides, and the TMR gel used to determine the relative concentrations.
  • Figure 10 shows a graph of the luminescence of various mutations of residue Rl 1 of NLpoly-5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 11 shows a graph of the luminescence of various mutations of residue A15 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 12 shows a graph of the luminescence of various mutations of residue LI 8 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 13 shows a graph of the luminescence of various mutations of residue F31 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 14 shows a graph of the luminescence of various mutations of residue V58 of
  • NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 15 shows a graph of the luminescence of various mutations of residue A67 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 16 shows a graph of the luminescence of various mutations of residue Ml 06 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 17 shows a graph of the luminescence of various mutations of residue LI 49 of
  • NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 18 shows a graph of the luminescence of various mutations of residue VI 57 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
  • Figure 19 shows a graph of the luminescence of NLpep-HT fusions.
  • Figure 20 shows a graph of the luminescence of NLpep-HT fusions, and a TMR gel indicating their relative expression levels.
  • Figure 21 shows a graph of the luminescence of NLpep-HT fusions.
  • Figure 22 shows a graph of the luminescence of NLpoly 5A2 (top)
  • NLpoly5A2+Rl IE in the presence of various NLpeps (bottom) .
  • Figure 23 shows a graph of the luminescence of NLpep-HT fusions.
  • Figure 24 shows a graph of the luminescence of NLpolys 1-13 with NLpep53 (top) and without complimentary peptide (bottom).
  • Figure 25 shows a graph of the luminescence of various NLpolys with NLpep53 with
  • Figure 26 shows a graph comparing luminescence in the presence of a ratio of furimazine with coelenterazine for various NLpolys and NLpep53.
  • Figure 27 shows a graph comparing luminescence in the presence of a ratio of furimazine to coelenterazine for various NLpolys and NLpep53.
  • Figure 28 shows a graph comparing luminescence in the presence of furimazine with coelenterazine for various NLpolys and NLpep53 in HEK293 cell lysate.
  • Figure 29 shows a graph of the luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine.
  • Figure 30 shows a graph of the signal/background luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine.
  • Figure 31 shows a graph of luminescence and substrate specificity of various NLpoly mutants with NLpep69 using either furimazine or coelenterazme as a substrate.
  • Figure 32 shows a comparison of luminescence and substrate specificity of various
  • Figure 33 shows a comparison of luminescence and substrate specificity of NLpoly mutants with NLpep78 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
  • Figure 34 shows a comparison of luminescence and substrate specificity of various NLpoly mutants with NLpep79 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
  • Figure 35 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys.
  • Figure 36 shows a graph of the luminescence of various NLpolys in the absence of
  • Figure 37 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys with either furimazine or coelenterazme substrates.
  • Figure 38 shows a graph of the luminescence of NLpep78-HT with various NLpolys expressed in CHO and HeLa cells.
  • Figure 39 shows graphs of raw and normalized luminescence from NLpoly fused to firefly luciferase expressed in HEK293, Hela, and CHO cell lysates.
  • Figure 40 shows graphs of raw and normalized luminescence from NLpoly fused to click beetle red luciferase expressed in HEK293, Hela, and CHO cell lysates.
  • Figure 41 shows a graphs of luminescence of complementation in live cells using either NLpoly wild-type or 5P.
  • Figure 42 shows graphs of luminescence of cell-free complementation of NLpep78-HT fusion (top) and NLpep79-HT fusion (bottom) with various NLpolys.
  • Figure 43 shows a graph of binding affinities for various combinations of NLpeps and NLpolys expressed in HeLa, HEK293 and CHO cell lysate.
  • Figure 44 shows a graph of binding affinities for various combinations of NLpeps and NLpolys in PBS or NANOGLO buffer.
  • Figure 45 shows a graph of binding affinities for NLpoly 5P with NLpep9 or NLpep53 expressed in HeLa, HEK293 or CHO cell lysate.
  • Figure 46 shows a graph of luminescence of varying amounts of NLpolys in the absence of NLpep.
  • Figure 47 shows a graph of background luminescence of various NLpoly variants.
  • Figure 48 shows a graph of background luminescence of various NLpoly variants.
  • Figure 49 shows a SDS-PAGE gel of total lysate and soluble fraction of several NLpoly variants
  • Figure 50 shows (a) a SDS-PAGE gel of the total lysate and soluble fraction of NLpoly variants and (b) background luminescence of NLpoly variants.
  • Figure 51 shows graphs of the luminescence generated with several NLpoly variants when complemented with lOnm (right) or lOOnM (left) of NLpep78.
  • Figure 52 shows graphs depicting background luminescence in E. coli lysate of various NLpoly variants.
  • Figure 53 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep78.
  • Figure 54 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep79.
  • Figure 55 shows a graph of signal to background of various NLPolys variants complemented with NLpep78 or NLpep79 and normalized to NLpoly 5P.
  • Figure 56 shows a graph depicting background, luminescence with NLpep79 (right) or NLpep78 (left) and signal-to-noise or various NLpoly variants.
  • Figure 57 shows a SDS-PAGE gel of the total lysate and soluble fraction in various NLpoly 5P variants.
  • Figure 58 shows (A) the amount of total lysate and soluble fraction of NLpoly 5P and
  • NLpoly I107L (B) luminescence generated by NLpoly 5P or NLpoly I107L without NLpep or with NLpep78 or NLpep79 and (C) the improved signal-to-background of NLpoly I107L over NLpoly 5P.
  • Figure 59 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
  • Figure 60 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
  • Figure 61 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
  • Figure 62 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
  • Figure 63 shows binding affinity between an elongated NLpoly variant (additional amino acids at the C-terminus) and a shortened NLpep (deleted amino acids at the N-terminus).
  • Figure 64 shows a graph of binding affinity of various NLpoly variants with NLpep78.
  • Figure 65 shows the binding and Vmax of NLpep80 and NLpep87 to 5P expressed in mammalian cells (CHO, HEK293T and HeLa).
  • Figure 66 shows the binding and Vmax of NLpep80 and NLpep87 to NLpoly 5P expressed in E. coli.
  • Figure 67 shows a graph of luminescence of shortened NLpolys with elongated NLpeps.
  • Figure 68 shows graphs of Kd and Vmax of NLpoly 5P in HeLa lysate with various complementary NLpeps.
  • Figure 69 shows a graph of binding affinities for several NLpoly variants with NLpep81.
  • Figure 70 shows a graph of binding affinities for several NLpoly variants with NLpep82.
  • Figure 71 shows a graph of binding affinities for several NLpoly mutants with NLpep78.
  • Figure 72 shows a graph of Michaelis constants for several NLpoly mutants with NLpep78.
  • Figure 73 shows graphs of luminescence from a tertiary complementation of two NLpeps and NLpoly 5P-B9.
  • Figure 74 shows a graph of luminescence of titration of NLpoly 5P with NLpep88-HT.
  • Figure 75 shows images of intracellular localization of various NLpep fusions with HaloTag (HT).
  • Figure 76 shows images of intracellular localization of NLpoly(wt) and NLpoly(5P).
  • Figure 77 demonstrates the ability to detect via complementation an NLPep-conjugated protein of interest following separation by SDS-PAGE and transfer to a PVDF membrane.
  • Figure 78 shows a graph of relative luminescent signal from various NLpoly variants compared to NLpoly 5P (in the absence of NLpep).
  • Figure 79 shows a graph of relative luminescent signal over background from various NLpolys compared to NLpoly 5P (in the absence of NLpep).
  • Figure 80 compares the dissociation constants for NLpeps consisting of either 1 or 2 repeat units of NLpep78.
  • Figure 81 shows the affinity between NLpoly 5A2 and NLpep86.
  • Figure 82 shows graphs of the luminescence from NLpoly variants without NLpep, with NLpep78, and NLpep79.
  • Figure 83-90 show the dissociation constants as well as the Vmax values for NLpoly
  • 5A2, 5P, 8S and 1 IS with 96 variants of NLpeps.
  • Figure 91 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
  • Figure 92 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants as well as a table containing the dissociation constants for the same variants.
  • Figure 93 shows the substrate specificity for NLpoly 5P and 1 IS with NLpep79 and demonstrates that NLpoly 1 IS has superior specificity for furimazine than 5P.
  • Figure 94 shows an image of a protein gel that follows the affinity purification of NLpoly
  • Figure 95 contains a table of the association and dissociation rate constants for the binding of NLpoly WT or 1 IS to NLpepWT, 78 or 79.
  • Figure 96 shows the Km values for various pairs of NLpoly/NLpep.
  • Figure 97 compares the dissociation constant for NLpoly 1 lS/NLpep79 at sub-saturating and saturating concentrations of furimazine.
  • Figure 98 compares the Km values for NLpoly 5A2 with NLpepWT, 78 and 79.
  • Figure 99 shows the luminescence of NLpolys from various steps in the evolution process in the absence of NLpep.
  • Figure 100 shows the improvement in luminescence from E. co/z-derived NLpoly over the course of the evolution process with an overall ⁇ 10 5 improvement (from
  • Figure 101 shows the improvement in luminescence from HeLa-expressed NLpoly over the course of the evolution process with an overall ⁇ 10 5 improvement (from
  • Figure 102 shows the improvement in luminescence from HEK293 cell-expressed NLpoly over the course of the evolution process with an overall ⁇ 10 4 improvement (from
  • Figure 103 shows dissociation constants and demonstrates a ⁇ 10 4 fold improvement in binding affinity from NLpolyWT:NLpepWT to NLpoly 11 S :NLpep86.
  • Figure 104 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants from various steps of the evolution process.
  • Figure 105 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
  • Figure 106 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
  • Figure 107 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
  • Figure 108 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 15 min treatment with rapamycin or vehicle.
  • Fold induction refers to signal generated in the presence of rapamycin compared to signal generated with vehicle.
  • Figure 109 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 60 min treatment with rapamycin or vehicle.
  • Figure 110 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle.
  • Figure 111 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle. All 8 possible combinations of FRB and FKBP fused to
  • NLpoly/NLpep were tested and less total DNA was used.
  • Figure 112 shows a comparison of luminescence generated by FRB or FKBP fusions expressed in the absence of binding partner.
  • Figure 113 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
  • Figure 114 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner.
  • Figure 115 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA. This example differs from Figure 113 in that lower levels of DNA were used.
  • Figure 116 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner. This differs from Figure 114 in that lower levels of DNA were used.
  • Figure 117 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80 DNA after treatment with rapamycin for different lengths of time.
  • Figure 118 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep87 DNA after treatment with rapamycin for different lengths of time.
  • Figure 119 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5P with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
  • Figure 120 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
  • Figure 121 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 or FRB-NLpolyl lS with FKBP- NLpep 101/104/105/106/107/108/109/110.
  • Figure 122 shows a comparison of luminescence generated by cells transfected with different combinations of FRB-NLpoly5 A2 or FRB-NLpolyl lS with FKBP- NLpep87/96/98/99/l 00/101/102/103.
  • Figure 123 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpolyl lS and FKBP-NLpep87/l 01/102/107 DNA.
  • Figure 124 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpoly5 A2 and FKBP-NLpep87/l 01/102/107 DNA.
  • Figure 125 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
  • Figure 126 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5A2 or FRB-NLpolyl lS and FKBP-NLpep87/101 DNA.
  • Figure 127 shows a comparison of luminescence generated by cells expressing FRB-11S and FKBP-101 and treated with substrate PBI-4377 or furimazine.
  • Figure 128 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added manually.
  • Figure 129 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added via instrument injector.
  • Figure 130 shows luminescence generated by FRB-NLpolyl lS and FKBP-NLpeplOl as measured on two different luminescence-reading instruments.
  • Figure 131 provides images showing luminescence of cells expressing FRB-NLpolyl lS and FKBP-NLpep 101 at various times after treatment with rapamycin.
  • Figure 132 provides a graph showing Image J quantitation of the signal generated by individual cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl at various times after treatment with rapamycin.
  • Figure 133 shows a comparison of luminescence in different cell lines expressing FRB- NLpoly 11 S and FKBP-NLpep 101.
  • Figure 134 shows a comparison of luminescence generated by cells expressing FRB- NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506.
  • Figure 135 shows (left side) luminescence generated by cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506, and (right side) the percent of luminescence remaining after treatment with FK506.
  • Figure 136 shows luminescence generated by cells transfected with different
  • V2R-NLpoly5A2 or V2R-NLpolyl lS with NLpep87/101-ARRB2 in the presence or absence of the V2R agonist AVP.
  • Figure 137 shows an AVP treatment time course showing luminescence generated by cells transfected with V2R-NLpoly 11 S and NLpep87/l 01 -ARRB2 after treatment with AVP wherein AVP was added manually.
  • Figure 138 shows an AVP treatment time course showing luminescence generated by cells transfected with different combinations of V2R-NLpoly5A2 or V2R-NLpolyl lS with
  • NLpep87/101-ARRB2 after treatment with AVP wherein AVP was added via instrument injector.
  • Figure 139 shows an AVP treatment time course at 37°C showing luminescence generated by cells expressing different configurations of V2R and ARRB2 fused to NLpolyl lS and NLpep 101 after treatment with AVP.
  • Figure 140 shows a comparison of luminescence in different cell lines expressing V2R- NLpep 11 S and NLpep 101 -ARRB2.
  • Figure 141 shows 60X images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
  • Figure 142 shows 15 OX images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
  • Figure 143 shows a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
  • Figure 144 shows the dissociation constants for NLpoly 5P and combinations of mutations at positions 31, 46, 75, 76, and 93 in NLpoly 5P.
  • Figure 145 shows a transferase example of post translational modification enzyme activity detection using an NLpep and aminopeptidase.
  • Figure 146 shows a hydrolase example of post translational modification enzyme activity detection using an NLpep and methyl-specific antibody.
  • Figure 147 contains wavelength scans for NLpoly WT complemented with either NLpep WT or NLpep WT conjugated to TMR.
  • Figure 148 contains wavelength scans for NanoLuc fused to HaloTag (NL-HT) and
  • NCT Non-chloroTOM
  • Figure 149 shows a schematic a tertiary interaction wherein the energy transfer with an NLpoly and NLpep can also be used to measure three molecules interacting.
  • a GPCR labeled with an NLpoly and a GPCR interacting protein labeled with an NLpep form a bioluminescent complex when they interact. This allows measurement of the binary interaction. If a small molecule GPCR ligand bearing an appropriate fluorescent moiety for energy transfer interacts with this system, energy transfer will occur. Therefore, the binary protein-protein interaction and the ternary drug-protein-protein interaction can be measured in the same experiment.
  • Figure 150 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep78 and NLPep78 at the N- or C-terminus of a fusion partner (HaloTag).
  • Figure 151 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep79 and NLPep79 at the N- or C-terminus of a fusion partner (HaloTag).
  • Figure 152 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with
  • Figure 153 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5434.
  • Figure 154 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5436.
  • Figure 155 shows a graph demonstrating furimazine binding affinity in affinity buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114.
  • Figure 156 shows a graph demonstrating furimazine binding affinity in NanoGlo assay buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114.
  • Figure 157 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
  • Figure 158 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
  • Figure 159 shows a graph depicting Vmax and Bmax NLPolyl 56, NLPolyl IS, and NanoLuc® luciferase (Nluc) with NLPepl .
  • Figure 160 shows a graph depicting RLU as a function of NLPep concentration for
  • Figure 161 shows a Western blot depicting expression level in HEK293T cells of NLPolyl 56 and NLPolyl IS compared to full-length NanoLuc® luciferase.
  • Figure 162 shows graphs depicting a comparison of the affinity of the ⁇ -lactamase SME and its inhibitor BLIPY50A as unfused proteins or when fused to NLPolyl IS and NLPepl 14.
  • Figure 163 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpeplOl/111-136
  • Figure 164 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpepl 14 and 137-143.
  • Figure 165 shows rapamycin dose response curves of cells expressing FRB-NLpolyl IS and FKBP-NLpep78/79/99/l 01/104/114/128
  • Figure 166 shows response of cells expressing FRB-NLpolyl IS and FKBP- 78/79/99/101/104/114/128 to the rapamycin competitive inhibitor FK506
  • Figure 167 shows a comparison of luminescence generated by cells transfected with different ratios of FRB-NLpolyl IS and FKBP-NLpepl 14.
  • Figure 168 shows a comparison of luminescence generated by cells expressing
  • Figure 169 shows graphs depicting rapamycin (A) dose-specific and (B) time-specific induction of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals.
  • Figure 170 shows graphs depicting FK506(A) dose-specific and (B) time-specific inhibition of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals.
  • Figure 171 shows Western blots depicting similar expression levels of FKBP-NLpepl 14 and FKBP-Fluc(394-544) at equal levels of transfected DNA.
  • Figure 172 shows graphs depicting (A) dose-specific and (B) time-specific inhibition of NLpolyl 1S-BRD4 and Histone H3.3-NLpepl 14 interaction by IBET-151.
  • Figure 173 shows a graph depicting dose dependent increases in RAS/CRAF
  • Figure 174 shows a graph depicting RLU as a function of NLPep concentration for NLpolyl IS and NLpep86, wt, and NLpepl 14.
  • Figure 175 shows a schematic of an assay utilizing a high affinity peptide of a
  • luminescent pair as an intracellular protein tag and the polypeptide of the luminescent pair as a detection reagent.
  • Figure 176 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and MLpep86.
  • Figure 177 shows images demonstrating the sensitivity of detecting proteins tagged with a high affinity NLPep using 1 IS. This figure also compares the detection using NLPep/NLPoly to the detection using fluorescently labeled HaloTag.
  • Figure 178 shows a graph demonstating the stability of NLpolyl IS.
  • Figure 179 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and NLpep78.
  • Figure 180 shows a summary of NLpep sequences.
  • High affinity (spontaneous) peptides are those peptides (NLpep) which bind to NLpolyl IS with high affinity.
  • Dark/Quencher peptides are those peptides (NLpep) which can reduce the levels of light being produced or detected from NLpolyl IS.
  • Figure 181 shows a schematic for the concept of structural complementation where the LSP and SSP (i.e., NLpoly and NLpep) are brought together to produce a bioluminescent signal (panels A, B). Upon disruption of a protein interaction (i.e. X and Y), LSP and SSP come apart resulting in a decrease in luminescence (Panel C).
  • LSP and SSP i.e., NLpoly and NLpep
  • Figure 182 A shows two options (A, B) for engineering structural complementation to be a loss of signal upon protein interaction between X and Y and a gain of signal upon disruption of the interaction between X and Y.
  • Option A represents intermolecular structural complementation.
  • Option B represents intramolecular structural complementation.
  • Figure 182B shows a list of genetic constructs that could be suitable for intramolecular structural complementation.
  • Figure 183 shows (A) inhibition of NLpolyl IS and NLpepl 14 binding by various dark peptides, and (B) dose-dependent inhibition by Lys-162 and Gin- 162 peptides.
  • Figure 184 A shows that inhibition by Q-162 and A- 162 is dose-dependent.
  • Panel B shows that Q-162 produces a signal on its own in a dose-dependent manner, while the dose- dependency of A- 162 is subtle at best.
  • Figure 185 shows graphs demonstrating dose-response of the dark peptides with CP Nluc.
  • Figure 186 shows graphs depicting a time course of dark peptide with CP Nluc.
  • Figure 187 shows the dark peptide dose-dependent inhibition of luminescence generated from FRB-NLpolyl IS alone and also between FRB-NLpolyl IS and FKBP-NLpepl 14 in the presence and absence of rapamycin.
  • Figure 188 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (RLU) .
  • Figure 189 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (normalized to no dark peptide control; 100%).
  • Figure 190 shows that the dark peptides, when fused to FKBP, can compete with both low (114) and high (80) affinity peptides (also FKBP fusions) and as a result reduce the total luminescence being produced and detected in live cells.
  • Figure 191 shows the signal comparison between Flue and NLpep86-based assays for intracellular levels of Flue.
  • Figure 192 shows graphs demonstrating the utility of tandem linked NLpeps in complementing Npoly 11 S .
  • Figure 193 shows a graph demonstrating that NLpoly and NLpep components do not interfere with intracellular degradation of reporter protein FlucP.
  • Figure 194 shows a schematic demonstrating and extracellular protease activity assay.
  • Figure 195 shows a schematic of an assay for measuring the activity of an enzyme using a ProNLpep.
  • Figure 196 shows a schematic of an assay for screening antibodies, proteins, peptides or transporters that mediate cellular internalization.
  • Figure 197 shows a schematic of a post-translational modification transferase assay.
  • Figure 198 shows a schematic of a post-translational modification hydrolase assay.
  • Figure 199 shows graphs correlating Tyrosine Kinase SRC activity with luminescence over background in a post-translational modification assay.
  • Figure 200 shows a graph depicting spontaneous complementation of three different versions of NLpolyl IS with twelve synthetic peptides.
  • Figure 201 shows a schematic of a homogeneous immunoassay format utilizing fusions of NLpep and NLpoly with separate binding moieties A and B.
  • Figure 202 shows graphs demonstrating: (A) reduction in background luminescence from NLpolyl IS upon complex formation with GWALFKK and Dabcyl-GWALFKK, and (B) NLpep86 forms a complex with NLpolyl IS in the presence of GWALFKK and Dabcyl - GWALFKK.
  • Figure 203 shows graphs demonstrating: (A) VTGWALFEEIL (Trp 1 lmer) and
  • VTGYALFEEIL Tyr 1 lmer induce luminescence over background (NLpolyl IS alone; no peptide control), and that the N-terminal Dabcyl versions of each provide significant quenching of this signal, and (B) that NLpep86 forms a complex with NLpolyl IS in the presence of Dabcyl versions of Trp 1 lmer and Tyr 1 lmer.
  • the term "substantially” means that the recited characteristic, parameter, and/or value need not be achieved exactly, but that deviations or variations, including for example, tolerances, measurement error, measurement accuracy limitations and other factors known to skill in the art, may occur in amounts that do not preclude the effect the characteristic was intended to provide.
  • a characteristic or feature that is substantially absent e.g.,
  • substantially non-luminescent may be one that is within the noise, beneath background, below the detection capabilities of the assay being used, or a small fraction (e.g., ⁇ 1%, ⁇ 0.1%, ⁇ 0.01%, ⁇ 0.001%, ⁇ 0.00001%, ⁇ 0.000001%, 0.0000001%) of the significant characteristic (e.g., luminescent intensity of a biolummescent protein or biolummescent complex).
  • bioluminescence refers to production and emission of light by a chemical reaction catalyzed by, or enabled by, an enzyme, protein, protein complex, or other biomolecule (e.g., biolummescent complex).
  • a substrate for a biolummescent entity e.g., biolummescent protein or biolummescent complex
  • the substrate subsequently emits light.
  • the term "complementary” refers to the characteristic of two or more structural elements (e.g., peptide, polypeptide, nucleic acid, small molecule, etc.) of being able to hybridize, dimerize, or otherwise form a complex with each other.
  • structural elements e.g., peptide, polypeptide, nucleic acid, small molecule, etc.
  • Complementary peptide and polypeptide are capable of coming together to form a complex.
  • Complementary elements may require assistance to form a complex (e.g., from interaction elements), for example, to place the elements in the proper conformation for complementarity, to co-localize complementary elements, to lower interaction energy for complementary, etc.
  • the term “complex” refers to an assemblage or aggregate of molecules (e.g., peptides, polypeptides, etc.) in direct and/or indirect contact with one another.
  • "contact,” or more particularly, “direct contact” means two or more molecules are close enough so that attractive noncovalent interactions, such as Van der Waal forces, hydrogen bonding, ionic and hydrophobic interactions, and the like, dominate the interaction of the molecules.
  • a complex of molecules e.g., a peptide and polypeptide
  • the term “complex” unless described as otherwise, refers to the assemblage of two or more molecules (e.g., peptides, polypeptides or a combination thereof).
  • non-luminescent refers to an entity (e.g., peptide, polypeptide, complex, protein, etc.) that exhibits the characteristic of not emitting a detectable amount of light in the visible spectrum (e.g., in the presence of a substrate).
  • an entity may be referred to as non-luminescent if it does not exhibit detectable luminescence in a given assay.
  • non-luminescent is synonymous with the term “substantially non- luminescent.
  • a non-luminescent polypeptide is substantially non- luminescent, exhibiting, for example, a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl0 3 -fold, lxl0 4 -fold, lxl0 5 -fold, lxl0 6 -fold, lxl 0 7 -fold, etc.) reduction in luminescence compared to a complex of the NLpoly with its non-luminescent complement peptide.
  • an entity is "non-luminescent" if any light emission is sufficiently minimal so as not to create interfering background for a particular assay.
  • non-luminescent peptide e.g., NLpep
  • non-luminescent polypeptide e.g., NLpoly
  • peptides and polypeptides that exhibit substantially no luminescence (e.g., in the presence of a substrate), or an amount that is beneath the noise, or a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl0 3 -fold, lxl0 4 -fold, lxl0 5 -fold, lxlO 6 - fold, lxl0 7 -fold, etc.) when compared to a significant signal (e.g., luminescent complex) under standard conditions (e.g., physiological conditions, assay conditions, etc.) and with typical instrumentation (e.g., luminometer, etc.).
  • a significant signal e.g., luminescent complex
  • non-luminescent peptides and polypeptides assemble, according to the criteria described herein, to form a bioluminescent complex.
  • a "non-luminescent element” is a non-luminescent peptide or non- luminescent polypeptide.
  • bioluminescent complex refers to the assembled complex of two or more non-luminescent peptides and/or non-luminescent polypeptides. The biolummescent complex catalyzes or enables the conversion of a substrate for the biolummescent complex into an unstable form; the substrate subsequently emits light.
  • non-luminescent pair two non-luminescent elements that form a biolummescent complex may be referred to as a "non- luminescent pair.” If a biolummescent complex is formed by three or more non-luminescent peptides and/or non-luminescent polypeptides, the uncomplexed constituents of the
  • biolummescent complex may be referred to as a "non-luminescent group.”
  • interaction element refers to a moiety that assists in bringing together a pair of non-luminescent elements or a non-luminescent group to form a
  • a pair of interaction elements (a.k.a.
  • interaction pair is attached to a pair of non-luminescent elements (e.g., non-luminescent peptide/polypeptide pair), and the attractive interaction between the two interaction elements facilitates formation of the biolummescent complex; although the present invention is not limited to such a mechanism, and an understanding of the mechanism is not required to practice the invention.
  • Interaction elements may facilitate formation of the biolummescent complex by any suitable mechanism (e.g., bringing non-luminescent pair/group into close proximity, placing a non- luminescent pair/group in proper conformation for stable interaction, reducing activation energy for complex formation, combinations thereof, etc.).
  • An interaction element may be a protein, polypeptide, peptide, small molecule, cofactor, nucleic acid, lipid, carbohydrate, antibody, etc.
  • An interaction pair may be made of two of the same interaction elements (i.e. homopair) or two different interaction elements (i.e. heteropair).
  • the interaction elements may be the same type of moiety (e.g., polypeptides) or may be two different types of moieties (e.g., polypeptide and small molecule).
  • an interaction pair in which complex formation by the interaction pair is studied, an interaction pair may be referred to as a "target pair” or a “pair of interest,” and the individual interaction elements are referred to as “target elements” (e.g., “target peptide,” “target polypeptide,” etc.) or “elements of interest” (e.g., "peptide of interest,” “polypeptide or interest,” etc.).
  • preexisting protein refers to an amino acid sequence that was in physical existence prior to a certain event or date.
  • a "peptide that is not a fragment of a preexisting protein” is a short amino acid chain that is not a fragment or sub-sequence of a protein (e.g., synthetic or naturally-occurring) that was in physical existence prior to the design and/or synthesis of the peptide.
  • fragment refers to a peptide or polypeptide that results from dissection or “fragmentation” of a larger whole entity (e.g., protein, polypeptide, enzyme, etc.), or a peptide or polypeptide prepared to have the same sequence as such. Therefore, a fragment is a subsequence of the whole entity (e.g., protein, polypeptide, enzyme, etc.) from which it is made and/or designed.
  • a peptide or polypeptide that is not a subsequence of a preexisting whole protein is not a fragment (e.g., not a fragment of a preexisting protein).
  • a peptide or polypeptide that is "not a fragment of a preexisting bioluminescent protein” is an amino acid chain that is not a subsequence of a protein (e.g., natural or synthetic) that: (1) was in physical existence prior to design and/or synthesis of the peptide or polypeptide, and (2) exhibits substantial bioluminescent activity.
  • subsequence refers to peptide or polypeptide that has 100% sequence identify with another, larger peptide or polypeptide.
  • the subsequence is a perfect sequence match for a portion of the larger amino acid chain.
  • sequence identity refers to the degree two polymer sequences
  • sequence similarity refers to the degree with which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences.
  • similar amino acids are those that share the same biophysical characteristics and can be grouped into the families, e.g., acidic (e.g., aspartate, glutamate), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine).
  • acidic e.g., aspartate, glutamate
  • basic e.g., lysine, arginine, histidine
  • non-polar e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • uncharged polar e.g.
  • the "percent sequence identity” is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity.
  • a window of comparison e.g., the length of the longer sequence, the length of the shorter sequence, a specified window
  • peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70%> sequence identity, but peptide D has 93.3%) sequence identity to an optimal comparison window of peptide C.
  • any gaps in aligned sequences are treated as mismatches at that position.
  • physiological conditions encompasses any conditions compatible with living cells, e.g., predominantly aqueous conditions of a temperature, pH, salinity, chemical makeup, etc. that are compatible with living cells.
  • sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples.
  • Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases.
  • Biological samples include blood products, such as plasma, serum and the like.
  • Sample may also refer to cell lysates or purified forms of the peptides and/or polypeptides described herein.
  • Cell lysates may include cells that have been lysed with a lysing agent or lysates such as rabbit reticulocyte or wheat germ lysates. Sample may also include cell- free expression systems.
  • Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
  • peptide and polypeptide refer to polymer compounds of two or more amino acids joined through the main chain by peptide amide bonds (— C(0)NH— ).
  • peptide typically refers to short amino acid polymers (e.g., chains having fewer than 25 amino acids), whereas the term “polypeptide” typically refers to longer amino acid polymers (e.g., chains having more than 25 amino acids).
  • protein interactions with small molecules, nucleic acids, other proteins, etc. are detected based on the association of two non-luminescent elements that come together to from a bioluminescent complex capable of producing a detectable signal (e.g., luminescence).
  • a bioluminescent complex capable of producing a detectable signal (e.g., luminescence).
  • the formation of the bioluminescent complex is dependent upon the protein interaction that is being monitored.
  • compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent peptide and/or polypeptide units e.g., non- luminescent pair.
  • the non-luminescent peptide and/or polypeptide units are not fragments of a preexisting protein (e.g., are not complementary subsequences of a known polypeptide sequence).
  • bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with a non-luminescent peptide.
  • non-luminescent pairs for use in detecting and monitoring molecular interactions (e.g., protein-protein, protein-DNA, protein-R A interactions, RNA-DNA, protein-small molecule, RNA-small-molecule, etc.).
  • complementary panels of interchangeable non-luminescent elements e.g., peptides and polypeptides
  • variable affinities and luminescence upon formation of the various bioluminescent complexes e.g., a high-affinity/high-luminescence pair, a moderate- affinity/high-luminescence pair, a low-affinity/moderate-luminescence pair, etc.
  • non-luminescent elements Utilizing different combinations of non-luminescent elements provides an adaptable system comprising various pairs ranging from lower to higher affinities, luminescence and other variable characteristics. This adaptability allows the detection/monitoring of molecular interactions to be fine-tuned to the specific molecule(s) of interest and expands the range of molecular interactions that can be monitored to include interactions with very high or low affinities. Further provided herein are methods by which non-luminescent pairs (or groups) and panels of non- luminescent pairs (or groups) are developed and tested.
  • the interaction between the peptide/polypeptide members of the non-luminescent pair alone is insufficient to form the bioluminescent complex and produce the resulting bioluminescent signal.
  • an interaction element is attached to each peptide/polypeptide member of the non- luminescent pair, then the interactions of the interaction pair (e.g., to form an interaction complex) facilitate formation of the bioluminescent complex.
  • the bioluminescent signal from the bioluminescent complex serves as a reporter for the formation of the interaction complex.
  • an interaction complex is formed, then a bioluminescent complex is formed, and a bioluminescent signal is detected/measured/monitored (e.g., in the presence of substrate). If an interaction complex fails to form (e.g., due to unfavorable conditions, due to unstable interaction between the interaction elements, due to incompatible interaction elements), then a bioluminescent complex does not form, and a bioluminescent signal is not produced.
  • the interaction pair comprises two molecules of interest (e.g., proteins of interest).
  • assays can be performed to detect the interaction of two molecules of interest by tethering each one to a separate member of a non-luminescent pair. If the molecules of interest interact (e.g., transiently interact, stably interact, etc.), the non- luminescent pair is brought into close proximity in a suitable conformation and a bioluminescent complex is formed (and bioluminescent signal is produced/detected (in the presence of substrate)).
  • the non-luminescent pair does not interact in a sufficient manner, and a bioluminescent signal is not produced or only weakly produced.
  • Such embodiments can be used to study the effect of inhibitors on complex formation, the effect of mutations on complex formation, the effect of conditions (e.g., temperature, pH, etc.) on complex formation, the interaction of a small molecule (e.g., potential therapeutic) with a target molecule, etc.
  • Different non-luminescent pairs may require different strength, duration and/or stability of the interaction complex to result in bioluminescent complex formation.
  • a stable interaction complex is required to produce a detectable bioluminescent signal. In other embodiments, even a weak or transient interaction complex results in
  • bioluminescent complex formation In some embodiments, the strength or extent of an interaction complex is directly proportional to the strength of the resulting bioluminescent signal. Some non-luminescent pairs produce a detectable signal when combined with an interaction complex with a high millimolar dissociation constant (e.g., K d >100 mM).
  • K d millimolar dissociation constant
  • non- luminescent pairs require an interaction pair with a low millimolar (e.g., K d ⁇ 100 mM), micromolar (e.g., K d ⁇ l mM), nanomolar (e.g., K d ⁇ l ⁇ ), or even picomolar (e.g., K d ⁇ l nM) dissociation constant in order to produce a bioluminescent complex with a detectable signal.
  • a low millimolar e.g., K d ⁇ 100 mM
  • micromolar e.g., K d ⁇ l mM
  • nanomolar e.g., K d ⁇ l ⁇
  • picomolar e.g., K d ⁇ l nM
  • one or more of the non-luminescent peptides/polypeptides are not fragments of a pre-existing protein. In some embodiments, one or more of the non- luminescent peptides/polypeptides are not fragments of a pre-existing bioluminescent protein. In some embodiments, neither/none of the non-luminescent peptides/polypeptides are fragments of a preexisting protein. In some embodiments, neither/none of the non-luminescent
  • peptides/polypeptides are fragments of a pre-existing bioluminescent protein.
  • neither the non-luminescent peptide nor non-luminescent polypeptide that assemble together to form a bioluminescent complex are fragments of a pre-existing protein.
  • a non-luminescent element for use in embodiments of the present invention is not a subsequence of a preexisting protein.
  • a non-luminescent pair for use in embodiments described herein does not comprise complementary subsequences of a preexisting protein.
  • non-luminescent peptides/polypeptides are substantially non- luminescent in isolation.
  • suitable conditions e.g., physiological conditions
  • non-luminescent peptides/polypeptides when placed in suitable conditions (e.g., physiological conditions), interact to form a
  • bioluminescent complex and produce a bioluminescent signal in the presence of substrate.
  • interaction elements e.g.,
  • non-luminescent peptides/polypeptides are unable to form a bioluminescent complex or only weakly form a complex.
  • non- luminescent peptides/polypeptides are substantially non-luminescent in each other's presence alone, but produce significant detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements.
  • peptides and/or polypeptides that assemble into the bio luminescent complex produce a low level of luminescence in each other's presence, but undergo a significant increase in detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements.
  • interaction elements e.g., complementary interaction elements attached to the component peptide and polypeptide
  • compositions and methods described herein comprise one or more interaction elements.
  • an interaction element is a moiety (e.g., peptide, polypeptide, protein, small molecule, nucleic acid, lipid, carbohydrate, etc.) that is attached to a peptide and/or polypeptide to assemble into the bioluminescent complex.
  • the interaction element facilitates the formation of a bioluminescent complex by any suitable mechanism, including: interacting with one or both non-luminescent elements, inducing a conformational change in a non-luminescent element, interacting with another interaction element (e.g., an interaction element attached to the other non-luminescent element), bringing non-luminescent elements into close proximity, orienting non-luminescent elements for proper interaction, etc.
  • a bioluminescent complex by any suitable mechanism, including: interacting with one or both non-luminescent elements, inducing a conformational change in a non-luminescent element, interacting with another interaction element (e.g., an interaction element attached to the other non-luminescent element), bringing non-luminescent elements into close proximity, orienting non-luminescent elements for proper interaction, etc.
  • one or more interaction elements are added to a solution containing the non-luminescent elements, but are not attached to the non- luminescent elements.
  • the interaction element(s) interact with the non-luminescent elements to induce formation of the bioluminescent complex or create conditions suitable for formation of the bioluminescent complex.
  • a single interaction element is attached to one member of a non-luminescent pair.
  • the lone interaction element interacts with one or both of the non-luminescent elements to create favorable interactions for formation of the bioluminescent complex.
  • one interaction element is attached to each member of a non-luminescent pair. Favorable interactions between the interaction elements facilitate interactions between the non-luminescent elements.
  • the interaction pair may stably interact, transiently interact, form a complex, etc.
  • the interaction of the interaction pair facilitates interaction of the non-luminescent elements (and formation of a bioluminescent complex) by any suitable mechanism, including, but not limited to: bringing the non-luminescent pair members into close proximity, properly orienting the non-luminescent pair members from interaction, reducing non-covalent forces acting against non-luminescent pair interaction, etc.
  • an interaction pair comprises any two chemical moieties that facilitate interaction of an associated non-luminescent pair.
  • An interaction pair may consist of, for example: two complementary nucleic acids, two polypeptides capable of dimerization (e.g., homodimer, heterodimer, etc.), a protein and ligand, protein and small molecule, an antibody and epitope, a reactive pair of small molecules, etc. Any suitable pair of interacting molecules may find use as an interaction pair.
  • an interaction pair comprises two molecules of interest (e.g., proteins of interest) or target molecules.
  • compositions and methods herein provide useful assays (e.g., in vitro, in vivo, in situ, whole animal, etc.) for studying the interactions between a pair of target molecules.
  • a pair off interaction elements each attached to one of the non- luminescent elements, interact with each other and thereby facilitate formation of the
  • bioluminescent complex In some embodiments, the presence of a ligand, substrate, co-factor or addition interaction element (e.g., not attached to non-luminescent element) is necessary to induce the interaction between the interaction elements and facilitate bioluminescent complex formation. In some embodiments, detecting a signal from the bioluminescent complex indicates the presence of the ligand, substrate, co-factor or addition interaction element or conditions that allow for interaction with the interaction elements.
  • a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain (e.g., (interaction element l)-NLpep- (interaction element 2)-NLpoly, NLpoly-(interaction element l)-NLpep ⁇ (interaction element 2), NLpoly-(interaction element l)-(interaction element 2)-NLpep, etc.).
  • a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain
  • a ligand, substrate, co-factor or addition interaction element is required for the interaction pair to form an interaction complex and facilitate formation of the
  • an interaction element and a non-luminescent element are attached, fused, linked, connected, etc.
  • a first non-luminescent element and a first interaction element are attached to each other, and a second non-luminescent element and a second interaction element are attached to each other.
  • Attachment of signal and interaction elements may be achieved by any suitable mechanism, chemistry, linker, etc.
  • the interaction and non-luminescent elements are typically attached through covalent connection, but non- covalent linking of the two elements is also provided.
  • the signal and interaction elements are directly connected and, in other embodiments, they are connected by a linker.
  • the signal and interaction elements are contained within a single amino acid chain.
  • a single amino acid chain comprises, consists of, or consists essentially of a non- luminescent element and interaction element.
  • a single amino acid chain comprises, consists of, or consists essentially of a non-luminescent element, an interaction element, and optionally one or more an N-terminal sequence, a C-terminal sequence, regulatory elements (e.g., promoter, translational start site, etc.), and a linker sequence.
  • the signal and interaction elements are contained within a fusion polypeptide.
  • the signal and interaction elements (and any other amino acid segments to be included in the fusion) may be expressed separately; however, in other embodiments, a fusion protein is expressed that comprises or consist of both the interaction and signal sequences.
  • a first fusion protein comprising a first non-luminescent element and first interaction element as well as a second fusion protein comprising a second non- luminescent element and second interaction element are expressed within the same cells.
  • the first and second fusion proteins are purified and/or isolated from the cells, or the interaction of the fusion proteins is assayed within the cells.
  • first and second fusion proteins are expressed in separate cells and combined (e.g., following purification and/or isolation, or following fusion of the cells or portions of the cells, or by transfer of a fusion protein from one cell to another, or by secretion of one or more fusion proteins into the extracellular medium) for signal detection.
  • one or more fusion proteins are expressed in cell lysate (e.g., rabbit reticulocyte lysate) or in a cell-free system. In some embodiments, one or more fusion proteins are expressed from the genome of a virus or other cellular pathogen.
  • nucleic acids DNA, RNA, vectors, etc. are provided that encode peptide, polypeptides, fusion polypeptide, fusion proteins, etc. of the present invention.
  • Such nucleic acids and vectors may be used for expression, transformation, transfection, injection, etc.
  • a non-luminescent element and interaction element are connected by a linker.
  • a linker connects the signal and interaction elements while providing a desired amount of space/distance between the elements.
  • a linker allows both the signal and interaction elements to form their respective pairs (e.g., non- luminescent pair and interaction pair) simultaneously.
  • a linker assists the interaction element in facilitating the formation of a non-luminescent pair interaction.
  • the linkers that connect each non-luminescent element to their respective interaction elements position the non-luminescent elements at the proper distance and conformation to form a bioluminescent complex.
  • an interaction element and non-luminescent element are held in close proximity (e.g., ⁇ 4 monomer units) by a linker.
  • a linker provides a desired amount of distance (e.g., 1, 2, 3, 4, 5, 6...10... 20, or more monomer units) between signal and interaction elements (e.g., to prevent undesirable interactions between signal and interaction elements, for steric considerations, to allow proper orientation of non-luminescent element upon formation of interaction complex, to allow propagation of a complex-formation from interaction complex to non-luminescent elements, etc.).
  • a linker provides appropriate attachment chemistry between the signal and interaction elements.
  • a linker may also improve the synthetic process of making the signal and interaction element (e.g., allowing them to be synthesized as a single unit, allowing post synthesis connection of the two elements, etc.).
  • a linker is any suitable chemical moiety capable of linking, connecting, or tethering a non-luminescent element to an interaction element.
  • a linker is a polymer of one or more repeating or non-repeating monomer units (e.g., nucleic acid, amino acid, carbon-containing polymer, carbon chain, etc.).
  • a linker when present, is typically an amino acid chain.
  • a linker may comprise any chemical moiety with functional (or reactive) groups at either end that are reactive with functional groups on the signal and interaction elements, respectively. Any suitable moiety capable of tethering the signal and interaction elements may find use as a linker.
  • linker is a single covalent bond.
  • the linker comprises a linear or branched, cyclic or heterocyclic, saturated or unsaturated, structure having 1-20 nonhydrogen atoms (e.g., C, N, P, O and S) and is composed of any combination of alkyl, ether, thioether, imine, carboxylic, amine, ester, carboxamide, sulfonamide, hydrazide bonds and aromatic or heteroaromatic bonds.
  • linkers are longer than 20 nonhydrogen atoms (e.g.
  • the linker comprises 1-50 non- hydrogen atoms (in addition to hydrogen atoms) selected from the group of C, N, P, O and S (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 non-hydrogen atoms).
  • 1-50 non- hydrogen atoms selected from the group of C, N, P, O and S (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 non-hydrogen atoms).
  • the present invention is not limited by the types of linkers available.
  • the signal and interaction elements are linked, either directly (e.g. linker consists of a single covalent bond) or linked via a suitable linker.
  • the present invention is not limited to any particular linker group.
  • linker groups are contemplated, and suitable linkers could comprise, but are not limited to, alkyl groups, methylene carbon chains, ether, polyether, alkyl amide linker, a peptide linker, a modified peptide linker, a Poly(ethylene glycol) (PEG) linker, a streptavidin-biotin or avidin- biotin linker, polyaminoacids (e.g. polylysine), functionalised PEG, polysaccharides, glycosaminoglycans, dendritic polymers (WO93/06868 and by Tomalia et al. in Angew. Chem.
  • oligonucleotide linker e.g., enzymatically (e.g., TEV protease site), chemically, photoinduced, etc.
  • substantially non-luminescent peptides and polypeptides are provided with less than 100% sequence identity and/or similarity to any portion of an existing luciferase (e.g., a firefly luciferase, a Renilla luciferase, an Oplophorus luciferase, enhanced Oplophorus luciferases as described in U.S. Pat. App. 2010/0281552 and U.S. Pat. App.
  • an existing luciferase e.g., a firefly luciferase, a Renilla luciferase, an Oplophorus luciferase, enhanced Oplophorus luciferases as described in U.S. Pat. App. 2010/0281552 and U.S. Pat. App.
  • Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100% sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence).
  • Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence).
  • 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%
  • non-luminescent peptides and polypeptides are provided with less than 100% sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and
  • non- luminescent peptides and polypeptides are provided with less than 100%, but more than 40%> (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%,
  • sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and polypeptides that interact to form bioluminescent complexes).
  • Non-luminescent peptides are provided that have less than 100% sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
  • Non-luminescent peptides are provided that have less than 100%>sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
  • Non- luminescent peptides are provided that have less than 100%, but more than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
  • 40% e.g., >40%>, >45%, >50%, >55%,
  • non-luminescent polypeptides are provided that have less than 100%), but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with a portion of SEQ ID NO: 2157, wherein such polypeptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a peptide having less than 100%), but optionally more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
  • 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70
  • non- luminescent peptides with less than lOOsequence identity or similarity with SEQ ID NO: 2 are provided.
  • non- luminescent peptides with less than 100%, but more than 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99% sequence identity or similarity with SEQ ID NO: 2 are provided.
  • non- luminescent polypeptides with less than 100 sequence identity or similarity with SEQ ID NO: 440 are provided.
  • non- luminescent polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with SEQ ID NO: 440 are provided.
  • non-luminescent peptides that find use in embodiments of the present invention include peptides with one or more amino acid substitutions, deletions, or additions from GVTGWRLCK ISA (SEQ ID NO: 236).
  • the present invention provides peptides comprising one or more of amino acid sequences of Table 1 , and/or nucleic acids comprising the nucleic acid sequences of Table 1 (which code for the peptide sequences of Table 1). Table 1.
  • NLpep20 (w/ Met) N.A. ATGGGACAGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
  • NLpep21 (w/ Met) N.A. ATGGGAAGCACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
  • NLpep22 (w/ Met) N.A. ATGGGAGTGGTGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
  • NLpep28 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCACTGCAAGCGCATTAGCGCG
  • NLpep35 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAAGATTAGCGCG
  • NLpep36 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAACATTAGCGCG
  • NLpep37 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCGTGAGCGCG
  • NLpep40 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCCGGAGCGCG 80 NLpep40 (w/ Met) A.A. MGVTGWRLCK SA
  • peptides from Table 1 are provided.
  • peptides comprise a single amino acid difference from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
  • peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
  • peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
  • peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
  • peptides comprise two or more (e.g., 2, 3,
  • peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a peptide or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequence of SEQ ID NOS: 3-438 and 2162-2365.
  • nucleic acids are provided comprising one of the nucleic acid coding sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided comprising one of the nucleic acid sequences of SEQ ID NOS: 3-438 and 2162-2365with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acid sequence of SEQ ID NOS: 3-438 and 2162-2365.
  • nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid is provided that codes for an amino acid with greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365.
  • 70% sequence identity e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%
  • nucleic acid from Table 1 is provided.
  • a nucleic acid encoding a peptide from Table 1 is provided.
  • a nucleic acid of the present invention codes for a peptide that comprises a single amino acid difference from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1.
  • nucleic acids code for peptides comprising two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1.
  • nucleic acids are provided comprising the sequence of one of the nucleic acids in Table 1.
  • nucleic acids are provided comprising one of the nucleic acids of Table 1 with one or more additions,
  • a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acids of Table 1.
  • non-luminescent polypeptides that find use in embodiments of the present invention include polypeptides with one or more amino acid substitutions, deletions, or additions from SEQ ID NO: 440.
  • the present invention provides polypeptides comprising one or more of amino acid sequences of Table 2, and/or nucleic acids comprising the nucleic acid sequences of Table 2 (which code for the polypeptide sequences of Table 2). Table 2. Pol e tide se uences

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Business, Economics & Management (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Accounting & Taxation (AREA)
  • Finance (AREA)
  • Development Economics (AREA)
  • General Engineering & Computer Science (AREA)
  • Signal Processing (AREA)
  • Strategic Management (AREA)
  • Computer Networks & Wireless Communication (AREA)
  • General Business, Economics & Management (AREA)
  • Theoretical Computer Science (AREA)
  • Marketing (AREA)
  • Economics (AREA)
  • Veterinary Medicine (AREA)

Abstract

Provided herein are compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent (e.g., substantially non-luminescent) peptide and/or polypeptide units. In particular, bioluminescent activity is conferred upon a non-luminescent polypeptide via structural complementation with another, complementary non-luminescent peptide. Biological processes rely on covalent and non-covalent interactions between molecules, macromolecules and molecular complexes. In order to understand such processes, and to develop techniques and compounds to manipulate them for research, clinical and other practical applications, it is necessary to have tools available to detect and monitor these interactions.

Description

ACTIVATION OF BIOLUMINE SCENCE BY STRUCTURAL COMPLEMENTATION
CROSS-REFERENCE TO RELATED APPLICATION
The present application claims priority to U.S. Provisional Patent Application Serial No. 61/791,549 filed March 15, 2013, which is hereby incorporated by reference in its entirety.
FIELD
Provided herein are compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent (e.g., substantially non-luminescent) peptide and/or polypeptide units. In particular, bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with another, complementary non-luminescent peptide.
BACKGROUND
Biological processes rely on covalent and non-covalent interactions between molecules, macromolecules and molecular complexes. In order to understand such processes, and to develop techniques and compounds to manipulate them for research, clinical and other practical applications, it is necessary to have tools available to detect and monitor these interactions. The study of these interactions, particularly under physiological conditions (e.g. at normal expression levels for monitoring protein interactions), requires high sensitivity.
SUMMARY
The present invention relates to compositions comprising complementary non- luminescent amino acid chains (e.g., substantially non-luminescent peptides and/or polypeptides that are not fragments of a preexisting protein), complexes thereof, and methods of generating an optically detectable bioluminescent signal upon association of the non-luminescent amino acid chains (e.g., peptides and/or polypeptides). In some embodiments, the present invention provides two or more non-luminescent, or substantially non-luminescent peptides and/or polypeptides, that, when brought together, assemble into a bioluminescent complex. In some embodiments, a pair of substantially non-luminescent peptide and/or polypeptide units assembles into a bioluminescent complex. In other embodiments, three or more substantially non-luminescent peptide and/or polypeptide units assemble into a bioluminescent complex (e.g., ternary complex, tertiary complex, etc.). Provided herein are technologies for detecting interactions between molecular entities (e.g., proteins, nucleic acids, carbohydrates, small molecules (e.g., small molecule libraries)) by correlating such interactions to the formation of a bioluminescent complex of otherwise non-luminescent (e.g., substantially non-luminescent) amino acid chains.
In some embodiments, the assembled pair catalyzes a chemical reaction of an appropriate substrate into a high energy state, and light is emitted. In some embodiments, a bioluminescent complex exhibits luminescence in the presence of substrate (e.g., coelenterazine, furimazine, etc.).
Although the embodiments described herein primarily describe and refer to
complementary, non-luminescent amino acid chains that form bioluminescent complexes, it is noted that the present technology can equally be applied to other detectable attributes (e.g., other enzymatic activities, generation of a fluorophore, generation of a chromophore, etc.). The embodiments described herein relating to luminescence should be viewed as applying to complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides that are not fragments of a preexisting protein) that separately lack a specified detectable activity (e.g., enzymatic activity) or substantially non-enzymatically active subunits of a polypeptide, complexes thereof, and methods of generating the detectable activity (e.g., an enzymatic activity) upon association of the complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides). Further, embodiments described herein that refer to non-luminescent peptides and/or polypeptides are applied, in some embodiments, to substantially non-luminescent peptides and/or polypeptides.
The invention is further directed to assays for the detection of molecular interactions between molecules of interest by linking the interaction of a pair of non-luminescent
peptides/polypeptides to the interaction molecules of interest (e.g., transient association, stable association, complex formation, etc.). In such embodiments, a pair of a non-luminescent elements are tethered (e.g., fused) to molecules of interest and assembly of the bioluminescent complex is operated by the molecular interaction of the molecules of interest. If the molecules of interest engage in a sufficiently stable interaction, the bioluminescent complex forms, and a bioluminescent signal is generated. If the molecules of interest fail to engage in a sufficiently stable interaction, the bioluminescent complex will not form or only form weakly, and a bioluminescent signal is not detectable or is substantially reduced (e.g., substantially
undetectable, essentially not detectable, etc.). In some embodiments, the magnitude of the detectable bioluminescent signal is proportional (e.g., directly proportional) to the amount, strength, favorability, and/or stability of the molecular interactions between the molecules of interest.
In some embodiments, the present invention provides peptides comprising an amino acid sequence having less than 100% (e.g., 20%... 30%... 40%... 50%... 60%... 70%... 80%, or more) sequence identity with SEQ ID NO: 2, wherein a detectable bio luminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440. In some embodiments, the present invention provides peptides comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440. In some embodiments, a detectable bioluminescent signal is produced when the peptide contacts a polypeptide having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440. In certain embodiments, the detectable bioluminescent signal is produced, or is substantially increased, when the peptide associates with the polypeptide comprising or consisting of SEQ ID NO: 440, or a portion thereof. In preferred embodiments, the peptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 2, wherein the traits are selected from: affinity for the polypeptide consisting of SEQ ID NO: 440, expression, intracellular solubility, intracellular stability and bioluminescent activity when combined with the polypeptide consisting of SEQ ID NO: 440. Although not limited to these sequences, the peptide amino acid sequence may be selected from amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, fusion polypeptides are provided that comprise: (a) an above described peptide, and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide. In certain embodiments, bioluminescent complexes are provided that comprise: (a) a first fusion polypeptide described above and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement polypeptide that emits a detectable bioluminescent signal when associated with the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2; wherein the first fusion polypeptide and second fusion polypeptide are associated; and wherein the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2 and the complement polypeptide are associated.
In some embodiments, the present invention provides polypeptides comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2. In some embodiments, the present invention provides polypeptides comprising an amino acid sequence having less than 100%) and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein a detectable bio luminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2. In some embodiments, a detectable bioluminescent signal is produced when the polypeptide contacts a peptide having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2. In some embodiments, the polypeptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 440, wherein the traits are selected from: affinity for the peptide consisting of SEQ ID NO: 2, expression, intracellular solubility, intracellular stability, and bioluminescent activity when combined with the peptide consisting of SEQ ID NO: 2.
Although not limited to such sequences, the polypeptide amino acid sequence may be selected from one of the amino acid sequences of SEQ ID NOS: 441-2156. In some embodiments, the detectable bioluminescent signal is produced when the polypeptide associates with the peptide consisting of SEQ ID NO: 2. In some embodiments, a fusion polypeptide is provided that comprises: (a) a polypeptide described above and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide. In certain embodiments, a bioluminescent complex is provided that comprises: (a) a first fusion polypeptide described above; and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement peptide that causes the polypeptide comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440 to emit a detectable
bioluminescent signal when an association is formed between the two; wherein the first fusion polypeptide and second fusion polypeptide are associated; and wherein the polypeptide comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440 and the complement peptide are associated.
In some embodiments, the present invention provides nucleic acids (e.g., DNA, RNA, etc.), oligonucleotides, vectors, etc., that code for any of the peptides, polypeptides, fusion proteins, etc., described herein. In some embodiments, a nucleic acid comprising or consisting of one of the nucleic acid sequences of SEQ ID NOS : 3-438 and 2162-2365 (coding for non- luminescent peptides) and/or SEQ ID NOS 441-2156 (coding for non-luminescent polypeptides) are provided. In some embodiments, other nucleic acid sequences coding for amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 and/or SEQ ID NOS 441-2156 are provided.
In certain embodiments, the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% sequence identity (e.g., >99%, <95%, <90%, <80%, <70%, <60%, <50%, etc.) with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence. In certain embodiments, the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence. Although not limited to particular sequences, in some embodiments, the peptide amino acid sequence is selected from one of the amino acid sequences provided in SEQ ID NOS: 3-438 and 2162-2365.
In various embodiments, bioluminescent complexes are provided that comprise: (a) a first amino acid sequence that is not a fragment of a preexisting protein; and (b) a second amino acid sequence that is not a fragment of a preexisting protein, wherein the bioluminescent complex exhibits detectable luminescence, wherein the first amino acid sequence and the second amino acid sequence are associated. Some such bioluminescent complexes further comprise: (c) a third amino acid sequence comprising a first member of an interaction pair, wherein the third amino acid sequence is covalently attached to the first amino acid sequence; and (d) a fourth amino acid sequence comprising a second member of an interaction pair, wherein the fourth amino acid sequence is covalently attached to the second amino acid sequence. In certain embodiments, interactions (e.g., non-covalent interactions (e.g., hydrogen bonds, ionic bonds, van der Waals forces, hydrophobic interactions, etc.) covalent interactions (e.g., disulfide bonds), etc.) between the first amino acid sequence and the second amino acid sequence do not significantly associate the first amino acid sequence and the second amino acid sequence in the absence of the interactions between the first member and the second member of the interaction pair. In some embodiments, a first polypeptide chain comprises the first amino acid sequence and the third amino acid sequence, and wherein a second polypeptide chain comprises the second amino acid sequence and the fourth amino acid sequence. In some embodiments, the first polypeptide chain and the second polypeptide chain are expressed within a cell.
In some embodiments, the present invention provides a bioluminescent complex comprising: (a) a pair of non-luminescent elements, wherein each non-luminescent element is not a fragment of a preexisting protein; (b) an interaction pair, wherein each interaction element of the interaction pair is covalently attached to one of the non- luminescent elements.
Various embodiments described herein provide methods of detecting an interaction between a first amino acid sequence and a second amino acid sequence comprising, for example, the steps of: (a) attaching the first amino acid sequence to a third amino acid sequence and attaching the second amino acid sequence to a fourth amino acid sequence, wherein the third and fourth amino acid sequences are not fragments of a preexisting protein, wherein a complex of the third and fourth amino acid sequences emits a detectable bioluminescent signal (e.g.,
substantially increased bioluminescence relative to the polypeptide chains separately), wherein the interactions (e.g., non-covalent) between the third and fourth amino acid sequences are insufficient to form, or only weakly form, a complex of the third and fourth amino acid sequences in the absence of additional stabilizing and/or aggregating conditions, and wherein a interaction between the first amino acid sequence and the second amino acid sequence provides the additional stabilizing and/or aggregating forces to produce a complex of the third and fourth amino acid sequences; (b) placing the first, second, third, and fourth amino acid sequences of step (a) in conditions to allow for interactions between the first amino acid sequence and the second amino acid sequence to occur; and (c) detecting the bioluminescent signal emitted by the complex of the third and fourth amino acid sequences, wherein detection of the bioluminescent signal indicates an interaction between the first amino acid sequence and the second amino acid sequence. In some embodiments, attaching the first amino acid sequence to the third amino acid sequence and the second amino acid sequence to the fourth amino acid sequence comprises forming a first fusion protein comprising the first amino acid sequence and the third amino acid sequence and forming a second fusion protein comprising the second amino acid sequence and the fourth amino acid sequence. In some embodiments, the first fusion protein and the second fusion protein further comprise linkers between said first and third amino acid sequences and said second and fourth amino acid sequences, respectively. In certain embodiments, the first fusion protein is expressed from a first nucleic acid sequence coding for the first and third amino acid sequences, and the second fusion protein is expressed from a second nucleic acid sequence coding for the second and fourth amino acid sequences. In some embodiments, a single vector comprises the first nucleic acid sequence and the second nucleic acid sequence. In other embodiments, the first nucleic acid sequence and the second nucleic acid sequence are on separate vectors. In certain embodiments, the steps of (a) "attaching" and (b) "placing" comprise expressing the first and second fusion proteins within a cell.
Provided herein are methods of creating, producing, generating, and/or optimizing a pair of non-luminescent elements comprising: (a) aligning the sequences of three or more related proteins; (b) determining a consensus sequence for the related proteins; (c) providing first and second fragments of a protein related to three or more proteins (or providing first and second fragments of one of the three or more proteins), wherein the fragments are individually substantially non-luminescent but exhibit luminescence upon interaction of the fragments; (d) mutating the first and second fragments at one or more positions each, wherein the mutations alter the sequences of the fragments to be more similar to a corresponding portion of the consensus sequence (e.g., wherein the mutating results in a pair of non-luminescent elements that are not fragments of a preexisting protein), and (e) testing the pair of non-luminescent elements for the absence (e.g., essential absence, substantial absence, etc.) of luminescence when unassociated, and luminescence upon association of the non- luminescent pair into a
bioluminescent complex. Examples of such a process are described in Examples 1-5. In some embodiments, the non-luminescent elements exhibit enhancement of one or more traits compared to the first and second fragments, wherein the traits are selected from: increased reconstitution affinity, decreased reconstitution affinity, enhanced expression, increased intracellular solubility, increased intracellular stability, and increased intensity of reconstituted luminescence.
In some embodiments, the present invention provides detection reagents comprising: (a) a polypeptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2, and (b) a substrate for a bioluminescent complex produced by the polypeptide and a peptide consisting of SEQ ID NO: 2. In some embodiments, the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440. In some
embodiments, the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a graph depicting the effect of various mutations of the
GVTGWRLCKRISA (SEQ ID NO: 236) peptide on luminescence resulting from
complementation with SEQ ID NO: 440.
Figure 2 shows a graph depicting the effect of various mutations of the SEQ ID NO: 440 polypeptide on luminescence resulting from complementation with GVTGWRLCKRISA (SEQ ID NO: 236) or GVTGWRLFKRISA (SEQ ID NO: 108) peptides.
Figure 3 A shows the luminescence (RLUs) detected in each non-luminescent polypeptide (NLpoly) mutant containing a single glycine to alanine substitution. Figure 3B shows the fold increase in luminescence over wild-type.
Figure 4A show the luminescence (RLUs) detected in each NLpoly mutant containing a composite of glycine to alanine substitutions. Figure 4B shows the fold increase in luminescence over wild-type.
Figure 5 shows a graph depicting the luminescence (RLUs) detected in HT-NLpeptide fusions.
Figure 6 shows a graph depicting the luminescence (RLUs) detected in HT-NLpep fusions.
Figure 7 shows a graph depicting the luminescence (RLUs) detected in NLpeptide-HT fusions.
Figure 8 shows the luminescence (RLUs) generated by a luminescent complex after freeze-thaw cycles of non- luminescent peptide (NLpep).
Figure 9 shows concentration normalized activity of peptides, and the TMR gel used to determine the relative concentrations.
Figure 10 shows a graph of the luminescence of various mutations of residue Rl 1 of NLpoly-5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 11 shows a graph of the luminescence of various mutations of residue A15 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 12 shows a graph of the luminescence of various mutations of residue LI 8 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 13 shows a graph of the luminescence of various mutations of residue F31 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom). Figure 14 shows a graph of the luminescence of various mutations of residue V58 of
NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 15 shows a graph of the luminescence of various mutations of residue A67 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 16 shows a graph of the luminescence of various mutations of residue Ml 06 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 17 shows a graph of the luminescence of various mutations of residue LI 49 of
NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 18 shows a graph of the luminescence of various mutations of residue VI 57 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
Figure 19 shows a graph of the luminescence of NLpep-HT fusions.
Figure 20 shows a graph of the luminescence of NLpep-HT fusions, and a TMR gel indicating their relative expression levels.
Figure 21 shows a graph of the luminescence of NLpep-HT fusions.
Figure 22 shows a graph of the luminescence of NLpoly 5A2 (top) and
NLpoly5A2+Rl IE in the presence of various NLpeps (bottom) .
Figure 23 shows a graph of the luminescence of NLpep-HT fusions.
Figure 24 shows a graph of the luminescence of NLpolys 1-13 with NLpep53 (top) and without complimentary peptide (bottom).
Figure 25 shows a graph of the luminescence of various NLpolys with NLpep53 with
NANOGLO or DMEM buffer and furimazine or coelenterazine substrate.
Figure 26 shows a graph comparing luminescence in the presence of a ratio of furimazine with coelenterazine for various NLpolys and NLpep53.
Figure 27 shows a graph comparing luminescence in the presence of a ratio of furimazine to coelenterazine for various NLpolys and NLpep53.
Figure 28 shows a graph comparing luminescence in the presence of furimazine with coelenterazine for various NLpolys and NLpep53 in HEK293 cell lysate.
Figure 29 shows a graph of the luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine. Figure 30 shows a graph of the signal/background luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine.
Figure 31 shows a graph of luminescence and substrate specificity of various NLpoly mutants with NLpep69 using either furimazine or coelenterazme as a substrate.
Figure 32 shows a comparison of luminescence and substrate specificity of various
NLpoly mutants with NLpep69 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
Figure 33 shows a comparison of luminescence and substrate specificity of NLpoly mutants with NLpep78 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
Figure 34 shows a comparison of luminescence and substrate specificity of various NLpoly mutants with NLpep79 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
Figure 35 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys.
Figure 36 shows a graph of the luminescence of various NLpolys in the absence of
NLpep.
Figure 37 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys with either furimazine or coelenterazme substrates.
Figure 38 shows a graph of the luminescence of NLpep78-HT with various NLpolys expressed in CHO and HeLa cells.
Figure 39 shows graphs of raw and normalized luminescence from NLpoly fused to firefly luciferase expressed in HEK293, Hela, and CHO cell lysates.
Figure 40 shows graphs of raw and normalized luminescence from NLpoly fused to click beetle red luciferase expressed in HEK293, Hela, and CHO cell lysates.
Figure 41 shows a graphs of luminescence of complementation in live cells using either NLpoly wild-type or 5P.
Figure 42 shows graphs of luminescence of cell-free complementation of NLpep78-HT fusion (top) and NLpep79-HT fusion (bottom) with various NLpolys.
Figure 43 shows a graph of binding affinities for various combinations of NLpeps and NLpolys expressed in HeLa, HEK293 and CHO cell lysate.
Figure 44 shows a graph of binding affinities for various combinations of NLpeps and NLpolys in PBS or NANOGLO buffer. Figure 45 shows a graph of binding affinities for NLpoly 5P with NLpep9 or NLpep53 expressed in HeLa, HEK293 or CHO cell lysate.
Figure 46 shows a graph of luminescence of varying amounts of NLpolys in the absence of NLpep.
Figure 47 shows a graph of background luminescence of various NLpoly variants.
Figure 48 shows a graph of background luminescence of various NLpoly variants. Figure 49 shows a SDS-PAGE gel of total lysate and soluble fraction of several NLpoly variants
Figure 50 shows (a) a SDS-PAGE gel of the total lysate and soluble fraction of NLpoly variants and (b) background luminescence of NLpoly variants.
Figure 51 shows graphs of the luminescence generated with several NLpoly variants when complemented with lOnm (right) or lOOnM (left) of NLpep78.
Figure 52 shows graphs depicting background luminescence in E. coli lysate of various NLpoly variants.
Figure 53 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep78.
Figure 54 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep79.
Figure 55 shows a graph of signal to background of various NLPolys variants complemented with NLpep78 or NLpep79 and normalized to NLpoly 5P.
Figure 56 shows a graph depicting background, luminescence with NLpep79 (right) or NLpep78 (left) and signal-to-noise or various NLpoly variants.
Figure 57 shows a SDS-PAGE gel of the total lysate and soluble fraction in various NLpoly 5P variants.
Figure 58 shows (A) the amount of total lysate and soluble fraction of NLpoly 5P and
NLpoly I107L, (B) luminescence generated by NLpoly 5P or NLpoly I107L without NLpep or with NLpep78 or NLpep79 and (C) the improved signal-to-background of NLpoly I107L over NLpoly 5P.
Figure 59 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
Figure 60 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
Figure 61 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT. Figure 62 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
Figure 63 shows binding affinity between an elongated NLpoly variant (additional amino acids at the C-terminus) and a shortened NLpep (deleted amino acids at the N-terminus).
Figure 64 shows a graph of binding affinity of various NLpoly variants with NLpep78.
Figure 65 shows the binding and Vmax of NLpep80 and NLpep87 to 5P expressed in mammalian cells (CHO, HEK293T and HeLa).
Figure 66 shows the binding and Vmax of NLpep80 and NLpep87 to NLpoly 5P expressed in E. coli.
Figure 67 shows a graph of luminescence of shortened NLpolys with elongated NLpeps.
Figure 68 shows graphs of Kd and Vmax of NLpoly 5P in HeLa lysate with various complementary NLpeps.
Figure 69 shows a graph of binding affinities for several NLpoly variants with NLpep81.
Figure 70 shows a graph of binding affinities for several NLpoly variants with NLpep82.
Figure 71 shows a graph of binding affinities for several NLpoly mutants with NLpep78.
Figure 72 shows a graph of Michaelis constants for several NLpoly mutants with NLpep78.
Figure 73 shows graphs of luminescence from a tertiary complementation of two NLpeps and NLpoly 5P-B9.
Figure 74 shows a graph of luminescence of titration of NLpoly 5P with NLpep88-HT. Figure 75 shows images of intracellular localization of various NLpep fusions with HaloTag (HT).
Figure 76 shows images of intracellular localization of NLpoly(wt) and NLpoly(5P).
Figure 77 demonstrates the ability to detect via complementation an NLPep-conjugated protein of interest following separation by SDS-PAGE and transfer to a PVDF membrane.
Figure 78 shows a graph of relative luminescent signal from various NLpoly variants compared to NLpoly 5P (in the absence of NLpep).
Figure 79 shows a graph of relative luminescent signal over background from various NLpolys compared to NLpoly 5P (in the absence of NLpep).
Figure 80 compares the dissociation constants for NLpeps consisting of either 1 or 2 repeat units of NLpep78.
Figure 81 shows the affinity between NLpoly 5A2 and NLpep86.
Figure 82 shows graphs of the luminescence from NLpoly variants without NLpep, with NLpep78, and NLpep79. Figure 83-90 show the dissociation constants as well as the Vmax values for NLpoly
5A2, 5P, 8S and 1 IS with 96 variants of NLpeps.
Figure 91 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
Figure 92 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants as well as a table containing the dissociation constants for the same variants.
Figure 93 shows the substrate specificity for NLpoly 5P and 1 IS with NLpep79 and demonstrates that NLpoly 1 IS has superior specificity for furimazine than 5P.
Figure 94 shows an image of a protein gel that follows the affinity purification of NLpoly
8S through binding NLpep78.
Figure 95 contains a table of the association and dissociation rate constants for the binding of NLpoly WT or 1 IS to NLpepWT, 78 or 79.
Figure 96 shows the Km values for various pairs of NLpoly/NLpep.
Figure 97 compares the dissociation constant for NLpoly 1 lS/NLpep79 at sub-saturating and saturating concentrations of furimazine.
Figure 98 compares the Km values for NLpoly 5A2 with NLpepWT, 78 and 79.
Figure 99 shows the luminescence of NLpolys from various steps in the evolution process in the absence of NLpep.
Figure 100 shows the improvement in luminescence from E. co/z-derived NLpoly over the course of the evolution process with an overall ~105 improvement (from
NLpolyWT:NLpepWT to NLpolyl lS:NLpep80).
Figure 101 shows the improvement in luminescence from HeLa-expressed NLpoly over the course of the evolution process with an overall ~105 improvement (from
NLpolyWT:NLpepWT to NLpoly 11 S :NLpep80).
Figure 102 shows the improvement in luminescence from HEK293 cell-expressed NLpoly over the course of the evolution process with an overall ~104 improvement (from
NLpolyWT:NLpepWT to NLpolyl lS:NLpep80).
Figure 103 shows dissociation constants and demonstrates a ~104 fold improvement in binding affinity from NLpolyWT:NLpepWT to NLpoly 11 S :NLpep86.
Figure 104 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants from various steps of the evolution process.
Figure 105 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79. Figure 106 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
Figure 107 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
Figure 108 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 15 min treatment with rapamycin or vehicle. Fold induction refers to signal generated in the presence of rapamycin compared to signal generated with vehicle.
Figure 109 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 60 min treatment with rapamycin or vehicle.
Figure 110 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle.
Figure 111 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle. All 8 possible combinations of FRB and FKBP fused to
NLpoly/NLpep were tested and less total DNA was used.
Figure 112 shows a comparison of luminescence generated by FRB or FKBP fusions expressed in the absence of binding partner.
Figure 113 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
Figure 114 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner.
Figure 115 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA. This example differs from Figure 113 in that lower levels of DNA were used.
Figure 116 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner. This differs from Figure 114 in that lower levels of DNA were used.
Figure 117 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80 DNA after treatment with rapamycin for different lengths of time. Figure 118 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep87 DNA after treatment with rapamycin for different lengths of time.
Figure 119 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5P with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
Figure 120 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
Figure 121 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 or FRB-NLpolyl lS with FKBP- NLpep 101/104/105/106/107/108/109/110.
Figure 122 shows a comparison of luminescence generated by cells transfected with different combinations of FRB-NLpoly5 A2 or FRB-NLpolyl lS with FKBP- NLpep87/96/98/99/l 00/101/102/103.
Figure 123 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpolyl lS and FKBP-NLpep87/l 01/102/107 DNA.
Figure 124 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpoly5 A2 and FKBP-NLpep87/l 01/102/107 DNA.
Figure 125 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
Figure 126 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5A2 or FRB-NLpolyl lS and FKBP-NLpep87/101 DNA.
Figure 127 shows a comparison of luminescence generated by cells expressing FRB-11S and FKBP-101 and treated with substrate PBI-4377 or furimazine.
Figure 128 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added manually.
Figure 129 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added via instrument injector.
Figure 130 shows luminescence generated by FRB-NLpolyl lS and FKBP-NLpeplOl as measured on two different luminescence-reading instruments.
Figure 131 provides images showing luminescence of cells expressing FRB-NLpolyl lS and FKBP-NLpep 101 at various times after treatment with rapamycin. Figure 132 provides a graph showing Image J quantitation of the signal generated by individual cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl at various times after treatment with rapamycin.
Figure 133 shows a comparison of luminescence in different cell lines expressing FRB- NLpoly 11 S and FKBP-NLpep 101.
Figure 134 shows a comparison of luminescence generated by cells expressing FRB- NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506.
Figure 135 shows (left side) luminescence generated by cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506, and (right side) the percent of luminescence remaining after treatment with FK506.
Figure 136 shows luminescence generated by cells transfected with different
combinations of V2R-NLpoly5A2 or V2R-NLpolyl lS with NLpep87/101-ARRB2 in the presence or absence of the V2R agonist AVP.
Figure 137 shows an AVP treatment time course showing luminescence generated by cells transfected with V2R-NLpoly 11 S and NLpep87/l 01 -ARRB2 after treatment with AVP wherein AVP was added manually.
Figure 138 shows an AVP treatment time course showing luminescence generated by cells transfected with different combinations of V2R-NLpoly5A2 or V2R-NLpolyl lS with
NLpep87/101-ARRB2 after treatment with AVP wherein AVP was added via instrument injector.
Figure 139 shows an AVP treatment time course at 37°C showing luminescence generated by cells expressing different configurations of V2R and ARRB2 fused to NLpolyl lS and NLpep 101 after treatment with AVP.
Figure 140 shows a comparison of luminescence in different cell lines expressing V2R- NLpep 11 S and NLpep 101 -ARRB2.
Figure 141 shows 60X images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
Figure 142 shows 15 OX images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
Figure 143 shows a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
Figure 144 shows the dissociation constants for NLpoly 5P and combinations of mutations at positions 31, 46, 75, 76, and 93 in NLpoly 5P.
Figure 145 shows a transferase example of post translational modification enzyme activity detection using an NLpep and aminopeptidase. Figure 146 shows a hydrolase example of post translational modification enzyme activity detection using an NLpep and methyl-specific antibody.
Figure 147 contains wavelength scans for NLpoly WT complemented with either NLpep WT or NLpep WT conjugated to TMR.
Figure 148 contains wavelength scans for NanoLuc fused to HaloTag (NL-HT) and
NLpoly 5 A2 complemented with NLPepWT with 4 additional amino acids (DEVD) and conjugated to Non-chloroTOM (NCT).
Figure 149 shows a schematic a tertiary interaction wherein the energy transfer with an NLpoly and NLpep can also be used to measure three molecules interacting. In the schematic, a GPCR labeled with an NLpoly and a GPCR interacting protein labeled with an NLpep form a bioluminescent complex when they interact. This allows measurement of the binary interaction. If a small molecule GPCR ligand bearing an appropriate fluorescent moiety for energy transfer interacts with this system, energy transfer will occur. Therefore, the binary protein-protein interaction and the ternary drug-protein-protein interaction can be measured in the same experiment.
Figure 150 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep78 and NLPep78 at the N- or C-terminus of a fusion partner (HaloTag).
Figure 151 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep79 and NLPep79 at the N- or C-terminus of a fusion partner (HaloTag). Figure 152 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with
NLPep86 or PBI-4877.
Figure 153 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5434.
Figure 154 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5436.
Figure 155 shows a graph demonstrating furimazine binding affinity in affinity buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114.
Figure 156 shows a graph demonstrating furimazine binding affinity in NanoGlo assay buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114. Figure 157 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
NLpolyl lS/NLPepl) with increasing concentrations of furimazine substrate. Figure 158 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
NLpolyl lS/NLPepl) with increasing concentrations of NLPepl .
Figure 159 shows a graph depicting Vmax and Bmax NLPolyl 56, NLPolyl IS, and NanoLuc® luciferase (Nluc) with NLPepl . Figure 160 shows a graph depicting RLU as a function of NLPep concentration for
NLPolyl IS and NLPep86, 78, 79, 99, 101, 104, 114, 128 and wt.
Figure 161 shows a Western blot depicting expression level in HEK293T cells of NLPolyl 56 and NLPolyl IS compared to full-length NanoLuc® luciferase.
Figure 162 shows graphs depicting a comparison of the affinity of the β-lactamase SME and its inhibitor BLIPY50A as unfused proteins or when fused to NLPolyl IS and NLPepl 14.
Figure 163 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpeplOl/111-136
Figure 164 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpepl 14 and 137-143. Figure 165 shows rapamycin dose response curves of cells expressing FRB-NLpolyl IS and FKBP-NLpep78/79/99/l 01/104/114/128
Figure 166 shows response of cells expressing FRB-NLpolyl IS and FKBP- 78/79/99/101/104/114/128 to the rapamycin competitive inhibitor FK506
Figure 167 shows a comparison of luminescence generated by cells transfected with different ratios of FRB-NLpolyl IS and FKBP-NLpepl 14.
Figure 168 shows a comparison of luminescence generated by cells expressing
NLpolyl IS/NLpepl 14 fusions of FRB/FKBP in different orientations and with different linker lengths. Figure 169 shows graphs depicting rapamycin (A) dose-specific and (B) time-specific induction of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals.
Figure 170 shows graphs depicting FK506(A) dose-specific and (B) time-specific inhibition of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals. Figure 171 shows Western blots depicting similar expression levels of FKBP-NLpepl 14 and FKBP-Fluc(394-544) at equal levels of transfected DNA.
Figure 172 shows graphs depicting (A) dose-specific and (B) time-specific inhibition of NLpolyl 1S-BRD4 and Histone H3.3-NLpepl 14 interaction by IBET-151.
Figure 173 shows a graph depicting dose dependent increases in RAS/CRAF,
BRAF/BRAF and CRAF/BRAF dimerization in response to BRAF inhibitor GDC0879.
Figure 174 shows a graph depicting RLU as a function of NLPep concentration for NLpolyl IS and NLpep86, wt, and NLpepl 14.
Figure 175 shows a schematic of an assay utilizing a high affinity peptide of a
luminescent pair as an intracellular protein tag and the polypeptide of the luminescent pair as a detection reagent.
Figure 176 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and MLpep86.
Figure 177 shows images demonstrating the sensitivity of detecting proteins tagged with a high affinity NLPep using 1 IS. This figure also compares the detection using NLPep/NLPoly to the detection using fluorescently labeled HaloTag.
Figure 178 shows a graph demonstating the stability of NLpolyl IS.
Figure 179 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and NLpep78.
Figure 180 shows a summary of NLpep sequences. High affinity (spontaneous) peptides are those peptides (NLpep) which bind to NLpolyl IS with high affinity. Dark/Quencher peptides are those peptides (NLpep) which can reduce the levels of light being produced or detected from NLpolyl IS.
Figure 181 shows a schematic for the concept of structural complementation where the LSP and SSP (i.e., NLpoly and NLpep) are brought together to produce a bioluminescent signal (panels A, B). Upon disruption of a protein interaction (i.e. X and Y), LSP and SSP come apart resulting in a decrease in luminescence (Panel C).
Figure 182 A shows two options (A, B) for engineering structural complementation to be a loss of signal upon protein interaction between X and Y and a gain of signal upon disruption of the interaction between X and Y. Option A represents intermolecular structural complementation. Option B represents intramolecular structural complementation. Figure 182B shows a list of genetic constructs that could be suitable for intramolecular structural complementation.
Figure 183 shows (A) inhibition of NLpolyl IS and NLpepl 14 binding by various dark peptides, and (B) dose-dependent inhibition by Lys-162 and Gin- 162 peptides.
Figure 184 A shows that inhibition by Q-162 and A- 162 is dose-dependent. Panel B shows that Q-162 produces a signal on its own in a dose-dependent manner, while the dose- dependency of A- 162 is subtle at best.
Figure 185 shows graphs demonstrating dose-response of the dark peptides with CP Nluc. Figure 186 shows graphs depicting a time course of dark peptide with CP Nluc.
Figure 187 shows the dark peptide dose-dependent inhibition of luminescence generated from FRB-NLpolyl IS alone and also between FRB-NLpolyl IS and FKBP-NLpepl 14 in the presence and absence of rapamycin.
Figure 188 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (RLU) .
Figure 189 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (normalized to no dark peptide control; 100%).
Figure 190 shows that the dark peptides, when fused to FKBP, can compete with both low (114) and high (80) affinity peptides (also FKBP fusions) and as a result reduce the total luminescence being produced and detected in live cells.
Figure 191 shows the signal comparison between Flue and NLpep86-based assays for intracellular levels of Flue.
Figure 192 shows graphs demonstrating the utility of tandem linked NLpeps in complementing Npoly 11 S .
Figure 193 shows a graph demonstrating that NLpoly and NLpep components do not interfere with intracellular degradation of reporter protein FlucP.
Figure 194 shows a schematic demonstrating and extracellular protease activity assay. Figure 195 shows a schematic of an assay for measuring the activity of an enzyme using a ProNLpep.
Figure 196 shows a schematic of an assay for screening antibodies, proteins, peptides or transporters that mediate cellular internalization.
Figure 197 shows a schematic of a post-translational modification transferase assay.
Figure 198 shows a schematic of a post-translational modification hydrolase assay. Figure 199 shows graphs correlating Tyrosine Kinase SRC activity with luminescence over background in a post-translational modification assay.
Figure 200 shows a graph depicting spontaneous complementation of three different versions of NLpolyl IS with twelve synthetic peptides.
Figure 201 shows a schematic of a homogeneous immunoassay format utilizing fusions of NLpep and NLpoly with separate binding moieties A and B.
Figure 202 shows graphs demonstrating: (A) reduction in background luminescence from NLpolyl IS upon complex formation with GWALFKK and Dabcyl-GWALFKK, and (B) NLpep86 forms a complex with NLpolyl IS in the presence of GWALFKK and Dabcyl - GWALFKK.
Figure 203 shows graphs demonstrating: (A) VTGWALFEEIL (Trp 1 lmer) and
VTGYALFEEIL (Tyr 1 lmer) induce luminescence over background (NLpolyl IS alone; no peptide control), and that the N-terminal Dabcyl versions of each provide significant quenching of this signal, and (B) that NLpep86 forms a complex with NLpolyl IS in the presence of Dabcyl versions of Trp 1 lmer and Tyr 1 lmer.
DEFINITIONS
As used herein, the term "substantially" means that the recited characteristic, parameter, and/or value need not be achieved exactly, but that deviations or variations, including for example, tolerances, measurement error, measurement accuracy limitations and other factors known to skill in the art, may occur in amounts that do not preclude the effect the characteristic was intended to provide. A characteristic or feature that is substantially absent (e.g.,
substantially non-luminescent) may be one that is within the noise, beneath background, below the detection capabilities of the assay being used, or a small fraction (e.g., <1%, <0.1%, <0.01%, <0.001%, <0.00001%, <0.000001%, 0.0000001%) of the significant characteristic (e.g., luminescent intensity of a biolummescent protein or biolummescent complex).
As used herein, the term "bioluminescence" refers to production and emission of light by a chemical reaction catalyzed by, or enabled by, an enzyme, protein, protein complex, or other biomolecule (e.g., biolummescent complex). In typical embodiments, a substrate for a biolummescent entity (e.g., biolummescent protein or biolummescent complex) is converted into an unstable form by the biolummescent entity; the substrate subsequently emits light.
As used herein the term "complementary" refers to the characteristic of two or more structural elements (e.g., peptide, polypeptide, nucleic acid, small molecule, etc.) of being able to hybridize, dimerize, or otherwise form a complex with each other. For example, a
"complementary peptide and polypeptide" are capable of coming together to form a complex. Complementary elements may require assistance to form a complex (e.g., from interaction elements), for example, to place the elements in the proper conformation for complementarity, to co-localize complementary elements, to lower interaction energy for complementary, etc.
As used herein, the term "complex" refers to an assemblage or aggregate of molecules (e.g., peptides, polypeptides, etc.) in direct and/or indirect contact with one another. In one aspect, "contact," or more particularly, "direct contact" means two or more molecules are close enough so that attractive noncovalent interactions, such as Van der Waal forces, hydrogen bonding, ionic and hydrophobic interactions, and the like, dominate the interaction of the molecules. In such an aspect, a complex of molecules (e.g., a peptide and polypeptide) is formed under assay conditions such that the complex is thermodynamically favored (e.g., compared to a non-aggregated, or non-complexed, state of its component molecules). As used herein the term "complex," unless described as otherwise, refers to the assemblage of two or more molecules (e.g., peptides, polypeptides or a combination thereof).
As used herein, the term "non-luminescent" refers to an entity (e.g., peptide, polypeptide, complex, protein, etc.) that exhibits the characteristic of not emitting a detectable amount of light in the visible spectrum (e.g., in the presence of a substrate). For example, an entity may be referred to as non-luminescent if it does not exhibit detectable luminescence in a given assay. As used herein, the term "non-luminescent" is synonymous with the term "substantially non- luminescent. For example, a non-luminescent polypeptide (NLpoly) is substantially non- luminescent, exhibiting, for example, a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl03-fold, lxl04-fold, lxl05-fold, lxl06-fold, lxl 07-fold, etc.) reduction in luminescence compared to a complex of the NLpoly with its non-luminescent complement peptide. In some embodiments, an entity is "non-luminescent" if any light emission is sufficiently minimal so as not to create interfering background for a particular assay.
As used herein, the terms "non-luminescent peptide" (e.g., NLpep) and "non-luminescent polypeptide" (e.g., NLpoly) refer to peptides and polypeptides that exhibit substantially no luminescence (e.g., in the presence of a substrate), or an amount that is beneath the noise, or a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl03-fold, lxl04-fold, lxl05-fold, lxlO6- fold, lxl07-fold, etc.) when compared to a significant signal (e.g., luminescent complex) under standard conditions (e.g., physiological conditions, assay conditions, etc.) and with typical instrumentation (e.g., luminometer, etc.). In some embodiments, such non-luminescent peptides and polypeptides assemble, according to the criteria described herein, to form a bioluminescent complex. As used herein, a "non-luminescent element" is a non-luminescent peptide or non- luminescent polypeptide. The term "bioluminescent complex" refers to the assembled complex of two or more non-luminescent peptides and/or non-luminescent polypeptides. The biolummescent complex catalyzes or enables the conversion of a substrate for the biolummescent complex into an unstable form; the substrate subsequently emits light. When uncomplexed, two non-luminescent elements that form a biolummescent complex may be referred to as a "non- luminescent pair." If a biolummescent complex is formed by three or more non-luminescent peptides and/or non-luminescent polypeptides, the uncomplexed constituents of the
biolummescent complex may be referred to as a "non-luminescent group."
As used herein, the term "interaction element" refers to a moiety that assists in bringing together a pair of non-luminescent elements or a non-luminescent group to form a
biolummescent complex. In a typical embodiment, a pair of interaction elements (a.k.a.
"interaction pair") is attached to a pair of non-luminescent elements (e.g., non-luminescent peptide/polypeptide pair), and the attractive interaction between the two interaction elements facilitates formation of the biolummescent complex; although the present invention is not limited to such a mechanism, and an understanding of the mechanism is not required to practice the invention. Interaction elements may facilitate formation of the biolummescent complex by any suitable mechanism (e.g., bringing non-luminescent pair/group into close proximity, placing a non- luminescent pair/group in proper conformation for stable interaction, reducing activation energy for complex formation, combinations thereof, etc.). An interaction element may be a protein, polypeptide, peptide, small molecule, cofactor, nucleic acid, lipid, carbohydrate, antibody, etc. An interaction pair may be made of two of the same interaction elements (i.e. homopair) or two different interaction elements (i.e. heteropair). In the case of a heteropair, the interaction elements may be the same type of moiety (e.g., polypeptides) or may be two different types of moieties (e.g., polypeptide and small molecule). In some embodiments, in which complex formation by the interaction pair is studied, an interaction pair may be referred to as a "target pair" or a "pair of interest," and the individual interaction elements are referred to as "target elements" (e.g., "target peptide," "target polypeptide," etc.) or "elements of interest" (e.g., "peptide of interest," "polypeptide or interest," etc.).
As used herein, the term "preexisting protein" refers to an amino acid sequence that was in physical existence prior to a certain event or date. A "peptide that is not a fragment of a preexisting protein" is a short amino acid chain that is not a fragment or sub-sequence of a protein (e.g., synthetic or naturally-occurring) that was in physical existence prior to the design and/or synthesis of the peptide.
As used herein, the term "fragment" refers to a peptide or polypeptide that results from dissection or "fragmentation" of a larger whole entity (e.g., protein, polypeptide, enzyme, etc.), or a peptide or polypeptide prepared to have the same sequence as such. Therefore, a fragment is a subsequence of the whole entity (e.g., protein, polypeptide, enzyme, etc.) from which it is made and/or designed. A peptide or polypeptide that is not a subsequence of a preexisting whole protein is not a fragment (e.g., not a fragment of a preexisting protein). A peptide or polypeptide that is "not a fragment of a preexisting bioluminescent protein" is an amino acid chain that is not a subsequence of a protein (e.g., natural or synthetic) that: (1) was in physical existence prior to design and/or synthesis of the peptide or polypeptide, and (2) exhibits substantial bioluminescent activity.
As used herein, the term "subsequence" refers to peptide or polypeptide that has 100% sequence identify with another, larger peptide or polypeptide. The subsequence is a perfect sequence match for a portion of the larger amino acid chain.
As used herein, the term "sequence identity" refers to the degree two polymer sequences
(e.g., peptide, polypeptide, nucleic acid, etc.) have the same sequential composition of monomer subunits. The term "sequence similarity" refers to the degree with which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences. For example, similar amino acids are those that share the same biophysical characteristics and can be grouped into the families, e.g., acidic (e.g., aspartate, glutamate), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). The "percent sequence identity" (or "percent sequence similarity") is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity. For example, if peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70%> sequence identity, but peptide D has 93.3%) sequence identity to an optimal comparison window of peptide C. For the purpose of calculating "percent sequence identity" (or "percent sequence similarity") herein, any gaps in aligned sequences are treated as mismatches at that position. As used herein, the term "physiological conditions" encompasses any conditions compatible with living cells, e.g., predominantly aqueous conditions of a temperature, pH, salinity, chemical makeup, etc. that are compatible with living cells.
As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Sample may also refer to cell lysates or purified forms of the peptides and/or polypeptides described herein. Cell lysates may include cells that have been lysed with a lysing agent or lysates such as rabbit reticulocyte or wheat germ lysates. Sample may also include cell- free expression systems. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
As used herein, unless otherwise specified, the terms "peptide" and "polypeptide" refer to polymer compounds of two or more amino acids joined through the main chain by peptide amide bonds (— C(0)NH— ). The term "peptide" typically refers to short amino acid polymers (e.g., chains having fewer than 25 amino acids), whereas the term "polypeptide" typically refers to longer amino acid polymers (e.g., chains having more than 25 amino acids).
DETAILED DESCRIPTION
The study of protein interactions, particularly under physiological conditions and/or at physiologic expression levels, requires high sensitivity. In particular embodiments described herein, protein interactions with small molecules, nucleic acids, other proteins, etc. are detected based on the association of two non-luminescent elements that come together to from a bioluminescent complex capable of producing a detectable signal (e.g., luminescence). The formation of the bioluminescent complex is dependent upon the protein interaction that is being monitored.
Provided herein are compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent peptide and/or polypeptide units (e.g., non- luminescent pair). In some embodiments, the non-luminescent peptide and/or polypeptide units are not fragments of a preexisting protein (e.g., are not complementary subsequences of a known polypeptide sequence). In particular, bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with a non-luminescent peptide.
In some embodiments, provided herein are non-luminescent pairs for use in detecting and monitoring molecular interactions (e.g., protein-protein, protein-DNA, protein-R A interactions, RNA-DNA, protein-small molecule, RNA-small-molecule, etc.). Also provided herein are complementary panels of interchangeable non-luminescent elements (e.g., peptides and polypeptides) that have variable affinities and luminescence upon formation of the various bioluminescent complexes (e.g., a high-affinity/high-luminescence pair, a moderate- affinity/high-luminescence pair, a low-affinity/moderate-luminescence pair, etc.). Utilizing different combinations of non-luminescent elements provides an adaptable system comprising various pairs ranging from lower to higher affinities, luminescence and other variable characteristics. This adaptability allows the detection/monitoring of molecular interactions to be fine-tuned to the specific molecule(s) of interest and expands the range of molecular interactions that can be monitored to include interactions with very high or low affinities. Further provided herein are methods by which non-luminescent pairs (or groups) and panels of non- luminescent pairs (or groups) are developed and tested.
In some embodiments, the interaction between the peptide/polypeptide members of the non-luminescent pair alone is insufficient to form the bioluminescent complex and produce the resulting bioluminescent signal. However, if an interaction element is attached to each peptide/polypeptide member of the non- luminescent pair, then the interactions of the interaction pair (e.g., to form an interaction complex) facilitate formation of the bioluminescent complex. In such embodiments, the bioluminescent signal from the bioluminescent complex (or the capacity to produce such a signal in the presence of substrate) serves as a reporter for the formation of the interaction complex. If an interaction complex is formed, then a bioluminescent complex is formed, and a bioluminescent signal is detected/measured/monitored (e.g., in the presence of substrate). If an interaction complex fails to form (e.g., due to unfavorable conditions, due to unstable interaction between the interaction elements, due to incompatible interaction elements), then a bioluminescent complex does not form, and a bioluminescent signal is not produced.
In certain embodiments, the interaction pair comprises two molecules of interest (e.g., proteins of interest). For example, assays can be performed to detect the interaction of two molecules of interest by tethering each one to a separate member of a non-luminescent pair. If the molecules of interest interact (e.g., transiently interact, stably interact, etc.), the non- luminescent pair is brought into close proximity in a suitable conformation and a bioluminescent complex is formed (and bioluminescent signal is produced/detected (in the presence of substrate)). In the absence of an interaction between the molecules of interest (e.g., no complex formation, not even transient interaction, etc.), the non-luminescent pair does not interact in a sufficient manner, and a bioluminescent signal is not produced or only weakly produced. Such embodiments can be used to study the effect of inhibitors on complex formation, the effect of mutations on complex formation, the effect of conditions (e.g., temperature, pH, etc.) on complex formation, the interaction of a small molecule (e.g., potential therapeutic) with a target molecule, etc.
Different non-luminescent pairs may require different strength, duration and/or stability of the interaction complex to result in bioluminescent complex formation. In some
embodiments, a stable interaction complex is required to produce a detectable bioluminescent signal. In other embodiments, even a weak or transient interaction complex results in
bioluminescent complex formation. In some embodiments, the strength or extent of an interaction complex is directly proportional to the strength of the resulting bioluminescent signal. Some non-luminescent pairs produce a detectable signal when combined with an interaction complex with a high millimolar dissociation constant (e.g., Kd>100 mM). Other non- luminescent pairs require an interaction pair with a low millimolar (e.g., Kd<100 mM), micromolar (e.g., Kd<l mM), nanomolar (e.g., Kd<l μΜ), or even picomolar (e.g., Kd<l nM) dissociation constant in order to produce a bioluminescent complex with a detectable signal.
In some embodiments, one or more of the non-luminescent peptides/polypeptides are not fragments of a pre-existing protein. In some embodiments, one or more of the non- luminescent peptides/polypeptides are not fragments of a pre-existing bioluminescent protein. In some embodiments, neither/none of the non-luminescent peptides/polypeptides are fragments of a preexisting protein. In some embodiments, neither/none of the non-luminescent
peptides/polypeptides are fragments of a pre-existing bioluminescent protein. In some embodiments, neither the non-luminescent peptide nor non-luminescent polypeptide that assemble together to form a bioluminescent complex are fragments of a pre-existing protein. In some embodiments, a non-luminescent element for use in embodiments of the present invention is not a subsequence of a preexisting protein. In some embodiments, a non-luminescent pair for use in embodiments described herein does not comprise complementary subsequences of a preexisting protein.
In some embodiments, non-luminescent peptides/polypeptides are substantially non- luminescent in isolation. In certain embodiments, when placed in suitable conditions (e.g., physiological conditions), non-luminescent peptides/polypeptides interact to form a
bioluminescent complex and produce a bioluminescent signal in the presence of substrate. In other embodiments, without the addition of one or more interaction elements (e.g.,
complementary interaction elements attached to the component non-luminescent peptide and non-luminescent polypeptide), non-luminescent peptides/polypeptides are unable to form a bioluminescent complex or only weakly form a complex. In such embodiments, non- luminescent peptides/polypeptides are substantially non-luminescent in each other's presence alone, but produce significant detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements. In some embodiments, without the addition of one or more interaction elements (e.g., complementary interaction elements attached to the component peptide and polypeptide), peptides and/or polypeptides that assemble into the bio luminescent complex produce a low level of luminescence in each other's presence, but undergo a significant increase in detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements.
In some embodiments, compositions and methods described herein comprise one or more interaction elements. In a typical embodiment, an interaction element is a moiety (e.g., peptide, polypeptide, protein, small molecule, nucleic acid, lipid, carbohydrate, etc.) that is attached to a peptide and/or polypeptide to assemble into the bioluminescent complex. The interaction element facilitates the formation of a bioluminescent complex by any suitable mechanism, including: interacting with one or both non-luminescent elements, inducing a conformational change in a non-luminescent element, interacting with another interaction element (e.g., an interaction element attached to the other non-luminescent element), bringing non-luminescent elements into close proximity, orienting non-luminescent elements for proper interaction, etc.
In some embodiments, one or more interaction elements are added to a solution containing the non-luminescent elements, but are not attached to the non- luminescent elements. In such embodiments, the interaction element(s) interact with the non-luminescent elements to induce formation of the bioluminescent complex or create conditions suitable for formation of the bioluminescent complex. In other embodiments, a single interaction element is attached to one member of a non-luminescent pair. In such embodiments, the lone interaction element interacts with one or both of the non-luminescent elements to create favorable interactions for formation of the bioluminescent complex. In typical embodiments of the present invention, one interaction element is attached to each member of a non-luminescent pair. Favorable interactions between the interaction elements facilitate interactions between the non-luminescent elements.
The interaction pair may stably interact, transiently interact, form a complex, etc. The interaction of the interaction pair facilitates interaction of the non-luminescent elements (and formation of a bioluminescent complex) by any suitable mechanism, including, but not limited to: bringing the non-luminescent pair members into close proximity, properly orienting the non-luminescent pair members from interaction, reducing non-covalent forces acting against non-luminescent pair interaction, etc.
In some embodiments, an interaction pair comprises any two chemical moieties that facilitate interaction of an associated non-luminescent pair. An interaction pair may consist of, for example: two complementary nucleic acids, two polypeptides capable of dimerization (e.g., homodimer, heterodimer, etc.), a protein and ligand, protein and small molecule, an antibody and epitope, a reactive pair of small molecules, etc. Any suitable pair of interacting molecules may find use as an interaction pair.
In some embodiments, an interaction pair comprises two molecules of interest (e.g., proteins of interest) or target molecules. In some embodiments, compositions and methods herein provide useful assays (e.g., in vitro, in vivo, in situ, whole animal, etc.) for studying the interactions between a pair of target molecules.
In certain embodiments, a pair off interaction elements, each attached to one of the non- luminescent elements, interact with each other and thereby facilitate formation of the
bioluminescent complex. In some embodiments, the presence of a ligand, substrate, co-factor or addition interaction element (e.g., not attached to non-luminescent element) is necessary to induce the interaction between the interaction elements and facilitate bioluminescent complex formation. In some embodiments, detecting a signal from the bioluminescent complex indicates the presence of the ligand, substrate, co-factor or addition interaction element or conditions that allow for interaction with the interaction elements.
In some embodiments, a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain (e.g., (interaction element l)-NLpep- (interaction element 2)-NLpoly, NLpoly-(interaction element l)-NLpep~(interaction element 2), NLpoly-(interaction element l)-(interaction element 2)-NLpep, etc.). In some embodiments in which a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain, a ligand, substrate, co-factor or addition interaction element is required for the interaction pair to form an interaction complex and facilitate formation of the
bioluminescent complex.
In certain embodiments, an interaction element and a non-luminescent element are attached, fused, linked, connected, etc. In typical embodiments, a first non-luminescent element and a first interaction element are attached to each other, and a second non-luminescent element and a second interaction element are attached to each other. Attachment of signal and interaction elements may be achieved by any suitable mechanism, chemistry, linker, etc. The interaction and non-luminescent elements are typically attached through covalent connection, but non- covalent linking of the two elements is also provided. In some embodiments, the signal and interaction elements are directly connected and, in other embodiments, they are connected by a linker.
In some embodiments, in which the interaction element is a peptide or polypeptide, the signal and interaction elements are contained within a single amino acid chain. In some embodiments, a single amino acid chain comprises, consists of, or consists essentially of a non- luminescent element and interaction element. In some embodiments, a single amino acid chain comprises, consists of, or consists essentially of a non-luminescent element, an interaction element, and optionally one or more an N-terminal sequence, a C-terminal sequence, regulatory elements (e.g., promoter, translational start site, etc.), and a linker sequence. In some
embodiments, the signal and interaction elements are contained within a fusion polypeptide. The signal and interaction elements (and any other amino acid segments to be included in the fusion) may be expressed separately; however, in other embodiments, a fusion protein is expressed that comprises or consist of both the interaction and signal sequences.
In some embodiments, a first fusion protein comprising a first non-luminescent element and first interaction element as well as a second fusion protein comprising a second non- luminescent element and second interaction element are expressed within the same cells. In such embodiments, the first and second fusion proteins are purified and/or isolated from the cells, or the interaction of the fusion proteins is assayed within the cells. In other embodiments, first and second fusion proteins are expressed in separate cells and combined (e.g., following purification and/or isolation, or following fusion of the cells or portions of the cells, or by transfer of a fusion protein from one cell to another, or by secretion of one or more fusion proteins into the extracellular medium) for signal detection. In some embodiments, one or more fusion proteins are expressed in cell lysate (e.g., rabbit reticulocyte lysate) or in a cell-free system. In some embodiments, one or more fusion proteins are expressed from the genome of a virus or other cellular pathogen.
In certain embodiments, nucleic acids, DNA, RNA, vectors, etc. are provided that encode peptide, polypeptides, fusion polypeptide, fusion proteins, etc. of the present invention. Such nucleic acids and vectors may be used for expression, transformation, transfection, injection, etc.
In some embodiments, a non-luminescent element and interaction element are connected by a linker. In some embodiments, a linker connects the signal and interaction elements while providing a desired amount of space/distance between the elements. In some embodiments, a linker allows both the signal and interaction elements to form their respective pairs (e.g., non- luminescent pair and interaction pair) simultaneously. In some embodiments, a linker assists the interaction element in facilitating the formation of a non-luminescent pair interaction. In some embodiments, when an interaction pair is formed, the linkers that connect each non-luminescent element to their respective interaction elements position the non-luminescent elements at the proper distance and conformation to form a bioluminescent complex. In some embodiments, an interaction element and non-luminescent element are held in close proximity (e.g., <4 monomer units) by a linker. In some embodiments, a linker provides a desired amount of distance (e.g., 1, 2, 3, 4, 5, 6...10... 20, or more monomer units) between signal and interaction elements (e.g., to prevent undesirable interactions between signal and interaction elements, for steric considerations, to allow proper orientation of non-luminescent element upon formation of interaction complex, to allow propagation of a complex-formation from interaction complex to non-luminescent elements, etc.). In certain embodiments, a linker provides appropriate attachment chemistry between the signal and interaction elements. A linker may also improve the synthetic process of making the signal and interaction element (e.g., allowing them to be synthesized as a single unit, allowing post synthesis connection of the two elements, etc.).
In some embodiments, a linker is any suitable chemical moiety capable of linking, connecting, or tethering a non-luminescent element to an interaction element. In some embodiments, a linker is a polymer of one or more repeating or non-repeating monomer units (e.g., nucleic acid, amino acid, carbon-containing polymer, carbon chain, etc.). When a non- luminescent element and interaction element are part of a fusion protein, a linker (when present) is typically an amino acid chain. When a non-luminescent element and interaction element are tethered together after the expression of the individual elements, a linker may comprise any chemical moiety with functional (or reactive) groups at either end that are reactive with functional groups on the signal and interaction elements, respectively. Any suitable moiety capable of tethering the signal and interaction elements may find use as a linker.
A wide variety of linkers may be used. In some embodiments, the linker is a single covalent bond. In some embodiments, the linker comprises a linear or branched, cyclic or heterocyclic, saturated or unsaturated, structure having 1-20 nonhydrogen atoms (e.g., C, N, P, O and S) and is composed of any combination of alkyl, ether, thioether, imine, carboxylic, amine, ester, carboxamide, sulfonamide, hydrazide bonds and aromatic or heteroaromatic bonds. In some embodiments, linkers are longer than 20 nonhydrogen atoms (e.g. 21 non-hydrogen atoms, 25 non-hydrogen atoms, 30 non-hydrogen atoms, 40 non-hydrogen atoms, 50 non-hydrogen atoms, 100 non-hydrogen atoms, etc.) In some embodiments, the linker comprises 1-50 non- hydrogen atoms (in addition to hydrogen atoms) selected from the group of C, N, P, O and S (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 non-hydrogen atoms).
The present invention is not limited by the types of linkers available. The signal and interaction elements are linked, either directly (e.g. linker consists of a single covalent bond) or linked via a suitable linker. The present invention is not limited to any particular linker group. A variety of linker groups are contemplated, and suitable linkers could comprise, but are not limited to, alkyl groups, methylene carbon chains, ether, polyether, alkyl amide linker, a peptide linker, a modified peptide linker, a Poly(ethylene glycol) (PEG) linker, a streptavidin-biotin or avidin- biotin linker, polyaminoacids (e.g. polylysine), functionalised PEG, polysaccharides, glycosaminoglycans, dendritic polymers (WO93/06868 and by Tomalia et al. in Angew. Chem.
Int. Ed. Engl. 29: 138-175 (1990), herein incorporated by reference in their entireties), PEG- chelant polymers (W94/08629, WO94/09056 and W096/26754, herein incorporated by reference in their entireties), oligonucleotide linker, phospholipid derivatives, alkenyl chains, alkynyl chains, disulfide, or a combination thereof. In some embodiments, the linker is cleavable (e.g., enzymatically (e.g., TEV protease site), chemically, photoinduced, etc.
In some embodiments, substantially non-luminescent peptides and polypeptides are provided with less than 100% sequence identity and/or similarity to any portion of an existing luciferase (e.g., a firefly luciferase, a Renilla luciferase, an Oplophorus luciferase, enhanced Oplophorus luciferases as described in U.S. Pat. App. 2010/0281552 and U.S. Pat. App.
2012/0174242, herein incorporated by reference in their entireties). Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100% sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence). Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence). In some embodiments, non-luminescent peptides and polypeptides are provided with less than 100% sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and
polypeptides that interact to form bioluminescent complexes). In some embodiments, non- luminescent peptides and polypeptides are provided with less than 100%, but more than 40%> (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%,
>98%, >99%) sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and polypeptides that interact to form bioluminescent complexes). Non-luminescent peptides are provided that have less than 100% sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157. Non-luminescent peptides are provided that have less than 100%>sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157. Non- luminescent peptides are provided that have less than 100%, but more than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157. Similarly, non-luminescent polypeptides are provided that have less than 100%), but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with a portion of SEQ ID NO: 2157, wherein such polypeptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a peptide having less than 100%), but optionally more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157. In some embodiments, non- luminescent peptides with less than lOOsequence identity or similarity with SEQ ID NO: 2 are provided. In some embodiments, non- luminescent peptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with SEQ ID NO: 2 are provided. In some embodiments, non- luminescent polypeptides with less than 100 sequence identity or similarity with SEQ ID NO: 440 are provided.
In some embodiments, non- luminescent polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with SEQ ID NO: 440 are provided.
In some embodiments, non-luminescent peptides that find use in embodiments of the present invention include peptides with one or more amino acid substitutions, deletions, or additions from GVTGWRLCK ISA (SEQ ID NO: 236). In some embodiments, the present invention provides peptides comprising one or more of amino acid sequences of Table 1 , and/or nucleic acids comprising the nucleic acid sequences of Table 1 (which code for the peptide sequences of Table 1). Table 1. Peptide sequences
Figure imgf000035_0001
NLpep20 (w/ Met) N.A. ATGGGACAGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
NLpep20 (w/ Met) A.A. MGQTGWRLCK ISA
NLpep21 (w/ Met) N.A. ATGGGAAGCACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
NLpep21 (w/ Met) A.A. MGSTGWRLCKRISA
NLpep22 (w/ Met) N.A. ATGGGAGTGGTGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
NLpep22 (w/ Met) A.A. MGVVGWRLCKRISA
NLpep23 (w/ Met) N.A. ATGGGAGTGAAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
NLpep23 (w/ Met) A.A. MGVKGWRLCKRISA
NLpep24 (w/ Met) N.A. ATGGGAGTGCAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
NLpep24 (w/ Met) A.A. MGVQGWRLCKRISA
NLpep25 (w/ Met) N.A. ATGGGAGTGACCGGCACCCGGCTGTGCAAGCGCATTAGCGCG
NLpep25 (w/ Met) A.A. MGVTGTRLCKRISA
NLpep26 (w/ Met) N.A. ATGGGAGTGACCGGCAAGCGGCTGTGCAAGCGCATTAGCGCG
NLpep26 (w/ Met) A.A. MGVTGKRLCKRISA
NLpep27 (w/ Met) N.A. ATGGGAGTGACCGGCGTGCGGCTGTGCAAGCGCATTAGCGCG
NLpep27 (w/ Met) A.A. MGVTGVRLCKRISA
NLpep28 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCACTGCAAGCGCATTAGCGCG
NLpep28 (w/ Met) A.A. MGVTGWRICKRISA
NLpep29 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGGTGTGCAAGCGCATTAGCGCG
NLpep29 (w/ Met) A.A. MGVTGWRVCKRISA
NLpep30 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGACCTGCAAGCGCATTAGCGCG
NLpep30 (w/ Met) A.A. MGVTGWRTCKRISA
NLpep31 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGTACTGCAAGCGCATTAGCGCG
NLpep31 (w/ Met) A.A. MGVTGWRYCKRISA
NLpep32 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGAAGTGCAAGCGCATTAGCGCG
NLpep32 (w/ Met) A.A. MGVTGWRKCKRISA
NLpep33 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGAACAAGCGCATTAGCGCG
NLpep33 (w/ Met) A.A. MGVTGWRLNKRISA
NLpep34 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGACCAAGCGCATTAGCGCG
NLpep34 (w/ Met) A.A. MGVTGWRLTKRISA
NLpep35 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAAGATTAGCGCG
NLpep35 (w/ Met) A.A. MGVTGWRLCKKISA
NLpep36 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAACATTAGCGCG
NLpep36 (w/ Met) A.A. MGVTGWRLCKNISA
NLpep37 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCGTGAGCGCG
NLpep37 (w/ Met) A.A. MGVTGWRLCKRVSA
NLpep38 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCCAGAGCGCG
NLpep38 (w/ Met) A.A. MGVTGWRLCKRQSA
NLpep39 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCGAGAGCGCG
NLpep39 (w/ Met) A.A. MGVTGWRLCKRESA
NLpep40 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCCGGAGCGCG 80 NLpep40 (w/ Met) A.A. MGVTGWRLCK SA
81 NLpep41 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCTTCAGCGCG
82 NLpep41 (w/ Met) A.A. MGVTG WRLCKRF S A
83 NLpep42 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCAAC
84 NLpep42 (w/ Met) A.A. MGVTGWRLCKRISN
85 NLpep43 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCACC
86 NLpep43 (w/ Met) A.A. MGVTGWRLCKRIST
87 NLpep44 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCCGG
88 NLpep44 (w/ Met) A.A. MGVTGWRLCKRISR
89 NLpep45 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCCTG
90 NLpep45 (w/ Met) A.A. MGVTGWRLCKRISL
91 NLpep46 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGAG
92 NLpep46 (w/ Met) A.A. MGVTGWRLCKRISE
93 NLpep47 (w/ Met) N.A. ATGGGAGTGACCGGCTTCCGGCTGTGCAAGCGCATTAGCGCG
94 NLpep47 (w/ Met) A.A. MGVTGFRLCKRISA
95 NLpep48 (w/ Met) N.A. ATGGGAGTGACCGGCTACCGGCTGTGCAAGCGCATTAGCGCG
96 NLpep48 (w/ Met) A.A. MGVTGYRLCKRISA
97 NLpep49(w/ Met) N.A. ATGGGAGTGACCGGCGAGCGGCTGTGCAAGCGCATTAGCGCG
98 NLpep49(w/ Met) A.A. MGVTGERLCKRISA
99 NLpep50 (w/ Met) N.A. ATGCAGGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
100 NLpep50 (w/ Met) A.A. MQVTGWRLCKRISA
101 NLpep51 (w/ Met) N.A. ATGACCGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
102 NLpep51 (w/ Met) A.A. MTVTGWRLCKRISA
103 NLpep52 (w/ Met) N.A. ATGGGAGTGGAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
104 NLpep52 (w/ Met) A.A. MGVEGWRLCKRISA
105 NLpep53 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
106 NLpep53 (w/ Met) A.A. MGVTGWRLFKRISA
107 NLpep54 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTACAAGCGCATTAGCGCG
108 NLpep54 (w/ Met) A.A. MGVTGWRLYKRISA
109 NLpep55 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGAGCAAGCGCATTAGCGCG
110 NLpep55 (w/ Met) A.A. MGVTGWRLSKRISA
111 NLpep56 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGGGCAAGCGCATTAGCGCG
112 NLpep56 (w/ Met) A.A. MGVTGWRLHKRISA
113 NLpep57 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGATGAAGCGCATTAGCGCG
114 NLpep57 (w/ Met) A.A. MGVTGWRLMKRISA
115 NLpep58 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGGCCAAGCGCATTAGCGCG
116 NLpep58 (w/ Met) A.A. MGVTGWRLAKRISA
117 NLpep59 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGCAGAAGCGCATTAGCGCG
118 NLpep59 (w/ Met) A.A. MGVTGWRLQKRISA
119 NLpep60 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGCTGAAGCGCATTAGCGCG
120 NLpep60 (w/ Met) A.A. MGVTGWRLLKRISA 121 NLpep61 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGAAGAAGCGCATTAGCGCG
122 NLpep61 (w/ Met) A.A. MGVTGW LKK ISA
123 NLpep62 (w/ Met) N.A. ATGAACCACACCGGCTGGCGGCTGAACAAGAAGGTGAGCAAC
124 NLpep62 (w/ Met) A.A. MNITGWRLNKKVSN
125 NLpep63 (w/ Met) N.A. ATGAACCACACCGGCTACCGGCTGAACAAGAAGGTGAGCAAC
126 NLpep63 (w/ Met) A.A. MNITGYRLNKKVSN
127 NLpep64 (w/ Met) N.A. ATGTGCGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
128 NLpep64 (w/ Met) A.A. MCVTGWRLFKRISA
129 NLpep65 (w/ Met) N.A. ATGCCCGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
130 NLpep65 (w/ Met) A.A. MPVTGWRLFKRISA
131 NLpep66 (w/ Met) N.A. ATGAACCACACCGGCTACCGGCTGTTCAAGAAGGTGAGCAAC
132 NLpep66 (w/ Met) A.A. MNITGYRLFKKVSN
133 NLpep67 (w/ Met) N.A. ATGAACGTGACCGGCTACCGGCTGTTCAAGAAGGTGAGCAAC
134 NLpep67 (w/ Met) A.A. MNVTGYRLFKKVSN
135 NLpep68 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCAAGAAGGTGAGCAAC
136 NLpep68 (w/ Met) A.A. MNVTGWRLFKKVSN
137 NLpep69 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
138 NLpep69 (w/ Met) A.A. MNVTGWRLFKKISN
139 NLpep70 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCAAC
140 NLpep70 (w/ Met) A.A. MNVTGWRLFKRISN
141 NLpep71 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCAAC
142 NLpep71 (w/ Met) A.A. MGVTGWRLFKRISN
143 NLpep72 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCGAACGCATTAGCAAC
144 NLpep72 (w/ Met) A.A. MNVTGWRLFERISN
145 NLpep73 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCAAGCGCATTCTGAAC
146 NLpep73 (w/ Met) A.A. MNVTGWRLFKRILN
147 NLpep74 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
148 NLpep74 (w/ Met) A.A. MNVTGWRLFKRISA
149 NLpep75 (w/ Met) N.A. ATGAACGTGACCGGCTGGCGGCTGTTCGAAAAGATTAGCAAC
150 NLpep75 (w/ Met) A.A. MNVTGWRLFEKISN
151 NLpep76 (w/ Met) N.A. ATGAACGTGAGCGGCTGGCGGCTGTTCGAAAAGATTAGCAAC
152 NLpep76 (w/ Met) A.A. MNVSGWRLFEKISN
153 NLpep77 (w/ Met) N.A. ATG-GTGACCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
154 NLpep77 (w/ Met) A.A. M-VTGWRLFKKISN
155 NLpep78 (w/ Met) N.A. ATGAACGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
156 NLpep78 (w/ Met) A.A. MNVSGWRLFKKISN
157 NLpep79 (w/ Met) N.A. ATGAACGTGACCGGCTACCGGCTGTTCAAGAAGATTAGCAAC
158 NLpep79 (w/ Met) A.A. MNVTGYRLFKKISN
159 NLpep80(w/ Met) N.A. ATGGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
160 NLpep80(w/ Met) A.A. MVSGWRLFKKISN
161 NLpep81 (w/ Met) N.A. ATGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
Figure imgf000039_0001
199 NLpeplOO (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGCAGATTAGC
200 NLpeplOO (w/ Met) A.A. MVTGY LFEQIS
201 NLpeplOl (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGAAGGAGAGC
202 NLpeplOl (w/ Met) A.A. MVTGYRLFEKES
203 NLpepl02 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGCAGGAGAGC
204 NLpepl02 (w/ Met) A.A. MVTGYRLFEQES
205 NLpepl03 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGCAGGAGCTG
206 NLpepl03 (w/ Met) A.A. MVTGYRLFEQEL
207 NLpepl04 (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGAAGATTAGC
208 NLpepl04 (w/ Met) A.A. MVEGYRLFEKIS
209 NLpepl05 (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGCAGATTAGC
210 NLpepl05 (w/ Met) A.A. MVEGYRLFEQIS
211 NLpepl06 (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGAAGGAGAGC
212 NLpepl06 (w/ Met) A.A. MVEGYRLFEKES
213 NLpepl07 (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGCAGGAGAGC
214 NLpepl07 (w/ Met) A.A. MVEGYRLFEQES
215 NLpepl08 (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGCAGGAGCTG
216 NLpepl08 (w/ Met) A.A. MVEGYRLFEQEL
217 NLpepl09 (w/ Met) N.A. ATGATTAGCGGCTGGCGGCTGATGAAGAACATTAGC
218 NLpepl09 (w/ Met) A.A. MISGWRLMKNIS
219 NLpepl lO (w/ Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCAAGAAGATTAGC
220 NLpepl lO (w/ Met) A.A. MVEGYRLFKKIS
221 NLpep2 (w/o Met) N.A. GACGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCG
222 NLpep2 (w/o Met) A.A. DVTGWRLCERILA
223 NLpep3 (w/o Met) N.A. GGAGTGACCGCCTGGCGGCTGTGCGAACGCATTCTGGCG
224 NLpep3 (w/o Met) A.A. GVTAWRLCERILA
225 NLpep4 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTCTGGCG
226 NLpep4 (w/o Met) A.A. GVTGWRLCKRILA
227 NLpep5 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCGAACGCATTAGCGCG
228 NLpep5 (w/o Met) A.A. GVTGWRLCERISA
229 NLpep6 (w/o Met) N.A. GACGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
230 NLpep6 (w/o Met) A.A. DVTGWRLCKRISA
231 NLpep7 (w/o Met) N.A. GACGTGACCGGCTGGCGGCTGTGCAAGCGCATTCTGGCG
232 NLpep7 (w/o Met) A.A. DVTGWRLCKRILA
233 NLpep8 (w/o Met) N.A. GACGTGACCGGCTGGCGGCTGTGCGAACGCATTAGCGCG
234 NLpep8 (w/o Met) A.A. DVTGWRLCERISA
235 NLpep9 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
236 NLpep9 (w/o Met) A.A. GVTGWRLCKRISA
237 NLpeplO (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGAACGAACGCATTCTGGCG
238 NLpeplO (w/o Met) A.A. GVTGWRLNERILA
239 NLpepl l (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGCAGGAACGCATTCTGGCG 240 NLpe l l (w/o Met) A.A. GVTGW LQE ILA
241 NLpe l2 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGAAGAAGCGCCGGAGCCGG
242 NLpepl2 (w/o Met) A.A. GVTGWRLKKRRSR
243 NLpepl3 (w/o Met) N.A. AACGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
244 NLpepl3 (w/o Met) A.A. NVTGWRLCKRISA
245 NLpepl4 (w/o Met) N.A. AGCGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
246 NLpepl4 (w/o Met) A.A. SVTGWRLCKRISA
247 NLpepl5 (w/o Met) N.A. GAGGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
248 NLpepl5 (w/o Met) A.A. EVTGWRLCKRISA
249 NLpepl6 (w/o Met) N.A. GGCGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
250 NLpepl6 (w/o Met) A.A. HVTGWRLCKRISA
251 NLpepl7 (w/o Met) N.A. GGACACACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
252 NLpepl7 (w/o Met) A.A. GITGWRLCKRISA
253 NLpepl8 (w/o Met) N.A. GGAGCCACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
254 NLpepl8 (w/o Met) A.A. GATGWRLCKRISA
255 NLpepl9 (w/o Met) N.A. GGAAAGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
256 NLpepl9 (w/o Met) A.A. GKTGWRLCKRISA
257 NLpep20 (w/o Met) N.A. GGACAGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
258 NLpep20 (w/o Met) A.A. GQTGWRLCKRISA
259 NLpep21 (w/o Met) N.A. GGAAGCACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
260 NLpep21 (w/o Met) A.A. GSTGWRLCKRISA
261 NLpep22 (w/o Met) N.A. GGAGTGGTGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
262 NLpep22 (w/o Met) A.A. GVVGWRLCKRISA
263 NLpep23 (w/o Met) N.A. GGAGTGAAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
264 NLpep23 (w/o Met) A.A. GVKGWRLCKRISA
265 NLpep24 (w/o Met) N.A. GGAGTGCAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
266 NLpep24 (w/o Met) A.A. GVQGWRLCKRISA
267 NLpep25 (w/o Met) N.A. GGAGTGACCGGCACCCGGCTGTGCAAGCGCATTAGCGCG
268 NLpep25 (w/o Met) A.A. GVTGTRLCKRISA
269 NLpep26 (w/o Met) N.A. GGAGTGACCGGCAAGCGGCTGTGCAAGCGCATTAGCGCG
270 NLpep26 (w/o Met) A.A. GVTGKRLCKRISA
271 NLpep27 (w/o Met) N.A. GGAGTGACCGGCGTGCGGCTGTGCAAGCGCATTAGCGCG
272 NLpep27 (w/o Met) A.A. GVTGVRLCKRISA
273 NLpep28 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCACTGCAAGCGCATTAGCGCG
274 NLpep28 (w/o Met) A.A. GVTGWRICKRISA
275 NLpep29 (w/o Met) N.A. GGAGTGACCGGCTGGCGGGTGTGCAAGCGCATTAGCGCG
276 NLpep29 (w/o Met) A.A. GVTGWRVCKRISA
277 NLpep30 (w/o Met) N.A. GGAGTGACCGGCTGGCGGACCTGCAAGCGCATTAGCGCG
278 NLpep30 (w/o Met) A.A. GVTGWRTCKRISA
279 NLpep31 (w/o Met) N.A. GGAGTGACCGGCTGGCGGTACTGCAAGCGCATTAGCGCG
280 NLpep31 (w/o Met) A.A. GVTGWRYCKRISA 281 NLpep32 (w/o Met) N.A. GGAGTGACCGGCTGGCGGAAGTGCAAGCGCATTAGCGCG
282 NLpep32 (w/o Met) A.A. GVTGW KCKRISA
283 NLpep33 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGAACAAGCGCATTAGCGCG
284 NLpep33 (w/o Met) A.A. GVTGWRLNKRISA
285 NLpep34 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGACCAAGCGCATTAGCGCG
286 NLpep34 (w/o Met) A.A. GVTGWRLTKRISA
287 NLpep35 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGAAGATTAGCGCG
288 NLpep35 (w/o Met) A.A. GVTGWRLCKKISA
289 NLpep36 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGAACATTAGCGCG
290 NLpep36 (w/o Met) A.A. GVTGWRLCKNISA
291 NLpep37 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCGTGAGCGCG
292 NLpep37 (w/o Met) A.A. GVTGWRLCKRVSA
293 NLpep38 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCCAGAGCGCG
294 NLpep38 (w/o Met) A.A. GVTGWRLCKRQSA
295 NLpep39 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCGAGAGCGCG
296 NLpep39 (w/o Met) A.A. GVTGWRLCKRESA
297 NLpep40 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCCGGAGCGCG
298 NLpep40 (w/o Met) A.A. GVTGWRLCKRRSA
299 NLpep41 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCTTCAGCGCG
300 NLpep41 (w/o Met) A.A. GVTG WRLCKRF S A
301 NLpep42 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCAAC
302 NLpep42 (w/o Met) A.A. GVTGWRLCKRISN
303 NLpep43 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCACC
304 NLpep43 (w/o Met) A.A. GVTGWRLCKRIST
305 NLpep44 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCCGG
306 NLpep44 (w/o Met) A.A. GVTGWRLCKRISR
307 NLpep45 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCCTG
308 NLpep45 (w/o Met) A.A. GVTGWRLCKRISL
309 NLpep46 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGAG
310 NLpep46 (w/o Met) A.A. GVTGWRLCKRISE
311 NLpep47 (w/o Met) N.A. GGAGTGACCGGCTTCCGGCTGTGCAAGCGCATTAGCGCG
312 NLpep47 (w/o Met) A.A. GVTGFRLCKRISA
313 NLpep48 (w/o Met) N.A. GGAGTGACCGGCTACCGGCTGTGCAAGCGCATTAGCGCG
314 NLpep48 (w/o Met) A.A. GVTGYRLCKRISA
315 NLpep49(w/o Met) N.A. GGAGTGACCGGCGAGCGGCTGTGCAAGCGCATTAGCGCG
316 NLpep49(w/o Met) A.A. GVTGERLCKRISA
317 NLpep50 (w/o Met) N.A. CAGGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
318 NLpep50 (w/o Met) A.A. QVTGWRLCKRISA
319 NLpep51 (w/o Met) N.A. ACCGTGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
320 NLpep51 (w/o Met) A.A. TVTGWRLCKRISA
321 NLpep52 (w/o Met) N.A. GGAGTGGAGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG 322 NLpep52 (w/o Met) A.A. GVEGW LCKRISA
323 NLpep53 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
324 NLpep53 (w/o Met) A.A. GVTGWRLFKRISA
325 NLpep54 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTACAAGCGCATTAGCGCG
326 NLpep54 (w/o Met) A.A. GVTGWRLYKRISA
327 NLpep55 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGAGCAAGCGCATTAGCGCG
328 NLpep55 (w/o Met) A.A. GVTGWRLSKRISA
329 NLpep56 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGGGCAAGCGCATTAGCGCG
330 NLpep56 (w/o Met) A.A. GVTGWRLHKRISA
331 NLpep57 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGATGAAGCGCATTAGCGCG
332 NLpep57 (w/o Met) A.A. GVTG WRLMKRI S A
333 NLpep58 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGGCCAAGCGCATTAGCGCG
334 NLpep58 (w/o Met) A.A. GVTGWRLAKRISA
335 NLpep59 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGCAGAAGCGCATTAGCGCG
336 NLpep59 (w/o Met) A.A. GVTGWRLQKRISA
337 NLpep60 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGCTGAAGCGCATTAGCGCG
338 NLpep60 (w/o Met) A.A. GVTGWRLLKRISA
339 NLpep61 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGAAGAAGCGCATTAGCGCG
340 NLpep61 (w/o Met) A.A. GVTGWRLKKRISA
341 NLpep62 (w/o Met) N.A. AACCACACCGGCTGGCGGCTGAACAAGAAGGTGAGCAAC
342 NLpep62 (w/o Met) A.A. NITGWRLNKKVSN
343 NLpep63 (w/o Met) N.A. AACCACACCGGCTACCGGCTGAACAAGAAGGTGAGCAAC
344 NLpep63 (w/o Met) A.A. NITGYRLNKKVSN
345 NLpep64 (w/o Met) N.A. TGCGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
346 NLpep64 (w/o Met) A.A. CVTGWRLFKRISA
347 NLpep65 (w/o Met) N.A. CCCGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCGCG
348 NLpep65 (w/o Met) A.A. PVTGWRLFKRISA
349 NLpep66 (w/o Met) N.A. AACCACACCGGCTACCGGCTGTTCAAGAAGGTGAGCAAC
350 NLpep66 (w/o Met) A.A. NITGYRLFKKVSN
351 NLpep67 (w/o Met) N.A. AACGTGACCGGCTACCGGCTGTTCAAGAAGGTGAGCAAC
352 NLpep67 (w/o Met) A.A. NVTGYRLFKKVSN
353 NLpep68 (w/o Met) N.A. AACGTGACCGGCTGGCGGCTGTTCAAGAAGGTGAGCAAC
354 NLpep68 (w/o Met) A.A. NVTGWRLFKKVSN
355 NLpep69 (w/o Met) N.A. AACGTGACCGGCTGGCGGCTGTTCAAGAAGATTAGCAAC
356 NLpep69 (w/o Met) A.A. NVTGWRLFKKISN
357 NLpep70 (w/o Met) N.A. AACGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCAAC
358 NLpep70 (w/o Met) A.A. NVTGWRLFKRISN
359 NLpep71 (w/o Met) N.A. GGAGTGACCGGCTGGCGGCTGTTCAAGCGCATTAGCAAC
360 NLpep71 (w/o Met) A.A. GVTGWRLFKRISN
361 NLpep72 (w/o Met) N.A. AACGTGACCGGCTGGCGGCTGTTCGAACGCATTAGCAAC
362 NLpep72 (w/o Met) A.A. NVTGWRLFERISN
Figure imgf000044_0001
403 NLpep93 (w/o Met) N.A. GTGACCATCAACCCCGTGAGCGGCTGGCGGCTGTTCAAGAAGATTA
GCAAC
404 NLpep93 (w/o Met) A.A. VTINPVSGW LFKKISN
405 NLpep94 (w/o Met) N.A. CGGGTGACCATCAACCCCGTGAGCGGCTGGCGGCTGTTCAAGAAG
ATTAGCAAC
406 NLpep94 (w/o Met) A.A. RVTINPVSGWRLFKKISN
407 NLpep95 (w/o Met) N.A. AGCGGCTGGCGGCTGCTGAAGAAGATT
408 NLpep95 (w/o Met) A.A. SGWRLLKKI
409 NLpep96 (w/o Met) N.A. ACCGGCTACCGGCTGCTGAAGAAGATT
410 NLpep96 (w/o Met) A.A. TGYRLLKKI
411 NLpep97 (w/o Met) N.A. AGCGGCTGGCGGCTGTTCAAGAAG
412 NLpep97 (w/o Met) A.A. SGWRLFKK
413 NLpep98 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCAAGAAGATTAGC
414 NLpep98 (w/o Met) A.A. VTGYRLFKKIS
415 NLpep99 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGAAGATTAGC
416 NLpep99 (w/o Met) A.A. VTGYRLFEKIS
417 NLpeplOO (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGCAGATTAGC
418 NLpeplOO (w/o Met) A.A. VTGYRLFEQIS
419 NLpeplOl (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGAAGGAGAGC
420 NLpeplOl (w/o Met) A.A. VTGYRLFEKES
421 NLpepl02 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGCAGGAGAGC
422 NLpepl02 (w/o Met) A.A. VTGYRLFEQES
423 NLpepl03 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGCAGGAGCTG
424 NLpepl03 (w/o Met) A.A. VTGYRLFEQEL
425 NLpepl04 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGAAGATTAGC
426 NLpepl04 (w/o Met) A.A. VEGYRLFEKIS
427 NLpepl05 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGCAGATTAGC
428 NLpepl05 (w/o Met) A.A. VEGYRLFEQIS
429 NLpepl06 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGAAGGAGAGC
430 NLpepl06 (w/o Met) A.A. VEGYRLFEKES 431 NLpe l07 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGCAGGAGAGC
432 NLpe l07 (w/o Met) A.A. VEGY LFEQES
433 NLpepl08 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGCAGGAGCTG
434 NLpepl08 (w/o Met) A.A. VEGYRLFEQEL
435 NLpepl09 (w/o Met) N.A. ATTAGCGGCTGGCGGCTGATGAAGAACATTAGC
436 NLpepl09 (w/o Met) A.A. ISGWRLMKNIS
437 NLpepllO(w/oMet) N.A. GTGGAGGGCTACCGGCTGTTCAAGAAGATTAGC
438 NLpepllO(w/oMet) A.A. VEGYRLFKKIS
2162 NLpeplll (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGATCAGC
2163 NLpeplll (w/Met) A.A. MVTGYRLFEEIS
2164 NLpepll2 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGGCCAGC
2165 NLpepll2 (w/Met) A.A. MVTGYRLFEEAS
2166 NLpepll3 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGGAGAGC
2167 NLpepll3 (w/Met) A.A. MVTGYRLFEEES
2168 NLpepll4 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGATCCTG
2169 NLpepll4 (w/Met) A.A. MVTGYRLFEEIL
2170 NLpepll5 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGGCCCTG
2171 NLpepll5 (w/Met) A.A. MVTGYRLFEEAL
2172 NLpepll6 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGGAGCTG
2173 NLpepll6 (w/Met) A.A. MVTGYRLFEEEL
2174 NLpepll7 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGATCAGC
2175 NLpepll7 (w/Met) A.A. MVEGYRLFEEIS
2176 NLpepll8 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGGCCAGC 2177 NLpepll8 (w/Met) A.A. MVEGY LFEEAS
2178 NLpepll9 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGGAGAGC
2179 NLpepll9 (w/Met) A.A. MVEGYRLFEEES
2180 NLpepl20 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGATCCTG
2181 NLpepl20 (w/Met) A.A. MVEGYRLFEEIL
2182 NLpepl21 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGGCCCTG
2183 NLpepl21 (w/Met) A.A. MVEGYRLFEEAL
2184 NLpepl22 (w/Met) N.A. ATGGTGGAGGGCTACCGGCTGTTCGAGGAGGAGCTG
2185 NLpepl22 (w/Met) A.A. MVEGYRLFEEEL
2186 NLpepl23 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCAAGAAGATCCTG
2187 NLpepl23 (w/Met) A.A. MVTGYRLFKKIL
2188 NLpepl24 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGATGAAGAAGATCCTG
2189 NLpepl24 (w/Met) A.A. MVTGYRLMKKIL
2190 NLpepl25 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGCACAAGAAGATCCTG
2191 NLpepl25 (w/Met) A.A. MVTGYRLHKKIL
2192 NLpepl26 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGCTGAAGAAGATCCTG
2193 NLpepl26 (w/Met) A.A. MVTGYRLLKKIL
2194 NLpepl27 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGAGCAAGAAGATCCTG
2195 NLpepl27 (w/Met) A.A. MVTGYRLSKKIL
2196 NLpepl28 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGAAGATCCTG
2197 NLpepl28 (w/Met) A.A. MVTGYRLFEKIL
2198 NLpepl29(w/Met) N.A. ATGGTGACCGGCTACCGGCTGATGGAGAAGATCCTG
2199 NLpepl29(w/Met) A.A. MVTGYRLMEKIL
2200 NLpepl30 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGCACGAGAAGATCCTG 2201 NLpepl30 (w/ Met) A.A. MVTGY LHEKIL
2202 NLpepl31 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGCTGGAGAAGATCCTG
2203 NLpepl31 (w/ Met) A.A. MVTGYRLLEKIL
2204 NLpepl32 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGAGCGAGAAGATCCTG
2205 NLpepl32 (w/ Met) A.A. MVTGYRLSEKIL
2206 NLpepl33 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGATGGAGGAGATCCTG
2207 NLpepl33 (w/ Met) A.A. MVTGYRLMEEIL
2208 NLpepl34(w/ Met) N.A. ATGGTGACCGGCTACCGGCTGCACGAGGAGATCCTG
2209 NLpepl34(w/ Met) A.A. MVTGYRLHEEIL
2210 NLpepl35 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGCTGGAGGAGATCCTG
2211 NLpepl35 (w/ Met) A.A. MVTGYRLLEEIL
2212 NLpepl36 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGAGCGAGGAGATCCTG
2213 NLpepl36 (w/ Met) A.A. MVTGYRLSEEIL
2214 NLpepl37(w/ Met) N.A. ATGGTGAGCGGCTACCGGCTGTTCGAGGAGATCCTG
2215 NLpepl37(w/ Met) A.A. MVSGYRLFEEIL
2216 NLpepl38(w/ Met) N.A. ATGGTGACCGGCTGGCGGCTGTTCGAGGAGATCCTG
2217 NLpepl38(w/ Met) A.A. MVTGWRLFEEIL
2218 NLpepl39 (w/ Met) N.A. ATGGTGAGCGGCTGGCGGCTGTTCGAGGAGATCCTG
2219 NLpepl39 (w/ Met) A.A. MVSGWRLFEEIL
2220 NLpepl40 (w/ Met) N.A. ATGAACGTGACCGGCTACCGGCTGTTCGAGGAGATCCTG
2221 NLpepl40 (w/ Met) A.A. MNVTGYRLFEEIL
2222 NLpepl41 (w/ Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGATCCTGAAC
2223 NLpepl41 (w/ Met) A.A. MVTGYRLFEEILN
2224 NLpepl42 (w/ Met) N.A. ATGAACGTGACCGGCTACCGGCTGTTCGAGGAGATCCTGAAC 2225 NLpe l42 (w/Met) A.A. MNVTGY LFEEILN
2226 NLpe l43 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCGAGGAGATC
2227 NLpepl43 (w/Met) A.A. MVTGYRLFEEI
2228 NLpepl44 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCCAGAAGATCAGC
2229 NLpepl44 (w/Met) A.A. MVTGYRLFQKIS
2230 NLpepl45 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCAAGAAGATCAGCAAC
2231 NLpepl45 (w/Met) A.A. MVTGYRLFKKISN
2232 NLpepl46 (w/Met) N.A. ATGGTGACCGGCTACCGGCTGTTCAAGAAGATCAGC
2233 NLpepl46 (w/Met) A.A. MVTGYRLFKKIS
2234 NLpepl47 (w/Met) A.A. MVSGWRLFKKISA
2235 NLpepl48 (w/Met) A.A. MGVSGWRLFKKIS
2236 NLpepl49 (w/Met) A.A. MSVSGWRLFKKISN
2237 NLpepl50 (w/Met) A.A. MSVSGWRLFKKISA
2238 NLpepl51 (w/Met) A.A. MNSVSGWRLFKKISA
2239 NLpepl52 (w/Met) A.A. MNSVSGWRLFKKISN
2240 NLpepl53 (w/Met) A.A. MSNVSGWRLFKKIS
2241 NLpepl54 (w/Met) A.A. MSGVSGWRLFKKIS
2242 NLpepl55 (w/Met) A.A. MNSNVSGWRLFKKIS
2243 NLpepl56 (w/Met) A.A. MNSGVSGWRLFKKIS
2244 NLpepl57 (w/Met) A.A. MSVSGWRLFKKIS
2245 NLpepl58 (w/Met) A.A. MNSVSGWRLFKKIS
2246 NLpepl59 (w/Met) A.A. MSNVSGWRLFKKISN
2247 NLpepl60 (w/Met) A.A. MNSNVSGWRLFKKISN
2248 NLpepl61 (w/Met) A.A. MGWRLFKK 2249 NLpepl62(w/Met) A.A. MGWALFKK
2250 NLpe l63 (w/Met) A.A. MVTGWALFEEIL
2251 NLpepl64 (w/Met) A.A. MVTGYALFQEIL
2252 NLpepl65 (w/Met) A.A. MVTGYALFEQIL
2253 NLpepl66 (w/Met) A.A. MVTGYALFEEIL
2254 NLpepl67 (w/Met) N.A. ATGGTGTCCGGCTGGGCACTGTTCAAGAAAATTTCC
2255 NLpepl67 (w/Met) A.A. MVSGWALFKKIS
2256 NLpepl68 (w/Met) A.A. MVSGWKLFKKIS
2257 NLpepl69 (w/Met) N.A. ATGGTGTCCGGCTGGCAGCTGTTCAAGAAAATTTCC
2258 NLpepl69 (w/Met) A.A. MVSGWQLFKKIS
2259 NLpepl70 (w/Met) A.A. MVSGWELFKKIS
2260 NLpepl71 (w/Met) N.A. ATGGTGTCCGGCTGGCTGCTGTTCAAGAAAATTTCC
2261 NLpepl71 (w/Met) A.A. MVSGWLLFKKIS
2262 NLpepl72(w/Met) N.A. ATGGTGTCCGGCTGGGTGCTGTTCAAGAAAATTTCC
2263 NLpepl72(w/Met) A.A. MVSGWVLFKKIS
2264 NLpeplll (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGATCAGC
2265 NLpeplll (w/o Met) A.A. VTGYRLFEEIS
2266 NLpepll2 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGGCCAGC
2267 NLpepll2 (w/o Met) A.A. VTGYRLFEEAS
2268 NLpepll3 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGGAGAGC
2269 NLpepll3 (w/o Met) A.A. VTGYRLFEEES
2270 NLpepll4 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGATCCTG
2271 NLpepll4 (w/o Met) A.A. VTGYRLFEEIL
2272 NLpepll5 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGGCCCTG 2273 NLpepl l5 (w/o Met) A.A. VTGYRLFEEAL
2274 NLpepl l6 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGGAGCTG
2275 NLpepl l6 (w/o Met) A.A. VTGYRLFEEEL
2276 NLpepl l7 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGATCAGC
2277 NLpepl l7 (w/o Met) A.A. VEGY LFEEIS
2278 NLpepl l 8 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGGCCAGC
2279 NLpepl l 8 (w/o Met) A.A. VEGYRLFEEAS
2280 NLpepl l9 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGGAGAGC
2281 NLpepl l9 (w/o Met) A.A. VEGYRLFEEES
2282 NLpepl20 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGATCCTG
2283 NLpepl20 (w/o Met) A.A. VEGYRLFEEIL
2284 NLpepl21 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGGCCCTG
2285 NLpepl21 (w/o Met) A.A. VEGYRLFEEAL
2286 NLpepl22 (w/o Met) N.A. GTGGAGGGCTACCGGCTGTTCGAGGAGGAGCTG
2287 NLpepl22 (w/o Met) A.A. VEGYRLFEEEL
2288 NLpepl23 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCAAGAAGATCCTG
2289 NLpepl23 (w/o Met) A.A. VTGYRLFKKIL
2290 NLpepl24 (w/o Met) N.A. GTGACCGGCTACCGGCTGATGAAGAAGATCCTG
2291 NLpepl24 (w/o Met) A.A. VTGYRLMKKIL
2292 NLpepl25 (w/o Met) N.A. GTGACCGGCTACCGGCTGCACAAGAAGATCCTG
2293 NLpepl25 (w/o Met) A.A. VTGYRLHKKIL
2294 NLpepl26 (w/o Met) N.A. GTGACCGGCTACCGGCTGCTGAAGAAGATCCTG
2295 NLpepl26 (w/o Met) A.A. VTGYRLLKKIL
2296 NLpepl27 (w/o Met) N.A. GTGACCGGCTACCGGCTGAGCAAGAAGATCCTG 2297 NLpe l27 (w/o Met) A.A. VTGYRLSKKIL
2298 NLpepl28 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGAAGATCCTG
2299 NLpepl28 (w/o Met) A.A. VTGYRLFEKIL
2300 NLpepl29(w/o Met) N.A. GTGACCGGCTACCGGCTGATGGAGAAGATCCTG
2301 NLpepl29(w/o Met) A.A. VTGYRLMEKIL
2302 NLpepl30 (w/o Met) N.A. GTGACCGGCTACCGGCTGCACGAGAAGATCCTG
2303 NLpepl30 (w/o Met) A.A. VTGYRLHEKIL
2304 NLpepl31 (w/o Met) N.A. GTGACCGGCTACCGGCTGCTGGAGAAGATCCTG
2305 NLpepl31 (w/o Met) A.A. VTGYRLLEKIL
2306 NLpepl32 (w/o Met) N.A. GTGACCGGCTACCGGCTGAGCGAGAAGATCCTG
2307 NLpepl32 (w/o Met) A.A. VTGYRLSEKIL
2308 NLpepl33 (w/o Met) N.A. GTGACCGGCTACCGGCTGATGGAGGAGATCCTG
2309 NLpepl33 (w/o Met) A.A. VTGYRLMEEIL
2310 NLpepl34(w/o Met) N.A. GTGACCGGCTACCGGCTGCACGAGGAGATCCTG
2311 NLpepl34(w/o Met) A.A. VTGYRLHEEIL
2312 NLpepl35 (w/o Met) N.A. GTGACCGGCTACCGGCTGCTGGAGGAGATCCTG
2313 NLpepl35 (w/o Met) A.A. VTGYRLLEEIL
2314 NLpepl36 (w/o Met) N.A. GTGACCGGCTACCGGCTGAGCGAGGAGATCCTG
2315 NLpepl36 (w/o Met) A.A. VTGYRLSEEIL
2316 NLpepl37(w/o Met) N.A. GTGAGCGGCTACCGGCTGTTCGAGGAGATCCTG
2317 NLpepl37(w/o Met) A.A. VSGY LFEEIL
2318 NLpepl38(w/o Met) N.A. GTGACCGGCTGGCGGCTGTTCGAGGAGATCCTG
2319 NLpepl38(w/o Met) A.A. VTGWRLFEEIL
2320 NLpepl39 (w/o Met) N.A. GTGAGCGGCTGGCGGCTGTTCGAGGAGATCCTG 2321 NLpe l39 (w/o Met) A.A. VSGW LFEEIL
2322 NLpe l40 (w/o Met) N.A. AACGTGACCGGCTACCGGCTGTTCGAGGAGATCCTG
2323 NLpepl40 (w/o Met) A.A. NVTGYRLFEEIL
2324 NLpepl41 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGATCCTGAAC
2325 NLpepl41 (w/o Met) A.A. VTGYRLFEEILN
2326 NLpepl42 (w/o Met) N.A. AACGTGACCGGCTACCGGCTGTTCGAGGAGATCCTGAAC
2327 NLpepl42 (w/o Met) A.A. NVTGYRLFEEILN
2328 NLpepl43 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCGAGGAGATC
2329 NLpepl43 (w/o Met) A.A. VTGYRLFEEI
2330 NLpepl44 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCCAGAAGATCAGC
2331 NLpepl44 (w/o Met) A.A. VTGYRLFQKIS
2332 NLpepl45 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCAAGAAGATCAGCAAC
2333 NLpepl45 (w/o Met) A.A. VTGYRLFKKISN
2334 NLpepl46 (w/o Met) N.A. GTGACCGGCTACCGGCTGTTCAAGAAGATCAGC
2335 NLpepl46 (w/o Met) A.A. VTGYRLFKKIS
2336 NLpepl47 (w/o Met) A.A. VSGWRLFKKISA
2337 NLpepl48 (w/o Met) A.A. GVSGWRLFKKIS
2338 NLpepl49 (w/o Met) A.A. SVSGWRLFKKISN
2339 NLpepl50 (w/o Met) A.A. SVSGWRLFKKISA
2340 NLpepl51 (w/o Met) A.A. NSVSGWRLFKKISA
2341 NLpepl52 (w/o Met) A.A. NSVSGWRLFKKISN
2342 NLpepl53 (w/o Met) A.A. SNVSGWRLFKKIS
2343 NLpepl54 (w/o Met) A.A. SGVSGWRLFKKIS
2344 NLpepl55 (w/o Met) A.A. NSNVSGWRLFKKIS 2345 NLpe l56 (w/o Met) A.A. NSGVSGW LFKKIS
2346 NLpe l57 (w/o Met) A.A. SVSGWRLFKKIS
2347 NLpepl58 (w/o Met) A.A. NSVSGWRLFKKIS
2348 NLpepl59 (w/o Met) A.A. SNVSGWRLFKKISN
2349 NLpepl60 (w/o Met) A.A. NSNVSGWRLFKKISN
2350 NLpepl61 (w/o Met) A.A. GWRLFKK
2351 NLpepl62(w/o Met) A.A. GWALFKK
2352 NLpepl63 (w/o Met) A.A. VTGWALFEEIL
2353 NLpepl64 (w/o Met) A.A. VTGYALFQEIL
2354 NLpepl65 (w/o Met) A.A. VTGYALFEQIL
2355 NLpepl66 (w/o Met) A.A. VTGYALFEEIL
2356 NLpepl67 (w/o Met) N.A. GTGTCCGGCTGGGCACTGTTCAAGAAAATTTCC
2357 NLpepl67 (w/o Met) A.A. VSGWALFKKIS
2358 NLpepl68 (w/o Met) A.A. VSGWKLFKKIS
2359 NLpepl69 (w/o Met) N.A. GTGTCCGGCTGGCAGCTGTTCAAGAAAATTTCC
2360 NLpepl69 (w/o Met) A.A. VSGWQLFKKIS
2361 NLpepl70 (w/o Met) A.A. VSGWELFKKIS
2362 NLpepl71 (w/o Met) N.A. GTGTCCGGCTGGCTGCTGTTCAAGAAAATTTCC
2363 NLpepl71 (w/o Met) A.A. VSGWLLFKKIS
2364 NLpepl72(w/o Met) N.A. GTGTCCGGCTGGGTGCTGTTCAAGAAAATTTCC
2365 NLpepl72(w/o Met) A.A. VSGWVLFKKIS
In certain embodiments, a peptide from Table 1 is provided. In some embodiments, peptides comprise a single amino acid difference from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1. In some embodiments, peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ
ID NO: 236) and/or any of the peptides listed in Table 1. In some embodiments, peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a peptide or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequence of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided comprising one of the nucleic acid coding sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided comprising one of the nucleic acid sequences of SEQ ID NOS: 3-438 and 2162-2365with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acid sequence of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid is provided that codes for an amino acid with greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365.
In certain embodiments, a nucleic acid from Table 1 is provided. In some embodiments, a nucleic acid encoding a peptide from Table 1 is provided. In some embodiments, a nucleic acid of the present invention codes for a peptide that comprises a single amino acid difference from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1. In some embodiments, nucleic acids code for peptides comprising two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1. In some embodiments, nucleic acids are provided comprising the sequence of one of the nucleic acids in Table 1. In some embodiments, nucleic acids are provided comprising one of the nucleic acids of Table 1 with one or more additions,
substitutions, and/or deletions. In some embodiments, a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acids of Table 1.
In some embodiments, non-luminescent polypeptides that find use in embodiments of the present invention include polypeptides with one or more amino acid substitutions, deletions, or additions from SEQ ID NO: 440. In some embodiments, the present invention provides polypeptides comprising one or more of amino acid sequences of Table 2, and/or nucleic acids comprising the nucleic acid sequences of Table 2 (which code for the polypeptide sequences of Table 2). Table 2. Pol e tide se uences
Figure imgf000056_0001
461 N.A. N33K 747 N.A. 5A2+A67F 1033 N.A. 5P+F31L
462 A.A N33K 748 A.A 5A2+A67F 1034 A.A 5P+F31L
463 N.A. N33 749 N.A. 5A2+A67G 1035 N.A. 5P+F31M
464 A.A N33R 750 A.A 5A2+A67G 1036 A.A 5P+F31M
465 N.A. I56N 751 N.A. 5A2+A67H 1037 N.A. 5P+F31N
466 A.A I56N 752 A.A 5A2+A67H 1038 A.A 5P+F31N
467 N.A. V58A 753 N.A. 5A2+A67I 1039 N.A. 5P+F31P
468 A.A V58A 754 A.A 5A2+A67I 1040 A.A 5P+F31P
469 N.A. I59T 755 N.A. 5A2+A67K 1041 N.A. 5P+F31Q
470 A.A I59T 756 A.A 5A2+A67K 1042 A.A 5P+F31Q
471 N.A. G67S 757 N.A. 5A2+A67L 1043 N.A. 5P+F31R
472 A.A G67S 758 A.A 5A2+A67L 1044 A.A 5P+F31R
473 N.A. G67D 759 N.A. 5A2+A67M 1045 N.A. 5P+F31 S
474 A.A G67D 760 A.A 5A2+A67M 1046 A.A 5P+F31 S
475 N.A. K75E 761 N.A. 5A2+A67N 1047 N.A. 5P+F31T
476 A.A K75E 762 A.A 5A2+A67N 1048 A.A 5P+F31T
477 N.A. Ml 06V 763 N.A. 5A2+A67P 1049 N.A. 5P+F31V
478 A.A Ml 06V 764 A.A 5A2+A67P 1050 A.A 5P+F31V
479 N.A. M106I 765 N.A. 5A2+A67Q 1051 N.A. 5P+F31W
480 A.A M106I 766 A.A 5A2+A67Q 1052 A.A 5P+F31W
481 N.A. D108N 767 N.A. 5A2+A67R 1053 N.A. 5P+F31Y
482 A.A D108N 768 A.A 5A2+A67R 1054 A.A 5P+F31Y
483 N.A. R112Q 769 N.A. 5A2+A67S 1055 N.A. 5P +L46A
484 A.A R112Q 770 A.A 5A2+A67S 1056 A.A 5P +L46A
485 N.A. N144T 771 N.A. 5A2+A67T 1057 N.A. 5P+L46C 486 A.A N144T 772 A.A 5A2+A67T 1058 A.A 5P+L46C
487 N.A. L149M 773 N.A. 5A2+A67V 1059 N.A. 5P+L46D
488 A.A L149M 774 A.A 5A2+A67V 1060 A.A 5P+L46D
489 N.A. N156D 775 N.A. 5A2+A67W 1061 N.A. 5P+L46E
490 A.A N156D 776 A.A 5A2+A67W 1062 A.A 5P+L46E
491 N.A. N156S 777 N.A. 5A2+A67Y 1063 N.A. 5P+L46F
492 A.A N156S 778 A.A 5A2+A67Y 1064 A.A 5P+L46F
493 N.A. V157D 779 N.A. 5A2+M106A 1065 N.A. 5P+L46G
494 A.A V157D 780 A.A 5A2+M106A 1066 A.A 5P+L46G
495 N.A. V157S 781 N.A. 5A2+M106C 1067 N.A. 5P+L46H
496 A.A V157S 782 A.A 5A2+M106C 1068 A.A 5P+L46H
497 N.A. G8A 783 N.A. 5A2+M106D 1069 N.A. 5P+L46I
498 A.A G8A 784 A.A 5A2+M106D 1070 A.A 5P+L46I
499 N.A. G15A 785 N.A. 5A2+M106E 1071 N.A. 5P+L46K
500 A.A G15A 786 A.A 5A2+M106E 1072 A.A 5P+L46K
501 N.A. G25A 787 N.A. 5A2+M106F 1073 N.A. 5P+L46M
502 A.A G25A 788 A.A 5A2+M106F 1074 A.A 5P+L46M
503 N.A. G26A 789 N.A. 5A2+M106G 1075 N.A. 5P+L46N
504 A.A G26A 790 A.A 5A2+M106G 1076 A.A 5P+L46N
505 N.A. G35A 791 N.A. 5A2+M106H 1077 N.A. 5P+L46P
506 A.A G35A 792 A.A 5A2+M106H 1078 A.A 5P+L46P
507 N.A. G48A 793 N.A. 5A2+M106I 1079 N.A. 5P+L46Q
508 A.A G48A 794 A.A 5A2+M106I 1080 A.A 5P+L46Q
509 N.A. G51A 795 N.A. 5A2+M106K 1081 N.A. 5P+L46 510 A.A G51A 796 A.A 5A2+M106K 1082 A.A 5P+L46R
511 N.A. G64A 797 N.A. 5A2+M106L 1083 N.A. 5P+L46S
512 A.A G64A 798 A.A 5A2+M106L 1084 A.A 5P+L46S
513 N.A. G67A 799 N.A. 5A2+M106N 1085 N.A. 5P+L46T
514 A.A G67A 800 A.A 5A2+M106N 1086 A.A 5P+L46T
515 N.A. G71A 801 N.A. 5A2+M106P 1087 N.A. 5P+L46V
516 A.A G71A 802 A.A 5A2+M106P 1088 A.A 5P+L46V
517 N.A. G95A 803 N.A. 5A2+M106Q 1089 N.A. 5P+L46W
518 A.A G95A 804 A.A 5A2+M106Q 1090 A.A 5P+L46W
519 N.A. G101A 805 N.A. 5A2+M106 1091 N.A. 5P+L46Y
520 A.A G101A 806 A.A 5A2+M106R 1092 A.A 5P+L46Y
521 N.A. G111A 807 N.A. 5A2+M106S 1093 N.A. 5P +N108A
522 A.A G111A 808 A.A 5A2+M106S 1094 A.A 5P +N108A
523 N.A. G116A 809 N.A. 5A2+M106T 1095 N.A. 5P+N108C
524 A.A G116A 810 A.A 5A2+M106T 1096 A.A 5P+N108C
525 N.A. G122A 811 N.A. 5A2+M106V 1097 N.A. 5P+N108D
526 A.A G122A 812 A.A 5A2+M106V 1098 A.A 5P+N108D
527 N.A. G129A 813 N.A. 5A2+M106W 1099 N.A. 5P+N108E
528 A.A G129A 814 A.A 5A2+M106W 1100 A.A 5P+N108E
529 N.A. G134A 815 N.A. 5A2+M106Y 1101 N.A. 5P+N108F
530 A.A G134A 816 A.A 5A2+M106Y 1102 A.A 5P+N108F
531 N.A. G147A 817 N.A. 5A2+L149A 1103 N.A. 5P+N108G
532 A.A G147A 818 A.A 5A2+L149A 1104 A.A 5P+N108G
533 N.A. I54A 819 N.A. 5A2+L149C 1105 N.A. 5P+N108H 534 A.A I54A 820 A.A 5A2+L149C 1106 A.A 5P+N108H
5A1
535 N.A. (G15A/D19A/G35 821 N.A. 5A2+L149D 1107 N.A. 5P+N108I
A/G51A/G67A)
5A1
536 A.A (G15A/D19A/G35 822 A.A 5A2+L149D 1108 A.A 5P+N108I
A/G51A/G67A)
4A1
537 N.A. (G15A/G35A/G67 823 N.A. 5A2+L149E 1109 N.A. 5P+N108K
A/G71A)
4A1
538 A.A (G15A/G35A/G67 824 A.A 5A2+L149E 1110 A.A 5P+N108K
A/G71A)
5A2
539 N.A. (G15A/G35A/G51 825 N.A. 5A2+L149F 1111 N.A. 5P+N108L
A/G67A/G71A)
5A2
540 A.A (G15A/G35A/G51 826 A.A 5A2+L149F 1112 A.A 5P+N108L
A/G67A/G71A)
541 N.A. 5A2+A15G 827 N.A. 5A2+L149G 1113 N.A. 5P+N108M
542 A.A 5A2+A15G 828 A.A 5A2+L149G 1114 A.A 5P+N108M
543 N.A. 5A2+A35G 829 N.A. 5A2+L149H 1115 N.A. 5P+N108P
544 A.A 5A2+A35G 830 A.A 5A2+L149H 1116 A.A 5P+N108P
545 N.A. 5A2+A51G 831 N.A. 5A2+L149I 1117 N.A. 5P+N108Q
546 A.A 5A2+A51G 832 A.A 5A2+L149I 1118 A.A 5P+N108Q
547 N.A. 5A2+A67G 833 N.A. 5A2+L149K 1119 N.A. 5P+N108R
548 A.A 5A2+A67G 834 A.A 5A2+L149K 1120 A.A 5P+N108R
549 N.A. 5A2+A71G 835 N.A. 5A2+L149M 1121 N.A. 5P+N108S
550 A.A 5A2+A71G 836 A.A 5A2+L149M 1122 A.A 5P+N108S
551 N.A. 5A2+ 11 A 837 N.A. 5A2+L149N 1123 N.A. 5P+N108T 552 A.A 5A2+ 11 A 838 A.A 5A2+L149N 1124 A.A 5P+N108T
553 N.A. 5A2+R11C 839 N.A. 5A2+L149P 1125 N.A. 5P+N108V
554 A.A 5A2+R11C 840 A.A 5A2+L149P 1126 A.A 5P+N108V
555 N.A. 5A2+R11D 841 N.A. 5A2+L149Q 1127 N.A. 5P+N108W
556 A.A 5A2+R11D 842 A.A 5A2+L149Q 1128 A.A 5P+N108W
557 N.A. 5A2+R11E 843 N.A. 5A2+L149R 1129 N.A. 5P+N108Y
558 A.A 5A2+R11E 844 A.A 5A2+L149R 1130 A.A 5P+N108Y
559 N.A. 5A2+R11F 845 N.A. 5A2+L149S 1131 N.A. 5P +T144A
560 A.A 5A2+R11F 846 A.A 5A2+L149S 1132 A.A 5P +T144A
561 N.A. 5A2+R11G 847 N.A. 5A2+L149T 1133 N.A. 5P+T144C
562 A.A 5A2+R11G 848 A.A 5A2+L149T 1134 A.A 5P+T144C
563 N.A. 5A2+R11H 849 N.A. 5A2+L149V 1135 N.A. 5P+T144D
564 A.A 5A2+R11H 850 A.A 5A2+L149V 1136 A.A 5P+T144D
565 N.A. 5A2+R11I 851 N.A. 5A2+L149W 1137 N.A. 5P+T144E
566 A.A 5A2+R11I 852 A.A 5A2+L149W 1138 A.A 5P+T144E
567 N.A. 5A2+R11K 853 N.A. 5A2+L149Y 1139 N.A. 5P+T144F
568 A.A 5A2+R11K 854 A.A 5A2+L149Y 1140 A.A 5P+T144F
569 N.A. 5A2+R11L 855 N.A. 5A2+V157A 1141 N.A. 5P+T144G
570 A.A 5A2+R11L 856 A.A 5A2+V157A 1142 A.A 5P+T144G
571 N.A. 5A2+R11M 857 N.A. 5A2+V157C 1143 N.A. 5P+T144H
572 A.A 5A2+R11M 858 A.A 5A2+V157C 1144 A.A 5P+T144H
573 N.A. 5A2+R1 IN 859 N.A. 5A2+V157D 1145 N.A. 5P+T144I
574 A.A 5A2+R1 IN 860 A.A 5A2+V157D 1146 A.A 5P+T144I
575 N.A. 5A2+R11P 861 N.A. 5A2+V157E 1147 N.A. 5P+T144K 576 A.A 5A2+ 11P 862 A.A 5A2+V157E 1148 A.A 5P+T144K
577 N.A. 5A2+R11Q 863 N.A. 5A2+V157F 1149 N.A. 5P+T144L
578 A.A 5A2+R11Q 864 A.A 5A2+V157F 1150 A.A 5P+T144L
579 N.A. 5A2+R11 S 865 N.A. 5A2+V157G 1151 N.A. 5P+T144M
580 A.A 5A2+R11 S 866 A.A 5A2+V157G 1152 A.A 5P+T144M
581 N.A. 5A2+R11T 867 N.A. 5A2+V157H 1153 N.A. 5P+T144N
582 A.A 5A2+R11T 868 A.A 5A2+V157H 1154 A.A 5P+T144N
583 N.A. 5A2+R1 IV 869 N.A. 5A2+V157I 1155 N.A. 5P+T144P
584 A.A 5A2+R1 IV 870 A.A 5A2+V157I 1156 A.A 5P+T144P
585 N.A. 5A2+R11W 871 N.A. 5A2+V157K 1157 N.A. 5P+T144Q
586 A.A 5A2+R11W 872 A.A 5A2+V157K 1158 A.A 5P+T144Q
587 N.A. 5A2+R11 Y 873 N.A. 5A2+V157L 1159 N.A. 5P+T144R
588 A.A 5A2+R11 Y 874 A.A 5A2+V157L 1160 A.A 5P+T144R
589 N.A. 5A2+A15C 875 N.A. 5A2+V157M 1161 N.A. 5P+T144S
590 A.A 5A2+A15C 876 A.A 5A2+V157M 1440 A.A 5P+T144S
591 N.A. 5A2+A15D 877 N.A. 5A2+V157N 1163 N.A. 5P+T144V
592 A.A 5A2+A15D 878 A.A 5A2+V157N 1164 A.A 5P+T144V
593 N.A. 5A2+A15E 879 N.A. 5A2+V157P 1165 N.A. 5P+T144W
594 A.A 5A2+A15E 880 A.A 5A2+V157P 1166 A.A 5P+T144W
595 N.A. 5A2+A15F 881 N.A. 5A2+V157Q 1167 N.A. 5P+T144Y
596 A.A 5A2+A15F 882 A.A 5A2+V157Q 1168 A.A 5P+T144Y
597 N.A. 5A2+A15G 883 N.A. 5A2+V157R 1169 N.A. 5P +P157A
598 A.A 5A2+A15G 884 A.A 5A2+V157R 1170 A.A 5P +P157A
599 N.A. 5A2+A15H 885 N.A. 5A2+V157S 1171 N.A. 5P+P157C 600 A.A 5A2+A15H 886 A.A 5A2+V157S 1172 A.A 5P+P157C
601 N.A. 5A2+A15I 887 N.A. 5A2+V157T 1173 N.A. 5P+P157D
602 A.A 5A2+A15I 888 A.A 5A2+V157T 1174 A.A 5P+P157D
603 N.A. 5A2+A15K 889 N.A. 5A2+V157W 1175 N.A. 5P+P157E
604 A.A 5A2+A15K 890 A.A 5A2+V157W 1176 A.A 5P+P157E
605 N.A. 5A2+A15L 891 N.A. 5A2+V157Y 1177 N.A. 5P+P157F
606 A.A 5A2+A15L 892 A.A 5A2+V157Y 1178 A.A 5P+P157F
607 N.A. 5A2+A15M 893 N.A. 5A2+Q20K 1179 N.A. 5P+P157G
608 A.A 5A2+A15M 894 A.A 5A2+Q20K 1180 A.A 5P+P157G
609 N.A. 5A2+A15N 895 N.A. 5A2+V27M 1181 N.A. 5P+P157H
610 A.A 5A2+A15N 896 A.A 5A2+V27M 1182 A.A 5P+P157H
611 N.A. 5A2+A15P 897 N.A. 5A2+N33K 1183 N.A. 5P+P157I
612 A.A 5A2+A15P 898 A.A 5A2+N33K 1184 A.A 5P+P157I
613 N.A. 5A2+A15Q 899 N.A. 5A2+V38I 1185 N.A. 5P+P157K
614 A.A 5A2+A15Q 900 A.A 5A2+V38I 1186 A.A 5P+P157K
615 N.A. 5A2+A15 901 N.A. 5A2+I56N 1187 N.A. 5P+P157L
616 A.A 5A2+A15R 902 A.A 5A2+I56N 1188 A.A 5P+P157L
617 N.A. 5A2+A15S 903 N.A. 5A2+D108N 1189 N.A. 5P+P157M
618 A.A 5A2+A15S 904 A.A 5A2+D108N 1190 A.A 5P+P157M
619 N.A. 5A2+A15T 905 N.A. 5A2+N144T 1191 N.A. 5P+P157N
620 A.A 5A2+A15T 906 A.A 5A2+N144T 1192 A.A 5P+P157N
621 N.A. 5A2+A15V 907 N.A. 5A2+V27M+A35G 1193 N.A. 5P+P157Q
622 A.A 5A2+A15V 908 A.A 5A2+V27M+A35G 1194 A.A 5P+P157Q
623 N.A. 5A2+A15W 909 N.A. 5A2+A71G+K75E 1195 N.A. 5P+P157R
Figure imgf000064_0001
3E
642 A.A 5A2+L18I 928 A.A (5A2+R11E+L149 1214 A.A 5P +I76V
M+V157E)
5P
643 N.A. 5A2+L18K 929 N.A. 3E+D108N 1215 N.A. +G48D+H57R+L9
2M+I99V
5P
644 A.A 5A2+L18K 930 A.A 3E+D108N 1216 A.A +G48D+H57R+L9
2M+I99V
5P
645 N.A. 5A2+L18M 931 N.A. 3E+N144T 1217 N.A. +F31L+V36A+I99
V
5P
646 A.A 5A2+L18M 932 A.A 3E+N144T 1218 A.A +F31L+V36A+I99
V
5P
647 N.A. 5A2+L18N 933 N.A. (3P+D108N+N144 1219 N.A. 5P+F31L+H93P
T)
5P
648 A.A 5A2+L18N 934 A.A (3P+D108N+N144 1220 A.A 5P+F31L+H93P
T)
649 N.A. 5A2+L18P 935 N.A. 6P (5P+I56N) 1221 N.A. 5P+V90A
650 A.A 5A2+L18P 936 A.A 6P (5P+I56N) 1222 A.A 5P+V90A
5E
651 N.A. 5A2+L18Q 937 N.A. (3E+D108N+N144 1223 N.A. 5P+I44V
T)
5E
652 A.A 5A2+L18Q 938 A.A (3E+D108N+N144 1224 A.A 5P+I44V
T)
5P+L46R+H86Q+
653 N.A. 5A2+L18 939 N.A. 6E (5E+I56N) 1225 N.A.
Ml 06V
5P+L46R+H86Q+
654 A.A 5A2+L18R 940 A.A 6E (5E+I56N) 1226 A.A
Ml 06V
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
NLpolyl2
(5A2+A15S+L18Q
678 A.A 5A2+F31I 964 A.A 1250 A.A 5P+H86Q
+A67D+M106V+L
149M+V157D)
NLpolyl3
(5A2+R11N+A15S
679 N.A. 5A2+F31K 965 N.A. 1251 N.A. 5P+H93P
+L18Q+M106V+L
149M+V157D)
NLpolyl3
(5A2+R11N+A15S
680 A.A 5A2+F31K 966 A.A 1252 A.A 5P+H93P
+L18Q+M106V+L
149M+V157D)
681 N.A. 5A2+F31L 967 N.A. 5P+V 1253 N.A. 5P+I99V
682 A.A 5A2+F31L 968 A.A 5P+V 1254 A.A 5P+I99V
683 N.A. 5A2+F31M 969 N.A. 5P+A 1255 N.A. 5P+K123E
684 A.A 5A2+F31M 970 A.A 5P+A 1256 A.A 5P+K123E
685 N.A. 5A2+F31N 971 N.A. 5P+VT 1257 N.A. 5P+T128S
686 A.A 5A2+F31N 972 A.A 5P+VT 1258 A.A 5P+T128S
687 N.A. 5A2+F31P 973 N.A. 5P+VA 1259 N.A. 5P+L142Q+T154N
688 A.A 5A2+F31P 974 A.A 5P+VA 1260 A.A 5P+L142Q+T154N
689 N.A. 5A2+F31Q 975 N.A. 5P+AT 1261 N.A. 5P+H57Q
690 A.A 5A2+F31Q 976 A.A 5P+AT 1262 A.A 5P+H57Q
691 N.A. 5A2+F31 977 N.A. 5P+AA 1263 N.A. 5P+L92M
692 A.A 5A2+F31R 978 A.A 5P+AA 1264 A.A 5P+L92M
693 N.A. 5A2+F31 S 979 N.A. 5P+GG 1265 N.A. 5P+P113L
694 A.A 5A2+F31 S 980 A.A 5P+GG 1266 A.A 5P+P113L
695 N.A. 5A2+F31T 981 N.A. 5P+AA 1267 N.A. 5P+G48D
696 A.A 5A2+F31T 982 A.A 5P+AA 1268 A.A 5P+G48D
697 N.A. 5A2+F31V 983 N.A. 5P+ATG 1269 N.A. 5P-B9 (-147-157)
698 A.A 5A2+F31V 984 A.A 5P+ATG 1270 A.A 5P-B9 (-147-157)
699 N.A. 5A2+F31W 985 N.A. 5P+VTG 1271 N.A. 5P+L46R+P157S
Figure imgf000071_0001
Figure imgf000072_0001
The polypeptides and coding nucleic acid sequences of Table 2 (SEQ ID NOS: 441-1298) all contain N-terminal Met residues (amino acids) or ATG start codons (nucleic acids). In some embodiments, the polypeptides and coding nucleic acid sequences of Table 2 are provided without N-terminal Met residues or ATG start codons (SEQ ID NOS: 1299-2156).
In certain embodiments, a polypeptide of one of the amino acid polymers of SEQ ID NOS: 441-2156 is provided. In some embodiments, polypeptides comprise a single amino acid difference from SEQ ID NO: 440. In some embodiments, polypeptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30... 35... 40... 45... 50, or more) amino acid differences from SEQ ID NO: 440 and/or any of the amino acid polymers of SEQ ID NOS :441-2156. In some embodiments, polypeptides are provided comprising the sequence of one of the amino acid polymers of SEQ ID NOS: 441-2156 with one or more additions, substitutions, and/or deletions. In some embodiments, a polypeptide or a portion thereof comprises greater than 70% sequence identity (e.g., >71%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%) with one or more of the amino acid polymers of SEQ ID NOS: 441-2156.
In certain embodiments, a nucleic acid from Table 2 is provided. In some embodiments, a nucleic acid encoding a polypeptide from Table 2 is provided. In some embodiments, a nucleic acid of the present invention codes for a polypeptide that comprises a single amino acid difference from SEQ ID NO: 440 and/or any of the amino acid polymers of SEQ ID NOS: 441- 2156. In some embodiments, nucleic acids code for a polypeptide comprising two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30... 35... 40... 45... 50, or more) amino acid differences from SEQ ID NO: 440 and/or any of the polypeptides listed in Table 2. In some embodiments, nucleic acids are provided comprising the sequence of one of the nucleic acid polymers of SEQ ID NOS: 441-2156. In some embodiments, nucleic acids are provided comprising the sequence of one of the nucleic acid polymers of SEQ ID NOS: 441-2156 with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., >71%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%) with one or more of the nucleic acid polymers of SEQ ID NOS: 441- 2156. In some embodiments, a nucleic acid or a portion thereof codes for an polypeptide comprising greater than 70% sequence identity (e.g., >71%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or >99%) with one or more of the amino acid polymers of SEQ ID NOS: 441-2156. In some embodiments, nucleic acids are provided that code for one of the polypeptides of SEQ ID NOS: 441-2156. In some embodiments, nucleic acids are provided that code for one of the polypeptides of SEQ ID NOS: 441-2156 with one or more additions, substitutions, and/or deletions.
In some embodiments, a non-luminescent peptide or polypeptide and/or an interaction element, comprises a synthetic peptide, peptide containing one or more non-natural amino acids, peptide mimetic, conjugated synthetic peptide (e.g., conjugated to a functional group (e.g., fluorophore, luminescent substrate, etc.)).
The present invention provides compositions and methods that are useful in a variety of fields including basic research, medical research, molecular diagnostics, etc. Although the reagents and assays described herein are not limited to any particular applications, and any useful application should be viewed as being within the scope of the present invention, the following are exemplary assays, kits, fields, experimental set-ups, etc. that make use of the presently claimed invention.
Typical applications that make use of embodiments of the present invention involve the monitoring/detection of protein dimerization (e.g., heterodimers, homodimers), protein-protein interactions, protein-R A interactions, protein-DNA interactions, nucleic acid hybridization, protein-small molecule interactions, or any other combinations of molecular entities. A first entity of interest is attached to a first member of a non-luminescent pair and the second entity of interest is attached to the second member of a non-luminescent pair. If a detectable signal is produced under the particular assay conditions, then interaction of the first and second entities are inferred. Such assays are useful for monitoring molecular interactions under any suitable conditions (e.g., in vitro, in vivo, in situ, whole animal, etc.), and find use in, for example, drug discovery, elucidating molecular pathways, studying equilibrium or kinetic aspects of complex assembly, high throughput screening, proximity sensor, etc.
In some embodiments, a non-luminescent pair of known characteristics (e.g., spectral characteristics, mutual affinity of pair) is used to elucidate the affinity of, or understand the interaction of, an interaction pair of interest. In other embodiments, a well-characterized interaction pair is used to determine the characteristics (e.g., spectral characteristics, mutual affinity of pair) of a non-luminescent pair.
Embodiments described herein may find use in drug screening and/or drug development.
For example, the interaction of a small molecule drug or an entire library of small molecules with a target protein of interest (e.g., therapeutic target) is monitored under one or more relevant conditions (e.g., physiological conditions, disease conditions, etc.). In other embodiments, the ability of a small molecule drug or an entire library of small molecules to enhance or inhibit the interactions between two entities (e.g., receptor and ligand, protein-protein, etc.) is assayed. In some embodiments, drug screening applications are carried out in a high through-put format to allow for the detection of the binding of tens of thousands of different molecules to a target, or to test the effect of those molecules on the binding of other entities.
In some embodiments, the present invention provides the detection of molecular interactions in living organisms (e.g., bacteria, yeast, eukaryotes, mammals, primates, human, etc.) and/or cells. In some embodiments, fusion proteins comprising signal and interaction (target) polypeptides are co-expressed in the cell or whole organism, and signal is detected and correlated to the formation of the interaction complex. In some embodiments, cells are transiently and/or stably transformed or transfected with vector(s) coding for non-luminescent element(s), interaction element(s), fusion proteins (e.g., comprising a signal and interaction element), etc. In some embodiments, transgenic organisms are generated that code for the necessary fusion proteins for carrying out the assays described herein. In other embodiments, vectors are injected into whole organisms. In some embodiments, a transgenic animal or cell (e.g., expressing a fusion protein) is used to monitor the biodistribution of a small molecule or a biologic tethered (e.g., conjugated or genetically fused) to NLpeptide sequence that would form a complex in the subcellular compartments and/or tissues where it concentrates.
In some embodiments, a peptide (e.g., non-luminescent peptide) portion of a luminescent complex is employed as a protein tag (e.g., within cells). In such embodiments, a polypeptide (e.g., non-luminescent polypeptide) portion of a luminescent complex (e.g., capable of forming a luminescent complex with the non- luminescent peptide) is applied to cells (e.g., as part of a reagent) to detect/quantify the presence of proteins tagged with the non-luminescent peptide. For example, a protein of interest is fused to a high affinity NLpep (e.g., NLpep86). The NLpep is then transfected into cells of interest, a reagent containing NanoGlo+NLpolyl IS is then added to cells+media, and luminescence is detected. This assay scheme is demonstrated in Figure 175. In some embodiments, the small size of the peptide is useful for protein tagging. In some embodiments, non-luminescent polypeptides used in such a system are stable enough to exist in a suitable buffer for extended periods of time (e.g., in the presence of the furimazine substrate). In certain embodiments, the non-luminescent polypeptide has minimal detectable luminescence in the absence of the complementing peptide (e.g., even in the presence of furimazine substrate). In some embodiments, optimized buffer conditions are utilized to meet criteria necessary for protein tagging. High affinity spontaneously polypeptides and peptides are useful in such systems, and have utility in, for example, immunoassays, detection of virus particles, the study of protein dynamics in living cells, etc. In some embodiments, such a system provides an extremely small protein tag (e.g., 11 amino acids) providing high sensitivity detection, stability (e.g., particularly under denaturing conditions), and/or a broad dynamic range.
The compositions and methods provided herein, as well as any techniques or technologies based thereon find use in a variety of applications and fields, a non-limiting list of example applications follows:
• Antibody-free Western Blot: For example, a protein of interest is fused to a non- luminescent peptide (e.g., by genetic engineering) and expressed by any suitable means. The proteins separated (e.g., by PAGE) and transferred to a membrane. The membrane is then washed with complimentary non-luminescent polypeptide (e.g. allowing a luminescent complex to form), and placed on imager (e.g., utilizing a CCD camera) with Furimazine (PBI-3939) atop the membrane, and the protein of interest is detected (e.g., via the luminescence of the luminescent complex).
• "LucCyto chemistry": For example, a protein of interest is expressed fused to a non- luminescent peptide or polypeptide and then detected with a complimentary non- luminescent polypeptide or peptide in a fashion analogous to immunocytochemistry. • Protein localization assay: For example, a localization signal is added to a non- luminescent polypeptide or polypeptide (e.g., via genetic engineering) and expressed in cells (e.g., a nuclear localization signal added would result in expression of the non- luminescent polypeptide in the nucleus). A complimentary non-luminescent peptide or polypeptide is fused to a protein of interest (e.g., via genetic engineering) and expressed in cells with the non-luminescent polypeptide or peptide. Luminescence is produced if the protein of interest localizes in the same subcellular compartment (e.g., the nucleus) as the signal-localized non-luminescent polypeptide.
• Protein Stability Assay: For example, a protein of interest is fused to a non-luminescent peptide or polypeptide (e.g., via genetic engineering) and incubated under one or more conditions of interest. A complimentary non-luminescent polypeptide or peptide is added (e.g., at various time points), and luminescence is used to quantify the amount of protein of interest (e.g., a proxy for stability).
• Protein Detection/Quantification: For example, a protein of interest fused to a non- luminescent peptide or polypeptide (e.g., via genetic engineering) and expressed and/or manipulated by any method. The complimentary non-luminescent polypeptide or peptide is then added to detect and/or quantify the protein of interest.
• Protein Purification: For example, a protein of interest is fused to a non-luminescent peptide or polypeptide (e.g., via genetic engineering) and expressed by any method. The mixture of proteins is passed through an immobilized complimentary non-luminescent polypeptide or peptide (e.g., on beads, on a column, on a chip, etc.), washed with suitable buffer and eluted (e.g., with a buffer of high ionic strength or low pH). A mutant form of the non-luminescent peptide or polypeptide that does not activate the luminescence of the complimentary non-luminescent peptide or polypeptide may be used to elute the protein of interest.
• Pull-down: For example, an immobilized, complimentary, non-luminescent polypeptide is used to isolate a protein of interest (and interacting proteins) that is fused to a non- luminescent peptide (e.g., via genetic engineering).
• G-Coupled Protein Receptor (GPCR) Internalization Assay: For example, a non- luminescent peptide or polypeptide is fused to a GPCR of interest (e.g., via genetic engineering) and expressed on the surface of cells. A complimentary non-luminescent polypeptide or peptide is added to the media of the cells and used to detect the GPCR on cell surface. A ligand is added to stimulate the internalization of the GPCR, and a decrease in luminescence is observed. • Membrane Integrity Assay for Cell Viability: For example, when the cell membrane of a cell expressing a non-luminescent polypeptide become compromised, a non-luminescent peptide enters the cell (e.g., a peptide that otherwise can't cross the cell membrane), thereby forming a luminescent complex, and generating luminescence.
· 5-Hydroxymethyl Cytosine Detection: For example, a cysteine is added to a non- luminescent peptide and incubated with DNA and a methyltransferase. The
methyltransferase catalyzes the addition of the thiol (cysteine) only onto cytosine residues that are 5-hydroxymethylated. Unincorporated peptide is then separated from the DNA (using any method possible), and a non-luminescent polypeptide is added to detect the peptide conjugated to the DNA.
• Formyl Cytosine Detection: For example, similar to the 5-hydroxymethyl cytosine
detection above, this detection method uses chemistry with specific reactivity for formyl cytosine.
• Viral Incorporation: Nucleic acid coding for a non-luminescent peptide or polypeptide is incorporated into a viral genome, and the complementary non- luminescent polypeptide or peptide is constitutively expressed in the target cells. Upon infection of the target cells and expression of the non-luminescent peptide, the bioluminescent complex forms and a signal is detected (e.g., in the presence of substrate).
• Chemical Labeling of Proteins: A non-luminescent peptide is fused or tethered to a
reactive group (e.g., biotin, succinimidyl ester, maleimide, etc.). A protein of interest
(e.g., antibody) is tagged with the non-luminescent peptide through binding of the reactive group to the protein of interest. Because the peptide is small, it does not affect the functionality of the protein of interest. Complimentary non-luminescent polypeptide is added to the system, and a luminescent complex is produced upon binding to the polypeptide to the peptide.
• Protease Assay: For example, a peptide sequence that is recognized by a protease of interest can be joined to NLPep in such a way that prevents bioluminescence upon exposure to NLPoly. Ways to do this include attaching a luminescence quencher to the protease recognition sequence or binding the protease recognition sequence to NLPep in such a way that complementation is hindered. Upon activity of the protease to cleave the recognition sequence, the ability of NLPoly to complement to NLPep and emit luminescence is restored, and thus the system is a sensitive protease assay.
• RNA detection.
• Biomolecule Linker characterization: For example, a linker attached to a biomolecule such as an antibody can be evaluated for its stability under a set of conditions through attaching NLPep to the molecule via the linker of interest. Over time, the production of free NLPep through linker degradation can be monitored by addition of NLPoly and furimazine and quantification of bio luminescence produced.
• Mutation assay: For example, a point mutation, a frameshift mutation, etc. introduced in vitro or in vivo results in either a gain of signal or loss of signal from a complementation pair. Such an assay could be used, for example, to test compounds for mutagenicity.
• Target engagement for peptide inhibitors: Use of low affinity NLpep-conjugated peptides (expressed in cells) to monitor target engagement of peptide-based inhibitors. NLpoly is tethered to the target of interest. Engagement results in loss of signal from luminescent complex.
• Gain of signal Protease biosensors: A protease cleavage site is expressed between
NLpoly and a dark peptide NLpep (low affinity). Cleavage releases dark peptide allowing for high affinity NLpep to complement NLpoly.
• Gain of function protease assay: The sequence of an NLpep is engineered proximal to a cleavage site of a full length substrate for a protease (e.g., caspase, ADAM, etc). The peptide remains sterically inaccessible as long as the substrate remains intact and the peptide is "buried". Both the genetically engineered protease substrate and a NLpoly (e.g., NLpoly 1 IS) are co-transfected into a target cell line. Luciferase activity is induced upon induction of protease activity which leads to the cleavage of the substrate and exposure of the activator peptide on the N- or C-terminus of one of the fragments. This principle is expandable to detect conformational changes and /or protein modifications as well.
• Intracellular analyte quantification using recombinant intrabodies: Antibody fragments expressed within cells as NLpoly or NLpep fusion. Complementary subunit is genetically fused to an analyte of interest. When analyte is present, antibody binds and luminescent complex is formed. The application is expandable to intracellular PTM (e.g.
phosphorylation) biosensors, in which the intrabody only binds to the analyte when it has been phosphorylated (or otherwise bound by the modification- specific Ab). The above applications of the compositions and methods of the present invention are not limiting and may be modified in any suitable manner while still being within the scope of the present invention.
The present invention also provides methods for the design and/or optimization of non- luminescent pairs/groups and the bio luminescent complexes that form therefrom. Any suitable method for the design of non-luminescent pairs/groups that are consistent with embodiments described herein, and/or panels thereof, is within the scope of the present invention.
In certain embodiments, non-luminescent pairs/groups are designed de novo to lack luminescence individually and exhibit luminescence upon association. In such embodiments, the strength of the interaction between the non-luminescent elements is insufficient to produce a bioluminescent signal in the absence of interaction elements to facilitate formation of the bioluminescent complex.
In other embodiments, non-luminescent elements and/or non-luminescent pairs are rationally designed, for example, using a bioluminescent protein (e.g., SEQ ID NO: 2157) as a starting point. For example, such methods may comprise: (a) aligning the sequences of three or more related proteins; (b) determining a consensus sequence for the related proteins; (c) providing first and second fragments of a bioluminescent protein that is related to the ones from which the consensus sequence was determined, wherein the fragments are individually substantially non-luminescent but exhibit luminescence upon interaction of the fragments; (d) mutating the first and second fragments at one or more positions each (e.g., in vitro, in silico, etc.), wherein said mutations alter the sequences of the fragments to be more similar to a corresponding portion of the consensus sequence, wherein the mutating results in a non- luminescent pair that are not fragments of a preexisting protein, and (e) testing the non- luminescent pair for the absence of luminescence when unassociated and luminescence upon association of the non-luminescent pair. In other embodiments, first and second fragments of one of the proteins used in determining the consensus sequence are provided, mutated, and tested.
In some embodiments, a peptide of a luminescent pair is a 'dark peptide,' or one that binds to its complement (e.g., NLpoly) (e.g., with low or high affinity) but produces minimal or no luminescence (See figures 180-182). In some embodiments, a high affinity dark peptide finds use in inverse complementation, or gain of signal assays for measuring inhibitors. In some embodiments, a low affinity dark peptide is used to bring down background of NLpoly 1 IS in a reagent for the detection of a high affinity peptide tag (e.g. NLpep86). Exemplary dark peptides are provided in Figure 180.
In some embodiments, a peptide of a luminescent pair is a 'quencher peptide,' or one that contains a quencher moiety (e.g., DAB), and the quencher absorbs the light/energy produced by both a NLpoly in isolation (e.g., the signal produced independent of a complementing NLpep) and a NLpoly-NLpep complex (e.g., the signal produced as a result of complex formation). Exemplary dark quencher peptides would have a suitable absorption spectrum and include DAB- 161 (DAB-GWRLFK ), DAB-162 (D AB-GWALFK ),D AB- 163 (DAB- VTGWALFEEIL),DAB- 164 (DAB-VTGYALFQEIL),DAB- 165 (DAB-VTGYALFEQIL), and
DAB- 166 (DAB-VTGYALFEEIL); wherein DAB = Dabcyl (475nm quencher)+dPEG4 spacer.
In some embodiments, the above methods are not limited to the design and/or
optimization of non-luminescent pairs. The same steps are performed to produce pairs of elements that lack a given functionality (e.g., enzymatic activity) individually, but display such functionality when associated. In any of these cases, the strength of the interaction between the non-luminescent pair elements may be altered via mutations to ensure that it is insufficient to produce functionality in the absence of interaction elements that facilitate formation of the bioluminescent complex.
EXPERIMENTAL
Example 1
Generation of Peptides
Peptide constructs were generated by one of three methods: annealing 5 '-phosphorylated oligonucleotides followed by ligation to pF4Ag-Barnase-HALOTAG vector (Promega
Corporation; cut with Sgfl and Xhol) or pFN18A (Promega Corporation; cut with Sgfl and Xbal), site directed mutagenesis using Quik Change Lightning Multi kit from Agilent or outsourcing the cloning to Gene Dynamics.
Example 2
Peptide Preparation
The peptides generated in Example 1 were prepared for analysis by inoculating a single colony of KRX E.coli cells (Promega Corporation) transformed with a plasmid encoding a peptide into 2-5 ml of LB culture and grown at 37°C overnight. The overnight cultures (10 ml) were then diluted into 1L of LB and grown at 37°C for 3 hours. The cultures were then induced by adding 10 ml 20% rhamnose to the 1L culture and induced at 25°C for 18 hours.
After induction, 800 ml of each culture was spun at 5000xg at 4°C for 30 minutes. The pellet generated was then resuspended in 80 ml Peptide Lysis Buffer (25mM HEPES pH 7.4, O. lx Passive Lysis Buffer (Promega Corporation), lml/ml lysozyme and 0.03υ/μ1 RQ1 DNase (Promega Corporation)) and incubated at room temperature for 15 minutes. The lysed cells were then frozen on dry ice for 15 minutes and then thawed in a room temperature bath for 15minutes. The cells were then spun at 3500xg at 4°C for 30 minutes. The supematants were aliquoted into 10ml samples with one aliquot of 50μ1 placed into a 1.5ml tube.
To the 50μ1 samples, 450μ1 H20 and 167μ1 4x SDS Loading Dye were added, and the samples incubated at 95°C for 5 minutes. After heating, 5μ1 of each sample was loaded (in triplicate) onto an SDS-PAGE gel, and the gel run and stained according to the manufacturer's protocol. The gel was then scanned on a Typhoon Scanner (excitation 532nm, emission 580nm,
PMT sensitivity 400V). The resulting bands were quantified using the ImageQuant (5.2) software. Each of the three replicate intensities was averaged, and the average intensity of
NLpep53-HT was defined at 12x concentration. The concentrations of all other peptides were relative to Pep53-HT.
Example 3
Peptide Analysis
All of the peptides generated in Examples 1-2 contained single mutations to the peptide sequence: GVTGWRLCK ISA (SEQ ID NO: 236). All of the peptides were fused to a
HALOTAG protein (Promega Corporation). Peptides identified as "HT-NLpep" indicate that the peptide is located at the C-terminus of the HALOTAG protein. In this case, the gene encoding the peptide includes a stop codon, but does not include a methionine to initiate translation.
Peptides identified as "NLpep-HT" indicate that the peptide is at the N-terminus of the
HALOTAG protein. In this case, the peptide does include a methionine to initiate translation, but does not include a stop codon.
To determine the ability of the peptides to activate luminescence, individual colonies of KRX E.coli cells (Promega Corporation) was transformed with a plasmid encoding a peptide from Example 1, inoculated in 200μ1 of minimal medium (lx M9 salts, O.lmM CaCl2, 2mM MgS04, ImM Thiamine HC1, 1% gelatin, 0.2% glycerol, and lOOul/ml Ampicillin) and grown at 37°C overnight. In addition to the peptides, a culture of KRX E.coli cells expressing a wild-type (WT) fragment of residues 1-156 of the NanoLuc was grown. All peptides and the WT fragment were inoculated into at least 3 separate cultures.
After the first overnight growth, ΙΟμΙ of culture was diluted into 190μ1 fresh minimal medium and again grown at 37°C overnight.
After the second overnight growth, ΙΟμΙ of the culture was diluted into 190μ1 of auto- induction medium (minimal medium + 5% glucose and 2% rhamnose). The cultures were then inducted at 25°C for approximately 18 hours.
After induction, the small peptide mutant cultures were assayed for activity. The cultures containing the WT 1-156 fragment were pooled, mixed with 10 ml of 2x Lysis Buffer (50mM HEPES pH 7.4, 0.3x Passive Lysis Buffer, and lmg/ml lysozyme) and incubated at room temperature for 10 minutes. 30μ1 of the lysed WT 1-156 culture was then aliquoted into wells of a white, round bottom 96-well assay plate (Costar 3355). To wells of the assay plate, 20μ1 of a peptide culture was added, and the plate incubated at room temperature for 10 minutes. After incubation, 50μ1 NANOGLO Luciferase Assay Reagent (Promega Corporation) was added, and the samples incubated at room temperature for 10 minutes. Luminescence was measured on a
GLOMAX luminometer with 0.5s integrations.
The results (See Table 3 and Figure 1) demonstrate various mutations in the peptide (relative to SEQ ID NO: 1) that altered (e.g., increased, decreased) the luminescence following complementation with the wild-type non-luminescent polypeptide. The increased luminescence is thought to stem from one (or a combination) of five main factors, any of which are beneficial: affinity between the non-luminescent peptide and non-luminescent polypeptide, expression of the peptide, intracellular solubility, intracellular stability, and bioluminescent activity. The present invention though is not limited to any particular mechanism of action and an understanding of the mechanism of action is not necessary to practice the present invention.
Table 3
Figure imgf000082_0001
W161K 0.0002 0.0008 9.7E-06 0.0001
W161V 0.0086 0.0050 0.0062 0.0016
W161F N.D. 0.0717 N.D. 0.0049
W161Y N.D. 0.2154 N.D. 0.0103
W161E N.D. 0.0012 N.D. 0.0002
L163I N.D. 0.2923 N.D. 0.1198
L163V 0.1727 0.1190 0.0257 0.0288
L163T 0.0259 0.0262 0.0077 0.0122
L163Y 0.0512 0.1959 0.0126 0.1043
L163K 0.0885 0.0786 0.0130 0.0244
C164N 0.0874 0.1081 0.0097 0.0160
C164T 0.0116 0.0084 0.0029 0.0013
C164F N.D. 13.3131 N.D. 3.6429
C164Y N.D. 1.0092 N.D. 0.2592
C164S N.D. 0.0202 N.D. 0.0029
C164H N.D. 0.7597 N.D. 0.2149
C164M N.D. 3.2618 N.D. 1.1763
CI 64 A N.D. 0.0858 N.D. 0.0196
CI 640 N.D. 0.0211 N.D. 0.0044
C164L N.D. 1.0170 N.D. 0.2464
C164K N.D. 0.0005 N.D. 0.0001
R166K 1.0910 1.2069 0.2266 0.5913
R166N 0.1033 0.1182 0.0289 0.0542
1167 V 0.8770 1.0824 0.1113 0.2642
11670 0.0178 0.1172 0.0252 0.0150
I167E 0.2771 0.2445 0.0358 0.0456
I167R 0.0464 0.0469 0.0027 0.0084 I167F 0.2832 0.1793 0.0159 0.0683
A169N 0.9115 1.7775 0.1114 0.5901
A169T 0.9448 1.3720 0.0930 0.6021
A169R 0.9851 0.5014 0.2205 0.1895
A169L 1.1127 0.9047 0.1906 0.2481
A169E 0.8457 0.7889 0.1445 0.0819
Example 4
Generation of non-luminescent polypeptides
Using pF4Ag-NanoLucl-156 (WT 1-156) as a template, error-prone PCR (epPCR) was performed using the Diversify PCR Random Mutagenesis Kit from Clontech. The resulting PCR product was digested with Sgfl and Xbal and ligated to pF4Ag-Barnase (Promega Corporation), a version of the commercially-available pF4A vector (Promega) which contains T7 and CMV promoters and was modified to contain an E. coli ribosome-binding site. Following
transformation into KRX E. coli cells (Promega Corporation) by heat shock at 42°C, individual colonies were used to inoculate 200μ1 cultures in clear, flat bottom 96-well plates (Costar 3370).
Example 5
Non-luminescent polypeptide analysis
To determine the luminescence of the non-luminescent polypeptide mutants generated in Example 4, individual colonies of the KRX E.coli cells (Promega Corporation) transformed with a plasmid containing one of the non- luminescent polypeptide mutants from Example 4 was grown according to the procedure used in Example 3. The bacterial cultures were also induced according to the procedure used in Example 3.
To assay each non-luminescent polypeptide mutant induced culture, 30μ1 of assay lysis buffer (25mM HEPES pH 7.4, 0.3x Passive Lysis Buffer (Promega Corporation)), 0.006 U/μΙ RQ1 DNase (Promega Corporation) and lx Peptide Solution (the relative concentration of the peptides were determined as explained in Example 2; from the relative concentration determined, the peptides were diluted to lx in the lysis buffer) containing either the peptide fragment
GVTGWRLCKRISA (SEQ ID NO: 18) or GVTGWRLFKRISA (SEQ ID NO: 106) were aliquoted into wells of a 96-well assay plate (Costar 3355). To the wells of the assay plate, 20μ1 of an induced non-luminescent polypeptide mutant culture was added, and the plate incubated at room temperature for 10 minutes. After incubation, 50μ1 of NANOGLO Luciferase Assay Reagent (Promega Corporation) was added, and the samples incubated at room temperature for 10 minutes. Luminescence was measured on a GLOMAX luminometer with 0.5s integrations. The results (Table 4 and Figure 2) demonstrate numerous point mutations that improve the luminescence of the non-luminescent polypeptide upon complementation with two different peptides. Similar to the mutations in the peptide, these mutations in the non-luminescent polypeptide may stem from various factors, all of which are beneficial to the system as a whole.
Table 4
Figure imgf000085_0001
*Units in Table 4 are RLU(mutant)/RLU(WT)
Example 6
Glycine to Alanine Substitutions in non-luminescent polypeptide The following example identified glycine residues within the non-luminescent polypeptide that can be substituted to alanine to provide an improved (e.g., greater luminescent signal) non-luminescent polypeptide. The substitutions were made singly (See Figure 3), or in composites (Figure 2). Non-luminescent polypeptides containing glycine to alanine substitutions were generated as described in Example 1.
Each single mutant colony was inoculated in 200μ1 Minimal Media (lx M9 salts, O. lmM CaCl2, 2mM MgS04, ImM Thiamine HC1, 1% gelatin, 0.2% glycerol and lx ampicillin) and incubated with shaking at 37°C for 20 hours. ΙΟμΙ of the culture was then added to 190μ1 of fresh Minimal Media and incubated again with shaking at 37°C for 20 hours. ΙΟμΙ of the second culture was then added to 190μ1 Auto-Induction Media (Minimal Media + 5% glucose + 2% rhamnose) and incubated with shaking at 25°C for 18 hours to allow expression of the non- luminescent polypeptide.
To assay each mutant culture, 30μ1 of assay lysis buffer (50mM HEPES pH 7.5, 0.3x Passive Lysis Buffer (Promega Corporation)) and 0.006 U/μΙ RQ1 DNase (Promega
Corporation)) containing non-luminescent peptide (1 : 10 dilution ofNLpep9-HT (NLpep9 is SEQ ID NO: 17 and 18; HT is HaloTag E.coli clarified lysate) was added. The samples were shaken at room temperature for 10 minutes, and then 50μ1 NANOGLO Luciferase Assay Reagent (Promega Corporation) was added. The samples were incubated at room temperature for 10 minutes, and luminescence was measured on a GLOMAX luminometer with 0.5s integrations.
To generate the NLpep9-HT E.coli clarified lysate, 5ml LB was inoculated with a single E.coli colony of NLpep9-HT and incubated at 37°C overnight. 500μ1 of the overnight culture was then diluted in 50mls LB and incubated at 37°C for 3 hours. 500μ1 of 20% rhamnose was added and incubated at 25°C for 18 hours. The expression culture was centrifuged at 3000xg for 30 minutes, and the cell pellet resuspended in 5ml peptide lysis buffer (25mM HEPES, pH 7.5, O. lx Passive Lysis Buffer, lmg/ml lysozyme, and 0.3υ/μ1 RQ1 DNase) and incubated at room temperature for 10 minutes. The lysed sample was placed on dry ice for 15 minutes, thawed in a room temperature water bath and centrifuged at 3500xg for 30 minutes. The supernatant was the clarified lysate.
Figures 3 and 4 demonstrate the effects of the mutations on luminescence.
Example 7
Mutations in non-luminescent peptide
In the following example, mutations were made in the non-luminescent peptide based on alignment to other fatty acid binding proteins (FABPs) and were chosen based on high probability (frequency in FABPs) to identify a mutation that retains/improves activity (such as NLpep2, 4, and 5) or establish that a mutation is not likely to be tolerated at that position (such as
NLpep3). NLpepl-5 contain single mutations (See Table 1), and NLpep6-9 are composite sets of the mutations in NLpep2, 4, and 5 (See Table 1). Mutants were generated as described in Example 1.
Each mutant colony was inoculated in 200μ1 Minimal Media and incubated with shaking at 37°C for 20 hours. ΙΟμΙ of the culture was then added to 190μ1 of fresh Minimal Media and incubated again with shaking at 37°C for 20 hours. ΙΟμΙ of the second culture was then added to 190μ1 Auto-Induction Media and incubated with shaking at 25°C for 18 hours to allow expression of the non-luminescent peptide mutant.
To assay each mutant culture, 30μ1 of assay lysis buffer (50mM HEPES pH 7.5, 0.3x Passive Lysis Buffer (Promega Corporation)) and 0.006 U/μΙ RQ1 DNase (Promega
Corporation)) containing non-luminescent polypeptide (1 : 10 dilution of wild-type non- luminescent polypeptide E.coli clarified lysate) was added. The samples were shaken at room temperature for 10 minutes, and then 50μ1 NANOGLO Luciferase Assay Reagent (Promega Corporation) added. The samples were incubated at room temperature for 10 minutes, and luminescence was measured on a GLOMAX luminometer with 0.5s integrations.
Figure 1 shows the luminescence (RLUs) detected in each non-luminescent peptide mutant. The results demonstrate various positions that are able to tolerate a mutation without substantial loss in luminescence, as well as a few specific mutations that improve luminescence.
Example 8
Effect of Orientation of Fusion Tag on Luminescence
In the following example, luminescence generated by non-luminescent peptides with N- or C-terminus HaloTag protein was compared.
Single colony of each peptide-HT fusion was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7.
Figure 6 and 7 demonstrate the luminescence (RLUs) detected in each peptide-HT fusion. The results demonstrate combinations of mutations that produce similar luminescence as NLpepl .
Example 9
Effect of Multiple Freeze-Thaw Cycles on non-luminescent peptides lml of NLpep9-HT was frozen on dry ice for 5 minutes and then thawed in a room temperature water bath for 5 minutes. 60μ1 was then removed for assaying. The freeze-thaw procedure was then repeated another 10 times. After each freeze-thaw cycle, 60μ1 of sample was removed for assaying. To assay, 20μ1 of each freeze-thaw sample was mixed with 30μ1 of SEQ ID NO:2 and incubated at room temperature for 10 minutes. 50μ1 of NANOGLO Luciferase Assay Reagent was added, and the samples incubated at room temperature for 10 minutes. Luminescence was measured on a GLOMAX luminometer with 0.5s integrations. The results are depicted in Figure8 and demonstrate that NLpep can be subjected to multiple freeze-thaw cycles without a loss in activity (luminescence).
Example 10
Distinction of mutations in non-luminescent peptides
In the following example, TMR gel analysis was used to normalize the concentration of the non- luminescent peptide mutants to distinguish mutations that alter the expression from those that alter luminescence (e.g., altered luminescence may stem from altered binding affinity).
5ml of LB was inoculated with a single mutant peptide colony and incubated with shaking at 37°C for 20 hours. 50μ1 of the overnight culture was diluted into 5ml of fresh LB and incubated with shaking at 37°C for 3 hours. 50μ1 of 20% rhamnose was then added and incubated with shaking at 25°C for 18 hours.
For TMR gel analysis, 79μ1 of each induced culture was mixed with ΙΟμΙ ΙΟχ Fast Break Lysis Buffer (Promega Corporation), ΙΟμΙ of a 1 : 100 dilution of HALOTAG TMR ligand (Promega Corporation) non- luminescent polypeptide and ΙΟμΙ of RQ1 DNase and incubated at room temperature for 10 minutes. 33.3μ1 of 4x SDS-loading buffer was added, and the samples incubated at 95°C for 5 minutes. 15μ1 of each sample was loaded onto an SDS gel and run according to the manufacturer's directions. The gel was then scanned on a Typhoon.
Each culture was diluted based on the TMR-gel intensity to normalize concentrations. 20μ1 of each diluted culture was then mixed with 30μ1 assay lysis buffer containing non-luminescent polypeptide (1 : 10 dilution of SEQ ID NO: 2 E.coli clarified lysate) and incubated with shaking at room temperature for 10 minutes. 50μ1 of NANOGLO Luciferase Assay Reagent was added, and the samples incubated at room temperature for 10 minutes. Luminescence was measured on a GLOMAX luminometer with 0.5s integrations (SEE FIG. 9).
Example 11
Site saturation in non-luminescent polypeptide
In the following example, positions 11, 15, 18, 31, 58, 67, 106, 149, and 157 were identified as sites of interest from screening the library of random mutations in wild-type non- luminescent polypeptide. All 20 amino acids at these positions (built on 5A2 non-luminescent mutant generated in Example 6 (SEQ ID NOS: 539 and 540) to validate with other mutations in the 5 A2 mutant) were compared to determine the optimal amino acid at that position. Mutant non-luminescent polypeptides were generated as previously described in Example 1. Single colony of each non-luminescent polypeptide mutant was grown according to the procedure used in Example 6. The bacterial cultures were also induced according to the procedure used in Example 6. Luminescence was assayed and detected according to the procedure used in Example 6 expect NLpep53 E.coli clarified lysate was used at 1 : 11.85 dilution.
Figures 10-18 demonstrate the effect of the mutations on the ability to produce luminescence with and without NLpep.
Example 12
Comparison of cysteine vs. proline as first amino acid in non-luminescent peptide
In the following example, a comparison of using cysteine or proline as first amino acid (after necessary methionine) in the non-luminescent peptide was performed. The mutant non- luminescent peptides were generated as previously described in Example 1. Single colony of each non-luminescent polypeptide mutant was grown according to the procedure used in
Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7.
Figure 19 demonstrates that both cysteine and proline can be used as the first amino acid of NLpep and produce luminescence.
Example 13
Identification of the optimal composite set of mutations for the non-luminescent peptide
In the following examples, an optimal composite set(s) of mutations for the non- luminescent peptide were identified. The mutant non-luminescent peptides were generated as previously described in Example 1.
1) For non-luminescent peptide composite mutants NLpep53, NLpep66,
NLpep67, and NLpep68, a single colony of each was grown according to the procedure used in Example 10. The bacterial cultures were also induced according to the procedure used in Example 10. TMR gel analysis and luminescence was assayed and detected according to the procedure used in Example 10. The results in Figure 20 demonstrate the luminescence as well as the E. coli expression of NLpeps containing multiple mutations.
2) For non-luminescent peptide composite mutants NLpep53 and NLpeps 66-74, a single colony of each was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7.
Luminescence was assayed and detected according to the procedure used in Example 7. The results in Figure 21 demonstrate the luminescence of NLpeps containing multiple mutations.
3) For non-luminescent peptide composite mutants NLpep53 and NLpeps 66-76, a single colony of each was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7 except the non-luminescent polypeptide was 5A2 or 5A2+R1 IE (1 : 10 dilution of E.coli clarified lysate). The results in Figure 22 demonstrate the luminescence of NLpeps containing multiple mutations with 5A2 or 5A2+R1 IE. These results also demonstrate the lower luminescence when the NLpoly mutation Rl IE is complemented with an NLpep containing E as the 9th residue
(NLpep72, 75, and 76).
4) For non-luminescent peptide composite mutants NLpep 1, NLpep69, NLpep78 and NLpep79, a single colony of each was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7 except the non-luminescent polypeptide was WT (1 : 10 dilution of E.coli clarified lysate). The results in Figure 23 demonstrate the luminescence of NLpeps containing multiple mutations.
Example 14
Composite non-luminescent polypeptide mutants
In the following example, 9 mutations from the library screens were combined into a composite clone (NLpolyl, SEQ ID NOS: 941,942), and then one of the mutations reverted back to the original amino acid (NLpoly2-10, SEQ ID NOS: 943-960) in order to identify the optimal composite set. Based on previous results of NLpolyl-10, NLpolyl 1-13 (SEQ ID NOS: 961-966) were designed and tested for the same purpose. Mutant NLpolys were generated as previously described in Example 1. Single colony of each non-luminescent polypeptide mutant was grown according to the procedure used in Example 6. The bacterial cultures were also induced according to the procedure used in Example 6. Luminescence was assayed and detected according to the procedure used in Example 6 expect NLpep53 E.coli clarified lysate was used at 1 : 11.85 dilution.
Figure 24 demonstrates the luminescence of NLpolys containing multiple mutations.
Example 15
Substrate specificity of non-luminescent polypeptide mutants
The following example investigates the substrate specificity of the non-luminescent polypeptide mutants. Luminescence generated from luminescent complexes formed from various non-luminescent polypeptide mutants, either Furimazine or coelenterazine as a substrate, and various non-luminescent peptides. HEK 293 cells were plated at 100,000 cells/ml into wells of a 24 well plates containing
0.5ml DMEM+10% FBS (50,000/well). The cells were incubated in a 37°C, 5% C02 incubator overnight. DNA for expression of each non-luminescent polypeptide mutant was transfected in duplicate, lug plasmid DNA containing a non-luminescent polypeptide mutant was mixed with OptiMEM (Life Technologies) to a final volume of 52ul. 3.3μ1 of Fugene HD (Promega
Corporation) was added, and samples incubated for 15 minutes at room temperature. 25 μΐ of each sample mixture was added to two wells and incubated overnight in a 37°C, 5% C02 incubator overnight. After overnight incubation, the growth media was removed and 0.5ml DMEM (without phenol red) + 0.1% Prionex added. The cells were then frozen on dry ice (for how long) and thawed prior to detecting luminescence.
In Figures 25-26, luminescence was assayed and detected according to the procedure used in Example 6, except NLpep53 E.coli clarified lysate was used at 1 : 10 dilution and either Furimazine or coelenterazine in either NanoGlo Luciferase Assay buffer or DMEM were used. This data demonstrates the luminescence of NLpolys in NANOGLO and DMEM with either Furimazine or Coelenterazine as the substrate. This indicates the substrate specificity
(Furimazine versus Coelenterazine) of the NLpoly in both NANOGLO and DMEM.
In Figure 27, luminescence was assayed and detected according to the procedure used in Example 6, except E.coli clarified lysate from various non-luminescent peptides (NLpepl, NLpep9, NLpep48, NLpep53, NLpep69 or NLpep76) were used at 1 : 10 dilution. In addition, either Furimazine or coelenterazine in either NanoGlo Luciferase Assay buffer were used. This data demonstrates the substrate specificity of NLpoly/NLpep pairs.
In Figure 28, luminescence was assayed and detected by separately diluting NLpep53-HT fusion 1 : 10 and the non-luminescent polypeptide lysates 1 : 10 in DMEM+0.1% Prionex. 20μ1 of non-luminescent peptide and 20μ1ηοη-1υηώιε8ΰεηί polypeptide were then combined and incubated for 10 minutes at room temperature. 40μ1 of NanoGlo Buffer with lOOuM Furimazine or DMEM with 0.1% Prionex and 20uM Furimazine was then added to the samples, and luminescence detected on GloMax Multi. This data demonstrates the substrate specificity of NLpolys expressed in HEK293 cells.
In Figure 29, luminescence was assayed and detected by separately diluting NLpepl -HT, NLpep53-HT, NLpep69-HT or NLpep76-HT fusion 1 : 10 and the non-luminescent polypeptide lysates 1 : 10 in DMEM+0.1 % Prionex. 20μ1 of non-luminescent peptide and 20μ1ηοη- luminescent polypeptide were then combined and incubated for 10 minutes at room temperature. 40μ1 of NanoGlo Buffer with lOOuM Furimazine or DMEM with 0.1% Prionex and 20uM Furimazine was then added to the samples, and luminescence detected on GloMax Multi. This data demonstrates the luminescence of NLpolys expressed in mammalian cells and assayed with various NLpeps.
Example 16
Signal-to-background of non-luminescent polypeptide mutants with Furimazine or coelenterazine
The following example investigates signal-to-background of the non-luminescent polypeptide mutants. Luminescence generated from various non-luminescent polypeptide mutants was measured using either Furimazine or coelenterazine as a substrate as well as with various non- luminescent peptides.
HEK 293 cells were plated at 15,000 cells/well in ΙΟΟμΙ DMEM+10% FBS into wells of
96-well plates. The cells were incubated in a 37°C, 5% C02 incubator overnight. Transfection complexes were prepared by adding 0.66ug each of plasmid DNA for expression of a non- luminescent polypeptide mutant and a non-luminescent peptide mutant plasmid to a final volume of 31 μΐ in OptiMem. 2μ1 Fugene HD was added to each transfection complex and incubated for 15 minutes at room temperature. For each peptide/polypeptide combination, 5μ1 of a transfection complex was added to 6 wells of the 96-well plate and grown overnight at 37C in C02 incubator. After overnight incubation, the growth media was removed and replaced with C02- independent media containing either 20uM coelenterazine or 20uM Furimazine . The samples were incubated for 10 minutes at 37°C, and kinetics measured over the course of 1 hour at 37°C on a GloMax Multi +. Figure 30 demonstrates the substrate specificity of various NLpoly/NLpep pairs when the NLpoly is expressed in mammalian cells.
Example 17
Luminescence and Substrate Specificity
The following example investigates the luminescence and substrate specificity of various non-luminescent polypeptide mutants with NLpep69 and using either Furimazine or
coelenterazine as a substrate.
CHO cells were plated at 20,000 cells/ well in ΙΟΟμΙ of DMEM+10% FBS into wells of 96-well plates. The cells were incubated in a 37°C, 5% C02 incubator overnight. Transfection complexes were prepared by adding 0.66ug each of plasmid DNA for expression of a non- luminescent polypeptide mutant and a non- luminescent peptide mutant plasmid to a final volume of 31 μΐ in OptiMem. 2μ1 Fugene HD was added to each transfection complex and incubated for 15 minutes at room temperature. For each peptide/polypeptide combination, 5μ1 of transfection complex was added to 6 wells of the 96-well plate and grown overnight at 37C in C02 incubator. After overnight incubation, the growth media was removed and replaced with C02- independent media containing either 20uM coelenterazine or 20uM Furimazine . The samples were incubated for 10 minutes at 37°C, and kinetics measured over the course of 1 hour at 37°C on a GloMax
Multi +. Figure 31 demonstrates the substrate specificity when NLpolys are coexpressed in mammalian cells with NLpep69.
Example 18
Luminescence and Substrate Specificity Between Live-Cell and Lytic Conditions
The following example investigates the luminescence and substrate specificity of various non-luminescent polypeptide mutants with NLpep69, NLpep78 or NLpep79, using either Furimazine or coelenterazine as a substrate and under either lytic or live cell conditions.
HEK 293 cells were plated at 15,000 cells/well in ΙΟΟμΙ DMEM+10% FBS into wells of 96-well plates. The cells were incubated in a 37°C, 5% C02 incubator overnight. Transfection complexes were prepared by adding 0.66ug each of plasmid DNA for expression of a non- luminescent polypeptide mutant and a non-luminescent peptide mutant plasmid to a final volume of 31 μΐ in OptiMem. 2μ1 Fugene HD was added to each transfection complex and incubated for 15 minutes at room temperature. For each NLpoly-NLpep combination, 5μ1 of transfection complex was added to 6 wells of the 96-well plate and grown overnight at 37C in C02 incubator. After overnight incubation, the growth media was removed and replaced with C02- independent media containing either 20uM coelenterazine or 20uM Furimazine . The samples were incubated for 10 minutes at 37°C, and kinetics measured over the course of 1 hour at 37°C on a GloMax Multi +. Figures 32-34 demonstrate the substrate specificity of NLPolys coexpressed in mammalian cells with NLpep69, 78, or 79 in live-cell and lytic formats.
Example 19
Comparison of non-luminescent polypeptide mutants expressed in E.coli
A single colony of each non-luminescent polypeptide was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7 except NLpep78-HT or NLpep79-HT at 1 : 1 ,000 dilution was used. Figure 35 demonstrates the luminescence of NLpolys expressed in E. coli and assayed with NLpep78 or 79.
Example 20
Ability of non-luminescent polypeptide clones to produce luminescence without
complementing non-luminescent peptide
A single colony of each non-luminescent polypeptide was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example 7 except no non-luminescent peptide was added to the assay buffer. Figure 36 demonstrates the luminescence of NLpolys expressed in E. coli and assayed in the absence of NLpep.
Example 21
Substrate specificity of non-luminescent polypeptide mutants expressed in E.coli A single colony of each non-luminescent polypeptide was grown according to the procedure used in Example 7. The bacterial cultures were also induced according to the procedure used in Example 7. Luminescence was assayed and detected according to the procedure used in Example except either Furimazine or coelenterazine was mixed with
NANOGLO Assay Buffer. Figure 37 demonstrates the substrate specificity of NLpolys expressed in E. coli and assayed with NLpep78 or 79.
Example 22
Improved luminescence of non-luminescent polypeptide mutants with NLpep78
Complementation of the non-luminescent polypeptide mutants with NLpep78-HT was demonstrated in CHO and Hela cells.
CHO and Hela cells (CHO: 100,000 seeded the day prior to transfection; Hela: 50,000 seeded the day prior to transfection) were transfected with 5ng of a non-luminescent polypeptide mutant 5A2 or 5P or with wild-type non-luminescent polypeptide using Fugene HD into wells of a 24-well plate and incubated at 37°C overnight. After the overnight incubation, the media was replaced with DMEM without phenol red, and the cells frozen at -80°C for 30 minutes. The cells were then thawed and transferred to a 1.5ml tube. The cell lysates were then diluted 1 : 10 DMEM without phenol red, 20μ1 mixed with NLpep78 (NLpep78-HT7 E.coli lysate diluted 1 : 1,000 in DMEM without phenol red) and shaken at room temperature for 10 minutes. 40μ1 DMEM without phenol red and 20uM Furimazine were added and luminescence measured on a GloMax with a 0.5 second integration. Figure 38 demonstrates the luminescence of NLpolys expressed in mammalian cells and assayed with NLpep78.
Example 23
Non-luminescent polypeptide fusions and normalizing non-luminescent polypeptide concentrations
A comparison of raw and normalized luminescence from non-luminescent polypeptide fused to either firefly luciferase (Figure 39) or click beetle red luciferase (Figure 40) were performed to provide insight into how much benefit, e.g., in expression, solubility and/or stability, stems from the concentration of the non- luminescent polypeptide as well as
complementation as a fusion non-luminescent polypeptide..
HEK293, Hela or CHO cells were transfected with 5ng 5P NLpoly- firefly luciferase fusion, 5P NLpoly-click beetle luciferase fusion, wild-type 5P-firefly luciferase fusion or wild- type 5P-click beetle luciferase fusion according to the procedure in Example 22. Lysates were also prepared according to Example 22. The cell lysates were then diluted 1 : 10 DMEM without phenol red, 20μ1 mixed with NLpep78 (diluted 1 : 100 in DMEM without phenol red; E.coli lysate) and shaken at room temperature for 10 minutes. 40μ1 NanoGlo with 20uM Furimazine or Bright-Glo (Promega Corporation) was added and luminescence measured on a GloMax with 0.5 second integration. Figures 39 and 40 demonstrate the specific activity of 5P versus WT NLpoly expressed in mammalian cells and assayed with NLpep78.
Example 24
Complementation in live cells
This example demonstrates complementation in live-cells using either wild-type or 5P NLpoly. Hela cells plated into wells of 96-well plated, transfected with 0.5ng of wild-type or 5P non- luminescent polypeptide plasmid DNA using Fugene HD and incubated at 37°C overnight. After the overnight incubation, the cells were then transfected with 0.5ng NLpep78-HT plasmid DNA using Fugene HD and incubated at 37°C for 3 hours. The media was then replaced with C02- independent media+0.1% FBS and 20uM PBI-4377 and luminescence measured at 37°C on a GloMax with 0.5 second integration. Figure 41 demonstrates the live-cell complementation between 5P or WT NLpoly and NLpep78.
Example 25
Complementation in cell-free extract
To demonstrate complementation in cell-free extract, 0.5ug NLpep78-HT and 0.5ug non- luminescent polypeptide mutant plasmid DNA were mixed with TNT rabbit reticulocyte lysate master mix (Promega Corporation) and incubated at 30°C for 1 hour. 25 μΐ of the cell-free expression extract was mixed with 25 μΐ NanoGlo Luciferase Assay reagent and incubated at room temperature for 10 minutes. Luminescence was measured on a GloMax with 0.5 second integration. Figure 42 demonstrates luminescence from complementing NLpoly/NLpep pairs expressed in a cell-free format.
Example 26
Binding affinity of non-luminescent polypeptide expressed in mammalian cells with synthetic non-luminescent peptide
To demonstrate the binding affinity between non- luminescent polypeptide and non- luminescent peptide pairs, non-luminescent polypeptide lysates from Hela, HEK293 and CHO cells were prepared as previously described and diluted 1 : 10 PBS+0.1% Prionex. 4x
concentrations of non-luminescent peptide (synthetic) were made in PBS+0.1% Prionex. 20μ1 of the non-luminescent polypeptide lysate was mixed with 20μ1 non-luminescent peptide and shaken at room temperature for 10 minutes. 40μ1 of NanoGlo Luciferase Assay Reagent or PBS+0.1% Prionex with Furimazine was added and shaken at room temperature for 10 minutes.
Luminescence was detected on a GloMax with 0.5s integration. Kd values were determined using Graphpad Prism, One Site-Specific Binding. Figure 43 and 44 demonstrate the dissociation constants measured under various buffer conditions (PBS for complementation then NanoGlo for detection, PBS for complementation and detection, NanoGlo for complementation and detection).
Example 27
Improved binding affinity when cysteine mutated to phenylalanine in non-luminescent peptide mutants
To demonstrate improved binding affinity in non- luminescent peptide mutants with a mutated cysteine at the 8th residue of the peptide, non-luminescent polypeptide mutant lysates from Hela, HEK293 and CHO cells were prepared as previously described and diluted 1 : 10 PBS+0.1% Prionex. 4x concentrations of non-luminescent peptide (NLpep) were made in PBS+0.1% Prionex+lOmM DTT. 20μ1 of the non-luminescent polypeptide lysate was mixed with 20μ1 non-luminescent peptide and shaken at room temperature for 10 minutes. 40μ1 of NanoGlo Luciferase Assay Reagent was added and shaken at room temperature for 10 minutes. Luminescence was detected on a GloMax with 0.5s integration. Figure 45 demonstrates NLpep C8F mutation significantly improves the binding affinity for 5P.
Example 28Detectable luminescence of polypeptide variants without non-luminescent peptide in Hela cells
To demonstrate luminescence in non-luminescent polypeptide without non-luminescent peptide, Hela cells (10,000 seeded the day prior to transfection) in wells of a 96-well plate were transfected with varying amounts of non-luminescent polypeptide + pGEM-3zf Carrier DNA to a total of 50ng using Fugene HD and incubated 37°C overnight. After incubation, the media was replaced with C02-independent media+0.1% FBS+20uM Furimazine and incubated at 37°C for 10 minutes, and luminescence detected on a GloMax with 0.5s integration. Figure 46
demonstrates the luminescence of NLpoly WT or 5P in live Hela cells without NLpep after transfection of various amounts of plasmid DNA.
Example 29
Generation of additional non-luminescent polypeptide variants
Additional non-luminescent polypeptide variants: Ile-11 (He at residue 11), Val-11 , Tyr- 11, Glu-11, Glu-157, Pro- 157, Asp- 157, Ser-157, Met-149, Leu-106, NLpolyl l, and NLpolyl2 were generated as described below, and their expression analyzed. The additional non- luminescent polypeptide variants were made in the 5 A2 non-luminescent polypeptide
background. Fresh individual colonies (KRX) of each additional non-luminescent polypeptide variants were picked and grown overnight in LB+ampicillin (lOOug/ml) at 30°C and then diluted 1 : 100 in LB+ampicillin and grown at 37°C for 2.5 hours (OD600 -0.5). Rhamnose was added to a final concentration of 0.2%, and the cells were split in triplicate and grown overnight at 25°C for ~18 h. Cells were lysed using 0.5X Fast Break for 30 minutes at ambient temperature, snap-frozen on dry ice, and stored at -20°C. Upon fast thawing, soluble fractions were prepared by
centrifugation at 10K for 15 min at 4°C. Samples were assayed for luminescence on a Tecan Infinite F-500 luminometer.
Figure 49 demonstrates that total lysate and soluble fraction of each non-luminescent polypeptide variant as analyzed by SDS-PAGE. The data provides information about expression, solubility and stability of the additional non-luminescent polypeptide variants. A majority of the additional non-luminescent polypeptide variants produced more protein (total and soluble) than wild-type, but in many cases, the difference is subtle. Improved expression for NLpoly 11 and NLpolyl2 was more noticeable.
Example 30
Background luminescence of additional non-luminescent polypeptide variants
The background luminescence of the additional non-luminescent polypeptide variants generated in Example 29 was measured by incubating 25 μΐ of non- luminescent polypeptide variant lysate with 25μ1 DMEM at room temperature for 10 minutes. 50μ1 NanoGlo Luciferase Assay Reagent was then added, and luminescence measured at 5 and 30 minutes on a Tecan Infinite F500. NLpep53 (Pep 53) alone and DMEM (DMEM) alone were used as controls.
Figure 47 demonstrates that a majority of the additional non-luminescent polypeptide variants showed elevated background luminescence.
Example 31
Luminescence of additional non-luminescent polypeptide variants after complementation
Luminescence of the additional non-luminescent polypeptide variants generated in Example 28 was measured by incubating 25 μΐ of non- luminescent polypeptide variant lysate with 25μ1 NLpep-53 at room temperature for 10 ηώηιίε850μ1 NanoGlo Luciferase Assay
Reagent was then added, and luminescence measured at 5 and 30 minutes on a Tecan Infinite F500. NLpep53 (Pep 53) alone and DMEM (DMEM) alone were used as controls. Figure 48 demonstrates that the non-luminescent polypeptide variants Val-11, Glu-11, Glu-157, Pro-157, Asp-157, Ser-157 and Met-149 generated significantly more luminescence than parental 5A2.
Example 32 Correlation between increased background luminescence of non-luminescent polypeptide in the absence of non-luminescent peptide and amount of protein in soluble fraction
Individual colonies of the non-luminescent polypeptide variants 3P, 3E, 5P, 5E, 6P and 6E were picked and grown overnight in LB+ampicillin at 30°C and then diluted 1 : 100 in
LB+ampicillin and grown at 37°C for 2.5 hours (OD600 -0.5). Rhamnose was added to a final concentration of 0.2%, and the cells were split in triplicate and grown overnight at 25°C for ~18 h. Cells were lysed using 0.5X Fast Break for 30 minutes at ambient temperature, snap-frozen on dry ice, and stored at -20°C. Upon fast thawing, soluble fractions were prepared by
centrifugation at 10K for 15 min at 4°C. Samples were assayed for luminescence on a Tecan Infinite F-500. Figure 50A shows the total lysate and soluble fraction of each non- luminescent polypeptide variant. Figure 50B shows the background luminescence of each non- luminescent polypeptide variant. Figure 51 shows the luminescence generated with each non-luminescent polypeptide variant when complemented with 10 or ΙΟΟηΜ NLpep78 (NVSGWRLFKKISN) in LB medium.
Example 33
Elongations and deletions of non-luminescent polypeptide
The non-luminescent polypeptide variant 5P was either elongated at the C-terminus by the addition of the residues VAT, AA, VTG, VT, VTGWR, VTGW, V, A, VA, GG, AT, GTA, ATG or GT or deletion of 1 to 7 residues at the C-terminus of 5P, e.g., Dl=deletion of 1 residue, D2=deletion of 2 residues, etc. Background luminescence in E.coli lysates (Figure 52) and luminescence generated after complementation with NLpep78 (Figure 53; NVSGWRLFKKISN) or NLpep79 (Figure 54; NVTGYRLFKKISN) were measured. Figure 55 shows the signal-to- background of the non-luminescent polypeptide 5P variants. Figure 56 provides a summary of the luminescent results. Figure 57 shows the amount of total lysate and soluble fraction in each non-luminescent polypeptide 5P variant.
Example 34
Comparison of 5P and I107L non-luminescent polypeptide Variant
Figure 58 shows the amount of total lysate and soluble fraction of 5P and I107L (A), luminescence generated by 5P or I107L without non- luminescent peptide or with NLpep78 or NLpep79 (B) and the improved signal-to-background of I107L over 5P (C).
Example 35
Generation of 5P non-luminescent polypeptide mutants
Mutations identified in a screening of random mutations in the 5P non-luminescent polypeptide variant were generated as previously described. Each single 5P non-luminescent polypeptide mutant colony was inoculated in 200μ1 Minimal Media and incubated with shaking at 37°C for 20 hours. ΙΟμΙ of the culture was then added to 190μ1 of fresh Minimal Media and incubated again with shaking at 37°C for 20 hours. ΙΟμΙ of the second culture was then added to 190μ1 Auto-Induction Media (Minimal Media + 5% glucose + 2% rhamnose) and incubated with shaking at 25°C for 18 hours to allow expression of the non-luminescent polypeptide mutant. ΙΟμΙ of the 5P non- luminescent polypeptide mutant expression culture was added to 40μ1 of assay lysis buffer containing NLpep78-HT (1 :386 dilution) or NLpep79-HT (1 : 1 ,000 dilution) and shaken at room temperature for 10 minutes. 50μ1 of NanoGlo Assay Buffer containing lOOuM coelenterazine was added and shaken at room temperature for 10 minutes. Luminescence was measured on GloMax with 0.5sec integration. Figures 59-62A shows background luminescence while Figures 59-62B and C show luminescence generated after complementation with NLpep78 or NLpep79.
Example 36
Binding affinity between elongated non-luminescent polypeptide variant and deleted non- luminescent peptide
The binding affinity between an elongated non- luminescent polypeptide variant, i.e., containing additional amino acids at the C-terminus, and a deleted non-luminescent peptide, i.e., deleted amino acids at the N-terminus.
Lysates of E.coli expressing non-luminescent polypeptide 5P/+V/+VT/+VTG prepared as previously described were diluted 1 :2000 in PBS + 0.1% Prionex. 25μ1 of the diluted lysate was incubated with 25μ1 of NLpep78, NLpep80, NLpep81 or NLpep82 (diluted 0-500nM in dilution buffer) for 5 min at room temp. 50μ1 of Furimazine diluted to IX with NanoGlo Assay Buffer was added to each sample and incubated for 10 minutes at room temperature. Luminescence was measured on a GloMax Multi with 0.5s integration time. Figure 63 demonstrates the binding affinity between NLpolys with additional amino acids at the C-terminus with NLpeps with amino acids deleted from the N-terminus.
Example 37
Binding affinity between non-luminescent polypeptide expressed in E.coli and synthetic non-luminescent peptide
Non-luminescent polypeptide LB lysates were prepared and diluted 1 : 100 into PBS+0.1% Prionex. 2X dilutions of synthetic NLpep78 were made in PBS+0.1% Prionex. 25μ1 of the diluted non- luminescent polypeptide lysate was mixed with 25 μΐ of each dilution of non- luminescent peptide and incubated 3 minutes at ambient temperature. 50μ1 of NanoGlo
Luciferase Assay Reagent was added, incubated for 5 minutes at room temperature, and luminescence measured on a GloMax Multi+. Figure 64 shows the calculated Kd values using one-site specific binding. Example 38
Binding affinity between 5P non-luminescent polypeptide expressed in mammalian cells and NLpep80 or NLpep87
Lysates of CHO, HEK293T, or HeLa cells expressing NLpoly 5P were diluted 1 : 1000 in dilution buffer (PBS + 0.1% Prionex.) 25 μΐ of diluted lysate was incubated with 25 μΐ of NLpep80/87 (diluted 0-5 μΜ in dilution buffer) for 5 min at room temp. 50 μΐ of furimazine (diluted to IX with NanoGlo buffer) was added to each well, and the plate was incubated for 10 min at room temp. Luminescence was then read on a GloMax Multi with 0.5s integration time (Figure 65).
Example 39
Binding affinity between 5P non-luminescent polypeptide expressed in E.coli and NLpep80 or NLpep87
Lysates of E.coli expressing NLpoly 5P were diluted 1 :2000 in dilution buffer (PBS + 0.1%) Prionex.) 25 μΐ of diluted lysate was incubated with 25 μΐ of NLpep80/87 (diluted 0-5 μΜ in dilution buffer) for 5 min at room temp. 50 μΐ of furimazine (diluted to IX with NanoGlo buffer) was added to each well, and the plate was incubated for 10 min at room temp.
Luminescence was then read on a GloMax Multi with 0.5s integration time (Figure 66).
Example 40
Complementation between a deleted non-luminescent polypeptide and elongated non- luminescent peptide
Complementation between a deleted non- luminescent polypeptide, i.e., amino acids deleted from the C-terminus, and an elongated non-luminescent peptide, i.e., amino acids added to the N-terminus, was performed. NLpep-HT E. coli clarified lysates as prepared as previously described in Example 6. The amount of NLpep-HT was quantitated via the HaloTag fusion. Briefly, ΙΟμΙ of clarified lysate was mixed with ΙΟμΙ HaloTag-TMR ligand (diluted 1 : 100) and 80μ1 water and incubated at room temperature for 10 minutes. 33.3μ1 4x SDS Loading Buffer was added and incubated at 95°C for 5 minutes. 15μ1 was loaded onto an SDS-PAGE gel and imaged on a Typhoon. Based on the intensities from the SDS-PAGE gel, non-luminescent peptides were diluted in PBS+0.1%> Prionex non-luminescent peptides to make equivalent concentrations. The non-luminescent polypeptide lysates were then diluted 1 : 100 in PBS+0.1% Prionex. 20μ1 of diluted non-luminescent polypeptide and 20μ1 diluted non-luminescent peptide were mixed and shaken at room temperature for 10 minutes. 40μ1 NanoGlo Luciferase Assay Reagent was added and shaken at room temperature for 10 minutes. Luminescence was measured on a GloMax using 0.5sec integration. Figure 67 demonstrates the luminescence of NLpolys with amino acids removed from the C-terminus with NLpeps with additional amino acids on the N-terminus.
Example 41
Binding affinity between 5P non-luminescent polypeptide expressed in Hela Cells and
NLpep78 or truncated NLpep78 (NLpep80-87)
5P non-luminescent polypeptide lysate was prepared from Hela cells as previously described and diluted prepared 1 : 10 in PBS +0.1% Prionex. 4x concentrations (range determined in preliminary titration experiment) of non-luminescent peptide (synthetic peptide; by Peptide 2.0 (Virginia); made at either 5, 10, or 20 mg scale; blocked at the ends by acetylation and amidation, and verified by net peptide content analysis) was prepared in PBS +0.1% Prionex. 20μ1 5P non- luminescent polypeptide and 20μ1 non-luminescent peptide were mixed and shaken at room temperature for 10 minutes. 40μ1 of NanoGlo Luciferase Assay reagent was added and shaken at room temperature for lOminutes. Luminescence was measured on GloMax with 0.5s integration. Figure 68 demonstrates the binding affinity and corresponding luminescence between 5P and truncated versions of NLpep78. The binding affinity is increased when 1 amino acid is removed from the N-terminus, the C-terminus, or 1 amino acid from each terminus. Removing more than 1 amino acid from either terminus lowers the affinity but does not always lower the Vmax to the same extent.
Example 42
Binding affinity between elongated non-luminescent polypeptide and truncated non- luminescent peptide
The binding affinity between an elongated non- luminescent polypeptide, i.e., one with 2 extra amino acids on C-terminus, and a truncated non-luminescent peptide, i.e., one with 2 amino acids removed from N-terminus (NLpep81), was determined.
Non-luminescent polypeptide lysate was prepared as previously described and diluted prepared 1 : 100 in PBS +0.1% Prionex. 2x dilutions ofNLpep81 (synthetic peptide; by Peptide 2.0 (Virginia); made at either 5, 10, or 20 mg scale; blocked at the ends by acetylation and amidation, and verified by net peptide content analysis) was prepared in PBS +0.1% Prionex. 25 μΐ non- luminescent polypeptide and 25 μΐ of each non- luminescent peptide dilution were mixed and shaken at room temperature for 3 minutes. 50μ1 of NanoGlo Luciferase Assay reagent was added and shaken at room temperature for 5 minutes. Luminescence was measured on GloMax with 0.5s integration. Figure 69 shows the calculate Kd values using one-site specific binding.
Example 43 Binding affinity between elongated non-luminescent polypeptide and truncated non- luminescent peptide
The binding affinity between an elongated non- luminescent polypeptide, i.e., one with 3 extra amino acids on C-terminus, and a truncated non-luminescent peptide, i.e., one with 3 amino acids removed from N-terminus (NLpep82), was determined.
Non-luminescent polypeptide lysate was prepared and diluted prepared 1 : 100 in PBS +0.1% Prionex. 2x dilutions of NLpep82 (synthetic peptide; by Peptide 2.0 (Virginia); made at either 5, 10, or 20 mg scale; blocked at the ends by acetylation and amidation, and verified by net peptide content analysis) was prepared in PBS +0.1% Prionex. 25μ1 non-luminescent polypeptide and 25 μΐ of each non-luminescent peptide dilution were mixed and shaken at room temperature for 3 minutes. 50μ1 of NanoGlo Luciferase Assay reagent was added and shaken at room temperature for 5 minutes. Luminescence was measured on GloMax with 0.5s integration. Figure 70 shows the calculate Kd values derived using one-site specific binding.
Example 44
Binding affinity between non-luminescent polypeptide clones expressed in E.coli and
Synthetic NLpep78
Non-luminescent polypeptide variants were grown in M9 minimal media. Individual colonies were inoculated and grown overnight at 37°C. Samples were diluted 1 :20 in M9 minimal media and grown overnight at 37°C. Samples were again diluted 1 :20 in M9 induction media and grown overnight at 25°C. Samples were pooled, and ΙΟΟμΙ of the pooled cells were lysed with 400μ1 of PLB lysis buffer and incubate at room temperature for 10 minutes. The lysates were diluted 1 : 100 in PBS+0.1%> Prionex. 2X dilutions of synthetic NLpep78 were made in PBS+0.1% Prionex. 25μ1 of non-luminescent polypeptide dilution was mixed with 25μ1 of each non-luminescent peptide dilution and incubated for 3 minutes at room temperature. 50μ1 of NanoGlo Luciferase Assay Reagent was added, incubated at room temperature for 5 minutes, and luminescence read on GloMax Multi+. Figure 71 shows the calculate Kd values derived using one-site specific binding.
Example 45
Determination of the effect of mutations on Km
Using diluted pooled lysates from Example 11, 25 μΐ of non- luminescent polypeptide diluted lysate (1 : 100 in PBS+0.1% Prionex) was mixed with 25μ1 of 500nM NLpep78 for each sample and incubated at room temperature for 5 minutes. 2X dilutions of Furimazine in NanoGlo Luciferase Assay Buffer were prepared, and 50μ1 of non-luminescent peptide and non- luminescent polypeptide sample mixed with 50μ1 of NanoGlo/Furimazine dilutions. Luminescence was measured after 5 minute incubation at room temperature. Figure 72 show the calculated Km derived using Michaelis-Menten.
Example 46
Demonstration of a three-component complementation
A tertiary complementation using 2 NLpeps and NLpoly 5P non-luminescent polypeptide is demonstrated. NLpoly 5P-B9 (5P with residues 147-157 deleted) and NLpep B9-HT (Met+ residues 147-157 fused to N-terminus of HT7) lysates were prepared.
A) NLpoly 5P-B9+ NLpoly B9 titration with NLpep78
NLpoly 5P-B9+ NLpoly B9 was titrated with NLpep78. 20μ1 5P-B9 (undiluted) was mixed with 20μ1 peptideB9-HT (undiluted). Dilutions of NLpep78 (synthetic peptide, highest concentration = lOOuM) were made in PBS +0.1% Prionex. 20μ1 NLpep78 was added to 40μ1 of the 5P-B9+peptideB9-HT mixture and shaken at room temperature for 10 minutes. 60μ1 NanoGlo Luciferase Assay Reagent was added and shaken at room temperature for 10 minutes. Luminescence was measured on GloMax with 0.5s integration.
B) NLpoly 5P-B9+ NLpep78 titration with NLpepB9-HT
20μ1 NLpoly 5P-B9 (undiluted) was mixed with 20μ1 NLpep78 (lOOuM). Dilutions of peptideB9-HT (highest concentration = undiluted) were made in PBS +0.1% Prionex. 20μ1 of peptideB9-HT was added to 40μ1 of the 5P-B9+NLpep78 mixture and shaken at room
temperature for 10 minutes. 60μ1 NanoGlo Luciferase Assay Reagent was added and shaken at room temperature for 10 minutes. Luminescence was measured on GloMax with 0.5s integration.
Figure 73 demonstrates the feasibility of a ternary system consisting of 2 different NLpeps and a truncated NLpoly. Since all 3 components are non-luminescent without the other 2, this system could be configured such that each NLpep is fused (synthetically or genetic engineering) to a binding moiety and the truncated NLpoly used at high concentrations to produce light only in the presence of an interaction between the binding moieties, or such that each of the 3 components are fused to binding moieties to produce light only in the event of ternary complex formation.
Example 47
Complementation with NLpep88 (NLpep78 with Gly as 6th residue instead of Arg)
NLpep88-HT and 5P E. coli clarified lysates were prepared as previously described. Serial dilutions of NLpep88-HT lysate were made in PBS+0.1% Prionex. 20μ1 of 5P lysate and 20μ1 NLpep88-HT lysate were mixed and shaken at room temperature for 10 minutes. 40μ1 of NanoGlo Luciferase Assay Reagent was added and shaken at room temperature for 10 minutes.
Luminescence was measured on GloMax with 0.5s integration. Figure 74 demonstrates the importance of the arginine residue at the 6th position of the NLpep. While there is no increase in luminescence above 5P alone at lower concentrations of NLpep88, high concentrations of NLpep increased the luminescence suggesting a catalytically compromised complex and not a lack of interaction between 5P and NLpep88.
Example 48
Subcellular localization of NLpep78 and 79 as N-terminal fusions to HaloTag.
U20S cells were plated and left to recover overnight at 37°C. Cells were then transfected with HaloTag alone DNA construct or the HaloTag-NanoLuc peptide DNA constructs (all under the control of CMV promoter): Pl-HT, P78-HT or P79-HT diluted 1 : 10 with carrier DNA (pSI) using FuGENE HD and incubated for 24 hours at 37°C. Cells were then labeled with HaloTag- TMR ligand by the manufacturer's standard rapid labeling protocol and imaged. Figure 75 demonstrates that NLpep78 and 79 do not alter the intracellular localization of the HaloTag protein.
Example 49
Subcellular localization of non-luminescent polypeptide (WT and 5P)
U20S cells were plated and left to recover overnight at 37°C. Cells were either kept as non-transfection controls or transfected with the NanoLuc DNA constructs: FL, NLpoly (wt) or NLpoly(5P) diluted 1 : 10 with carrier DNA (pSI) using FuGENE HD and incubated for 24 hours at room temperature. Cells were fixed and subsequently processed for ICC. ICC was done using 1 :5000 GS (PRO) primary antibody overnight at 4°C followed by an Alexa488 goat anti-rabbit secondary antibody. Figure 76 demonstrates that both NLpoly WT and NLpoly 5P localize uniformly in cells.
Example 50
Demonstration that non-luminescent polypeptide can easily and quickly detect non- luminescent peptide conjugated to a protein of interest.
99μ1 of NLpep53-HT E. coli clarified lysate was mixed with24.75μl 4x SDS loading buffer. 1 : 10 serial dilutions of the lysate-loading buffer mixture were made and incubated at 95°C for 5 minutes. 15μ1 was loaded onto a SDS-PAGE gel. After gel completions, it was transferred to PVDF using iBlot and washed with lOmL NLpoly L149M E. coli clarified lysate at room temperature for 30 minutes. The membrane was then placed on a LAS4000 imager and 2mL NanoGlo® Luciferase Assay Reagent added. A 60 second exposure was taken (Figure 77).
Example 51 Site saturation at non-luminescent polypeptide positions 31, 46, 108, 144, and 157 in the context of 5P
Single amino acid change variants were constructed onto NLpoly 5P (pF4Ag vector background) at the sites according to table 5 below. In effect, the native residue was varied to each of the 19 alternative amino acids for a total of 95 variants.
Table 5
Position 31 Position 46 Position 108 Position 144 Position 157
Bl Aia E3 Ala H5 Ala C8 Ala F10 Ala
CI Cys F3 Cys A6 Cys D8 Cys G10 Cys
Dl Asp G3 Asp B6 Asp E8 Asp H10 Asp
El Gki H3 Glu C6 Glu F8 Glu Al l Glu
Fl Giy A4 Phe D6 Phe GS Phe Bll Phe
Gl His B4 Gly E6 Gly H8 Gly Cll Gly
HI He C4 His F6 His A9 His Dll His
A2 Lys D4 lie G6 He B9 ile Ell He
B2 Leu E4 Lys H6 Lys C9 Lys Fll Lys
C2 Met F4 Met A7 Leu D9 Leit Gil Leu
D2 Asn G4 Asn B7 Met E9 Met Hll Met
E2 Pro H4 Pro C7 Pro F9 Asn A12 Asn
F2 Gin A5 Gin D7 Gin G9 Pro B12 Gin
G2 Arg B5 Arg E7 Arg H9 Gin C12 Arg
H2 Ser CS Ser F7 Ser A10 Arg D12 Ser
A3 Thr D5 Thr G7 Thr BIO Ser E12 Thr
B3 Val E5 Val H Val CIO Val F12 Val
C3 Trp F5 Trp A8 Trp DIG Trp G12 Trp
D3 Tyr G5 Tyr Εί8 Tyr E10 Tyr HI 2 Tyr
Individual colonies were grown in LB+amp and incubated overnight at 30°C. A 5P control was also included. The overnight cultures were used to inoculate fresh LB+amp (1 : 100), and these cultures grew for 2 hours 45 minutes at 37°C. Rhamnose was added to 0.2%, and the cultures left to grow/induce overnight at 25°C. After 18 hours of induction, cells were lysed using 0.5X FastBreak (30 min ambient temperature), snap frozen on dry ice, and stored at -20°C. Following a fast thaw, samples were assayed in the absence and presence of Pep87 (aka NLpep 87).
For the (-) peptide reactions, 30 uL lysate was incubated with 30uL PBS pH 7.5 for 10 min and then 60 uL NanoGlo® Luciferase Assay reagent (Promega Corporation) added. After 5 minutes, luminescence was measured. For the (+) peptide reactions, 30uL lysate was incubated with 30uL of 8nM Pep87. After 10 min, 60 uL NanoGlo® Luciferase Assay reagent was added, and luminescence measured at 5 minutes.
Luminescence (RLU) data for the (-) peptide samples were normalized to the readings for the 5P control, and these results are presented in Figure 78. Luminescence (RLU) data for the (+) peptide samples were also normalized to 5P, but then also normalized to the values in Figure
76 in order to represent signal to background (S/B; Figure 79).
Example 52
Use of the High Affinity Between NLpoly and NLpep for Protein Purification/Pull Downs MAGNEHALOTAG beads (Promega Corporation; G728A) were equilibrated as follows: a) ImL of beads were placed on magnet for ~30sec, and the buffer removed; b) the beads were removed from magnet, resuspended in ImL PBS+0.1% Prionex, and shaken for 5min at RT; and c) steps a) and b) were repeated two more times NLpep78-HaloTag (E. coli clarified lysate) was bound to MAGNEHALOTAG beads by resuspending the beads in lmL NLpep78-HT clarified lysate, shaking for lhr at RT and placing on magnet for ~30sec. The lysate (flow through) was removed and saved for analysis. NLpoly 8S (E. coli clarified lysate) was bound to the NLpep78 bound-MagneHaloTag beads from the step above by resuspending the beads in 1.5mL 8S lysate, shaking for lhr at RT and placing on a magnet for ~30sec. The lysate (flow through) was removed and saved for analysis. The beads were resuspended in ImL PBS +0.1% Prionex, shaken for 5 min at RT, placed on magnet for ~30sec, and PBS (wash) removed. The beads were washed three more times.
To elute the bound peptide/polypeptide, the beads were resuspended in 500uL lxSDS buffer and shaken for 5min at RT. The beads were then placed on a magnet for ~30sec; the SDS buffer (elution) removed and saved for analysis. The elution was repeated one more time.
The samples were then analyzed by gel. 37.5uL of sample (except elutions) was mixed with 12.5uL 4X SDS buffer and incubated at 95°C for 5min. 5uL was loaded onto a Novex 4- 20% Tris-Glycine gel and run at -180V for ~50min. The gel was stained with SimplyBlue Safe Stain and imaged on a LAS4000 imager.
Figure 94 illustrates that the affinity of NLpoly and NLpep is sufficient to allow for purification from an E. coli lysate. As NLpoly 8S was purified from an E. coli lysate, it is reasonable to expect a protein fused to NLpoly 8S (or other variant described herein) could also be purified in a similar fashion. While in this example the NLpep was immobilized and used to purify NLpoly, it is also reasonable to expect a similar result if NLpoly were immobilized.
Example 53
Kinetics of NLpoly/NLpep Binding
2x concentrations of synthetic NLpep were made and diluted 2.7-fold nine times (10 concentrations) in PBS+0.1% Prionex. Final concentrations used in the assay were 30uM- 3.9nM. WT NLpoly (E.coli clarified lysate; 1 : 10,000) or 11S (1 : 10,000,000) was diluted in NanoGlo+lOOuM Furmazine (Fz). 50uL of NLpep was placed into wells of white 96-well assay plate. 50uL NLpoly/NanoGlo/Fz was injected into the wells using the injector on GloMax® Multi+ instrument, and luminescence measured every 3 sec over 5min. kQbs was found by fitting data to: Y = Ymax -— e ~k°bst) using Graphpad Prism. kQn and kQff were then fitted to: kobs = [NLpep]kon + k0ff . Figure 95 illustrates the association and dissociation rate constants for the binding between NLpolys and NLpeps.
Example 54
NLpoly/NLpep Substrate Affinity
NLpoly was diluted into PBS+0.1% Prionex as follows: WT at 1 : 105, 5P at 1 : 107, and U S at 1 : 108. NLpep was diluted into PBS+0.1 % Prionex as follows: 30uM for WT NLpoly studies or 3uM for NLpoly 5P and 11 S studies. 50uL NLpoly/NLpep was incubated at RT for 5min, 50uL NanoGlo + Fz (ranging from lOOuM to 1.2uM, 2X) added, and incubated for lOmin at RT. Luminescence was measured on GloMax® Multi+ with 0.5sec integration. Km was derived using Graphpad Prism, Michaelis-Menton best-fit values. Figure 96 illustrates the Km values for various NLpoly/NLpep pairs.
Example 55
Substrate Effect on NLpoly/NLpep Affinity
U S (E. coli clarified lysate) was diluted into PBS+0.1% Prionex at 1 : 107. Synthetic NLpep79 was diluted serially (1 :2) from 800nM to 0.39nM (2X). 20uL 11 S + 20uL NLpep79 were then mixed and incubated for 5min at RT. 40uL NanoGlo + 5uM or 50uM Fz was added and incubated another 5min at RT. Luminescence was measured on GloMax® Multi+ with 0.5sec integration. Kd was derived using Graphpad prism, One site-Specific binding value. Figure 97 illustrates that saturating concentrations of furimazine increase the affinity between U S and NLpep79.
Example 56
Km for NLpoly 5A2: NLpep
NLpoly 5A2 was diluted into PBS+0.1% Prionex at 1 : 105. NLpep (WT, NLpep 78 or
NLpep79) was diluted into PBS+0.1% Prionex to 30uM. 50uL NLpoly/NLpep was incubated at RT for 5min. 50uL NanoGlo + Fz (ranging from lOOuM to 1.2uM, 2X) was added and incubated for lOmin at RT. Luminescence was measured on GloMax® Multi+ with 0.5sec integration. Km was derived using Graphpad Prism, Michaelis-Menton best-fit values. Figure 98 illustrates the Km values for NLpoly5 A2 and NLpep WT, 78, and 79.
Example 57
Luminescence of NLpoly without NLpep
E. coli clarified lysate were prepared as described previously for NLpoly WT, 5A2, 5P, 8S and U S. 50uL of each lysate and 50uL NanoGlo +Fz were mixed and incubated for 5min RT. Luminescence was measured on GloMax® Multi+ with 0.5 sec integration. Figure 99 illustrates that the ability of the NLpoly to produce luminescence in the absence of NLpep gradually increased throughout the evolution process resulting in -500 fold higher luminescence for 1 I S than WT NLpoly
Example 58
Improved Luminescence in E. coli Throughout Evolution Process
A single NLpoly colony of WT, 5A2, 5P, 8S or 1 I S was inoculated in 200uL minimal media and grown for 20hrs at 37°C on shaker. I OUL of the overnight culture was diluted into 190uL fresh minimal media and grown for 20hrs at 37°C on shaker. IOuL of this overnight culture was diluted into 190uL auto-induction media (previously described) and grown for 18hrs at 25 °C on shaker. The auto-induced cultures were diluted 50-fold (4uL into 196uL assay lysis buffer), IOuL expression culture added to 40uL of assay lysis buffer containing NLpep
(synthetic; InM; WT, NLpep78, NL79 or NLpep80) and shaken for lOmin at RT. 50uL NanoGlo + Fz was added, and samples shaken for 5 min at RT. Luminescence was measured on a GloMax luminometer with 0.5 sec integration. Figure 100 illustrates the improvement in luminescence from E. coli-derived NLpoly over the course of the evolution process, an overall ~105 improvement (from NLpolyWT:NLpepWT to NLpolyl l S:NLpep80).
Example 59
Improved Luminescence in HeLa Cells Throughout Evolution Process
50ng plasmid DNA expressing NLpoly WT, 5 A2, 5P, 8S or 11 S was transfected into HeLa cells into wells of a 12-well plate using FugeneHD. The cells were then incubated overnight at 37°C/5%C02. The media was replaced with 500uL DMEM without phenol red, and the cells frozen at -80°C for >30min. The cells were thawed and transferred to 1.5mL tubes. NLpep WT, NLpep78, NLpep79 or NLpep 80 (synthetic) were diluted to ΙΟηΜ in PBS+0.1% Prionex, and 25ul mixed with 25uL of each of the NLpoly cell lysate. The samples were shaken for lOmin at RT, and then 50uL NanoGlo+lOOuM Fz added and incubated for 5min at RT.
Luminescence was measured on a GloMax luminometer with 0.5s integration. Figure 101 illustrates the improvement in luminescence from HeLa-expressed NLpoly over the course of the evolution process, an overall ~105 improvement (from NLpolyWT:NLpepWT to
NLpolyl l S:NLpep80).
Example 60
Improved Luminescence in HEK293 Cells Throughout Evolution Process
50ng plasmid DNA expressing NLpoly WT, 5 A2, 5P, 8S or 11 S was transfected into HEK293 cells into wells of a 12-well plate using FugeneHD. The cells were then incubated overnight at 37°C/5%C02. The media was replaced with 500uL DMEM without phenol red, and the cells frozen at -80°C for >30min. The cells were thawed and transferred to 1.5mL tubes. NLpep WT, NLpep78, NLpep79 or NLpep 80 (synthetic) were diluted to ΙΟηΜ in PBS+0.1%
Prionex, and 25ul mixed with 25uL of each of the NLpoly cell lysate. The samples were shaken for lOmin at RT, and then 50uL NanoGlo+lOOuM Fz added and incubated for 5min at RT.
Luminescence was measured on a GloMax luminometer with 0.5s integration. Figure 102 illustrates the improvement in luminescence from HEK293 -expressed NLpoly over the course of the evolution process, an overall ~104 improvement (from NLpoly WT:NLpepWT to
NLpolyl lS:NLpep80).
Example 61
Improved Binding Affinity Throughout Evolution
NLpoly WT, 5A2, 5P, 8S or US (E. coli clarified lysates) were diluted into PBS+0.1% Prionex as follows: WT 1 : 104; 5A2 1 : 105; 5P 1 : 106; 8S l : 107; and l lS 1 : 107.
NLpep WT, NLpep78, NLpep79 or NLpep80 (synthetic) were serially into PBS+0.1% Prionex to 4X concentration. 25uL NLpoly and 25uL NLpep were mixed and incubated for lOmin at RT. 50uL NanoGlo+lOOuM Fz was added and incubated for 5min at RT. Luminescence was measured on a GloMax Multi+ with 0.5sec integration. Kd was determined using Graphpad Prism, One Site-Specific Binding, Best- fit values. Figure 103 illustrates a 104 fold improved affinity (starting affinity: NLpolyWT:NLpepWT, Kd~10uM) of Kd<lnM (NLpolyl lS:NLpep86 or NLpoly 1 lS:NLpep80) of the variants tested over wild-type.
Example 62
NLpoly luminescence
Single NLpoly variant colonies were inoculated with 200uL minimal media and grown for 20hrs at 37°C on a shaker. lOuL of the overnight culture were diluted into 190uL fresh minimal media and grown for 20hrs at 37°C on a shaker. lOuL of this overnight culture was then diluted into 190uL auto-induction media (previously described) and grown for 18hrs at 25°C on a shaker. lOuL of this expression culture was mixed with 40uL of assay lysis buffer (previously described) without NLpep or NLpep78-HT (1 :3,860 dilution) or NLpep79-HT (1 : 10,000 dilution) and shaken forlOmin at RT. 50uL of NanoGlo + Fz was added and again shake for lOmin at RT. Luminescence was measured on GloMax® luminometer with 0.5sec integration. Figures 105-107 illustrate the luminescence of various NLpolys in the absence of NLpep.
Example 63
Solubility of NLpoly Variants
A single NLpoly variant colony (SEE FIG. 143) was inoculated into 5mL LB culture and incubated at 37°C overnight with shaking. The overnight culture was diluted 1 : 100 into fresh LB and incubated at 37°C for 3hrs with shaking. Rhamnose was added to the cultures to 0.2% and incubated 25°C overnight with shaking. 900ul of these overnight cultures were mixed with lOOuL 10X FastBreak Lysis Buffer (Promega Corporation) and incubated for 15min at RT. A
75uL aliquot (total) was removed from each culture and saved for analysis. The remaining culture from each sample were centrifuged at 14,000xrpm in a benchtop microcentrifuge at 4°C for 15min. A 75uL aliquot of supernatant (soluble) was removed from each sample and saved for analysis. 25uL of 4x SDS buffer was added to the saved aliquots and incubated at 95°C for
5min. 5ul of each sample was loaded onto a 4-20% Tris-Glycine SDS gel and run at -190V for
~50min. The gel was stained with SimplyBlue Safe Stain and imaged on a LAS4000.
Figure 143 shows a protein gel of total lysates and the soluble fraction of the same lysate for the
NLpoly variants.
Example 64
Dissociation constants
NLpoly variant lysate (SEE FIG. 144; prepared as described previously) was diluted 1 : 10 into PBS +0.1% Prionex. 4x concentrations of NLpep78 (synthetic NLpep78) were made in PBS +0.1% Prionex. 20uL NLpoly variant lysate and 20uL NLpep were mixed and shaken for lOmin at RT. 40uL NanoGlo/Fz was added and shaken for lOmin at RT. Luminescence was measured on a GloMax® luminometer with 0.5s integration. Kd determined using Graphpad Prism, One site-specific binding, best-fit values. Figure 144 illustrates dissociation constants of NLpep78 with various NLpolys.
Example 65
Comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpolySP and NLpep80/87
HEK293T cells (400,000) were reverse-transfected with 1 μg pF4A Ag FKBP or 1 μg pF4A Ag FRB vectors expressing N- or C-terminal fusions of NLpoly5P and/or NLpep80/87 using FuGENE HD at a DNA-to-FuGENE HD ratio of 1 :4. 24-hours post transfection, cells were trypsinized and re-plated in opaque 96-well assay plates at a density of 10,000 cells per well. 24-hours after plating, cells were washed with PBS and then incubated with or without 20nM rapamycin for 15, 60 or 120 min in phenol red- free OptiMEMI. 10μΜ furimazine substrate with or without 20nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figures 108 (15 min induction), 109 (60 min induction) and 110 (120 min induction) illustrate a general increase in induction over time, with NLpoly5P and NLpep80 combinations generating the most luminescence. Individual components contribute minimally to signal.
Example 66
Comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpolySP and NLpep80/87
Although similar to Example 65, this example tested all 8 possible combinations of FRB and FKBP fused to NLpoly/NLpep as well as used less total DNA. HEK293T cells (400,000) were reverse-transfected with a total of 0.001 μg pF4A Ag FRB-NLpoly5P and 0.001 μg pF4A Ag FKBP-NLpep80/NLpep87 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM- 3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24-hours post- transfection, 10,000 cells were re-plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red-free
OptiMEMI with 0 or 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with 0 or 50nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figures 111 illustrates that NLpep80 combinations generated the highest luminescence and that all configurations respond to rapamycin treatment.
Example 67
Comparison of luminescence generated by FRB or FKBP fusions expressed in the absence of binding partner
HEK293T cells (400,000) were reverse-transfected with a total of 0.001 μg pF4A Ag FRB-NLpoly5P or pF4A Ag FKBP-NLpep80/NLpep87 using FuGENE HD at a DNA-to- FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24-hours post-transfection, 10,000 cells were re-plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red-free OptiMEMI with 0 or 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with 0 or 50nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 112 illustrates that the individual components generate a low basal level of luminescence that is not responsive to rapamycin treatment.
Example 68
Comparison of luminescence generated by cells transfected with varying amounts of FRB-
NLpolySP and FKBP-NLpep80/87 DNA
HEK293T (400,000) cells were reverse-transfected with a total of 2, 0.2, 0.02, or 0.002 μg pF4A Ag FRB-NLpoly5P and pF4A Ag FKBP-NLpep80 using FuGENE HD at a DNA-to- FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 2 μg. 24-hours post-transfection, 10,000 cells were re-plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 20nM rapamycin for 2 h. 10μΜ furimazine substrate (final concentration on cells) with or without 20nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 113 illustrates that transfection with less DNA decreases overall luminescence but increases fold induction.
Example 69
Comparison of luminescence generated by cells transfected with varying amounts of FRB- NLpolySP or FKBP-NLpep80/87 DNA in the absence of binding partner HEK293T cells (400,000) were reverse-transfected with a total of 2, 0.2, 0.02, or 0.002 μg pF4A Ag FRB-NLpoly5P or pF4A Ag FKBP-NLpep80 using FuGENE HD at a DNA-to- FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 2 μg. 24-hours post-transfection, 10,000 cells were replated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 20nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 20nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a
GloMax Multi with 0.5s integration time. Figure 114 illustrates that lower DNA levels do not change overall luminescence of cells transfected with individual components.
Example 70
Comparison of luminescence generated by cells transfected with varying amounts of FRB- NLpolySP and FKBP-NLpep80/87 DNA
HEK293T cells (400,000) were reverse-transfected with a total of 0.2, 0.02, 0.002, or 0.0002 μg pF4A Ag FRB-NLpoly5P and pF4A Ag FKBP-NLpep80/NLpep87 using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 2 μg. 24-hours post-transfection, 10,000 cells were re -plated in opaque 96- well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red- free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 115 illustrates that luminescence above background, as determined in Examples 69 and 71, and rapamycin induction can be achieved with DNA levels down to 2.5 pg.
Example 71
Comparison of luminescence generated by cells transfected with varying amounts of FRB- NLpolySP or FKBP-NLpep80/87 DNA in the absence of binding partner HEK293T cells (400,000) were reverse-transfected with a total of 0.2, 0.02, 0.002, or
0.0002 μ pF4A Ag FRB-NLpoly5P or pF4A Ag FKBP-NLpep80/NLpep87 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 2 μg. 24-hours post-transfection, 10,000 cells were re-plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red- free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 116 illustrates no significant change in luminescence generated by individual components when less DNA was used.
Example 72
Comparison of luminescence generated by cells transfected with varying amounts of FRB- NLpolySP and FKBP-NLpep80 or FKBP-NLpep87 DNA after treatment with rapamycin for different lengths of time
HEK293T cells (400,000) were reverse-transfected with a total of 2, 0.2, 0.02, or 0.002 μg pF4A Ag FRB-NLpoly5P and pF4A Ag FKBP-NLpep80 or FKBP-NLpep87 using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 2 μg. 24-hours post-transfection, 10,000 cells were re -plated in opaque 96- well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 20nM rapamycin for 5/15/30/60/120 min. 10 μΜ furimazine substrate (final concentration on cells) with or without 20nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min.
Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 117 and 118 illustrates a decline in luminescence with less DNA and an increase in rapamycin induction over time.
Example 73
Comparison of luminescence generated by cells expressing different combinations of FRB- NLpolySP or FRB-NLpoly5A2 with FKBP-NLpep80/87/95/96/97 In this example, the assay was performed in both a two-day and three-day format.
For the 2 day assay, 20,000 HEK293T cells were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpoly5P or FRB-NLpoly5A2 and pF4A Ag FKBP- NLpep80/87/95/96/97 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without
50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time.
For 3 day assay, 400,000 HEK293T cells were reverse-transfected with a total of 0.002 μg pF4A Ag FRB-NLpoly5P and pF4A Ag FKBP-NLpep80/87/95/96/97 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24-hours post-transfection, 10,000 cells were re -plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red- free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in
OptiMEMI was added directly to each well and incubated at room temperature for 5 min.
Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figures 119 and 120 illustrate similar levels of luminescence in both the 2 day and 3 day assays. Assays performed with NLpoly5A2 showed greater rapamycin induction relative to NLpoly5P, and assays performed with NLpoly5 A2 and NLpep96 showed greatest rapamycin induction of all tested combinations.
Example 73
Comparison of luminescence generated by cells expressing different combinations of FRB- NLpoly5A2 or FRB-NLpolyllS with FKBP-NLpep 101/104/105/106/107/108/109/110
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O.lng pF4A Ag FRB-NLpoly5A2/l IS and pF4A Ag FKBP- NLpep 101/104/105/106/107/108/109/110 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 121 illustrates that, of tested combinations, NLpolyl IS with NLpep 101 showed the greatest rapamycin induction and one of the strongest rapamycin-specific
luminescent signals.
Example 74
Comparison of luminescence generated by cells transfected with different combinations of FRB-NLpoly5A2 or FRB-NLpolyllS with FKBP-NLpep87/96/98/99/100/101/102/103 HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0. lng pF4A Ag FRB-NLpoly5 A2/11 S and pF4A Ag FKBP-
NLpep87/96/98/99/l 00/101/102/103 using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 122 illustrates that the NLpolyl IS and NLpeplOl combination produces the highest induction while maintaining high levels of specific luminescence.
Example 75
Comparison of luminescence generated by cells transfected with different levels of FRB- NLpolyllS and FKBP-NLpep87/l 01/102/107 DNA
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0.01 , 0.1 , 1 , or 1 Ong pF4A Ag FRB-NLpoly 11 S and pF4A Ag FKBP-
NLpep87/l 01/102/107 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 123 illustrates NLpolyl IS with NLpeplOl produces the overall lowest luminescence in untreated samples at all tested DNA levels, and the combination maintains relatively high levels of luminescence in rapamycin-treated samples.
Example 76
Comparison of luminescence generated by cells transfected with different levels of FRB- NLpoly5A2 and FKBP-NLpep87/101/l 02/107 DNA
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0.01, 0.1, 1, or lOng pF4A Ag FRB-NLpoly5A2 and pF4A Ag FKBP- NLpep87/l 01/102/107 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration on cells) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 124 illustrates that NLpoly5A2 generates higher luminescence in untreated samples than NLpolyl IS shown in example 75.
Example 77
Rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5P and FKBP-NLpep80/87 DNA
HEK293T cells (400,000) were reverse-transfected with a total of 0.001 μg pF4A Ag FRB-NLpoly5P and 0.001 μg pF4A Ag FKBP-NLpep80/NLpep87 using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24-hours post-transfection, 10,000 cells were re-plated in opaque 96-well assay plates and incubated an additional 24 hours. Cells were washed with PBS and then incubated in phenol red- free OptiMEMI with 0 to 500nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration on cells) with 0 to 500nM rapamycin in OptiMEM was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Kd was calculated with GraphPad Prism version 5.00 for Windows. Figure 125 illustrates a rapamycin-specific increase in luminescence.
Example 78
Rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5A2 and FKBP-NLpep87/101 DNA
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpoly5A2/l IS and pF4A Ag FKBP-NLpep87/101 using
FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red- free OptiMEMI with 0 to 1 μΜ rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration on cells) with 0 to 1 μΜ rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 126 illustrates a sigmoidal dose response to rapamycin with NLpoly5 A2/NLpep 101 and NLpolyl 1 S/NLpep 101
combinations. While combinations with NLpep87 show an increase in luminescence with rapamycin, the collected data points deviate more from the sigmoidal curve.
Example 79
Comparison of luminescence generated by cells expressing FRB-llS and FKBP-101 and treated with substrate PBI-4377 or furimazine
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0.1/1/1 Ong pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpeplOl using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to l μg. 24 hours-post transfection, cells were washed with PBS and then incubated in phenol red- free OptiMEMI with 0 or 50nM rapamycin for 1.5 h. 10 μΜ furimazine or PBI-4377 substrate (final concentration on cells) with 0 to 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time. Figure 127 illustrates a decrease in luminescence and fold induction with the PBI-4377 substrate compared to the furimazine substrate.
Example 80
Time course of cells expressing FRB-NLpolyllS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpolyl 1S/5A2 and pF4A Ag FKBP-NLpep87/101 using
FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red- free OptiMEMI with 0 or 50nM rapamycin and 10 μΜ furimazine was added either manually or via instrument injection. Luminescence was immediately measured on a GloMax Multi with 0.5s integration time. Figure 128 and 129 illustrate that, of all combinations tested, NLpolyl IS with NLpeplOl has the lowest luminescence at time 0, hits a luminescent plateau faster and has the largest dynamic range.
Example 81
Luminescence generated by FRB-NLpolyl IS and FKBP-NLpeplOl as measured on two different instruments
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpeplOl using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red- free OptiMEMI with 0 or 50nM rapamycin was added for 20 min. 10 μΜ furimazine (final concentration on cells) in OptiMEMI with 0 or 50nM rapamycin was added and incubated for an additional 5 min. Luminescence was immediately measured on a GloMax Multi with 0.5s integration time and on the Varioskan Flash with 450nM band pass filter. Figure 130 illustrates that the rapamycin-specific induction of FRB-NLpolyl IS and FKBP-NLpeplOl can be measured on different instruments.
Example 82
Images showing luminescence of cells expressing FRB-NLpolyl IS and FKBP-NLpeplOl at various times after treatment with rapamycin HeLa cells (500,000) were reverse transfected with 1 μg pF4 Ag FRB-NLpolyl IS and 1 μg pF4 Ag FKBP-NLpeplOl using FuGENE HD at a DNA to FuGENE ratio of 1 to 4. Cells were transfected in 35 mm glass bottom culture dishes (MatTek #p35gc-1.5-14-C). 24 hours post-transfection, cells were washed with PBS and then incubate with 10 μΜ furimazine in OptiMEM for 5 min. 50nM rapamycin in OptiMEMI was added to cells and luminescent images were acquired with LV200 at 10s intervals for a total of 20 min. Instrument was at 37oC, objective was 60X, gain was 200 and exposure was 600ms. Figure 131 illustrates that imaging can detect an increase in cellular luminescence in cells expressing FRB-NLpolyl IS and FKBP-
NLpeplOl following rapamycin treatment.
Example 83
Quantitation of the signal generated by individual cells expressing FRB-NLpolyl IS and
FKBP-NLpeplOl at various times after treatment with rapamycin HeLa cells (500,000) were reverse transfected with 1 μg pF4 Ag FRB-NLpolyl IS and 1 μg pF4 Ag FKBP-NLpeplOl using FuGENE HD at a DNA to FuGENE ratio of 1 to 4. Cells were transfected in 35 mm glass bottom culture dishes (MatTek #p35gc-l .5-14-C). 24 hours post-transfection, cells were washed with PBS and then incubate with 10 μΜ furimazine in OptiMEM for 5 min. 50nM rapamycin in OptiMEMI was added to cells, and luminescent images were acquired with LV200 at 10s intervals for a total of 20 min. Instrument was at 37°C, objective was 60X, gain was 200, and exposure was 600ms. The signal intensity of every cell in the field of view was analyzed with Image J software over the entire time period. Figure 132 illustrates that signal generated by individual cells can be measured and that the increase in signal by each cell parallels the increase observed in the 96-well plate assay shown in Figures 128 and 129.
Example 84
Comparison of luminescence in different cell lines expressing FRB-NLpolyl IS and FKBP- NLpeplOl
HEK293T, HeLa, or U2-OS cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0. lng pF4A Ag FRB-NLpolyl 1 S and pF4A Ag FKBP-NLpep 101 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red-free OptiMEMI with 0 or 50nM rapamycin was added for 20 min. 10 μΜ furimazine (final concentration on cells) in OptiMEMI with 0 or 50nM rapamycin was added and incubated for an additional 5 min. Luminescence was immediately measured on a GloMax Multi with 0.5s integration time. Figure 133 illustrates similar levels of luminescence generated in the absence and presence of rapamycin in three different cells lines transfected with FRB- NLpolyl 1 S and FKBP-NLpep 101.
Example 85
Comparison of luminescence generated by cells expressing FRB-NLpolyl IS and FKBP- NLpeplOl after treatment with the rapamycin competitive inhibitor FK506
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpeplOl using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red- free OptiMEMI with 0 or 20nM rapamycin was added for 20 min. FK506 inhibitor in OptiMEM was added to cell at final concentration of 5 μΜ and incubated for 3 or 5 hours. Furimazine in OptiMEM was added to cells for a final concentration of 10 μΜ on cells. Luminescence was immediately measured on a GloMax Multi with 0.5s integration time. Figure 134 illustrates a decrease in rapamycin-induced luminescence after treatment with the competitive inhibitor FK506.
Example 86
Luminescence generated by cells expressing FRB-NLpolyl IS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506 HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of O. lng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpeplOl using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red- free OptiMEMI with 0 or 20nM rapamycin was added for 2.5 hours. FK506 inhibitor in
OptiMEM was added to cell via injector at final concentration of 0, 1 or 10 μΜ in OptiMEM with 10 μΜ. Luminescence was measured every 10 min for 4 hours on a GloMax Multi set to 37oC with 0.5s integration time. Figure 135 illustrates that by 200 s, FK506 inhibitor can reduce luminescence close to levels of untreated cells.
Example 87
Luminescence generated by cells transfected with different combinations of V2R-
NLpoly5A2 or V2R-NLpolyllS with NLpep87/101-ARRB2 in the presence or absence of the V2R agonist AVP
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0.1, 1, or lOng pF4A Ag V2R-NLpoly 11 S and pF4A Ag ARRB2-NLpep87/101 using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to l μg. 24 hours-post transfection, cells were washed with PBS and then phenol red- free OptiMEMI with 0 or 1 μΜ AVP and 10 μΜ furimazine was added for 25 min. Luminescence was then measured on a GloMax Multi with 0.5s integration time.
Figure 136 illustrates that V2R-NLpolyl IS with NLpeplOl generates the greatest AVP-specific increase in luminescence. Combinations with NLpep87 show no significant response to AVP.
Example 88
Time course showing luminescence generated by cells transfected with V2R-NLpoly5A2 or
V2R-NLpolyllS and NLpep87/101-ARRB2 after treatment with AVP
HEK293T cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of 0.1 or lng pF4A Ag V2R-NLpoly 11 S or lng pF4A Ag V2R-NLpoly5 A2 and pF4A Ag ARRB2-NLpep87/101 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. 24 hours-post transfection, cells were washed with PBS and then phenol red-free OptiMEMI with 0 or 1 μΜ AVP and 10 μΜ furimazine was added either manually (Figure 137) or via instrument injection (Figure 138). Luminescence was then measured on a GloMax Multi every 5 min for 25 min with 0.5s integration time at room temperature (Figures 137 and 138) or 37°C (Figure 139). Figures 137 and 138 illustrate a time-dependent increase in AVP -induced luminescence for V2R-NLpolyl IS with NLpepl01-ARRB2 that begins to peak at 600 s. Combinations with V2R-NLpoly5A2 and NLpep87 do not show a significant increase in luminescence over time. Figure 139 illustrates that at 37°C all NLpolyl IS and NLpeplOl combinations tested show a time-dependent increase in AVP -induced luminescence that levels out around 200s.
Example 89
Comparison of luminescence in different cell lines expressing V2R-NLpolyllS and
NLpepl01-ARRB2
HEK293T, HeLa, or U2-OS cells (20,000) were reverse-transfected in opaque 96-well assay plates with a total of lng pF4A Ag V2R-NLpolyl IS and pF4A Ag ARRB2-NLpep87/101 using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. 24 hours-post transfection, cells were washed with PBS and then phenol red-free OptiMEMI with 0 or 1 μΜ AVP was added for 20 min.
Furimazine in OptiMEM was then added to a final concentration of 10 μΜ on cells, and luminescence was measured on a GloMax Multi with 0.5s integration time.
Figure 140 illustrates similar luminescence levels in three different cell lines expressing V2R-NLpolyl IS and NLpepl01-ARRB2 in the presence and absence of AVP.
Example 90
Luminescence of cells expressing V2R-NLpolyllS and NLpepl01-ARRB2 at various times after treatment with AVP
HeLa cells (500,000) were reverse transfected with 1 μg pF4 Ag V2R-NLpolyl IS and ^g pF4 Ag ARRB2-NLpepl01 using FuGENE HD at a DNA to FuGENE ratio of 1 to 4. Cells were transfected in 35 mm glass bottom culture dishes (MatTek #p35gc-1.5-14-C). 24 hours post-transfection, cells were washed with PBS and then incubate with 10 μΜ furimazine in OptiMEM for 5 min. ΙμΜ AVP in OptiMEMI was added to cells, and luminescent images were acquired with LV200 at 15s intervals for a total of 30 min. Instrument was at 37°C, objective was 60X or 150X, gain was 600, and exposure was Is or 2s. Figures 141 and 142 illustrate that imaging can detect the increase in luminescence and formation of punctate in individual cells after treatment with AVP.
Example 91
Dissociation Constants for NLpeps
NLpoly 5P E. coli clarified lysate (prepared as described previously) was diluted 1 : 1 ,000 into PBS +0.1% Prionex. 4x concentrations of NLpep78-HT (E. coli clarified lysate prepared as described previously) were made in PBS +0.1 %> Prionex. 20uL NLpoly 5P and 20uL NLpep78 were mixed and shaken for lOmin at RT. 40uL NanoGlo/Fz was added and shaken for lOmin at RT. Luminescence was measured on GloMax luminometer with 0.5s integration. Kd was determined using Graphpad Prism, One site-specific binding, best-fit values. Figure 80 compares the dissociation constants for an NLpep consisting of either 1 or 2 repeat units of NLpep78.
Example 92
Affinity Between NLpoly 5A2 and NLpep86
NLpoly 5 A2 lysate (prepared as described previously after transfecting CHO cells) was diluted 1 : 10 into PBS +0.1% Prionex. 4x concentrations ofNLpep86 (synthetic NLpep) were made in PBS +0.1% Prionex. 20uL NLpoly and 20uL NLpep were mixed and shaken for lOmin at RT. 40uL NanoGlo/Fz was added and shaken for lOmin at RT. Luminescence was measured on GloMax luminometer with 0.5s integration. Kd was determined using Graphpad Prism, One site-specific binding, best- fit values. Figure 81 illustrates the affinity between NLpoly 5A2 and NLpep86.
Example 93
Luminescence of NLpoly variants
A single colony of various NLpolys were inoculated individually into 200uL minimal media and grown for 20hrs at 37°C on shaker. lOuL of overnight culture was diluted into 190uL fresh minimal media and grown for 20hrs at 37°C on shaker. lOuL of this overnight culture was diluted into 190uL auto-induction media (previously described) and grow for 18hrs at 25°C on shaker. lOuL of the expression culture was mixed with 40uL of assay lysis buffer (previously described) without NLpep or with NLpep78-HT (1 :3,860 dilution) or NLpep79-HT (1 : 10,000 dilution). The mixtures were shaken for lOmin at RT, 50uL NanoGlo + Fz added and shaken again for lOmin at RT. Luminescence was measured on a GloMax luminometer with 0.5 sec integration. Figure 82 demonstrates the luminescence from NLpoly variants without an NLpep or with NLpep78 or NLpep79. The results show that the NLpoly variant 11 S (12S-51) has improved luminescence over the other variants.
Example 94
Dissociation Constants and Vmax Values for NLpolys with 96 variants of NLpeps
NLpeps were synthesized in array format by New England Peptide (peptides blocked at N-terminus by acetylation and at C-terminus by amidation; peptides in arrays were synthesized at ~1 mg scale) (Table 6). Each peptide was lyophilized in 3 separate plates. Each well from 1 of the 3 plates of peptides was dissolved in lOOuL nanopure water, and the A260 measured and used to calculate the concentration using the extinction coefficient of each peptide. The concentration was then adjusted based on the purity of the peptide, and nanopure water was added to give a final concentration of 750uM.
Peptides were diluted to 12.66uM (4X) in PBS+0.1% Prionex and then diluted serially 7 times (8 concentrations total) in 0.5 log steps (3.162 fold dilution). NLpolys 5P, 8S, 5A2 or 1 IS were diluted into PBS+0.1% Prionex as follows: 5P 1 :2,000; 8S 1 : 10,000; US 1 : 150,000, 5A2 1 : 1 ,000. 25uL each NLpep + 25uL each NLpoly were mixed and incubated for 30min at RT. 50uL NanoGlo+lOOuM Fz was added and incubated for 30min at RT. Luminescence was measure on a GloMax Multi+ with 0.5sec integration. Kd/Vmax were determined using
Graphpad Prism, One site-specific binding, best-fit values. Figures 83-90 illustrate the dissociation constant and Vmax values from NLpolys with the 96 variant NLpeps. The results indicate specific mutations in the NLpeps that exhibit lower binding affinity without loss in Vmax.
Table 6. Peptide Array 1
Figure imgf000122_0001
arrayl.12 VVGWRLFKKIS arrayl.13 VKGWRLFKKIS arrayl.14 VIGWRLFKKIS arrayl.15 VEGWRLFKKIS arrayl.16 VAGWRLFKKIS arrayl.17 VQGWRLFKKIS arrayl.18 VHGWRLF IS arrayl.19 VSAWRLFKKIS arrayl.20 VSSWRLFKKIS arrayl.21 VSGFRLFKKIS arrayl.22 VSGWKLFKKIS arrayl.23 VSGWQLFKKIS arrayl.24 VSGWELFKKIS arrayl.25 VSGWALFKKIS arrayl.26 VSGWRIFKKIS arrayl.27 VSGWRVFKKIS arrayl.28 VSGWRTFKKIS arrayl.29 VSGWRYFKKIS arrayl.30 VSGWRKFKKIS arrayl.31 VSGWRFFKKIS arrayl.32 VSGWRLAKKIS arrayl.33 VSGWRLDKKIS arrayl.34 VSGWRLEKKIS arrayl.35 VSGWRLGKKIS arrayl.36 VSGWRLHKKIS arrayl.37 VSGWRLIKKIS arrayl.38 VSGWRLKKKIS arrayl.39 VSGWRLLKKIS arrayl.40 VSGWRLMKKIS arrayl.41 VSGWRLNKKIS arrayl.42 VSGWRLQKKIS arrayl.43 VSGWRLRKKIS arrayl.44 VSGWRLSKKIS arrayl.45 VSGWRLTKKIS arrayl.46 VSGWRLVKKIS arrayl.47 VSGWRLWKKIS arrayl.48 VSGWRLYKKIS arrayl.49 VSGWRLFEKIS arrayl.50 VSGWRLFVKIS arrayl.51 VSGWRLFSKIS arrayl.52 VSGWRLFRKIS arrayl.53 VSGWRLFTKIS arrayl.54 VSGWRLFNKIS arrayl.55 VSGWRLFQKIS arrayl.56 VSGWRLFKRIS arrayl.57 VSGWRLFKQIS arrayl.58 VSGWRLFKEIS arrayl.59 VSGW LFKAIS
arrayl.60 VSGWRLFKKVS
arrayl.61 VSGWRLFKKLS
arrayl.62 VSGWRLFKKAS
arrayl.63 VSGWRLFKKFS
arrayl.64 VSGWRLFKKES
arrayl.65 VSGWRLFKKTS
arrayl.66 VSGWRLFKKIL
arrayl.67 VSGWRLFKKIA
arrayl.68 VSGWRLFKKIE
arrayl.69 VSGWRLFKKIV
arrayl.70 VSGWRLFKKIG
arrayl.71 VSGWRLFKKIH
arrayl.72 VSGWRLFKKIT
arrayl.73 VVGYRLFKKIS
arrayl.74 VKGYRLFKKIS
arrayl.75 VIGYRLFKKIS
arrayl.76 VEGYRLFKKIS
arrayl.77 VAGYRLFKKIS
arrayl.78 VQGYRLFKKIS
arrayl.79 VHGYRLFKKIS
arrayl.80 VTAYRLFKKIS
arrayl.81 VTSYRLFKKIS
arrayl.82 VTGYRIFKKIS
arrayl.83 VTGYRVFKKIS
arrayl.84 VTGYRTFKKIS
arrayl.85 VTGYRYFKKIS
arrayl.86 VTGYRKFKKIS
arrayl.87 VTGYRFFKKIS
arrayl.88 ISGWRLMKNIS
arrayl.89 ASGWRLMKKES
arrayl.90 VSGWRLMKKVS
arrayl.91 ISGWRLLKNIS
arrayl.92 ASGWRLLKKES
arrayl.93 VSGWRLLKKVS
arrayl.94 ISGWRLAKNIS
arrayl.95 ASGWRLAKKES
arrayl.96 VSGWRLAKKVS
Example 95
Solubility of NLpoly Variants
A single NLpoly 5A2, 12S, 1 IS, 12S-75, 12S-107 or 5P-B9 colony was inoculated into 5mL LB culture and incubated at 37°C overnight with shaking. The overnight culture was diluted 1 : 100 into fresh LB and incubated at 37°C for 3hrs with shaking. Rhamnose was added to the cultures to 0.2% and incubated 25 °C overnight with shaking. 900ul of these overnight cultures were mixed with lOOuL 10X FastBreak Lysis Buffer (Promega Corporation) and incubated for 15min at RT. A 75uL aliquot (total) was removed from each culture and saved for analysis. The remaining culture from each sample was centrifuged at 14,000xrpm in a benchtop
microcentrifuge at 4°C for 15min. A 75uL aliquot of supernatant (soluble) was removed from each sample and saved for analysis. 25uL of 4x SDS buffer was added to the saved aliquots and incubated at 95°C for 5min. 5ul of each sample was loaded onto a 4-20% Tris-Glycine SDS gel and run at -190V for ~50min. The gel was stained with SimplyBlue Safe Stain and imaged on a
LAS4000. Figure 91 shows a protein gel of total lysates and the soluble fraction of the same lysate for the NLpoly variants. With the exception of 5A2, all variants exhibit a percentage of NLpoly in the soluble fraction.
Example 96
Solubility and Dissociation Constant of NLpoly Variants
A single NLpoly colony (listed in Figure 92) was inoculated into 5mL LB culture and incubated at 37°C overnight with shaking. The overnight culture was diluted 1 : 100 into fresh LB and incubated at 37°C for 3hrs with shaking. Rhamnose was added to the cultures to 0.2% and incubated 25°C overnight with shaking. 900ul of these overnight cultures were mixed with lOOuL 10X FastBreak Lysis Buffer (Promega Corporation) and incubated for 15min at RT. A 75uL aliquot (total) was removed from each culture and saved for analysis. The remaining culture from each sample was centrifuged at 14,000xrpm in a benchtop microcentrifuge at 4°C for 15min. A 75uL aliquot of supernatant (soluble) was removed from each sample and saved for analysis. 25uL of 4x SDS buffer was added to the saved aliquots and incubated at 95°C for 5min. 5ul of each sample was loaded onto a 4-20% Tris-Glycine SDS gel and run at -190V for ~50min. The gel was stained with SimplyBlue Safe Stain and imaged on a LAS4000.
Figure 92 shows a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants as well a table containing the dissociation constants for the same variants.
Example 97
Substrate Specificity for NLpoly 5P and 1 IS with NLpep79
E. coli clarified lysates were prepared for NLpoly 5P or 1 IS as described previously. The NLpoly lysates were then serially diluted in steps of 10-fold into PBS+0.1%> Prionex. 25uL NLpoly and 25uL synthetic NLpep79 (400nM, 4X) were mixed and incubated for 10 min at RT. 50uL NanoGlo + lOOuM Fz was added, incubated forlOmin at RT, luminescence measured on a GloMax Multi+ with 0.5sec integration. Figure 93 shows the substrate specificity for 5P and 1 IS with NLpep79 and demonstrates that 1 IS has superior specificity for furimazine than 5P.
Example 98
Solubility of NLpoly variants from Various Steps of Evolution A single NLpoly WT, 5A2, 5P, 8S or 1 IS colony was inoculated into 5mL LB culture and incubated at 37°C overnight with shaking. The overnight culture was diluted 1 : 100 into fresh LB and incubated at 37°C for 3hrs with shaking. Rhamnose was added to the cultures to 0.2% and incubated 25°C overnight with shaking. 900ul of these overnight cultures were mixed with lOOuL 10X FastBreak Lysis Buffer (Promega Corporation) and incubated for 15min at RT. A 75uL aliquot (total) was removed from each culture and saved for analysis. The remaining culture from each sample was centrifuged at 14,000xrpm in a benchtop microcentrifuge at 4°C for 15min. A 75uL aliquot of supernatant (soluble) was removed from each sample and saved for analysis. 25uL of 4x SDS buffer was added to the saved aliquots and incubated at 95°C for 5min. 5ul of each sample was loaded onto a 4-20% Tris-Glycine SDS gel and run at -190V for ~50min. The gel was stained with SimplyBlue Safe Stain and imaged on a LAS4000.
Figure 104 shows a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants from various steps of the evolution process. These results demonstrate that the solubility of NLpoly was dramatically increased in the evolution process.
Example 99
Chemical Labeling of Proteins
The non-luminescent peptides (NLpeps) of the present invention can be used to chemically label proteins. An NLpep of the present invention can be synthesized to contain a reactive group, e.g., biotin, succinimidyl ester, maleimide, etc., and attached (e.g., conjugated, linked, labeled, etc.) to a protein, e.g., antibody. The NLpep-labeled protein, e.g., NLpep- antibody, can then be used in a variety of applications, e.g., ELISA. The interaction/binding of the NLpep-labeled protein, e.g., NLpep-antibody, to its target/binding partner would be detected by adding an NLpoly of the present invention and NanoGlo® assay reagent. The luminescence generated by the interaction of the NLpep-labeled protein and NLpoly would correlate to the interaction of the NL-labeled protein to its target/binding partner. This concept could allow for multiple NLpeps to be attached to a single protein molecule thereby resulting in multiple NLpep- labeled protein/NLpoly interactions leading to signal amplification.
Example 100
Detection of post-translational protein modification using HaloTag-NLpep by Western
Blotting
Several proteins can be posttranslationally modified by AMPylation or ADP-ribosylation. In AMPylation, AMP is added to the target protein by a phosphodiester bond using ATP as the donor molecule. Similarly, in ADP-ribosylation, an ADP-ribose moiety is added to target proteins through a phosphodiester bond using NAD+ as the donor molecule. It has been shown that the N6-position of both ATP and NAD+ can be used to tag linkers without affecting the posttranslational event. If a N6-modified chloroalkane-ATP or -NAD+ is used to perform the
AMPylation or ADP-ribosylation reaction, the target proteins would be modified to contain the chloroalkane-ATP or -NAD+.
The N6-modified ATP/NAD has been used in combination with click-chemistry to develop in-gel fluorescent-based detection systems. Detection of these post-translational modifications by western blotting techniques requires antibodies, which are often not specific or not available. An alternative approach could be to combine the properties of HaloTag®
technology and the high luminescence of NanoLuc® luciferase (NL).
Upon post-translational modification of target proteins with chloroalkane-ATP (for AMPylation) or chloroalkane-NAD+ (for ADP-ribosylation) using either cell lysate or purified proteins, samples can be resolved by SDS-PAGE and transferred to PVDF membrane. Following blocking, the blot can be incubated with HaloTag-NLpep. HaloTag will bind to the post-translationally- modified proteins. In the next step, the NLpoly and furimazine could be added to the blot to detect the bioluminescence. This detection method is an alternative to a chemiluminescent-based approach for detection of western blots. A chemiluminescent-based approach could involve incubation HaloTag-protein G fusions (as a primary) in the next step any secondary antibody- linked to HRP could be used followed by ECL reaction.
Example 101
Post translational Modification Assays
Post translational modifications (PTMs) of proteins are central to all aspects of biological regulation. PTMs amplify the diverse functions of the proteome by covalently adding functional groups to proteins. These modifications include phosphorylation, methylation, acetylation, glycosylation, ubiquitination, nitrosylation, lipidation and influence many aspects of normal cell biology and pathogenesis. More specifically, histone related PTMs are of great importance.
Epigenetic covalent modifications of histone proteins have a strong effect on gene transcriptional regulation and cellular activity. Examples of post translational modification enzymes include but not limited to, Kinases/Phosphatases, Methyltransferases (HMT)/Demethylases (HDMT), Acetyltransferases/Histone Deacetylases, Glycosyltransferases/Glucanases and ADP-Ribosyl Transferases. Under normal physiological conditions, the regulation of PTM enzymes is tightly regulated. However, under pathological conditions, these enzymes activity can be dysregulated, and the disruption of the intracellular networks governed by these enzymes leads to many diseases including cancer and inflammation.
The non-luminescent peptides (NLpep) and non-luminescent polypeptides (NLpoly) of the present invention can be used to determine the activity of PTM enzymes by monitoring changes in covalent group transfer (e.g. phosphoryl, acetyl) to a specific peptide substrate linked to an NLpep of the present invention. The NLpep will be linked through peptide synthesis to small PTM enzyme specific peptide and used as a substrate for the PTM enzyme.
A) PTM Transferase assays (HAT)
Once the PTM enzyme reaction has occurred, an aminopeptidase can be used to degrade the non-modified peptide (NLpep; control). The modified ( acetylated) peptide (NLpep-PTM enzyme substrate) would be degraded at a very slow rate or would not be degraded at all as the aminopeptidase activity is known to be affected by a PTM. Once the aminopeptidase reaction is complete, the NLpoly is added with the NanoGlo® assay reagent containing Furimazine.
Luminescence would be generated from the sample where PTM occurred via the interaction of the NLpep and NLpoly. If no PTM occurred, the NLpep would be degraded, and no interaction between the NLpep and NLpoly would occur, thereby no luminescence would be generated. This concept is exemplified in Figure 197 for a general transferase enzyme concept and in Figure 145 for H3K4/9 acetyltransferases.
The reaction would be performed under optimal enzyme reaction condition using the histone peptide substrate linked to NLpep of the present invention and Acetyl-CoA or SAM as the acetyl or methyl group donor. A buffer containing aminopeptidase or a mixture of aminopeptidases would be added to degrade specifically all the non-modified substrates. A buffer containing a NLpoly of the present invention and an aminopeptidase inhibitor would be added. NanoGlo® assay reagent would be added, and luminescence detected. Luminescence generated would be proportional to the amount of non-degraded NLpep present, and therefore would correlate with the amount of methylated or acetylated substrates, thereby indicating the amount of methyl or acetyl transferase activity. The assay can also be applied to PTM such as
phosphorylation, glycosylation, ubiquitination, nitrosylation, and lipidation.
B) PTM Hydrolase Assays (HDMT)
In a similar concept to A) can be used for Histone Demethylases (HDMT). However, instead of an aminopeptidase, a PTM-specific antibody can be used to create activity interference. An NLpep of the present invention could be linked through peptide synthesis to small methylated peptide and used as a substrate for the hydrolase. Once a hydrolase reaction has been completed, an anti-methyl antibody can be added to the reaction. This antibody will bind specifically to the methylated peptide (control). The peptide product generated by the HDMT will not bind to the antibody. Then, an NLpoly of the present invention can be added. If the antibody interferes with the interaction of NLpep and NLpoly, no luminescence will be generated. If there was hydrolysis of the PTM by the demethylase, the NLpep and NLpoly will interact, and luminescence will be generated. This concept is exemplified in Figure 198 for a general hydrolase enzyme concept and in Figure 146 H3K4/9 demethylases.
The concept of aminopeptidase degradation of the non-modified substrate can also be used for a hydrolase assay except it would be a loss of signal assay instead of a gain of signal. The reaction would be performed under optimal enzyme reaction condition using a modified (methylated or acetylated) histone peptide substrate linked to an NLpep of the present invention. A buffer containing an antibody capable of recognizing the methyl or acetyl group would be added. A buffer containing an NLpoly of the present invention would be added. The NLpoly would interact with NLpep not bound to the antibody. NanoGlo® assay reagent would be added, and luminescence detected. The luminescence generated would be proportional to the amount of NLpep not bound to the antibody, and therefore would correlate with the amount of demethylated or deacetylated substrate, thereby indicating the amount of demethylase or deacetylase activity. Both hydrolase assay concepts can also be applied to PTM hydrolases such as phosphatases, glucanases and deubiquitinases.
In another version of these concepts, the PTM transfer or hydrolysis on the peptide- NLpep would be alone sufficient to reduce or enhance the interaction of NLpep with NLpoly and therefore decrease or increase the luminescence signal without the need of aminopeptidase or antibody.
The method of the present invention was used to assay a representative transferase, the Tyrosine Kinase SRC using the following NLpep-SRC substrate peptide:
YIYGAFKRRGGVTGWRLCERILA. SRC enzyme was titrated in ΙΟμΙ Reaction Buffer A (40mM Tris 7.5, 20mM MgC12 and O. lmg/ml BSA) in the presence of 150μΜ ATP and 2.5μΜ NLpep-Src substrate and incubated for 1 hour at 23°C. After incubation, ΙΟμΙ of Amino- peptidase M (APM) reagent (40mM Tris 7.5, O.lmg/ml BSA and 50mU APM) was added, mixed for 2 minutes on an orbital shaker, and then incubated at 37°C for 2 hours. To the samples, 30μ1 of NLpoly Reagent was added, and the samples were incubated at room temperature. NLpoly Reagent contained the NLpoly fragment and an Aminopeptidase inhibitor. After 30 minutes, 50μ1 NanoGlo® assay reagent was added and the luminescence was recorded after 3 minutes on a luminometer. It was found that an increase in SRC kinase enzyme activity is correlated with an increase in luminescence over background (Figure 199). Only background activity was found when SRC was not present indicating that the non-phosphorylated NLpep-SRC substrate peptide was digested resulting in no light production by the NLpoly fragment, thus demonstrating use of the method of the present invention to monitor the activity of a transferase enzyme such as a kinase.
Example 102 Detection of specific RNAs (noncoding RNA or mRNA) of interest in mammalian cells, cell lysate or clinical sample
The non-luminescent peptide (NLpep) and non-luminescent polypeptide (NLpoly) of the present invention can be tethered to an RNA binding domain (RBD) with engineered sequence specificity. The specificity of the RBD can be changed with precision by changing unique amino acids that confers the base-specificity of the RBD. An example of one such RBD is the human pumilio domain (referred here as PUM). The RNA recognition code of PUM has been very well established. PUM is composed of eight tandem repeats (each repeat consists of 34 amino acids which folds into tightly packed domains composed of alpha helices). Conserved amino acids from the center of each repeat make specific contacts with individual bases within the RNA recognition sequence (composed of eight bases). The sequence specificity of the PUM can be altered precisely by changing the conserved amino acid (by site-directed mutagenesis) involved in base recognition within the RNA recognition sequence. For detection of specific RNAs in the cell, PUM domains (PUMl and PUM2) with customized sequence specificities for the target RNA can be tethered to a NLpep and NLpoly of the present invention (e.g., as a genetic fusion protein via genetic engineering) and can be expressed in mammalian cells. PUMl and PUM2 are designed to recognize 8-nucleotide sequences in the target RNA which are proximal to each other (separated by only few base pairs, determined experimentally). Optimal interaction of PUMl and PUM2 to their target sequence is warranted by introducing a flexible linker (sequence and length of the linker to be determined experimentally) that separates the PUM and the non- luminescent peptide and non- luminescent polypeptide. Binding of the PUMl and PUM2 to their target sequence will bring the NLpep and NLpoly into close proximity in an orientation that results in a functional complex formation capable of generating bioluminescent signal under our specific assay condition. A functional bioluminescent complex would not be generated in the absence of the RNA target due to the unstable interaction of the NLpep and NLpoly pairs that constitutes the complex.
A similar strategy can also be used for detecting RNA in clinical sample in vitro. The NLpep-PUM fusion proteins with customized RNA specificity can be expressed and purified from suitable protein expression system (such as E.coli or mammalian protein expression system). Purified components can be added to the biological sample along with suitable substrate and assay components to generate the bioluminescent signal.
Examplel03
DNA oligo-based detection of specific RNA (noncoding RNA or mRNA) in clinical sample or mammalian cell lysate A non-luminescent peptide (NLpep) and non-luminescent polypeptide (NLpoly) of the present invention can be attached to oligonucleotides complementary to the target RNA with suitable linker (amino acids or nucleotides). Functional assembly of bio luminescent complex occurs only when sequence specific hybridization of DNA oligo to their target RNA brings the NLpep and NLpoly into close proximity in an ideal conformation optimal for the generation of a bio luminescent signal under the assay conditions. The detection can also be achieved through a three-component complementation system involving two NLpeps and a third NLpoly. For example, two NLpep-DNA conjugates will be mixed with the target RNA. Functional assembly of the bioluminescent complex is achieved by subsequent addition of the third NLpoly. Thus, if a detectable signal is produced under specific assay conditions using a clinical sample or cell lysate, the presence of target RNA in such a sample is inferred. Such assays are useful for detecting RNAs derived from infectious agents (viral RNAs) and specific RNA biomarkers (implicated in many disease conditions such as various forms of cancers, liver diseases, and heart diseases), and could provide a new avenue for diagnosis and prognosis of many disease conditions.
Example 104
In-vivo imaging
Biotechnology-derived products (Biologies), including antibodies, peptides and proteins, hold great promises as therapeutics agents. Unlike small molecule drugs, biologies are large molecules with secondary and tertiary structures and often contain posttranslational
modifications. Internalization, intracellular trafficking, bio-distribution, pharmacokinetics and pharmacodynamics (PK/PD), immunogenicity, etc. of biologies differ significantly from small molecule drugs, and there is a need for new tools to 'track' these antibodies in vivo. Conventional chemical labeling with enzyme reporters (HRP, luciferase, etc.) or small fluorescent tags can significantly alter the therapeutic value of the biologies and are not ideal for in vivo imaging using biologies. Radioisotope-labeling for PET -based imaging is also not convenient.
The NLpolys and NLpeps described herein offer a novel solution for in vivo imaging of biologies. The NLpep can be genetically encoded into a biologic therapeutics without any synthetic steps. Genetic encoding allows precise control over amount of peptide per biologic molecule as well as its position, thereby minimizing any perturbation to its therapeutic value. For imaging, a NLpoly along with substrate, e.g., furimazine, can be injected into the animal. If the NLpep-biologic and NLpoly interact, luminescence would be generated. Alternatively, a transgenic animal expressing NLpoly can be used as a model system.
Example 105
BRET Applications This concept fundamentally measures three moieties coming together. Two of the
NLpolys and/or NLpeps form a complex, and the third moiety, which is either fluorescent or bioluminescent, provides an energy transfer component. If the complex formed is
bio luminescent, both bio luminescence and energy transfer (i.e., BRET) can be measured. If the complex formed is fluorescent, the magnitude of energy transfer can be measured if the third component is a bioluminescent molecule.
A) This example demonstrates a fluorescent dye attached to a NLpep. Alternatively, a fluorescent protein could be fused, e.g., a fusion protein, with a NLpoly or NLpep (created from a genetic construct).
E. coli clarified lysate of NLpoly WT was prepared as described previously. 40uL
NLpoly WT lysate was mixed with lOuL of PBI-4730 (NLpep 1) or PBI-4877 (NLpep 1-TMR) and incubated for lOmin at RT. 50uL lOOuM furimazine in 50mM HEPES pH 7.4 was added and incubated for 30min at RT. Luminescence was measured over 400-700nm on TEC AN M1000.
Figure 147 illustrates very efficient energy transfer from the NLPoly/NLPep complex
(donor) to TMR (acceptor), and the corresponding red shift in the wavelength of light being emitted.
B) This example demonstrates using the BRET in detection, such as detecting small molecule concentration or enzymatic activity. Because energy transfer is strongly dependent on distance, the magnitude of energy transfer can often be related to the conformation of the system. For instance, insertion of a polypeptide that chelates calcium can be used to measure calcium concentration through modulation of energy transfer.
An enzyme that also changes the distance, either through causing a conformational change of the sensor as above or through cleavage of the sensor from the fluorescent moiety, can be measured through a system as described herein. A NLpoly or NLpep bound to a fluorescent moiety gives energy transfer when the NLpoly and NLpep interact. One example of this is a peptide sensor that has been made wherein the NLpep is conjugated to a fluorescent TOM dye via a DEVD linker (Caspase-3 cleavage site). When exposed to the NLpoly, energy transfer is observed. When exposed to Caspase-3, energy transfer is eliminated, but luminescence at 460nm remains.
NLpoly 5A2 and NL-HT (NanoLuc fused to HaloTag) were purified. 20uL of 8pM NL- HT was mixed with 20uL of ΙΟΟηΜ PBI-3781 (See, e.g., U.S. Pat. App. Ser. No. 13/682,589, herein incorporated by reference in its entirety) and incubated for lOmin at RT. 40uL
NanoGlo+lOOuM furimazine was added, and luminescence measured over 300-800nm on TECAN M1000. 20uL of 33ng/uL NLpoly 5A2 was mixed with 20uL of ~500uM PBI-5074 (TOM-NCT-
NLpep). 40uL NanoGlo+lOOuM furimazine was added, and luminescence measured over 300-
800nm on TECAN M1000.
Figure 148 illustrates energy transfer from the NLPoly/NLPep complex (donor) to TOM- dye (acceptor), and the corresponding red shift in the wavelength of light being emitted.
C) Ternary Interactions
The energy transfer with an NLpoly and NLpep can also be used to measure three molecules interacting. One example would be a GPCR labeled with NLpoly and a GPCR interacting protein with NLpep that forms a bioluminescent complex when they interact. This allows measurement of the binary interaction. If a small molecule GPCR ligand bearing an appropriate fluorescent moiety for energy transfer interacts with this system, energy transfer will occur. Therefore, the binary protein-protein interaction and the ternary drug-protein-protein interaction can be measured in the same experiment. Also, the fluorescent molecule only causes a signal when interacting with a protein pair, which removes any signal from the ligand interacting with an inactive protein (Figure 149).
Example 106
6-Tetramethylrhodamine-PEG3-NH2:
To a solution of 6-Tetramethylrhodamine succidimidyl ester (0.25g, 0.5 mmol) in DMF (5 mL), l-Boc-4,7,10-trioxatridecan-l,13-diamine (0.15g, 0.5 mmol) was added followed by diisopropylethylamine (0.25mL, 1.4 mmol). After stirring for 16 h, the reaction was analyzed by HPLC to confirm complete consumption of the 6-tetramethylrhodamine succidimyl ester. The reaction was concentrated to a pink film, which was dissolved in a combination of
triisopropylsilane (0.2mL) and trifluoroacetic acid (4mL). The pink solution was stirred for 2h, after which analytical HPLC confirmed complete consumption of starting material. The reaction was concentrated to dryness to provide crude 6-Tetramethylrhodamine-PEG3-NH2 as a pink film.
H-GVTGWRLCERILA-PEG-TMR (PBI-4877 :
Figure imgf000133_0001
The fully protected peptide Boc-GVTGWRLCERILA-resin was synthesized by standard solid phase peptide synthesis using Fmoc techniques, then cleaved from the resin using dichloroacetic acid to liberate the fully protected peptide as a white solid. To a solution of 6- Tetramethylrhodamine-PEG3-NH2 (0.05g, 0.08mmol) in DMF (1.5mL), this Boc- GVTGWRLCERILA-OH (0.2g, 0.07mmol), 1-hydroxyazabenzotriazole (l lmg, 0.08mmol), 1- Ethyl-3-(3-dimethylaminopropyl)carbodiimide (15mg, 0.08 mmol) and diisopropylethylamine (0.28mL, 0.16mmol) was added . After stirring for 30min, the reaction was concentrated, and the resulting crude was partitioned between CH2CI2 and water, the layers separated and the organic layer was washed with water and brine, dried over sodium sulfate and concentrated. The resulting pink solid was dissolved in a combination of triisopropylsilane (0.2mL) and
trifluoroacetic acid (4mL). After stirring for 3h, the reaction was concentrated, and the resulting pink film was purified with reverse phase HPLC using a gradient of ACN in 0.1% aqueous TFA to provide PBI 4877 as a pink powder: MS (M+) calcd 2088.5, found 2089.1.
TOM-DEVDGVTGWRLCERILA-OH (PBI-5074 :
Figure imgf000134_0001
The fully protected peptide H-DEVDGVTGWRLCERILA-resin was synthesized by standard solid phase peptide synthesis using Fmoc techniques. While still on the resin, a solution of 6-TOM (PBI-3739) succidimidyl ester was added and allowed to react with the free N- terminus. The peptide was then cleaved from the resin and fully deprotected using trifluoroacetic acid (TFA) to provide a blue solid. This solid was purified with reverse phase HPLC using a gradient of ACN in 0.1% aqueous TFA to provide PBI 5074 as a blue powder: MS (M+Z/2) calcd 1238.9, found 1238.8.
Example 107
Complementation Comparison Between a Synthetic, N-terminal Fusion and C-terminal
Fusion of LPep78
Fusions of NLpep78-HaloTag (78-HT) and HaloTag-NLPep78 (HT-78) were quantitated, with a GST-HaloTag® fusion (GST-HT) as a control, by labeling E. coli lysates with the HaloTag-TMR® ligand, separated by SDS-PAGE, and scanned on Typhoon. A standard curve was then created using known concentrations of GST-HT standard, and band intensities of 78-
HT and HT-78 were used to determine their concentrations.
E. coli lysates containing NLpolyl IS were diluted 1 : 107 into PBS pH 7 + 0.1% Prionex. Serial dilutions of 78-HT, HT-78, and synthetic NLpep78 were made in PBS pH 7 + 0.1% Prionex. 20uL NLpolyl 1 S and 20uL of one of the NLPep were mixed and incubated at ambient temperature for 5 minutes. 40uL NanoGlo® reagent (Promega Corporation) + lOOuM Fz were added, and the samples incubates at ambient temperature for 5 min. Luminescence was measured on GlomaxMulti+ using 0.5s integration. Data was fit to one-site, specific binding using GraphPad Prism to determine Bmax and Kd.
The results (Figure 150) compare the binding of NLpolyl IS to synthetic NLPep78 and
NLPep78 at the N- or C-terminus of a fusion partner (HaloTag). The binding affinities were not found to change significantly, but Bmax was reduced when NLPep78 was at the C-terminus.
Example 108
Complementation Comparison Between a Synthetic, N-terminal Fusion and C-terminal
Fusion of NLPep79
Fusions of NLpep79-HaloTag (79-HT) and HaloTag-NLPep79 (HT-79) were quantitated, with a GST-HaloTag® fusion (GST-HT) as a control, by labeling E. coli lysates with the HaloTag-TMR® ligand, separated by SDS-PAGE, and scanned on Typhoon. A standard curve was then created using known concentrations of GST-HT standard, and band intensities of 79- HT and HT-79 were used to determine their concentrations.
E. coli lysates containing NLpolyl IS were diluted 1 : 107 into PBS pH 7 + 0.1% Prionex. Serial dilutions of 79-HT, HT-79, and synthetic NLpep79 were made in PBS pH 7 + 0.1% Prionex. 20uL NLpolyl IS and 20uL of one of the NLPep were mixed and incubated at ambient temperature for 5 minutes. 40uL NanoGlo® reagent (Promega Corporation) + lOOuM Fz were added, and the samples incubates at ambient temperature for 5 min. Luminescence was measured on GlomaxMulti+ using 0.5s integration. Data was fit to one-site, specific binding using GraphPad Prism to determine Bmax and Kd.
The results (Figure 151) compare the binding of NLpolyl IS to synthetic NLPep79 and NLPep79 at the N- or C-terminus of a fusion partner (HaloTag). The binding affinities were not found to change significantly, but Bmax was reduced when NLPep79 was at the C-terminus.
Example 109
Spectral Scan of NLpolyllS with NLPep86 Compared to PBI-4877 (NLPepl-fluorophore)
Purified NLpolyl IS was diluted to InM in PBS pH 7 + 0.01% Prionex + ImM DTT. NLPep86 or PBI-4877 was diluted to 40uM in PBS pH 7 + 0.01% Prionex + ImM DTT. 25uL NLpolyl IS and 25uL NLPep86 or PBI-4877 were mixed and then incubated at ambient temperature for lOmin. 50uL buffer (PBS pH 7 + 0.01% Prionex + ImM DTT) + lOOuM Fz was then added. Luminescence was measured on Tecan Infinite M1000: 300-800nm, every 5nm, bandwidth lOnm, gain 127, integration 0.5s, z-position 22,000um.
The results demonstrate (Figure 152) that the NLPep can be conjugated to small molecules such as fluorescent dyes and retain interaction with NLpoly 11 S to produce luminescence. It also demonstrates efficient energy transfer and the ability to alter the emission spectra.
Example 110
Spectral Scan of NLpolyllS with NLPep86 Compared to PBI-5434 (fluorophore- NLPepl) Purified NLpoly 11 S was diluted to InM in PBS pH 7 + 0.01 % Prionex + ImM DTT.
NLPep86 or PBI-5434 was diluted to 40uM in PBS pH 7 + 0.01% Prionex + ImM DTT. 25uL NLpoly 1 IS and 25uL NLPep86 or PBI-5434 were mixed and then incubated at ambient temperature for lOmin. 50uL buffer (PBS pH 7 + 0.01% Prionex + ImM DTT) + lOOuM Fz was then added. Luminescence was measured on Tecan Infinite M1000: 300-800nm, every 5nm, bandwidth lOnm, gain 127, integration 0.5s, z-position 22,000um.
The results demonstrate (Figure 153) that the NLPep can be conjugated to small molecules such as fluorescent dyes and retain interaction with 1 IS to produce luminescence. This, along with the results with PBI-4877 in Example 109, also suggests that the terminus and/or the linker length used for the conjugation can significantly affect the energy transfer.
Example 111
Spectral Scan of NLpolyllS with NLPep86 Compared to PBI-5436 (fluorophore- NLPepl)
Purified NLpolyl lS was diluted to InM in PBS pH 7 + 0.01% Prionex + ImM DTT. NLPep86 or PBI-5436 was diluted to 40uM in PBS pH 7 + 0.01% Prionex + ImM DTT. 25uL NLpoly 1 IS and 25uL NLPep86 or PBI-5436 were mixed and then incubated at ambient temperature for lOmin. 50uL buffer (PBS pH 7 + 0.01% Prionex + ImM DTT) + lOOuM Fz was then added. Luminescence was measured on Tecan Infinite M1000: 300-800nm, every 5nm, bandwidth lOnm, gain 127, integration 0.5s, z-position 22,000um.
The results demonstrate (Figure 154) that the NLPep can be conjugated to small molecules such as fluorescent dyes and retain interaction with 1 IS to produce luminescence. It also demonstrates efficient energy transfer and the ability to alter the emission spectra.
Example 112
Comparison of Km Values for 11S with Various NLPeps in Affinity Buffer
Purified NLpolyl lS was diluted to 40pM in PBS pH 7 + 0.01% Prionex + ImM DTT +0.005% Tergitol (affinity buffer) or NanoGlo assay reagent (Promega Corporation). NLPeps (NLpep86, 78, 99, 101, 104, 128 and 114) were diluted to 400uM (NLPep to ImM) in affinity buffer or NanoGlo assay reagent. 300uL NLpolyl IS and 300uL of an NLPep were mixed and incubated at ambient temperature for 30min. 50ul was then added to a well of white 96-well plates. 50ul affinity buffer + 2x Fz (12.5uM diluted 2-fold 7 times) or 50ul NanoGlo + 2x Fz (lOOuM diluted 2-fold 7 times) was added to each well, and luminescence measured on a Glomax Multi+ using 0.5s integration. Km was determined using GraphPad Prism, Michaelis- Menten.
The results demonstrate substrate binding in affinity buffer (Figure 155) or NanoGlo assay buffer (Figure 156) to the complex between NLpolyl IS and various NLPeps. The determined Km values do not fluctuate significantly with the indicated NLPeps.
Example 113
NLPepl Binding Affinity to NLpolyllS at Various Concentrations of Furimazine Purified NLpolyl 56 and NLpolyl IS to 40pM in affinity buffer (PBS pH 7 +
0.01%prionex + ImM DTT + 0.005%tergitol). Synthetic NLPepl (WT) was diluted to 560uM for NLpolyl 56 or 80uM for NLpolyl 1 S in affinity buffer and then serially diluted 3-fold to make 8 concentrations. 350uL NLPepl and 350uL NLPolyl56 or 1 IS were mixed and then incubated at ambient temperature for 30min. 50uL was then aliquoted into a well of white 96-well assay plate. Fz was added to affinity buffer to 40, 20, 10, 5, 2.5 and 1.25uM, 50uL Fz/affmity buffer added to each well and incubated at ambient temperature for 2min. Luminescence was measured on a Glomax Multi+ with 0.5s integration. GraphPad Prism and 1 - site specific binding was used to calculate Kd at each concentration of Fz.
The results (Figure 157) indicate the change in affinity (NLPoly/NLPep) with increasing concentrations of Fz.
Example 114
Furimazine Km Values for NLpolyl 56/NLPepl and NLpolyl lS/NLPepl at Various
Concentrations of NLPepl
Purified NLpolyl 56 and NLpolyl IS were diluted to 40pM in affinity buffer (PBS pH 7 + 0.01%prionex + ImM DTT + 0.005%tergitol). Synthetic NLPepl (WT) was diluted to 560uM for NLpolyl 56 or 80uM for NLpolyl 1 S in affinity buffer and then serially diluted 3-fold to make 8 concentrations. 50uL was then aliquoted into a well of white 96-well assay plate. Fz was added to affinity buffer to 40, 20, 10, 5, 2.5 and 1.25uM, 50uL Fz/affinity buffer added to each well and incubated at ambient temperature for 2min. Luminescence was measured on a Glomax Multi+ with 0.5s integration. GraphPad Prism and 1 -site specific binding was used to calculate Kd at each concentration ofNLPepl .
The results (Figure 158) indicate the change in affinity (NLPoly/NLPep) with increasing concentrations of NLPep 1. Example 115
Comparison of Maximal Activity for NLPolyl56/NLPepl, NLPolyllS/NLPepl, and
NanoLuc® luciferase
Purified NLPolyl56, NLPolyl IS, or NanoLuc® luciferase (Nluc) were diluted to 40pM in affinity buffer (PBS pH 7 + 0.01%prionex + ImM DTT + 0.005%tergitol). Synthetic NLPepl (WT) was diluted to 560uM for NLPolyl 56 or 80uM for NLPolyl IS in affinity buffer and then serially diluted 3-fold to make 8 concentrations. 350uL NLPepl (or affinity buffer) and 350uL NLPoly (or Nluc) were mixed and then incubated at ambient temperature for 30min. 50uL was then aliquoted into a well of white 96-well assay plate. Fz was added to affinity buffer to 40, 20, 10, 5, 2.5 and 1.25uM, 50uL Fz/affinity buffer added to each well and incubated at ambient temperature for 2min. Luminescence was measured on a Glomax Multi+ with 0.5s integration. GraphPad Prism and Michaelis-Menton equation was used to calculate Vmax at each
concentration of NLPep (input calculated Vmax values at each concentration of NLPepl into 1- site specific binding to calculate Bmax). GraphPad Prism and 1-site specific binding was used to calculate Bmax at each concentration of Fz (input calculated Bmax values at each concentration of Fz into Michaelis-Menton equation to calculate Vmax).
The results (Figure 159) demonstrate the maximal activity of NLPoly 156 or NLPolyl IS upon activation by NLPepl to the maximal activity of NanoLuc luciferase.
Example 116
Luminescent Values Resulting from Titrating NLpolyllS with Various NLPeps
Purified NLPolyl IS was diluted to 40pM in PBS pH 7 + 0.01% Prionex + ImM DTT +0.005% Tergitol (affinity buffer). Synthetic NLPeps (NLPep86, 78, 79, 99, 101, 104, 114, 128 or wt) were diluted in affinity buffer as follows: NLPep86 = 60nM, NLPep78 = 280nM, NLPep79 = 800nM, NLPep99 = 4uM, NLPeplOl = 34uM, NLPep 104 = 20uM, NLPep 128 = 4uM, NLPepl 14 = 4.48mM and NLPep WT = 20uM. 25uL NLPolyl IS and 25uL an NLPep were mixed and then incubated at ambient temperature for 30min. 50ul affinity buffer + 20uM Fz was then added to each mixture, and luminescence measured on a GlomaxMulti+ using 0.5s integration. Bmax and Kd values were determined using GraphPad Prism and 1 site specific binding.
The results (Figure 160) demonstrate ~ 100,000-fold range of affinities using NLPolyl IS and various NLPeps. Minimal loss in Bmax was observed between the high affinity and low affinity NLPeps.
Example 117
Western Blot of NLPolyl56, NLPolyllS, and NanoLuc® luciferase After Transfection intoHEK293T Cells On day 1, a transfection mixture of 2ng NLPolyl56, NLPolyl IS or NanoLuc® luciferase
(Nluc) DNA, lug pGEM3Zf(+) carrier DNA, 4ul Fugene HD (Promega Corporation) and Phenol red-free OptiMEM to lOOul was made and incubated at RT for 10 minutes. The transfection mixture was then transferred to one well of 6 well plate, and 2 ml of HEK293T cells at 400,000 cells/ml (800,000 cells total) was added. The cells were incubated overnight at 37°C.
On day 2, the cells were washed with phenol red-free DMEM, 500uL phenol red-free DMEM added to each well, and the cells frozen at -70°C for at least 30 min. The cells were then thawed, 500uL transferred to microcentrifuge tube, and 20ul mixed with 80uL of 1.25x SDS loading buffer and incubated at 95°C for 5min. lOul was loaded onto 10% Bis-Tris NuPAGE gel with MES running buffer. Protein was transferred to PVDF using iBlot, and the membrane washed in methanol. The membrane was then blocked in TBST + 5% BSA for lhr at ambient temperature, washed 3 times in TBST and then incubated with lOmL TBST + 2uL rabbit anti- Nluc polyclonal antibody + 2uL rabbit anti-P-actin polyclonal antibody (Abeam #ab8227) at 4°C overnight.
On day 3, the membrane was washed 3 times in TBST, incubated with lOmL TBST +
2uL anti-rabbit HRP conjugated antibody for lhr at ambient temperature, washed again 3 times with TBST and incubated with 12mL ECL Western Blotting Substrate for 1 min.
Chemiluminescence was imaged with LAS 4000 Image Quant.
The results (Figure 161) show the expression level of NLPoly compared to full-length NanoLuc® luciferase. NLPolyl 56 does not express as well as NanoLuc® luciferase (Nluc), whereas NLPolyl IS expresses similarly to Nluc.
Example 118
Determination of the Influence of NLPolyllS/NLPepll4 Affinity on the Interaction Between a β-lactamase (SME) and β-lactamase Inhibitory Protein (BLIP) and Comparison Between Affinity Values Measured Through 11S/114 and β-lactamase Activity
Protein purification
pFlK-signal-6H-SME, pFlK-signal-6H-SME-l I S, pFlK-signal-6H-BLIPY50A, and pFlK-signal-6H-BLIPy50A-l 14 (Promega Flexi vectors for T7 promoter-based expression of recombinant protein in E. coli; the signal refers to the native signal peptide for either SME or BLIP ) were induced with rhamnose to express in the periplasm of KRX cells at 25°C for 18- 20hrs. Cells were pelleted and resuspended in B-Per lysis reagent (Pierce; l/50th culture volume) and incubated at ambient temperature for 15min. Lysate was then diluted by addition of 1.5x volume 20mM Tris pH 8 + 500mM NaCl and centrifuged at 12,000xg for lOmin. The supernatant was transferred to a clean tube, lmL RQ1 DNase (Promega Corporation) added and centrifuged again at 12,000xg for lOmin. Supernatant was purified over HisTALON column Clontech) with 25mM Tris pH 8 and 500mM NaCl loading buffer and eluted with 25mM Tris pH
8, 500mM NaCl and 50mM imidazole. Eluted protein was dialyzed into 25mM Tris pH 7.5 and 25mM NaCl and purified over HiTrap Q FF column (GE Healthcare) with 25mM Tris pH 7.5 and 25mM NaCl loading buffer and eluted with 25mM Tris pH 7.5 and 125mM NaCl. Ionic strength was adjusted to final concentration of 150mM NaCl, and concentrated using a VivaSpin concentrator.
Assay
BLIP Y5 OA and BLIPY50A-1 14 were diluted to 312.5nM in affinity buffer (PBS pH 7 0.01%prionex 0.005%tergitol ImM DTT), and then serially dilute 1.5-fold. SME and SME-1 I S were diluted to 0.2nM in affinity buffer. 1 1.1 luL SME and 88.89uL BLIP were mixed and then incubated at ambient temperature for 2hrs. 90uL of the mixture was transferred to a clear 96- well plate with lOuL of l OOuM Nitrocefm (Calbiochem in affinity buffer). 90uL of SME- 1 I S/BLIP Y5 OA- 1 14 was transferred to a white 96-well plate with lOuL of lOOuM Fz (in affinity buffer). Absorbance (nitrocefin) was measured at 486nm every 15sec over 30min, and luminescence (Fz) was measure every 2min over 30min.
For nitrocefin, initial velocities were fit using Excel. Initial velocities vs. BLIP concentration were plotted. Fit Ki using E_ ree=[E]-([E_0 ]+[/_0 ]+K_app-^l(([E_0 ]+[/_0 ]+K_app )Λ2-(4[£_0 ][/_0]) ))/2 and K_app=K_i (\+([S])/K_M )
For Fz, Kd using RLU=(Bmax x [BLIP-\ \4])/([BLIP-\ \4]+K_D ) was fit.
The results (Figure 162) compares the affinity of a protein interaction (the β-lactamase SME and its inhibitor BLIP Y5 OA) as unfused proteins to the affinity when NLPoly and NLPep are fused to them and demonstrates the affinity between NLPoly 1 I S and NLPep 1 14 does not result in an increased apparent affinity for the SME/BLIPY50A interaction. This also demonstrates the use of NLPoly 1 I S and NLPep 1 14 to measure an equilibrium binding constant for a protein interaction, and the affinity measured through NLPoly 1 I S and NLPep 1 14 is consistent with the affinity measured by activity of the target protein (SME).
Example 119
Comparison of luminescence generated by cells expressing different combinations of FRB- NLPolyllS with FKBP-NLPeplOl and 111-136
HEK293T cells (20,000) were reverse-transfected into wells of opaque 96-well assay plates with a total of lng pF4A Ag FRB-NLpolyl I S and pF4A Ag FKBP- NLpeplOl or 1 1 1-136 plasmid DNA using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. Twenty- four hours-post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration) with or without
50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then read on a GloMax Multi with 0.5s integration time.
Figure 163 demonstrates that, of tested combinations, NLpolyl IS with NLpepl 14 shows the greatest rapamycin induction and one of the strongest rapamycin-specific luminescent signals.
Example 120
Comparison of luminescence generated by cells expressing different combinations of FRB- NLpolyllS with FKBP-NLpepll4 and 137-143
HEK293T cells (20,000) were reverse-transfected into wells of opaque 96-well assay plates with a total of lng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpepl 14 or 137-143 plasmid DNA using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. Twenty- four hours post transfection, cells were washed with PBS and then incubated in phenol red- free OptiMEMI with or without 50nM rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then read on a GloMax Multi with 0.5s integration time.
Figure 164 demonstrates that, of tested combinations, NLpolyl IS with NLpepl 14 shows the greatest rapamycin induction and one of the strongest rapamycin-specific luminescent signals.
Example 121
Rapamycin dose response curves of cells expressing FRB-NLpolyl IS and FKBP- NLpep78/79/99/101/104/l 14/128
HEK293T cells (20,000) were reverse-transfected into wells of opaque 96-well assay plates with a total of O.lng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpep78/79/99/101/104/128 plasmid DNA using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. Twenty- four hours post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with 0 to 300nM rapamycin for 2 h. 10 μΜ furimazine substrate (final concentration) with 0 to 300nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then read on a GloMax Multi with 0.5s integration time. Graphpad Prism was used to fit data to sigmoidal curve and calculate EC50 values. Figure 165 shows a sigmoidal dose response to rapamycin for NLpolyl I S with
NLpep78/79/99/l 01/104/1 14/128. Of the combinations plotted, NLpolyl 1 S with NLpepl 14 shows the greatest dynamic range.
Example 122
Response of cells expressing FRB-NLpolyllS and FKBP-78/79/99/101/104/114/128 to the rapamycin competitive inhibitor FK506
HEK293T cells (20,000) were reverse-transfected into wells of opaque 96-well assay plates with a total of 0. lng pF4A Ag FRB-NLpolyl 1 S and pF4A Ag FKBP- NLpep78/79/99/l 01/104/1 14/128 plasmid DNA using FuGENE HD at a DN A-to -FuGENE ratio of 1 to 8. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μ .
Twenty-four hours post transfection, cells were washed with PBS and then phenol red-free OptiMEMI with ΙΟηΜ rapamycin was added for 2 h. FK506 inhibitor in OptiMEM was added to cells at final concentrations of 0 to 50 μΜ and incubated for 3h. Furimazine in OptiMEM was added to cells for a final concentration of 10 μΜ on cells. Luminescence was immediately read on a GloMax Multi with 0.5s integration time. Graphpad Prism was used to plot data, fit to a sigmoidal curve, and calculate IC50 values.
Figure 166 demonstrates dose-dependent decreases in rapamycin-induced signal of FRB- NLpolyl I S and FKBP-78/79/99/101/104/1 14/128 with the rapamycin competitive inhibitor, FK506.
Example 123
Comparison of luminescence generated by cells transfected with different ratios of FRB-
NLpolyllS and FKBP-NLpepll4
HEK293T cells (20,000) were reverse-transfected into wells of opaque 96-well assay plates with lng pF4A Ag FRB-NLpolyl I S and 0.01 , 0.1 , 1 , 10, or lOOng pF4A Ag FKBP- NLpepl 14 plasmid DNA using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 8. HEK293T cells (20,000) were also reverse transfected with lng pF4A Ag FKBP-NLpepl 14 and 0.01 , 0.1 , 1 , 10, or lOOng pF4A Ag FRB-NLpolyl I S. In both situations, pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to ^g. Twenty-four hours post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin for 1.5 h. 10 μΜ furimazine substrate (final concentration) with or without 50nM rapamycin in OptiMEMI was added directly to each well and incubated at room temperature for 5 min. Luminescence was then read on a GloMax Multi with 0.5s integration time.
Figure 167 demonstrates that a DNA ratio of 1 : 1 generated the greatest rapamycin induction, although a significant induction was observed at all DNA ratios tested.
Example 124 Comparison of luminescence generated by cells expressing NLpolyllS/NLpepll4 fusions of FRB/FKBP in different orientations and with different linker lengths
HEK293T cells (20,000) were transfected into wells of 96-well plates with vectors expressing combinations of N- and C-terminal fusions of pF4Ag NLpolyl IS and pF4Ag
NLpepl 14 with FRB or FKBP. In these constructs, NLpolyl lS/NLpepl 14 were separated from their fusion partners with either a 4, 10, or 15 serine/glycine linker. O. lng NLpolyl IS and NLpepl 14 DNA was transfected per well at a DNA-to-FugeneHD ratio of 1 to 8. Twenty- four hours post transfection, cells were washed with PBS and then incubated in phenol red-free OptiMEMI with or without 50nM rapamycin in OptiMEMI for 2 h. 10 μΜ Furimazine substrate was then added, and following a 5 min incubation at room temperature, the plate was read using a GloMax Multi with 0.5s integration time.
Figure 168 illustrates a rapamycin-specific increase in RLU regardless of fusion orientation or linker length.
Example 125
Comparison of rapamycin dose response curve and time course generated by
FRB-NLpolyllS/FKBP-NLpepll4 and split firefly complementation systems
HEK293T cells (800,000) were transfected into wells of 6-well plates with a total of 20ng pF4A Ag FPvB-NLpolyl IS and pF4A Ag FKBP-NLpepl 14 or 750ng pF4A Ag N-Fluc(l-398)- FRB and FKBP-C-Fluc(394-544) using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. Twenty- four hours post transfection, 20,000 cells were re -plated into wells of opaque 96-well assay plates and incubated an additional 24 h.
For dose response experiments (Figure 169 A), NLpolyl lS/NLpepl 14-expressing cells were treated with 0-1 μΜ rapamycin in phenol red- free OptiMEMI for 3 h and then incubated with 10μΜ furimazine for 5 min before recording luminescence on GloMax Multi. Cells expressing N-Fluc(l-398)/C-Fluc(394-544) were incubated with 0-1 μΜ rapamycin in phenol red-free for 2 h, followed by an additional 1 h incubation in the presence of 4 mM D-Luciferin, prior to recording luminescence on GloMax Multi.
For time course experiments (Figure 169B), NLpolyl lS/NLpepl 14-expressing cells were treated with 0 or 50nM rapamycin in phenol red- free OptiMEMI was added via GloMax Multi injector, and luminescence was immediately measured. Cells expressing N-Flu(l-398)/C- Flu(394-544) were treated with 4 mM D-luciferin in phenol red-free OptiMEMI for 1 h followed by addition of 0 or 50nM rapamycin via injector and measurement of luminescence by GloMax Multi. Curves were fit using GraphPad Prism 6 software. Figure 169A-B demonstrate that both NLpolyl IS/NLpe l 14 and split firefly complementation systems respond in a rapamycin-dependent manner, generating sigmoidal dose response curves and similar EC50 values. The NLpolyl IS/NLpepl 14 system displays faster association kinetics and a higher maximum signal.
Example 126
Comparison of FK506 dose response curve and time course generated by FRB-NLpolyllS/FKBP-NLpepll4 and split firefly complementation systems
HEK293T cells (800,000) were transfected into wells of 6-well plates with a total of 20ng pF4A Ag FRB-NLpolyl IS and pF4A Ag FKBP-NLpepl 14 or 750ng pF4A Ag N-Fluc(l-398)- FRB and FKBP-C-Fluc(394-544) using FuGENE HD at a DNA-to-FuGENE ratio of 1 to 4. pGEM-3Zf(+) DNA was added to bring total DNA in each transfection to 1 μg. Twenty- four hours post transfection, 20,000 cells were re -plated into wells of opaque 96-well assay plates and incubated an additional 24 h. Cells were then treated with 0 or 20nM rapamycin in phenol red- free OptiMEMI for 3 h.
For FK506 dose response experiments (Figure 170A), cells were incubated with 0 to
ΙΟΟμΜ FK506 inhibitor in phenol red- free OptiMEMI for 5 h, treated with 10μΜ furimazine, and then read with GloMax Multi in luminescence mode with 0.5s integration time.
For time course experiments (Figure 170B), cells were treated with 10 μΜ FK506 in phenol red- free OptiMEMI containing 10 μΜ furimazine and luminescence was immediately read with GloMax Multi.
Figure 170A-B demonstrates that the NLpolyl IS/NLpepl 14 and split firefly
complementation systems show a dose-dependent decrease in light output following treatment with the FK506 inhibitor. The loss of signal in the NLpolyl IS/NLpepl 14 system begins at an earlier time point, is more rapid, and is more complete than the split firefly system.
Example 127
Western blot showing expression levels of FKBP-NLpepl 14 and FKBP-Fluc(394-544) HEK293T cells (200,000) were transfected with 0 to 30ng of pF4Ag NLpepl 14-FKBP or pF4Ag FKBP-Fluc(394-544) DNA using FugeneHD at a DNA to Fugene ratio of 1 to 8. Forty- eight hours post-transfection, cells were harvested with IX SDS gel loading buffer. Samples were separated on a 4-10% Tris-HCl SDS-PAGE gel and transferred to PVDF membrane. The membrane was blocked in 5% BSA in TBST for lh and then incubated with anti-FKBP (Abeam #ab2918) overnight. Secondary antibody incubation with horse radish peroxidase-conjugated donkey anti -rabbit IgG was performed for lh and then the blot was developed using ECL Western Blotting Substrate (Promega Corporation) and the Image Quant LAS 4000 system. Figure 171 demonstrates similar expression levels of FKBP-NLpepl 14 and FKBP-
Fluc(394-544) at equal levels of transfected DNA.
Example 128
Dose- and time-specific inhibition of NLpolyllS-BRD4 and Histone H3.3-NLpepll4 interaction by IBET-151
HEK293T cells (20,000) were transfected into wells of a 96-well white assay plate with lOng of pF4Ag Histone H3.3-NLpepl 14 and NLpolyl lS-NLpolyl IS using Fugene HD at a DNA to Fugene ratio of 1 to 8.
For dose response experiment (Figure 172 A), cells were treated with 0 to 10μΜ IBET- 151 in phenol red-free OptiMEMI for 4 h at 37°C and then treated with 10μΜ furimazine for 5 min before reading luminescence with GloMax Multi.
For time course experiment (Figure 172B), cells were pre-incubated with 10μΜ furimazine for 5 min, treated with 0-500nM IBET-151 and immediately placed in a GloMax Multi for luminescent measurements every 5 min.
Figure 172A-B demonstrates a dose-dependent decline in luminescence upon treatment with the BPvD4 inhibitor IBET-15 lthat occurs within 3 hours of treatment, consistent with literature reports.
Example 129
RAS/CRAF, BRAF/BRAF, and CRAF/BRAF dimerization in response to GDC0879 HEK293T cells (20,000) were co-transfected into wells of 96-well assay plates with combinations of pF4Ag NLpolyl 1S-BRAF, NLpolyl 1S-CRAF, NLpepl 14-KRAS, or
NLpepl 14-BPvAF using a total of 0. lng DNA per well and Fugene HD at a ratio of 1 to 4.
Twenty- four hours post-transfection, cells were treated with 0 to 10μΜ of the BRAF inhibitor GDC0879 in phenol red-free OptiMEMI for 4h. Furimazine substrate in phenol red-free OptiMEMI was added to 10μΜ, and luminescence was read immediately with GloMax Multi set to 0.5s integration time.
Figure 173 demonstrates a dose dependent increase of RAS/CRAF, BRAF/BRAF and CRAF/BRAF dimerization in response to BRAF inhibitor GDC0879.
Example 130
Twelve synthetic peptides (Figure 180) were examined for their ability to structurally complement three different versions of NLpolyl I S (i.e. 1 IS, 1 lS-amino acid 157, 1 lS-amino acids 156 and 157). Stocks of NLpoly were made to 35 nM in NanoGlo reagent and stocks of NLpep were made to 12.5 nM in PBS pH 7.2. Equal volumes were mixed and samples measured for luminescence on a Tecan Infinite F500 reader (100 msec integration time; 10 min time point) (Figure 200). Example 131
Spontaneously interacting peptide NLpep86
Purified NLPolyl IS was diluted to 40pM in PBS pH 7 + 0.01% Prionex + ImM DTT +0.005% Tergitol (affinity buffer). Synthetic NLPeps (NLPep86, WT, 114) were diluted in affinity buffer as follows: NLPep86 = 60nM, NLPepl 14 = 4.48mM and NLPep WT = 20uM.
25uL NLPolyl IS and 25uL an NLPep were mixed and then incubated at ambient temperature for 30min. 50ul affinity buffer + 20uM Fz was then added to each mixture, and luminescence measured on a GlomaxMulti+ using 0.5s integration. Bmax and Kd values were determined using GraphPad Prism and 1 site specific binding.
Figure 174 demonstrates ~ 100,000-fold range of affinities using NLPolyl IS and various
NLPeps. Pep 86 is an example of a spontaneously interacting peptide (with LSP 1 IS), and Pep 114 is shown for reference as a low affinity interacting peptide.
Example 132
Titration of high affinity peptide in vitro
Purified NLpolyl IS (HaloTag purification/E. coli expression; pFN18K) and synthetic peptide NLpep86 (obtained from Peptide 2.0) were titrated at a linear dynamic range using 33nM NLpolyl IS in Nano-Glo® assay buffer to 3.3 fM - 100 nM high affinity NLpep86. For a 30 kDa protein, this corresponds to LOD of 10 fg.
Figure 176 demonstrates the broad linear range and ability to detect femptamolar concentrations of the high affinity peptide tag (NLpep86). This rivals most sensitive Western Blot (WB)+ Enhanced Chemiluminescence (ECL) kits
Example 133
Western Blot-Like Utility of NLpoly and NLpep
A titration of HaloTag (HT7)-NLpep 80 (80) or NLpep80-HaloTag (HT7) were run on an SDS page gel. The HaloTag® protein was imaged with HaloTag-TMR ligand (Promega
Corporation) on a Typhoon scanner. The samples were transferred to a membrane and PBS pH 7 + 0.1%) Prionex + NLpolyl 1 S (E. coli lysate diluted 1 : 1 ,000) was used to blot the membrane. NanoGlo/Fz was then added to the membrane and it was imaged on a ImageQuant.
Figure 177 demonstrates the sensitivity of detecting proteins tagged with a high affinity NLPep using NLpolyl IS. Figure 177 also compares the detection using NLPep/NLPoly to the detection using fluorescently labeled HaloTag.
Example 134
Stability of an NLpolyl IS Reagent
ΙΟΟηΜ NLpolyl IS was incubated in NanoGlo assay buffer (Promega
Corporation)+100uM furimazine and assayed with equal amounts of diluted NLpep86. As a control, NanoGlo assay buffer+lOOuM furimazine was used to assay an equal volume of diluted NanoLuc® luciferase (Promega Corporation).
The results (Figure 178) demonstrate that an NLpolyl IS reagent (containing Fz) has similar stability compared to the commercial NanoGlo® assay reagent (also containing Fz).
Example 135
Titration of DNA for High Affinity NLpep78-HT7 fusion
HEK293 cells (200,000/ml) were reverse transfected with 10-fold dilutions of DNA (starting with lOOng) from a high affinity peptide, NLpep78, fused to HaloTag® protein (HT7). lOOul of each transfection was plated in triplicate into wells of a 96-well plate. Twenty- four hours post-transfection, lOOul NanoGlo® assay buffer containing lOOnM NLpolyl IS and lOOul furimazine was added and mixed. Luminescence was measured 10 minutes after reagent addition on a GloMax luminometer.
The results (Figure 179) demonstrate the broad linear range similar to Example 131/Fig 27. This is essentially a similar experiment to what was done in Example 131 except that this examples uses recombinantly expressed peptide (fused to HaloTag) in a mammalian cell.
Example 136
Preliminary results (array peptides)
In Figure 183A, 50nM NLpolyl IS was mixed with 7.5μΜ NLpepl 14 and 37.5 μΜ dark peptide (DP) candidate (Q-162, A- 162, K-162 or E-162). NanoGlo® assay reagent (Promega Corporation) was added and incubated for 5 minutes. Luminescence was detected.
In Figure 183B, 50nM NLpolyl IS in assay buffer (PBS pH7 + 0.01% Prionex + 1 mM DTT + 0.005% Tergitol) was mixed with 7.5μΜ NLpepl 14 (also in assay buffer) and variable amounts of dark peptide (DP) candidates Q-162 or K-162 (also in assay buffer). NanoGlo® assay reagent (Promega Corporation) was added and incubated for 5 minutes. Luminescence was detected on a Tecan Infinite F500 reader; 100 ms integration time; 5 min time point used.
Panel A indicates that each of the peptide candidates (at 7.5 uM) can inhibit the binding between NLpolyl IS and NLpepl 14, as indicated by less bio luminescence. Note these "dark" peptides do generate some luminescence, thus the increased signal compared to no peptides at all.
Panel B indicates that with the Lys-162 and Gin- 162 peptides the inhibition is dose- dependent.
Example 137
High purity (>95%) dark peptides In Figure 184A, 5nM NLpolyl IS was mixed with 500nM NLpepl 14 and variable amounts of a dark peptide (DP) candidate Q-162 or A- 162 (n=3). NanoGlo® assay reagent (Promega Corporation) was added and incubated for 5 minutes. Luminescence was detected.
In Figure 184B, 5nM NLpolyl IS in assay buffer was mixed with variable amounts of dark peptide (DP) candidates Q-162 or A- 162 in assay buffer (no NLpepl 14)(n=3). NanoGlo® assay reagent (Promega Corporation) was added and incubated for 5 minutes. Luminescence was detected.
The results (Figure 184 A and B) substantiate the results from Example 135, but there is greater confidence here because the peptides are more pure. These results also suggest that of the dark peptides variants tested the Ala peptide is the most potent as an inhibitor.
Example 138
Inhibition of Circularly Permuted NanoLuc® Luciferase by Dark Peptides
To determine whether "high affinity/low activity" NLpeps (a.k.a. Dark Peptides) can compete with the intramolecular interaction (i.e., protein folding) between NanoLuc® luciferase (Nluc) residues 1-156 and 157-169 in the context of circularly permuted Nluc (CP Nluc).
CP NLuc: NLuc 157-169— 33aa-linker— Nluc 1-156
Dark peptides: VTGWRLCERIL (wt)
1. Gln-162 VSGWQLFKKIS
2. Ala-162 VSGWALFKKIS
Recombinant CP Nluc was prepared as a soluble fraction of an E. coli 5x-concentrated lysate (T7-promoter; overnight expression). A 10,000-fold dilution of the CP Nluc in Assay Buffer (PBS pH 7/0.01% Prionex/lmM DTT/0.005% Tergitol) was used. Synthetically-derived dark peptides were prepared across a range of concentrations, also in the Assay Buffer. Reactions were set up using 30μί of CP NLuc and 60μί of Dark peptide and assayed by adding 90μί NanoGlo® assay reagent (Promega Corporation). Luminescence was measured (5 min) on a Tecan Infinite F500 reader (100 ms integration). Three replicates were used for Dark peptide samples. Two replicates were used for buffer controls (acetic acid from peptide stocks).
Figure 185 demonstrates a dose-response of the dark peptides with CP Nluc. Figure 186 demonstrates a time course of dark peptide (56 μΜ peptide) with CP Nluc.
The results indicate that both dark peptides, particularly the Ala 162 version, are able to significantly inhibit generation of luminescence by CP Nluc (Alal62 >2 logs; Glnl62 >1 log). This indicates that a CP Nluc approach has utility for inverse complementation.
Example 139
Dark Peptides in Cells
In this example, the following constructs were used: -Four dark peptide vectors: pF4Ag + FKBP-dark peptide Ala- 162, Leu- 162, Gin- 162 and
Val-162
-Two non-dark peptide vectors: pFc5K2 FKBP-NLpepl l4 (low affinity peptide) and pFc5K2 FKBP-NLpep80 (high affinity peptide)
-One NLpoly vector: pFc5K2 FRB-NLpoly 11 S
All constructs harbored a CMV promoter for mammalian cell expression. All fusions constructs contained a lOaa Gly-Ser flexible linker.
Serial dilutions of the dark peptide constructs, Ala- 162 (A), Leu- 162 (L), Gin- 162 (Q) and Val-162 (V), were made in OptiMem and additionally contained carrier DNA (pGEM-3Z).
For transfection containing NLpolyl lS only, 20ul of diluted dark peptide was mixed with 20ul NLpoly 1 IS, 60ul OptiMem and 8uL Fugene. For transfections containing NLpoly 11 S and NLpepl 14 or NLpep80, 20ul of diluted dark peptide was mixed with 20ul NLpolyl lS (lOng/ul), 20ul NLpepl 14 or NLpep80 (lOng/ul), 40ul OptiMem and 8ul Fugene. All were incubated at RT for 15 minutes. 5ul of each transfection, in triplicate, was added to wells of two, 96-well plates (one +Rapamycin one without Rapamycin). lOOul of HEK293T at 200,000 cells/ml in
DMEM+10% FBS were then added to the wells, and the transfected cells incubated overnight at 37°C
The medium was then removed from the cells, and the cells washed with 200 μΐ DPBS. 50 μΐ of 50nM rapamycin was added, and the cells incubated for 1 h at 37°C. 20μ1 of 5mM furimazine in 5 ml phenol red-free OptiMEMI + 50 nM rapamycin was diluted, 50μ1 added directly to the cells and incubated for 5 min in GloMax Multi+. Luminescence was measured on the GloMax.
Figure 187 demonstrates that the dark peptides, when fused to FKBP, can reduce the background signal of NLpolyl lS (i.e., FRB-NLpoly 1 IS). Taken together Figures 188-190 demonstrate that the dark peptides, when fused to FKBP, can 1) compete with the folding of full length NanoLuc (i.e., FRB-NanoLuc or NanoLuc-FRB) and 2) compete with both low and high affinity peptides (also FKBP fusions) for binding to NLpoly 11 S (i.e. FRB-NLpoly 11 S), and as a result reduce the total luminescence being produced and detected in live cells.
Example 140
Virology Applications
In addition to enabling measurement of viral titers, spontaneously interacting NLpeps also enable studying re-assortment of viruses (e.g., influenza). Re-assortment of viruses refers to the formation of new "hybrid" viruses from dual infections e.g. H1N1, H5N1, H3N2 (H is hemagglutinin; N is neuraminidase); bird, human, pig, chicken (most common in pigs) Because of its segmented nature, the influenza genome can be readily shuffled in host cells infected with more than one virus. When a cell is infected with influenza viruses from different species, reassortment can result in progeny viruses that contain genes from strains that normally infect birds and genes from strains that normally infect humans, leading to the creation of new strains that have never been seen in most hosts. Moreover, because at least 16 different subtypes and nine different neuraminidase subtypes have been characterized, many different combinations of capsid proteins are possible. Of these subtypes, three subtypes of hemagglutinin (HI, H2, and H3) and two subtypes of neuraminidase (Nl and N2) have caused sustained epidemics in the human population. Birds are hosts for all influenza A subtypes and are the reservoir from which new HA subtypes are introduced into humans (Palese, 2004).
The application of the present system for detecting re-assortment is that the two components of spontaneously interacting NLpeps are be put into different viral particles, or the large component in cells and the small component in a virus, and the presence of both elements (e.g., being present in a cell) is detected by luminescence.
Example 141
Validating the Use of Spontaneously Interacting NLpep86 as an Epitope Tag for Proteins
Degraded by the Proteasome
Experiments were conducted during development of embodiments of the present invention to validate the use of NLpep86 as a tag to monitor expression levels of proteins degraded by the proteasome. To do this, Nlpep86 was fused to firefly luciferase variants that were also fused to either one or more PEST, CL1 or ubiquitin sequences (pBC21, 22, 24-29). Each of these constructs is expected to undergo proteasome-mediated turnover to varying degrees following expression from a mutant CMV promoter (dlCMV).
The constructs pBC21,22, 24-29 and control constructs expressing untagged firefly luciferase or untagged firefly luciferase fused to a PEST sequence (ATG082 and ATG083) were transiently transfected into HELA cells plated at 10,000 cells per well in a 96-well plate using 100 μΐχιΐ DMEM + 10% FBS. The following day, 10 μΕ of a transfection mixture (920ul OptiMEM I + 5 ug of the respective construct + 15ul Fugene HD) was added per well and cells were allowed to incubate for 48 hours in a 37 °C incubator containing 5% C02. Protein expression levels were quantified in replicate wells for each construct by detecting firefly luciferase activity or by adding a detection reagent containing NLpoly 11 S (purified NLpoly 11 S added to NanoGlo®). A good correlation was observed between the NLpep86 and Flue signals in each case, suggesting that NLpep86 detection can be used to monitor fusion protein expression levels for proteins degraded by the proteasome. BC21 MVSGWRLFKKIS-GGSGGGGSGG-Fluc(high affinity)
BC22 MVSGWRLFKKIS-GGSGGGGSGG-FlucP(high affinity)
BC24 pFC15A/MVSGWRLFKKIS-GGSGGGGSGG-Fluc-CLl
BC25 MVSGWRLFKKIS-GGSGGGGSGG-Fluc-PEST12opt(high affinity)
BC26 MVSGWRLFKKIS-GGSGGGGSGG-Fluc-CP(high affinity)
BC27 UBQ G76V-VGKLGRQDP-Fluc(EDAKNIKK..)-GGSGGGGSGG-
VSGWRLFKKIS(high affinity)
BC28 UBQ-RGKLGRQDP-Fluc(EDAKNIK ..)-GGSGGGGSGG- VSGWRLFKKIS(high affinity)
BC29 UBQ-LGKLGRQDP-Fluc (EDAKNIK ..)-GGSGGGGSGG-
VSGWRLFK IS(high affinity)
ATG083 Dl FlucP; pF4Ag CMV Luc2-PEST
ATG082 DlFluc; pF4Ag CMV Luc2 After a 48 hour incubation, 1 OOuL NanoGlo® NLpep 11 S reagent (90ul of NLpoly 11 S in 50ml of
NanoGlo® assay reagent was added to each well and incubate for 3 minutes with shaking.
Luminescence was then read on GloMax luminometer (0.5 sec/well).
The results in Figure 191 demonstrate that the signal from Flue and NLpep86 appear to reflect each other with respect to relative brightness and have similar RLUs. BC21, BC25 and BC29 are the brightest constructs of the BC series with BC21 appearing the brightest in this experiment BC24, 26 and 27 are the least bright which is predicted from the engineered destabilization.
Example 142
This example demonstrates that a known complementing peptide can be used as a linker between the same or a different complementing NLpep and NLpolyl 1 S (e.g., NLpep78(2X)).
HEK293T cells (20,000) were transfection with a mixture containing 20 of NLpep78- HaloTag (HT) or NLpep78(2x)-HT DNA, 80 μΕ of phenol-free Opimex and 8 μΕ of FugeneHD. Cells were grown overnight at 37°C and assayed at 24h using NanoGlo® assay reagent (Promega Corporation) containing 33nM purified NLpolyl I S.
The results (Figure 192) demonstrate that a tandem binding peptide can be used and that it may suffice as a linker.
Example 143
Comparison of the Specific Activities of Wild- Type Oplophorus luciferase residues 1-156,
NLpolyllS and NanoLuc in HEK293T lysates Each clone was inserted into pFN21A HaloTag® CMV Flexi® Vector (Promega G2821), and lysates were prepared as follows: 3ml HEK293T cells that have been diluted to a
concentration of 200,000 cells/ml (600,000 cells total) were plated into each well of a 6-well plate and grown overnight at 37°C in a C02 incubator. The following day transfection complexes of each DNA were prepared by combining 6^g of DNA, Opti-MEM® (Life Technologies 11058-021) to a final volume of 310μ1 and 20μ1 of FuGENE® HD (Promega E231a). The transfection complexes were incubated for 20 minutes and then 150μ1 of each complex added in duplicate to cells. The cells were grown overnight 37°C in a C02 incubator. The following day, the cells were washed cells with DPBS (Life Technologies 14190-144), and lml fresh DPBS added. Cells were frozen to lyse and then thawed for testing. Duplicate transfection reactions lysates were combined.
To quantitate the level of protein expression for each sample, each sample was labeled with HaloTag® TMR Ligand (Promega Corporation) as follows: HaloTag® TMR Ligand (Promega G8251) was diluted 1 : 100 into water to a concentration of 0.05ιηΜ;100μ1 of each lysate was mixed with 2μ1 of diluted TMR ligand and incubated for 30 minutes at RT; 20μ1 of SDS loading dye was added, and the samples heated to 95°C for 5 minutes. ΙΟμΙ and 20μ1 of each sample was loaded onto a polyacrylamide gel (Bio-Rad, 4-15% Criterion™ Tris-HCl Gel #345-0030.), run at 200V for 1 hour and then quantitated using ImageQuant™ LAS 4000 (GE). Both NLpolyl IS and NanoLuc® luciferase (Nluc) expressed approximately 4-fold higher than 1-
156.
In order to compare the specific activities of Nluc (full length enzyme) to wt
Oplophorus 1-156 and NLpolyl IS in combination with wt Oplophorus 157-169 peptide (binary proteins), substrate titrations were run for all of the samples, but for the binary samples substrate titrations were run at multiple peptide concentrations. Using this format, it was possible to calculate a Vmax value for Nluc and both Vmax and Bmax values for NLpolyl 1 S and wt Oplophorus 1-156. Three separate experiments were run using this format and Vmax and Bmax values were normalized to the Vmax of NanoLuc. Relative specific activities (calculated as averages of Vmax and Bmax) are normalized to NanoLuc.
Relative specific activity (*with
Sample
wt 157-169 peptide)
NanoLuc 1.00
wt 1-156 0.07*
US 0.18* Example 144
Effect of NLpoly and NLpep on Intracellular Half-life of FlucP
To determine if appending either NLpoly 1 IS or NLpep 114 to Luc2-PEST alters the intracellular half-live as measured by decay of signal after cycloheximide (CHX) treatment.
Day 1 : Plate Hela cells in 6 well plates. Plate 3 ml of cells (200,000/ml) into two 6 well plates. Grow overnight. DMEM+10%FBS.
Constructs containing FlucP, wt 157-169 FlucP, NLpolyl IS, NLpepl 14 FlucP and pBC22 (all pF4Ag Dl-CMV) were transfected into HeLa cells. Briefly, 33ul of DNA (3.3ug) was added to 122ul of OptiMem, mixed and 9.9ul of FuGENE®HD added. The transfection mixtures were then incubated at RT for 20 minutes, andl50ul added to cells. After an overnight incubation, cells were replated at 10,000 cells/well and incubated again overnight.
After incubation, the growth media was removed and replaced with either 0.4mM cycloheximide (CHX) or control (DMSO). At each time point, ONE-Glo™ assay reagent was added, incubated at RT for 3 minutes and luminescence measured on Tecan GENios Pro luminometer.
Figure 193 demonstrates that none of the NLpoly or NLpep components tested interfere with the normal intracellular degradation of a reporter enzyme (FlucP).
Example 145
Extracellular Protease Activity Assay
In some embodiments, the present invention provides an assay for extracellular protease
(e.g. caspase) activity. A quenched peptide is provided (e.g., high affinity peptide such as NLpep86) that can only be accessed and refolded into an active luciferase with an NLpoly, e.g., NLpolyl IS, upon removal of the quencher moiety by a protease (e.g. caspase)(Figure 194). NLpolyl IS and furimazine are introduced to the assay as a reagent and then samples are measured for bioluminescence.
Example 146
Medially Attached Pro-Groups (isopeptides and glycosylated amino acids)
Assays are provided for measuring the activity of an enzyme through using a ProNLpep. This configuration of ProNLpep is a NLpep with one of the internal amino acids conjugated to a group that prevents the complementation of the peptide to an NLpoly. When this ProNLpep encounters an enzyme that removes the blocking group (e.g., caspase 1 in the case of WEHD or a glycosidase in the case of the serine glycoside), the ability of the NLpep to complement to an NLpoly is restored (Figure 195). In the presence of furimazine, this results in production of light in proportion to the activity of the enzyme of interest. Because each enzymatic cleavage results in the formation of a luciferase, the sensitivity of this system for assaying small concentrations of enzyme is expected to be high.
Example 147
Linker Evaluation
Assays are provided measuring the release of cargo from an antibody. An NLpep is attached to an antibody, protein, peptide, or transporter recognition moiety in such a manner that prevents it from associating with a NLpoly to form a luciferase. Upon a stimulus, such as cellular internalization, the linker between the antibody, protein, peptide, or transporter recognition moiety and the NLpep is cleaved, due to intracellular reducing potential, and the NLpep is released (Figure 196). The NLpep can now complement with an NLpoly to form a luciferase, and the light generated will be proportional to the cleavage of the linker. This provides a system to measure the release of a compound from an antibody, which is a surrogate for cytotoxic drug delivery from Antibody Drug Conjugates. The linker can be cleaved through any manner known in the art, such as through intracellular proteases or pH sensitivity. Again, because a luciferase is generated through every cleavage, this is expected to be a sensitive method for assaying cleavage.
Example 148
The use of antibodies to target and destroy diseased cells has shown significant therapeutical promise and occurs through a process called Antibody-dependent cell-mediated cytotoxicity (ADCC). There are many ways to monitor ADCC activity, including crosslinking of different cells types or monitoring gene transcription using specific luciferase reporters expressed in the effector cells. A potential alternative readout to the ADCC mechanism of action could be in the monitoring of specific protein:protein interactions induced or disrupted after the binding of therapeutical antibodies to their target antigens or receptors presented on the cell surface. In some embodiments, the specific protein:protein interactions are monitored using the system of the present invention, which provides a readout in the time frame of minutes versus hours which is required by other methods.
Example 149
Immunoassays
Embodiments of the presnt invention find use in homogeneous immunoassays, for example, as depicted in Figure 201 , where the NLpep and NLpoly are fused to binding moieties (e.g., A and B). The binding moieties A and B may comprise many different components, making up several different formats of immunoassays than can be utilized as target specific assays or more generalized reagents to be used in immunoassays. The binding moieties will only come into close proximity in the presence of the target, thus bringing the NLpep and NLpoly into close proximity resulting in production of luminescence upon substrate addition. Table 7 lists exemplary of binding moieties (Mie et al. The Analyst. 2012 Mar 7; 137(5): 1085-9.;
Stains et al. ACS chemical biology. 2010 Oct 15;5(10):943-52.; Ueda et al. Journal of immunological methods. 2003 Aug;279(l-2):209-18. Ueda et al. Nature biotechnology. 1996 Dec;14(13): 1714-8.; Lim et al. Analytical chemistry. 2007 Aug 15;79(16):6193-200.; Komiya et al. Analytical biochemistry. 2004 Apr 15;327(2):241-6.; Shirasu et al. Analytical sciences : the international journal of the Japan Society for Analytical Chemistry. 2009 Sep;25(9): 1095-100.; herein incorporated by reference in their entireties).
Table 7.
Figure imgf000155_0001
In some embodiments in which the binding moieties are comprised of protein A, protein G, or domains of protein A or G, the immunoassay system utilizes the NLpoly and NLpep fusions to complex with antibodies prior to addition with the sample containing the target. Antibodies bind non-covalently to protein A and G naturally. Introduction of a covalent coupling between the antibody and the fusions are introduced in the complex formation step. The NLpep/NLpoly- protein A/G/domain fusions binding moieties can be complexed to the antibodies in various formats, for example:
• individually with two different specific antibodies targeting two different proteins to determine if proteins exist in complex;
• together with a single target specific polyclonal antibody;
• together with secondary antibody (e.g., rabbit anti mouse IgG) to bind to sample
preincubated with primary antibody (e.g., target specific mouse IgG); and
• individually with two antibodies targeting two different epitopes on the same target
protein.
As described in Table 7, in some embodiments, the binding moieties are target specific antibodies, domains of target specific antibodies, receptor domains that bind target ligands, or a combination of antibodies, antibody domains, and target receptor domains.
In some embodiments, targets are monitored in samples which include but are not limited to blood, plasma, urine, serum, cell lysates, cells (primary or cell lines), cell culture supernatant, cerebral spinal fluid, bronchial alveolar lavage, tissue biopsy samples, chemical compounds, etc.
Methods describe analysis of targets which include but are not limited to: proteins, small molecules and compounds, haptens, peptides, hormones, heterodimeric protein-protein interactions, cell surface antigens, interactions between receptors and ligands, proteins in complex, viruses and viral components, bacteria, toxins, synthetic and natural drugs, steroids, catecholamines, eicosanoids, protein phosphorylation events, etc.
Applications include but are not limited to detection or quantitation of target for clinical disease monitoring, diagnostics, therapeutic drug monitoring, biological research,
pharmaceuticals, compound detection and monitoring in the food/beverage/fragrance industry, viral clade identification, etc.
Additional applications include high throughput screening of molecules capable of disrupting the interactions of target with its receptor thus resulting in a loss of signal assay. There are several proposed formats for use of NLpep/NLpoly in immunoassays. In some embodiments, these are performed homogeneously and supplied as a kit, as separate diagnostic and research kit components, or as stand-alone reagents customizable to the individual's assay. In other embodiments, homogeneous immunoassay utilizing NLpep/NLpolyutilize variations of the HitHunter or CEDIA technology (Yang et al. Analytical biochemistry. 2005 Jan l;336(l): 102-7.; Golla and Seethala. Journal of biomolecular screening. 2002 Dec;7(6):515-25.; herein incorporated by reference in their entireties). In such assays, components include: target specific antibody, NLpoly, NLpep-recombinant target fusion, and substrate. The NLpoly and NLpep-recombinant target fusion form a luminescent complex when the NLpep is not bound to the target specific antibody. Upon addition of the test sample to the assay components, the amount of luminescence is directly proportional to the target concentration in the test sample as the target present in the test sample will compete with the NLpep-recombinant target fusion on the antibody (e.g., gain of signal indicates the presence of the target).
Example 150
Exemplary configurations for NLpolyllS in spontaneous complementation
Various configurations of NLpoly 1 IS may find use in spontaneous complementation assays or systems. Such configurations may include: deletions at the C-term (e.g., to reduce background luminescence), N- and/or C-terminal appendages (e.g., based on whether they are to be purified by His or HaloTag), etc. For example, the appendage left by HaloTag when it's a N- terminal tag is SDNIAI. Exemplary configurations include: SDNAIA-1 IS (HaloTag
purification); SDN-1 IS; SDNAIA-1 IS, with single del at C-term; SDN-1 I S, with single del at C- term; SDNAIA-1 IS, with double del at C-term; SDN-1 IS, with double del at C-term; SDNAIA- US, with triple del at C-term; SDN-1 IS, with triple del at C-term; 6His-AIA-l IS; 6His-l IS;
6His-AIA-l IS with single del at C-term; 6His-l IS with single del at C-term; 6His-AIA-l IS with double del at C-term; 6His-l IS with double del at C-term; 6His-AIA-l IS with triple del at C- term; 6His-l IS with triple del at C-term; 1 lS-6His; 1 lS-6His, minus C-term 1 IS residue; 11S- 6His, minus last two C-term 1 IS residues; 1 lS-6His, minus last three C-term 1 IS residues; 11S- HT7, minus C-term 1 IS residue; 1 IS- HT7, minus last two C-term 1 IS residues; 1 IS- HT7, minus last three C-term 1 IS residues; 6His-HT7-AIA-l IS; 6His-HT7 -1 IS; 6His-AIA-HT7 -1 IS (with single, double, triple 1 IS C-term dels); 6His -HT7 -1 IS (with single, double, triple 1 IS C- term dels); 1 lS-HT7-6His; 1 lS-HT7-6His (with single, double, triple 1 IS C-term dels); and Ternary 1 IS.
Example 151
Protein interactions for binary complementation studies
The binary complementation system described herein has been used to analyze a wide variety of protein interactions (See Table 8). Table 8. Protein Interactions for Binary Cemp!iemeritatiQrt Studies
interact k»i Status
^^^^^^^^^^^^^^^^^^^^^^^^^^
V2R/AR B2 Tested
ir. rt :.fy-cii wer a. sr. ΙΙΙΙΙΙΙΙΙΙΙϊΙΙ ΙΙ^ίΙΙΙΙΙΙΙΙΙΙΙΙΙίΙΙΙ
BR0 /H3.3 Tes.e-d:
GR Homodi mer szatson Tested:
SASfSAf Test-fed
P53/MQM2 Tesied
Tested
BCL2/B§M/8AX Tested:
mc &L Tested
CULl/N EDO'S ¾n: Progress
GABAA tiHsmenzatlon in Progress
Example 152
Dissociation Constants and Bmax Values for NLpolys with 108 variants of NLpeps
(array#2)
NLpeps were synthesized in array format by New England Peptide (peptides blocked at N-terminus by acetylation and at C-terminus by amidation; peptides in arrays were synthesized at ~2 mg scale) (Table 9). Each peptide was lyophilized in 2 separate plates. Each well from 1 of the plates of peptides was dissolved in lOOuL nanopure water, and the A260 measured and used to calculate the concentration using the extinction coefficient of each peptide. The concentration was then adjusted based on the purity of the peptide, and nanopure water was added to give a final concentration of 800uM.
Table 9. Peptide array 2 sequences
Figure imgf000158_0001
array2.11 VTGYRLFQKAS array2.12 VTGYRLFQKES array2.13 VTGYRLFQQIS array2.14 VTGYRLFQQAS array2.15 VTGYRLFQQES array2.16 VTGYRLFQEIS array2.17 VTGYRLFQEAS array2.18 VTGYRLFQEES array2.19 VTGYRLFEKIS array2.20 VTGYRLFEKAS array2.21 VTGYRLFEKES array2.22 VTGYRLFEQIS array2.23 VTGYRLFEQAS array2.24 VTGYRLFEQES array2.25 VTGYRLFEEIS array2.26 VTGYRLFEEAS array2.27 VTGYRLFEEES array2.28 VTGYRLFKKI L array2.29 VTGYRLFKKAL array2.30 VTGYRLFKKEL array2.31 VTGYRLFKQIL array2.32 VTGYRLFKQAL array2.33 VTGYRLFKQEL array2.34 VTGYRLFKEIL array2.35 VTGYRLFKEAL array2.36 VTGYRLFKEEL array2.37 VTGYRLFQKIL array2.38 VTGYRLFQKAL array2.39 VTGYRLFQKEL array2.40 VTGYRLFQQI L array2.41 VTGYRLFQQAL array2.42 VTGYRLFQQEL array2.43 VTGYRLFQEI L array2.44 VTGYRLFQEAL array2.45 VTGYRLFQEEL array2.46 VTGYRLFEKIL array2.47 VTGYRLFEKAL array2.48 VTGYRLFEKEL array2.49 VTGYRLFEQI L array2.50 VTGYRLFEQAL array2.51 VTGYRLFEQEL array2.52 VTGYRLFEEIL array2.53 VTGYRLFEEAL array2.54 VTGYRLFEEEL array2.55 VEGYRLFKKIS array2.56 VEGYRLFKKAS array2.57 VEGYRLFKKES array2.58 VEGYRLFKQIS array2.59 VEGYRLFKQAS array2.60 VEGYRLFKQES array2.61 VEGYRLFKEIS array2.62 VEGYRLFKEAS array2.63 VEGYRLFKEES array2.64 VEGYRLFQKIS array2.65 VEGYRLFQKAS array2.66 VEGYRLFQKES array2.67 VEGYRLFQQIS array2.68 VEGYRLFQQAS array2.69 VEGYRLFQQES array2.70 VEGYRLFQEIS array2.71 VEGYRLFQEAS array2.72 VEGYRLFQEES array2.73 VEGYRLFEKIS array2.74 VEGYRLFEKAS array2.75 VEGYRLFEKES array2.76 VEGYRLFEQIS array2.77 VEGYRLFEQAS array2.78 VEGYRLFEQES array2.79 VEGYRLFEEIS array2.80 VEGYRLFEEAS array2.81 VEGYRLFEEES array2.82 VEGYRLFKKI L array2.83 VEGYRLFKKAL array2.84 VEGYRLFKKEL array2.85 VEGYRLFKQIL array2.86 VEGYRLFKQAL array2.87 VEGYRLFKQEL array2.88 VEGYRLFKEIL array2.89 VEGYRLFKEAL array2.90 VEGYRLFKEEL array2.91 VEGYRLFQKIL array2.92 VEGYRLFQKAL array2.93 VEGYRLFQKEL array2.94 VEGYRLFQQI L array2.95 VEGYRLFQQAL array2.96 VEGYRLFQQEL array2.97 VEGYRLFQEI L array2.98 VEGYRLFQEAL array2.99 VEGYRLFQEEL array2.100 VEGYRLFEKIL array2.101 VEGYRLFEKAL array2.102 VEGYRLFEKEL array2.103 VEGYRLFEQI L array2.104 VEGYRLFEQAL array2.105 VEGY LFEQEL
array2.106 VEGYRLFEEIL
array2.107 VEGYRLFEEAL
array2.108 VEGYRLFEEEL
Peptides were diluted to 400uM (4X) in PBS+0.1% Prionex and then diluted serially 7 times (8 concentrations total) in 0.5 log steps (3.162 fold dilution). NLpoly 1 IS was diluted 1 : 10Λ6 into PBS+0.1 % Prionex. 25uL each NLpep + 25uL NLpoly 11 S were mixed and incubated for 30min at RT. 50uL NanoGlo+lOOuM Fz was added and incubated for 30min at RT. Luminescence was measured on a GloMax Multi+ with 0.5sec integration. Kd/Bmax were determined using Graphpad Prism, One site-specific binding, best- fit values. Table 10 indicates the dissociation constant and Bmax values for NLpoly 1 IS and the indicated NLPep. The results indicate the affects of mutations on the binding to NLpoly 11 S and the ability of the complex to produce luminescence.
Table 10
Peptide Sequence Bmax Kd Bmax Kd
array2.1 VTGYRLFKKIS 134567 0.01334 4936 0.003695
array2.2 VTGYRLFKKAS 103904 0.2411 711.8 0.006084
array2.3 VTGYRLFKKES 55963 0.773 1705 0.06499
array2.4 VTGYRLFKQIS 104275 0.7462 4670 0.09318
array2.5 VTGYRLFKQAS 31031 1.953 436.4 0.05649
array2.6 VTGYRLFKQES 5006 1.348 182 0.1583
array2.7 VTGYRLFKEIS 32026 4.438 1173 0.5196
array2.8 VTGYRLFKEAS 3929 2.568 200.6 0.3566
array2.9 VTGYRLFKEES 1453 3.863 118.6 1.044
array2.10 VTGYRLFQKIS 112540 0.08118 4037 0.01352
array2.11 VTGYRLFQKAS 80943 0.7485 4035 0.1039
array2.12 VTGYRLFQKES 17237 0.4173 3190 0.3233
array2.13 VTGYRLFQQIS 19401 0.876 2357 0.47
array2.14 VTGYRLFQQAS 4351 1.111 311.1 0.3392
array2.15 VTGYRLFQQES 5197 7.486 198.7 0.797
array2.16 VTGYRLFQEIS 1321 2.561 112.6 0.5939
array2.17 VTGYRLFQEAS ND ND ND ND
array2.18 VTGYRLFQEES 5112 67.32 426.5 11.22
array2.19 VTGYRLFEKIS 122961 0.6047 11827 0.2689
array2.20 VTGYRLFEKAS 36284 1.794 935.8 0.09793
array2.21 VTGYRLFEKES 8622 1.491 599.7 0.3267
array2.22 VTGYRLFEQIS 121402 10.78 3711 1.121
array2.23 VTGYRLFEQAS 3824 4.174 243.4 0.8621
array2.24 VTGYRLFEQES 1829 7.832 24.45 0.2891
array2.25 VTGYRLFEEIS ND ND ND ND
array2.26 VTGYRLFEEAS ND ND ND ND
array2.27 VTGYRLFEEES ND ND ND ND
array2.28 VTGYRLFKKIL 140640 0.07664 6033 0.02
array2.29 VTGYRLFKKAL 98575 0.2755 1679 0.0168
array2.30 VTGYRLFKKEL 51143 0.6714 2000 0.07542
array2.31 VTGYRLFKQIL 115248 2.989 2995 0.3361
array2.32 VTGYRLFKQAL 34875 3.561 496 0.1247
array2.33 VTGYRLFKQEL 8548 1.953 581.1 0.5209
array2.34 VTGYRLFKEIL 21933 4.405 867.2 0.7072 array2.35 VTGYRLFKEAL 5547 5.153 180.1 0.6609 array2.36 VTGYRLFKEEL 1720 7.785 75.68 1.256 array2.37 VTGYRLFQKIL 127404 0.3625 7870 0.1108 array2.38 VTGYRLFQKAL 72788 0.9748 3853 0.1796 array2.39 VTGYRLFQKEL 33109 2.477 687.6 0.1414 array2.40 VTGYRLFQQIL 66256 122.3 13366 40.42 array2.41 VTGYRLFQQAL 3472 3.97 314 1.484 array2.42 VTGYRLFQQEL 14230 18.99 180.8 0.714 array2.43 VTGYRLFQEIL 9406 17.25 544.2 2.141 array2.44 VTGYRLFQEAL 4233 15.99 426.5 4.994 array2.45 VTGYRLFQEEL 14254 35.43 614.2 3.766 array2.46 VTGYRLFEKIL 219381 1.917 7349 0.2965 array2.47 VTGYRLFEKAL 34526 1.807 1377 0.216 array2.48 VTGYRLFEKEL 10865 2.437 823.9 0.5103 array2.49 VTGYRLFEQIL 99205 124.3 2780 5.68 array2.50 VTGYRLFEQAL 17117 40.4 294 1.642 array2.51 VTGYRLFEQEL 46162 85 1436 4.881 array2.52 VTGYRLFEEIL 15703 104.1 560 6.409 array2.53 VTGYRLFEEAL ND ND ND ND array2.54 VTGYRLFEEEL 251166 68.27 15593 5.901 array2.55 VEGYRLFKKIS 42384 0.07805 3011 0.02593 array2.56 VEGYRLFKKAS 15920 0.6409 510.2 0.05975 array2.57 VEGYRLFKKES 3374 0.891 142.5 0.1335 array2.58 VEGYRLFKQIS 21512 2.091 665.9 0.244 array2.59 VEGYRLFKQAS 2300 2.088 74.01 0.1938 array2.60 VEGYRLFKQES 4346 10.64 91.51 0.7646 array2.61 VEGYRLFKEIS 5459 14.43 116.8 0.7024 array2.62 VEGYRLFKEAS 2375 22.05 112.3 2.964 array2.63 VEGYRLFKEES 17264 220.3 3074 54.34 array2.64 VEGYRLFQKIS 36517 0.5863 781.4 0.05853 array2.65 VEGYRLFQKAS 10620 1.929 271.7 0.1454 array2.66 VEGYRLFQKES 3489 2.87 132.3 0.3846 array2.67 VEGYRLFQQIS 5223 8.143 199.6 0.8457 array2.68 VEGYRLFQQAS 3753 20.01 117.8 1.833 array2.69 VEGYRLFQQES ND ND ND ND array2.70 VEGYRLFQEIS 29161 230.2 560.4 6.062 array2.71 VEGYRLFQEAS 44893 24.03 1778 1.825 array2.72 VEGYRLFQEES ND ND ND ND array2.73 VEGYRLFEKIS 22544 2.148 641.3 0.2291 array2.74 VEGYRLFEKAS 3808 4.138 122.2 0.3119 array2.75 VEGYRLFEKES 1170 2.969 136.7 1.282 array2.76 VEGYRLFEQIS 17957 52.79 724 4.614 array2.77 VEGYRLFEQAS 26862 48.29 436.5 1.752 array2.78 VEGYRLFEQES 39375 252.3 4842 41.61 array2.79 VEGYRLFEEIS ND ND ND ND array2.80 VEGYRLFEEAS 383183 1419 572696 2258 array2.81 VEGYRLFEEES ND ND ND ND array2.82 VEGYRLFKKIL 43371 0.563 2640 0.16 array2.83 VEGYRLFKKAL 20849 1.588 591.2 0.1396 array2.84 VEGYRLFKKEL 7828 1.413 ND ND array2.85 VEGYRLFKQIL 31425 10.34 358.7 0.2986 array2.86 VEGYRLFKQAL 2304 2.274 54.26 0.2428 array2.87 VEGYRLFKQEL 1790 12.59 113 2.614 array2.88 VEGYRLFKEIL 9831 17.75 551.8 3.002 array2.89 VEGYRLFKEAL 5574 42.42 435.1 7.715 array2.90 VEGYRLFKEEL 12241 100.9 458.5 6.589 array2.91 VEGYRLFQKIL 50503 2.077 2173 0.3373 array2.92 VEGYRLFQKAL 12294 2.023 430.5 0.206 array2.93 VEGYRLFQKEL 4090 1.691 278.5 0.4617
array2.94 VEGYRLFQQIL 2281 9.39 112 1.201
array2.95 VEGYRLFQQAL 38229 18.81 1578 1.617
array2.96 VEGYRLFQQEL 104621 99.4 6265 10.43
array2.97 VEGYRLFQEIL ND ND ND ND
array2.98 VEGYRLFQEAL 2696 99.9 238.8 15.53
array2.99 VEGYRLFQEEL ND ND ND ND
array2.100 VEGYRLFEKIL 34989 10.56 1747 1.801
array2.101 VEGYRLFEKAL 6372 12.62 186 0.8756
array2.102 VEGYRLFEKEL 961.5 5.786 67.06 1.216
array2.103 VEGYRLFEQIL ND ND ND ND
array2.104 VEGYRLFEQAL 9882 335.8 544.7 23.35
array2.105 VEGYRLFEQEL ND ND ND ND
array2.106 VEGYRLFEEIL ND ND ND ND
array2.107 VEGYRLFEEAL ND ND ND ND
array2.108 VEGYRLFEEEL ND ND ND ND
Example 153
Dark peptides and quencher peptides for reducing background signal from NLpolyllS
A purified sample of NLpolyl IS was diluted into NanoGlo reagent to give a final concentration of 2 uM. Pep86 is a high affinity luminogenic peptide and was used to induce maximum signal for NLpolyl IS. Pep86 was prepared at 1 nM in PBS (pH 7.2) for a working solution. Dark peptide and quencher peptides (Figure 180) were dissolved to 1 mM (or lower) in either PBS pH 7.2 or 150 mM NH4HC03 and added in equal volume to the
NanoGlo/NLpolyl IS and then samples were read on a Tecan Infinite F500 reader using a 5 min time point.
Figure 202A shows that both GWALFK and Dabcyl-GWALFK reduce the background luminescence generated by NLpolyl 1 S in the absence of any other luminogenic peptide. Figure 202B shows that Pep86 is able to induce luminescence even in the presence of GWALFKK and Dabcyl-GWALFKK.
Figure 203 A shows that VTGWALFEEIL (Trp 1 lmer) and VTGYALFEEIL (Tyr 1 lmer) induce luminescence over background (NLpolyl IS alone; no peptide control), but that the N- terminal Dabcyl versions of each provide significant quenching of this signal. Figure 203B shows that Pep86 is able to induce luminescence even in the presence of the Dabcyl versions of Trp 1 lmer and Tyr 1 lmer.
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the present invention.

Claims

1. A peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2, wherein a detectable bio luminescent signal is produced in the presence of a substrate when the peptide contacts a polypeptide consisting of SEQ ID NO: 440.
2. The peptide of claim 1, wherein the detectable bioluminescent signal is produced in the presence of a substrate when the peptide associates with the polypeptide consisting of SEQ
ID NO: 440.
3. The peptide of claim 1, wherein the peptide exhibits enhancement of one or more traits compared to a peptide of SEQ ID NO: 2, wherein the traits are selected from: affinity for the polypeptide consisting of SEQ ID NO: 440, expression, intracellular solubility, intracellular stability, and bioluminescent activity when combined with the polypeptide consisting of SEQ ID NO: 440.
4. The peptide of claim 1, wherein the amino acid sequence is selected from the peptides of Table 1.
5. The peptide of claim 1, wherein the amino acid sequence is synthetic, contains non-natural amino acids or is a peptide mimic.
6. A nucleic acid comprising a sequence coding for a peptide of claim 1.
7. A fusion polypeptide comprising the peptide of claim 1 and a first interaction polypeptide that is configured to form a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
8. A nucleic acid comprising a sequence coding for a fusion polypeptide of claim 7.
9. A bioluminescent complex comprising:
(a) the fusion polypeptide of claim 7; and
(b) a second fusion polypeptide comprising:
(i) the second interaction polypeptide, and (ii) a complement polypeptide that emits a detectable biolummescent signal in the presence of a substrate when associated with the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2;
wherein the first fusion polypeptide and second fusion polypeptide are associated;
and wherein the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440 and the complement polypeptide are associated.
10. A polypeptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440, wherein a detectable biolummescent signal is produced in the presence of a substrate when the polypeptide contacts a peptide consisting of SEQ ID NO: 2.
11. The polypeptide of claim 9, wherein the polypeptide exhibits enhancement of one or more traits compared to a polypeptide of SEQ ID NO: 440, wherein the traits are selected from: affinity for the peptide consisting of SEQ ID NO: 2, expression, intracellular solubility, intracellular stability, and biolummescent activity when combined with the peptide consisting of SEQ ID NO: 2.
12. The polypeptide of claim 10, wherein the amino acid sequence is selected from one of the polypeptide sequences of Table 2.
13. The polypeptide of claim 10, wherein the detectable biolummescent signal is produced in the presence of a substrate when the polypeptide associates with the peptide consisting of SEQ ID NO: 2.
14. The polypeptide of claim 10, wherein the amino acid sequence is synthetic, contains non-natural amino acids or is a peptide mimic.
15. A nucleic acid comprising a sequence coding for a polypeptide of claim 10.
16. A fusion polypeptide comprising the polypeptide of claim 10 and a first interaction polypeptide that is configured to form a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
17. A bio luminescent complex comprising :
(a) the fusion polypeptide of claim 16; and
(b) a second fusion polypeptide comprising:
i) the second interaction polypeptide, and
ii) a complement peptide that causes the polypeptide comprising an amino acid sequence having less than 100% and greater than 40%> sequence identity with SEQ ID NO: 2 to emit a detectable bioluminescent signal in the presence of a substrate when an association is formed between the two;
wherein the first fusion polypeptide and second fusion polypeptide are associated; and wherein the polypeptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440 and the complement peptide are associated.
18. A bioluminescent complex comprising :
(a) a peptide comprising a peptide amino acid sequence having less than 100% and greater than 40%> sequence identity with SEQ ID NO: 2; and
(b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence.
19. The bioluminescent complex of claim 18, wherein the peptide amino acid sequence and the polypeptide amino acid sequence are associated.
20. The bioluminescent complex of claim 18, wherein the peptide amino acid sequence is selected from the peptide sequences of Table 1.
21. The bioluminescent complex of claim 18, wherein the polypeptide amino acid sequence is selected from the polypeptide sequences of Table 2.
22. The bioluminescent complex of claim 19, wherein the peptide amino acid sequence is attached to a first interaction element that is associated with a second interaction element.
23. The bio luminescent complex of claim 22, wherein the polypeptide amino acid sequence is attached to the second interaction element.
24. The bio luminescent complex of claim 23, wherein the polypeptide amino acid sequence and peptide amino acid sequence are incapable of associating in the absence of the association of the first and second interaction elements.
25. A bio luminescent complex comprising:
(a) a first amino acid sequence that is not a fragment of a preexisting protein; and
(b) a second amino acid sequence that is not a fragment of a preexisting protein, wherein the bioluminescent complex exhibits detectable luminescence, wherein the first amino acid sequence and the second amino acid sequence are associated, and wherein the
bioluminescent complex emits a detectable bioluminescent signal in the presence of a substrate when the first amino acid sequence and the second amino acid sequence are associated.
26. The bioluminescent complex of claim 25, further comprising:
(c) a third amino acid sequence comprising a first member of an interaction pair, wherein the third amino acid sequence is covalently attached to the first amino acid sequence; and
(d) a fourth amino acid sequence comprising a second member of an interaction pair, wherein the fourth amino acid sequence is covalently attached to the second amino acid sequence.
27. The bioluminescent complex of claim 26, wherein the non-covalent interactions between the first amino acid sequence and the second amino acid sequence are not sufficient to associate the first amino acid sequence and the second amino acid sequence in the absence of the non-covalent interactions between the first member and the second member of the interaction pair.
28. The bioluminescent complex of claim 26, wherein a first polypeptide chain comprises the first amino acid sequence and the third amino acid sequence, and wherein a second polypeptide chain comprises the second amino acid sequence and the fourth amino acid sequence.
29. The bioluminescent complex of claim 28, wherein the first polypeptide chain and the second polypeptide chain are expressed within a cell.
30. A bioluminescent complex comprising:
(a) a non-luminescent pair, wherein each non-luminescent element of the non- luminescent pair is not a fragment of a preexisting protein;
(b) an interaction pair, wherein each interaction element of the interaction pair is covalently attached to one of the non-luminescent elements of the non-luminescent pair.
31. A method of detecting a stable interaction between a first amino acid sequence and a second amino acid sequence comprising:
(a) attaching the first amino acid sequence to a third amino acid sequence, and attaching the second amino acid sequence to a fourth amino acid sequence, wherein the third and fourth amino acid sequences are not fragments of a preexisting protein, wherein a stable complex of the third and fourth amino acid sequences emits a detectable bioluminescent signal in the presence of a substrate, wherein the non-covalent interactions between the third and fourth amino acid sequences are insufficient to form a complex of the third and fourth amino acid sequences in the absence of additional stabilizing and/or aggregating forces, and wherein a stable interaction between the first amino acid sequence and the second amino acid sequence provides the additional stabilizing and/or aggregating forces to produce a stable complex of the third and fourth amino acid sequences;
(b) placing the first, second, third, and fourth amino acid sequences of step (a) in conditions to allow for stable interactions between the first amino acid sequence and the second amino acid sequence to occur; and
(c) detecting the bioluminescent signal emitted, in the presence of a substrate, by the stable complex of the third and fourth amino acid sequences in the presence of a substrate, wherein detection of the bioluminescent signal indicates a stable interaction between the first amino acid sequence and the second amino acid sequence.
32. The method of claim 31 , wherein attaching the first amino acid sequence to the third amino acid sequence and the second amino acid sequence to the fourth amino acid sequence comprises forming a first fusion protein comprising the first amino acid sequence and the third amino acid sequence and forming a second fusion protein comprising the second amino acid sequence and the fourth amino acid sequence.
33. The method of claim 32, wherein the first fusion protein and the second fusion protein further comprise linkers between said first and third amino acid sequences and said second and fourth amino acid sequences, respectively.
34. The method of claim 32, wherein the first fusion protein is expressed from a first nucleic acid sequence coding for the first and third amino acid sequences, and the second fusion protein is expressed from a second nucleic acid sequence coding for the second and fourth amino acid sequences.
35. The method of claim 34, wherein a single vector comprises the first nucleic acid sequence and the second nucleic acid sequence.
36. The method of claim 34, wherein the first nucleic acid sequence and the second nucleic acid sequence are on separate vectors.
37. The method of claim 34, wherein steps (a) and (b) comprise expressing the first and second fusion proteins within a cell.
38. A method of optimizing a non- luminescent pair comprising:
(a) aligning the sequences of three or more related proteins;
(b) determining a consensus sequence for the related proteins;
(c) providing first and second fragments of a protein related to three or more proteins, wherein the fragments are individually substantially non-luminescent but exhibit luminescence upon stable interaction of the fragments;
(d) mutating the first and second fragments at one or more positions each, wherein said mutations alter the sequences of the fragments to be more similar to a corresponding portion of the consensus sequence, wherein the mutating results in a non-luminescent pair that are not fragments of a preexisting protein,
(e) testing the non-luminescent pair for the absence of luminescence when
unassociated and luminescence upon stable association of the non-luminescent pair.
39. The method of claim 38, wherein the non- luminescent pair exhibits enhancement of one or more traits compared to the first and second fragments, wherein the traits are selected from: increased reconstitution affinity, decreased reconstitution affinity, enhanced expression, increased intracellular solubility, increased intracellular stability, and increased intensity of reconstituted luminescence.
40. A detection reagent comprising: (a) a polypeptide comprising an amino acid sequence having less than 100% and greater than 40%> sequence identity with SEQ ID NO: 440, wherein a detectable biolummescent signal is produced, in the presence of a substrate, when the polypeptide contacts a peptide consisting of SEQ ID NO: 2, and (b) a substrate for a
biolummescent complex produced by said polypeptide and a peptide consisting of SEQ ID NO: 2.
41. A detection reagent comprising: (a) a peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2, wherein a detectable biolummescent signal is produced, in the presence of a substrate, when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a biolummescent complex produced by said peptide and a polypeptide consisting of SEQ ID NO: 440.
PCT/US2014/026354 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation Ceased WO2014151736A1 (en)

Priority Applications (22)

Application Number Priority Date Filing Date Title
EP14769752.8A EP2970412B1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
DK14769752.8T DK2970412T5 (en) 2013-03-15 2014-03-13 ACTIVATION OF BIOLUMINESCENCE VIA STRUCTURAL COMPLEMENTATION
EP22182344.6A EP4177261A1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
KR1020157024687A KR20150129721A (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
CN202310649630.0A CN117024548A (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
KR1020237017712A KR20230079494A (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
PL14769752.8T PL2970412T3 (en) 2013-03-15 2014-03-13 ACTIVATION OF BIOLUMINSCENCE BY STRUCTURAL COMPLEMENT
AU2014236949A AU2014236949C1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
SG11201507306VA SG11201507306VA (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
KR1020217008951A KR102675860B1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
ES14769752T ES2926463T3 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
IL286816A IL286816B (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
CA2906063A CA2906063C (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
BR112015023394A BR112015023394B8 (en) 2013-03-15 2014-03-13 Bioluminescent system and complex
EP20197758.4A EP3783011B1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
EP22196592.4A EP4169935A1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
CN201480015213.XA CN105143249A (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation
JP2016502113A JP6654557B2 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementarity
IL240985A IL240985B (en) 2013-03-15 2015-09-01 Activation of bioluminescence by structural complementation
AU2018256548A AU2018256548B2 (en) 2013-03-15 2018-10-31 Activation of bioluminescence by structural complementation
IL273989A IL273989B (en) 2013-03-15 2020-04-16 Activation of bioluminescence by structural complementation
AU2020213288A AU2020213288B2 (en) 2013-03-15 2020-08-04 Activation of bioluminescence by structural complementation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361791549P 2013-03-15 2013-03-15
US61/791,549 2013-03-15

Publications (1)

Publication Number Publication Date
WO2014151736A1 true WO2014151736A1 (en) 2014-09-25

Family

ID=51581027

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/026354 Ceased WO2014151736A1 (en) 2013-03-15 2014-03-13 Activation of bioluminescence by structural complementation

Country Status (15)

Country Link
US (11) US9797889B2 (en)
EP (4) EP4169935A1 (en)
JP (4) JP6654557B2 (en)
KR (3) KR102675860B1 (en)
CN (2) CN117024548A (en)
AU (3) AU2014236949C1 (en)
BR (1) BR112015023394B8 (en)
CA (3) CA3249512A1 (en)
DK (2) DK2970412T5 (en)
ES (2) ES2926463T3 (en)
IL (3) IL286816B (en)
PL (2) PL3783011T3 (en)
PT (2) PT2970412T (en)
SG (2) SG11201507306VA (en)
WO (1) WO2014151736A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9797890B2 (en) 2013-03-15 2017-10-24 Promega Corporation Activation of bioluminescence by structural complementation
EP3254113A4 (en) * 2015-02-05 2018-06-27 Promega Corporation Luciferase-based thermal shift assays
WO2020072775A2 (en) 2018-10-03 2020-04-09 Promega Corporation Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof
US10634680B2 (en) 2016-04-26 2020-04-28 University Of Utah Research Foundation Target-binding activated split reporter systems for analyte detection and related components and methods
WO2020113036A2 (en) 2018-11-28 2020-06-04 Promega Corporation Reactive peptide labeling
CN112567028A (en) * 2018-06-12 2021-03-26 普洛麦格公司 Multi-part luciferases
US20210215682A1 (en) * 2018-02-26 2021-07-15 Technische Universiteit Eindhoven Bioluminescent biosensor for detecting and quantifying biomolecules
WO2021194343A1 (en) 2020-03-25 2021-09-30 Erasmus University Medical Center Rotterdam Reporter system for radionuclide imaging
EP3953374A4 (en) * 2019-04-10 2023-06-07 Promega Corporation COMPOSITIONS AND METHODS FOR DETECTING ANALYTES USING BIOLUMINESCENCE
EP4219736A1 (en) * 2014-09-12 2023-08-02 Promega Corporation Internal protein tags
US11788069B2 (en) 2016-10-20 2023-10-17 President And Fellows Of Harvard College In vitro and cell based assays for measuring the activity of botulinum neurotoxins
US11913944B2 (en) 2019-03-20 2024-02-27 Promega Corporation Photoaffinity probes
US12061202B2 (en) 2019-12-10 2024-08-13 Promega Corporation Compositions and methods for bioluminescent detection using multifunctional probes
US12606863B2 (en) 2021-05-13 2026-04-21 Promega Corporation Bioluminescent detection of DNA synthesis

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11365402B2 (en) 2014-09-12 2022-06-21 Promega Corporation Internal protein tags
EP3395803A1 (en) 2017-04-28 2018-10-31 Institut Pasteur Imidazopyrazine derivatives, process for preparation thereof, and their uses as luciferins
US11579149B2 (en) * 2017-11-01 2023-02-14 Queen's University At Kingston Hippo pathway bioluminescent biosensor
EP4140991B1 (en) 2018-06-01 2024-05-15 Promega Corporation Inhibitors of oplophorus luciferase-derived bioluminescent complexes
US10962538B2 (en) 2018-06-14 2021-03-30 The Trustees Of Columbia University In The City Of New York Assays using arrestin recruitment and unmodified receptors
US20200200765A1 (en) 2018-12-04 2020-06-25 Promega Corporation Broad spectrum gpcr binding agents
US11360096B2 (en) 2019-05-16 2022-06-14 Duke University Complex BRET technique for measuring biological interactions
CN114450326B (en) 2019-06-24 2025-02-11 普罗美加公司 Modified polyamine polymers for delivery of biomolecules into cells
DE102019127894B4 (en) * 2019-10-16 2022-05-12 Sensor-Instruments Entwicklungs- Und Vertriebs-Gmbh PRODUCT IDENTIFICATION SYSTEM AND PROCEDURES FOR IDENTIFICATION OF A PRODUCT
US20230031446A1 (en) * 2019-11-22 2023-02-02 The Regents Of The University Of California Split-enzyme system to detect specific dna in living cells
KR20220121816A (en) 2019-11-27 2022-09-01 프로메가 코포레이션 Multiparticulate luciferase peptides and polypeptides
US20230257726A1 (en) * 2020-05-11 2023-08-17 Chan Zuckerberg Biohub, Inc. Ace2 compositions and methods
JP7677997B2 (en) 2020-05-22 2025-05-15 プロメガ コーポレイション Enhanced kinase target engagement
CN116391129A (en) 2020-08-28 2023-07-04 普罗美加公司 Target Engagement Assays for RAS Proteins
US20240252689A1 (en) * 2021-05-18 2024-08-01 The Board Of Regents Of The University Of Texas System Poly-adp ribose (par) tracker optimized split-protein reassembly par detection reagents
EP4519426A2 (en) 2022-05-04 2025-03-12 Promega Corporation Split modified dehalogenase variants
US20240060059A1 (en) 2022-05-04 2024-02-22 Promega Corporation Circularly permuted dehalogenase variants
JP2025515181A (en) 2022-05-04 2025-05-13 プロメガ コーポレイション Modified dehalogenases having extended surface loop regions
WO2023215497A1 (en) 2022-05-04 2023-11-09 Promega Corporation Photoactivatable compounds and uses thereof
WO2024151471A1 (en) * 2023-01-09 2024-07-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services High-throughput assay based on ligand-biased structural dynamics response
EP4700040A1 (en) * 2023-04-21 2026-02-25 Shenzhen Loggene Life Science & Technology Co., Ltd. Peptide and luminescent complex containing same
AU2024265176A1 (en) * 2023-05-04 2025-12-11 Promega Corporation Complementation-based tags and reporters for dual-modality labeling
WO2025064581A1 (en) * 2023-09-18 2025-03-27 The Brigham And Women’S Hospital, Inc. Biosensor platform for the rapid detection of analytes
WO2025158412A1 (en) 2024-01-26 2025-07-31 Biohaven Therapeutics Ltd. BIFUNCTIONAL DEGRADERS OF IgG4 IMMUNOGLOBULINS
WO2026008850A1 (en) 2024-07-04 2026-01-08 Insempra Gmbh Linear nucleic acid templates for high-efficient cell-free protein expression
WO2026008852A2 (en) 2024-07-04 2026-01-08 Insempra Gmbh Optimized media for highly efficient cell-free protein expression systems

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1156103A2 (en) 2000-04-26 2001-11-21 Chisso Corporation Oplophorus luciferase
US20090170069A1 (en) * 2007-11-01 2009-07-02 The Arizona Board Of Regents On Behalf Of The University Of Arizona Cell free methods for detecting protein-ligand binding
US20120117667A1 (en) * 2010-11-02 2012-05-10 Klaubert Dieter H Novel coelenterazine substrates and methods of use
WO2014093677A1 (en) 2012-12-12 2014-06-19 Promega Corporation Recognition of cellular target binding by a bioactive agent using intracellular bioluminescence resonance energy transfer

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4444879A (en) * 1981-01-29 1984-04-24 Science Research Center, Inc. Immunoassay with article having support film and immunological counterpart of analyte
US5914095A (en) 1989-04-07 1999-06-22 Salutar, Inc. Polychelants containg amide bonds
WO1994009056A1 (en) 1992-10-14 1994-04-28 Sterling Winthrop Inc. Chelating polymers
US5756688A (en) 1992-10-14 1998-05-26 Sterling Winthrop Inc. MR imaging compositions and methods
GB9503969D0 (en) 1995-02-28 1995-04-19 Sams Bernard Incrementing mechanism
CA2196496A1 (en) 1997-01-31 1998-07-31 Stephen William Watson Michnick Protein fragment complementation assay for the detection of protein-protein interactions
US5879739A (en) 1997-02-20 1999-03-09 Tower Semiconductor Ltd. Batch process for forming metal plugs in a dielectric layer of a semiconductor wafer
JP4613441B2 (en) * 2000-04-26 2011-01-19 チッソ株式会社 Novel luciferase and photoprotein
US20040181830A1 (en) 2001-05-07 2004-09-16 Kovalic David K. Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement
US7008642B1 (en) 2001-02-12 2006-03-07 Advanced Cardiovascular Systems, Inc. Compositions for achieving a therapeutic effect in an anatomical structure and methods of using the same
US7195884B2 (en) 2002-07-19 2007-03-27 Promega Corp. Methods and kits for transferases
US20040115814A1 (en) * 2002-09-30 2004-06-17 Protein Design Labs, Inc. Efficient generation of stable expression cell lines through the use of scorable homeostatic reporter genes
US7237811B1 (en) * 2005-04-20 2007-07-03 Lawrence Barry G Casement window latch assembly
EP1931787A4 (en) 2005-09-30 2010-10-20 Univ Montana State SYSTEM FOR DETECTING PROTEIN-PROTEIN INTERACTIONS
US7601517B2 (en) 2006-01-10 2009-10-13 Stanford University Split protein self complementing fragments, systems, and methods of use thereof
US20130332133A1 (en) 2006-05-11 2013-12-12 Ramot At Tel Aviv University Ltd. Classification of Protein Sequences and Uses of Classified Proteins
US20090075313A1 (en) 2007-05-04 2009-03-19 Stanford University Split protein fragments, split protein systems, methods of making split protein systems, and methods of using split protein systems
JP5554713B2 (en) * 2007-11-15 2014-07-23 エンドサイト,インク. Method of administering a conjugate
GB2479847B (en) 2009-02-09 2014-02-19 Jnc Corp Coelenterazine analogs and manufacturing method thereof
WO2010119721A1 (en) 2009-04-17 2010-10-21 独立行政法人産業技術総合研究所 Stable artificial bioluminescent enzyme having super-high brightness
LT3409764T (en) 2009-05-01 2020-06-10 Promega Corporation SYNTHETIC OPLOPHORUS LUCIFERASE WITH ENHANCED LIGHT YIELD
EP4012714A1 (en) 2010-03-23 2022-06-15 Iogenetics, LLC. Bioinformatic processes for determination of peptide binding
US20150125438A1 (en) * 2012-07-20 2015-05-07 Sang Jae Kim Anti-Inflammatory Peptides and Composition Comprising the Same
SG11201507306VA (en) 2013-03-15 2015-10-29 Promega Corp Activation of bioluminescence by structural complementation
EP4219736A1 (en) * 2014-09-12 2023-08-02 Promega Corporation Internal protein tags

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1156103A2 (en) 2000-04-26 2001-11-21 Chisso Corporation Oplophorus luciferase
US20090170069A1 (en) * 2007-11-01 2009-07-02 The Arizona Board Of Regents On Behalf Of The University Of Arizona Cell free methods for detecting protein-ligand binding
US20120117667A1 (en) * 2010-11-02 2012-05-10 Klaubert Dieter H Novel coelenterazine substrates and methods of use
US20120174242A1 (en) 2010-11-02 2012-07-05 Brock Binkowski Oplophorus-derived luciferases, novel coelenterazine substrates, and methods of use
WO2014093677A1 (en) 2012-12-12 2014-06-19 Promega Corporation Recognition of cellular target binding by a bioactive agent using intracellular bioluminescence resonance energy transfer

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HALL ET AL., ACS CHEM. BIOL., vol. 7, 2012
HALL ET AL.: "Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate", ACS CHEM. BIOL., vol. 7, 15 August 2012 (2012-08-15), pages 1848 - 1857, XP055256124 *
INOUYE ET AL., FEBS LETTERS, vol. 481, no. 1, 2000
KERPPOLA ET AL.: "Complementary Methods for Studies of Protein Interactions in Living Cells", NAT METHODS., vol. 3, no. 12, December 2006 (2006-12-01), pages 969 - 971., XP009102126 *
MIE ET AL., THE ANALYST, vol. 137, no. 5, 7 March 2012 (2012-03-07), pages 1085 - 9

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12367513B2 (en) 2013-03-15 2025-07-22 Promega Corporation Activation of bioluminescence by structural complementation
US9797890B2 (en) 2013-03-15 2017-10-24 Promega Corporation Activation of bioluminescence by structural complementation
US9869670B2 (en) 2013-03-15 2018-01-16 Promega Corporation Activation of bioluminescence by structural complementation
US12366572B2 (en) 2013-03-15 2025-07-22 Promega Corporation Activation of bioluminescence by structural complementation
US10107800B2 (en) 2013-03-15 2018-10-23 Promega Corporation Activation of bioluminescence by structural complementation
US10184936B2 (en) 2013-03-15 2019-01-22 Promega Corporation Activation of bioluminescence by structural complementation
US10288605B2 (en) 2013-03-15 2019-05-14 Promega Corporation Activation of bioluminescence by structural complementation
US11493504B2 (en) 2013-03-15 2022-11-08 Promega Corporation Activation of bioluminescene by structural complementation
US9797889B2 (en) 2013-03-15 2017-10-24 Promega Corporation Activation of bioluminescence by structural complementation
US10648971B2 (en) 2013-03-15 2020-05-12 Promega Corporation Activation of bioluminescence by structural complementation
EP4219736A1 (en) * 2014-09-12 2023-08-02 Promega Corporation Internal protein tags
US10571471B2 (en) 2015-02-05 2020-02-25 Promega Corporation Luciferase-based thermal shift assays
EP3254113A4 (en) * 2015-02-05 2018-06-27 Promega Corporation Luciferase-based thermal shift assays
EP4455668A3 (en) * 2015-02-05 2025-02-19 Promega Corporation Luciferase-based thermal shift assays
US10928400B2 (en) 2015-02-05 2021-02-23 Promega Corporation Luciferase-based thermal shift assays
US11899021B2 (en) 2015-02-05 2024-02-13 Promega Corporation Luciferase-based thermal shift assays
US11567083B2 (en) 2015-02-05 2023-01-31 Promega Corporation Luciferase-based thermal shift assays
US10634680B2 (en) 2016-04-26 2020-04-28 University Of Utah Research Foundation Target-binding activated split reporter systems for analyte detection and related components and methods
US12253523B2 (en) 2016-04-26 2025-03-18 University Of Utah Research Foundation Target-binding activated split reporter systems for analyte detection and related components and methods
US11774453B2 (en) 2016-04-26 2023-10-03 University Of Utah Research Foundation Target-binding activated split reporter systems for analyte detection and related components and methods
US11788069B2 (en) 2016-10-20 2023-10-17 President And Fellows Of Harvard College In vitro and cell based assays for measuring the activity of botulinum neurotoxins
US20210215682A1 (en) * 2018-02-26 2021-07-15 Technische Universiteit Eindhoven Bioluminescent biosensor for detecting and quantifying biomolecules
CN112567028A (en) * 2018-06-12 2021-03-26 普洛麦格公司 Multi-part luciferases
EP3807419A4 (en) * 2018-06-12 2022-09-07 Promega Corporation MULTIPARTY LUCIFERASE
WO2020072775A2 (en) 2018-10-03 2020-04-09 Promega Corporation Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof
US11534504B2 (en) 2018-10-03 2022-12-27 Promega Corporation Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof
EP4015644A1 (en) 2018-10-03 2022-06-22 Promega Corporation Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof
WO2020113036A3 (en) * 2018-11-28 2020-07-16 Promega Corporation Reactive peptide labeling
WO2020113036A2 (en) 2018-11-28 2020-06-04 Promega Corporation Reactive peptide labeling
US11175228B2 (en) 2018-11-28 2021-11-16 Promega Corporation Reactive peptide labeling
US11913944B2 (en) 2019-03-20 2024-02-27 Promega Corporation Photoaffinity probes
EP3953374A4 (en) * 2019-04-10 2023-06-07 Promega Corporation COMPOSITIONS AND METHODS FOR DETECTING ANALYTES USING BIOLUMINESCENCE
AU2020272037B2 (en) * 2019-04-10 2025-11-27 Promega Corporation Compositions and methods for analyte detection using bioluminescence
US12061202B2 (en) 2019-12-10 2024-08-13 Promega Corporation Compositions and methods for bioluminescent detection using multifunctional probes
WO2021194343A1 (en) 2020-03-25 2021-09-30 Erasmus University Medical Center Rotterdam Reporter system for radionuclide imaging
US12606863B2 (en) 2021-05-13 2026-04-21 Promega Corporation Bioluminescent detection of DNA synthesis

Also Published As

Publication number Publication date
US10288605B2 (en) 2019-05-14
US9797890B2 (en) 2017-10-24
ES2926463T3 (en) 2022-10-26
US20140348747A1 (en) 2014-11-27
SG11201507306VA (en) 2015-10-29
PL2970412T3 (en) 2022-11-14
PT2970412T (en) 2022-09-13
US20230342826A1 (en) 2023-10-26
CN105143249A (en) 2015-12-09
US9797889B2 (en) 2017-10-24
JP2020097597A (en) 2020-06-25
US20180306782A1 (en) 2018-10-25
US20160282340A1 (en) 2016-09-29
DK2970412T3 (en) 2022-08-29
BR112015023394B1 (en) 2023-08-29
CA2906063A1 (en) 2014-09-25
JP2024167207A (en) 2024-12-03
JP2023055734A (en) 2023-04-18
AU2014236949B2 (en) 2018-08-02
KR20210036422A (en) 2021-04-02
AU2018256548A1 (en) 2018-11-22
EP4169935A1 (en) 2023-04-26
BR112015023394A2 (en) 2017-11-28
KR102675860B1 (en) 2024-06-20
EP4177261A1 (en) 2023-05-10
IL273989B (en) 2021-10-31
CA3249512A1 (en) 2026-03-02
IL273989A (en) 2020-05-31
US20180313825A1 (en) 2018-11-01
EP3783011A1 (en) 2021-02-24
EP2970412B1 (en) 2022-08-10
US20200292534A1 (en) 2020-09-17
JP6654557B2 (en) 2020-02-26
EP3783011B1 (en) 2022-09-21
PL3783011T3 (en) 2022-11-21
DK2970412T5 (en) 2024-10-14
IL286816A (en) 2021-10-31
US20140363375A1 (en) 2014-12-11
DK3783011T5 (en) 2024-08-19
US9869670B2 (en) 2018-01-16
AU2014236949A1 (en) 2015-09-24
IL240985B (en) 2020-05-31
US12366572B2 (en) 2025-07-22
US20250022022A1 (en) 2025-01-16
US10184936B2 (en) 2019-01-22
AU2020213288B2 (en) 2022-07-07
US10107800B2 (en) 2018-10-23
JP7280842B2 (en) 2023-05-24
JP7843318B2 (en) 2026-04-09
US20250045806A1 (en) 2025-02-06
KR20150129721A (en) 2015-11-20
AU2014236949C1 (en) 2018-11-29
US20180095074A1 (en) 2018-04-05
BR112015023394B8 (en) 2023-09-26
SG10201601929YA (en) 2016-04-28
US12367513B2 (en) 2025-07-22
CN117024548A (en) 2023-11-10
US11493504B2 (en) 2022-11-08
US20180196038A1 (en) 2018-07-12
DK3783011T3 (en) 2022-10-17
ES2929362T3 (en) 2022-11-28
AU2018256548B2 (en) 2020-05-14
CA2906063C (en) 2025-10-07
EP2970412A4 (en) 2016-07-27
IL286816B (en) 2022-09-01
EP2970412A1 (en) 2016-01-20
CA3254603A1 (en) 2026-02-19
PT3783011T (en) 2022-10-26
JP7532562B2 (en) 2024-08-13
US10648971B2 (en) 2020-05-12
JP2016519065A (en) 2016-06-30
KR20230079494A (en) 2023-06-07
IL240985A0 (en) 2015-11-30
AU2020213288A1 (en) 2020-08-27

Similar Documents

Publication Publication Date Title
US12366572B2 (en) Activation of bioluminescence by structural complementation

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480015213.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14769752

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 240985

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 20157024687

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2906063

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2014769752

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016502113

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2014236949

Country of ref document: AU

Date of ref document: 20140313

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015023394

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015023394

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150914