WO2014150812A2 - Drought tolerant plants and related constructs and methods involving genes encoding ring-h2 polypeptides - Google Patents
Drought tolerant plants and related constructs and methods involving genes encoding ring-h2 polypeptides Download PDFInfo
- Publication number
- WO2014150812A2 WO2014150812A2 PCT/US2014/024301 US2014024301W WO2014150812A2 WO 2014150812 A2 WO2014150812 A2 WO 2014150812A2 US 2014024301 W US2014024301 W US 2014024301W WO 2014150812 A2 WO2014150812 A2 WO 2014150812A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- recombinant dna
- dna construct
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
- C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Definitions
- the field of invention relates to plant breeding and genetics and, in particular, relates to recombinant DNA constructs useful in plants for conferring tolerance to drought.
- Abiotic stress is the primary cause of crop loss worldwide, causing average yield losses of more than 50% for major crops (Boyer, J.S. (1982) Science 218:443- 448; Bray, E.A. et al . (2000) In Biochemistry and Molecular Biology of Plants, Edited by Buchannan, B.B. et al., Amer. Soc. Plant Biol., pp. 1 158-1203).
- drought is the major factor that limits crop productivity worldwide. Exposure of plants to a water-limiting environment during various developmental stages appears to activate various physiological and developmental changes. Understanding of the basic biochemical and molecular mechanism for drought stress perception, transduction and tolerance is a major challenge in biology. Reviews on the molecular mechanisms of abiotic stress responses and the genetic regulatory networks of drought stress tolerance have been published
- Activation tagging can be utilized to identify genes with the ability to affect a trait. This approach has been used in the model plant species Arabidopsis thaliana (Weigel, D., et al . (2000) Plant Physiol. 122:1003-1013). Insertions of transcriptional enhancer elements can dominantly activate and/or elevate the expression of nearby endogenous genes. This method can be used to select genes involved in
- agronomically important phenotypes including stress tolerance.
- the present invention includes:
- a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.
- a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
- the plant exhibits said alteration of said at least one agronomic characteristic when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct.
- the at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
- the present invention includes any of the plants of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
- the present invention includes seed of any of the plants of the present invention, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein a plant produced from said seed exhibits either an increased drought tolerance, or an alteration of at least one agronomic characteristic, or both, when compared to a control plant not comprising said recombinant DNA construct.
- the at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
- a method of increasing drought tolerance in a plant comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) regenerating a transgenic plant from the
- step (a) wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) obtaining a progeny plant derived from the transgenic plant of step (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
- a method of selecting for increased drought tolerance in a plant comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
- a method of selecting for an alteration of at least one agronomic characteristic in a plant comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the transgenic plant of part (b) that exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA
- said selecting step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.
- the at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
- the present invention includes any of the methods of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
- the present invention includes an isolated polynucleotide comprising: (a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , or (b) a full complement of the nucleotide sequence, wherein the full
- the polypeptide may comprise the amino acid sequence of SEQ ID NO:18, 20, 22, 23-63 or 64 .
- the nucleotide sequence may comprise the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 .
- the present invention concerns a recombinant DNA construct comprising any of the isolated polynucleotides of the present invention operably linked to at least one regulatory sequence, and a cell, a microorganism, a plant, and a seed comprising the recombinant DNA construct.
- the cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.
- a plant comprising in its genome a polynucleotide
- heterologous regulatory element e.g., a recombinant element such as at least one enhancer element
- said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element.
- FIG. 1 A - 1 D show the multiple alignment of the amino acid sequences of the RING-H2 polypeptides of SEQ ID NOs:18, 20, 22, 61 -64. Residues that are identical to the residue of SEQ ID NO:18 at a given position are enclosed in a box.
- a consensus sequence (SEQ ID NO:67) is presented where a residue is shown if identical in all sequences, otherwise, a period is shown. The conserved residues of the RING-H2 motif of the RING-H2 polypeptides are shown boxed in the consensus sequence.
- FIG. 2 shows the percent sequence identity and the divergence values for each pair of amino acids sequences of RING-H2 polypeptides displayed in FIG. 1 A - 1 D.
- FIG. 3 shows the treatment schedule for screening plants with enhanced drought tolerance.
- FIG.4 shows the yield analysis of maize lines transformed with PHP45754 encoding the Arabidopsis lead gene At5g43420.
- FIG. 5 shows the effect of the transgene on ear height (EARHT), in maize lines transformed with the plasm id PHP45754 encoding the Arabidopsis lead gene At5g43420.
- FIG. 6 shows the effect of the transgene on plant height (PLTHT), in maize lines transformed with the plasm id PHP45754 encoding the Arabidopsis lead gene At5g43420.
- SEQ ID NO:1 is the nucleotide sequence of the 4x35S enhancer element from the pHSbarENDs2 activation tagging vector.
- SEQ ID NO:2 is the nucleotide sequence of the attP1 site.
- SEQ ID NO:3 is the nucleotide sequence of the attP2 site.
- SEQ ID NO:4 is the nucleotide sequence of the attl_1 site.
- SEQ ID NO:5 is the nucleotide sequence of the attl_2 site.
- SEQ ID NO:6 is the nucleotide sequence of the ubiquitin promoter with 5' UTR and first intron from Zea mays.
- SEQ ID NO:7 is the nucleotide sequence of the Pinll terminator from Solanum tuberosum.
- SEQ ID NO:8 is the nucleotide sequence of the attR1 site.
- SEQ ID NO:9 is the nucleotide sequence of the attR2 site.
- SEQ ID NO:10 is the nucleotide sequence of the attB1 site.
- SEQ ID NO:1 1 is the nucleotide sequence of the attB2 site.
- SEQ ID NO:12 is the nucleotide sequence of the At5g43420-5'attB forward primer, containing the attB1 sequence, used to amplify the At5g43420 protein- coding region.
- SEQ ID NO:13 is the nucleotide sequence of the At5g43420-3'attB reverse primer, containing the attB2 sequence, used to amplify the At5g43420 protein- coding region.
- SEQ ID NO:14 is the nucleotide sequence of the VC062 primer, containing the T3 promoter and attB1 site, useful to amplify cDNA inserts cloned into a
- SEQ ID NO:15 is the nucleotide sequence of the VC063 primer, containing the T7 promoter and attB2 site, useful to amplify cDNA inserts cloned into a
- SEQ ID NO:16 corresponds to NCBI Gl No. 30694289, which is the cDNA sequence from locus At5g43420 encoding an Arabidopsis RING-finger polypeptide.
- SEQ ID NO:17 is the protein coding (CDS sequence) for AT-RING-H2.
- SEQ ID NO:18 corresponds to NCBI Gl No.15239865, the amino acid sequence of At5g43420 encoded by SEQ ID NO:16.
- Table 1 presents SEQ ID NOs for the nucleotide sequences obtained from cDNA clones from corn. The SEQ ID NOs for the corresponding amino acid sequences encoded by the cDNAs are also presented.
- FES Frull-Insert Sequence
- SEQ ID NO:23 is the amino acid sequence corresponding to NCBI Gl No. 15219716, encoded by the locus At1 g04360 ⁇ Arabidopsis thaliana).
- SEQ ID NO:24 is the amino acid sequence corresponding to NCBI Gl No. 15237991 , encoded by the locus At5g17600 ⁇ Arabidopsis thaliana).
- SEQ ID NO:25 is the amino acid sequence corresponding to NCBI Gl No. 18396583, encoded by the locus At3g03550 ⁇ Arabidopsis thaliana).
- SEQ ID NO:26 is the amino acid sequence corresponding to NCBI Gl No. 18651 1980, encoded by the locus At4g17905 ⁇ Arabidopsis thaliana).
- SEQ ID NO:27 is the amino acid sequence corresponding to the locus
- LOC_Os02g57460.1 a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
- SEQ ID NO:28 is the amino acid sequence corresponding to the locus
- LOC_Os03g05560.1 a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6
- SEQ ID NO:29 is the amino acid sequence corresponding to the locus
- LOC_Os02g46600.1 a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
- SEQ ID NO:30 is the amino acid sequence corresponding to the locus
- LOC_Os04g50100.1 a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
- SEQ ID NO:31 is the amino acid sequence corresponding to the locus
- LOC_Os03g05570.1 a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
- SEQ ID NO:32 is the amino acid sequence corresponding to Sb01 g046940.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
- SEQ ID NO:33 is the amino acid sequence corresponding to Sb04g037520.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
- SEQ ID NO:34 is the amino acid sequence corresponding to Sb04g031240.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
- SEQ ID NO:35 is the amino acid sequence corresponding to Sb06g026980.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
- SEQ ID NO:36 is the amino acid sequence corresponding to Sb01 g046930.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
- SEQ ID NO:37 is the amino acid sequence corresponding to
- Glyma20g34540.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:38 is the amino acid sequence corresponding to
- Glymal 0g33090.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:39 is the amino acid sequence corresponding to
- Glymal 0g04140.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:40 is the amino acid sequence corresponding to
- Glymal 3g18320.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:41 is the amino acid sequence corresponding to
- Glymal 0g01000.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:42 is the amino acid sequence corresponding to
- Glyma20g22040.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:43 is the amino acid sequence corresponding to
- Glymal 9g34640.1 a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
- SEQ ID NO:44 is the amino acid sequence corresponding to NCBI Gl No. 224107873 (Populus trichocarpa).
- SEQ ID NO:45 is the amino acid sequence corresponding to NCBI Gl No. 225433055 ⁇ Vitis vinifera).
- SEQ ID NO:46 is the amino acid sequence corresponding to NCBI Gl No. 255576814 (Ricinus communis).
- SEQ ID NO:47 is the amino acid sequence corresponding to NCBI Gl No. 224062153 ⁇ Populus trichocarpa).
- SEQ ID NO:48 is the amino acid sequence corresponding to NCBI Gl No. 255583204 (Ricinus communis).
- SEQ ID NO:49 is the amino acid sequence corresponding to NCBI Gl No.
- SEQ ID NO:50 (AC190771_29) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:51 (AC198979_65) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:52 (AC188126_44) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:53 (AC192457_18) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:54 (AC185621_2) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:55 (AC190771_39) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:56 (AC204551_34) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:57 (AC187083_54) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:58 (AC196578_64) is a maize amino acid sequence from a public database (Zea mays).
- SEQ ID NO:59 is the amino acid sequence corresponding to NCBI Gl NO.
- SEQ ID NO:60 is the amino acid sequence corresponding to NCBI Gl No. 225437852 (Vitis vinifera).
- SEQ ID NO:61 is the amino acid sequence corresponding to NCBI Gl No. 194703040 (Zea mays).
- SEQ ID NO:62 is the amino acid sequence presented in SEQ ID NO: 421 18 of US Publication No. US20120017338 (Zea mays).
- SEQ ID NO:63 is the amino acid sequence corresponding to NCBI Gl No. 399529262 (Eragrsotis tef).
- SEQ ID NO:64 is the amino acid sequence presented in SEQ ID NO: 10259 of PCT International Patent Publication No. WO2009134339 (Zea mays).
- SEQ ID NO:65 is the consensus sequence for RING-H2 domain motif sequence for the RING-H2 polypeptides described in the current invention.
- SEQ ID NO:66 is the amino acid sequence presented in SEQ ID NO: 1 197 of US Publication No. US20090144849 ⁇ Arabidopsis thaliana).
- the Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the lUPAC-IUBMB standards described in Nucleic Acids Res. 73:3021 -3030 (1985) and in the Biochemical J. 219 (No. 2 ⁇ :345-373 (1984) which are herein incorporated by reference.
- the symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. ⁇ 1 .822.
- AT-RING-H2 polypeptide or "ATL16” refers to an Arabidopsis thaliana protein that confers a drought tolerance phenotype and is encoded by the Arabidopsis thaliana locus At5g43420.
- RING-H2 polypeptide refers to a protein with a Drought Tolerance Phenotype and refers herein to AT-RING-H2 polypeptide and its homologs from other organisms.
- the RING finger is a class of zinc-finger domain that uses a distinct "cross- brace” arrangement of cysteine and histidine residues to bind two zinc-ions.
- the RING-H2 polypeptides contain the RING-H2 variation of the canonical RING finger domain, in which the fifth cysteine residue is replaced by a histidine residue.
- RING-H2 polypeptides contain a RING-H2 finger domain comprised of two cysteines corresponding to the third and sixth zinc ligands, two histidines
- the RING-H2 domain has the signature motif
- polypeptide of the current invention is given in SEQ ID NO:65, given below.
- ATL16 belongs to a particular family of RING (Really Interesting New Gene) finger proteins, named ATL that includes at least 80 members in A. thaliana and 121 in O. sativa.
- ATL Arabidopsis To ' xicos en Levadura
- ATL2 the first member of the family described
- Saccharomyces cerevisiae The name of ATL16 (Arabidopsis To ' xicos en Levadura) was given because ATL2 (the first member of the family described) was identified as a conditionally toxic A. thaliana cDNA when overexpressed in Saccharomyces cerevisiae.
- the RING-H2 polypeptides described in the current invention comprise SEQ ID NO:65.
- ATL16 has been shown to be induced in the A thaliana eca (expresio ' n constitutiva de ATL2) mutants that show alterations on the expression of several defense related genes (Serrano et al. (2004), Genetic 167:919-929). Hoth et al. have shown the down regulation of At5g43420 gene expression in response to ABA (Hoth et al., (2002) Journal of Cell Science 1 15, 4891 -4900; Aguilar-Herna ' ndez, V. et al. (201 1 ) PLoS one ;August 6(8):e23934).
- a monocot of the current invention includes the Gramineae.
- a dicot of the current invention includes the following families:
- nucleotide sequence refers to a complement of a given nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.
- EST is a DNA sequence derived from a cDNA library and therefore is a sequence which has been transcribed.
- An EST is typically obtained by a single sequencing pass of a cDNA insert.
- the sequence of an entire cDNA insert is termed the "Full-Insert Sequence” (“FIS").
- FIS Frull-Insert Sequence
- a "Contig” sequence is a sequence assembled from two or more sequences that can be selected from, but not limited to, the group consisting of an EST, FIS and PCR sequence.
- a sequence encoding an entire or functional protein is termed a
- CCS Complete Gene Sequence
- a “trait” refers to a physiological, morphological, biochemical, or physical characteristic of a plant or a particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar concentrations, or by the observation of the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.
- Agronomic characteristic is a measurable parameter including but not limited to, abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.
- Abiotic stress may be at least one condition selected from the group consisting of: drought, water deprivation, flood, high light intensity, high temperature, low temperature, salinity, etiolation, defoliation, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, UV irradiation, atmospheric pollution (e.g., ozone) and exposure to chemicals (e.g., paraquat) that induce production of reactive oxygen species (ROS).
- ROS reactive oxygen species
- “Increased stress tolerance" of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under stress conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar stress conditions.
- a plant with "increased stress tolerance” can exhibit increased tolerance to one or more different stress conditions.
- Stress tolerance activity of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased stress tolerance to the transgenic plant relative to a reference or control plant.
- Increased biomass can be measured, for example, as an increase in plant height, plant total leaf area, plant fresh weight, plant dry weight or plant seed yield, as compared with control plants.
- Crop species may be generated that produce larger cultivars, generating higher yield in, for example, plants in which the vegetative portion of the plant is useful as food, biofuel or both.
- Increased leaf size may be of particular interest.
- Increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products.
- An increase in total plant photosynthesis is typically achieved by increasing leaf area of the plant.
- Additional photosynthetic capacity may be used to increase the yield derived from particular plant tissue, including the leaves, roots, fruits or seed, or permit the growth of a plant under decreased light intensity or under high light intensity.
- Modification of the biomass of another tissue, such as root tissue may be useful to improve a plant's ability to grow under harsh environmental conditions, including drought or nutrient deprivation, because larger roots may better reach water or nutrients or take up water or nutrients.
- thermal time examples include “growing degree days” (GDD), “growing degree units” (GDU) and “heat units” (HU).
- Transgenic refers to any cell, cell line, callus, tissue, plant part or plant, the genome of which has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct, including those initial transgenic events as well as those created by sexual crosses or asexual propagation from the initial transgenic event.
- a heterologous nucleic acid such as a recombinant DNA construct
- the term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross- fertilization, non-recombinant viral infection, non-recombinant bacterial
- Gene as it applies to plant cells encompasses not only chromosomal
- components e.g., mitochondrial, plastid
- Plant includes reference to whole plants, plant organs, plant tissues, plant propagules, seeds and plant cells and progeny of same.
- Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
- Propagule includes all products of meiosis and mitosis able to propagate a new plant, including but not limited to, seeds, spores and parts of a plant that serve as a means of vegetative reproduction, such as corms, tubers, offsets, or runners.
- Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention).
- Progeny comprises any subsequent generation of a plant.
- Transgenic plant includes reference to a plant which comprises within its genome a heterologous polynucleotide.
- heterologous polynucleotide For example, the heterologous
- polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations.
- the heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.
- Gene stacking can be accomplished by many means including but not limited to co-transformation, retransformation, and crossing lines with different transgenes.
- Transgenic plant also includes reference to plants which comprise more than one heterologous polynucleotide within their genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant.
- Heterologous with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human
- nucleic acid sequence is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
- Nucleotides are referred to by their single letter designation as follows: “A” for adenylate or deoxyadenylate (for RNA or DNA, respectively), “C” for cytidylate or deoxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, “R” for purines (A or G), “Y” for pyrimidines (C or T), "K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.
- Polypeptide”, “peptide”, “amino acid sequence” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
- the terms “polypeptide”, “peptide”, “amino acid sequence”, and “protein” are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.
- mRNA essential RNA
- mRNA RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase.
- the cDNA can be single- stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase I.
- Coding region refers to the portion of a messenger RNA (or the
- Non-coding region refers to all portions of a messenger RNA or other nucleic acid molecule that are not a coding region, including but not limited to, for example, the promoter region, 5' untranslated region (“UTR”), 3' UTR, intron and terminator.
- the terms “coding region” and “coding sequence” are used interchangeably herein.
- the terms “non-coding region” and “non-coding sequence” are used interchangeably herein.
- “Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or pro-peptides present in the primary translation product have been removed.
- Precursor protein refers to the primary product of translation of mRNA; i.e., with pre- and pro-peptides still present. Pre- and pro-peptides may be and are not limited to intracellular localization signals.
- isolated refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally accompany or interact with the materials in a naturally occurring environment.
- Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.
- Recombinant refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
- Recombinant also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural
- transformation/transduction/transposition such as those occurring without deliberate human intervention.
- Recombinant DNA construct refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a
- recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature.
- the terms "recombinant DNA construct” and “recombinant construct” are used interchangeably herein.
- regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms “regulatory sequence” and “regulatory element” are used interchangeably herein.
- Promoter refers to a nucleic acid fragment capable of controlling
- Promoter functional in a plant is a promoter capable of controlling
- tissue-specific promoter and “tissue-preferred promoter” are used interchangeably, and refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell.
- “Developmentally regulated promoter” refers to a promoter whose activity is determined by developmental events.
- “Operably linked” refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other.
- a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.
- “Expression” refers to the production of a functional product.
- expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.
- Phenotype means the detectable characteristics of a cell or organism.
- “Introduced” in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
- a nucleic acid fragment e.g., a recombinant DNA construct
- a “transformed cell” is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.
- Transformation refers to both stable transformation and transient transformation.
- “Stable transformation” refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.
- Transient transformation refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.
- Allele is one of several alternative forms of a gene occupying a given locus on a chromosome. When the alleles present at a given locus on a pair of
- homologous chromosomes in a diploid plant are the same that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant that plant is hemizygous at that locus.
- chloroplast transit peptide is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made (Lee et al. (2008) Plant Cell 20:1603-1622).
- chloroplast transit peptide and “plastid transit peptide” are used interchangeably herein.
- Chloroplast transit sequence refers to a nucleotide sequence that encodes a chloroplast transit peptide.
- a “signal peptide” is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels (1991 ) Ann. Rev. Plant Phys. Plant Mol. Biol.
- a vacuolar targeting signal can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added.
- any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel (1992) Plant Phys. 700:1627-1632).
- a "mitochondrial signal peptide” is an amino acid sequence which directs a precursor protein into the mitochondria (Zhang and Glaser (2002) Trends Plant Sci 7:14-21 ).
- Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE®
- PENALTY 10).
- the Clustal W method of alignment may be used.
- Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook”).
- Embodiments include isolated polynucleotides and polypeptides,
- compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs.
- the present invention includes the following isolated polynucleotides and polypeptides:
- An isolated polynucleotide comprising: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and
- the polypeptide is preferably a RING-H2 polypeptide.
- the polypeptide preferably has drought tolerance activity.
- the polypeptide is preferably a RING-H2
- the polypeptide preferably has drought tolerance activity
- An isolated polynucleotide comprising (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 17, 19 or 21 , and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i).
- the isolated polynucleotide preferably encodes a RING-H2 polypeptide.
- the RING- H2 polypeptide preferably has drought tolerance activity.
- An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NOS:16, 17, 19 or 21 .
- the isolated polynucleotide preferably encodes a RING-H2 polypeptide.
- the RING-H2 polypeptide preferably has drought tolerance activity.
- An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is derived from SEQ ID NOS:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion.
- the isolated polynucleotide preferably encodes a RING-H2 polypeptide.
- the RING-H2 polypeptide preferably has drought tolerance activity.
- An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence corresponds to an allele of SEQ ID NOS:16, 17, 19 or 21 .
- a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine.
- the protein of the current invention may also be a protein which comprises an amino acid sequence comprising deletion, substitution, insertion and/or addition of one or more amino acids in an amino acid sequence presented in SEQ ID NO:18, 20, 22, 23-63 or 64.
- the substitution may be conservative, which means the replacement of a certain amino acid residue by another residue having similar physical and chemical characteristics.
- conservative substitution include replacement between aliphatic group-containing amino acid residues such as lie, Val, Leu or Ala, and replacement between polar residues such as Lys-Arg, Glu-Asp or Gln-Asn replacement.
- Proteins derived by amino acid deletion, substitution, insertion and/or addition can be prepared when DNAs encoding their wild-type proteins are subjected to, for example, well-known site-directed mutagenesis (see, e.g., Nucleic Acid Research, Vol. 10, No. 20, p.6487-6500, 1982, which is hereby incorporated by reference in its entirety).
- site-directed mutagenesis see, e.g., Nucleic Acid Research, Vol. 10, No. 20, p.6487-6500, 1982, which is hereby incorporated by reference in its entirety.
- the term "one or more amino acids” is intended to mean a possible number of amino acids which may be deleted, substituted, inserted and/or added by site-directed mutagenesis.
- Site-directed mutagenesis may be accomplished, for example, as follows using a synthetic oligonucleotide primer that is complementary to single-stranded phage DNA to be mutated, except for having a specific mismatch (i.e., a desired mutation).
- the above synthetic oligonucleotide is used as a primer to cause synthesis of a complementary strand by phages, and the resulting duplex DNA is then used to transform host cells.
- the transformed bacterial culture is plated on agar, whereby plaques are allowed to form from phage-containing single cells.
- 50% of new colonies contain phages with the mutation as a single strand, while the remaining 50% have the original sequence.
- the resulting plaques are allowed to hybridize with a synthetic probe labeled by kinase treatment.
- plaques hybridized with the probe are picked up and cultured for collection of their DNA.
- Techniques for allowing deletion, substitution, insertion and/or addition of one or more amino acids in the amino acid sequences of biologically active peptides such as enzymes while retaining their activity include site-directed mutagenesis mentioned above, as well as other techniques such as those for treating a gene with a mutagen, and those in which a gene is selectively cleaved to remove, substitute, insert or add a selected nucleotide or nucleotides, and then ligated.
- the protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence comprising deletion, substitution, insertion and/or addition of one or more nucleotides in the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 . Nucleotide deletion, substitution, insertion and/or addition may be accomplished by site-directed mutagenesis or other techniques as mentioned above.
- the protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence hybridizable under stringent conditions with the complementary strand of the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 .
- under stringent conditions means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5xSSC, 0.5% SDS, 1 .0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC to 6xSSC at about 40-50 °C (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42 °C) and washing conditions of, for example, about 40- 60 °C, 0.5-6xSSC, 0.1 % SDS.
- moderately stringent conditions include hybridization (and washing) at about 50 °C and 6xSSC. Highly stringent conditions can
- such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65 °C, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably 2xSSC, most preferably 0.2xSSC), compared to the moderately stringent conditions.
- highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68 °C, 0.2xSSC, 0.1 % SDS.
- SSPE (I xSSPE is 0.15 M NaCI, 10 mM NaH2PO4, and 1 .25 mM EDTA, pH 7.4) can be substituted for SSC (1 xSSC is 0.15 M NaCI and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.
- hybridization kit which uses no radioactive substance as a probe.
- Specific examples include hybridization with an ECL direct labeling & detection system (Amersham).
- Stringent conditions include, for example, hybridization at 42 °C for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCI, and washing twice in 0.4% SDS, 0.5xSSC at 55 °C for 20 minutes and once in 2xSSC at room temperature for 5 minutes.
- the present invention includes recombinant DNA constructs (including suppression DNA constructs).
- a recombinant DNA construct comprises a
- polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64,
- a recombinant DNA construct comprises a
- polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 17, 19 or 21 , and combinations thereof; or (ii)
- a recombinant DNA construct comprises a
- the RING-H2 polypeptide preferably has drought tolerance activity .
- the RING-H2 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor, Saccharum officinarum,or Triticum aestivum
- the present invention includes suppression DNA constructs.
- a suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or
- the suppression DNA construct may comprise a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct). It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art.
- a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine.
- a codon encoding another less hydrophobic residue such as glycine
- a more hydrophobic residue such as valine, leucine, or isoleucine.
- changes which result in substitution of one negatively charged residue for another such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product.
- Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide.
- “Suppression DNA construct” is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in “silencing” of a target gene in the plant.
- the target gene may be endogenous or transgenic to the plant.
- “Silencing,” as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality.
- suppression include lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing.
- RNAi-based approaches RNAi-based approaches
- small RNA-based approaches RNAi-based approaches
- a suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest.
- the region may be 100% identical or less than 100% identical (e.g., at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to all or part of the sense strand (or antisense strand) of the
- a suppression DNA construct may comprise 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 contiguous nucleotides of the sense strand (or antisense strand) of the gene of interest, and combinations thereof.
- RNAi RNA interference
- small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.
- Suppression of gene expression may also be achieved by use of artificial miRNA precursors, ribozyme constructs and gene disruption.
- a modified plant miRNA precursor may be used, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the nucleotide sequence of interest.
- Gene disruption may be achieved by use of transposable elements or by use of chemical agents that cause site-specific mutations.
- Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Patent No. 5,107,065).
- the complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- Codon refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product.
- Sense RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see Vaucheret et al., Plant J. 16:651 -659 (1998); and Gura, Nature 404:804-808 (2000)).
- RNA interference refers to the process of sequence-specific post- transcriptional gene silencing in animals mediated by short interfering RNAs
- RNA silencing (Fire et al., Nature 391 :806 (1998)).
- PTGS post-transcriptional gene silencing
- quelling in fungi.
- the process of post- transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 (1999)).
- Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
- Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
- MicroRNAs are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 (2001 ), Lagos-Quintana et al., Curr. Biol. 12:735-739 (2002); Lau et al., Science 294:858-862 (2001 ); Lee and Ambros, Science 294:862-864 (2001 ); Llave et al., Plant Cell 14:1605-1619 (2002);
- MicroRNAs appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1 ) translational inhibition; and (2) RNA cleavage. MicroRNAs entering the RNA cleavage pathway are analogous to the 21 -25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants, and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
- siRNAs short interfering RNAs
- PTGS posttranscriptional gene silencing
- miRNA-star sequence and “miRNA * sequence” are used interchangeably herein and they refer to a sequence in the miRNA precursor that is highly complementary to the miRNA sequence.
- miRNA and miRNA * are used interchangeably herein and they refer to a sequence in the miRNA precursor that is highly complementary to the miRNA sequence.
- sequences form part of the stem region of the miRNA precursor hairpin structure.
- a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target.
- the miRNA comprises about 19, 20, 21 , 22, 23, 24 or 25 nucleotides.
- the miRNA comprises 21 nucleotides.
- the nucleic acid construct encodes the miRNA.
- the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
- the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence.
- the plant miRNA precursor may be full-length of may comprise a fragment of the full-length precursor.
- the endogenous plant miRNA precursor is from a dicot or a monocot.
- the endogenous miRNA precursor is from Arabidopsis, tomato, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass.
- the miRNA template (i.e. the polynucleotide encoding the miRNA), and thereby the miRNA, may comprise some mismatches relative to the target sequence.
- the miRNA template has > 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence.
- the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
- the miRNA template (i.e. the polynucleotide encoding the miRNA) and thereby the miRNA, may comprise some mismatches relative to the miRNA-star sequence.
- the miRNA template has > 1 nucleotide mismatch as compared to the miRNA-star sequence, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the miRNA-star sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA-star sequence.
- the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA-star sequence.
- a recombinant DNA construct (including a suppression DNA construct) of the present invention may comprise at least one regulatory sequence.
- a regulatory sequence may be a promoter.
- promoters can be used in recombinant DNA constructs of the present invention.
- the promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.
- Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
- Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., Nature 313:810-812 (1985)); rice actin (McElroy et al., Plant Cell 2:163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last et al., Theor. Appl.
- tissue-specific or developmentally regulated promoter it may be desirable to use a tissue-specific or developmentally regulated promoter.
- a tissue-specific or developmentally regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant critical to tassel development, seed set, or both, and limits the expression of such a DNA sequence to the period of tassel development or seed maturation in the plant. Any identifiable promoter may be used in the methods of the present invention which causes the desired temporal and spatial expression.
- Promoters which are seed or embryo-specific and may be useful in the invention include soybean Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell 1 :1079-1093 (1989)), patatin (potato tubers) (Rocha-Sosa, M., et al. (1989) EMBO J. 8:23-29), convicilin, vicilin, and legumin (pea cotyledons) (Rerie, W.G., et al. (1991 ) Mol. Gen. Genet. 259:149-157; Newbigin, E.J., et al. (1990) Planta 180:461 -470; Higgins, T.J.V., et al.
- Promoters of seed-specific genes operably linked to heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants.
- Such examples include Arabidopsis thaliana 2S seed storage protein gene promoter to express enkephalin peptides in
- Arabidopsis and Brassica napus seeds (Vanderkerckhove et al ., Bio/Technology 7:L929-932 (1989)), bean lectin and bean beta-phaseolin promoters to express luciferase (Riggs et al., Plant Sci. 63:47-57 (1989)), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al., EMBO J 6:3559- 3564 (1987)).
- Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals.
- Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, flooding or drought, phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, or safeners.
- Promoters for use in the current invention include the following: 1 ) the stress- inducible RD29A promoter (Kasuga et al. (1999) Nature Biotechnol. 17:287-91 ); 2) the barley promoter, B22E; expression of B22E is specific to the pedicel in developing maize kernels ("Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers". Klemsdal, S.S. et al., Mol. Gen. Genet.
- Zag2 transcripts can be detected 5 days prior to pollination to 7 to 8 days after pollination ("DAP"), and directs expression in the carpel of developing female inflorescences and Ciml which is specific to the nucleus of developing maize kernels. Ciml transcript is detected 4 to 5 days before pollination to 6 to 8 DAP.
- Other useful promoters include any promoter which can be derived from a gene whose expression is maternally associated with developing female florets.
- sequences of the present invention in plants are stalk-specific promoters.
- Such stalk-specific promoters include the alfalfa S2A promoter (GenBank Accession No. EF030816; Abrahams et al., Plant Mol. Biol. 27:513-528 (1995)) and S2B promoter (GenBank Accession No. EF030817) and the like, herein incorporated by reference.
- Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
- endogenous promoter operably linked to at least one enhancer element; e.g., a 35S, nos or ocs enhancer element.
- Promoters for use in the current invention may include: RIP2, ml_IP15, ZmCORI , Rab17, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, the vascular tissue preferred promoters S2A (Genbank accession number EF030816) and S2B (Genbank accession number EF030817), and the constitutive promoter GOS2 from Zea mays.
- promoters include root preferred promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, published July 13, 2006), the maize ROOTMET2 promoter (WO05063998, published July 14, 2005), the CR1 BIO promoter (WO06055487, published May 26, 2006), the CRWAQ81
- Recombinant DNA constructs of the present invention may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences.
- a recombinant DNA construct of the present invention further comprises an enhancer or silencer.
- An intron sequence can be added to the 5' untranslated region, the protein- coding region or the 3' untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); Callis et al., Genes Dev. 1 :1 183-1200 (1987).
- Any plant can be selected for the identification of regulatory sequences and RING-H2 polypeptide genes to be used in recombinant DNA constructs and other compositions (e.g. transgenic plants, seeds and cells) and methods of the present invention.
- suitable plants for the isolation of genes and regulatory sequences and for compositions and methods of the present invention would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, Clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew,
- persimmon pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, switchgrass, tangerine, tea, tobacco, tomato, triticale, turf, turnip, a vine, watermelon, wheat, yams, and zucchini.
- compositions are Compositions:
- a composition of the present invention includes a transgenic microorganism, cell, plant, and seed comprising the recombinant DNA construct.
- the cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.
- composition of the present invention is a plant comprising in its genome any of the recombinant DNA constructs (including any of the suppression DNA constructs) of the present invention (such as any of the constructs discussed above).
- Compositions also include any progeny of the plant, and any seed obtained from the plant or its progeny, wherein the progeny or seed comprises within its genome the recombinant DNA construct (or suppression DNA construct).
- Progeny includes subsequent generations obtained by self-pollination or out-crossing of a plant.
- Progeny also includes hybrids and inbreds.
- mature transgenic plants can be self- pollinated to produce a homozygous inbred plant.
- the inbred plant produces seed containing the newly introduced recombinant DNA construct (or suppression DNA construct).
- These seeds can be grown to produce plants that would exhibit an altered agronomic characteristic (e.g., an increased agronomic characteristic optionally under water limiting conditions), or used in a breeding program to produce hybrid seed, which can be grown to produce plants that would exhibit such an altered agronomic characteristic.
- the seeds may be maize seeds.
- the plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant.
- the plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass.
- the plant may be a hybrid plant or an inbred plant.
- the recombinant DNA construct may be stably integrated into the genome of the plant.
- a plant for example, a maize, rice or soybean plant
- a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to
- a plant for example, a maize, rice or soybean plant
- a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a RING- H2 polypeptide, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.
- the plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.
- a plant for example, a maize, rice or soybean plant
- a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a RING- H2 polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
- a plant for example, a maize, rice or soybean plant
- a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits increased tolerance to drought stress, when compared to a control plant not comprising said recombinant DNA construct.
- the plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.
- a plant for example, a maize, rice or soybean plant
- a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a
- polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
- a plant for example, a maize, rice or soybean plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
- a plant for example, a maize, rice or soybean plant
- a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared
- a plant for example, a maize, rice or soybean plant
- a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-
- a plant for example, a maize, rice or soybean plant
- a polynucleotide (optionally an endogenous polynucleotide) operably linked to at least one heterologous regulatory element
- said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment
- heterologous regulatory element may comprise one, two, three or four copies of the CaMV 35S enhancer.
- the RING-H2 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor,
- the recombinant DNA construct may comprise at least a promoter functional in a plant as a regulatory sequence.
- the alteration of at least one agronomic characteristic is either an increase or decrease.
- the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.
- the alteration of at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield
- characteristic may be an increase in yield, greenness or biomass.
- the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).
- the plant may exhibit less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.
- Water limiting conditions refers to a plant growth environment where the amount of water is not sufficient to sustain optimal plant growth and development. The terms “drought” and “water limiting conditions” are used interchangeably herein.
- “Drought tolerance” is a trait of a plant to survive under drought conditions over prolonged periods of time without exhibiting substantial physiological or physical deterioration. "Drought tolerance activity" of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased drought tolerance to the transgenic plant relative to a reference or control plant.
- “Increased drought tolerance” of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under drought conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar drought conditions.
- the reference or control plant does not comprise in its genome the recombinant DNA construct or
- Thousand stress refers to the abiotic stress exerted on the plant by the combination of drought stress, high temperature stress and high light stress.
- heat stress and “temperature stress” are used interchangeably herein, and are defined as where ambient temperatures are hot enough for sufficient time that they cause damage to plant function or development, which might be reversible or irreversible in damage.
- “High temperature” can be either “high air temperature” or “high soil temperature”, “high day temperature” or “high night temperature, or a combination of more than one of these.
- the ambient temperature can be in the range of 30°C to 36°C.
- the duration for the high temperature stress could be in the range of 1 -16 hours.
- High light intensity and “high irradiance” and “light stress” are used interchangeably herein, and refer to the stress exerted by subjecting plants to light intensities that are high enough for sufficient time that they cause photoinhibition damage to the plant.
- the light intensity can be in the range of 250 ⁇ to 450 ⁇ . In one embodiment of the invention, the duration for the high light inetnsity stress could be in the range of 12-16 hours.
- Multiple stress tolerance is a trait of a plant to survive under the combined stress conditions of drought, high temperature and high light intensity over prolonged periods of time without exhibiting substantial physiological or physical deterioration.
- Parenter is an herbicide that exerts oxidative stress on the plants.
- Paraquat a bipyridylium herbicide, acts by intercepting electrons from the electron transport chain at PSI. This reaction results in the production of bipyridyl radicals that readily react with dioxygen thereby producing superoxide. Paraquat tolerance in a plant has been associated with the scavenging capacity for oxyradicals
- Paraquat stress is defined as stress exerted on the plants by subjecting them to Paraquat concentrations ranging from 0.03 to 0.3 ⁇ .
- ROS reactive oxygen species
- a polypeptide with "triple stress tolerance activity” indicates that over- expression of the polypeptide in a transgenic plant confers increased triple stress tolerance to the transgenic plant relative to a reference or control plant.
- polypeptide with "paraquat stress tolerance activity” indicates that over-expression of the polypeptide in a transgenic plant confers increased Paraquat stress tolerance to the transgenic plant relative to a reference or control plant.
- a transgenic plant comprising a recombinant DNA construct or suppression DNA construct in its genome exhibits increased stress tolerance relative to a reference or control plant
- the reference or control plant does not comprise in its genome the recombinant DNA construct or suppression DNA construct.
- One of ordinary skill in the art is familiar with protocols for simulating drought conditions and for evaluating drought tolerance of plants that have been subjected to simulated or naturally-occurring drought conditions. For example, one can simulate drought conditions by giving plants less water than normally required or no water over a period of time, and one can evaluate drought tolerance by looking for differences in physiological and/or physical condition, including (but not limited to) vigor, growth, size, or root length, or in particular, leaf color or leaf area size. Other techniques for evaluating drought tolerance include measuring chlorophyll fluorescence, photosynthetic rates and gas exchange rates.
- a drought stress experiment may involve a chronic stress (i.e., slow dry down) and/or may involve two acute stresses (i.e., abrupt removal of water) separated by a day or two of recovery.
- Chronic stress may last 8 - 10 days.
- Acute stress may last 3 - 5 days.
- the following variables may be measured during drought stress and well watered treatments of transgenic plants and relevant control plants:
- variable "% area chg_start chronic - acute2" is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of the second acute stress.
- variable "% area chg_start chronic - end chronic” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the last day of chronic stress.
- variable "% area chg_start chronic - harvest” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of harvest.
- variable "% area chg_start chronic - recovery24hr” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and 24 hrs into the recovery (24hrs after acute stress 2).
- variable "psii_acute1” is a measure of Photosystem II (PSIl) efficiency at the end of the first acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSIl antennae and is directly related to carbon dioxide assimilation within the leaf.
- PSIl Photosystem II
- variable "psii_acute2" is a measure of Photosystem II (PSIl) efficiency at the end of the second acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSIl antennae and is directly related to carbon dioxide assimilation within the leaf.
- the variable "fv/fm_acute1 " is a measure of the optimum quantum yield (Fv/Fm) at the end of the first acute stress - (variable fluorescence difference between the maximum and minimum fluorescence / maximum fluorescence)
- variable "fv/fm_acute2" is a measure of the optimum quantum yield (Fv/Fm) at the end of the second acute stress - (variable flourescence difference between the maximum and minimum fluorescence / maximum fluorescence).
- the variable "leaf rolling_harvest” is a measure of the ratio of top image to side image on the day of harvest.
- the variable "leaf rolling_recovery24hr” is a measure of the ratio of top image to side image 24 hours into the recovery.
- SGR Specific Growth Rate
- the variable "shoot dry weight” is a measure of the shoot weight 96 hours after being placed into a 104 °C oven.
- the variable "shoot fresh weight” is a measure of the shoot weight immediately after being cut from the plant.
- a characteristic or phenotype of a transgenic plant in any embodiment of the present invention in which a control plant is utilized e.g., compositions or methods as described herein.
- a control plant e.g., compositions or methods as described herein.
- 1 Progeny of a transformed plant which is hemizygous with respect to a recombinant DNA construct (or suppression DNA construct), such that the progeny are segregating into plants either comprising or not comprising the recombinant DNA construct (or suppression DNA construct): the progeny comprising the recombinant DNA construct (or suppression DNA construct) would be typically measured relative to the progeny not comprising the recombinant DNA construct (or suppression DNA construct) (i.e., the progeny not comprising the recombinant DNA construct (or the suppression DNA construct) is the control or reference plant).
- the second hybrid line would typically be measured relative to the first hybrid line (i.e., the first hybrid line is the control or reference plant).
- a plant comprising a recombinant DNA construct (or suppression DNA construct) the plant may be assessed or measured relative to a control plant not comprising the recombinant DNA construct (or suppression DNA construct) but otherwise having a comparable genetic background to the plant (e.g., sharing at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity of nuclear genetic material compared to the plant comprising the
- SCARs Characterized Amplified Regions
- AFLP®s Amplified Fragment Length Polymorphisms
- SSRs Simple Sequence Repeats
- a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant would not include a plant that had been previously selected, via mutagenesis or transformation, for the desired agronomic characteristic or phenotype.
- Methods include but are not limited to methods for increasing drought tolerance in a plant, methods for evaluating drought tolerance in a plant, methods for altering an agronomic characteristic in a plant, methods for determining an alteration of an agronomic characteristic in a plant, and methods for producing seed.
- the plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant.
- the plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or sorghum.
- the seed may be a maize or soybean seed, for example, a maize hybrid seed or maize inbred seed.
- Methods include but are not limited to the following:
- a method for transforming a cell (or microorganism) comprising transforming a cell (or microorganism) with any of the isolated polynucleotides or recombinant DNA constructs of the present invention.
- the cell (or microorganism) transformed by this method is also included.
- the cell is eukaryotic cell, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.
- the microorganism may be Agrobacterium, e.g. Agrobacterium tumefaciens or
- a method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs
- the invention is also directed to the transgenic plant produced by this method, and transgenic seed obtained from this transgenic plant.
- the transgenic plant obtained by this method may be used in other methods of the present invention.
- a method for isolating a polypeptide of the invention from a cell or culture medium of the cell wherein the cell comprises a recombinant DNA construct comprising a polynucleotide of the invention operably linked to at least one regulatory sequence, and wherein the transformed host cell is grown under conditions that are suitable for expression of the recombinant DNA construct.
- a method of altering the level of expression of a polypeptide of the invention in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct of the present invention; and (b) growing the transformed host cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of the polypeptide of the invention in the transformed host cell.
- a method of increasing drought tolerance in a plant comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity,
- the method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
- a method of increasing drought tolerance comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
- the method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance, when compared to a control plant not comprising the recombinant DNA construct.
- a method of selecting for (or identifying) increased drought tolerance in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%,
- a method of selecting for (or identifying) increased drought tolerance in a plant comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
- a method of selecting for (or identifying) increased drought tolerance in a plant comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (i) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (ii) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance, when
- a method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 9
- a method of selecting for (or identifying) an alteration of at least one agronomic characteristic in a plant comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a
- recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , wherein the transgenic plant comprises in its
- said selecting (or identifying) step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.
- the at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
- a method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (i) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (ii) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant that exhibit
- polynucleotide preferably encodes a RING-H2 polypeptide.
- the RING-H2 polypeptide preferably has drought tolerance activity.
- a method of producing seed comprising any of the preceding methods, and further comprising obtaining seeds from said progeny plant, wherein said seeds comprise in their genome said recombinant DNA construct (or suppression DNA construct).
- said regenerable plant cell may comprise a callus cell, an embryogenic callus cell, a gametic cell, a meristematic cell, or a cell of an immature embryo.
- the regenerable plant cells may derive from an inbred maize plant.
- said regenerating step may comprise the following: (i) culturing said transformed plant cells in a media comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.
- the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.
- the alteration of at least one agronomic characteristic may be an increase in yield, greenness or biomass.
- the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).
- a regulatory sequence such as one or more enhancers, optionally as part of a transposable element
- recombinant DNA constructs of the present invention into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation.
- suitable technique including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation.
- the development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art.
- the regenerated plants may be self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
- a transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
- pHSbarENDs2 PCT Publication No. WO/2012/058528
- the construct also contains vector sequences (pUC9) and a polylinker to allow plasmid rescue, transposon sequences (Ds) to remobilize the T-DNA, and the bar gene to allow for glufosinate selection of transgenic plants.
- Arabidopsis activation-tagged populations were created by whole plant Agrobacterium transformation.
- the pHSbarENDs2 construct was transformed into Agrobacterium tumefaciens strain C58, grown in LB at 25 °C to OD600 ⁇ 1 .0. Cells were then pelleted by centrifugation and resuspended in an equal volume of 5% sucrose/0.05% Silwet L-77 (OSI Specialties, Inc).
- soil grown Arabidopsis thaliana ecotype Col-0 were top watered with the Agrobacterium suspension.
- the same plants were top watered again with the same Agrobacterium strain in sucrose/Silwet. The plants were then allowed to set seed as normal.
- T1 seed were sown on soil, and transgenic seedlings were selected by spraying with glufosinate (Finale®; AgrEvo; Bayer Environmental Science). A total of 100,000 glufosinate resistant T1 seedlings were selected. T2 seed from each line was kept separate.
- the soil is watered to saturation and then plants are grown under standard conditions (i.e., 16 hour light, 8 hour dark cycle; 22°C; -60% relative humidity). No additional water is given.
- Digital images of the plants are taken at the onset of visible drought stress symptoms. Images are taken once a day (at the same time of day), until the plants appear dessicated. Typically, four consecutive days of data is captured.
- Color analysis is employed for identifying potential drought tolerant lines. Color analysis can be used to measure the increase in the percentage of leaf area that falls into a yellow color bin. Using hue, saturation and intensity data ("HSI"), the yellow color bin consists of hues 35 to 45.
- HSUMI hue, saturation and intensity data
- Leaf area is also used as another criterion for identifying potential drought tolerant lines, since Arabidopsis leaves wilt during drought stress. Maintenance of leaf area can be measured as reduction of rosette leaf area over time.
- Leaf area is measured in terms of the number of green pixels obtained using the LemnaTec imaging system.
- Activation-tagged and control plants are grown side by side in flats that contain 72 plants (9 plants/pot).
- images are measured for a number of days to monitor the wilting process. From these data wilting profiles are determined based on the green pixel counts obtained over four consecutive days for activation-tagged and accompanying control plants. The profile is selected from a series of measurements over the four day period that gives the largest degree of wilting.
- the ability to withstand drought is measured by the tendency of activation-tagged plants to resist wilting compared to control plants.
- LemnaTec HTSBonitUV software is used to analyze CCD images. Estimates of the leaf area of the Arabidopsis plants are obtained in terms of the number of green pixels. The data for each image is averaged to obtain estimates of mean and standard deviation for the green pixel counts for activation-tagged and wild-type plants. Parameters for a noise function are obtained by straight line regression of the squared deviation versus the mean pixel count using data for all images in a batch. Error estimates for the mean pixel count data are calculated using the fit parameters for the noise function. The mean pixel counts for activation-tagged and wild-type plants are summed to obtain an assessment of the overall leaf area for each image.
- the four-day interval with maximal wilting is obtained by selecting the interval that corresponds to the maximum difference in plant growth.
- the individual wilting responses of the activation-tagged and wild-type plants are obtained by normalization of the data using the value of the green pixel count of the first day in the interval.
- the drought tolerance of the activation-tagged plant compared to the wild-type plant is scored by summing the weighted difference between the wilting response of activation-tagged plants and wild-type plants over day two to day four; the weights are estimated by propagating the error in the data.
- a positive drought tolerance score corresponds to an activation-tagged plant with slower wilting compared to the wild-type plant. Significance of the difference in wilting response between activation-tagged and wild-type plants is obtained from the weighted sum of the squared deviations.
- Phase 1 hits Lines with a significant delay in yellow color accumulation and/or with significant maintenance of rosette leaf area, when compared to the average of the whole flat, are designated as Phase 1 hits.
- Phase 1 hits are re-screened in duplicate under the same assay conditions.
- the line is then considered a validated drought tolerant line.
- TAIL PCR thermal asymmetric interlaced PCR
- SAIFF PCR Southern et al., (1995) Nucleic Acids Res. 23:1087-1088.
- TAIL PCR and SAIFF PCR may both prove insufficient to identify candidate genes.
- other procedures including inverse PCR, plasmid rescue and/or genomic library construction, can be employed.
- a successful result is one where a single TAIL or SAIFF PCR fragment contains a T-DNA border sequence and Arabidopsis genomic sequence.
- candidate genes are identified by alignment to publicly available Arabidopsis genome sequence.
- the annotated gene nearest the 35S enhancer elements/T-DNA RB are candidates for genes that are activated.
- a diagnostic PCR on genomic DNA is done with one oligo in the T-DNA and one oligo specific for the candidate gene. Genomic DNA samples that give a PCR product are
- T-DNA insertion interpreted as representing a T-DNA insertion. This analysis also verifies a situation in which more than one insertion event occurs in the same line, e.g., if multiple differing genomic fragments are identified in TAIL and/or SAIFF PCR analyses.
- An activation-tagged line (No. 1 1 1664) showing drought tolerance was further analyzed. DNA from the line was extracted, and genes flanking the T-DNA insert in the mutant line were identified using SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A PCR amplified fragment was identified that contained T- DNA border sequence and Arabidopsis genomic sequence. Genomic sequence flanking the T-DNA insert was obtained, and the candidate gene was identified by alignment to the completed Arabidopsis genome. For a given T-DNA integration event, the annotated gene nearest the 35S enhancer elements/T-DNA RB was the candidate for gene that is activated in the line.
- a functional activation-tagged allele should result in either up-regulation of the candidate gene in tissues where it is normally expressed, ectopic expression in tissues that do not normally express that gene, or both.
- RT-PCR procedure such as the QuantiTect® Reverse Transcription Kit from Qiagen®, is used.
- RT-PCR of the actin gene is used as a control to show that the amplification and loading of samples from the mutant line and wild-type are similar.
- Assay conditions are optimized for each gene. Expression levels are checked in mature rosette leaves. If the activation-tagged allele results in ectopic expression in other tissues (e.g., roots), it is not detected by this assay. As such, a positive result is useful but a negative result does not eliminate a gene from further analysis.
- Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated "lead gene" in Arabidopsis.
- the candidate Arabidopsis RING-H2 polypeptide CDS (At5g43420; SEQ ID NO:17) was tested for its ability to confer drought tolerance in the following manner.
- At5g43420 cDNA protein-coding region was amplified by RT-PCR with the following primers: (1 ) At5g43420-5'attB forward primer (SEQ ID NO:12):
- the forward primer contains the attB1 sequence
- the reverse primer contains the attB2 sequence
- Recombination Reaction was performed with pDONRTM/Zeo (INVITROGENTM). This process removed the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONRTM/Zeo and directionally cloned the PCR product with flanking attB1 and attB2 sites creating an entry clone, PHP43712. This entry clone was used for a subsequent LR Recombination Reaction with a
- a 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow (PCT Publication No. WO/2012/058528), was constructed with a 1 .3-kb 35S promoter immediately upstream of the INVITROGENTM GATEWAY® C1 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences.
- the vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow
- cDNA libraries may be prepared by any one of many methods available.
- the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in UNI-ZAPTM XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA). The UNI-ZAPTM XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector
- cDNAs may be introduced directly into precut BLUESCRIPT® II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products).
- plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBLUESCRIPT® plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"; see Adams et al., (1991 ) Science
- FIS data Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers.
- Confirmed templates are transposed via the Primer Island transposition kit (PE Applied Biosystems, Foster City, CA) which is based upon the Saccharomyces cerevisiae Ty1 transposable element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772).
- the in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules.
- the transposed DNA is then used to transform DH10B electro-competent cells (GIBCO BRL/Life
- the transposable element contains an additional selectable marker (named DHFR; Fling and Richards (1983) Nucleic Acids Res. 47-5158), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI PRISM® dye-terminator
- Phred and Phrap are a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files.
- the Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (Gordon et al. (1998) Genome Res. 8:195-202).
- the cDNA fragment may correspond to a portion of the 3'-terminus of the gene and does not cover the entire open reading frame.
- one of two different protocols is used. The first of these methods results in the production of a fragment of DNA containing a portion of the desired gene sequence while the second method results in the production of a fragment containing the entire open reading frame. Both of these methods use two rounds of PCR amplification to obtain fragments from one or more libraries. The libraries some times are chosen based on previous knowledge that the specific gene should be found in a certain tissue and sometimes are randomly-chosen. Reactions to obtain the same gene may be performed on several libraries in parallel or on a pool of libraries.
- Library pools are normally prepared using from 3 to 5 different libraries and normalized to a uniform dilution.
- both methods use a vector-specific (forward) primer corresponding to a portion of the vector located at the 5'-terminus of the clone coupled with a
- the first method uses a sequence that is
- the second method uses a gene-specific primer complementary to a portion of the already known gene sequence while the second method uses a gene-specific primer complementary to a portion of the
- a nested set of primers is used for both methods.
- the resulting DNA fragment is ligated into a pBLUESCRIPT® vector using a commercial kit and following the manufacturer's protocol. This kit is selected from many available from several vendors including INVITROGENTM (Carlsbad, CA), Promega Biotech (Madison, Wl), and GIBCO-BRL (Gaithersburg, MD).
- INVITROGENTM Carlsbad, CA
- Promega Biotech Madison, Wl
- GIBCO-BRL Gaithersburg, MD.
- the plasmid DNA is isolated by alkaline lysis method and submitted for sequencing and assembly using
- mRNAs can be isolated using the Qiagen® RNA isolation kit for total RNA isolation, followed by mRNA isolation via attachment to oligo(dT) Dynabeads from Invitrogen (Life Technologies, Carlsbad, CA), and sequencing libraries can be prepared using the standard mRNA-Seq kit and protocol from lllumina, Inc. (San Diego, CA). In this method, mRNAs are
- Ligated cDNA fragments can then be PCR amplified using lllumina paired-end library primers, and purified PCR products can be checked for quality and quantity on the Agilent Bioanalyzer DNA 1000 chip prior to sequencing on the Genome Analyzer II equipped with a paired end module.
- Reads from the sequencing runs can be soft-trimmed prior to assembly such that the first base pair of each read with an observed FASTQ quality score lower than 15 and all subsequent bases are clipped using a Python script.
- the Velvet assembler (Zerbino et al. Genome Research 18:821 -9 (2008)) can be run under varying kmer and coverage cutoff parameters to produce several putative assemblies along a range of stringency.
- the contiguous sequences (contigs) within those assemblies can be combined into clusters using Vmatch software (available on the Vmatch website) such that contigs which are identified as substrings of longer contigs are grouped and eliminated, leaving a non-redundant set of longest "sentinel" contigs. These non-redundant sets can be used in alignments to homologous sequences from known model plant species.
- cDNA clones encoding the polypeptide of interest can be identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410; see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health) searches for similarity to amino acid sequences contained in the BLAST "nr" database
- GenBank CDS complementary metal-oxide-semiconductor
- GenBank CDS sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases.
- the DNA sequences from clones can be translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the "nr” database using the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI.
- the polypeptides encoded by the cDNA sequences can be analyzed for similarity to all publicly available amino acid sequences contained in the "nr” database using the BLASTP algorithm provided by the National Center for Biotechnology Information (NCBI).
- the P-value (probability) or the E-value (expectation) of observing a match of a cDNA- encoded sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as "pLog" values, which represent the negative of the logarithm of the reported P-value or E-value.
- ESTs sequences can be compared to the Genbank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTN algorithm (Altschul et al (1997) Nucleic Acids Res. 25:3389-3402.) against the DUPONTTM proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction.
- the TBLASTN algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.
- sequence assemblies are in fragments
- percent identity to other homologous genes can be used to infer which fragments represent a single gene.
- the fragments that appear to belong together can be
- Table 3 Shown in Table 3 (non-patent literature) and Table 4 (patent literature) are the BLAST results for one or more of the following: individual Expressed Sequence Tag (“EST”), the sequences of the entire cDNA inserts comprising the indicated cDNA clones (“Full-Insert Sequence” or “FIS”), the sequences of contigs assembled from two or more EST, FIS or PCR sequences ("Contig"), or sequences encoding an entire or functional protein derived from an FIS or a contig (“Complete Gene Sequence” or "CGS”). Also shown in Tables 3 and 4 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:
- Figures 1 A-1 D present an alignnnent of the amino acid sequences of RING-H2 polypeptides set forth in SEQ ID NOs:18, 20, 22, 61 -64.
- Figure 2 presents the percent sequence identities and divergence values for each sequence pair presented in Figures 1 A-1 D.
- Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode RING-H2 polypeptides.
- Sequences homologous to the Arabidopsis AT-RING-H2 polypeptide can be identified using sequence comparison algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul et al., J. Mol. Biol. 215:403-410 (1993); see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health). Sequences encoding homologous RING-H2 polypeptides can be PCR-amplified by any of the following methods.
- Method 1 (RNA-based): If the 5' and 3' sequence information for the protein- coding region, or the 5' and 3' UTR, of a gene encoding a RING-H2 polypeptide homolog is available, gene-specific primers can be designed as outlined in Example 5. RT-PCR can be used with plant RNA to obtain a nucleic acid fragment containing the protein-coding region flanked by attB1 (SEQ ID NO:10) and attB2 (SEQ ID NO:1 1 ) sequences. The primer may contain a consensus Kozak sequence
- Method 2 (DNA-based): Alternatively, if a cDNA clone is available for a gene encoding a RING-H2 polypeptide homolog, the entire cDNA insert (containing 5' and 3' non-coding regions) can be PCR amplified. Forward and reverse primers can be designed that contain either the attB1 sequence and vector-specific sequence that precedes the cDNA insert or the attB2 sequence and vector-specific sequence that follows the cDNA insert, respectively. For a cDNA insert cloned into the vector pBulescript SK+, the forward primer VC062 (SEQ ID NO:14) and the reverse primer VC063 (SEQ ID NO:15) can be used.
- Genomic DNA can be obtained using long range genomic PCR capture. Primers can be designed based on the sequence of the genomic locus and the resulting PCR product can be sequenced. The sequence can be analyzed using the FGENESH (Salamov, A. and Solovyev, V. (2000) Genome Res., 10: 516-522) program, and optionally, can be aligned with homologous sequences from other species to assist in identification of putative introns.
- FGENESH Samov, A. and Solovyev, V. (2000) Genome Res., 10: 516-522
- Method 1 may contain restriction sites instead of attB1 and attB2 sites, for subsequent cloning of the PCR product into a vector containing attB1 and attB2 sites.
- Method 2 can involve amplification from a cDNA clone, a lambda clone, a BAC clone or genomic DNA.
- a PCR product obtained by either method above can be combined with the
- GATEWAY® donor vector such as pDONRTM/Zeo (INVITROGENTM) or
- pDONRTM221 (INVITROGENTM), using a BP Recombination Reaction. This process removes the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONRTM221 and directionally clones the PCR product with flanking attB1 and attB2 sites to create an entry clone.
- CAM chloramphenicol resistance gene
- the sequence encoding the homologous RING-H2 polypeptide from the entry clone can then be transferred to a suitable destination vector, such as pBC-Yellow, PHP27840 or PHP23236 (PCT Publication No. WO/2012/058528; herein incorporated by reference), to obtain a plant expression vector for use with Arabidopsis, soybean and corn, respectively.
- Sequences of the attP1 and attP2 sites of donor vectors pDONRTM/Zeo or pDONRTM221 are given in SEQ ID NOs:2 and 3, respectively.
- the sequences of the attR1 and attR2 sites of destination vectors pBC-Yellow, PHP27840 and PHP23236 are given in SEQ ID NOs:8 and 9, respectively.
- a BP Reaction is a recombination reaction between an Expression Clone (or an attB-flanked PCR product) and a Donor (e.g., pDONRTM) Vector to create an Entry Clone.
- a LR Reaction is a recombination between an Entry Clone and a Destination Vector to create an Expression Clone.
- a Donor Vector contains attP1 and attP2 sites.
- An Entry Clone contains attl_1 and attl_2 sites (SEQ ID NOs:4 and 5, respectively).
- a Destination Vector contains attR1 and attR2 site.
- An Expression Clone contains attB1 and attB2 sites.
- the attB1 site is composed of parts of the attl_1 and attR1 sites.
- the attB2 site is composed of parts of the attl_2 and attR2 sites.
- a MultiSite GATEWAY® LR recombination reaction between multiple entry clones and a suitable destination vector can be performed to create an expression vector.
- Soybean plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
- Example 5 The same GATEWAY® entry clone described in Example 5 can be used to directionally clone each gene into the PHP27840 vector (PCT Publication No.
- Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides.
- Techniques for soybean transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.
- T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in soybean to enhance drought tolerance.
- Soybean plants transformed with validated genes can then be assayed under more vigorous field-based studies to study yield enhancement and/or stability under well-watered and water-limiting conditions.
- Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
- the same GATEWAY® entry clone described in Example 5 can be used to directionally clone each gene into a maize transformation vector.
- Expression of the gene in the maize transformation vector can be under control of a constitutive promoter such as the maize ubiquitin promoter (Christensen et al., (1989) Plant Mol. Biol. 12:619-632 and Christensen et al., (1992) Plant Mol. Biol. 18:675-689)
- the recombinant DNA construct described above can then be introduced into corn cells by particle bombardment.
- Techniques for corn transformation by particle bombardment have been described in International Patent Publication WO
- T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in maize to enhance drought tolerance.
- Electroporation of Agrobacterium tumefaciens LBA4404 Electroporation competent cells (40 ⁇ _), such as Agrobacterium tumefaciens LBA4404 containing PHP10523 (PCT Publication No. WO/2012/058528), are thawed on ice (20-30 min). PHP10523 contains VIR genes for T-DNA transfer, an Agrobacterium low copy number plasmid origin of replication, a tetracycline resistance gene, and a Cos site for in vivo DNA bimolecular recombination.
- electroporation cuvette is chilled on ice.
- the electroporator settings are adjusted to 2.1 kV.
- a DNA aliquot (0.5 ⁇ _ parental DNA at a concentration of 0.2 g -1 .0 pg in low salt buffer or twice distilled H 2 O) is mixed with the thawed Agrobacterium tumefaciens LBA4404 cells while still on ice.
- the mixture is transferred to the bottom of electroporation cuvette and kept at rest on ice for 1 -2 min.
- the cells are electroporated (Eppendorf electroporator 2510) by pushing the "pulse" button twice (ideally achieving a 4.0 millisecond pulse).
- Option 1 Overlay plates with 30 ⁇ _ of 15 mg/mL rifampicin.
- LBA4404 has a chromosomal resistance gene for rifampicin. This additional selection eliminates some contaminating colonies observed when using poorer preparations of LBA4404 competent cells.
- Option 2 Perform two replicates of the electroporation to compensate for poorer electrocompetent cells.
- Aliquots of 2 ⁇ are used to electroporate 20 ⁇ of DH10b + 20 ⁇ of twice distilled H 2 O as per above.
- a 15 ⁇ aliquot can be used to transform 75-100 ⁇ of INVITROGENTM Library Efficiency DH5a.
- the cells are spread on plates containing LB medium and 50 g/mL spectinomycin and incubated at 37 °C overnight.
- Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
- Agrobacterium-mediated transformation of maize is performed essentially as described by Zhao et al. in Meth. Mol. Biol. 318:315-323 (2006) (see also Zhao et al., Mol. Breed. 8:323-333 (2001 ) and U.S. Patent No. 5,981 ,840 issued November 9, 1999, incorporated herein by reference).
- the transformation process involves bacterium innoculation, co-cultivation, resting, selection and plant regeneration.
- Immature maize embryos are dissected from caryopses and placed in a 2 mL microtube containing 2 mL PH I-A medium.
- PHI-A medium of (1 ) is removed with 1 mL micropipettor, and 1 mL of Agrobacterium suspension is added. The tube is gently inverted to mix. The mixture is incubated for 5 min at room temperature.
- the Agrobacterium suspension is removed from the infection step with a 1 mL micropipettor. Using a sterile spatula the embryos are scraped from the tube and transferred to a plate of PHI-B medium in a 100x15 mm Petri dish. The embryos are oriented with the embryonic axis down on the surface of the medium. Plates with the embryos are cultured at 20 °C, in darkness, for three days. L- Cysteine can be used in the co-cultivation phase. With the standard binary vector, the co-cultivation medium supplied with 100-400 mg/L L-cysteine is critical for recovering stable transgenic events.
- Embryos that produce no events may be brown and necrotic, and little friable tissue growth is evident.
- Putative transgenic embryonic tissue is subcultured to fresh PHI- D plates at two-three week intervals, depending on growth rate. The events are recorded.
- Embryonic tissue propagated on PHI-D medium is subcultured to PHI-E medium (somatic embryo maturation medium), in 100x25 mm Petri dishes and incubated at 28 °C, in darkness, until somatic embryos mature, for about ten to eighteen days.
- PHI-E medium synthetic embryo maturation medium
- Individual, matured somatic embryos with well-defined scutellum and coleoptile are transferred to PHI-F embryo germination medium and incubated at 28 °C in the light (about 80 ⁇ from cool white or equivalent fluorescent lamps).
- regenerated plants about 10 cm tall, are potted in horticultural mix and hardened-off using standard horticultural methods.
- PHI-A 4g/L CHU basal salts, 1 .0 mL/L 1000X Eriksson's vitamin mix, 0.5 mg/L thiamin HCI, 1 .5 mg/L 2,4-D, 0.69 g/L L-proline, 68.5 g/L sucrose, 36 g/L glucose, pH 5.2. Add 100 ⁇ acetosyringone (filter-sterilized).
- PHI-B PHI-A without glucose, increase 2,4-D to 2 mg/L, reduce sucrose to 30 g/L and supplemente with 0.85 mg/L silver nitrate (filter-sterilized), 3.0 g/L Gelrite®, 100 ⁇ acetosyringone (filter- sterilized), pH 5.8.
- PHI-C PHI-B without Gelrite® and acetosyringonee, reduce 2,4-D to 1 .5 mg/L and supplemente with 8.0 g/L agar, 0.5 g/L 2-[N- morpholino]ethane-sulfonic acid (MES) buffer, 100 mg/L carbenicillin (filter-sterilized).
- MES 2-[N- morpholino]ethane-sulfonic acid
- PHI-D PHI-C supplemented with 3 mg/L bialaphos (filter-sterilized).
- nicotinic acid 0.1 mg/L thiamine HCI, 0.5 mg/L pyridoxine HCI, 2.0 mg/L glycine, 0.1 g/L myo-inositol, 0.5 mg/L zeatin (Sigma, Cat. No. Z-0164), 1 mg/L indole acetic acid (IAA), 26.4 g/L abscisic acid (ABA), 60 g/L sucrose, 3 mg/L bialaphos (filter-sterilized), 100 mg/L carbenicillin (filter-sterilized), 8 g/L agar, pH 5.6. 6.
- PHI-F PHI-E without zeatin, IAA, ABA; reduce sucrose to 40 g/L; replacing agar with 1 .5 g/L Gelrite®; pH 5.6.
- Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al., Bio/Technology 8:833-839 (1990)).
- Transgenic TO plants can be regenerated and their phenotype determined. T1 seed can be collected.
- Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.
- Transgenic plants can undergo more vigorous field- based experiments to study yield enhancement and/or stability under water limiting and water non-limiting conditions.
- water limiting conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants. Plants containing the validated Arabidopsis lead gene would have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.
- the vector PHP45523 contains the following expression cassettes: 1 . Ubiquitin promoter::nnoPAT::Pinll terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.
- LTP2 promoter :DS-RED2::Pinll terminator; cassette expressing the DS- RED color marker gene used for seed sorting.
- the RING-H2 polypeptide expression cassette present in vector PHP45523 can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-med ⁇ aied transformation as described in Examples 12 and 13.
- Vector PHP45523 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 (PCT Publication No. WO/2012/058528) to create the co-integrate vector PHP45754.
- the co-integrate vector is formed by recombination of the 2 plasmids, PHP45523 and PHP10523, through the COS recombination sites contained on each vector.
- the co-integrate vector PHP45754 contains the same 3 expression cassettes as above (Example 14A) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1 , VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-med ⁇ aied transformation.
- Destination vector PHP23236 was obtained by transformation of
- Destination vector PHP23236 can be used in a recombination reaction with an entry clone as described in
- Example 16 to create a maize expression vector for transformation of Gaspe Flint- derived maize lines.
- the protein-coding region of the candidate gene described in Example 5, PHP43712 can be directionally cloned into the destination vector PHP23236 (PCT Publication No. WO/2012/058528) to create an expression vector.
- This expression vector contains the protein-coding region of interest, encoding the AT-RING-H2
- polypeptide under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.
- the protein-coding region of the candidate gene described in Example 5, PHP45523, can be directionally cloned into the destination vector PHP29634 to create an expression vector,.
- Destination vector PHP29634 is similar to destination vector PHP23236, however, destination vector PHP29634 has site-specific recombination sites FRT1 and FRT87 and also encodes the GAT4602 selectable marker protein for selection of transformants using glyphosate.
- This expression vector will contain the protein-coding region of interest, encoding the Arabidopsis RING-H2 polypeptide, under control of the UBI promoter and is a T-DNA binary vector for /AgrOi acter/um-mediated transformation into corn as described, but not limited to, the examples described herein.
- Maize plants can be transformed to overexpress the Arabidopsis lead gene or the corresponding homologs from other species in order to examine the resulting phenotype.
- Recipient plant cells can be from a uniform maize line having a short life cycle ("fast cycling"), a reduced size, and high transformation potential.
- Typical of these plant cells for maize are plant cells from any of the publicly available Gaspe Flint (GBF) line varieties.
- GBF Gaspe Flint
- One possible candidate plant line variety is the F1 hybrid of GBF x QTM (Quick Turnaround Maize, a publicly available form of Gaspe Flint selected for growth under greenhouse conditions) disclosed in Tomes et al. U.S. Patent Application Publication No. 2003/0221212.
- Transgenic plants obtained from this line are of such a reduced size that they can be grown in four inch pots (1/4 the space needed for a normal sized maize plant) and mature in less than 2.5 months.
- Another suitable line is a double haploid line of GS3 (a highly transformable line) X Gaspe Flint.
- GS3 a highly transformable line
- X Gaspe Flint a transformable elite inbred line carrying a transgene which causes early flowering, reduced stature, or both.
- Any suitable method may be used to introduce the transgenes into the maize cells, including but not limited to inoculation type procedures using Agrobacterium based vectors. Transformation may be performed on immature embryos of the recipient (target) plant.
- the event population of transgenic (TO) plants resulting from the transformed maize embryos is grown in a controlled greenhouse environment using a modified randomized block design to reduce or eliminate environmental error.
- a randomized block design is a plant layout in which the experimental plants are divided into groups (e.g., thirty plants per group), referred to as blocks, and each plant is randomly assigned a location with the block.
- a replicate group For a group of thirty plants, twenty-four transformed, experimental plants and six control plants (plants with a set phenotype) (collectively, a "replicate group") are placed in pots which are arranged in an array (a.k.a. a replicate group or block) on a table located inside a greenhouse. Each plant, control or experimental, is randomly assigned to a location with the block which is mapped to a unique, physical greenhouse location as well as to the replicate group. Multiple replicate groups of thirty plants each may be grown in the same greenhouse in a single experiment. The layout (arrangement) of the replicate groups should be determined to minimize space requirements as well as environmental effects within the greenhouse. Such a layout may be referred to as a compressed greenhouse layout.
- An alternative to the addition of a specific control group is to identify those transgenic plants that do not express the gene of interest.
- a variety of techniques such as RT-PCR can be applied to quantitatively assess the expression level of the introduced gene.
- TO plants that do not express the transgene can be compared to those which do.
- each plant in the event population is identified and tracked throughout the evaluation process, and the data gathered from that plant is automatically associated with that plant so that the gathered data can be associated with the transgene carried by the plant.
- each plant container can have a machine readable label (such as a Universal Product Code (UPC) bar code) which includes information about the plant identity, which in turn is correlated to a greenhouse location so that data obtained from the plant can be automatically associated with that plant.
- UPC Universal Product Code
- any efficient, machine readable, plant identification system can be used, such as two-dimensional matrix codes or even radio frequency
- RFID radio frequency identification tags
- Each greenhouse plant in the TO event population is analyzed for agronomic characteristics of interest, and the agronomic data for each plant is recorded or stored in a manner so that it is associated with the identifying data (see above) for that plant. Confirmation of a phenotype (gene effect) can be accomplished in the T1 generation with a similar experimental design to that described above.
- the TO plants are analyzed at the phenotypic level using quantitative, nondestructive imaging technology throughout the plant's entire greenhouse life cycle to assess the traits of interest.
- a digital imaging analyzer may be used for automatic multi-dimensional analyzing of total plants. The imaging may be done inside the greenhouse. Two camera systems, located at the top and side, and an apparatus to rotate the plant, are used to view and image plants from all sides. Images are acquired from the top, front and side of each plant. All three images together provide sufficient information to evaluate the biomass, size and morphology of each plant.
- Plants are allowed at least six hours of darkness per twenty four hour period in order to have a normal day/night cycle.
- imaging instrumentation including but not limited to light spectrum digital imaging instrumentation commercially available from
- the images are taken and analyzed with a LemnaTec Scanalyzer HTS LT-0001 -2 having a 1 /2" IT Progressive Scan IEE CCD imaging device.
- the imaging cameras may be equipped with a motor zoom, motor aperture and motor focus. All camera settings may be made using LemnaTec software.
- the instrumental variance of the imaging analyzer is less than about 5% for major components and less than about 10% for minor
- the imaging analysis system comprises a LemnaTec HTS Bonit software program for color and architecture analysis and a server database for storing data from about 500,000 analyses, including the analysis dates.
- the original images and the analyzed images are stored together to allow the user to do as much
- the database can be connected to the imaging hardware for automatic data collection and storage.
- a variety of commercially available software systems e.g. Matlab, others
- Matlab can be used for quantitative interpretation of the imaging data, and any of these software systems can be applied to the image data set.
- a conveyor system with a plant rotating device may be used to transport the plants to the imaging area and rotate them during imaging. For example, up to four plants, each with a maximum height of 1 .5 m, are loaded onto cars that travel over the circulating conveyor system and through the imaging measurement area. In this case the total footprint of the unit (imaging analyzer and conveyor loop) is about 5 m x 5 m.
- the conveyor system can be enlarged to accommodate more plants at a time.
- the plants are transported along the conveyor loop to the imaging area and are analyzed for up to 50 seconds per plant. Three views of the plant are taken.
- the conveyor system, as well as the imaging equipment, should be capable of being used in greenhouse environmental conditions.
- any suitable mode of illumination may be used for the image acquisition.
- a top light above a black background can be used.
- a combination of top- and backlight using a white background can be used.
- the illuminated area should be housed to ensure constant illumination conditions.
- the housing should be longer than the measurement area so that constant light conditions prevail without requiring the opening and closing or doors.
- the illumination can be varied to cause excitation of either transgene (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP)) or endogenous (e.g.
- transgene e.g., green fluorescent protein (GFP), red fluorescent protein (RFP)
- endogenous e.g.
- Chlorophyll fluorophores Chlorophyll fluorophores.
- the plant images should be taken from at least three axes, for example, the top and two side (sides 1 and 2) views. These images are then analyzed to separate the plant from the background, pot and pollen control bag (if applicable).
- the volume of the plant can be estimated by the calculation:
- Volume(voxels) ⁇ TopArea(pixels) x ⁇ SidelArea(pixels) x ⁇ ' Side2Area(pixels)
- the units of volume and area are "arbitrary units".
- Arbitrary units are entirely sufficient to detect gene effects on plant size and growth in this system because what is desired is to detect differences (both positive-larger and negative-smaller) from the experimental mean, or control mean.
- the arbitrary units of size (e.g. area) may be trivially converted to physical measurements by the addition of a physical reference to the imaging process. For instance, a physical reference of known area can be included in both top and side imaging processes. Based on the area of these physical references a conversion factor can be determined to allow conversion from pixels to a unit of area such as square centimeters (cm 2 ).
- the physical reference may or may not be an independent sample. For instance, the pot, with a known diameter and height, could serve as an adequate physical reference.
- the imaging technology may also be used to determine plant color and to assign plant colors to various color classes.
- the assignment of image colors to color classes is an inherent feature of the LemnaTec software. With other image analysis software systems color classification may be determined by a variety of computational approaches.
- a useful classification scheme is to define a simple color scheme including two or three shades of green and, in addition, a color class for chlorosis, necrosis and bleaching, should these conditions occur.
- a background color class which includes non plant colors in the image (for example pot and soil colors) is also used and these pixels are specifically excluded from the determination of size.
- the plants are analyzed under controlled constant illumination so that any change within one plant over time, or between plants or different batches of plants (e.g. seasonal differences) can be quantified.
- Improvement in yield may be assessed by a color classification that separates shades of green from shades of yellow and brown (which are indicative of senescing tissues).
- a color classification that separates shades of green from shades of yellow and brown (which are indicative of senescing tissues).
- Green/Yellow Ratio Green/Yellow Ratio
- Transgenes which modify plant architecture parameters may also be identified using the present invention, including such parameters as maximum height and width, internodal distances, angle between leaves and stem, number of leaves starting at nodes and leaf length.
- the LemnaTec system software may be used to determine plant architecture as follows. The plant is reduced to its main geometric architecture in a first imaging step and then, based on this image, parameterized identification of the different architecture parameters can be performed. Transgenes that modify any of these architecture parameters either singly or in combination can be identified by applying the statistical approaches previously described.
- Pollen shed date is an important parameter to be analyzed in a transformed plant, and may be determined by the first appearance on the plant of an active male flower. To find the male flower object, the upper end of the stem is classified by color to detect yellow or violet anthers. This color classification analysis is then used to define an active flower, which in turn can be used to calculate pollen shed date.
- pollen shed date and other easily visually detected plant attributes can be recorded by the personnel responsible for performing plant care.
- pollination date, first silk date can be recorded by the personnel responsible for performing plant care.
- this data is tracked by utilizing the same barcodes utilized by the
- LemnaTec light spectrum digital analyzing device A computer with a barcode reader, a palm device, or a notebook PC may be used for ease of data capture recording time of observation, plant identifier, and the operator who captured the data.
- Mature maize plants grown at densities approximating commercial planting often have a planar architecture. That is, the plant has a clearly discernable broad side, and a narrow side.
- the image of the plant from the broadside is determined.
- To each plant a well defined basic orientation is assigned to obtain the maximum difference between the broadside and edgewise images.
- the top image is used to determine the main axis of the plant, and an additional rotating device is used to turn the plant to the appropriate orientation prior to starting the main image acquisition.
- Transgenic Gaspe Flint derived maize lines containing the candidate gene can be screened for tolerance to drought stress in the following manner.
- Transgenic maize plants are subjected to well-watered conditions (control) and to drought-stressed conditions. Transgenic maize plants are screened at the T1 stage or later.
- the soil mixture consists of 1 ⁇ 2 TURFACE®, 1 ⁇ 2 SB300 and 1 ⁇ 2 sand. All pots are filled with the same amount of soil ⁇ 10 grams. Pots are brought up to 100% field capacity ("FC") by hand watering. All plants are maintained at 60% FC using a 20-10-20 (N-P-K) 125 ppm N nutrient solution. Throughout the experiment pH is monitored at least three times weekly for each table. Starting at 13 days after planting (DAP), the experiment can be divided into two treatment groups, well watered and reduce watered. All plants comprising the reduced watered treatment are maintained at 40% FC while plants in the well watered treatment are maintained at 80% FC.
- FC field capacity
- Lines with Enhanced Drought Tolerance can also be screened using the following method (see also FIG. 3 for treatment schedule):
- Transgenic maize seedlings are screened for drought tolerance by measuring chlorophyll fluorescence performance, biomass accumulation, and drought survival. Transgenic plants are compared against the null plant (i.e., not containing the transgene). Experimental design is a Randomized Complete Block and Replication consist of 13 positive plants from each event and a construct null (2 negatives each event).
- WW well watered
- %FC Field Capacity
- SEV DRT severe drought stress
- REC recovery
- variable "Fv'/Fm' no stress” is a measure of the optimum quantum yield (Fv'/Fm') under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib.
- Fv'/Fm' provides an estimate of the maximum efficiency of PSII photochemistry at a given PPFD, which is the PSII operating efficiency if all the PSII centers were open (QA oxidized) .
- the variable "Fv'/Fm' stress” is a measure of the optimum quantum yield (Fv'/Fm') under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.
- phiPSII no stress is a measure of Photosystem II (PSII) efficiency under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib.
- the phiPSII value provides an estimate of the PSII operating efficiency, which estimates the efficiency at which light absorbed by PSII is used for Q A reduction.
- phiPSII_stress is a measure of Photosystem II (PSII) efficiency under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.
- a recombinant DNA construct containing a validated Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.
- Transgenic plants, either inbred or hybrid, can undergo more vigorous field- based experiments to study yield enhancement and/or stability under well-watered and water-limiting conditions.
- Subsequent yield analysis can be done to determine whether plants that contain the validated Arabidopsis lead gene have an improvement in yield performance under water-limiting conditions, when compared to the control plants that do not contain the validated Arabidopsis lead gene.
- drought conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants.
- Reduction in yield can be measured for both. Plants containing the validated Arabidopsis lead gene have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss.
- the above method may be used to select transgenic plants with increased yield, under water-limiting conditions and/or well-watered conditions, when compared to a control plant not comprising said recombinant DNA construct.
- Plants containing the validated Arabidopsis lead gene may have increased yield, under water-limiting conditions and/or well-watered conditions, relative to the control plants, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield.
- AT-RING-H2 polypeptide present in the vector PHP45754 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14A and 14B.
- Clones cfp5n.pk073.p4 and cfp6n.pk073.c17 encode maize RING-H2 polypeptides designated "Zm-RING-H2a", “Zm-RING-H2b” (SEQ ID NOS:20 and 22, respectively).
- the protein-coding region of these clones can be introduced into the INVITROGENTM vector pENTR/D-TOPO® to create entry clones.
- an LR Recombination Reaction can be performed with the entry clone and a destination vector to create a precursor plasmid.
- the precursor plasmid contains the following expression cassettes:
- Ubiquitin promoter::moPAT::Pinll terminator cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.
- LTP2 promoter :DS-RED2::Pinll terminator; cassette expressing the DS- RED color marker gene used for seed sorting.
- Ubiquitin promoter :Zm-RING-H2-Polypeptide::Pinll terminator; cassette overexpressing the gene of interest, maize RING-H2 polypeptide.
- the maize RING-H2 polypeptide expression cassette present in the vector can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.
- the co-integrate vector is formed by recombination of the 2 plasmids, the precursor plasmid and PHP10523, through the COS recombination sites contained on each vector.
- the co-integrate vector contains the same 3 expression cassettes as above (Example 20A) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1 , VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-med ⁇ aied transformation.
- each expression vector contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-med ⁇ aied
- soybean homologs of validated Arabidopsis lead genes can be identified and also be assessed for their ability to enhance drought tolerance in soybean.
- Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.
- Soybean and maize homologs to validated Arabidopsis lead genes can be transformed into Arabidopsis under control of the 35S promoter and assessed for their ability to enhance drought tolerance in Arabidopsis.
- Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.
- Seeds from an Arabidopsis activation-tagged mutant line can be tested for emergence after cold stress at 4°C. Each trial can consist of a 96 well plate of MS/GELRITE® medium with an individual seed in each well .
- MS/GELRITE® medium is prepared as follows: 0.215 g of PHYTOTECHNOLOGY
- Row "A" of each plate is filled with Arabidopsis thaliana Colombia wild-type seed as a control.
- the seeds are sterilized with 20% bleach (20% bleach; 0.05% TWEEN® 20) and placed into 1 % agarose.
- the sterilized seed is covered with aluminum and placed into the wall refrigerator at 4 °C for three days. After cold dark stratification treatment the seeds are plated onto 96 well plates and placed in a dark growth chamber at 4 °C. Each plate is labeled with a unique plate number.
- germination counts are taken using a dissecting microscope. The plates are then removed from 4 °C and placed on the lab bench at 22-25 °C. Seedlings are allowed to grow within the plates until the two leaf stage (3-4 days), and are sprayed with glufosinate herbicide (e.g., 0.002% FINALE® herbicide). After the non-transgenic seedlings have died from the herbicide spray (approximately three days), the number of germinated activation- tagged transgenic seeds are assessed.
- glufosinate herbicide e.g., 0.002% FINALE® herbicide
- Arabidopsis activation-tagged line 1 1 1664 can be screened for seedling emergence under cold temperature stress as described in Example 24A.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Isolated polynucleotides and polypeptides and recombinant DNA constructs useful for conferring drought tolerance, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs. The recombinant DNA construct comprises a polynucleotide operably linked to a promoter that is functional in a plant, wherein said polynucleotide encodes a RING-H2 polypeptide.
Description
TITLE
DROUGHT TOLERANT PLANTS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING RING-H2 POLYPEPTIDES This application claims the benefit of U.S. Application No. 61 /786778, filed
March 15, 2013, now pending, the entire content of which is hereby incorporated by reference.
FIELD OF THE INVENTION
The field of invention relates to plant breeding and genetics and, in particular, relates to recombinant DNA constructs useful in plants for conferring tolerance to drought.
BACKGROUND OF THE INVENTION
Abiotic stress is the primary cause of crop loss worldwide, causing average yield losses of more than 50% for major crops (Boyer, J.S. (1982) Science 218:443- 448; Bray, E.A. et al . (2000) In Biochemistry and Molecular Biology of Plants, Edited by Buchannan, B.B. et al., Amer. Soc. Plant Biol., pp. 1 158-1203). Among the various abiotic stresses, drought is the major factor that limits crop productivity worldwide. Exposure of plants to a water-limiting environment during various developmental stages appears to activate various physiological and developmental changes. Understanding of the basic biochemical and molecular mechanism for drought stress perception, transduction and tolerance is a major challenge in biology. Reviews on the molecular mechanisms of abiotic stress responses and the genetic regulatory networks of drought stress tolerance have been published
(Valliyodan, B., and Nguyen, H.T., (2006) Curr. Opin. Plant Biol . 9:189-195; Wang, W., et al. (2003) Planta 218:1 -14); Vinocur, B., and Altman, A. (2005) Curr. Opin. Biotechnol. 16:123-132; Chaves, M.M., and Oliveira, M.M. (2004) J. Exp. Bot.
55:2365-2384; Shinozaki, K., et al. (2003) Curr. Opin. Plant Biol. 6:410-417;
Yamaguchi-Shinozaki, K., and Shinozaki, K. (2005) Trends Plant Sci. 10:88-94).
Earlier work on molecular aspects of abiotic stress responses was
accomplished by differential and/or subtractive analysis (Bray, E.A. (1993) Plant Physiol. 103:1035-1040; Shinozaki, K., and Yamaguchi-Shinozaki, K. (1997) Plant Physiol. 1 15:327-334; Zhu, J.-K. et al. (1997) Crit. Rev. Plant Sci. 16:253-277;
Thomashow, M.F. (1999) Annu. Rev. Plant Physiol. Plant Mol. Biol. 50:571 - 599). Other methods include selection of candidate genes and analyzing
expression of such a gene or its active product under stresses, or by functional complementation in a stressor system that is well defined (Xiong, L, and Zhu, J.-K. (2001 ) Physiologia Plantarum 1 12:152-166). Additionally, forward and reverse genetic studies involving the identification and isolation of mutations in regulatory genes have also been used to provide evidence for observed changes in gene expression under stress or exposure (Xiong, L, and Zhu, J.-K. (2001 ) Physiologia Plantarum 1 12:152-166).
Activation tagging can be utilized to identify genes with the ability to affect a trait. This approach has been used in the model plant species Arabidopsis thaliana (Weigel, D., et al . (2000) Plant Physiol. 122:1003-1013). Insertions of transcriptional enhancer elements can dominantly activate and/or elevate the expression of nearby endogenous genes. This method can be used to select genes involved in
agronomically important phenotypes, including stress tolerance.
SUMMARY OF THE INVENTION
The present invention includes:
In one embodiment, a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.
In another embodiment, a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said
recombinant DNA construct. Optionally, the plant exhibits said alteration of said at least one agronomic characteristic when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
In another embodiment, the present invention includes any of the plants of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
In another embodiment, the present invention includes seed of any of the plants of the present invention, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein a plant produced from said seed exhibits either an increased drought tolerance, or an alteration of at least one agronomic characteristic, or both, when compared to a control plant not comprising said recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
In another embodiment, a method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) regenerating a transgenic plant from the
regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) obtaining a progeny plant derived from the transgenic plant of step (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
In another embodiment, a method of selecting for increased drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
In another embodiment, a method of selecting for an alteration of at least one agronomic characteristic in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the transgenic plant of part (b) that exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct. Optionally, said selecting step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
In another embodiment, the present invention includes any of the methods of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
In another embodiment, the present invention includes an isolated polynucleotide comprising: (a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , or (b) a full complement of the nucleotide sequence, wherein the full
complement and the nucleotide sequence consist of the same number of
nucleotides and are 100% complementary. The polypeptide may comprise the amino acid sequence of SEQ ID NO:18, 20, 22, 23-63 or 64 . The nucleotide sequence may comprise the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 .
In another embodiment, the present invention concerns a recombinant DNA construct comprising any of the isolated polynucleotides of the present invention operably linked to at least one regulatory sequence, and a cell, a microorganism, a plant, and a seed comprising the recombinant DNA construct. The cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.
In another embodiment, a plant comprising in its genome a polynucleotide
(optionally an endogenous polynucleotide) operably linked to at least one
heterologous regulatory element (e.g., a recombinant element such as at least one enhancer element), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element.
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING
The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application.
FIG. 1 A - 1 D show the multiple alignment of the amino acid sequences of the RING-H2 polypeptides of SEQ ID NOs:18, 20, 22, 61 -64. Residues that are identical to the residue of SEQ ID NO:18 at a given position are enclosed in a box. A consensus sequence (SEQ ID NO:67) is presented where a residue is shown if identical in all sequences, otherwise, a period is shown.
The conserved residues of the RING-H2 motif of the RING-H2 polypeptides are shown boxed in the consensus sequence.
FIG. 2 shows the percent sequence identity and the divergence values for each pair of amino acids sequences of RING-H2 polypeptides displayed in FIG. 1 A - 1 D.
FIG. 3 shows the treatment schedule for screening plants with enhanced drought tolerance.
FIG.4 shows the yield analysis of maize lines transformed with PHP45754 encoding the Arabidopsis lead gene At5g43420.
FIG. 5 shows the effect of the transgene on ear height (EARHT), in maize lines transformed with the plasm id PHP45754 encoding the Arabidopsis lead gene At5g43420.
FIG. 6 shows the effect of the transgene on plant height (PLTHT), in maize lines transformed with the plasm id PHP45754 encoding the Arabidopsis lead gene At5g43420.
SEQ ID NO:1 is the nucleotide sequence of the 4x35S enhancer element from the pHSbarENDs2 activation tagging vector.
SEQ ID NO:2 is the nucleotide sequence of the attP1 site.
SEQ ID NO:3 is the nucleotide sequence of the attP2 site.
SEQ ID NO:4 is the nucleotide sequence of the attl_1 site.
SEQ ID NO:5 is the nucleotide sequence of the attl_2 site.
SEQ ID NO:6 is the nucleotide sequence of the ubiquitin promoter with 5' UTR and first intron from Zea mays.
SEQ ID NO:7 is the nucleotide sequence of the Pinll terminator from Solanum tuberosum.
SEQ ID NO:8 is the nucleotide sequence of the attR1 site.
SEQ ID NO:9 is the nucleotide sequence of the attR2 site.
SEQ ID NO:10 is the nucleotide sequence of the attB1 site.
SEQ ID NO:1 1 is the nucleotide sequence of the attB2 site.
SEQ ID NO:12 is the nucleotide sequence of the At5g43420-5'attB forward primer, containing the attB1 sequence, used to amplify the At5g43420 protein- coding region.
SEQ ID NO:13 is the nucleotide sequence of the At5g43420-3'attB reverse primer, containing the attB2 sequence, used to amplify the At5g43420 protein- coding region.
SEQ ID NO:14 is the nucleotide sequence of the VC062 primer, containing the T3 promoter and attB1 site, useful to amplify cDNA inserts cloned into a
BLUESCRIPT® II SK(+) vector (Stratagene).
SEQ ID NO:15 is the nucleotide sequence of the VC063 primer, containing the T7 promoter and attB2 site, useful to amplify cDNA inserts cloned into a
BLUESCRIPT® II SK(+) vector (Stratagene).
SEQ ID NO:16 corresponds to NCBI Gl No. 30694289, which is the cDNA sequence from locus At5g43420 encoding an Arabidopsis RING-finger polypeptide.
SEQ ID NO:17 is the protein coding (CDS sequence) for AT-RING-H2.
SEQ ID NO:18 corresponds to NCBI Gl No.15239865, the amino acid sequence of At5g43420 encoded by SEQ ID NO:16.
Table 1 presents SEQ ID NOs for the nucleotide sequences obtained from cDNA clones from corn. The SEQ ID NOs for the corresponding amino acid sequences encoded by the cDNAs are also presented.
TABLE 1
cDNAs Encoding RING-H2 Polypeptides
*The "Full-Insert Sequence" ("FIS") is the sequence of the entire cDNA insert.
SEQ ID NO:23 is the amino acid sequence corresponding to NCBI Gl No. 15219716, encoded by the locus At1 g04360 {Arabidopsis thaliana).
SEQ ID NO:24 is the amino acid sequence corresponding to NCBI Gl No. 15237991 , encoded by the locus At5g17600 {Arabidopsis thaliana).
SEQ ID NO:25 is the amino acid sequence corresponding to NCBI Gl No. 18396583, encoded by the locus At3g03550 {Arabidopsis thaliana).
SEQ ID NO:26 is the amino acid sequence corresponding to NCBI Gl No. 18651 1980, encoded by the locus At4g17905 {Arabidopsis thaliana).
SEQ ID NO:27 is the amino acid sequence corresponding to the locus
LOC_Os02g57460.1 , a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
SEQ ID NO:28 is the amino acid sequence corresponding to the locus
LOC_Os03g05560.1 , a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6
SEQ ID NO:29 is the amino acid sequence corresponding to the locus
LOC_Os02g46600.1 , a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
SEQ ID NO:30 is the amino acid sequence corresponding to the locus
LOC_Os04g50100.1 , a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
SEQ ID NO:31 is the amino acid sequence corresponding to the locus
LOC_Os03g05570.1 , a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6.
SEQ ID NO:32 is the amino acid sequence corresponding to Sb01 g046940.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
SEQ ID NO:33 is the amino acid sequence corresponding to Sb04g037520.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
SEQ ID NO:34 is the amino acid sequence corresponding to Sb04g031240.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
SEQ ID NO:35 is the amino acid sequence corresponding to Sb06g026980.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
SEQ ID NO:36 is the amino acid sequence corresponding to Sb01 g046930.1 , a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1 .4 from the US Department of energy Joint Genome Institute.
SEQ ID NO:37 is the amino acid sequence corresponding to
Glyma20g34540.1 , a soybean (Glycine max) predicted protein from predicted
coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:38 is the amino acid sequence corresponding to
Glymal 0g33090.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:39 is the amino acid sequence corresponding to
Glymal 0g04140.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:40 is the amino acid sequence corresponding to
Glymal 3g18320.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:41 is the amino acid sequence corresponding to
Glymal 0g01000.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:42 is the amino acid sequence corresponding to
Glyma20g22040.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:43 is the amino acid sequence corresponding to
Glymal 9g34640.1 , a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glymal .01 genomic sequence from the US Department of energy Joint Genome Institute.
SEQ ID NO:44 is the amino acid sequence corresponding to NCBI Gl No. 224107873 (Populus trichocarpa).
SEQ ID NO:45 is the amino acid sequence corresponding to NCBI Gl No. 225433055 {Vitis vinifera).
SEQ ID NO:46 is the amino acid sequence corresponding to NCBI Gl No. 255576814 (Ricinus communis).
SEQ ID NO:47 is the amino acid sequence corresponding to NCBI Gl No. 224062153 {Populus trichocarpa).
SEQ ID NO:48 is the amino acid sequence corresponding to NCBI Gl No. 255583204 (Ricinus communis).
SEQ ID NO:49 is the amino acid sequence corresponding to NCBI Gl No.
297744127 (Vitis vinifera).
SEQ ID NO:50 (AC190771_29) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:51 (AC198979_65) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:52 (AC188126_44) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:53 (AC192457_18) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:54 (AC185621_2) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:55 (AC190771_39) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:56 (AC204551_34) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:57 (AC187083_54) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:58 (AC196578_64) is a maize amino acid sequence from a public database (Zea mays).
SEQ ID NO:59 is the amino acid sequence corresponding to NCBI Gl NO.
293336774 (Zea mays).
SEQ ID NO:60 is the amino acid sequence corresponding to NCBI Gl No. 225437852 (Vitis vinifera).
SEQ ID NO:61 is the amino acid sequence corresponding to NCBI Gl No. 194703040 (Zea mays).
SEQ ID NO:62 is the amino acid sequence presented in SEQ ID NO: 421 18 of US Publication No. US20120017338 (Zea mays).
SEQ ID NO:63 is the amino acid sequence corresponding to NCBI Gl No. 399529262 (Eragrsotis tef).
SEQ ID NO:64 is the amino acid sequence presented in SEQ ID NO: 10259 of PCT International Patent Publication No. WO2009134339 (Zea mays).
SEQ ID NO:65 is the consensus sequence for RING-H2 domain motif sequence for the RING-H2 polypeptides described in the current invention.
SEQ ID NO:66 is the amino acid sequence presented in SEQ ID NO: 1 197 of US Publication No. US20090144849 {Arabidopsis thaliana).
The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §1 .821 -1 .825.
The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the lUPAC-IUBMB standards described in Nucleic Acids Res. 73:3021 -3030 (1985) and in the Biochemical J. 219 (No. 2^:345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1 .822.
DETAILED DESCRIPTION
The disclosure of each reference set forth herein is hereby incorporated by reference in its entirety.
As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants, reference to "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.
As used herein:
The term "AT-RING-H2 polypeptide" or "ATL16" refers to an Arabidopsis thaliana protein that confers a drought tolerance phenotype and is encoded by the Arabidopsis thaliana locus At5g43420. "RING-H2 polypeptide" refers to a protein with a Drought Tolerance Phenotype and refers herein to AT-RING-H2 polypeptide and its homologs from other organisms.
The RING finger is a class of zinc-finger domain that uses a distinct "cross- brace" arrangement of cysteine and histidine residues to bind two zinc-ions. The
RING-H2 polypeptides contain the RING-H2 variation of the canonical RING finger domain, in which the fifth cysteine residue is replaced by a histidine residue.
RING-H2 polypeptides contain a RING-H2 finger domain comprised of two cysteines corresponding to the third and sixth zinc ligands, two histidines
corresponding to the fourth and fifth zinc ligands, a highly conserved proline spaced out a residue upstream from the third zinc ligand, and a highly conserved tryptophan spaced out three residues downstream from the sixth zinc ligand. (Serrano et al. (2006) J Mol Evol, 62:434-445, Kosarev et al Genome Biology Vol 3 No 4 :1 -12; US Patent No. US 7,977,535).
The RING-H2 domain has the signature motif
CX2CX(9-39)CX(1-3)HX(2-3)HX2CX(4-48)CX2C
The consensus sequence of the RING-H2 domain in the RING-H2
polypeptide of the current invention is given in SEQ ID NO:65, given below.
CX2CX3FX9PXCXHXFHXXCX3WX6CPXCR
ATL16 belongs to a particular family of RING (Really Interesting New Gene) finger proteins, named ATL that includes at least 80 members in A. thaliana and 121 in O. sativa. The name ATL (Arabidopsis To'xicos en Levadura) was given because ATL2 (the first member of the family described) was identified as a conditionally toxic A. thaliana cDNA when overexpressed in Saccharomyces cerevisiae.
In one embodiment, the RING-H2 polypeptides described in the current invention comprise SEQ ID NO:65.
ATL16 has been shown to be induced in the A thaliana eca (expresio'n constitutiva de ATL2) mutants that show alterations on the expression of several defense related genes (Serrano et al. (2004), Genetic 167:919-929). Hoth et al. have shown the down regulation of At5g43420 gene expression in response to ABA (Hoth et al., (2002) Journal of Cell Science 1 15, 4891 -4900; Aguilar-Herna'ndez, V. et al. (201 1 ) PLoS one ;August 6(8):e23934).
The terms "monocot" and "monocotyledonous plant" are used
interchangeably herein. A monocot of the current invention includes the Gramineae.
The terms "dicot" and "dicotyledonous plant" are used interchangeably herein. A dicot of the current invention includes the following families:
Brassicaceae, Leguminosae, and Solanaceae.
The terms "full complement" and "full-length complement" are used
interchangeably herein, and refer to a complement of a given nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.
An "Expressed Sequence Tag" ("EST") is a DNA sequence derived from a cDNA library and therefore is a sequence which has been transcribed. An EST is typically obtained by a single sequencing pass of a cDNA insert. The sequence of an entire cDNA insert is termed the "Full-Insert Sequence" ("FIS"). A "Contig" sequence is a sequence assembled from two or more sequences that can be selected from, but not limited to, the group consisting of an EST, FIS and PCR sequence. A sequence encoding an entire or functional protein is termed a
"Complete Gene Sequence" ("CGS") and can be derived from an FIS or a contig.
A "trait" refers to a physiological, morphological, biochemical, or physical characteristic of a plant or a particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar concentrations, or by the observation of the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.
"Agronomic characteristic" is a measurable parameter including but not limited to, abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.
Abiotic stress may be at least one condition selected from the group consisting of: drought, water deprivation, flood, high light intensity, high temperature, low temperature, salinity, etiolation, defoliation, heavy metal toxicity, anaerobiosis,
nutrient deficiency, nutrient excess, UV irradiation, atmospheric pollution (e.g., ozone) and exposure to chemicals (e.g., paraquat) that induce production of reactive oxygen species (ROS).
"Increased stress tolerance" of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under stress conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar stress conditions.
A plant with "increased stress tolerance" can exhibit increased tolerance to one or more different stress conditions.
"Stress tolerance activity" of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased stress tolerance to the transgenic plant relative to a reference or control plant.
Increased biomass can be measured, for example, as an increase in plant height, plant total leaf area, plant fresh weight, plant dry weight or plant seed yield, as compared with control plants.
The ability to increase the biomass or size of a plant would have several important commercial applications. Crop species may be generated that produce larger cultivars, generating higher yield in, for example, plants in which the vegetative portion of the plant is useful as food, biofuel or both.
Increased leaf size may be of particular interest. Increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products. An increase in total plant photosynthesis is typically achieved by increasing leaf area of the plant. Additional photosynthetic capacity may be used to increase the yield derived from particular plant tissue, including the leaves, roots, fruits or seed, or permit the growth of a plant under decreased light intensity or under high light intensity.
Modification of the biomass of another tissue, such as root tissue, may be useful to improve a plant's ability to grow under harsh environmental conditions, including drought or nutrient deprivation, because larger roots may better reach water or nutrients or take up water or nutrients.
For some ornamental plants, the ability to provide larger varieties would be highly desirable. For many plants, including fruit-bearing trees, trees that are used
for lumber production, or trees and shrubs that serve as view or wind screens, increased stature provides improved benefits in the forms of greater yield or improved screening.
The growth and emergence of maize silks has a considerable importance in the determination of yield under drought (Fuad-Hassan et al. 2008 Plant Cell Environ. 31 :1349-1360). When soil water deficit occurs before flowering, silk emergence out of the husks is delayed while anthesis is largely unaffected, resulting in an increased anthesis-silking interval (ASI) (Edmeades et al . 2000 Physiology and Modeling Kernel set in Maize (eds M.E.Westgate & K. Boote; CSSA (Crop Science Society of America)Special Publication No.29. Madison, Wl: CSSA, 43-73). Selection for reduced ASI has been used successfully to increase drought tolerance of maize (Edmeades et al. 1993 Crop Science 33: 1029-1035; Bolanos & Edmeades 1996 Field Crops Research 48:65-80; Bruce et al. 2002 J. Exp. Botany 53:13-25).
Terms used herein to describe thermal time include "growing degree days" (GDD), "growing degree units" (GDU) and "heat units" (HU).
"Transgenic" refers to any cell, cell line, callus, tissue, plant part or plant, the genome of which has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct, including those initial transgenic events as well as those created by sexual crosses or asexual propagation from the initial transgenic event. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross- fertilization, non-recombinant viral infection, non-recombinant bacterial
transformation, non-recombinant transposition, or spontaneous mutation.
"Genome" as it applies to plant cells encompasses not only chromosomal
DNA found within the nucleus, but organelle DNA found within subcellular
components (e.g., mitochondrial, plastid) of the cell.
"Plant" includes reference to whole plants, plant organs, plant tissues, plant propagules, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
"Propagule" includes all products of meiosis and mitosis able to propagate a new plant, including but not limited to, seeds, spores and parts of a plant that serve as a means of vegetative reproduction, such as corms, tubers, offsets, or runners. Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention).
"Progeny" comprises any subsequent generation of a plant.
"Transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. For example, the heterologous
polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.
The commercial development of genetically improved germplasm has also advanced to the stage of introducing multiple traits into crop plants, often referred to as a gene stacking approach. In this approach, multiple genes conferring different characteristics of interest can be introduced into a plant. Gene stacking can be accomplished by many means including but not limited to co-transformation, retransformation, and crossing lines with different transgenes.
"Transgenic plant" also includes reference to plants which comprise more than one heterologous polynucleotide within their genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant.
"Heterologous" with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human
intervention.
"Polynucleotide", "nucleic acid sequence", "nucleotide sequence", or "nucleic acid fragment" are used interchangeably and is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are referred to by their single letter designation as follows: "A" for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate,
"G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide.
"Polypeptide", "peptide", "amino acid sequence" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence", and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.
"Messenger RNA (mRNA)" refers to the RNA that is without introns and that can be translated into protein by the cell.
"cDNA" refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase. The cDNA can be single- stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase I.
"Coding region" refers to the portion of a messenger RNA (or the
corresponding portion of another nucleic acid molecule such as a DNA molecule) which encodes a protein or polypeptide. "Non-coding region" refers to all portions of a messenger RNA or other nucleic acid molecule that are not a coding region, including but not limited to, for example, the promoter region, 5' untranslated region ("UTR"), 3' UTR, intron and terminator. The terms "coding region" and "coding sequence" are used interchangeably herein. The terms "non-coding region" and "non-coding sequence" are used interchangeably herein.
"Mature" protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or pro-peptides present in the primary translation product have been removed.
"Precursor" protein refers to the primary product of translation of mRNA; i.e., with pre- and pro-peptides still present. Pre- and pro-peptides may be and are not limited to intracellular localization signals.
"Isolated" refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally
accompany or interact with the materials in a naturally occurring environment.
Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.
"Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
"Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural
transformation/transduction/transposition) such as those occurring without deliberate human intervention.
"Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a
recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein.
The terms "entry clone" and "entry vector" are used interchangeably herein. "Regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein.
"Promoter" refers to a nucleic acid fragment capable of controlling
transcription of another nucleic acid fragment.
"Promoter functional in a plant" is a promoter capable of controlling
transcription in plant cells whether or not its origin is from a plant cell.
"Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably, and refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell.
"Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events.
"Operably linked" refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.
"Expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.
"Phenotype" means the detectable characteristics of a cell or organism.
"Introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.
"Transformation" as used herein refers to both stable transformation and transient transformation.
"Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.
"Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.
"Allele" is one of several alternative forms of a gene occupying a given locus on a chromosome. When the alleles present at a given locus on a pair of
homologous chromosomes in a diploid plant are the same that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant that plant is hemizygous at that locus.
A "chloroplast transit peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made (Lee et al. (2008) Plant Cell 20:1603-1622). The terms "chloroplast transit peptide" and "plastid transit peptide" are used interchangeably herein. "Chloroplast transit sequence" refers to a nucleotide sequence that encodes a chloroplast transit peptide. A "signal peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels (1991 ) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21 -53). If the protein is to be directed to a vacuole, a vacuolar targeting signal (supra) can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added. If the protein is to be directed to the nucleus, any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel (1992) Plant Phys. 700:1627-1632). A "mitochondrial signal peptide" is an amino acid sequence which directs a precursor protein into the mitochondria (Zhang and Glaser (2002) Trends Plant Sci 7:14-21 ).
Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE®
bioinformatics computing suite (DNASTAR® Inc., Madison, Wl). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS.
5:151 -153) with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1 , GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and
DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.
Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5:151 -153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in the MegAlign™ v6.1 program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow-Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain "percent identity" and
"divergence" values by viewing the "sequence distances" table in the same program.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook").
Complete sequences and figures for vectors described herein (e.g., pHSbarENDs2, pDONR™/Zeo, pDONR™221 , pBC-yellow, PHP27840, PHP23236, PHP10523, PHP23235 and PHP28647) are given in PCT Publication No.
WO/2012/058528, the contents of which are herein incorporated by reference.
Turning now to the embodiments:
Embodiments include isolated polynucleotides and polypeptides,
recombinant DNA constructs useful for conferring drought tolerance, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs.
Isolated Polynucleotides and Polypeptides:
The present invention includes the following isolated polynucleotides and polypeptides:
An isolated polynucleotide comprising: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and
combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs
(including suppression DNA constructs) of the present invention. The polypeptide is preferably a RING-H2 polypeptide. The polypeptide preferably has drought tolerance activity.
An isolated polypeptide having an amino acid sequence of at least 50%,
51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and combinations thereof. The polypeptide is preferably a RING-H2
polypeptide. The polypeptide preferably has drought tolerance activity
An isolated polynucleotide comprising (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 17, 19 or 21 , and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present invention. The isolated polynucleotide preferably encodes a RING-H2 polypeptide. The RING- H2 polypeptide preferably has drought tolerance activity.
An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NOS:16, 17, 19 or 21 . The isolated polynucleotide preferably encodes a RING-H2 polypeptide. The RING-H2 polypeptide preferably has drought tolerance activity.
An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is derived from SEQ ID NOS:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion. The isolated polynucleotide preferably encodes a RING-H2 polypeptide. The RING-H2 polypeptide preferably has drought tolerance activity.
An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence corresponds to an allele of SEQ ID NOS:16, 17, 19 or 21 .
It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is
determination of retention of biological activity of the encoded products.
The protein of the current invention may also be a protein which comprises an amino acid sequence comprising deletion, substitution, insertion and/or addition of one or more amino acids in an amino acid sequence presented in SEQ ID NO:18, 20, 22, 23-63 or 64. The substitution may be conservative, which means the replacement of a certain amino acid residue by another residue having similar
physical and chemical characteristics. Non-limiting examples of conservative substitution include replacement between aliphatic group-containing amino acid residues such as lie, Val, Leu or Ala, and replacement between polar residues such as Lys-Arg, Glu-Asp or Gln-Asn replacement.
Proteins derived by amino acid deletion, substitution, insertion and/or addition can be prepared when DNAs encoding their wild-type proteins are subjected to, for example, well-known site-directed mutagenesis (see, e.g., Nucleic Acid Research, Vol. 10, No. 20, p.6487-6500, 1982, which is hereby incorporated by reference in its entirety). As used herein, the term "one or more amino acids" is intended to mean a possible number of amino acids which may be deleted, substituted, inserted and/or added by site-directed mutagenesis.
Site-directed mutagenesis may be accomplished, for example, as follows using a synthetic oligonucleotide primer that is complementary to single-stranded phage DNA to be mutated, except for having a specific mismatch (i.e., a desired mutation). Namely, the above synthetic oligonucleotide is used as a primer to cause synthesis of a complementary strand by phages, and the resulting duplex DNA is then used to transform host cells. The transformed bacterial culture is plated on agar, whereby plaques are allowed to form from phage-containing single cells. As a result, in theory, 50% of new colonies contain phages with the mutation as a single strand, while the remaining 50% have the original sequence. At a temperature which allows hybridization with DNA completely identical to one having the above desired mutation, but not with DNA having the original strand, the resulting plaques are allowed to hybridize with a synthetic probe labeled by kinase treatment.
Subsequently, plaques hybridized with the probe are picked up and cultured for collection of their DNA.
Techniques for allowing deletion, substitution, insertion and/or addition of one or more amino acids in the amino acid sequences of biologically active peptides such as enzymes while retaining their activity include site-directed mutagenesis mentioned above, as well as other techniques such as those for treating a gene with a mutagen, and those in which a gene is selectively cleaved to remove, substitute, insert or add a selected nucleotide or nucleotides, and then ligated.
The protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence comprising deletion,
substitution, insertion and/or addition of one or more nucleotides in the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 . Nucleotide deletion, substitution, insertion and/or addition may be accomplished by site-directed mutagenesis or other techniques as mentioned above.
The protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence hybridizable under stringent conditions with the complementary strand of the nucleotide sequence of SEQ ID NO:16, 17, 19 or 21 .
The term "under stringent conditions" means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5xSSC, 0.5% SDS, 1 .0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC to 6xSSC at about 40-50 °C (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42 °C) and washing conditions of, for example, about 40- 60 °C, 0.5-6xSSC, 0.1 % SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50 °C and 6xSSC. Highly stringent conditions can also be readily determined by those skilled in the art, e.g., depending on the length of DNA.
Generally, such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65 °C, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably 2xSSC, most preferably 0.2xSSC), compared to the moderately stringent conditions. For example, highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68 °C, 0.2xSSC, 0.1 % SDS. SSPE (I xSSPE is 0.15 M NaCI, 10 mM NaH2PO4, and 1 .25 mM EDTA, pH 7.4) can be substituted for SSC (1 xSSC is 0.15 M NaCI and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.
It is also possible to use a commercially available hybridization kit which uses no radioactive substance as a probe. Specific examples include hybridization with
an ECL direct labeling & detection system (Amersham). Stringent conditions include, for example, hybridization at 42 °C for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCI, and washing twice in 0.4% SDS, 0.5xSSC at 55 °C for 20 minutes and once in 2xSSC at room temperature for 5 minutes.
Recombinant DNA Constructs and Suppression DNA Constructs:
In one aspect, the present invention includes recombinant DNA constructs (including suppression DNA constructs).
In one embodiment, a recombinant DNA construct comprises a
polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and
combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i).
In another embodiment, a recombinant DNA construct comprises a
polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 17, 19 or 21 , and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i).
In another embodiment, a recombinant DNA construct comprises a
polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide encodes a RING-H2 polypeptide. The RING-H2 polypeptide preferably has drought tolerance activity . The RING-H2 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine
tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor, Saccharum officinarum,or Triticum aestivum
In another aspect, the present invention includes suppression DNA constructs.
A suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a RING-H2 polypeptide; or (c) all or part of: (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 17, 19 or 21 , and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (c)(i). The suppression DNA construct may comprise a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct).
It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is
determination of retention of biological activity of the encoded products.
"Suppression DNA construct" is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in "silencing" of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. "Silencing," as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The terms
"suppression", "suppressing" and "silencing", used interchangeably herein, include lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing.
"Silencing" or "gene silencing" does not specify mechanism and is inclusive, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem- loop suppression, RNAi-based approaches, and small RNA-based approaches.
A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to all or part of the sense strand (or antisense strand) of the gene of interest.
A suppression DNA construct may comprise 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 contiguous nucleotides of the sense strand (or antisense strand) of the gene of interest, and combinations thereof.
Suppression DNA constructs are well-known in the art, are readily
constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.
Suppression of gene expression may also be achieved by use of artificial miRNA precursors, ribozyme constructs and gene disruption. A modified plant miRNA precursor may be used, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the nucleotide sequence of interest. Gene disruption may be achieved by use of transposable elements or by use of chemical agents that cause site-specific mutations.
"Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product.
"Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Patent No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
"Cosuppression" refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Sense" RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA
having homology to the overexpressed sequence (see Vaucheret et al., Plant J. 16:651 -659 (1998); and Gura, Nature 404:804-808 (2000)).
Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083 published on August 20, 1998).
RNA interference refers to the process of sequence-specific post- transcriptional gene silencing in animals mediated by short interfering RNAs
(siRNAs) (Fire et al., Nature 391 :806 (1998)). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post- transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 (1999)).
Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
MicroRNAs (miRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 (2001 ), Lagos-Quintana et al., Curr. Biol. 12:735-739 (2002); Lau et al., Science 294:858-862 (2001 ); Lee and Ambros, Science 294:862-864 (2001 ); Llave et al., Plant Cell 14:1605-1619 (2002);
Mourelatos et al., Genes Dev. 16:720-728 (2002); Park et al., Curr. Biol. 12:1484- 1495 (2002); Reinhart et al., Genes. Dev. 16:1616-1626 (2002)). They are processed from longer precursor transcripts that range in size from approximately
70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures.
MicroRNAs (miRNAs) appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1 ) translational inhibition; and (2) RNA cleavage. MicroRNAs entering the RNA cleavage pathway are analogous to the 21 -25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants, and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
The terms "miRNA-star sequence" and "miRNA* sequence" are used interchangeably herein and they refer to a sequence in the miRNA precursor that is highly complementary to the miRNA sequence. The miRNA and miRNA*
sequences form part of the stem region of the miRNA precursor hairpin structure.
In one embodiment, there is provided a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target. In some embodiments the miRNA comprises about 19, 20, 21 , 22, 23, 24 or 25 nucleotides. In some embodiments the miRNA comprises 21 nucleotides. In some embodiments the nucleic acid construct encodes the miRNA. In some embodiments the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
In some embodiments, the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence. The plant miRNA precursor may be full-length of may comprise a fragment of the full-length precursor. In some embodiments, the endogenous plant miRNA precursor is from a dicot or a monocot. In some embodiments the endogenous miRNA precursor is from Arabidopsis, tomato, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass.
In some embodiments, the miRNA template, (i.e. the polynucleotide encoding the miRNA), and thereby the miRNA, may comprise some mismatches relative to
the target sequence. In some embodiments the miRNA template has > 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence. For example, the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
In some embodiments, the miRNA template, (i.e. the polynucleotide encoding the miRNA) and thereby the miRNA, may comprise some mismatches relative to the miRNA-star sequence. In some embodiments the miRNA template has > 1 nucleotide mismatch as compared to the miRNA-star sequence, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the miRNA-star sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA-star sequence. For example, the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA-star sequence.
Regulatory Sequences:
A recombinant DNA construct (including a suppression DNA construct) of the present invention may comprise at least one regulatory sequence.
A regulatory sequence may be a promoter.
A number of promoters can be used in recombinant DNA constructs of the present invention. The promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.
Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters".
High level, constitutive expression of the candidate gene under control of the 35S or UBI promoter may have pleiotropic effects, although candidate gene efficacy may be estimated when driven by a constitutive promoter. Use of tissue-specific
and/or stress-specific promoters may eliminate undesirable effects but retain the ability to enhance drought tolerance. This effect has been observed in Arabidopsis (Kasuga et al. (1999) Nature Biotechnol. 17:287-91 ).
Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., Nature 313:810-812 (1985)); rice actin (McElroy et al., Plant Cell 2:163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last et al., Theor. Appl. Genet. 81 :581 -588 (1991 )); MAS (Velten et al ., EMBO J. 3:2723- 2730 (1984)); ALS promoter (U.S. Patent No. 5,659,026), the constitutive synthetic core promoter SCP1 (International Publication No. 03/033651 ) and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121 ; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,61 1 .
In choosing a promoter to use in the methods of the invention, it may be desirable to use a tissue-specific or developmentally regulated promoter.
A tissue-specific or developmentally regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant critical to tassel development, seed set, or both, and limits the expression of such a DNA sequence to the period of tassel development or seed maturation in the plant. Any identifiable promoter may be used in the methods of the present invention which causes the desired temporal and spatial expression.
Promoters which are seed or embryo-specific and may be useful in the invention include soybean Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell 1 :1079-1093 (1989)), patatin (potato tubers) (Rocha-Sosa, M., et al. (1989) EMBO J. 8:23-29), convicilin, vicilin, and legumin (pea cotyledons) (Rerie, W.G., et al. (1991 ) Mol. Gen. Genet. 259:149-157; Newbigin, E.J., et al. (1990) Planta 180:461 -470; Higgins, T.J.V., et al. (1988) Plant. Mol. Biol. 1 1 :683-695), zein (maize endosperm) (Schemthaner, J. P., et al. (1988) EMBO J. 7:1249-1255), phaseolin (bean cotyledon) (Segupta-Gopalan, C, et al. (1985) Proc. Natl. Acad. Sci. U .S.A. 82:3320-3324), phytohemagglutinin (bean cotyledon) (Voelker, T. et al. (1987) EMBO J. 6:3571 -3577), B-conglycinin and glycinin (soybean cotyledon) (Chen, Z-L,
et al. (1988) EMBO J. 7:297- 302), glutelin (rice endosperm), hordein (barley endosperm) (Marris, C, et al . (1988) Plant Mol. Biol. 10:359-366), glutenin and gliadin (wheat endosperm) (Colot, V., et al. (1987) EMBO J. 6:3559-3564), and sporamin (sweet potato tuberous root) (Hattori, T., et al. (1990) Plant Mol. Biol. 14:595-604). Promoters of seed-specific genes operably linked to heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants. Such examples include Arabidopsis thaliana 2S seed storage protein gene promoter to express enkephalin peptides in
Arabidopsis and Brassica napus seeds (Vanderkerckhove et al ., Bio/Technology 7:L929-932 (1989)), bean lectin and bean beta-phaseolin promoters to express luciferase (Riggs et al., Plant Sci. 63:47-57 (1989)), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al., EMBO J 6:3559- 3564 (1987)).
Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, flooding or drought, phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, or safeners.
Promoters for use in the current invention include the following: 1 ) the stress- inducible RD29A promoter (Kasuga et al. (1999) Nature Biotechnol. 17:287-91 ); 2) the barley promoter, B22E; expression of B22E is specific to the pedicel in developing maize kernels ("Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers". Klemsdal, S.S. et al., Mol. Gen. Genet. 228(1 /2):9-16 (1991 )); and 3) maize promoter, Zag2 ("Identification and molecular characterization of ZAG1 , the maize homolog of the Arabidopsis floral homeotic gene AGAMOUS", Schmidt, R.J. et al., Plant Cell 5(7):729-737 (1993); "Structural characterization, chromosomal localization and phylogenetic evaluation of two pairs of / G/AMOL/S-like MADS-box genes from maize", Theissen et al. Gene 156(2):155- 166 (1995); NCBI GenBank Accession No. X80206)). Zag2 transcripts can be detected 5 days prior to pollination to 7 to 8 days after pollination ("DAP"), and directs expression in the carpel of developing female inflorescences and Ciml which
is specific to the nucleus of developing maize kernels. Ciml transcript is detected 4 to 5 days before pollination to 6 to 8 DAP. Other useful promoters include any promoter which can be derived from a gene whose expression is maternally associated with developing female florets.
Additional promoters for regulating the expression of the nucleotide
sequences of the present invention in plants are stalk-specific promoters. Such stalk-specific promoters include the alfalfa S2A promoter (GenBank Accession No. EF030816; Abrahams et al., Plant Mol. Biol. 27:513-528 (1995)) and S2B promoter (GenBank Accession No. EF030817) and the like, herein incorporated by reference.
Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
In one embodiment the at least one regulatory element may be an
endogenous promoter operably linked to at least one enhancer element; e.g., a 35S, nos or ocs enhancer element.
Promoters for use in the current invention may include: RIP2, ml_IP15, ZmCORI , Rab17, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, the vascular tissue preferred promoters S2A (Genbank accession number EF030816) and S2B (Genbank accession number EF030817), and the constitutive promoter GOS2 from Zea mays. Other promoters include root preferred promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, published July 13, 2006), the maize ROOTMET2 promoter (WO05063998, published July 14, 2005), the CR1 BIO promoter (WO06055487, published May 26, 2006), the CRWAQ81
(WO05035770, published April 21 , 2005) and the maize ZRP2.47 promoter (NCBI accession number: U38790; Gl No. 1063664),
Recombinant DNA constructs of the present invention may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another embodiment of the present invention, a recombinant DNA construct of the present invention further comprises an enhancer or silencer.
An intron sequence can be added to the 5' untranslated region, the protein- coding region or the 3' untranslated region to increase the amount of the mature
message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); Callis et al., Genes Dev. 1 :1 183-1200 (1987).
Any plant can be selected for the identification of regulatory sequences and RING-H2 polypeptide genes to be used in recombinant DNA constructs and other compositions (e.g. transgenic plants, seeds and cells) and methods of the present invention. Examples of suitable plants for the isolation of genes and regulatory sequences and for compositions and methods of the present invention would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, Clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper,
persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, switchgrass, tangerine, tea, tobacco, tomato, triticale, turf, turnip, a vine, watermelon, wheat, yams, and zucchini.
Compositions:
A composition of the present invention includes a transgenic microorganism, cell, plant, and seed comprising the recombinant DNA construct. The cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.
A composition of the present invention is a plant comprising in its genome any of the recombinant DNA constructs (including any of the suppression DNA constructs) of the present invention (such as any of the constructs discussed above). Compositions also include any progeny of the plant, and any seed obtained from the plant or its progeny, wherein the progeny or seed comprises within its
genome the recombinant DNA construct (or suppression DNA construct). Progeny includes subsequent generations obtained by self-pollination or out-crossing of a plant. Progeny also includes hybrids and inbreds.
In hybrid seed propagated crops, mature transgenic plants can be self- pollinated to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced recombinant DNA construct (or suppression DNA construct). These seeds can be grown to produce plants that would exhibit an altered agronomic characteristic (e.g., an increased agronomic characteristic optionally under water limiting conditions), or used in a breeding program to produce hybrid seed, which can be grown to produce plants that would exhibit such an altered agronomic characteristic. The seeds may be maize seeds.
The plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass. The plant may be a hybrid plant or an inbred plant.
The recombinant DNA construct may be stably integrated into the genome of the plant.
Particular embodiments include but are not limited to the following:
1 . A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.
2. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked
to at least one regulatory sequence, wherein said polynucleotide encodes a RING- H2 polypeptide, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.
3. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a RING- H2 polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
4. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits increased tolerance to drought stress, when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.
5. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a
polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein
said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
6. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.
7. A plant (for example, a maize, rice or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a RING-H2 polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said suppression DNA construct.
8. A plant (for example, a maize, rice or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when
compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said suppression DNA construct.
9. A plant (for example, a maize, rice or soybean plant) comprising in its genome a polynucleotide (optionally an endogenous polynucleotide) operably linked to at least one heterologous regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element. The at least one heterologous regulatory element may comprise an enhancer sequence or a multimer of identical or different enhancer sequences. The at least one
heterologous regulatory element may comprise one, two, three or four copies of the CaMV 35S enhancer.
10. Any progeny of the plants in the embodiments described herein, any seeds of the plants in the embodiments described herein, any seeds of progeny of the plants in embodiments described herein, and cells from any of the above plants in embodiments described herein and progeny thereof.
In any of the embodiments described herein, the RING-H2 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor,
Saccharum officinarum, or Triticum aestivum.
In any of the embodiments described herein, the recombinant DNA construct (or suppression DNA construct) may comprise at least a promoter functional in a plant as a regulatory sequence.
In any of the embodiments described herein or any other embodiments of the present invention, the alteration of at least one agronomic characteristic is either an increase or decrease.
In any of the embodiments described herein, the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress. For example, the alteration of at least one agronomic
characteristic may be an increase in yield, greenness or biomass.
In any of the embodiments described herein, the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).
In any of the embodiments described herein, the plant may exhibit less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.
"Drought" refers to a decrease in water availability to a plant that, especially when prolonged, can cause damage to the plant or prevent its successful growth (e.g., limiting plant growth or seed yield). "Water limiting conditions" refers to a plant growth environment where the amount of water is not sufficient to sustain optimal plant growth and development. The terms "drought" and "water limiting conditions" are used interchangeably herein.
"Drought tolerance" is a trait of a plant to survive under drought conditions over prolonged periods of time without exhibiting substantial physiological or physical deterioration.
"Drought tolerance activity" of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased drought tolerance to the transgenic plant relative to a reference or control plant.
"Increased drought tolerance" of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under drought conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar drought conditions. Typically, when a transgenic plant comprising a recombinant DNA construct or suppression DNA construct in its genome exhibits increased drought tolerance relative to a reference or control plant, the reference or control plant does not comprise in its genome the recombinant DNA construct or
suppression DNA construct.
"Triple stress" as used herein refers to the abiotic stress exerted on the plant by the combination of drought stress, high temperature stress and high light stress.
The terms "heat stress" and "temperature stress" are used interchangeably herein, and are defined as where ambient temperatures are hot enough for sufficient time that they cause damage to plant function or development, which might be reversible or irreversible in damage. "High temperature" can be either "high air temperature" or "high soil temperature", "high day temperature" or "high night temperature, or a combination of more than one of these.
In one embodiment of the invention, the ambient temperature can be in the range of 30°C to 36°C. In one embodiment of the invention, the duration for the high temperature stress could be in the range of 1 -16 hours.
"High light intensity" and "high irradiance" and "light stress" are used interchangeably herein, and refer to the stress exerted by subjecting plants to light intensities that are high enough for sufficient time that they cause photoinhibition damage to the plant.
In one embodiment of the invention, the light intensity can be in the range of 250μΕ to 450 μΕ. In one embodiment of the invention, the duration for the high light inetnsity stress could be in the range of 12-16 hours.
"Triple stress tolerance" is a trait of a plant to survive under the combined stress conditions of drought, high temperature and high light intensity over
prolonged periods of time without exhibiting substantial physiological or physical deterioration.
"Paraquat" is an herbicide that exerts oxidative stress on the plants.
Paraquat, a bipyridylium herbicide, acts by intercepting electrons from the electron transport chain at PSI. This reaction results in the production of bipyridyl radicals that readily react with dioxygen thereby producing superoxide. Paraquat tolerance in a plant has been associated with the scavenging capacity for oxyradicals
(Lannelli, M.A. et al (1999) J Exp Botany, Vol. 50, No. 333, pp. 523-532). Paraquat resistant plants have been reported to have higher tolerance to other oxidative stresses as well.
"Paraquat stress" is defined as stress exerted on the plants by subjecting them to Paraquat concentrations ranging from 0.03 to 0.3μΜ.
Many adverse environmental conditions such as drought, salt stress, and use of herbicide promote the overproduction of reactive oxygen species (ROS) in plant cells. ROS such as singlet oxygen, superoxide radicals, hydrogen peroxide (H2O2), and hydroxyl radicals are believed to be the major factor responsible for rapid cellular damage due to their high reactivity with membrane lipids, proteins, and DNA (Mittler, R. (2002) Trends Plant Sci Vol.7 No.9).
A polypeptide with "triple stress tolerance activity" indicates that over- expression of the polypeptide in a transgenic plant confers increased triple stress tolerance to the transgenic plant relative to a reference or control plant. A
polypeptide with "paraquat stress tolerance activity" indicates that over-expression of the polypeptide in a transgenic plant confers increased Paraquat stress tolerance to the transgenic plant relative to a reference or control plant.
Typically, when a transgenic plant comprising a recombinant DNA construct or suppression DNA construct in its genome exhibits increased stress tolerance relative to a reference or control plant, the reference or control plant does not comprise in its genome the recombinant DNA construct or suppression DNA construct.
One of ordinary skill in the art is familiar with protocols for simulating drought conditions and for evaluating drought tolerance of plants that have been subjected to simulated or naturally-occurring drought conditions. For example, one can simulate drought conditions by giving plants less water than normally required or no
water over a period of time, and one can evaluate drought tolerance by looking for differences in physiological and/or physical condition, including (but not limited to) vigor, growth, size, or root length, or in particular, leaf color or leaf area size. Other techniques for evaluating drought tolerance include measuring chlorophyll fluorescence, photosynthetic rates and gas exchange rates.
A drought stress experiment may involve a chronic stress (i.e., slow dry down) and/or may involve two acute stresses (i.e., abrupt removal of water) separated by a day or two of recovery. Chronic stress may last 8 - 10 days. Acute stress may last 3 - 5 days. The following variables may be measured during drought stress and well watered treatments of transgenic plants and relevant control plants:
The variable "% area chg_start chronic - acute2" is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of the second acute stress.
The variable "% area chg_start chronic - end chronic" is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the last day of chronic stress.
The variable "% area chg_start chronic - harvest" is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of harvest.
The variable "% area chg_start chronic - recovery24hr" is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and 24 hrs into the recovery (24hrs after acute stress 2).
The variable "psii_acute1 " is a measure of Photosystem II (PSIl) efficiency at the end of the first acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSIl antennae and is directly related to carbon dioxide assimilation within the leaf.
The variable "psii_acute2" is a measure of Photosystem II (PSIl) efficiency at the end of the second acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSIl antennae and is directly related to carbon dioxide assimilation within the leaf.
The variable "fv/fm_acute1 " is a measure of the optimum quantum yield (Fv/Fm) at the end of the first acute stress - (variable fluorescence difference between the maximum and minimum fluorescence / maximum fluorescence)
The variable "fv/fm_acute2" is a measure of the optimum quantum yield (Fv/Fm) at the end of the second acute stress - (variable flourescence difference between the maximum and minimum fluorescence / maximum fluorescence).
The variable "leaf rolling_harvest" is a measure of the ratio of top image to side image on the day of harvest.
The variable "leaf rolling_recovery24hr" is a measure of the ratio of top image to side image 24 hours into the recovery.
The variable "Specific Growth Rate (SGR)" represents the change in total plant surface area (as measured by Lemna Tec Instrument) over a single day (Y(t) = r*t r*t
Y0*e ). Y(t) = Y0*e is equivalent to % change in Υ/Δ t where the individual terms are as follows: Y(t) = Total surface area at t; Y0 = Initial total surface area
(estimated); r = Specific Growth Rate day"1 - and t = Days After Planting ("DAP").
The variable "shoot dry weight" is a measure of the shoot weight 96 hours after being placed into a 104 °C oven.
The variable "shoot fresh weight" is a measure of the shoot weight immediately after being cut from the plant.
The Examples below describe some representative protocols and techniques for simulating drought conditions and/or evaluating drought tolerance.
One can also evaluate drought tolerance by the ability of a plant to maintain sufficient yield (at least 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% yield) in field testing under simulated or naturally-occurring drought conditions (e.g., by measuring for substantially equivalent yield under drought conditions compared to non-drought conditions, or by measuring for less yield loss under drought conditions compared to a control or reference plant).
One of ordinary skill in the art would readily recognize a suitable control or reference plant to be utilized when assessing or measuring an agronomic
characteristic or phenotype of a transgenic plant in any embodiment of the present invention in which a control plant is utilized (e.g., compositions or methods as described herein). For example, by way of non-limiting illustrations:
1 . Progeny of a transformed plant which is hemizygous with respect to a recombinant DNA construct (or suppression DNA construct), such that the progeny are segregating into plants either comprising or not comprising the recombinant DNA construct (or suppression DNA construct): the progeny comprising the recombinant DNA construct (or suppression DNA construct) would be typically measured relative to the progeny not comprising the recombinant DNA construct (or suppression DNA construct) (i.e., the progeny not comprising the recombinant DNA construct (or the suppression DNA construct) is the control or reference plant).
2. Introgression of a recombinant DNA construct (or suppression DNA construct) into an inbred line, such as in maize, or into a variety, such as in soybean: the introgressed line would typically be measured relative to the parent inbred or variety line (i.e., the parent inbred or variety line is the control or reference plant).
3. Two hybrid lines, where the first hybrid line is produced from two parent inbred lines, and the second hybrid line is produced from the same two parent inbred lines except that one of the parent inbred lines contains a recombinant DNA construct (or suppression DNA construct): the second hybrid line would typically be measured relative to the first hybrid line (i.e., the first hybrid line is the control or reference plant).
4. A plant comprising a recombinant DNA construct (or suppression DNA construct): the plant may be assessed or measured relative to a control plant not comprising the recombinant DNA construct (or suppression DNA construct) but otherwise having a comparable genetic background to the plant (e.g., sharing at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity of nuclear genetic material compared to the plant comprising the
recombinant DNA construct (or suppression DNA construct)). There are many laboratory-based techniques available for the analysis, comparison and
characterization of plant genetic backgrounds; among these are Isozyme
Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain
Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence
Characterized Amplified Regions (SCARs), Amplified Fragment Length
Polymorphisms (AFLP®s), and Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites.
Furthermore, one of ordinary skill in the art would readily recognize that a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant would not include a plant that had been previously selected, via mutagenesis or transformation, for the desired agronomic characteristic or phenotype.
Methods:
Methods include but are not limited to methods for increasing drought tolerance in a plant, methods for evaluating drought tolerance in a plant, methods for altering an agronomic characteristic in a plant, methods for determining an alteration of an agronomic characteristic in a plant, and methods for producing seed. The plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or sorghum. The seed may be a maize or soybean seed, for example, a maize hybrid seed or maize inbred seed.
Methods include but are not limited to the following:
A method for transforming a cell (or microorganism) comprising transforming a cell (or microorganism) with any of the isolated polynucleotides or recombinant DNA constructs of the present invention. The cell (or microorganism) transformed by this method is also included. In particular embodiments, the cell is eukaryotic cell, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell. The microorganism may be Agrobacterium, e.g. Agrobacterium tumefaciens or
Agrobacterium rhizogenes.
A method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs
(including suppression DNA constructs) of the present invention and regenerating a transgenic plant from the transformed plant cell. The invention is also directed to the transgenic plant produced by this method, and transgenic seed obtained from this transgenic plant. The transgenic plant obtained by this method may be used in other methods of the present invention.
A method for isolating a polypeptide of the invention from a cell or culture medium of the cell, wherein the cell comprises a recombinant DNA construct
comprising a polynucleotide of the invention operably linked to at least one regulatory sequence, and wherein the transformed host cell is grown under conditions that are suitable for expression of the recombinant DNA construct.
A method of altering the level of expression of a polypeptide of the invention in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct of the present invention; and (b) growing the transformed host cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of the polypeptide of the invention in the transformed host cell.
A method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
A method of increasing drought tolerance, the method comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (b) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method
selected from the group consisting of: deletion, substitution, addition and insertion; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance, when compared to a control plant not comprising the recombinant DNA construct.
A method of selecting for (or identifying) increased drought tolerance in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the
recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
In another embodiment, a method of selecting for (or identifying) increased drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence
identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting (or identifying) the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
A method of selecting for (or identifying) increased drought tolerance in a plant, the method comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (i) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (ii) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance, when compared to a control plant not comprising the recombinant DNA construct.
A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not
comprising the recombinant DNA construct. The polynucleotide preferably encodes a RING-H2 polypeptide. The RING-H2 polypeptide preferably has drought tolerance activity.
In another embodiment, a method of selecting for (or identifying) an alteration of at least one agronomic characteristic in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a
recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting (or identifying) the transgenic plant of part (b) that exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct. Optionally, said selecting (or identifying) step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.
A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (i) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 17, 19 or 21 ; or (ii) derived from SEQ ID NO:16, 17, 19 or 21 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion;
(b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The
polynucleotide preferably encodes a RING-H2 polypeptide. The RING-H2 polypeptide preferably has drought tolerance activity.
A method of producing seed (for example, seed that can be sold as a drought tolerant product offering) comprising any of the preceding methods, and further comprising obtaining seeds from said progeny plant, wherein said seeds comprise in their genome said recombinant DNA construct (or suppression DNA construct).
In any of the preceding methods or any other embodiments of methods of the present invention, in said introducing step said regenerable plant cell may comprise a callus cell, an embryogenic callus cell, a gametic cell, a meristematic cell, or a cell of an immature embryo. The regenerable plant cells may derive from an inbred maize plant.
In any of the preceding methods or any other embodiments of methods of the present invention, said regenerating step may comprise the following: (i) culturing said transformed plant cells in a media comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.
In any of the preceding methods or any other embodiments of methods of the present invention, the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early
seedling vigor and seedling emergence under low temperature stress. The alteration of at least one agronomic characteristic may be an increase in yield, greenness or biomass.
In any of the preceding methods or any other embodiments of methods of the present invention, the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).
In any of the preceding methods or any other embodiments of methods of the present invention, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, optionally as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant invention.
The introduction of recombinant DNA constructs of the present invention into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation. Techniques for plant transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.
The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. The regenerated plants may be self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
EXAMPLES
The present invention is further illustrated in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise
stated. It should be understood that these Examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
EXAMPLE 1
Creation of an Arabidopsis Population with Activation-Tagged Genes
An 18.5-kb T-DNA based binary construct was created, pHSbarENDs2 (PCT Publication No. WO/2012/058528), that contains four multimerized enhancer elements derived from the Cauliflower Mosaic Virus 35S promoter (corresponding to sequences -341 to -64, as defined by Odell et al., Nature 313:810-812 (1985)). The construct also contains vector sequences (pUC9) and a polylinker to allow plasmid rescue, transposon sequences (Ds) to remobilize the T-DNA, and the bar gene to allow for glufosinate selection of transgenic plants. In principle, only the 10.8-kb segment from the right border (RB) to left border (LB) inclusive will be transferred into the host plant genome. Since the enhancer elements are located near the RB, they can induce cis-activation of genomic loci following T-DNA integration.
Arabidopsis activation-tagged populations were created by whole plant Agrobacterium transformation. The pHSbarENDs2 construct was transformed into Agrobacterium tumefaciens strain C58, grown in LB at 25 °C to OD600 ~1 .0. Cells were then pelleted by centrifugation and resuspended in an equal volume of 5% sucrose/0.05% Silwet L-77 (OSI Specialties, Inc). At early bolting, soil grown Arabidopsis thaliana ecotype Col-0 were top watered with the Agrobacterium suspension. A week later, the same plants were top watered again with the same Agrobacterium strain in sucrose/Silwet. The plants were then allowed to set seed as normal. The resulting T1 seed were sown on soil, and transgenic seedlings were selected by spraying with glufosinate (Finale®; AgrEvo; Bayer Environmental Science). A total of 100,000 glufosinate resistant T1 seedlings were selected. T2 seed from each line was kept separate.
EXAMPLE 2
Screens to Identify Lines with Enhanced Drought Tolerance Quantitative Drought Screen: From each of 96,000 separate T1 activation- tagged lines, nine glufosinate resistant T2 plants are sown, each in a single pot on Scotts® Metro-Mix® 200 soil. Flats are configured with 8 square pots each. Each of the square pots is filled to the top with soil. Each pot (or cell) is sown to produce 9 glufosinate resistant seedlings in a 3x3 array.
The soil is watered to saturation and then plants are grown under standard conditions (i.e., 16 hour light, 8 hour dark cycle; 22°C; -60% relative humidity). No additional water is given.
Digital images of the plants are taken at the onset of visible drought stress symptoms. Images are taken once a day (at the same time of day), until the plants appear dessicated. Typically, four consecutive days of data is captured.
Color analysis is employed for identifying potential drought tolerant lines. Color analysis can be used to measure the increase in the percentage of leaf area that falls into a yellow color bin. Using hue, saturation and intensity data ("HSI"), the yellow color bin consists of hues 35 to 45.
Maintenance of leaf area is also used as another criterion for identifying potential drought tolerant lines, since Arabidopsis leaves wilt during drought stress. Maintenance of leaf area can be measured as reduction of rosette leaf area over time.
Leaf area is measured in terms of the number of green pixels obtained using the LemnaTec imaging system. Activation-tagged and control (e.g., wild-type) plants are grown side by side in flats that contain 72 plants (9 plants/pot). When wilting begins, images are measured for a number of days to monitor the wilting process. From these data wilting profiles are determined based on the green pixel counts obtained over four consecutive days for activation-tagged and accompanying control plants. The profile is selected from a series of measurements over the four day period that gives the largest degree of wilting. The ability to withstand drought is measured by the tendency of activation-tagged plants to resist wilting compared to control plants.
LemnaTec HTSBonitUV software is used to analyze CCD images. Estimates of the leaf area of the Arabidopsis plants are obtained in terms of the number of
green pixels. The data for each image is averaged to obtain estimates of mean and standard deviation for the green pixel counts for activation-tagged and wild-type plants. Parameters for a noise function are obtained by straight line regression of the squared deviation versus the mean pixel count using data for all images in a batch. Error estimates for the mean pixel count data are calculated using the fit parameters for the noise function. The mean pixel counts for activation-tagged and wild-type plants are summed to obtain an assessment of the overall leaf area for each image. The four-day interval with maximal wilting is obtained by selecting the interval that corresponds to the maximum difference in plant growth. The individual wilting responses of the activation-tagged and wild-type plants are obtained by normalization of the data using the value of the green pixel count of the first day in the interval. The drought tolerance of the activation-tagged plant compared to the wild-type plant is scored by summing the weighted difference between the wilting response of activation-tagged plants and wild-type plants over day two to day four; the weights are estimated by propagating the error in the data. A positive drought tolerance score corresponds to an activation-tagged plant with slower wilting compared to the wild-type plant. Significance of the difference in wilting response between activation-tagged and wild-type plants is obtained from the weighted sum of the squared deviations.
Lines with a significant delay in yellow color accumulation and/or with significant maintenance of rosette leaf area, when compared to the average of the whole flat, are designated as Phase 1 hits. Phase 1 hits are re-screened in duplicate under the same assay conditions. When either or both of the Phase 2 replicates show a significant difference (score of greater than 0.9) from the whole flat mean, the line is then considered a validated drought tolerant line.
EXAMPLE 3
Identification of Activation-Tagged Genes
Genes flanking the T-DNA insert in drought tolerant lines are identified using one, or both, of the following two standard procedures: (1 ) thermal asymmetric interlaced (TAIL) PCR (Liu et al., (1995), Plant J. 8:457-63); and (2) SAIFF PCR (Siebert et al., (1995) Nucleic Acids Res. 23:1087-1088). In lines with complex multimerized T-DNA inserts, TAIL PCR and SAIFF PCR may both prove insufficient
to identify candidate genes. In these cases, other procedures, including inverse PCR, plasmid rescue and/or genomic library construction, can be employed.
A successful result is one where a single TAIL or SAIFF PCR fragment contains a T-DNA border sequence and Arabidopsis genomic sequence.
Once a tag of genomic sequence flanking a T-DNA insert is obtained, candidate genes are identified by alignment to publicly available Arabidopsis genome sequence.
Specifically, the annotated gene nearest the 35S enhancer elements/T-DNA RB are candidates for genes that are activated.
To verify that an identified gene is truly near a T-DNA and to rule out the possibility that the TAIL/SAIFF fragment is a chimeric cloning artifact, a diagnostic PCR on genomic DNA is done with one oligo in the T-DNA and one oligo specific for the candidate gene. Genomic DNA samples that give a PCR product are
interpreted as representing a T-DNA insertion. This analysis also verifies a situation in which more than one insertion event occurs in the same line, e.g., if multiple differing genomic fragments are identified in TAIL and/or SAIFF PCR analyses.
EXAMPLE 4A
Identification of Activation-Tagged
AT-RING-H2 polypeptide Gene
An activation-tagged line (No. 1 1 1664) showing drought tolerance was further analyzed. DNA from the line was extracted, and genes flanking the T-DNA insert in the mutant line were identified using SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A PCR amplified fragment was identified that contained T- DNA border sequence and Arabidopsis genomic sequence. Genomic sequence flanking the T-DNA insert was obtained, and the candidate gene was identified by alignment to the completed Arabidopsis genome. For a given T-DNA integration event, the annotated gene nearest the 35S enhancer elements/T-DNA RB was the candidate for gene that is activated in the line. In the case of line 1 1 1664, the gene nearest the 35S enhancers at the integration site was At5g43420 (SEQ ID NO:16; NCBI Gl No. 30694289), encoding a RING-H2 polypeptide (SEQ ID NO:18; NCBI Gl No. 15239865).
EXAMPLE 4B
Assay for Expression Level of Candidate Drought Tolerance Genes
A functional activation-tagged allele should result in either up-regulation of the candidate gene in tissues where it is normally expressed, ectopic expression in tissues that do not normally express that gene, or both.
Expression levels of the candidate genes in the cognate mutant line vs. wild-type are compared. A standard RT-PCR procedure, such as the QuantiTect® Reverse Transcription Kit from Qiagen®, is used. RT-PCR of the actin gene is used as a control to show that the amplification and loading of samples from the mutant line and wild-type are similar.
Assay conditions are optimized for each gene. Expression levels are checked in mature rosette leaves. If the activation-tagged allele results in ectopic expression in other tissues (e.g., roots), it is not detected by this assay. As such, a positive result is useful but a negative result does not eliminate a gene from further analysis.
EXAMPLE 5
Validation of Arabidopsis Candidate Gene At5q43420 (AT-RING-H2 Polypeptide) via Transformation into Arabidopsis
Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated "lead gene" in Arabidopsis.
The candidate Arabidopsis RING-H2 polypeptide CDS (At5g43420; SEQ ID NO:17) was tested for its ability to confer drought tolerance in the following manner.
A 16.8-kb T-DNA based binary vector, called pBC-yellow (PCT Publication
No. WO/2012/058528; herein incorporated by reference), was constructed with a 1 .3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed.
The At5g43420 cDNA protein-coding region was amplified by RT-PCR with the following primers:
(1 ) At5g43420-5'attB forward primer (SEQ ID NO:12):
TTAAACAAGTTTGTACAAAAAAGCAGGCTCAACAATGGATCTATCAA ACCGTCGC
(2) At5g43420-3'attB reverse primer (SEQ ID NO:13):
TTAAACCACTTTGTACAAGAAAGCTGGGTTTAGGGTTCAAAATAAAG TGG
The forward primer contains the attB1 sequence
(ACAAGTTTGTACAAAAAAGCAGGCT; SEQ ID NO:10) and a consensus Kozak sequence (CAACA) adjacent to the first 21 nucleotides of the protein -coding region, beginning with the ATG start codon,.
The reverse primer contains the attB2 sequence
(ACCACTTTGTACAAGAAAGCTGGGT; SEQ ID NO:1 1 ) adjacent to the reverse complement of the last 21 nucleotides of the protein-coding region, beginning with the reverse complement of the stop codon.
Using the INVITROGEN™ GATEWAY® CLONASE™ technology, a BP
Recombination Reaction was performed with pDONR™/Zeo (INVITROGEN™). This process removed the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™/Zeo and directionally cloned the PCR product with flanking attB1 and attB2 sites creating an entry clone, PHP43712. This entry clone was used for a subsequent LR Recombination Reaction with a
destination vector, as follows.
A 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow (PCT Publication No. WO/2012/058528), was constructed with a 1 .3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow
(INVITROGEN™), which confers yellow fluorescence to transformed seed. Using the INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed on the PHP43712 entry clone, containing the directionally cloned PCR product, and pBC-yellow. This allowed for rapid and directional cloning of the candidate gene behind the 35S promoter in pBC-yellow to create the 35S
promoter: :At5g43420 expression construct, pBC-Yellow-At5g43420.
Applicants then introduced the 35S promoter: :At5g43420 expression construct into wild-type Arabidopsis ecotype Col-0, using the same Agrobacterium- mediated transformation procedure described in Example 1 . Transgenic T1 seeds were selected by yellow fluorescence, and T1 seeds were plated next to wild-type seeds and grown under water limiting conditions. Growth conditions and imaging analysis were as described in Example 2. It was found that the original drought tolerance phenotype from activation tagging could be recapitulated in wild-type Arabidopsis plants that were transformed with a construct where At5g43420 was directly expressed by the 35S promoter. The drought tolerance score, as determined by the method of Example 2, was 1 .481 .
EXAMPLE 6
Preparation of cDNA Libraries and
Isolation and Sequencing of cDNA Clones
cDNA libraries may be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in UNI-ZAP™ XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA). The UNI-ZAP™ XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector
pBLUESCRIPT®. In addition, the cDNAs may be introduced directly into precut BLUESCRIPT® II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBLUESCRIPT® plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"; see Adams et al., (1991 ) Science
252:1651 -1656). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.
Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as
single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers.
Confirmation of clone identification is performed by sequence alignment to the original EST sequence from which the FIS request is made.
Confirmed templates are transposed via the Primer Island transposition kit (PE Applied Biosystems, Foster City, CA) which is based upon the Saccharomyces cerevisiae Ty1 transposable element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772). The in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules. The transposed DNA is then used to transform DH10B electro-competent cells (GIBCO BRL/Life
Technologies, Rockville, MD) via electroporation. The transposable element contains an additional selectable marker (named DHFR; Fling and Richards (1983) Nucleic Acids Res. 47-5158), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI PRISM® dye-terminator
ReadyReaction mix) outward from the transposition event site, utilizing unique primers specific to the binding sites within the transposon.
Sequence data is collected (ABI PRISM® Collections) and assembled using
Phred and Phrap (Ewing et al. (1998) Genome Res. 8:175-185; Ewing and Green (1998) Genome Res. 8:186-194). Phred is a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files. The Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (Gordon et al. (1998) Genome Res. 8:195-202).
In some of the clones the cDNA fragment may correspond to a portion of the 3'-terminus of the gene and does not cover the entire open reading frame. In order to obtain the upstream information one of two different protocols is used. The first of these methods results in the production of a fragment of DNA containing a portion of the desired gene sequence while the second method results in the production of a fragment containing the entire open reading frame. Both of these methods use two
rounds of PCR amplification to obtain fragments from one or more libraries. The libraries some times are chosen based on previous knowledge that the specific gene should be found in a certain tissue and sometimes are randomly-chosen. Reactions to obtain the same gene may be performed on several libraries in parallel or on a pool of libraries. Library pools are normally prepared using from 3 to 5 different libraries and normalized to a uniform dilution. In the first round of amplification both methods use a vector-specific (forward) primer corresponding to a portion of the vector located at the 5'-terminus of the clone coupled with a
gene-specific (reverse) primer. The first method uses a sequence that is
complementary to a portion of the already known gene sequence while the second method uses a gene-specific primer complementary to a portion of the
3'-untranslated region (also referred to as UTR). In the second round of
amplification a nested set of primers is used for both methods. The resulting DNA fragment is ligated into a pBLUESCRIPT® vector using a commercial kit and following the manufacturer's protocol. This kit is selected from many available from several vendors including INVITROGEN™ (Carlsbad, CA), Promega Biotech (Madison, Wl), and GIBCO-BRL (Gaithersburg, MD). The plasmid DNA is isolated by alkaline lysis method and submitted for sequencing and assembly using
Phred/Phrap, as above.
An alternative method for preparation of cDNA Libraries and obtainment of sequences can be the following. mRNAs can be isolated using the Qiagen® RNA isolation kit for total RNA isolation, followed by mRNA isolation via attachment to oligo(dT) Dynabeads from Invitrogen (Life Technologies, Carlsbad, CA), and sequencing libraries can be prepared using the standard mRNA-Seq kit and protocol from lllumina, Inc. (San Diego, CA). In this method, mRNAs are
fragmented using a ZnCI2 solution, reverse transcribed into cDNA using random primers, end repaired to create blunt end fragments, 3' A-tailed, and ligated with lllumina paired-end library adaptors. Ligated cDNA fragments can then be PCR amplified using lllumina paired-end library primers, and purified PCR products can be checked for quality and quantity on the Agilent Bioanalyzer DNA 1000 chip prior to sequencing on the Genome Analyzer II equipped with a paired end module.
Reads from the sequencing runs can be soft-trimmed prior to assembly such that the first base pair of each read with an observed FASTQ quality score lower
than 15 and all subsequent bases are clipped using a Python script. The Velvet assembler (Zerbino et al. Genome Research 18:821 -9 (2008)) can be run under varying kmer and coverage cutoff parameters to produce several putative assemblies along a range of stringency. The contiguous sequences (contigs) within those assemblies can be combined into clusters using Vmatch software (available on the Vmatch website) such that contigs which are identified as substrings of longer contigs are grouped and eliminated, leaving a non-redundant set of longest "sentinel" contigs. These non-redundant sets can be used in alignments to homologous sequences from known model plant species.
EXAMPLE 7
Identification of cDNA Clones
cDNA clones encoding the polypeptide of interest can be identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410; see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health) searches for similarity to amino acid sequences contained in the BLAST "nr" database
(comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The DNA sequences from clones can be translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the "nr" database using the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI. The polypeptides encoded by the cDNA sequences can be analyzed for similarity to all publicly available amino acid sequences contained in the "nr" database using the BLASTP algorithm provided by the National Center for Biotechnology Information (NCBI). For convenience, the P-value (probability) or the E-value (expectation) of observing a match of a cDNA- encoded sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as "pLog" values, which represent the negative of the logarithm of the reported P-value or E-value.
Accordingly, the greater the pLog value, the greater the likelihood that the cDNA- encoded sequence and the BLAST "hit" represent homologous proteins.
ESTs sequences can be compared to the Genbank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTN algorithm (Altschul et al (1997) Nucleic Acids Res. 25:3389-3402.) against the DUPONT™ proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction. Once the most 5-prime EST is identified, its complete sequence can be determined by Full Insert Sequencing as described above. Homologous genes belonging to different species can be found by comparing the amino acid sequence of a known gene (from either a proprietary source or a public database) against an EST database using the
TBLASTN algorithm. The TBLASTN algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.
In cases where the sequence assemblies are in fragments, the percent identity to other homologous genes can be used to infer which fragments represent a single gene. The fragments that appear to belong together can be
computationally assembled such that a translation of the resulting nucleotide sequence will return the amino acid sequence of the homologous protein in a single open-reading frame. These computer-generated assemblies can then be aligned with other polypeptides of the invention.
EXAMPLE 8
Characterization of cDNA Clones Encoding RING-H2 Polypeptides
cDNA libraries representing mRNAs from various tissues of Maize were prepared and cDNA clones encoding RING-H2 polypeptides were identified. The characteristics of the libraries are described below.
TABLE 2
cDNA Libraries from Maize,
These libraries were normalized essentially as described in U.S. Pat. No.
5,482,845
The BLAST search using the sequences from clones listed in Table 2 revealed similarity of the polypeptides encoded by the cDNAs to the RING-H2 polypeptides from various organisms. As shown in Table 2 and Figures 1A-1 D, certain cDNAs encoded polypeptides similar to RING-H2 polypeptide from
Arabidopsis (Gl No.15239865; SEQ ID NO:18),
Shown in Table 3 (non-patent literature) and Table 4 (patent literature) are the BLAST results for one or more of the following: individual Expressed Sequence Tag ("EST"), the sequences of the entire cDNA inserts comprising the indicated cDNA clones ("Full-Insert Sequence" or "FIS"), the sequences of contigs assembled from two or more EST, FIS or PCR sequences ("Contig"), or sequences encoding an entire or functional protein derived from an FIS or a contig ("Complete Gene Sequence" or "CGS"). Also shown in Tables 3 and 4 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:
Shown in Table 3 (non-patent literature) and Table 4 (patent literature) are the BLASTP results for the amino acid sequences derived from the nucleotide sequences of the entire cDNA inserts ("Full-Insert Sequence" or "FIS") of the clones listed in Table 2. Each cDNA insert encodes an entire or functional protein
("Complete Gene Sequence" or "CGS"). Also shown in Tables 3 and 4 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:
TABLE 3
BLASTP Results for RING-H2 polypeptides
BLASTP Percent
Sequence NCBI Gl No.
Type pLog of Sequence
(SEQ ID NO) (SEQ ID NO)
E-value Identity cfp5n.pk073.p4.fis 194703040
FIS >180 99.7
(SEQ ID NO:20) (SEQ ID NO:61 )
cfp6n.pk073.c17.fis 399529262
FIS 150 48.4
(SEQ ID NO:22) (SEQ ID NO:63)
TABLE 4
BLASTP Results for RING-H2 polypeptides
BLASTP Percent
Sequence Reference
Type pLog of Sequence
(SEQ ID NO) (SEQ ID NO)
E-value Identity
SEQ ID NO:1 197 of
At5g43420
CGS US20090144849 >180 100
(SEQ ID NO:18)
(SEQ ID NO:66)
SEQ ID NO:421 18
cfp5n.pk073.p4:fis
FIS of US20120017338 >180 97.4
(SEQ ID NO:20)
(SEQ ID NO:62)
SEQ ID NO:10259
cfp6n.pk073.c17.fis
FIS of WO2009134339 >180 93.7
(SEQ ID NO:22)
(SEQ ID NO:64)
Figures 1 A-1 D present an alignnnent of the amino acid sequences of RING-H2 polypeptides set forth in SEQ ID NOs:18, 20, 22, 61 -64. Figure 2 presents the percent sequence identities and divergence values for each sequence pair presented in Figures 1 A-1 D.
Sequence alignments and percent identity calculations were performed using the Megalign® program of the LASERGENE® bioinformatics computing suite
(DNASTAR® Inc., Madison, Wl). Multiple alignment of the sequences was performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151 -153) with the default parameters (GAP PENALTY=10, GAP
LENGTH PENALTY=10). Default parameters for pairwise alignments using the
Clustal method were KTUPLE=1 , GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode RING-H2 polypeptides.
EXAMPLE 9
Preparation of a Plant Expression Vector
Containing a Homolog to the Arabidopsis Lead Gene Sequences homologous to the Arabidopsis AT-RING-H2 polypeptide can be identified using sequence comparison algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul et al., J. Mol. Biol. 215:403-410 (1993); see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health). Sequences encoding homologous RING-H2 polypeptides can be PCR-amplified by any of the following methods.
Method 1 (RNA-based): If the 5' and 3' sequence information for the protein- coding region, or the 5' and 3' UTR, of a gene encoding a RING-H2 polypeptide homolog is available, gene-specific primers can be designed as outlined in Example 5. RT-PCR can be used with plant RNA to obtain a nucleic acid fragment containing the protein-coding region flanked by attB1 (SEQ ID NO:10) and attB2 (SEQ ID NO:1 1 ) sequences. The primer may contain a consensus Kozak sequence
(CAACA) upstream of the start codon.
Method 2 (DNA-based): Alternatively, if a cDNA clone is available for a gene encoding a RING-H2 polypeptide homolog, the entire cDNA insert (containing 5' and 3' non-coding regions) can be PCR amplified. Forward and reverse primers can be designed that contain either the attB1 sequence and vector-specific sequence that precedes the cDNA insert or the attB2 sequence and vector-specific sequence that follows the cDNA insert, respectively. For a cDNA insert cloned into the vector pBulescript SK+, the forward primer VC062 (SEQ ID NO:14) and the reverse primer VC063 (SEQ ID NO:15) can be used.
Method 3 (genomic DNA): Genomic sequences can be obtained using long range genomic PCR capture. Primers can be designed based on the sequence of the genomic locus and the resulting PCR product can be sequenced. The
sequence can be analyzed using the FGENESH (Salamov, A. and Solovyev, V. (2000) Genome Res., 10: 516-522) program, and optionally, can be aligned with homologous sequences from other species to assist in identification of putative introns.
The above methods can be modified according to procedures known by one skilled in the art. For example, the primers of Method 1 may contain restriction sites instead of attB1 and attB2 sites, for subsequent cloning of the PCR product into a vector containing attB1 and attB2 sites. Additionally, Method 2 can involve amplification from a cDNA clone, a lambda clone, a BAC clone or genomic DNA.
A PCR product obtained by either method above can be combined with the
GATEWAY® donor vector, such as pDONR™/Zeo (INVITROGEN™) or
pDONR™221 (INVITROGEN™), using a BP Recombination Reaction. This process removes the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™221 and directionally clones the PCR product with flanking attB1 and attB2 sites to create an entry clone. Using the INVITROGEN™ GATEWAY® CLONASE™ technology, the sequence encoding the homologous RING-H2 polypeptide from the entry clone can then be transferred to a suitable destination vector, such as pBC-Yellow, PHP27840 or PHP23236 (PCT Publication No. WO/2012/058528; herein incorporated by reference), to obtain a plant expression vector for use with Arabidopsis, soybean and corn, respectively.
Sequences of the attP1 and attP2 sites of donor vectors pDONR™/Zeo or pDONR™221 are given in SEQ ID NOs:2 and 3, respectively. The sequences of the attR1 and attR2 sites of destination vectors pBC-Yellow, PHP27840 and PHP23236 are given in SEQ ID NOs:8 and 9, respectively. A BP Reaction is a recombination reaction between an Expression Clone (or an attB-flanked PCR product) and a Donor (e.g., pDONR™) Vector to create an Entry Clone. A LR Reaction is a recombination between an Entry Clone and a Destination Vector to create an Expression Clone. A Donor Vector contains attP1 and attP2 sites. An Entry Clone contains attl_1 and attl_2 sites (SEQ ID NOs:4 and 5, respectively). A Destination Vector contains attR1 and attR2 site. An Expression Clone contains attB1 and attB2 sites. The attB1 site is composed of parts of the attl_1 and attR1 sites. The attB2 site is composed of parts of the attl_2 and attR2 sites.
Alternatively a MultiSite GATEWAY® LR recombination reaction between multiple entry clones and a suitable destination vector can be performed to create an expression vector.
EXAMPLE 10
Preparation of Soybean Expression Vectors and
Transformation of Soybean with Validated Arabidopsis Lead Genes
Soybean plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
The same GATEWAY® entry clone described in Example 5 can be used to directionally clone each gene into the PHP27840 vector (PCT Publication No.
WO/2012/058528) such that expression of the gene is under control of the SCP1 promoter (International Publication No. 03/033651 ).
Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides. Techniques for soybean transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.
T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in soybean to enhance drought tolerance.
Soybean plants transformed with validated genes can then be assayed under more vigorous field-based studies to study yield enhancement and/or stability under well-watered and water-limiting conditions.
EXAMPLE 1 1
Transformation of Maize with Validated
Arabidopsis Lead Genes Using Particle Bombardment
Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
The same GATEWAY® entry clone described in Example 5 can be used to directionally clone each gene into a maize transformation vector. Expression of the gene in the maize transformation vector can be under control of a constitutive promoter such as the maize ubiquitin promoter (Christensen et al., (1989) Plant Mol. Biol. 12:619-632 and Christensen et al., (1992) Plant Mol. Biol. 18:675-689)
The recombinant DNA construct described above can then be introduced into corn cells by particle bombardment. Techniques for corn transformation by particle bombardment have been described in International Patent Publication WO
2009/006276, the contents of which are herein incorporated by reference.
T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in maize to enhance drought tolerance.
EXAMPLE 12
Electroporation of Agrobacterium tumefaciens LBA4404 Electroporation competent cells (40 μΙ_), such as Agrobacterium tumefaciens LBA4404 containing PHP10523 (PCT Publication No. WO/2012/058528), are thawed on ice (20-30 min). PHP10523 contains VIR genes for T-DNA transfer, an Agrobacterium low copy number plasmid origin of replication, a tetracycline resistance gene, and a Cos site for in vivo DNA bimolecular recombination.
Meanwhile the electroporation cuvette is chilled on ice. The electroporator settings are adjusted to 2.1 kV. A DNA aliquot (0.5 μΙ_ parental DNA at a concentration of 0.2 g -1 .0 pg in low salt buffer or twice distilled H2O) is mixed with the thawed Agrobacterium tumefaciens LBA4404 cells while still on ice. The mixture is transferred to the bottom of electroporation cuvette and kept at rest on ice for 1 -2 min. The cells are electroporated (Eppendorf electroporator 2510) by pushing the "pulse" button twice (ideally achieving a 4.0 millisecond pulse). Subsequently, 0.5 ml_ of room temperature 2xYT medium (or SOC medium) are added to the cuvette and transferred to a 15 mL snap-cap tube (e.g., FALCON™ tube). The cells are incubated at 28-30 °C, 200-250 rpm for 3 h.
Aliquots of 250 μΙ_ are spread onto plates containing YM medium and 50 pg/nriL spectinomycin and incubated three days at 28-30 °C. To increase the number of transformants one of two optional steps can be performed:
Option 1 : Overlay plates with 30 μΙ_ of 15 mg/mL rifampicin. LBA4404 has a chromosomal resistance gene for rifampicin. This additional selection eliminates some contaminating colonies observed when using poorer preparations of LBA4404 competent cells.
Option 2: Perform two replicates of the electroporation to compensate for poorer electrocompetent cells.
Identification of transformants:
Four independent colonies are picked and streaked on plates containing AB minimal medium and 50 pg/nriL spectinomycin for isolation of single colonies. The plates are incubated at 28 °C for two to three days. A single colony for each putative co-integrate is picked and inoculated with 4 mL of 10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride and 50 mg/L spectinomycin. The mixture is incubated for 24 h at 28 °C with shaking. Plasmid DNA from 4 mL of culture is isolated using Qiagen® Miniprep and an optional Buffer PB wash. The DNA is eluted in 30 μΐ. Aliquots of 2 μΐ are used to electroporate 20 μΐ of DH10b + 20 μΐ of twice distilled H2O as per above. Optionally a 15 μΐ aliquot can be used to transform 75-100 μΐ of INVITROGEN™ Library Efficiency DH5a. The cells are spread on plates containing LB medium and 50 g/mL spectinomycin and incubated at 37 °C overnight.
Three to four independent colonies are picked for each putative co-integrate and inoculated 4 mL of 2xYT medium (10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride) with 50 μg/mL spectinomycin. The cells are incubated at 37 °C overnight with shaking. Next, isolate the plasmid DNA from 4 mL of culture using QIAprep® Miniprep with optional Buffer PB wash (elute in 50 μί). Use 8 μί for digestion with Sail (using parental DNA and PHP10523 as controls). Three more digestions using restriction enzymes BamHI, EcoRI, and Hindi 11 are performed for 4 plasmids that represent 2 putative co-integrates with correct Sai l digestion pattern (using parental DNA and PHP10523 as controls). Electronic gels are recommended for comparison.
EXAMPLE 13
Transformation of Maize Using Aarobacterium
Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.
Agrobacterium-mediated transformation of maize is performed essentially as described by Zhao et al. in Meth. Mol. Biol. 318:315-323 (2006) (see also Zhao et al., Mol. Breed. 8:323-333 (2001 ) and U.S. Patent No. 5,981 ,840 issued November 9, 1999, incorporated herein by reference). The transformation process involves bacterium innoculation, co-cultivation, resting, selection and plant regeneration.
1 . Immature Embryo Preparation:
Immature maize embryos are dissected from caryopses and placed in a 2 mL microtube containing 2 mL PH I-A medium.
2. Agrobacterium Infection and Co-Cultivation of Immature Embryos:
2.1 Infection Step:
PHI-A medium of (1 ) is removed with 1 mL micropipettor, and 1 mL of Agrobacterium suspension is added. The tube is gently inverted to mix. The mixture is incubated for 5 min at room temperature.
2.2 Co-culture Step:
The Agrobacterium suspension is removed from the infection step with a 1 mL micropipettor. Using a sterile spatula the embryos are scraped from the tube and transferred to a plate of PHI-B medium in a 100x15 mm Petri dish. The embryos are oriented with the embryonic axis down on the surface of the medium. Plates with the embryos are cultured at 20 °C, in darkness, for three days. L- Cysteine can be used in the co-cultivation phase. With the standard binary vector, the co-cultivation medium supplied with 100-400 mg/L L-cysteine is critical for recovering stable transgenic events.
3. Selection of Putative Transgenic Events:
To each plate of PHI-D medium in a 100x15 mm Petri dish, 10 embryos are transferred, maintaining orientation and the dishes are sealed with parafilm. The plates are incubated in darkness at 28 °C. Actively growing putative events, as pale yellow embryonic tissue, are expected to be visible in six to to eight weeks.
Embryos that produce no events may be brown and necrotic, and little friable tissue
growth is evident. Putative transgenic embryonic tissue is subcultured to fresh PHI- D plates at two-three week intervals, depending on growth rate. The events are recorded.
4. Regeneration of TO plants:
Embryonic tissue propagated on PHI-D medium is subcultured to PHI-E medium (somatic embryo maturation medium), in 100x25 mm Petri dishes and incubated at 28 °C, in darkness, until somatic embryos mature, for about ten to eighteen days. Individual, matured somatic embryos with well-defined scutellum and coleoptile are transferred to PHI-F embryo germination medium and incubated at 28 °C in the light (about 80 μΕ from cool white or equivalent fluorescent lamps). In seven to ten days, regenerated plants, about 10 cm tall, are potted in horticultural mix and hardened-off using standard horticultural methods.
Media for Plant Transformation:
1 . PHI-A: 4g/L CHU basal salts, 1 .0 mL/L 1000X Eriksson's vitamin mix, 0.5 mg/L thiamin HCI, 1 .5 mg/L 2,4-D, 0.69 g/L L-proline, 68.5 g/L sucrose, 36 g/L glucose, pH 5.2. Add 100 μΜ acetosyringone (filter-sterilized).
2. PHI-B: PHI-A without glucose, increase 2,4-D to 2 mg/L, reduce sucrose to 30 g/L and supplemente with 0.85 mg/L silver nitrate (filter-sterilized), 3.0 g/L Gelrite®, 100 μΜ acetosyringone (filter- sterilized), pH 5.8.
3. PHI-C: PHI-B without Gelrite® and acetosyringonee, reduce 2,4-D to 1 .5 mg/L and supplemente with 8.0 g/L agar, 0.5 g/L 2-[N- morpholino]ethane-sulfonic acid (MES) buffer, 100 mg/L carbenicillin (filter-sterilized).
4. PHI-D: PHI-C supplemented with 3 mg/L bialaphos (filter-sterilized).
5. PHI-E: 4.3 g/L of Murashige and Skoog (MS) salts, (Gibco, BRL
1 1 1 17-074), 0.5 mg/L nicotinic acid, 0.1 mg/L thiamine HCI, 0.5 mg/L pyridoxine HCI, 2.0 mg/L glycine, 0.1 g/L myo-inositol, 0.5 mg/L zeatin (Sigma, Cat. No. Z-0164), 1 mg/L indole acetic acid (IAA), 26.4 g/L abscisic acid (ABA), 60 g/L sucrose, 3 mg/L bialaphos (filter-sterilized), 100 mg/L carbenicillin (filter-sterilized), 8 g/L agar, pH 5.6.
6. PHI-F: PHI-E without zeatin, IAA, ABA; reduce sucrose to 40 g/L; replacing agar with 1 .5 g/L Gelrite®; pH 5.6.
Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al., Bio/Technology 8:833-839 (1990)).
Transgenic TO plants can be regenerated and their phenotype determined. T1 seed can be collected.
Furthermore, a recombinant DNA construct containing a validated
Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.
Transgenic plants, either inbred or hybrid, can undergo more vigorous field- based experiments to study yield enhancement and/or stability under water limiting and water non-limiting conditions.
Subsequent yield analysis can be done to determine whether plants that contain the validated Arabidopsis lead gene have an improvement in yield
performance (under water limiting or non-limiting conditions), when compared to the control (or reference) plants that do not contain the validated Arabidopsis lead gene. Specifically, water limiting conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants. Plants containing the validated Arabidopsis lead gene would have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.
EXAMPLE 14A
Preparation of Arabidopsis Lead Gene (At5g43420)
Expression Vector for Transformation of Maize
Using INVITROGEN™ GATEWAY® technology, an LR Recombination
Reaction was performed to create the precursor plasmid PHP45523, using PCR amplified AT-RING-H2 CDS sequence. The vector PHP45523 contains the following expression cassettes:
1 . Ubiquitin promoter::nnoPAT::Pinll terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.
2. LTP2 promoter::DS-RED2::Pinll terminator; cassette expressing the DS- RED color marker gene used for seed sorting.
3. Ubiquitin promoter::AT-RING-H2::Pinll terminator; cassette
overexpressing the gene of interest, Arabidopsis AT-RING-H2 polypeptide.
EXAMPLE 14B
Transformation of Maize with the Arabidopsis
Lead Gene (At5q43420) Using Agrobacterium
The RING-H2 polypeptide expression cassette present in vector PHP45523 can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-med\aied transformation as described in Examples 12 and 13.
Vector PHP45523 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 (PCT Publication No. WO/2012/058528) to create the co-integrate vector PHP45754. The co-integrate vector is formed by recombination of the 2 plasmids, PHP45523 and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector PHP45754 contains the same 3 expression cassettes as above (Example 14A) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1 , VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-med\aied transformation.
EXAMPLE 15
Preparation of the Destination Vector PHP23236 for Transformation into Gaspe Flint Derived Maize Lines
Destination vector PHP23236 was obtained by transformation of
Agrobacterium strain LBA4404 containing plasmid PHP10523 with plasmid
PHP23235 and isolation of the resulting co-integration product. Plasmids
PHP23236, PHP10523 and PHP23235 are described in PCT Publication No.
WO/2012/058528, herein incorporated by reference. Destination vector PHP23236, can be used in a recombination reaction with an entry clone as described in
Example 16 to create a maize expression vector for transformation of Gaspe Flint- derived maize lines.
EXAMPLE 16
Preparation of Plasmids for Transformation
into Gaspe Flint Derived Maize Lines
Using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5, PHP43712, can be directionally cloned into the destination vector PHP23236 (PCT Publication No. WO/2012/058528) to create an expression vector. This expression vector contains the protein-coding region of interest, encoding the AT-RING-H2
polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.
Alternatively, using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5, PHP45523, can be directionally cloned into the destination vector PHP29634 to create an expression vector,. Destination vector PHP29634 is similar to destination vector PHP23236, however, destination vector PHP29634 has site-specific recombination sites FRT1 and FRT87 and also encodes the GAT4602 selectable marker protein for selection of transformants using glyphosate. This expression vector will contain the protein-coding region of interest, encoding the Arabidopsis RING-H2 polypeptide, under control of the UBI promoter and is a T-DNA binary vector for /AgrOi acter/um-mediated transformation into corn as described, but not limited to, the examples described herein.
EXAMPLE 17
Transformation of Gaspe Flint Derived Maize Lines
with a Validated Arabidopsis Lead Gene
Maize plants can be transformed to overexpress the Arabidopsis lead gene or the corresponding homologs from other species in order to examine the resulting phenotype.
Recipient Plants:
Recipient plant cells can be from a uniform maize line having a short life cycle ("fast cycling"), a reduced size, and high transformation potential. Typical of these plant cells for maize are plant cells from any of the publicly available Gaspe Flint (GBF) line varieties. One possible candidate plant line variety is the F1 hybrid
of GBF x QTM (Quick Turnaround Maize, a publicly available form of Gaspe Flint selected for growth under greenhouse conditions) disclosed in Tomes et al. U.S. Patent Application Publication No. 2003/0221212. Transgenic plants obtained from this line are of such a reduced size that they can be grown in four inch pots (1/4 the space needed for a normal sized maize plant) and mature in less than 2.5 months. (Traditionally 3.5 months is required to obtain transgenic TO seed once the transgenic plants are acclimated to the greenhouse.) Another suitable line is a double haploid line of GS3 (a highly transformable line) X Gaspe Flint. Yet another suitable line is a transformable elite inbred line carrying a transgene which causes early flowering, reduced stature, or both.
Transformation Protocol:
Any suitable method may be used to introduce the transgenes into the maize cells, including but not limited to inoculation type procedures using Agrobacterium based vectors. Transformation may be performed on immature embryos of the recipient (target) plant.
Precision Growth and Plant Tracking:
The event population of transgenic (TO) plants resulting from the transformed maize embryos is grown in a controlled greenhouse environment using a modified randomized block design to reduce or eliminate environmental error. A randomized block design is a plant layout in which the experimental plants are divided into groups (e.g., thirty plants per group), referred to as blocks, and each plant is randomly assigned a location with the block.
For a group of thirty plants, twenty-four transformed, experimental plants and six control plants (plants with a set phenotype) (collectively, a "replicate group") are placed in pots which are arranged in an array (a.k.a. a replicate group or block) on a table located inside a greenhouse. Each plant, control or experimental, is randomly assigned to a location with the block which is mapped to a unique, physical greenhouse location as well as to the replicate group. Multiple replicate groups of thirty plants each may be grown in the same greenhouse in a single experiment. The layout (arrangement) of the replicate groups should be determined to minimize space requirements as well as environmental effects within the greenhouse. Such a layout may be referred to as a compressed greenhouse layout.
An alternative to the addition of a specific control group is to identify those transgenic plants that do not express the gene of interest. A variety of techniques such as RT-PCR can be applied to quantitatively assess the expression level of the introduced gene. TO plants that do not express the transgene can be compared to those which do.
Each plant in the event population is identified and tracked throughout the evaluation process, and the data gathered from that plant is automatically associated with that plant so that the gathered data can be associated with the transgene carried by the plant. For example, each plant container can have a machine readable label (such as a Universal Product Code (UPC) bar code) which includes information about the plant identity, which in turn is correlated to a greenhouse location so that data obtained from the plant can be automatically associated with that plant.
Alternatively any efficient, machine readable, plant identification system can be used, such as two-dimensional matrix codes or even radio frequency
identification tags (RFID) in which the data is received and interpreted by a radio frequency receiver/processor. See U.S. Published Patent Application No.
2004/0122592, incorporated herein by reference.
Phenotypic Analysis Using Three-Dimensional Imaging:
Each greenhouse plant in the TO event population, including any control plants, is analyzed for agronomic characteristics of interest, and the agronomic data for each plant is recorded or stored in a manner so that it is associated with the identifying data (see above) for that plant. Confirmation of a phenotype (gene effect) can be accomplished in the T1 generation with a similar experimental design to that described above.
The TO plants are analyzed at the phenotypic level using quantitative, nondestructive imaging technology throughout the plant's entire greenhouse life cycle to assess the traits of interest. A digital imaging analyzer may be used for automatic multi-dimensional analyzing of total plants. The imaging may be done inside the greenhouse. Two camera systems, located at the top and side, and an apparatus to rotate the plant, are used to view and image plants from all sides. Images are acquired from the top, front and side of each plant. All three images together
provide sufficient information to evaluate the biomass, size and morphology of each plant.
Due to the change in size of the plants from the time the first leaf appears from the soil to the time the plants are at the end of their development, the early stages of plant development are best documented with a higher magnification from the top. This may be accomplished by using a motorized zoom lens system that is fully controlled by the imaging software.
In a single imaging analysis operation, the following events occur: (1 ) the plant is conveyed inside the analyzer area, rotated 360 degrees so its machine readable label can be read, and left at rest until its leaves stop moving; (2) the side image is taken and entered into a database; (3) the plant is rotated 90 degrees and again left at rest until its leaves stop moving, and (4) the plant is transported out of the analyzer.
Plants are allowed at least six hours of darkness per twenty four hour period in order to have a normal day/night cycle.
Imaging Instrumentation:
Any suitable imaging instrumentation may be used, including but not limited to light spectrum digital imaging instrumentation commercially available from
LemnaTec GmbH of Wurselen, Germany. The images are taken and analyzed with a LemnaTec Scanalyzer HTS LT-0001 -2 having a 1 /2" IT Progressive Scan IEE CCD imaging device. The imaging cameras may be equipped with a motor zoom, motor aperture and motor focus. All camera settings may be made using LemnaTec software. For example, the instrumental variance of the imaging analyzer is less than about 5% for major components and less than about 10% for minor
components.
Software:
The imaging analysis system comprises a LemnaTec HTS Bonit software program for color and architecture analysis and a server database for storing data from about 500,000 analyses, including the analysis dates. The original images and the analyzed images are stored together to allow the user to do as much
reanalyzing as desired. The database can be connected to the imaging hardware for automatic data collection and storage. A variety of commercially available software systems (e.g. Matlab, others) can be used for quantitative interpretation of
the imaging data, and any of these software systems can be applied to the image data set.
Conveyor System:
A conveyor system with a plant rotating device may be used to transport the plants to the imaging area and rotate them during imaging. For example, up to four plants, each with a maximum height of 1 .5 m, are loaded onto cars that travel over the circulating conveyor system and through the imaging measurement area. In this case the total footprint of the unit (imaging analyzer and conveyor loop) is about 5 m x 5 m.
The conveyor system can be enlarged to accommodate more plants at a time. The plants are transported along the conveyor loop to the imaging area and are analyzed for up to 50 seconds per plant. Three views of the plant are taken. The conveyor system, as well as the imaging equipment, should be capable of being used in greenhouse environmental conditions.
Illumination:
Any suitable mode of illumination may be used for the image acquisition. For example, a top light above a black background can be used. Alternatively, a combination of top- and backlight using a white background can be used. The illuminated area should be housed to ensure constant illumination conditions. The housing should be longer than the measurement area so that constant light conditions prevail without requiring the opening and closing or doors. Alternatively, the illumination can be varied to cause excitation of either transgene (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP)) or endogenous (e.g.
Chlorophyll) fluorophores.
Biomass Estimation Based on Three-Dimensional Imaging:
For best estimation of biomass the plant images should be taken from at least three axes, for example, the top and two side (sides 1 and 2) views. These images are then analyzed to separate the plant from the background, pot and pollen control bag (if applicable). The volume of the plant can be estimated by the calculation:
Volume(voxels) = ^TopArea(pixels) x ^ SidelArea(pixels) x ^ ' Side2Area(pixels)
In the equation above the units of volume and area are "arbitrary units".
Arbitrary units are entirely sufficient to detect gene effects on plant size and growth in this system because what is desired is to detect differences (both positive-larger and negative-smaller) from the experimental mean, or control mean. The arbitrary units of size (e.g. area) may be trivially converted to physical measurements by the addition of a physical reference to the imaging process. For instance, a physical reference of known area can be included in both top and side imaging processes. Based on the area of these physical references a conversion factor can be determined to allow conversion from pixels to a unit of area such as square centimeters (cm2). The physical reference may or may not be an independent sample. For instance, the pot, with a known diameter and height, could serve as an adequate physical reference.
Color Classification:
The imaging technology may also be used to determine plant color and to assign plant colors to various color classes. The assignment of image colors to color classes is an inherent feature of the LemnaTec software. With other image analysis software systems color classification may be determined by a variety of computational approaches.
For the determination of plant size and growth parameters, a useful classification scheme is to define a simple color scheme including two or three shades of green and, in addition, a color class for chlorosis, necrosis and bleaching, should these conditions occur. A background color class which includes non plant colors in the image (for example pot and soil colors) is also used and these pixels are specifically excluded from the determination of size. The plants are analyzed under controlled constant illumination so that any change within one plant over time, or between plants or different batches of plants (e.g. seasonal differences) can be quantified.
In addition to its usefulness in determining plant size growth, color
classification can be used to assess other yield component traits. For these other yield component traits additional color classification schemes may be used. For instance, the trait known as "staygreen", which has been associated with
improvements in yield, may be assessed by a color classification that separates shades of green from shades of yellow and brown (which are indicative of senescing
tissues). By applying this color classification to images taken toward the end of the TO or T1 plants' life cycle, plants that have increased amounts of green colors relative to yellow and brown colors (expressed, for instance, as Green/Yellow Ratio) may be identified. Plants with a significant difference in this Green/Yellow ratio can be identified as carrying transgenes which impact this important agronomic trait.
The skilled plant biologist will recognize that other plant colors arise which can indicate plant health or stress response (for instance anthocyanins), and that other color classification schemes can provide further measures of gene action in traits related to these responses.
Plant Architecture Analysis:
Transgenes which modify plant architecture parameters may also be identified using the present invention, including such parameters as maximum height and width, internodal distances, angle between leaves and stem, number of leaves starting at nodes and leaf length. The LemnaTec system software may be used to determine plant architecture as follows. The plant is reduced to its main geometric architecture in a first imaging step and then, based on this image, parameterized identification of the different architecture parameters can be performed. Transgenes that modify any of these architecture parameters either singly or in combination can be identified by applying the statistical approaches previously described.
Pollen Shed Date:
Pollen shed date is an important parameter to be analyzed in a transformed plant, and may be determined by the first appearance on the plant of an active male flower. To find the male flower object, the upper end of the stem is classified by color to detect yellow or violet anthers. This color classification analysis is then used to define an active flower, which in turn can be used to calculate pollen shed date.
Alternatively, pollen shed date and other easily visually detected plant attributes (e.g. pollination date, first silk date) can be recorded by the personnel responsible for performing plant care. To maximize data integrity and process efficiency this data is tracked by utilizing the same barcodes utilized by the
LemnaTec light spectrum digital analyzing device. A computer with a barcode reader, a palm device, or a notebook PC may be used for ease of data capture
recording time of observation, plant identifier, and the operator who captured the data.
Orientation of the Plants:
Mature maize plants grown at densities approximating commercial planting often have a planar architecture. That is, the plant has a clearly discernable broad side, and a narrow side. The image of the plant from the broadside is determined. To each plant a well defined basic orientation is assigned to obtain the maximum difference between the broadside and edgewise images. The top image is used to determine the main axis of the plant, and an additional rotating device is used to turn the plant to the appropriate orientation prior to starting the main image acquisition.
EXAMPLE 18A
Evaluation of Gaspe Flint Derived
Maize Lines for Drought Tolerance
Transgenic Gaspe Flint derived maize lines containing the candidate gene can be screened for tolerance to drought stress in the following manner.
Transgenic maize plants are subjected to well-watered conditions (control) and to drought-stressed conditions. Transgenic maize plants are screened at the T1 stage or later.
For plant growth, the soil mixture consists of ½ TURFACE®, ½ SB300 and ½ sand. All pots are filled with the same amount of soil ± 10 grams. Pots are brought up to 100% field capacity ("FC") by hand watering. All plants are maintained at 60% FC using a 20-10-20 (N-P-K) 125 ppm N nutrient solution. Throughout the experiment pH is monitored at least three times weekly for each table. Starting at 13 days after planting (DAP), the experiment can be divided into two treatment groups, well watered and reduce watered. All plants comprising the reduced watered treatment are maintained at 40% FC while plants in the well watered treatment are maintained at 80% FC. Reduced watered plants are grown for 10 days under chronic drought stress conditions (40% FC). All plants are imaged daily throughout chronic stress period. Plants are sampled for metabolic profiling analyses at the end of chronic drought period, 22 DAP. At the conclusion of the chronic stress period all plants are imaged and measured for chlorophyll
fluorescence. Reduced watered plants are subjected to a severe drought stress
period followed by a recovery period, 23 - 31 DAP and 32 - 34 DAP respectively. During the severe drought stress, water and nutrients are withheld until the plants reached 8% FC. At the conclusion of severe stress and recovery periods all plants are again imaged and measured for chlorophyll fluorescence. The probability of a greater Student's t Test is calculated for each transgenic mean compared to the appropriate null mean (either segregant null or construct null). A minimum (P<t) of 0.1 is used as a cut off for a statistically significant result.
EXAMPLE 18B
Evaluation of Maize Lines for Drought Tolerance
Lines with Enhanced Drought Tolerance can also be screened using the following method (see also FIG. 3 for treatment schedule):
Transgenic maize seedlings are screened for drought tolerance by measuring chlorophyll fluorescence performance, biomass accumulation, and drought survival. Transgenic plants are compared against the null plant (i.e., not containing the transgene). Experimental design is a Randomized Complete Block and Replication consist of 13 positive plants from each event and a construct null (2 negatives each event).
Plant are grown at well watered (WW) conditions = 60% Field Capacity (%FC) to a three leaf stage. At the three leaf stage and under WW conditions the first fluorescence measurement is taken on the uppermost fully extended leaf at the inflection point, in the leaf margin and avoiding the mid rib.
This is followed by imposing a moderate drought stress (FIG. 3, day 13, MOD DRT) by maintaining 20% FC for duration of 9 to 10 days. During this stress treatment leaves may appear gray and rolling may occur. At the end of MOD DRT period, plants are recovered (MOD rec) by increasing to 25% FC. During this time, leaves will begin to unroll. This is a time sensitive step that may take up to 1 hour to occur and can be dependent upon the construct and events being tested. When plants appear to have recovered completed (leaves unrolled), the second
fluorescence measurement is taken.
This is followed by imposing a severe drought stress (SEV DRT) by withholding all water until the plants collapse. Duration of severe drought stress is 8-10 days and/or when plants have collapse. Thereafter, a recovery (REC) is
imposed by watering all plants to 100% FC. Maintain 100% FC 72 hours. Survival score (yes/no) is recorded after 24, 48 and 72 hour recovery.
The entire shoot (Fresh) is sampled and weights are recorded (Fresh shoot weights). Fresh shoot material is then dried for 120hrs at 70 degrees at which time a Dry Shoot weight is recorded.
Measured variables are defined as follows:
The variable "Fv'/Fm' no stress" is a measure of the optimum quantum yield (Fv'/Fm') under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib. Fv'/Fm' provides an estimate of the maximum efficiency of PSII photochemistry at a given PPFD, which is the PSII operating efficiency if all the PSII centers were open (QA oxidized) .
The variable "Fv'/Fm' stress" is a measure of the optimum quantum yield (Fv'/Fm') under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.
The variable "phiPSII no stress" is a measure of Photosystem II (PSII) efficiency under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib. The phiPSII value provides an estimate of the PSII operating efficiency, which estimates the efficiency at which light absorbed by PSII is used for QA reduction.
The variable "phiPSII_stress" is a measure of Photosystem II (PSII) efficiency under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.
EXAMPLE 19A
Yield Analysis of Maize Lines with the
Arabidopsis Lead Gene
A recombinant DNA construct containing a validated Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.
Transgenic plants, either inbred or hybrid, can undergo more vigorous field- based experiments to study yield enhancement and/or stability under well-watered and water-limiting conditions.
Subsequent yield analysis can be done to determine whether plants that contain the validated Arabidopsis lead gene have an improvement in yield performance under water-limiting conditions, when compared to the control plants that do not contain the validated Arabidopsis lead gene. Specifically, drought conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants. Reduction in yield can be measured for both. Plants containing the validated Arabidopsis lead gene have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss.
The above method may be used to select transgenic plants with increased yield, under water-limiting conditions and/or well-watered conditions, when compared to a control plant not comprising said recombinant DNA construct. Plants containing the validated Arabidopsis lead gene may have increased yield, under water-limiting conditions and/or well-watered conditions, relative to the control plants, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield.
EXAMPLE 19B
Yield Analysis of Maize Lines transformed with PHP45754
Encoding the Arabidopsis Lead Gene At5g43420
The AT-RING-H2 polypeptide present in the vector PHP45754 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14A and 14B.
Eight transgenic events were field tested in 2012 at the locations A, B, C, D and E. At the location D, drought conditions were imposed from the mid vegetative stage up to the onset of flowering (this treatment was divided into 2 areas D1 and D2) and during the grain fill period (grain fill stress; D3 and D4). The location B had supplemental irrigation and experienced only mild stress despite the widespread drought conditions in Iowa in 2012. The location E experienced mild drought during the grain-filling period. The location York, NE experienced drought from flowering
through the grain-filling period. Both the locations A and C experienced severe vegetative stage stress.
Yield data were collected in all locations in 2012, with 4-6 replicates per location.
Yield data (bushel/ acre; bu/ac) for 2012 for the 8 transgenic events is shown in FIG. 5 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased
Prediction) (Cullis, B. Ret al (1998) Biometrics 54: 1 -18, Gilmour, A. R. et al (2009). ASReml User Guide 3.0, Gilmour, A.R., et al (1995) Biometrics 51 : 1440-50).
To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.
In the single location analysis, main effect of construct is considered as a random effect. (However, construct effect might be considered as fixed in other circumstances). The main effect of event is considered as random. The blocking factors such as replicates and incblock (incomplete block design) within replicates are considered as random.
There are 3 components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1 *AR1 to remove the noise caused by spatial variation in the field.
In the multi-location analysis (ML), main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as replicates and incblock within replicates are considered as random.
We calculated blup (Best Linear Unbiased Prediction) for each event. The significance test between the event and BN was performed using a p-value of 0.1 in a two-tailed test, and the results are shown in FIG. 4. The significant values (with p- value less than or equal to 0.1 with a 2-tailed test) are shown in bold when the value is greater than the null comparator and in bold and italics when that value is less than the null.
As shown in FIG. 4, the effect of the transgene on yield was positive for several events in 2012, (shown in bold). It did well with severe stress and at high yield levels in location A it had a penalty. It also reduced plant height (PLTHT_1 ) and ear height (EARHT) (FIG. 5 and FIG. 6).
In addition to the values for the individual events described in FIG. 4, FIG.5 and FIG. 6, the row labeled with the plasmid name, PHP45754, provides the construct-level analysis.
EXAMPLE 20A
Preparation of Maize RING-H2 Polypeptide Lead Gene
Expression Vector for Transformation of Maize
Clones cfp5n.pk073.p4 and cfp6n.pk073.c17, encode maize RING-H2 polypeptides designated "Zm-RING-H2a", "Zm-RING-H2b" (SEQ ID NOS:20 and 22, respectively). The protein-coding region of these clones can be introduced into the INVITROGEN™ vector pENTR/D-TOPO® to create entry clones.
Using INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction can be performed with the entry clone and a destination vector to create a precursor plasmid. The precursor plasmid contains the following expression cassettes:
1 . Ubiquitin promoter::moPAT::Pinll terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.
2. LTP2 promoter::DS-RED2::Pinll terminator; cassette expressing the DS- RED color marker gene used for seed sorting.
3. Ubiquitin promoter::Zm-RING-H2-Polypeptide::Pinll terminator; cassette overexpressing the gene of interest, maize RING-H2 polypeptide.
EXAMPLE 20B
Transformation of Maize with Maize RING-H2 polypeptide
Lead Gene Using Aarobacterium
The maize RING-H2 polypeptide expression cassette present in the vector (precursor plasmid) can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.
Vector (precursor plasmid) can be electroporated into the LBA4404
Agrobacterium strain containing vector PHP10523 (PCT Publication No.
WO/2012/058528) to create a co-integrate vector. The co-integrate vector is formed by recombination of the 2 plasmids, the precursor plasmid and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector contains the same 3 expression cassettes as above (Example 20A) in addition to
other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1 , VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-med\aied transformation.
EXAMPLE 21
Preparation of Maize Expression Plasm ids for Transformation
into Gaspe Flint Derived Maize Lines
Clones cfp5n.pk073.p4, cfp6n.pk073.c17, encode complete maize RING-H2 polypeptide homologs designated "Zm-RING-H2a" and "Zm-RING-H2b" (SEQ ID NOS:20 and 22, respectively). Using the INVITROGEN™ GATEWAY®
Recombination technology described in Example 9, the clones encoding maize RING-H2 polypeptide homologs can be directionally cloned into the destination vector PHP23236 (PCT Publication No. WO/2012/058528) to create expression vectors. Each expression vector contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-med\aied
transformation into corn as described, but not limited to, the examples described herein.
EXAMPLE 22
Transformation and Evaluation of Soybean with Soybean Homologs of Validated Lead Genes
Based on homology searches, one or several candidate soybean homologs of validated Arabidopsis lead genes can be identified and also be assessed for their ability to enhance drought tolerance in soybean. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.
EXAMPLE 23
Transformation and Evaluation of Maize
with Maize Homologs of Validated Lead Genes
Based on homology searches, one or several candidate maize homologs of validated Arabidopsis lead genes can be identified and also be assessed for their ability to enhance drought tolerance in maize. Vector construction, plant
transformation and phenotypic analysis will be similar to that in previously described Examples.
EXAMPLE 24
Transformation of Arabidopsis with
Maize and Soybean Homologs of Validated Lead Genes Soybean and maize homologs to validated Arabidopsis lead genes can be transformed into Arabidopsis under control of the 35S promoter and assessed for their ability to enhance drought tolerance in Arabidopsis. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.
Example 25A
Screen for Seedling Emergence under Cold Temperature Stress
Seeds from an Arabidopsis activation-tagged mutant line can be tested for emergence after cold stress at 4°C. Each trial can consist of a 96 well plate of MS/GELRITE® medium with an individual seed in each well . MS/GELRITE® medium is prepared as follows: 0.215 g of PHYTOTECHNOLOGY
LABORATORIES™ Murashige and Skoog (MS) basal salt mixture per 100 ml of medium, pH adjusted to 5.6 with KOH, GELRITE® to 0.6%; the medium is autoclaved for 30 min. Row "A" of each plate is filled with Arabidopsis thaliana Colombia wild-type seed as a control. The seeds are sterilized with 20% bleach (20% bleach; 0.05% TWEEN® 20) and placed into 1 % agarose. The sterilized seed is covered with aluminum and placed into the wall refrigerator at 4 °C for three days. After cold dark stratification treatment the seeds are plated onto 96 well plates and placed in a dark growth chamber at 4 °C. Each plate is labeled with a unique plate number. On the third day after plating, germination counts are taken using a dissecting microscope. The plates are then removed from 4 °C and placed on the lab bench at 22-25 °C. Seedlings are allowed to grow within the plates until the two leaf stage (3-4 days), and are sprayed with glufosinate herbicide (e.g., 0.002% FINALE® herbicide). After the non-transgenic seedlings have died from the herbicide spray (approximately three days), the number of germinated activation- tagged transgenic seeds are assessed.
Example 25B
Arabidopsis Activation-Tagged Line 1 1 1664 (At5a43420)
Seedling Emergence under Cold Temperature Stress
Arabidopsis activation-tagged line 1 1 1664 can be screened for seedling emergence under cold temperature stress as described in Example 24A.
Claims
1 . A plant comprising in its genome a recombinant DNA construct
comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.
2. A plant comprising in its genome a recombinant DNA construct
comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein said plant exhibits an increase in yield, biomass, or both, when compared to a control plant not comprising said recombinant DNA construct.
3. The plant of Claim 2, wherein said plant exhibits said increase in yield, biomass, or both when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct.
4. The plant of any one of Claims 1 to 3, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
5. Seed of the plant of any one of Claims 1 to 4, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , and wherein a plant produced from said seed exhibits an increase in at least one trait selected from the group consisting of: drought tolerance, yield and biomass, when compared to a control plant not comprising said recombinant DNA construct.
6. A method of increasing drought tolerance in a plant, comprising:
(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ;
(b) regenerating a transgenic plant from the regenerable plant cell of (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and
(c) obtaining a progeny plant derived from the transgenic plant of (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
7. A method of selecting for increased drought tolerance in a plant, comprising:
(a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ;
(b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
(c) selecting the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
8. A method of selecting for an alteration of yield, biomass, or both in a plant, comprising:
(a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 ;
(b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
(c) selecting the transgenic plant of part (b) that exhibits an alteration of yield, biomass or both when compared to a control plant not comprising the recombinant DNA construct.
9. The method of Claim 8, wherein said selecting step (c) comprises determining whether the transgenic plant of (b) exhibits an alteration of yield, biomass or both when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.
10. The method of claim 8 or claim 9, wherein said alteration is an increase.
1 1 . The method of any one of Claims 6 to 10, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
12. An isolated polynucleotide comprising:
(a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 95% sequence identity when compared to SEQ ID NO:18, 20, 22, 23-63 or 64 , based on the Clustal V method of alignment with pairwise alignment default parameters of KTUPLE=1 , GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5; or
(b) the full complement of the nucleotide sequence of (a).
13. The polynucleotide of Claim 12, wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:18, 20, 22, 23-63 or 64 .
14. The polynucleotide of Claim 12 wherein the nucleotide sequence comprises SEQ ID NO:16, 17, 19 or 21 .
15. A plant or seed comprising a recombinant DNA construct, wherein the recombinant DNA construct comprises the polynucleotide of any one of Claims 12 to 14 operably linked to at least one regulatory sequence.
16. A plant comprising in its genome an endogenous polynucleotide operably linked to at least one heterologous regulatory element, wherein said endogenous polynucleotide encodes a polypeptide having an amino acid sequence of at least 80% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 22, 23-63 or 64, and wherein said plant exhibits
increased drought tolerance when compared to a control plant not comprising the heterologous regulatory element.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2901927A CA2901927A1 (en) | 2013-03-15 | 2014-03-12 | Drought tolerant plants and related constructs and methods involving genes encoding ring-h2 polypeptides |
| US14/773,595 US20160264988A1 (en) | 2013-03-15 | 2014-03-12 | Drought tolerant plants and related constructs and methods |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361786778P | 2013-03-15 | 2013-03-15 | |
| US61/786,778 | 2013-03-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014150812A2 true WO2014150812A2 (en) | 2014-09-25 |
| WO2014150812A3 WO2014150812A3 (en) | 2014-12-04 |
Family
ID=50483526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/024301 Ceased WO2014150812A2 (en) | 2013-03-15 | 2014-03-12 | Drought tolerant plants and related constructs and methods involving genes encoding ring-h2 polypeptides |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20160264988A1 (en) |
| CA (1) | CA2901927A1 (en) |
| WO (1) | WO2014150812A2 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016095124A1 (en) * | 2014-12-17 | 2016-06-23 | Kunming Institute Of Botany, The Chinese Academy Of Sciences | Compositions and methods for increasing drought tolerance in plants |
| CN108949786A (en) * | 2018-06-29 | 2018-12-07 | 山东农业大学 | Application of the arabidopsis E3 ubiquitinbond enzyme coding gene ATL27 in regulation plant salt resistant character |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480415B (en) * | 2021-12-31 | 2023-03-10 | 中国农业科学院生物技术研究所 | sgRNA for improving drought tolerance and saline-alkali tolerance of cotton and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030121070A1 (en) * | 2000-08-22 | 2003-06-26 | Luc Adam | Genes for modifying plant traits IV |
| WO2002015675A1 (en) * | 2000-08-22 | 2002-02-28 | Mendel Biotechnology, Inc. | Genes for modifying plant traits iv |
| CN102348803A (en) * | 2009-03-09 | 2012-02-08 | 纳幕尔杜邦公司 | Drought tolerant plants and methods involving genes encoding type c3hc4 ring finger zinc-finger family polypeptides |
-
2014
- 2014-03-12 CA CA2901927A patent/CA2901927A1/en not_active Abandoned
- 2014-03-12 WO PCT/US2014/024301 patent/WO2014150812A2/en not_active Ceased
- 2014-03-12 US US14/773,595 patent/US20160264988A1/en not_active Abandoned
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016095124A1 (en) * | 2014-12-17 | 2016-06-23 | Kunming Institute Of Botany, The Chinese Academy Of Sciences | Compositions and methods for increasing drought tolerance in plants |
| CN108949786A (en) * | 2018-06-29 | 2018-12-07 | 山东农业大学 | Application of the arabidopsis E3 ubiquitinbond enzyme coding gene ATL27 in regulation plant salt resistant character |
| CN108949786B (en) * | 2018-06-29 | 2021-07-23 | 山东农业大学 | Application of Arabidopsis thaliana E3 ubiquitin ligase encoding gene ATL27 in regulating plant salt tolerance |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2901927A1 (en) | 2014-09-25 |
| US20160264988A1 (en) | 2016-09-15 |
| WO2014150812A3 (en) | 2014-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9624504B2 (en) | Drought tolerant plants and related constructs and methods involving genes encoding DTP6 polypeptides | |
| US8916746B2 (en) | Drought tolerant plants and related constructs and methods involving genes encoding DTP21 polypeptides | |
| US20130269063A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding mate-efflux polypeptides | |
| CA2726105A1 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding lnt1 polypeptides and homologs thereof | |
| US20110016583A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding protein tyrosine phosphatases | |
| US20140068811A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding zinc-finger (c3hc4-type ring finger) family polypeptides | |
| US20150307895A1 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding snf2 domain-containing polypeptides | |
| US20160264988A1 (en) | Drought tolerant plants and related constructs and methods | |
| US20160040181A1 (en) | Agronomic characteristics under nitrogen limiting conditions for plants expressing ph11 or nucpu29 polypeptides | |
| US20160024517A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding self-incompatibility protein related polypeptides | |
| WO2014151213A2 (en) | Drought tolerant plants and related constructs and methods involving genes encoding dtp32 polypeptides | |
| US20130133104A1 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding lnt5 polypeptides and homologs thereof | |
| US20160060647A1 (en) | DROUGHT TOLERANT PLANTS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING PHOSPHATIDIC ACID PHOSPHATASE (PAP), DTP25 and DTP46 POLYPEPTIDES | |
| CA2736486A1 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding lnt6 polypeptides and homologs thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14717296 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2901927 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14773595 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14717296 Country of ref document: EP Kind code of ref document: A2 |

