WO2014146202A1 - Bacteria for the prevention, treatment and diagnosis of breast cancer - Google Patents

Bacteria for the prevention, treatment and diagnosis of breast cancer Download PDF

Info

Publication number
WO2014146202A1
WO2014146202A1 PCT/CA2014/050292 CA2014050292W WO2014146202A1 WO 2014146202 A1 WO2014146202 A1 WO 2014146202A1 CA 2014050292 W CA2014050292 W CA 2014050292W WO 2014146202 A1 WO2014146202 A1 WO 2014146202A1
Authority
WO
WIPO (PCT)
Prior art keywords
bacteria
breast
subject
breast cancer
unclassified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2014/050292
Other languages
French (fr)
Inventor
Gregor Reid
Camilla Teresa URBANIAK
John Mark TANGNEY
Joanne CUMMINS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
London Health Sciences Centre Research Inc
Original Assignee
London Health Sciences Centre Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by London Health Sciences Centre Research Inc filed Critical London Health Sciences Centre Research Inc
Publication of WO2014146202A1 publication Critical patent/WO2014146202A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745—Bifidobacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/335—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Lactobacillus (G)

Definitions

  • the present invention relates to bacteria-based compositions useful for the prevention and/or treatment of breast cancer and to methods of using those bacterial-based compositions for the same, to uses of the bacteria-based compositions and to methods of diagnosing breast cancer based on bacteria profile of breast tissues and /or the presence of a certain bacterium in breast tissue.
  • the present invention provides methods and uses useful for assessing the risk of, the treatment, prevention, diagnosis and/or prognosis of breast cancer and protection of DNA damage.
  • the present disclosure provides for a method of breast cancer diagnosis.
  • the method includes, in one embodiment, determining the bacterial profile in a test breast sample obtained from a subject, wherein the subject is diagnosed with cancer, if the bacterial profile of the test breast sample is relatively different to the bacterial profile of a normal breast, or relatively similar to the bacterial profile of breast cancer.
  • the present invention provides for a method of prognosis of breast cancer.
  • the method includes, in one embodiment, comparing the bacterial profile of a test breast sample with the bacterial profile of different control samples representing different stages of breast cancer or comparing the bacterial profile of a test sample with the bacterial profile of different control samples that are associated with various prognoses.
  • the test breast sample is suspected of containing tumor cells.
  • test breast sample is a tissue biopsy sample.
  • test sample is obtained non-invasively from the breast of the subject.
  • test sample is obtained non-invasively from the breast of the subject with a swab, from nipple exudates including milk, or from blood or lymphatic samples.
  • the present invention provides for a method of treating, preventing or reducing the risk of breast cancer in a subject.
  • the method includes, in one embodiment, administering to the subject an effective amount of bacteria or their metabolic by-products, wherein the bacteria or their metabolic by-products are capable of increasing the levels of ceramide in a cell, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
  • the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
  • the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 x10 9 of the bacteria per milliliter or less of the suitable carrier.
  • the suitable carrier is a carbohydrate-containing medium.
  • the carbohydrate-containing medium is a dairy product.
  • the bacteria are probiotic bacteria.
  • the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
  • the probiotic bacteria are lactic acid bacteria. In yet another embodiment, the bacteria are breast bacteria.
  • the present disclosure provides for a method of treating, preventing or reducing the risk of breast cancer in a subject.
  • the method includes, in one embodiment, administering to the subject an effective amount of a bacteria, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer.
  • the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
  • the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 x10 9 of the bacteria per milliliter or less of the suitable carrier.
  • the suitable carrier is a carbohydrate-containing medium.
  • the carbohydrate-containing medium is a dairy product.
  • the bacteria are probiotic bacteria.
  • the probiotic bacteria include Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
  • the probiotic bacteria are lactic acid bacteria.
  • the present invention provides for a method of treating, reducing the risk or preventing breast cancer in a subject.
  • the method includes, in one embodiment, administering to the subject a composition for killing bacteria associated with breast cancer, or for generating an immune response against bacteria associated with cancer.
  • the present invention provides for a method of treating or reducing the risk or preventing breast cancer in a subject.
  • the method includes, in one embodiment: (a) determining a bacteria profile form the breast of the subject, (b) determining if the bacteria profile includes a bacterium or bacteria associated with breast cancer, and (c) administering to the subject a composition capable of killing the bacterium or bacteria associated with breast cancer or capable of generating an immune response to the bacterium or bacteria associated with breast cancer.
  • the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
  • the present invention provides for breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject.
  • the bacteria are capable of increasing the levels of ceramide.
  • the bacteria are lactic acid bacteria.
  • the bacteria are probiotic bacteria.
  • the bacteria are probiotic bacteria
  • the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
  • the present invention provides for a use of bacteria profiles of normal control breasts in the preparation of a kit for assessing the risk, the diagnosis or prognosis of breast cancer in a subject.
  • the present invention provides for breast tissue bacteria for use in the delivery of a compound to the breast of a subject in need of said compound.
  • the present invention provides for breast tissue delivery system for administration of a compound to a subject in need of such compound, wherein said breast tissue delivery system comprises a bacterium that is generally found in breast tissue.
  • the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
  • the present disclosure provides for a method of assessing the risk or diagnosing breast cancer. The method, in one embodiment, includes determining the expression and abundance of bacteria in a breast of a subject.
  • the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
  • the present invention provides for a method for protecting against DNA damage in a subject.
  • the method includes the step of administering to the subject a composition comprising a therapeutically effective amount of a probiotic and a suitable carrier.
  • the probiotic includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
  • the present invention provides for the use of a probiotic for protecting against DNA damage in a subject.
  • the probiotic for protecting against DNA damage includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
  • Figure 1 illustrations of the location within the breast of tissue samples collected.
  • Panels (A) and (B) illustrate the location of tissue collected from women in Canada undergoing lumpectomies or mastectomies for either malignant (A) or benign (B) tumours.
  • NB Subject 25 underwent a prophylactic mastectomy due to previous cancer in theother breast.
  • Panel (C) illustrate the location of tissue collected from women in Ireland undergoing lumpectomies or mastectomies for malignant tumours.
  • Ovals represent the location of the tumour and squares represent the location of the specimen obtained for bacterial analysis. The distance between the ovals and squares are approximate estimates of the distance between the tumour and the specimen, which was at least 5cm away from the tumour.
  • Panel (D) illustrates the location of tissue collected from women in both Canada and Ireland undergoing breast reduction surgery. Asterisks in the boxes underneath the subject number, indicate samples from Ireland. All samples were a minimum of 1 cm deep to the skin with the surgeons aiming for mid-deep rather than superficial. As shown in the panels, specimens were obtained from a variety of locations within the breast.
  • Figure 2 are graphs illustrating the percent abundance of different bacterial phyla in breast tissue identified by 16S rRNA sequencing.
  • Panel B The least abundant phyla shown in (A) were plotted on another graph with a smaller scale to allow for better visualization of percentage. In samples from both countries Proteobacteria was the most abundant phyla followed by Firmicutes (Kruskal-Wallis/Mann-Whitney U with Bonferroni correction, p ⁇ 0.001 ).
  • FIG. 3 Bray-Curtis dissimilarity principal coordinate analysis (PCoA) plots comparing bacterial profiles in breast tissue from women with and without cancer. Each tissue sample is represented as a circle on this 3D, 3-axis plane. Only the first 3 components are plotted representing (A) 44% of the variation in the Canadian samples and (B) 51 % of the variation in the Irish samples. Tissue samples collected from women without cancer are labelled “LH” or " ⁇ ", while normal-adjacent tissue collected from women with cancer are labelled "LN" or "CN”.
  • PCoA principal coordinate analysis
  • LH Prevotella
  • LN Acinetobacter, Bacillus, Comamonadaceae, Cytophaga/Flavobacterium, Enterobacteriaceae, Gammaproteobacteria, Prevotella, Propionibacterium, Pseudomonas, Staphylococcus
  • CH Janibacter
  • CN Alloiococcus otitidis, Acinetobacter, Enterobacteriaceae, Listeria welshimeri, Lysobacter, Propionibacterium, Pseudomonas, Staphylococcus.
  • Figure 4 Graph comparing Escherichia coli/Shigella amounts in tissue from women with ("CN”) and without ("CH”) cancer from Ireland. Mann Whitney U test p ⁇ 0.05. Each bar represents the mean +/- SEM.
  • FIG. 5 Graphs illustrating qPCR analysis of malignant tumour tissue (“C#T”) samples and corresponding normal adjacent tissue (“C#N”) from women recruited from Ireland ("#” represents a subject's sample number). qPCR was performed for (A) E. coli/Shigella specific 16S rRNA gene (B) Citrobacter specific 16S rRNA gene and (C) Bifidobacterium specific 16S rRNA gene. The bars represent the mean and standard deviation of 3 technical replicates. All samples were normalised to the eukaryotic gene GAPDH. Star represents samples that were shown to be
  • FIG. 7 Graph illustrating the effect of Lactobacillus on DNA damaging effects of Etoposide. Each dot on the graph represents the measurement of one individual cell. Approximately 250 cells were visualized and measured per treatment group. Stars represent significant differences between the bacterial treatment and cells treated with just Etoposide (pval ⁇ 0.01 ).
  • Figure 8 Graph illustrating JSpecies analysis comparing Bacillus cereus (S34) isolated from breast tissue to that of other Bacillus isolates with fully sequenced genomes. In addition, a comparison was also done with an isolate from breast tissue of a healthy woman. Bacillus cereus S34 was most closely related to the B.cereus ATCC 14579 strain.
  • Figure 9. Unweighted principal coordinate analysis (PCoA) plot comparing bacterial profiles in breast milk and normal adjacent tissue taken from women with breast cancer. Each symbol represents a sample, with triangles representing tissue and spheres representing milk. Distinct clusters are indicative of different bacterial communities. As show in this plot, the milk samples cluster together and the tissue samples cluster together and these clusters are distinct between the different groups. The unweighted unifrac distance matrix used for the analysis looks at differences based on presence or absence of bacteria, not abundance.
  • PCoA principal coordinate analysis
  • adjacent refers to tissue taken adjacent to a tumour and “tumour” refers to tissue taken directly from a tumour.
  • Bacteast bacteria refers to bacteria, alive or dead, that is found in breast tissue or milk.
  • food grade bacteria refers to any bacteria, alive or dead, that have no harmful effect on human health or that have a GRAS (generally recognized as safe) status. Such bacteria maybe selected from the group consisting of Lactobacilli and Bacilli.
  • “Dairy product” refers to milk or a food produced from the milk of mammals (including human milk), and includes cheese, yogurt, cream, powdered milk, butter, ice cream, and so forth.
  • probiotic as used in this document refers to bacteria, including those of food-grade, which perform beneficial functions for the subject organisms when they are present and in viable form.
  • Food production animal is used herein to describe any animal that is prepared and used for human consumption.
  • a food production animal can be, but not limited to, a ruminant animal such as beef and dairy cattle, pigs, lamb, deer, rabbits, chicken, turkey or any other fowl, or aquatic animals including shrimp, lobster or fish used for human consumption.
  • Subject or “subjects” are used herein to describe a member of the animal kingdom, including food production animals and humans.
  • the inventors rationalized that given the nutrient rich fatty composition of the female breast, the widespread vasculature and lymphatics, and the diffuse location of the lobules and ducts leading from the nipple, bacteria would be widespread within the mammary glands, irrespective of lactation.
  • the inventors used culture and 16S rRNA sequencing to analyze the breast tissue microbiota. To ensure that the results obtained were not an artifact of a single demographic, tissue was collected and processed from two countries: Canada and Ireland.
  • the inventors discovered that regardless of location sampled within the breast, presence/absence of breast malignancy, country of origin, age of the subject, history of pregnancy, and method of DNA preparation, a variety of bacteria were detected in breast tissue (see Table 7).
  • the present invention provides a method of breast cancer diagnosis or assessing the risk of developing breast cancer.
  • the method of breast cancer diagnosis or assessing the risk of developing breast cancer may include comparing the bacterial profile in a test breast sample, which may or may not be suspected of containing tumor cells obtained from a subject, with the bacterial profile of a normal breast, with the bacterial profile of a breast known to have cancer, or with both.
  • the subject may be diagnosed with cancer, if the bacterial profile of the test breast sample is relatively different to the bacterial profile of the normal breast, or if bacterial profile of the test breast sample is relatively similar to the bacterial profile of a control breast cancer tissue sample.
  • the present invention provides for a method of prognosis of breast cancer.
  • the method may include comparing the bacterial profile of a test breast sample with the bacterial profile of different control samples representing different stages of breast cancer.
  • Libraries of bacterial profiles of breast cancer tissues may be created a priori.
  • the libraries may be regionally or country based. For example, a library may be created for North America, or a library for Canada, United States and so forth.
  • the test breast sample may or may not be suspected of containing tumor cells.
  • the test sample may be obtained by any method known in the art.
  • the test sample may be a tissue sample obtained by biopsy.
  • non-invasive method may be preferred.
  • the test sample may be obtained non- invasively from the breast of the subject with a swab, or from nipple exudates including milk, or from blood or lymphatic samples.
  • the present invention relates also to the use of breast bacterial profile for diagnosing or assessing the risk of developing breast cancer.
  • a method of breast cancer diagnosis or assessing the risk of developing breast cancer may include determining the expression level and/or abundance of a bacterium and/or bacteria, in a test breast sample, which in aspects of the present invention may be suspected of containing tumor cells obtained.
  • the bacteria may be (a) over-expressed or over-represented in the test breast sample relative to normal healthy breast, (b) expressed in the test breast sample and not in the normal breast, or (c) not expressed in the test breast sample and it is expressed in the normal breast. In the latter case, the absence of certain bacterial types that have protective effects against disease, might place the test subject at higher risk of disease.
  • the subject may be diagnosed with breast cancer or of having a risk of developing breast cancer, if (a) said bacteria are overexpressed in the test breast sample relative to the expression of said bacteria in a normal healthy breast, (b) said bacteria are expressed in the test breast sample and not in the normal breast, or (c) said bacteria are not expressed in the test breast sample and it is expressed in the normal breast.
  • the present invention in another embodiment, is a method of treating or preventing or reducing the risk of breast cancer.
  • the method may include administering to a subject an antibiotic or antimicrobial agent to kill bacteria associated with breast cancer.
  • the method may also include administering to the subject a vaccine or whole bacteria or their metabolic by-products to generate an immune response against bacteria associated with breast cancer.
  • the present invention may also be a use of a vaccine or whole bacteria or their metabolic byproducts for generating an immune response against bacteria associated with breast cancer.
  • the methods of the present invention may be used alone or in combination with other known breast cancer therapies.
  • the method may include determining a bacterial profile form the breast of a subject, determining if the profile includes a bacterium or bacteria associated with breast cancer, and administering a composition capable of killing the bacteria associated with breast cancer or capable of generating an immune response to the bacteria associated with breast cancer.
  • the present invention relates also to the use of an antibiotic or antimicrobial agent against a bacteria associated with breast cancer for treating or preventing or reducing the risk of breast cancer.
  • the present invention relates also to the use of a composition, such as a vaccine, that generates an immune response against a bacteria associated with breast cancer for treating or preventing or reducing the risk of breast cancer.
  • Treatment or prevention of breast cancer in a subject may be accomplished, for example, by reducing or eliminating the amount of the carcinogenic compound carried by the subject, by administering a bacteria known to be present in the breast, which may be food-grade bacteria, or extracts thereof, to the subject.
  • a bacteria known to be present in the breast which may be food-grade bacteria, or extracts thereof
  • Another example would be the control of aberrant cell growth before it reaches the cancer stage, by up-regulating pro-apoptotic signaling molecules, such as ceramide. This could also have a role in treatment as increased ceramide levels have been shown to make chemotherapeutic drugs more effective.
  • the methods for administering bacteria may essentially be the same, whether for prevention or treatment.
  • the risk of breast cancer may be substantially reduced or eliminated by a combination of prevention and treatment.
  • Food-grade bacteria may also be used, according to another embodiment of the present invention, to feed animals that may be consumed by humans.
  • food-grade bacteria of the present invention may be added to animal feeds.
  • the present invention is a use of antibiotics, such as anti-Sac/7/ivs, anti-E. coli, or anti-H. pylori, for reducing DNA damage in breast tissue.
  • Lactobacillus isolated from human breast milk and food-grade Lactobacillus rhamnosus GR-1 were able to reduce DNA damaging effects of Etoposide, a DNA damaging chemical (see Figure 7).
  • Lactobacillus isolated from human breast milk and Lactobacillus rhamnosus GR-1 may be used for reducing DNA damage.
  • the inventors discovered that bacteria are present in breast tissue.
  • Breast tissue is an appropriate environment for these bacteria.
  • different bacterial profiles exist in tissue from women with and without cancer (see Table 7).
  • the bacteria present in breast tissue of women with cancer may be used as vectors for the delivery of anticancer therapy more effectively.
  • the bacteria used as vector will be a bacterial that will not harm the subject, such as a Lactobacillus.
  • compositions are preferred.
  • One bacterium may be administered alone or in conjunction with a second, different bacterium. Any number of different bacteria may be used in conjunction.
  • conjunction with is meant together, substantially simultaneously or sequentially.
  • the compositions may be administered in the form of tablet, pill or capsule, for example.
  • One preferred form of application involves the preparation of a freeze-dried capsule comprising the composition of the present invention.
  • Another preferred form of application involves the preparation of a lyophilized capsule of the present invention.
  • Still another preferred form of application involves the preparation of a heat dried capsule of the present invention.
  • another preferred form of application involves the preparation of a creme or solution that delivers the beneficial microorganisms.
  • amount effective is meant to be an amount of a bacterium or bacteria, high enough to significantly positively modify the condition to be treated but low enough to avoid serious side effects (at a reasonable benefit/risk ratio), within the scope of sound medical judgment.
  • An effective amount of a bacterium will vary with the particular goal to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy and the specific Lactobacillus employed. The effective amount of a bacterium will thus be the minimum amount which will provide the desired detoxification.
  • a decided practical advantage of using food-grade bacteria or bacterial strains or their metabolic by-products, with properties attributed to anti-cancer effects, is that they may be administered in a convenient manner such as by the oral, intravenous (where non-viable), topical over the breast, or suppository (vaginal or rectal) routes.
  • the active ingredients which comprise bacteria may be required to be coated in a material to protect said organisms from the action of enzymes, acids and other natural conditions which may inactivate said organisms.
  • they should be coated by, or administered with, a material to prevent inactivation.
  • bacteria may be co-administered with enzyme inhibitors or in liposomes.
  • Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP) and trasylol.
  • Liposomes include water-in-oil-in- water P40 emulsions as well as conventional and specifically designed liposomes which transport bacteria, such as Lactobacillus, or their by-products to an internal target of a host subject.
  • Dispersions can also be prepared, for example, in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the bacteria or their metabolic by-products, in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required.
  • dispersions are prepared by incorporating the various sterilized bacteria or their metabolic by- products, into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile- filtered solution thereof. Additional preferred methods of preparation include but are not limited to lyophilization and heat-drying.
  • the active compound may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets designed to pass through the stomach (i.e., enteric coated), or it may be incorporated directly with the food of the diet, or it may be incorporated with compounds that support and promote the growth of the bacteria being administered.
  • the food-grade bacteria may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • the tablets, troches, pills, capsules, and the like, as described above, may also contain the following: a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid, and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil or wintergreen or cherry flavoring.
  • a binder such as gum tragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid, and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin may be added or a
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the organism may be incorporated into sustained-release preparations and formulations.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the bacteria calculated to produce the desired preventive or therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the novel dosage unit forms of the invention may be dictated by and may be directly depending on (a) the unique characteristics of the bacteria and the particular preventive, detoxification or therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such bacteria for the establishment and maintenance of a healthy biota in the intestinal tract.
  • the organism can be compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically or food acceptable carrier in dosage unit form as hereinbefore disclosed.
  • a unit dosage form can, for example, contain the principal active compound in an amount approximating 10 9 viable or non- viable, for example lactobacilli, per ml.
  • the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
  • the pharmaceutically acceptable carrier may be in the form of milk or portions thereof including yogurt. Skim milk, skim milk powder, non-milk or non-lactose containing products may also be employed.
  • the skim milk powder is conventionally suspended in phosphate buffered saline (PBS), autoclaved or filtered to eradicate proteinaceous and living contaminants, then freeze dried heat dried, vacuum dried, or lyophilized.
  • PBS phosphate buffered saline
  • substances which can serve as pharmaceutical carriers are sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethycellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerine, sorbitol, manitol, and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline; cranberry extracts and phosphate buffer solution; skim milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example.
  • sugars such as lac
  • wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, lubricants, excipients, tabletting agents, stabilizers, anti-oxidants and preservatives, can also be present. Accordingly, the subject may be orally administered a therapeutically effective amount of at least one food-grade bacteria and a pharmaceutically acceptable carrier in accordance with the present invention.
  • a preferred bacterium is a lactic acid bacterium.
  • Example 1 Microbiota of Breast Tissue
  • Sample processing Tissue samples were homogenized in sterile phosphate buffered saline (PBS) using a PolyTron 2100 homogenizer at 28000 rpm until the tissue was fully homogenized. The amount of PBS added was based on the weight of the tissue to obtain a final concentration of 0.4g/mL. Fresh homogenate was plated on different agar plates for culture dependent analysis and the remaining amount aliquotted and stored at -80°C until DNA extraction.
  • PBS sterile phosphate buffered saline
  • tissue homogenates were thawed on ice, 400 ⁇ (equivalent to 160mg of tissue) were added to tubes containing 1 .2ml of ASL buffer (QIAamp® DNA Stool Kit, Qiagen) and 400mg of 0.1 mm diameter zirconium-glass beads (BioSpec Products). Mechanical and chemical lyses were performed by bead beading at 4800rpm for 60s, then 60s on ice (repeated twice) (mini-beadbeater-1 , BioSpec Products) and then incubated at 95oC for 5min.
  • ASL buffer QIAamp® DNA Stool Kit, Qiagen
  • CBA Columbia Blood agar
  • CBA + vancomycin to select for gram negative aerobes
  • CBA+vancomycin+ kanamycin to select for gram negative anaerobes
  • MRS and MacConkey agar to detect lactic acid bacteria and conforms, respectively, and plated aerobically for 24hours at 37oC and anaerobically for 48-72hours at 37oC.
  • DNA from single colonies were then extracted using Instragene Matrix (Bio-Rad) and 10 ⁇ of instagene supernatant were then amplified using the eubacterial primers pA (5' AGAGTTTGATCCTGGCTCAG 3') and pH (5' AAGGAGGTGATCCAGCCGCA 3') which amplify the 1 .5kb 16s rRNA gene.
  • the PCR reaction was carried out in 50 ⁇ reaction containing 10 ⁇ of DNA template (or nuclease free water as a negative control), 1 .5mM MgCI2, 1 .0 ⁇ of each primer, 0.2mM dNTP, 5 ⁇ 10X PCR buffer (Invitrogen), and 0.05 Taq Polymerase (Invitrogen).
  • Thermal cycling was carried out in an Eppendorf Mastercycler under the following conditions: Initial denaturation step at 95oC for 2min, followed by 30 cycles of 94oC for 30s, 55oC for 30s and 72oC for 1 min. A final elongation step was performed at 72oC for 10min. After running 10 ⁇ of the PCR mixture on a 1 % agarose gel to verify the presence of amplicons, 40 ⁇ of the PCR mixture was then purified using the QIAquick PCR purification kit (Qiagen). The purified PCR products were then sent for Sanger sequencing to the London Regional Genomics Centre, London, Ontario, Canada. Sequences were analyzed using the GenBank 16S ribosomal RNA sequences database using the BLAST algorithm (1 1 ). Taxonomy was assigned based on the highest Max score.
  • Tissue collection Breast tissue was collected from 38 women (aged 20-85) undergoing breast surgery at Cork University Hospital or South Infirmary Victoria Hospital, Cork, Ireland. Thirty-three women underwent lumpectomies or mastectomies for cancerous tumours (taken at least 5cm away from the primary tumour site) while 5 women underwent breast reductions and had no history of breast cancer. Once collected the specimens were placed in sterile cryotubes and flash frozen in liquid nitrogen within 45 minutes of collection and then stored at - 80oC until DNA extraction. In addition to collecting non-malignant tissue adjacent to the tumour, tissue was also collected directly from the tumour itself from the same subject. Since the Canadian pathologist did not permit collection of tumour tissue, these samples were only collected from the Irish subjects.
  • DNA isolation from Irish samples Total DNA was extracted from tumour, normal and environmental swabs using Gene-Elute Mammalian Genomic DNA miniprep kit (Sigma-Aldrich) as per the manufacturer's protocol, with the exception of the elution step, where the column was eluted with 70 ⁇ of elution buffer.
  • V6-L and V6-R which amplify the V6 hypervariable region of the 16s rRNA gene.
  • the V6-L primer contained an adaptor sequence and a unique barcode. The primer sequences were as follows:
  • V6-LT 5' ccatctcatccctgcgtgtctccgactcagnnnncwacgcgargaaccttacc 3'.
  • V6-RT 5' cctctctatgggcagtcggtgatacracacgagctgacgac 3'
  • the N represents the unique barcode sequence.
  • the PCR was carried out in a 40 ⁇ reaction containing 5 ⁇ of DNA template (or nuclease free water as a negative control), 1 .5mM MgCI2, ⁇ . ⁇ of each primer, 4 ⁇ of 10x PCR Buffer (Invitrogen), 0.2mM dNTPs, 0.05U Taq Polymerase (Invitrogen) and 0.15 ⁇ 9/ ⁇ of bovine serum albumin.
  • Thermal cycling was carried out in an Eppendorf Mastercyler under the following conditions: Initial denaturation at 95oC for 2min followed by 25 cycles of 95oC for 1 min, 55oC for 1 min and 72oC for 1 min.
  • the DNA concentration was measured with the Qubit® 2.0 Fluorometer (Invitrogen) using the broad range assay. Equimolar amounts of each PCR product were then pooled together and purified using the QIAquick PCR purification kit (Qiagen). The PCR purified sample was then sent to the London Regional Genomics Center, London, Ontario, Canada for V6 16S rRNA sequencing using the Ion Torrent platform as per the Center's standard operating procedure.
  • V6 rRNA gene sequencing DNA from milk and tissue samples were run on a separate chip on different days and thus processed separately. PCR products were first thawed and the DNA concentration of the PCR reaction was measured with QuBit 2.0 using the high sensitivity assay. The concentrations were roughly the same (within 5% variance) between milk and tissue samples, so 10 ⁇ of each product (for each sample type) was pooled together and purified using the PCR purification kit (Qiagen). Samples were eluted in 50 ⁇ of buffer and then sent to the Robarts Research Institute for Ion Torrent sequencing using standard protocols set up by the facility.
  • Read processing and taxonomic assignment Custom Perl and Bash scripts were used to de-multiplex the reads and assign barcoded reads to individual samples. Reads were kept if a sequence read included a perfect match to the barcode and the V6 16s rRNA gene primers and were within the length expected for the V6 variable region, amples with more than 600 reads were kept while those with less than 600 were discarded. Reads were clustered by 97% identity into Operational Taxonomic Units (OTUs) using UCIust v. 3.0.617 (12). OTUs that represented at least 2% of the reads in any one sample were kept, while the rare OTUs were discarded to account for the high error rate intrinsic to Ion Torrent sequencing.
  • OTUs Operational Taxonomic Units
  • Taxonomic assignments for the representative OTU sequences were made by determining the lowest common taxonomy from the Ribosomal Database Project (RDP) Seqmatch tool (13). Comparisons were made with named isolates and the top 20 hits were retained for analysis. The taxonomic assignments were verified manually using BLAST against the Greengenes database with an output of 100 hits (14). Taxonomy was assigned based on hits with the highest % identities and coverage. If multiple hits fulfilled this criterion, classification was re-assigned to a higher common taxonomy.
  • RDP Ribosomal Database Project
  • the QIIME pipeline (15) was used to (i) calculate weighted UniFrac distances and Shannon's diversity index (logarithms with base 2); (ii) summarize OTUs by different taxonomic levels and (iii) generate Unweighted Pair Group Method with Arithmetic Mean (UPGMA) trees representing hierarchical clustering of samples.
  • the UniFrac distances were calculated by using a phylogenetic tree of OTU sequences built with FastTree (17) and based on an OTU sequence alignment with MUSCLE (17). Weighted UniFrac compares microbial profiles (presence/absence and abundance) between samples (i.e.
  • beta-diversity (18) while Shannon's diversity index evaluates the microbial diversity within a sample (i.e. alpha diversity). The higher the Shannon's diversity index, the more diverse a sample is and a value of zero indicates the presence of only one species (19).
  • UPGMA trees allows one to visualize the distance matrix and the robustness of what was observed was tested with jackknifing and bootstrapping. For beta-diversity analyses, the data set was rarified to the lowest read count/sample. Barplots, boxplots and stripcharts were all generated in R (20).
  • Genus-specific PCR Primers were designed to amplify specific genes within certain bacterial genera. Total genomic DNA from the tissue sample was used as template for PCR. BioMix Red (Bioline) was used for the PCR reaction. The PCR cycle was as follows (95°C x 5 min, 94°C x 30 sec, 50-55°C x 30 sec, 72°C x 30 sec for 40 cycles and final extension of 72°C for 4 min). The PCR product was run on a 1 % gel and immediately photographed on a UV transillumination. PCR primers used are listed in Table 1 .
  • Tissue was obtained from various locations within the breast, from close to the nipple to as far back as the chest wall ( Figure 1 ). Regardless of location sampled within the breast, presence/absence of breast malignancy, country of origin, age, history of pregnancy and method of DNA preparation, a variety of bacteria were detected in breast tissue (Table 7). Bacterial diversity within samples varied between individuals with Shannon's diversity indices ranging from 0.8-5.2, with an average value of 3.6. To put into perspective, using the same index, oral and gut samples, known for their diverse bacterial communities, have values between 3.9-6.5 (22-25), while vaginal samples of low bacterial diversity, generate values between 0.46-2.9 (26-28) .
  • OTUs operational taxonomic units
  • Table 7 The bacteria identified in tissue were grouped into 121 operational taxonomic units (OTUs) based on 97% sequence similarity (Table 7). These OTUs belonged to 7 different phyla: Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, Deinococcus-Thermus, Verrucomicrobia and Fusobacteria with Proteobacteria being the most abundant phylum followed by Firmicutes (specifically from the class Bacilli) (see Figure 2). Of the 121 OTUs identified, 57 could be classified at the genus level and 25 at the species level (Table 7).
  • Bacteria were able to be cultured from all 43 of the Canadian samples (culture analysis was not performed on the Irish samples) with amounts ranging from 75- 2000 cfu/gram of tissue, depending on the sample. Collectively, eight different strains were identified: Bacillus sp, Micrococcus luteus, Propionibacterium acnes, Propionibacterium granulosum, Staphylococcus sp, Staphylococcus saprophytics, Streptococcus oralis, Streptococcus agalactiae. No bacteria were isolated from the environmental controls.
  • ANOSIM generates the global test statistic, R, which lies between -1 and +1 .
  • Taxa information added to the PCoA plots allowed us to visualize correlations between tissue type and microbial communities (Figure 3).
  • Enterobacteriaceae, Pseudomonas, Propionibacterium, Staphylococcus and Acinetobacter were associated with tissue from women with cancer, in addition to Bacillus, Comamonadaceae, Gammaproteobacteria and Cytophaga/Flavobacterium in the Canadian samples and Listeria welshimeri, Lysobacter and Alloiococcus otitidis in the Irish ones.
  • Taxa associated with tissue from women without cancer were Prevotella in the Canadian samples and Janibacter and Gammaproteobacteria in the Irish ones.
  • PapR the PlcR regulon is the major virulence regulator for B. cereus and is regulated via bacterial density. The fact that none of the subjects had any signs of infection may be due to the low density of Bacillus in the tissue.
  • S-layer proteins are monomolecular crystalline arrays of
  • S-layer proteins proteinaceous subunits attached to peptidoglycan of gram positive bacteria. Changes in environmental conditions lead to different variations of these S-layer proteins. S-layers from Bacillaceae were found to function as adhesion sites for cell associated exo-enzymes. It is believed that the S-layer may contribute to virulence in Bacillus, as only virulent clinical isolates have S-layers. It has also been observed that strains containing S-layers adhere tomatrix proteins and are resistant to polymorphonulcear leukocytes in the absence of opsonins.
  • Chitin binding protein and chitinases Chitin is the second most abundant polysaccharide in nature next to cellulose. Chitinases are found in a variety of eukaryotic and prokaryotic species even though they do no produce endogenous chitin. It is believed that chitin binding protein and chitinases act as virulence factors in some pathogens by modulating adhesion and/or invasion into host cells. Chitinase like proteins, which are found in mammals and have the ability to bind but not cleave chitin, have been shown to enhance the adhesion of intestinal bacteria to colonic epithelial cells, promoting the pathogenesis of inflammatory bowel disease. Increased serum levels of chitinase like proteins correlate with disease severity, poorer prognosis, and shorter survival in many human cancers such as breast, colon, prostate, ovaries, brain, thyroid, lung, and liver.
  • Bacillolysin is an enzyme found in many Bacillus species. It has been shown that bacillolysin from B. megaterium has the ability to convert plasminogen to angiostatin-like fragments. Angiostatin inhibits proliferation of vascular endothelial cells, which is a fundamental process in angiogenesis. Angiostatin has been shown to suppress both in situ and metastatic tumour growth in animal models.
  • Subsequent analyses may include comparisons between this strain and the avirulent ATCC 14579 strain, as well as virulent clinical isolates.
  • Aneurinibacillus aneurinilyticus isolated from the tissue of a healthy woman, was also sequenced. This isolateshares 79% sequence identity with our Bacillus cereus isolate and was once classified in the genus Bacillus.
  • DNA damage increases the risk of developing cancer and certain bacterial strains, such as E.coli (30) and H. pylori (31 ) have been shown to induce DNA damage with the latter being linked to the development of gastric cancer. Since the Bacillus isolate that we sequenced had genes for potential toxins, we examined, using the ⁇ 2 ⁇ assay, whether this isolate had the ability to induce DNA damage. Doing a time course, we saw that the induction of DNA damage occurred as early as 30min after incubation (Figure 6).
  • Lactobacillus could protect against damage by strong DNA damaging chemicals, in this case Etoposide.
  • MDA-MB-231 cells were treated with Lactobacillus isolated from breast milk or Lactobacillus rhamnosus GR-1 for 2 hours before bacteria were washed away and Etoposide added for 4 hours. Lactobacillus isolated from both milk and GR-1 were able to reduce the DNA damaging effects of Etoposide, possibly through sequestration of this chemical (Figure 7).
  • the Inventors have also collected 50 milk samples from lactating women and analyzed the bacterial profiles in these samples. Interestingly, the predominant organisms were different than that seen in tissue with the predominant organisms being Cloacibacterium, Brevundimonas and Acinetobacter. A combination of both culture and Ion Torrent 16s rRNA sequencing have identified bacteria in milk, that have not yet been published in the literature, to be associated with breast milk (Table 3).
  • a Principal Coordinate analysis plot using an unweighted UNIFRAC distance matrix shows that bacterial profiles differ between tissue and milk (Figure 9).
  • nitrate reductase assay Some of the bacteria isolated from milk and tissue were tested for their ability to reduce nitrate to nitrite using the nitrate reductase assay. Coupling of nitrite with dietary secondary amines leads to the formation of nitrosamine, a carcinogenic compound.
  • the milk isolates Streptococcus nepalensis, Corynebacterium simulans, Staphylococcus aureus, Staphylococcus capitis, Peptostreptococcus, Staphylococcus hominis, Veillonella, Staphylocococcus pasteuri and the Bacillus tissue isolates were able to reduce nitrate to nitrite while Acinetobacter Iwoffii was able to reduce nitrate but not to something other than nitrite (Table 4).
  • Table 3 Bacteria identified in breast tissue by Ion Torrent 16s rRNA sequencing.
  • Table 5 Bacterial types detected but not previously associated with breast milk
  • Ion Torrent 16s sequencing backed by culture, provides evidence that breast tissue does indeed harbour a range of bacterial types, including many not yet reported in human milk. These include organisms known for pathogenic properties and also those reported to have mutagenic and carcinogenic potential.
  • nitrate reductase assay shows the potential of some of these breast isolates to form nitrosamines, a carcinogenic compound. We have also tested harmful effects of these bacteria such as the ability to induce DNA damage which may lead to mutations.
  • the form of administering microorganisms to prevent, reduce the risk of, or treat cancer can include fecal transplant, or multiple species of microorganisms, with and without, before or after administration of antibiotics or antimicrobial or chemotherapeutic agents.
  • antimicrobial agents and beneficial bacteria for example Lactobacillus species
  • Betaproteobactena unclassified; unclassified; Class unclassified; unclassified
  • Verrucomicrobia 73 Verrucomicrobia; Verrucomicrobiae; Verrucomicrobiales; Species Verrucomicrobiaceae; Akkermansia; muciniphila
  • DCIS ductal in situ carcinoma.
  • Lactobacillus reuteri RC-14 a randomized, double-blind, placebo-controlled trial. Can J Microbiol. 55(2): 133-138.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention discloses methods of using bacterial profiles of breast samples for the diagnosis and prognosis of breast cancer. The present invention discloses also methods of using microorganisms in the prevention, risk reduction and treatment of breast cancer.

Description

BACTERIA FOR THE PREVENTION, TREATMENT AND DIAGNOSIS OF
BREAST CANCER
FIELD OF THE INVENTION
The present invention relates to bacteria-based compositions useful for the prevention and/or treatment of breast cancer and to methods of using those bacterial-based compositions for the same, to uses of the bacteria-based compositions and to methods of diagnosing breast cancer based on bacteria profile of breast tissues and /or the presence of a certain bacterium in breast tissue.
BACKGROUND OF THE INVENTION
While the presence of bacteria at various body sites has long been recognized it is only been more recently that sites believed to be sterile are in fact home to various microbial species such as the stomach (1 ,2) bladder (3) and lower respiratory tracts (4), many not able to be cultured. Such discoveries have been made possible by deep sequencing of the 16S rRNA gene.
While bacteria are known to be present in human milk (5), there has not yet been a dedicated study on the microbiome of breast tissue.
SUMMARY OF THE INVENTION
The present invention provides methods and uses useful for assessing the risk of, the treatment, prevention, diagnosis and/or prognosis of breast cancer and protection of DNA damage.
Accordingly, in one embodiment, the present disclosure provides for a method of breast cancer diagnosis. The method includes, in one embodiment, determining the bacterial profile in a test breast sample obtained from a subject, wherein the subject is diagnosed with cancer, if the bacterial profile of the test breast sample is relatively different to the bacterial profile of a normal breast, or relatively similar to the bacterial profile of breast cancer.
In another embodiment, the present invention provides for a method of prognosis of breast cancer. The method includes, in one embodiment, comparing the bacterial profile of a test breast sample with the bacterial profile of different control samples representing different stages of breast cancer or comparing the bacterial profile of a test sample with the bacterial profile of different control samples that are associated with various prognoses.
In one embodiment of the previous two methods, the test breast sample is suspected of containing tumor cells.
In another embodiment, the test breast sample is a tissue biopsy sample.
In another embodiment, the test sample is obtained non-invasively from the breast of the subject.
In yet another embodiment, the test sample is obtained non-invasively from the breast of the subject with a swab, from nipple exudates including milk, or from blood or lymphatic samples.
In one embodiment, the present invention provides for a method of treating, preventing or reducing the risk of breast cancer in a subject. The method includes, in one embodiment, administering to the subject an effective amount of bacteria or their metabolic by-products, wherein the bacteria or their metabolic by-products are capable of increasing the levels of ceramide in a cell, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
In one embodiment of the previous method of treating, preventing or reducing the risk of breast cancer in a subject, the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
In another embodiment, the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 x109 of the bacteria per milliliter or less of the suitable carrier.
In another embodiment, the suitable carrier is a carbohydrate-containing medium. In another embodiment, the carbohydrate-containing medium is a dairy product.
In another embodiment, the bacteria are probiotic bacteria.
In another embodiment, the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
In another embodiment, the probiotic bacteria are lactic acid bacteria. In yet another embodiment, the bacteria are breast bacteria.
In one embodiment, the present disclosure provides for a method of treating, preventing or reducing the risk of breast cancer in a subject. The method includes, in one embodiment, administering to the subject an effective amount of a bacteria, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer.
In one embodiment of the previous method of treating, preventing or reducing the risk of breast cancer in a subject, the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
In another embodiment, the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 x109 of the bacteria per milliliter or less of the suitable carrier.
In another embodiment, the suitable carrier is a carbohydrate-containing medium.
In another embodiment, the carbohydrate-containing medium is a dairy product. In another embodiment, the bacteria are probiotic bacteria.
In another embodiment, the probiotic bacteria include Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
In yet another embodiment, the probiotic bacteria are lactic acid bacteria.
In one embodiment, the present invention provides for a method of treating, reducing the risk or preventing breast cancer in a subject. The method includes, in one embodiment, administering to the subject a composition for killing bacteria associated with breast cancer, or for generating an immune response against bacteria associated with cancer.
In another embodiment, the present invention provides for a method of treating or reducing the risk or preventing breast cancer in a subject. The method includes, in one embodiment: (a) determining a bacteria profile form the breast of the subject, (b) determining if the bacteria profile includes a bacterium or bacteria associated with breast cancer, and (c) administering to the subject a composition capable of killing the bacterium or bacteria associated with breast cancer or capable of generating an immune response to the bacterium or bacteria associated with breast cancer. In one embodiment of the previous two methods of treating, reducing the risk or preventing breast cancer in a subject, the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
In one embodiment, the present invention provides for breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject.
In one embodiment of the breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject, the bacteria are capable of increasing the levels of ceramide.
In another embodiment of the breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject, the bacteria are lactic acid bacteria.
In another embodiment of the breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject, the bacteria are probiotic bacteria.
In another embodiment of the breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject, the bacteria are probiotic bacteria, and the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
In one embodiment, the present invention provides for a use of bacteria profiles of normal control breasts in the preparation of a kit for assessing the risk, the diagnosis or prognosis of breast cancer in a subject.
In another embodiment, the present invention provides for breast tissue bacteria for use in the delivery of a compound to the breast of a subject in need of said compound.
In another embodiment, the present invention provides for breast tissue delivery system for administration of a compound to a subject in need of such compound, wherein said breast tissue delivery system comprises a bacterium that is generally found in breast tissue.
In one embodiment of the use of the previous three uses, the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof. In one embodiment, the present disclosure provides for a method of assessing the risk or diagnosing breast cancer. The method, in one embodiment, includes determining the expression and abundance of bacteria in a breast of a subject.
In one embodiment of the method of assessing the risk or diagnosing breast cancer, the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
In another embodiment, the present invention provides for a method for protecting against DNA damage in a subject. In one embodiment, the method includes the step of administering to the subject a composition comprising a therapeutically effective amount of a probiotic and a suitable carrier.
In one embodiment of the method for protecting against DNA damage in a subject, the probiotic includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
In another embodiment, the present invention provides for the use of a probiotic for protecting against DNA damage in a subject.
In one embodiment, the probiotic for protecting against DNA damage includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
BRIEF DESCRIPTION OF THE FIGURES
The present invention will become more fully understood from the detailed description given herein and from the accompanying drawings, which are given by way of illustration only and do not limit the intended scope of the invention.
Figure 1 illustrations of the location within the breast of tissue samples collected. Panels (A) and (B) illustrate the location of tissue collected from women in Canada undergoing lumpectomies or mastectomies for either malignant (A) or benign (B) tumours. NB: Subject 25 underwent a prophylactic mastectomy due to previous cancer in theother breast. Panel (C) illustrate the location of tissue collected from women in Ireland undergoing lumpectomies or mastectomies for malignant tumours. Ovals represent the location of the tumour and squares represent the location of the specimen obtained for bacterial analysis. The distance between the ovals and squares are approximate estimates of the distance between the tumour and the specimen, which was at least 5cm away from the tumour. Panel (D) illustrates the location of tissue collected from women in both Canada and Ireland undergoing breast reduction surgery. Asterisks in the boxes underneath the subject number, indicate samples from Ireland. All samples were a minimum of 1 cm deep to the skin with the surgeons aiming for mid-deep rather than superficial. As shown in the panels, specimens were obtained from a variety of locations within the breast.
Figure 2 are graphs illustrating the percent abundance of different bacterial phyla in breast tissue identified by 16S rRNA sequencing. Panel A: Boxplots of the seven different phyla identified in breast tissue from the Canadian and Irish samples. The box signifies the 75% (upper) and 25% (lower) quartiles and thus shows where 50% of the samples lie. The black line inside the box represents the median. The whiskers represent the lowest datum still within 1 .5 IQR of the lower quartile and the highest datum still within 1 .5 IQR of the upper quartile (IQR= interquartile range). Outliers are shown with open circles. Panel B: The least abundant phyla shown in (A) were plotted on another graph with a smaller scale to allow for better visualization of percentage. In samples from both countries Proteobacteria was the most abundant phyla followed by Firmicutes (Kruskal-Wallis/Mann-Whitney U with Bonferroni correction, p < 0.001 ).
For panel A the order of the boxplots are as follows: Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, Deinococcus-Thermus, Verrucomicrobia and Fusobacteria. For panel B the order of the boxplots are as follows: Deinococcus- Thermus, Verrucomicrobia and Fusobacteria.
Figure 3. Bray-Curtis dissimilarity principal coordinate analysis (PCoA) plots comparing bacterial profiles in breast tissue from women with and without cancer. Each tissue sample is represented as a circle on this 3D, 3-axis plane. Only the first 3 components are plotted representing (A) 44% of the variation in the Canadian samples and (B) 51 % of the variation in the Irish samples. Tissue samples collected from women without cancer are labelled "LH" or " Η", while normal-adjacent tissue collected from women with cancer are labelled "LN" or "CN". Bacteria that were associated with the different groups were as follows: LH= Prevotella; LN= Acinetobacter, Bacillus, Comamonadaceae, Cytophaga/Flavobacterium, Enterobacteriaceae, Gammaproteobacteria, Prevotella, Propionibacterium, Pseudomonas, Staphylococcus; CH= Janibacter, CN= Alloiococcus otitidis, Acinetobacter, Enterobacteriaceae, Listeria welshimeri, Lysobacter, Propionibacterium, Pseudomonas, Staphylococcus.
Figure 4. Graph comparing Escherichia coli/Shigella amounts in tissue from women with ("CN") and without ("CH") cancer from Ireland. Mann Whitney U test p < 0.05. Each bar represents the mean +/- SEM.
Figure 5. Graphs illustrating qPCR analysis of malignant tumour tissue ("C#T") samples and corresponding normal adjacent tissue ("C#N") from women recruited from Ireland ("#" represents a subject's sample number). qPCR was performed for (A) E. coli/Shigella specific 16S rRNA gene (B) Citrobacter specific 16S rRNA gene and (C) Bifidobacterium specific 16S rRNA gene. The bars represent the mean and standard deviation of 3 technical replicates. All samples were normalised to the eukaryotic gene GAPDH. Star represents samples that were shown to be
significantly different by paired t-test (p < 0.05). Black bars correspond to tumour tissue and white to normal-adjacent tissue samples.
Figure 6. Graph illustrating DNA damaging effects of Bacillus isolated from breast tissue. Each dot on the graph represents the measurement of one individual cell. Approximately 150 cells were visualized and measured per treatment group. "15m"= 15min incubation with bacteria, "30m"= 30 min incubation etc. "Un"= untreated cells.
Figure 7. Graph illustrating the effect of Lactobacillus on DNA damaging effects of Etoposide. Each dot on the graph represents the measurement of one individual cell. Approximately 250 cells were visualized and measured per treatment group. Stars represent significant differences between the bacterial treatment and cells treated with just Etoposide (pval<0.01 ).
Figure 8. Graph illustrating JSpecies analysis comparing Bacillus cereus (S34) isolated from breast tissue to that of other Bacillus isolates with fully sequenced genomes. In addition, a comparison was also done with an isolate from breast tissue of a healthy woman. Bacillus cereus S34 was most closely related to the B.cereus ATCC 14579 strain. Figure 9. Unweighted principal coordinate analysis (PCoA) plot comparing bacterial profiles in breast milk and normal adjacent tissue taken from women with breast cancer. Each symbol represents a sample, with triangles representing tissue and spheres representing milk. Distinct clusters are indicative of different bacterial communities. As show in this plot, the milk samples cluster together and the tissue samples cluster together and these clusters are distinct between the different groups. The unweighted unifrac distance matrix used for the analysis looks at differences based on presence or absence of bacteria, not abundance.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Also, unless indicated otherwise, except within the claims, the use of "or" includes "and" and vice versa. Non-limiting terms are not to be construed as limiting unless expressly stated or the context clearly indicates otherwise (for example "including", "having" and "comprising" typically indicate "including without limitation"). Singular forms including in the claims such as "a", "an" and "the" include the plural reference unless expressly stated otherwise. All publications cited herein, as well as the priority document, are incorporated by reference in their entirety.
"Adjacent" refers to tissue taken adjacent to a tumour and "tumour" refers to tissue taken directly from a tumour.
"Breast bacteria" refers to bacteria, alive or dead, that is found in breast tissue or milk.
The expression "food grade bacteria" refers to any bacteria, alive or dead, that have no harmful effect on human health or that have a GRAS (generally recognized as safe) status. Such bacteria maybe selected from the group consisting of Lactobacilli and Bacilli.
"Dairy product" refers to milk or a food produced from the milk of mammals (including human milk), and includes cheese, yogurt, cream, powdered milk, butter, ice cream, and so forth. The term "probiotic" as used in this document refers to bacteria, including those of food-grade, which perform beneficial functions for the subject organisms when they are present and in viable form.
"Food production animal" is used herein to describe any animal that is prepared and used for human consumption. A food production animal can be, but not limited to, a ruminant animal such as beef and dairy cattle, pigs, lamb, deer, rabbits, chicken, turkey or any other fowl, or aquatic animals including shrimp, lobster or fish used for human consumption.
"Subject" or "subjects" are used herein to describe a member of the animal kingdom, including food production animals and humans.
Overview
The inventors rationalized that given the nutrient rich fatty composition of the female breast, the widespread vasculature and lymphatics, and the diffuse location of the lobules and ducts leading from the nipple, bacteria would be widespread within the mammary glands, irrespective of lactation. The inventors used culture and 16S rRNA sequencing to analyze the breast tissue microbiota. To ensure that the results obtained were not an artifact of a single demographic, tissue was collected and processed from two countries: Canada and Ireland.
The inventors discovered that regardless of location sampled within the breast, presence/absence of breast malignancy, country of origin, age of the subject, history of pregnancy, and method of DNA preparation, a variety of bacteria were detected in breast tissue (see Table 7).
Bacterial profiles in breast tissue differ in women with and without breast cancer
As bacterial profiles have been shown to differ in "healthy" and "diseased" states, such as in periodontitis (6), inflammatory bowel disease (7), asthma (8), diabetes (9) and bacterial vaginosis (10), a comparison was performed of bacterial profiles in normal-adjacent tissue collected from women with cancer and normal tissue collected from breast reduction patients. Distinct clustering between the two tissue types on principal coordinate analysis (PCoA) plots showed that different bacterial profiles exist in breast tissue from women with and without cancer (see Figure 3). These differences were shown to be statistically significant by the non-parametric permutation analysis of similarity (ANOSIM) test (Table 2).
As such, in one embodiment, the present invention provides a method of breast cancer diagnosis or assessing the risk of developing breast cancer.
In one embodiment, the method of breast cancer diagnosis or assessing the risk of developing breast cancer may include comparing the bacterial profile in a test breast sample, which may or may not be suspected of containing tumor cells obtained from a subject, with the bacterial profile of a normal breast, with the bacterial profile of a breast known to have cancer, or with both. The subject may be diagnosed with cancer, if the bacterial profile of the test breast sample is relatively different to the bacterial profile of the normal breast, or if bacterial profile of the test breast sample is relatively similar to the bacterial profile of a control breast cancer tissue sample.
In another embodiment, the present invention provides for a method of prognosis of breast cancer. The method may include comparing the bacterial profile of a test breast sample with the bacterial profile of different control samples representing different stages of breast cancer.
Libraries of bacterial profiles of breast cancer tissues (including the bacterial profiles of breast cancer at different states) and/or normal breast tissues may be created a priori. The libraries may be regionally or country based. For example, a library may be created for North America, or a library for Canada, United States and so forth.
The test breast sample may or may not be suspected of containing tumor cells. The test sample may be obtained by any method known in the art. For example, the test sample may be a tissue sample obtained by biopsy. However, non-invasive method may be preferred. For example, the test sample may be obtained non- invasively from the breast of the subject with a swab, or from nipple exudates including milk, or from blood or lymphatic samples.
The present invention relates also to the use of breast bacterial profile for diagnosing or assessing the risk of developing breast cancer.
In one embodiment, a method of breast cancer diagnosis or assessing the risk of developing breast cancer may include determining the expression level and/or abundance of a bacterium and/or bacteria, in a test breast sample, which in aspects of the present invention may be suspected of containing tumor cells obtained. In some instances, the bacteria may be (a) over-expressed or over-represented in the test breast sample relative to normal healthy breast, (b) expressed in the test breast sample and not in the normal breast, or (c) not expressed in the test breast sample and it is expressed in the normal breast. In the latter case, the absence of certain bacterial types that have protective effects against disease, might place the test subject at higher risk of disease.
The subject may be diagnosed with breast cancer or of having a risk of developing breast cancer, if (a) said bacteria are overexpressed in the test breast sample relative to the expression of said bacteria in a normal healthy breast, (b) said bacteria are expressed in the test breast sample and not in the normal breast, or (c) said bacteria are not expressed in the test breast sample and it is expressed in the normal breast.
Prevention and Treatment of Breast Cancer
The present invention, in another embodiment, is a method of treating or preventing or reducing the risk of breast cancer. In one embodiment, the method may include administering to a subject an antibiotic or antimicrobial agent to kill bacteria associated with breast cancer. The method may also include administering to the subject a vaccine or whole bacteria or their metabolic by-products to generate an immune response against bacteria associated with breast cancer. The present invention may also be a use of a vaccine or whole bacteria or their metabolic byproducts for generating an immune response against bacteria associated with breast cancer. The methods of the present invention may be used alone or in combination with other known breast cancer therapies.
The method, in one embodiment, may include determining a bacterial profile form the breast of a subject, determining if the profile includes a bacterium or bacteria associated with breast cancer, and administering a composition capable of killing the bacteria associated with breast cancer or capable of generating an immune response to the bacteria associated with breast cancer.
The present invention relates also to the use of an antibiotic or antimicrobial agent against a bacteria associated with breast cancer for treating or preventing or reducing the risk of breast cancer. The present invention relates also to the use of a composition, such as a vaccine, that generates an immune response against a bacteria associated with breast cancer for treating or preventing or reducing the risk of breast cancer.
Therapeutic and Non-Therapeutic Applications
Treatment or prevention of breast cancer in a subject may be accomplished, for example, by reducing or eliminating the amount of the carcinogenic compound carried by the subject, by administering a bacteria known to be present in the breast, which may be food-grade bacteria, or extracts thereof, to the subject. Another example would be the control of aberrant cell growth before it reaches the cancer stage, by up-regulating pro-apoptotic signaling molecules, such as ceramide. This could also have a role in treatment as increased ceramide levels have been shown to make chemotherapeutic drugs more effective.
The methods for administering bacteria, including food-grade bacteria, may essentially be the same, whether for prevention or treatment. By routinely administering an effective dose to a subject, the risk of breast cancer may be substantially reduced or eliminated by a combination of prevention and treatment.
The inventors surprisingly discovered that the bacterial profiles of milk and tissue can differ. It is known that breast feeding for 12 months or more decreases the risk of breast cancer, and even reduces the risk of breast cancer in women carrying the BRCA1 mutation. Bacteria known to exist in the mammary glands of women with low risk of cancer, may be used for reducing the risk of breast cancer development in the same or other women.
Food-grade bacteria may also be used, according to another embodiment of the present invention, to feed animals that may be consumed by humans. In one embodiment, food-grade bacteria of the present invention may be added to animal feeds.
Reducing the Effects of DNA Damage
The inventors discovered that certain bacteria species found in breast tissue of subjects with cancer may induce DNA damage. DNA damage increases the risk of developing cancer. For example, the inventors discovered that women with cancer Bacillus sp were detected by both culture and 16s sequencing, while in healthy women no isolates were cultured and those detected by 16S sequencing were present at very low levels (less than 1 %). The inventors discovered that Bacillus induces DNA damage (see Figure 6). As such, in another embodiment, the present invention is a use of antibiotics, such as anti-Sac/7/ivs, anti-E. coli, or anti-H. pylori, for reducing DNA damage in breast tissue.
The inventors discovered that cells treated with Lactobacillus isolated from human breast milk and food-grade Lactobacillus rhamnosus GR-1 were able to reduce DNA damaging effects of Etoposide, a DNA damaging chemical (see Figure 7). As such, Lactobacillus isolated from human breast milk and Lactobacillus rhamnosus GR-1 may be used for reducing DNA damage.
Breast Bacteria as Delivery Vectors
As previously described, the inventors discovered that bacteria are present in breast tissue. Breast tissue is an appropriate environment for these bacteria. The inventors further discovered that different bacterial profiles exist in tissue from women with and without cancer (see Table 7). As such, the bacteria present in breast tissue of women with cancer may be used as vectors for the delivery of anticancer therapy more effectively. Preferably the bacteria used as vector will be a bacterial that will not harm the subject, such as a Lactobacillus. As such, in another embodiment of the present invention, is the use of breast bacteria as vectors for the delivery of compounds or molecules to the breast.
Preparation and Administration
Although this invention is not intended to be limited to any particular mode of application, oral administration of the compositions are preferred. One bacterium may be administered alone or in conjunction with a second, different bacterium. Any number of different bacteria may be used in conjunction. By "in conjunction with" is meant together, substantially simultaneously or sequentially. The compositions may be administered in the form of tablet, pill or capsule, for example. One preferred form of application involves the preparation of a freeze-dried capsule comprising the composition of the present invention. Another preferred form of application involves the preparation of a lyophilized capsule of the present invention. Still another preferred form of application involves the preparation of a heat dried capsule of the present invention. Yet, another preferred form of application involves the preparation of a creme or solution that delivers the beneficial microorganisms.
By "amount effective" as used herein is meant to be an amount of a bacterium or bacteria, high enough to significantly positively modify the condition to be treated but low enough to avoid serious side effects (at a reasonable benefit/risk ratio), within the scope of sound medical judgment. An effective amount of a bacterium will vary with the particular goal to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy and the specific Lactobacillus employed. The effective amount of a bacterium will thus be the minimum amount which will provide the desired detoxification.
A decided practical advantage of using food-grade bacteria or bacterial strains or their metabolic by-products, with properties attributed to anti-cancer effects, is that they may be administered in a convenient manner such as by the oral, intravenous (where non-viable), topical over the breast, or suppository (vaginal or rectal) routes. Depending on the route of administration, the active ingredients which comprise bacteria may be required to be coated in a material to protect said organisms from the action of enzymes, acids and other natural conditions which may inactivate said organisms. In order to administer bacteria by other than parenteral administration, they should be coated by, or administered with, a material to prevent inactivation. For example, bacteria may be co-administered with enzyme inhibitors or in liposomes. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP) and trasylol. Liposomes include water-in-oil-in- water P40 emulsions as well as conventional and specifically designed liposomes which transport bacteria, such as Lactobacillus, or their by-products to an internal target of a host subject.
The organisms may also be administered parenterally or intraperitoneally. Dispersions can also be prepared, for example, in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the bacteria or their metabolic by-products, in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required. Generally, dispersions are prepared by incorporating the various sterilized bacteria or their metabolic by- products, into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile- filtered solution thereof. Additional preferred methods of preparation include but are not limited to lyophilization and heat-drying.
When the food-grade bacteria are suitably protected as described above, the active compound may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets designed to pass through the stomach (i.e., enteric coated), or it may be incorporated directly with the food of the diet, or it may be incorporated with compounds that support and promote the growth of the bacteria being administered. For oral therapeutic administration, the food-grade bacteria may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
The tablets, troches, pills, capsules, and the like, as described above, may also contain the following: a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid, and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil or wintergreen or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills or capsules or lactobacilli or other bacteria in suspension may be coated with shellac, sugar or both.
A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the organism may be incorporated into sustained-release preparations and formulations.
It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the bacteria calculated to produce the desired preventive or therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosage unit forms of the invention may be dictated by and may be directly depending on (a) the unique characteristics of the bacteria and the particular preventive, detoxification or therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such bacteria for the establishment and maintenance of a healthy biota in the intestinal tract.
The organism can be compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically or food acceptable carrier in dosage unit form as hereinbefore disclosed. A unit dosage form can, for example, contain the principal active compound in an amount approximating 109 viable or non- viable, for example lactobacilli, per ml. In the case of compositions containing supplementary ingredients such as prebiotics, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients. The pharmaceutically acceptable carrier may be in the form of milk or portions thereof including yogurt. Skim milk, skim milk powder, non-milk or non-lactose containing products may also be employed. The skim milk powder is conventionally suspended in phosphate buffered saline (PBS), autoclaved or filtered to eradicate proteinaceous and living contaminants, then freeze dried heat dried, vacuum dried, or lyophilized.
Some other examples of substances which can serve as pharmaceutical carriers are sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethycellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerine, sorbitol, manitol, and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline; cranberry extracts and phosphate buffer solution; skim milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example. Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, lubricants, excipients, tabletting agents, stabilizers, anti-oxidants and preservatives, can also be present. Accordingly, the subject may be orally administered a therapeutically effective amount of at least one food-grade bacteria and a pharmaceutically acceptable carrier in accordance with the present invention.
A preferred bacterium is a lactic acid bacterium.
In order to aid in the understanding and preparation of the within invention, the following illustrative, non-limiting, examples are provided.
EXAMPLES
Example 1 - Microbiota of Breast Tissue
Materials and Methods
Canadian subject and sample collection: Ethical approval for this study was obtained from Western Research Ethics Board and Lawson Health Research Institute, London, Ontario, Canada. Patients provided written consent for sample collection and subsequent analyses.
Breast tissue was collected from 43 women (aged 18-90) undergoing breast surgery at St. Joseph's Hospital in London, Ontario, Canada. Thirty-eight of those women underwent lumpectomies or mastectomies for either benign (n=1 1 ) or cancerous (n=27) tumours and 5 women underwent breast reductions and had no history of breast cancer. For those women with tumours, the tissue obtained for analysis was collected outside of the marginal zone, approximately 5cm away from the tumour. After excision, the fresh tissue was immediately placed in a sterile vial on ice and homogenized within 30 min of collection. As an environmental control, a tube filled with sterile phosphate buffered saline (PBS) was left open for the duration of the surgical procedure and then processed in parallel with the tissue samples.
Sample processing: Tissue samples were homogenized in sterile phosphate buffered saline (PBS) using a PolyTron 2100 homogenizer at 28000 rpm until the tissue was fully homogenized. The amount of PBS added was based on the weight of the tissue to obtain a final concentration of 0.4g/mL. Fresh homogenate was plated on different agar plates for culture dependent analysis and the remaining amount aliquotted and stored at -80°C until DNA extraction.
DNA isolation
After tissue homogenates were thawed on ice, 400μΙ (equivalent to 160mg of tissue) were added to tubes containing 1 .2ml of ASL buffer (QIAamp® DNA Stool Kit, Qiagen) and 400mg of 0.1 mm diameter zirconium-glass beads (BioSpec Products). Mechanical and chemical lyses were performed by bead beading at 4800rpm for 60s, then 60s on ice (repeated twice) (mini-beadbeater-1 , BioSpec Products) and then incubated at 95oC for 5min. Subsequent procedures were performed using the Qiagen QIAamp® DNA Stool Kit according to the manufacturer's protocol, with the exception of the last step in which the column was eluted with 120μΙ of elution buffer. DNA was stored at -20oC until further use. For DNA isolation from human milk, 2ml of milk were spun down and 1 .2ml ASL buffer was added to the pellet. The same procedure was then followed as above for the tissue samples. Culture analysis
In an effort to prove that bacteria in the breast were viable, 10ΟμΙ of Canadian tissue homogenates from each of the 43 samples and 50μΙ of a 10-1 dilution of milk were plated on Columbia Blood agar (CBA), CBA + vancomycin (to select for gram negative aerobes), CBA+vancomycin+ kanamycin (to select for gram negative anaerobes), as well as MRS and MacConkey agar to detect lactic acid bacteria and conforms, respectively, and plated aerobically for 24hours at 37oC and anaerobically for 48-72hours at 37oC. DNA from single colonies were then extracted using Instragene Matrix (Bio-Rad) and 10μΙ of instagene supernatant were then amplified using the eubacterial primers pA (5' AGAGTTTGATCCTGGCTCAG 3') and pH (5' AAGGAGGTGATCCAGCCGCA 3') which amplify the 1 .5kb 16s rRNA gene. The PCR reaction was carried out in 50μΙ reaction containing 10μΙ of DNA template (or nuclease free water as a negative control), 1 .5mM MgCI2, 1 .0μΜ of each primer, 0.2mM dNTP, 5μΙ 10X PCR buffer (Invitrogen), and 0.05 Taq Polymerase (Invitrogen). Thermal cycling was carried out in an Eppendorf Mastercycler under the following conditions: Initial denaturation step at 95oC for 2min, followed by 30 cycles of 94oC for 30s, 55oC for 30s and 72oC for 1 min. A final elongation step was performed at 72oC for 10min. After running 10μΙ of the PCR mixture on a 1 % agarose gel to verify the presence of amplicons, 40μΙ of the PCR mixture was then purified using the QIAquick PCR purification kit (Qiagen). The purified PCR products were then sent for Sanger sequencing to the London Regional Genomics Centre, London, Ontario, Canada. Sequences were analyzed using the GenBank 16S ribosomal RNA sequences database using the BLAST algorithm (1 1 ). Taxonomy was assigned based on the highest Max score.
Irish subject and sample collection: Ethical approval for this study was obtained from University College Cork clinical research committee and from patients by informed consent.
Tissue collection: Breast tissue was collected from 38 women (aged 20-85) undergoing breast surgery at Cork University Hospital or South Infirmary Victoria Hospital, Cork, Ireland. Thirty-three women underwent lumpectomies or mastectomies for cancerous tumours (taken at least 5cm away from the primary tumour site) while 5 women underwent breast reductions and had no history of breast cancer. Once collected the specimens were placed in sterile cryotubes and flash frozen in liquid nitrogen within 45 minutes of collection and then stored at - 80oC until DNA extraction. In addition to collecting non-malignant tissue adjacent to the tumour, tissue was also collected directly from the tumour itself from the same subject. Since the Canadian pathologist did not permit collection of tumour tissue, these samples were only collected from the Irish subjects.
DNA isolation from Irish samples: Total DNA was extracted from tumour, normal and environmental swabs using Gene-Elute Mammalian Genomic DNA miniprep kit (Sigma-Aldrich) as per the manufacturer's protocol, with the exception of the elution step, where the column was eluted with 70 μΙ of elution buffer.
PCR amplification for Ion Torrent sequencing: DNA from the clinical samples was amplified using the barcoded Primers V6-L and V6-R which amplify the V6 hypervariable region of the 16s rRNA gene. The V6-L primer contained an adaptor sequence and a unique barcode. The primer sequences were as follows:
V6-LT 5' ccatctcatccctgcgtgtctccgactcagnnnnncwacgcgargaaccttacc 3'.
V6-RT 5' cctctctatgggcagtcggtgatacracacgagctgacgac 3'
The N represents the unique barcode sequence.
The PCR was carried out in a 40 μΙ reaction containing 5μΙ of DNA template (or nuclease free water as a negative control), 1 .5mM MgCI2, Ο.δμΜ of each primer, 4μΙ of 10x PCR Buffer (Invitrogen), 0.2mM dNTPs, 0.05U Taq Polymerase (Invitrogen) and 0.15μ9/μΙ of bovine serum albumin. Thermal cycling was carried out in an Eppendorf Mastercyler under the following conditions: Initial denaturation at 95oC for 2min followed by 25 cycles of 95oC for 1 min, 55oC for 1 min and 72oC for 1 min. After amplification, the DNA concentration was measured with the Qubit® 2.0 Fluorometer (Invitrogen) using the broad range assay. Equimolar amounts of each PCR product were then pooled together and purified using the QIAquick PCR purification kit (Qiagen). The PCR purified sample was then sent to the London Regional Genomics Center, London, Ontario, Canada for V6 16S rRNA sequencing using the Ion Torrent platform as per the Center's standard operating procedure.
16s V6 rRNA gene sequencing: DNA from milk and tissue samples were run on a separate chip on different days and thus processed separately. PCR products were first thawed and the DNA concentration of the PCR reaction was measured with QuBit 2.0 using the high sensitivity assay. The concentrations were roughly the same (within 5% variance) between milk and tissue samples, so 10μΙ of each product (for each sample type) was pooled together and purified using the PCR purification kit (Qiagen). Samples were eluted in 50μΙ of buffer and then sent to the Robarts Research Institute for Ion Torrent sequencing using standard protocols set up by the facility.
Read processing and taxonomic assignment: Custom Perl and Bash scripts were used to de-multiplex the reads and assign barcoded reads to individual samples. Reads were kept if a sequence read included a perfect match to the barcode and the V6 16s rRNA gene primers and were within the length expected for the V6 variable region, amples with more than 600 reads were kept while those with less than 600 were discarded. Reads were clustered by 97% identity into Operational Taxonomic Units (OTUs) using UCIust v. 3.0.617 (12). OTUs that represented at least 2% of the reads in any one sample were kept, while the rare OTUs were discarded to account for the high error rate intrinsic to Ion Torrent sequencing. Taxonomic assignments for the representative OTU sequences were made by determining the lowest common taxonomy from the Ribosomal Database Project (RDP) Seqmatch tool (13). Comparisons were made with named isolates and the top 20 hits were retained for analysis. The taxonomic assignments were verified manually using BLAST against the Greengenes database with an output of 100 hits (14). Taxonomy was assigned based on hits with the highest % identities and coverage. If multiple hits fulfilled this criterion, classification was re-assigned to a higher common taxonomy. In instances where the highest % identity/coverage yielded a single match, if this were less than 90% and the S_ab score from RDP was less than 0.7, taxonomy was assigned at the Family level instead of at the Genus level. The RDP/Greengenes classification are shown in Table 8.
Data analysis: The QIIME pipeline (15) was used to (i) calculate weighted UniFrac distances and Shannon's diversity index (logarithms with base 2); (ii) summarize OTUs by different taxonomic levels and (iii) generate Unweighted Pair Group Method with Arithmetic Mean (UPGMA) trees representing hierarchical clustering of samples. The UniFrac distances were calculated by using a phylogenetic tree of OTU sequences built with FastTree (17) and based on an OTU sequence alignment with MUSCLE (17). Weighted UniFrac compares microbial profiles (presence/absence and abundance) between samples (i.e. beta-diversity) (18) while Shannon's diversity index evaluates the microbial diversity within a sample (i.e. alpha diversity). The higher the Shannon's diversity index, the more diverse a sample is and a value of zero indicates the presence of only one species (19). UPGMA trees allows one to visualize the distance matrix and the robustness of what was observed was tested with jackknifing and bootstrapping. For beta-diversity analyses, the data set was rarified to the lowest read count/sample. Barplots, boxplots and stripcharts were all generated in R (20).
Statistical analysis: Statistical analysis was performed in R using the Kruskal-Wallis one-way analysis of variance followed by the Mann-Whitney U test with Bonferroni correction.
Genus-specific PCR: Primers were designed to amplify specific genes within certain bacterial genera. Total genomic DNA from the tissue sample was used as template for PCR. BioMix Red (Bioline) was used for the PCR reaction. The PCR cycle was as follows (95°C x 5 min, 94°C x 30 sec, 50-55°C x 30 sec, 72°C x 30 sec for 40 cycles and final extension of 72°C for 4 min). The PCR product was run on a 1 % gel and immediately photographed on a UV transillumination. PCR primers used are listed in Table 1 .
Table 1 : Sequences of primers used to detect different bacteria
Primer Name Description (5' - 3') Bacterial gene
LM3 5' CGGGTGCTCCCCACTTTCATG 3' Listeria 16s rRNA LM26 5' GATTCTGGCTCAGGATGAACG 3'
P f-FP 5' GAGTTAGAGAACGGTATTTATGCTGC 3' Bacillus cerA P f-RP 5' CTACTGCCGCTCCATGAATCC 3'
Bifidobacterium 16s
Bif164F 5' GGGTGGTAATGCCGGATG 3' rRNA
Bif601 R 5' TAAGCCATGGACTTTCACACC 3'
Escherchial Shigella
SE coli F 5' GAGTAAAGTTAATACCTTTGCTCATTG 3' 16s rRNA
SE coli R 5' GAGACTCAAGCTKRCCAGTATCAG 3'
Citro 16s qFP 5' ACGGTAGCACAGAGGAGCTT 3' Citrobacter 16s rRNA Citro 16s qRP 5' GGAGTTAGCCGGTGCTTCTT 3' Nitrate reductase assay: A selection of breast isolates at a concentration of 107"9 were inoculated in 5ml_ of nitrate broth made up by 3.0 grams of beef extract, 5.0 grams of peptone, 1 .0 gram of potassium nitrate, 1 litre of deionized water (Sigma- Aldrich, Toronto, Canada) and incubated for 24 hours at 37.5°C with a blank control of 5 ml_ nitrate broth. The suspensions were vortexed and 100μΙ removed and placed in tubes with 100μΙ of Griess Reagent (Sigma-Aldrich). Presence of nitrite indicative of nitrate reductase activity was noted by the solution turning red. If the colour change did not occur, Zinc (concentration, amount) was added, and the solution then turns red, it is a negative reaction, while if the solution remains colourless then the bacteria have reduced the nitrate to something other than nitrite. PCoA plots and Unifrac analyses were performed using Qiime and R.
Results
Tissue was obtained from various locations within the breast, from close to the nipple to as far back as the chest wall (Figure 1 ). Regardless of location sampled within the breast, presence/absence of breast malignancy, country of origin, age, history of pregnancy and method of DNA preparation, a variety of bacteria were detected in breast tissue (Table 7). Bacterial diversity within samples varied between individuals with Shannon's diversity indices ranging from 0.8-5.2, with an average value of 3.6. To put into perspective, using the same index, oral and gut samples, known for their diverse bacterial communities, have values between 3.9-6.5 (22-25), while vaginal samples of low bacterial diversity, generate values between 0.46-2.9 (26-28) .
The bacteria identified in tissue were grouped into 121 operational taxonomic units (OTUs) based on 97% sequence similarity (Table 7). These OTUs belonged to 7 different phyla: Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, Deinococcus-Thermus, Verrucomicrobia and Fusobacteria with Proteobacteria being the most abundant phylum followed by Firmicutes (specifically from the class Bacilli) (see Figure 2). Of the 121 OTUs identified, 57 could be classified at the genus level and 25 at the species level (Table 7). The most abundant taxa in the Canadian samples were Bacillus (1 1 .4%), Acinetobacter (10.0%), unclassified Enterobacteriaceae (8.3%), Pseudomonas (6.5%), Staphylococcus (6.5%), Propionibacterium (5.8%), unclassified Comamonadaceae (5.7%), unclassified Gammaproteobacteria (5.0%) and Prevotella (5.0%). In the Irish samples the most abundant taxa were unclassified Enterobacteriaceae (30.8%), Staphylococcus (12.7%), Listeria weishimeri (12.1 %), Propionibacterium (10.1 %) and Pseudomonas (5.3%).
Of the 18 environmental samples that passed quality control, 13 of them had lower read counts than their respective tissue samples. The 7 lowest read counts overall belonged to the environmental controls (<600 reads).
Bacteria were able to be cultured from all 43 of the Canadian samples (culture analysis was not performed on the Irish samples) with amounts ranging from 75- 2000 cfu/gram of tissue, depending on the sample. Collectively, eight different strains were identified: Bacillus sp, Micrococcus luteus, Propionibacterium acnes, Propionibacterium granulosum, Staphylococcus sp, Staphylococcus saprophytics, Streptococcus oralis, Streptococcus agalactiae. No bacteria were isolated from the environmental controls.
Bacterial profiles in breast tissue differ in women with and without breast cancer. A comparison was made between bacterial profiles in normal-adjacent tissue collected from women with cancer and normal tissue collected from breast reduction patients. Distinct clustering between the two tissue types on PCoA plots showed that different bacterial profiles exist in breast tissue from women with and without cancer (Figure 3). These differences were shown to be statistically significant by the non- parametric permutation analysis of similarity (ANOSI M) test (Table 2).
Table 2. Summary of the non-parametric permutation analysis of similarity (ANOSIM) test comparing Bray-Curtis dissimilarity between women with and without cancer
Figure imgf000025_0001
ANOSIM generates the global test statistic, R, which lies between -1 and +1 . R=0 represents the null hypothesis (i.e. no differences between groups) while R= +1 means that samples within a certain group (i.e. women without cancer, "CH") are more similar to each other than to samples belonging to a different group (i.e.
women with cancer, "CN"). Thus, the closer the R value is to +1 , the more significant the difference is between groups. 10, 000 permutations were used for the test.
Statistical significance= p <0.05. "LH"= Tissue collected from women undergoing breast reductions in Canada (n=5). "LN"= Non-malignant tissue collected adjacent to cancerous tumours in Canada (n=27). "CH"= Tissue collected from women undergoing breast reductions in Ireland (n=5). "CN"= Non-malignant tissue collected adjacent to cancerous tumours in Ireland (n=33).
Taxa information added to the PCoA plots (i.e. biplots) allowed us to visualize correlations between tissue type and microbial communities (Figure 3). In both the Canadian and Irish samples, Enterobacteriaceae, Pseudomonas, Propionibacterium, Staphylococcus and Acinetobacterwere associated with tissue from women with cancer, in addition to Bacillus, Comamonadaceae, Gammaproteobacteria and Cytophaga/Flavobacterium in the Canadian samples and Listeria welshimeri, Lysobacter and Alloiococcus otitidis in the Irish ones. Taxa associated with tissue from women without cancer were Prevotella in the Canadian samples and Janibacter and Gammaproteobacteria in the Irish ones.
PCoA biplots created at the OTU level showed that the Enterobacteriaceae group associated with cancer was specifically OTU 0. While we were not able to classify this OTU sequence down to the genus level, 97/100 BLAST hits in Greengenes came up as either Escherichia or Shigella. qPCR analysis on the Irish samples, using primers specific for Escherichia/Shigella, showed that this organism was indeed more abundant in women with cancer ("CN") compared to those without ("CH") (Figure 4).
A diverse population of bacteria was also detected within the tumour and the same 9 phyla identified in non-malignant tissue were also represented within the tumour, with Proteobacteria and Firmicutes also the most abundant. With the exception of 7 OTUs, all those identified in non-malignant tissue were also detected within the tumour.
Contrary to what has been documented in oral and colon cancer (29), microbial profiles did not differ between tumour and normal adjacent tissue. To determine whether differences would exist when tumour tissue was compared to normal- adjacent tissue from the same subject, qPCR was performed using primers specific for Escherichia/Shigella and Citrobacter, two members of the family Enterobacteriaceae, the most abundant taxon in the Irish samples and Bifidobacterium, an organism generally regarded for its health promoting properties. Only 9 out of the 30 subjects analyzed had significantly different amounts of Escherichia/Shigella and Citrobacter between tumour and their matched normal adjacent tissue with no differences observed between Bifidobacterium levels (Figure
Genome sequencing of breast tissue isolates. In women with cancer, Bacillus sp were detected by both culture and 16S sequencing, while in healthy women (n=5) no isolates were cultured and those detected by 16S sequencing were present at very low levels (<1 %). To elucidate a potential role in disease, the genome of one Bacillus isolate (S34) was sequenced, using paired end reads on the lllumina platform.
Sequences were assembled using Velvet (1 .2.10), with a kmer length of 31 . After assembly, JSpecies was used to calculate the similarity between our Bacillus cereus isolate and that of other Bacillus strains with fully sequenced genomes (Figure 8). Annotations were then performed in RAST showing 5536 coding sequences, with 41 % belonging to a functional subsystem and the remaining 59% not in a
subsystem. Analysis is still in progress but a brief overview of these 5536 coding sequences showed some interesting predictive proteins:
1. Toxins. While genes for numerous toxins were detected, their
expression may depend on multiple factors. It has been shown that in a homogenous monoculture of B. cereus ATCC 14579, only 1 -2% of the cell population produced the 3 main enterotoxins.
2. Transcriptional activator PlcR and the PlcR activating protein
PapR: the PlcR regulon is the major virulence regulator for B. cereus and is regulated via bacterial density. The fact that none of the subjects had any signs of infection may be due to the low density of Bacillus in the tissue.
3. S-layer proteins are monomolecular crystalline arrays of
proteinaceous subunits attached to peptidoglycan of gram positive bacteria. Changes in environmental conditions lead to different variations of these S-layer proteins. S-layers from Bacillaceae were found to function as adhesion sites for cell associated exo-enzymes. It is believed that the S-layer may contribute to virulence in Bacillus, as only virulent clinical isolates have S-layers. It has also been observed that strains containing S-layers adhere tomatrix proteins and are resistant to polymorphonulcear leukocytes in the absence of opsonins.
4. Chitin binding protein and chitinases. Chitin is the second most abundant polysaccharide in nature next to cellulose. Chitinases are found in a variety of eukaryotic and prokaryotic species even though they do no produce endogenous chitin. It is believed that chitin binding protein and chitinases act as virulence factors in some pathogens by modulating adhesion and/or invasion into host cells. Chitinase like proteins, which are found in mammals and have the ability to bind but not cleave chitin, have been shown to enhance the adhesion of intestinal bacteria to colonic epithelial cells, promoting the pathogenesis of inflammatory bowel disease. Increased serum levels of chitinase like proteins correlate with disease severity, poorer prognosis, and shorter survival in many human cancers such as breast, colon, prostate, ovaries, brain, thyroid, lung, and liver.
5. Bacillolysin is an enzyme found in many Bacillus species. It has been shown that bacillolysin from B. megaterium has the ability to convert plasminogen to angiostatin-like fragments. Angiostatin inhibits proliferation of vascular endothelial cells, which is a fundamental process in angiogenesis. Angiostatin has been shown to suppress both in situ and metastatic tumour growth in animal models.
Subsequent analyses may include comparisons between this strain and the avirulent ATCC 14579 strain, as well as virulent clinical isolates. In addition to this isolate, Aneurinibacillus aneurinilyticus, isolated from the tissue of a healthy woman, was also sequenced. This isolateshares 79% sequence identity with our Bacillus cereus isolate and was once classified in the genus Bacillus.
Ability of breast isolates to induce DNA damage: DNA damage increases the risk of developing cancer and certain bacterial strains, such as E.coli (30) and H. pylori (31 ) have been shown to induce DNA damage with the latter being linked to the development of gastric cancer. Since the Bacillus isolate that we sequenced had genes for potential toxins, we examined, using the γΗ2ΑΧ assay, whether this isolate had the ability to induce DNA damage. Doing a time course, we saw that the induction of DNA damage occurred as early as 30min after incubation (Figure 6).
In addition to examining the DNA damaging effects of bacteria, the inventors also explored whether Lactobacillus could protect against damage by strong DNA damaging chemicals, in this case Etoposide. MDA-MB-231 cells were treated with Lactobacillus isolated from breast milk or Lactobacillus rhamnosus GR-1 for 2 hours before bacteria were washed away and Etoposide added for 4 hours. Lactobacillus isolated from both milk and GR-1 were able to reduce the DNA damaging effects of Etoposide, possibly through sequestration of this chemical (Figure 7).
Example II- Microbiota of human milk
The Inventors have also collected 50 milk samples from lactating women and analyzed the bacterial profiles in these samples. Interestingly, the predominant organisms were different than that seen in tissue with the predominant organisms being Cloacibacterium, Brevundimonas and Acinetobacter. A combination of both culture and Ion Torrent 16s rRNA sequencing have identified bacteria in milk, that have not yet been published in the literature, to be associated with breast milk (Table 3).
A Principal Coordinate analysis plot using an unweighted UNIFRAC distance matrix shows that bacterial profiles differ between tissue and milk (Figure 9).
Some of the bacteria isolated from milk and tissue were tested for their ability to reduce nitrate to nitrite using the nitrate reductase assay. Coupling of nitrite with dietary secondary amines leads to the formation of nitrosamine, a carcinogenic compound. The milk isolates Streptococcus nepalensis, Corynebacterium simulans, Staphylococcus aureus, Staphylococcus capitis, Peptostreptococcus, Staphylococcus hominis, Veillonella, Staphylocococcus pasteuri and the Bacillus tissue isolates were able to reduce nitrate to nitrite while Acinetobacter Iwoffii was able to reduce nitrate but not to something other than nitrite (Table 4).
Table 3: Bacteria identified in breast tissue by Ion Torrent 16s rRNA sequencing.
Figure imgf000030_0001
Bacteria identified by Genus Bacteria identified by species
Turnebacillus
Ralstonia
Legionella
Faecalibacterium
Bifidobacterium
Marinomonas
Friedmannella
Corynebacterium
Table 4: Bacteria cultured from tissue
Figure imgf000031_0001
Table 5: Bacterial types detected but not previously associated with breast milk
Figure imgf000031_0002
Genus Species
Tepidimonas N/D
Schlegeiella N/D
Legionella N/D
Lysobacter N/D
Akkermansia muciniphila
Acinetobacter Iwoffi
Staphylococcus saprophytics
Corynebacterium amycolatum, simulans
Aeromonas N/D
Propionibacterium avidum
Peptoniphilus harei
Micrococcus lute us
Peptostreptococcus anaerobius
Lactobacillus paracasei
Culture and Ion Torrent 16s rRNA sequencing analyses on 13 milk samples collected from women in London, Canada have revealed the presence of 23 bacteria not yet identified in the literature to be associated with breast milk (ref 5, 32-38). Table 6: Ability of bacterial isolates to reduce nitrate.
Bacteria Reaction with Griess Reaction with zinc reagent
Bacillus Red No reaction
Peptostreptococcus Red No reaction
Veillonella Red No reaction
Corynebacterium simulans Red No reaction
Staphylococcus capitis Red No reaction
Staphylococcus pasteuri Red No reaction
Staphylococcus aureus Red No reaction
Staphylococcus hominis Red No reaction
Staphylococcus nepalensis Red No reaction
Acinetobacter Iwoffi Colourless No reaction
Streptococcus salivarius Colourless Red
E.coli DH5a Red No reaction Bacteria Reaction with Griess Reaction with zinc reagent
Lactobacillus rhamnosus GR-1 Colourless Red
Nitrate broth (blank) Colourless Red
Bacteria isolated from both milk and tissue samples from women recruited in London, Canada, were tested for their ability to reduce nitrate using the Nitrate Reductase test. An ability to reduce nitrate to nitrite is shown by a colour change to red after the addition of the Griess reagent. The ability to reduce nitrate to something other than nitrite is shown by the absence of a reaction when zinc is added. If a red colour appears after the addition of zinc, then the bacterium does not have the ability to reduce nitrate. With the exception of Bacillus, which was isolated from tissue, all the bacteria were isolated from milk. The numbers in parentheses refer to isolates from different subjects. E.coli DH5a was the positive control and Lactobacillus rhamnosus GR-1 was the negative control.
Discussion
Ion Torrent 16s sequencing, backed by culture, provides evidence that breast tissue does indeed harbour a range of bacterial types, including many not yet reported in human milk. These include organisms known for pathogenic properties and also those reported to have mutagenic and carcinogenic potential.
The presence of these and other potentially detrimental bacteria at the margins of breast cancer tissue raises the question of a potential role in the disease process. In vitro experiments showed the ability of a selection of the isolates to reduce nitrate to nitrite, an important step in carcinogenesis (39). On the other hand, the inability of Lactobacillus rhamnosus GR-1 to do this, it's previous tumouricidal activity (40), and its capacity to degrade some carcinogenic molecules raises the question of whether some species present in the breast may reduce the risk of cancers. For example, Akkermansia sp, a common inhabitant of the gastrointestinal tract, has been reported to have health promoting properties (41 ).
Studies have shown that women who breast feed for 6 months or longer have a reduced risk of breast cancer development. (42, 43) While it has been suggested that changes in hormones could be a contributing factor, this protective effect was still observed in triple negative cancers, which are not influenced by hormones. (44) This raises the question as to whether the bacteria in the milk and/or breast tissue may be contributing to these effects, and thus raises an additional question as to whether the differences in bacterial populations between milk and tissue could be a result of bacterial dysbiosis in women with cancer. Since 16S sequencing did show different bacterial profiles between women with and without cancer, this is highly possible.
The nitrate reductase assay shows the potential of some of these breast isolates to form nitrosamines, a carcinogenic compound. We have also tested harmful effects of these bacteria such as the ability to induce DNA damage which may lead to mutations.
On the flip side, other organisms may have a protective role. A transcriptomics experiment performed in our lab, in conjunction with qPCR, has shown that the probiotic, Lactobacillus rhamnosus GR-1 , up-regulates genes involved in the breakdown of lactosylceramide to ceramide when grown in milk. Published studies have shown that ceramide can cause apoptosis of aberrant cell growth and make multi drug resistant cancers more susceptible to therapy. Thus there is the potential that certain strains of bacteria which can produce ceramide from nutrients in the breast tissue or from the cells themselves could be used in conjunction with pre- exiting cancer therapies to make them more effective.
The form of administering microorganisms to prevent, reduce the risk of, or treat cancer, can include fecal transplant, or multiple species of microorganisms, with and without, before or after administration of antibiotics or antimicrobial or chemotherapeutic agents. The conjoint use of antimicrobial agents and beneficial bacteria (for example Lactobacillus species) to improve disease outcome has been shown previously (45-48), albeit not for breast cancer.
In conclusion, the discovery and isolation of bacteria from female breast tissue, including patients with cancer, provides evidence that microorganisms may be involved in contributing to disease processes on the one hand, or reducing the risk of said diseases occurring on the other hand, depending on the properties of the bacteria. These findings form the basis for a novel approach to detecting and treating early changes associated with cancer risk, or monitoring changes in the bacterial profile indicative of successfully altering the bacterial profiles in favour of a healthy state following the use of probiotics, prebiotics, antibiotics or other such remedies administered orally or by other methods.
Table 7. Summary of strains of bacteria found in breast tissue (in bold are show bacteria which may be used as probiotics)
Figure imgf000035_0001
OTU# Taxonomy Level
19 Actinobacteria; Actinobacteria; Actinomycetales; Genus Micrococcaceae; Micrococcus; unclassified
20 Firmicutes; Bacilli; Lactobacillales; Carnobacteriaceae; Genus Alloiococcus; unclassified
21 Bacteroidetes; Bacteroidia; Bacteroidales; Prevotellaceae; Genus Prevotella; unclassified
22 Actinobacteria; Actinobacteria; Actinomycetales; Species Corynebacteriaceae; Turicella; otitidis
23 Firmicutes; Bacilli; Lactobacillales; Streptococcaceae; Genus Streptococcus; unclassified
24 Proteobactena; Gammaproteobacteria; Alteromonadales; Genus Shewanellaceae; Shewanella; unclassified
25 Proteobactena; Betaproteobactena; unclassified; unclassified; Class unclassified; unclassified
26 Firmicutes; Bacilli; Bacillales; Staphylococcaceae; Species Staphylococcus; epidermidis
27 Proteobacteria; Betaproteobactena; Burkholderiales; Family Oxalobacteraceae; unclassified; unclassified
28 Proteobacteria; Gammaproteobacteria; Enterobacteriales; Family Enterobacteriaceae; unclassified; unclassified
29 Actinobacteria; Actinobacteria; Rubrobacterales; Genus Rubrobacteraceae; Rubrobacter; unclassified
30 Firmicutes; Bacilli; Lactobacillales; Streptococcaceae; Species Lactococcus; lactis
31 Actinobacteria; Actinobacteria; Actinomycetales; Family Microbacteriaceae; unclassified; unclassified
32 Proteobacteria; Alphaproteobacteria; Caulobacterales; Family Caulobacteraceae; unclassified; unclassified
33 Proteobacteria; Alphaproteobacteria; Sphingomonadales; Genus Sphingomonadaceae; Sphingomonas; unclassified
34 Proteobacteria; Betaproteobactena; Burkholderiales; Family Oxalobacteraceae; unclassified; unclassified
35 Firmicutes; Bacilli; Bacillales; Staphylococcaceae; Genus Staphylococcus; unclassified
36 Firmicutes; Clostridia; Clostridiales; Eubacteriaceae; Species Eubacterium; rectale
37 Proteobacteria; Alphaproteobacteria; Rhizobiales; Rhizobiaceae; Genus Rhizobium/Agrobacterium; unclassified
38 Proteobacteria; Betaproteobactena; unclassified; unclassified; Class unclassified; unclassified
39 Proteobacteria; Gammaproteobacteria; Thiotrichales; Family Thiotrichaceae; unclassified; unclassified OTU# Taxonomy Level
40 Firmicutes; Bacilli; Lactobacillales; Lactobacillaceae; Genus Lactobacillus; unclassified
41 Proteobacteria; Gammaproteobacteria; Enterobacteriales; Genus Enterobacteriaceae; Salmonella; unclassified
42 Firmicutes; Bacilli; Lactobacillales; Aerococcaceae; Aerococcus; Genus unclassified
43 Proteobacteria; Betaproteobacteria; Burkholderiales; Family Comamonadaceae; unclassified; unclassified
44 unclassified; unclassified; unclassified; unclassified; unclassified; unclassified unclassified; unclassified
45 Proteobacteria; Gammaproteobacteria; Aeromonadales; Family Succinivibrionaceae; unclassified; unclassified
46 Firmicutes; Bacilli; Bacillales; unclassified; unclassified; Order unclassified
47 Firmicutes; Clostridia; Clostridiales; Species ClostridialesJncertaeSedisXI; Finegoldia; magna
48 Proteobacteria; unclassified; unclassified; unclassified; Phylum unclassified; unclassified
49 Proteobacteria; Alphaproteobacteria; Rhizobiales; Brucellaceae; Genus Ochrobactrum; unclassified
50 Proteobacteria; Alphaproteobacteria; Sphingomonadales; Genus Erythrobacteraceae; Porphyrobacter; unclassified
51 Proteobacteria; Gammaproteobacteria; Enterobacteriales; Family Enterobacteriaceae; unclassified; unclassified
52 Proteobacteria; Alphaproteobacteria; Sphingomonadales; Genus Sphingomonadaceae; Sphingobium/Sphingomonas; unclassified
54 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Genus Pseudomonadaceae; Pseudomonas; unclassified
59 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Genus Moraxellaceae; Acinetobacter; unclassified
62 Proteobacteria; Alphaproteobacteria; Rhodospirillales; Species Acetobacteraceae; Roseomonas; cervicalis
63 Proteobacteria; Betaproteobacteria; Burkholderiales; Genus Comamonadaceae; Schlegelella; unclassified
64 Firmicutes; Clostridia; Clostridiales; Lachnospiraceae; Species Butyrivibrio; crossotus
66 Firmicutes; Bacilli; Lactobacillales; Lactobacillaceae; Genus Lactobacillus; unclassified
67 Firmicutes; Clostridia; Clostridiales; Ruminococcaceae; Family unclassified; unclassified
68 Bacteroidetes; unclassified; unclassified; unclassified; Genus Cytophaga/Flavobacterium; unclassified OTU# Taxonomy Level
70 Proteobacteha; Gammaproteobacteria; Pseudomonadales; Genus Moraxellaceae; Acinetobacter; unclassified
72 Proteobacteria; Alphaproteobacteria; Caulobacterales; Species Caulobacteraceae; Brevundimonas; diminuta
73 Verrucomicrobia; Verrucomicrobiae; Verrucomicrobiales; Species Verrucomicrobiaceae; Akkermansia; muciniphila
75 Proteobacteha; Betaproteobacteria; Burkholderiales; Family Comamonadaceae; unclassified; unclassified
76 Actinobacteha; Actinobacteha; Actinomyce tales; Genus Micrococcaceae; Micrococcus; unclassified
77 unclassified; unclassified; unclassified; unclassified; unclassified; Kingdom unclassified
79 Bacteroidetes; Bacteroidia; Bacteroidales; unclassified; Order unclassified; unclassified
81 Proteobacteria; Gammaproteobacteria; unclassified; Class unclassified; unclassified; unclassified
83 Deinococcus-Thermus; Deinococci; Deinococcales; Species Trueperaceae; Truepera; radiovictrix
85 Firmicutes; Clostridia; Clostridiales; Lachnospiraceae; Genus Roseburia; unclassified
86 Bacteroidetes; Bacteroidia; Bacteroidales; Bacteroidaceae; Genus Bacteroides; unclassified
88 Proteobacteria; Gammaproteobacteria; Alteromonadales; Genus Shewanellaceae; Shewanella; unclassified
91 Proteobacteria; Alphaproteobacteria; Rhizobiales; Genus Methylobacteriaceae; Methylobacterium; unclassified
93 Actinobacteha; Actinobacteha; Actinomycetales; Species Corynebacteriaceae; Corynebacterium; matruchotii
94 Actinobacteha; Actinobacteha; Actinomycetales; Genus Corynebacteriaceae; Corynebacterium; unclassified
95 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Species Pseudomonadaceae; Pseudomonas; andersonii
96 Bacteroidetes; Flavobacteria; Flavobacteriales; Genus Flavobacteriaceae; Myroides; unclassified
99 Proteobacteria; Betaproteobacteria; Burkholderiales; Family Comamonadaceae; unclassified; unclassified
100 Proteobacteria; Betaproteobacteria; Burkholderiales; Genus Burkholderiaceae; Burkholderia; unclassified
102 Proteobacteria; Betaproteobacteria; Burkholderiales; Family Oxalobacteraceae; unclassified; unclassified
104 Firmicutes; Clostridia; Clostridiales; Ruminococcaceae; Species Faecalibacterium; prausnitzii OTU# Taxonomy Level
107 Proteobacteria; Gammaproteobacteria; unclassified; Class unclassified; unclassified; unclassified
109 Proteobacteria; Betaproteobacteria; Burkholderiales; Genus Burkholderiales_incertae_sedis; Tepidimonas; unclassified
1 10 Firmicutes; Bacilli; Bacillales; Planococcaceae; Caryophanon; Genus unclassified
113 Firmicutes; Clostridia; Clostridiales; Eubacteriaceae; Species Eubacterium; hallii
1 19 Proteobacteria; Gammaproteobacteria; Xanthomonadales; Genus Xanthomonadaceae; Lysobacter; unclassified
120 Firmicutes; Bacilli; Lactobacillales; Lactobacillaceae; Genus Lactobacillus; unclassified
123 Actinobacteria; Actinobacteria; Actinomycetales; Family Microbacteriaceae; unclassified; unclassified
128 Bacteroidetes; Flavobacteria; Flavobacteriales; Family Flavobacteriaceae; unclassified; unclassified
132 Firmicutes; Clostridia; Clostridiales; unclassified; unclassified; Order unclassified
137 Fusobacteria; Fusobacteria; Fusobacteriales; Fusobacteriaceae; Genus Fusobacterium; unclassified
138 Proteobacteria; Deltaproteobacteria; Bdellovibrionales; Order unclassified; unclassified; unclassified
141 Bacteroidetes; Bacteroidia; Bacteroidales; Prevotellaceae; Species Prevotella; b re vis
143 Proteobacteria; Gammaproteobacteria; Oceanospirillales; Genus Oceanospirillaceae; Marinomonas;unclassified
145 Proteobacteria; Alphaproteobacteria; Sphingomonadales; Genus Sphingomonadaceae; Sphingomonas; unclassified
154 Actinobacteria; Actinobacteria; Bifidobacteriales; Species Bifidobacteriaceae; Bifidobacterium; longum
156 Firmicutes; Bacilli; Bacillales; unclassified; unclassified; Order unclassified
157 Proteobacteria; Alphaproteobacteria; Rhizobiales; Genus Bradyrhizobiaceae; Bradyrhizobium; unclassified
162 Proteobacteria; Gammaproteobacteria; unclassified; Class unclassified; unclassified; unclassified
164 Actinobacteria; Actinobacteria; Bifidobacteriales; Genus Bifidobacteriaceae; Bifidobacterium; unclassified
165 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Genus Pseudomonadaceae; Pseudomonas; unclassified
166 Proteobacteria; Alphaproteobacteria; Rhodobacterales; Genus Rhodobacteraceae; Paracoccus; unclassified OTU# Taxonomy Level
174 Bacteroidetes; Bacteroidia; Bacteroidales; Prevotellaceae; Genus Prevotella; unclassified
199 Proteobacteria; Alphaproteobactena; Rhizobiales; Rhizobiaceae; Genus Rhizobium/Agrobacterium; unclassified
201 Firmicutes; Negativicutes; Selenomonadales; Species Acidaminococcaceae; Phascolarctobacterium; faecium
204 Actinobacteria; Actinobacteria; Actinomycetales; unclassified; Order unclassified; unclassified
210 Firmicutes; Bacilli; Lactobacillales; Lactobacillaceae; Species Lactobacillus; iners
212 Proteobacteria; Gammaproteobacteria; Legionellales; Genus Legionellaceae; Legionella; unclassified
223 Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus; unclassified Genus
225 Proteobacteria; Betaproteobacteria; unclassified; unclassified; Class unclassified; unclassified
233 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Genus Pseudomonadaceae; Pseudomonas; unclassified
267 Deinococcus-Thermus; Deinococci; Thermales; Thermaceae; Genus Thermus; unclassified
313 Firmicutes; Erysipelotrichia; Erysipelotrichales; Species Erysipelotrichaceae; ClostridiumXVIII; ramosum
321 Actinobacteria; Actinobacteria; Actinomycetales; Family Microbacteriaceae; unclassified; unclassified
323 Firmicutes; Clostridia; Clostridiales; unclassified; unclassified; Order unclassified
325 Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus; unclassified Genus
331 Firmicutes; Clostridia; Clostridiales; Ruminococcaceae; Species Ruminococcus; gnavus
370 Proteobacteria; Gammaproteobacteria; Pseudomonadales; Genus Moraxellaceae; Acinetobacter; unclassified
375 Firmicutes; Bacilli; Bacillales; Bacillaceae; Genus Anoxybacillus/Bacillus; unclassified
1281 Proteobacteria; Betaproteobacteria; unclassified; unclassified; Class unclassified; unclassified
Table i 3 - Clinical data of subjects participating in the study
Figure imgf000040_0001
Subject Age Location Tissue type Type of tumour Stage of cancer
L6N 60 Canada n. a. invasive ductal 1
L7N b 22 Canada n. a. benign (mammary hamartoma) N/A
L8N 68 Canada n. a. invasive ductal 1
L9N b 19 Canada n. a. benign (fibroadenoma) N/A
LlON b 26 Canada n. a. benign (fibroadenoma) N/A
L11N 90 Canada n. a. invasive lobular 2
L12N 71 Canada n. a. DCIS 0
L13N b 36 Canada n. a. benign (fibroadenoma) N/A
L14N b 49 Canada n. a. benign (complex, sclerosing lesion, N/A atypia)
L15N 60 Canada n. a. invasive ductal 1
L16N 54 Canada n. a. invasive 3
L17N 58 Canada n. a. invasive 2
L18N 68 Canada n. a. invasive lobular 2
L19N b 64 Canada n. a. benign (diffuse atypical lobular N/A hyperlsie)
L20N 66 Canada n. a. DCIS 0
L21N b 30 Canada n. a. benign (sclerosed intraductal N/A papilloma, focal atypia)
L22N 67 Canada n. a. invasive ductal 3
L23N 63 Canada n. a. DCIS (multifocal) 0
L24N 57 Canada n. a. DCIS 0
L25N 34 Canada n. a. N/A (prophylactic mastecomy due N/A to prior invasive carcinoma)
L26N 73 Canada n. a. invasive ductal 2
L27N 80 Canada n. a. invasive lobular 3
L28N 74 Canada n. a. invasive ductal 1
L29N b 49 Canada n. a. benign (intraductal papillomata, no N/A atypia)
L30N b 21 Canada n. a. benign (fibroadenoma) N/A
L31N 62 Canada n. a. invasive ductal 4
L32N 50 Canada n. a. invasive ductal 2
L33N b 68 Canada n. a. benign (papillary lesion without N/A atypia)
L34N 70 Canada n. a. invasive ductal 1
L35N 65 Canada n. a. DCIS 0
L36N 54 Canada n. a. invasive ductal 1
L37N 59 Canada n. a. invasive ductal 3
L38N 66 Canada n. a. invasive ductal 1
L39H 47 Canada normal N/A (breast reductions) N/A
L40H 42 Canada normal N/A (breast reductions) N/A
L41RH 21 Canada normal N/A (breast reductions) N/A Subject Age Location Tissue type Type of tumour Stage of cancer
L42H 53 Canada normal N/A (breast reductions) N/A
L43RH 46 Canada normal N/A (breast reductions) N/A
C1N 46 Ireland n. a. invasive ductal-multifocal 3 & 2
C2N 70 Ireland n. a. invasive ductal 3
C3N 69 Ireland n. a. invasive ductal- multifocal 3
C4N 60 Ireland n. a. invasive ductal 3
C5N 66 Ireland n. a. invasive ductal 3
C6N 76 Ireland n. a. invasive ductal 2
C7N 76 Ireland n. a. invasive ductal 3
C8N 34 Ireland n. a. invasive ductal 3
C9N 63 Ireland n. a. invasive ductal 3
CION 37 Ireland n. a. invasive ductal 3
C11N 76 Ireland n. a. invasive ductal 3
C12N 59 Ireland n. a. invasive ductal 3
C13N 54 Ireland n. a. invasive ductal 3
C14N 55 Ireland n. a. invasive ductal 3
C15N 67 Ireland n. a. invasive solid papillary 2
C18N 45 Ireland n. a. DCIS 0
C19N 51 Ireland n. a. invasive ductal 3
C20N 51 Ireland n. a. invasive ductal 1
C21N 78 Ireland n. a. invasive ductal 3
C22N 61 Ireland n. a. invasive ductal 3
C23N 52 Ireland n. a. invasive ductal 3
C25N 60 Ireland n. a. invasive ductal 3
C26N 56 Ireland n. a. invasive ductal 3
C28N 74 Ireland n. a. invasive mucinous colloid 2
C29N 86 Ireland n. a. invasive ductal multifocal 3
C30N 83 Ireland n. a. invasive ductal multifocal 3
C31N 60 Ireland n. a. invasive ductal multifocal 3
C32N 40 Ireland n. a. invasive ductal 3
C33N 67 Ireland n. a. invasive ductal multifocal 3
C34N 78 Ireland n. a. invasive ductal multifocal 2
C35N 68 Ireland n. a. invasive ductal 2
C36N 41 Ireland n. a. invasive ductal 2
C37N 85 Ireland n. a. invasive ductal 2
C38RH 20 Ireland normal N/A (breast reductions) N/A
C39RH 35 Ireland normal N/A (breast reductions) N/A
C40H 40 Ireland normal N/A (breast reductions) N/A
C41RH 41 Ireland normal N/A (breast reductions) N/A
C42RH 43 Ireland normal N/A (breast reductions) N/A "n.a." = normal adjacent
"N/A" = not applicable
DCIS= ductal in situ carcinoma.
References
1 . E. M. Bik et ai, Molecular analysis of the bacterial microbiota in the human stomach. Proc. Natl. Acad. Sci. U. S. A. 103, 732-737 (2006).
2. B.J. Marshall et ai, Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 321 , 1273-1275 (1983).
3. A. J. Wolfe et ai , Evidence of uncultivated bacteria in the adult female bladder. J. Clin. Microbiol. 50, 1376-1383 (2012).
4. J. M. Beck, V. B. Young, G. B. Huffnagle, The microbiome of the lung. Transl. Res. 160, 258-266 (2012)
5. K. M. Hunt et ai, Characterization of the diversity and temporal stability of bacterial communities in human milk. PLoS One. 6, e21313 (201 1 ).
6. Ximenez-Fyvie LA, Haffajee AD, Socransky SS. 2000. Comparison of the microbiota of supra- and subgingival plaque in health and periodontitis. J. Clin. Periodontol. 27:648-657.
7. Frank DN, St Amand AL, Feldman RA, Boedeker EC, Harpaz N, Pace NR. 2007. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. U. S. A. 104: 13780- 13785. doi: 10.1073/pnas.0706625104.
8. Hilty M, Burke C, Pedro H, Cardenas P, Bush A, Bossley C, Davies J, Ervine A, Poulter L, Pachter L, Moffatt MF, Cookson WO. 2010. Disordered microbial communities in asthmatic airways. PLoS One. 5:e8578. doi: 10.1371 /journal. pone.0008578; 10.1371/journal. pone.0008578.
9. Larsen N, Vogensen FK, van den Berg FW, Nielsen DS, Andreasen AS, Pedersen BK, Al-Soud WA, Sorensen SJ, Hansen LH, Jakobsen M. 2010. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults. PLoS One. 5:e9085. doi: 10.1371 /journal, pone.0009085;
10.1371/journal. pone.0009085.
10. Hummelen R, Fernandes AD, Macklaim JM, Dickson RJ, Changalucha J, Gloor GB, Reid G. 2010. Deep sequencing of the vaginal microbiota of women with HIV. PLoS One. 5:e12078. doi: 10.1371/journal. pone.0012078; 10.1371/journal. pone.0012078.
1 1 . Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment
search tool. J. Mol. Biol. 215:403-410. doi: 10.1016/S0022-2836(05)80360-2.
12. Edgar RC. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26:2460-2461 . doi: 10.1093/bioinformatics/btq461 ; 10.1093/bioinformatics/btq461 .
13. Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, Kulam-Syed- Mohideen AS, McGarrell DM, Marsh T, Garrity GM, Tiedje JM. 2009. The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37:D141 -5. doi: 10.1093/nar/gkn879; 10.1093/nar/gkn879.
14. DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, Huber T, Dalevi D, Hu P, Andersen GL. 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72:5069-5072. doi: 10.1 128/AEM.03006-05.
15. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK, Gordon Jl, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, Walters WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. 2010.QIIME allows analysis of high-throughput community sequencing data. Nat. Methods. 7: 335- 336. doi: 10.1038/nmeth.f.303; 10.1038/nmeth.f.303.
16. Price MN, Dehal PS, Arkin AP. 2009. FastTree: computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. 26: 1641 - 1650. doi: 10.1093/molbev/msp077; 10.1093/molbev/msp077. 17. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 5: 1 13. doi: 10.1 186/1471 - 2105-5-1 13.
18. Lozupone C, Knight R. 2005. UniFrac: a new phylogenetic method for comparing microbial communities. Appl. Environ. Microbiol. 71 : 8228-8235. doi:
10.1 128/AEM.71 .12.8228-8235.2005.
19. Hill TC, Walsh KA, Harris JA, Moffett BF. 2003. Using ecological diversity measures with bacterial communities. FEMS Microbiol. Ecol. 43: 1 -1 1 . doi: 10.1 1 1 1 /j.1574- 6941 .2003.tb01040.x; 10.1 1 /j.1574-6941 .2003.tb01040.x.
20. R Development Core Team. 2006. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing: Vienna, Austria.
21 . Burton JP, G. Reid. Evaluation of the bacterial vaginal flora of 20 postmenopausal women by direct (Nugent score) and molecular (polymerase chain reaction and denaturing gradient gel electrophoresis) techniques). J Infect Dis. 186, 770-80 (2002).
22. Li K, Bihan M, Yooseph S, Methe BA. 2012. Analyses of the microbial diversity across the human microbiome. PLoS One. 7:e321 18. doi: 10.1371/journal. pone.00321 18; 10.1371/journal. pone.00321 18.
23. Dethlefsen L, Huse S, Sogin ML, Relman DA. 2008. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biol. 6:e280. doi: 10.1371/journal. pbio.0060280; 10.1371/journal. pbio.0060280.
24. Bik EM, Long CD, Armitage GC, Loomer P, Emerson J, Mongodin EF, Nelson KE, Gill SR, Fraser-Liggett CM, Relman DA. 2010. Bacterial diversity in the oral cavity of 10 healthy individuals. ISME J. 4:962-974. doi: 10.1038/ismej.2010.30; 10.1038/ismej.2010.30.
25. Dethlefsen L, Relman DA. 201 1 . Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1 :4554-4561 . doi: 10.1073/pnas.1000087107; 10.1073/pnas.1000087107. 26. Ravel J, Gajer P, Abdo Z, Schneider GM, Koenig SS, McCulle SL, Karlebach S, Gorle R, Russell J, Tacket CO, Brotman RM, Davis CC, Ault K, Peralta L, Forney LJ. 201 1 . Vaginal microbiome of reproductive-age women. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1 :4680-4687. doi: 10.1073/pnas.100261 1 107; 10.1073/pnas.100261 1 107.
27. Kim TK, Thomas SM, Ho M, Sharma S, Reich CI, Frank JA, Yeater KM, Biggs DR, Nakamura N, Stumpf R, Leigh SR, Tapping Rl , Blanke SR, Slauch JM, Gaskins HR, Weisbaum JS, Olsen GJ, Hoyer LL, Wilson BA. 2009. Heterogeneity of vaginal microbial communities within individuals. J. Clin. Microbiol. 47: 1 181 -1 189. doi: 10.1 128/JCM.00854-08; 10.1 128/JCM.00854-08.
28. Oakley BB, Fiedler TL, Marrazzo JM, Fredricks DN. 2008. Diversity of human vaginal bacterial communities and associations with clinically defined bacterial vaginosis. Appl. Environ. Microbiol. 74:4898-4909. doi: 10.1 128/AEM.02884-07; 10.1 128/AEM.02884-07.
29. Cummins J, Tangney M. 2013. Bacteria and tumours: causative agents or opportunistic inhabitants? Infect. Agent Cancer. 8: 1 1 -9378-8-1 1 . doi: 10.1 186/1750- 9378-8-1 1 ; 10.1 186/1750-9378-8-1 1 .
30. Nougayrede JP, Homburg S, Taieb F, Boury M, Brzuszkiewicz E, Gottschalk G, Buchrieser C, Hacker J, Dobrindt U, Oswald E. 2006. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science. 313:848-851 . doi: 10.1 126/science.1 127059.
31 . Toller I M, Neelsen KJ, Steger M, Hartung ML, Hottiger MO, Stucki M, Kalali B, Gerhard M, Sartori AA, Lopes M, Muller A. 201 1 . Carcinogenic bacterial pathogen Helicobacter pylori triggers DNA double-strand breaks and a DNA damage response in its host cells. Proc. Natl. Acad. Sci. U. S. A. 108: 14944-14949. doi: 10.1073/pnas.1 100959108; 10.1073/pnas.1 100959108.
32. R. Albesharat, M. A. Ehrmann, M. Korakli, S. Yazaji, R. F. Vogel, Phenotypic and genotypic analyses of lactic acid bacteria in local fermented food, breast milk and faeces of mothers and their babies. Syst. Appl. Microbiol. 34, 148-155 (201 1 ). 33. S. Delgado, R. Arroyo, R. Martin, J. M. Rodriguez, PCR-DGGE assessment of the bacterial diversity of breast milk in women with lactational infectious mastitis. BMC Infect. Dis. 8, 51 -2334-8-51 (2008).
34. L. Fernandez et ai, The human milk microbiota: Origin and potential roles in health and disease. Pharmacol. Res.(2012).
35. M. P. Heikkila, P. E. Saris, Inhibition of Staphylococcus aureus by the commensal bacteria of human milk. J. Appl. Microbiol. 95, 471 -478 (2003).
36. R. Martin, G. H. Heilig, E. G. Zoetendal, H. Smidt, J. M. Rodriguez, Diversity of the Lactobacillus group in breast milk and vagina of healthy women and potential role in the colonization of the infant gut. J. Appl. Microbiol. 103, 2638-2644 (2007).
37. R. Martin et ai, Cultivation-independent assessment of the bacterial diversity of breast milk among healthy women. Res. Microbiol. 158, 31 -37 (2007).
38. R. Martin et ai, Human milk is a source of lactic acid bacteria for the infant gut. J. Pediatr. 143, 754-758 (2003).
39. C.J. Rumney et ai, Effects of risk-associated human dietary macrocomponents on processes related to carcinogenesis in human-flora- associated (HFA) rats. Carcinogenesis.14, 79-84 (1993).
40. J.A McGroarty et a/.,Anti-tumour activity of lactobacilli in vitro. MicrobiosLetters39, 105-1 12 (1988).
41 . M. W. van Passel et ai , The genome of Akkermansiamuciniphila, a dedicated intestinal mucin degrader, and its use in exploring intestinal metagenomes. PLoS One. 6, e16876 (201 1 ).
42. Collaborative Group on Hormonal Factors in Breast Cancer, Breast cancer and breastfeeding: collaborative reanalysis of individual data from 47 epidemiological studies in 30 countries, including 50302 women with breast cancer and 96973 women without the disease. Lancet. 360, 187-195 (2002).
43. H. Jernstrom et ai, Breast-feeding and the risk of breast cancer in BRCA1 and BRCA2 mutation carriers. J. Natl. Cancer Inst. 96, 1094-1098 (2004). 44. M. M. Gaudet et al., Risk factors by molecular subtypes of breast cancer across a population-based study of women 56 years or younger. Breast Cancer Res. Treat. 130, 587-597 (201 1 ).
45. Anukam K, Osazuwa E, Ahonkhai I, Ngwu M, Osemene G, Bruce AW, Reid G. 2006. Augmentation of antimicrobial metronidazole therapy of bacterial vaginosis with oral probiotic Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14: randomized, double-blind, placebo controlled trial. Microbes Infect. 8(6): 1450-4.
46. Martinez RC, Franceschini, SA, Patta MC, Quintana SM, Candido RC, Ferreira JC, Pereira De Martinis EC, and Reid G. 2009. Improved cure of bacterial vaginosis with single dose of tinidazole (2g) and Lactobacillus rhamnosus GR-1 and
Lactobacillus reuteri RC-14: a randomized, double-blind, placebo-controlled trial. Can J Microbiol. 55(2): 133-138.
47. Martinez RC, Franceschini, SA, Patta MC, Quintana SM, Candido RC, Ferreira JC, Pereira De Martinis EC, and Reid G. 2009. Improved treatment of vulvovaginal candidiasis with fluconazole plus probiotic Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14. Letts Appl. Microbiol. 48(3):269-74.
48. Anukam, K. C, M. U. Duru, C. C. Eze, J.Egharevba, A. Aiyebelehin, A. W.
Bruce, and G. Reid. 2009. Oral use of probiotics as an adjunctive therapy to fluconazole in the treatment of yeast vaginitis: a study of Nigerian women in an outdoor clinic. Microbial Ecol Health Dis. 21 : 72-77.
The above disclosure generally describes the present invention, changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

Claims

CLAIMS What is claimed is:
1. A method of breast cancer diagnosis comprising determining the bacterial profile in a test breast sample obtained from a subject, wherein the subject is diagnosed with cancer, if the bacterial profile of the test breast sample is relatively different to the bacterial profile of a normal breast, or relatively similar to the bacterial profile of breast cancer.
2. A method of prognosis of breast cancer comprising comparing the bacterial profile of a test breast sample with the bacterial profile of different control samples representing different stages of breast cancer or comparing the bacterial profile of a test sample with the bacterial profile of different control samples that are associated with various prognoses.
3. The method according as in claim 1 or 2, wherein the test breast sample is suspected of containing tumor cells.
4. The method according as in claim 1 or 2, wherein the test breast sample is a tissue biopsy sample.
5. The method according as in claim 1 or 2, wherein the test sample is obtained non-invasively from the breast of the subject.
6. The method of claim 5, wherein the test sample is obtained non-invasively from the breast of the subject with a swab, from nipple exudates including milk, or from blood or lymphatic samples.
7. A method of treating, preventing or reducing the risk of breast cancer in a subject, the method comprising administering to the subject an effective amount of bacteria or their metabolic by-products, wherein the bacteria or their metabolic by- products are capable of increasing the levels of ceramide in a cell, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
8. The method of claim 7, wherein the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
9. The method of claim 7, wherein the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 *1Q9 of the bacteria per milliliter or less of the suitable carrier.
10. The method of claim 8, wherein the suitable carrier is a carbohydrate-containing medium.
1 1 . The method of claim 10, wherein the carbohydrate-containing medium is a dairy product.
12. The method of any one of claims 7-1 1 , wherein the bacteria are probiotic bacteria.
13. The method of claim 12, wherein the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
14. The method of claim 12, wherein the probiotic bacteria are lactic acid bacteria.
15. The method of any one of claims 7-1 1 , wherein the bacteria are breast bacteria.
16. A method of treating, preventing or reducing the risk of breast cancer in a subject, the method comprising administering to the subject an effective amount of a bacteria, and wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer.
17. The method of claim 16, wherein the bacteria are administered in a composition comprising the bacteria and a suitable carrier.
18. The method of claim 16, wherein the bacteria are administered in a composition comprising the bacteria and a suitable carrier, and wherein the effective amount is at least about 1 109 of the bacteria per milliliter or less of the suitable carrier.
19. The method of claim 18, wherein the suitable carrier is a carbohydrate- containing medium.
20. The method of claim 19, wherein the carbohydrate-containing medium is a dairy product.
21 , The method of any one of claims 16-20, wherein the bacteria are probiotic bacteria.
22. The method of claim 21 , wherein the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
23. The method of claim 22, wherein the probiotic bacteria are lactic acid bacteria.
24. A method of treating, reducing the risk or preventing breast cancer in a subject, the method comprising administering to the subject a composition for killing bacteria associated with breast cancer, or for generating an immune response against bacteria associated with cancer.
25. A method of treating or reducing the risk or preventing breast cancer in a subject comprising: (a) determining a bacteria profile form the breast of the subject, (b) determining if the bacteria profile includes a bacterium or bacteria associated with breast cancer, and (c) administering to the subject a composition capable of killing the bacterium or bacteria associated with breast cancer or capable of generating an immune response to the bacterium or bacteria associated with breast cancer,
26. The method of claim 24 or 25, wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
27, A breast bacteria for use in the treatment, prevention or reducing risk of breast cancer in a subject.
28. The breast bacteria for use of claim 27, wherein the bacteria are capable of increasing the levels of ceramide.
29. The bacteria for use of claim 27 or 28, wherein the bacteria are lactic acid bacteria.
30. The bacteria for use of claim 27, wherein the bacteria are probiotic bacteria.
31 . The bacteria for use of claim 30, wherein the probiotic bacteria includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
32. Use of bacteria profiles of normal control breasts in the preparation of a kit for assessing the risk, the diagnosis or prognosis of breast cancer in a subject.
33. A breast tissue bacteria for use in the delivery of a compound to the breast of a subject in need of said compound.
34. A breast tissue delivery system for administration of a compound to a subject in need of such compound, wherein said breast tissue delivery system comprises a bacterium that is generally found in breast tissue.
35. The use of claim 27, 32, 33 or 34, wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
36. A method of assessing the risk or diagnosing breast cancer comprising determining the expression and abundance of bacteria in a breast of a subject.
37. The method of claim 36, wherein the subject is a subject at risk of having breast cancer, or suspected of having breast cancer or having breast cancer, or in need thereof.
38. A method for protecting against DNA damage in a subject comprising the step of administering to the subject a composition comprising a therapeutically effective amount of a probiotic and a suitable carrier.
39. The method of claim 38, wherein the probiotic includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
40. Use of a probiotic for protecting against DNA damage in a subject.
41. The use of 40, wherein the probiotic includes Lactobacillus rhamnosus, Lactobacillus rhamnosus GR-1, Eubacterium hallii and Bifidobacterium longum, or a combination thereof.
PCT/CA2014/050292 2013-03-18 2014-03-18 Bacteria for the prevention, treatment and diagnosis of breast cancer Ceased WO2014146202A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361802942P 2013-03-18 2013-03-18
US61/802,942 2013-03-18

Publications (1)

Publication Number Publication Date
WO2014146202A1 true WO2014146202A1 (en) 2014-09-25

Family

ID=51579243

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2014/050292 Ceased WO2014146202A1 (en) 2013-03-18 2014-03-18 Bacteria for the prevention, treatment and diagnosis of breast cancer

Country Status (1)

Country Link
WO (1) WO2014146202A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018229519A1 (en) 2017-06-12 2018-12-20 Debreceni Egyetem Methods for diagnosing breast cancer
CN110982733A (en) * 2019-11-14 2020-04-10 北京科拓恒通生物技术股份有限公司 A strain of Lactobacillus rhamnosus for prevention and treatment of mastitis and its application
EP3561070A4 (en) * 2016-12-26 2020-08-05 MD Healthcare Inc. METHOD OF DIAGNOSING BREAST CANCER BY MICROBIAL METAGENOMIC ANALYSIS
CN111733270A (en) * 2020-08-27 2020-10-02 中国药科大学 A fluorescent quantitative PCR primer for detecting the risk of atherosclerosis caused by lipopolysaccharide infection and its application and detection kit
CN113403244A (en) * 2014-12-23 2021-09-17 伊利亚制药公司 Method of wound healing
CN114717343A (en) * 2022-04-24 2022-07-08 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) Application of bacterial load as marker in prediction of nasopharyngeal carcinoma recurrence and metastasis risk

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DI MARZIO, L. ET AL.: "Effect of the Lactic Acid Bacterium Streptococcus thermophiles on Ceramide Levels in Human Keratinocytes In Vitro and Stratum Corneum In Vivo", EXP. DERMATOL., vol. 12, no. 5, October 2003 (2003-10-01), pages 615 - 620 *
FURLONG, S. ET AL.: "Lactoferricin-induced Apoptosis in Estrogen-nonresponsive MDA-MB-435 Breast Cancer Cells is Enhanced by C6 Ceramide or Tamoxifen", ONCOL. REP., vol. 15, no. 5, pages 1385 - 1390 *
OBERREUTHER-MOSCHNER, D. ET AL.: "Dietary Intervention with the Probiotics Lactobacillus acidophilus 145 and Bifidobacterium longum 913 Modulates the Potential of Human Faecal Water to Induce Damage in HT29clonel9A cells", BR. J. NUTR., vol. 91, no. 6, 8 June 2004 (2004-06-08), pages 925 - 932 *
ZHAI, M. ET AL.: "Targeted Therapy with a Salmonella typhimurium Leucine-Arginine Auxotroph Cures Orthotopic Human Breast Tumors in Nude Mice", CANCER RES., vol. 66, no. 15, 1 August 2006 (2006-08-01), pages 7647 - 7652 *
ZHANG, Y. ET AL.: "Escherichia coli Nissle 1917 Targets and Restrains Mouse B16 Melanoma and 4T1 Breast Tumors through expression of Azurin Protein", APPL. ENVIRON. MICROBIOL., vol. 78, no. 21, 14 November 2012 (2012-11-14), pages 7603 - 7610 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113403244A (en) * 2014-12-23 2021-09-17 伊利亚制药公司 Method of wound healing
CN113403244B (en) * 2014-12-23 2022-08-19 伊利亚制药公司 Method of wound healing
US11473091B2 (en) 2014-12-23 2022-10-18 Ilya Pharma Ab Methods for wound healing
EP3561070A4 (en) * 2016-12-26 2020-08-05 MD Healthcare Inc. METHOD OF DIAGNOSING BREAST CANCER BY MICROBIAL METAGENOMIC ANALYSIS
WO2018229519A1 (en) 2017-06-12 2018-12-20 Debreceni Egyetem Methods for diagnosing breast cancer
CN110982733A (en) * 2019-11-14 2020-04-10 北京科拓恒通生物技术股份有限公司 A strain of Lactobacillus rhamnosus for prevention and treatment of mastitis and its application
CN111733270A (en) * 2020-08-27 2020-10-02 中国药科大学 A fluorescent quantitative PCR primer for detecting the risk of atherosclerosis caused by lipopolysaccharide infection and its application and detection kit
CN114717343A (en) * 2022-04-24 2022-07-08 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) Application of bacterial load as marker in prediction of nasopharyngeal carcinoma recurrence and metastasis risk

Similar Documents

Publication Publication Date Title
Fernández et al. The microbiota of the human mammary ecosystem
Muñoz-Atienza et al. Antimicrobial activity, antibiotic susceptibility and virulence factors of lactic acid bacteria of aquatic origin intended for use as probiotics in aquaculture
Yan et al. A ropy exopolysaccharide producing strain Bifidobacterium longum subsp. longum YS108R alleviates DSS-induced colitis by maintenance of the mucosal barrier and gut microbiota modulation
Xue et al. The effect of fucoidan on intestinal flora and intestinal barrier function in rats with breast cancer
Yang et al. Identification of an intestinal microbiota signature associated with the severity of necrotic enteritis
Nordeste et al. Molecules produced by probiotics prevent enteric colibacillosis in pigs
Lin et al. Autochthonous lactic acid bacteria isolated from dairy cow feces exhibiting promising probiotic properties and in vitro antibacterial activity against foodborne pathogens in cattle
Fan et al. Diversity of the intestinal microbiota in different patterns of feeding infants by Illumina high-throughput sequencing
US11723935B2 (en) Methods and compositions for treating and diagnosing pancreatic cancers
KR102517581B1 (en) Probiotic and prebiotic compositions
Oh et al. Protective effects of Bacillus subtilis against Salmonella infection in the microbiome of Hy-Line Brown layers
Mejia et al. Interspecies interactions within the host: the social network of group B Streptococcus
Zhao et al. Genomic analysis and functional properties of Lactobacillus johnsonii GJ231 isolated from healthy beagles
Geniş et al. Safety assessment of enterocin-producing Enterococcus strains isolated from sheep and goat colostrum
Rattigan et al. Maternal and/or post-weaning supplementation with Bacillus altitudinis spores modulates the microbial composition of colostrum, digesta and faeces in pigs
Xu et al. Functional evaluation of Bacillus licheniformis PF9 for its potential in controlling enterotoxigenic Escherichia coli in weaned piglets
Kim et al. Lactobacillus rhamnosus KBL2290 ameliorates gut inflammation in a mouse model of dextran sulfate sodium-induced colitis
Mann et al. High diversity of viable bacteria isolated from lymph nodes of slaughter pigs and its possible impacts for food safety
Xu et al. Anti-Helicobacter pylori activity and gastroprotective effects of human stomach-derived Lactobacillus paragasseri strain LPG-9
Sharma et al. Crosstalk between Helicobacter pylori and gastrointestinal microbiota in various gastroduodenal diseases—a systematic review
Lei et al. Enterococcus durans 98D alters gut microbial composition and function to improve DSS-induced colitis in mice
US11666611B2 (en) Defined therapeutic microbiota and methods of use thereof
Mikelsaar Human microbial ecology: lactobacilli, probiotics, selective decontamination
Cui et al. Probiotic characteristics and protective effects of chicken-derived Enterococcus faecium against infection with Avian Pathogenic Escherichia coli and Salmonella in laying hens
Lee et al. Antimicrobial and immunoprotective effects of Bacillus safensis BS22LVI against acute hepatopancreatic necrosis disease in whiteleg shrimp (Penaeus vannamei)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14769628

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14769628

Country of ref document: EP

Kind code of ref document: A1