WO2014138661A1 - Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation - Google Patents

Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation Download PDF

Info

Publication number
WO2014138661A1
WO2014138661A1 PCT/US2014/022037 US2014022037W WO2014138661A1 WO 2014138661 A1 WO2014138661 A1 WO 2014138661A1 US 2014022037 W US2014022037 W US 2014022037W WO 2014138661 A1 WO2014138661 A1 WO 2014138661A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
ascll
elevated level
ret
mammal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/022037
Other languages
French (fr)
Inventor
Farhad Kosari
George Vasmatzis
Marie-Christine AUBRY
Cristiane M. Ida
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mayo Foundation for Medical Education and Research
Mayo Clinic in Florida
Original Assignee
Mayo Foundation for Medical Education and Research
Mayo Clinic in Florida
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mayo Foundation for Medical Education and Research, Mayo Clinic in Florida filed Critical Mayo Foundation for Medical Education and Research
Priority to US14/773,488 priority Critical patent/US20160018399A1/en
Publication of WO2014138661A1 publication Critical patent/WO2014138661A1/en
Anticipated expiration legal-status Critical
Priority to US15/456,146 priority patent/US10203330B2/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5752Immunoassay; Biospecific binding assay; Materials therefor for cancer of the lungs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/225Polycarboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/26Cyanate or isocyanate esters; Thiocyanate or isothiocyanate esters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/428Thiazoles condensed with carbocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4709Non-condensed quinolines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/5025Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7135Compounds containing heavy metals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/48Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482Serine endopeptidases (3.4.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21007Plasmin (3.4.21.7), i.e. fibrinolysin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21068Tissue plasminogen activator (3.4.21.68), i.e. tPA
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701Details
    • G01N2333/4703Regulators; Modulating activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/71Assays involving receptors, cell surface antigens or cell surface determinants for growth factors; for growth regulators

Definitions

  • This document relates to methods and materials involved in identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation as well as methods and materials involved in treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • this document provides methods and materials for using achaete-scute homo log 1 (ASCLl) and RET expression levels to identify lung cancer patients having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • neuroendocrine (NE) differentiation in lung adenocarcinoma has been long debated.
  • IHC immunohistochemistry
  • neuroendocrine markers such as chromogranin (CHGA), synaptophysin (SYP), neuron-specific enolase (NSE), or neural cell adhesion molecule (CD56/NCAM) to assess the role of neuroendocrine differentiation in lung cancer survival.
  • CHGA chromogranin
  • SYP synaptophysin
  • NSE neuron-specific enolase
  • CD56/NCAM neural cell adhesion molecule
  • This document provides methods and materials involved in identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation as well as methods and materials involved in treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, this document provides methods and materials for using ASCLl and RET expression levels to identify lung cancer patients having lung adenocarcinoma characterized by neuroendocrine
  • the presence of an elevated level of ASCLl expression and an elevated level of RET within a lung cancer sample can indicate that a mammal (e.g., a human) has lung adenocarcinoma characterized by neuroendocrine differentiation.
  • a mammal e.g., a human
  • the absence of an elevated level of ASCLl expression and an elevated level of RET within a lung cancer sample can indicate that a mammal (e.g., a human) does not have lung adenocarcinoma characterized by neuroendocrine
  • Having the ability to identify mammals as having lung adenocarcinoma characterized by neuroendocrine differentiation as described herein can allow those lung cancer patients to be properly identified and treated in an effective and reliable manner.
  • the lung cancer treatments provided herein can be used to treat lung cancer patients identified as having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • one aspect of this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • the method comprises, or consist essentially of, determining whether or not cancer cells from the mammal contain an elevated level of ASCLl expression and an elevated level of RET expression, wherein the presence of the elevated level of ASCLl expression and the presence of the elevated level of RET expression indicates that the mammal has lung adenocarcinoma characterized by neuroendocrine differentiation, and wherein the absence of the elevated level of ASCLl expression and the absence of the elevated level of RET expression indicates that the mammal does not have lung adenocarcinoma characterized by neuroendocrine differentiation.
  • the mammal can be a human.
  • the elevated level can be determined using PCR.
  • the elevated level can be determined using immunohistochemistry.
  • this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • the method comprises, or consists essentially of, (a) determining whether or not a lung cancer cells from the mammal contain an elevated level of ASCL1 expression and an elevated level of RET expression, (b) classifying the mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation if the sample contains the elevated level of ASCL1 expression and the elevated level of RET expression, and (c) classifying the mammal as not having lung adenocarcinoma characterized by neuroendocrine
  • the mammal can be a human.
  • the elevated level can be determined using PCR.
  • the elevated level can be determined using
  • this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation, wherein the method comprises, or consists essentially of, (a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from the mammal, and (b) classifying the mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation based at least in part on the presence of the elevated level of ASCL1 expression and the elevated level of RET expression.
  • the mammal can be a human.
  • the elevated level can be detecting using PCR.
  • the elevated level can be detecting using immunohistochemistry.
  • this document features a method for treating lung cancer, wherein the method comprises, or consists essentially of, (a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from a mammal, and (b) administering a molecule to the mammal under conditions wherein the number of lung cancer cells within the mammal is reduced, wherein the molecule is selected from the group consisting of sunitinib, vandetanib, riluzole,reteplase, anistreplase, tenecteplase, sucralfate, dasatinib, pazopanib, tivozanib, OSI-930, telatinib, tandutinib, imatinib, sorafenib, levodopa, carbidopa, entacapone orion, L-dopa, ABT-089, mecamylamine, and succinylcho
  • Figure 1 is a schematic showing the composition of Datasets 1 and 2. Boxes with dotted shadings in Dataset 1 denote samples collected by laser capture microdissection (LCM). Numbers in parenthesis in Dataset 2 are all stages and stage 1 only sample sizes, respectively. Dataset 2 was used in survival analysis by RET. All samples in this dataset were collected in bulk.
  • LCM laser capture microdissection
  • FIG. 3 contains photographs and a heat graph of an immunohistochemical analysis.
  • A-E AD characterized by ASCL1 mRNA expression (ASCL1 + AD): (A) Adenocarcinoma with an acinar pattern. H&E. 400x; (B) ASCL1 protein expression (nuclear pattern, 70%, 2+). 400x; (C) CHGA (cytoplasmic pattern, 5%, 3+). 400x; (D) SYP (cytoplasmic pattern, 5%, 2+) 400x; and (E) CD56/NCAM (membranous pattern, 5%, 2+) 400x.
  • Figure 4 is a heat map of the microarray Log 2 expression values using known NE genes and RET.
  • the map also includes SQCC and AD specific genes (DSG3 and NKX2.1, respectively).
  • ASCLl expression is much more frequent in AD than in SQCC.
  • Each gene is represented by the most variable probeset with the highest standard deviation.
  • Figure 5 contains graphs demonstrating that NE differentiation in never smoker AD is rare. In contrast with typical carcinoid (CT), no subset of AD has a distinguishably higher expression of the NE markers than non-neoplastic lung. Similar observations can be made about SQCC, but the number of samples is small.
  • Figure 6 is a graph of a KM plot of stage I AD in Dataset 2 based on ASCLl status.
  • the drop off for the ASCL1 + tumors is sharper than the ASCLl " tumors, suggesting nonproportional hazard.
  • Figures 7A and 7B are graphs demonstrating the over representation of tumors expressing RET (211421_s_at probe set) in ASCL1 + compared with ASCLl " in (A) stage I ADs (Dataset 2), and in (B) all lung cancers (Dataset 1). This over-representation was consistent in all datasets. Few samples (shown in black circles) expressed RET while ASCLl was below noise level (arbitrary Log 2 signal intensity of 3.5). Data points correspond to the samples from the Mayo Clinic unless stated in the figure legends.
  • Figures 8 A and 8B are graphs plotting overall survival in ASCLl + stage I (A) and all (B) AD as a function of the RET mRNA expression level by microarrays.
  • Figure 9 contains photographs and graphs of RET protein expression by IHC.
  • RET staining in fatal adenocarcinoma was typically much less intense in ASCLl " (A) than in ASCLl + (B) tumors.
  • C Co-IHC of ASCLl (nuclear brown staining) and RET (cytoplasmic red staining) identified areas with overlapping expression of the two proteins.
  • E When samples were not stratified by the ASCLl expression, RET IHC was not significant in predicting OS (overall survival).
  • Figure 11 is a plot of ASCLl and RET expression versus promoter methylation of the ASCLl promoter in the GSE32867 dataset. This data indicates that promoter hypo- methylation increases expression levels of the ASCLl transcript. Interestingly, high expression level of ASCLl is significantly associated with high level of RET. In the plot, samples with high transcript levels of RET are indicated by circles around the solid circles. RET and ASCLl expression levels are based on the Illumina ILMN 1655610 and ILMN_1701653 probesets, respectively. ASCLl promoter methylation is assessed by the cg20053158 probeset. High RET expression is marked by circles.
  • Figure 13 contains three graphs of an in vitro analysis that confirms that ASCLl regulates RET expression.
  • Figure 14 contains photographs of cells from a filling the gap scratch assay (see, e.g., Liang et al, Nature Protocols, 2:329-333 (2007)). Wild-type HCC1833 cells and HCC1833 cells transfected with a control vector filled most of the gap by day 3, while HCC1833 cells transfected with an ASCLl knock down vector (ASCLl -sh2 cells) did not fill as much of the gap, indicating that wild-type HCC1833 cells and cells transfected with empty vector (VEC) have a higher migration capacity than cells transfected with ASCLl shRNA (ASCLl -sh2).
  • ASCLl -sh2 ASCLl knock down vector
  • Figure 15 contains a bar graph plotting the clonogenic number of cells that do not express ASCLl (A549 cells) and cells that express ASCLl (A549-ASCL1 cells) after treatment with the indicated amount of cisplatin (e.g., 0 ⁇ , 3 ⁇ , or 9 ⁇ ) for 14 days.
  • Figure 15 also contains a line graph plotting the viability of A549 cells and A549-ASCL1 cells 72 hours after treatment with the indicated amount of cisplatin.
  • Figure 16 is a line graph plotting the viability of A549 cells and A549-ASCL1 cells 72 hours after treatment with the indicated amount of sunitinib (marketed as Sutent by Pfizer, and previously known as SU11248). The vertical line is drawn at about 3 ⁇ .
  • This document provides methods and materials related to identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, this document provides methods and materials for identifying mammals (e.g., humans) as having lung adenocarcinoma characterized by neuroendocrine differentiation by determining whether or not a lung cancer sample (e.g., lung tissue biopsy) from the mammal contains cancer cells having an elevated level of ASCLl expression and/or an elevated level of RET expression. As described herein, if a mammal contains lung cancer cells with an elevated level of ASCLl expression and/or an elevated level of RET expression, then that mammal can be classified as having lung adenocarcinoma characterized by neuroendocrine differentiation. If a mammal contains a lung cancer cells that lack an elevated level of ASCLl expression and lack an elevated level of RET expression, then that mammal can be classified as not having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • a lung cancer sample e.
  • elevated level refers to any level that is greater than a reference level for that molecule (e.g., a reference level of ASCLl and/or RET expression).
  • reference level refers to the level of expression that is typically observed with normal healthy lung cells or lung adenocarcinoma characterized by a lack of neuroendocrine differentiation from mammals (e.g., humans).
  • a reference level of ASCLl expression can be the average level of ASCLl expression that is present in lung cells obtained from a random sampling of 50 humans free of lung cancer.
  • an elevated level of expression e.g., ASCL1 and/or RET expression
  • ASCL1 and/or RET expression can be a level that is at least 10, 25, or 50 percent greater than a reference level for that molecule (e.g., a reference level of ASCL1 and/or RET expression).
  • an elevated level of ASCL1 expression or RET expression can be a detectable level (e.g., an expression level detectable by immunocytochemistry). It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an elevated level.
  • the level of ASCL1 and/or RET expression within lung cancer cells can be used to determine whether or not a particular mammal has lung adenocarcinoma characterized by neuroendocrine differentiation.
  • Any appropriate lung cancer sample can be used as described herein to identify mammals having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • lung cancer tissue samples, lung cancer cell samples, and lung cancer needle biopsy specimen can be used to determine whether or not a mammal has lung adenocarcinoma
  • a lung cancer sample can be obtained by a tissue biopsy or following a surgical resection. Once obtained, a sample can be processed prior to measuring a level of expression. For example, a lung cancer sample can be processed to extract RNA from the sample. Once obtained, the RNA can be evaluated to determine the level of an mRNA of interest.
  • nucleic acids present within a sample can be amplified (e.g., linearly amplified) prior to determining the level of expression (e.g., using array technology).
  • a lung cancer sample can be frozen, and sections of the frozen tissue sample can be prepared on glass slides. The frozen tissue sections can be stored (e.g., at -80°C) prior to analysis, or they can be analyzed immediately (e.g., by immunohistochemistry with an antibody specific for a particular polypeptide of interest).
  • any appropriate methods can be used to determine the level of ASCL1 and/or RET expression within lung cancer cells. For example, quantitative real time PCR, in situ hybridization, or microarray technology can be used to determine whether or not a particular sample contains an elevated level of mRNA expression for a particular nucleic acid or lacks an elevated level of mRNA expression for a particular nucleic acid.
  • the level of expression can be determined using polypeptide detection methods such as immunochemistry techniques.
  • antibodies specific for ASCL1 and/or RET polypeptides can be used to determine the polypeptide level in a sample.
  • polypeptide -based techniques such as ELISAs and immunocytochemistry techniques can be used to determine whether or not a particular sample contains an elevated level of polypeptide expression for a particular nucleic acid or lacks an elevated level of polypeptide expression for a particular nucleic acid.
  • Examples of a human ASCL1 nucleic acid can have the sequence set forth in GenBank ® Accession No. NM 004316 (GI No. 190343011), and a human ASCL1 polypeptide can have the sequence set forth in GenBank ® Accession No. NP 004307 (GI No. 55743094).
  • Examples of a human RET nucleic acid can have the sequence set forth in GenBank ® Accession No. NM_020630 (GI No. 126273513) or NM_020975 (GI No. 126273511), and a human RET polypeptide can have the sequence set forth in GenBank ® Accession No. NP_065681 (GI No. 10862701) or NP_066124 (GI No. 10862703).
  • the level(s) can be compared to reference level(s) and used to classify the mammal as having or lacking lung adenocarcinoma characterized by neuroendocrine differentiation as described herein.
  • This document also provides methods and materials to assist medical or research professionals in identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • Medical professionals can be, for example, doctors, nurses, medical laboratory technologists, and pharmacists.
  • Research professionals can be, for example, principle investigators, research technicians, postdoctoral trainees, and graduate students.
  • a professional can be assisted by (a) determining the level of ASCL1 and/or RET expression within lung cancer cells, and (b) communicating information about that the level(s) to that professional.
  • Any method can be used to communicate information to another person (e.g., a professional).
  • information can be given directly or indirectly to a professional.
  • any type of communication can be used to communicate the information.
  • mail, e-mail, telephone, and face-to-face interactions can be used.
  • the information also can be communicated to a professional by making that information electronically available to the professional.
  • the information can be communicated to a professional by placing the information on a computer database such that the professional can access the information.
  • the information can be communicated to a hospital, clinic, or research facility serving as an agent for the professional.
  • This document also provides methods and materials for treating lung
  • adenocarcinoma characterized by neuroendocrine differentiation can be administered to a mammal (e.g., a human) having lung adenocarcinoma characterized by neuroendocrine differentiation under conditions wherein the presence or progression of the lung adenocarcinoma characterized by neuroendocrine differentiation is reduced.
  • a molecule listed in Table 1 such as tedisamil can be administered to a human having lung adenocarcinoma characterized by neuroendocrine differentiation such that the number of lung adenocarcinoma cells within the human is reduced.
  • one or more of molecules listed in Table 2A or 2B can be administered in combination with one or more of molecules listed in Table 1 to treat lung adenocarcinoma characterized by
  • tedisamil can be administered in combination with riluzole to a human having lung adenocarcinoma characterized by neuroendocrine differentiation.
  • Table 1 Molecules for treating lung adenocarcinoma characterized by neuroendocrine differentiation.
  • Table 2A Molecules that can be used in combination with one or more molecules listed in Table 1 for treating lung adenocarcinoma characterized by neuroendocrine differentiation.
  • mg/levodopa 100 mg orally 3 times a day, or 1 tablet of 10 mg carbidopa/ 100 mg levodopa orally 3 to 4 times a day.
  • the dose may be increased by 1 tablet orally every 1 to 2 days to a dose of 8 tablets/day (2 tablets orally 4 times a day)
  • guaifenesin/phenylpropanolamine oxymetazoline, prazosin, phenylpropanolamine, ephedrine, tolazoline, guanfacine, guanabenz, guanethidine, phenoxybenzamine, dexmedetomidine, UK 14304, clonidine, dexefaroxan, quinidine, polythiazide/prazosin,
  • chlorothiazide/methyldopa chlorthalidone/ clonidine, propafenone, guanadrel, hydrochlorothiazide/methyldopa, metaraminol, tizanidine, quetiapine, D-pseudoephedrine, apraclonidine, venlafaxine, phentolamine, labetalol, mephentermine, propylhexedrine, yohimbine,
  • ABT-089 isoflurane, mecamylamine, succinylcholine, rocuronium, doxacurium, amobarbital, mivacurium, pipecuronium, rapacuronium, metocurine, atracurium, cisatracurium, acetylcholine, nicotine, D-tubocurarine,
  • CHRNA9 arecoline, enflurane, pancuronium, vecuronium
  • Example 1 Elevated ASCL1 and RET expression can be used to identify patients with lung adenocarcinoma characterized by neuroendocrine differentiation Patient sample population
  • lung specimens resected from 303 patients between 1997 and 2007 were selected.
  • Neoadjuvant therapy was not given to any patient included in this study.
  • Formalin- fixed paraffin-embedded H&E sections from the corresponding surgical specimens were reviewed, and the diagnoses were confirmed according to the 2004 World Health Organization classification of tumors.
  • FFPE formalin fixed paraffin embedded
  • Cases were considered immunoreactive when exhibiting 5% or more tumor cells showing a nuclear staining pattern for ASCLl, a clear granular cytoplasmic staining pattern for CHGA and SYP, and a distinct membranous staining pattern for CD56/NCAM.
  • AD samples 14 ASCLl + and 15 ASCLl "
  • RET IHC RET IHC using 1 :500 dilutions of Epitomics 3454-1 rabbit monoclonal antibody.
  • An ASCL1/RET co-IHC was developed by DAB staining for ASCLl first (1 : 100 dilution monoclonal, clone 24B72D11.1, BD/Pharmingen, San Diego, CA) and then Fast Red staining (1 :500 dilutions of Epitomics 3454-1 rabbit monoclonal antibody) for RET.
  • Immunoreactivity was semi-quantitatively scored based on a) the percentage of positive tumor cells (Labeling index, LI), ranging from 0 to 100%, in increments of 5%; and b) the intensity of staining, graded as: weak +1, moderate +2, and strong +3.
  • the Log 2 of the product of the percentage of positive tumor cells (Labeling index, LI) multiplied by the intensity of staining was determined for each IHC NE marker and used to generate a heat map of the IHC NE markers using 'heatmap' function in the open source package R version 2.12.2 (World Wide Web at "r-project.org/").
  • RET IHC frequently had areas with different intensity of stains.
  • RET IHC score was computed as the summation of Log 2 (LI) x intensity for each stained area.
  • Total RNA from samples collected by LCM was isolated using the Micropure kit (Qiagen Corp, Valencia, CA) as described elsewhere (Savci-Heijink et al., Am. J. Pathol., 174(5): 1629-37 (2009)).
  • RNA quality and quantity were controlled by the Agilent bioanalyzer and the Ribogreen assay or by a quantitative PCR assay based on the ratio of concentration of 3' to middle transcript of ⁇ -actin.
  • Total RNA (10 ng) from these LCM- collected samples were labeled in a two round linear amplification/labeling process according to the Small Sample Preparation protocol (Affymetrix Corp, Santa Clara, CA). Affymetrix arrays were scanned according to the manufacturer's protocol.
  • Total RNA from samples obtained by macrodissection was isolated using the RNeasy kit (Qiagen). The quality and quantity of RNA samples were controlled by the Agilent bioanalyzer and a NanoDrop spectrophotometer.
  • Total RNA (1.2 ⁇ g) was labeled according to the standard Affymetrix protocol. Labeled cRNA was hybridized to
  • RNA from macrodissected samples were purified by the RNeasy kit (Qiagen) and analyzed by the Agilent bioanalyzer and a NanoDrop spectrophotometer.
  • WG- DASL assay Illumina, San Diego, CA
  • total RNA 100 ng was reverse transcribed with biotinylated primers.
  • the resulting cDNA was annealed to chimeric query
  • oligonucleotides which contained a gene-specific region and a universal primer sequence for PCR amplification, and then bound to streptavidin-conjugated paramagnetic particles.
  • the gene-specific oligonucleotides were extended by second-strand cDNA synthesis and then ligated. Subsequently, the products were sequestered by magnetic separation, washed to remove unbound molecules, and then amplified by PCR with fluorophore- labeled universal primers. The resulting PCR products were purified, applied to
  • HumanRef-8 v3 beadchips were washed and scanned in a BeadArray Reader using BeadScan v3 software (Illumina).
  • ASCL1 + and ASCLl " tumors in stage I AD. All files had follow up information. Array files (n 593) with more than 22,000 common Affymetrix probesets were included in this dataset.
  • the reported KM plot used a threshold of 3.5, as signal intensities below this threshold are usually not detected by RT-PCR. If the data was not censored at 5 years, p-values ranged from 0.00053 to 0.037 as the threshold changed from 3.0 to 6.5. Same probeset and threshold was used in the KM plot of all AD stages. Also, a KM plot for RET stains was generated by using the mean of all RET IHC scores as the threshold for selecting "low” and "high” levels.
  • MSigDB Molecular Signatures Database
  • CD56/NCAM for AD, SCLC, LCNEC and LCC are shown in Table 4.
  • ASCLl immunoreactivity varied according to tumor histological subtype.
  • AD showing ASCLl immunoreactivity (ASCL1+AD)
  • ASCL1 + cells were focal and admixed with ASCLl " cells ( Figures 3 A and 3B), resulting in low to moderate Lis (Table 4).
  • SCLC Figures 3F and 3G
  • LCNEC examples
  • ASCLl immunostaining was diffuse, resulting in moderate to high Lis (Table 4).
  • ASCLl immunoreactivity in AD was more frequent than for CHGA (Figure 3C) and CD56/NCAM ( Figure 3D); however, SYP (Figure 3E) was the most common IHC NE marker expressed in this group as shown in Table 5 and illustrated in Figure 3P.
  • ASCLl + AD was not immunoreactive for any of the other IHC NE markers, whereas six ADs exhibiting reactivity for at least one of the other NE markers were ASCLl- AD (Table 6).
  • SCLC Figures 3H, 31 and 3 J
  • LCNEC Figures 3M, 3N and 30
  • all cases were immunoreactive for ASCLl as well as for most other IHC NE markers (CHGA, SYP, and CD56/NCAM); whereas the remaining 4 LCC examples were not immunoreactive for any IHC NE marker, including ASCLl ( Figure 3P).
  • ASCLl also was highly prevalent in other NE lung tumors, including SCLC and carcinoid tumors (CT).
  • CT carcinoid tumors
  • Neuroendocrine differentiation is rare in non-smoker adenocarcinomas
  • NE markers were examined in the Mayo Clinic lung cancer samples from NS, which included 75 AD, 32 CT, 8 adenosquamous carcinomas and SQCC, and 125 adjacent non-neoplastic (N) samples. Compared with N, all NE markers were over-expressed in a majority of CT as expected ( Figure 5). In contrast, the expression levels of NE markers in AD were within the range of N. A subset of AD was not identified with marked over-expression of any of the NE markers. These data suggest that NE differentiation in lung AD is largely restricted to smokers.
  • stage I AD were stratified by ASCL1 status, differences in age and gender between the ASCL1 + and ASCL1 " patients were not identified (group t-test and chi-square p > 0.09). Table 8. Survival times of patients with fatal stage I AD according to the ASCLl status.
  • RETmRNA expression in ASCLl AD is predictive of overall survival
  • RET was the fourth most over-expressed gene after ASCLl followed by CALCA and Clorf95 (Table 9).
  • Figure 7A illustrates the expression of RET in ASCLl " and ASCL1 + stage I AD. The over-expression of RET in ASCL1 + tumors was consistent in all four datasets ( Figure 7A). RET expression was more consistent with ASCLl than other NE markers ( Figure 4). Depending on the microarray signal threshold for calling a transcript present (Log 2 signal intensity of 3.5 or 4.5), 91 to 95% of samples that expressed RET also expressed ASCLl .
  • FIG. 7B illustrates the expression of RET in Dataset 1.
  • ASCLl was largely absent
  • RET was also rarely expressed.
  • SCLC, CT, and LCC RET expression was largely restricted to ASCL1 + tumors.
  • RET mRNA was detectable in a limited number of lung cancers that did not express ASCLl (black circles in Figure 7B).
  • RET IHC was not predictive of OS ( Figure 9E).
  • median survival times of tumors with 'low' levels of RET was slightly less than tumors with 'high' levels of RET, but this difference was statistically insignificant.
  • probesets were ranked by SNR in aggressive versus non-aggressive tumors two probesets for RET were among the list of top 10 probesets.
  • GSA analysis in these tumors identified six gene sets (Table 11). Most notably, KANG-CISPLATIN-RESISTANCE-UP was positively associated with aggressive tumors. This set included genes that were up-regulated in gastric cancer cell lines resistant to cisplatin (Kang et al., Clin. Cancer Res., 10(1 Pt l):272-84 (2004)).
  • lung cancer patients can be examined for the presence of lung cancer cells expressing ASCL1 (e.g., an elevated level ASCL1 ) and RET (e.g., an elevated level RET). If the presence of lung cancer cells expressing ASCL1 and RET is detected in a particular lung cancer patient, then that lung cancer patient can be classified as having lung adenocarcinoma characterized by neuroendocrine differentiation and/or as having a poor survival prognosis. In some cases, lung cancer patients classified as having lung adenocarcinoma characterized by neuroendocrine differentiation can be treated as described herein.
  • Example 2 Genes over expressed in lung adenocarcinoma
  • adenocarcinoma samples that express ASCLl and RET. Additional information about each of these ten genes is provided in Table 13. Possible drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation are listed in Table 14, Table 1, Table 2 A, or Table 2B.
  • tu ocurar ne areco ne, en urane, pancuron um, vecuron um
  • Example 3 Methods for confirming effectiveness of drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation
  • Two cell lines are used to confirm the effectiveness of drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation. The first is the
  • HCC1833 cell line which was derived from lung AD and has high expression levels of ASCLl and RET.
  • the second in the A549 cell line which has low endogenous expression of ASCLl and is stably transfected with ASCLl (A549-As + ).
  • A549-As + captures salient features of ASCLl + lung AD from patients, including increased expression of RET.
  • HCC 1833 are stably transfected with ASCL 1 siRNA to knock down ASCLl and produce a HCC1833-AsKD cell line. Lowering ASCLl expression leads to low levels of RET expression.
  • Selected drugs such as sunitinib, sorafmib, or others listed in Table 14 are incubated with A549 and A549-As + cells in vitro and HCC 1833 and HCC1833-AsKD cells in vitro.
  • the cells are treated in culture at various concentrations (e.g., 10 to 100 nM or 2 to 10 ⁇ concentrations).
  • the treated cell lines are examined for sensitivity to the selected drugs. Cell viability and apoptosis are assessed using standard assays to compare sensitivity of A549, A549-As + , HCC1833, and HCC1833-AsKD cells to the selected drugs.
  • HCC 1833 or A549-As + cells are transplanted into Nude mice subcutaneously or by IP injections. Tumors are allowed to grow, and the animals are treated to receive daily treatments of a selected drug (e.g., sunitinib and/or sorafmib) given by oral administration at a particular dose (e.g., 30 mg/kg or 60 mg/kg). Tumor growth is evaluated twice-weekly by measurement of tumor volume, and histology of the tumors is assessed at the end of the treatment or after mice become moribund.
  • a selected drug e.g., sunitinib and/or sorafmib
  • a particular dose e.g., 30 mg/kg or 60 mg/kg.
  • the HCC1833 adenocarcinoma cell line expressed high endogenous levels of ASCLl and RET (Figure 13, left).
  • Transfection with shl a small interfering RNA construct that includes: GCCAACAAGAAGATGAGTAAG (SEQ ID NO: l)
  • sh2 a small interfering RNA construct that includes: CAACCGCGTCAAGTTGGTCAA (SEQ ID NO:2)
  • ASCLl is an upstream regulator of RET.
  • STAT3 expression in JAK/STAT3 pathway
  • Knocking down ASCLl expression also caused reduced cell proliferation (Figure 13, right).
  • HCC1833 cells with reduced ASCLl expression (ASCLl -sh2 cells) exhibited a much slower ability to filling the gap in a scratch assay ( Figure 14).
  • Example 4 Treating lung adenocarcinoma characterized by neuroendocrine
  • a patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered Brentuximab vedotin at a dose that is between 1.5 and 2.0 mg/kg (1.8 mg/kg) via intravenous infusion over 30 minutes every 3 weeks.
  • Example 5 Treating lung adenocarcinoma characterized by neuroendocrine differentiation with sucralfate
  • a patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered sucralfate at a dose of about 1 g (10 mL/2 teaspoonfuls) four times per day.
  • Example 6 Treating lung adenocarcinoma characterized by neuroendocrine differentiation with paliperidone
  • a patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered paliperidone at a dose of 6 to 12 mg daily orally.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Emergency Medicine (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

This document provides methods and materials involved in identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation as well as methods and materials involved in treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, methods and materials for using ASCL1 and RET expression levels to identify lung cancer patients having lung adenocarcinoma characterized by neuroendocrine differentiation are provided.

Description

METHODS AND MATERIALS FOR IDENTIFYING AND TREATING MAMMALS HAVING LUNG ADENOCARCINOMA CHARACTERIZED BY NEUROENDOCRINE DIFFERENTIATION CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No. 61/775,316, filed March 8, 2013. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application. BACKGROUND
1. Technical Field
This document relates to methods and materials involved in identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation as well as methods and materials involved in treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, this document provides methods and materials for using achaete-scute homo log 1 (ASCLl) and RET expression levels to identify lung cancer patients having lung adenocarcinoma characterized by neuroendocrine differentiation. 2. Background Information
The clinical significance of neuroendocrine (NE) differentiation in lung adenocarcinoma, and the most appropriate biomarkers for this assessment, has been long debated. In the absence of a gold standard, investigators have most commonly used immunohistochemistry (IHC) of one or a combination of neuroendocrine markers, such as chromogranin (CHGA), synaptophysin (SYP), neuron-specific enolase (NSE), or neural cell adhesion molecule (CD56/NCAM) to assess the role of neuroendocrine differentiation in lung cancer survival.
SUMMARY
This document provides methods and materials involved in identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation as well as methods and materials involved in treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, this document provides methods and materials for using ASCLl and RET expression levels to identify lung cancer patients having lung adenocarcinoma characterized by neuroendocrine
differentiation. As described herein, the presence of an elevated level of ASCLl expression and an elevated level of RET within a lung cancer sample can indicate that a mammal (e.g., a human) has lung adenocarcinoma characterized by neuroendocrine differentiation. In some cases, the absence of an elevated level of ASCLl expression and an elevated level of RET within a lung cancer sample can indicate that a mammal (e.g., a human) does not have lung adenocarcinoma characterized by neuroendocrine
differentiation.
Having the ability to identify mammals as having lung adenocarcinoma characterized by neuroendocrine differentiation as described herein can allow those lung cancer patients to be properly identified and treated in an effective and reliable manner. For example, the lung cancer treatments provided herein can be used to treat lung cancer patients identified as having lung adenocarcinoma characterized by neuroendocrine differentiation.
In general, one aspect of this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation. The method comprises, or consist essentially of, determining whether or not cancer cells from the mammal contain an elevated level of ASCLl expression and an elevated level of RET expression, wherein the presence of the elevated level of ASCLl expression and the presence of the elevated level of RET expression indicates that the mammal has lung adenocarcinoma characterized by neuroendocrine differentiation, and wherein the absence of the elevated level of ASCLl expression and the absence of the elevated level of RET expression indicates that the mammal does not have lung adenocarcinoma characterized by neuroendocrine differentiation. The mammal can be a human. The elevated level can be determined using PCR. The elevated level can be determined using immunohistochemistry.
In another aspect, this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation. The method comprises, or consists essentially of, (a) determining whether or not a lung cancer cells from the mammal contain an elevated level of ASCL1 expression and an elevated level of RET expression, (b) classifying the mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation if the sample contains the elevated level of ASCL1 expression and the elevated level of RET expression, and (c) classifying the mammal as not having lung adenocarcinoma characterized by neuroendocrine
differentiation if the sample lacks the elevated level of ASCL1 expression and the elevated level of RET expression. The mammal can be a human. The elevated level can be determined using PCR. The elevated level can be determined using
immunohistochemistry.
In another aspect, this document features a method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation, wherein the method comprises, or consists essentially of, (a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from the mammal, and (b) classifying the mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation based at least in part on the presence of the elevated level of ASCL1 expression and the elevated level of RET expression. The mammal can be a human. The elevated level can be detecting using PCR. The elevated level can be detecting using immunohistochemistry.
In another aspect, this document features a method for treating lung cancer, wherein the method comprises, or consists essentially of, (a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from a mammal, and (b) administering a molecule to the mammal under conditions wherein the number of lung cancer cells within the mammal is reduced, wherein the molecule is selected from the group consisting of sunitinib, vandetanib, riluzole, alteplase, anistreplase, tenecteplase, sucralfate, dasatinib, pazopanib, tivozanib, OSI-930, telatinib, tandutinib, imatinib, sorafenib, levodopa, carbidopa, entacapone orion, L-dopa, ABT-089, mecamylamine, and succinylcholine.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic showing the composition of Datasets 1 and 2. Boxes with dotted shadings in Dataset 1 denote samples collected by laser capture microdissection (LCM). Numbers in parenthesis in Dataset 2 are all stages and stage 1 only sample sizes, respectively. Dataset 2 was used in survival analysis by RET. All samples in this dataset were collected in bulk.
Figure 2 is a graph plotting the threshold selection for ASCL1 positive and negative status. With minor exceptions, signal intensities at or above 8 produced a positive staining on the IHC. There was a strong Pearson's correlation (rho = 0.89) between the Labeling index (LI) and microarray signal intensities (Log2).
Figure 3 contains photographs and a heat graph of an immunohistochemical analysis. (A-E) AD characterized by ASCL1 mRNA expression (ASCL1+ AD): (A) Adenocarcinoma with an acinar pattern. H&E. 400x; (B) ASCL1 protein expression (nuclear pattern, 70%, 2+). 400x; (C) CHGA (cytoplasmic pattern, 5%, 3+). 400x; (D) SYP (cytoplasmic pattern, 5%, 2+) 400x; and (E) CD56/NCAM (membranous pattern, 5%, 2+) 400x. (F-J) SCLC: (F) High-grade tumor characterized by extensive areas of necrosis and cells with high nuclear to cytoplasmic ratio, delicate nuclear chromatin and inconspicuous nucleoli. H&E 400x; (G) ASCL1 protein expression (nuclear pattern, 95%, 3+) 400x; (H) CHGA (cytoplasmic pattern, 100%, 2+) 400x; (I) SYP (cytoplasmic pattern, 100%, 1+) 400x; and (J) CD56/NCAM (membranous pattern, 100%, 2+) 400x. (K-O) LCNEC: (K) Poorly differentiated tumor with high mitotic activity (>10 mitotic figures/ 2mm2) and organoid nesting composed by cells with vesicular nuclei, evident nucleoli and moderate amount of cytoplasm. H&E, 400x; (L) ASCLl protein expression (nuclear pattern, 95%, 3+) 400x; (M) CHGA (cytoplasmic pattern, 90%, 3+) 400x; (N) SYP (cytoplasmic pattern, 95%, 2+) 400x; and (O) CD56/NCAM (membranous pattern, 90%, 3+) 400x. (P) Heat map of IHC protein expression of ASCLl, CHGA, SYP, and CD56/NCAM.
Figure 4 is a heat map of the microarray Log2 expression values using known NE genes and RET. The map also includes SQCC and AD specific genes (DSG3 and NKX2.1, respectively). ASCLl expression is much more frequent in AD than in SQCC. Each gene is represented by the most variable probeset with the highest standard deviation.
Figure 5 contains graphs demonstrating that NE differentiation in never smoker AD is rare. In contrast with typical carcinoid (CT), no subset of AD has a distinguishably higher expression of the NE markers than non-neoplastic lung. Similar observations can be made about SQCC, but the number of samples is small.
Figure 6 is a graph of a KM plot of stage I AD in Dataset 2 based on ASCLl status. The drop off for the ASCL1+ tumors is sharper than the ASCLl" tumors, suggesting nonproportional hazard.
Figures 7A and 7B are graphs demonstrating the over representation of tumors expressing RET (211421_s_at probe set) in ASCL1+ compared with ASCLl" in (A) stage I ADs (Dataset 2), and in (B) all lung cancers (Dataset 1). This over-representation was consistent in all datasets. Few samples (shown in black circles) expressed RET while ASCLl was below noise level (arbitrary Log2 signal intensity of 3.5). Data points correspond to the samples from the Mayo Clinic unless stated in the figure legends.
Figures 8 A and 8B are graphs plotting overall survival in ASCLl + stage I (A) and all (B) AD as a function of the RET mRNA expression level by microarrays.
Figure 9 contains photographs and graphs of RET protein expression by IHC. RET staining in fatal adenocarcinoma was typically much less intense in ASCLl" (A) than in ASCLl + (B) tumors. (C) Co-IHC of ASCLl (nuclear brown staining) and RET (cytoplasmic red staining) identified areas with overlapping expression of the two proteins. (D) KM plot of 14 ASCLl + AD samples indicate a significant association with OS (p = 0.05). (E) When samples were not stratified by the ASCLl expression, RET IHC was not significant in predicting OS (overall survival).
Figure 10 is a Kaplan Meir plot of the overall survival (OS) in ASCLl + stage I AD in patients with low (n = 38) and high (n = 15) expression levels of RET. A significant association with the overall survival was identified (p =0.007).
Figure 11 is a plot of ASCLl and RET expression versus promoter methylation of the ASCLl promoter in the GSE32867 dataset. This data indicates that promoter hypo- methylation increases expression levels of the ASCLl transcript. Interestingly, high expression level of ASCLl is significantly associated with high level of RET. In the plot, samples with high transcript levels of RET are indicated by circles around the solid circles. RET and ASCLl expression levels are based on the Illumina ILMN 1655610 and ILMN_1701653 probesets, respectively. ASCLl promoter methylation is assessed by the cg20053158 probeset. High RET expression is marked by circles.
Figure 12 is a Kaplan Meir plot of the ASCLl + AD patients overall survival based on the levels of the RET protein by IHC. Samples are from Mayo patients and were used in the discovery step by microarrays. A significant association between RET IHC and the overall survival was identified (p = 0.038).
Figure 13 contains three graphs of an in vitro analysis that confirms that ASCLl regulates RET expression.
Figure 14 contains photographs of cells from a filling the gap scratch assay (see, e.g., Liang et al, Nature Protocols, 2:329-333 (2007)). Wild-type HCC1833 cells and HCC1833 cells transfected with a control vector filled most of the gap by day 3, while HCC1833 cells transfected with an ASCLl knock down vector (ASCLl -sh2 cells) did not fill as much of the gap, indicating that wild-type HCC1833 cells and cells transfected with empty vector (VEC) have a higher migration capacity than cells transfected with ASCLl shRNA (ASCLl -sh2).
Figure 15 contains a bar graph plotting the clonogenic number of cells that do not express ASCLl (A549 cells) and cells that express ASCLl (A549-ASCL1 cells) after treatment with the indicated amount of cisplatin (e.g., 0 μΜ, 3 μΜ, or 9 μΜ) for 14 days. Figure 15 also contains a line graph plotting the viability of A549 cells and A549-ASCL1 cells 72 hours after treatment with the indicated amount of cisplatin. These results demonstrate that adenocarcinomas that express ASCLl appear to be more resistant to treatment by cisplatin.
Figure 16 is a line graph plotting the viability of A549 cells and A549-ASCL1 cells 72 hours after treatment with the indicated amount of sunitinib (marketed as Sutent by Pfizer, and previously known as SU11248). The vertical line is drawn at about 3 μΜ. These results demonstrate that adenocarcinomas that express ASCLl /RET are more susceptible to treatment by sunitinib.
DETAILED DESCRIPTION
This document provides methods and materials related to identifying mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, this document provides methods and materials for identifying mammals (e.g., humans) as having lung adenocarcinoma characterized by neuroendocrine differentiation by determining whether or not a lung cancer sample (e.g., lung tissue biopsy) from the mammal contains cancer cells having an elevated level of ASCLl expression and/or an elevated level of RET expression. As described herein, if a mammal contains lung cancer cells with an elevated level of ASCLl expression and/or an elevated level of RET expression, then that mammal can be classified as having lung adenocarcinoma characterized by neuroendocrine differentiation. If a mammal contains a lung cancer cells that lack an elevated level of ASCLl expression and lack an elevated level of RET expression, then that mammal can be classified as not having lung adenocarcinoma characterized by neuroendocrine differentiation.
The term "elevated level" as used herein with respect to a level of expression (e.g., ASCLl and/or RET expression) refers to any level that is greater than a reference level for that molecule (e.g., a reference level of ASCLl and/or RET expression). The term "reference level" as used herein with respect to a particular molecule (e.g., a reference level of ASCLl and/or RET expression) refers to the level of expression that is typically observed with normal healthy lung cells or lung adenocarcinoma characterized by a lack of neuroendocrine differentiation from mammals (e.g., humans). For example, a reference level of ASCLl expression can be the average level of ASCLl expression that is present in lung cells obtained from a random sampling of 50 humans free of lung cancer. In some cases, an elevated level of expression (e.g., ASCL1 and/or RET expression) can be a level that is at least 10, 25, or 50 percent greater than a reference level for that molecule (e.g., a reference level of ASCL1 and/or RET expression). In some cases, an elevated level of ASCL1 expression or RET expression can be a detectable level (e.g., an expression level detectable by immunocytochemistry). It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an elevated level.
As described herein, the level of ASCL1 and/or RET expression within lung cancer cells can be used to determine whether or not a particular mammal has lung adenocarcinoma characterized by neuroendocrine differentiation. Any appropriate lung cancer sample can be used as described herein to identify mammals having lung adenocarcinoma characterized by neuroendocrine differentiation. For example, lung cancer tissue samples, lung cancer cell samples, and lung cancer needle biopsy specimen can be used to determine whether or not a mammal has lung adenocarcinoma
characterized by neuroendocrine differentiation.
In addition, any appropriate method can be used to obtain lung cancer cells. For example, a lung cancer sample can be obtained by a tissue biopsy or following a surgical resection. Once obtained, a sample can be processed prior to measuring a level of expression. For example, a lung cancer sample can be processed to extract RNA from the sample. Once obtained, the RNA can be evaluated to determine the level of an mRNA of interest. In some embodiments, nucleic acids present within a sample can be amplified (e.g., linearly amplified) prior to determining the level of expression (e.g., using array technology). In another example, a lung cancer sample can be frozen, and sections of the frozen tissue sample can be prepared on glass slides. The frozen tissue sections can be stored (e.g., at -80°C) prior to analysis, or they can be analyzed immediately (e.g., by immunohistochemistry with an antibody specific for a particular polypeptide of interest).
Any appropriate methods can be used to determine the level of ASCL1 and/or RET expression within lung cancer cells. For example, quantitative real time PCR, in situ hybridization, or microarray technology can be used to determine whether or not a particular sample contains an elevated level of mRNA expression for a particular nucleic acid or lacks an elevated level of mRNA expression for a particular nucleic acid. In some cases, the level of expression can be determined using polypeptide detection methods such as immunochemistry techniques. For example, antibodies specific for ASCL1 and/or RET polypeptides can be used to determine the polypeptide level in a sample. In some cases, polypeptide -based techniques such as ELISAs and immunocytochemistry techniques can be used to determine whether or not a particular sample contains an elevated level of polypeptide expression for a particular nucleic acid or lacks an elevated level of polypeptide expression for a particular nucleic acid.
Examples of a human ASCL1 nucleic acid can have the sequence set forth in GenBank® Accession No. NM 004316 (GI No. 190343011), and a human ASCL1 polypeptide can have the sequence set forth in GenBank® Accession No. NP 004307 (GI No. 55743094). Examples of a human RET nucleic acid can have the sequence set forth in GenBank® Accession No. NM_020630 (GI No. 126273513) or NM_020975 (GI No. 126273511), and a human RET polypeptide can have the sequence set forth in GenBank® Accession No. NP_065681 (GI No. 10862701) or NP_066124 (GI No. 10862703).
Once the level of ASCL1 and/or RET expression within lung cancer cells from a mammal is determined, the level(s) can be compared to reference level(s) and used to classify the mammal as having or lacking lung adenocarcinoma characterized by neuroendocrine differentiation as described herein.
This document also provides methods and materials to assist medical or research professionals in identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation. Medical professionals can be, for example, doctors, nurses, medical laboratory technologists, and pharmacists. Research professionals can be, for example, principle investigators, research technicians, postdoctoral trainees, and graduate students. A professional can be assisted by (a) determining the level of ASCL1 and/or RET expression within lung cancer cells, and (b) communicating information about that the level(s) to that professional.
Any method can be used to communicate information to another person (e.g., a professional). For example, information can be given directly or indirectly to a professional. In addition, any type of communication can be used to communicate the information. For example, mail, e-mail, telephone, and face-to-face interactions can be used. The information also can be communicated to a professional by making that information electronically available to the professional. For example, the information can be communicated to a professional by placing the information on a computer database such that the professional can access the information. In addition, the information can be communicated to a hospital, clinic, or research facility serving as an agent for the professional.
This document also provides methods and materials for treating lung
adenocarcinoma characterized by neuroendocrine differentiation. For example, one or more molecules listed in Table 1, 2, or 3 can be administered to a mammal (e.g., a human) having lung adenocarcinoma characterized by neuroendocrine differentiation under conditions wherein the presence or progression of the lung adenocarcinoma characterized by neuroendocrine differentiation is reduced. For example, a molecule listed in Table 1 such as tedisamil can be administered to a human having lung adenocarcinoma characterized by neuroendocrine differentiation such that the number of lung adenocarcinoma cells within the human is reduced. In some cases, one or more of molecules listed in Table 2A or 2B can be administered in combination with one or more of molecules listed in Table 1 to treat lung adenocarcinoma characterized by
neuroendocrine differentiation. For example, tedisamil can be administered in combination with riluzole to a human having lung adenocarcinoma characterized by neuroendocrine differentiation.
Table 1. Molecules for treating lung adenocarcinoma characterized by neuroendocrine differentiation.
Figure imgf000012_0001
KCNMB4 tedisamil 0.5-4 mg/kg, i.v.
Table 2A. Molecules that can be used in combination with one or more molecules listed in Table 1 for treating lung adenocarcinoma characterized by neuroendocrine differentiation.
Gene Molecule Dosage Range (mg/kg)
RET sunitinib 30 mg/kg
RET vandetanib 60 mg/kg
SCN3A riluzole 40-60 mg twice daily
FGA Alteplase 0.9 mg/kg, and a total not
exceeding 90 mg
FGA Anistreplase IV 30 units over 2 to 5
into IV line or vein
FGA Tenecteplase less than 60 kg: 30 mg IV bolus administered over 5 seconds.
60 to less than 70 kg: 35 mg IV bolus administered over 5 seconds
70 to less than 80 kg: 40 mg IV bolus administered over 5 seconds
80 to less than 90 kg: 45 mg IV bolus administered over 5 seconds
90 kg or greater: 50 mg IV bolus administered over 5 seconds)
FGA Sucralfate 1 g (10 mL/2 teaspoonfuls) four times per day
KIT Dasatinib 100-180 mg once daily
KIT sunitinib 30 mg/kg
KIT pazopanib 400-800 mg orally once daily
KIT tivozanib 1-2 mg daily
KIT OSI-930 500 mg twice a day
KIT Telatinib 20 mg once daily to 1,500 mg
twice daily
KIT tandutinib 50 mg to 700 mg twice daily
KIT imatinib 400-800 mg a day KIT sorafenib 400-800 mg a day
DDC Levodopa/Carbidopa/Entacapone 200 mg/50 mg/200 mg dose is
Orion 7 tablets per day (maximum dose a day)
DDC carbidopa/levodopa 1 tablet of carbidopa 25
mg/levodopa 100 mg orally 3 times a day, or 1 tablet of 10 mg carbidopa/ 100 mg levodopa orally 3 to 4 times a day.
The dose may be increased by 1 tablet orally every 1 to 2 days to a dose of 8 tablets/day (2 tablets orally 4 times a day)
DDC Carbidopa 70-100 mg a day
DDC L-Dopa 100-500 mg
CHRNA9 ABT-089 1-50 mg
CHRNA9 mecamylamine 2-25 mg
CHRNA9 succinylcholine 0.3-2.0 mg/kg
Table 2B. Molecules that can be used to reduce or inhibit the activity of polypeptides encoded b the listed enes.
Figure imgf000014_0001
cetirizine/pseudoephedrine, asenapine,
epinephrine/prilocaine, epinephrine/lidocaine, PYM-
50018, V2006, lurasidone, paliperidone palmitate, fexofenadine/pseudoephedrine,
guaifenesin/phenylpropanolamine, oxymetazoline, prazosin, phenylpropanolamine, ephedrine, tolazoline, guanfacine, guanabenz, guanethidine, phenoxybenzamine, dexmedetomidine, UK 14304, clonidine, dexefaroxan, quinidine, polythiazide/prazosin,
chlorothiazide/methyldopa, chlorthalidone/ clonidine, propafenone, guanadrel, hydrochlorothiazide/methyldopa, metaraminol, tizanidine, quetiapine, D-pseudoephedrine, apraclonidine, venlafaxine, phentolamine, labetalol, mephentermine, propylhexedrine, yohimbine,
dihydroergotamine, ergotamine, norepinephrine, alpha- methyl dopa, epinephrine, dopamine,
chlorpheniramine/phenylpropanolamine,
desloratadine/pseudoephedrine,
acrivastine/pseudoephedrine,
carbinoxamine/pseudoephedrine,
brompheniramine/codeine/phenylpropanolamine, pseudoephedrine/triprolidine,
codeine/pseudoephedrine/triprolidine,
carbetapentane/chlorpheniramine/ephedrine/phenylephrine, brompheniramine/dextromethorphan/pseudoephedrine, chlorpheniramine/hydrocodone/pseudoephedrine, azatadine/pseudoephedrine, naphazoline,
carbinoxamine/dextromethorphan/pseudoephedrine
FGA F2
FGB F2
KIT dasatinib, sunitinib, pazopanib, tivozanib, OSI-930, telatinib, tandutinib, imatinib, sorafenib
carbidopa/entacapone/levodopa, carbidopa/levodopa, S(-)-
DDC carbidopa, L-dopa
TUBB2B brentuximab vedotin, cabazitaxel
ABT-089, isoflurane, mecamylamine, succinylcholine, rocuronium, doxacurium, amobarbital, mivacurium, pipecuronium, rapacuronium, metocurine, atracurium, cisatracurium, acetylcholine, nicotine, D-tubocurarine,
CHRNA9 arecoline, enflurane, pancuronium, vecuronium
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1 - Elevated ASCL1 and RET expression can be used to identify patients with lung adenocarcinoma characterized by neuroendocrine differentiation Patient sample population
Using the Mayo Clinic frozen tumor bank, lung specimens resected from 303 patients between 1997 and 2007 were selected. Neoadjuvant therapy was not given to any patient included in this study. Formalin- fixed paraffin-embedded H&E sections from the corresponding surgical specimens were reviewed, and the diagnoses were confirmed according to the 2004 World Health Organization classification of tumors.
Bronchioloalveolar carcinoma variant of lung adenocarcinoma (AD) was excluded; hence, all ADs analyzed were clearly and predominantly invasive tumors. Never- smokers (NS) were characterized by less than 100 cigarettes per lifetime. Samples exclusively from NS (n = 130) were analyzed on the Illumina platform, and samples from former and current smokers (S) patients (n = 186) and NS (n = 18) were analyzed on the Affymetrix platform. Table 3 describes the clinicopathologic features of the samples. Table 3. Clinicopatho logic features of samples used.
Figure imgf000017_0001
Immunohistochemical (IHC) Analysis
IHC procedures for ASCL1, CHGA, SYP, CD56/NCAM, and RET were as follows. A representative formalin fixed paraffin embedded (FFPE) block from a subset of gene expression profiled lung tumors of smokers (S), consisting of adenocarcinoma (AD) (n=83), small cell lung carcinoma (SCLC) (n=12), large cell carcinoma (LCC) (n=4), and large cell neuroendocrine carcinoma (LCNEC) (n=2), was selected. The analysis was limited to S as NE differentiation was significantly more prevalent in this group of tumors. IHC studies using antibodies directed against ASCL1/MASH1 (monoclonal, clone 24B72D11.1, 1 :50 dilution, BD/Pharmingen, San Diego, CA), CHGA (monoclonal, clone LK2H10, 1 :500 dilution, Chemicon/Millipore, Billerica, MA), SYP (monoclonal, clone SY38, 1 :40 dilution, ICN, Irvine, CA), and CD56/NCAM
(monoclonal clone 123C3, 1 :25 dilution, Monosan, Uden, the Netherlands) were performed. The IHC stains were detected by the Dako Advance polymer-based detection system (Dako, Carpenteria, CA, U.S.) using the Dako Autostainer. For each IHC assay, a positive control and negative control were performed. Immunostained slides were reviewed and scored by two pathologists, who were blinded to the corresponding microarray data. A consensus score was achieved for all cases. Cases were considered immunoreactive when exhibiting 5% or more tumor cells showing a nuclear staining pattern for ASCLl, a clear granular cytoplasmic staining pattern for CHGA and SYP, and a distinct membranous staining pattern for CD56/NCAM.
Similarly, twenty nine AD samples (14 ASCLl + and 15 ASCLl") with microarray expression data were selected for RET IHC using 1 :500 dilutions of Epitomics 3454-1 rabbit monoclonal antibody. An ASCL1/RET co-IHC was developed by DAB staining for ASCLl first (1 : 100 dilution monoclonal, clone 24B72D11.1, BD/Pharmingen, San Diego, CA) and then Fast Red staining (1 :500 dilutions of Epitomics 3454-1 rabbit monoclonal antibody) for RET.
Immunoreactivity was semi-quantitatively scored based on a) the percentage of positive tumor cells (Labeling index, LI), ranging from 0 to 100%, in increments of 5%; and b) the intensity of staining, graded as: weak +1, moderate +2, and strong +3. For a comparative analysis of NE markers (ASCLl, CHGA, SYP, and CD56/NCAM), the Log2 of the product of the percentage of positive tumor cells (Labeling index, LI) multiplied by the intensity of staining was determined for each IHC NE marker and used to generate a heat map of the IHC NE markers using 'heatmap' function in the open source package R version 2.12.2 (World Wide Web at "r-project.org/"). RET IHC frequently had areas with different intensity of stains. In each case, RET IHC score was computed as the summation of Log2 (LI) x intensity for each stained area. Preparation of samples for expression profiling on the Affymetrix platform
Lung tumor cells and non-neoplastic cells were collected by either laser capture microdissection (LCM=86) or macrodissection (M=l 12) to assure high tumor content (>80%) as described elsewhere (Klee et al, BMC Med. Genomics, 2: 13 (2009)). Total RNA from samples collected by LCM was isolated using the Micropure kit (Qiagen Corp, Valencia, CA) as described elsewhere (Savci-Heijink et al., Am. J. Pathol., 174(5): 1629-37 (2009)). Briefly, RNA quality and quantity were controlled by the Agilent bioanalyzer and the Ribogreen assay or by a quantitative PCR assay based on the ratio of concentration of 3' to middle transcript of β-actin. Total RNA (10 ng) from these LCM- collected samples were labeled in a two round linear amplification/labeling process according to the Small Sample Preparation protocol (Affymetrix Corp, Santa Clara, CA). Affymetrix arrays were scanned according to the manufacturer's protocol. Total RNA from samples obtained by macrodissection was isolated using the RNeasy kit (Qiagen). The quality and quantity of RNA samples were controlled by the Agilent bioanalyzer and a NanoDrop spectrophotometer. Total RNA (1.2 μg) was labeled according to the standard Affymetrix protocol. Labeled cRNA was hybridized to
U133PLUS2 chipset.
Preparation of samples for expression profiling on the Illumina platform
RNA from macrodissected samples were purified by the RNeasy kit (Qiagen) and analyzed by the Agilent bioanalyzer and a NanoDrop spectrophotometer. For the WG- DASL assay (Illumina, San Diego, CA), total RNA (100 ng) was reverse transcribed with biotinylated primers. The resulting cDNA was annealed to chimeric query
oligonucleotides, which contained a gene-specific region and a universal primer sequence for PCR amplification, and then bound to streptavidin-conjugated paramagnetic particles. The gene-specific oligonucleotides were extended by second-strand cDNA synthesis and then ligated. Subsequently, the products were sequestered by magnetic separation, washed to remove unbound molecules, and then amplified by PCR with fluorophore- labeled universal primers. The resulting PCR products were purified, applied to
HumanRef-8 v3 beadchips, and then hybridized for 16 hours at 58° C. The beadchips were washed and scanned in a BeadArray Reader using BeadScan v3 software (Illumina).
Microarray data analysis
Normalized expression values from WG-DASL experiments were generated by the Bead Studio software (Illumina). Affymetrix intensity files (.CEL files) were processed and normalized by the 'gcrma' package in R. All subsequent analyses of DASL and Affymetrix data were carried out in R. Other than data generated at Mayo, expression analysis included various publically available Affymetrix datasets. Two major datasets which were a compendium of smaller datasets and frequently used in this study were named Dataset 1 and Dataset 2. Compositions of these two sets are shown in Figure 1. AD and LCC samples with high expression of either DSG3 or K T5
(squamous differentiation markers) were excluded. Similarly, squamous cell carcinoma (SQCC) samples with low expression of DSG3 and K T5 were excluded. Pearson correlation coefficients between various NE markers were calculated by 'cor .test,' and a heatmap of all samples in Dataset 1 was generated by the 'heatmap' function.
Differentially expressed transcripts between ASCL1+ and ASCLl' tumors
Dataset 2 (Figure 1) was used to examine the expression differences between
ASCL1+ and ASCLl" tumors in stage I AD. All files had follow up information. Array files (n = 593) with more than 22,000 common Affymetrix probesets were included in this dataset. The microarray signal intensity (.CEL) files were normalized and processed by the "gcrma" package in R. Threshold for ASCLl status (+ or -) was chosen as before using 209988_s_at probeset at Log2 intensity of 8. To identify most differentially expressed genes in ASCLl + versus ASCLl" tumors, probesets were ranked by signal to noise ratio calculated as SNR = ^ASCLI+ - μΑβα,ι-) / ( ASCLI+ + aAscLi-) where μ'β were mean expression values and a's were maximum of 0.2 x μ and standard deviation (Golub et al., Science, 286(5439):531-7 (1999)). SNR values greater than and less than zero potentially indicate over and under expression in ASCLl + compared with ASCLl" tumors, respectively. It was also required in this example that the average expression in samples over-expressing a gene had greater than 3.5 Log2 intensities. Log2 expression intensities for the gcrma normalized data ranged from 2 to 15. Based on experience with quantitative RT-PCR, gene expression intensities below 3.5 were not reliable and frequently not detected. Significant figures for over-expression in ASCLl + compared with ASCLl" tumors were calculated by t-test and then corrected for multiple comparison correction using the 'qvalue' package in R (Storey et al., Proc. Natl. Acad. Sci. USA, 100(16):9440-5 (2003)). Survival analysis
Given that only 15-20% of AD expresses ASCL1, any one dataset by itself did not provide sufficient samples for statistical analysis. Therefore, the Mayo dataset (n = 132) was combined with four other lung AD microarray datasets that had follow up information available. These included the Director's Challenge dataset (Shedden et al., Nat. Med., 14(8):822-7 (2008)) (n = 420), Bhattarcharjee dataset (Bhattacharjee et al, Proc. Natl. Acad. Sci. USA, 98(24): 13790-5 (2001)) (n = 139), Kune dataset (GEO dataset GSE10245, n = 40), and Hou dataset (GEO dataset GSE19188, n = 45). With the exception of Bhattarcharjee dataset, all other array files had common probesets for ASCL1, and the most variable probeset in all sets (209988_s_at) was chosen to determine the expression levels of ASCL1. Based on the IHC data, expression levels above signal intensity 8 (Log2) were chosen as the threshold for ASCL1+ and ASCL1" status (Figure 2). The range of microarray Log2 signal intensities for this probeset was 2-15.
Therefore, signal intensity of 8 or higher corresponded to a moderate to high expression level in the 85th percentile and higher. The ASCL1 status in the Bhattarcharjee dataset was determined by inspecting ASCL1 expression histograms and selecting thresholds breakpoints at the 85 percentile. Survival analyses used the "survival" package in R (http at "//cran.at.r-project.org") and included time to progression and overall survival stratified by stage. In the combined dataset, differences in survival times between ASCL1" and ASCL1+ tumors for stage I patients who died was assessed by a group t-test. A subset of 11 AD in the Director's Challenge data with high expression of CHGA, SCG2, CHGB, NCAM1 (CD56), or SYP were identified as large cell NE carcinomas (LCNEC) after histologic review (Bryant et al, PLoS One, 5(7):el 1712 (2010)). In light of this finding, the cases of AD in this study were re-reviewed, and the diagnosis confirmed by morphology. Furthermore, in the Director's Challenge data, 19 cases were identified with high expression of at least one of these NE markers which could have represented LCNEC and thus NSCLC with poorer prognosis. A group t-test was repeated after excluding these samples, but did not alter the overall results and conclusions. In the analysis of overall survival, the proportional hazard assumption for stage I tumors was tested by the "cox.zph" routine in the "survival" package. A small p-value indicated non- proportional hazard. Proportional hazard assumption was tested after censoring follow up times at five and more years.
Associations between RET expression and survival in ASCL1+ tumors
By Cox proportional hazards regression analysis in R (coxph), two probesets corresponding to the RET oncogene (215771_x_at, 205879_x_at) had significant associations with overall survival in stage I AD after the follow up data at 5 years was censored. To visualize this association by a Kaplan Meir (KM) plot, varying the threshold for "low" and "high" expression levels of RET (215771_x_at) was examined. Values in 3.0 to 6.5 were significant with p values ranging 0.0005 to 0.029. Excluding AD samples where an alternative diagnosis of LCNEC was possible did not appreciably change these results (Bryant et al, PLoS One, 5(7):el 1712 (2010)). The reported KM plot used a threshold of 3.5, as signal intensities below this threshold are usually not detected by RT-PCR. If the data was not censored at 5 years, p-values ranged from 0.00053 to 0.037 as the threshold changed from 3.0 to 6.5. Same probeset and threshold was used in the KM plot of all AD stages. Also, a KM plot for RET stains was generated by using the mean of all RET IHC scores as the threshold for selecting "low" and "high" levels. Gene set analysis
To find gene sets enriched in ASCL1+ tumors compared with ASCL1" tumors, probesets (13166) with SNR greater or less than zero were used in the GSA package in R and using Molecular Signatures Database (MSigDB) version 3.0. The analysis used 500 permutations and an FDR default value of 0.05. For robustness, 20 iterations were performed, and gene sets identified in at least 16 iterations (80%) were reported. To find gene sets associated with aggressive behavior in ASCL1+ tumors, these tumors were divided into aggressive and non-aggressive groups. Aggressive tumors were from patients who died in less than 3.5 years after surgery (n = 21) and non-aggressive tumors were from patients who survived 6 or more years after surgery (n = 20). Probesets (13126) with SNR greater or less than zero in comparisons of aggressive versus non- aggressive tumors were used in the GSA program with the same selection criteria as above.
Comparative IHC analysis ofNE markers (ASCLl, CHGA, SYP and CD56/NCAM)
Immunostaining quality of ASCLl, CHGA, SYP, and CD56/NCAM was comparable, and all slides were interpretable. Scattered immunoreactive bronchiolar basal-located NE cells were considered as positive internal controls for the IHC reaction. Labeling indices (Lis) and immunoreactivity for ASCLl, CHGA, SYP, and
CD56/NCAM for AD, SCLC, LCNEC and LCC are shown in Table 4.
Table 4. Detailed results of the immunohistochemical study for ASCLl and other NE
Figure imgf000023_0001
The pattern of ASCLl immunoreactivity varied according to tumor histological subtype. In AD showing ASCLl immunoreactivity (ASCL1+AD), ASCL1+ cells were focal and admixed with ASCLl" cells (Figures 3 A and 3B), resulting in low to moderate Lis (Table 4). In SCLC (Figures 3F and 3G) and LCNEC examples (Figures 3K and 3L), ASCLl immunostaining was diffuse, resulting in moderate to high Lis (Table 4). In addition, ASCLl immunoreactivity in AD was more frequent than for CHGA (Figure 3C) and CD56/NCAM (Figure 3D); however, SYP (Figure 3E) was the most common IHC NE marker expressed in this group as shown in Table 5 and illustrated in Figure 3P. One ASCLl + AD was not immunoreactive for any of the other IHC NE markers, whereas six ADs exhibiting reactivity for at least one of the other NE markers were ASCLl- AD (Table 6). Among SCLC (Figures 3H, 31 and 3 J) and LCNEC (Figures 3M, 3N and 30), all cases were immunoreactive for ASCLl as well as for most other IHC NE markers (CHGA, SYP, and CD56/NCAM); whereas the remaining 4 LCC examples were not immunoreactive for any IHC NE marker, including ASCLl (Figure 3P).
Table 5. Detailed results of correlation between ASLCl and other NE markers in all lung cancer subt es
Figure imgf000024_0001
Table 6. Correlation of ASCLl with other NE markers in AD
Figure imgf000024_0002
ASCLl mRNA expression is more prevalent in AD than in SQCC
The expression of ASCLl and other known NE markers in Dataset 1 (Figure 1) consisting of AD (n = 232), SQCC (n = 100), SCLC (n = 15), adjacent non-neoplastic lung (N, n = 12), and LCC and LCNEC (n = 9) is shown as a heatmap in Figure 4. The heatmap also includes the SQCC and AD differentiation genes DSG3 and NKX2.1/TTFl, respectively, and RET. ASCLl had the highest correlation with calcitonin
(CPRG/CALCA) (correlation coefficient = 0.65). However, in general, there was not a high correlation between the mRNA expression levels of the NE markers (Table 7).
Most NE markers had similar frequency of expression in the AD and SQCC samples. In contrast, ASCLl was much more specific to AD than to SQCC. For a quantitative analysis, a threshold was selected for ASCLl that corresponded to a positive IHC stain (Figure 2). Microarray signal intensity levels above this threshold had excellent correlation with the IHC staining (correlation coefficient = 0.89, Figure 2). In AD, 44 of 232 cases (19.0%) were ASCL1+. On the other hand, in 100 SQCC only 1 of 100 cases (1.0%) was ASCLl +. Of the nine LCC, two had strong expression of ASCLl and all other NE markers and were classified as LCNEC. Importantly, ASCLl also was highly prevalent in other NE lung tumors, including SCLC and carcinoid tumors (CT). Six of 10 (60%) and 14 of 15 (93%) CT and SCLC, respectively, were ASCL1+. Table 7. Correlation between any two NE markers in AD and SQCC that express either or both markers.
Figure imgf000025_0001
*NS: Pearson correlation p-value > 0.05
Neuroendocrine differentiation is rare in non-smoker adenocarcinomas
Expression levels of known NE markers were examined in the Mayo Clinic lung cancer samples from NS, which included 75 AD, 32 CT, 8 adenosquamous carcinomas and SQCC, and 125 adjacent non-neoplastic (N) samples. Compared with N, all NE markers were over-expressed in a majority of CT as expected (Figure 5). In contrast, the expression levels of NE markers in AD were within the range of N. A subset of AD was not identified with marked over-expression of any of the NE markers. These data suggest that NE differentiation in lung AD is largely restricted to smokers.
Survival analysis of lung AD in relation to ASCL1 mRNA expression
Given that ASCL1 is expressed in about 20% of AD, to obtain sufficient statistical power for survival analysis, the Mayo Clinic AD microarray data was combined with four publicly available AD datasets for which outcome data was available. An association was not identified between the ASCL1 expression status and survival or time to progression in stage I tumors nor in combined stage II-IV tumors (p > 0.28). However, the Kaplan Meir (KM) survival curves for ASCL1+ and ASCL1" stage I tumors had different drop off profiles (Figure 6). ASCL1+ patients who died had significantly shorter survival times causing a sharp drop in the survival curve. Upon further investigation, this pattern was found to be consistent in all five data sets (Table 8). In the combined datasets, ASCL1+ patients who died had statistically shorter survival times than ASCL1" patients who died (p < 5x10~6). This trend did not change after excluding samples suspected of LCNEC in the Director's Challenge dataset. A statistical test (cox.zph) indicated non-proportional hazards in ASCL1" / ASCL1+ tumors when censoring times of 6.5 or more years (p < 0.05) were used. These observations suggested that ASCL1+ status might reflect a different underlying biology for these tumors. The roles of traditional prognostic markers such as age, gender, tumor grade, race, smoking status (former or current), tumor "T" stage, and tumor grade were assessed by cox analysis. The only significant parameters were age (p = 10"6) and gender (p = 0.045).
When stage I AD were stratified by ASCL1 status, differences in age and gender between the ASCL1+ and ASCL1" patients were not identified (group t-test and chi-square p > 0.09). Table 8. Survival times of patients with fatal stage I AD according to the ASCLl status.
Figure imgf000027_0001
RETmRNA expression in ASCLl AD is predictive of overall survival
To gain further insight into the biology of ASCLl + tumors, gene expression data for ASCLl and ASCL 1" tumors were compared. Gene expression analysis used Dataset 2 (Figure 1), which was a compendium of four sets of microarray data with follow up information and more than 22,000 common Affymetrix probesets from 593 AD including 367 stage I AD. Genes (probesets) over-expressed in ASCL1+ compared with ASCLl" tumors were identified by signal to noise ratio (SNR). The top 12 genes (16 probesets) following ASCLl are listed in Table 9. All genes in the list were significantly over- expressed in ASCL1+ tumors after correcting for multiple comparisons (q- value < 10"6) (Storey and Tibshirani, Proc. Natl. Acad. Sci. USA, 100(16):9440-5 (2003)). RET was the fourth most over-expressed gene after ASCLl followed by CALCA and Clorf95 (Table 9). Figure 7A illustrates the expression of RET in ASCLl" and ASCL1+ stage I AD. The over-expression of RET in ASCL1+ tumors was consistent in all four datasets (Figure 7A). RET expression was more consistent with ASCLl than other NE markers (Figure 4). Depending on the microarray signal threshold for calling a transcript present (Log2 signal intensity of 3.5 or 4.5), 91 to 95% of samples that expressed RET also expressed ASCLl . In contrast, only 0% to 55% of samples that expressed RET also expressed CHGA, CHGB, SCG2, SYP, INSM1, PCSK1, or NCAM1. Also noted was a small portion of samples with high levels of RET in the absence of ASCLl (black circles in Figure 7A), indicating that in rare cases RET is expressed independent of ASCLl . Table 9. Probesets (20) with highest signal to noise ratio (SNR) in ASCLl compared with ASCLl" tumors in Dataset 2.
Figure imgf000028_0001
RET expression coinciding with ASCLl was not limited to stage I AD
A similar ASCL1/RET co-expression was observed in all stages of AD and other lung cancer subtypes. Figure 7B illustrates the expression of RET in Dataset 1. In SQCC where ASCLl was largely absent, RET was also rarely expressed. In SCLC, CT, and LCC, RET expression was largely restricted to ASCL1+ tumors.
As in Figure 7A, RET mRNA was detectable in a limited number of lung cancers that did not express ASCLl (black circles in Figure 7B).
Two probesets corresponding to RET were significant in predicting the overall survival (OS) in stage I ASCL1+ tumors by cox analysis (p values of 0.029 and 0.006). High expression of RET was associated with shorter survival. In contrast, an association was not identified between the OS and RET expression level in ASCLl" tumors. For illustration, a threshold for 'low' and 'high' expression of RET in a Kaplan Meir (KM) plot was selected as shown in Figure 8A. The results did not appreciably change after excluding samples where an alternative diagnosis of LCNEC was possible. Using the same threshold, RET mRNA also was significant in predicting OS in all AD (Figure 8B).
RET protein expression analysis by IHC
A select set of Mayo AD samples with expression data by the microarrays were immunostained for RET. RET protein expression by IHC was more prevalent than expected from the microarrays, perhaps due to the sensitivity of antibody to multiple variants of RET. A blush staining was observed in some ASCLl" cases with RET mRNA expression below detection levels by microarrays (Figure 9A). However, ASCL1+ cases from fatal tumors often had intensely stained areas (Figure 9B). There was a significant correlation between RET IHC scores and microarray signal intensity by the RET probeset used in OS analysis (rho = 0.43, p < 0.02). An ASCLl /RET co-IHC assay was developed, and overlapping tumor areas with positive staining for both proteins were frequently found (Figure 9C). However, because of the discrepancies in sensitivity and specificity of RET and ASCLl antibodies or because of ASCLl independent activation of RET, areas with positive RET staining without ASCLl expression also were encountered.
RET protein level by IHC was predictive of OS in the Mayo AD samples, which also were positive for ASCLl by IHC (log-rank test p value = 0.05, Figure 9D). When cases were not stratified by the ASCLl expression, RET IHC was not predictive of OS (Figure 9E). In this situation, median survival times of tumors with 'low' levels of RET was slightly less than tumors with 'high' levels of RET, but this difference was statistically insignificant. These results indicate that RET protein is predictive of OS survival only in the context of ASCLl expression. Gene Set Analysis of ASCL1+ tumors
To gain further insight in the biology of ASCLl + tumors, gene set enrichment analysis was performed by the GSA program and MSigDB version 3 with close to 7000 gene sets. The results are shown in Table 10. Notably, positively and negatively associated gene sets included OSADA ASCLl TARGET S UP and _DN, respectively. These sets contained genes that were up and down regulated by ASCLl in a study of ASCLl -transduced A549 lung AD cells (Osada et al., Cancer Res., 68(6): 1647-55 (2008)). Importantly, RET was among the target genes up regulated by ASCLl in the OSADA ASCL1 TARGETS UP set corroborating the observations in patient data. In the module corresponding to human chromosome and cytogenetic bands, 12q22 and 8p22 were enriched. Ten of 37 genes (including ASCLl) on chrl2q22 and twelve of 41 genes on chr 8p22 were significantly over-expressed in ASCL1+ tumors. The high
concentration of over-expressed genes in these regions suggested potential copy number changes.
Table 10. Gene sets positively and negatively associated with ASCL1+ compared with ASCLl" sta e I tumors.
Figure imgf000030_0001
module 341 90 -0.65
WU CELL MIGRATION 85 -0.74
OSADA ASCL1 TARGETS DN 80 -1.29
KIM LRRC3B TARGETS 80 -1.94
CASTELLANO NRAS TARGETS UP 80 -0.86 mRNA correlates of aggressive behavior in stage I ASCL1 AD also were examined. Tumors from patients who died in less than 3.5 years following surgery (n=21) and from patients who survived more than 6 years following surgery (n = 20) were designated as aggressive and non-aggressive tumors, respectively. When probesets were ranked by SNR in aggressive versus non-aggressive tumors, two probesets for RET were among the list of top 10 probesets. GSA analysis in these tumors identified six gene sets (Table 11). Most notably, KANG-CISPLATIN-RESISTANCE-UP was positively associated with aggressive tumors. This set included genes that were up-regulated in gastric cancer cell lines resistant to cisplatin (Kang et al., Clin. Cancer Res., 10(1 Pt l):272-84 (2004)).
Table 1 1. Gene sets positively and negatively associated with aggressive behavior ASCL1+ sta e I AD.
Figure imgf000031_0001
In summary, the results provided herein demonstrate that lung cancer patients can be examined for the presence of lung cancer cells expressing ASCL1 (e.g., an elevated level ASCL1 ) and RET (e.g., an elevated level RET). If the presence of lung cancer cells expressing ASCL1 and RET is detected in a particular lung cancer patient, then that lung cancer patient can be classified as having lung adenocarcinoma characterized by neuroendocrine differentiation and/or as having a poor survival prognosis. In some cases, lung cancer patients classified as having lung adenocarcinoma characterized by neuroendocrine differentiation can be treated as described herein. Example 2 - Genes over expressed in lung adenocarcinoma
expressing ASCLl and RET
The genes listed in Table 12 were found to be overexpressed in lung
adenocarcinoma samples that express ASCLl and RET. Additional information about each of these ten genes is provided in Table 13. Possible drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation are listed in Table 14, Table 1, Table 2 A, or Table 2B.
Table 12.
Figure imgf000032_0001
Table 13.
Figure imgf000032_0002
Membrane coupled
receptor
FGA 205649_s_at Extracellular other 2243 14161 361969
Space
FGB 204988_at Extracellular other 2244 110135 24366
Space
KIT 20505 l s at Plasma kinase 3815 16590 64030
Membrane
DDC 205311 at Cytoplasm enzyme 1644 13195 24311
TUBB2B 214023 x at Cytoplasm other 347733 73710 291081
CHRNA9 221107 at Plasma transmembrane 55584 231252 65024
Membrane receptor
Table 14.
Figure imgf000033_0001
Figure imgf000034_0001
tu ocurar ne, areco ne, en urane, pancuron um, vecuron um
Example 3 - Methods for confirming effectiveness of drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation
Two cell lines are used to confirm the effectiveness of drugs for treating lung adenocarcinoma characterized by neuroendocrine differentiation. The first is the
HCC1833 cell line, which was derived from lung AD and has high expression levels of ASCLl and RET. The second in the A549 cell line which has low endogenous expression of ASCLl and is stably transfected with ASCLl (A549-As+). A549-As+ captures salient features of ASCLl + lung AD from patients, including increased expression of RET. HCC 1833 are stably transfected with ASCL 1 siRNA to knock down ASCLl and produce a HCC1833-AsKD cell line. Lowering ASCLl expression leads to low levels of RET expression.
Selected drugs such as sunitinib, sorafmib, or others listed in Table 14 are incubated with A549 and A549-As+ cells in vitro and HCC 1833 and HCC1833-AsKD cells in vitro. The cells are treated in culture at various concentrations (e.g., 10 to 100 nM or 2 to 10 μΜ concentrations). The treated cell lines are examined for sensitivity to the selected drugs. Cell viability and apoptosis are assessed using standard assays to compare sensitivity of A549, A549-As+, HCC1833, and HCC1833-AsKD cells to the selected drugs.
In vivo methods are performed as follows. HCC 1833 or A549-As+ cells are transplanted into Nude mice subcutaneously or by IP injections. Tumors are allowed to grow, and the animals are treated to receive daily treatments of a selected drug (e.g., sunitinib and/or sorafmib) given by oral administration at a particular dose (e.g., 30 mg/kg or 60 mg/kg). Tumor growth is evaluated twice-weekly by measurement of tumor volume, and histology of the tumors is assessed at the end of the treatment or after mice become moribund.
The HCC1833 adenocarcinoma cell line expressed high endogenous levels of ASCLl and RET (Figure 13, left). Transfection with shl (a small interfering RNA construct that includes: GCCAACAAGAAGATGAGTAAG (SEQ ID NO: l)) or sh2 (a small interfering RNA construct that includes: CAACCGCGTCAAGTTGGTCAA (SEQ ID NO:2)) reduced ASCLl expression as well as RET expression (Figure 13, left). These results suggest that ASCLl is an upstream regulator of RET. In addition, STAT3 expression (in JAK/STAT3 pathway) went down. Knocking down ASCLl expression also caused reduced cell proliferation (Figure 13, right). Also, HCC1833 cells with reduced ASCLl expression (ASCLl -sh2 cells) exhibited a much slower ability to filling the gap in a scratch assay (Figure 14).
A549 cells expressed little ASCLl and RET, while A549 cells transfected with ASCLl lentivirus (A549-ASCL1 cells or A549-As+ cells) exhibited much more ASCLl expression (Figure 13, center). Importantly, A549-As+ cells also expressed high levels of RET, again suggesting that ASCLl is an up-stream regulator of RET. Also, the A549- As+ cells exhibited increased resistance to cisplatin-induced cytotoxicity (Figure 15). Furthermore, after cisplatin treatment, the remaining clonogenic potential in ASCLl over-expressing cells was higher than in cells that did not express ASCLl . The effects of sunitinib, a tyrosine kinase inhibitor, also were examined. A549-As+ cells were more susceptible to sunitinib than the wild type A549 cells (Figure 16).
Example 4 - Treating lung adenocarcinoma characterized by neuroendocrine
differentiation with brentuximab vedotin
A patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered Brentuximab vedotin at a dose that is between 1.5 and 2.0 mg/kg (1.8 mg/kg) via intravenous infusion over 30 minutes every 3 weeks. Example 5 - Treating lung adenocarcinoma characterized by neuroendocrine differentiation with sucralfate
A patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered sucralfate at a dose of about 1 g (10 mL/2 teaspoonfuls) four times per day.
Example 6 - Treating lung adenocarcinoma characterized by neuroendocrine differentiation with paliperidone
A patient is identified as having lung adenocarcinoma characterized by neuroendocrine differentiation and is administered paliperidone at a dose of 6 to 12 mg daily orally.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:
1. A method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation, wherein said method comprises determining whether or not cancer cells from said mammal contain an elevated level of ASCLl expression and an elevated level of RET expression, wherein the presence of said elevated level of ASCLl expression and the presence of said elevated level of RET expression indicates that said mammal has lung adenocarcinoma characterized by neuroendocrine
differentiation, and wherein the absence of said elevated level of ASCLl expression and the absence of said elevated level of RET expression indicates that said mammal does not have lung adenocarcinoma characterized by neuroendocrine differentiation.
2. The method of claim 1, wherein said mammal is a human.
3. The method of claim 1, wherein said elevated level is determined using PCR.
4. The method of claim 1, wherein said elevated level is determined using immunohistochemistry.
5. A method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation, wherein said method comprises:
(a) determining whether or not a lung cancer cells from said mammal contain an elevated level of ASCLl expression and an elevated level of RET expression,
(b) classifying said mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation if said sample contains said elevated level of ASCLl expression and said elevated level of RET expression, and
(c) classifying said mammal as not having lung adenocarcinoma characterized by neuroendocrine differentiation if said sample lacks said elevated level of ASCLl expression and said elevated level of RET expression.
6. The method of claim 5, wherein said mammal is a human.
7. The method of claim 5, wherein said elevated level is determined using PCR.
8. The method of claim 5, wherein said elevated level is determined using immunohistochemistry.
9. A method for identifying a mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation, wherein said method comprises:
(a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from said mammal, and
(b) classifying said mammal as having lung adenocarcinoma characterized by neuroendocrine differentiation based at least in part on said presence of said elevated level of ASCL1 expression and said elevated level of RET expression.
10. The method of claim 9, wherein said mammal is a human.
11. The method of claim 9, wherein said elevated level is detecting using PCR.
12. The method of claim 9, wherein said elevated level is detecting using
immunohistochemistry.
13. A method for treating lung cancer, wherein said method comprises:
(a) detecting the presence of an elevated level of ASCL1 expression and an elevated level of RET expression in lung cancer cells from a mammal, and
(b) administering a molecule to said mammal under conditions wherein the number of lung cancer cells within said mammal is reduced, wherein said molecule is selected from the group consisting of sunitinib, vandetanib, riluzole, alteplase, anistreplase, tenecteplase, sucralfate, dasatinib, pazopanib, tivozanib, OSI-930, telatinib, tandutinib, imatinib, sorafenib, levodopa, carbidopa, entacapone orion, L-dopa, ABT- 089, mecamylamine, and succinylcholine.
PCT/US2014/022037 2013-03-08 2014-03-07 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation Ceased WO2014138661A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/773,488 US20160018399A1 (en) 2013-03-08 2014-03-07 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation
US15/456,146 US10203330B2 (en) 2013-03-08 2017-03-10 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361775316P 2013-03-08 2013-03-08
US61/775,316 2013-03-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/773,488 A-371-Of-International US20160018399A1 (en) 2013-03-08 2014-03-07 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation
US15/456,146 Continuation US10203330B2 (en) 2013-03-08 2017-03-10 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation

Publications (1)

Publication Number Publication Date
WO2014138661A1 true WO2014138661A1 (en) 2014-09-12

Family

ID=51492020

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/022037 Ceased WO2014138661A1 (en) 2013-03-08 2014-03-07 Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation

Country Status (2)

Country Link
US (2) US20160018399A1 (en)
WO (1) WO2014138661A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019020649A1 (en) * 2017-07-25 2019-01-31 Idp Discovery Pharma, S.L. Anticancer peptides

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023230770A1 (en) * 2022-05-30 2023-12-07 Suzhou Singleron Biotechnologies Co., Ltd. Methods of lung adenocarcinoma treatment with non anti-luad drugs or compounds
CN116452898B (en) * 2023-06-16 2023-10-17 中国人民大学 Lung adenocarcinoma subtype identification method and device based on image histology and deep learning

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110195072A1 (en) * 2006-09-12 2011-08-11 Anne Boulay Non-neuroendocrine cancer therapy
WO2013025952A2 (en) * 2011-08-16 2013-02-21 Oncocyte Corporation Methods and compositions for the treatment and diagnosis of breast cancer

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996006951A1 (en) 1994-08-31 1996-03-07 The Johns Hopkins University School Of Medicine Detection of hypermutable nucleic acid sequence in tissue
JP4357295B2 (en) 2001-08-03 2009-11-04 バーテックス ファーマシューティカルズ インコーポレイテッド Pyrazole-induced kinase inhibitors and uses thereof
AU2002343443A1 (en) 2001-09-28 2003-04-14 Whitehead Institute For Biomedical Research Classification of lung carcinomas using gene expression analysis
EP2295570A1 (en) * 2005-07-27 2011-03-16 Oncotherapy Science, Inc. Method of diagnosing small cell lung cancer
US8133686B2 (en) * 2008-05-15 2012-03-13 Van Andel Research Institute IL-8 as a biomarker for sunitinib resistance
WO2010006432A1 (en) * 2008-07-14 2010-01-21 Queen's University At Kingston Pharmaceutical compositions comprising ret inhibitors and methods for the treatment of cancer
US20110287034A1 (en) 2008-11-14 2011-11-24 The Brigham And Womens Hospital, Inc. Therapeutic and diagnostic methods relating to cancer stem cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110195072A1 (en) * 2006-09-12 2011-08-11 Anne Boulay Non-neuroendocrine cancer therapy
WO2013025952A2 (en) * 2011-08-16 2013-02-21 Oncocyte Corporation Methods and compositions for the treatment and diagnosis of breast cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ENDOH ET AL.: "Prognostic Model of Pulmonary Adenocarcinoma by Expression Profiling of Eight Genes As Determined by Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction.", J CLIN ONCOL., vol. 22, no. 5, 1 March 2004 (2004-03-01), pages 811 - 819, XP002440527, DOI: doi:10.1200/JCO.2004.04.109 *
KUNNIMALAIYAAN ET AL.: "Over Expression of the Notch1 Intracellular Domain (NICD) Inhibits Cellular Proliferation and Alters the Neuroendocrine Phenotype of Medullary Thyroid Cancer Cells.", J. BIOL. CHEM., vol. 281, 7 November 2006 (2006-11-07), pages 1 - 23 *
WESTERMAN ET AL.: "Quantitative Reverse Transcription-Polymerase Chain Reaction Measurement of HASH 1 (ASCL1), a Marker for Small Cell Lung Carcinomas with Neuroendocrine Features", CLIN CANCER RES., vol. 8, 2002, pages 1082 - 1086 *
ZAREBCZAN ET AL.: "Signaling Mechanisms in Neuroendocrine Tumors as Targets for Therapy.", ENDOCRINOL METAB CLIN NORTH AM., vol. 39, no. 4, December 2010 (2010-12-01), pages 801 - 810 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019020649A1 (en) * 2017-07-25 2019-01-31 Idp Discovery Pharma, S.L. Anticancer peptides
CN111263768A (en) * 2017-07-25 2020-06-09 Idp研发制药有限公司 Anticancer peptides
US11440939B2 (en) 2017-07-25 2022-09-13 Idp Discovery Pharma, S.L. Anticancer peptides
CN111263768B (en) * 2017-07-25 2023-10-13 Idp研发制药有限公司 anticancer peptides

Also Published As

Publication number Publication date
US20160018399A1 (en) 2016-01-21
US10203330B2 (en) 2019-02-12
US20170285034A1 (en) 2017-10-05

Similar Documents

Publication Publication Date Title
Wan et al. METTL3/IGF2BP3 axis inhibits tumor immune surveillance by upregulating N6-methyladenosine modification of PD-L1 mRNA in breast cancer
CN109890982B (en) Method for diagnosing and treating cancer by expression status and mutation status of NRF2 and target genes downstream thereof
EP2443252B1 (en) Biomarkers and methods for determining efficacy of anti-egfr antibodies in cancer therapy
Stejerean‐Todoran et al. MCU controls melanoma progression through a redox‐controlled phenotype switch
Xu et al. FKBP9 promotes the malignant behavior of glioblastoma cells and confers resistance to endoplasmic reticulum stress inducers
Takeuchi et al. LAT1 expression in non-small-cell lung carcinomas: analyses by semiquantitative reverse transcription-PCR (237 cases) and immunohistochemistry (295 cases)
US20130059903A1 (en) Compositions and Methods for Characterizing Breast Cancer
JP2013520958A (en) Method of using AXL as a biomarker for epithelial-mesenchymal transition
AU2016270686B2 (en) Quantifying Her2 protein for optimal cancer therapy
Andrejeva et al. Metabolic control of PPAR activity by aldehyde dehydrogenase regulates invasive cell behavior and predicts survival in hepatocellular and renal clear cell carcinoma
KR20160086326A (en) Nucleic acid biomarker and use thereof
KR102216590B1 (en) Composition for treatment and diagnosis of pancreatic neuroendocrine tumors
Zhao et al. Role of GPER1, EGFR and CXCR1 in differentiating between malignant follicular thyroid carcinoma and benign follicular thyroid adenoma
US10203330B2 (en) Methods and materials for identifying and treating mammals having lung adenocarcinoma characterized by neuroendocrine differentiation
AU2016325715B2 (en) Quantifying Met protein for cancer treatment
US20200085802A1 (en) Method for prediction of susceptibility to sorafenib treatment by using sulf2 gene, and composition for treatment of cancer comprising sulf2 inhibitor
US20260110036A1 (en) Marker for prognosis of diffuse type gastric cancer and treatment target
US10942183B2 (en) Methods of detecting progesterone receptor and of detecting an expression level
Zheng et al. PTK6 promotes ferroptosis resistance and CD8+ T cell exhaustion in pancreatic tumors via reprogramming glucose and lipid metabolism
CN110678203A (en) Prediction of therapeutic effect of gastric cancer
Koo et al. Impact of grade, hormone receptor, and HER-2 status in women with breast cancer on response to specific chemotherapeutic agents by in vitro adenosine triphosphate-based chemotherapy response assay
KR102042332B1 (en) TCIRG1 biomarker for diagnosing recurrent and prognosis of liver cancer and use thereof
CN119193829A (en) Application of PRTFDC1 in the treatment and prognostic assessment of testicular germ cell tumors
CN120870556A (en) Application of reagent for detecting ADSL S140 phosphorylation and Beclin 1K 117 dimethyl level in preparation of liver tumor diagnosis and prognosis products
Kim et al. Reduced RNA-binding protein HuD in pancreatic neuroendocrine tumors lowers p27Kip1 levels linked to poor prognosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14761048

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14761048

Country of ref document: EP

Kind code of ref document: A1