WO2014134698A1 - Cpg oligonucleotide formulations and methods and uses thereof - Google Patents
Cpg oligonucleotide formulations and methods and uses thereof Download PDFInfo
- Publication number
- WO2014134698A1 WO2014134698A1 PCT/CA2013/000190 CA2013000190W WO2014134698A1 WO 2014134698 A1 WO2014134698 A1 WO 2014134698A1 CA 2013000190 W CA2013000190 W CA 2013000190W WO 2014134698 A1 WO2014134698 A1 WO 2014134698A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cpg
- composition
- odn
- carbon nanotube
- surfactant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
- A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/28—Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
Definitions
- the disclosure relates to formulations of CpG-oligonucleotides with carbon nanotubes or lipid surfactants.
- the disclosure further relates to methods and uses of the formulations in ovo for promoting innate immunity.
- Neonatal chickens are highly susceptible to diseases since many pathogens enter through mucosal surfaces and the mucosal immune system is not fully mature until several weeks post hatch 1 .
- Escherichia coli causes a variety of disease syndromes in poultry including yolk-sac infection, omphalitis, respiratory tract infection, septicemia, and cellulitis 2 .
- Vaccines are a well-known method to stimulate the immune system for improved disease protection, but they are not available for all disease agents and are not effective when an immediate protective effect is required.
- the vertebral innate immune system identifies pathogen- associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs), inducing immune responses which prevent infections 4 .
- PAMPs pathogen- associated molecular patterns
- PRRs pattern recognition receptors
- Non-vertebral DNA acts as a PAMP which contains comparatively higher amounts of unmethylated cytosine-phosphodiester-guanine (CpG) dinucleotides than vertebral DNA.
- CpG motifs unmethylated CpG dinucleotides
- Toll-like receptor 9 in mammals, which is an intracellular PRR, recognizes these unmethylated CpG motifs and initiates immunostimulatory pathways 5 .
- the context of the unmethylated CpG dinucleotides including specific flanking sequences are responsible for the extent of immune stimulation 6 .
- Synthetic preparations of oligodeoxynucleotides containing CpG motifs (CpG-ODNs) simulating non- vertebral DNA have shown similar immunostimulatory activity 7 . This discovery has shown an important preventive immunotherapeutic treatment option which stimulates the host's immune system.
- CpG-ODNs are being used as vaccine adjuvants due to the ability to activate antigen presenting cells and B cells 13 .
- CpG-ODNs are also used for cancer therapy due to natural killer cell and cytotoxic T cell activation 13 .
- CpG-ODNs are being used for anti-allergic treatments due to the ability to promote Th1 -type immune response and thus suppress Th2-type allergic responses 13 .
- the immunoprotective effect of CpG- ODN against several crucial bacterial diseases such as E. co// 1 1 ,14,15 and Salmonella typhimurium , protozoan diseases like Eimeria 16 and viral diseases such as infectious bursal disease 17 and infectious bronchitis 18 have been demonstrated in chickens.
- CpG-ODNs as immunostimulatory molecules
- cost large doses needed for an effective response
- CpG-ODN recognizing PRR which is located intracellular ⁇ and tough to reach.
- CpG-ODN recognizing PRR which is located intracellular ⁇ and tough to reach.
- Considerations in drug delivery systems have been taken into account to overcome these problems.
- CpG-ODNs used in vivo are rapidly eliminated from the circulation due to adsorption onto serum proteins and degradation by serum nucleases 23 .
- a possible technique for protecting CpG-ODNs from degradation while increasing their uptake by cells of the immune system involves liposome encapsulation 21 or fusion with biphasic lipid vesicles 22 .
- Formulating CpG-ODN with polyphosphazenes showed an enhanced protection of chickens from E. coli infection 24 .
- Carbon nanotubes can be, for example single walled (SWNT) or multi walled (MWNT).
- SWNT single walled
- MWNT multi walled
- CNTs have been investigated as multipurpose carriers for drug delivery and diagnostic applications.
- the organic functionalization of CNTs can significantly improve their solubility and biocompatibility profile; as a result, their manipulation and integration into biological systems has become possible.
- Functionalized CNTs currently hold strong promise as novel systems for the delivery of drugs, antigens and genes 25 .
- Use of carbon nanotubes to enhance uptake of CpG- ODN and increase antiglioma immunity in mice have been reported 19 .
- CNT toxicity is related to properties of the CNT material, such as its structure (for example, SWNT vs. MWNT), length, aspect ratio, surface area, chirality, degree of aggregation, extent of oxidation, surface topology, bound functional group(s), and method of manufacturing (which can, for example leave catalyst residues and/or produce impurities). Toxicity of CNTs is also related to their concentration in a formulation and the dose to which cells or organisms are exposed 30 .
- the present inventors have prepared novel formulations of CpG-ODN with carbon nanotubes and CpG-ODN with lipid surfactants and have demonstrated the delivery and immunostimulatory activity of these novel formulations in chicken embryos.
- the present disclosure provides a composition
- a composition comprising (a) a CpG oligonucleotide noncovalently complexed with a non- functionalized carbon nanotube or (b) a CpG oligonucleotide complexed with a cationic lipid surfactant; and a pharmaceutically acceptable carrier.
- the non-functionalized carbon nanotube of (a) is a single-walled carbon nanotube.
- the non- functionalized carbon nanotube of (a) is a multi-walled carbon nanotube.
- the mean length of the non-functionalized single-walled or multi-walled carbon nanotube of (a) is from about 50 nm to about 5000 nm, optionally, about 100 nm to about 1000 nm.
- the mean diameter of the non-functionalized single- walled carbon nanotube of (a) is from about 0.6 nm to about 2.0 nm, optionally about 1.0 nm.
- the mean diameter of the non-functionalized multi- walled carbon nanotube of (a) is from about 2 nm to 50 nm.
- the CpG oligonucleotide complexed with the cationic lipid surfactant in (b) is further formulated with a lipid phase to form a liposome.
- the lipid phase comprises about 2 wt% of a phospholipid, about 0.2 wt% cholesterol and about 4 wt% propylene glycol.
- the cationic lipid surfactant is a dicationic gemini surfactant having the configuration m-s-m or m-sN-m, for example, the dicationic gemini surfactant has the configuration 12-3-12 or 12- 7N-12.
- the cationic lipid surfactant is at least one dicationic gemini surfactant having a structure of Formula (I):
- each of R 1 and R 2 is the same or different and is independently selected from C3- 40 alkyl, C3_4oalkenyl and C 3 -4 0 alkynyl;
- each of R 3 , R 4 , R 5 and R 6 is the same or different and is independently selected from C h alky!;
- Y is selected from C2-i2alkylene, C3_i 2 alkenylene and -Ci-6alkylene-NR 7 - Ci-6alkylene-, wherein R 7 is H, Ci_ 4 alkyl, C2- 4 alkenyl or C2- 4 alkynyl; and
- each X " is the same or different and is a pharmaceutically acceptable counteranion.
- R 1 and R 2 are both -(CH 2 )iiCH 3 ; each of R 3 , R 4 , R 5 and R 6 is -CH 3 ; Y is -(CH 2 ) 3 - and each X " is the same and is Br " .
- R 1 and R 2 are both -(CH 2 )nCH 3 ; each of R 3 , R 4 , R 5 and R 6 is -CH 3 ; Y is -(CH 2 )3-N(CH3)-(CH 2 )3- and each X " is the same and is Br " .
- the CpG oligonucleotide has a nucleotide sequence selected from TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:1 ), TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO:2),
- the CpG oligonucleotide has the nucleotide sequence 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO: 1 ).
- the CpG oligonucleotide is unmethylated.
- Also disclosed herein is a method of promoting innate immunity in an avian subject comprising administering in ovo to the avian subject a composition of the present disclosure. Further disclosed herein is use of a composition of the present disclosure for promoting innate immunity in an avian subject in need thereof. In another embodiment, the disclosure provides use of a composition of the present disclosure in the preparation of a medicament formulated for in ovo delivery for promoting innate immunity in an avian subject in need thereof. Further provided is a composition of the present disclosure for use in ovo in promoting innate immunity in an avian subject in need thereof.
- the methods and uses of the present disclosure are for treating or preventing a bacterial, protozoan or viral disease or infection.
- the bacteria are E. coli or Salmonella;
- the protozoan disease or infection is Eimeria.
- the viral disease or infection is infectious bursal disease or infectious bronchitis.
- the administration in ovo to the subject embryo is 2 to 3 days prior to hatching.
- the avian subject is a turkey or chicken.
- Figure 1 shows the survival of broiler chickens following E. coli challenge.
- Groups of broiler chicken embryos at day-18 of incubation delivered with CpG-ODN formulated with SWNT # 1 or LSC # 1 , CpG-ODN alone or saline by the in ovo route (n 40 per group).
- Each formulation contains 50pg of CpG-ODN.
- Groups of birds that received CpG-ODN - SWNT # 1 or LSC # 1 -CpG-ODN were significantly protected against E. coli infection compared to the control group (p ⁇ 0.0001 ).
- FIG. 2 shows the cumulative clinical scores (CCS) of broiler chickens following E. coli challenge.
- CCS cumulative clinical scores
- Groups of birds that received 50pg CpG-ODN formulated with of SWNT # 1 - CpG-ODN, or LSC #1-CpG-ODN had a significantly lower CCS compared to the CpG-ODN or saline group.
- Figure 3 shows the bacterial score per each bird according to bacterial growth on blood agar.
- Bacterial swabs were taken from air sacs.
- E. coli colonies were enumerated on sheep blood agar by streaking sequentially in four distinct areas on agar plates. The enumeration was expressed on a scale of 0 to 4+ (0, no growth; 1 +, growth of bacteria on area 1 ; 2+, growth of the bacteria on areas 1 and 2; 3+, growth of bacteria on areas 1 ,2, and 3; 4+, growth of bacteria on areas 1 , 2, 3, and 4).
- Figure 4 shows the survival of broiler chickens following E. coli challenge.
- Each formulation contains 50pg of CpG-ODN.
- FIG. 5 shows cumulative clinical scores (CCS) of broiler chickens following E. coli challenge.
- SWNT#2-CpG 33
- gemini surfactant-CpG-ODN (LSC#2-CpG) 40
- Figure 6 shows E. coli colonies were enumerated on sheep blood agar by streaking sequentially in four distinct areas on agar plates. The enumeration was expressed on a scale of 0 to 4+ (0, no growth; 1 +, growth of bacteria on area 1 ; 2+, growth of the bacteria on areas 1 and 2; 3+, growth of bacteria on areas 1 ,2, and 3; 4+, growth of bacteria on areas 1 , 2, 3, and 4). Heavy bacterial growth was observed more frequently in lesions from birds in the control group than in the groups treated with SWNT#2-CpG-ODN, gemini surfactant-CpG-ODN (LSC#2 CpG-ODN) or CpG-ODN alone by the in ovo route.
- SWNT#2-CpG-ODN gemini surfactant-CpG-ODN
- LSC#2 CpG-ODN gemini surfactant-CpG-ODN
- CpG-ODN alone by the in ovo route.
- the second component as used herein is chemically different from the other components or first component.
- a “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.
- the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
- the foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives.
- the term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
- suitable means that the selection of the particular compound, composition and/or conditions would depend on the specific synthetic manipulation to be performed, and the identity of the molecule(s)/material(s) to be transformed, but the selection would be well within the skill of a person trained in the art. All process/method steps described herein are to be conducted under conditions sufficient to provide the desired product. A person skilled in the art would understand that all conditions, including, for example, solvent, time, temperature, pressure, reactant ratio and whether or not the process/method should be performed under an anhydrous or inert atmosphere, can be varied to optimize the yield and/or properties of the desired product and it is within their skill to do so.
- compositions of the present disclosure refers to a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, for example a non-functionalized single-walled carbon nanotube and a carrier; a CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier; or a CpG oligonucleotide complexed with a cationic lipid surfactant further formulated with a lipid phase to form a liposome and a carrier.
- the carrier is a pharmaceutically acceptable carrier.
- alkyl as used herein means straight or branched chain, saturated alkyl groups.
- Ci_ 3 alkyl means an alkyl group having 1 , 2 or 3 carbon atoms.
- alkenyl as used herein means straight or branched chain, unsaturated alkenyl groups.
- C 2-4 alkenyl means an alkenyl group having 2, 3 or 4 carbon atoms and at least one double bond.
- alkynyl as used herein means straight or branched chain, unsaturated alkynyl groups.
- C 2 - 4 alkynyl means an alkynyl group having 2, 3 or 4 carbon atoms and at least one triple bond.
- alkylene refers to a bivalent alkyl group.
- C 2 -i 2 alkylene means an alkylene group having 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 carbon atoms.
- alkenylene refers to a bivalent alkenyl group.
- C 3 .i 2 alkenylene means an alkenylene group having 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 carbon atoms and at least 1 , for example 1 -4, 1 -3, 1 -2 or 1 double bond(s).
- carbon nanotube refers to an allotrope of carbon comprising a graphene sheet rolled into a cylindrical nanostructure.
- a carbon nanotube may be single-walled, in which case it is referred to herein as a "SWNT” or a “single-walled carbon nanotube” or the like.
- a carbon nanotube may also be multi-walled, in which case it is generally referred to as a "MWNT” or a multi-walled carbon nanotube or the like.
- a carbon nanotube, for example, a SWNT may vary in respect one or more of a number of physical properties such as length, diameter, aspect ratio, surface area, molecular weight, surface topology, the way the graphene sheet is rolled
- a carbon nanotube for example a SWNT can be functionalized; i.e. a surface of the carbon nanotube has been modified with at least one functional group.
- a carbon nanotube, for example a SWNT can also be non-functionalized; i.e. the carbon nanotube surfaces have not been modified.
- a SWNT that has not been functionalized is referred to herein as a "non-functionalized single-walled carbon nanotube".
- a carbon nanotube for example a SWNT may be available from a commercial source (for example, from UnidymTM, Inc. or from Nanolntegris, Inc.) and/or it may be prepared by a suitable synthetic method.
- a commercial source for example, from UnidymTM, Inc. or from Nanolntegris, Inc.
- a number of synthetic routes are known in the art, for example those that use arc discharge, laser ablation, plasma torch or chemical vapor deposition (CVD) techniques and the like.
- CVD chemical vapor deposition
- Samples of non-functionalized carbon nanotubes such as single-walled carbon nanotubes may have a polydisperse distribution in terms of the length and/or diameter of the non-functionalized carbon nanotubes therein.
- length range refers to the range of lengths present in a sample of carbon nanotubes
- diameter range refers to the range of diameters present in a sample of carbon nanotubes.
- mean length refers to the mean length of the carbon nanotubes in a sample of carbon nanotubes
- mean diameter refers to the mean diameter of the carbon nanotubes in a sample of carbon nanotubes.
- mean length and/or mean diameter between different samples of carbon nanotubes such as single-walled carbon nanotubes may differ
- a person skilled in the art would understand that there can be a range of mean lengths and/or diameters that may have utility, for example in the methods and uses herein.
- amphiphilic refers to a compound comprising both hydrophilic (water loving) and lipophilic (fat loving) portions.
- liposome refers to artificially prepared vesicles, the surface of which is a bilayer comprising amphiphilic structures.
- cmc refers to the "critical micelle concentration” which is the concentration of a surfactant, for example a gemini surfactant, above which monomeric surfactants assemble into micelles.
- gemini surfactant refers to an amphiphilic structure also known as a "bis-surfactant” which comprises at least two lipophilic tails and two polar groups linked by a spacer.
- the gemini surfactant has two lipophilic tails and two polar groups linked by a spacer in the sequence: lipophilic tail- polar group-spacer-polar group— lipophilic tail.
- gemini surfactant spacers are known which are, for example, short (e.g. two methylene groups) or long (e.g. 12 methylene groups); rigid (e.g. a 1 ,2-diphenylethylene moiety) or flexible (e.g.
- a methylene chain e.g. a polyether
- polar e.g. a polyether
- nonpolar e.g. an aliphatic or aromatic moiety
- the polar group can be nonionic (for example, a polyether or a sugar), negatively charged (for example, a phosphate, a sulfate or a carboxylate moiety) or positively charged (for example an ammonium moiety).
- Gemini surfactants with two positively charged polar groups are referred to herein as "dicationic gemini surfactants".
- PCT Application Publication No. WO 2010/055416 discloses certain possible variations of the structure of a dicationic gemini surfactant.
- a suitable dicationic gemini surfactant for the compositions of the present disclosure can be made by a person skilled in the art.
- Gemini surfactants having either a symmetrical or an unsymmetrical set of polar groups and/or lipophilic tails are known.
- Gemini surfactants, for example dicationic gemini surfactants may be commercially available and/or they may be prepared by a suitable synthetic method.
- a number of synthetic routes are known in the art, for example as described in F.M. enger & J.S. Keiper, "Gemini Surfactants” Angew. Chem. Int. Ed. 2000, 39, 1906-1920; in D. Shukla & V.K.
- Dicationic gemini surfactants having lipophilic tails comprising alkyl groups, polar groups comprising a dimethyl ammonium moiety, and a spacer comprising an alkylene group may be referred to as having an m-s-m configuration, wherein m is the number of alkyl carbon atoms in the lipophilic tail and s is the number of carbon atoms in the spacer.
- m is the number of alkyl carbon atoms in the lipophilic tail and s is the number of carbon atoms in the spacer.
- 12-3-12 refers to a dicationic gemini surfactant having the following structure:
- X " is a counteranion, for example a pharmaceutically acceptable counteranion.
- X " is Br " .
- a dicationic gemini surfactant having the configuration 12-3-12 can be synthesized using a methodology which is low in cost, and its synthesis can also be scaled up.
- Dicationic gemini surfactants having lipophilic tails comprising alkyl groups, polar groups comprising a dimethyl ammonium moiety, and a spacer comprising an -alkylene-N(CH 3 )-alkylene- group may be referred to as having an m-sN-m configuration, wherein m is the number of alkyl carbon atoms in the lipophilic tail and s is the number of atoms in the main chain of the spacer.
- the term "12-7N-12" as used herein refers to a dicationic gemini surfactant having the following structure:
- X " is a counteranion, for example a pharmaceutically acceptable counteranion.
- X " is Br " .
- pharmaceutically acceptable means compatible with the treatment of subjects, in particular birds.
- counteranion refers to a negatively charged species consisting of a single element, or a negatively charged species consisting of a group of elements connected by ionic and/or covalent bonds.
- the counteranion can be an inorganic counteranion or an organic counteranion.
- the counteranion has a single negative charge.
- the counteranion is a pharmaceutically acceptable counteranion.
- pharmaceutically acceptable counteranion means a counteranion that is suitable for, or compatible with, the treatment of subjects.
- the pharmaceutically acceptable counteranion is CI “ or Br " . It is an embodiment that the pharmaceutically acceptable counteranion is Br " .
- the dicationic gemini surfactants described herein have at least one asymmetric center. Such compounds exist as enantiomers. Where compounds possess more than one asymmetric center, they may exist as diastereomers. It is to be understood that all such isomers and mixtures thereof in any proportion are encompassed within the scope of the present disclosure. It is to be further understood that while the stereochemistry of the compounds may be as shown in any given compound listed herein, such compounds may also contain certain amounts (e.g. less than 20%, suitably less than 10%, more suitably less than 5%) of compounds having alternate stereochemistry. For example, the dicationic gemini surfactants that are shown without any stereochemical designations are understood to be racemic mixtures (i.e.
- treating means an approach for obtaining beneficial or desired results, including clinical results.
- beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e.
- Treating can also mean prolonging survival as compared to expected survival if not receiving treatment.
- Treating and “treatment” as used herein also include prophylactic treatment.
- a subject with an early bacterial infection can be treated to prevent progression, or alternatively a subject in remission can be treated with a composition described herein to prevent recurrence.
- Treatment methods comprise administering to a subject a therapeutically effective amount of one or more of the compositions of the present disclosure, and optionally consists of a single administration, or alternatively comprises a series of administrations.
- the term "effective amount” or “therapeutically effective amount” means an amount effective, at dosages and for periods of time necessary to achieve the desired result.
- an effective amount is an amount that, for example, reduces the bacterial infection in comparison to the bacterial infection without administration of the composition. Effective amounts may vary according to factors such as the disease state, age, sex and/or weight of the subject.
- compositions The amount of a given composition that will correspond to such an amount will vary depending upon various factors, such as the given composition, the pharmaceutical formulation, the route of administration, the type of condition, disease or disorder, the subject being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.
- Compositions :
- the CpG oligonucleotide noncovalently complexed with a non- functionalized carbon nanotube and/or the CpG oligonucleotide complexed with a cationic lipid surfactant are suitably formulated into compositions.
- the present disclosure includes a composition comprising (a) a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube or (b) a CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier.
- the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier.
- the carbon nanotube is a single-walled carbon nanotube.
- CpG oligonucleotide or “CpG-ODN” as used herein refers to single stranded DNA molecules that contain a cytosine followed by a guanine, also called a CG motif, and a phosphodiester backbone or a modified phosphorothioate (PS) backbone.
- the CpG oligonucleotide comprises a phosphorothioate (PS) backbone.
- the CpG oligonucleotide or CpG-ODN is unmethylated. Vertebrate, for example avian immune systems, recognize unmethylated CpG oligonucleotides as foreign.
- the CpG oligonucleotide is at least 6 nucleotides long.
- the CpG-ODN is between 8 and 100 nucleotides in length, optionally 8-40 nucleotides in length.
- the CpG-ODN is at least 20 nucleotides in length, at least 24 nucleotides in length, at least 27 nucleotides in length or at least 30 nucleotides in length.
- the CpG oligonucleotide can be isolated or synthetic in nature. A person skilled in the art would readily be able to isolate or synthesize the CpG oligonucleotides disclosed herein.
- the CpG ODN comprises the following formula: 5'-n n 2 CGn3n4-3' (SEQ ID NO:5), wherein C is unmethylated and ni , n 2 , n 3 and n 4 are nucleotides.
- the CpG ODN may be a non-palindromic or a palindromic sequence.
- ⁇ ⁇ ⁇ 2 are selected from GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and n 3 n 4 are selected from TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA.
- n-in 2 are GpA or GpT and n 3 n 4 are TpT.
- the nin 2 are purines and the n 3 or n 4 are pyrimidines, or nin 2 is GpA and n 3 or n 4 or both are pyrimidines.
- the CpG oligonucleotides are of the formula: (SEQ ID NO:6), wherein ni and n 2 are nucleotides and Ni and N 2 are nucleic acid sequences composed of from about 0-25 nucleotides each.
- ⁇ is A, G or T and n 2 is C, A or T, optionally wherein n-i is C and/or n 2 is G.
- the CpG oligonucleotides are of the formula: 5'-Ninin 2 CGn 3 n 4 N 2 -3' (SEQ ID NO:7), wherein ni , n 2 , n 3 and n 4 are nucleotides and Ni and N 2 are nucleic acid sequences composed of from about 0-25 nucleotides each.
- ni n 2 are selected from GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and n 3 n 4 are selected from TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA.
- n ⁇ 2 are GpA or GpT and n 3 n 4 are TpT.
- the n-i n 2 are purines and the n 3 or n 4 are pyrimidines, or nin 2 is GpA and n 3 or n 4 or both are pyrimidines.
- the Ni and N 2 do not contain a CCGG or CGCT sequence or more than on CCG or CGG trimer.
- the nucleic acid has a phosphodiester backbone or a chimeric backbone, such quadramers or trimmers will only have minimal biological activity.
- the backbone has a primarily phosphorothioate backbone, inclusion of these quadramers and trimmers would be useful for biological activity.
- the CpG oligonucleotides are of the formula: (SEQ ID NO:8).
- Suitable CpG oligonucleotides comprise a nucleotide sequence selected from the group consisting of TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:1 ), TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO:2), TCGTCGTTTGTCGTTTTGTCGTT (SEQ ID NO:3), and ggGGGACGATCGTCggggG (SEQ ID NO:4).
- the lower case letters represent nucleotides linked together by phosphorothioate linkages
- the upper case G's represent nucleotides linked together by phosphodiester linkages.
- CpG oligonucleotides that are suitable for the present formulations are described in WO01/22972, published on April 1 , 2001 and in WO03/03656, published on April 17, 2003.
- the CpG oligonucleotide for use in the present formulations is 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO:1 ).
- isolated refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.
- nucleic acid molecule is intended to include unmodified DNA or RNA or modified DNA or RNA.
- the nucleic acid molecules of the disclosure can be composed of single- and double stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions.
- the nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
- the nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
- Modified bases include, for example, tritiated bases and unusual bases such as inosine.
- a variety of modifications can be made to DNA and RNA; thus “nucleic acid molecule” embraces chemically, enzymatically, or metabolically modified forms.
- polynucleotide shall have a corresponding meaning.
- CpG oligonucleotides are synthetic oligonucleotides and are readily available, for example, from OPERON.
- a nucleic acid molecule of the disclosure may also be chemically synthesized using standard techniques.
- Various methods of chemically synthesizing polydeoxynucleotides are known, including solid- phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S. Patent Nos. 4,401 ,796 and 4,373,071 ).
- An isolated nucleic acid molecule of the disclosure which comprises DNA can be isolated by preparing a labelled nucleic acid probe based on all or part of the nucleic acid sequences and using this labelled nucleic acid probe to screen an appropriate DNA library.
- the composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, such as a single-walled carbon nanotube, and a carrier can be prepared by adding a solution comprising a CpG oligonucleotide to non-functionalized carbon nanotubes under conditions to form the composition.
- the particular conditions for example, the relative concentrations of the CpG oligonucleotide to the non-functionalized carbon nanotubes, the time and the temperature can vary depending, for example, on the particular CpG oligonucleotide and/or the particular non-functionalized carbon nanotube used but can be determined by a person skilled in the art.
- a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, such as a single-walled carbon nanotube, would be a substantially uniformly black solution without any appreciable evidence of sedimentation.
- a concentration of the CpG oligonucleotide in comparison to the non- functionalized carbon nanotube the composition would not be fully monodisperse and sedimentation would be observed even after, for example an extended time of sonication.
- Increasing the temperature and/or the intensity of sonication may, in certain cases be used to prepare a monodisperse composition where the concentration of the CpG oligonucleotide in comparison to the non-functionalized carbon nanotube was initially too low to prepare a monodisperse composition.
- the composition would be monodisperse (i.e. the non-functionalized carbon nanotubes therein would have a CpG oligonucleotide noncovalently complexed) but there would also be free CpG oligonucleotide in the composition.
- Such compositions would have utility in the methods and uses of the present disclosure, but, for example may be wasteful as they contain excess CpG oligonucleotide that is not complexed.
- an about 0.5 mg/mL solution of CpG-ODN in sterile water can be added to a non-functionalized single-walled carbon nanotube powder (for example, 0.1 mg HiPco SWNTs per mL of CpG-ODN solution or 0.1 mg Puretubes SWNTs per mL of CpG-ODN solution) in a suitable vessel, for example a glass vial, and sonicating, for example bath sonicating at low shear the resulting suspension for a time and at a temperature that allows for the formation of a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized single- walled carbon nanotube, for example for about 5 hours at a temperature not exceeding about 40 °C to prepare a composition comprising about 10 pg non- functionalized single-walled carbon nanotubes and about 50 pg CpG oligonucleotide, for example CpG-ODN per about 100
- the compositions comprise a ratio by weight of the CpG oligonucleotide, for example CpG-ODN to the non-functionalized carbon nanotube such as a single-walled carbon nanotube of about 4:1 , about 5:1 , about 6: 1 , about 7:1 , about 8:1 , about 9: 1 , about 10: 1 , about 1 1 :1 , about 12:1 , about 13: 1 , about 14:1 , about 15:1 , about 16: 1 , about 17: 1 , about 18: 1 , about 19:1 , about 20: 1 , about 25:1 , about 30: 1 , about 35: 1 , about 40: 1 , about 45: 1 or about 50: 1.
- the CpG oligonucleotide for example CpG-ODN
- the non-functionalized carbon nanotube such as a single-walled carbon nanotube of about 4:1 , about 5:1 , about 6: 1 , about 7:1 , about
- the compositions comprise a ratio by weight of CpG-ODN to the non- functionalized single-walled carbon nanotube of about 5: 1 , about 7.5:1 or about 10: 1. It is an embodiment that the compositions comprise a ratio by weight of CpG-ODN to the non-functionalized single-walled carbon nanotube of about 5:1 , for example, the composition of the present disclosure comprises about 50 pg CpG oligonucleotide, for example CpG-ODN and about 10 pg non-functionalized single-walled carbon nanotubes in a pharmaceutically acceptable carrier.
- the composition comprising the CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier can be prepared by adding a solution comprising a CpG oligonucleotide to a cationic lipid surfactant, for example a dicationic gemini surfactant under conditions to form the composition.
- a solution comprising a CpG oligonucleotide to a cationic lipid surfactant for example a dicationic gemini surfactant under conditions to form the composition.
- the particular conditions for example the relative concentrations of the CpG oligonucleotide to the cationic lipid surfactant, the time and the temperature can vary depending, for example, on the particular CpG oligonucleotide and/or the particular cationic lipid surfactant used but can be determined by a person skilled in the art.
- a person skilled in the art would understand that there must be an excess of the cationic lipid surfactant, for example, the dicationic gemini surfactant in comparison to the CpG oligonucleotide so that the negative charges on the CpG oligonucleotide are neutralized by the cationic lipid surfactant, for example, the dicationic gemini surfactant, and there is a further excess of the cationic lipid surfactant, for example, the dicationic gemini surfactant, so that the final complex between the CpG oligonucleotide and the cationic lipid surfactant is positively charged.
- the cationic lipid surfactant for example, the dicationic gemini surfactant in comparison to the CpG oligonucleotide so that the negative charges on the CpG oligonucleotide are neutralized by the cationic lipid surfactant, for example, the dicationic gemini surfactant, and there is a further excess of the
- an about 0.5 mg/mL solution of CpG-ODN in sterile water can be added to 1.1 mg of a dicationic gemini surfactant such as 12-7N-12 per ml.
- a suitable vessel for example a glass vial to give a composition having a concentration of CpG-ODN of about 0.5 mg/mL and a concentration of the dicationic gemini surfactant such as 12- 7N-12 of about 1.1 mg/mL.
- compositions comprise a cationic lipid, for example, a dicationic gemini surfactant and a CpG oligonucleotide, for example CpG-ODN in a charge ratio of about 40:1, about 37.5:1, about 35:1, about 32.5:1, about 30:1, about 27.5:1, about 25:1, about 22.5:1, about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1 or about 2.5:1.
- a cationic lipid for example, a dicationic gemini surfactant and a CpG oligonucleotide, for example CpG-ODN in a charge ratio of about 40:1, about 37.5:1, about 35:1, about 32.5:1, about 30:1, about 27.5:1, about 25:1, about 22.5:1, about 20:1,
- compositions comprise a dicationic gemini surfactant, for example 12-7N-12 and CpG-ODN in a charge ratio of about 2.5:1 , for example, the composition comprises about 1.1 mg/mL of 12-7N-12 and about 0.5 mg/mL CpG-ODN in a pharmaceutically acceptable carrier.
- a dicationic gemini surfactant for example 12-7N-12 and CpG-ODN in a charge ratio of about 2.5:1
- the composition comprises about 1.1 mg/mL of 12-7N-12 and about 0.5 mg/mL CpG-ODN in a pharmaceutically acceptable carrier.
- compositions comprise a cationic lipid, for example, a dicationic gemini surfactant such as 12-3-12 at a percentage of about 0.1% (w/v) to about 0.5% (w/v) or about 0.125% (w/v) and a CpG oligonucleotide, for example CpG-ODN at a concentration of about 0.4 mg/mL to about 1.0 mg/mL or about 0.5 mg/mL.
- a cationic lipid for example, a dicationic gemini surfactant such as 12-3-12 at a percentage of about 0.1% (w/v) to about 0.5% (w/v) or about 0.125% (w/v) and a CpG oligonucleotide, for example CpG-ODN at a concentration of about 0.4 mg/mL to about 1.0 mg/mL or about 0.5 mg/mL.
- the composition comprising the CpG oligonucleotide complexed with the cationic lipid surfactant and a carrier can be further formulated with a lipid phase to form a composition comprising a liposome.
- the composition comprising the CpG oligonucleotide complexed with the cationic lipid surfactant and a carrier can be added to a lipid phase under conditions to form the composition comprising a liposome.
- the lipid phase comprises a phospholipid, for example a phosphatidylcholine such as PhospholiponTM 90H or a similar lipid, and optionally cholesterol and/or a hydrophilic solvent other than water, for example a glycol, such as propylene glycol or butylene glycol or a polyol such as glycerol or mixtures thereof.
- a phospholipid for example a phosphatidylcholine such as PhospholiponTM 90H or a similar lipid
- cholesterol and/or a hydrophilic solvent other than water for example a glycol, such as propylene glycol or butylene glycol or a polyol such as glycerol or mixtures thereof.
- the phospholipid is a pharmaceutical grade phospholipid.
- cholesterol can be used to put the lipid bilayer of the liposome into a liquid crystalline intermediate phase, thus lowering the transition temperature of the lipid bilayer and making the liposome more flexible so that it can, for example, be taken up more easily by a cell.
- the transition temperature of the lipid bilayer can be lowered so that it is closer to body temperature (about 37 °C).
- the hydrophilic solvent other than water can be added to assist in the manufacturing process.
- the composition comprising the CpG oligonucleotide, for example CpG-ODN complexed with the cationic lipid surfactant, for example a dicationic gemini surfactant such as 12-7N-12 and a carrier such as sterile water, the composition having a concentration of CpG- ODN of about 0.5 mg/mL and a concentration of the 12-7N-12 of about 1.1 mg/mL can be warmed, for example to about 40 °C and added to a lipid phase comprising, for example about 2 wt% Phospholipon 90H, about 0.2 wt% cholesterol and about 4 wt% propylene glycol which has been melted, for example at about 70 °C in, for example, a water bath to give a substantially clear liquid, and the resulting mixture mixed, for example by intermittent vortexing/heating until a substantially homogeneous formulation is formed, then sonicating, for example using a cup-horn Sonicator 4000 on ampli
- the compositions further formulated with the lipid phase to form the composition of the present disclosure comprising a liposome have a lipid phase comprising about 1 wt% to about 5 wt% or about 2 wt% of a phospholipid such as Phospholipon 90H or a similar lipid, about 0 wt% to about 0.5 wt% or about 0.2 wt% of cholesterol and about 0 wt% to about 10 wt% or about 4 wt% of a hydrophilic solvent other than water for example a glycol, such as propylene glycol or butylene glycol or a polyol such as glycerol or mixtures thereof. It is an embodiment that the lipid phase comprises about 2 wt% Phospholipon 90H, about 0.2 wt% cholesterol and about 4 wt% propylene glycol.
- the non- functionalized single-walled or multi-walled carbon nanotube has a length range of about 50 nm to about 5000 nm, about 100 nm to about 4000 nm, about 65 nm to about 2000 nm, about 80 nm to about 1500 nm or about 100 nm to about 1000 nm.
- the non-functionalized single- walled carbon nanotube has a length range of about 100 nm to about 4000 nm.
- the non-functionalized single-walled carbon nanotube has a length range of about 65 nm to about 2000 nm, about 80 nm to about 1500 nm or about 100 nm to about 1000 nm. It is an embodiment of the present disclosure that the non-functionalized single-walled carbon nanotube has a length range of about 100 nm to about 1000 nm.
- the non-functionalized single-walled or multi-walled carbon nanotube has a mean length of about 50 nm to about 5000 nm, about 250 nm to about 2500 nm, about 500 nm to about 1500 nm, about 100 nm to about 1000 nm or about 1000 nm. It is an embodiment that the non-functionalized single-walled or multi-walled carbon nanotube has a mean length of about 100 nm to about 1000 nm.
- the non- functionalized single-walled carbon nanotube has a diameter range of about 0.6 nm to about 2.0 nm, about 0.65 nm to about 1.5 nm, about 0.7 nm to about 1.3 nm, about 0.8 nm to about 1 .2 nm or about 1.2 nm to about 1.7 nm.
- the non-functionalized single-walled carbon nanotube has a diameter range of about 0.65 nm to about 1.5 nm, about 0.7 nm to about 1 .3 nm or about 0.8 nm to about 1 .2 nm.
- the non-functionalized single-walled carbon nanotube has a diameter range of about 1.2 nm to about 1.7 nm. It is an embodiment of the present disclosure that the non-functionalized single-walled carbon nanotube has a diameter range of about 0.8 nm to about 1 .2 nm.
- the non- functionalized multi-walled carbon nanotube has a diameter range of about 2 nm to about 50 nm.
- the non- functionalized single-walled carbon nanotube has a mean diameter of about 0.6 nm to about 2 nm, about 0.65 to about 1.4 nm, about 0.7 to about 1.3 nm, about 0.8 nm to about 1.2 nm, about 1 .2 nm to about 1 .6 nm, about 1 .0 nm or about 1.4 nm.
- the non-functionalized single-walled carbon nanotube has a mean diameter of about 0.65 to about 1 .4 nm, about 0.7 to about 1 .3 nm, about 0.8 nm to about 1 .2 nm or about 1.0 nm.
- the non-functionalized single-walled carbon nanotube has a mean diameter of about 0.8 nm to about 1.2 nm or about 1.0 nm. It is an embodiment that the non-functionalized single-walled carbon nanotube has a mean diameter of about 1 .0 nm. In another embodiment of the present disclosure, the non-functionalized single-walled carbon nanotube has a mean diameter of about 1.4 nm.
- the non- functionalized multi-walled carbon nanotube has a mean diameter of about 2 nm to about 50 nm.
- the non-functionalized single-walled carbon nanotube is a PureTubesTM carbon nanotube from Nanolntegris having a length range of about 100 nm to about 4000 nm, a mean length of about 1000 nm, a diameter range of about 1 .2 nm to about 1 .7 nm and a mean diameter of about 1.4 nm.
- the non-functionalized single-walled carbon nanotube is a HiPcoTM carbon nanotube from Unidym having a length range of about 100 to about 1000 nm, a diameter range of about 0.8 nm to about 1.2 nm and a mean diameter of about .0 nm.
- the cationic lipid surfactant is a dicationic gemini surfactant having, for example, a low cmc. It is an embodiment that the cationic lipid surfactant is at least one dicationic gemini surfactant havin a structure of Formula (I):
- each of R 1 and R 2 is the same or different and is independently selected from C3-4oalkyl, C3- 4 oalkenyl and C 3 -4oalkynyl;
- each of R 3 , R 4 , R 5 and R 6 is the same or different and is independently selected from d ⁇ alkyl;
- Y is selected from C2-i 2 alkylene, C 3- i2alkenylene and -Ci -6 alkylene-NR 7 - Ci -6 alkylene-, wherein R 7 is H, Ci_ 4 alkyl, C2 -4 alkenyl or C2- 4 alkynyl; and
- each X " is the same or different and is a counteranion.
- each of R 1 and R 2 is the same or different and is independently selected from C 5-2 oalkyl, C5- 20 alkenyl and C 5 _ 2 oalkynyl. In another embodiment, each of R 1 and R 2 is the same or different and is independently selected from C 5-2 oalkyl. In a further embodiment, R and R 2 are the same and are selected from Cs ⁇ oalkyl. It is an embodiment that R and R 2 are both -(CH 2 )ii CH3. [0099] In another embodiment, each of R 3 , R 4 , R 5 and R 6 is the same or different and is independently selected from Ci_ 2 alkyl. It is an embodiment that each of R 3 , R 4 , R 5 and R 6 is -CH 3 .
- Y is selected from C 2- i 2 alkylene and -Ci_ 6 alkylene-NR 7 -C 1-6 alkylene-, wherein R 7 is H or Ci ⁇ alkyl.
- Y is C 2 -i2alkylene. It is an embodiment that Y is -(CH 2 )3-.
- Y is -Ci_6alkylene-NR 7 -Ci-6alkylene- wherein R 7 is d- 4 alkyl. It is an embodiment that Y is -(CH 2 )3-N(CH 3 )-(CH 2 ) 3 -.
- R 7 is H, i.e. Y is -(CH 2 )3-N(H)-(CH 2 )3- the N-H moiety of the spacer can be protonated in use.
- each X " is the same or different and is a pharmaceutically acceptable counteranion. In another embodiment, each X " is the same and is selected from the group consisting of Br " and CI " . It is an embodiment that each X " is the same and is Br " .
- the dicationic gemini surfactant has the configuration m-s-m, wherein m is an integer from 3 to 40 and s is an integer from 2 to 16. In another embodiment, m is an integer from 5 to 20. In a further embodiment, s is an integer from 2 to 12. It is an embodiment that m is 12. In another embodiment, s is an integer from 2 to 8. It is an embodiment that s is 3. In an embodiment, the dicationic gemini surfactant has the configuration 12-2-12, 12-3-12, 12-7-12, 12-16-12, 16-3-16 or 18-3-18. In another embodiment, the dicationic gemini surfactant has the configuration 12-3-12.
- the dicationic gemini surfactant has the configuration m-sN-m, wherein m is an integer from 3 to 40 and s is an integer from 2 to 12. In another embodiment, m is an integer from 5 to 20. It is an embodiment that m is 12. In another embodiment, s is an integer from 5 to 10. It is an embodiment that s is 7. In an embodiment, the dicationic gemini surfactant has the configuration 12-7N- 2.
- the lipid phase comprises a phospholipid.
- the phospholipid is a phosphatidylcholine such as Phospholipon 90H or a similar lipid.
- the lipid phase further comprises cholesterol.
- the lipid phase further comprises a hydrophilic solvent other than water. It is an embodiment that the hydrophilic solvent other than water is a glycerol or a polyol or mixtures thereof.
- the glycol is propylene glycol or butylene glycol.
- the glycol is propylene glycol.
- the polyol is glycerol. It is an embodiment that the lipid phase comprises a phospholipid, cholesterol and propylene glycol.
- compositions disclosed herein are useful for promoting innate immunity in a subject.
- the compositions are useful for in ovo delivery to an avian embryo for promoting innate immunity to prevent and/or treatment infection.
- the present disclosure provides a method of promoting innate immunity in an avian subject in need thereof comprising administering in ovo a composition disclosed herein to the animal in need thereof. Also provided is use of a composition disclosed herein for promoting innate immunity in ovo in an avian subject in need thereof. Further provided is use of a composition disclosed herein in the preparation of a medicament formulated for in ovo delivery for promoting innate immunity in an avian subject in need thereof. Even further provided is a composition disclosed herein for use in promoting innate immunity in ovo in an avian subject in need thereof.
- promoting innate immunity refers to promoting immunity that is not antigen specific and involves phagocytosis, cytokine release and cytolytic functions. In one embodiment, promoting innate immunity is effective at preventing, reducing or eliminating a microbial infection. Promoting innate immunity includes, without limitation, increasing interferon-gamma production and increasing natural killer cell activity. [00108] In an embodiment, the methods and uses disclosed herein are used for treating or preventing an infection, including without limitation, a bacterial infection, such as an E. coli infection or a Salmonella infection, a viral infection, such as infectious bursal disease or infectious bronchitis, or a protozoan infection, such as Eimeria.
- an infection including without limitation, a bacterial infection, such as an E. coli infection or a Salmonella infection, a viral infection, such as infectious bursal disease or infectious bronchitis, or a protozoan infection, such as Eimeria.
- avian subject refers to all avian species.
- the bird is poultry such as a fowl (for example, a chicken, a turkey or a quail), a waterfowl (for example, a domestic duck or a domestic goose), a pigeon, a dove or a pheasant. It is an embodiment that the bird is a chicken or a turkey.
- the formulation is delivered to an egg at an embryonic stage of development of the avian subject.
- compositions of the present disclosure may be administered to a subject in a variety of forms as will be understood by those skilled in the art.
- the in ovo administration is at 2 to 3 days before hatching of a subject avian species.
- the in ovo administration is at 17 to 19 days, for example at 18 days of incubation of the chicken embryo.
- in ovo delivery was conducted by administering 100 ⁇ volume by the in ovo route into the amniotic cavity through the air cell of the egg using a 20 gauge, 1 inch needle.
- compositions of the present disclosure may be used alone or in combination with other known agents useful for promoting innate immunity in a subject. When used in combination with other agents useful for promoting innate immunity in a subject, it is an embodiment that the compositions of the present disclosure are administered contemporaneously with those agents.
- “contemporaneous administration" of two substances to a subject means providing each of the two substances so that they are both biologically active in the individual at the same time.
- the exact details of the administration will depend on the pharmacokinetics of the two substances in the presence of each other, and can include administering the two substances within a few hours of each other, or even administering one substance within 24 hours of administration of the other, if the pharmacokinetics are suitable. Design of suitable dosing regimens is routine for one skilled in the art.
- two substances will be administered substantially simultaneously, i.e., within minutes of each other, or in a single composition that contains both substances. It is a further embodiment of the present disclosure that the composition of the present disclosure and the other agent(s) is administered to a subject in a non-contemporaneous fashion.
- compositions of the present disclosure can vary depending on many factors such as the pharmacodynamic properties of the composition, the mode of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the frequency of the treatment and the type of concurrent treatment, if any, and the clearance rate of the composition in the subject to be treated.
- One of skill in the art can determine the appropriate dosage based on, for example the above factors.
- Compositions of the present disclosure may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response, and may be administered in a single daily dose or the total daily dose may be divided into two, three or four daily doses.
- in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about 1 .0 ⁇ , about 5.0 ⁇ , about 10.0 ⁇ , about 20.0 ⁇ , about 25.0 ⁇ , about 30.0 ⁇ , about 40.0 ⁇ , about 50.0 ⁇ , about 60.0 ⁇ , about 70.0 ⁇ , about 75.0 ⁇ , about 80.0 ⁇ , about 85.0 ⁇ , about 90.0 ⁇ , about 95.0 ⁇ , about 100.0 ⁇ , about 105.0 ⁇ , about 1 10.0 ⁇ , about 1 15.0 ⁇ , about 120.0 ⁇ , about 125.0 ⁇ , about 150 ⁇ , about 200 ⁇ , about 250 ⁇ , about 300 ⁇ , about 350 ⁇ , about 400 ⁇ , about 450 ⁇ , about 500 ⁇ , about 550 ⁇ , about 600 ⁇ , about 650 ⁇ , about 700 ⁇ , about 750 ⁇ , about 800 ⁇ , about 850 ⁇ , about 900 ⁇ , about 950 ⁇ or
- in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about 50 ⁇ to about 150 ⁇ , about 75 ⁇ to about 125 ⁇ , about 90 ⁇ to about 1 10 ⁇ or about 100 ⁇ . In a further embodiment, in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about 00 ⁇ .
- Treatment or prevention methods comprise administering to a subject, a therapeutically effective amount of one or more of the compositions of the present disclosure, and optionally consists of a single administration, or alternatively comprises a series of administrations.
- the one or more compositions of the present disclosure are administered in a single administration any time prior to or following the onset of the disease, disorder or condition.
- the one or more compositions of the present disclosure are administered immediately prior to the onset of the disease, disorder or condition or about 24 hours prior to the onset of the disease, disorder or condition, or any time in between.
- compositions of the present disclosure are administered immediately following the onset of the disease, disorder or condition or about 48 hours following the onset of the disease, disorder or condition, or any time in between, for example about 1 minute, about 10 minutes, about 30 minutes, about 1 hour, about 5 hours, about 10 hours, about 20 hours, about 24 hours, about 30 hours or about 36 hours, following the onset of the disease, disorder or condition.
- compositions may be administered to the subject in a series of administrations, for example about
- the compositions are administered to the subject in an amount and for a duration sufficient to treat the subject.
- E. coli A field isolate of E. coli from a turkey with septicemia, was used as the challenge strain.
- This E. coli was serogroup 02, nonhemolytic, serum- resistant, produced aerobactin, a K1 capsule and Type 1 pili.
- Aliquots of bacteria were stored at -70 °C in 50% brain-heart infusion broth (BHI; Difco, Detroit, Ml) supplemented with 25% (w/v) glycerol (VWR Scientific, Inc., Montreal, Quebec).
- Bacteria for use as the challenge were cultured on sheep blood agar plates for 24 hours at 37 °C. One colony was added to 100 ml of Luria broth in a 250ml Erienmeyer flask.
- the culture was grown at 37 °C for 16 - 18 hours with shaking at 150 rpm.
- Stationary phase culture contained approximately 1 * 10 9 colony forming units (CFUs) of bacteria per milliliter.
- CFUs colony forming units
- the cultures were further diluted in sterile saline to the concentration of bacteria required for challenge (1 10 5 or 1 *10 4 CFU/ bird).
- Viable bacterial counts were determined by plating serial dilutions of the diluted culture on sheep blood agar plates, incubating for 24 hours at 37 °C then counting the number of colonies.
- E. coli septicemia with airsacculitis, pericarditis, or perihepatitis develops in 60%-90% of birds that are not protected by treatment intervention.
- Two doses of E. coli were given to groups of birds to simulate field conditions since all birds in a commercial poultry barn will not be exposed to a constant dose of E. coli. Birds were evaluated three times daily at the critical stage then twice thereafter for 7 days post challenge.
- CpG ODN used was 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO:1 ). ODNs were produced with a phosphorothioate backbone. This synthetic CpG-ODN is available through a commercial source, for example Eurofins MWG Operon, Huntsville, Alabama, USA. CpG-ODN formulations were prepared either with SWNTs or lipid surfactant composites (LSC) at the School of Pharmacy, University of Waterloo, Canada.
- LSC lipid surfactant composites
- Synthetic CpG-ODN was diluted in sterile, pyrogen-free saline or formulation substrates and administered in a 100 ⁇ volume by either the in ovo route into the amniotic cavity through the air cell of the egg using a 20 gauge, 1 inch needle,.
- the volume of the injection and the length of the needle were selected to simulate the in ovo technology used in the poultry industry.
- CNT formulations
- SWNT#1 CpG-ODN was prepared using 0.1 mg/mL HiPco SWNTs (Unidym, Inc., Sunnyvale, CA) and 0.5 mg/mL CpG-ODN aqueous solution (quantum satis with sterile water).
- SWNT#2 CpG-ODN contained 0.1 mg/mL Puretubes SWNTs (Nanolntegris, Inc., Menlo Park, CA; supplied as a powder) and 0.5 mg/mL CpG-ODN aqueous solution (quantum satis with sterile water).
- Both of the above CNT formulations were prepared by weighing out the required amount of the SWNT powder, adding the required amount of the CpG-ODN aqueous solution to the SWNT powder in a glass vial, and then bath sonicating the mixture for 5 h at temperatures not exceeding 40 °C.
- Final doses contained 10 pg SWNT and 50 ⁇ g CpG-ODN per 100 pi.
- LSC-CpG-ODN formulations were made up of two phases: an aqueous phase (AP; 1.1 mg/mL gemini surfactant 12-7N-12 [synthesized in house according to Wettig et al.
- CpG- ODN formulated with SWNTs or LSC enhanced the immunoprotective effects in neonatal birds.
- Day 18 old embryonated eggs were injected with 50 pg of CpG-ODN formulated with SWNT (SWNT#1 CpG-ODN), LSC-CpG-ODN (LSC#1 ), unformulated CpG-ODN or saline.
- SWNT#1 CpG-ODN SWNT#1 CpG-ODN
- LSC#1 LSC-CpG-ODN
- saline unformulated CpG-ODN or saline.
- Each of four groups of embryonating eggs received 100 ⁇ of formulation or saline by the in ovo route in the amniotic cavity through the air cell using 21 gauge needles with 1 inch length. Forty birds were randomly allocated into each of four groups.
- Groups of birds were inoculated on day 1 of age or 24 h following post-hatch with 1 *10 5 or 1 *10 4 CFU of stationary phase E. coli by the subcutaneous route in the neck.
- Birds were examined daily for 7 days for clinical signs following E. coli challenge. Bacterial isolations from air sacs were conducted in all dead and euthanized birds during the clinical evaluation period, and at the termination of the experiment.
- the third objective of these experiments was to study the safety and toxicity of these CpG-ODN formulations in neonatal broiler chickens until 9 days post-hatch. This experiment was conducted in parallel to the above experiments.
- Tissue sections were collected from the gastrointestinal tract (crop, esophagus, proventriculus, gizzard, duodenum, jejunum, ileum, ceca), kidneys, lungs, trachea and lymphoid organs (spleen, bursa, thymus) at 19, 20 and 21 days of incubation and at 3, 6 and 9 days post-hatch for histopathology. At each time point, three embryonated eggs or birds were randomly selected and euthanized for sample collection. Tissue sections were fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned at 5pm thickness and stained with hematoxylin and eosin (H&E).
- H&E hematoxylin and eosin
- Protective immunotherapeutic treatments have been a topic of great interest as a method to fight infectious disease because of their ability to stimulate the host's immune system and prepare the host to fight pathogenic microbes.
- disease prevention by prophylactic measures or by immune stimulation is preferred compared to the use of therapeutic agents which may lead to concern about residues in edible products. This has become especially important due to a number of food safety and human health issues.
- the use of antibiotics in the animal industry has been related to the emergence of resistant strains of bacteria and the possibility of drug residues in meat products. For these reasons, novel immunostimulants may serve as alternative, desirable ways to prevent disease.
- CpG-ODN has been used as an immuno stimulant in many species, including chickens 8" 1 , 26 .
- CpG-ODN is an effective immunostimulant in chickens and appeared to have its effectiveness for 6 days 1 1 following administration. Moreover, the present inventors were able to increase effectiveness of CpG-ODN by formulating with polyphosphazenes 24 . In the present study, the present inventors demonstrated a significant health promoting effect of CpG-ODN formulated with CNT or LSC. CpG-ODN formulations significantly increase survival, reduce clinical signs and decrease the bacterial load in birds challenged with a lethal dose of E. coli.
- E. coli or Salmonella septicemia is common in the neonatal period of broiler chickens and causes a significant mortality and production loss 12 . Furthermore, if broiler flocks experience mortality greater than 2% in the first week of life, the overall performance of the flock becomes very poor due to chronic infections, poor weight gain and uneven birds in the flock 27 . It is essential to have good health during the first week of broiler chicken growth as it will provide better performance and profitability 1 . Currently in the broiler chicken industry, broiler chickens reach 2 kilograms body weight by 30-35 days post-hatch 28 . Thus, in ovo delivery of CpG-ODN formulations either with CNT or lipid formulations will provide effective immunostimulation and likely be a better alternative to antibiotics.
- CpG-ODN formulations are industry feasible.
- the present inventors have previously demonstrated that in ovo delivery of unformulated CpG-ODN are very effective against E.coli infection 1 1 or Salmonella 12 septicemia in neonatal broilers and here have demonstrated a significant synergy or potentiation of CpG-ODN with CNT or lipid delivery systems as an immunostimulant in chicken embryos.
- CpG-ODN formulations significantly reduce the bacterial load in birds infected with E. coli becoming a significant consideration if CpG-ODNs are able to reduce bacterial load in birds in field.
- E. coli cannot be used to validate this possibility since the animal model causes very high (between 60-80%) mortality following challenge.
- Broiler chicken embryos are a well suited model to study toxicity of CNT.
- all organs can be studied for histopathology to identify any morphological changes.
- the present inventors did not see embryo mortality, decreased hatchability, clinical signs or any evidence of alteration of morphology of any internal organs that were studied during day-18 of incubation until day-9 post-hatch.
- lipid based delivery systems have proven to be safe and effective for delivering CpG ODN in many
- CpG-ODN formulated with CNT or lipid surfactants was observed to synergistically enhance the immunoprotective efficiency against E. coli infections in neonatal broiler chickens.
- CpG-ODN formulations with CNT did not have adverse reactions in chicken embryos or neonatal broiler chickens. This is the first demonstration of in ovo delivery of CpG-ODN formulated with CNT or lipid-surfactant delivery systems against a lethal bacterial infection in broiler chickens.
- Table 1 Bacterial score per each bird according to bacterial growth on blood agar. Bacterial swabs were taken from air sacs.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Biochemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Dermatology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Dispersion Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present disclosure relates to formulations of CpG oligonucleotides with carbon nanotubes or lipid surfactants. Also disclosed are methods of promoting innate immunity in an avian subject comprising administering in ovo the formulations.
Description
TITLE: CPG OLIGONUCLEOTIDE FORMULATIONS AND METHODS AND
USES THEREOF
FIELD
[0001] The disclosure relates to formulations of CpG-oligonucleotides with carbon nanotubes or lipid surfactants. The disclosure further relates to methods and uses of the formulations in ovo for promoting innate immunity.
BACKGROUND
[0002] An increasing emergence of diseases in animals, mainly food animal species, has focused attention on immune-based methods of protection from disease. Neonatal chickens are highly susceptible to diseases since many pathogens enter through mucosal surfaces and the mucosal immune system is not fully mature until several weeks post hatch1. Escherichia coli (E. coli) causes a variety of disease syndromes in poultry including yolk-sac infection, omphalitis, respiratory tract infection, septicemia, and cellulitis2. Vaccines are a well-known method to stimulate the immune system for improved disease protection, but they are not available for all disease agents and are not effective when an immediate protective effect is required. Additionally, the routine prophylactic use of antibiotics is controversial because it can lead to the emergence of antibiotic-resistant microbes. This may result in food allergies and soil or water contamination via fecal excretion of antibiotics in poultry manure applied to the land. The emergence and increasing spread of resistant bacteria are rendering current antibiotics progressively less effective. Thus, there is pressure to restrict the use of antibiotics in agriculture, while antibiotics are becoming less effective in treating infections. Hence, these trends point to a need for development of alternative strategies for infectious disease control3.
[0003] The vertebral innate immune system identifies pathogen- associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs), inducing immune responses which prevent infections4. Non-vertebral DNA acts as a PAMP which contains comparatively higher amounts of
unmethylated cytosine-phosphodiester-guanine (CpG) dinucleotides than vertebral DNA. These unmethylated CpG dinucleotides (CpG motifs), are recognized as the molecular pattern that contributes to the immunostimulatory activity of non-vertebral DNA5. Toll-like receptor 9 (TLR 9) in mammals, which is an intracellular PRR, recognizes these unmethylated CpG motifs and initiates immunostimulatory pathways5. The context of the unmethylated CpG dinucleotides including specific flanking sequences are responsible for the extent of immune stimulation6. Synthetic preparations of oligodeoxynucleotides containing CpG motifs (CpG-ODNs) simulating non- vertebral DNA have shown similar immunostimulatory activity7. This discovery has shown an important preventive immunotherapeutic treatment option which stimulates the host's immune system. Studies have revealed the immunostimulatory action of CpG-ODNs in many vertebral species including mice8, fish9, cattle and sheep10, and chicken11 ,12. Other than the immunostimulatory action, CpG-ODNs are being used as vaccine adjuvants due to the ability to activate antigen presenting cells and B cells13. CpG-ODNs are also used for cancer therapy due to natural killer cell and cytotoxic T cell activation13. Furthermore, CpG-ODNs are being used for anti-allergic treatments due to the ability to promote Th1 -type immune response and thus suppress Th2-type allergic responses13. The immunoprotective effect of CpG- ODN against several crucial bacterial diseases such as E. co//1 1 ,14,15 and Salmonella typhimurium , protozoan diseases like Eimeria16 and viral diseases such as infectious bursal disease17 and infectious bronchitis18 have been demonstrated in chickens.
[0004] There have been several drawbacks in using CpG-ODNs as immunostimulatory molecules such as cost, large doses needed for an effective response and CpG-ODN recognizing PRR which is located intracellular^ and tough to reach. Considerations in drug delivery systems have been taken into account to overcome these problems. Studies have shown that lipid based drug delivery systems and carbon nanotube associated delivery systems can improve the immunostimulatory effect as well as the
uptake of CpG-ODN in many species, including mice19,20,21 , and pigs22. However, little is known about the use of CpG-ODN delivery and formulation systems in neonatal chickens.
[0005] Extending the bioavailability and duration of action of CpG ODNs may increase their therapeutic value. Unfortunately, CpG-ODNs used in vivo are rapidly eliminated from the circulation due to adsorption onto serum proteins and degradation by serum nucleases23. A possible technique for protecting CpG-ODNs from degradation while increasing their uptake by cells of the immune system involves liposome encapsulation21 or fusion with biphasic lipid vesicles22. Formulating CpG-ODN with polyphosphazenes showed an enhanced protection of chickens from E. coli infection24.
[0006] Nanotechnology can be described as the technology involved in the manufacture, control, manipulation, and study of structures or devices whose size is of the nanometer scale. Carbon nanotubes (CNTs) can be, for example single walled (SWNT) or multi walled (MWNT). CNTs have been investigated as multipurpose carriers for drug delivery and diagnostic applications. The organic functionalization of CNTs can significantly improve their solubility and biocompatibility profile; as a result, their manipulation and integration into biological systems has become possible. Functionalized CNTs currently hold strong promise as novel systems for the delivery of drugs, antigens and genes25. Use of carbon nanotubes to enhance uptake of CpG- ODN and increase antiglioma immunity in mice have been reported19.
[0007] Despite the widely demonstrated potential of CNTs in drug delivery, research indicates these particles can potentially cause adverse effects because of their small size and extreme aspect ratio29. However, controversy surrounds the interpretation ascribed to CNT toxicity data, and the state of the art is presently uncertain. To date, the toxicity of a particular CNT or CNT formulation is usually determined on a case-by-case basis. What is apparent however, is that toxicity is related to properties of the CNT material, such as its structure (for example, SWNT vs. MWNT), length, aspect
ratio, surface area, chirality, degree of aggregation, extent of oxidation, surface topology, bound functional group(s), and method of manufacturing (which can, for example leave catalyst residues and/or produce impurities). Toxicity of CNTs is also related to their concentration in a formulation and the dose to which cells or organisms are exposed30.
SUMMARY
[0008] The present inventors have prepared novel formulations of CpG-ODN with carbon nanotubes and CpG-ODN with lipid surfactants and have demonstrated the delivery and immunostimulatory activity of these novel formulations in chicken embryos.
[0009] Accordingly, the present disclosure provides a composition comprising (a) a CpG oligonucleotide noncovalently complexed with a non- functionalized carbon nanotube or (b) a CpG oligonucleotide complexed with a cationic lipid surfactant; and a pharmaceutically acceptable carrier.
[0010] In an embodiment, the non-functionalized carbon nanotube of (a) is a single-walled carbon nanotube. In another embodiment, the non- functionalized carbon nanotube of (a) is a multi-walled carbon nanotube. The mean length of the non-functionalized single-walled or multi-walled carbon nanotube of (a) is from about 50 nm to about 5000 nm, optionally, about 100 nm to about 1000 nm. The mean diameter of the non-functionalized single- walled carbon nanotube of (a) is from about 0.6 nm to about 2.0 nm, optionally about 1.0 nm. The mean diameter of the non-functionalized multi- walled carbon nanotube of (a) is from about 2 nm to 50 nm.
[0011] In another embodiment, the CpG oligonucleotide complexed with the cationic lipid surfactant in (b) is further formulated with a lipid phase to form a liposome. Optionally, the lipid phase comprises about 2 wt% of a phospholipid, about 0.2 wt% cholesterol and about 4 wt% propylene glycol.
[0012] In yet another embodiment, the cationic lipid surfactant is a dicationic gemini surfactant having the configuration m-s-m or m-sN-m, for
example, the dicationic gemini surfactant has the configuration 12-3-12 or 12- 7N-12.
[0013] In yet another embodiment, the cationic lipid surfactant is at least one dicationic gemini surfactant having a structure of Formula (I):
R1— N— Y— N— R2
I I
R4 R6
(D
wherein,
each of R1 and R2 is the same or different and is independently selected from C3-40alkyl, C3_4oalkenyl and C3-40alkynyl;
each of R3, R4, R5 and R6 is the same or different and is independently selected from Chalky!;
Y is selected from C2-i2alkylene, C3_i2alkenylene and -Ci-6alkylene-NR7- Ci-6alkylene-, wherein R7 is H, Ci_4alkyl, C2-4alkenyl or C2-4alkynyl; and
each X" is the same or different and is a pharmaceutically acceptable counteranion.
[0014] In an embodiment, R1 and R2 are both -(CH2)iiCH3; each of R3, R4, R5 and R6 is -CH3; Y is -(CH2)3- and each X" is the same and is Br".
[0015] In another embodiment, R1 and R2 are both -(CH2)nCH3; each of R3, R4, R5 and R6 is -CH3; Y is -(CH2)3-N(CH3)-(CH2)3- and each X" is the same and is Br".
[0016] In one embodiment, the CpG oligonucleotide has a nucleotide sequence selected from TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:1 ), TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO:2),
TCGTCGTTTGTCGTTTTGTCGTT (SEQ ID NO:3), and ggGGGACGATCGTCggggG (SEQ ID NO:4).
[0017] In a particular embodiment, the CpG oligonucleotide has the nucleotide sequence 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO: 1 ).
[0018] In another embodiment, the CpG oligonucleotide is unmethylated.
[0019] Also disclosed herein is a method of promoting innate immunity in an avian subject comprising administering in ovo to the avian subject a composition of the present disclosure. Further disclosed herein is use of a composition of the present disclosure for promoting innate immunity in an avian subject in need thereof. In another embodiment, the disclosure provides use of a composition of the present disclosure in the preparation of a medicament formulated for in ovo delivery for promoting innate immunity in an avian subject in need thereof. Further provided is a composition of the present disclosure for use in ovo in promoting innate immunity in an avian subject in need thereof.
[0020] In an embodiment, the methods and uses of the present disclosure are for treating or preventing a bacterial, protozoan or viral disease or infection.
[0021] In an embodiment, the bacteria are E. coli or Salmonella;
[0022] In another embodiment, the protozoan disease or infection is Eimeria.
[0023] In yet another embodiment, the viral disease or infection is infectious bursal disease or infectious bronchitis.
[0024] In one embodiment, the administration in ovo to the subject embryo is 2 to 3 days prior to hatching.
[0025] In an embodiment, the avian subject is a turkey or chicken.
[0026] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples
while indicating embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The disclosure will now be described in relation to the drawings in which:
[0028] Figure 1 shows the survival of broiler chickens following E. coli challenge. Groups of broiler chicken embryos at day-18 of incubation delivered with CpG-ODN formulated with SWNT # 1 or LSC # 1 , CpG-ODN alone or saline by the in ovo route (n = 40 per group). Each formulation contains 50pg of CpG-ODN. 50% of birds in each group (n = 20) was subcutaneously inoculated with 1 ><104 E. coli and the remaining 50% of birds (n = 20) was subcutaneously inoculated with 1 χ 105 cfu of E. coli at day-1 post-hatch or 24 h following hatch. Groups of birds that received CpG-ODN - SWNT # 1 or LSC # 1 -CpG-ODN were significantly protected against E. coli infection compared to the control group (p < 0.0001 ).
[0029] Figure 2 shows the cumulative clinical scores (CCS) of broiler chickens following E. coli challenge. CCS of neonatal broiler chickens following challenge with 1 χ104 (n = 20) or 1 χ 105 (n = 20) cfu of E. coli. Groups of birds that received 50pg CpG-ODN formulated with of SWNT # 1 - CpG-ODN, or LSC #1-CpG-ODN had a significantly lower CCS compared to the CpG-ODN or saline group.
[0030] Figure 3 shows the bacterial score per each bird according to bacterial growth on blood agar. Bacterial swabs were taken from air sacs. E. coli colonies were enumerated on sheep blood agar by streaking sequentially in four distinct areas on agar plates. The enumeration was expressed on a scale of 0 to 4+ (0, no growth; 1 +, growth of bacteria on area 1 ; 2+, growth of the bacteria on areas 1 and 2; 3+, growth of bacteria on areas 1 ,2, and 3; 4+, growth of bacteria on areas 1 , 2, 3, and 4). Heavy bacterial growth was
observed more frequently in lesions from birds in the control group or groups treated with CpG-ODN alone than in the groups treated with SWNT # 1 -CpG- ODN or LSC # 1 -CpG-ODN by the in ovo route.
[0031] Figure 4 shows the survival of broiler chickens following E. coli challenge. Groups of broiler chicken embryos at day-18 of incubation delivered with CpG-ODN formulated with SWNT#2 or gemini surfactant-CpG- ODN (LSC#2), CpG-ODN alone or saline by the in ovo route (n = 40 per group). Each formulation contains 50pg of CpG-ODN. Fifty % of birds in each group (n = 20) was subcutaneously inoculated with 1 * 104 E. coli and the remaining 50% of birds (n = 20) was subcutaneously inoculated with 1 x 10 5 cfu of E. coli at day-1 post-hatch or 24 h following hatch. Groups of birds received CpG-ODN - SWNT#2 or gemini surfactant-CpG-ODN (LSC#2- CpG- ODN) were significantly protected against E. coli infection compared to the saline control group (p < 0.0001 ). The group that received CpG-ODN alone had increased survival but protection was not statistically significant (p = 0.0573).
[0032] Figure 5 shows cumulative clinical scores (CCS) of broiler chickens following E. coli challenge. CCS of neonatal broiler chickens following challenge with 1 χ 104 (n = 20) or 1 * 105 (n = 20) cfu of E. coli. Groups of birds received 50pg CpG-ODN formulated with of SWNT#2-CpG- ODN, or surfactant (gemini surfactant-CpG-ODN or LSC#2 CpG-ODN) had a significantly lower CCS compared to the CpG-ODN or saline group. [Bird Numbers per group; SWNT#2-CpG = 33; gemini surfactant-CpG-ODN (LSC#2-CpG) = 40; CpG ODN = 26; and Saline = 40].
[0033] Figure 6 shows E. coli colonies were enumerated on sheep blood agar by streaking sequentially in four distinct areas on agar plates. The enumeration was expressed on a scale of 0 to 4+ (0, no growth; 1 +, growth of bacteria on area 1 ; 2+, growth of the bacteria on areas 1 and 2; 3+, growth of bacteria on areas 1 ,2, and 3; 4+, growth of bacteria on areas 1 , 2, 3, and 4). Heavy bacterial growth was observed more frequently in lesions from birds in
the control group than in the groups treated with SWNT#2-CpG-ODN, gemini surfactant-CpG-ODN (LSC#2 CpG-ODN) or CpG-ODN alone by the in ovo route.
DETAILED DESCRIPTION
[0034] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art.
Definitions:
[0035] As used in the present disclosure, the singular forms "a", "an" and "the" include plural references unless the content clearly dictates otherwise. For example, an embodiment including "a dicationic gemini surfactant" should be understood to present certain aspects with one dicationic gemini surfactant, or two or more additional dicationic gemini surfactants.
[0036] In embodiments comprising an "additional" or "second" component, such as an additional or second dicationic gemini surfactant, the second component as used herein is chemically different from the other components or first component. A "third" component is different from the other, first, and second components, and further enumerated or "additional" components are similarly different.
[0037] In understanding the scope of the present disclosure, the term "comprising" and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, "including", "having" and their derivatives. The term "consisting" and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups,
integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term "consisting essentially of", as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.
[0038] Terms of degree such as "about" and "approximately" as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies.
[0039] The term "suitable" as used herein means that the selection of the particular compound, composition and/or conditions would depend on the specific synthetic manipulation to be performed, and the identity of the molecule(s)/material(s) to be transformed, but the selection would be well within the skill of a person trained in the art. All process/method steps described herein are to be conducted under conditions sufficient to provide the desired product. A person skilled in the art would understand that all conditions, including, for example, solvent, time, temperature, pressure, reactant ratio and whether or not the process/method should be performed under an anhydrous or inert atmosphere, can be varied to optimize the yield and/or properties of the desired product and it is within their skill to do so.
[0040] The term "compositions of the present disclosure" and the like as used herein refers to a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, for example a non-functionalized single-walled carbon nanotube and a carrier; a CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier; or a CpG oligonucleotide complexed with a cationic lipid surfactant further formulated with a lipid phase to form a liposome and a carrier. In an embodiment, the carrier is a pharmaceutically acceptable carrier.
[0041] The term "alkyl" as used herein means straight or branched chain, saturated alkyl groups. The term Ci_3alkyl means an alkyl group having 1 , 2 or 3 carbon atoms.
[0042] The term "alkenyl" as used herein means straight or branched chain, unsaturated alkenyl groups. The term C2-4alkenyl means an alkenyl group having 2, 3 or 4 carbon atoms and at least one double bond.
[0043] The term "alkynyl" as used herein means straight or branched chain, unsaturated alkynyl groups. The term C2-4alkynyl means an alkynyl group having 2, 3 or 4 carbon atoms and at least one triple bond.
[0044] The term "alkylene" as used herein refers to a bivalent alkyl group. The term C2-i2alkylene means an alkylene group having 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 carbon atoms.
[0045] The term "alkenylene" as used herein refers to a bivalent alkenyl group. The term C3.i2alkenylene means an alkenylene group having 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 carbon atoms and at least 1 , for example 1 -4, 1 -3, 1 -2 or 1 double bond(s).
[0046] The term "carbon nanotube" as used herein refers to an allotrope of carbon comprising a graphene sheet rolled into a cylindrical nanostructure. A carbon nanotube may be single-walled, in which case it is referred to herein as a "SWNT" or a "single-walled carbon nanotube" or the like. A carbon nanotube may also be multi-walled, in which case it is generally referred to as a "MWNT" or a multi-walled carbon nanotube or the like. A carbon nanotube, for example, a SWNT may vary in respect one or more of a number of physical properties such as length, diameter, aspect ratio, surface area, molecular weight, surface topology, the way the graphene sheet is rolled
(denoted by indices {n,m)), degree of aggregation, morphology, extent of oxidation, and purity. For example, a person skilled in the art would understand that a high purity carbon nanotube is expected to be less toxic than a carbon nanotube of lower purity. A carbon nanotube, for example a SWNT can be functionalized; i.e. a surface of the carbon nanotube has been modified with
at least one functional group. A carbon nanotube, for example a SWNT can also be non-functionalized; i.e. the carbon nanotube surfaces have not been modified. A SWNT that has not been functionalized is referred to herein as a "non-functionalized single-walled carbon nanotube". A carbon nanotube, for example a SWNT may be available from a commercial source (for example, from Unidym™, Inc. or from Nanolntegris, Inc.) and/or it may be prepared by a suitable synthetic method. A number of synthetic routes are known in the art, for example those that use arc discharge, laser ablation, plasma torch or chemical vapor deposition (CVD) techniques and the like. The choice of a suitable commercial source or synthetic route for the required carbon nanotube, for example a SWNT can be made by a person skilled in the art.
[0047] Samples of non-functionalized carbon nanotubes such as single-walled carbon nanotubes may have a polydisperse distribution in terms of the length and/or diameter of the non-functionalized carbon nanotubes therein. Accordingly, the term "length range" as used herein refers to the range of lengths present in a sample of carbon nanotubes, and the term "diameter range" as used herein refers to the range of diameters present in a sample of carbon nanotubes. The term "mean length" as used herein refers to the mean length of the carbon nanotubes in a sample of carbon nanotubes, and the term "mean diameter" as used herein refers to the mean diameter of the carbon nanotubes in a sample of carbon nanotubes. While the mean length and/or mean diameter between different samples of carbon nanotubes such as single-walled carbon nanotubes may differ, a person skilled in the art would understand that there can be a range of mean lengths and/or diameters that may have utility, for example in the methods and uses herein.
[0048] The term "amphiphilic" as used herein refers to a compound comprising both hydrophilic (water loving) and lipophilic (fat loving) portions.
[0049] The term "liposome" as used herein refers to artificially prepared vesicles, the surface of which is a bilayer comprising amphiphilic structures.
[0050] The term "cmc" as used herein refers to the "critical micelle concentration" which is the concentration of a surfactant, for example a gemini surfactant, above which monomeric surfactants assemble into micelles.
[0051] The term "gemini surfactant" as used herein refers to an amphiphilic structure also known as a "bis-surfactant" which comprises at least two lipophilic tails and two polar groups linked by a spacer. In an embodiment of the present disclosure, the gemini surfactant has two lipophilic tails and two polar groups linked by a spacer in the sequence: lipophilic tail- polar group-spacer-polar group— lipophilic tail. Examples of gemini surfactant spacers are known which are, for example, short (e.g. two methylene groups) or long (e.g. 12 methylene groups); rigid (e.g. a 1 ,2-diphenylethylene moiety) or flexible (e.g. a methylene chain); and polar (e.g. a polyether) or nonpolar (e.g. an aliphatic or aromatic moiety). The polar group can be nonionic (for example, a polyether or a sugar), negatively charged (for example, a phosphate, a sulfate or a carboxylate moiety) or positively charged (for example an ammonium moiety). Gemini surfactants with two positively charged polar groups are referred to herein as "dicationic gemini surfactants". For example, PCT Application Publication No. WO 2010/055416 discloses certain possible variations of the structure of a dicationic gemini surfactant. The selection of a suitable dicationic gemini surfactant for the compositions of the present disclosure can be made by a person skilled in the art. Gemini surfactants having either a symmetrical or an unsymmetrical set of polar groups and/or lipophilic tails are known. Gemini surfactants, for example dicationic gemini surfactants may be commercially available and/or they may be prepared by a suitable synthetic method. A number of synthetic routes are known in the art, for example as described in F.M. enger & J.S. Keiper, "Gemini Surfactants" Angew. Chem. Int. Ed. 2000, 39, 1906-1920; in D. Shukla & V.K. Tyagi, "Cationic Gemini Surfactants: A Review" Journal of Oleo Science 2006, 55, 381-390 and/or in B.S. Sekhon, "Gemini (dimeric) Surfactants: The Two-Faced Molecules" Resonance, 2004, 42-49. The
selection of a suitable synthetic route to the required gemini surfactant can be made by a person skilled in the art.
[0052] Dicationic gemini surfactants having lipophilic tails comprising alkyl groups, polar groups comprising a dimethyl ammonium moiety, and a spacer comprising an alkylene group may be referred to as having an m-s-m configuration, wherein m is the number of alkyl carbon atoms in the lipophilic tail and s is the number of carbon atoms in the spacer. For example, the term "12-3-12" as used herein refers to a dicationic gemini surfactant having the following structure:
(H3C)2N (CH2)3 (CH3)2 2 X"
I I
(CH2)1 1CH3 (CH2)1 iCH3 wherein X" is a counteranion, for example a pharmaceutically acceptable counteranion. In the studies of the present disclosure, X" is Br". A dicationic gemini surfactant having the configuration 12-3-12 can be synthesized using a methodology which is low in cost, and its synthesis can also be scaled up.
[0053] Dicationic gemini surfactants having lipophilic tails comprising alkyl groups, polar groups comprising a dimethyl ammonium moiety, and a spacer comprising an -alkylene-N(CH3)-alkylene- group may be referred to as having an m-sN-m configuration, wherein m is the number of alkyl carbon atoms in the lipophilic tail and s is the number of atoms in the main chain of the spacer. For example, the term "12-7N-12" as used herein refers to a dicationic gemini surfactant having the following structure:
wherein X" is a counteranion, for example a pharmaceutically acceptable counteranion. In the studies of the present disclosure, X" is Br".
[0054] The term "pharmaceutically acceptable" as used herein means compatible with the treatment of subjects, in particular birds.
[0055] The term "counteranion" as used herein refers to a negatively charged species consisting of a single element, or a negatively charged species consisting of a group of elements connected by ionic and/or covalent bonds. For example, the counteranion can be an inorganic counteranion or an organic counteranion. In an embodiment of the present disclosure, the counteranion has a single negative charge. In another embodiment, the counteranion is a pharmaceutically acceptable counteranion.
[0056] The term "pharmaceutically acceptable counteranion" means a counteranion that is suitable for, or compatible with, the treatment of subjects. In an embodiment of the present disclosure, the pharmaceutically acceptable counteranion is CI" or Br". It is an embodiment that the pharmaceutically acceptable counteranion is Br".
[0057] In embodiments of the present disclosure, the dicationic gemini surfactants described herein have at least one asymmetric center. Such compounds exist as enantiomers. Where compounds possess more than one asymmetric center, they may exist as diastereomers. It is to be understood that all such isomers and mixtures thereof in any proportion are encompassed within the scope of the present disclosure. It is to be further understood that while the stereochemistry of the compounds may be as shown in any given compound listed herein, such compounds may also contain certain amounts (e.g. less than 20%, suitably less than 10%, more suitably less than 5%) of compounds having alternate stereochemistry. For example, the dicationic gemini surfactants that are shown without any stereochemical designations are understood to be racemic mixtures (i.e. contain an equal amount of each possible enantiomer or diastereomer). However, it is to be understood that all enantiomers and diastereomers are included within the scope of the present disclosure, including mixtures thereof in any proportion.
[0058] The term "treating" or "treatment" as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. "Treating" and "treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. "Treating" and "treatment" as used herein also include prophylactic treatment. For example, a subject with an early bacterial infection can be treated to prevent progression, or alternatively a subject in remission can be treated with a composition described herein to prevent recurrence. Treatment methods comprise administering to a subject a therapeutically effective amount of one or more of the compositions of the present disclosure, and optionally consists of a single administration, or alternatively comprises a series of administrations. As used herein, the term "effective amount" or "therapeutically effective amount" means an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example in the context of treating a bacterial infection, an effective amount is an amount that, for example, reduces the bacterial infection in comparison to the bacterial infection without administration of the composition. Effective amounts may vary according to factors such as the disease state, age, sex and/or weight of the subject. The amount of a given composition that will correspond to such an amount will vary depending upon various factors, such as the given composition, the pharmaceutical formulation, the route of administration, the type of condition, disease or disorder, the subject being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.
Compositions:
[0059] The CpG oligonucleotide noncovalently complexed with a non- functionalized carbon nanotube and/or the CpG oligonucleotide complexed with a cationic lipid surfactant are suitably formulated into compositions. Accordingly, the present disclosure includes a composition comprising (a) a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube or (b) a CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier. In another embodiment, the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier. In an embodiment, the carbon nanotube is a single-walled carbon nanotube.
[0060] The term "CpG oligonucleotide" or "CpG-ODN" as used herein refers to single stranded DNA molecules that contain a cytosine followed by a guanine, also called a CG motif, and a phosphodiester backbone or a modified phosphorothioate (PS) backbone. In an embodiment, the CpG oligonucleotide comprises a phosphorothioate (PS) backbone. In an embodiment, the CpG oligonucleotide or CpG-ODN is unmethylated. Vertebrate, for example avian immune systems, recognize unmethylated CpG oligonucleotides as foreign.
[0061] The CpG oligonucleotide is at least 6 nucleotides long. In one embodiment, the CpG-ODN is between 8 and 100 nucleotides in length, optionally 8-40 nucleotides in length. In another embodiment, the CpG-ODN is at least 20 nucleotides in length, at least 24 nucleotides in length, at least 27 nucleotides in length or at least 30 nucleotides in length.
[0062] The CpG oligonucleotide can be isolated or synthetic in nature. A person skilled in the art would readily be able to isolate or synthesize the CpG oligonucleotides disclosed herein.
[0063] In an embodiment, the CpG ODN comprises the following formula: 5'-n n2CGn3n4-3' (SEQ ID NO:5), wherein C is unmethylated and ni ,
n2, n3 and n4 are nucleotides. The CpG ODN may be a non-palindromic or a palindromic sequence.
[0064] In an embodiment, ηΊη2 are selected from GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and n3n4 are selected from TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA. In another embodiment, n-in2 are GpA or GpT and n3n4 are TpT. In other embodiments, the nin2 are purines and the n3 or n4 are pyrimidines, or nin2 is GpA and n3 or n4 or both are pyrimidines.
[0065] In another embodiment, the CpG oligonucleotides are of the formula:
(SEQ ID NO:6), wherein ni and n2 are nucleotides and Ni and N2 are nucleic acid sequences composed of from about 0-25 nucleotides each. In an embodiment, ^ is A, G or T and n2 is C, A or T, optionally wherein n-i is C and/or n2 is G.
[0066] In yet another embodiment, the CpG oligonucleotides are of the formula: 5'-Ninin2CGn3n4N2-3' (SEQ ID NO:7), wherein ni , n2, n3 and n4 are nucleotides and Ni and N2 are nucleic acid sequences composed of from about 0-25 nucleotides each. In some embodiments, ni n2 are selected from GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and n3n4 are selected from TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA. In another embodiment, n^2 are GpA or GpT and n3n4 are TpT. In other embodiments, the n-i n2 are purines and the n3 or n4 are pyrimidines, or nin2 is GpA and n3 or n4 or both are pyrimidines.
[0067] In an embodiment, the Ni and N2 do not contain a CCGG or CGCT sequence or more than on CCG or CGG trimer. For example, if the nucleic acid has a phosphodiester backbone or a chimeric backbone, such quadramers or trimmers will only have minimal biological activity. However, if the backbone has a primarily phosphorothioate backbone, inclusion of these quadramers and trimmers would be useful for biological activity.
[0068] In yet a further embodiment, the CpG oligonucleotides are of the formula:
(SEQ ID NO:8).
[0069] Suitable CpG oligonucleotides comprise a nucleotide sequence selected from the group consisting of TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:1 ), TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO:2), TCGTCGTTTGTCGTTTTGTCGTT (SEQ ID NO:3), and ggGGGACGATCGTCggggG (SEQ ID NO:4). In the last sequence, the lower case letters represent nucleotides linked together by phosphorothioate linkages, while the upper case G's represent nucleotides linked together by phosphodiester linkages.
[0070] Further examples of CpG oligonucleotides that are suitable for the present formulations are described in WO01/22972, published on April 1 , 2001 and in WO03/03656, published on April 17, 2003.
[0071] In a particular embodiment, the CpG oligonucleotide for use in the present formulations is 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO:1 ).
[0072] The term "isolated" refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.
[0073] The term "nucleic acid molecule" is intended to include unmodified DNA or RNA or modified DNA or RNA. For example, the nucleic acid molecules of the disclosure can be composed of single- and double stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions. In addition, the nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritiated bases
and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus "nucleic acid molecule" embraces chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have a corresponding meaning.
[0074] CpG oligonucleotides are synthetic oligonucleotides and are readily available, for example, from OPERON.
[0075] A nucleic acid molecule of the disclosure may also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid- phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S. Patent Nos. 4,401 ,796 and 4,373,071 ).
[0076] An isolated nucleic acid molecule of the disclosure which comprises DNA can be isolated by preparing a labelled nucleic acid probe based on all or part of the nucleic acid sequences and using this labelled nucleic acid probe to screen an appropriate DNA library.
[0077] The composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, such as a single-walled carbon nanotube, and a carrier can be prepared by adding a solution comprising a CpG oligonucleotide to non-functionalized carbon nanotubes under conditions to form the composition. The particular conditions, for example, the relative concentrations of the CpG oligonucleotide to the non-functionalized carbon nanotubes, the time and the temperature can vary depending, for example, on the particular CpG oligonucleotide and/or the particular non-functionalized carbon nanotube used but can be determined by a person skilled in the art.
[0078] For example, a person skilled in the art would understand that a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube, such as a single-walled carbon
nanotube, would be a substantially uniformly black solution without any appreciable evidence of sedimentation. For example, if there is too low a concentration of the CpG oligonucleotide in comparison to the non- functionalized carbon nanotube, the composition would not be fully monodisperse and sedimentation would be observed even after, for example an extended time of sonication. Increasing the temperature and/or the intensity of sonication may, in certain cases be used to prepare a monodisperse composition where the concentration of the CpG oligonucleotide in comparison to the non-functionalized carbon nanotube was initially too low to prepare a monodisperse composition. On the other hand, if there is a high concentration of the CpG oligonucleotide in comparison to the non- functionalized carbon nanotube, the composition would be monodisperse (i.e. the non-functionalized carbon nanotubes therein would have a CpG oligonucleotide noncovalently complexed) but there would also be free CpG oligonucleotide in the composition. Such compositions would have utility in the methods and uses of the present disclosure, but, for example may be wasteful as they contain excess CpG oligonucleotide that is not complexed.
[0079] For example, an about 0.5 mg/mL solution of CpG-ODN in sterile water can be added to a non-functionalized single-walled carbon nanotube powder (for example, 0.1 mg HiPco SWNTs per mL of CpG-ODN solution or 0.1 mg Puretubes SWNTs per mL of CpG-ODN solution) in a suitable vessel, for example a glass vial, and sonicating, for example bath sonicating at low shear the resulting suspension for a time and at a temperature that allows for the formation of a composition comprising a CpG oligonucleotide noncovalently complexed with a non-functionalized single- walled carbon nanotube, for example for about 5 hours at a temperature not exceeding about 40 °C to prepare a composition comprising about 10 pg non- functionalized single-walled carbon nanotubes and about 50 pg CpG oligonucleotide, for example CpG-ODN per about 100 μΙ carrier.
[0080] In an embodiment of the present disclosure, the compositions comprise a ratio by weight of the CpG oligonucleotide, for example CpG-ODN
to the non-functionalized carbon nanotube such as a single-walled carbon nanotube of about 4:1 , about 5:1 , about 6: 1 , about 7:1 , about 8:1 , about 9: 1 , about 10: 1 , about 1 1 :1 , about 12:1 , about 13: 1 , about 14:1 , about 15:1 , about 16: 1 , about 17: 1 , about 18: 1 , about 19:1 , about 20: 1 , about 25:1 , about 30: 1 , about 35: 1 , about 40: 1 , about 45: 1 or about 50: 1. In another embodiment, the compositions comprise a ratio by weight of CpG-ODN to the non- functionalized single-walled carbon nanotube of about 5: 1 , about 7.5:1 or about 10: 1. It is an embodiment that the compositions comprise a ratio by weight of CpG-ODN to the non-functionalized single-walled carbon nanotube of about 5:1 , for example, the composition of the present disclosure comprises about 50 pg CpG oligonucleotide, for example CpG-ODN and about 10 pg non-functionalized single-walled carbon nanotubes in a pharmaceutically acceptable carrier.
[0081] For example, the composition comprising the CpG oligonucleotide complexed with a cationic lipid surfactant and a carrier can be prepared by adding a solution comprising a CpG oligonucleotide to a cationic lipid surfactant, for example a dicationic gemini surfactant under conditions to form the composition. The particular conditions, for example the relative concentrations of the CpG oligonucleotide to the cationic lipid surfactant, the time and the temperature can vary depending, for example, on the particular CpG oligonucleotide and/or the particular cationic lipid surfactant used but can be determined by a person skilled in the art.
[0082] For example, a person skilled in the art would understand that there must be an excess of the cationic lipid surfactant, for example, the dicationic gemini surfactant in comparison to the CpG oligonucleotide so that the negative charges on the CpG oligonucleotide are neutralized by the cationic lipid surfactant, for example, the dicationic gemini surfactant, and there is a further excess of the cationic lipid surfactant, for example, the dicationic gemini surfactant, so that the final complex between the CpG oligonucleotide and the cationic lipid surfactant is positively charged.
[0083] For example, an about 0.5 mg/mL solution of CpG-ODN in sterile water can be added to 1.1 mg of a dicationic gemini surfactant such as 12-7N-12 per ml. of CpG-ODN solution in a suitable vessel, for example a glass vial to give a composition having a concentration of CpG-ODN of about 0.5 mg/mL and a concentration of the dicationic gemini surfactant such as 12- 7N-12 of about 1.1 mg/mL.
[0084] In another embodiment of the present disclosure, the compositions comprise a cationic lipid, for example, a dicationic gemini surfactant and a CpG oligonucleotide, for example CpG-ODN in a charge ratio of about 40:1, about 37.5:1, about 35:1, about 32.5:1, about 30:1, about 27.5:1, about 25:1, about 22.5:1, about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1 or about 2.5:1. In a further embodiment, the compositions comprise a dicationic gemini surfactant, for example 12-7N-12 and CpG-ODN in a charge ratio of about 2.5:1 , for example, the composition comprises about 1.1 mg/mL of 12-7N-12 and about 0.5 mg/mL CpG-ODN in a pharmaceutically acceptable carrier.
[0085] In another embodiment, the compositions comprise a cationic lipid, for example, a dicationic gemini surfactant such as 12-3-12 at a percentage of about 0.1% (w/v) to about 0.5% (w/v) or about 0.125% (w/v) and a CpG oligonucleotide, for example CpG-ODN at a concentration of about 0.4 mg/mL to about 1.0 mg/mL or about 0.5 mg/mL.
[0086] In a further embodiment, the composition comprising the CpG oligonucleotide complexed with the cationic lipid surfactant and a carrier can be further formulated with a lipid phase to form a composition comprising a liposome. For example, the composition comprising the CpG oligonucleotide complexed with the cationic lipid surfactant and a carrier can be added to a lipid phase under conditions to form the composition comprising a liposome.
[0087] The particular conditions, for example the relative concentrations of each of the components, the time and the temperature can vary depending, for example on the particular CpG oligonucleotide and/or the particular cationic lipid surfactant used and/or the particular lipid phase used, but can be determined by a person skilled in the art. In an embodiment, the lipid phase comprises a phospholipid, for example a phosphatidylcholine such as Phospholipon™ 90H or a similar lipid, and optionally cholesterol and/or a hydrophilic solvent other than water, for example a glycol, such as propylene glycol or butylene glycol or a polyol such as glycerol or mixtures thereof. It is an embodiment that the phospholipid is a pharmaceutical grade phospholipid. For example, cholesterol can be used to put the lipid bilayer of the liposome into a liquid crystalline intermediate phase, thus lowering the transition temperature of the lipid bilayer and making the liposome more flexible so that it can, for example, be taken up more easily by a cell. For example, the transition temperature of the lipid bilayer can be lowered so that it is closer to body temperature (about 37 °C). The hydrophilic solvent other than water can be added to assist in the manufacturing process.
[0088] For example, the composition comprising the CpG oligonucleotide, for example CpG-ODN complexed with the cationic lipid surfactant, for example a dicationic gemini surfactant such as 12-7N-12 and a carrier such as sterile water, the composition having a concentration of CpG- ODN of about 0.5 mg/mL and a concentration of the 12-7N-12 of about 1.1 mg/mL can be warmed, for example to about 40 °C and added to a lipid phase comprising, for example about 2 wt% Phospholipon 90H, about 0.2 wt% cholesterol and about 4 wt% propylene glycol which has been melted, for example at about 70 °C in, for example, a water bath to give a substantially clear liquid, and the resulting mixture mixed, for example by intermittent vortexing/heating until a substantially homogeneous formulation is formed, then sonicating, for example using a cup-horn Sonicator 4000 on amplitude 1 1 for about 30 minutes to give the composition comprising the liposome.
[0089] In an embodiment of the present disclosure, the compositions further formulated with the lipid phase to form the composition of the present disclosure comprising a liposome have a lipid phase comprising about 1 wt% to about 5 wt% or about 2 wt% of a phospholipid such as Phospholipon 90H or a similar lipid, about 0 wt% to about 0.5 wt% or about 0.2 wt% of cholesterol and about 0 wt% to about 10 wt% or about 4 wt% of a hydrophilic solvent other than water for example a glycol, such as propylene glycol or butylene glycol or a polyol such as glycerol or mixtures thereof. It is an embodiment that the lipid phase comprises about 2 wt% Phospholipon 90H, about 0.2 wt% cholesterol and about 4 wt% propylene glycol.
[0090] In an embodiment of the present disclosure, the non- functionalized single-walled or multi-walled carbon nanotube has a length range of about 50 nm to about 5000 nm, about 100 nm to about 4000 nm, about 65 nm to about 2000 nm, about 80 nm to about 1500 nm or about 100 nm to about 1000 nm. In another embodiment, the non-functionalized single- walled carbon nanotube has a length range of about 100 nm to about 4000 nm. In a further embodiment, the non-functionalized single-walled carbon nanotube has a length range of about 65 nm to about 2000 nm, about 80 nm to about 1500 nm or about 100 nm to about 1000 nm. It is an embodiment of the present disclosure that the non-functionalized single-walled carbon nanotube has a length range of about 100 nm to about 1000 nm.
[0091] In another embodiment, the non-functionalized single-walled or multi-walled carbon nanotube has a mean length of about 50 nm to about 5000 nm, about 250 nm to about 2500 nm, about 500 nm to about 1500 nm, about 100 nm to about 1000 nm or about 1000 nm. It is an embodiment that the non-functionalized single-walled or multi-walled carbon nanotube has a mean length of about 100 nm to about 1000 nm.
[0092] In an embodiment of the present disclosure, the non- functionalized single-walled carbon nanotube has a diameter range of about 0.6 nm to about 2.0 nm, about 0.65 nm to about 1.5 nm, about 0.7 nm to
about 1.3 nm, about 0.8 nm to about 1 .2 nm or about 1.2 nm to about 1.7 nm. In another embodiment, the non-functionalized single-walled carbon nanotube has a diameter range of about 0.65 nm to about 1.5 nm, about 0.7 nm to about 1 .3 nm or about 0.8 nm to about 1 .2 nm. In a further embodiment, the non-functionalized single-walled carbon nanotube has a diameter range of about 1.2 nm to about 1.7 nm. It is an embodiment of the present disclosure that the non-functionalized single-walled carbon nanotube has a diameter range of about 0.8 nm to about 1 .2 nm.
[0093] In an embodiment of the present disclosure, the non- functionalized multi-walled carbon nanotube has a diameter range of about 2 nm to about 50 nm.
[0094] In another embodiment of the present disclosure, the non- functionalized single-walled carbon nanotube has a mean diameter of about 0.6 nm to about 2 nm, about 0.65 to about 1.4 nm, about 0.7 to about 1.3 nm, about 0.8 nm to about 1.2 nm, about 1 .2 nm to about 1 .6 nm, about 1 .0 nm or about 1.4 nm. In another embodiment, the non-functionalized single-walled carbon nanotube has a mean diameter of about 0.65 to about 1 .4 nm, about 0.7 to about 1 .3 nm, about 0.8 nm to about 1 .2 nm or about 1.0 nm. In a further embodiment, the non-functionalized single-walled carbon nanotube has a mean diameter of about 0.8 nm to about 1.2 nm or about 1.0 nm. It is an embodiment that the non-functionalized single-walled carbon nanotube has a mean diameter of about 1 .0 nm. In another embodiment of the present disclosure, the non-functionalized single-walled carbon nanotube has a mean diameter of about 1.4 nm.
[0095] In an embodiment of the present disclosure, the non- functionalized multi-walled carbon nanotube has a mean diameter of about 2 nm to about 50 nm.
[0096] In an embodiment, the non-functionalized single-walled carbon nanotube is a PureTubes™ carbon nanotube from Nanolntegris having a length range of about 100 nm to about 4000 nm, a mean length of about 1000
nm, a diameter range of about 1 .2 nm to about 1 .7 nm and a mean diameter of about 1.4 nm. In another embodiment, the non-functionalized single-walled carbon nanotube is a HiPco™ carbon nanotube from Unidym having a length range of about 100 to about 1000 nm, a diameter range of about 0.8 nm to about 1.2 nm and a mean diameter of about .0 nm.
[0097] In another embodiment of the present disclosure, the cationic lipid surfactant is a dicationic gemini surfactant having, for example, a low cmc. It is an embodiment that the cationic lipid surfactant is at least one dicationic gemini surfactant havin a structure of Formula (I):
(I)
wherein,
each of R1 and R2 is the same or different and is independently selected from C3-4oalkyl, C3-4oalkenyl and C3-4oalkynyl;
each of R3, R4, R5 and R6 is the same or different and is independently selected from d^alkyl;
Y is selected from C2-i2alkylene, C3-i2alkenylene and -Ci-6alkylene-NR7- Ci-6alkylene-, wherein R7 is H, Ci_4alkyl, C2-4alkenyl or C2-4alkynyl; and
each X" is the same or different and is a counteranion.
[0098] In an embodiment, each of R1 and R2 is the same or different and is independently selected from C5-2oalkyl, C5-20alkenyl and C5_2oalkynyl. In another embodiment, each of R1 and R2 is the same or different and is independently selected from C5-2oalkyl. In a further embodiment, R and R2 are the same and are selected from Cs^oalkyl. It is an embodiment that R and R2 are both -(CH2)ii CH3.
[0099] In another embodiment, each of R3, R4, R5 and R6 is the same or different and is independently selected from Ci_2alkyl. It is an embodiment that each of R3, R4, R5 and R6 is -CH3.
[00100] In an embodiment, Y is selected from C2-i2alkylene and -Ci_ 6alkylene-NR7-C1-6alkylene-, wherein R7 is H or Ci^alkyl. In another embodiment, Y is C2-i2alkylene. It is an embodiment that Y is -(CH2)3-. In another embodiment, Y is -Ci_6alkylene-NR7-Ci-6alkylene- wherein R7 is d- 4alkyl. It is an embodiment that Y is -(CH2)3-N(CH3)-(CH2)3-. When R7 is H, i.e. Y is -(CH2)3-N(H)-(CH2)3- the N-H moiety of the spacer can be protonated in use.
[00101] In an embodiment, each X" is the same or different and is a pharmaceutically acceptable counteranion. In another embodiment, each X" is the same and is selected from the group consisting of Br" and CI". It is an embodiment that each X" is the same and is Br".
[00102] In an embodiment, the dicationic gemini surfactant has the configuration m-s-m, wherein m is an integer from 3 to 40 and s is an integer from 2 to 16. In another embodiment, m is an integer from 5 to 20. In a further embodiment, s is an integer from 2 to 12. It is an embodiment that m is 12. In another embodiment, s is an integer from 2 to 8. It is an embodiment that s is 3. In an embodiment, the dicationic gemini surfactant has the configuration 12-2-12, 12-3-12, 12-7-12, 12-16-12, 16-3-16 or 18-3-18. In another embodiment, the dicationic gemini surfactant has the configuration 12-3-12.
[00103] In another embodiment, the dicationic gemini surfactant has the configuration m-sN-m, wherein m is an integer from 3 to 40 and s is an integer from 2 to 12. In another embodiment, m is an integer from 5 to 20. It is an embodiment that m is 12. In another embodiment, s is an integer from 5 to 10. It is an embodiment that s is 7. In an embodiment, the dicationic gemini surfactant has the configuration 12-7N- 2.
[00104] In an embodiment, the lipid phase comprises a phospholipid. In another embodiment, the phospholipid is a phosphatidylcholine such as
Phospholipon 90H or a similar lipid. In another embodiment, the lipid phase further comprises cholesterol. In a further embodiment, the lipid phase further comprises a hydrophilic solvent other than water. It is an embodiment that the hydrophilic solvent other than water is a glycerol or a polyol or mixtures thereof. In an embodiment, the glycol is propylene glycol or butylene glycol. In another embodiment, the glycol is propylene glycol. In a further embodiment, the polyol is glycerol. It is an embodiment that the lipid phase comprises a phospholipid, cholesterol and propylene glycol.
Methods and Uses
[00105] The compositions disclosed herein are useful for promoting innate immunity in a subject. In particular, the compositions are useful for in ovo delivery to an avian embryo for promoting innate immunity to prevent and/or treatment infection.
[00106] Accordingly, in one embodiment, the present disclosure provides a method of promoting innate immunity in an avian subject in need thereof comprising administering in ovo a composition disclosed herein to the animal in need thereof. Also provided is use of a composition disclosed herein for promoting innate immunity in ovo in an avian subject in need thereof. Further provided is use of a composition disclosed herein in the preparation of a medicament formulated for in ovo delivery for promoting innate immunity in an avian subject in need thereof. Even further provided is a composition disclosed herein for use in promoting innate immunity in ovo in an avian subject in need thereof.
[00107] The phrase "promoting innate immunity" as used herein refers to promoting immunity that is not antigen specific and involves phagocytosis, cytokine release and cytolytic functions. In one embodiment, promoting innate immunity is effective at preventing, reducing or eliminating a microbial infection. Promoting innate immunity includes, without limitation, increasing interferon-gamma production and increasing natural killer cell activity.
[00108] In an embodiment, the methods and uses disclosed herein are used for treating or preventing an infection, including without limitation, a bacterial infection, such as an E. coli infection or a Salmonella infection, a viral infection, such as infectious bursal disease or infectious bronchitis, or a protozoan infection, such as Eimeria.
[00109] The term "avian subject" as used herein refers to all avian species. In an embodiment of the present disclosure, the bird is poultry such as a fowl (for example, a chicken, a turkey or a quail), a waterfowl (for example, a domestic duck or a domestic goose), a pigeon, a dove or a pheasant. It is an embodiment that the bird is a chicken or a turkey. For in ovo delivery, the formulation is delivered to an egg at an embryonic stage of development of the avian subject.
[00110] The compositions of the present disclosure may be administered to a subject in a variety of forms as will be understood by those skilled in the art.
[00111] In an embodiment, the in ovo administration is at 2 to 3 days before hatching of a subject avian species. For example, if the subject is a chicken, the in ovo administration is at 17 to 19 days, for example at 18 days of incubation of the chicken embryo.
[00112] A person skilled in the art would readily be able to determine the appropriate amounts and dosing for in ovo delivery. In the present examples, in ovo delivery was conducted by administering 100 μΙ volume by the in ovo route into the amniotic cavity through the air cell of the egg using a 20 gauge, 1 inch needle.
[00113] Conventional procedures and ingredients for the selection and preparation of suitable compositions are described, for example, in Remington's Pharmaceutical Sciences (2000 - 20th edition) and in The United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999.
[00114] Compositions of the present disclosure may be used alone or in combination with other known agents useful for promoting innate immunity in a subject. When used in combination with other agents useful for promoting innate immunity in a subject, it is an embodiment that the compositions of the present disclosure are administered contemporaneously with those agents. As used herein, "contemporaneous administration" of two substances to a subject means providing each of the two substances so that they are both biologically active in the individual at the same time. The exact details of the administration will depend on the pharmacokinetics of the two substances in the presence of each other, and can include administering the two substances within a few hours of each other, or even administering one substance within 24 hours of administration of the other, if the pharmacokinetics are suitable. Design of suitable dosing regimens is routine for one skilled in the art. In particular embodiments, two substances will be administered substantially simultaneously, i.e., within minutes of each other, or in a single composition that contains both substances. It is a further embodiment of the present disclosure that the composition of the present disclosure and the other agent(s) is administered to a subject in a non-contemporaneous fashion.
[00115] The dosage of compositions of the present disclosure can vary depending on many factors such as the pharmacodynamic properties of the composition, the mode of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the frequency of the treatment and the type of concurrent treatment, if any, and the clearance rate of the composition in the subject to be treated. One of skill in the art can determine the appropriate dosage based on, for example the above factors. Compositions of the present disclosure may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response, and may be administered in a single daily dose or the total daily dose may be divided into two, three or four daily doses.
[00116] As a representative example, in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about
1 .0 μΙ, about 5.0 μΙ, about 10.0 μΙ, about 20.0 μΙ, about 25.0 μΙ, about 30.0 μΙ, about 40.0 μΙ, about 50.0 μΙ, about 60.0 μΙ, about 70.0 μΙ, about 75.0 μΙ, about 80.0 μΙ, about 85.0 μΙ, about 90.0 μΙ, about 95.0 μΙ, about 100.0 μΙ, about 105.0 μΙ, about 1 10.0 μΙ, about 1 15.0 μΙ, about 120.0 μΙ, about 125.0 μΙ, about 150 μΙ, about 200 μΙ, about 250 μΙ, about 300 μΙ, about 350 μΙ, about 400 μΙ, about 450 μΙ, about 500 μΙ, about 550 μΙ, about 600 μΙ, about 650 μΙ, about 700 μΙ, about 750 μΙ, about 800 μΙ, about 850 μΙ, about 900 μΙ, about 950 μΙ or about 1000 μΙ. In an embodiment, in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about 50 μΙ to about 150 μΙ, about 75 μΙ to about 125 μΙ, about 90 μΙ to about 1 10 μΙ or about 100 μΙ. In a further embodiment, in-ovo dosages of one or more compositions of the present disclosure are administered in a volume of about 00 μΙ.
[00117] Treatment or prevention methods comprise administering to a subject, a therapeutically effective amount of one or more of the compositions of the present disclosure, and optionally consists of a single administration, or alternatively comprises a series of administrations. For example, the one or more compositions of the present disclosure are administered in a single administration any time prior to or following the onset of the disease, disorder or condition. For example, the one or more compositions of the present disclosure are administered immediately prior to the onset of the disease, disorder or condition or about 24 hours prior to the onset of the disease, disorder or condition, or any time in between. Alternatively, the one or more compositions of the present disclosure are administered immediately following the onset of the disease, disorder or condition or about 48 hours following the onset of the disease, disorder or condition, or any time in between, for example about 1 minute, about 10 minutes, about 30 minutes, about 1 hour, about 5 hours, about 10 hours, about 20 hours, about 24 hours, about 30 hours or about 36 hours, following the onset of the disease, disorder or condition.
[00118] However, in another embodiment, the compositions may be administered to the subject in a series of administrations, for example about
1 , 2, 3, 4, 5 or 6 times daily for 1 day to about 10 days either before or after
the onset of the disease, disorder or condition. The length of the treatment period depends on a variety of factors, such as the cause of the disease, disorder or condition, severity of the disease, disorder or condition, the age of the subject, the concentration of the composition, the activity of the composition, and/or a combination thereof. It will also be appreciated that the effective dosage of the composition used for the treatment or prevention may increase or decrease over the course of a particular treatment or prevention regime. Changes in dosage may result and become apparent by standard diagnostic assays known in the art. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the subject.
[00119] The above disclosure generally describes the present application. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the disclosure. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
[00120] The following non-limiting examples are illustrative of the present disclosure:
EXAMPLES
Materials and methods: Bacteria
[00121] A field isolate of E. coli from a turkey with septicemia, was used as the challenge strain. This E. coli was serogroup 02, nonhemolytic, serum- resistant, produced aerobactin, a K1 capsule and Type 1 pili. Aliquots of bacteria were stored at -70 °C in 50% brain-heart infusion broth (BHI; Difco, Detroit, Ml) supplemented with 25% (w/v) glycerol (VWR Scientific, Inc.,
Montreal, Quebec). Bacteria for use as the challenge were cultured on sheep blood agar plates for 24 hours at 37 °C. One colony was added to 100 ml of Luria broth in a 250ml Erienmeyer flask. The culture was grown at 37 °C for 16 - 18 hours with shaking at 150 rpm. Stationary phase culture contained approximately 1 * 109 colony forming units (CFUs) of bacteria per milliliter. The cultures were further diluted in sterile saline to the concentration of bacteria required for challenge (1 105 or 1 *104 CFU/ bird). Viable bacterial counts were determined by plating serial dilutions of the diluted culture on sheep blood agar plates, incubating for 24 hours at 37 °C then counting the number of colonies.
Animal model
[00122] This work was approved by the University of Saskatchewan's Animal Research Ethics Board, and adhered to the Canadian Council on Animal Care guidelines for humane animal use. Day-old broiler chicks or hatching eggs were obtained from a local hatchery or broiler breeder operation in Saskatchewan, Canada. Eggs were incubated at the Animal Care Unit at the Western College of Veterinary Medicine, University of Saskatchewan. Groups of chicks were allocated randomly into animal isolation rooms at the Animal Care Unit, University of Saskatchewan. Water and commercial broiler ration were provided ad libitum. Each room was ventilated with filtered, non-recirculated air at a rate of 10-12 changes/hour. Air pressure differentials and strict sanitation were maintained in this isolation facility. The subjects received either 1 * 05 or 1 > 104 CFUs of stationary - phase E. coli in a 0.25 ml volume, inoculated by subcutaneous injection in the neck of neonatal chicks and resulted in E. coli septicemia. In this model, E. coli septicemia with airsacculitis, pericarditis, or perihepatitis develops in 60%-90% of birds that are not protected by treatment intervention. Two doses of E. coli were given to groups of birds to simulate field conditions since all birds in a commercial poultry barn will not be exposed to a constant dose of E. coli. Birds were evaluated three times daily at the critical stage then
twice thereafter for 7 days post challenge. Birds were observed for clinical signs and each individual was assigned a daily clinical score: 0 = normal; 0.5 = slightly abnormal appearance, slow to move; 1 = depressed, reluctant to move; 1.5 = reluctant to move, may take a drink and peck some; 2 = unable to stand or reach food or water; and 3 = found dead. Birds that received a clinical score of 2 were euthanatized by cervical dislocation. Chicks that were found dead or euthanatized were necropsied immediately. On day-7 post E. coli challenge, the remaining birds were euthanatized by cervical dislocation. Bacterial swabs were taken from the air sacs and cultured on sheep blood agar using a typical method of inoculation and streaking on four quadrants of the plate of medium. A semi quantitative estimate of E. coli isolation was conducted on sheep blood agar. Growth on these plates was recorded on a scale from 0 to 4+, where 0 = no growth; 1 + = growth of bacteria on the area 1 ; 2+ = growth of the bacteria on areas 1 and 2; 3+ = growth of bacteria on areas 1 , 2, and 3; and 4+ = growth of bacteria on areas 1 , 2, 3, and 4.
Synthetic CpG ODN and CpG ODN formulations.
[00123] The sequence of CpG ODN used was 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO:1 ). ODNs were produced with a phosphorothioate backbone. This synthetic CpG-ODN is available through a commercial source, for example Eurofins MWG Operon, Huntsville, Alabama, USA. CpG-ODN formulations were prepared either with SWNTs or lipid surfactant composites (LSC) at the School of Pharmacy, University of Waterloo, Canada. Synthetic CpG-ODN was diluted in sterile, pyrogen-free saline or formulation substrates and administered in a 100 μΙ volume by either the in ovo route into the amniotic cavity through the air cell of the egg using a 20 gauge, 1 inch needle,. The volume of the injection and the length of the needle were selected to simulate the in ovo technology used in the poultry industry.
CNT formulations
[00124] SWNT#1 CpG-ODN was prepared using 0.1 mg/mL HiPco SWNTs (Unidym, Inc., Sunnyvale, CA) and 0.5 mg/mL CpG-ODN aqueous solution (quantum satis with sterile water).
[00125] SWNT#2 CpG-ODN contained 0.1 mg/mL Puretubes SWNTs (Nanolntegris, Inc., Menlo Park, CA; supplied as a powder) and 0.5 mg/mL CpG-ODN aqueous solution (quantum satis with sterile water).
[00126] Both of the above CNT formulations were prepared by weighing out the required amount of the SWNT powder, adding the required amount of the CpG-ODN aqueous solution to the SWNT powder in a glass vial, and then bath sonicating the mixture for 5 h at temperatures not exceeding 40 °C. Final doses contained 10 pg SWNT and 50 μg CpG-ODN per 100 pi.
Lipid-surfactant formulations
[00127] LSC-CpG-ODN formulations (LSC#1 ) were made up of two phases: an aqueous phase (AP; 1.1 mg/mL gemini surfactant 12-7N-12 [synthesized in house according to Wettig et al. 2007 32], 0.5mg/ml CpG-ODN, quantum satis with sterile water [Fisher Scientific, Toronto, ON, Canada]) and a lipid phase (LP; 2% w/w Phospholipon 90H [Nattermann Phospholipids GmbH, Koln, Germany], 0.2% w/w cholesterol [Croda, Vaughan, ON, Canada], 4% w/w propylene glycol [Spectrum Chemicals, Gardena, CA]). In a glass vial, the required amount of CpG-ODN solution was added to the gemini surfactant powder and topped up with the sterile water (AP). In a second glass vial, all of the LP ingredients were weighed out and melted in a 70 °C water bath to a clear liquid. The premixed, prewarmed (to 40 °C) AP was added to the LP and incorporated by intermittent vortexing/heating until a homogenous formulation formed. This final mixture was then sonicated in a cup-horn Sonicator 4000 (Misonix, Qsonica, LLC, Newtown, CT) on amplitude 1 for 30 min.
[00128] Gemini surfactant-CpG-ODN complexes were prepared with 0.125% (w/v) gemini surfactant 12-3-12 (synthesized in house according to Donkuru et al. 2012 33) at 0.5 mg/mL CpG-ODN. The mixture was bath sonicated for 3 h at temperatures not exceeding 40 °C.
Experimental design
Delivery of CpG ODN formulations by the in-ovo route
[00129] The objective of this experiment was to study whether CpG- ODN formulated with SWNTs or LSC enhanced the immunoprotective effects in neonatal birds. Day 18 old embryonated eggs were injected with 50 pg of CpG-ODN formulated with SWNT (SWNT#1 CpG-ODN), LSC-CpG-ODN (LSC#1 ), unformulated CpG-ODN or saline. Each of four groups of embryonating eggs received 100 μΙ of formulation or saline by the in ovo route in the amniotic cavity through the air cell using 21 gauge needles with 1 inch length. Forty birds were randomly allocated into each of four groups. Groups of birds were inoculated on day 1 of age or 24 h following post-hatch with 1 *105 or 1 *104 CFU of stationary phase E. coli by the subcutaneous route in the neck. Half of each group (n=20) were inoculated with 1x105 CFU of E. coli and the remaining of the group (n=20) was inoculated with 1 x104 CFU of E. coli. Birds were examined daily for 7 days for clinical signs following E. coli challenge. Bacterial isolations from air sacs were conducted in all dead and euthanized birds during the clinical evaluation period, and at the termination of the experiment.
[00130] The second part of the objective was to study the immunoprotective effect of CpG-ODN formulated with two other delivery systems: SWNT (SWNT#2 CpG-ODN) and gemini surfactant-CpG-ODN. In ovo delivery of formulations, E. coli challenge experiments following clinical evaluation, mortality and bacterial isolations were performed as stated above. In this trial the group sizes were SWNT#2-CpG-ODN: n = 33; gemini surfactant-CpG-ODN: n = 40; CpG-ODN: n = 26; and Saline n = 40.
Safety of CpG-ODN formulated with CNT or LSC
[00131] The third objective of these experiments was to study the safety and toxicity of these CpG-ODN formulations in neonatal broiler chickens until 9 days post-hatch. This experiment was conducted in parallel to the above experiments. Four groups of birds (n=18) were injected with SWNT#1 -CpG- ODN, LSC-CpG-ODN, CpG-ODN or saline by the in ovo route as described above, but were not challenged with E. coli. Birds were examined daily for any clinical signs and mortality. Tissue sections were collected from the gastrointestinal tract (crop, esophagus, proventriculus, gizzard, duodenum, jejunum, ileum, ceca), kidneys, lungs, trachea and lymphoid organs (spleen, bursa, thymus) at 19, 20 and 21 days of incubation and at 3, 6 and 9 days post-hatch for histopathology. At each time point, three embryonated eggs or birds were randomly selected and euthanized for sample collection. Tissue sections were fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned at 5pm thickness and stained with hematoxylin and eosin (H&E).
Statistical analysis
[00132] Survival and other data were analyzed with the use of Prism (Prism 5.0, GraphPad Software Inc., San Diego, CA) and Statistix7 (Analytical Software, Tallahassee, FL) with a significance level of P < 0.05. The survival patterns and median survival times were compared using the log-rank test and chi-square statistics. The relative risk of mortality for control subjects was calculated using proportional hazards regression. The clinical score for each bird was summed over the 8-day observation period and the significance of differences among groups was tested with the use of the Kruskal-Wallis nonparametric analysis of variance. The homogeneity of distribution of bacterial scores was tested using chi-square statistics.
Results:
Delivery of CpG ODN formulations by the in-ovo route
[00133] The unchallenged viability control birds experienced no mortality, and the groups of birds that received CpG-ODN either alone or in any formulation experienced about half the relative risk of mortality as the birds that received saline (0.48; p=0.0020 in the first trial and 0.51 ; p=0.0044 in the second trial).
[00134] Birds in the first trial that received either CpG-ODN formulated with SWNT#1 or LSC#1 (> 75% survival) experienced one-third (0.32; p<0.001 ) the relative risk of mortality following a lethal dose of E. coli compared to CpG-ODN alone and saline control groups (30% survival) (Fig. 1 ). The cumulative clinical score was significantly lower in birds who received CpG-ODN formulated with SWNT#1 or LSC#1 compared to birds who received either CpG-ODN alone or saline (p< 0.05) (Figure 2). Moreover, birds who received CpG-ODN formulated with either SWNT#1 or LSC#1 had a significantly greater proportion of lower bacterial loads compared to birds that received CpG-ODN alone or saline (p<0.005) (Figure 3 and Table 1 ).
[00135] The eggs that were set and treated did not all hatch in one day; hence some group sizes were reduced. SWNT#2-CpG n=33; gemini surfactant-CpG-ODN n=40; unformulated CpG n=26; Saline n=40). The second challenge, birds which received CpG-ODN formulated with SWNT#2, gemini surfactant-CpG-ODN - experienced significantly lower risk of mortality (0.57; p =0.0149) compared to the birds who received CpG-ODN alone or saline (Fig. 4) The cumulative clinical score was significantly different among groups (p=0.016) and there were 2 sets of groups between which the CCS was significantly different (p<0.05) as shown in Figure 5. Additionally, birds who received various treatments had significantly different bacterial loads (overall Chi-square=30.94; p= 0.002), and birds that received CpG-ODN alone or saline had the higher levels of bacteria (Figure 6).
Safety of CpG-ODN formulated with CNT or LSC
[00136] No mortality or any clinical signs were detected in any of the unchallenged birds during the experiment. Histopathological lesions were not noted in any of the organs at any of the time points examined in the groups of birds who received SWNT#1 CpG-ODN, LSC # 1 CpG-ODN, CpG-ODN or saline.
Discussion
[00137] Protective immunotherapeutic treatments have been a topic of great interest as a method to fight infectious disease because of their ability to stimulate the host's immune system and prepare the host to fight pathogenic microbes. In the food-animal industry, disease prevention by prophylactic measures or by immune stimulation is preferred compared to the use of therapeutic agents which may lead to concern about residues in edible products. This has become especially important due to a number of food safety and human health issues. The use of antibiotics in the animal industry has been related to the emergence of resistant strains of bacteria and the possibility of drug residues in meat products. For these reasons, novel immunostimulants may serve as alternative, desirable ways to prevent disease. CpG-ODN has been used as an immuno stimulant in many species, including chickens8" 1 , 26. Previously, the present inventors have demonstrated that CpG-ODN is an effective immunostimulant in chickens and appeared to have its effectiveness for 6 days1 1 following administration. Moreover, the present inventors were able to increase effectiveness of CpG-ODN by formulating with polyphosphazenes24. In the present study, the present inventors demonstrated a significant health promoting effect of CpG-ODN formulated with CNT or LSC. CpG-ODN formulations significantly increase survival, reduce clinical signs and decrease the bacterial load in birds challenged with a lethal dose of E. coli.
[00138] E. coli or Salmonella septicemia is common in the neonatal period of broiler chickens and causes a significant mortality and production
loss12. Furthermore, if broiler flocks experience mortality greater than 2% in the first week of life, the overall performance of the flock becomes very poor due to chronic infections, poor weight gain and uneven birds in the flock 27. It is essential to have good health during the first week of broiler chicken growth as it will provide better performance and profitability1. Currently in the broiler chicken industry, broiler chickens reach 2 kilograms body weight by 30-35 days post-hatch 28. Thus, in ovo delivery of CpG-ODN formulations either with CNT or lipid formulations will provide effective immunostimulation and likely be a better alternative to antibiotics. Likewise, in ovo delivery of vaccines is in common place in the broiler chicken industry. Hence, delivery of CpG-ODN formulations are industry feasible. The present inventors have previously demonstrated that in ovo delivery of unformulated CpG-ODN are very effective against E.coli infection1 1 or Salmonella12 septicemia in neonatal broilers and here have demonstrated a significant synergy or potentiation of CpG-ODN with CNT or lipid delivery systems as an immunostimulant in chicken embryos. Moreover, CpG-ODN formulations significantly reduce the bacterial load in birds infected with E. coli becoming a significant consideration if CpG-ODNs are able to reduce bacterial load in birds in field. The animal model of E. coli cannot be used to validate this possibility since the animal model causes very high (between 60-80%) mortality following challenge. In the animal model of E. coli, 50% of birds were infected with 1x104 cfu of E. coli and the remaining 50% with 1x105 cfu a higher dose of E. coli to simulate field challenge since all the birds in the field are not exposed at a constant dose of E. coli.
[00139] Broiler chicken embryos are a well suited model to study toxicity of CNT. In addition, all organs can be studied for histopathology to identify any morphological changes. The present inventors did not see embryo mortality, decreased hatchability, clinical signs or any evidence of alteration of morphology of any internal organs that were studied during day-18 of incubation until day-9 post-hatch. Moreover, lipid based delivery systems
have proven to be safe and effective for delivering CpG ODN in many
22 "¾1
species · .
[00140] In conclusion, CpG-ODN formulated with CNT or lipid surfactants was observed to synergistically enhance the immunoprotective efficiency against E. coli infections in neonatal broiler chickens. CpG-ODN formulations with CNT did not have adverse reactions in chicken embryos or neonatal broiler chickens. This is the first demonstration of in ovo delivery of CpG-ODN formulated with CNT or lipid-surfactant delivery systems against a lethal bacterial infection in broiler chickens.
[00141] While the present disclosure has been described with reference to what are presently considered to be the examples, it is to be understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
[00142] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
Table 1: Bacterial score per each bird according to bacterial growth on blood agar. Bacterial swabs were taken from air sacs.
Bacterial score SWNT #1- CpG ODN LSC # 1-CpG ODN CpG ODN Saline
0 20 ■■ - 17 5 . 5
8 10 7 7
5 ■ '7
+3 4 6 \5 14
, ■■ 3 4 5 . 7
Dibner, J.J. et al. Early feeding and development of the immune system in neonatal poultry. J Appl Poultry Res 7, 425-436 (1998). Goren, E. Observations on experimental infection of chicks with Escherichia coli. Avian pathology : journal of the W. V.P.A 7, 213-224 (1978).
Al-Ghamdi, M.S., El-Morsy, F., Al-Mustafa, Z.H., Al-Ramadhan, M. & Hanif, M. Antibiotic resistance of Escherichia coli isolated from poultry workers, patients and chicken in the eastern province of Saudi Arabia. Tropical medicine & international health : TM & IH 4, 278-283 (1999). Medzhitov, R. & Janeway, C.A., Jr. Decoding the patterns of self and nonself by the innate immune system. Science 296, 298-300 (2002). Ahmad-Nejad, P. et al. Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments. European journal of immunology 32, 1958-1968 (2002).
Krieg, A.M. CPG MOTIFS IN BACTERIAL DNA AND THEIR IMMUNE EFFECTS*. Annual review of immunology 20, 709-760 (2002).
Yamamoto, S. ef al. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiology and immunology 36, 983-997 (1992).
Cho, H.C. et al. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model. International immunopharmacology 8, 1401 - 1407 (2008).
Jorgensen, J.B., Johansen, L.-H., Steiro, K. & Johansen, A. CpG DNA Induces Protective Antiviral Immune Responses in Atlantic Salmon (Salmo salar L). Journal of virology 77, 1 1471 -1 1479 (2003).
Nichani, A.K. et al. In vivo immunostimulatory effects of CpG oligodeoxynucleotide in cattle and sheep. Veterinary immunology and immunopathology 98, 17-29 (2004).
Gomis, S. ef al. Protection of chickens against Escherichia coli infections by DNA containing CpG motifs. Infection and Immunity 71 , 857-863 (2003).
Taghavi, A. et al. Protection of Neonatal Broiler Chicks Against Salmonella Typhimurium Septicemia by DNA Containing CpG Motifs. Avian Diseases 52, 398-406 (2008).
Klinman, D.M. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat Rev Immunol 4, 249-258 (2004).
Gomis, S. ef al. Protection of chickens against a lethal challenge of Escherichia coli by a vaccine containing CpG oligodeoxynucleotides as an adjuvant. Avian Diseases 51 , 78-83 (2007).
Gomis, S. et al. Protection of neonatal chicks against a lethal challenge of Escherichia coli using DNA containing cytosine-phosphodiester- guanine motifs. Avian Diseases 48, 813-822 (2004).
Dalloul, R.A. ef al. In vivo effects of CpG oligodeoxynucleotide on Eimeria infection in chickens. Avian Dis 48, 783-790 (2004).
17. Wang, X. et al. Efficacy of DNA vaccines against infectious bursal disease virus in chickens enhanced by coadministration with CpG oligodeoxynucleotide. Avian Dis 47, 1305-1312 (2003).
18. Dar, A. et al. CpG Oligodeoxynucleotides Activate Innate Immune Response that Suppresses Infectious Bronchitis Virus Replication in
Chicken Embryos. Avian Diseases 53, 261 -267 (2009).
19. Badie, B. et al. Carbon Nanotubes Enhance CpG Uptake and Potentiate Antiglioma Immunity. Clin Cancer Res 17, 771 -782 (201 1 ).
20. de Jong, S. et al. Encapsulation in liposomal nanoparticles enhances the immunostimulatory, adjuvant and anti-tumor activity of subcutaneously administered CpG ODN. Cancer immunology, immunotherapy : Cll 56, 1251 -1264 (2007).
21. Wilson, K.D., de Jong, S.D. & Tarn, Y.K. Lipid-based delivery of CpG oligonucleotides enhances immunotherapeutic efficacy. Advanced Drug Delivery Reviews 61 , 233-242 (2009).
22. Alcon, V. et al. Mucosal delivery of bacterial antigens and CpG oligonucleotides formulated in biphasic lipid vesicles in pigs. The AAPS Journal 7, E566-E571 (2005).
23. Litzinger, D.C. et al. Fate of cationic liposomes and their complex with oligonucleotive in vivo. Biochimica et Biophysica Acta (BBA) -
Biomembranes 1281 , 139-149 ( 1996).
24. Taghavi, A. et al. Enhancement of immunoprotective effect of CpG- ODN by formulation with polyphosphazenes against E. coli septicemia in neonatal chickens. Current drug delivery 6, 76-82 (2009).
25. Bianco, A., Kostarelos, K. & Prato, M. Applications of carbon nanotubes in drug delivery. Current opinion in chemical biology 9, 674- 679 (2005).
26. Saavedra, R. et al. CpG-containing ODN has a limited role in the protection against Toxoplasma gondii. Parasite immunology 26, 67-73 (2004).
27. Klasing, K.C. Nutritional modulation of resistance to infectious diseases. Poultry science 77, 1 1 19-1 125 (1998).
28. Rampling, A. et al. SALMONELLA ENTERITIDIS PHAGE TYPE 4 INFECTION OF BROILER CHICKENS: A HAZARD TO PUBLIC HEALTH. The Lancet 334, 436-438 (1989).
29. Foldvari, M. & Bagonluri, M. Carbon nanotubes as functional excipients for nanomedicines: I. pharmaceutical properties. Nanomed- Nanotechnol 4, 173-182 (2008).
30. Foldvari, M. & Bagonluri, M. Carbon nanotubes as functional excipients for nanomedicines: I I. Drug delivery and biocompatibility issues.
Nanomed-Nanotechnol 4, 183-200 (2008).
31. Alcon, V.L. et al. Intranasal immunization using biphasic lipid vesicles as delivery systems for OmIA bacterial protein antigen and CpG oligonucleotides adjuvant in a mouse model. Journal of Pharmacy and Pharmacology 57 ', 955-961 (2005).
32. Wettig SD, Wang C, Verrall RE, Foldvari . (2007) Thermodynamic and aggregation properties of aza- and imino-substituted gemini surfactants designed for gene delivery. Phys Chem Chem Phys 9:871- 877
33. Donkuru, M., Wettig, S.D., Verrall, R.E., Badea, I. and Foldvari, M.
(2012) Non-viral gene delivery into keratinocytes using pH-sensitive gemini nanoparticles. J. Materials Chem. 22:6232-6244
Claims
1. A composition comprising (a) a CpG oligonucleotide noncovalently complexed with a non-functionalized carbon nanotube or (b) a CpG oligonucleotide complexed with a cationic lipid surfactant; and a pharmaceutically acceptable carrier.
2. The composition of claim 1 , wherein the non-functionalized carbon nanotube of (a) is a single-walled carbon nanotube.
3. The composition of claim 2, wherein the mean length of the non- functionalized single-walled carbon nanotube of (a) is from about 50 nm to about 5000 nm.
4. The composition of claim 3, wherein the mean length of the non- functionalized single-walled carbon nanotube is about 100 nm to about 1000 nm.
5. The composition of claim 2, wherein the mean diameter of the non- functionalized single-walled carbon nanotube of (a) is from about 0.6 nm to about 2.0 nm.
6. The composition of claim 5, wherein the mean diameter of the non- functionalized single-walled carbon nanotube is about 1.0 nm.
7. The composition of claim 1 , wherein the CpG oligonucleotide complexed with the cationic lipid surfactant in (b) is further formulated with a lipid phase to form a liposome.
8. The composition of claim 7, wherein the lipid phase comprises about 2 wt% of a phospholipid, about 0.2 wt% cholesterol and about 4 wt% propylene glycol.
9. The composition of claim 1 or 7-8, wherein the cationic lipid surfactant is a dicationic gemini surfactant having the configuration m-s-m or m-sN-m.
10. The composition of claim 9, wherein the dicationic gemini surfactant has the configuration 12-3-12 or 12-7N-12.
11. The composition of claim 1 or 7-8, wherein the cationic lipid surfactant is at least one dicationic gemini surfactant having a structure of Formula (I ):
)
wherein, each of R and R2 is the same or different and is independently selected from C3-4oalkyl, C3-4oalkenyl and C3-4oalkynyl;
each of R3, R4, R5 and R6 is the same or different and is independently selected from Ci_3alkyl;
Y is selected from C2-i2alkylene, C3-i2alkenylene and -Ci-6alkylene-NR7- Ci-6alkylene-, wherein R7 is H, Ci-4alkyl, C2-4alkenyl or C2-4alkynyl; and each X" is the same or different and is a pharmaceutically acceptable counteranion.
12. The composition of claim 11 , wherein R1 and R2 are both -(CH2)nCH3; each of R3, R4, R5 and R6 is -CH3; Y is -(CH2)3- and each X" is the same and is Br".
13. The composition of claim 1 1 , wherein R1 and R2 are both -(CH2)iiCH3; each of R3, R4, R5 and R6 is -CH3; Y is -(CH2)3-N(CH3HCH2)3- and each X" is the same and is Br".
14. The composition of any one of claims 1 to 13, wherein the CpG oligonucleotide has a nucleotide sequence selected from
TCGTCGTTGTCGTTTTGTCGTT (SEQ I D NO:1 ),
TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO:2),
TCGTCGTTTGTCGTTTTGTCGTT (SEQ ID NO:3), and ggGGGACGATCGTCggggG (SEQ ID N0:4).
15. The composition of any one of claims 1 to 13, wherein the CpG oligonucleotide has the nucleotide sequence 5'- TCGTCGTTGTCGTTTTGTCGTT -3' (SEQ ID NO: 1 ).
16. The composition of any one of claims 1 to 15, wherein the CpG oligonucleotide is unmethylated.
17. A method of promoting innate immunity in an avian subject comprising administering in ovo to the avian subject the composition of any one of claims 1 -16.
18. The method of claim 17, for treating or preventing a bacterial, protozoan or viral disease or infection.
19. The method of claim 18, wherein the bacteria are E. coli or Salmonella.
20. The method of claim 18, wherein the protozoan disease or infection is Eimeria.
21. The method of claim 18, wherein the viral disease or infection is infectious bursal disease or infectious bronchitis.
22. The method of any one of claims 17-21 , wherein the administration in ovo is 2 to 3 days prior to hatching.
23. The method of any one of claims 17-22, wherein the bird is a turkey or chicken.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CA2013/000190 WO2014134698A1 (en) | 2013-03-06 | 2013-03-06 | Cpg oligonucleotide formulations and methods and uses thereof |
| CA2940893A CA2940893C (en) | 2013-03-06 | 2013-03-06 | Cpg oligonucleotide formulations and methods and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CA2013/000190 WO2014134698A1 (en) | 2013-03-06 | 2013-03-06 | Cpg oligonucleotide formulations and methods and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014134698A1 true WO2014134698A1 (en) | 2014-09-12 |
Family
ID=51490507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2013/000190 Ceased WO2014134698A1 (en) | 2013-03-06 | 2013-03-06 | Cpg oligonucleotide formulations and methods and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| CA (1) | CA2940893C (en) |
| WO (1) | WO2014134698A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019014761A1 (en) * | 2017-07-17 | 2019-01-24 | University Of Saskatchewan | Methods and compositions for inducing protective immunity |
| EP3357507A4 (en) * | 2015-09-30 | 2019-05-29 | Shionogi & Co., Ltd | NUCLEIC ACID DERIVATIVE WITH IMMUNOSTIMULATING ACTIVITY |
| CN110218729A (en) * | 2019-05-07 | 2019-09-10 | 华南农业大学 | A kind of specific chicken immune activation agent CpG-ODN and its application |
| US10940201B2 (en) | 2015-09-30 | 2021-03-09 | Shionogi & Co., Ltd. | Nucleic acid derivative having immunostimulatory activity |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003030656A2 (en) * | 2001-10-06 | 2003-04-17 | Merial Limited | Methods and compositions for promoting growth and innate immunity in young animals |
| WO2005039642A1 (en) * | 2003-10-24 | 2005-05-06 | University Of Saskatchewan | Dna delivery with gemini cationic surfactants |
-
2013
- 2013-03-06 CA CA2940893A patent/CA2940893C/en active Active
- 2013-03-06 WO PCT/CA2013/000190 patent/WO2014134698A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003030656A2 (en) * | 2001-10-06 | 2003-04-17 | Merial Limited | Methods and compositions for promoting growth and innate immunity in young animals |
| WO2005039642A1 (en) * | 2003-10-24 | 2005-05-06 | University Of Saskatchewan | Dna delivery with gemini cationic surfactants |
Non-Patent Citations (5)
| Title |
|---|
| BIANCO, A. ET AL.: "Cationic carbon nanotubes bind to CpG oligodeoxynucleotides and enhance their immunostimulatory properties.", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 127, no. 1, 12 January 2005 (2005-01-12), pages 58 - 59 * |
| DE JONG, S. ET AL.: "Encapsulation in liposomal nanoparticles enhances the immunostimulatory, adjuvant and anti-tumor activity of subcutaneously administered CpG ODN.", CANCER IMMUNOLOGY, IMMUNOTHERAPY: CII, vol. 56, no. 8, August 2007 (2007-08-01), pages 1251 - 1264 * |
| KRISHNAMACHARI, Y. ET AL.: "Innovative strategies for co- delivering antigens and CpG oligonucleotides", ADVANCED DRUG DELIVERY REVIEWS, vol. 61, no. 3, 28 March 2009 (2009-03-28), pages 205 - 217 * |
| TAGHAVI, A. ET AL.: "Enhancement of immunoprotective effect of CpG-ODN by formulation with polyphosphazenes against E.coli septicemia in neonatal chickens.", CURRENT DRUG DELIVERY, vol. 6, no. 1, January 2009 (2009-01-01), pages 76 - 82 * |
| ZHAO, D. ET AL.: "Carbon nanotubes enhance CpG uptake and potentiate anti- glioma immunity.", CLINICAL CANCER RESEARCH, vol. 17, no. 4, 15 February 2011 (2011-02-15), pages 771 - 782 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3357507A4 (en) * | 2015-09-30 | 2019-05-29 | Shionogi & Co., Ltd | NUCLEIC ACID DERIVATIVE WITH IMMUNOSTIMULATING ACTIVITY |
| RU2730871C1 (en) * | 2015-09-30 | 2020-08-26 | Сионоги Энд Ко., Лтд. | Nucleic acid derivative exhibiting immunostimulating activity |
| US10940201B2 (en) | 2015-09-30 | 2021-03-09 | Shionogi & Co., Ltd. | Nucleic acid derivative having immunostimulatory activity |
| WO2019014761A1 (en) * | 2017-07-17 | 2019-01-24 | University Of Saskatchewan | Methods and compositions for inducing protective immunity |
| US11839652B2 (en) | 2017-07-17 | 2023-12-12 | University Of Saskatchewan | Methods and compositions for inducing protective immunity |
| CN110218729A (en) * | 2019-05-07 | 2019-09-10 | 华南农业大学 | A kind of specific chicken immune activation agent CpG-ODN and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2940893C (en) | 2022-07-26 |
| CA2940893A1 (en) | 2014-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7278551B2 (en) | Oligonucleotide-containing complex having immunostimulatory activity and use thereof | |
| Gunawardana et al. | Protection of neonatal broiler chickens following in ovo delivery of oligodeoxynucleotides containing CpG motifs (CpG-ODN) formulated with carbon nanotubes or liposomes | |
| ES2661038T3 (en) | Encapsulated vaccines for oral and booster vaccination of fish and other animals | |
| ES2943385T3 (en) | Modifying compound of the lipidated immune response and its medical use | |
| Kitiyodom et al. | The potential of mucoadhesive polymer in enhancing efficacy of direct immersion vaccination against Flavobacterium columnare infection in tilapia | |
| NZ718900A9 (en) | Complex containing oligonucleotide having immunopotentiating activity and use thereof | |
| Giri et al. | Applications of carbon nanotubes and polymeric micro‐/nanoparticles in fish vaccine delivery: progress and future perspectives | |
| CA2940893C (en) | Cpg oligonucleotide formulations and methods and uses thereof | |
| BRPI0910036B1 (en) | kit comprising a first administrator for the intravenous route of a cationic lipid-dna complex (cldc) and a second administrator for a vaccine | |
| TW201043698A (en) | Enhanced immune response in avian species | |
| Samms et al. | Oral delivery of a dsRNA-phytoglycogen nanoparticle complex enhances both local and systemic innate immune responses in rainbow trout | |
| CN114681612B (en) | Bladder perfusion medicine and preparation method and application thereof | |
| US11839652B2 (en) | Methods and compositions for inducing protective immunity | |
| JP6975132B2 (en) | Liposomal adjuvant composition | |
| JP7487892B2 (en) | Methods for preparing pharmaceutical vesicle formulations and related products and uses - Patents.com | |
| EP3471706A1 (en) | Oral pharmaceutical composition comprising a pharmaceutically active agent, at least one cationic bioadhesive polymer and at least two anionic polymers | |
| Tomporowski et al. | Carbon nanotubes significantly enhance the biological activity of CpG ODN in chickens | |
| CN115737800B (en) | Composite liposome adjuvant and preparation method thereof | |
| CN110218729B (en) | Chicken specific immune activator CpG-ODN and application thereof | |
| Parra et al. | Toll like receptors agonists-based nanomedicines as veterinary immunotherapies | |
| Gunawardana | IMMUNOPROTECTIVE MECHANISMS ASSOCIATED WITH IN OVO DELIVERY OF OLIGODEOXYNUCLEOTIDES CONTAINING CpG MOTIFS (CpG-ODN) AND FORMULATION OF CpG WITH NANOPARTICLES TO ENHANCE ITS EFFICACY IN NEONATAL BROILER CHICKENS | |
| HK40013889A (en) | Complex containing oligonucleotide having immunopotentiating activity and use thereof | |
| CN121337975A (en) | A lipid nanoparticle targeting immune tissues and cells, its preparation method and application | |
| HK1227439A1 (en) | Complex containing oligonucleotide having immunopotentiating activity and use thereof | |
| HK1227439B (en) | Complex containing oligonucleotide having immunopotentiating activity and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13877339 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13877339 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2940893 Country of ref document: CA |


