WO2014130364A1 - Collection of probes for autistic spectrum disorders and their use - Google Patents

Collection of probes for autistic spectrum disorders and their use Download PDF

Info

Publication number
WO2014130364A1
WO2014130364A1 PCT/US2014/016537 US2014016537W WO2014130364A1 WO 2014130364 A1 WO2014130364 A1 WO 2014130364A1 US 2014016537 W US2014016537 W US 2014016537W WO 2014130364 A1 WO2014130364 A1 WO 2014130364A1
Authority
WO
WIPO (PCT)
Prior art keywords
collection
probes
nucleotide sequence
biomarkers
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/016537
Other languages
French (fr)
Inventor
Stephen GLATT
Ming TSUANG
Eric COURCHESNE
Nicholas J. Schork
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
University of California Berkeley
University of California San Diego UCSD
Research Foundation of the State University of New York
Original Assignee
Scripps Research Institute
University of California Berkeley
University of California San Diego UCSD
Research Foundation of the State University of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute, University of California Berkeley, University of California San Diego UCSD, Research Foundation of the State University of New York filed Critical Scripps Research Institute
Priority to US14/770,205 priority Critical patent/US20160017424A1/en
Publication of WO2014130364A1 publication Critical patent/WO2014130364A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention is directed to collections of probes for autistic disorders and their use.
  • Autism spectrum disorders include Autistic Disorder (autism), Asperger Disorder, and Pervasive Developmental Disorder - Not Otherwise Specified (PDD-NOS).
  • PDD-NOS is characterized by developmental delays of sociability, communication and use imagination.
  • Asperger's syndrome is a more severe form of PDD- NOS but lacks the language and intelligence deficits normally associated with autism.
  • Autism is exemplified by severe communication impairments, social interaction deficits and repetitive/stereotypic behaviors.
  • Each of these disorders has specific diagnostic criteria as outlined by the American Psychiatric Association (APA) in its Diagnostic & Statistical Manual of Mental Disorders (DSM-IV-TR).
  • APA American Psychiatric Association
  • DSM-IV-TR Diagnostic & Statistical Manual of Mental Disorders
  • lymphoblastoid cell lines Purcell et al., "Postmortem Brain Abnormalities of the
  • the present invention is directed to overcoming these and other limitations in the art.
  • a first aspect of the present invention relates to a collection of probes or their complements that recognize biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF biomarkers; (2) MRPS10, ARF3, CLORF85, KCNE1L, BF 2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 biomarkers; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 biomarkers; (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ,
  • the present invention is also directed to a method of diagnosing whether a subject has an ASD that involves obtaining a biological sample from a subject potentially having an ASD and providing a collection of probes recognizing biomarkers comprising as least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPll; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1; or (4) C50RF44
  • the biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample.
  • This method further involves detecting any hybridization as a result of said contacting and identifying whether the subject has an ASD based on said detecting.
  • Another aspect of the present invention is directed to a method of determining whether a subject has a predisposition for developing an ASD.
  • This method involves obtaining a biological sample from a subject at risk of potentially having a predisposition for developing an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1 , MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN
  • the biological sample from the subject is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample.
  • This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has a predisposition for developing an ASD based on said detecting.
  • the present invention is also directed to a method of diagnosing whether a subject has an autism spectrum disorder involving obtaining a biological sample from a subject potentially having an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPI1, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNA1, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54
  • GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has an autism spectrum disorder based on said detecting.
  • a final aspect of the present invention relates to a method of diagnosing whether a subject has a predisposition for developing an autism spectrum disorder involving obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12- EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNAl, C50RF44, ARHG
  • the present invention provides reliable diagnostics to more people, facilitate primary and differential diagnoses, and, importantly, result in earlier identification of the disorder in affected children. This will lead to earlier intervention and a more favorable prognosis.
  • the identification of ASD-specific biomarkers could revolutionize the diagnosis and treatment of these disorders. For example, the availability of ASD biomarkers could expedite and standardize the diagnostic process, which presently involves considerable time, effort, and uncertainty. By allowing earlier identification, biomarkers could hasten the provision of effective treatment and improve prognoses. Further, biomarkers could form the basis for prevention efforts targeting at- risk individuals, which could reduce the morbidity and prevalence of these conditions.
  • biomarker research may also help differentiate subtypes of ASDs, which in turn may shed light on the distinct etiologies of these conditions.
  • a first aspect of the present invention relates to a collection of probes or their complements that recognize biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF biomarkers; (2) MRPS10, ARF3, CLORF85, KCNE1L, ⁇ 2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 biomarkers; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 biomarkers; (4) C50RF44, ARHGAP
  • ZNF329 has the nucleotide sequence corresponding to the NCBI
  • NM_024620.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with ZNF329 has the nucleotide sequence of SEQ ID NO: 1 as shown below:
  • LOC641518 has the nucleotide sequence corresponding to the NCBI
  • TAP1 has the nucleotide sequence corresponding to the NCBI Reference
  • NM 000593.5 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TAP1 has the nucleotide sequence of SEQ ID NO: 3 as shown below:
  • GBP2 has the nucleotide sequence corresponding to the NCBI Reference
  • NM_004120.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GBP2 has the nucleotide sequence of SEQ ID NO: 4 as shown below:
  • RAB3IP has the nucleotide sequence corresponding to the NCBI
  • NM_175624.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RAB3IP has the nucleotide sequence of SEQ ID NO: 5 as shown below:
  • MYOF has the nucleotide sequence corresponding to the NCBI Reference
  • NM_133337.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MYOF has the nucleotide sequence of SEQ ID NO: 6 as shown below:
  • MRPS 10 has the nucleotide sequence corresponding to the NCBI
  • NM_018141.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MRPS 10 has the nucleotide sequence of SEQ ID NO: 7 as shown below:
  • ARF3 has the nucleotide sequence corresponding to NCBI Reference
  • C10RF85 has the nucleotide sequence corresponding to NCBI Reference
  • NM_144580.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C10RF85 has the nucleotide sequence of SEQ ID NO: 9 as shown below:
  • KCNE1L has the nucleotide sequence corresponding to NCBI Reference
  • NM_012282.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with KCNE1L has the nucleotide sequence of SEQ ID NO: 10 as shown below:
  • BIN2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_016293.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with BIN2 has the nucleotide sequence of SEQ ID NO: 11 as shown below:
  • CACHD1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_020925.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CACHD1 has the nucleotide sequence of SEQ ID NO: 12 as shown below:
  • CYB5R3 has the nucleotide sequence corresponding to NCBI Reference
  • FKBP12-EXI has the nucleotide sequence corresponding to NCBI
  • CHM has the nucleotide sequence corresponding to NCBI Reference
  • NM 000390.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CHM has the nucleotide sequence of SEQ ID NO: 15 as shown below:
  • DUS4L has the nucleotide sequence corresponding to NCBI Reference
  • S equence NM_ 181581.1 , which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DUS4L has the nucleotide sequence of SEQ ID NO: 16 as shown below:
  • STX5 has the nucleotide sequence corresponding to NCBI Reference
  • AK3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_016282.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AK3 has the nucleotide sequence of SEQ ID NO 18 as shown below:
  • BU580973 has the nucleotide sequence corresponding to NCBI Reference
  • BU580973 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with BU580973 has the nucleotide sequence of SEQ ID NO: 19 as shown below:
  • TCRA has the nucleotide sequence corresponding to NCBI Reference
  • CR608770 has the nucleotide sequence corresponding to NCBI Reference
  • SPI1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_003120.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SPI1 has the nucleotide sequence of SEQ ID NO: 22 as shown below:
  • ACGCC AGCTGGGCGTCAGACCCCACCGGGGCAACCTTGC AGAGGACGACC
  • SC65 has the nucleotide sequence corresponding to NCBI Reference
  • FUNDC2 has the nucleotide sequence corresponding to NCBI Reference
  • NDRG2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_201539.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NDRG2 has the nucleotide sequence of SEQ ID NO: 25 as shown below:
  • RPL28 has the nucleotide sequence corresponding to NCBI Reference
  • SRP54 has the nucleotide sequence corresponding to NCBI Reference
  • LOC643466 has the nucleotide sequence corresponding to NCBI
  • ZDHHC1 IB has the nucleotide sequence corresponding to NCBI
  • NSUN5B has the nucleotide sequence corresponding to NCBI Reference
  • NM 001039575.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NSUN5B has the nucleotide sequence of SEQ ID NO: 30 as shown below:
  • NDRG3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_022477.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NDRG3 has the nucleotide sequence of SEQ ID NO: 31 as shown below:
  • DHRS3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_004753.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DHRS3 has the nucleotide sequence of SEQ ID NO: 32 as shown below:
  • CPEB2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_182646.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CPEB2 has the nucleotide sequence of SEQ ID NO: 33 as shown below:
  • PPID has the nucleotide sequence corresponding to NCBI Reference
  • NM_005038.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with PPID has the nucleotide sequence of SEQ ID NO: 34 as shown below:
  • FOXP1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_032682.5 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with FOXP1 has the nucleotide sequence of SEQ ID NO: 35 as shown below:
  • EFNAl has the nucleotide sequence corresponding to NCBI Reference
  • NM_004428.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with EFNAl has the nucleotide sequence of SEQ ID NO: 36 as shown below:
  • An example of another probe that hybridizes with EFNAl has the nucleotide sequence of SEQ ID NO: 37 as shown below:
  • C50RF44 has the nucleotide sequence corresponding to NCBI Reference Sequence: NR 003545.1 , which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C50RF44 has the nucleotide sequence of SEQ ID NO: 38 as shown below:
  • ARHGAP25 has the nucleotide sequence corresponding to NCBI
  • CTDSPL2 has the nucleotide sequence corresponding to NCBI Reference Sequence: NM 016396.2, which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CTDSPL2 has the nucleotide sequence of SEQ ID NO: 40 as shown below:
  • CKAP2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_001098525.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CKAP2 has the nucleotide sequence of SEQ ID NO: 41 as shown below:
  • MAZ has the nucleotide sequence corresponding to NCBI Reference
  • BET1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_005868.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with BET1 has the nucleotide sequence of SEQ ID NO: 43 as shown below:
  • CR617556 has the nucleotide sequence corresponding to NCBI Reference
  • RPE has the nucleotide sequence corresponding to NCBI Reference
  • EHHADH has the nucleotide sequence corresponding to NCBI Reference
  • CMAH has the nucleotide sequence corresponding to NCBI Reference
  • ECD has the nucleotide sequence corresponding to NCBI Reference
  • NM_007265.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with ECD has the nucleotide sequence of SEQ ID NO 48 as shown below:
  • NMD3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_015938.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NMD3 has the nucleotide sequence of SEQ ID NO: 49 as shown below:
  • SLC10A7 has the nucleotide sequence corresponding to NCBI Reference
  • SNX4 has the nucleotide sequence corresponding to NCBI Reference
  • NM_003794.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SNX4 has the nucleotide sequence of SEQ ID NO: 51 as shown below:
  • NEDD1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_152905.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NEDD1 has the nucleotide sequence of SEQ ID NO: 52 as shown below:
  • GABPA has the nucleotide sequence corresponding to NCBI Reference
  • NM 002040.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GABPA has the nucleotide sequence of SEQ ID NO: 53 as shown below:
  • MAGMAS has the nucleotide sequence corresponding to NCBI Reference
  • NM 016069.9 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MAGMAS has the nucleotide sequence of SEQ ID NO: 54 as shown below:
  • UBE2V2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_003350.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with UBE2V2 has the nucleotide sequence of SEQ ID NO: 55 as shown below:
  • C150RF44 has the nucleotide sequence corresponding to NCBI Reference
  • PCGF6 has the nucleotide sequence corresponding to NCBI Reference
  • CABIN 1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_012295.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CABIN 1 has the nucleotide sequence of SEQ ID NO: 58 as shown below:
  • EIF3 J has the nucleotide sequence corresponding to NCBI Reference
  • NM_003758.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with EIF3 J has the nucleotide sequence of SEQ ID NO: 59 as shown below:
  • HS.561844 has the nucleotide sequence corresponding to NCBI Reference
  • IMPACT has the nucleotide sequence corresponding to NCBI Reference
  • NM_018439.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with IMPACT has the nucleotide sequence of SEQ ID NO: 61 as shown below:
  • ATAD2 has the nucleotide sequence corresponding to NCBI Reference
  • RGL2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_004761.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RGL2 has the nucleotide sequence of SEQ ID NO: 63 as shown below:
  • CASD 1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_022900.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CASD1 has the nucleotide sequence of SEQ ID NO: 64 as shown below:
  • TMEM185A has the nucleotide sequence corresponding to NCBI
  • TMEM185A has the nucleotide sequence of SEQ ID NO: 65 as shown below:
  • ESM1 has the nucleotide sequence corresponding to NCBI Reference
  • ADSSL1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_152328.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with ADSSL1 has the nucleotide sequence of SEQ ID NO: 67 as shown below:
  • ACSL5 has the nucleotide sequence corresponding to NCBI Reference
  • C10RF124 has the nucleotide sequence corresponding to NCBI Reference
  • NM_032018.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C10RF124 has the nucleotide sequence of SEQ ID NO: 69 as shown below:
  • CYB561 has the nucleotide sequence corresponding to NCBI Reference
  • MAP4K5 has the nucleotide sequence corresponding to NCBI Reference
  • NM_006575.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MAP4K5 has the nucleotide sequence of SEQ ID NO: 71 as shown below:
  • CRIPl has the nucleotide sequence corresponding to NCBI Reference
  • NM_001311.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CRIPl has the nucleotide sequence of SEQ ID NO: 72 as shown below:
  • ING1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_198219.2 which is hereby incorporated by reference in its entirety .
  • An example of a probe that hybridizes with ING1 has the nucleotide sequence of SEQ ID NO: 73 as shown below:
  • LILRB1 has the nucleotide sequence corresponding to NCBI Reference
  • SPNS3 has the nucleotide sequence corresponding to NCBI Reference
  • CDH11 has the nucleotide sequence corresponding to NCBI Reference
  • NM_001797.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CDH11 has the nucleotide sequence of SEQ ID NO: 76 as shown below:
  • LOC642403 has the nucleotide sequence corresponding to NCBI
  • CASP4 has the nucleotide sequence corresponding to NCBI Reference
  • NM_001225.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CASP4 has the nucleotide sequence of SEQ ID NO: 78 as shown below:
  • TEAD2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_003598.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TEAD2 has the nucleotide sequence of SEQ ID NO: 79 as shown below:
  • KHDRBS3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_006558.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with KHDRBS3 has the nucleotide sequence of SEQ ID NO: 80 as shown below:
  • FHL3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_004468.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with FHL3 has the nucleotide sequence of SEQ ID NO: 81 as shown below:
  • EPPK1 has the nucleotide sequence corresponding to NCBI Reference
  • MARCKSL1 has the nucleotide sequence corresponding to NCBI
  • FAM44B has the nucleotide sequence corresponding to NCBI Reference
  • NM_138369.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with FAM44B has the nucleotide sequence of SEQ ID NO: 84 as shown below:
  • VEGFB has the nucleotide sequence corresponding to NCBI Reference
  • NM_003377.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with VEGFB has the nucleotide sequence of SEQ ID NO: 85 as shown below:
  • LYRM4 has the nucleotide sequence corresponding to NCBI Reference
  • AB007962 has the nucleotide sequence corresponding to NCBI Reference
  • PPP2R3B has the nucleotide sequence corresponding to NCBI Reference
  • SPINK2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_021114.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SPINK2 has the nucleotide sequence of SEQ ID NO: 89 as shown below:
  • C90RF123 has the nucleotide sequence corresponding to NCBI Reference
  • NM_033428.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C90RF123 has the nucleotide sequence of SEQ ID NO: 90 as shown below:
  • PANK 2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_024960.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with PANK2 has the nucleotide sequence of SEQ ID NO: 91 as shown below:
  • COG2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_007357.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with COG2 has the nucleotide sequence of SEQ ID NO: 92 as shown below:
  • CRY2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_021117.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CRY2 has the nucleotide sequence of SEQ ID NO: 93 as shown below:
  • SESN1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_014454.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SESN1 has the nucleotide sequence of SEQ ID NO: 94 as shown below:
  • EPN2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_014964.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with EPN2 has the nucleotide sequence of SEQ ID NO: 95 as shown below:
  • IL23A has the nucleotide sequence corresponding to NCBI Reference
  • BE439556 has the nucleotide sequence corresponding to NCBI Reference
  • BE439556.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with BE439556 has the nucleotide sequence of SEQ ID NO: 97 as shown below:
  • DB050967 has the nucleotide sequence corresponding to NCBI Reference
  • DA760637.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DB050967 has the nucleotide sequence of SEQ ID NO: 98 as shown below:
  • TMEM203 has the nucleotide sequence corresponding to NCBI Reference
  • NM_053045.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TMEM203 has the nucleotide sequence of SEQ ID NO: 99 as shown below:
  • RCBTB2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_001268.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RCBTB2 has the nucleotide sequence of SEQ ID NO: 100 as shown below:
  • ZNF627 has the nucleotide sequence corresponding to NCBI Reference
  • NM_145295.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with ZNF627 has the nucleotide sequence of SEQ ID NO: 101 as shown below:
  • CMTM1 has the nucleotide sequence corresponding to NCBI Reference
  • HSD11B1L has the nucleotide sequence corresponding to NCBI Reference
  • NM_198707.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with HSD11B1L has the nucleotide sequence of SEQ ID NO: 103 as shown below:
  • MAL has the nucleotide sequence corresponding to NCBI Reference
  • NM_002371.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MAL has the nucleotide sequence of SEQ ID NO: 104 as shown below:
  • TOP1MT has the nucleotide sequence corresponding to NCBI Reference
  • NM_052963.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TOP1MT has the nucleotide sequence of SEQ ID NO: 105 as shown below:
  • NSUN5 has the nucleotide sequence corresponding to NCBI Reference
  • NM_018044.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with NSUN5 has the nucleotide sequence of SEQ ID NO: 106 as shown below:
  • GRB10 has the nucleotide sequence corresponding to NCBI Reference
  • NM 001001555.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GRBIO has the nucleotide sequence of SEQ ID NO: 107 as shown below:
  • ANXA8L1 has the nucleotide sequence corresponding to NCBI Reference
  • ERI2 has the nucleotide sequence corresponding to NCBI Reference
  • AK098672 has the nucleotide sequence corresponding to NCBI Reference
  • CRCP has the nucleotide sequence corresponding to NCBI Reference
  • NM_014478.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CRCP has the nucleotide sequence of SEQ ID NO: 111 as shown below:
  • TWIST2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_057179.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TWIST2 has the nucleotide sequence of SEQ ID NO: 112 as shown below:
  • RIMKLB has the nucleotide sequence corresponding to NCBI Reference
  • NM_020734.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RIMKLB has the nucleotide sequence of SEQ ID NO: 113 as shown below:
  • AM393854 has the nucleotide sequence corresponding to NCBI Reference
  • NM_133477.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AM393854 has the nucleotide sequence of SEQ ID NO: 114 as shown below:
  • PAQR6 has the nucleotide sequence corresponding to NCBI Reference
  • NM_024897.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with PAQR6 has the nucleotide sequence of SEQ ID NO: 115 as shown below:
  • GTF3C6 has the nucleotide sequence corresponding to NCBI Reference
  • NM_138408.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GTF3C6 has the nucleotide sequence of SEQ ID NO: 116 as shown below:
  • GRASP has the nucleotide sequence corresponding to NCBI Reference
  • CENPE has the nucleotide sequence corresponding to NCBI Reference
  • NM_001813.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CENPE has the nucleotide sequence of SEQ ID NO: 118 as shown below:
  • P2RY4 has the nucleotide sequence corresponding to NCBI Reference
  • NM_002565.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with P2RY4 has the nucleotide sequence of SEQ ID NO: 119 as shown below:
  • BC038536 has the nucleotide sequence corresponding to NCBI Reference
  • ZNF268 has the nucleotide sequence corresponding to NCBI Reference
  • NM_152943.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with ZNF268 has the nucleotide sequence of SEQ ID NO: 121 as shown below:
  • SMPDl has the nucleotide sequence corresponding to NCBI Reference
  • NM 001007593.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SMPDl has the nucleotide sequence of SEQ ID NO: 122 as shown below:
  • MRP63 has the nucleotide sequence corresponding to NCBI Reference
  • NM_024026.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MRP63 has the nucleotide sequence of SEQ ID NO: 123 as shown below:
  • CSTF3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_001326.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CSTF3 has the nucleotide sequence of SEQ ID NO: 124 as shown below:
  • TTF2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_003594.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TTF2 has the nucleotide sequence of SEQ ID NO: 125 as shown below:
  • AW004814 has the nucleotide sequence corresponding to NCBI Reference
  • AW004814.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AW004814 has the nucleotide sequence of SEQ ID NO: 126 as shown below:
  • AWl 19108 has the nucleotide sequence corresponding to NCBI Reference
  • AWl 19108.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AWl 19108 has the nucleotide sequence of SEQ ID NO: 127 as shown below:
  • AWl 82429 has the nucleotide sequence corresponding to NCBI Reference
  • AWl 82429.1 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AW 182429 has the nucleotide sequence of SEQ ID NO: 128 as shown below:
  • HS.566857 has the nucleotide sequence corresponding to NCBI Reference
  • BX109554 has the nucleotide sequence corresponding to NCBI Reference
  • APOBEC3B has the nucleotide sequence corresponding to NCBI
  • NM 004900.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with APOBEC3B has the nucleotide sequence of SEQ ID NO: 131 as shown below:
  • EZH2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_152998.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with EZH2 has the nucleotide sequence of SEQ ID NO: 132 as shown below:
  • GCOM1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_015532.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GCOM1 has the nucleotide sequence of SEQ ID NO: 133 as shown below:
  • ZBTB20 has the nucleotide sequence corresponding to NCBI Reference
  • LOC729973 has the nucleotide sequence corresponding to NCBI
  • MAP2K3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_002756.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with MAP2K3 has the nucleotide sequence of SEQ ID NO: 136 as shown below:
  • BF701780 has the nucleotide sequence corresponding to NCBI Reference
  • KCNA6 has the nucleotide sequence corresponding to NCBI Reference
  • NM_002235.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with KCNA6 has the nucleotide sequence of SEQ ID NO: 138 as shown below:
  • OR1J4 has the nucleotide sequence corresponding to NCBI Reference
  • SKP1 has the nucleotide sequence corresponding to NCBI Reference
  • STATl has the nucleotide sequence corresponding to NCBI Reference
  • NM_007315.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with STATl has the nucleotide sequence of SEQ ID NO: 141 as shown below:
  • STATl also has the nucleotide sequence corresponding to NCBI
  • NM_139266.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with STATl has the nucleotide sequence of SEQ ID NO: 142 as shown below:
  • C10RF26 has the nucleotide sequence corresponding to NCBI Reference
  • NM_017673.6 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C10RF26 has the nucleotide sequence of SEQ ID NO: 143 as shown below:
  • VAT1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_006373.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with VAT1 has the nucleotide sequence of SEQ ID NO: 144 as shown below:
  • LOC390427 has the nucleotide sequence corresponding to NCBI
  • THSD1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_018676.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with THSD1 has the nucleotide sequence of SEQ ID NO: 146 as shown below:
  • C70RF49 has the nucleotide sequence corresponding to NCBI Reference
  • NM_024033.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with C70RF49 has the nucleotide sequence of SEQ ID NO: 147 as shown below:
  • SSX5 has the nucleotide sequence corresponding to NCBI Reference
  • S equence XM 941508.1 , which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with SSX5 has the nucleotide sequence of SEQ ID NO: 148 as shown below:
  • TMPRSS 1 IB has the nucleotide sequence corresponding to NCBI
  • NM_ 182502.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with TMPRSS 1 IB has the nucleotide sequence of SEQ ID NO: 149 as shown below:
  • DIP2B has the nucleotide sequence corresponding to NCBI Reference
  • NM_173602.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DIP2B has the nucleotide sequence of SEQ ID NO: 150 as shown below:
  • RFX3 has the nucleotide sequence corresponding to NCBI Reference
  • NM_134428.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RFX3 has the nucleotide sequence of SEQ ID NO: 151 as shown below:
  • ZNF774 has the nucleotide sequence corresponding to NCBI Reference
  • GPAH2 has the nucleotide sequence corresponding to NCBI Reference
  • NM_130769.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with GPAH2 has the nucleotide sequence of SEQ ID NO: 153 as shown below:
  • RDHl 1 has the nucleotide sequence corresponding to NCBI Reference
  • NM_016026.3 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with RDHl 1 has the nucleotide sequence of SEQ ID NO: 154 as shown below:
  • BC050625 has the nucleotide sequence corresponding to NCBI Reference
  • NM_052941.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with BC050625 has the nucleotide sequence of SEQ ID NO: 155 as shown below:
  • DBF4 has the nucleotide sequence corresponding to NCBI Reference
  • NM_006716.4 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DBF4 has the nucleotide sequence of SEQ ID NO: 156 as shown below:
  • BX248296 has the nucleotide sequence corresponding to NCBI Reference
  • CD364714 has the nucleotide sequence corresponding to NCBI Reference
  • CD364714 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with CD364714 has the nucleotide sequence of SEQ ID NO: 158 as shown below:
  • DAI 96703 has the nucleotide sequence corresponding to NCBI Reference
  • DA196703 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with DAI 96703 has the nucleotide sequence of SEQ ID NO: 159 as shown below:
  • AA884785 has the nucleotide sequence corresponding to NCBI Reference
  • AA884785 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AA884785 has the nucleotide sequence of SEQ ID NO: 160 as shown below:
  • ZNF33B has the nucleotide sequence corresponding to NCBI Reference
  • AK125234 has the nucleotide sequence corresponding to NCBI Reference
  • AK125234 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AK125234 has the nucleotide sequence of SEQ ID NO: 162 as shown below:
  • AA961268 has the nucleotide sequence corresponding to NCBI Reference
  • AA961268 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with AA961268 has the nucleotide sequence of SEQ ID NO: 163 as shown below:
  • LGSN has the nucleotide sequence corresponding to NCBI Reference
  • NM_016571.2 which is hereby incorporated by reference in its entirety.
  • An example of a probe that hybridizes with LGSN has the nucleotide sequence of SEQ ID NO: 164 as shown below:
  • STAG3L1 has the nucleotide sequence corresponding to NCBI Reference
  • probe sequences other than those disclosed above, that hybridize to the target sequence or isoforms of the target sequence are encompassed by the present invention.
  • biomarker means an entire gene, or a portion thereof, such as an EST derived from that gene, the expression or level of which changes between certain conditions.
  • EST derived from that gene
  • the gene is a marker for that condition.
  • probe refers to a nucleic acid molecule, or oligonucleotide, corresponding to DNA or RNA, with a variable length that is
  • Probes of the present invention can be naturally occurring or synthetic, but are typically prepared by synthetic means. Synthesis of probes is well known to those skilled in the art (Oligonucleotide Synthesis: Methods and Applications, Piet Herdewijn (ed) Humana Press (2004), which is hereby incorporated by reference in its entirety.)
  • a probe comprises an oligonucleotide capable of hybridizing specifically to a nucleic acid target molecule of a complementary sequence through one or more types of chemical bond. Such binding may usually occur through complementary base pairing, and usually through hydrogen bond formation. Suitable probes may include natural (i.e. A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.).
  • probes of the present invention may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages.
  • the minimum size of the probes of the present invention is the size required for formation of a stable hybrid between the probe and a complementary sequence on a nucleic acid molecule.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of an oligonucleotides probe preferentially to a particular target nucleotide sequence under stringent conditions when that sequence is present in a sample.
  • Stringent conditions are sequence-dependent and will be different in different circumstances. For example, longer sequences hybridize specifically at higher temperatures.
  • the probes or targets of the present invention may also be labeled in order that they may be easily detected.
  • detectable moieties that may be used in the labeling of probes or targets include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials and colorimetric materials.
  • the present invention is also directed to a method of diagnosing whether a subject has an ASD that involves obtaining a biological sample from a subject potentially having an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPIl; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1; or (4) C50RF
  • the biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample.
  • This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has an ASD based on said detecting.
  • the method described above will identify whether or not a child who is already displaying developmental concerns actually has an ASD or will go on to develop normally. Also, as shown in the Examples, this method can also distinguish the diagnosis of ASD from other developmental disorders, specifically developmental delay (DD) and language delay (LD).
  • DD developmental delay
  • LD language delay
  • a collection of probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF is informative of a diagnosis of an ASD when there is an increase in expression levels of ZNF329, LOC641518, and RAB31P, along with a corresponding decrease in TAP1, GBP2, and MYOF, as compared to a normally developing subject.
  • This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • the collection of probes recognizing at least 50% of the following biomarkers: MRPS10, ARF3, CLORF85, KCNEIL, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 is informative of a diagnosis of an ASD when there is an increase in the expression levels of MRPS10, CACHD1, CHM, DUS4L, AK3, BU580973, TCRA, and CR608770, along with a corresponding decrease in ARF3, C10RF85, KCNEIL, BIN2, CYB5R3, FKBP12- EXI, STX5, and SPI1, as compared to a subject with a DD or an LD.
  • This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • IMPACT ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5 is informative of a diagnosis of an ASD when there is an increase in the expression levels of CR617556, MAGMAS, CABIN1 , HS.561844, RGL2, and TMEM185A along with a corresponding decrease in C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1, GABPA, UBE2V2, GBP2, C150RF44, PCGF6,
  • EIF3J EIF3J,IMPACT, ATAD2, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and
  • MAP4K5 as compared to a normally developing subject.
  • This collection is also informative of a diagnosis of ASD as compared to a subject with DD or LD when there is an increase in expression levels of C50RF44, CTDSPL2, CKAP2,BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, UBE2V2, C150RF44, PCGF6, EIF3J, HS.561844, IMPACT, ATAD2, CASDl, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, MAP4K5, and a corresponding decrease in ARHGAP25, MAZ, MAGMAS, CABIN1, RGL2, TMEM185A.
  • Another aspect of the present invention is directed to a method of determining whether a subject has a predisposition for developing an ASD.
  • This method involves obtaining a biological sample from a subject at risk of potentially having a predisposition for developing an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1 , MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN
  • the biological sample from the subject is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample.
  • This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has a predisposition for developing an ASD based on said detecting.
  • the collection of probes recognizing at least 50% of the following biomarkers: CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B, VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627,
  • CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5 is informative for a subject having a predisposition for developing an ASD when there is a increase in expression levels of CRIPl, ING1, SPNS3, CDH11, LOC642403, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B, VEGFB, LYRM4, PPP2R3B, SPINK2, C90RF123, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, ZNF627, HSD 11 B 1 L, MAL, TOP 1 MT, and NSUN5 along with a corresponding decrease in LILRB1, CASP4, AB007962, PANK2, RCBTB2, and CMTM1, as compared to a normally developing subject.
  • This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • PAQR6,GRASP, SMPDl, AW004814, AW119108, HS.566857, BX109554, and EFNA along with a corresponding decrease in ERI2, CRCP, TWIST2, AM393854,GTF3C6, CENPE,P2RY4,BC038536, ZNF268, PANK2, MRP63, CSTF3, TTF2, AW182429, ATAD2, ESM1, APOBEC3B, EZH2, ACSL5, as compared to a normally developing subject.
  • This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD, DD, or LD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • probes recognizing at least 50% of the following biomarkers: GCOMl, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STATl, C10RF26, VAT1, LOC390427, THSDl, C70RF49, SSX5,
  • TMPRSSl lB, DIP2B, RFX3, ZNF774, GPHA2, RDHl l, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 is informative for a subject having a predisposition for developing an ASD when there is a increase in expression levels of ZBTB20, BF701780, RIMKLB, OR1J4, SKP1, VAT1, LOC390427, C70RF49, SSX5, TMPRSSl lB, ZNF774, RDHl l, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, and AK125234 along with a corresponding decrease in LOC729973, MAP2K3, KCNA6, STATl, C10RF26,
  • This collection is also informative of a diagnosis of ASD as compared to a subject with DD or LD when there is an increase in expression levels of ZBTB20, BF701780, RIMKLB, KCNA6,0R1J4, SKP1, C10RF26, VAT1, LOC390427,
  • This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
  • the present invention is also directed to a method of diagnosing whether a subject has an autism spectrum disorder involving obtaining a biological sample from a subject potentially having an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNAl, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP
  • GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has an autism spectrum disorder based on said detecting.
  • a final aspect of the present invention relates to a method of diagnosing whether a subject has a predisposition for developing an autism spectrum disorder involving obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12- EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXPl, EFNAl, C50RF44, AR
  • the subject can be any mammal (e.g., mouse, rat, rabbit, hamster, guinea pig, cat, dog, pig, goat, cow, horse, primate, or human).
  • the subject is a human. More preferably, the subject is between 11 months to 4 years of age.
  • the initial determination that a subject is suspected of having an ASD, and, therefore, should be tested in accordance with the method of the present invention can be made based on a general population-based screening method called the One- Year Well-Baby Check-Up Approach (Pierce et al, "Detecting, Studying, and Treating Autism Early: The One-year Well-Baby Check-Up Approach," J Pediatr 159:458-465 (2011), which is hereby incorporated by reference in its entirety).
  • subject's failing the Communication and Symbolic Behavior Scales Development Profile (CSBS DP) can be suspected to have an ASD.
  • CSBS DP Communication and Symbolic Behavior Scales Development Profile
  • failure of the Autism Diagnostic Observation Schedule (ADOS) and the clinical judgment of a Ph.D. -level psychologist can result in the determination that a subject is suspected of having an ASD.
  • the isolation of biological samples from a subject which contain nucleic acids is well known in the art.
  • the biological sample can be sputum, blood, a blood fraction, tissue or fine needle biopsy sample, urine, stool, peritoneal fiuid, or pleural fluid.
  • the biological sample is blood.
  • the biological sample is isolated peripheral blood mononuclear cells (PBMCs).
  • PBMCs Methods for isolation of PBMCs are well known in the art.
  • blood is collected from subjects into heparinized blood collection tubes by personnel trained in phlebotomy using sterile technique.
  • the collected blood samples can be divided into aliquots and centrifuged, and the thin layer of cells between the erythrocyte layer and the plasma layer, which contains the PBMCs, is removed and used for analysis.
  • RNA and DNA from biological samples are readily known in the art. These methods are described in detail in LABORATORY TECHNIQUES IN
  • RNA can be isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction, a guanidinium isothiocyanate-ultracentrifugation method, or lithium chloride-SDS-urea method.
  • PolyA + mRNA can be isolated using oligo(dT) column chromatography or (dT)n magnetic beads (See e.g., SAMBROO AND RUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL (Cold Springs Laboratory Press, 1989) or CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Fred M. Ausubel et al. eds., 1992) which are hereby
  • PCR polymerase chain reaction
  • LCR Ligation Amplification Reaction
  • the biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample.
  • the probes comprise nucleotide sequences that are complementary to at least a region of mRNA or corresponding cDNA of the biomarkers listed above.
  • hybridization refers to the complementary base-pairing interaction of one nucleic acid with another nucleic acid that results in formation of a duplex, triplex, or other higher-ordered structure.
  • the primary interaction is base specific, e.g., A/T and G/C, by Watson/Crick and Hoogsteen- type hydrogen bonding. Base-stacking and hydrophobic interactions can also contribute to duplex stability.
  • Conditions for hybridizing detector probes to complementary and substantially complementary target sequences are well known in the art ⁇ see e.g. ,
  • hybridization is influenced by, among other things, the length of the polynucleotides and their complements, the pH, the temperature, the presence of mono- and divalent cations, the proportion of G and C nucleotides in the hybridizing region, the viscosity of the medium, and the presence of denaturants. Such variables influence the time required for hybridization. Thus, the preferred hybridization conditions will depend upon the particular application.
  • probes are sufficiently complementary to the target sequence to hybridize under the selected reaction conditions to achieve selective detection and measurement.
  • Detection of hybridization between said probes and corresponding target molecules from the biological sample can be performed by several assays known in the art that permit detection of the expression level of the biomarkers.
  • the "expression level" of a biomarker can be achieved by measuring any suitable value that is representative of the gene expression level.
  • the measurement of gene expression levels can be direct or indirect.
  • a direct measurement involves measuring the level or quantity of R A or protein.
  • An indirect measurement may involve measuring the level or quantity of cDNA, amplified RNA, DNA, or protein; the activity level of RNA or protein; or the level or activity of other molecules (e.g. a metabolite) that are indicative of the foregoing.
  • the measurement of expression can be a measurement of the absolute quantity of a gene product.
  • the measurement can also be a value representative of the absolute quantity, a normalized value (e.g., a quantity of gene product normalized against the quantity of a reference gene product), an averaged value (e.g., average quantity obtained at different time points or from different sample from a subject, or average quantity obtained using different probes, etc.), or a combination thereof.
  • a normalized value e.g., a quantity of gene product normalized against the quantity of a reference gene product
  • an averaged value e.g., average quantity obtained at different time points or from different sample from a subject, or average quantity obtained using different probes, etc.
  • hybridization is detected by measuring RNA expression level of the biomarkers.
  • Measuring gene expression by quantifying mRNA expression can be achieved using any commonly used method known in the art including northern blotting and in situ hybridization (Parker et al., "mRNA: Detection by in Situ and Northern Hybridization,” Methods in Molecular Biology 106:247-283 (1999), which is hereby incorporated by reference in its entirety); RNAse protection assay (Hod et al., "A Simplified Ribonuclease Protection Assay," Biotechniques 13:852-854 (1992), which is hereby incorporated by reference in its entirety); reverse transcription polymerase chain reaction (RT-PCR) (Weis et al, "Detection of Rare mRNAs via Quantitative RT-PCR,” Trends in Genetics 8:263-264 (1992), which is hereby incorporated by reference in its entirety); and serial analysis of gene expression (SAGE) (Velculescu e
  • RNA expression level is measured using a nucleic acid hybridization assay or a nucleic acid amplification assay.
  • nucleic acid hybridization assay the expression level of nucleic acids corresponding to biomarkers is detected using an array-based technique.
  • arrays also commonly referred to as “microarrays” or “chips” have been generally described in the art, see e.g., U.S. Patent Nos. 5,143,854 to Pirrung et al; 5,445,934 to Fodor et al; 5,744,305 to Fodor et al; 5,677,195 to Winkler et al; 6,040,193 to Winkler et al;
  • a microarray comprises an assembly of distinct polynucleotide or oligonucleotide probes immobilized at defined positions on a substrate.
  • Arrays are formed on substrates fabricated with materials such as paper, glass, plastic (e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, silicon, optical fiber or any other suitable solid or semisolid support, and configured in a planar (e.g., glass plates, silicon chips) or three- dimensional (e.g., pins, fibers, beads, particles, microtiter wells, capillaries)
  • Probes forming the arrays may be attached to the substrate by any number of ways including (i) in situ synthesis (e.g., high-density oligonucleotide arrays) using photolithographic techniques (see Fodor et al, “Light-Directed, Spatially Addressable Parallel Chemical Synthesis," Science 251 :767-773 (1991); Pease et al, "Light-Generated Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Natl. Acad. Sci.
  • in situ synthesis e.g., high-density oligonucleotide arrays
  • photolithographic techniques see Fodor et al, "Light-Directed, Spatially Addressable Parallel Chemical Synthesis," Science 251 :767-773 (1991); Pease et al, "Light-Generated Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Natl. Acad. Sci.
  • Probes may also be noncovalently immobilized on the substrate by hybridization to anchors, by means of magnetic beads, or in a fluid phase such as in microtiter wells or capillaries.
  • the probe molecules are generally nucleic acids such as DNA, RNA, PNA, and cDNA.
  • Fluorescently labeled cDNA for hybridization to the array may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from ASD subject samples of interest. Labeled cDNA applied to the array hybridizes with specificity to each nucleic acid probe spotted on the array. After stringent washing to remove non-specifically bound cDNA, the array is scanned by confocal laser microscopy or by another detection method, such as a CCD camera.
  • Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance.
  • dual color fluorescence separately labeled cDNA samples generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously.
  • the miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes.
  • Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., "Parallel Human Genome Analysis: Microarray-Based Expression Monitoring of 1000 Genes," " roc. Natl. Acad. Sci. USA 93(20): 10614-9 (1996), which is hereby
  • the expression levels of biomarkers informative of ASD diagnosis can be detected using the collections of probes of the present invention.
  • the nucleic acid probes of the present invention have a nucleotide sequence that is complementary to at least a portion of an RNA transcript or DNA nucleotide sequence encoded by a biomarker informative of ASD diagnosis.
  • a nucleic acid amplification assay that is a semi-quantitative or quantitative real-time polymerase chain reaction (RT-PCR) assay can also be performed.
  • RT-PCR real-time polymerase chain reaction
  • AMV- RT avian myeloblastosis virus reverse transcriptase
  • MMV-RT Moloney murine leukemia virus reverse transcriptase
  • the reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling.
  • extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions.
  • the derived cDNA can then be used as a template in the subsequent PCR reaction.
  • thermostable DNA-dependent PCR step can use a variety of thermostable DNA-dependent primers.
  • DNA polymerases typically employs the Taq DNA polymerase, which has a 5 '-3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity.
  • An exemplary PCR amplification system using Taq polymerase is TaqMan® PCR (Applied Biosystems,
  • Taqman® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
  • Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction.
  • a third oligonucleotide, or probe, is designed to detect the nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye.
  • any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
  • the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner.
  • the resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore.
  • One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
  • TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, the ABI PRISM 7700® Sequence Detection System® (Perkin-Elmer- Applied Biosystems, Foster City, Calif, USA), or the Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
  • ABI PRISM 7700® Sequence Detection System® Perkin-Elmer- Applied Biosystems, Foster City, Calif, USA
  • the Lightcycler Roche Molecular Biochemicals, Mannheim, Germany.
  • RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase
  • Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization and quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
  • internal competitor for each target sequence is used for normalization
  • quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
  • the identification of whether or not the subject has an ASD based on said detecting can be performed by comparing the expression levels of said biomarkers with the expression levels of the same biomarkers in a typically developing subject.
  • a "typically developing" subject is one who does not have or is not suspected of having any developmental disorder.
  • comparisons may also be made to subjects with different disorders (e.g. Developmental Delay (DD) and Language Delay (LD)).
  • DD Developmental Delay
  • LD Language Delay
  • the data generated from the detection of the previously biomarker expression levels can then be used to prepare a personalized genomic profile for a subject.
  • the genomic profile can be used to establish a personalized treatment plan for the subject.
  • CSBS DP Developmental Profile
  • Infant-Toddler questionnaire at their pediatrician's office were provisionally identified as at-risk for one of the disorders of interest and then referred for further evaluation.
  • Subjects who passed the CSBS were identified as typically developing (TD) and some of these were also referred for further evaluation as unaffected comparison subjects.
  • TD typically developing
  • toddlers as young as 12-months were recruited and tracked every six months until at least their third birthday, thus allowing for the prospective study of autism beginning at 12 months.
  • ADOS Diagnostic Observation Schedule
  • Schedule-Toddler Module A New Module of a Standardized Diagnostic Measure for Austism Spectrum Disorders," J Autism Dev Disord 39: 1305-20 (2009), which is hereby incorporated by reference in its entirety) at age two or beyond, when the diagnosis of autism can be made reliably.
  • Final diagnoses for participants with an ASD older than 30 months were confirmed with the Autism
  • Subjects who failed the CSBS DP Infant-Toddler questionnaire but who passed the ADOS were diagnosed with global developmental delay (DD) if scores were more than one standard deviation lower than expected on three or more subtests of the Mullen Scales and the overall developmental quotient was more than one standard deviation lower than expected ( ⁇ 85).
  • Subjects who failed the CSBS DP Infant-Toddler questionnaire but who passed the ADOS and who did not deviate from norms on any of the Mullen Scales or the developmental quotient were judged to be developing typically and identified as TIEs.
  • Glatt et al "Comparative Gene Expression Analysis of Blood and Brain Provides Concurrent Validation of SELENBP1 Up-Regulation in Schizophrenia," Proc Natl Acad Sci USA 102: 15533-15538 (2005); Tsuang et al, “Assessing the Validity of Blood-Based Gene Expression Profiles for the Classification of Schizophrenia and Bipolar Disorder: A Preliminary Report," Am J Med Genet B Neuropsychiatr Genet. 133B: 1-5 (2005), each of which are hereby incorporated by reference in its entirety).
  • RNAlater phosphate- buffered saline solution
  • LeukoLOCK filters were processed in a batch by flushing the filter with TRI reagent to lyse the cells and isolate mRNA. Eluted mRNA samples were stored at -20°C until transferred to Scripps Genomic Medicine for quality assurance and microarray hybridization.
  • mRNA Quantitation and Quality Control The concentration of mRNA in each sample was quantified by the absorption of ultraviolet light at 260 nm. The quantity of mRNA in each sample exceeded the minimally sufficient amount required for microarray hybridization. The purity of each mRNA sample was estimated by the
  • Amplification kit Amplification steps consisted of the following: reverse transcription to synthesize first-strand cDNA; second-strand cDNA synthesis; cDNA purification; in vitro transcription to synthesize biotin-labeled cR A; and cRNA purification. cRNA was then normalized to a concentration of 150 ng/ ⁇ . (in ⁇ - ⁇ volume) and run through the Illumina Gene Expression assay which includes a 16- to 20-hour overnight incubation at 58°C and subsequent scanning of the expression beadchip on a Bead Array Reader.
  • Genomics Suite software version 6.3 (Partek, St. Louis, MO), was used for all analytic procedures performed on microarray scan data. First, raw probe-intensity values were imported; then corrections for background signal were applied using the robust multi- array average (RMA) method (Irizarry et al., "Exploration, Normalization, and
  • RNA Integrity Number (RIN) and, according to convention (Schroeder et al., "The RIN: an RNA Integrity Number for Assigning Integrity Values to RNA Measurements," BMC Molecular Biology 7:3 (2006), which is hereby incorporated by reference in its entirety) values of 6.0 or greater were deemed acceptable; values observed in samples ranged from 9.0-10.0.
  • a total of 383 samples selected for analysis in Wave I had acceptable levels of mRNA quantity, purity, and quality.
  • the ASD sample was split into two independent subgroups: a discovery sample and a replication sample. The two subsamples were drawn to be equivalent in sample size, age, sex, and diagnostic composition (AD versus PDD).
  • the CNT sample was similarly split into discovery and replication samples drawn to be equivalent in size, age, sex, and diagnostic composition (TD versus TIE).
  • the basic analytic model for identifying candidate biomarkers in the discovery samples was an analysis of covariance (ANCOVA), with each gene's expression intensity value as the dependent measure, diagnostic group (ASD versus CNT) and sex as fixed between- subjects factors, and age in months as a continuous covariate.
  • the kernel for the SVM was a radial basis function, with gamma equal to the inverse of the number of evaluated markers.
  • the optimal (i.e., the most accurate and parsimonious) SVM was derived by shrinking centroids (which prunes highly correlated or redundant features) and 10-fold cross-validation.
  • the optimal SVM classifier was then tested for classification accuracy in the fully independent ASD and CNT replication samples, and then re-evaluated in the presence of the LD and DD samples as affected but nonautistic comparators.
  • Bonferroni-corrected p value threshold of a 0.05/number of terms evaluated in a particular category.
  • biomarker panel that can differentiate children who go on to develop an ASD from children who go on to develop typically (TIE). This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of six genetic transcripts in a support vector machine of radial basis function with a cost of 601 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 4-Fold Cross- Validation in 24 individuals with ASD vs 24 TIE individuals.
  • the first lines of the tables below, as well as the following tables for Biomarker Panel 1, show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true- positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called ASD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • Example 2 - Biomarker Panel 2 [0247] Among children identified with at least some developmental concerns, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD or to develop a DD or LD?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 16 genetic transcripts in a support vector machine of radial basis function with a cost of 501 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 27 individuals with ASD vs 27 DD/LD individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 2 show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly DD/LD and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called DD/LD (false-negative or FN calls), and the number of individuals who were truly DD/LD but were called ASD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • biomarker panel that can differentiate children who go on to develop an ASD, DD, or LD from children who go on to develop typically. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, DD, or LD or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 16 genetic transcripts in a support vector machine of radial basis function with a cost of 101 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 4-Fold Cross- Validation in 39 individuals with ASD/DD/LD vs 39 TIE individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 3, show the cross-tabulation of the number of individuals who were truly ASD/DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true -negative or TN calls), the number of individuals who were truly ASD/DD/LD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called ASD/DD/LD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • biomarker panel that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD and from children who go on to develop typically.
  • This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, to develop a DD or LD, or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 36 genetic transcripts in a support vector machine of radial basis function with a cost of 101 and a gamma of 0.01. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • ILMN 1763884 Magmas 1.17 1.29 -1.1
  • ILMN 2139035 CASD1 -1.1 -1.36 1.24
  • ILMN 2370882 ACSL5 -1.15 -1.22 1.06
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 21 individuals with ASD vs 21 DD/LD vs 21 TIE individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 4, show the cross-tabulation of the number of individuals who were truly DD/LD, or ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly DD/LD, or ASD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called DD/LD or ASD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • biomarker panel that can differentiate children who go on to develop an ASD from children who go on to develop typically (TD/TIE). This biomarker panel addresses the clinical question: "Is my child more likely to develop an ASD or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 36 genetic transcripts in a support vector machine of radial basis function with a cost of 701 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 5-Fold Cross- Validation in 35 individuals with ASD vs 35 TD/TIE individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 5, show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called ASD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • Example 6 - Biomarker Panel 6 [0267] Among all children, a biomarker panel is described that can differentiate children who go on to develop an ASD, DD, or LD from children who go on to develop typically. This biomarker panel addresses the clinical question: "Is my child more likely to develop an ASD, DD, or LD or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 31 genetic transcripts in a support vector machine of radial basis function with a cost of 801 and a gamma of 0.01. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not.
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 6-Fold Cross- Validation in 52 individuals with ASD/DD/LD vs 52 TD/TIE individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 6, show the cross-tabulation of the number of individuals who were truly ASD/DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD/DD/LD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called
  • ASD/DD/LD false-positive or FP calls.
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
  • biomarker panel that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD and from children who go on to develop typically.
  • This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, to develop a DD or LD, or to develop typically?"
  • the optimal model for this classification problem is determined to comprise the expression levels of 35 genetic transcripts in a support vector machine of radial basis function with a cost of 601 and a gamma of 0.001.
  • ILMN 1660403 GCOM1 -1.07 -1.02 -1.02
  • ILMN 1700690 VAT1 1.13 1.19 1.19
  • ILMN 2362832 STAG 3 LI -1.07 -1.01 -1.01
  • the table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 26 individuals with ASD vs 26 DD/LD vs 26 TD/TIE individuals.
  • the first lines of the table below, as well as the following tables for Biomarker Panel 7, show the cross-tabulation of the number of individuals who were truly ASD or DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD or DD/LD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called ASD or DD/LD (false-positive or FP calls).
  • the subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN.
  • the final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to collections of probes or their complements that recognize a set of biomarkers related to autism spectrum disorders (ASDs), as well as to methods utilizing these probes for diagnosing whether a subject has an ASD or has a predisposition for developing an ASD.

Description

COLLECTION OF PROBES FOR AUTISTIC SPECTRUM DISORDERS AND
THEIR USE
[0001] This application claims the priority benefit of U.S. Provisional Patent
Application Serial No. 61/769,000, filed February 25, 2013, which is hereby incorporated by reference in its entirety.
[0002] This invention was made with government support under United States
National Institutes of Health Grant No.5P50MH081755-003. The government has certain rights in this invention.
FIELD OF THE INVENTION
[0003] The present invention is directed to collections of probes for autistic disorders and their use.
BACKGROUND OF THE INVENTION
[0004] Autism spectrum disorders (ASDs) include Autistic Disorder (autism), Asperger Disorder, and Pervasive Developmental Disorder - Not Otherwise Specified (PDD-NOS). PDD-NOS is characterized by developmental delays of sociability, communication and use imagination. Asperger's syndrome is a more severe form of PDD- NOS but lacks the language and intelligence deficits normally associated with autism. Autism is exemplified by severe communication impairments, social interaction deficits and repetitive/stereotypic behaviors. Each of these disorders has specific diagnostic criteria as outlined by the American Psychiatric Association (APA) in its Diagnostic & Statistical Manual of Mental Disorders (DSM-IV-TR).
[0005] In the first description of the disease, anner suggested an influence of child-rearing practices on the development of autism, after observing similar traits in parents of the affected children. While experimental data fail to support several environmental hypotheses, there has been growing evidence for a strong genetic influence on this disorder. The rate of autism in siblings of affected individuals was shown to be a 2-6%, two orders of magnitude higher than in the general population. Twin studies have demonstrated significant differences in monozygotic and dizygotic twin concordance rates, the former concordant in 60% of twin pairs, with most of the non-autistic monozygotic co-twins displaying milder related social and communicative abnormali ies. Social, language, and cognitive difficulties have also been found among relatives of autistic individuals in comparison to the relatives of controls. The heritability of autism has been estimated to be >90%.
[0006] Prevalence estimates for ASDs have been reported to be approximately 1 in every 100 children in the general population. In families with an autistic child, recurrence rates are estimated to be greater than 15% that an additional offspring will also have autism (Landa et al., "Social and Communication Development in Toddlers with Early and Later Diagnosis of Autism Spectrum Disorders," Arch Gen Psychiatry 64:853- 64 (2007); Landa RJ, "Diagnosis of Autism Spectrum Disorders in the First 3 Years of Life," Nat Clin Pract Neurol 138-47 (2008)). These disorders are among the most severe and debilitating disorders of early brain development, typically emerging between infancy and early childhood, and commonly imposing lifelong disability on affected children as well as considerable strain on their caretakers and society at large.
[0007] The current state-of-the-art diagnosis of ASD is a seri es of vario us behavioral questionnaires. A brief observation in a single setting cannot present a true picture of an individual's abilities and behaviors. Parental and other caregivers' input and developmental history are very important components of making an accurate diagnosis. At first glance, some persons with autism may appear to have mental retardation, a behavior disorder, problems with hearing, or even odd and eccentric behavior. To complicate matters further, these conditions can co-occur with autism. Because the ASD phenotype is so complicated, a molecular-based test would greatly improve the accuracy of diagnosis at an earlier age, when phenotypic/behavioral assessment is not possible, or integrated with phenotypic/behavioral assessment. Also, diagnosis at an earlier age would allow initiation of ASD treatment at an earlier age which may be beneficial to short and long-term outcomes.
[0008] In the last decade, autism diagnoses have increased by 300% to 500%) in the United States and many other countries. Accordingly there is a need to diagnose ASD in subjects suspected of having ASD or to identify subjects that are at risk of developing an ASD. One way to combat ASDs would be to discover biological signatures— or "biomarkers"— of early risk for ASDs that could be exploited for early detection and treatment and could thereby improve long-term clinical outcomes. [0009] The current standard for diagnosing ASDs solely involves behavioral analysis. There are currently no biomarkers or medical tests available, and, as a result, diagnosis is delayed until 1.5 to 4 years of age. Most prior transcriptome-wide studies of gene expression in ASDs have used post mortem brain tissue or transformed
lymphoblastoid cell lines (Purcell et al., "Postmortem Brain Abnormalities of the
Glutamate Neurotransmitter System in Autism," Neurology 57: 1618-1628 (2001); Chow et al., "Age-Dependent Brain Gene Expression and Copy Number Anomalies in Autism Suggest Distinct Pathological Processes at Young Versus Mature Ages," PLoS Genet 8:el002592 (2012)). Both approaches are quite useful and revealing, often observing dysregulation of viable candidate pathways in autism, but both have limitations, such as the inability to fully account for agonal factors or the effects of viral transformation on the observed gene expression differences in autism. In contrast, Kuwano et al. sought autism biomarkers in peripheral leukocytes of young adults with autism, observing dysregulation of 16 genes related to cell morphology, cellular assembly and organization, and nerve system development and function (Kuwano et al, "Autism- Associated Gene Expression in Peripheral Leucocytes Commonly Observed Between Subjects With Austism and Healthy Women Having Autistic Children," PLoS One 6:e24723 (2001)). Albeit informative regarding persistent gene expression abnormalities in peripheral blood in individuals with ASDs, this study cannot shed light on the peripheral blood
transcriptomic events accompanying the emergence of autism in its earliest
developmental stages of infancy or toddlerhood.
[0010] The present invention is directed to overcoming these and other limitations in the art.
SUMMARY OF THE INVENTION
[0011] A first aspect of the present invention relates to a collection of probes or their complements that recognize biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF biomarkers; (2) MRPS10, ARF3, CLORF85, KCNE1L, BF 2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 biomarkers; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 biomarkers; (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5 biomarkers; (5) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5 biomarkers; (6) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB,
AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, and EFNA1 biomarkers; or (7) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5,
TMPRSSl lB, DIP2B, RFX3, ZNF774, GPHA2, RDHl l, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers.
[0012] The present invention is also directed to a method of diagnosing whether a subject has an ASD that involves obtaining a biological sample from a subject potentially having an ASD and providing a collection of probes recognizing biomarkers comprising as least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPll; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1; or (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5. The biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample. This method further involves detecting any hybridization as a result of said contacting and identifying whether the subject has an ASD based on said detecting.
[0013] Another aspect of the present invention is directed to a method of determining whether a subject has a predisposition for developing an ASD. This method involves obtaining a biological sample from a subject at risk of potentially having a predisposition for developing an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1 , MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5; (2) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AWl 19108, AW182429, HS.566857, BX109554, ATAD2, ESM1, APOBEC3B, EZH2, ACSL5, and EFNA1; or (3) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234,
AA961268, LGSN, and STAG3L1. The biological sample from the subject is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample. This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has a predisposition for developing an ASD based on said detecting.
[0014] The present invention is also directed to a method of diagnosing whether a subject has an autism spectrum disorder involving obtaining a biological sample from a subject potentially having an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPI1, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNA1, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESMl, ADSSL1, ACSL5, C10RF124, CYB561, MAP4K5, CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854,
PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, EFNAl, GCOMl, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774,
GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers, contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has an autism spectrum disorder based on said detecting.
[0015] A final aspect of the present invention relates to a method of diagnosing whether a subject has a predisposition for developing an autism spectrum disorder involving obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12- EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNAl, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESMl, ADSSL1, ACSL5, C10RF124, CYB561, MAP4K5, CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESM1,
APOBEC3B, EZH2, ACSL5, EFNA1, GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKPl, STATl, C10RF26, VATl, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers, contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has a predisposition for developing an autism spectrum disorder based on said detecting.
[0016] The present invention provides reliable diagnostics to more people, facilitate primary and differential diagnoses, and, importantly, result in earlier identification of the disorder in affected children. This will lead to earlier intervention and a more favorable prognosis. The identification of ASD-specific biomarkers could revolutionize the diagnosis and treatment of these disorders. For example, the availability of ASD biomarkers could expedite and standardize the diagnostic process, which presently involves considerable time, effort, and uncertainty. By allowing earlier identification, biomarkers could hasten the provision of effective treatment and improve prognoses. Further, biomarkers could form the basis for prevention efforts targeting at- risk individuals, which could reduce the morbidity and prevalence of these conditions. As ASDs are very heterogeneous conditions, biomarker research may also help differentiate subtypes of ASDs, which in turn may shed light on the distinct etiologies of these conditions. Collectively, these advances would translate into an enormous improvement in global public health and substantially decrease the suffering of affected individuals and families. DETAILED DESCRIPTION OF THE INVENTION [0017] A first aspect of the present invention relates to a collection of probes or their complements that recognize biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF biomarkers; (2) MRPS10, ARF3, CLORF85, KCNE1L, ΒΓΝ2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 biomarkers; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 biomarkers; (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5 biomarkers; (5) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5 biomarkers; (6) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, and EFNA1 biomarkers; or (7) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5,
TMPRSSl lB, DIP2B, RFX3, ZNF774, GPHA2, RDHl l, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers.
[0018] ZNF329 has the nucleotide sequence corresponding to the NCBI
Reference Sequence: NM_024620.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZNF329 has the nucleotide sequence of SEQ ID NO: 1 as shown below:
CCCCACCACTACCTCCATGGTTGTTCATTTAGGATGCTTCTAATTCAGCC
[0019] LOC641518 has the nucleotide sequence corresponding to the NCBI
Reference Sequence: XR 017788.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LOC641518 has the nucleotide sequence of SEQ ID NO: 2 as shown below:
GGGGCTATATTCTCAGGCTTCCTGGGCTCTGTTGGCATTGGGCAAGCACG
[0020] TAP1 has the nucleotide sequence corresponding to the NCBI Reference
Sequence: NM 000593.5, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TAP1 has the nucleotide sequence of SEQ ID NO: 3 as shown below:
GTAACGGAGTTTAGAGCCAGGGCTGATGCTTTGGTGTGGCCAGCACTCTG
[0021] GBP2 has the nucleotide sequence corresponding to the NCBI Reference
Sequence: NM_004120.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GBP2 has the nucleotide sequence of SEQ ID NO: 4 as shown below:
GCCTGTCCAGCTCCCTCTCCCCAAGAAACAACATGAATGAGCAACTTCAG
[0022] RAB3IP has the nucleotide sequence corresponding to the NCBI
Reference Sequence: NM_175624.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RAB3IP has the nucleotide sequence of SEQ ID NO: 5 as shown below:
GGAACTCTGATGCTCTGCGTGGGACCATGCCTGAACTCCCCGAATAACTG
[0023] MYOF has the nucleotide sequence corresponding to the NCBI Reference
Sequence: NM_133337.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MYOF has the nucleotide sequence of SEQ ID NO: 6 as shown below:
GCCATGTCACCGAGCCCCATTGATTCCCAGAGGGTCTTAGTCCTGGAAAG
[0024] MRPS 10 has the nucleotide sequence corresponding to the NCBI
Reference Sequence: NM_018141.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MRPS 10 has the nucleotide sequence of SEQ ID NO: 7 as shown below:
GTAGAAGCAGGTCCATGTCTTTTGTGGTTTCCTGCACATCTTTGGAGTAG [0025] ARF3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001659.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ARF3 has the nucleotide sequence of SEQ ID NO: 8 as shown below:
AGGGACCAATCTGGGGCTGGAAATGTTAGGAGGTTGCCTTGGTGCTGCCC
[0026] C10RF85 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_144580.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C10RF85 has the nucleotide sequence of SEQ ID NO: 9 as shown below:
GGGAC AGGGCTATTGATAAGGTCCCCTTGGTGTTGCCTTCTTGCATCTCC
[0027] KCNE1L has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_012282.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with KCNE1L has the nucleotide sequence of SEQ ID NO: 10 as shown below:
TCTTGCCTCCCCAGTTTTCATCCCAGTGGTAACGCCTGATTTTTGGTAGC
[0028] BIN2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_016293.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BIN2 has the nucleotide sequence of SEQ ID NO: 11 as shown below:
GGTTGCTTCAGAGCCTGGAGAGGCAAAGAAGATGGAAGACAAGGAAAAGG
[0029] CACHD1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_020925.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CACHD1 has the nucleotide sequence of SEQ ID NO: 12 as shown below:
CACGGTTAAAAGCTGCTGCCAGTTAGCCAAGACATTATCCACCAAATTGC
[0030] CYB5R3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 000398.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CYB5R3 has the nucleotide sequence of SEQ ID NO: 13 as shown below:
GGGCCCTCCCAGAACCTCAGCATTTCCTTCCAGCCCATCCAAACACTGAG
[0031] FKBP12-EXI has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM 925989.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with FKBP12-EXI has the nucleotide sequence of SEQ ID NO: 14 as shown below:
TCCCTGGGCCAGCAGGGACCTCTGAAGCCTTCTTTGTGGCCTTATTTTTT
[0032] CHM has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 000390.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CHM has the nucleotide sequence of SEQ ID NO: 15 as shown below:
CTGCCATAGTTACCTGGATTGTCAGCCTTGGTAGCCTTTGTCTAAAGTCC
[0033] DUS4L has the nucleotide sequence corresponding to NCBI Reference
S equence : NM_ 181581.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DUS4L has the nucleotide sequence of SEQ ID NO: 16 as shown below:
GTGCCTCTCAGCCGTTGATTGTAACTTTAAAGTCCCATGGTTTTGGAGTG
[0034] STX5 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003164.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with STX5 has the nucleotide sequence of SEQ ID NO: 17 as shown below:
GGAACAGGAGGAAACCATTCAGAGGATCGACGAGAACGTGCTAGGAGCCC
[0035] AK3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_016282.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AK3 has the nucleotide sequence of SEQ ID NO 18 as shown below:
GTGGCTATTACTTTGTTCTTGGTCCTTCACAGGGCCTGCTCCATCCCACC
[0036] BU580973 has the nucleotide sequence corresponding to NCBI Reference
Sequence: BU580973, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BU580973 has the nucleotide sequence of SEQ ID NO: 19 as shown below:
GCCTGTTGCTTTGGCTTGTATTTTCAGTGCTGTGTTGAATAAGAGTGGTG
[0037] TCRA has the nucleotide sequence corresponding to NCBI Reference
Sequence: AY375451 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TCRA has the nucleotide sequence of SEQ ID NO: 20 as shown below:
GCGCGAAGAGCAACTATCAGTTAATCTGGGGCGCTGGGACCAAGCTAATT [0038] CR608770 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AL528570, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CR608770 has the nucleotide sequence of SEQ ID NO: 21 as shown below:
TGCACACTGCCCTATTGTAGTCAAGTCTTACCCCCACCTCACATCTCCTG
[0039] SPI1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003120.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SPI1 has the nucleotide sequence of SEQ ID NO: 22 as shown below:
ACGCC AGCTGGGCGTCAGACCCCACCGGGGCAACCTTGC AGAGGACGACC
[0040] SC65 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_006455.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SC65 has the nucleotide sequence of SEQ ID NO: 23 as shown below:
TCTGGACCAC AGGATGGTGGTGGCATTGC AGGTTGGC AAGTGGGCTGATG
[0041] FUNDC2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_023934.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with FUNDC2 has the nucleotide sequence of SEQ ID NO: 24 as shown below:
CCTGCTTCCCCACACTCTGCCTCTCCTGACATCTGGGTCTCTGGGTTATG
[0042] NDRG2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_201539.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NDRG2 has the nucleotide sequence of SEQ ID NO: 25 as shown below:
GTTGGAATGGGAGTTGGCGGGCAGTGAACGAGTGTGGGGAAGGATTGGTG
[0043] RPL28 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 000991.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RPL28 has the nucleotide sequence of SEQ ID NO: 26 as shown below:
CCCAAGCACCTGGAAGACATGCCAGATCCATGTGCAGTAATGCCTGGTGG
[0044] SRP54 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_939727.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SRP54 has the nucleotide sequence of SEQ ID NO: 27 as shown below:
GTTATATAGCTATACAGAAATGGATCCTGTCATCATTGCTTCTGAAGGAG
[0045] LOC643466 has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM 926789.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LOC643466 has the nucleotide sequence of SEQ ID NO: 28 as shown below:
TTGACTCAAACCCACGGTGCGCCTCGGGCCGTTAGGGGTACCCCGAGGCA
[0046] ZDHHC1 IB has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM_942335.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZDHHC1 IB has the nucleotide sequence of SEQ ID NO: 29 as shown below:
TGGGGCATGTGGGCTCTGCACTACCTCCAGCTGACCATGGCATTCAGTTG
[0047] NSUN5B has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001039575.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NSUN5B has the nucleotide sequence of SEQ ID NO: 30 as shown below:
CGGGGCGGGGAAGTGAACCCCGACGGTCAGCGCTTTGTCATCTGGTTTCA
[0048] NDRG3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_022477.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NDRG3 has the nucleotide sequence of SEQ ID NO: 31 as shown below:
CTACTGTTAGGTGAGGGAGTCACAGCCAGACAGAGAGTATTGCTGGAGGG
[0049] DHRS3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_004753.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DHRS3 has the nucleotide sequence of SEQ ID NO: 32 as shown below:
TGACCCCCACAGGGAGGCAGGAAAACAGCCAGAAGCCACCTTGACACTTT
[0050] CPEB2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_182646.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CPEB2 has the nucleotide sequence of SEQ ID NO: 33 as shown below:
TCAGAGCAGTGGCTGGGGCACTGGAAGTATGTCCTGGGGAGCAATGCATG [0051] PPID has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_005038.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with PPID has the nucleotide sequence of SEQ ID NO: 34 as shown below:
CAGGTGTGAGCCACCGTGCCCGGCCAAGTAAAATGTTTTTTAAAATGGTT
[0052] FOXP1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_032682.5, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with FOXP1 has the nucleotide sequence of SEQ ID NO: 35 as shown below:
AGAATATTGGATGACATTTCCTGACATGTGGGAGGGAGAAACTCCCTAAC
[0053] EFNAl has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_004428.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EFNAl has the nucleotide sequence of SEQ ID NO: 36 as shown below:
CCTGCCTTTAAGCCAAAGAAACAAGCTGTGCAGGCATGGTCCCTTAAGGC.
An example of another probe that hybridizes with EFNAl has the nucleotide sequence of SEQ ID NO: 37 as shown below:
CAGGGCCCACGTGTATAGTATCTGTATATAAGTTGCTGTGTGTCTGTCCT
[0054] C50RF44 has the nucleotide sequence corresponding to NCBI Reference Sequence: NR 003545.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C50RF44 has the nucleotide sequence of SEQ ID NO: 38 as shown below:
TGTGGGTCAAAAGTGCCGGTCAAAATGGAAGTGAATCCCCCTAAACAGGA
[0055] ARHGAP25 has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM 001007231.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ARHGAP25 has the nucleotide sequence of SEQ ID NO: 39 as shown below:
GGGAAAGAGTGAAAAGACAAGAAGGGCGCAAACTGTGACAGACTCACCGC
[0056] CTDSPL2 has the nucleotide sequence corresponding to NCBI Reference Sequence: NM 016396.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CTDSPL2 has the nucleotide sequence of SEQ ID NO: 40 as shown below:
CCTGTGGCGCAGTACACTCCCAAGCCACCAATGCAGTTAATATGCTCTCA [0057] CKAP2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001098525.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CKAP2 has the nucleotide sequence of SEQ ID NO: 41 as shown below:
CTTGCGTCCCTTGGACTGCCTGTTGATTGATGGAAAGTGTCTGCACTGAC
[0058] MAZ has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001042539.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MAZ has the nucleotide sequence of SEQ ID NO: 42 as shown below:
GTTGGTTGCGGGGGAGAGGGGAGAATGGAGTAGAGTCCCTTGGTAC AAGC
[0059] BET1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_005868.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BET1 has the nucleotide sequence of SEQ ID NO: 43 as shown below:
GGAAACTTAGTGGGAGAGTAACAGAATGCCTGGAGAGCCTGACTCTGAGC
[0060] CR617556 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XR 015150.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CR617556 has the nucleotide sequence of SEQ ID NO: 44 as shown below:
CAGCATAGACTTAACTCCCTTAAGCCCAGACATCTGTTGGGACCTGACCC
[0061] RPE has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_199229.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RPE has the nucleotide sequence of SEQ ID NO: 45 as shown below:
TTTGGAGGTAATATTGGGTTGAATTCTGACTGCCCCTTTCTAGCTGGACC
[0062] EHHADH has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 01966.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EHHADH has the nucleotide sequence of SEQ ID NO: 46 as shown below:
CCAGCACAGGGAACTTAGGTTAGTGTGGCAAGCCTTTCCTCTTCTGGTCT
[0063] CMAH has the nucleotide sequence corresponding to NCBI Reference
Sequence: NR_002174.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CMAH has the nucleotide sequence of SEQ ID NO: 47 as shown below:
CACCACCCAACTGGAAGTCATTCCTGATGTGCTGTGAGCAGAATGGGCCT
[0064] ECD has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_007265.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ECD has the nucleotide sequence of SEQ ID NO 48 as shown below:
GCCCCAAATGTGGCCCTCTTGGCACAAGTCTTTGTGATCTCAGCTGTGGG
[0065] NMD3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_015938.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NMD3 has the nucleotide sequence of SEQ ID NO: 49 as shown below:
GGTAGGGAAATTAGGGTTCAGTTTATCACTGGACATTCAGGAGGCAAGTC
[0066] SLC10A7 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001029998.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SLC10A7 has the nucleotide sequence of SEQ ID NO: 50 as shown below:
CTACGAGAACACTTTTCTGTGTTTCCCCCATGCCGTCCTGTCACATCCTC
[0067] SNX4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003794.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SNX4 has the nucleotide sequence of SEQ ID NO: 51 as shown below:
CTGCTTGGCTCTCTACACATGGCATTTCAGGGTATAAGATGTAGCATTTC
[0068] NEDD1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_152905.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NEDD1 has the nucleotide sequence of SEQ ID NO: 52 as shown below:
CTGTCACTGCTGGAGTTGCCAGTTCACTCTCAGAAAAAATAGCCGACAGC
[0069] GABPA has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 002040.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GABPA has the nucleotide sequence of SEQ ID NO: 53 as shown below:
GGTTTTGCACCATCCTCTTACGGCCTAGAGAGTTGACAAGTTGCTTGTAG [0070] MAGMAS has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 016069.9, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MAGMAS has the nucleotide sequence of SEQ ID NO: 54 as shown below:
TTCTACCTGCAGTCAAAGGTGGTCCGCGCAAAGGAGCGCCTGGATGAGGA
[0071] UBE2V2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003350.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with UBE2V2 has the nucleotide sequence of SEQ ID NO: 55 as shown below:
CAAGATGAAAGCGTGTGGAGAAGTGTC AGATGGCAGTGGAAGCATGTGTG
[0072] C150RF44 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 030800.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C150RF44 has the nucleotide sequence of SEQ ID NO: 56 as shown below:
GTGACTGTCTGGATCAAACCCAGCGGCCTGCAGACAGATGTACAGAAGAT
[0073] PCGF6 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001011663.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with PCGF6 has the nucleotide sequence of SEQ ID NO: 57 as shown below:
GAGGTCTAGAAGTACCTAAACCTGCTGTTCCACAGCCAGTCCCTTCAAGC
[0074] CABIN 1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_012295.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CABIN 1 has the nucleotide sequence of SEQ ID NO: 58 as shown below:
TGACTTTGTAAATCTGCCCACACCCAGCTGGCCATATCCACCCCTCGACG
[0075] EIF3 J has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003758.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EIF3 J has the nucleotide sequence of SEQ ID NO: 59 as shown below:
GCCAGGTCCTTATGTTGTCACCATAGAGCAACAAAGGTATAGGGCTGCCT
[0076] HS.561844 has the nucleotide sequence corresponding to NCBI Reference
Sequence: BX101194.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with HS.561844 has the nucleotide sequence of SEQ ID NO: 60 as shown below:
CAACCTTAGTTCACAGTGCAGTACCACCCCTCACCTTCCATGACTTGTCC
[0077] IMPACT has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_018439.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with IMPACT has the nucleotide sequence of SEQ ID NO: 61 as shown below:
GGCTCGTCTTGAGCTCCTGGCCTCAATCGATCTTCCTGCCAAGGTTTTGG
[0078] ATAD2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 014109.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ATAD2 has the nucleotide sequence of SEQ ID NO: 62 as shown below:
GGCTTTGGCAATTCTTTCTCAGCCTACACCCTCACTTGTTGTGGATCATG
[0079] RGL2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_004761.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RGL2 has the nucleotide sequence of SEQ ID NO: 63 as shown below:
CAGAAATTCAGAAAGGGAGCCAGCCACCCTGGGGCAGTGAAGTGCCACTG
[0080] CASD 1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_022900.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CASD1 has the nucleotide sequence of SEQ ID NO: 64 as shown below:
GCCAGTATCACATATGGCTGGCAGCGGACACAAGGGGTATCTTGGTACTG
[0081] TMEM185A has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM_032508.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TMEM185A has the nucleotide sequence of SEQ ID NO: 65 as shown below:
ACGTGTGCGTGCCGTTTCTCCAAGCACTGCAGGTTCCACCGTGTGTCAGA
[0082] ESM1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 007036.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ESM1 has the nucleotide sequence of SEQ ID NO: 66 as shown below:
CTGCTGATGTAGTTCCCGGGTTACCTGTATCTGAAGGACGGTTCTGGGGC [0083] ADSSL1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_152328.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ADSSL1 has the nucleotide sequence of SEQ ID NO: 67 as shown below:
AGGGCAAAGGCAAGGTGGTGGACCTGCTGGCCACGGACGCCGACATCATC
[0084] ACSL5 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_203379.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ACSL5 has the nucleotide sequence of SEQ ID NO: 68 as shown below:
TTAGTAACC ACAAGTTCAAGGGTCAAAGGGACCCTCTGTGCCTTCTTCTT
[0085] C10RF124 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_032018.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C10RF124 has the nucleotide sequence of SEQ ID NO: 69 as shown below:
GCCATCCC AGGATGTGAGTGGGTCTGAAGATACATTCCCAAATAAACGAC
[0086] CYB561 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001017917.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CYB561 has the nucleotide sequence of SEQ ID NO: 70 as shown below:
GGGGCCAGTCTCCTCTAATGCTCAGATTTCCCATAGTTGGCTTTTGCTGT
[0087] MAP4K5 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_006575.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MAP4K5 has the nucleotide sequence of SEQ ID NO: 71 as shown below:
GGGTTGTCGTTTTGGAAAGTAGGCCAACAGAAAATCCTACTGCACACAGC
[0088] CRIPl has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001311.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CRIPl has the nucleotide sequence of SEQ ID NO: 72 as shown below:
GCCGAGAGCCACACTTTCAAGTAAACCAGGTGGTGGAGACCCCATCCTTG
[0089] ING1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_198219.2, which is hereby incorporated by reference in its entirety . An example of a probe that hybridizes with ING1 has the nucleotide sequence of SEQ ID NO: 73 as shown below:
GCTTGGGTACACTTCTCTTAAGTGGTCTAGTCAAGGAACCTCAAGTCATG
[0090] LILRB1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_943444.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LILRB1 has the nucleotide sequence of SEQ ID NO: 74 as shown below:
TGTCAGATGCGTCTCTGCTGACCTGAGTCTGCCCTGCACCATGGACCTGC
[0091] SPNS3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_ 182538.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SPNS3 has the nucleotide sequence of SEQ ID NO: 75 as shown below:
GCACATCTGCCACTTTTGAATTCCCGGCTGGAGAGCTGGCAGGACCCTGT
[0092] CDH11 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001797.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CDH11 has the nucleotide sequence of SEQ ID NO: 76 as shown below:
CGTGCCAGATATAACTGTCTTGTTTCAGTGAGAGACGCCCTATTTCTATG
[0093] LOC642403 has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM 925924.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LOC642403 has the nucleotide sequence of SEQ ID NO: 77 as shown below:
AATGGTATGGACAGTAAGGTGCAGGCTGAGGAGGTCTCAGATGGAGATGA
[0094] CASP4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001225.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CASP4 has the nucleotide sequence of SEQ ID NO: 78 as shown below:
ACTCCAAGGGCCAAAGCTCAAATGCCCACCATAGAACGACTGTCCATGAC
[0095] TEAD2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003598.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TEAD2 has the nucleotide sequence of SEQ ID NO: 79 as shown below:
AGTGGGTGCTAGGGTCTTGACTTTATCTCCGCTGCACAAGCAGTGTGTTG [0096] KHDRBS3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_006558.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with KHDRBS3 has the nucleotide sequence of SEQ ID NO: 80 as shown below:
AGGCACCTTCAGCGAGGACAGCAAAGGGCGTCTACAGAGACCAGCCATAT
[0097] FHL3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_004468.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with FHL3 has the nucleotide sequence of SEQ ID NO: 81 as shown below:
AGGTCTCCTATGGGTGCCTGGGAAGTCCTTGAAAGTGGACTGTTCTCAGG
[0098] EPPK1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_937579.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EPPK1 has the nucleotide sequence of SEQ ID NO: 82 as shown below:
CC AGTGTCTACTATTTAGTGCCCTGGCTCTATTTCGGTCCTCCTCCCCGG
[0099] MARCKSL1 has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM 023009.5, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MARCKSL1 has the nucleotide sequence of SEQ ID NO: 83 as shown below:
CCTGAGCCAGAAGTGGGGTGCTTATACTCCCAAACCTTGAGTGTCCAGCC
[0100] FAM44B has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_138369.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with FAM44B has the nucleotide sequence of SEQ ID NO: 84 as shown below:
TAGGCATAAGGAAACTCGTTTGCAGGCTCTCTGTCCAGGGCTGCTTCCTG
[0101] VEGFB has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003377.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with VEGFB has the nucleotide sequence of SEQ ID NO: 85 as shown below:
GGACAGAGTTGGAAGAGGAGACTGGGAGGCAGCAAGAGGGGTCACATACC
[0102] LYRM4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_020408.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LYRM4 has the nucleotide sequence of SEQ ID NO: 86 as shown below:
ACCGGTGCCCAAATCTGGCTGGTGGACAGAAGCACCTGGAGAGTTGGAGA
[0103] AB007962 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_941243.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AB007962 has the nucleotide sequence of SEQ ID NO: 87 as shown below:
CTTATCAGAACGGAGTGGATGGTCACCTTCCTCACTTATTGCTAATCTCC
[0104] PPP2R3B has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_199326.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with PPP2RB3 has the nucleotide sequence of SEQ ID NO: 88 as shown below:
CGTTCCTGTGAAGCTCTCCCTGACATGCATCTTCGTCTCTCCATCCTGGC
[0105] SPINK2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_021114.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SPINK2 has the nucleotide sequence of SEQ ID NO: 89 as shown below:
GCTCCTGGCAGTCACCTTCGCAGCCTCTCTGATCCCTCAATTTGGTCTGT
[0106] C90RF123 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_033428.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C90RF123 has the nucleotide sequence of SEQ ID NO: 90 as shown below:
CGCTGAGTAGTCTGAGGAGCAAGAGGAGTTGGTCTTTCTGTCCCAGTGGC
[0107] PANK 2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_024960.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with PANK2 has the nucleotide sequence of SEQ ID NO: 91 as shown below:
GCTGGCGGCCTCGACGGCAGCTGCGGAACTAGGCCGAGGGACAAAGGCTA
[0108] COG2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_007357.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with COG2 has the nucleotide sequence of SEQ ID NO: 92 as shown below:
GAGAACTCCTGGGCTTTCTAAAGAGGCTGCGGGAAGCCATCCTCCACTCC [0109] CRY2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_021117.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CRY2 has the nucleotide sequence of SEQ ID NO: 93 as shown below:
TGACCCAAGGGCCAGCATGGGGAAGAGATGGTTGCAGGCAAAATGCACTT
[0110] SESN1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_014454.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SESN1 has the nucleotide sequence of SEQ ID NO: 94 as shown below:
CCTGAC ACTGGAGGGCAGCTGTCTTGTGCATTACTTGTGTTCCC AGCACC
[0111] EPN2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_014964.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EPN2 has the nucleotide sequence of SEQ ID NO: 95 as shown below:
ACTGATCATGAAGCCACCGGCCACTGCCACGC ATGTTGC ACCTGTGCCAT
[0112] IL23A has the nucleotide sequence corresponding to NCBI Reference
Sequence: X00437.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with IL23 A has the nucleotide sequence of SEQ ID NO: 96 as shown below:
GGAGCTTCTAACCCGTCATGGTTCAATACACATTCTTCTTTTGCCAGCGC
[0113] BE439556 has the nucleotide sequence corresponding to NCBI Reference
Sequence: BE439556.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BE439556 has the nucleotide sequence of SEQ ID NO: 97 as shown below:
CCCTCTCCCTGGGGCATGTGCAGAGTTTCAACTTCTTGTTGGCTGCTCTC
[0114] DB050967 has the nucleotide sequence corresponding to NCBI Reference
Sequence: DA760637.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DB050967 has the nucleotide sequence of SEQ ID NO: 98 as shown below:
CAGGACACTCTCCAAACTCTCCCTCCAGTCTAAGATGATGCCAGCTCCAG
[0115] TMEM203 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_053045.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TMEM203 has the nucleotide sequence of SEQ ID NO: 99 as shown below:
GAACTCTGCTGTCCAGGCACTGCTTGGCTTACTATCCCAGCAAAGACTGC
[0116] RCBTB2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001268.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RCBTB2 has the nucleotide sequence of SEQ ID NO: 100 as shown below:
TCACATAAGGTCCTTTGCTTTTCTTTGTGTTAAGAGGGACTTGCCTCTGT
[0117] ZNF627 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_145295.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZNF627 has the nucleotide sequence of SEQ ID NO: 101 as shown below:
GTGCTCTCTTGCTAAAGACCGCAGAGACCATACCTGTTGTCAAAGAGGGT
[0118] CMTM1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_181289.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CMTM1 has the nucleotide sequence of SEQ ID NO: 102 as shown below:
TGTACCCAAGGCACAGCGCAACATCTCAGCGAAGACCGCACCCCGGAAGC
[0119] HSD11B1L has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_198707.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with HSD11B1L has the nucleotide sequence of SEQ ID NO: 103 as shown below:
GGGGACTTGCAAGGCCTCACCTGTTTGGCCATGATTGATGACGTGACTGC
[0120] MAL has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_002371.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MAL has the nucleotide sequence of SEQ ID NO: 104 as shown below:
ACTTGAGCTGAAAACCCAGATGGTGTTAACTGGCCGCCCCACTTTCCGGC
[0121] TOP1MT has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_052963.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TOP1MT has the nucleotide sequence of SEQ ID NO: 105 as shown below:
CAGGATCAGCATTGCCTGGTGCAAGCGGTTCAGGGTGCCAGTGGAGAAGA [0122] NSUN5 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_018044.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with NSUN5 has the nucleotide sequence of SEQ ID NO: 106 as shown below:
ACGTGCTCCCTCTGCCAGGAGGAGAATGAAGACGTGGTGCGAGATGCGCT
[0123] GRB10 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001001555.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GRBIO has the nucleotide sequence of SEQ ID NO: 107 as shown below:
GCGCTCGGAGACCCGGTGGAGCCC AAAGTTTCCGCGC AGCCCCTGGGTGG
[0124] ANXA8L1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_931775.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ANXA8L1 has the nucleotide sequence of SEQ ID NO: 108 as shown below:
GGCTGTGGCC AACACTACGTGAGCCCCTCCCTTCCCAGTGGGCACCATGT
[0125] ERI2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_001132328.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ERI2 has the nucleotide sequence of SEQ ID NO: 109 as shown below:
TTACTGCCAGCATCTCAGCCTGAGGAAAACGTAGACTGTACAGTTCCCAT
[0126] AK098672 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_933327.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AK098672 has the nucleotide sequence of SEQ ID NO: 110 as shown below:
GCAGAAAGTTGAGGCTTAGAAGGTGCACGGCCCTACCTCTTCCGAGGTGC
[0127] CRCP has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_014478.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CRCP has the nucleotide sequence of SEQ ID NO: 111 as shown below:
GAAAGATTTCCTCCACGGCCTTTGCCCCAGTTGTGGGGAGGTCTCTGTGC
[0128] TWIST2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_057179.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TWIST2 has the nucleotide sequence of SEQ ID NO: 112 as shown below:
GCAGAGCGACGAGATGGACAATAAGATGACCAGCTGCAGCTACGTGGCCC
[0129] RIMKLB has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_020734.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RIMKLB has the nucleotide sequence of SEQ ID NO: 113 as shown below:
GTAAATGCACCGGTTTGGATTCAGGCACAGCCCCAGTCTGCCTACAGCAG
[0130] AM393854 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_133477.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AM393854 has the nucleotide sequence of SEQ ID NO: 114 as shown below:
TCCAGTAGCTGATTACAACTACAACCCACACCCAAGGGGATGGAGACGCC
[0131] PAQR6 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_024897.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with PAQR6 has the nucleotide sequence of SEQ ID NO: 115 as shown below:
GCCTTGAGCTCAGAGGGGGTACCCAGGCGGGCAGGGACCGTCCAGGCCCA
[0132] GTF3C6 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_138408.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GTF3C6 has the nucleotide sequence of SEQ ID NO: 116 as shown below:
CGGAGAAGACGAGGAAGAGGAGGAGCAGTTGGTTCTGGTGGAATTATCAG
[0133] GRASP has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_181711.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GRASP has the nucleotide sequence of SEQ ID NO: 117 as shown below:
TCCCATGAAGCCCTCTCCTCAGCTTTACTTGCTCCCCCGCCCTTAGCCTT
[0134] CENPE has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001813.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CENPE has the nucleotide sequence of SEQ ID NO: 118 as shown below:
CCAGAGGTGCAAAATGCAGGAGCAGAGAGTGTGGATTCTCAGCCAGGTCC [0135] P2RY4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_002565.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with P2RY4 has the nucleotide sequence of SEQ ID NO: 119 as shown below:
CTTGCTCACTGGGGACAAATATCGACGTCAGCTCCGTCAGCTCTGTGGTG
[0136] BC038536 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_931524.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BC038536 has the nucleotide sequence of SEQ ID NO: 120 as shown below:
GGGCTAAC ACATTAATGAGATTTCCTGAGACTGCCCTGTAGAGATGCTTG
[0137] ZNF268 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_152943.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZNF268 has the nucleotide sequence of SEQ ID NO: 121 as shown below:
GTTTGGTGTCTGGTGAGGGCCTGCTCTGTGCTTCC AAGATGACGCCTTGT
[0138] SMPDl has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001007593.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SMPDl has the nucleotide sequence of SEQ ID NO: 122 as shown below:
CTCCTTTCCTGGAGCTGGTTTAGCTGGATATGGGAGGGGGTTTGGCTGCC
[0139] MRP63 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_024026.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MRP63 has the nucleotide sequence of SEQ ID NO: 123 as shown below:
GTCAAAGTTGTATGGCTGAGGCCCACACGGTGGCTCACTTCTGTAATCCC
[0140] CSTF3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_001326.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CSTF3 has the nucleotide sequence of SEQ ID NO: 124 as shown below:
GTGGCAGAACCACATTTTGTTCCCTCTTCAAGGGTGTCTTGTATGTGCCG
[0141] TTF2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_003594.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TTF2 has the nucleotide sequence of SEQ ID NO: 125 as shown below:
CAGCCATCTCTGCAGTTCTCTCAGTGCAGGCAGTTCTTCCTCTCAGGCTG
[0142] AW004814 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AW004814.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AW004814 has the nucleotide sequence of SEQ ID NO: 126 as shown below:
AAAGAATGACCCCTGTTGATGAGAGGTGTTACATGTGGCCATGGGACAGG
[0143] AWl 19108 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AWl 19108.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AWl 19108 has the nucleotide sequence of SEQ ID NO: 127 as shown below:
CACGGTCTGGAAGGTGGAAAGTCCAAGATCATGGCTCTGGCAGGTCTCTG
[0144] AWl 82429 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AWl 82429.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AW 182429 has the nucleotide sequence of SEQ ID NO: 128 as shown below:
GGCTTCAGAGCTGTATTTCGGCCAACCCAGTCTTTGTTCAGTTTCTAGCG
[0145] HS.566857 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AI83821.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with HS.566857 has the nucleotide sequence of SEQ ID NO: 129 as shown below:
TTGCAGGGGGCAGACAGATTTATTATGAGGAATTGACTCCTGTGATTATG
[0146] BX109554 has the nucleotide sequence corresponding to NCBI Reference
Sequence: BX109554.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BX109554 has the nucleotide sequence of SEQ ID NO: 130 as shown below:
GCCTGTGAGATGGGTTGCAGAATTGACCTGAGCAGACCAGGCTTCCGAGG
[0147] APOBEC3B has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM 004900.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with APOBEC3B has the nucleotide sequence of SEQ ID NO: 131 as shown below:
ACCCTTTGGTCCTTCGACGGCGCCAGACCTACTTGTGCTATGAGGTGGAG [0148] EZH2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_152998.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with EZH2 has the nucleotide sequence of SEQ ID NO: 132 as shown below:
AGTGTGACCCTGACCTCTGTCTTACTTGTGGAGCCGCTGACCATTGGGAC
[0149] GCOM1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_015532.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GCOM1 has the nucleotide sequence of SEQ ID NO: 133 as shown below:
ATTGC AGAATGTGAAGAAGTTAGAAGAAAAAGTGAACTGTTTAACCCTGT
[0150] ZBTB20 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_932718.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZBTB20 has the nucleotide sequence of SEQ ID NO: 134 as shown below:
TGTTTTCTTAACTTCCTAACCTATGGTTAATTATTCTGACC AGTGGAAAG
[0151] LOC729973 has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM 001131929.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LOC729973 has the nucleotide sequence of SEQ ID NO: 135 as shown below:
GAGGAGCCATAGCAGCAAGGAGTACCTGGAGCTGCACAGGGAGAACTTCC
[0152] MAP2K3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_002756.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with MAP2K3 has the nucleotide sequence of SEQ ID NO: 136 as shown below:
GGGACCTTTGGAGCACAGCCTACGATCCTGGTGCAAGGCCGGTGGATGCA
[0153] BF701780 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM 932199.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BF701780 has the nucleotide sequence of SEQ ID NO: 137 as shown below:
AGCACTGTCGAGGTCACAGACTGCAGACCTCCTTGTATCTTCAAATGGAG
[0154] KCNA6 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_002235.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with KCNA6 has the nucleotide sequence of SEQ ID NO: 138 as shown below:
CCCCTCCCTACCTCATGGGGAATGTCTGGGAAGCTGGGGACATTGCTATG
[0155] OR1J4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001004452.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with OR1J4 has the nucleotide sequence of SEQ ID NO: 139 as shown below:
GGCCACATTGGGGTCACCATCCTCAAGGCTCCATCTACTAAGGGCATCTT
[0156] SKP1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM 940504.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SKP1 has the nucleotide sequence of SEQ ID NO: 140 as shown below:
TTGAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTCTCAAAATCATG
[0157] STATl has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_007315.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with STATl has the nucleotide sequence of SEQ ID NO: 141 as shown below:
TACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAA
[0158] STATl also has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM_139266.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with STATl has the nucleotide sequence of SEQ ID NO: 142 as shown below:
CGCCATCACAGCTGAACTTGTTGAGATCCCCGTGTTACTGCCTATCAGCA
[0159] C10RF26 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_017673.6, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C10RF26 has the nucleotide sequence of SEQ ID NO: 143 as shown below:
GGGCTTGTCACTTTTCAGTACATTTCTAGTGGGGAAGAGCAGGGCGACCC
[0160] VAT1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_006373.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with VAT1 has the nucleotide sequence of SEQ ID NO: 144 as shown below:
AGGACCTGGGCCATTGCAACCAAAATGGGGACTTCCTGGGTAGGGAGGTC [0161] LOC390427 has the nucleotide sequence corresponding to NCBI
Reference Sequence: XM 939524.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LOC390427 has the nucleotide sequence of SEQ ID NO: 145 as shown below:
CCACGTTTCTGTGACTTGAGTGCCCTGGGAGTTTTACGCTGCCTCGTCTC
[0162] THSD1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_018676.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with THSD1 has the nucleotide sequence of SEQ ID NO: 146 as shown below:
GAGC ATTTCCAAGAGGCAAGTGGAACCCGTGGTCC ATTAAACCCTCTCCC
[0163] C70RF49 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_024033.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with C70RF49 has the nucleotide sequence of SEQ ID NO: 147 as shown below:
GC AAGAGGGAC AGGAGCCC AGAAGAGAC ACTGAGGACAAGAGATCAC ACC
[0164] SSX5 has the nucleotide sequence corresponding to NCBI Reference
S equence : XM 941508.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with SSX5 has the nucleotide sequence of SEQ ID NO: 148 as shown below:
CTCTGCCTTCCCAACAAGGGTCTGTACATCTTTCAGGGACAGACTGCTCC
[0165] TMPRSS 1 IB has the nucleotide sequence corresponding to NCBI
Reference Sequence: NM_ 182502.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with TMPRSS 1 IB has the nucleotide sequence of SEQ ID NO: 149 as shown below:
GAGGTCATCAAGGGCAGAGAACTGTGTGGCATCTCCTTATAGTAAAAGTG
[0166] DIP2B has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_173602.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DIP2B has the nucleotide sequence of SEQ ID NO: 150 as shown below:
CAGGCTGTTTAGGGACCATTGCCTGTCTTGGTCACATGAGTCTGTCTCCT
[0167] RFX3 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_134428.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RFX3 has the nucleotide sequence of SEQ ID NO: 151 as shown below:
GGCGTGCAACCAAGCCTCCTGAATCCAATTCACAGCGAGCACATTGTCAC
[0168] ZNF774 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001004309.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZNF774 has the nucleotide sequence of SEQ ID NO: 152 as shown below:
TGCTACTGTCTTCAAGCACCCCAAATAGAGAAAACCTGGGCGTCAGTGGC
[0169] GPAH2 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_130769.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with GPAH2 has the nucleotide sequence of SEQ ID NO: 153 as shown below:
AAAGTACAGCTGCAGTGTGTGGGGAGCCGGAGGGAGGAGCTCGAGATCTT
[0170] RDHl 1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_016026.3, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with RDHl 1 has the nucleotide sequence of SEQ ID NO: 154 as shown below:
GGAGGAATTGAGGGCAAGCACCCAGGACTGATGAGGTCTTAACAAAAACC
[0171] BC050625 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_052941.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BC050625 has the nucleotide sequence of SEQ ID NO: 155 as shown below:
CCATGGGCCTTTTCACAGGGGACACAGGCTTCTTAAAACAACCCGGCTTC
[0172] DBF4 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_006716.4, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DBF4 has the nucleotide sequence of SEQ ID NO: 156 as shown below:
GACTCTACCCCCTAATTTGGTAGGAGATGAAGGAGAAAAGGATGGCATTG
[0173] BX248296 has the nucleotide sequence corresponding to NCBI Reference
Sequence: XM_375081.3 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with BX248296 has the nucleotide sequence of SEQ ID NO: 157 as shown below:
CTGCTACTTGACCCTAGAGCTCTTTGACTCCGATTCCCATGTACGTGCCC [0174] CD364714 has the nucleotide sequence corresponding to NCBI Reference
Sequence: CD364714, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with CD364714 has the nucleotide sequence of SEQ ID NO: 158 as shown below:
GCAAGGCTGGGGTGCTTTGAGATTGTCCATGTCTGATCTACGCACCACGC
[0175] DAI 96703 has the nucleotide sequence corresponding to NCBI Reference
Sequence: DA196703, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with DAI 96703 has the nucleotide sequence of SEQ ID NO: 159 as shown below:
GGGGGAGGGAGCGTGAAGAATTGTTTAAC ATTTGGCC ATCGTTTGGCTGC
[0176] AA884785 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AA884785, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AA884785 has the nucleotide sequence of SEQ ID NO: 160 as shown below:
CCCTCAGAGTCAGTGATCCAAGAGTGTAAGCTACCAGTGCTTCCTGGGAC
[0177] ZNF33B has the nucleotide sequence corresponding to NCBI Reference
Sequence: BI258188.1 , which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with ZNF33B has the nucleotide sequence of SEQ ID NO: 161 as shown below:
GCTGGAAATGTGGGGGCAACAAATACATTAGTGAACACCCTGGCGGATCC
[0178] AK125234 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AK125234, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AK125234 has the nucleotide sequence of SEQ ID NO: 162 as shown below:
GAGGCCCTGGAGGATGGCAGAGGGAACAGGAGGAAAACAAAGTCACATGC
[0179] AA961268 has the nucleotide sequence corresponding to NCBI Reference
Sequence: AA961268, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with AA961268 has the nucleotide sequence of SEQ ID NO: 163 as shown below:
ACCACCAGCTTTCCTGGTTCTCCACCTTGCAGAAAGAAGATCCTGGGACT
[0180] LGSN has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM_016571.2, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with LGSN has the nucleotide sequence of SEQ ID NO: 164 as shown below:
GCAAACTTACCAGATCTTGTCAGTCATTTCCTATGTGTATGTTGACCTGG
[0181] STAG3L1 has the nucleotide sequence corresponding to NCBI Reference
Sequence: NM 001002840.1, which is hereby incorporated by reference in its entirety. An example of a probe that hybridizes with STAG3L1 has the nucleotide sequence of SEQ ID NO: 165 as shown below:
TGGCCAGGATGGTCTTGATCTCTTGACCTTGTGATCCACCTGCCTCATCA
[0182] One of skill in the art will appreciate that probe sequences, other than those disclosed above, that hybridize to the target sequence or isoforms of the target sequence are encompassed by the present invention.
[0183] As used herein, the term "biomarker" means an entire gene, or a portion thereof, such as an EST derived from that gene, the expression or level of which changes between certain conditions. When the expression of the gene correlates with a certain condition, for example a drug treatment or a disease state (i.e. an ASD), the gene is a marker for that condition.
[0184] As used herein, the term "probe" refers to a nucleic acid molecule, or oligonucleotide, corresponding to DNA or RNA, with a variable length that is
complementary to a portion of the biomarkers of the present invention.
[0185] Probes of the present invention can be naturally occurring or synthetic, but are typically prepared by synthetic means. Synthesis of probes is well known to those skilled in the art (Oligonucleotide Synthesis: Methods and Applications, Piet Herdewijn (ed) Humana Press (2004), which is hereby incorporated by reference in its entirety.) For the purpose of the present invention, a probe comprises an oligonucleotide capable of hybridizing specifically to a nucleic acid target molecule of a complementary sequence through one or more types of chemical bond. Such binding may usually occur through complementary base pairing, and usually through hydrogen bond formation. Suitable probes may include natural (i.e. A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, a linkage other than a phosphodiester bond may be used to join the bases in the probe, so long as this variation does not interfere with hybridization of the probe to its target. Thus, probes of the present invention may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. The minimum size of the probes of the present invention is the size required for formation of a stable hybrid between the probe and a complementary sequence on a nucleic acid molecule.
[0186] The phrase "hybridizing specifically to" as used herein refers to the binding, duplexing, or hybridizing of an oligonucleotides probe preferentially to a particular target nucleotide sequence under stringent conditions when that sequence is present in a sample. Stringent conditions are sequence-dependent and will be different in different circumstances. For example, longer sequences hybridize specifically at higher temperatures.
[0187] The probes or targets of the present invention may also be labeled in order that they may be easily detected. Examples of detectable moieties that may be used in the labeling of probes or targets include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials and colorimetric materials.
[0188] The present invention is also directed to a method of diagnosing whether a subject has an ASD that involves obtaining a biological sample from a subject potentially having an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPIl; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1; or (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5. The biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample. This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has an ASD based on said detecting.
[0189] The method described above will identify whether or not a child who is already displaying developmental concerns actually has an ASD or will go on to develop normally. Also, as shown in the Examples, this method can also distinguish the diagnosis of ASD from other developmental disorders, specifically developmental delay (DD) and language delay (LD).
[0190] As described herein, a collection of probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF is informative of a diagnosis of an ASD when there is an increase in expression levels of ZNF329, LOC641518, and RAB31P, along with a corresponding decrease in TAP1, GBP2, and MYOF, as compared to a normally developing subject.
[0191] This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0192] The collection of probes recognizing at least 50% of the following biomarkers: MRPS10, ARF3, CLORF85, KCNEIL, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 is informative of a diagnosis of an ASD when there is an increase in the expression levels of MRPS10, CACHD1, CHM, DUS4L, AK3, BU580973, TCRA, and CR608770, along with a corresponding decrease in ARF3, C10RF85, KCNEIL, BIN2, CYB5R3, FKBP12- EXI, STX5, and SPI1, as compared to a subject with a DD or an LD.
[0193] This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0194] The collection of probes recognizing at least 50% of the following biomarkers: SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 is
informative of a diagnosis of an ASD, DD, or LD when there is an increase in the expression levels of SC65, FUNDC2, NDRG2, RPL28, LOC643466, NSUN5B, NDRG3, DHRS3, CPEB2, FOXP1, EFNA1 and RAB3IP, along with a corresponding decrease in SRP54, ZDHHC1 IB, and PPID, as compared to a normally developing subject.
[0195] This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0196] The collection of probes recognizing at least 50% of the following biomarkers: C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54,
CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5 is informative of a diagnosis of an ASD when there is an increase in the expression levels of CR617556, MAGMAS, CABIN1 , HS.561844, RGL2, and TMEM185A along with a corresponding decrease in C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1, GABPA, UBE2V2, GBP2, C150RF44, PCGF6,
EIF3J,IMPACT, ATAD2, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and
MAP4K5, as compared to a normally developing subject.
[0197] This collection is also informative of a diagnosis of ASD as compared to a subject with DD or LD when there is an increase in expression levels of C50RF44, CTDSPL2, CKAP2,BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, UBE2V2, C150RF44, PCGF6, EIF3J, HS.561844, IMPACT, ATAD2, CASDl, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, MAP4K5, and a corresponding decrease in ARHGAP25, MAZ, MAGMAS, CABIN1, RGL2, TMEM185A.
[0198] This collection of probes is most effective for diagnosing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0199] Another aspect of the present invention is directed to a method of determining whether a subject has a predisposition for developing an ASD. This method involves obtaining a biological sample from a subject at risk of potentially having a predisposition for developing an ASD and providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1 , MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5; (2) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AWl 19108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, and EFNA1; or (3) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1. The biological sample from the subject is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample. This method further involves detecting any hybridization as a result of said contacting, and identifying whether or not the subject has a predisposition for developing an ASD based on said detecting.
[0200] As described herein, the collection of probes recognizing at least 50% of the following biomarkers: CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B, VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627,
CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5 is informative for a subject having a predisposition for developing an ASD when there is a increase in expression levels of CRIPl, ING1, SPNS3, CDH11, LOC642403, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B, VEGFB, LYRM4, PPP2R3B, SPINK2, C90RF123, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, ZNF627, HSD 11 B 1 L, MAL, TOP 1 MT, and NSUN5 along with a corresponding decrease in LILRB1, CASP4, AB007962, PANK2, RCBTB2, and CMTM1, as compared to a normally developing subject.
[0201] This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0202] The collection of probes recognizing at least 50% of the following biomarkers: GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, and EFNAl is informative for a subject having a predisposition for developing an ASD, DD, or LD when there is a increase in expression levels of GRB10, ANXA8L1, AK098672, RIMKLB,
PAQR6,GRASP, SMPDl, AW004814, AW119108, HS.566857, BX109554, and EFNA along with a corresponding decrease in ERI2, CRCP, TWIST2, AM393854,GTF3C6, CENPE,P2RY4,BC038536, ZNF268, PANK2, MRP63, CSTF3, TTF2, AW182429, ATAD2, ESM1, APOBEC3B, EZH2, ACSL5, as compared to a normally developing subject.
[0203] This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD, DD, or LD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0204] The collection of probes recognizing at least 50% of the following biomarkers: GCOMl, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STATl, C10RF26, VAT1, LOC390427, THSDl, C70RF49, SSX5,
TMPRSSl lB, DIP2B, RFX3, ZNF774, GPHA2, RDHl l, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 is informative for a subject having a predisposition for developing an ASD when there is a increase in expression levels of ZBTB20, BF701780, RIMKLB, OR1J4, SKP1, VAT1, LOC390427, C70RF49, SSX5, TMPRSSl lB, ZNF774, RDHl l, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, and AK125234 along with a corresponding decrease in LOC729973, MAP2K3, KCNA6, STATl, C10RF26, THSDl, DIP2B, RFX3, GPHA2, BC050625, AA961268, LGSN, and
STAG3L1, as compared to a normally developing subject.
[0205] This collection is also informative of a diagnosis of ASD as compared to a subject with DD or LD when there is an increase in expression levels of ZBTB20, BF701780, RIMKLB, KCNA6,0R1J4, SKP1, C10RF26, VAT1, LOC390427,
C70RF49, TMPRSSl lB, ZNF774, RDHl l, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, and AK125234 along with a corresponding decrease in GCOMl, LOC729973, MAP2K3, STATl, THSDl, DIP2B, RFX3, GPHA2, BC050625, AA961268, LGSN, and STAG3L1 and no change in SSX5.
[0206] This collection of probes is most effective for determining that a subject has a predisposition for developing an ASD when used with subjects between 12 and 24 months of age that are also matched on gender and age within 1 month.
[0207] The present invention is also directed to a method of diagnosing whether a subject has an autism spectrum disorder involving obtaining a biological sample from a subject potentially having an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNAl, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESMl, ADSSL1, ACSL5, C10RF124, CYB561, MAP4K5, CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854,
PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, EFNAl, GCOMl, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774,
GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers, contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has an autism spectrum disorder based on said detecting.
[0208] A final aspect of the present invention relates to a method of diagnosing whether a subject has a predisposition for developing an autism spectrum disorder involving obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder, providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12- EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXPl, EFNAl, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESM1, ADSSL1, ACSL5, C10RF124, CYB561, MAP4K5, CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESM1,
APOBEC3B, EZH2, ACSL5, EFNAl, GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers, contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample, detecting any hybridization as a result of said contacting, and identifying whether the subject has a predisposition for developing an autism spectrum disorder based on said detecting.
[0209] The subject can be any mammal (e.g., mouse, rat, rabbit, hamster, guinea pig, cat, dog, pig, goat, cow, horse, primate, or human). Preferably, the subject is a human. More preferably, the subject is between 11 months to 4 years of age.
[0210] The initial determination that a subject is suspected of having an ASD, and, therefore, should be tested in accordance with the method of the present invention, can be made based on a general population-based screening method called the One- Year Well-Baby Check-Up Approach (Pierce et al, "Detecting, Studying, and Treating Autism Early: The One-year Well-Baby Check-Up Approach," J Pediatr 159:458-465 (2011), which is hereby incorporated by reference in its entirety). For example, subject's failing the Communication and Symbolic Behavior Scales Development Profile (CSBS DP) can be suspected to have an ASD. In addition, failure of the Autism Diagnostic Observation Schedule (ADOS) and the clinical judgment of a Ph.D. -level psychologist can result in the determination that a subject is suspected of having an ASD.
[0211] The isolation of biological samples from a subject which contain nucleic acids is well known in the art. The biological sample can be sputum, blood, a blood fraction, tissue or fine needle biopsy sample, urine, stool, peritoneal fiuid, or pleural fluid. Preferably, the biological sample is blood. In a more preferred embodiment, the biological sample is isolated peripheral blood mononuclear cells (PBMCs).
[0212] Methods for isolation of PBMCs are well known in the art. Typically, blood is collected from subjects into heparinized blood collection tubes by personnel trained in phlebotomy using sterile technique. The collected blood samples can be divided into aliquots and centrifuged, and the thin layer of cells between the erythrocyte layer and the plasma layer, which contains the PBMCs, is removed and used for analysis.
[0213] For the purposes of the present invention, the isolation of nucleic acids from the biological sample is desirable. Methods of isolating RNA and DNA from biological samples for use in the methods of the present invention are readily known in the art. These methods are described in detail in LABORATORY TECHNIQUES IN
BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, PART I. THEORY AND NUCLEIC ACID PREPARATION (P. Tijssen ed., Elsevier 1993), which is hereby incorporated by reference in its entirety. Total RNA can be isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction, a guanidinium isothiocyanate-ultracentrifugation method, or lithium chloride-SDS-urea method. PolyA+ mRNA can be isolated using oligo(dT) column chromatography or (dT)n magnetic beads (See e.g., SAMBROO AND RUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL (Cold Springs Laboratory Press, 1989) or CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Fred M. Ausubel et al. eds., 1992) which are hereby
incorporated by reference in their entirety). See also WO/2000024939 to Dong et al., which is hereby incorporated by reference in its entirety, for complexity management and other nucleic acid sample preparation techniques.
[0214] It may be desirable to amplify the nucleic acid sample prior to detecting biomarker expression. One of skill in the art will appreciate that a method which maintains or controls for the relative frequencies of the amplified nucleic acids to achieve quantitative amplification should be used. [0215] Typically, methods for amplifying nucleic acids employ a polymerase chain reaction (PCR) (See e.g., PCR TECHNOLOGY: PRINCIPLES AND APPLICATIONS FOR DNA AMPLIFICATION (Henry Erlich ed., Freeman Press 1992); PCR PROTOCOLS: A
GUIDE TO METHODS AND APPLICATIONS (Michael Innis ed., Academic Press 1990);
Mattila et al., "Fidelity of DNA Synthesis by the Thermococcus litoralis DNA
Polymerase— An Extremely Heat Stable Enzyme with Proofreading Activity," Nucleic Acids Res. 19:4967-73 (1991); Eckert et al, "DNA Polymerase Fidelity and the
Polymerase Chain Reaction," PCR Methods and Applications 1 : 17-24 (1991); and U.S. Patent Nos. 4,683,202, 4,683,195, 4,800,159, 4,965,188, and 5,333,675 all to Mullis et al., which are hereby incorporated by reference in their entireties for all purposes). The sample can also be amplified on an array as described in U.S. Patent No. 6,300,070 to Boles, which is hereby incorporated by reference in its entirety.
[0216] Other suitable amplification methods include the ligase chain reaction
(LCR) (e.g. Wu et al., "The Ligation Amplification Reaction (LAR)— Amplification of Specific DNA Sequences Using Sequential Rounds of Template-Dependent Ligation," Genomics 4:560-9 (1989), Landegren et al, "A Ligase-Mediated Gene Detection
Technique," Science 241 : 1077-80 (1988), and Barringer et al, "Blunt-End and Single- Strand Ligations by Escherichia coli Ligase: Influence on an In Vitro Amplification Scheme," Gene 89: 117-22 (1990), which are hereby incorporated by reference in their entirety); transcription amplification (Kwoh et al., "Transcription-Based Amplification System and Detection of Amplified Human Immunodeficiency Virus Type I with a Bead- Based Sandwich Hybridization Format," Proc. Natl. Acad. Sci. USA 86: 1173-7 (1989) and WO 88/10315 to Gingeras, which are hereby incorporated by reference in their entirety); self-sustained sequence replication (Guatelli et al, "Isothermal, In Vitro Amplification of Nucleic Acids by a Multienzyme Reaction Modeled After Retroviral Replication," Proc. Natl. Acad. Sci. USA 87: 1874-8 (1990) and WO 90/06995 to
Gingeras, which are hereby incorporated by reference in their entirety); selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276 to Burg at al, which is hereby incorporated by reference in its entirety); consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Patent No. 5,437,975 to McClelland, which is hereby incorporated by reference in its entirety); arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Patent Nos. 5,413,909 to Bassam, and 5,861,245 to McClelland which are hereby incorporated by reference in their entirety); and nucleic acid based sequence amplification (NABS A) (See U.S. Patent Nos. 5,409,818, 5,554,517, and 6,063,603 all to Davey, which are hereby incorporated by reference in their entirety). Other amplification methods that may be used are described in U.S. Patent Nos.
5,242,794 to Whiteley; 5,494,810 to Barany; and 4,988,617 to Landgren, which are hereby incorporated by reference in their entirety.
[0217] The biological sample is then contacted with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample. The probes comprise nucleotide sequences that are complementary to at least a region of mRNA or corresponding cDNA of the biomarkers listed above. As used herein, the term "hybridization" refers to the complementary base-pairing interaction of one nucleic acid with another nucleic acid that results in formation of a duplex, triplex, or other higher-ordered structure. Typically, the primary interaction is base specific, e.g., A/T and G/C, by Watson/Crick and Hoogsteen- type hydrogen bonding. Base-stacking and hydrophobic interactions can also contribute to duplex stability. Conditions for hybridizing detector probes to complementary and substantially complementary target sequences are well known in the art {see e.g. ,
NUCLEIC ACID HYBRIDIZATION, A PRACTICAL APPROACH, B. Hames and S. Higgins, eds., IRL Press, Washington, D.C. (1985), which is hereby incorporated by reference in its entirety). In general, hybridization is influenced by, among other things, the length of the polynucleotides and their complements, the pH, the temperature, the presence of mono- and divalent cations, the proportion of G and C nucleotides in the hybridizing region, the viscosity of the medium, and the presence of denaturants. Such variables influence the time required for hybridization. Thus, the preferred hybridization conditions will depend upon the particular application. Such conditions, however, can be routinely determined by the person of ordinary skill in the art without undue experimentation. It will be appreciated that complementarity need not be perfect; there can be a small number of base pair mismatches that will minimally interfere with hybridization between the target sequence and single stranded nucleic acid probe. Thus, what is meant by
complementarity herein is that the probes are sufficiently complementary to the target sequence to hybridize under the selected reaction conditions to achieve selective detection and measurement.
[0218] Detection of hybridization between said probes and corresponding target molecules from the biological sample can be performed by several assays known in the art that permit detection of the expression level of the biomarkers. As described herein, the "expression level" of a biomarker can be achieved by measuring any suitable value that is representative of the gene expression level. The measurement of gene expression levels can be direct or indirect. A direct measurement involves measuring the level or quantity of R A or protein. An indirect measurement may involve measuring the level or quantity of cDNA, amplified RNA, DNA, or protein; the activity level of RNA or protein; or the level or activity of other molecules (e.g. a metabolite) that are indicative of the foregoing. The measurement of expression can be a measurement of the absolute quantity of a gene product. The measurement can also be a value representative of the absolute quantity, a normalized value (e.g., a quantity of gene product normalized against the quantity of a reference gene product), an averaged value (e.g., average quantity obtained at different time points or from different sample from a subject, or average quantity obtained using different probes, etc.), or a combination thereof.
[0219] In a preferred embodiment, hybridization is detected by measuring RNA expression level of the biomarkers. Measuring gene expression by quantifying mRNA expression can be achieved using any commonly used method known in the art including northern blotting and in situ hybridization (Parker et al., "mRNA: Detection by in Situ and Northern Hybridization," Methods in Molecular Biology 106:247-283 (1999), which is hereby incorporated by reference in its entirety); RNAse protection assay (Hod et al., "A Simplified Ribonuclease Protection Assay," Biotechniques 13:852-854 (1992), which is hereby incorporated by reference in its entirety); reverse transcription polymerase chain reaction (RT-PCR) (Weis et al, "Detection of Rare mRNAs via Quantitative RT-PCR," Trends in Genetics 8:263-264 (1992), which is hereby incorporated by reference in its entirety); and serial analysis of gene expression (SAGE) (Velculescu et al, "Serial Analysis of Gene Expression," Science 270:484-487 (1995); and Velculescu et al,
"Characterization of the Yeast Transcriptome," Cell 88:243-51 (1997), which is hereby incorporated by reference in its entirety).
[0220] In a more preferred embodiment, RNA expression level is measured using a nucleic acid hybridization assay or a nucleic acid amplification assay.
[0221] In a nucleic acid hybridization assay, the expression level of nucleic acids corresponding to biomarkers is detected using an array-based technique. These arrays, also commonly referred to as "microarrays" or "chips" have been generally described in the art, see e.g., U.S. Patent Nos. 5,143,854 to Pirrung et al; 5,445,934 to Fodor et al; 5,744,305 to Fodor et al; 5,677,195 to Winkler et al; 6,040,193 to Winkler et al;
5,424,186 to Fodor et al., which are all hereby incorporated by reference in their entirety. A microarray comprises an assembly of distinct polynucleotide or oligonucleotide probes immobilized at defined positions on a substrate. Arrays are formed on substrates fabricated with materials such as paper, glass, plastic (e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, silicon, optical fiber or any other suitable solid or semisolid support, and configured in a planar (e.g., glass plates, silicon chips) or three- dimensional (e.g., pins, fibers, beads, particles, microtiter wells, capillaries)
configuration. Probes forming the arrays may be attached to the substrate by any number of ways including (i) in situ synthesis (e.g., high-density oligonucleotide arrays) using photolithographic techniques (see Fodor et al, "Light-Directed, Spatially Addressable Parallel Chemical Synthesis," Science 251 :767-773 (1991); Pease et al, "Light-Generated Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Natl. Acad. Sci.
U.S.A. 91 :5022-5026 (1994); Lockhart et al, "Expression Monitoring by Hybridization to High-Density Oligonucleotide Arrays," Nature Biotechnology 14: 1675 (1996); and U.S. Patent Nos. 5,578,832 to Trulson; 5,556,752 to Lockhart; and 5,510,270 to Fodor, which are hereby incorporated by reference in their entirety); (ii) spotting/printing at medium to low-density (e.g., cDNA probes) on glass, nylon or nitrocellulose (Schena et al., "Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray," Science 270:467-470 (1995), DeRisi et al, "Use of a cDNA Microarray to Analyse Gene Expression Patterns in Human Cancer," Nature Genetics 14:457-460 (1996); Shalon et al., "A DNA Microarray System for Analyzing Complex DNA Samples Using Two-Color Fluorescent Probe Hybridization," Genome Res. 6:639-645 (1996); and Schena et al, "Proc. Natl. Acad. Sci. U.S.A. 93: 10539-11286) (1995), which are hereby incorporated by reference in their entirety); (iii) masking (Maskos et al., "Oligonucleotide Hybridizations on Glass Supports: A Novel Linker for Oligonucleotide Synthesis and Hybridization Properties of Oligonucleotides Synthesised In Situ," Nuc. Acids. Res. 20: 1679-1684 (1992), which is hereby incorporated by reference in its entirety); and (iv) dot-blotting on a nylon or nitrocellulose hybridization membrane {see e.g. , SAMB OO AND RUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL (Cold Springs
Laboratory Press, 1989), which is hereby incorporated by reference in its entirety).
Probes may also be noncovalently immobilized on the substrate by hybridization to anchors, by means of magnetic beads, or in a fluid phase such as in microtiter wells or capillaries. The probe molecules are generally nucleic acids such as DNA, RNA, PNA, and cDNA.
[0222] Fluorescently labeled cDNA for hybridization to the array may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from ASD subject samples of interest. Labeled cDNA applied to the array hybridizes with specificity to each nucleic acid probe spotted on the array. After stringent washing to remove non-specifically bound cDNA, the array is scanned by confocal laser microscopy or by another detection method, such as a CCD camera.
Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA samples generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., "Parallel Human Genome Analysis: Microarray-Based Expression Monitoring of 1000 Genes," " roc. Natl. Acad. Sci. USA 93(20): 10614-9 (1996), which is hereby
incorporated by reference in its entirety).
[0223] In a preferred embodiment, in the nucleic acid hybridization assay, the expression levels of biomarkers informative of ASD diagnosis can be detected using the collections of probes of the present invention. In accordance with this aspect of the present invention, the nucleic acid probes of the present invention have a nucleotide sequence that is complementary to at least a portion of an RNA transcript or DNA nucleotide sequence encoded by a biomarker informative of ASD diagnosis.
[0224] A nucleic acid amplification assay that is a semi-quantitative or quantitative real-time polymerase chain reaction (RT-PCR) assay can also be performed. Because RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avian myeloblastosis virus reverse transcriptase (AMV- RT) and Moloney murine leukemia virus reverse transcriptase (MLV-RT), although others are also known and suitable for this purpose. The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.
[0225] Although the PCR step can use a variety of thermostable DNA-dependent
DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5 '-3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity. An exemplary PCR amplification system using Taq polymerase is TaqMan® PCR (Applied Biosystems,
Foster City, CA). Taqman® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect the nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
[0226] TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, the ABI PRISM 7700® Sequence Detection System® (Perkin-Elmer- Applied Biosystems, Foster City, Calif, USA), or the Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
[0227] In addition to the TaqMan® primer/probe system, other quantitative methods and reagents for real-time PCR detection that are known in the art (e.g. SYBR green, Molecular Beacons, Scorpion Probes, etc.) are suitable for use in the methods of the present invention. [0228] To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the presence or absence of an ASD. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase
(GAPDH) and β-actin.
[0229] Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization and quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g., Heid et al, "Real Time Quantitative PCR," Genome Research 6:986-994 (1996), which is incorporated by reference in its entirety.
[0230] The identification of whether or not the subject has an ASD based on said detecting can be performed by comparing the expression levels of said biomarkers with the expression levels of the same biomarkers in a typically developing subject. For the purposes of this invention, a "typically developing" subject is one who does not have or is not suspected of having any developmental disorder. Dependent upon the collection of probes used in the described method, comparisons may also be made to subjects with different disorders (e.g. Developmental Delay (DD) and Language Delay (LD)). The data generated from the detection of the previously biomarker expression levels can then be used to prepare a personalized genomic profile for a subject. The genomic profile can be used to establish a personalized treatment plan for the subject.
EXAMPLES [0231] The following examples are provided to illustrate embodiments of the present invention but are by no means intended to limit its scope.
Materials and Methods for Examples 1-7
[0232] Protections. The Institutional Review Boards of the University of California, San Diego and SUNY Upstate Medical University approved all procedures. All minor subjects assented to the study procedures, and one or both parents or legal guardians of each subject provided written informed consent for their child to participate. [0233] Ascertainment. Participants were obtained via a general population- based screening method called the One- Year Well-Baby Check-Up Approach, which engages community pediatricians to screen for autism during regular checkups (Pierce et al., "Detecting, Studying, and Treating Autism Early: The One-Year Well-Baby Check- up Approach," J Pediatr (2011), which is hereby incorporated by reference in its entirety). All subjects failing the Communication and Symbolic Behavior Scales
Developmental Profile (CSBS DP) Infant-Toddler questionnaire at their pediatrician's office were provisionally identified as at-risk for one of the disorders of interest and then referred for further evaluation. Subjects who passed the CSBS were identified as typically developing (TD) and some of these were also referred for further evaluation as unaffected comparison subjects. Using this approach, toddlers as young as 12-months were recruited and tracked every six months until at least their third birthday, thus allowing for the prospective study of autism beginning at 12 months.
[0234] Diagnoses. ASDs were diagnosed based on failure of the Autism
Diagnostic Observation Schedule (ADOS) (Lord et al, "Autism Diagnostic Observation Schedule (ADOS) Manual," Western Psychological Services (2001), which is hereby incorporated by reference in its entirety) as well as the clinical judgment of a Ph.D. -level psychologist. While several ASD subjects were only one year old at the time of first blood sampling, all but one have been tracked and diagnosed with an ASD using the toddler module of the ADOS (Luyster et al., "The Autism Diagnostic Observation
Schedule-Toddler Module: A New Module of a Standardized Diagnostic Measure for Austism Spectrum Disorders," J Autism Dev Disord 39: 1305-20 (2009), which is hereby incorporated by reference in its entirety) at age two or beyond, when the diagnosis of autism can be made reliably. Final diagnoses for participants with an ASD older than 30 months (including some of the youngest subjects who had previously been diagnosed with or at-risk for an ASD based on the ADOS) were confirmed with the Autism
Diagnostic Interview-Revised (ADI-R) (Luyster et al., "The Autism Diagnostic
Observation Schedule-Toddler Module: A New Module of a Standardized Diagnostic Measure for Austism Spectrum Disorders," J Autism Dev Disord 39: 1305-20 (2009), which is hereby incorporated by reference in its entirety). Subjects who failed the CSBS DP Infant-Toddler questionnaire but who passed the ADOS were diagnosed with language delay (LD) if one or both of the language subtest scores of the Mullen Scales of Early Learning were more than one standard deviation lower than expected for that age (T-score <40). Since a significant percentage of individuals with ASDs exhibit language deficits not restricted to the pragmatic component of language (Tager-Flusberg et al., "Present and Future Possibilities for Defining a Phenotype for Specific Language Impairment," J Speech Lang Hear Res. 42: 1275-8 (1999); Rapin et al, "Update on the Language Disorders of Individuals on the Autistic Spectrum," Brain Dev. 25 : 166-72
(2003); Tager-Flusberg et al, "Identifying Neurocognitive Phenotypes in Autism," Philos Trans R Soc Lond B Biol Sci 358:303-14 (2003); Tager-Flusberg et al, "Model
Syndromes for Investigating Social Cognitive and Affective Neuroscience: A
Comparison of Autism and Williams Syndrome," Soc Cogn Affect Neurosci 1 : 175-82 (2006), each of which is hereby incorporated by reference in its entirety), this approach to diagnosing LD may not be highly specific; however, this criterion paired with ADOS evaluations not consistent with an ASD is sufficient to establish that these subjects have some language delay and are not on the autistic spectrum, making them suitable as an affected, non-autistic comparison sample for establishing the specificity of our ASD biomarkers. Subjects who failed the CSBS DP Infant-Toddler questionnaire but who passed the ADOS were diagnosed with global developmental delay (DD) if scores were more than one standard deviation lower than expected on three or more subtests of the Mullen Scales and the overall developmental quotient was more than one standard deviation lower than expected (<85). Subjects who failed the CSBS DP Infant-Toddler questionnaire but who passed the ADOS and who did not deviate from norms on any of the Mullen Scales or the developmental quotient were judged to be developing typically and identified as TIEs.
[0235] Laboratory Methods. From each subject, 4ml of venous blood was collected into EDTA-coated collection tubes and immediately transferred to an RNase- free laboratory where all subsequent procedures took place, including RNA isolation and storage at -80°C within six hours. Methods of mRNA extraction, stabilization, isolation, storage, quantitation, reverse transcription, and microarray hybridization, as well as methods of microarray scanning and data import, normalization, and transformation, were consistent with prior work (Glatt et al, "Comparative Gene Expression Analysis of Blood and Brain Provides Concurrent Validation of SELENBP1 Up-Regulation in
Schizophrenia," Proceedings of the National Academy of Sciences of the United States of America 102: 15533-8 (2005), which is hereby incorporated by reference in its entirety). [0236] mRNA Extraction, Stabilization, Isolation, and Storage. Total mRNA was extracted, stabilized, isolated, and stored from each blood sample in the same manner as described previously (Glatt et al, "Alternatively Spliced Genes as Biomarkers for Schizophrenia, Bipolar Disorder and Psychosis: a Blood-Based Spliceome-Profiling Exploratory Study," Curr Pharmacogenom Pers Med. 7: 164-188 (2009); Glatt et al, "Comparative Gene Expression Analysis of Blood and Brain Provides Concurrent Validation of SELENBP1 Up-Regulation in Schizophrenia," Proc Natl Acad Sci USA 102: 15533-15538 (2005); Tsuang et al, "Assessing the Validity of Blood-Based Gene Expression Profiles for the Classification of Schizophrenia and Bipolar Disorder: A Preliminary Report," Am J Med Genet B Neuropsychiatr Genet. 133B: 1-5 (2005), each of which are hereby incorporated by reference in its entirety). Briefly, 5 mL from each blood sample was passed over a LeukoLOCK filter, which was flushed with phosphate- buffered saline solution (PBS) and then fully saturated with RNAlater (Gonzales et al., "Isolate RNA from White Blood Cells Captured by a Novel Filter System," Ambion TechNotes 12:24-25 (2005), which is hereby incorporated by reference in its entirety). Each LeukoLOCK filter, containing bound, isolated, stabilized, and purified white blood cells, was sealed and stored in a sterile box at -20°C. Once all samples were collected, LeukoLOCK filters were processed in a batch by flushing the filter with TRI reagent to lyse the cells and isolate mRNA. Eluted mRNA samples were stored at -20°C until transferred to Scripps Genomic Medicine for quality assurance and microarray hybridization.
[0237] mRNA Quantitation and Quality Control. The concentration of mRNA in each sample was quantified by the absorption of ultraviolet light at 260 nm. The quantity of mRNA in each sample exceeded the minimally sufficient amount required for microarray hybridization. The purity of each mRNA sample was estimated by the
260:280 nm absorbance ratio, with an acceptable range designated a priori as 1.7-2.1.
[0238] Reverse Transcription, Microarray Hybridization, and Scanning. The samples were assayed in a batch on Illumina WG-6 v3 arrays (Illumina, San Diego, CA) according to the manufacturer's Direct Hybridization Gene Expression protocol, using 500 ng of total RNA from each sample. Briefly, each 500 ng sample was suspended in a volume of 11 and then amplified using Ambion' s Illumina TotalPrep-96 RNA
Amplification kit. Amplification steps consisted of the following: reverse transcription to synthesize first-strand cDNA; second-strand cDNA synthesis; cDNA purification; in vitro transcription to synthesize biotin-labeled cR A; and cRNA purification. cRNA was then normalized to a concentration of 150 ng/μΐ. (in ΙΟ-μί volume) and run through the Illumina Gene Expression assay which includes a 16- to 20-hour overnight incubation at 58°C and subsequent scanning of the expression beadchip on a Bead Array Reader.
[0239] Microarray Data Normalization and Transformation. Partek
Genomics Suite software, version 6.3 (Partek, St. Louis, MO), was used for all analytic procedures performed on microarray scan data. First, raw probe-intensity values were imported; then corrections for background signal were applied using the robust multi- array average (RMA) method (Irizarry et al., "Exploration, Normalization, and
Summaries of High Density Oligonucleotide Array Probe Level Data," Biostatistics 4:249-264 (2003), which is hereby incorporated by reference in its entirety). An additional correction was made for the GC content of each probe. Expression levels of each probe underwent log2 transformation to yield distributions of data that more closely approximated normality.
[0240] Quality Control and Final Sample Constitution. The quality of mRNA samples was quantified by the RNA Integrity Number (RIN) and, according to convention (Schroeder et al., "The RIN: an RNA Integrity Number for Assigning Integrity Values to RNA Measurements," BMC Molecular Biology 7:3 (2006), which is hereby incorporated by reference in its entirety) values of 6.0 or greater were deemed acceptable; values observed in samples ranged from 9.0-10.0. A total of 383 samples selected for analysis in Wave I had acceptable levels of mRNA quantity, purity, and quality. Once microarray data were generated, the first three principal components of global gene expression patterns in each individual were visualized. Subjects whose values on each of these three principal components were beyond four standard deviations from the grand mean (n=5) were removed from further analyses. Additional subjects were removed due to low signal intensity as observed by box-plot and evidenced by an average signal more than two standard deviations below the mean. The remaining 383 quality-assured samples were from a child proband in one of the six diagnostic groups described in Table 1. TABLE 1. Demographic and Clinical Characteristics of the Six Diagnostic Groups
Diagnostic Grojjp
AD FDD DD LD TD TIE
Sample size, n 338 35 17 34 84 75
Sex, male: female 105:33 29:6 13:4 26:8 47:37 49:26
Age, mo, range 11-49 12 -41 13- 42 11-31 11 -45 12-37
Mean (SD) 26.6 (8.6) 27.9 (7.31 ) 24.5 (8.5) 16.8 (4.6) 23.4 (10.1) 16.1 (5.5)
The majority of subjects in the full sample and within each diagnostic group was of Caucasian ancestry, with no other ancestral group (Asian, Pacific Islander, African- American, American Indian, or Mixed) individually comprising more than 10% of any diagnostic group, and there were no differences in overall ancestral composition between any of the diagnostic groups (Pearson χ (25)=21.516; /?=0.664). To increase sample size and inferential power, and maintain consistency with the conceptualization of AD and PDD as disorders on the same spectrum, these samples were pooled together into one ASD group for all subsequent analyses; likewise, both typically developing groups (TD and TIE) were pooled into one unaffected control (CNT) group for all subsequent analyses.
[0241] Microarray Data Analyses. The ASD sample was split into two independent subgroups: a discovery sample and a replication sample. The two subsamples were drawn to be equivalent in sample size, age, sex, and diagnostic composition (AD versus PDD). The CNT sample was similarly split into discovery and replication samples drawn to be equivalent in size, age, sex, and diagnostic composition (TD versus TIE). The basic analytic model for identifying candidate biomarkers in the discovery samples was an analysis of covariance (ANCOVA), with each gene's expression intensity value as the dependent measure, diagnostic group (ASD versus CNT) and sex as fixed between- subjects factors, and age in months as a continuous covariate. Genes with expression levels influenced by at least a nominally significant main effect of diagnostic group (p < .05) and with log2 fold change in the ASD group of > |1.2| were identified as putative candidate ASD biomarkers and advanced to the next phase of analysis. These fairly liberal criteria were used to cast a wide net to catch all potentially informative genes, whereas false positive results would be pared off the putative biomarker set by subsequent model building, optimization, and replication steps. These genes were then used to build a support vector machine (SVM) classifier of the same discovery sample in which they were initially discovered. The SVM was configured as cost-based, with costs varied from 1 to 1001 in intervals of 100. The tolerance (termination criterion) of the SVM was set at 0.001. The kernel for the SVM was a radial basis function, with gamma equal to the inverse of the number of evaluated markers. The optimal (i.e., the most accurate and parsimonious) SVM was derived by shrinking centroids (which prunes highly correlated or redundant features) and 10-fold cross-validation. The optimal SVM classifier was then tested for classification accuracy in the fully independent ASD and CNT replication samples, and then re-evaluated in the presence of the LD and DD samples as affected but nonautistic comparators. The list of genes comprising the optimal classifier was subjected to the Database for Annotation, Visualization, and Integrated Discovery (DAVID) (Dennis et al., "DAVID: Database for Annotation, Visualization, and Integrated Discovery," Genome Biol. 4:P3 (2003), which is hereby incorporated by reference in its entirety) algorithm to determine whether it was enriched with genes having particular functional, ontological, or structural annotations. Fold enrichments of such annotations were declared statistically significant only if they surpassed a
Bonferroni-corrected p value threshold of a = 0.05/number of terms evaluated in a particular category.
Example 1 - Biomarker Panel 1
[0242] Among children identified with at least some developmental concerns, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop typically (TIE). This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD or to develop typically?"
[0243] The optimal model for this classification problem is determined to comprise the expression levels of six genetic transcripts in a support vector machine of radial basis function with a cost of 601 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The six transcripts and their fold- change in ASD relative to typical development are as follows:
Figure imgf000057_0001
[0244] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 4-Fold Cross- Validation in 24 individuals with ASD vs 24 TIE individuals. The first lines of the tables below, as well as the following tables for Biomarker Panel 1, show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true- positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called ASD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
Figure imgf000058_0001
[0245] The tables below show the results of test samples using Biomarker Panel 1 to differentiate between ASD and typical development.
- Performance in Test Sample: 12 ASD vs 12 TIE, 12-24 mo. and individually matched on sex and age within 1 month (excludes training samples)
Figure imgf000058_0002
- Performance in Test Sample: All 41 ASD and 45 TIE, 12-24 mo. (excludes training samples)
Figure imgf000058_0003
Performance in Test Sample: All 149 ASD vs 51 TIE (excludes training samples)
Figure imgf000059_0001
[0246] According to conventions advocated by Hanley and McNeil (Hanley and
McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
Example 2 - Biomarker Panel 2 [0247] Among children identified with at least some developmental concerns, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD or to develop a DD or LD?"
[0248] The optimal model for this classification problem is determined to comprise the expression levels of 16 genetic transcripts in a support vector machine of radial basis function with a cost of 501 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 16 transcripts and their fold- change in ASD relative to typical development are as follows:
Figure imgf000060_0001
[0249] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 27 individuals with ASD vs 27 DD/LD individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 2, show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly DD/LD and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called DD/LD (false-negative or FN calls), and the number of individuals who were truly DD/LD but were called ASD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
Figure imgf000061_0001
[0250] The tables below show the results of test samples using Biomarker Panel 2 to differentiate between ASD and DD/LD.
Figure imgf000061_0002
Figure imgf000061_0003
Positive Predictive Value (TP/(TP+FP)): 10.8611 j
Negative Predictive Value (TN/(FN+TN)): 0.5625 j
Area Under Curve (((TP/(TP+FN)) + (TN/FP+TN))*0.5): 16.7293 j
Figure imgf000062_0001
[0251] According to conventions advocated by Hanley and McNeil (Hanley and McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
Example 3 - Biomarker Panel 3
[0252] Among children identified with at least some developmental concerns, a biomarker panel is described that can differentiate children who go on to develop an ASD, DD, or LD from children who go on to develop typically. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, DD, or LD or to develop typically?"
[0253] The optimal model for this classification problem is determined to comprise the expression levels of 16 genetic transcripts in a support vector machine of radial basis function with a cost of 101 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 16 transcripts and their fold- change in ASD relative to typical development are as follows:
Figure imgf000063_0001
[0254] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 4-Fold Cross- Validation in 39 individuals with ASD/DD/LD vs 39 TIE individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 3, show the cross-tabulation of the number of individuals who were truly ASD/DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true -negative or TN calls), the number of individuals who were truly ASD/DD/LD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called ASD/DD/LD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
- Performance in Training Sample: Four-Fold Cross- Validation of 39 ASD/DD/LD vs 39 TIE
Figure imgf000064_0001
[0255] The tabl es below show the results of test samples using Biomarker Panel 3 to differentiate between ASD and DD/LD as a group and typical development.
Figure imgf000064_0002
- Performance in Test Sample: All ASD/DD/LD and TIE, 12-24 mo. and individually matched on sex and age within 1 month (excludes training samples)
Figure imgf000064_0003
Positive Predictive Value (TP/(TP+FP)): 10.8039
Negative Predictive Value (TN/(FN+TN)): 0.7385
Area Under Curve (((TP/(TP+FN)) + (TN/FP+TN))*0.5): 10.7672
Figure imgf000065_0001
[0256] According to conventions advocated by Hanley and McNeil (Hanley and
McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
Example 4 - Biomarker Panel 4
[0257] Among children identified with at least some developmental concerns, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD and from children who go on to develop typically. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, to develop a DD or LD, or to develop typically?"
[0258] The optimal model for this classification problem is determined to comprise the expression levels of 36 genetic transcripts in a support vector machine of radial basis function with a cost of 101 and a gamma of 0.01. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 36 transcripts and their fold- change in ASD relative to typical development are as follows:
Gene Fold-Change Fold-Change Fold-Change
Probe Symbol (ASD vs. TIE) (DD/LD vs. TIE) (ASD vs. DD/LD)
ILMN 1658439 C5orf44 -1.08 -1.33 1.23
ILMN 1658853 ARHGAP25 -1.32 -1.29 -1.03
ILMN 1665655 CTDSPL2 -1.1 -1.24 1.12
ILMN 1674411 CKAP2 -1.15 -1.29 1.13
ILMN 1677997 MAZ -1.26 -1.04 -1.22
ILMN 1684042 BET1 -1.07 -1.27 1.19
ILMN 1685173 SRP54 -1.1 -1.11 1.01
ILMN 1689327 CR617556 1.03 -1.15 1.19
ILMN 1699476 RPE -1.14 -1.38 1.21
ILMN 1701507 EHHADH -1.07 -1.14 1.06
ILMN 1704084 CMAH -1.15 -1.33 1.16
ILMN 1714850 ECD -1.07 -1.24 1.16
ILMN 1727348 NMD3 -1.11 -1.3 1.17
ILMN 1732489 SLC10A7 -1.06 -1.27 1.19
ILMN 1738736 SNX4 -1.07 -1.29 1.21
ILMN 1743208 NEDD1 -1.1 -1.33 1.21
ILMN 1750029 GABPA -1.13 -1.55 1.37
ILMN 1763884 Magmas 1.17 1.29 -1.1
ILMN 1770515 UBE2V2 -1.06 -1.34 1.26
ILMN 1774077 GBP2 -1.4 -1.26 -1.11
ILMN 1795524 C15orf44 -1.07 -1.18 1.11
ILMN 1810181 PCGF6 -1.03 -1.22 1.18
ILMN 1814044 CABIN1 1.34 1.59 -1.19
ILMN 1815345 EIF3J -1.06 -1.28 1.21
ILMN 1818632 Hs.561844 1.39 1.2 1.16
ILMN 2043845 IMPACT -1.06 -1.13 1.07
ILMN 2048700 ATAD2 -1.12 -1.24 1.11
ILMN 2124386 RGL2 1.16 1.42 -1.22
ILMN 2139035 CASD1 -1.1 -1.36 1.24
ILMN 2140389 TMEM185A 1.17 1.27 -1.08
ILMN 2212878 ESM1 -1.08 -1.13 1.05
ILMN 2240009 ADSSL1 -1.09 -1.14 1.05
ILMN 2370882 ACSL5 -1.15 -1.22 1.06
ILMN 2371470 Clorfl24 -1.12 -1.24 1.11
ILMN 2378376 CYB561 -1.22 -1.23 1.01
ILMN 2408908 MAP4K5 -1.06 -1.26 1.19
[0259] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 21 individuals with ASD vs 21 DD/LD vs 21 TIE individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 4, show the cross-tabulation of the number of individuals who were truly DD/LD, or ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly DD/LD, or ASD but were called TIE (false-negative or FN calls), and the number of individuals who were truly TIE but were called DD/LD or ASD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
- Performance in Training Sample: 3-Fold Cross-Validation in 21 ASD vs 21 DD/LD vs 21 TIE
Figure imgf000068_0001
[0260] The tables below show the results of test samples using Biomarker Panel 4 to differentiate between ASD, DD/LD, and typical development.
Figure imgf000068_0002
Specificity (TN/(FP+TN)): iO.5000
Positive Predictive Value (TP/(TP+FP)): 10.4737
Negative Predictive Value (TN/(FN+TN)): 10.9091
Area Under Curve (((TP/(TP+FN)) + (TN/FP+TN))*0.5): iO.7000
Figure imgf000069_0001
[0261] According to conventions advocated by Hanley and McNeil (Hanley and McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
Example 5 - Biomarker Panel 5
[0262] Among all children, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop typically (TD/TIE). This biomarker panel addresses the clinical question: "Is my child more likely to develop an ASD or to develop typically?"
[0263] The optimal model for this classification problem is determined to comprise the expression levels of 36 genetic transcripts in a support vector machine of radial basis function with a cost of 701 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 36 transcripts and their fold- change in ASD relative to typical development are as follows:
Fold-Change
Illumina Probe Gene Symbol (ASD vs. TD/TIE)
ILMN 1656920 CRIPl 1.22
ILMN 1662243 ING1 1.08
ILMN 1668588 LILRBl -1.16
ILMN 1668984 SPNS3 1.22
ILMN 1672611 CDH11 1.07
ILMN 1674953 LOC642403 1.07
ILMN 1678454 CASP4 -1.22
ILMN 1682781 TEAD2 1.14
ILMN 1691747 KHDRBS3 1.14
ILMN 1703558 FHL3 1.26
ILMN 1707904 LOC641518 1.19
ILMN 1711087 EPPK1 1.13
ILMN 1714433 MARCKSL1 1.21
ILMN 1716730 FAM44B 1.11
ILMN 1722855 VEGFB 1.16
ILMN 1740927 LYRM4 1.14
ILMN 1748976 AB007962 -1.08
ILMN 1752032 PPP2R3B 1.13
ILMN 1763516 SPINK2 1.18
ILMN 1769409 C9orfl23 1.16
ILMN 1772058 PANK2 -1.06
ILMN 1776993 COG2 1.1
ILMN 1796180 CRY2 1.12
ILMN 1800626 SESN1 1.25
ILMN 1815519 EPN2 1.19
ILMN 1844464 IL23A 1.19
ILMN 1846630 BE439556 1.06
ILMN 1914495 DB050967 1.06
ILMN 2073012 TMEM203 1.1
ILMN 2148668 RCBTB2 -1.2
ILMN 2197519 ZNF627 1.09
ILMN 2287911 CMTM1 -1.08
ILMN 2317457 HSD11B1L 1.07
ILMN 2320330 MAL 1.23
ILMN 2405628 TOP1MT 1.18
ILMN 2408400 NSUN5 1.11
[0264] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 5-Fold Cross- Validation in 35 individuals with ASD vs 35 TD/TIE individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 5, show the cross-tabulation of the number of individuals who were truly ASD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called ASD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
Figure imgf000072_0001
[0265] The tables below show the results of test samples using Biomarker Panel 5 to differentiate between ASD and typical development in all children.
Figure imgf000072_0002
Positive Predictive Value (TP/(TP+FP)): 10.8235
Negative Predictive Value (TN/(FN+TN)): 10.8235
Area Under Curve (((TP/(TP+FN)) + (TN/FP+TN))*0.5): 10.8235
Figure imgf000073_0001
[0266] According to conventions advocated by Hanley and McNeil (Hanley and
McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
Example 6 - Biomarker Panel 6 [0267] Among all children, a biomarker panel is described that can differentiate children who go on to develop an ASD, DD, or LD from children who go on to develop typically. This biomarker panel addresses the clinical question: "Is my child more likely to develop an ASD, DD, or LD or to develop typically?"
[0268] The optimal model for this classification problem is determined to comprise the expression levels of 31 genetic transcripts in a support vector machine of radial basis function with a cost of 801 and a gamma of 0.01. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 31 transcripts and their fold- change in ASD relative to typical development are as follows:
Gene Fold-Change
Illumina Probe Symbol (ASD/DD/LD vs. TD/TIE)
ILMN 1652662 GRB10 1.05
ILMN 1653468 ANXA8L1 1.04
ILMN 1655403 ERI2 -1.06
ILMN 1671627 AK098672 1.04
ILMN 1672966 CRCP -1.07
ILMN 1677429 TWIST2 -1.04
ILMN 1681757 RIMKLB 1.07
ILMN 1688220 AM393854 -1.04
ILMN 1689852 PAQ.R6 1.06
ILMN 1691578 GTF3C6 -1.15
ILMN 1705210 GRASP 1.07
ILMN 1716279 CENPE -1.17
ILMN 1721630 P2RY4 -1.05
ILMN 1726701 BC038536 -1.04
ILMN 1750457 ZNF268 -1.05
ILMN 1757370 SMPD1 1.1
ILMN 1772058 PANK2 -1.04
ILMN 1774312 MRP63 -1.07
ILMN 1808779 CSTF3 -1.1
ILMN 1810228 TTF2 -1.11
ILMN 1838667 AW004814 1.06
ILMN 1849670 AW119108 1.04
ILMN 1887013 AW182429 -1.04
ILMN 1888639 Hs.566857 1.05
ILMN 1897142 BX109554 1.04
ILMN 2048700 ATAD2 -1.16
ILMN 2212878 ESM1 -1.08
ILMN 2219466 APOBEC3B -1.19
ILMN 2364529 EZH2 -1.12
ILMN 2370882 ACSL5 -1.1
ILMN 2371055 EFNA1 1.12
[0269] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 6-Fold Cross- Validation in 52 individuals with ASD/DD/LD vs 52 TD/TIE individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 6, show the cross-tabulation of the number of individuals who were truly ASD/DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD/DD/LD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called
ASD/DD/LD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
- Performance in Training Sample: 6-Fold Cross-Validation in 52 ASD/DD/LD
Figure imgf000076_0001
[0270] The tables below show the results of test samples using Biomarker Panel 6 to differentiate between ASD/LD/DD and typical development in all children.
Figure imgf000076_0002
Figure imgf000077_0001
- Performance in Test Sample: All 54 ASD/DD/LD vs 58 TD/TIE, 12-24 mo. (excludes training samples)
Figure imgf000077_0002
[0271] According to conventions advocated by Hanley and McNeil (Hanley and
McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively. Example 7 - Biomarker Panel 7
[0272] Among all children, a biomarker panel is described that can differentiate children who go on to develop an ASD from children who go on to develop a DD or LD and from children who go on to develop typically. This biomarker panel addresses the clinical question: "My 12-24 month-old child has developmental red flags. Is he more likely to develop an ASD, to develop a DD or LD, or to develop typically?" [0273] The optimal model for this classification problem is determined to comprise the expression levels of 35 genetic transcripts in a support vector machine of radial basis function with a cost of 601 and a gamma of 0.001. Expression levels of the genes in this classifier are measured in each individual, and these values are then combined in an equation (which was determined mathematically using a support vector machine-learning algorithm) that yields a dichotomous outcome (a 0 or 1) indicating whether the tested individual is more likely to have the disorder of interest or not. The methods of constructing and deploying support vector machine-learning algorithms on gene-expression data are described in detail by Byvatov and Schneider, "Support Vector Machine Applications in Bioinformatics," Appl Bioinformatics 2(2):67-77 (2003), which is hereby incorporated by reference in its entirety. The 35 transcripts and their fold- change in ASD relative to typical development are as follows:
Gene Fold-Change Fold-Change Fold-Chan^
Illumina Probe Symbol (ASD vs. TD/TIE) (DD/LD vs. TD/TIE) (ASD vs. DD/
ILMN 1660403 GCOM1 -1.07 -1.02 -1.02
ILMN 1665293 ZBTB20 1.05 1.07 1.07
ILMN 1666918 LOC729973 -1.05 -1.01 -1.01
ILMN 1668909 MAP2K3 -1.06 -1.03 -1.03
ILMN 1679113 BF701780 1.04 1.06 1.06
ILMN 1681757 RIMKLB 1.09 1.1 1.1
ILMN 1681916 KCNA6 -1.07 1.01 1.01
ILMN 1686250 OR1J4 1.05 1.05 1.05
ILMN 1688676 SKP1 1.06 1.01 1.01
ILMN 1690105 STAT1 -1.55 -1.17 -1.17
ILMN 1691364 STAT1 -1.46 -1.16 -1.16
ILMN 1692834 Clorf26 -1.02 1.06 1.06
ILMN 1700690 VAT1 1.13 1.19 1.19
ILMN 1723855 LOC390427 1.01 1.06 1.06
ILMN 1733157 THSD1 -1.06 -1.01 -1.01
ILMN 1740903 C7orf49 1.1 1.06 1.06
ILMN 1744962 SSX5 1.06 1 1
ILMN 1748675 TMPRSS11B 1.07 1.03 1.03
ILMN 1755589 DIP2B -1.17 -1.1 -1.1
ILMN 1756102 RFX3 -1.06 -1.02 -1.02
ILMN 1760339 ZNF774 1.08 1.05 1.05
ILMN 1766204 GPHA2 -1.07 -1.02 -1.02
ILMN 1768719 RDH11 1.11 1.12 1.12
ILMN 1771385 BC050625 -1.48 -1.18 -1.18
ILMN 1778717 DBF4 1.06 1.04 1.04
ILMN 1779832 BX248296 1.07 1.01 1.01
ILMN 1803197 RAB3IP 1.11 1.09 1.09
ILMN 1817427 CD364714 1.06 1.04 1.04
ILMN 1860487 DA196703 1.07 1.04 1.04
ILMN 1898096 AA884785 1.06 1.04 1.04
ILMN 1901934 ZNF33B 1.15 1.14 1.14
ILMN 1908878 AK125234 1.06 1.02 1.02
ILMN 1911278 AA961268 -1.06 -1.01 -1.01
ILMN 2143427 LGSN -1.13 -1.04 -1.04
ILMN 2362832 STAG 3 LI -1.07 -1.01 -1.01
[0274] The table below shows the historical performance of the optimal SVM classifier as determined in the Training Sample after 3-Fold Cross- Validation in 26 individuals with ASD vs 26 DD/LD vs 26 TD/TIE individuals. The first lines of the table below, as well as the following tables for Biomarker Panel 7, show the cross-tabulation of the number of individuals who were truly ASD or DD/LD and were called such by the SVM classifier (true-positive or TP calls), the number of individuals who were truly TD/TIE and were called such by the classifier (true-negative or TN calls), the number of individuals who were truly ASD or DD/LD but were called TD/TIE (false-negative or FN calls), and the number of individuals who were truly TD/TIE but were called ASD or DD/LD (false-positive or FP calls). The subsequent lines of the table show the values of sensitivity (the percent of time the model finds true cases), specificity (the percent of time the model avoids calling unaffected individuals cases), positive predictive value (the percent of time those individuals called cases are actually cases) and negative predictive value (the percent of time those individuals called unaffected are actually unaffected), as well as the formulae used for their derivation based on TP, TN, FP, and FN. The final row of the table shows the area under the receiver operating characteristic curve, which is a measure of balance between sensitivity and specificity and can be interpreted as a measure of the model's accuracy.
- Performance in Training Sample: 3-Fold Cross-Validation in 26 ASD vs 26 DD/LD vs 26 TD/TIE
Figure imgf000080_0001
[0275] The tables below show the results of test samples using Biomarker Panel 7 to differentiate between ASD, LD/DD and typical development in all children.
Figure imgf000080_0002
Sensitivity (TP/(TP+FN)): 10.9231 j
Specificity (TN/(FP+TN)): 0.9615 j
Positive Predictive Value (TP/(TP+FP)): 0.923 1 j
Negative Predictive Value (TN/(FN+TN)): 0.9615 j
Area Under Curve (((TP/(TP+FN)) + (TN/FP+TN))*0.5): 0.9423 j
Figure imgf000081_0001
- Performance in Test Sample: All 163 ASD vs 37 DD/LD vs 105 TD/TIE (excludes training samples)
Real Predicted TD/ΤΓΕ DD Π) ASD i
Sensitivity (TP/(TP+FN)): 10.3313
Speci ficity ( I N ( FP TN )): 0.7535
Positive Predictive Value (TP (TP FP)): 0.6067
Negative Predictive Value ( I N ( FN TN )): 0.4954
Area U nder Curve ((( TP ( TP FN )) ( I N FP TN ))*0.5 ): 0.5424
[0276] According to conventions advocated by Hanley and McNeil (Hanley and McNeil, "The Meaning and Use of the Area Under a Receiver Operating Characteristic (ROC) Curve," Radiology 143(l):29-36 (1982), which is hereby incorporated by reference in its entirety, diagnostic accuracy may be considered outstanding, excellent, good, fair, or poor if AUC is in the range of 0.9 - 1.0, 0.81 - 0.90, 0.71 - 0.80, 0.61 - 0.70, or < 0.60, respectively.
[0277] Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.

Claims

WHAT IS CLAIMED IS:
1. A collection of probes or their complements, said collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAPl, GBP2, RAB3IP, and MYOF biomarkers; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1 biomarkers; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1 biomarkers; (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BETl, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS,
UBE2V2, GBP2, C150RF44, PCGF6, CABINl, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESM1, ADSSL1, ACSL5, C10RF124, CYB561, and MAP4K5 biomarkers; (5) CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1,
FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5 biomarkers; (6) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESM1, APOBEC3B, EZH2, ACSL5, and EFNA1 biomarkers; or (7) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1,
C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers.
2. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: ZNF329, LOC641518, TAPl, GBP2, RAB3IP, and MYOF.
3. The collection of claim 2, wherein said collection of probes has at least 50% of the following nucleotide sequences: SEQ ID NOS: 1, 2, 3, 4, 5, and 6.
4. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: MRPS10, ARF3, CLORF85, KCNE1L, ΒΓΝ2,
CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1.
5. The collection of claim 4, wherein said collection of probes has at least 50% of the following nucleotide sequences: SEQ ID NOS: 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21 and 22.
6. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1.
7. The collection claim 6, wherein said collection of probes has at least 50% of the following nucleotide sequences: SEQ ID NOS: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 5, 34, 35, 36, and 37.
8. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD 3, SLC10A7, SNX4, NEDD1, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5.
9. The collection of claim 8, wherein said collection of probes have at least
50% of the following nucleotide sequences: SEQ ID NOS: 38, 39, 40, 41, 42, 43, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 4, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, and 71.
10. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5.
11. The collection of claim 10, wherein said collection of probes have at least 50% of the following nucleotide sequences: SEQ ID NOS: 72, 73, 74, 75, 76, 77, 78, 79,
80, 81, 2, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, and 106.
12. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: GRB10, ANXA8L1, ERI2, AK098672, CRCP,
TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4,
BC038536, ZNF268, SMPDl, PANK2, MRP63, CSTF3, TTF2, AW004814, AWl 19108, AW182429, HS.566857, BX109554, ATAD2, ESMl, APOBEC3B, EZH2, ACSL5, and EFNA1.
13. The collection of probes from claim 12, wherein said collection of probes have at least 50% of the following nucleotide sequences: SEQ ID NOS: 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 91, 123, 124, 125, 126, 127, 128, 129, 130, 62, 66, 131, 132, 68, and 37.
14. The collection of claim 1, wherein said collection of probes recognize at least 50% of the following biomarkers: GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1.
15. The collection of claim 14, wherein said collection of probes have at least 50% ofthe following nucleotide sequences: SEQ ID NOS: 133, 134, 135, 136, 137, 113, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 5, 158, 159, 160, 161, 162, 163, 164, and 165.
16. A method of diagnosing whether a subject has an autism spectrum disorder, said method comprising:
obtaining a biological sample from a subject potentially having an autism spectrum disorder;
providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF; (2) MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1; (3) SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and
EFNA1; or (4) C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1,
GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, and MAP4K5;
contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample;
detecting any hybridization as a result of said contacting; and
identifying whether the subject has an autism spectrum disorder based on said detecting.
17. The method according to claim 16, wherein the collection of probes recognize at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, and MYOF.
18. The method according to claim 16 further comprising: identifying whether a subject has developmental delay/language delay based on said detecting.
19. The method according to claim 18, wherein the collection of probes recognize at least 50% of the following biomarkers: MRPS10, ARF3, CLORF85, KCNE1L, BIN2, CACHD1, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, and SPI1.
20. The method according to claim 18, wherein the collection of probes recognize at least 50% of the following biomarkers: SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC11B, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, and EFNA1.
21. The method according to claim 18, wherein the collection of probes recognize at least 50% of the following biomarkers: C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDDl, GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J, HS.561844, IMPACT, ATAD2, RGL2, CASD1, TMEM185A, ESM1, ADSSL1, ACSL5, C10RF124, CYB561, and MAP4K5.
22. The method according to claim 16, wherein the subject is between 11 months to 4 years of age.
23. The method according to claim 16, wherein the biological sample is sputum, blood, a blood fraction, tissue or fine needle biopsy sample, urine, stool, peritoneal fluid, or pleural fluid.
24. The method according to claim 23, wherein the biological sample is blood.
25. The method according to claim 16, wherein the biological sample is isolated peripheral blood mononuclear cells.
26. The method according to claim 16, wherein said detecting any
hybridization comprises measuring RNA expression level.
27. The method according to claim 26, wherein RNA expression level is measured using a nucleic acid hybridization assay or a nucleic acid amplification assay.
28. The method according to claim 27, wherein the nucleic acid hybridization assay is carried out using an array comprising the collection of probes.
29. The method according to claim 16, wherein the autism spectrum disorder is selected from the group consisting of autistic disorder and pervasive development disorder.
30. A method of determining whether a subject has a predisposition for developing an autism spectrum disorder, said method comprising:
obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder;
providing a collection of probes recognizing biomarkers comprising at least 50% of the biomarkers from one of the following biomarker sets: (1) CRIPl, INGl, LILRBl, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5; (2) GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AWl 19108, AW182429, HS.566857, BX109554, ATAD2, ESM1, APOBEC3B, EZH2, ACSL5, and EFNA1; or (3) GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDHl l, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1; contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample;
detecting any hybridization as a result of said contacting; and
identifying whether the subject has a predisposition for developing an autism spectrum disorder based on said detecting.
31. The method according to claim 30, wherein the method identifies whether the subject has a predisposition for developmental delay/language delay based on said detecting.
32. The method according to claim 30, wherein the collection of probes recognize at least 50% of the following biomarkers: CRIPl, ING1, LILRB1, SPNS3, CDH11, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSLl, FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, and NSUN5.
33. The method according to claim 31 , wherein the collection of probes recognize at least 50% of the following biomarkers: GRB10, ANXA8L1, ERI2,
AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESM1,
APOBEC3B, EZH2, ACSL5, and EFNA1.
34. The method according to claim 31 , wherein the collection of probes recognize at least 50% of the following biomarkers: GCOMl, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKPl, STATl, C10RF26, VATl, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1.
35. The method according to claim 30, wherein the subject is between 11 months to 4 years of age.
36. The method according to claim 30, wherein the biological sample is sputum, blood, a blood fraction, tissue or fine needle biopsy sample, urine, stool, peritoneal fluid, or pleural fluid.
37. The method according to claim 36, wherein the biological sample is blood.
38. The method according to claim 30, wherein the biological sample is isolated peripheral blood mononuclear cells.
39. The method according to claim 30, wherein said detecting any
hybridization comprises measuring RNA expression level.
40. The method according to claim 39, wherein RNA expression level is measured using a nucleic acid hybridization assay or a nucleic acid amplification assay.
41. The method according to claim 40, wherein the nucleic acid hybridization assay is carried out using an array comprising the collection of probes.
42. The method according to claim 30, wherein the autism spectrum disorder is selected from the group consisting of autistic disorder and pervasive development disorder.
43. A method of diagnosing whether a subject has an autism spectrum disorder, said method comprising:
obtaining a biological sample from a subject potentially having an autism spectrum disorder;
providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAPl, GBP2, RAB3IP, MYOF, MRPSIO, ARF3, CLORF85, KCNEIL, BIN2, CACHDl, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPll, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNA1, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1,
GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, MAP4K5, CRIPI, INGl, LILRBl, SPNS3, CDHl l, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1,
FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl,
APOBEC3B, EZH2, ACSL5, EFNA1, GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKP1, STAT1, C10RF26, VAT1, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers.
contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample;
detecting any hybridization as a result of said contacting; and
identifying whether the subject has an autism spectrum disorder based on said detecting.
44. A method of diagnosing whether a subject has a predisposition for developing an autism spectrum disorder, said method comprising:
obtaining a biological sample from a subject potentially having a predisposition for developing an autism spectrum disorder;
providing one or more probes recognizing at least 50% of the following biomarkers: ZNF329, LOC641518, TAP1, GBP2, RAB3IP, MYOF, MRPS10, ARF3, CLORF85, KCNEIL, BIN2, CACHDl, CYB5R3, FKBP12-EXI, CHM, DUS4L, STX5, AK3, BU580973, TCRA, CR608770, SPI1, SC65, FUNDC2, NDRG2, RPL28, SRP54, LOC643466, ZDHHC1 IB, NSUN5B, NDRG3, DHRS3, CPEB2, RAB3IP, PPID, FOXP1, EFNA1, C50RF44, ARHGAP25, CTDSPL2, CKAP2, MAZ, BET1, SRP54, CR617556, RPE, EHHADH, CMAH, ECD, NMD3, SLC10A7, SNX4, NEDD1,
GABPA, MAGMAS, UBE2V2, GBP2, C150RF44, PCGF6, CABIN1, EIF3J,
HS.561844, IMPACT, ATAD2, RGL2, CASDl, TMEM185A, ESMl, ADSSLl, ACSL5, C10RF124, CYB561, MAP4K5, CRIPI, INGl, LILRBl, SPNS3, CDHl l, LOC642403, CASP4, TEAD2, KHDRBS3, FHL3, LOC641518, EPPK1, MARCKSL1,
FAM44B,VEGFB, LYRM4, AB007962, PPP2R3B, SPINK2, C90RF123, PANK2, COG2, CRY2, SESN1, EPN2, IL23A, BE439556, DB050967, TMEM203, RCBTB2, ZNF627, CMTM1, HSD11B1L, MAL, TOP1MT, NSUN5, GRB10, ANXA8L1, ERI2, AK098672, CRCP, TWIST2, RIMKLB, AM393854, PAQR6, GTF3C6, GRASP, CENPE, P2RY4, BC038536, ZNF268, SMPD1, PANK2, MRP63, CSTF3, TTF2, AW004814, AW119108, AW182429, HS.566857, BX109554, ATAD2, ESMl,
APOBEC3B, EZH2, ACSL5, EFNA1, GCOM1, ZBTB20, LOC729973, MAP2K3, BF701780, RIMKLB, KCNA6, OR1J4, SKPl, STATl, C10RF26, VATl, LOC390427, THSD1, C70RF49, SSX5, TMPRSS11B, DIP2B, RFX3, ZNF774, GPHA2, RDH11, BC050625, DBF4, BX248296, RAB3IP, CD364714, DA196703, AA884785, ZNF33B, AK125234, AA961268, LGSN, and STAG3L1 biomarkers.
contacting the biological sample from the subject with said collection of probes under conditions effective to permit hybridization of said probes to complementary nucleic acid molecules, if present, in the sample;
detecting any hybridization as a result of said contacting; and
identifying whether the subject has a predisposition for developing an autism spectrum disorder based on said detecting.
PCT/US2014/016537 2013-02-25 2014-02-14 Collection of probes for autistic spectrum disorders and their use Ceased WO2014130364A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/770,205 US20160017424A1 (en) 2013-02-25 2014-02-14 Collection of probes for autistic spectrum disorders and their use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361769000P 2013-02-25 2013-02-25
US61/769,000 2013-02-25

Publications (1)

Publication Number Publication Date
WO2014130364A1 true WO2014130364A1 (en) 2014-08-28

Family

ID=51391723

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/016537 Ceased WO2014130364A1 (en) 2013-02-25 2014-02-14 Collection of probes for autistic spectrum disorders and their use

Country Status (2)

Country Link
US (1) US20160017424A1 (en)
WO (1) WO2014130364A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017004191A1 (en) * 2015-06-30 2017-01-05 Regents Of The University Of Minnesota Transgenic mouse for expressing apobec3b
CN113151451A (en) * 2021-05-28 2021-07-23 苏州市立医院 Biomarker for diagnosing maturation of ovum development and application thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150036666A1 (en) * 2013-07-30 2015-02-05 Blackberry Limited Timing Advance Group in LTE Small Cell Enhancement

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110196614A1 (en) * 2008-06-25 2011-08-11 Baylor Research Institute Blood transcriptional signature of mycobacterium tuberculosis infection
US20120036101A1 (en) * 2009-04-14 2012-02-09 Cardiodx, Inc. Predictive models and method for assessing age
US20120207726A1 (en) * 2009-06-16 2012-08-16 The Trustees Of Columbia University In The City Of New York Autism-associated biomarkers and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110196614A1 (en) * 2008-06-25 2011-08-11 Baylor Research Institute Blood transcriptional signature of mycobacterium tuberculosis infection
US20120036101A1 (en) * 2009-04-14 2012-02-09 Cardiodx, Inc. Predictive models and method for assessing age
US20120207726A1 (en) * 2009-06-16 2012-08-16 The Trustees Of Columbia University In The City Of New York Autism-associated biomarkers and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KONG ET AL.: "Characteristics and predictive value of blood transcriptome signature in males with autism spectrum disorders.", PLOS ONE., vol. 7, no. 12, 2012, pages E49475 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017004191A1 (en) * 2015-06-30 2017-01-05 Regents Of The University Of Minnesota Transgenic mouse for expressing apobec3b
CN113151451A (en) * 2021-05-28 2021-07-23 苏州市立医院 Biomarker for diagnosing maturation of ovum development and application thereof
CN113151451B (en) * 2021-05-28 2022-08-02 苏州市立医院 Biomarker for diagnosing maturation of ovum development and application thereof

Also Published As

Publication number Publication date
US20160017424A1 (en) 2016-01-21

Similar Documents

Publication Publication Date Title
Glatt et al. Blood-based gene expression signatures of infants and toddlers with autism
US20250277269A1 (en) Methods for assessing risk of developing a viral disease using a genetic test
EP3356556B1 (en) A method for diagnosing a disease by detection of circrna in bodily fluids
Lionel et al. Disruption of the ASTN2/TRIM32 locus at 9q33. 1 is a risk factor in males for autism spectrum disorders, ADHD and other neurodevelopmental phenotypes
JP2023138990A (en) Diagnosis of sepsis
CN101918589B (en) The diagnostic biomarkers of diabetes
US9746479B2 (en) Methods and compositions to predict and detect acute rejection
US9758828B2 (en) Methods to detect, treat and prevent acute cellular rejection in kidney allografts
CA2922005A1 (en) Methods and compositions for screening and treating developmental disorders
JP2013530727A (en) Identification and use of differentially presented fetal or maternal genomic regions
EP2324129A1 (en) Methods and compositions for determining a graft tolerant phenotype in a subject
WO2013103945A1 (en) Composite assay for developmental disorders
US20040185474A1 (en) Method of diagnosing depression
JP2019503663A (en) Methods for assessing complication risk in patients with systemic inflammatory response syndrome (SIRS)
CA2674211A1 (en) Methods and kits for diagnosis and/or prognosis of the tolerant state in liver transplantation
AU2013229381A1 (en) A genotyping test for assessing risk of autism
KR102691806B1 (en) Use of upregulated mirna for diagnosis and treatment
US10428384B2 (en) Biomarkers for post-traumatic stress states
US20160017424A1 (en) Collection of probes for autistic spectrum disorders and their use
US20130079235A1 (en) Splice variant specific messenger rna transcripts as biomarkers of parkinson&#39;s disease
WO2025078620A1 (en) Autism spectrum disorder assessment via alternative polyadenylation analysis
Liang et al. Application of array-based comparative genome hybridization in children with developmental delay or mental retardation
US20130217656A1 (en) Methods and compositions for diagnosing and treating lupus
WO2012173809A2 (en) Method of identifying de novo copy number variants (cnv) using mz twins discordant for attention problems/disorders
WO2009120755A1 (en) Multiplex screening for pathogenic hypertrophic cardiomyopathy mutations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14753664

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14770205

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 14753664

Country of ref document: EP

Kind code of ref document: A1