WO2014115078A1 - Heterocyclic amide derivatives as p2x7 receptor antagonists - Google Patents

Heterocyclic amide derivatives as p2x7 receptor antagonists Download PDF

Info

Publication number
WO2014115078A1
WO2014115078A1 PCT/IB2014/058434 IB2014058434W WO2014115078A1 WO 2014115078 A1 WO2014115078 A1 WO 2014115078A1 IB 2014058434 W IB2014058434 W IB 2014058434W WO 2014115078 A1 WO2014115078 A1 WO 2014115078A1
Authority
WO
WIPO (PCT)
Prior art keywords
thiazole
formula
carboxamide
compound
diseases
Prior art date
Application number
PCT/IB2014/058434
Other languages
French (fr)
Inventor
Kurt Hilpert
Francis Hubler
Dorte Renneberg
Simon STAMM
Original Assignee
Actelion Pharmaceuticals Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Actelion Pharmaceuticals Ltd filed Critical Actelion Pharmaceuticals Ltd
Priority to JP2015553217A priority Critical patent/JP6282017B2/en
Priority to ES14703442.5T priority patent/ES2616883T3/en
Priority to US14/762,717 priority patent/US9388198B2/en
Priority to KR1020157022715A priority patent/KR102220847B1/en
Priority to CN201480005210.8A priority patent/CN104918946B/en
Priority to EP14703442.5A priority patent/EP2956457B1/en
Priority to CA2897459A priority patent/CA2897459C/en
Publication of WO2014115078A1 publication Critical patent/WO2014115078A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D513/00Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04Ortho-condensed systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/06Antigout agents, e.g. antihyperuricemic or uricosuric agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/06Antimigraine agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/64Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/64Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2
    • C07D277/66Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2 with aromatic rings or ring systems directly attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/68Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/68Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C07D277/82Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings

Definitions

  • the present invention relates to heterocyclic amide derivatives of formula (I) and their use as pharmaceuticals.
  • the invention also concerns related aspects including processes for the preparation of the compounds, pharmaceutical compositions containing one or more compounds of formula (I), and especially their use as P2X 7 receptor antagonists.
  • P2X 7 receptors belong to the family of P2X ionotropic receptors that are activated by extracellular nucleotides, in particular adenosine triphosphate (ATP).
  • P2RX7 is distinguished from other P2X family members by the high concentrations (mM range) of ATP required to activate it and its ability to form a large pore upon prolonged or repeated stimulation (North, R. A., Physiol. Rev. 2002, 82(4), 1013-67; Surprenant, A., Rassendren, F. et al., Science 1996, 272(5262), 735-8; Virginio, C, MacKenzie, A. et al., J.
  • P2RX7 is present on many cell types, especially ones known to be involved in inflammatory and immune processes. This is reflected within both the periphery and the CNS as Lipopolysaccharide S (LPS) priming of monocytes and microglia followed by ATP stimulation has been shown to lead to the local release and processing of I L1 ⁇ and other family members including IL18 through a P2RX7 mediated mechanism. Indeed mice lacking the P2X7 receptor are unable to release I L1 ⁇ following LPS priming and ATP stimulation providing further evidence of its role in this pathway (Solle, M., Labasi, J. et al., J. Biol.
  • LPS Lipopolysaccharide S
  • P2RX7 is also expressed on epithelial and endothelial cells (Ferrari, D., Chiozzi, P. et al., Neuropharmacology 1997, 36(9), 1295-301 ; Wiley, J. S., Chen, J. R. et al., Ciba Found Symp. 1996, 198, 149-60 and 160-5; North, R. A., Physiol. Rev. 2002, 82(4), 1013-67).
  • diseases associated with the central nervous system such as stroke or injury and diseases associated with neuro-degeneration and neuroinflammation such as Alzheimer's disease, Huntington's disease, epilepsy, Amyotrophic lateral sclerosis, acute spinal cord injury additionally to meningitis, sleep disorders, mood and anxiety disorders as well as chronic and neuropathic and inflammatory pain.
  • peripheral inflammatory disorders and autoimmune diseases including but not limited to rheumatoid arthritis, osteoarthritis, psoriasis, allergic dermatitis, asthma, chronic obstructive pulmonary disease, airways hyper-responsiveness, septic shock, bronchitis, glomerulonephritis, irritable bowel disease, skin injury, lung emphysema, Limb girdle dystrophy type 2B, fibrosis, Syndrome of synovitis Acne Pustulosis, atherosclerosis, burn injury, spinal cord injury, Hyperostosis Osteitis, Crohn's disease, ulcerative colitis, growth and metastases of malignant cells, myoblastic leukaemia, diabetes, trauma, meningitis, osteoporosis, burn injury, ischemic heart disease, and varicose veins and trauma, are all examples where the involvement of P2X7 channels has been implicated.
  • P2X7 antagonists that can be efficiently used in treating neuropathic pain, chronic inflammatory pain, inflammation, and neurodegenerative conditions.
  • the present invention relates to heterocyclic amide derivatives of formula (I),
  • n 1 , 2 or 3;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen, (C 1 -C 2 )alkyl or hydroxy-(C 1 -C 2 )alkyl;
  • R 2 represents hydrogen and R 3 represents heterocyclyl; or R 2 and R 3 form, together with the carbon atom to which they are attached, a 5- to 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
  • R 4 represents hydrogen or heteroaryl which is unsubstituted or mono- or di-substituted with (Ci-C 4 )alkyl, (C 1 -C 3 )fluoroalkyl or halogen;
  • the compounds of formula (I) according to embodiment 1) may contain one or more stereogenic or asymmetric centers, such as one or more asymmetric carbon atoms. Substituents at a double bond may be present in the (2 or (£)-configuration unless indicated otherwise.
  • the compounds of formula (I) may thus be present as mixtures of stereoisomers or preferably as pure stereoisomers. Mixtures of stereoisomers may be separated in a manner known to a person skilled in the art.
  • Definitions provided herein are intended to apply uniformly to the compounds of formulae (I), (Isn), (Ist2> and (l st 3) , as defined in any one of embodiments 1) to 22), and, mutatis mutandis, throughout the description and the claims unless an otherwise expressly set out definition provides a broader or narrower definition. It is well understood that a definition or preferred definition of a term defines and may replace the respective term independently of (and in combination with) any definition or preferred definition of any or all other terms as defined herein.
  • alkyl refers to a straight or branched chain alkyl group containing one to four carbon atoms.
  • (C x -C y )alkyl refers to an alkyl group as defined before containing x to y carbon atoms.
  • a (d-C 4 )alkyl group contains from one to four carbon atoms.
  • Representative examples of alkyl groups include methyl, ethyl, n-propyl, / ' so-propyl, n-butyl, / ' so-butyl, sec-butyl and tert. -butyl.
  • R 1 represents "(C 1 -C 2 )alkyl”
  • the term means (CrC 2 )alkyl groups as defined above. Examples of said groups are methyl and ethyl. Preferred is methyl.
  • (C C ⁇ alkyl) is a substituent to a heteroaryl group
  • the term "(C C ⁇ alkyl” means (CrC 4 )alkyl groups as defined above. Examples of said groups are methyl, ethyl, n- propyl, / ' so-propyl, n-butyl, / ' so-butyl, sec-butyl and fe/ .-butyl. Preferred is methyl.
  • hydroxy-(C x -C y )alkyl refers to an alkyl group as defined before containing x to y carbon atoms in which one hydrogen atom has been replaced with hydroxy.
  • a hydroxy- (C 1 -C 2 )alkyl group contains one or two carbon atoms in which one hydrogen atom has been replaced with hydroxy. Examples of said groups are hydroxy-methyl and hydroxy- ethyl.
  • R 1 represents "hydroxy-(C C 2 )alkyr
  • the term means hydroxy-(C 1 -C 2 )alkyl groups as defined above. Representative examples of said groups are hydroxy-methyl, 1 - hydroxy-ethyl and 2-hydroxy-ethyl. Preferred is hydroxy-methyl.
  • 5- to 7-membered saturated carbocyclic ring refers to a saturated monocyclic ring containing 5, 6 or 7 carbon atoms.
  • saturated monocyclic rings containing 6 or 7 carbon atoms are saturated monocyclic rings containing 6 or 7 carbon atoms; and most preferred is a saturated monocyclic ring containing 6 carbon atoms. Examples of said rings are cyclopentyl, cyclohexyl and cycloheptyl. Most preferred is cyclohexyl.
  • (C x -C y )fluoroalkyl refers to an alkyl group as defined before containing x to y carbon atoms in which one or more (and possibly all) hydrogen atoms have been replaced with fluoro.
  • a (C 1 -C 3 )fluoroalkyl group contains from one to three carbon atoms in which one to seven hydrogen atoms have been replaced with fluoro.
  • (C 1 -C 3 )fluoroalkyl is a substituent to a heteroaryl group
  • the term "(C C 3 )fluoroalkyl” means (C 1 -C 3 )fluoroalkyl groups as defined above. Representative examples of said groups are difluoromethyl, trifluoromethyl, 2,2-difluoroethyl and 2,2,2- trifluoroethyl. Preferred is trifluoromethyl.
  • halogen means fluoro, chloro or bromo.
  • halogen is a substituent to a heteroaryl group
  • halogen means fluoro, chloro or bromo; and preferably chloro.
  • heterocyclyl refers to a saturated monocyclic moiety of 5 to 7 ring members containing a nitrogen atom and optionally one additional heteroatom selected from nitrogen, oxygen and sulfur. Preferred is a 6-membered heterocyclyl group.
  • the heterocyclyl group is preferably attached to the rest of the molecule via a nitrogen atom.
  • Representative examples of such heterocyclyl groups are pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, azepanyl, 1 ,4- oxazepanyl and 1 ,4-thiazepanyl.
  • Preferred examples are piperidinyl (notably piperidin-1 - yl) and morpholinyl (notably morpholin-4-yl).
  • the heterocyclyl group is unsubstituted or mono- or di-substituted with fluoro.
  • Most preferred examples of unsubstituted or mono- or di-substituted heterocyclyl groups are 4,4-difluoro-piperidin-1 -yl and morpholin-4-yl.
  • 6-membered heterocyclyl refers to a saturated monocyclic moiety of 6 ring members containing one nitrogen atom and optionally one oxygen atom.
  • the 6-membered heterocyclyl group is preferably attached to the rest of the molecule via the nitrogen atom.
  • Representative examples of such heterocyclyl groups are piperidinyl and morpholinyl. Preferred examples are piperidin-1 -yl and morpholin-4-yl.
  • the 6-membered heterocyclyl group is unsubstituted or mono- or di-substituted with fluoro. Most preferred examples of unsubstituted or mono- or di-substituted 6-membered heterocyclyl groups are 4,4-difluoro-piperidin-1 -yl and morpholin-4-yl.
  • heteroaryl used alone or in combination, means a 5- or 6-membered monocyclic aromatic ring containing 1 or 2 heteroatoms independently selected from oxygen, nitrogen and sulphur. Preferred is a 6-membered heteroaryl group. Examples are furanyl, oxazolyl, isoxazolyl, thienyl, thiazolyl, isothiazolyl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidyl, pyridazinyl and pyrazinyl. Preferred examples are pyridyl (notably pyridin-3-yl) and pyrimidyl (notably pyrimidin-5-yl).
  • the heteroaryl group is unsubstituted or substituted as explicitly defined.
  • Preferred examples of unsubstituted or substituted heteroaryl groups are 2-chloro-pyridin-5-yl, 2-trifluoromethyl-pyridin-5-yl, 2-methyl- pyrimidin-5-yl and 2-trifluoromethyl-pyrimidin-5-yl. Most preferred is 2-chloro-pyridin-5-yl.
  • 6-membered heteroaryl used alone or in combination, means a 6-membered monocyclic aromatic ring containing 1 or 2 nitrogen atoms. Examples are pyridyl, pyrimidyl, pyridazinyl and pyrazinyl.
  • Preferred examples are pyridyl (notably pyridin-3-yl) and pyrimidyl (notably pyrimidin-5-yl).
  • the 6-membered heteroaryl group is unsubstituted or substituted as explicitly defined.
  • Preferred examples of unsubstituted or substituted heteroaryl groups are 2-chloro-pyridin-5-yl, 2-trifluoromethyl-pyridin-5-yl, 2-methyl- pyrimidin-5-yl and 2-trifluoromethyl-pyrimidin-5-yl. Most preferred is 2-chloro-pyridin-5-yl.
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 , 2 or 3;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen, (C 1 -C 2 )alkyl or hydroxy-(C 1 -C 2 )alkyl;
  • R 2 represents hydrogen and R 3 represents 6-membered heterocyclyl; or R 2 and R 3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and R 4 represents hydrogen or a 6-membered heteroaryl group, which group is unsubstituted or mono- or di-substituted with (C ⁇ -C ⁇ alkyl, (C 1 -C 3 )fluoroalkyl or halogen;
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1 ) or 2), wherein
  • n 1 or 2;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen, methyl or hydroxy-methyl
  • R 2 represents hydrogen and R 3 represents 6-membered heterocyclyl; or R 2 and R 3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
  • R 4 represents hydrogen or a 6-membered heteroaryl group, which group is mono- substituted with methyl, trifluoromethyl or chloro;
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 or 2;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen
  • R 2 represents hydrogen and R 3 represents heterocyclyl; or (preferably) R 2 and R 3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
  • R 4 represents heteroaryl which is unsubstituted or mono- or di-substituted with (C ⁇ - C 4 )alkyl, (C 1 -C 3 )fluoroalkyl or halogen;
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 or 2;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen
  • R 2 represents hydrogen and R 3 represents 6-membered heterocyclyl; or R 2 and R 3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and R 4 represents a 6-membered heteroaryl group, which group is unsubstituted or mono- substituted with methyl, trifluoromethyl or chloro;
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 or 2;
  • X represents -O- or -CH 2 -
  • R 1 represents hydrogen
  • R 2 and R 3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro;
  • R 4 represents a 6-membered heteroaryl group, which group is mono-substituted with chloro;
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 , 2 or 3;
  • X represents -O- or -CH 2 -
  • R 1 represents (C 1 -C 2 )alkyl or hydroxy-(C 1 -C 2 )alkyl
  • R 2 and R 3 form, together with the carbon atom to which they are attached, a 6- or 7- membered saturated carbocyclic ring which is unsubstituted;
  • R 4 represents hydrogen
  • a further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
  • n 1 or 2;
  • X represents -O- or -CH 2 -
  • R 1 represents methyl or hydroxy-methyl
  • R 2 and R 3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted;
  • R 4 represents hydrogen
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1), 2) or 7), wherein
  • n 1 or 2; and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 8), wherein
  • n 1 ;
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 8), wherein
  • n 2;
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 1 1 ), wherein
  • X represents -0-
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 1 1 ), wherein
  • X represents -CH 2 -
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1), 2), 7) or 9) to 13), wherein
  • R 1 represents hydroxy-(C 1 -C 2 )alkyl
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1), 4) or 9) to 14), wherein
  • R 2 represents hydrogen and R 3 represents heterocyclyl
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 5) or 9) to 14), wherein
  • R 2 represents hydrogen and R 3 represents 6-membered heterocyclyl
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 6) or 9) to 14), wherein
  • R 2 and R 3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 5) or 9) to 17), wherein
  • R 4 represents a 6-membered heteroaryl group, which group is unsubstituted or mono- substituted with methyl, trifluoromethyl or chloro;
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 18), wherein the stereogenic center at the a-carbon atom of the amide moiety is as depicted in formula (l st i) and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 18), wherein the stereogenic center at the a-carbon atom of the amide moiety is as depicted in formula (l st 2)
  • a further embodiment of the invention relates to compounds according to any one of embodiments 1) to 20), wherein the stereogenic center at the carbon atom which is attached to R 1 is as depicted in formula (l S t3>
  • Preferred compounds of formula (I) as defined in embodiment 1 ) are selected from the group consisting of: N-(1 -cycloheptyl-2-hydroxyethyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxamid
  • a stereogenic center which is not specifically assigned, may be in absolute (/?)- or absolute (S)-configuration; for example, the stereogenic center at the a-carbon atom of the amide moiety may be in absolute (/ ⁇ -configuration or absolute (S)-configu ration.
  • a compound listed as N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide may be N-((1-(6-chloropyridin-3-yl)cyclohexyl)methyl)-(S)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide, N-((1-(6-chloropyridin-3-yl)cyclohexyl)methyl)- (R)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide or any mixture thereof.
  • compounds containing more than one stereogenic center may be at each stereogenic center, which is not specifically assigned, in absolute (R)- or absolute (S)-configuration; for example a compound listed as N-(2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5- yl)ethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide may be N-((S)-2-morpholino-2- (2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-(S)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide, N-((S)-2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-(R)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide, N-((R)-2-morpholino-2-(2- (trifluoromethyl)
  • the invention relates to compounds according to embodiment 1); or according to embodiment 1) limited by the features of an embodiment dependent on embodiment 1; or according to embodiment 1) limited by the features of a cascade of dependent embodiments e.g. in the form of "embodiment 3) depending on embodiment 2) depending on embodiment 1)".
  • each combination is specifically disclosed.
  • one or more of said other embodiments are themselves dependent on one or more further embodiments, it is understood that each combination is specifically disclosed if obtainable with regard to the given dependencies and multiple dependencies.
  • embodiments resulting from cascades of more than three embodiments depending on each other may be construed under observance of the given dependencies and multiple dependencies and are thus intended to be specifically disclosed.
  • Representative examples of embodiments which are possible based on the dependencies of the embodiments 1) to 22) as disclosed hereinabove and which are therefore intended and herewith specifically disclosed in individualized form are:
  • the present invention also includes isotopically labelled, especially 2 H (deuterium) labelled compounds of formula (I), which compounds are identical to the compounds of formula (I) except that one or more atoms have each been replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature.
  • Isotopically labelled, especially 2 H (deuterium) labelled compounds of formula (I) and salts thereof are within the scope of the present invention. Substitution of hydrogen with the heavier isotope 2 H (deuterium) may lead to greater metabolic stability, resulting e.g. in increased in-vivo half-life or reduced dosage requirements, or may lead to reduced inhibition of cytochrome P450 enzymes, resulting e.g. in an improved safety profile.
  • the compounds of formula (I) are not isotopically labelled, or they are labelled only with one or more deuterium atoms. In a sub-embodiment, the compounds of formula (I) are not isotopically labelled at all. Isotopically labelled compounds of formula (I) may be prepared in analogy to the methods described hereinafter, but using the appropriate isotopic variation of suitable reagents or starting materials.
  • pharmaceutically acceptable salts refers to non-toxic, inorganic or organic acid and/or base addition salts, Lit. e.g. "Salt selection for basic drugs", Int. J. Pharm. (1986), 33, 201 -217.
  • compounds of formula (I) are suitable for use as medicaments.
  • compounds of formula (I) modulate the P2X 7 receptor, i.e. they act as P2X 7 receptor antagonists, and are useful for the prevention or treatment of diseases which are associated with the activation of the P2X 7 receptor such as pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; other auto-immune and allergic disorders; and other disorders with an inflammatory or immunological component.
  • Pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain; lower back and neck pain; inflammatory pain; neuropathic pain; visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain.
  • Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV-related neuropathy, post-herpetic neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions.
  • neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia).
  • normally non-painful sensations such as "pins and needles” (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia).
  • Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis.
  • Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome.
  • Neurodegenerative and neuro-inflammatory diseases include Alzheimer's disease and other dementing disorders including, but not limited to, Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); Amyotrophic lateral sclerosis, amyloidosis; multiple sclerosis and other demyelinating syndromes; cerebral atherosclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy Body dementia; and Parkinson's disease.
  • CJD Creutzfeldt-Jakob disease
  • nvCJD new variant Creutzfeldt-Jakob disease
  • cerebral atherosclerosis and vasculitis cerebral atherosclerosis and vasculitis
  • temporal arteritis myasthenia gravis
  • Huntington's disease Lewy Body dementia
  • Bone and joint diseases include arthritides such as rheumatoid arthritis, osteoarthritis, gout or crystal arthropathy; intervertebral disc degeneration; temporomandibular joint degeneration; bone remodelling disease such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; scleroderma; mixed connective tissue disorder; spondyloarthropathies; periodontal disease such as periodontitis; arthritides associated with or including osteoarthritis/osteoarthrosis, both primary and secondary to, for example, congenital hip dysplasia; cervical and lumbar spondylitis; Still's disease; seronegative spondyloarthropathies including ankylosing spondylitis, psoriatic arthritis, reactive arthritis and undifferenti
  • Obstructive diseases of the airways include asthma, including bronchial, allergic, intrinsic, and extrinsic asthma, exercise-induced, drug- induced (including aspirin and NSAID-induced) and dust- induced asthma, both intermittent and persistent and of all severities, and other causes of airway hyper- responsiveness; chronic obstructive pulmonary disease (COPD); bronchitis, including infectious and eosinophilic bronchitis; emphysema; bronchiectasis; cystic fibrosis; sarcoidosis; farmer's lung and related diseases; hypersensitivity pneumonitis; lung fibrosis, including cryptogenic fibrosing alveolitis, idiopathic interstitial pneumonias, fibrosis complicating anti-neoplastic therapy and chronic infection, including
  • Cardiovascular diseases include atherosclerosis, affecting the coronary and peripheral circulation; pericarditis; myocarditis; inflammatory and auto- immune cardiomyopathies including myocardial sarcoid; ischaemic reperfusion injuries; endocarditis, valvulitis, and aortitis including infective (for example syphilitic); vasculitides; and disorders of the proximal and peripheral veins including phlebitis and thrombosis, including deep vein thrombosis and complications of varicose veins.
  • Eye diseases include blepharitis; conjunctivitis, including perennial and vernal allergic conjunctivitis; ulceris; anterior and posterior uveitis; choroiditis; autoimmune, degenerative or inflammatory disorders affecting the retina; ophthalmitis including sympathetic ophthalmitis; sarcoidosis; and infections of the eyes including viral, fungal, and bacterial infections.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of skin diseases.
  • Skin diseases include psoriasis, skin burn, atopic dermatitis, contact dermatitis or other eczematous dermatoses, and delayed-type hypersensitivity reactions; phyto- and photodermatitis; seborrhoeic dermatitis, dermatitis herpetiformis, lichen planus, lichen sclerosus et atrophica, pyoderma gangrenosum, skin sarcoid, discoid lupus erythematosus, pemphigus, pemphigoid, epidermolysis bullosa, urticaria, angioedema, vasculitides, toxic erythemas, cutaneous eosinophilias, alopecia areata, male-pattern baldness, Sweet's syndrome, Weber-Christian
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of abdominal and gastrointestinal tract diseases.
  • Abdominal and gastrointestinal tract diseases include hepatitis, including autoimmune, alcoholic and viral hepatitis; fibrosis and cirrhosis of the liver; cholecystitis; pancreatitis, both acute and chronic; non-inflammatory diarrhea; glossitis, gingivitis, periodontitis; oesophagitis, including reflux; eosinophilic gastro-enteritis, mastocytosis, Crohn's disease, colitis including ulcerative colitis, proctitis, pruritis ani; Coeliac disease, irritable bowel disease/syndrome, and food-related allergies which may have effects remote from the gut, for example migraine, rhinitis or eczema; allograft rejection including acute and chronic allograft rejection following, for example, transplantation of kidney, heart, liver
  • Genitourinary diseases include nephritis including interstitial and glomerulonephritis; nephrotic syndrome; cystitis including acute and chronic (interstitial) cystitis and Hunner's ulcer; acute and chronic urethritis, hemorrhagic cystitis, prostatitis, epididymitis, oophoritis and salpingitis; vulvovaginitis; Peyronie's disease; and erectile dysfunction, both male and female.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of cancer.
  • the treatment of cancer includes the treatment of brain tumors, prostate, lung, breast, ovarian, bowel and colon, stomach, pancreatic, skin and bone marrow (including leukaemias) and lymphoproliferative systems, such as non-Hodgkin's and Hodgkin's lymphoma; including the prevention and treatment of metastatic disease and tumor recurrences, and paraneoplastic syndromes.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of other auto-immune and allergic disorders.
  • Other auto-immune and allergic disorders include Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-lgE syndrome, and antiphospholipid syndrome.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of other disorders with an inflammatory or immunological component.
  • Other disorders with an inflammatory or immunological component include acquired immune deficiency syndrome (AIDS), leprosy, Sezary syndrome, and paraneoplastic syndromes.
  • AIDS acquired immune deficiency syndrome
  • leprosy leprosy
  • Sezary syndrome Sezary syndrome
  • paraneoplastic syndromes paraneoplastic syndromes.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of mood, depression, sleep and anxiety disorders.
  • the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of injury induced trauma and spinal cord injury.
  • compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of diseases selected from one, several or all of the following groups of diseases and disorders:
  • Pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain; lower back and neck pain; inflammatory pain; neuropathic pain; visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain;
  • Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV- related neuropathy, post-herpetic neuralgia, trigeminal neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions.
  • neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
  • normally non-painful sensations such as "pins and needles” (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
  • Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis;
  • Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome;
  • Neurodegenerative and neuro-inflammatory diseases such as Alzheimer's disease and other dementing disorders including, but not limited to, Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); amyloidosis; Amyotrophic lateral sclerosis, multiple sclerosis and other demyelinating syndromes; cerebral atherosclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy Body dementia; and Parkinson's disease; 3) Bone and joint diseases such as arthritides such as rheumatoid arthritis, osteoarthritis, gout or crystal arthropathy; intervertebral disc degeneration; temporomandibular joint degeneration; bone remodelling disease such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; scleroderma; mixed connective tissue disorder; spondyloarthropathies; periodon
  • Obstructive diseases of the airways such as chronic obstructive pulmonary disease (COPD); cystic fibrosis; lung emphysema; sarcoidosis; farmer's lung and related diseases; lung fibrosis, including fibrosis complicating tuberculosis; and chronic cough associated with inflammatory and secretory conditions of the airways;
  • COPD chronic obstructive pulmonary disease
  • cystic fibrosis fibrosis
  • lung emphysema sarcoidosis
  • farmer's lung and related diseases lung fibrosis, including fibrosis complicating tuberculosis
  • chronic cough associated with inflammatory and secretory conditions of the airways such as chronic obstructive pulmonary disease (COPD); cystic fibrosis; lung emphysema; sarcoidosis; farmer's lung and related diseases; lung fibrosis, including fibrosis complicating tuberculosis; and chronic cough associated with inflammatory and
  • Cardiovascular diseases such as inflammatory and auto-immune cardiomyopathies
  • Eye diseases such as degenerative or inflammatory disorders affecting the retina
  • Skin diseases such as psoriasis, skin burn, atopic dermatitis, contact dermatitis or other eczematous dermatoses; and discoid lupus erythematosus;
  • Abdominal and gastrointestinal tract diseases such as fibrosis and cirrhosis of the liver; cholecystitis; pancreatitis, both acute and chronic; Crohn's disease; colitis including ulcerative colitis; and irritable bowel disease/syndrome;
  • Genitourinary diseases such as nephritis including interstitial and glomerulonephritis; nephrotic syndrome; and cystitis including acute and chronic (interstitial) cystitis; and 10) Other auto-immune and allergic disorders such as Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-lgE syndrome, and antiphospholipid syndrome.
  • compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of diseases selected from one, several or all of the following groups of diseases and disorders:
  • Pain wherein pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain (preferred); lower back and neck pain; inflammatory pain; neuropathic pain (preferred); visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain;
  • Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV- related neuropathy, post-herpetic neuralgia, trigeminal neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions.
  • neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
  • normally non-painful sensations such as "pins and needles” (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
  • Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis;
  • Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome;
  • the invention also relates to the use of a compound of formula (I) according to any one of embodiments 1) to 22) for the preparation of pharmaceutical compositions for the treatment and/or prophylaxis of the above-mentioned diseases.
  • the present invention also relates to pharmaceutically acceptable salts and to pharmaceutical compositions and formulations of compounds of formula (I) according to any one of embodiments 1 ) to 22).
  • a pharmaceutical composition according to the present invention contains at least one compound of formula (I) according to any one of embodiments 1) to 22) (or a pharmaceutically acceptable salt thereof) as the active agent and optionally carriers and/or diluents and/or adjuvants.
  • the compounds of formula (I) according to any one of embodiments 1) to 22) and their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical compositions for enteral (such as especially oral) or parenteral administration (including topical application or inhalation).
  • compositions can be effected in a manner which will be familiar to any person skilled in the art (see for example Remington, The Science and Practice of Pharmacy, 21 st Edition (2005), Part 5, "Pharmaceutical Manufacturing” [published by Lippincott Williams & Wilkins]) by bringing the described compounds of formula (I) or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
  • the present invention also relates to a method for the prevention or treatment of a disease or disorder mentioned herein comprising administering to a subject a pharmaceutically active amount of a compound of formula (I) according to any one of embodiments 1) to 22), or a pharmaceutically acceptable salt thereof.
  • any reference to a compound of formula (I), (l st i), (Ist2> and (l st 3), in this text is to be understood as referring also to the salts (and especially the pharmaceutically acceptable salts) of such compounds, as appropriate and expedient.
  • the preferences indicated for the compounds of formula (I) of course apply mutatis mutandis to the compounds of formula (l S n), of formula (l S t2) and of formula (l S t3> as well as to the salts and pharmaceutically acceptable salts of the compounds of formula (I), of formula (l S n), of formula (l st 2) and of formula (l st 3) .
  • the term “about” (or alternatively “around”) placed before a numerical value "X” refers in the current application to an interval extending from X minus 10% of X to X plus 10% of X, and preferably to an interval extending from X minus 5% of X to X plus 5% of X.
  • the term “about” (or alternatively “around”) placed before a temperature ⁇ " refers in the current application to an interval extending from the temperature Y minus 10 °C to Y plus 10 °C, and preferably to an interval extending from Y minus 5 °C to Y plus 5 °C.
  • room temperature RT as used herein refers to a temperature of about 25°C.
  • the compounds of Formula (I) can be manufactured by the methods given below, by the methods given in the Examples or by analogous methods. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by a person skilled in the art by routine optimisation procedures.
  • the generic groups R 1 , R 2 , R 3 , R 4 , n and X might be incompatible with the assembly illustrated in the schemes below and will therefore require the use of protecting groups (PG).
  • protecting groups are well known in the art (see for example "Protective Groups in Organic Synthesis", T.W. Greene, P.G.M. Wuts, Wiley- Interscience, 1999). For the purposes of this discussion, it will be assumed that such protecting groups are as necessary in place.
  • Compounds of formula (I) can be prepared by reaction of a carboxylic acid (II) with an amine (III) using standard amide coupling reagents such as EDC.HCI/HOBt, SiliaBond ® carbodiimide/HOAt, HATU/HOAt or PyBOP and a base like DIPEA in a solvent like DCM, THF or DMF referably at temperatures between RT and 45°C (scheme 1).
  • standard amide coupling reagents such as EDC.HCI/HOBt, SiliaBond ® carbodiimide/HOAt, HATU/HOAt or PyBOP and a base like DIPEA in a solvent like DCM, THF or DMF referably at temperatures between RT and 45°C (scheme 1).
  • Compounds of formula (II), wherein X represents -CH 2 - can be prepared from a methyl ester (IV) like, for instance, methyl cyclohex-2-enecarboxylate (Bioorg. Med. Chem. 1999, 7, 1505-151 1) by a bromohydrin-formation/oxidation sequence using (1) NBS in a THF/H 2 0 mixture at temperatures around RT and (2) an oxidant such as DMP in a solvent like DCM at temperatures around RT to form oc-bromoketone (V) (scheme 2). Condensation with thioformamide in a solvent such as dioxane at temperatures between 60°C and 1 10°C provide thiazoles (VII).
  • a methyl ester like, for instance, methyl cyclohex-2-enecarboxylate (Bioorg. Med. Chem. 1999, 7, 1505-151 1) by a bromohydrin-formation/oxidation sequence using (1) NBS in a THF
  • Thioformamide (VI) can be prepared from formamide with P 4 S 10 in a solvent such as dioxane at temperatures between 60°C and 1 10°C. Saponification of the methyl ester (VII) can be performed under standard conditions such as LiOH in a THF/MeOH/H 2 0 mixture, preferably at temperatures between 0°C and 45°C to form compounds of formula (Ma).
  • compounds of formula (II), wherein X represents -CH 2 - can be prepared from the corresponding cycloalk-2-enone (VIM) by (1 ) addition of TMS-CN, catalyzed by Ni(cod) 2 and Gd(OTf) 3 in the presence of norbornadiene in a solvent such as THF at temperatures around RT and (2) bromination of the resulting silylenolether using an electrophilic bromine source such as NBS in a THF/H 2 0 mixture at temperatures around 0°C to form a-bromoketone (IX) (scheme 3).
  • VIM cycloalk-2-enone
  • the aminothiazoles (X) are prepared by condensation of the corresponding -bromoketone (IX) with thiourea in a solvent such as dioxane at temperatures between 60°C and 100°C.
  • the aminothiazoles of formula (X) can be diazotized utilizing tBu-nitrite in THF at temperatures between 60°C and 80°C to provide the corresponding thiazoles.
  • Cyclization precursor (XIII) can be prepared by (1) dechlorination using an alkyllithium species such as nBuLi in a solvent like THF at temperatures between -100°C and -40°C and (2) treatment with a fluoride source such as TBAF in a solvent like THF at temperatures between 0°C and RT.
  • alkyllithium species such as nBuLi
  • fluoride source such as TBAF
  • Cyclization to compounds of formula (XIV) can be performed with a base such as NaH or KOtBu in a solvent like DMF or tBuOH, respectively, or through a palladium mediated procedure using Pd(OAc) 2 , rac-2-(di-tert- butylphosphino)-1 ,1 '-binaphthyl and a base like Cs 2 C0 3 in a solvent such as toluene at temperatures between 80°C and 1 10°C.
  • a base such as NaH or KOtBu in a solvent like DMF or tBuOH, respectively
  • Compounds of formula (Mb) are obtained by (1 ) removal of the THP protecting group under acidic conditions using, for instance, catalytic amounts of PTSA in a solvent mixture like THF/H 2 0 at temperatures around RT, (2) a Mitsunobu reaction, and (3) hydrolysis of the nitrile using aq. cone. HCI at temperatures between 60°C and 100°C.
  • the Mitsunobu reaction can be carried out with acetone cyanohydrin, (nBu) 3 P and 1 ,1 '-(azodicarbonyl)dipiperidine in a solvent like THF at temperatures between 0°C and RT.
  • Compound of formula (II), wherein X represents -O- and n represents 1 can be prepared by reaction of 4-bromothiazole (XV) with the sodium salt of DL-1 ,2-isoproylideneglycerol at temperatures between 120°C and 150°C and subsequent bromination with an electrophilic bromine source such as NBS in a solvent like MeCN at temperatures between 0°C and RT (scheme 5).
  • 4-bromothiazole (XV) with the sodium salt of DL-1 ,2-isoproylideneglycerol at temperatures between 120°C and 150°C and subsequent bromination with an electrophilic bromine source such as NBS in a solvent like MeCN at temperatures between 0°C and RT (scheme 5).
  • the resulting 5-bromothiazole (XVI) is sequentially treated with (1 ) catalytic amounts of an acid such as PPTS in a solvent like MeOH at temperatures around reflux, (2) trimethyl orthoformate in a solvent like DCM at temperatures around RT, (3) AcBr in a solvent like DCM at temperatures around RT, and (4) a carbonate base such as K 2 C0 3 in a solvent like MeOH at temperatures around RT to form oxirane (XVII).
  • an acid such as PPTS in a solvent like MeOH at temperatures around reflux
  • trimethyl orthoformate in a solvent like DCM at temperatures around RT
  • AcBr in a solvent like DCM at temperatures around RT
  • a carbonate base such as K 2 C0 3 in a solvent like MeOH at temperatures around RT
  • oxirane (XVII) in an ether solvent like THF is consecutively treated with an alkyl lithium reagent like nBuLi, a trialkylsilyl chloride like TIPSCI, and again with an alkyl lithium reagent like nBuLi to form dihydrofurothiazole (XVIII).
  • a two-step oxidation procedure utilizing (1) DMP in a solvent like DCM at temperatures between 0°C and RT and (2) sodium chlorite in a buffered aq. solution with tBuOH as co-solvent and 2-methyl-2-butene as scavenger at temperatures around 0°C provides carboxylic acid (XIX).
  • Removal of the silyl protecting group to form a compound of formula (lie) can be performed with a fluoride source such as TBAF in a solvent like THF at temperatures between 0°C and RT.
  • amines of formula III can be prepared according to procedures described in WO2009/132000, outlined in the schemes below and in the experimental part.
  • Amino nitriles of formula (XX), wherein NR 5 R 6 represents heterocyclyl which is unsubstituted or mono- or di-substituted with fluoro and R 4 represents heteroaryl (scheme 6) can be prepared by Strecker reaction between aldehydes of formula (XXI) and amines of formula R 5 R 6 NH in the presence of a suitable cyanating reagent such as TMS-CN and a suitable Lewis acid catalyst such as Znl 2 in a suitable mixture of solvents such as Et 2 0/MeOH at temperatures between 0°C and 80°C.
  • a suitable cyanating reagent such as TMS-CN
  • a suitable Lewis acid catalyst such as Znl 2
  • solvents such as Et 2 0/MeOH
  • the resulting nitriles of formula (XX) can be transformed to diamines of formula (Ilia) (scheme 6) by reduction under hydrogenation conditions in the presence of a suitable catalyst such as Raney nickel and a suitable solvent such as methanolic ammonia at temperatures around RT.
  • a suitable catalyst such as Raney nickel
  • a suitable solvent such as methanolic ammonia
  • nitriles of formula (XXII), wherein R 4 represents heteroaryl can be prepared by a two step procedure: (i) heteroarylation of methylcyanoacetate by treatment with a bromoheteroarene of formula Br-R 4 in the presence of a suitable base such as KOtBu, a suitable palladium catalyst such as Pd(OAc) 2 , a suitable ligand such as dppf in a suitable solvent such as dioxane as described in J. Org. Chem.
  • nitriles of formula (XXII), wherein R 4 represents heteroaryl can be prepared according to J. Am. Chem. Soc. 201 1 , 133, 6948-6951 .
  • Cyano alkenes of formula (XXIV) (scheme 7) wherein R 5 and R 6 form, together with the carbon atom to which they are attached, a heterocyclyl group which is unsubstituted or mono- or di-substituted with fluoro can be prepared by Knoevenagel condensation of heteroaryl-acetonitriles of formula (XXII) with ketones of formula R 5 COR 6 by treatment with a suitable base such as KOH or NaOMe in a suitable solvent such as MeOH at temperatures between 0°C and 60°C.
  • a suitable base such as KOH or NaOMe
  • MeOH a suitable solvent
  • the respective amines of formula (lllb) (scheme 7) can be prepared by reduction of cyano alkenes of formula (XXIV) using a two step procedure: (i) hydrogenation in the presence of a suitable catalyst such as Pd/C followed by (ii) hydrogenation in the presence of a suitable catalyst such as Raney nickel, both steps being carried out in a suitable solvent such as methanolic ammonia at temperatures around RT.
  • a suitable catalyst such as Pd/C
  • a suitable catalyst such as Raney nickel
  • amines of formula (lllb) can be prepared by reduction of cyano alkenes of formula (XXIV) in the presence of a suitable reducing reagent such as BH 3 THF complex in a suitable solvent such as THF at temperatures around 60°C.
  • a suitable reducing reagent such as BH 3 THF complex
  • a suitable solvent such as THF
  • heteroaryl-acetonitriles of formula (XXII), wherein R 4 represents heteroaryl (scheme 8) can be prepared from bromoheteroarene of formula Br- R 4 by a two step procedure as described above.
  • Nitriles of formula (XXV) (scheme 8) can be prepared by dialkylation of heteroaryl- acetonitriles of formula (XXII) with dihaloalkanes such as Br-(CH 2 ) m -CR 7 R 8 -(CH 2 ) 2 -Br, wherein m represents 1 , 2 or 3 and R 7 and R 8 represent hydrogen or fluoro, in the presence of a base such as NaH or tBuOK in a suitable organic solvent such as THF or DMSO preferably at temperatures between 0°C and RT.
  • a base such as NaH or tBuOK
  • suitable organic solvent such as THF or DMSO preferably at temperatures between 0°C and RT.
  • Amines of formula (III c) (scheme 8) can be prepared by reduction of nitriles of formula (XXV) for instance under hydrogenation conditions in the presence of a suitable catalyst such as Raney nickel and a suitable solvent such as methanolic ammonia at temperatures around RT or with a suitable reducing reagent such as BH 3 THF complex in a suitable solvent such as THF at temperatures around 70°C.
  • Amines of formula (lllc), wherein m represents 2 and R 7 and R 8 represent fluoro (scheme 8) can be prepared for instance following a 4-step sequence: (i) tandem double Michael addition-Dieckmann condensation reaction of acetonitrile derivatives of formula (XXII) with methyl acrylate according to J. Org.
  • Scheme 8 Synthesis of amines of formula (lllc), wherein R 4 represents heteroaryl, wherein R 7 and R 8 represent hydrogen or fluoro and wherein m represents 1 , 2 or 3
  • amines of formula (XXX), wherein R 9 and R 10 represent hydrogen and m represents 1 , 2 or 3 (scheme 9) can be prepared for instance by alkylation of N-(diphenylmethylene)glycine tert-butyl ester with cycloalkyi bromide or iodide of formula (XXIX) (X represents bromo or iodo) according to Angew. Chem. Int. Ed., 2005, 44, 1549-1551 .
  • amines of formula (XXX), wherein R 9 represents hydroxy, R 10 represents hydrogen and m represents 1 , 2 or 3 or R 9 and R 10 form an ethylenedioxy group and m represents 1 , 2 or 3 (scheme 9) can be prepared as previously described for the synthesis of amines of formula (XXX) wherein R 9 and R 10 represent hydrogen.
  • compounds of formula (XXXI), wherein R 11 represents tBu and R 12 represents Boc (or Z respectively) (scheme 9) can be prepared by treatment of amines of formula (XXX) wherein R 9 represents hydroxy and R 10 represents hydrogen with Boc-anhydride (or Z-CI respectively) in the presence of a base such as Et 3 N or NaOH in a suitable solvent such as DCM or dioxane/water at temperatures between 0°C and RT. Oxidation of resulting compounds using for instance DMP in a suitable solvent such as DCM at temperatures around RT gives ketones of formula (XXXII), wherein R 11 represents tBu or Me and R 12 represents Boc or Z.
  • ketones of formula (XXXII), wherein R 11 represents tBu or Me and R 12 represents Z can be prepared by a two step procedure: (i) Z-protection of amines of formula (XXX), wherein R 9 and R 10 form an ethylenedioxy group using conditions as previously described for the synthesis of compounds of formula (XXXI) and (ii) cleavage of the ketal protecting group using acidic conditions such as aq. HCI and a suitable organic solvent such as MeCN or THF at temperatures around RT.
  • compounds of formula (XXXIII), wherein R 11 represents tBu or Me and R 12 represents Boc or Z can be prepared by fluorination of ketones of formula (XXXII) wherein R 11 represents tBu or Me and R 12 represents Boc or Z using a fluorinating reagent such as DAST or bis(2-methoxyethyl)aminosulfur trifluoride in the presence of a suitable solvent such as THF or DCM at temperatures between 0°C and RT.
  • a fluorinating reagent such as DAST or bis(2-methoxyethyl)aminosulfur trifluoride
  • Amines of formula (llld), wherein R 7 and R 8 represent fluoro and m represents 1 , 2 or 3 (scheme 9) can be prepared by Boc cleavage (or Z cleavage respectively) from compounds of formula (XXXIV) wherein R 12 represents Boc (or Z respectively) using a suitable acid such as HCI or TFA in the presence of a suitable solvent such as dioxane, EtOAc or DCM (or under hydrogenation conditions in the presence of a suitable catalyst such as palladium on charcoal and a suitable solvent such as MeOH or dioxane respectively) at temperatures around RT.
  • a suitable acid such as HCI or TFA
  • a suitable solvent such as dioxane, EtOAc or DCM
  • a suitable catalyst such as palladium on charcoal and a suitable solvent such as MeOH or dioxane respectively
  • Amines of formula (Mid), wherein R 7 represents fluoro, R 8 represents hydrogen and m represents 1 , 2 or 3 can be prepared by fluorination of compounds of formula (XXXI), wherein R 11 represents tBu or Me and R 12 represents Boc or Z with for instance DAST in a solvent like DCM at temperatures between -78°C and RT, followed by (1) reduction of the ester following conditions such as those already described for the reduction of esters of formula (XXX), wherein R 9 and R 10 represent hydrogen and (2) removal of Boc (or Z, respectively) following conditions such as those already described for compounds of formula (XXXIV).
  • HPLC-MS analyses were performed on a Thermo MSQ mass spectrometer with a Dionex Ultimate HPG-3000 pump and a Dionex Ultimate 3000 photodiode array detector.
  • Preparative HPLC/MS purifications were performed on a Waters system, equipped with a binary gradient module (2545), a HPLC pump (515), a photodiode array detector (2998) and a mass detector (3100).
  • eluents acidic A: H 2 0 + 0.1 % HCOOH, B: CH 3 CN + 0.1 % HCOOH; eluents basic: A: H 2 0 + 0.1 % NH 4 OH, B: CH 3 CN + 0.1 % NH GH; flow: 40 mL/min; column: Waters XBridge C 8, 5 urn OBDTM, 19 50 mm.
  • NBS 9.08 g, 51 .0 mmol
  • methyl cyclohex-2- enecarboxylate 5.96 g, 42.5 mmol
  • THF/H 2 0 500 mL, 9:1
  • the mixture was allowed to warm to RT and stirred for 2 h.
  • aq. sat. Na 2 S 2 0 3 and aq. sat. NaHC0 3 were added and the mixture was cone, in vacuo.
  • the residue was partitioned between EtOAc and aq. sat. NaHC0 3 .
  • the org. layer was washed multiple times with aq. sat. NaHC0 3 and brine, dried over MgS0 4 , and cone, in vacuo.
  • n-BuLi in hexanes 2.3 M, 10.9 mL, 25.0 mmol
  • DIPA 3.5 mL, 25.0 mmol
  • THF 102 mL
  • the soln. was stirred at -20°C for 30 min, then, it was cooled to -78°C and a soln. of 2,4-dichlorothiazole (3.50 g, 22.7 mmol) in THF (16 mL) was added.
  • NBS (1 1 .94 g, 67.1 mmol) was added over 90 min to a soln. of 4-((2,2-dimethyl- 1 ,3-dioxolan-4-yl)methoxy)thiazole (13.75 g, 63.9 mmol) in MeCN (320 mL).
  • the mixture was further stirred at 0°C for 30 min, then, it was quenched by the addition of aq. 5% NaHC0 3 and extracted with EtOAc.
  • the comb. org. layers were washed with aq. 5% NaHC0 3 and brine, dried over MgS0 4 , and cone, in vacuo.
  • the P2X 7 receptor antagonistic activity of the compounds of formula (I) is determined in accordance with the following experimental method.
  • HEK Human embryonic kidney
  • Geneticin resistant cells were then selected during two consecutive rounds of cloning by serial limiting dilution with visual inspection. Individual clones were screened for P2X7 expression by applying ATP and recording the resultant uptake of YO-PR01 . Specific cell clones were chosen based on RNA and protein expression. HEK cells stably expressing P2X7 were used to screen drugs using the YO-PR01 assay. Cells were grown to confluency in adherent culture at 37°C in a humidified 5% C0 2 incubator (split 1 /5 every 3 - 4 days with DMEM, 10 % FCS, 1 % Penicillin/Streptomycin, 250 ⁇ g/ml Geneticin).
  • Adherent cells were detached by incubation with Trypsine (1 ml per 165 cm 2 dish) for 2 minutes, then washed off with 10 ml PBS (without Mg 2+ and Ca 2+ ), and resuspended in DMEM, 10 % FCS, 1 % Penicillin/Streptomycin, no Geneticin.
  • concentration was performed in duplicate. For IC 50 measurements 10 concentration points were measured (10 ⁇ being the highest concentration followed by 9 serial dilution steps 1 /3). The cells were incubated with the antagonists of the present invention together with ATP at a final concentration of 250 ⁇ for 90 minutes. During this time period, four time points were taken. Each time point comprised the average of several measurements made within a few seconds. Fluorescence was measured in the FLIPR tetra (Molecular Devices) using the filters appropriate for YO-PRO-1 fluorescence (excitation485/20, emission 530/25). The FLIPR tetra was equipped with Molecular Devices Screen Works system control software to define and run experimental protocols.
  • the maximal intensity was expressed as a percentage of that induced by the EC 50 value for agonist activation (0.25 mM ATP for HEK-293 cells expressing human recombinant P2X7 receptor).
  • the maximum intensity is plotted against the concentration of compound to determine IC50 values.
  • Antagonistic activities with respect to the P2X 7 receptor (IC 50 values) of exemplified compounds are displayed in Table 1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Dermatology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Psychology (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Transplantation (AREA)
  • Vascular Medicine (AREA)
  • Ophthalmology & Optometry (AREA)
  • Hospice & Palliative Care (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Psychiatry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Otolaryngology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Epidemiology (AREA)

Abstract

The invention relates to heterocyclic amide derivatives of formula (I), wherein R1, R2, R3, R4, n and X are as defined in the description, their preparation and their use as pharmaceutically active compounds.

Description

Heterocyclic Amide Derivatives as P2XZ Receptor Antagonists
The present invention relates to heterocyclic amide derivatives of formula (I) and their use as pharmaceuticals. The invention also concerns related aspects including processes for the preparation of the compounds, pharmaceutical compositions containing one or more compounds of formula (I), and especially their use as P2X7 receptor antagonists.
The P2X7 receptors (P2RX7) belong to the family of P2X ionotropic receptors that are activated by extracellular nucleotides, in particular adenosine triphosphate (ATP). P2RX7 is distinguished from other P2X family members by the high concentrations (mM range) of ATP required to activate it and its ability to form a large pore upon prolonged or repeated stimulation (North, R. A., Physiol. Rev. 2002, 82(4), 1013-67; Surprenant, A., Rassendren, F. et al., Science 1996, 272(5262), 735-8; Virginio, C, MacKenzie, A. et al., J. Physiol., 1999, 519, 335-46). P2RX7 is present on many cell types, especially ones known to be involved in inflammatory and immune processes. This is reflected within both the periphery and the CNS as Lipopolysaccharide S (LPS) priming of monocytes and microglia followed by ATP stimulation has been shown to lead to the local release and processing of I L1 β and other family members including IL18 through a P2RX7 mediated mechanism. Indeed mice lacking the P2X7 receptor are unable to release I L1 β following LPS priming and ATP stimulation providing further evidence of its role in this pathway (Solle, M., Labasi, J. et al., J. Biol. Chem., 2001 , 276(1), 125-32). In addition L-selectin shedding from monocytes, macrophages and lymphocytes, degranulation in mast cells and apoptosis in lymphocytes are all associated with P2RX7 stimulation. P2RX7 is also expressed on epithelial and endothelial cells (Ferrari, D., Chiozzi, P. et al., Neuropharmacology 1997, 36(9), 1295-301 ; Wiley, J. S., Chen, J. R. et al., Ciba Found Symp. 1996, 198, 149-60 and 160-5; North, R. A., Physiol. Rev. 2002, 82(4), 1013-67). In addition to its role in the periphery it may have an important function in neurotransmission within the CNS through its activation on postsynaptic and / or presynaptic central and peripheral neurons and glia (Deuchars, S. A., Atkinson, L. et al., J. Neurosci. 2001 , 21 (18), 7143-52; Sperlagh, B., Kofalvi, A. et al., J. Neurochem. 2002, 81 (6), 1 196-21 1). Recent data that has emerged using in situ hybridization demonstrated that P2X7 receptor mRNA was widely distributed throughout the rat brain. Specifically, among the areas of high P2X7mRNA expression noted were the piriform cortex, hippocampus, pontine nuclei and the anterior horn of the spinal cord (Yu, Y., Ugawa, S. et al., Brain. Res. 2008, 1 194, 45-55). Hence there is therapeutic rationale for the use of P2X7 ion channel blockers in the treatment of a variety of disease states. These include but are not limited to diseases associated with the central nervous system such as stroke or injury and diseases associated with neuro-degeneration and neuroinflammation such as Alzheimer's disease, Huntington's disease, epilepsy, Amyotrophic lateral sclerosis, acute spinal cord injury additionally to meningitis, sleep disorders, mood and anxiety disorders as well as chronic and neuropathic and inflammatory pain. Furthermore, peripheral inflammatory disorders and autoimmune diseases including but not limited to rheumatoid arthritis, osteoarthritis, psoriasis, allergic dermatitis, asthma, chronic obstructive pulmonary disease, airways hyper-responsiveness, septic shock, bronchitis, glomerulonephritis, irritable bowel disease, skin injury, lung emphysema, Limb girdle dystrophy type 2B, fibrosis, Syndrome of synovitis Acne Pustulosis, atherosclerosis, burn injury, spinal cord injury, Hyperostosis Osteitis, Crohn's disease, ulcerative colitis, growth and metastases of malignant cells, myoblastic leukaemia, diabetes, trauma, meningitis, osteoporosis, burn injury, ischemic heart disease, and varicose veins and trauma, are all examples where the involvement of P2X7 channels has been implicated. In addition a recent report suggests a link between P2RX7 and chronic, inflammatory and neuropathic pain (Chessell, I. P., Hatcher, J. P. et al., Pain, 2005, 1 14(3), 386-96). Overall, these findings indicate a role for the P2X7 receptor in the process of neuronal synaptic transmission and therefore a potential role for P2X7 antagonists as novel therapeutic tools to treat neuropathic pain.
In view of the above observations, there is significant requirement for P2X7 antagonists that can be efficiently used in treating neuropathic pain, chronic inflammatory pain, inflammation, and neurodegenerative conditions.
Different carboxamide derivatives, which are also P2X7 receptor antagonists, have been for instance disclosed in WO 2008/066789 (imidazo[1 ,2-a]pyridine derivatives), WO 2008/124153 (pyrazolo[1 ,5-a]pyridine derivatives), WO 2009/023623 (1 H-pyrrolo[2,3- bjpyridine and indole derivatives), WO 2009/108551 (indole derivatives) and WO 2009/132000 (quinoline and isoquinoline derivatives). Other P2X7 receptor antagonists with a heterocyclic amide structure have been disclosed in WO 2013/108227.
Various embodiments of the invention are presented hereafter:
1 ) The present invention relates to heterocyclic amide derivatives of formula (I),
Figure imgf000003_0001
(I) wherein
n represents 1 , 2 or 3;
X represents -O- or -CH2-;
R1 represents hydrogen, (C1-C2)alkyl or hydroxy-(C1-C2)alkyl;
R2 represents hydrogen and R3 represents heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached, a 5- to 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
R4 represents hydrogen or heteroaryl which is unsubstituted or mono- or di-substituted with (Ci-C4)alkyl, (C1-C3)fluoroalkyl or halogen;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
The compounds of formula (I) according to embodiment 1) may contain one or more stereogenic or asymmetric centers, such as one or more asymmetric carbon atoms. Substituents at a double bond may be present in the (2 or (£)-configuration unless indicated otherwise. The compounds of formula (I) may thus be present as mixtures of stereoisomers or preferably as pure stereoisomers. Mixtures of stereoisomers may be separated in a manner known to a person skilled in the art.
Definitions provided herein are intended to apply uniformly to the compounds of formulae (I), (Isn), (Ist2> and (lst3) , as defined in any one of embodiments 1) to 22), and, mutatis mutandis, throughout the description and the claims unless an otherwise expressly set out definition provides a broader or narrower definition. It is well understood that a definition or preferred definition of a term defines and may replace the respective term independently of (and in combination with) any definition or preferred definition of any or all other terms as defined herein.
The term "alkyl", used alone or in combination, refers to a straight or branched chain alkyl group containing one to four carbon atoms. The term "(Cx-Cy)alkyl" (x and y each being an integer), refers to an alkyl group as defined before containing x to y carbon atoms. For example a (d-C4)alkyl group contains from one to four carbon atoms. Representative examples of alkyl groups include methyl, ethyl, n-propyl, /'so-propyl, n-butyl, /'so-butyl, sec-butyl and tert. -butyl.
In case "R1" represents "(C1-C2)alkyl" the term means (CrC2)alkyl groups as defined above. Examples of said groups are methyl and ethyl. Preferred is methyl.
In case "(C C^alkyl" is a substituent to a heteroaryl group, the term "(C C^alkyl" means (CrC4)alkyl groups as defined above. Examples of said groups are methyl, ethyl, n- propyl, /'so-propyl, n-butyl, /'so-butyl, sec-butyl and fe/ .-butyl. Preferred is methyl. The term "hydroxy-(Cx-Cy)alkyl" (x and y each being an integer), used alone or in combination, refers to an alkyl group as defined before containing x to y carbon atoms in which one hydrogen atom has been replaced with hydroxy. For example a hydroxy- (C1-C2)alkyl group contains one or two carbon atoms in which one hydrogen atom has been replaced with hydroxy. Examples of said groups are hydroxy-methyl and hydroxy- ethyl.
In case "R1" represents "hydroxy-(C C2)alkyr the term means hydroxy-(C1-C2)alkyl groups as defined above. Representative examples of said groups are hydroxy-methyl, 1 - hydroxy-ethyl and 2-hydroxy-ethyl. Preferred is hydroxy-methyl.
The term "5- to 7-membered saturated carbocyclic ring", used alone or in combination, refers to a saturated monocyclic ring containing 5, 6 or 7 carbon atoms. Preferred are saturated monocyclic rings containing 6 or 7 carbon atoms; and most preferred is a saturated monocyclic ring containing 6 carbon atoms. Examples of said rings are cyclopentyl, cyclohexyl and cycloheptyl. Most preferred is cyclohexyl.
The term "(Cx-Cy)fluoroalkyl" (x and y each being an integer) refers to an alkyl group as defined before containing x to y carbon atoms in which one or more (and possibly all) hydrogen atoms have been replaced with fluoro. For example a (C1-C3)fluoroalkyl group contains from one to three carbon atoms in which one to seven hydrogen atoms have been replaced with fluoro.
In case "(C1-C3)fluoroalkyl" is a substituent to a heteroaryl group, the term "(C C3)fluoroalkyl" means (C1-C3)fluoroalkyl groups as defined above. Representative examples of said groups are difluoromethyl, trifluoromethyl, 2,2-difluoroethyl and 2,2,2- trifluoroethyl. Preferred is trifluoromethyl.
The term halogen means fluoro, chloro or bromo.
In case "halogen" is a substituent to a heteroaryl group, the term "halogen" means fluoro, chloro or bromo; and preferably chloro.
The term "heterocyclyl", used alone or in combination, refers to a saturated monocyclic moiety of 5 to 7 ring members containing a nitrogen atom and optionally one additional heteroatom selected from nitrogen, oxygen and sulfur. Preferred is a 6-membered heterocyclyl group. The heterocyclyl group is preferably attached to the rest of the molecule via a nitrogen atom. Representative examples of such heterocyclyl groups are pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, azepanyl, 1 ,4- oxazepanyl and 1 ,4-thiazepanyl. Preferred examples are piperidinyl (notably piperidin-1 - yl) and morpholinyl (notably morpholin-4-yl). The heterocyclyl group is unsubstituted or mono- or di-substituted with fluoro. Most preferred examples of unsubstituted or mono- or di-substituted heterocyclyl groups are 4,4-difluoro-piperidin-1 -yl and morpholin-4-yl.
The term "6-membered heterocyclyl", used alone or in combination, refers to a saturated monocyclic moiety of 6 ring members containing one nitrogen atom and optionally one oxygen atom. The 6-membered heterocyclyl group is preferably attached to the rest of the molecule via the nitrogen atom. Representative examples of such heterocyclyl groups are piperidinyl and morpholinyl. Preferred examples are piperidin-1 -yl and morpholin-4-yl. The 6-membered heterocyclyl group is unsubstituted or mono- or di-substituted with fluoro. Most preferred examples of unsubstituted or mono- or di-substituted 6-membered heterocyclyl groups are 4,4-difluoro-piperidin-1 -yl and morpholin-4-yl.
The term "heteroaryl", used alone or in combination, means a 5- or 6-membered monocyclic aromatic ring containing 1 or 2 heteroatoms independently selected from oxygen, nitrogen and sulphur. Preferred is a 6-membered heteroaryl group. Examples are furanyl, oxazolyl, isoxazolyl, thienyl, thiazolyl, isothiazolyl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidyl, pyridazinyl and pyrazinyl. Preferred examples are pyridyl (notably pyridin-3-yl) and pyrimidyl (notably pyrimidin-5-yl). The heteroaryl group is unsubstituted or substituted as explicitly defined. Preferred examples of unsubstituted or substituted heteroaryl groups are 2-chloro-pyridin-5-yl, 2-trifluoromethyl-pyridin-5-yl, 2-methyl- pyrimidin-5-yl and 2-trifluoromethyl-pyrimidin-5-yl. Most preferred is 2-chloro-pyridin-5-yl. The term "6-membered heteroaryl", used alone or in combination, means a 6-membered monocyclic aromatic ring containing 1 or 2 nitrogen atoms. Examples are pyridyl, pyrimidyl, pyridazinyl and pyrazinyl. Preferred examples are pyridyl (notably pyridin-3-yl) and pyrimidyl (notably pyrimidin-5-yl). The 6-membered heteroaryl group is unsubstituted or substituted as explicitly defined. Preferred examples of unsubstituted or substituted heteroaryl groups are 2-chloro-pyridin-5-yl, 2-trifluoromethyl-pyridin-5-yl, 2-methyl- pyrimidin-5-yl and 2-trifluoromethyl-pyrimidin-5-yl. Most preferred is 2-chloro-pyridin-5-yl.
2) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 , 2 or 3;
X represents -O- or -CH2-;
R1 represents hydrogen, (C1-C2)alkyl or hydroxy-(C1-C2)alkyl;
R2 represents hydrogen and R3 represents 6-membered heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and R4 represents hydrogen or a 6-membered heteroaryl group, which group is unsubstituted or mono- or di-substituted with (C^-C^alkyl, (C1-C3)fluoroalkyl or halogen;
with the proviso that one of R1 and R4 is different from hydrogen;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds. 3) A further embodiment of the invention relates to compounds according to any one of embodiments 1 ) or 2), wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen, methyl or hydroxy-methyl;
R2 represents hydrogen and R3 represents 6-membered heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
R4 represents hydrogen or a 6-membered heteroaryl group, which group is mono- substituted with methyl, trifluoromethyl or chloro;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
4) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen ;
R2 represents hydrogen and R3 represents heterocyclyl; or (preferably) R2 and R3 form, together with the carbon atom to which they are attached, a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
R4 represents heteroaryl which is unsubstituted or mono- or di-substituted with (C^- C4)alkyl, (C1-C3)fluoroalkyl or halogen;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
5) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen ;
R2 represents hydrogen and R3 represents 6-membered heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and R4 represents a 6-membered heteroaryl group, which group is unsubstituted or mono- substituted with methyl, trifluoromethyl or chloro;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
6) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen;
R2 and R3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and
R4 represents a 6-membered heteroaryl group, which group is mono-substituted with chloro;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
7) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 , 2 or 3;
X represents -O- or -CH2-;
R1 represents (C1-C2)alkyl or hydroxy-(C1-C2)alkyl;
R2 and R3 form, together with the carbon atom to which they are attached, a 6- or 7- membered saturated carbocyclic ring which is unsubstituted; and
R4 represents hydrogen;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
8) A further embodiment of the invention relates to compounds according to embodiment 1 ), wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents methyl or hydroxy-methyl;
R2 and R3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted; and
R4 represents hydrogen;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
9) A further embodiment of the invention relates to compounds according to any one of embodiments 1), 2) or 7), wherein
n represents 1 or 2; and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
10) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 8), wherein
n represents 1 ;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
1 1) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 8), wherein
n represents 2;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds. 12) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 1 1 ), wherein
X represents -0-;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
13) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 1 1 ), wherein
X represents -CH2-;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
14) A further embodiment of the invention relates to compounds according to any one of embodiments 1), 2), 7) or 9) to 13), wherein
R1 represents hydroxy-(C1-C2)alkyl;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
15) A further embodiment of the invention relates to compounds according to any one of embodiments 1), 4) or 9) to 14), wherein
R2 represents hydrogen and R3 represents heterocyclyl;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
16) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 5) or 9) to 14), wherein
R2 represents hydrogen and R3 represents 6-membered heterocyclyl;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds. 17) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 6) or 9) to 14), wherein
R2 and R3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
18) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 5) or 9) to 17), wherein
R4 represents a 6-membered heteroaryl group, which group is unsubstituted or mono- substituted with methyl, trifluoromethyl or chloro;
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
19) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 18), wherein the stereogenic center at the a-carbon atom of the amide moiety is as depicted in formula (lsti)
Figure imgf000010_0001
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
20) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 18), wherein the stereogenic center at the a-carbon atom of the amide moiety is as depicted in formula (lst2)
Figure imgf000010_0002
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
21) A further embodiment of the invention relates to compounds according to any one of embodiments 1) to 20), wherein the stereogenic center at the carbon atom which is attached to R1 is as depicted in formula (lSt3>
Figure imgf000010_0003
and to the salts (in particular pharmaceutically acceptable salts) of such compounds.
22) Preferred compounds of formula (I) as defined in embodiment 1 ) are selected from the group consisting of: N-(1 -cycloheptyl-2-hydroxyethyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxamid
N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-5,6-dihydrofuro[2,3-d]thiazole-6- carboxamide;
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5-yl)ethyl)-5,6-dihydrof^
d]thiazole-6-carboxamide;
N-(2-morpholino-2-(6-(trifluoromethyl)pyridin-3-yl)ethyl)-5,6-dihydrofuro[2,3-^
carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-5,6-dihydro-4H-cyclopenta[d]thiazole-6-carboxami N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-5,6-dihydro-4H-cyclopen^
carboxamide;
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5-yl)ethyl)-5,6-dihydro-4H- cyclopenta[d]thiazole-6-carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-6,7-dihydro-5H-pyrano[2,3-d]thiazole-7-carboxamide; N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-6 ,7-dihydro-5H-pyrano[2,3-d]thiazole-7- carboxamide;
N-(2-(6-chloropyridin-3-yl)-2-(4,4-difluoropiperidin-1 -yl)ethyl)-6 ,7-dihydro-5H-pyrano[2,3- d]thiazole-7-carboxamide;
N-((R)-1 -cyclohexylethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide; N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide;
N-((1 -(6-chloropyridin-3-yl)-4,4-difluorocyclohexyl)methyl)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide;
N-(2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-(S)-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8- carboxamide; and
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-(R)-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8- carboxamide;
or salts (in particular pharmaceutically acceptable salts) of such compounds;
it is to be understood for any of the above listed compounds, that a stereogenic center, which is not specifically assigned, may be in absolute (/?)- or absolute (S)-configuration; for example, the stereogenic center at the a-carbon atom of the amide moiety may be in absolute (/^-configuration or absolute (S)-configu ration. For example a compound listed as N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide may be N-((1-(6-chloropyridin-3-yl)cyclohexyl)methyl)-(S)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide, N-((1-(6-chloropyridin-3-yl)cyclohexyl)methyl)- (R)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide or any mixture thereof. Notably, compounds containing more than one stereogenic center may be at each stereogenic center, which is not specifically assigned, in absolute (R)- or absolute (S)-configuration; for example a compound listed as N-(2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5- yl)ethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide may be N-((S)-2-morpholino-2- (2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-(S)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide, N-((S)-2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-(R)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide, N-((R)-2-morpholino-2-(2- (trifluoromethyl)pyrimidin-5-yl)ethyl)-(S)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide, N-((R)-2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-(R)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide or any mixture thereof.
It is well understood that the invention relates to compounds according to embodiment 1); or according to embodiment 1) limited by the features of an embodiment dependent on embodiment 1; or according to embodiment 1) limited by the features of a cascade of dependent embodiments e.g. in the form of "embodiment 3) depending on embodiment 2) depending on embodiment 1)". In case of an embodiment depending on more than one other embodiment, it is understood that each combination is specifically disclosed. Also, in case an embodiment is dependent on more than one other embodiment and one or more of said other embodiments are themselves dependent on one or more further embodiments, it is understood that each combination is specifically disclosed if obtainable with regard to the given dependencies and multiple dependencies. Notably, embodiments resulting from cascades of more than three embodiments depending on each other may be construed under observance of the given dependencies and multiple dependencies and are thus intended to be specifically disclosed. Representative examples of embodiments which are possible based on the dependencies of the embodiments 1) to 22) as disclosed hereinabove and which are therefore intended and herewith specifically disclosed in individualized form are:
1, 2+1, 3+1, 3+2+1 , 4+1 , 5+1 , 6+1 , 7+1 , 8+1, 9+1, 9+2+1 , 9+7+1 , 10+1, 10+2+1 , 10+3+1 , 10+3+2+1, 10+4+1, 10+5+1, 10+6+1, 10+7+1, 10+8+1, 11+1, 11+2+1, 11+3+1, 11+3+2+1, 11+4+1, 11+5+1, 11+6+1, 11+7+1, 11+8+1, 12+1, 12+2+1, 12+3+1, 12+3+2+1, 12+4+1, 12+5+1, 12+6+1, 12+7+1, 12+8+1, 12+9+1, 12+9+2+1, 12+9+7+1, 12+10+1, 12+10+2+1, 12+10+3+1, 12+10+3+2+1, 12+10+4+1, 12+10+5+1, 12+10+6+1, 12+10+7+1, 12+10+8+1, 12+11+1, 12+11+2+1, 12+11+3+1, 12+11+3+2+1, 12+11+4+1, 12+11+5+1, 12+11+6+1, 12+11+7+1, 12+11+8+1, 13+1, 13+2+1, 13+3+1, 13+3+2+1 13+4+1, 13+5+1, 13+6+1, 13+7+1, 13+8+1, 13+9+1, 13+9+2+1, 13+9+7+1, 13+10+1 13+10+2+1, 13+10+3+1, 13+10+3+2+1, 13+10+4+1, 13+10+5+1, 13+10+6+1 13+10+7+1, 13+10+8+1, 13+11+1, 13+11+2+1, 13+11+3+1, 13+11+3+2+1, 13+11+4+1 13+11+5+1, 13+11+6+1, 13+11+7+1, 13+11+8+1, 14+1, 14+2+1, 14+7+1, 14+9+1 14+9+2+1, 14+9+7+1, 14+11+1, 14+11+2+1, 14+11+3+1, 14+11+3+2+1, 14+11+4+1 14+11+5+1, 14+11+6+1, 14+11+7+1, 14+11+8+1, 14+12+1, 14+12+2+1, 14+12+3+1 14+12+3+2+1, 14+12+4+1, 14+12+5+1, 14+12+6+1, 14+12+7+1, 14+12+8+1 14+12+9+1, 14+12+9+2+1, 14+12+9+7+1, 14+12+10+1, 14+12+10+2+1, 14+12+10+3+1 14+12+10+3+2+1, 14+12+10+4+1, 14+12+10+5+1, 14+12+10+6+1, 14+12+10+7+1 14+12+10+8+1, 14+12+11+1, 14+12+11+2+1, 14+12+11+3+1, 14+12+11+3+2+1 14+12+11+4+1, 14+12+11+5+1, 14+12+11+6+1, 14+12+11+7+1, 14+12+11+8+1 14+13+1, 14+13+2+1, 14+13+3+1, 14+13+3+2+1, 14+13+4+1, 14+13+5+1, 14+13+6+1 14+13+7+1, 14+13+8+1, 14+13+9+1, 14+13+9+2+1, 14+13+9+7+1, 14+13+10+1 14+13+10+2+1, 14+13+10+3+1, 14+13+10+3+2+1, 14+13+10+4+1, 14+13+10+5+1 14+13+10+6+1, 14+13+10+7+1, 14+13+10+8+1, 14+13+11+1, 14+13+11+2+1 14+13+11+3+1, 14+13+11+3+2+1, 14+13+11+4+1, 14+13+11+5+1, 14+13+11+6+1 14+13+11+7+1, 14+13+11+8+1, 15+1, 15+4+1, 15+9+1, 15+9+2+1, 15+9+7+1, 15+13+1 15+13+2+1, 15+13+3+1, 15+13+3+2+1, 15+13+4+1, 15+13+5+1, 15+13+6+1 15+13+7+1, 15+13+8+1, 15+13+9+1, 15+13+9+2+1, 15+13+9+7+1, 15+13+10+1 15+13+10+2+1, 15+13+10+3+1, 15+13+10+3+2+1, 15+13+10+4+1, 15+13+10+5+1 15+13+10+6+1, 15+13+10+7+1, 15+13+10+8+1, 15+13+11+1, 15+13+11+2+1 15+13+11+3+1, 15+13+11+3+2+1, 15+13+11+4+1, 15+13+11+5+1, 15+13+11+6+1 15+13+11+7+1, 15+13+11+8+1, 16+1, 16+2+1, 16+3+1, 16+3+2+1, 16+4+1, 16+5+1 16+9+1, 16+9+2+1, 16+9+7+1, 16+11+1, 16+11+2+1, 16+11+3+1, 16+11+3+2+1 16+11+4+1, 16+11+5+1, 16+11+6+1, 16+11+7+1, 16+11+8+1, 16+12+1, 16+12+2+1 16+12+3+1, 16+12+3+2+1, 16+12+4+1, 16+12+5+1, 16+12+6+1, 16+12+7+1 16+12+8+1, 16+12+9+1, 16+12+9+2+1, 16+12+9+7+1, 16+12+10+1, 16+12+10+2+1 16+12+10+3+1, 16+12+10+3+2+1, 16+12+10+4+1, 16+12+10+5+1, 16+12+10+6+1 16+12+10+7+1, 16+12+10+8+1, 16+12+11+1, 16+12+11+2+1, 16+12+11+3+1 16+12+11+3+2+1, 16+12+11+4+1, 16+12+11+5+1, 16+12+11+6+1, 16+12+11+7+1 16+12+11+8+1, 16+13+1, 16+13+2+1, 16+13+3+1, 16+13+3+2+1, 16+13+4+1 16+13+5+1, 16+13+6+1, 16+13+7+1, 16+13+8+1, 16+13+9+1, 16+13+9+2+1 16+13+9+7+1, 16+13+10+1, 16+13+10+2+1, 16+13+10+3+1, 16+13+10+3+2+1 16+13+10+4+1, 16+13+10+5+1, 16+13+10+6+1, 16+13+10+7+1, 16+13+10+8+1 16+13+11+1, 16+13+11+2+1, 16+13+11+3+1, 16+13+11+3+2+1, 16+13+11+4+1 16+13+11+5+1, 16+13+11+6+1, 16+13+11+7+1, 16+13+11+8+1, 17+1, 17+2+1, 17+3+1 17+3+2+1, 17+4+1, 17+5+1, 17+6+1, 17+9+1, 17+9+2+1, 17+9+7+1, 17+10+1 17+10+2+1, 17+10+3+1, 17+10+3+2+1, 17+10+4+1, 17+10+5+1, 17+10+6+1 17+10+7+1, 17+10+8+1, 17+11+1, 17+11+2+1, 17+11+3+1, 17+11+3+2+1, 17+11+4+1 17+11+5+1, 17+11+6+1, 17+11+7+1, 17+11+8+1, 17+12+1, 17+12+2+1, 17+12+3+1 17+12+3+2+1, 17+12+4+1, 17+12+5+1, 17+12+6+1, 17+12+7+1, 17+12+8+1 17+12+9+1, 17+12+9+2+1, 17+12+9+7+1, 17+12+10+1, 17+12+10+2+1, 17+12+10+3+1 17+12+10+3+2+1, 17+12+10+4+1, 17+12+10+5+1, 17+12+10+6+1, 17+12+10+7+1 17+12+10+8+1, 17+12+11+1, 17+12+11+2+1, 17+12+11+3+1, 17+12+11+3+2+1 17+12+11+4+1, 17+12+11+5+1, 17+12+11+6+1, 17+12+11+7+1, 17+12+11+8+1 17+13+1, 17+13+2+1, 17+13+3+1, 17+13+3+2+1, 17+13+4+1, 17+13+5+1, 17+13+6+1 17+13+7+1, 17+13+8+1, 17+13+9+1, 17+13+9+2+1, 17+13+9+7+1, 17+13+10+1 17+13+10+2+1, 17+13+10+3+1, 17+13+10+3+2+1, 17+13+10+4+1, 17+13+10+5+1 17+13+10+6+1, 17+13+10+7+1, 17+13+10+8+1, 17+13+11+1, 17+13+11+2+1 17+13+11+3+1, 17+13+11+3+2+1, 17+13+11+4+1, 17+13+11+5+1, 17+13+11+6+1 17+13+11+7+1, 17+13+11+8+1, 18+1, 18+4+1, 18+9+1, 18+9+2+1, 18+9+7+1, 18+10+1 18+10+2+1, 18+10+3+1, 18+10+3+2+1, 18+10+4+1, 18+10+5+1, 18+10+6+1 18+10+7+1, 18+10+8+1, 18+11+1, 18+11+2+1, 18+11+3+1, 18+11+3+2+1, 18+11+4+1 18+11+5+1, 18+11+6+1, 18+11+7+1, 18+11+8+1, 18+12+1, 18+12+2+1, 18+12+3+1 18+12+3+2+1, 18+12+4+1, 18+12+5+1, 18+12+6+1, 18+12+7+1, 18+12+8+1 18+12+9+1, 18+12+9+2+1, 18+12+9+7+1, 18+12+10+1, 18+12+10+2+1, 18+12+10+3+1 18+12+10+3+2+1, 18+12+10+4+1, 18+12+10+5+1, 18+12+10+6+1, 18+12+10+7+1 18+12+10+8+1, 18+12+11+1, 18+12+11+2+1, 18+12+11+3+1, 18+12+11+3+2+1 18+12+11+4+1, 18+12+11+5+1, 18+12+11+6+1, 18+12+11+7+1, 18+12+11+8+1 18+13+1, 18+13+2+1, 18+13+3+1, 18+13+3+2+1, 18+13+4+1, 18+13+5+1, 18+13+6+1 18+13+7+1, 18+13+8+1, 18+13+9+1, 18+13+9+2+1, 18+13+9+7+1, 18+13+10+1 18+13+10+2+1, 18+13+10+3+1, 18+13+10+3+2+1, 18+13+10+4+1, 18+13+10+5+1 18+13+10+6+1, 18+13+10+7+1, 18+13+10+8+1, 18+13+11+1, 18+13+11+2+1 18+13+11+3+1, 18+13+11+3+2+1, 18+13+11+4+1, 18+13+11+5+1, 18+13+11+6+1 18+13+11+7+1, 18+13+11+8+1, 18+16+1, 18+16+2+1, 18+16+3+1, 18+16+3+2+1 18+16+4+1, 18+16+5+1, 18+16+9+1, 18+16+9+2+1, 18+16+9+7+1, 18+16+11+1 18+16+11+2+1, 18+16+11+3+1, 18+16+11+3+2+1, 18+16+11+4+1, 18+16+11+5+1 18+16+11+6+1, 18+16+11+7+1, 18+16+11+8+1, 18+16+12+1, 18+16+12+2+1 18+16+12+3+1, 18+16+12+3+2+1, 18+16+12+4+1, 18+16+12+5+1, 18+16+12+6+1 18+16+12+7+1, 18+16+12+8+1, 18+16+12+9+1, 18+16+12+9+2+1, 18+16+12+9+7+1 18+16+12+10+1, 18+16+12+10+2+1, 18+16+12+10+3+1, 18+16+12+10+3+2+1 18+16+12+10+4+1, 18+16+12+10+5+1, 18+16+12+10+6+1, 18+16+12+10+7+1 18+16+12+10+8+1, 18+16+12+11+1, 18+16+12+11+2+1, 18+16+12+11+3+1 18+16+12+11+3+2+1, 18+16+12+11+4+1, 18+16+12+11+5+1, 18+16+12+11+6+1 18+16+12+11+7+1, 18+16+12+11+8+1, 18+16+13+1, 18+16+13+2+1, 18+16+13+3+1 18+16+13+3+2+1, 18+16+13+4+1, 18+16+13+5+1, 18+16+13+6+1, 18+16+13+7+1 18+16+13+8+1, 18+16+13+9+1, 18+16+13+9+2+1, 18+16+13+9+7+1, 18+16+13+10+1 18+16+13+10+2+1, 18+16+13+10+3+1, 18+16+13+10+3+2+1, 18+16+13+10+4+1 18+16+13+10+5+1, 18+16+13+10+6+1, 18+16+13+10+7+1, 18+16+13+10+8+1 18+16+13+11+1, 18+16+13+11+2+1, 18+16+13+11+3+1, 18+16+13+11+3+2+1 18+16+13+11+4+1, 18+16+13+11+5+1, 18+16+13+11+6+1, 18+16+13+11+7+1 18+16+13+11+8+1, 18+17+1, 18+17+2+1, 18+17+3+1, 18+17+3+2+1, 18+17+4+1 18+17+5+1, 18+17+6+1, 18+17+9+1, 18+17+9+2+1, 18+17+9+7+1, 18+17+10+1 18+17+10+2+1, 18+17+10+3+1, 18+17+10+3+2+1, 18+17+10+4+1, 18+17+10+5+1 18+17+10+6+1, 18+17+10+7+1, 18+17+10+8+1, 18+17+11+1, 18+17+11+2+1 18+17+11+3+1, 18+17+11+3+2+1, 18+17+11+4+1, 18+17+11+5+1, 18+17+11+6+1 18+17+11+7+1, 18+17+11+8+1, 18+17+12+1, 18+17+12+2+1, 18+17+12+3+1 18+17+12+3+2+1, 18+17+12+4+1, 18+17+12+5+1, 18+17+12+6+1, 18+17+12+7+1 18+17+12+8+1, 18+17+12+9+1, 18+17+12+9+2+1, 18+17+12+9+7+1, 18+17+12+10+1 18+17+12+10+2+1, 18+17+12+10+3+1, 18+17+12+10+3+2+1, 18+17+12+10+4+1 18+17+12+10+5+1, 18+17+12+10+6+1, 18+17+12+10+7+1, 18+17+12+10+8+1 18+17+12+11+1, 18+17+12+11+2+1, 18+17+12+11+3+1, 18+17+12+11+3+2+1 18+17+12+11+4+1, 18+17+12+11+5+1, 18+17+12+11+6+1, 18+17+12+11+7+1 18+17+12+11+8+1, 18+17+13+1, 18+17+13+2+1, 18+17+13+3+1, 18+17+13+3+2+1 18+17+13+4+1, 18+17+13+5+1, 18+17+13+6+1, 18+17+13+7+1, 18+17+13+8+1 18+17+13+9+1, 18+17+13+9+2+1, 18+17+13+9+7+1, 18+17+13+10+1 18+17+13+10+2+1, 18+17+13+10+3+1, 18+17+13+10+3+2+1, 18+17+13+10+4+1 18+17+13+10+5+1, 18+17+13+10+6+1, 18+17+13+10+7+1, 18+17+13+10+8+1 18+17+13+11+1, 18+17+13+11+2+1, 18+17+13+11+3+1, 18+17+13+11+3+2+1 18+17+13+11+4+1, 18+17+13+11+5+1, 18+17+13+11+6+1, 18+17+13+11+7+1 18+17+13+11+8+1, 19+1, 19+2+1, 19+3+1, 19+3+2+1, 19+4+1, 19+5+1, 19+6+1 19+7+1, 19+8+1, 19+9+1, 19+9+2+1, 19+9+7+1, 19+12+1, 19+12+2+1, 19+12+3+1 19+12+3+2+1, 19+12+4+1, 19+12+5+1, 19+12+6+1, 19+12+7+1, 19+12+8+1 19+12+9+1, 19+12+9+2+1, 19+12+9+7+1, 19+12+10+1, 19+12+10+2+1, 19+12+10+3+1 19+12+10+3+2+1, 19+12+10+4+1, 19+12+10+5+1, 19+12+10+6+1, 19+12+10+7+1 19+12+10+8+1, 19+12+11+1, 19+12+11+2+1, 19+12+11+3+1, 19+12+11+3+2+1 19+12+11+4+1, 19+12+11+5+1, 19+12+11+6+1, 19+12+11+7+1, 19+12+11+8+1 19+13+1, 19+13+2+1, 19+13+3+1, 19+13+3+2+1, 19+13+4+1, 19+13+5+1, 19+13+6+1 19+13+7+1, 19+13+8+1, 19+13+9+1, 19+13+9+2+1, 19+13+9+7+1, 19+13+10+1 19+13+10+2+1, 19+13+10+3+1, 19+13+10+3+2+1, 19+13+10+4+1, 19+13+10+5+1 19+13+10+6+1, 19+13+10+7+1, 19+13+10+8+1, 19+13+11+1, 19+13+11+2+1 19+13+11+3+1, 19+13+11+3+2+1, 19+13+11+4+1, 19+13+11+5+1, 19+13+11+6+1 19+13+11+7+1, 19+13+11+8+1, 20+1, 20+2+1, 20+3+1, 20+3+2+1, 20+4+1, 20+5+1 20+6+1, 20+7+1, 20+8+1, 20+9+1, 20+9+2+1, 20+9+7+1, 20+12+1, 20+12+2+1 20+12+3+1, 20+12+3+2+1, 20+12+4+1, 20+12+5+1, 20+12+6+1, 20+12+7+1 20+12+8+1, 20+12+9+1, 20+12+9+2+1, 20+12+9+7+1, 20+12+10+1, 20+12+10+2+1 20+12+10+3+1, 20+12+10+3+2+1, 20+12+10+4+1, 20+12+10+5+1, 20+12+10+6+1 20+12+10+7+1, 20+12+10+8+1, 20+12+11+1, 20+12+11+2+1, 20+12+11+3+1 20+12+11+3+2+1, 20+12+11+4+1, 20+12+11+5+1, 20+12+11+6+1, 20+12+11+7+1 20+12+11+8+1, 20+13+1, 20+13+2+1, 20+13+3+1, 20+13+3+2+1, 20+13+4+1 20+13+5+1, 20+13+6+1, 20+13+7+1, 20+13+8+1, 20+13+9+1, 20+13+9+2+1 20+13+9+7+1, 20+13+10+1, 20+13+10+2+1, 20+13+10+3+1, 20+13+10+3+2+1 20+13+10+4+1, 20+13+10+5+1, 20+13+10+6+1, 20+13+10+7+1, 20+13+10+8+1 20+13+11+1, 20+13+11+2+1, 20+13+11+3+1, 20+13+11+3+2+1, 20+13+11+4+1 20+13+11+5+1, 20+13+11+6+1, 20+13+11+7+1, 20+13+11+8+1, 21+1, 21+7+1 21+19+1, 21+19+2+1, 21+19+3+1, 21+19+3+2+1, 21+19+4+1, 21+19+5+1, 21+19+6+1 21+19+7+1, 21+19+8+1, 21+19+9+1, 21+19+9+2+1, 21+19+9+7+1, 21+19+12+1 21+19+12+2+1, 21+19+12+3+1, 21+19+12+3+2+1, 21+19+12+4+1, 21+19+12+5+1 21+19+12+6+1, 21+19+12+7+1, 21+19+12+8+1, 21+19+12+9+1, 21+19+12+9+2+1 21+19+12+9+7+1, 21+19+12+10+1, 21+19+12+10+2+1, 21+19+12+10+3+1 21+19+12+10+3+2+1, 21+19+12+10+4+1, 21+19+12+10+5+1, 21+19+12+10+6+1 21+19+12+10+7+1, 21+19+12+10+8+1, 21+19+12+11+1, 21+19+12+11+2+1 21+19+12+11+3+1, 21+19+12+11+3+2+1, 21+19+12+11+4+1, 21+19+12+11+5+1 21+19+12+11+6+1, 21+19+12+11+7+1, 21+19+12+11+8+1, 21+19+13+1 21+19+13+2+1, 21+19+13+3+1, 21+19+13+3+2+1, 21+19+13+4+1, 21+19+13+5+1 21+19+13+6+1, 21+19+13+7+1, 21+19+13+8+1, 21+19+13+9+1, 21+19+13+9+2+1 21+19+13+9+7+1, 21+19+13+10+1, 21+19+13+10+2+1, 21+19+13+10+3+1 21+19+13+10+3+2+1, 21+19+13+10+4+1, 21+19+13+10+5+1, 21+19+13+10+6+1 21+19+13+10+7+1, 21+19+13+10+8+1, 21+19+13+11+1, 21+19+13+11+2+1 21+19+13+11+3+1, 21+19+13+11+3+2+1, 21+19+13+11+4+1, 21+19+13+11+5+1, 21+19+13+11+6+1, 21+19+13+11+7+1, 21+19+13+11+8+1, 21+20+1, 21+20+2+1, 21+20+3+1, 21+20+3+2+1, 21+20+4+1, 21+20+5+1, 21+20+6+1, 21+20+7+1, 21+20+8+1, 21+20+9+1, 21+20+9+2+1, 21+20+9+7+1, 21+20+12+1, 21+20+12+2+1, 21+20+12+3+1, 21+20+12+3+2+1, 21+20+12+4+1, 21+20+12+5+1, 21+20+12+6+1, 21+20+12+7+1, 21+20+12+8+1, 21+20+12+9+1, 21+20+12+9+2+1, 21+20+12+9+7+1, 21+20+12+10+1, 21+20+12+10+2+1, 21+20+12+10+3+1, 21+20+12+10+3+2+1, 21+20+12+10+4+1, 21+20+12+10+5+1, 21+20+12+10+6+1, 21+20+12+10+7+1, 21+20+12+10+8+1, 21+20+12+11+1, 21+20+12+11+2+1, 21+20+12+11+3+1, 21+20+12+11+3+2+1, 21+20+12+11+4+1, 21+20+12+11+5+1, 21+20+12+11+6+1, 21+20+12+11+7+1, 21+20+12+11+8+1, 21+20+13+1, 21+20+13+2+1, 21+20+13+3+1, 21+20+13+3+2+1, 21+20+13+4+1, 21+20+13+5+1, 21+20+13+6+1, 21+20+13+7+1, 21+20+13+8+1, 21+20+13+9+1, 21+20+13+9+2+1, 21+20+13+9+7+1, 21+20+13+10+1, 21+20+13+10+2+1, 21+20+13+10+3+1, 21+20+13+10+3+2+1, 21+20+13+10+4+1, 21+20+13+10+5+1, 21+20+13+10+6+1, 21+20+13+10+7+1, 21+20+13+10+8+1, 21+20+13+11+1, 21+20+13+11+2+1, 21+20+13+11+3+1, 21+20+13+11+3+2+1, 21+20+13+11+4+1, 21+20+13+11+5+1, 21+20+13+11+6+1, 21+20+13+11+7+1, 21+20+13+11+8+1, and 22+1; wherein the list above is not to be construed as limiting with respect to further embodiments which are also possible based on the dependencies of the embodiments 1) to 22) as disclosed hereinabove and which are also intended. In the list above the numbers refer to the embodiments according to their numbering provided hereinabove whereas "+" indicates the dependency from another embodiment. The different individualized embodiments are separated by commas. In other words, "3+2+1" for example refers to embodiment 3) depending on embodiment 2) depending on embodiment 1), i.e. embodiment "3+2+1" corresponds to embodiment 1) further limited by the features of embodiments 2) and 3).
The present invention also includes isotopically labelled, especially 2H (deuterium) labelled compounds of formula (I), which compounds are identical to the compounds of formula (I) except that one or more atoms have each been replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Isotopically labelled, especially 2H (deuterium) labelled compounds of formula (I) and salts thereof are within the scope of the present invention. Substitution of hydrogen with the heavier isotope 2H (deuterium) may lead to greater metabolic stability, resulting e.g. in increased in-vivo half-life or reduced dosage requirements, or may lead to reduced inhibition of cytochrome P450 enzymes, resulting e.g. in an improved safety profile. In one embodiment of the invention, the compounds of formula (I) are not isotopically labelled, or they are labelled only with one or more deuterium atoms. In a sub-embodiment, the compounds of formula (I) are not isotopically labelled at all. Isotopically labelled compounds of formula (I) may be prepared in analogy to the methods described hereinafter, but using the appropriate isotopic variation of suitable reagents or starting materials.
The term "pharmaceutically acceptable salts" refers to non-toxic, inorganic or organic acid and/or base addition salts, Lit. e.g. "Salt selection for basic drugs", Int. J. Pharm. (1986), 33, 201 -217.
Where the plural form is used for compounds, salts, pharmaceutical compositions, diseases and the like, this is intended to mean also a single compound, salt, or the like.
The compounds of formula (I) according to any one of embodiments 1 ) to 22), or pharmaceutically acceptable salts thereof, are suitable for use as medicaments. In particular, compounds of formula (I) modulate the P2X7 receptor, i.e. they act as P2X7 receptor antagonists, and are useful for the prevention or treatment of diseases which are associated with the activation of the P2X7 receptor such as pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; other auto-immune and allergic disorders; and other disorders with an inflammatory or immunological component.
In particular, the compounds of formula (I) according to any one of embodiments 1 ) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of pain. Pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain; lower back and neck pain; inflammatory pain; neuropathic pain; visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain.
Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV-related neuropathy, post-herpetic neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia).
Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis.
Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of neurodegenerative and neuroinflammatory diseases. Neurodegenerative and neuro- inflammatory diseases include Alzheimer's disease and other dementing disorders including, but not limited to, Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); Amyotrophic lateral sclerosis, amyloidosis; multiple sclerosis and other demyelinating syndromes; cerebral atherosclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy Body dementia; and Parkinson's disease.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of bone and joint diseases. Bone and joint diseases include arthritides such as rheumatoid arthritis, osteoarthritis, gout or crystal arthropathy; intervertebral disc degeneration; temporomandibular joint degeneration; bone remodelling disease such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; scleroderma; mixed connective tissue disorder; spondyloarthropathies; periodontal disease such as periodontitis; arthritides associated with or including osteoarthritis/osteoarthrosis, both primary and secondary to, for example, congenital hip dysplasia; cervical and lumbar spondylitis; Still's disease; seronegative spondyloarthropathies including ankylosing spondylitis, psoriatic arthritis, reactive arthritis and undifferentiated spondyloarthropathy; septic arthritis and other infection-related arthopathies and bone disorders such as tuberculosis, including Potts' disease and Poncet's syndrome; acute and chronic crystal-induced synovitis including urate gout, calcium pyrophosphate deposition disease, and calcium apatite related tendon, bursal and synovial inflammation; Behcet's disease; primary and secondary Sjogren's syndrome; systemic sclerosis and limited scleroderma; systemic lupus erythematosus, mixed connective tissue disease, and undifferentiated connective tissue disease; inflammatory myopathies including dermatomyositits and polymyositis; polymalgia rheumatica; juvenile arthritis including idiopathic inflammatory arthritides of whatever joint distribution and associated syndromes, and rheumatic fever and its systemic complications; vasculitides including giant cell arteritis, Takayasu's arteritis, Churg-Strauss syndrome, polyarteritis nodosa, microscopic polyarteritis, and vasculitides associated with viral infection, hypersensitivity reactions, cryoglobulins, and paraproteins; Familial Mediterranean fever, Muckle-Wells syndrome, and Familial Hibernian Fever, Kikuchi disease; and drug-induced arthalgias, tendonitis, and myopathies including dystrophies and other inflammatory myopathies.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of obstructive diseases of the airways. Obstructive diseases of the airways include asthma, including bronchial, allergic, intrinsic, and extrinsic asthma, exercise-induced, drug- induced (including aspirin and NSAID-induced) and dust- induced asthma, both intermittent and persistent and of all severities, and other causes of airway hyper- responsiveness; chronic obstructive pulmonary disease (COPD); bronchitis, including infectious and eosinophilic bronchitis; emphysema; bronchiectasis; cystic fibrosis; sarcoidosis; farmer's lung and related diseases; hypersensitivity pneumonitis; lung fibrosis, including cryptogenic fibrosing alveolitis, idiopathic interstitial pneumonias, fibrosis complicating anti-neoplastic therapy and chronic infection, including tuberculosis and aspergillosis and other fungal infections; complications of lung transplantation; vasculitic and thrombotic disorders of the lung vasculature, and pulmonary hypertension; antitussive activity including treatment of chronic cough associated with inflammatory and secretory conditions of the airways, and iatrogenic cough; acute and chronic rhinitis including rhinitis medicamentosa, and vasomotor rhinitis; perennial and seasonal allergic rhinitis including rhinitis nervosa (hay fever); nasal polyposis; and acute viral infection including the common cold, and infection due to respiratory syncytial virus, influenza, coronavirus (including SARS) and adenovirus.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of cardiovascular diseases. Cardiovascular diseases include atherosclerosis, affecting the coronary and peripheral circulation; pericarditis; myocarditis; inflammatory and auto- immune cardiomyopathies including myocardial sarcoid; ischaemic reperfusion injuries; endocarditis, valvulitis, and aortitis including infective (for example syphilitic); vasculitides; and disorders of the proximal and peripheral veins including phlebitis and thrombosis, including deep vein thrombosis and complications of varicose veins.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of eye diseases. Eye diseases include blepharitis; conjunctivitis, including perennial and vernal allergic conjunctivitis; iritis; anterior and posterior uveitis; choroiditis; autoimmune, degenerative or inflammatory disorders affecting the retina; ophthalmitis including sympathetic ophthalmitis; sarcoidosis; and infections of the eyes including viral, fungal, and bacterial infections.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of skin diseases. Skin diseases include psoriasis, skin burn, atopic dermatitis, contact dermatitis or other eczematous dermatoses, and delayed-type hypersensitivity reactions; phyto- and photodermatitis; seborrhoeic dermatitis, dermatitis herpetiformis, lichen planus, lichen sclerosus et atrophica, pyoderma gangrenosum, skin sarcoid, discoid lupus erythematosus, pemphigus, pemphigoid, epidermolysis bullosa, urticaria, angioedema, vasculitides, toxic erythemas, cutaneous eosinophilias, alopecia areata, male-pattern baldness, Sweet's syndrome, Weber-Christian syndrome, erythema multiforme; cellulitis, both infective and non-infective; panniculitis; cutaneous lymphomas, non-melanoma skin cancer and other dysplastic lesions; and drug-induced disorders including fixed drug eruptions.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of abdominal and gastrointestinal tract diseases. Abdominal and gastrointestinal tract diseases include hepatitis, including autoimmune, alcoholic and viral hepatitis; fibrosis and cirrhosis of the liver; cholecystitis; pancreatitis, both acute and chronic; non-inflammatory diarrhea; glossitis, gingivitis, periodontitis; oesophagitis, including reflux; eosinophilic gastro-enteritis, mastocytosis, Crohn's disease, colitis including ulcerative colitis, proctitis, pruritis ani; Coeliac disease, irritable bowel disease/syndrome, and food-related allergies which may have effects remote from the gut, for example migraine, rhinitis or eczema; allograft rejection including acute and chronic allograft rejection following, for example, transplantation of kidney, heart, liver, lung, bone marrow, skin or cornea or following blood transfusion; and chronic graft versus host disease; Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of genitourinary diseases. Genitourinary diseases include nephritis including interstitial and glomerulonephritis; nephrotic syndrome; cystitis including acute and chronic (interstitial) cystitis and Hunner's ulcer; acute and chronic urethritis, hemorrhagic cystitis, prostatitis, epididymitis, oophoritis and salpingitis; vulvovaginitis; Peyronie's disease; and erectile dysfunction, both male and female.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of cancer. The treatment of cancer includes the treatment of brain tumors, prostate, lung, breast, ovarian, bowel and colon, stomach, pancreatic, skin and bone marrow (including leukaemias) and lymphoproliferative systems, such as non-Hodgkin's and Hodgkin's lymphoma; including the prevention and treatment of metastatic disease and tumor recurrences, and paraneoplastic syndromes.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of other auto-immune and allergic disorders. Other auto-immune and allergic disorders include Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-lgE syndrome, and antiphospholipid syndrome.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of other disorders with an inflammatory or immunological component. Other disorders with an inflammatory or immunological component include acquired immune deficiency syndrome (AIDS), leprosy, Sezary syndrome, and paraneoplastic syndromes.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of mood, depression, sleep and anxiety disorders.
Further, the compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of injury induced trauma and spinal cord injury.
Especially, compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of diseases selected from one, several or all of the following groups of diseases and disorders:
1) Pain, wherein pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain; lower back and neck pain; inflammatory pain; neuropathic pain; visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain;
Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV- related neuropathy, post-herpetic neuralgia, trigeminal neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis;
Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome;
2) Neurodegenerative and neuro-inflammatory diseases such as Alzheimer's disease and other dementing disorders including, but not limited to, Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); amyloidosis; Amyotrophic lateral sclerosis, multiple sclerosis and other demyelinating syndromes; cerebral atherosclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy Body dementia; and Parkinson's disease; 3) Bone and joint diseases such as arthritides such as rheumatoid arthritis, osteoarthritis, gout or crystal arthropathy; intervertebral disc degeneration; temporomandibular joint degeneration; bone remodelling disease such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; scleroderma; mixed connective tissue disorder; spondyloarthropathies; periodontal disease such as periodontitis; Behcet's disease; primary and secondary Sjogren's syndrome; systemic sclerosis and limited scleroderma; systemic lupus erythematosus, mixed connective tissue disease, and undifferentiated connective tissue disease; inflammatory myopathies including dermatomyositits and polymyositis; polymalgia rheumatica; juvenile arthritis including idiopathic inflammatory arthritides of whatever joint distribution and associated syndromes, and rheumatic fever and its systemic complications; vasculitides including giant cell arteritis, Takayasu's arteritis, Churg-Strauss syndrome, polyarteritis nodosa, microscopic polyarteritis, and vasculitides associated with viral infection, hypersensitivity reactions, cryoglobulins, and paraproteins; Muckle-Wells syndrome, and Familial Hibernian
Fever, Kikuchi disease; and drug-induced arthalgias, tendonitis, and myopathies;
4) Obstructive diseases of the airways such as chronic obstructive pulmonary disease (COPD); cystic fibrosis; lung emphysema; sarcoidosis; farmer's lung and related diseases; lung fibrosis, including fibrosis complicating tuberculosis; and chronic cough associated with inflammatory and secretory conditions of the airways;
5) Cardiovascular diseases such as inflammatory and auto-immune cardiomyopathies;
6) Eye diseases such as degenerative or inflammatory disorders affecting the retina; 7) Skin diseases such as psoriasis, skin burn, atopic dermatitis, contact dermatitis or other eczematous dermatoses; and discoid lupus erythematosus;
8) Abdominal and gastrointestinal tract diseases such as fibrosis and cirrhosis of the liver; cholecystitis; pancreatitis, both acute and chronic; Crohn's disease; colitis including ulcerative colitis; and irritable bowel disease/syndrome;
9) Genitourinary diseases such as nephritis including interstitial and glomerulonephritis; nephrotic syndrome; and cystitis including acute and chronic (interstitial) cystitis; and 10) Other auto-immune and allergic disorders such as Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-lgE syndrome, and antiphospholipid syndrome.
Most preferably, compounds of formula (I) according to any one of embodiments 1) to 22), or pharmaceutically acceptable salts thereof, are suitable for the prevention or treatment of diseases selected from one, several or all of the following groups of diseases and disorders:
1) Pain, wherein pain refers to acute pain; chronic pain; pain associated with sprains and strains; chronic articular pain; pain associated with rheumatic fever; musculoskeletal pain (preferred); lower back and neck pain; inflammatory pain; neuropathic pain (preferred); visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine, toothache and dysmenorrhea; headache including tension headache and cluster headaches; pain associated with myocardial ischemia; pain associated with functional bowel disorders; sympathetically maintained pain; myositis; pain associated with cancer chemotherapy; and post operative pain;
Neuropathic pain includes especially diabetic neuropathy, sciatica, non-specific lower back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV- related neuropathy, post-herpetic neuralgia, trigeminal neuralgia, and pain resulting from physical trauma, amputation, phantom limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, neuropathic pain conditions include pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation (hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia);
Chronic articular pain conditions include especially rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis;
Pain associated with functional bowel disorders includes especially non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome;
2) Rheumatoid arthritis and osteoarthritis; 3) Chronic obstructive pulmonary disease (COPD); and
4) Crohn's disease.
The invention also relates to the use of a compound of formula (I) according to any one of embodiments 1) to 22) for the preparation of pharmaceutical compositions for the treatment and/or prophylaxis of the above-mentioned diseases.
The present invention also relates to pharmaceutically acceptable salts and to pharmaceutical compositions and formulations of compounds of formula (I) according to any one of embodiments 1 ) to 22).
A pharmaceutical composition according to the present invention contains at least one compound of formula (I) according to any one of embodiments 1) to 22) (or a pharmaceutically acceptable salt thereof) as the active agent and optionally carriers and/or diluents and/or adjuvants.
The compounds of formula (I) according to any one of embodiments 1) to 22) and their pharmaceutically acceptable salts can be used as medicaments, e.g. in the form of pharmaceutical compositions for enteral (such as especially oral) or parenteral administration (including topical application or inhalation).
The production of the pharmaceutical compositions can be effected in a manner which will be familiar to any person skilled in the art (see for example Remington, The Science and Practice of Pharmacy, 21 st Edition (2005), Part 5, "Pharmaceutical Manufacturing" [published by Lippincott Williams & Wilkins]) by bringing the described compounds of formula (I) or their pharmaceutically acceptable salts, optionally in combination with other therapeutically valuable substances, into a galenical administration form together with suitable, non-toxic, inert, therapeutically compatible solid or liquid carrier materials and, if desired, usual pharmaceutical adjuvants.
The present invention also relates to a method for the prevention or treatment of a disease or disorder mentioned herein comprising administering to a subject a pharmaceutically active amount of a compound of formula (I) according to any one of embodiments 1) to 22), or a pharmaceutically acceptable salt thereof.
Any reference to a compound of formula (I), (lsti), (Ist2> and (lst3), in this text is to be understood as referring also to the salts (and especially the pharmaceutically acceptable salts) of such compounds, as appropriate and expedient. The preferences indicated for the compounds of formula (I) of course apply mutatis mutandis to the compounds of formula (lSn), of formula (lSt2) and of formula (lSt3> as well as to the salts and pharmaceutically acceptable salts of the compounds of formula (I), of formula (lSn), of formula (lst2) and of formula (lst3) . The same applies to these compounds as medicaments, to pharmaceutical compositions containing these compounds as active principles or to the uses of these compounds for the manufacture of a medicament for the treatment of the diseases according to this invention.
Unless used regarding temperatures, the term "about" (or alternatively "around") placed before a numerical value "X" refers in the current application to an interval extending from X minus 10% of X to X plus 10% of X, and preferably to an interval extending from X minus 5% of X to X plus 5% of X. In the particular case of temperatures, the term "about" (or alternatively "around") placed before a temperature Ύ" refers in the current application to an interval extending from the temperature Y minus 10 °C to Y plus 10 °C, and preferably to an interval extending from Y minus 5 °C to Y plus 5 °C. Besides, the term "room temperature" (RT) as used herein refers to a temperature of about 25°C.
Whenever the word "between" is used to describe a numerical range, it is to be understood that the end points of the indicated range are explicitly included in the range. For example: if a temperature range is described to be between 40 °C and 80 °C, this means that the end points 40 °C and 80 °C are included in the range; or if a variable is defined as being an integer between 1 and 4, this means that the variable is the integer 1 , 2, 3, or 4.
The compounds of Formula (I) can be manufactured by the methods given below, by the methods given in the Examples or by analogous methods. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by a person skilled in the art by routine optimisation procedures.
If not indicated otherwise, the generic groups R1 , R2, R3, R4, n and X are as defined for formula (I). Other abbreviations used are defined in the experimental section.
In some instances the generic groups R1 , R2, R3, R4, n and X might be incompatible with the assembly illustrated in the schemes below and will therefore require the use of protecting groups (PG). The use of protecting groups is well known in the art (see for example "Protective Groups in Organic Synthesis", T.W. Greene, P.G.M. Wuts, Wiley- Interscience, 1999). For the purposes of this discussion, it will be assumed that such protecting groups are as necessary in place.
Preparation of compounds of formula (I):
Compounds of formula (I) can be prepared by reaction of a carboxylic acid (II) with an amine (III) using standard amide coupling reagents such as EDC.HCI/HOBt, SiliaBond® carbodiimide/HOAt, HATU/HOAt or PyBOP and a base like DIPEA in a solvent like DCM, THF or DMF referably at temperatures between RT and 45°C (scheme 1).
Figure imgf000028_0001
II I
Scheme 1 : Synthesis of compounds of formula (I) Compounds of formula (II), if not commercially available, can be prepared following the procedures outlined in the schemes below and in the experimental part.
Compounds of formula (II), wherein X represents -CH2- can be prepared from a methyl ester (IV) like, for instance, methyl cyclohex-2-enecarboxylate (Bioorg. Med. Chem. 1999, 7, 1505-151 1) by a bromohydrin-formation/oxidation sequence using (1) NBS in a THF/H20 mixture at temperatures around RT and (2) an oxidant such as DMP in a solvent like DCM at temperatures around RT to form oc-bromoketone (V) (scheme 2). Condensation with thioformamide in a solvent such as dioxane at temperatures between 60°C and 1 10°C provide thiazoles (VII). Thioformamide (VI) can be prepared from formamide with P4S10 in a solvent such as dioxane at temperatures between 60°C and 1 10°C. Saponification of the methyl ester (VII) can be performed under standard conditions such as LiOH in a THF/MeOH/H20 mixture, preferably at temperatures between 0°C and 45°C to form compounds of formula (Ma).
Figure imgf000028_0002
VI
Scheme 2: Synthesis of compounds of formula (lla)
Alternatively, compounds of formula (II), wherein X represents -CH2- can be prepared from the corresponding cycloalk-2-enone (VIM) by (1 ) addition of TMS-CN, catalyzed by Ni(cod)2 and Gd(OTf)3 in the presence of norbornadiene in a solvent such as THF at temperatures around RT and (2) bromination of the resulting silylenolether using an electrophilic bromine source such as NBS in a THF/H20 mixture at temperatures around 0°C to form a-bromoketone (IX) (scheme 3). The aminothiazoles (X) are prepared by condensation of the corresponding -bromoketone (IX) with thiourea in a solvent such as dioxane at temperatures between 60°C and 100°C. The aminothiazoles of formula (X) can be diazotized utilizing tBu-nitrite in THF at temperatures between 60°C and 80°C to provide the corresponding thiazoles. Hydrolysis of the nitrile group using aq. cone. HCI at temperatures between 60°C and 100°C form carboxylic acids (lla).
Figure imgf000029_0001
VIII IX lla
Scheme 3: Synthesis of compounds of formula (lla) Compounds of formula (II), wherein X represents -O- and n represents 2 or 3, can be prepared by (1) addition of 3-(tert-butyldimethylsilyloxy)propanal or 4-(tert- butyldimethylsilyloxy)butanal, respectively to 5-lithiated 2,4-dichlorothiazole (obtained from 2,4-dichlorothiazole and a strong non-nucleophilic base like LDA in a solvent like THF at temperatures between -20°C and RT) in a solvent such as THF at -78°C and (2) protection of the resulting hydroxy group using DHP and a catalyst like PPTS in a solvent such as DCM at temperatures between RT and reflux to form intermediate (XII) (scheme 4). Cyclization precursor (XIII) can be prepared by (1) dechlorination using an alkyllithium species such as nBuLi in a solvent like THF at temperatures between -100°C and -40°C and (2) treatment with a fluoride source such as TBAF in a solvent like THF at temperatures between 0°C and RT. Cyclization to compounds of formula (XIV) can be performed with a base such as NaH or KOtBu in a solvent like DMF or tBuOH, respectively, or through a palladium mediated procedure using Pd(OAc)2, rac-2-(di-tert- butylphosphino)-1 ,1 '-binaphthyl and a base like Cs2C03 in a solvent such as toluene at temperatures between 80°C and 1 10°C. Compounds of formula (Mb) are obtained by (1 ) removal of the THP protecting group under acidic conditions using, for instance, catalytic amounts of PTSA in a solvent mixture like THF/H20 at temperatures around RT, (2) a Mitsunobu reaction, and (3) hydrolysis of the nitrile using aq. cone. HCI at temperatures between 60°C and 100°C. The Mitsunobu reaction can be carried out with acetone cyanohydrin, (nBu)3P and 1 ,1 '-(azodicarbonyl)dipiperidine in a solvent like THF at temperatures between 0°C and RT.
Figure imgf000030_0001
Figure imgf000030_0002
Mb XIV
Scheme 4: Synthesis of compounds of formula (Mb) wherein n represents 2 or 3
Compound of formula (II), wherein X represents -O- and n represents 1 can be prepared by reaction of 4-bromothiazole (XV) with the sodium salt of DL-1 ,2-isoproylideneglycerol at temperatures between 120°C and 150°C and subsequent bromination with an electrophilic bromine source such as NBS in a solvent like MeCN at temperatures between 0°C and RT (scheme 5). The resulting 5-bromothiazole (XVI) is sequentially treated with (1 ) catalytic amounts of an acid such as PPTS in a solvent like MeOH at temperatures around reflux, (2) trimethyl orthoformate in a solvent like DCM at temperatures around RT, (3) AcBr in a solvent like DCM at temperatures around RT, and (4) a carbonate base such as K2C03 in a solvent like MeOH at temperatures around RT to form oxirane (XVII). At temperatures between -78°C and RT, a soln. of oxirane (XVII) in an ether solvent like THF is consecutively treated with an alkyl lithium reagent like nBuLi, a trialkylsilyl chloride like TIPSCI, and again with an alkyl lithium reagent like nBuLi to form dihydrofurothiazole (XVIII). A two-step oxidation procedure utilizing (1) DMP in a solvent like DCM at temperatures between 0°C and RT and (2) sodium chlorite in a buffered aq. solution with tBuOH as co-solvent and 2-methyl-2-butene as scavenger at temperatures around 0°C provides carboxylic acid (XIX). Removal of the silyl protecting group to form a compound of formula (lie) can be performed with a fluoride source such as TBAF in a solvent like THF at temperatures between 0°C and RT.
Figure imgf000031_0001
Figure imgf000031_0002
llc XIX XVIII
Scheme 5: Synthesis of compound of formula (lie)
If not commercially available, amines of formula III can be prepared according to procedures described in WO2009/132000, outlined in the schemes below and in the experimental part.
Amino nitriles of formula (XX), wherein NR5R6 represents heterocyclyl which is unsubstituted or mono- or di-substituted with fluoro and R4 represents heteroaryl (scheme 6) can be prepared by Strecker reaction between aldehydes of formula (XXI) and amines of formula R5R6NH in the presence of a suitable cyanating reagent such as TMS-CN and a suitable Lewis acid catalyst such as Znl2 in a suitable mixture of solvents such as Et20/MeOH at temperatures between 0°C and 80°C. The resulting nitriles of formula (XX) can be transformed to diamines of formula (Ilia) (scheme 6) by reduction under hydrogenation conditions in the presence of a suitable catalyst such as Raney nickel and a suitable solvent such as methanolic ammonia at temperatures around RT.
Figure imgf000031_0003
XX Ilia
Scheme 6: Synthesis of amines of formula (Ilia), wherein R4 represents heteroaryl and wherein NR5R6 represents heterocyclyl
If not commercially available, nitriles of formula (XXII), wherein R4 represents heteroaryl (scheme 7) can be prepared by a two step procedure: (i) heteroarylation of methylcyanoacetate by treatment with a bromoheteroarene of formula Br-R4 in the presence of a suitable base such as KOtBu, a suitable palladium catalyst such as Pd(OAc)2, a suitable ligand such as dppf in a suitable solvent such as dioxane as described in J. Org. Chem. 2008, 73, 1643-1645 and (ii) subsequent decarboxylation of the isolated methyl heteroarylcyanoacetate intermediates by treatment with a suitable salt such as LiCI in a suitable mixture of solvents such as DMSO/water at temperatures around 140°C.
Alternatively, if not commercially available, nitriles of formula (XXII), wherein R4 represents heteroaryl can be prepared according to J. Am. Chem. Soc. 201 1 , 133, 6948-6951 .
Cyano alkenes of formula (XXIV) (scheme 7) wherein R5 and R6 form, together with the carbon atom to which they are attached, a heterocyclyl group which is unsubstituted or mono- or di-substituted with fluoro can be prepared by Knoevenagel condensation of heteroaryl-acetonitriles of formula (XXII) with ketones of formula R5COR6 by treatment with a suitable base such as KOH or NaOMe in a suitable solvent such as MeOH at temperatures between 0°C and 60°C.
The respective amines of formula (lllb) (scheme 7) can be prepared by reduction of cyano alkenes of formula (XXIV) using a two step procedure: (i) hydrogenation in the presence of a suitable catalyst such as Pd/C followed by (ii) hydrogenation in the presence of a suitable catalyst such as Raney nickel, both steps being carried out in a suitable solvent such as methanolic ammonia at temperatures around RT.
Alternatively, amines of formula (lllb) can be prepared by reduction of cyano alkenes of formula (XXIV) in the presence of a suitable reducing reagent such as BH3 THF complex in a suitable solvent such as THF at temperatures around 60°C.
Figure imgf000032_0001
XXIV lllb
Scheme 7: Synthesis of amines of formula (lllb), wherein R represents heteroaryl and wherein R5 and R6, together with the carbon atom to which they are attached, represent heterocyclyl
If not commercially available, heteroaryl-acetonitriles of formula (XXII), wherein R4 represents heteroaryl (scheme 8) can be prepared from bromoheteroarene of formula Br- R4 by a two step procedure as described above. Nitriles of formula (XXV) (scheme 8) can be prepared by dialkylation of heteroaryl- acetonitriles of formula (XXII) with dihaloalkanes such as Br-(CH2)m-CR7R8-(CH2)2-Br, wherein m represents 1 , 2 or 3 and R7 and R8 represent hydrogen or fluoro, in the presence of a base such as NaH or tBuOK in a suitable organic solvent such as THF or DMSO preferably at temperatures between 0°C and RT.
Amines of formula (III c) (scheme 8) can be prepared by reduction of nitriles of formula (XXV) for instance under hydrogenation conditions in the presence of a suitable catalyst such as Raney nickel and a suitable solvent such as methanolic ammonia at temperatures around RT or with a suitable reducing reagent such as BH3 THF complex in a suitable solvent such as THF at temperatures around 70°C.
Amines of formula (lllc), wherein m represents 2 and R7 and R8 represent fluoro (scheme 8) can be prepared for instance following a 4-step sequence: (i) tandem double Michael addition-Dieckmann condensation reaction of acetonitrile derivatives of formula (XXII) with methyl acrylate according to J. Org. Chem., 2007, 72, 7455-7458 (ii) Krapcho decarboxylation of intermediates of formula (XXVI) following conditions as those already described above for the synthesis of compounds of formula (XXII) (iii) difluorination of ketone intermediates of formula (XXVII) using DAST in a suitable solvent such as DCM at temperatures between -78°C and RT and (iv) reduction of nitriles of formula (XXVIII) following conditions such as those already described for the synthesis of amines of formula (lllc) from (XXV).
Figure imgf000033_0001
Scheme 8: Synthesis of amines of formula (lllc), wherein R4 represents heteroaryl, wherein R7 and R8 represent hydrogen or fluoro and wherein m represents 1 , 2 or 3
If not commercially available, amines of formula (XXX), wherein R9 and R10 represent hydrogen and m represents 1 , 2 or 3 (scheme 9) can be prepared for instance by alkylation of N-(diphenylmethylene)glycine tert-butyl ester with cycloalkyi bromide or iodide of formula (XXIX) (X represents bromo or iodo) according to Angew. Chem. Int. Ed., 2005, 44, 1549-1551 . Subsequent reduction of resulting esters of formula (XXX) using for instance lithium aluminum hydride in a suitable solvent such as THF at temperatures between 0°C and RT gives aminoalcohols of formula (llld) wherein R7 and R8 represent hydrogen.
If not commercially available, amines of formula (XXX), wherein R9 represents hydroxy, R10 represents hydrogen and m represents 1 , 2 or 3 or R9 and R10 form an ethylenedioxy group and m represents 1 , 2 or 3 (scheme 9) can be prepared as previously described for the synthesis of amines of formula (XXX) wherein R9 and R10 represent hydrogen.
If not commercially available as methyl ester (R11 represents Me), compounds of formula (XXXI), wherein R11 represents tBu and R12 represents Boc (or Z respectively) (scheme 9) can be prepared by treatment of amines of formula (XXX) wherein R9 represents hydroxy and R10 represents hydrogen with Boc-anhydride (or Z-CI respectively) in the presence of a base such as Et3N or NaOH in a suitable solvent such as DCM or dioxane/water at temperatures between 0°C and RT. Oxidation of resulting compounds using for instance DMP in a suitable solvent such as DCM at temperatures around RT gives ketones of formula (XXXII), wherein R11 represents tBu or Me and R12 represents Boc or Z.
Alternatively, ketones of formula (XXXII), wherein R11 represents tBu or Me and R12 represents Z (scheme 9) can be prepared by a two step procedure: (i) Z-protection of amines of formula (XXX), wherein R9 and R10 form an ethylenedioxy group using conditions as previously described for the synthesis of compounds of formula (XXXI) and (ii) cleavage of the ketal protecting group using acidic conditions such as aq. HCI and a suitable organic solvent such as MeCN or THF at temperatures around RT.
If not commercially available, compounds of formula (XXXIII), wherein R11 represents tBu or Me and R12 represents Boc or Z (scheme 9) can be prepared by fluorination of ketones of formula (XXXII) wherein R11 represents tBu or Me and R12 represents Boc or Z using a fluorinating reagent such as DAST or bis(2-methoxyethyl)aminosulfur trifluoride in the presence of a suitable solvent such as THF or DCM at temperatures between 0°C and RT.
Compounds of formula (XXXIV), wherein R12 represents Boc or Z (scheme 9) can be prepared by reduction of esters of formula (XXXIII) wherein R11 represents tBu or Me and R12 represents Boc or Z following conditions such as those already described for the reduction of esters of formula (XXX) wherein R9 and R10 represent hydrogen.
Amines of formula (llld), wherein R7 and R8 represent fluoro and m represents 1 , 2 or 3 (scheme 9) can be prepared by Boc cleavage (or Z cleavage respectively) from compounds of formula (XXXIV) wherein R12 represents Boc (or Z respectively) using a suitable acid such as HCI or TFA in the presence of a suitable solvent such as dioxane, EtOAc or DCM (or under hydrogenation conditions in the presence of a suitable catalyst such as palladium on charcoal and a suitable solvent such as MeOH or dioxane respectively) at temperatures around RT.
Amines of formula (Mid), wherein R7 represents fluoro, R8 represents hydrogen and m represents 1 , 2 or 3 can be prepared by fluorination of compounds of formula (XXXI), wherein R11 represents tBu or Me and R12 represents Boc or Z with for instance DAST in a solvent like DCM at temperatures between -78°C and RT, followed by (1) reduction of the ester following conditions such as those already described for the reduction of esters of formula (XXX), wherein R9 and R10 represent hydrogen and (2) removal of Boc (or Z, respectively) following conditions such as those already described for compounds of formula (XXXIV).
Figure imgf000035_0001
Scheme 9: Synthesis of amines of formula (Mid), wherein R7 and R8 represent hydrogen fluoro and wherein m represents 1 , 2 or 3.
Experimental Part
Abbreviations (as used herein and in the description
Ac acetyl
anh. anhydrous
aq. aqueous Boc tert-butoxycarbonyl
nBu n-butyl
tBu tert-butyl
CC column chromatography
cod 1 ,5-cyclooctadiene
cone. concentrated
comb. combined
DAST diethylaminosulfur trifluoride
dba dibenzylideneacetone
DCM dichloromethane
DHP 3,4-dihydro-2H-pyran
DIPA diisopropylamine
DIPEA diisopropylethylamine
DMF dimethylformamide
DMP Dess-Martin periodinane
DMSO dimethyl sulfoxide
dppf 1 ,1 '-bis(diphenylphosphino)ferrocene
Et ethyl
EDC.HCI N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride h hour(s)
HATU 0-(7-azabenzotriazol-1 -yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate
Hept heptane
HOAt 1 -hydroxy-7-azabenzotriazole
HOBt 1 -hydroxybenzotriazole hydrate
HV high vacuum
LC-MS liquid chromatography - mass spectrometry
LDA lithium diisopropylamide
M molar
Me methyl
MeCN acetonitrile
min minute(s)
NBS N-bromosuccinimide
NMR nuclear magnetic resonance
org. organic PPTS pyridinium p-toluenesulfonate
PTSA p-toluenesulfonic acid
PyBOP (benzotriazol-l -yloxy)tripyrrolidinophosph
hexafluorophosphate
RT room temperature
sat. saturated
soln. solution
TBAF tetra-n-butylammonium fluoride
TBS tert-butyldimethylsilyl
Tf trifluoromethanesulfonyl
TFA trifluoroacetic acid
THF tetrahydrofuran
THP tetrahydropyran
TIPS triisopropylsilyl
TMS trimethylsilyl
tR retention time
uv ultra-violet
Vis visible
Z benzyloxycarbonyl
A. Characterization Methods Used
Nuclear Magnetic Resonance:
Brucker Avance 400, 400 MHz; chemical shifts are given in ppm relative to the solvent used; multiplicities: s = singlet, d = doublet, t = triplet, q = quadruplet, m = multiplet, br = broad, coupling constants are given in Hz.
Analytical HPLC-MS Methods:
HPLC-MS analyses were performed on a Thermo MSQ mass spectrometer with a Dionex Ultimate HPG-3000 pump and a Dionex Ultimate 3000 photodiode array detector.
(1 ) eiuents: A: H20 + 0.05% HCOOH, B: CH3CN; gradient: 5% B 95% B (0.0 min - 2.0 min), 95% B (2.0 min - 2.3 min); flow: 1 .8 mlJmin; detection: UV/Vis + MS, tR is given in min; column: Ascentis Express C18, 2.7 urn. 2.1 x50 mm.
(2) eiuents: A: H20 + 0.05% NH4OH, B: CH3CN; gradient: 5% B - 95% B (0.0 min - 2.0 min), 95% B (2.0 min - 2.3 min); flow: 1 .8 mL/min; detection: UV/Vis + MS, tR is given in min; column: Ascentis Express C18, 2.7 urn, 2.1 x50 mm. HPLC- S analyses were performed on a Thermo MSQ Plus mass spectrometer with a Dionex HPG-3200RS pump (or Agilent G4220A) and a Dsonex DAD-300QRS photodiode array detector (or Agilent G4212A).
(3) eluents: A: H20 + 0.04% TFA, B: CH3CN; gradient: 5% B 95% B (0.0 min - 1 .0 min), 95% B (1 .0 min - 1 .5 min); flow: 4.5 mL/min; detection: UV/Vis + MS, tR is given in min; column: Waters XBridge C18, 2.5 urn, 4.8x30 mm.
(4) eluents: A: H20 + 0.04% TFA, B: CH3CN: gradient: 2% B ~> 40% B (0.0 min - 0.8 min), 40% B - 95% B (0.8 min - 1 .2 min), 95% B (1 .2 min - 1 .5 min); flow: 4.5 mL/min; detection: UV/Vis + MS, tR is given in min; column: Waters XBridge C 8, 2.5 urn, 4.6x30 mm.
Purification Methods Used
Preparative LC-MS Methods:
Preparative HPLC/MS purifications were performed on a Waters system, equipped with a binary gradient module (2545), a HPLC pump (515), a photodiode array detector (2998) and a mass detector (3100).
eluents acidic: A: H20 + 0.1 % HCOOH, B: CH3CN + 0.1 % HCOOH; eluents basic: A: H20 + 0.1 % NH4OH, B: CH3CN + 0.1 % NH GH; flow: 40 mL/min; column: Waters XBridge C 8, 5 urn OBD™, 19 50 mm.
normal gradient: 75% A (0.0 min - 0.2 min). 75% A - 65% A (0.2 min - 0.3 min), 65% A - 35% A (0.3 min - 3.2 min), 35% A -» 5% A (3.2 min - 3.3 min), 5% A (3.3 min - 4.3 min).
polar gradient: 90% A (0.0 min - 0.2 min), 90% A 80% A (0.2 min - 0.3 min), 80% A -» 50% A (0.3 min - 3.2 min), 50% A - 5% A (3.2 min - 3.3 min), 5% A (3.3 min - 4.3 min).
very polar gradient: 95% A (0.0 min - 0.3 min), 95% A -» 65% A (0.3 min - 3.2 min),
65% A -» 5% A (3.2 min - 3.3 min), 5% A (3.3 min - 4.3 min). acidic basic
very polar gradient (A) - polar gradient (B) (D)
normal gradient (C) Preparaiive HPLC/MS purifications were performed on a Gilson HPLC system, equipped with a Giison 21 5 autosampier, Gilson 333/334 pumps, Dionex MSQ Plus detector system, and a Dionex UVD340U (or Dionex DAD-3000) UV detector.
Method (E): eiuents: A: CH3CN, B: H20 + 0.5% HCGGH; gradient: 80% B -> 5% B (0.0 min - 4.Q min), 5% B (4.0 min - 8.0 min); flow: 75 mL/min; column: Waters
XBridge C18, 10 urn, 30x75 mm.
Method (F): eiuents: A: CH3CN, B: H2G + 0.5% ΝΗ,ΟΗ; gradient: 80% B - 5% B (0.0 min - 4.0 min), 5% B (4.0 min - 6.0 min); flow: 75 mL/min; column: Waters XBridge C18, 10 um, 30x75 mm.
Method (G): eiuents: A: CH3CN, B: H20 + 0.5% HCOGH; gradient: 100% B (0.0 min -
1 .0 min), 100% B -> 80% B (1 .0 min - 3.5 min), 80% B -> 5% B (3.5 min - 4.0 min), 5% B (4.0 min - 6.0 min); flow: 75 mL/min; column: Waters Atlantis T3 OBD, 10 um, 30 x75 mm. Racemates can be separated into their enantiomers by preparative chiral HPLC.
The following examples illustrate the invention but do not at all limit the scope thereof.
A. Preparation of precursors and intermediates:
A.1. Synthesis of carboxylic acid derivatives (II)
A.1.1. Synthesis of 4,5,6, 7-tetrahydrobenzo[d]thiazole-7 -carboxylic acid
A.1.1.1. Methyl 2-bromo-3-oxocyclohexanecarboxylate
At 0°C, NBS (9.08 g, 51 .0 mmol) was added to a soln. of methyl cyclohex-2- enecarboxylate (5.96 g, 42.5 mmol) [Bioorg. Med. Chem. 1999, 7, 1505-151 1 .] in THF/H20 (500 mL, 9:1). The mixture was allowed to warm to RT and stirred for 2 h. Subsequently, aq. sat. Na2S203 and aq. sat. NaHC03 were added and the mixture was cone, in vacuo. The residue was partitioned between EtOAc and aq. sat. NaHC03. The org. layer was washed multiple times with aq. sat. NaHC03 and brine, dried over MgS04, and cone, in vacuo.
The residue was dissolved in DCM (386 mL) and DMP (24.54 g, 57.9 mmol) was added at 0°C. The mixture was allowed to warm to RT and stirred for 2 h. Subsequently, the mixture was quenched by the addition of aq. sat. Na2S203 and aq. sat. NaHC03, diluted with H20, and extracted with DCM. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (0-0.5% MeOH/DCM) provided a yellow oil.
1H-NMR (CDCI3) δ: 4.75 (dd, J = 6.7, 1 .0 Hz, 0.2 H), 4.65 (d, J = 3.7 Hz, 0.8 Hz), 3.75, 3.75 (2s, 3H), 3.16-3.01 , 2.85-2.79, 2.47-2.39, 2.35-2.29 (4m, 3H), 2.28-1 .95, 1 .88-1 .79, 1 .72-1 .59 (3m, 4H). A.1.1.2. Methyl 4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxylate
At 0°C, finely crushed P4S10 (9.35 g, 21 .0 mmol) was added to a mixture of formamide (4.73 g, 105.0 mmol) in dioxane (28.5 mL). Subsequently, the mixture was stirred in a sealed vial at 100°C for 1 .5 h, cooled to RT and filtrated. The filtrate was added to a mixture of methyl 2-bromo-3-oxocyclohexanecarboxylate (2.06 g, 8.76 mmol) in dioxane (16.5 mL) and stirred in a sealed vial at 80°C overnight. The mixture was quenched by the addition of aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (10-40% EtOAc/Hept) provided a yellow oil.
LC-MS (3): tR = 0.47 min; [M+H]+: 198.16.
A.1.1.3. 4,5,6,7-Tetrahydrobenzo[d]thiazole-7-carboxylic acid
A mixture of methyl 4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxylate (1 .22 g, 6.1 1 mmol) and LiOH.H20 (0.39 g, 9.17 mmol) in THF/MeOH/H20 (60 mL, 3:1 :1) was stirred at RT for 75 min. The mixture was acidified to pH = 3 and extracted with DCM. The comb. org. layers were dried over MgS04 and cone, in vacuo to provide a yellow solid.
LC-MS (3): tR = 0.32 min; [M+H]+: 184.21 .
A.1.2. Synthesis of 5,6-dihydro-4H-cyclopenta[d]thiazole-6-carboxylic acid
A.1.2.1. 2-Bromo-3-oxocyclopentanecarbonitrile
Bicyclo[2.2.1 ]hepta-2,5-diene (0.84 g, 9.14 mmol), followed by Gd(OTf)3 (1 -84 g, 3.05 mmol), 2-cyclopenten-1 -one (5.00 g, 60.9 mmol) and TMS-CN (9.25 g, 91 .4 mmol) were added to a degassed solution of Ni(cod)2 (0.84 g, 3.04 mmol) in THF (160 mL) and the mixture was stirred at RT for 4 h. Subsequently, the mixture was quenched with solid NaHC03 and aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04 and cone, in vacuo. The residue, a yellow oil, was dissolved in THF/H20 (450 mL, 9:1). At 0°C, NBS (1 1 .98 g, 67.3 mmol) was added and the mixture was stirred at 0°C for 30 min. Subsequently, the mixture was quenched with aq. sat. Na2S03 and extracted with EtOAc. The comb. org. layers were washed with aq. 5% NaHC03 and brine, dried over Na2S04, and cone, in vacuo. The residue was re- dissolved in EtOAc, washed multiple times with aq. 5% NaHC03 and brine, the combined org. layer were dried over Na2S04, and cone, in vacuo to provide a brown liquid.
1H-NMR (CDCI3) δ: 4.42 (d, J = 7.7 Hz, 0.5 H), 4.34 (d, J = 5.8 Hz, 0.5 H), 3.43-3.40 (m, 0.5 H), 3.33-3.28 (m, 0.5 H), 2.72-2.26 (m, 4 H). A.1.2.2. 2-Amino-5,6-dihydro-4H-cyclopenta[d]thiazole-6-carbonitrile
A mixture of 2-bromo-3-oxocyclopentanecarbonitrile (crude from A.1 .2.1 .; ca. 13 g) and thiourea (13.77 g, 181 mmol) in dioxane (600 mL) was stirred at 80°C for 1 h. The mixture was allowed to cool to RT, quenched with aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (2-20% MeOH (0.5% Et3N)/DCM) provided a brown solid. LC-MS (3): tR = 0.19 min; [M+H]+: 166.06.
A.1.2.3. 5,6-Dihydro-4H-cyclopenta[d]thiazole-6-carbonitrile
To a soln. of 2-amino-5,6-dihydro-4H-cyclopenta[d]thiazole-6-carbonitrile (1 .00 g, 6.05 mmol) in THF (54 mL) was added tert-butyl nitrite (1 .04 g, 9.08 mmol) and the mixture was stirred at 65°C for 3 h. Subsequently, the mixture was quenched with aq. sat.
NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (10-80% EtOAc/Hept) provided a yellow oil.
LC-MS (4): tR = 0.52 min; [M+H]+: 151 .13.
A.1.2.4. 5,6-Dihydro-4H-cyclopenta[d]thiazole-6-carboxylic acid
A soln. of 5,6-dihydro-4H-cyclopenta[d]thiazole-6-carbonitrile (265 mg, 1 .59 mmol) in aq. cone. HCI was stirred at 90°C for 45 min in a sealed tube. The mixture was adjusted to pH = 3 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo to provide a yellow oil.
LC-MS (3): tR = 0.33 min; [M+H]+: 170.03.
A.1.3. Synthesis of 5,6,7, 8-tetrahydro-4H-cyclohepta[d]thiazole-8-carboxylic acid A.1.3.1. 2-Amino-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8-carbonitrile
Bicyclo[2.2.1 ]hepta-2,5-diene (0.50 g, 5.45 mmol), followed by Gd(OTf)3 (1 .10 g, 1 .82 mmol), 2-cyclohepten-1 -one (5.00 g, 36.3 mmol) and TMS-CN (5.51 g, 54.5 mmol) were added to a degassed solution of Ni(cod)2 (0.50 g, 1 .82 mmol) in THF (100 mL) and the mixture was stirred at RT for 4 h. Subsequently, the mixture was quenched with solid NaHC03 and aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04 and cone, in vacuo.
The residue, a yellow oil, was dissolved in THF/H20 (200 mL, 9:1). At 0°C, NBS (5.53 g, 31 .0 mmol) was added and the mixture was stirred at 0°C for 30 min. Subsequently, the mixture was quenched with aq. sat. Na2S03 and extracted with EtOAc. The comb. org. layers were washed with aq. 5% NaHC03 and brine, dried over Na2S04, and cone, in vacuo. The residue was re-dissolved in EtOAc, washed multiple times with aq. 5% NaHC03 and brine, the combined org. layer were dried over Na2S04, cone, in vacuo and the residue was filtrated over a plug of Si02 with EtOAc/Hept (1 :1) as eluent.
After cone, in vacuo, the residue, a brown oil, and thiourea (6.34 g, 83.2 mmol) were dissolved in dioxane (330 ml_) and the mixture was stirred at 80°C for 2 h. Subsequently, the mixture was quenched with aq. sat. NaHC03 and extracted with EtOAc. The comb, org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (2-20% MeOH/DCM) provided a brown oil.
LC-MS (3): tR = 0.34 min; [M+H]+: 194.21 .
A.1.3.2. 5,6,7,8-Tetrahydro-4H-cyclohepta[d]thiazole-8-carbonitrile
To a soln. of 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8-carbonitrile (1 .00 g, 5.17 mmol) in THF (46 ml_) was added tert-butyl nitrite (0.65 g, 5.68 mmol) and the mixture was stirred at 65°C for 2.5 h. Subsequently, the mixture was quenched with aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (2-40% EtOAc/Hept), CC (0-1 .5% MeOH/DCM) and prep. HPLC (E) provided a yellow oil.
LC-MS (3): tR = 0.51 min; [M+H]+: 179.23.
A.1.3.3. 5,6,7,8-Tetrahydro-4H-cyclohepta[d]thiazole-8-carboxylic acid
A soln. of 5,6,7, 8-tetrahydro-4H-cyclohepta[d]thiazole-8-carbonitrile (151 mg, 0.84 mmol) in aq. cone. HCI (2 ml_) was stirred at 90°C for 1 h in a sealed tube. The mixture was adjusted to pH = 3 and extracted with EtOAc. The combined org. layers were washed with brine, dried over MgS04, and cone, in vacuo to provide a beige solid.
LC-MS (3): tR = 0.36 min; [M+H]+: 198.20.
A.1.4. Synthesis of 6,7-dihydro-5H-pyrano[2,3-d]thiazole-7-carboxylic acid
A.1.4.1. 3-((tert-Butyldimethylsilyl)oxy)-1 -(2,4-dichlorothiazol-5-yl)propan-1 -ol
At -20°C, a soln. of n-BuLi in hexanes (2.3 M, 10.9 mL, 25.0 mmol) was added to a soln. of DIPA (3.5 mL, 25.0 mmol) in THF (102 mL). The soln. was stirred at -20°C for 30 min, then, it was cooled to -78°C and a soln. of 2,4-dichlorothiazole (3.50 g, 22.7 mmol) in THF (16 mL) was added. The mixture was stirred at -78°C for 30 min, then, 3-[(tert- butyldimethylsilyl)oxy]-1 -propanal (4.51 g, 22.7 mmol) was added and the mixture was stirred at -78°C for 1 h. Subsequently, the mixture was quenched with aq. sat. NH4CI and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (2-15% EtOAc/Hept) provided a yellow oil. LC-MS (3): tR = 1 .08 min; [M+H]+: 342.08. A.1.4.2. 5-(3-((tert-Butyldimethylsilyl)oxy)-1 -((tetrahydro-2H-pyran-2-yl)oxy)propyl)- 2,4-dichlorothiazole
A soln. of 3-((tert-butyldimethylsilyl)oxy)-1 -(2,4-dichlorothiazol-5-yl)propan-1 -ol (6.62 g, 19.3 mmol), 3,4-dihydro-2H-pyran (8.9 mL, 96.7 mmol) and PPTS (0.49 g, 1 .93 mmol) in DCM (75 mL) was stirred under reflux for 2 h. Subsequently, the volatiles were removed in vacuo and the residue was purified by means of CC (1 -10% EtOAc/Hept) to provide the product as a colorless oil as an isomeric mixture.
LC-MS (3): tR = 1 .27 min; 1 .28 min; [M+H]+: 426.1 1 ; 426.10.
A.1.4.3. 5-(3-((tert-Butyldimethylsilyl)oxy)-1 -((tetrahydro-2H-pyran-2-yl)oxy)propyl)- 4-chlorothiazole
At -78°C, a soln. of n-BuLi in hexanes (2.2 M, 9.6 mL, 21 .0 mmol) was added to a soln. of 5-(3-((tert-butyldimethylsilyl)oxy)-1 -((tetrahydro-2H-pyran-2-yl)oxy)propyl)-2,4- dichlorothiazole (6.89 g, 16.2 mmol) in THF (125 mL). The mixture was stirred at -78°C for 45 min, then, quenched by the addition of aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (2-20% EtOAc/Hept) provided the product as a yellow oil as an isomeric mixture.
LC-MS (3): tR = 1 .15 min; 1 .16 min; [M+H]+: 392.17; 392.17.
A.1.4.4. 3-(4-Chlorothiazol-5-yl)-3-((tetrahydro-2H-pyran-2-yl)oxy)propan-1 -ol
At 0°C, a soln. of TBAF in THF (1 M, 19.2 mL, 19.2 mmol) was added to a. soln. of 5-(3- ((tert-butyldimethylsilyl)oxy)-1 -((tetrahydro-2H-pyran-2-yl)oxy)propyl)-4-chlorothiazole (6.27 g, 16.0 mmol) in THF (80 mL). The mixture was allowed to warm to RT and stirred overnight. Then, the mixture was quenched by the addition of aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. Purification by means of CC (20-85% EtOAc/Hept) provided the product as a yellow oil as an isomeric mixture..
LC-MS (3): tR = 0.55 min; 0.57 min; [M+H]+: 278.1 1 ; 278.10.
A.1.4.5. 7-((Tetrahydro-2H-pyran-2-yl)oxy)-6,7-dihydro-5H-pyrano[2,3-d]thiazole
A soln. of 3-(4-chlorothiazol-5-yl)-3-((tetrahydro-2H-pyran-2-yl)oxy)propan-1 -ol (520 mg, 1 .87 mmol) in MePh (10 mL) was added to a Ar-filled vial charged with Pd(OAc)2 (63 mg, 0.28 mmol), 2-(di-tert-butylphosphino)-1 ,1 '-binaphthyl (140 mg, 0.35 mmol) and Cs2C03 (915 mg, 2.81 mmol). The vial was sealed and placed in a preheated oilbath (100°C) overnight. Subsequently, the mixture was diluted with DCM, filtrated over Celite, and cone. in vacuo. Purification by means of CC (20-80% EtOAc/Hept) provided the product as a yellow oil as an isomeric mixture..
LC-MS (3): tR = 0.60 min; 0.64 min; [M+H]+: 241 .94; 241 .94.
A.1.4.6. 6,7-Dihydro-5H-pyrano[2,3-d]thiazol-7-ol
A soln. of 7-((tetrahydro-2H-pyran-2-yl)oxy)-6,7-dihydro-5H-pyrano[2,3-d]thiazole (895 mg, 3.71 mmol) and PTSA (141 mg, 0.74 mmol) in THF/H20 (7.4 ml_, 1 :1) was stirred at RT overnight. The mixture was diluted with DCM, dried over Na2S04, and cone, in vacuo. Purification by means of CC (40-100% EtOAc/Hept) provided a yellow oil.
LC-MS (3): tR = 0.23 min; [M+H]+: 158.15.
A.1.4.7. 6,7-Dihydro-5H-pyrano[2,3-d]thiazole-7-carbonitrile
To a mixture of 6,7-dihydro-5H-pyrano[2,3-d]thiazol-7-ol (0.65 g, 4.14 mmol), acetone cyanohydrin (880 mg, 10.3 mmol) and (n-Bu)3P (1 .67 g, 8.27 mmol) in THF (79 mL) was added at 0°C 1 ,1 '-(azodicarbonyl)dipiperidine (2.09 g, 8.27 mmol). The mixture was stirred at 0°C for 30 min, then, it was allowed to warm to RT and was stirred for 2 h. Subsequently, the reaction mixture was diluted with diisopropyl ether, filtrated and the filtrate was cone, in vacuo. Purification by means of CC (5-70% EtOAc/Hept) provided a yellow solid.
LC-MS (3): tR = 0.36 min; [M+H]+: 167.13.
A.1.4.8. 6,7-Dihydro-5H-pyrano[2,3-d]thiazole-7-carboxylic acid
A soln. of 6,7-dihydro-5H-pyrano[2,3-d]thiazole-7-carbonitrile (462 mg, 2.78 mmol) in aq. HCI (32%, 13.9 mL) was stirred at 60°C for 30 min. Under ice-bath cooling, the pH of the mixture was adjusted to ca. 3, and the mixture was extracted with EtOAc. The comb. org. layers were dried over MgS04 and cone, in vacuo to provide a beige solid.
LC-MS (3): tR = 0.33 min; [M+H]+: 186.18.
A.1.5. Synthesis of 5,6-dihydrofuro[2,3-d]thiazole-6-carboxylic acid
A.1.5.1. 4-((2,2-Dimethyl-1 ,3-dioxolan-4-yl)methoxy)thiazole
NaH (60% dispersion in mineral oil, 12.19 g, 305.3 mmol) was added portionwise to DL- 1 ,2-isoproylideneglycerol (16.1 1 g, 1218 mmol) and the mixture was stirred until gas evolution had ceased (ca. 30 min RT, followed by 2 h at 60°C). Subsequently, 4- bromothiazole (20.00 g, 121 .9 mmol) was added and the mixture was stirred at 140°C for 45 min. Subsequently, the reaction mixture was quenched with aq. sat. NH4CI and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. The residue was subjected to distillation and the volatiles (HV, 60°C) were removed. The residue was purified by means of CC (5-40% EtOAc/Hept) to provide a yellow oil.
LC-MS (3): tR = 0.52 min; [M+H]+: 216.20.
A.1.5.2. 5-Bromo-4-((2,2-dimethyl-1 ,3-dioxolan-4-yl)methoxy)thiazole
At 0°C, NBS (1 1 .94 g, 67.1 mmol) was added over 90 min to a soln. of 4-((2,2-dimethyl- 1 ,3-dioxolan-4-yl)methoxy)thiazole (13.75 g, 63.9 mmol) in MeCN (320 mL). The mixture was further stirred at 0°C for 30 min, then, it was quenched by the addition of aq. 5% NaHC03 and extracted with EtOAc. The comb. org. layers were washed with aq. 5% NaHC03 and brine, dried over MgS04, and cone, in vacuo.
LC-MS (3): tR = 0.74 min; [M+H]+: 294.13.
A.1.5.3. 5-Bromo-4-(oxiran-2-ylmethoxy)thiazole
A soln. of 5-bromo-4-((2,2-dimethyl-1 ,3-dioxolan-4-yl)methoxy)thiazole (18.80 g, 63.9 mmol) and PPTS (0.80 g, 3.19 mmol) in MeOH (256 mL) was stirred under reflux for 3 h. More PPTS (0.40 g, 1 .60 mmol) was added and the mixture was stirred under reflux for additional 2 h. The mixture was cone, in vacuo, the residue was dissolved in MeOH (256 mL) and stirred under reflux for 2 h. The mixture was cone, in vacuo, the residue was dissolved in DCM (256 mL) and treated with trimethyl orthoformate (10.5 mL, 95.8 mmol). The mixture was stirred overnight at RT. Subsequently, additional trimethyl orthoformate (3.5 mL, 31 .9 mmol) was added and the mixture was stirred at RT for 1 h. Then, the mixture was cone, in vacuo, the residue was dissolved in DCM (256 mL), treated with AcBr (5.73 mL, 76.7 mmol) and stirred at RT for 90 min. Subsequently, the mixture was cone, in vacuo, the residue was dissolved in MeOH (320 mL) and K2C03 (17.66 g, 128 mmol) was added to the mixture. After the mixture was stirred at RT for 90 min, the mixture was filtrated and the filtrate was poured into cold aq. sat. NH4CI. The mixture was extracted with EtOAc, the comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. The residue was purified by means of CC (2-40% EtOAc/Hept) to provide a yellow oil.
LC-MS (3): tR = 0.60 min; [M+H]+: 236.06.
A.1.5.4. (2-(Triisopropylsilyl)-5,6-dihydrofuro[2,3-d]thiazol-6-yl)methanol
At -78°C, a soln. of n-BuLi in hexanes (2.18 M, 16.7 mL, 36.4 mmol) was added over 30 min to a soln. of 5-bromo-4-(oxiran-2-ylmethoxy)thiazole (7.17 g, 30.4 mmol) in THF (564 mL). The mixture was stirred at -78°C for 2 h, then, TIPSCI (6.63 mL, 31 .0 mmol) was added, the mixture was allowed to warm to RT and stirred at RT for 30 min. Subsequently, the mixture was cooled to -78°C and treated with a soln. of n-BuLi in hexanes (2.18 M, 13.9 mL, 30.4 mmol). The mixture was stirred at 0°C for 2 h, then, it was quenched with aq. sat. NaHC03 and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. The residue was purified by means of CC (5-50% EtOAc/Hept) to provide a yellow oil.
LC-MS (3): tR = 1 .01 min; [M+H]+: 314.13.
A.1.5.5. 2-(Triisopropylsilyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxylic acid
A soln. of (2-(triisopropylsilyl)-5,6-dihydrofuro[2,3-d]thiazol-6-yl)methanol (1 .77 g, 5.64 mmol)) in DCM (56 mL) was treated at 0°C with DMP (2.87 g, 6.77 mmol) portionwise over 1 h . The mixture was stirred at 0°C for 2 h, then, it was allowed to warm to RT and stirred for 2 h. Subsequently, the mixture was quenched with aq. sat. Na2S203 and aq. sat. NaHC03 and was extracted with DCM. The comb. org. layers were washed with brine, dried over MgS04, and cone, in vacuo. The residue was dissolved in tert-BuOH (16 mL) and 2-methyl-2-butene (4 mL) and treated at 0°C dropwise over 30 min with a soln. of NaH2P04 (2.64 g, 16.9 mmol) and NaCI02 (0.96 g, 8.46 mmol) in H20 (5 mL). The mixture was stirred at RT for 45 min, then, the volatiles were removed in vacuo, the residue was diluted with H20 and extracted with EtOAc. The comb. org. layers were dried over MgS04 and cone, in vacuo.
LC-MS (3): tR = 0.99 min; [M+H]+: 328.24.
A.1.5.6. 5,6-Dihydrofuro[2,3-d]thiazole-6-carboxylic acid
A soln. of TBAF in THF (1 M, 4.9 mL, 4.90 mmol) was added at 0°C to soln. of 2- (triisopropylsilyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxylic acid (1 .62 mg, 4.90 mmol) in THF (25 mL). The mixture was stirred at 0°C for 30 min, AcOH (0.42 mL, 7.35 mmol) was added, and the volatiles were removed in vacuo. The residue was purified by means of prep. HPLC (G) to provide a colorless solid.
LC-MS (3): tR = 0.30 min; [M+H]+: 172.05.
A.2. Synthesis of amines (III)
A.2.1. Synthesis of 2-amino-2-cycloheptylethanol
A.2.1.1. Synthesis of 2-amino-2-cycloheptylacetic acid tert-butyl ester
To a soln. of N-(diphenylmethylene)glycerine tert-butyl ester (6.83 mmol) and (R)-4,4- dibutyl-2,6-bis(3,4,5-trifluorophenyl)-4,5-dihydro-3/-/-dinaphthol[7,6,1 ,2-cde]azepinium bromide (6.84 μηιοΙ) in 45 mL toluene were sequentially added cycloheptyl bromide (8.2 mmol) and CsOH H20 (34.2 mmol) at -10°C. The reaction mixture was stirred at -10°C for 10 min and then at RT for 4 days. Another portion of (R)-4,4-dibutyl-2,6-bis(3,4,5- trifluorophenyl)-4,5-dihydro-3/-/-dinaphthol[7,6,1 ,2-cde]azepinium bromide (6.84 μηιοΙ) was added and stirring was continued at RT for another 24 h. The reaction was quenched with water and extracted 3 times with DCM. The comb. org. layers were combined, cone, and the residue was redissolved in 100 mL THF. A soln. of 100 mL aq. 0.5 M citric acid soln. was added and the mixture was stirred at RT for 4 h. The mixture was concentrated to half of its volume and extracted twice with Et20. The aqueous layer was basified with solid NaHC03 and extracted 3 times with DCM. The comb. org. layers were dried over MgS04 and cone, in vacuo to obtain the desired product as yellow oil.
LC-MS (3): tR = 0.61 min; [M+H]+: 228.29.
A.2.1.2 Synthesis of 2-amino-2-cycloheptylethanol
To a soln. of 3.43 mL LiAIH4 (1 M in THF) in 8 mL THF was added a soln. of 2-amino-2- cycloheptylacetic acid tert-butyl ester (1 .72 mmol) in 3 mL THF at 0°C. The ice bath was removed and stirring was continued at RT for 1 h. The reaction mixture was cooled to 0°C, quenched with water and a 1 M NaOH soln., filtered over a pad of celite and washed with EtOAc. The filtrate was basified with a 1 M NaOH soln. to pH 8-9 and it was then extracted 3 times with EtOAc. The comb. org. layers were dried over MgS04 and cone, in vacuo to obtain the crude product as yellow oil. The crude was dissolved in 3 mL Et20 and a soln. of 4 M HCI in dioxane was dropwise added at 0°C. The resulting precipitate was separated by filtration and dried in vacuo to give the corresponding HCI salt as yellow solid.
LC-MS (3): tR = 0.39 min; [M+H]+: 158.14.
A.2.2. Synthesis of (1 -(6-chloropyridin-3-yl)cyclohexyl)methanamine
A.2.2.1. Synthesis of 1 -(6-chloropyridin-3-yl)cyclohexanecarbonitrile
To a mixture of 2-(6-chloropyridin-3-yl)acetonitrile (26.2 mmol) and 1 ,5-dibromopentane (26.2 mmol) in THF/DMSO (1 :1 , 300 mL) was added NaH (60% in mineral oil, 55.1 mmol) portionwise at 0°C over 45 min. The mixture was allowed to warm to RT and stirred for 1 h 45 min. The reaction mixture was poured into water and extracted with DCM. The comb, org. layers were washed with brine, dried over MgS04, and cone, in vacuo. The residue was purified by means of CC (10-80% EtOAc/Hept) to provide a colorless solid.
LC-MS (3): tR = 0.78 min; [M+H]+: 221 .20.
A.2.2.2. Synthesis of (1 -(6-chloropyridin-3-yl)cyclohexyl)methanamine
A soln. of 1 -(6-chloropyridin-3-yl)cyclohexanecarbonitrile (20.1 mmol) in THF (88 mL) was added dropwised to a solution BH3 in THF (60.2 mmol, 1 M). After heating to reflux for 1 h, the reaction mixture was cooled in an ice bath before aq. 2 M HCI (120 mL) was slowly added. The mixture was then heated to reflux for another 20 min. After cooling to RT, the mixture was washed with DCM, then, it was basified with aq. 1 M NaOH and extracted with DCM. The comb. org. layers were dried over MgS04 and cone, in vacuo.
LC-MS (3): tR = 0.47 min; [M+H]+: 225.27.
A.2.3. Synthesis of (1 -(6-chloropyridin-3-yl)-4,4-difluorocyclohexyl)methanamine A.2.3.1. Synthesis of methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1 - enecarboxylate
To a soln. of 2-(6-chloro-3-pyridinyl)acetonitrile (13.1 mmol) in 35 mL THF were added methylacrylate (26.2 mmol) and KOtBu (15.7 mmol). The reaction mixture was stirred at RT for 1 h. The mixture was acidifed with aq. 1 M HCI soln. and then extracted with DCM. The comb. org. layers were washed with brine, dried over MgS04 and cone, in vacuo. The residue was purified by CC (10-50% EtOAc/Hept) to provide a white solid.
LC-MS (3): tR = 0.74 min; [M+CH3CN+H]+: 334.03.
A.2.3.2. Synthesis of 1 -(6-chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile
A mixture of methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1 -enecarboxylate (10.6 mmol) and LiCI (21 .1 mmol) in 15 mL wet DMSO was heated to 120°C under microwave conditions for 2 h. The reaction mixture was diluted with water and extracted with EtOAc. The comb. org. layers were washed with brine, dried over MgS04 and cone, in vacuo. The residue was purified by CC (5-20% EtOAc/Hept) to provide a yellow solid. LC-MS (3): tR = 0.56 min; [M+CH3CN+H]+: 276.12.
A.2.3.3. Synthesis of 1 -(6-chloropyridin-3-yl)-4,4-difluorocyclohexanecarbonitrile
A soln. of 1 -(6-chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile (3.89 mmol) in 4 mL DCM was cooled to -78°C, (diethylamino)sulfur trifluoride (7.78 mmol) was dropwise added and the mixture was stirred for 24 h allowing to reach slowly RT. The reaction mixture was quenched with aq. sat. NaHC03 solution under ice cooling and diluted with DCM. The org. phase was washed with brine, dried over MgS04 and cone, in vacuo. The residue was purified by CC (10-50% EtOAc/Hept) to provide a beige solid.
LC-MS (3): tR = 0.74 min; [M+CH3CN+H]+: 298.00.
A.2.3.4. Synthesis of (4,4-difluoro-1 -(6-chloropyridin-3-yl)cyclohexyl)methanamine
A soln. of 1 -(6-chloropyridin-3-yl)-4,4-difluorocyclohexanecarbonitrile (2.02 mmol) in 20 mL THF was added to a soln. of BH3 in THF (6.07 mmol, 1 M). After heating to reflux for 1 h, the reaction mixture was cooled in an ice bath before a 2 M HCI soln. was slowly added. The mixture was then heated to reflux for another 20 min. The reaction mixture was washed with DCM, basified with aq. 1 M NaOH and extracted with DCM. The com. org. layers were washed with brine, dried over MgS04 and cone, in vacuo to provide a yellow oil.
LC-MS (3): tR = 0.46 min; [M+CH3CN+H]+: 302.03.
A.2.4. Synthesis of 2-alkyl-2-heteroarylethanamines
A.2.4.1. Strecker reaction (general procedure I)
To a suspension of the corresponding aldehyde (24.6 mmol) in anh. Et20 (8 mL) was slowly added at RT, TMS-CN (27 mmol) followed by Znl2 (1 .23 mmol). The mixture was cooled to 0°C and a solution of the corresponding amine (24.6 mmol) in anh. MeOH (20 mL) was added dropwise (when the amine was a HCI salt, 24.6 mmol of TEA were additionally added). The mixture was heated at 70°C for 1 to 6 h then cooled to RT. It was quenched with an aq. 10% Na2C03 soln. and extracted 3 times with EtOAc. The comb, org. phases were dried over MgS04 and cone, in vacuo. The crude was purified by CC (KP-NH from Biotage) to isolate the desired a-amino-nitrile (see table below).
Figure imgf000049_0001
A.2.4.2. Hydrogenation of nitrile (general procedure II)
To a soln. of the a-amino-nitrile (4.38 mmol) from the previous step in a 7 M solution of NH3 in MeOH (32 mL) were added at 0°C a 4% soln. of thiophene in diisopropylether (0.16 mL) and Actimet M Raney nickel. The mixture was allowed to warm to RT and stirred under a hydrogen atmosphere for 30 h. It was filtered over Celite, washed with MeOH and cone, in vacuo. The amine was optionally transformed to its HCI salt by dissolution in Et20 (8.8 mL), addition of a 4 M HCI soln. in dioxane (4.4 mL) at 0°C and filtration of the formed solid.
Figure imgf000050_0001
B. Preparation of examples
B.1. Synthesis of compounds of formula (I) (general procedure)
A mixture of the respective carboxylic acid (II) (0.30 mmol), the respective amine (III) (0.36 mmol), HOBt (0.45 mmol), EDC.HCI (0.45 mmol) and DIPEA (0.90 mmol) in DMF (1 .2 mL) was stirred at RT overnight. The mixture was filtrated and the filtrate was purified by purification methods listed beforehand to give the desired amides (I).
EXAMPLE LIST
LC-MS
Purification
Compound Name LC- method tR [M+H]+
MS [min]
N-(1 -cycloheptyl-2-hydroxyethyl)-
Example 1
5,6-dihydrofuro[2,3-d]thiazole-6- B 1 0.83 31 1 .0 carboxamide (mixture of 4 isomers)
N-((1 -(6-chloropyridin-3-
Example 2 yl)cyclohexyl)methyl)-5,6-
B 1 1 .04 378.0 dihydrofuro[2,3-d]thiazole-6- carboxamide N-(2-(4,4-difluoropiperidin-1 -yl)-2- (2-methylpyrimidin-5-yl)ethyl)-5,6-
Example 3
dihydrofuro[2,3-d]thiazole-6- A 1 0.59 410.0 carboxamide
(mixture of 4 stereoisomers)
N-(2-morpholino-2-(6- (trifluoromethyl)pyridin-3-yl)ethyl)-
Example 4
5,6-dihydrofuro[2,3-d]thiazole-6- A 1 0.62 428.9 carboxamide
(mixture of 4 stereoisomers)
N-((S)-1 -cyclohexyl-2- hydroxyethyl)-5,6-dihydro-4H-
Example 5
cyclopenta[d]thiazole-6- B 1 0.76 295.2 carboxamide
(mixture of epimers)
N-(2-(2-methylpyrimidin-5-yl)-2- morpholinoethyl)-5,6-dihydro-4H-
Example 6
cyclopenta[d]thiazole-6- A 1 0.32 373.8 carboxamide
(mixture of 4 stereoisomers)
N-(2-(4,4-difluoropiperidin-1 -yl)-2- (2-methylpyrimidin-5-yl)ethyl)-5,6-
Example 7
dihydro-4H-cyclopenta[d]thiazole-6- A 1 0.61 408.2 carboxamide
(mixture of 4 stereoisomers)
N-((S)-1 -cyclohexyl-2- hydroxyethyl)-6,7-dihydro-5H-
Example 8
pyrano[2,3-d]thiazole-7- B 1 0.74 310.9 carboxamide
(mixture of epimers)
Example 9 N-(2-(2-methylpyrimidin-5-yl)-2-
A 1 0.31 389.7 morpholinoethyl)-6,7-dihydro-5H- pyrano[2,3-d]thiazole-7- carboxamide
(mixture of 4 stereoisomers)
N-(2-(6-chloropyridin-3-yl)-2-(4,4- difluoropiperidin-1 -yl)ethyl)-6,7-
Example
10 dihydro-5H-pyrano[2,3-d]thiazole-7- B 1 0.81 442.9 carboxamide
(mixture of 4 stereoisomers)
N-((R)-1 -cyclohexylethyl)-4,5,6,7-
Example tetrahydrobenzo[d]thiazole-7- 11 C 2 1 .09 293.1 carboxamide
(mixture of epimers)
N-((S)-1 -cyclohexyl-2- hydroxyethyl)-4, 5,6,7-
Example
12 tetrahydrobenzo[d]thiazole-7- E, F 3 0.53 309.0 carboxamide
(mixture of epimers)
N-((1 -(6-chloropyridin-3-
Example yl)cyclohexyl)methyl)-4, 5,6,7- 13 C 2 1 .09 389.8 tetrahydrobenzo[d]thiazole-7- carboxamide
N-((1 -(6-chloropyridin-3-yl)-4,4-
Example difluorocyclohexyl)methyl)-4,5,6,7- 14 D 2 0.99 426.1 tetrahydrobenzo[d]thiazole-7- carboxamide
N-(2-morpholino-2-(2- (trifluoromethyl)pyrimidin-5-
Example yl)ethyl)-4,5,6,7- 15 D 2 0.80 442.1 tetrahydrobenzo[d]thiazole-7- carboxamide
(mixture of 4 stereoisomers)
Example N-((S)-1 -cyclohexyl-2- E 3 0.56 323.2
16 hyd roxyethy l)-5 ,6,7, 8-tetra hyd ro- 4H-cyclohepta[d]thiazole-8- carboxamide
(epimer A)
N-((S)-1 -cyclohexyl-2- hyd roxyethy l)-5 ,6,7, 8-tetra hyd ro-
Example
17 4H-cyclohepta[d]thiazole-8- E 3 0.53 323.0 carboxamide
(epimer B)
BIOLOGICAL ASSAYS
A. In vitro assay
The P2X7 receptor antagonistic activity of the compounds of formula (I) is determined in accordance with the following experimental method.
B. Experimental method:
Cell line generation and YO-PRO assay
Cell line generation was performed in general according to established molecular cloning protocols. Specifically, RNA was extracted from human whole blood using the Qiagen RNeasy kit (Qiagen, CH) according to the manufacturer's instructions. Subsequently cDNA was made (Superscript II, Invitrogen AG, CH) and the human P2X7 gene (genbank ref. BC01 1913) was amplified with the following primers:
ATCGCGGCCGCTCAGTAAGGACTCTTGAAGCCACT and
CGCCGCTAGCACCACCATGCCGGCCTGCTGCAGCTGCA. The amplified sequence was subsequently ligated into a pcDNA3.1 (+) Notl, Nhel digested plasmid. Human embryonic kidney (HEK) cells (ATCC CRL - 1573, Manassas, VA, USA) were transfected with the pcDNA3.1 (+).hP2X7 plasmid using lipofectamine 2000 (Invitrogen AG, CH) according to the manufacturer's instructions. Following a 24h exposure to DNA, cells were trypsinized and re-seeded at low density in the presence of 250 μg Geneticin. Geneticin resistant cells were then selected during two consecutive rounds of cloning by serial limiting dilution with visual inspection. Individual clones were screened for P2X7 expression by applying ATP and recording the resultant uptake of YO-PR01 . Specific cell clones were chosen based on RNA and protein expression. HEK cells stably expressing P2X7 were used to screen drugs using the YO-PR01 assay. Cells were grown to confluency in adherent culture at 37°C in a humidified 5% C02 incubator (split 1 /5 every 3 - 4 days with DMEM, 10 % FCS, 1 % Penicillin/Streptomycin, 250 μg/ml Geneticin). Adherent cells were detached by incubation with Trypsine (1 ml per 165 cm2 dish) for 2 minutes, then washed off with 10 ml PBS (without Mg2+ and Ca2+), and resuspended in DMEM, 10 % FCS, 1 % Penicillin/Streptomycin, no Geneticin. 10Ό00 cells per well (48 hours before the assay) or 25Ό00 cells per well (Vi-cell XR (Beckman Coulter) (24 hours before the assay) in 50 μΙ full medium were seeded on 384-well black-wall, clear bottom plates, that were coated before with 10 μΙ per well Poly-L-Lysine, incubated for 30 - 60 minutes at 37° C and washed once with PBS. Medium was removed from cells and 50 μΙ of assay buffer containing 0.5 μΜ YO-PRO-1 was added into the wells. Solutions of antagonist compounds were prepared by serial dilutions of a 10 mM DMSO solution of the antagonist into PBS using a BioMek (Beckman Coulter). Each concentration was performed in duplicate. For IC50 measurements 10 concentration points were measured (10 μΜ being the highest concentration followed by 9 serial dilution steps 1 /3). The cells were incubated with the antagonists of the present invention together with ATP at a final concentration of 250 μΜ for 90 minutes. During this time period, four time points were taken. Each time point comprised the average of several measurements made within a few seconds. Fluorescence was measured in the FLIPR tetra (Molecular Devices) using the filters appropriate for YO-PRO-1 fluorescence (excitation485/20, emission 530/25). The FLIPR tetra was equipped with Molecular Devices Screen Works system control software to define and run experimental protocols. For antagonist activity measurements, the maximal intensity was expressed as a percentage of that induced by the EC50 value for agonist activation (0.25 mM ATP for HEK-293 cells expressing human recombinant P2X7 receptor). For IC50 measurements the maximum intensity is plotted against the concentration of compound to determine IC50 values.
Antagonistic activities with respect to the P2X7 receptor (IC50 values) of exemplified compounds are displayed in Table 1.
Table 1
Compound Name ICso [nM]
Example 1 N-(1 -cycloheptyl-2-hydroxyethyl)-5,6-dihydrofuro[2,3-
818 d]thiazole-6-carboxamide (mixture of 4 stereoisomers)
Example 2 N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-5,6-
28 dihydrofuro[2,3-d]thiazole-6-carboxamide
Example 3
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5- 2035 yl)ethyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxamide
(mixture of 4 stereoisomers)
N-(2-morpholino-2-(6-(trifluoromethyl)pyridin-3-yl)ethyl)-
Example 4
5,6-dihydrofuro[2,3-d]thiazole-6-carboxamide 332 (mixture of 4 stereoisomers)
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-5,6-dihydro-4H-
Example 5
cyclopenta[d]thiazole-6-carboxamide 272 (mixture of epimers)
N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-5,6-
Example 6
dihydro-4H-cyclopenta[d]thiazole-6-carboxamide 1372
(mixture of 4 stereoisomers)
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5-
Example 7
yl)ethyl)-5,6-dihydro-4H-cyclopenta[d]thiazole-6- 478 carboxamide (mixture of 4 stereoisomers)
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-6,7-dihydro-5H-
Example 8
pyrano[2,3-d]thiazole-7-carboxamide 340 (mixture of epimers)
N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-6,7-
Example 9
dihydro-5H-pyrano[2,3-d]thiazole-7-carboxamide 1430
(mixture of 4 stereoisomers)
N-(2-(6-chloropyridin-3-yl)-2-(4,4-difluoropiperidin-1 -
Example 10
yl)ethyl)-6,7-dihydro-5H-pyrano[2,3-d]thiazole-7- 74 carboxamide (mixture of 4 stereoisomers)
N-((R)-1 -cyclohexylethyl)-4,5,6,7-
Example 11
tetrahydrobenzo[d]thiazole-7-carboxamide 60
(mixture of epimers)
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-4, 5,6,7-
Example 12
tetrahydrobenzo[d]thiazole-7-carboxamide 41
(mixture of epimers)
Example 13 N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-4,5,6,7-
3.4 tetrahydrobenzo[d]thiazole-7-carboxamide N-((1 -(6-chloropyridin-3-yl)-4,4-
Example 14
difluorocyclohexyl)methyl)-4, 5,6,7- 6.3 tetrahydrobenzo[d]thiazole-7-carboxamide
N-(2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-
Example 15
yl)ethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- 33 carboxamide (mixture of 4 stereoisomers)
Example 16 N-((S)-1 -cyclohexyl-2-hydroxyethyl)-5,6,7,8-tetrahydro-
348 4H-cyclohepta[d]thiazole-8-carboxamide (epimer A)
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-5,6,7,8-tetrahydro-
Example 17
4H-cyclohepta[d]thiazole-8-carboxamide 543
(epimer B)

Claims

Claims
1 . A compound of the formula (I),
Figure imgf000057_0001
(I)
wherein
n represents 1 , 2 or 3;
X represents -O- or -CH2-;
R1 represents hydrogen, (C1-C2)alkyl or hydroxy-(C1-C2)alkyl;
R2 represents hydrogen and R3 represents heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached, a 5- to 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
R4 represents hydrogen or heteroaryl which is unsubstituted or mono- or di-substituted with (C!-C^alkyl, (C1-C3)fluoroalkyl or halogen ;
or a salt of such a compound.
2. A compound of formula (I) according to claim 1 , wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen ;
R2 represents hydrogen and R3 represents heterocyclyl; or R2 and R3 form, together with the carbon atom to which they are attached , a 6- or 7-membered saturated carbocyclic ring which is unsubstituted or mono- or di-substituted with fluoro; and
R4 represents heteroaryl which is unsubstituted or mono- or di-substituted with (C^- C4)alkyl, (C1-C3)fluoroalkyl or halogen;
or a salt of such a compound.
3. A compound of formula (I) according to claim 1 , wherein
n represents 1 or 2;
X represents -O- or -CH2-;
R1 represents hydrogen ;
R2 and R3 form, together with the carbon atom to which they are attached , a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro; and R4 represents a 6-membered heteroaryl group, which group is mono-substituted with chloro;
or a salt of such a compound.
4. A compound of formula (I) according to any one of claims 1 to 3, wherein
X represents -0-;
or a salt of such a compound.
5. A compound of formula (I) according to any one of claims 1 to 3, wherein
X represents -CH2-;
or a salt of such a compound.
6. A compound of formula (I) according to any one of claims 1 , 2, 4 or 5, wherein
R2 represents hydrogen and R3 represents heterocyclyl;
or a salt of such a compound.
7. A compound of formula (I) according to any one of claims 1 to 5, wherein
R2 and R3 form, together with the carbon atom to which they are attached, a 6-membered saturated carbocyclic ring which is unsubstituted or di-substituted with fluoro;
or a salt of such a compound.
8. A compound of formula (I) according to any one of claims 1 , 2 or 4 to 7, wherein
R4 represents a 6-membered heteroaryl group, which group is unsubstituted or mono- substituted with methyl, trifluoromethyl or chloro;
or a salt of such a compound.
9. A compound of formula (I) according to claim 1 , selected from the group consisting of: N-(1 -cycloheptyl-2-hydroxyethyl)-5,6-dihydrofuro[2,3-d]thiazole-6-carboxamide;
N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-5,6-dihydrofuro[2,3-d]thiazole-6- carboxamide;
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5-yl)ethyl)-5,6-dihydrofuro[2,3- d]thiazole-6-carboxamide;
N-(2-morpholino-2-(6-(trifluoromethyl)pyridin-3-yl)ethyl)-5,6-dihydrofuro[2,3-d]thiazole-6- carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-5,6-dihydro-4H-cyclopenta[d]thiazole-6-carboxamide; N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-5,6-dihydro-4H-cyclopenta[d]thiazole-6- carboxamide;
N-(2-(4,4-difluoropiperidin-1 -yl)-2-(2-methylpyrimidin-5-yl)ethyl)-5,6-dihydro-4H- cyclopenta[d]thiazole-6-carboxamide; N-((S)-1 -cyclohexyl-2-hydroxyethyl)-6,7-dihydro-5H-pyrano[2,3-d]thiazole-7-carboxa N-(2-(2-methylpyrimidin-5-yl)-2-morpholinoethyl)-6 ,7-dihydro-5H-pyrano[2,3-d]thiazole-7- carboxamide;
N-(2-(6-chloropyridin-3-yl)-2-(4,4-difluoropiperidin-1 -yl)ethyl)-6 ,7-dihydro-5H-pyrano[2,3- d]thiazole-7-carboxamide;
N-((R)-1 -cyclohexylethyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7-carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-4,5,6 ,7-tetrahydrobenzo[d]thiazole-7-carboxamide; N-((1 -(6-chloropyridin-3-yl)cyclohexyl)methyl)-4,5,6,7-tetrahydrobenzo[d]thiazole-7- carboxamide;
N-((1 -(6-chloropyridin-3-yl)-4,4-difluorocyclohexyl)methyl)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide;
N-(2-morpholino-2-(2-(trifluoromethyl)pyrimidin-5-yl)ethyl)-4, 5,6,7- tetrahydrobenzo[d]thiazole-7-carboxamide;
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-(S)-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8- carboxamide; and
N-((S)-1 -cyclohexyl-2-hydroxyethyl)-(R)-5,6,7,8-tetrahydro-4H-cyclohepta[d]thiazole-8- carboxamide;
or a salt of such a compound.
10. A compound of formula (I) according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, for use as a medicament.
11. A pharmaceutical composition containing, as active principle, a compound of formula (I) according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, and at least one therapeutically inert excipient.
12. Use of a compound of formula (I) according to any one of claims 1 to 9, or of a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the prevention or treatment of a disease selected from pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; other auto-immune and allergic disorders; and other disorders with an inflammatory or immunological component.
13. A compound of formula (I) according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of a disease selected from pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; other auto-immune and allergic disorders; and other disorders with an inflammatory or immunological component.
PCT/IB2014/058434 2013-01-22 2014-01-21 Heterocyclic amide derivatives as p2x7 receptor antagonists WO2014115078A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2015553217A JP6282017B2 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as P2X7 receptor antagonists
ES14703442.5T ES2616883T3 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as P2X7 receptor antagonists
US14/762,717 US9388198B2 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as P2X7 receptor antagonists
KR1020157022715A KR102220847B1 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as p2x7 receptor antagonists
CN201480005210.8A CN104918946B (en) 2013-01-22 2014-01-21 As P2X7The heterocyclic amide derivative of receptor antagonist
EP14703442.5A EP2956457B1 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as p2x7 receptor antagonists
CA2897459A CA2897459C (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as p2x7 receptor antagonists

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13152273 2013-01-22
EP13152273.2 2013-01-22

Publications (1)

Publication Number Publication Date
WO2014115078A1 true WO2014115078A1 (en) 2014-07-31

Family

ID=47559347

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/058434 WO2014115078A1 (en) 2013-01-22 2014-01-21 Heterocyclic amide derivatives as p2x7 receptor antagonists

Country Status (8)

Country Link
US (1) US9388198B2 (en)
EP (1) EP2956457B1 (en)
JP (1) JP6282017B2 (en)
KR (1) KR102220847B1 (en)
CN (1) CN104918946B (en)
CA (1) CA2897459C (en)
ES (1) ES2616883T3 (en)
WO (1) WO2014115078A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9221832B2 (en) 2011-07-22 2015-12-29 Actelion Pharmaceuticals Ltd. Heterocyclic amide derivatives as P2X7 receptor antagonists
JP2016506915A (en) * 2013-01-22 2016-03-07 アクテリオン ファーマシューティカルズ リミテッドActelion Pharmaceuticals Ltd Heterocyclic amide derivatives as P2X7 receptor antagonists
US9409917B2 (en) 2012-01-20 2016-08-09 Actelion Pharmaceuticals Ltd. Heterocyclic amide derivatives as P2X7 receptor antagonists
US9556117B2 (en) 2012-12-18 2017-01-31 Actelion Pharmaceuticals Ltd. Indole carboxamide derivatives as P2X7 receptor antagonists
US9718774B2 (en) 2012-12-12 2017-08-01 Idorsia Pharmaceuticals Ltd Indole carboxamide derivatives as P2X7 receptor antagonist
US11077100B2 (en) 2017-03-13 2021-08-03 Raqualia Pharma Inc. Tetrahydroquinoline derivatives as P2X7 receptor antagonists

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008066789A2 (en) 2006-11-27 2008-06-05 H. Lundbeck A/S Heteroaryl amide derivatives
WO2008124153A1 (en) 2007-04-10 2008-10-16 H. Lundbeck A/S Heteroaryl amide analogues as p2x7 antagonists
WO2009012482A2 (en) * 2007-07-19 2009-01-22 H.Lundbeck A/S 5-membered heterocyclic amides and related compounds
WO2009023623A1 (en) 2007-08-10 2009-02-19 H, Lundbeck A/S Heteroaryl amide analogues
WO2009108551A2 (en) 2008-02-25 2009-09-03 H. Lundbeck A/S Heteroaryl amide analogues
WO2009132000A1 (en) 2008-04-22 2009-10-29 Janssen Pharmaceutica Nv Quinoline or isoquinoline substituted p2x7 antagonists
WO2013108227A1 (en) 2012-01-20 2013-07-25 Actelion Pharmaceuticals Ltd Heterocyclic amide derivatives as p2x7 receptor antagonists

Family Cites Families (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4033977A (en) 1975-10-01 1977-07-05 American Home Products Corporation 4H-pyrano[4,3-d]thiazole derivatives and process therefor
FR2406635A1 (en) * 1977-10-24 1979-05-18 Logeais Labor Jacques NEW BENZO (D) THIAZOLE DERIVATIVES, THEIR PREPARATION PROCESS AND THEIR THERAPEUTIC APPLICATIONS
TR200102911T2 (en) 1999-04-09 2002-01-21 Astrazeneca Ab Adamantane derivatives.
SE9904505D0 (en) 1999-12-09 1999-12-09 Astra Pharma Prod Novel compounds
TWI258462B (en) 1999-12-17 2006-07-21 Astrazeneca Ab Adamantane derivative compounds, process for preparing the same and pharmaceutical composition comprising the same
GB0013737D0 (en) 2000-06-07 2000-07-26 Astrazeneca Ab Novel compounds
DE50108948D1 (en) * 2000-12-20 2006-04-20 Lanxess Deutschland Gmbh 2-bromo / chloro-thiazolium salts and their use as condensation reagents
PA8557501A1 (en) 2001-11-12 2003-06-30 Pfizer Prod Inc BENZAMIDA, HETEROARILAMIDA AND INVESTED AMIDAS
WO2003042190A1 (en) 2001-11-12 2003-05-22 Pfizer Products Inc. N-alkyl-adamantyl derivatives as p2x7-receptor antagonists
SE0103836D0 (en) 2001-11-16 2001-11-16 Astrazeneca Ab Novel compounds
SE0200920D0 (en) 2002-03-25 2002-03-25 Astrazeneca Ab Novel compounds
PA8591801A1 (en) 2002-12-31 2004-07-26 Pfizer Prod Inc BENZAMID INHIBITORS OF THE P2X7 RECEIVER.
MXPA05007130A (en) 2002-12-31 2005-08-26 Pfizer Prod Inc Benzamide inhibitors of the p2x7 receptor.
SE0300480D0 (en) 2003-02-21 2003-02-21 Astrazeneca Ab Novel compounds
EP1626962B1 (en) 2003-05-12 2007-02-28 Pfizer Products Inc. Benzamide inhibitors of the p2x7 receptor
GB0312609D0 (en) 2003-06-02 2003-07-09 Astrazeneca Ab Novel compounds
SE0302139D0 (en) 2003-07-28 2003-07-28 Astrazeneca Ab Novel compounds
MXPA06012595A (en) 2004-04-29 2007-05-09 Abbott Lab Amino-tetrazoles analogues and methods of use.
SA05260265A (en) 2004-08-30 2005-12-03 استرازينيكا ايه بي Novel compounds
SE0402925D0 (en) 2004-11-30 2004-11-30 Astrazeneca Ab Novel Compounds
EP1844003A4 (en) 2005-01-27 2010-09-22 Astrazeneca Ab Novel biaromatic compounds, inhibitors of the p2x7-receptor
US7297700B2 (en) 2005-03-24 2007-11-20 Renovis, Inc. Bicycloheteroaryl compounds as P2X7 modulators and uses thereof
WO2007055374A1 (en) 2005-11-14 2007-05-18 Mitsubishi Tanabe Pharma Corporation Therapeutic agent for osteoporosis
CA2645652A1 (en) 2006-03-16 2007-09-27 Renovis, Inc. Bicycloheteroaryl compounds as p2x7 modulators and uses thereof
TWI464148B (en) 2006-03-16 2014-12-11 Evotec Us Inc Bicycloheteroaryl compounds as p2x7 modulators and uses thereof
US20100298285A1 (en) 2006-03-16 2010-11-25 Kelly Michael G Biclycloheteroaryl Compounds as P2x7 Modulators and Uses Thereof
US20100184802A1 (en) 2006-03-16 2010-07-22 Kelly Michael G Bicycloheteroaryl Compounds as P2X7 Modulators and Uses Thereof
ES2569677T3 (en) 2006-03-16 2016-05-12 Second Genome, Inc. Bicycloheteroaryl compounds as modulators of P2X7 and uses thereof
MX2008011919A (en) 2006-03-16 2008-11-28 Renovis Inc Bicycloheteroaryl compounds as p2x7 modulators and uses thereof.
GB0611154D0 (en) 2006-06-06 2006-07-19 Glaxo Group Ltd Novel receptor antagonists and their methods of use
ATE489088T1 (en) 2006-06-06 2010-12-15 Glaxo Group Ltd N-(PHENYLMETHYL)-2-(1H-PYRAZOLE-4-YL) ACETAMIDE DERIVATIVES AS P2X7 ANTAGONISTS FOR THE TREATMENT OF PAIN, INFLAMMATION AND NEURODEGENERATION
PL2049478T3 (en) 2006-07-06 2012-09-28 Glaxo Group Ltd Substituted n-phenylmethyl -5-oxo-proline-2-amides as p2x7-receptor antagonists and their methods of use
TW200838516A (en) 2007-01-31 2008-10-01 Merck & Co Inc Substituted pyrano[2,3-B]pyridine derivatives as cannabinoid-1 receptor modulators
EP2124562B1 (en) 2007-03-09 2016-04-20 Second Genome, Inc. Bicycloheteroaryl compounds as p2x7 modulators and uses thereof
PE20091225A1 (en) 2007-03-22 2009-09-16 Astrazeneca Ab QUINOLINE DERIVATIVES AS ANTAGONISTS OF THE P2X7 RECEPTOR
GB0705882D0 (en) 2007-03-27 2007-05-02 Glaxo Group Ltd Novel compounds
WO2008116845A1 (en) 2007-03-28 2008-10-02 Glaxo Group Limited Piperidinone carboxamide derivatives as p2x7 modulators
JP2010522710A (en) 2007-03-29 2010-07-08 グラクソ グループ リミテッド Oxazolidine and morpholinecarboxamide derivatives as P2X7 modulators
KR20090127435A (en) 2007-04-03 2009-12-11 글락소 그룹 리미티드 Imidazolidine carboxamide derivatives as p2x7 modulators
WO2008125600A2 (en) 2007-04-11 2008-10-23 Glaxo Group Limited Pyrazole derivatives as p2x7 modulators
DE602008005582D1 (en) 2007-05-10 2011-04-28 Glaxo Group Ltd PYRAZONE DERIVATIVES AS P2X7 MODULATORS
PE20091036A1 (en) 2007-11-30 2009-08-15 Astrazeneca Ab QUINOLINE DERIVATIVE AS ANTAGONIST OF THE P2X7 RECEPTOR
GB0724258D0 (en) 2007-12-12 2008-01-30 Glaxo Group Ltd Novel combinations
WO2009074518A1 (en) 2007-12-12 2009-06-18 Glaxo Group Limited Combinations of prolinamide p2x7 modulators with further therapeutic agents
GB0724625D0 (en) 2007-12-18 2008-01-30 Glaxo Group Ltd Novel compounds
CA2709821A1 (en) 2007-12-18 2009-06-25 Glaxo Group Limited 5-oxo-3-pyrrolidinecarboxamide derivatives as p2x7 modulators
BRPI0910034B1 (en) 2008-03-25 2022-02-08 Affectis Pharmaceuticals Ag P2X7R ANTAGONISTS AND PHARMACEUTICAL COMPOSITIONS THAT COMPRISE THEM
EP2243772B1 (en) 2009-04-14 2012-01-18 Affectis Pharmaceuticals AG Novel P2X7R antagonists and their use
GB0919594D0 (en) 2009-11-09 2009-12-23 Glaxo Group Ltd Compounds
US20120157494A1 (en) 2010-12-16 2012-06-21 Harris Iii Ralph New Isoindolyl compounds
JP2014513671A (en) 2011-02-22 2014-06-05 アクテリオン ファーマシューティカルズ リミテッド Benzamide derivatives as P2X7 receptor antagonists
WO2012163792A1 (en) 2011-05-27 2012-12-06 Affectis Pharmaceuticals Ag Novel p2x7r antagonists and their use
AR087274A1 (en) 2011-07-22 2014-03-12 Actelion Pharmaceuticals Ltd DERIVATIVES OF AMETAS HETEROCICLICAS AS ANTAGONISTAS OF RECEPTORS P2X7
TW201427947A (en) 2012-10-12 2014-07-16 Lundbeck & Co As H Cyclic amines
TWI598325B (en) 2012-10-12 2017-09-11 H 朗德貝克公司 Benzamides
CA2890886C (en) 2012-12-12 2020-10-27 Actelion Pharmaceuticals Ltd Indole carboxamide derivatives as p2x7 receptor antagonists
WO2014097140A1 (en) 2012-12-18 2014-06-26 Actelion Pharmaceuticals Ltd Indole carboxamide derivatives as p2x7 receptor antagonists
JP6282016B2 (en) 2013-01-22 2018-02-21 イドーシア ファーマシューティカルズ リミテッドIdorsia Pharmaceuticals Ltd Heterocyclic amide derivatives as P2X7 receptor antagonists

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008066789A2 (en) 2006-11-27 2008-06-05 H. Lundbeck A/S Heteroaryl amide derivatives
WO2008124153A1 (en) 2007-04-10 2008-10-16 H. Lundbeck A/S Heteroaryl amide analogues as p2x7 antagonists
WO2009012482A2 (en) * 2007-07-19 2009-01-22 H.Lundbeck A/S 5-membered heterocyclic amides and related compounds
WO2009023623A1 (en) 2007-08-10 2009-02-19 H, Lundbeck A/S Heteroaryl amide analogues
WO2009108551A2 (en) 2008-02-25 2009-09-03 H. Lundbeck A/S Heteroaryl amide analogues
WO2009132000A1 (en) 2008-04-22 2009-10-29 Janssen Pharmaceutica Nv Quinoline or isoquinoline substituted p2x7 antagonists
WO2013108227A1 (en) 2012-01-20 2013-07-25 Actelion Pharmaceuticals Ltd Heterocyclic amide derivatives as p2x7 receptor antagonists

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Salt selection for basic drugs", INT. J. PHARM., vol. 33, 1986, pages 201 - 217
ANGEW. CHEM. INT. ED., vol. 44, 2005, pages 1549 - 1551
BIOORG. MED. CHEM., vol. 7, 1999, pages 1505 - 1511
CHESSELL, . P.; HATCHER, J. P. ET AL., PAIN, vol. 114, no. 3, 2005, pages 386 - 96
DEUCHARS, S. A.; ATKINSON, L. ET AL., J. NEUROSCI., vol. 21, no. 18, 2001, pages 7143 - 52
FERRARI, D.; CHIOZZI, P. ET AL., NEUROPHARMACOLOGY, vol. 36, no. 9, 1997, pages 1295 - 301
J. AM. CHEM. SOC., vol. 133, 2011, pages 6948 - 6951
J. ORG. CHEM., vol. 72, 2007, pages 7455 - 7458
J. ORG. CHEM., vol. 73, 2008, pages 1643 - 1645
NORTH, R. A., PHYSIOL. REV., vol. 82, no. 4, 2002, pages 1013 - 67
REMINGTON: "The Science and Practice of Pharmacy", 2005, PHARMACEUTICAL MANUFACTURING
SOLLE, M.; LABASI, J. ET AL., J. BIOL. CHEM., vol. 276, no. 1, 2001, pages 125 - 32
SPERLAGH, B.; KOFALVI, A. ET AL., J. NEUROCHEM., vol. 81, no. 6, 2002, pages 1196 - 211
SURPRENANT, A.; RASSENDREN, F. ET AL., SCIENCE, vol. 272, no. 5262, 1996, pages 735 - 8
T.W. GREENE; P.G.M. WUTS: "Protective Groups in Organic Synthesis", 1999, WILEY-INTERSCIENCE
VIRGINIO, C.; MACKENZIE, A. ET AL., J. PHYSIOL., vol. 519, 1999, pages 335 - 46
WILEY, J. S.; CHEN, J. R. ET AL., CIBA FOUND SYMP., vol. 198, 1996, pages 149 - 60
YU, Y.; UGAWA, S. ET AL., BRAIN. RES., vol. 1194, 2008, pages 45 - 55

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9221832B2 (en) 2011-07-22 2015-12-29 Actelion Pharmaceuticals Ltd. Heterocyclic amide derivatives as P2X7 receptor antagonists
US9409917B2 (en) 2012-01-20 2016-08-09 Actelion Pharmaceuticals Ltd. Heterocyclic amide derivatives as P2X7 receptor antagonists
US9718774B2 (en) 2012-12-12 2017-08-01 Idorsia Pharmaceuticals Ltd Indole carboxamide derivatives as P2X7 receptor antagonist
US9556117B2 (en) 2012-12-18 2017-01-31 Actelion Pharmaceuticals Ltd. Indole carboxamide derivatives as P2X7 receptor antagonists
JP2016506915A (en) * 2013-01-22 2016-03-07 アクテリオン ファーマシューティカルズ リミテッドActelion Pharmaceuticals Ltd Heterocyclic amide derivatives as P2X7 receptor antagonists
US9388197B2 (en) 2013-01-22 2016-07-12 Actelion Pharmaceuticals Ltd. Heterocyclic amide derivatives as P2X7 receptor antagonists
US11077100B2 (en) 2017-03-13 2021-08-03 Raqualia Pharma Inc. Tetrahydroquinoline derivatives as P2X7 receptor antagonists
US11439633B2 (en) 2017-03-13 2022-09-13 Raqualia Pharma Inc. Tetrahydroquinoline derivatives as P2X7 receptor antagonists

Also Published As

Publication number Publication date
CN104918946B (en) 2017-03-29
CA2897459C (en) 2021-03-02
EP2956457B1 (en) 2016-11-23
KR20150107881A (en) 2015-09-23
JP6282017B2 (en) 2018-02-21
EP2956457A1 (en) 2015-12-23
KR102220847B1 (en) 2021-02-26
US20150361097A1 (en) 2015-12-17
JP2016510325A (en) 2016-04-07
ES2616883T3 (en) 2017-06-14
US9388198B2 (en) 2016-07-12
CA2897459A1 (en) 2014-07-31
CN104918946A (en) 2015-09-16

Similar Documents

Publication Publication Date Title
US9388198B2 (en) Heterocyclic amide derivatives as P2X7 receptor antagonists
EP2804865B1 (en) Heterocyclic amide derivatives as p2x7 receptor antagonists
EP2956135B1 (en) Heterocyclic amide derivatives as p2x7 receptor antagonists
CA2890886C (en) Indole carboxamide derivatives as p2x7 receptor antagonists
EP2734526B1 (en) Heterocyclic amide derivatives as p2x7 receptor antagonists
CA2891499A1 (en) Indole carboxamide derivatives as p2x7 receptor antagonists
CA3237721A1 (en) Sulfonamide compounds for the treatment of neurological conditions
JP2014502993A (en) Piperazine derivatives as CaV2.2 calcium channel blockers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14703442

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2014703442

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014703442

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2897459

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2015553217

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14762717

Country of ref document: US

ENP Entry into the national phase

Ref document number: 20157022715

Country of ref document: KR

Kind code of ref document: A