WO2014093504A1 - Microrna biomarkers for graft versus host disease - Google Patents

Microrna biomarkers for graft versus host disease Download PDF

Info

Publication number
WO2014093504A1
WO2014093504A1 PCT/US2013/074426 US2013074426W WO2014093504A1 WO 2014093504 A1 WO2014093504 A1 WO 2014093504A1 US 2013074426 W US2013074426 W US 2013074426W WO 2014093504 A1 WO2014093504 A1 WO 2014093504A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
gvhd
mirna
subject
biological sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/074426
Other languages
French (fr)
Inventor
You-wen HE
Bin Xiao
Nelson J. Chao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Duke University
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Publication of WO2014093504A1 publication Critical patent/WO2014093504A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the presently disclosed subject matter relates to miRNA biomarkers for monitoring, predicting, diagnosising, and prognosing Graft versus Host Disease (GVHD).
  • GVHD Graft versus Host Disease
  • MicroRNAs constitute an evolutionary conserved class of RNA
  • miRNAS are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another R ase III termed Dicer cleaves of the loop of the pre-miR A hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miR A into a miR A-protein (miRNP).
  • pre-miRNAs stem-loop structured precursors
  • Dicer Dicer cleaves of the loop of the pre-miR A hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miR A into a miR A-protein (miRNP).
  • the miRNA guides the miRNPs to their target mRNAs where they exert their function (reviewed, e.g. in Bartel, D. P. (2004) Cell 23, 281-292; He, L. and Hannon, G. J. (2004) Nat. Rev. Genet. 5, 522-531).
  • miRNAs are present in plasma, serum, saliva, urine and other bodily fluids in a remarkably stable form that is protected from endogenous RNase activity.
  • Several publications have demonstrated that circulating miRNA may have potential use as a biomarker for cancer, cardiovascular diseases, ectoptic pregnancy, liver injury and the like.
  • Acute graft-versus-host disease is a common complication after allgeneic hematopoietic cell transplantation (HCT), affecting the skin, liver and gastrointestinal tract and contributing to transplant related morbidity and mortality.
  • HCT allgeneic hematopoietic cell transplantation
  • Approximately half of patients following HCT will develop GVHD and require systemic treatment.
  • the diagnosis of acute GVHD is based on clinical criteria that may be confirmed by biopsy of one of the three (3) target organs: skin, gastrointestinal tract, and/or liver.
  • Intensive studies have been devoted to identifying blood biomarkers for GVHD to improve the diagnosis and individualized treatment, and the majority of the work was focused on whole proteins or polypeptide.
  • inflammation conditions such as sepsis, idiopathic pneumonia syndrome, and veno-occlusive disease.
  • qPCR-based assay quantitative polymerase chain reaction-based assay
  • One aspect of the present disclosure provides a method of determining the risk of, prognosis of, and/or diagnosis of GVHD in a subject comprising, consisting of, or consisting essentially of quantifying the amount of at least one biomarker present in a biological sample derived from the subject, wherein the biomarker comprises, consists of, or consists essentially of an miR A associated with GVHD.
  • Another aspect of the present disclosure provides a method of diagnosing GVHD in a subject comprising, consisting of, or consisting essentially of: obtaining a biological sample from a subject; determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and (d) administering appropriate anti-GVHD therapy if one or more of the biomarkers are expressed.
  • Another aspect of the present disclosure provides a method of determining the risk of a subject developing GVHD comprising, consisting of, or consisting essentially of:
  • obtaining a biological sample from a subject determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and administering an appropriate prophylactic anti-GVHD therapy if one or more of the biomarkers are expressed.
  • Another aspect of the present disclosure provides a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising, consisting of, or consisting essentially of: obtaining a biological sample from a subject; determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and administering an appropriate anti-GVHD therapy or altering an already administered anti-GVHD therapy, if one or more of the biomarkers are expressed.
  • Another aspect of the present disclosure provides a method determining the efficacy of an GVHD treatment regime in a subject comprising, consisting of, or consisting essentially of: determining a baseline value for the expression of one or more miRNA biomarkers associated with GVHD; administering to the subject an anti-GVHD therapy regime; and redetermining the expression levels of one or more biomarkers in the subject, wherein observed decreases in one or more of the miRNA biomarker expression levels is correlated with the efficacy of the therapeutic regimen.
  • composition of matter comprising, consisting of, or consisting essentially of: a probe array for determining an miRNA level in a sample, the array comprising of a plurality of probes that hybridizes to one or more miRNAs that are associated with GVHD; or a kit for determining an miRNA level in a sample, comprising the probe array of and instructions for carrying out the determination of miRNA expression level in the sample.
  • the probe array of further comprises a solid support with the plurality of probes attached thereto.
  • the biomarker is selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and combinations thereof.
  • the biomarker comprises miR-423, miR-199a-3p, miR-93*, miR-377 and combinations thereof.
  • the subject is a mammal. In other embodiments, the subject is a human.
  • the biological sample is selected from the group consisting of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the sample comprises plasma.
  • FIG 1 shows the hierarchical clustering analysis of differentially expressed miRNAs in plasma of acute GVDH patients. miRNA profiling in plasma from 4 GVHD patients and 3 non-GVHD patients was performed by using quantitative RT-PCR based high throughput miRNA array.
  • ROC Receiver Operating Characteristic
  • FIG's 5A-50 are graphs showing the predictive value of the miRNA signature for GVHD.
  • H Plasma concentration of sIL-2Ra at 6 weeks after HCT in non-GVHD and GVHD patients before GVHD diagnosis.
  • (I-L) The expression of the 4-miRNA panel at 2 weeks after HCT in plasma of GVHD and non-GVHD patients.
  • (M) ROC curve of the 4-miRNA panel at 2 weeks after HCT when predicting GVHD.
  • N Plasma concentration of sIL-2Ra at 2 weeks after HCT.
  • O ROC curve of sIL-2Ra at 2 weeks after HCT when predicting GVHD.
  • FIG's 6A-6L are graphs showing correlation of the miRNA signature with GVHD severity. Expression levels of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-155 and (F) miR-30a in GVHD patients with different grade (grade 1-2 vs grade 3-4). P values were based on Mann-Whitney test. *, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001. The kinetic expression of the miRNA signature in a set of 9 patients before disease onset (at 2 weeks after HCT) and after onset (at 6 weeks after HCT) is shown in (G) miR-423, (H)
  • FIG 7 is a graph showing correlation of the expression of the 4 miRNA panel and overall survival of GVHD patients. All GVHD patients were divided into 2 groups (high and low risk) based on the predicted probabilities for developing GVHD using the 4 miRNA panel.
  • FIG's 8A-8B are graphs showing Spearman correlation analysis to test whether the expression of the four miRNAs are correlated with each other.
  • A Correlation analysis of miR-199a-3p and miR-423.
  • B Correlation analysis of miR-93* and miR-377.
  • FIG's 10A-10F are graphs showing ROC curve analysis for each of 6 miRNA's individually (A) miR-423, (B) miR-199a-3p, (C) miR-377, (D) miR-93*, (E) miR-155, and (F) miR-30a to evaluate the sensitivity and selectivity of the miRNAs as a diagnostic biomarker for GVHD.
  • Articles "a” and “an” are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article.
  • an element means at least one element and can include more than one element.
  • the term "miR A” or “miR” or “microR A” refers to a non-coding RNA between 10 and 30 nucleotides in length which hybridizes to and regulates the expression of a coding RNA (see, Zeng and Cullen, RNA, 9(1): 112-123, 2003; Kidner and Martienssen Trends Genet, 19(1): 13-6, 2003; Dennis C, Nature, 420(6917):732, 2002; Couzin J, Science 298(5602):2296-7, 2002, each of which is incorporated by reference herein).
  • a 10 to 30 nucleotide miRNA molecule can be obtained from a miRNA precursor through natural processing means (e.g., using intact cells or cell lysates) or by synthetic processing routes (e.g., using isolated processing enzymes, such as isolated Dicer, Argonaut, or RNAse III). It is understood that the 10 to 30 nucleotide RNA molecule can also be produced directly or by biological or chemical synthesis, without having been processed from a miR precursor.
  • miRNA molecules include pre-miRNA, pri-miRNA, miRNA molecules identical in nucleic acid sequence to the natural forms as well as nucleic acid sequences, wherein one or more nucleic acids has been replaced or is represented by one or more DNA nucleotides and/or nucleic acid analogue.
  • miRNA molecules in the present specification are occasionally referred to as a nucleic acid molecule(s) encoding a miR A or simply nucleic acid molecule(s).
  • biomarker refers to a naturally occurring biological molecule present in a subject at varying concentrations useful in predicting the risk or incidence of a disease or a condition, such as GVHD.
  • the biomarker can be an miRNA present in higher or lower amounts in a subject at risk for GVHD.
  • the biomarker can include nucleic acids, ribonucleic acids, or a polypeptide used as an indicator or marker for GVHD in a cell, tissue or subject.
  • the biomarker is an miRNA.
  • GVHD acute graft-versus-host disease
  • GVHD graft-versus-host disease
  • treatment refers to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible.
  • the aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition.
  • Treatment refers to one or both of therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented.
  • Treatment/therapy regimens will be different for each subject depending on several factors, including age/health of subject, stage of disease, etc. and can be readily determined by one skilled in the art (e.g., attending physician).
  • possible treatment/therapys include, but are not limited to, administration of immunosuppressive drugs (e.g., mycophenolate mofetil, Alemtuzumab [Campath], ATG, Sirolimus, etc.), selective depletion of alloreactive T lymphocytes, use of monoclonal antibodies (e.g., anti-CD3, anti-CD5, IL-2 antibodies) etc.
  • the term "prophylactic treatments” refer to those therapies that are used to prevent the occurrence of a condition such as GVHD from happening. Suitable prophylactic treatments may include prophylactic treatment with immunosuppressive drugs, use of umbilical cord blood as the source of donor cells, closer HLA matching between donor and patients, etc.
  • an effective amount or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.
  • the present disclosure provides miRNA biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of GVHD in a subject.
  • the present disclosure also provides methods of using such miRNA expression profiles to monitor a subject's response to treatment (e.g., efficacy of a treatment or therapy regimen) for conditions such as GVHD.
  • the methods of the present disclosure are noninvasive, highly specific, and sensistive.
  • the present disclosure profiles circulating miRNA as biomarkers for the diagnosis and prognosis of GVHD.
  • the present disclosure identifies plasma or tissue miRNA profiles as biomarkers for determining the risk of, prognosis of, and/or diagnosis of conditions such as GVHD.
  • miRNAs are key epigenetic regulators of gene expression, and their expression is highly regulated. Therefore, deregulation of miRNAs can play an important role in the development and progression of various conditions, such as GVHD.
  • the inventors have determined that miRNAs are directly involved in the development and progression of GVHD, and their expression pattern in plasma can be associated with the pathophysiological status of GVHD. It was discovered that miRNA expression patterns in subjects with GVHD are distinctly different from that of normal controls. Plasma miR As are stable under harsh conditions, including freezing and thawing, high temperature storage (up to 37°C), acidic conditions, and RNase digestion.
  • One aspect of the present disclosure provides miRNA biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of conditions such as GVHD.
  • the present disclosure provides miRNA biomarkers that are differentially expressed, such as upregulated, down-regulated, or disregulated in a condition such as GVHD, as compared to normal populations who do not have the condition, such as GVHD.
  • the biomarkers of the present disclosure are selected from one or any combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363.
  • the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377 and combinations thereof. The biomarkers are shown in Table 1 below.
  • let-7b 22 UGAGGUAGUAGGUUGUGUGGUU
  • the biomarkers are selected from one or more miRNAs that are up-regulated or over-expressed in GVHD.
  • the biomarkers for GVHD are selected from miR-423, miR-199a-3p, miR-93*, miR-377 or any combination thereof, wherein the up-regulation or over-expression of one or more aforementioned miRNA biomarkers in the subject's biological sample, when compared to a control, indicates that the subject has GVHD.
  • the biomarkers are selected from one or more miRNAs up-regulated or over-expressed more than 50-fold, 40-fold, 30-fold, 20-fold, 15-fold, 10-fold, 9-fold, 8-fold, 7-fold, 6-fold, 5-fold, 4-fold, 3-fold, 2-fold, or 1-fold in GVHD subjects, when compared to a control in GVHD.
  • the biomarkers for GVHD are selected from miR-423, miR-199a-3p, miR-93*, miR-377 , or any combination thereof, wherein the up-regulation or over-expression of the the one or more aforementioned miRNA biomarkers in the subject's biological sample, when compared to a control, indicates that the subject has GVHD.
  • the present disclosure provides a method for diagnosing condition such as GVHD in a subject comprising, consisting of, or consisting essentially of:
  • the present disclosure provides a method for determining the risk of a subject developing a condition such as GVHD comprising, consisting of, or consisting essentially of:
  • the present disclosure provides a method for determining the prognosis of a subject developing, or having already developed, a condition such as GVHD comprising, consisting of, or consisting essentially of:
  • the method further includes obtaining the biological sample from the subject.
  • the diagnosis and/or prognosis of a condition such as GVHD can be determined by comparing the subjects miRNA profile to a reference miRNA profile, such as one that corresponds to biological samples obtained froma normal population that do not have a condition such as GVHD, or that corresponds to biological samples obtained from a population that have a condition such as GVHD.
  • the reference profile comprises multiple miRNA expression profiles, with each corresponding to a different stage of a condition such as GVHD.
  • the term "subject” and “patient” are used interchangeably herein and refer to both human and nonhuman animals.
  • the term “nonhuman animals” of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like.
  • the subject is a human patient.
  • biological sample includes, but is not limited to, a sample containing tissues, cells, and/or biological fluids isolated from a subject.
  • biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus and tears.
  • the biological sample is a blood sample (such as a plasma sample).
  • a biological sample may be obtained directly from a subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary, such as a healthcare provider or lab technician).
  • the present disclosure provides methods for diagnosing a condition such as GVHD by characterizing one or a combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any
  • the present disclosure provides methods for diagnosing conditions such as GVHD by characterizing miR A selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any
  • the biomarkers include miR-423, miR-1 9a-3p, miR-93*, miR-377 and any combinations thereof.
  • the present disclosure provides methods for determining the risk of a subject developing a condition such as GVHD by characterizing one or a
  • biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof.
  • the present disclosure provides methods for determining the risk of a subject developing a condition such as GVHD by characterizing miRNA selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof, wherein the up-regulation or over-expression of one or more of the aforementioned miRNA, when compared to a control, indicates that the subject has a condition such as GVHD.
  • the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377 and any combination thereof, wherein the up
  • the present disclosure provides methods for
  • determining the prognosis of a subject having a condition such as GVHD by characterizing one or a combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof.
  • the present disclosure provides methods for determining the prognosis of a subject having a condition such as GVHD by characterizing miRNA selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any combinations thereof, wherein the up-regulation or over-expression of one or more of the aforementioned miRNA, when compared to a control, indicates that the subject has a condition such as GVHD.
  • the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377
  • the method comprises a method of determining the efficacy of an GVHD treatment regime in a subject comprising, consisting of, or consisting essentially of: (a) determining a baseline value for the expression of one or more miRNA baiomarkers associated with GVHD; (b) administering to the subject an anti-GVHD therapy regime; and (c) reetermining the expression levels of one or more biomarkers in the subject, wherein observed decreases in one or more or the miRNA biomarker expression levels is correlated with the efficacy of the therapeutic regimen.
  • composition of matter comprising, consisting of, or consisting essentially of: (a) a probe array for determining an miRNA level in a sample, the array comprising of a plurality of probes that hybridizes to one or more miRNAs that are associated with GVHD; or (b) a kit for determining an miRNA level in a sample, comprising the probe array of (a) and instructions for carrying out the determination of miRNA expression level in the sample.
  • the probe array of (a) further comprises a solid support with the plurality of probes attached thereto.
  • the present disclosure provides a method of determining the risk of, prognosis of, and/or diagnosis of a condition such as GVHD on at least one sample obtained from an individual.
  • the individual may be any mammal, but is preferably a human.
  • the present disclosure may involve obtaining more than one sample, such as two samples, such as three samples, four samples or more from individuals, and preferably the same individual. This allows the relative comparison of expression both as in the presence or absence of at least one nucleic acid and/or the level of expression of the at least one nucleic acid between the two samples.
  • a single sample may be compared against a "standardized" sample, such a sample comprising material or data from several samples, preferably also from several individuals.
  • sample preparation operations will include such manipulations as concentration, suspension, extraction of intracellular material, e.g., nucleic acids from tissue/whole cell samples and the like, amplification of nucleic acids, fragmentation, transcription, labelling and/or extension reactions.
  • Nucleic acids, especially RNA and specifically miRNA can be isolated using any techniques known in the art. There are two main methods for isolating RNA: phenol-based extraction and silica matrix or glass fiber filter (GFF)-based binding. Phenol-based reagents contain a combination of denaturants and RNase inhibitors for cell and tissue disruption and subsequent separation of RNA from contaminants. Phenol-based isolation procedures can recover RNA species in the 10-200-nucleotide range e.g., miRNAs, 5S rRNA, 5.8S rRNA, and Ul snRNA.
  • GFF silica matrix or glass fiber filter
  • RNA total RNA
  • Extraction procedures such as those using Trizol or TriReagent, however will purify all RNAs, large and small, and are the recommended methods for isolating total RNA from biological samples that will contain miRNAs/siRNAs.
  • an aspect of the present disclosure relates to the detection of the miRNA sequences as described in the plots and graphs of the figures contained herein.
  • the term “detect” or “determine the presence of refers to the qualitiative measurement of undetectable, low, normal, or high concentrations of one or more biomarkers such as, for example, nucleic acids, ribonucleic acids, or polypeptides and other biological molecules.
  • Detection may include 1) detection in the sense of presence versus absence of one or more miRNAs as well as 2) the registration / quantification of the level or degree of expression of one or more miRNAs, depending on the method of detection employed.
  • Quantify or “quantification” may be used interchangeable, and refer to a process of determining the quantity or abundance of a substance in a sample (e.., a biomarker), whether relative or absolute.
  • quantification may be determined by methods including but not limited to, micro-array analysis, qRT-PCR, band intensity on a Northern or Western blot, or by various other methods known in the art.
  • the detection of one or more nucleic acid molecules allows for the classification, diagnosis and prognosis of a condition such as GVHD.
  • the classification of such conditions is of relevance both medically and scientifically and may provide important information useful for the diagnosis, prognosis and treatment of the condition.
  • the diagnosis of a condition such as a GVHD is the affirmation of the presence of the disease based, as is the object of the present disclosure, on the expression of at least one miRNA herein also referred to as a nucleic acid molecule.
  • Prognosis is the estimate or prediction of the probable outcome of a condition such as a GVHD and the prognosis of such is greatly facilitated by increasing the amount of information on the particular condition.
  • the method of detection is thus a central aspect of the present disclosure.
  • the detection methods may be generic for the detection of nucleic acids especially RNA, or be optimized for the detection of small RNA species, as both mature and precursor miRNAs fall into this category or be specially designed for the detection of miRNA species.
  • the detection methods may be directed towards the scoring of a presence or absence of one or more nucleic acid molecules or may be useful in the detection of expression levels.
  • the detection methods can be divided into two categories herein referred to as in situ methods or screening methods.
  • the term in situ method refers to the detection of nucleic acid molecules in a sample wherein the structure of the sample has been preserved. This may thus be a biopsy wherein the structure of the tissue is preserved.
  • In situ methods are generally histological i.e. microscopic in nature and include but are not limited to methods such as: in situ hybridization techniques and in situ PCR methods.
  • Screening methods generally employ techniques of molecular biology and most often require the preparation of the sample material in order to access the nucleic acid molecules to be detected. Screening methods include, but are not limited to methods such as: Array systems, affinity matrices, Northern blotting and PCR techniques, such as real-time quantitative RT-PCR.
  • a probe as defined herein is a specific sequence of a nucleic acid used to detect nucleic acids by hybridization.
  • a nucleic acid is also here any nucleic acid, natural or synthetic such as DNA, RNA, LNA or PNA.
  • a probe may be labeled, tagged or immobilized or otherwise modified according to the requirements of the detection method chosen.
  • a label or a tag is an entity making it possible to identify a compound to which it is associated.
  • probes that are labeled or tagged by any means known in the art such as but not limited to: radioactive labeling, fluorescent labeling and enzymatic labeling.
  • the probe, labeled or not may be immobilized to facilitate detection according to the detection method of choice and this may be accomplished according to the preferred method of the particular detection method.
  • Another aspect of the present disclosure regards the detection of nucleic acid molecules by any method known in the art.
  • detection methods that can be employed for this purpose, and the present disclosure includes all the mentioned methods, but is not limited to any of these.
  • ISH In situ hybridization
  • ISH is a type of hybridization that uses a complementary nucleic acid to localize one or more specific nucleic acid sequences in a portion or section of tissue (in situ), or, if the tissue is small enough, in the entire tissue (whole mount ISH).
  • DNA ISH can be used to determine the structure of chromosomes and the localization of individual genes and optionally their copy numbers.
  • Fluorescent DNA ISH can for example be used in medical diagnostics to assess chromosomal integrity.
  • RNA ISH is used to assay expression and gene expression patterns in a tissue/across cells, such as the expression of miRNAs/nucleic acid molecules as herein described.
  • Sample cells are treated to increase their permeability to allow the probe to enter the cells, the probe is added to the treated cells, allowed to hybridize at pertinent temperature, and then excess probe is washed away.
  • a complementary probe is labeled with a radioactive, fluorescent or antigenic tag, so that the probe's location and quantity in the tissue can be determined using autoradiography, fluorescence microscopy or immunoassay, respectively.
  • the sample may be any sample as herein described.
  • the probe is likewise a probe according to any probe based upon the miRNAs mentioned herein.
  • In situ PCR is the PCR based amplification of the target nucleic acid sequences prior to ISH.
  • an intracellular reverse transcription (RT) step is introduced to generate complementary DNA from RNA templates prior to in situ PCR. This enables detection of low copy RNA sequences.
  • PCR amplification of target sequences is next performed either in intact cells held in suspension or directly in cytocentrifuge preparations or tissue sections on glass slides.
  • fixed cells suspended in the PCR reaction mixture are thermally cycled using conventional thermal cyclers.
  • the cells are cytocentrifugated onto glass slides with visualization of intracellular PCR products by ISH or immunohistochemistry.
  • In situ PCR on glass slides is performed by overlaying the samples with the PCR mixture under a coverslip which is then sealed to prevent evaporation of the reaction mixture.
  • Thermal cycling is achieved by placing the glass slides either directly on top of the heating block of a conventional or specially designed thermal cycler or by using thermal cycling ovens. Detection of intracellular PCR-products is achieved by one of two entirely different techniques. In indirect in situ PCR by ISH with PCR-product specific probes, or in direct in situ PCR without ISH through direct detection of labelld nucleotides (e.g. digoxigenin- 11 -dUTP, fluorescein-dUTP, H-CTP or biotin- 16-dUTP) which have been incorporated into the PCR products during thermal cycling.
  • labelld nucleotides e.g. digoxigenin- 11 -dUTP, fluorescein-dUTP, H-CTP or biotin- 16-dUTP
  • An embodiment of the present disclosure concerns the method of in situ PCR as mentioned herein above for the detection of nucleic acid molecules as detailed herein.
  • a microarray is a microscopic, ordered array of nucleic acids, proteins, small molecules, cells or other substances that enables parallel analysis of complex biochemical samples.
  • a DNA microarray consists of different nucleic acid probes, known as capture probes that are chemically attached to a solid substrate, which can be a microchip, a glass slide or a microsphere-sized bead. Microarrays can be used e.g. to measure the expression levels of large numbers of mRNAs/miRNAs simultaneously.
  • Microarrays can be fabricated using a variety of technologies, including printing with fine-pointed pins onto glass slides, photolithography using pre -made masks,
  • RNA is extracted from a cell or tissue sample, the small RNAs (18-26-nucleotide RNAs) are size-selected from total RNA using denaturing polyacrylamide gel electrophoresis (PAGE). Then oligonucleotide linkers are attached to the 5' and 3' ends of the small RNAs and the resulting ligation products are used as templates for an RT-PCR reaction with 10 cycles of amplification.
  • the sense strand PCR primer has a Cy3 fluorophore attached to its 5' end, thereby fluorescently labelling the sense strand of the PCR product.
  • the PCR product is denatured and then hybridized to the microarray.
  • a PCR product, referred to as the target nucleic acid that is complementary to the corresponding miRNA capture probe sequence on the array will hybridize, via base pairing, to the spot at which the capture probes are affixed.
  • the spot will then fluoresce when excited using a microarray laser scanner.
  • the fluorescence intensity of each spot is then evaluated in terms of the number of copies of a particular miRNA, using a number of positive and negative controls and array data normalization methods, which will result in assessment of the level of expression of a particular miRNA.
  • microarrays can be employed such as spotted oligonucleotide microarrays, pre-fabricated oligonucleotide microarrays or spotted long oligonucleotide arrays.
  • oligonucleotide microarrays the capture probes are oligonucleotides complementary to miRNA sequences.
  • This type of array is typically hybridized with amplified PCR products of size-selected small RNAs from two samples to be compared that are labelled with two different fluorophores.
  • total RNA containing the small RNA fraction is extracted from the abovementioned two samples and used directly without size-selection of small RNAs, and 3' end labeled using T4 RNA ligase and short RNA linkers labelled with two different fluorophores.
  • the samples can be mixed and hybridized to one single microarray that is then scanned, allowing the visualization of up-regulated and down-regulated miRNA genes in one go.
  • the downside of this is that the absolute levels of gene expression cannot be observed, but the cost of the experiment is reduced by half.
  • a universal reference can be used, comprising of a large set of fluorophore-labelled
  • oligonucleotides complementary to the array capture probes.
  • the probes are designed to match the sequences of known or predicted miRNAs.
  • miRNAs There are commercially available designs that cover complete genomes from companies such as Affymetrix, or Agilent. These microarrays give estimations of the absolute value of gene expression and therefore the comparison of two conditions requires the use of two separate microarrays.
  • Spotted long oligonucleotide arrays are composed of 50 to 70-mer oligonucleotide capture probes, and are produced by either ink-jet or robotic printing.
  • Short Oligonucleotide Arrays are composed of 20-25 -mer oligonucleotide probes, and are produced by photolithographic synthesis (Affymetrix) or by robotic printing. More recently, Maskless Array Synthesis from NimbleGen Systems has combined flexibility with large numbers of probes. Arrays can contain up to 390,000 spots, from a custom array design.
  • An embodiment of the present disclosure concerns the method of microarray use and analysis as described herein.
  • PCR reaction means interchangeable terms used to signify use of a nucleic acid amplification system, which multiplies the target nucleic acids being detected.
  • examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • Other methods recently described and known to the person of skill in the art are the nucleic acid sequence based amplification and Q Beta Replicase systems.
  • the products formed by said amplification reaction may or may not be monitored in real time or only after the reaction as an end-point measurement.
  • Real-time quantitative RT-PCR is a modification of polymerase chain reaction used to rapidly measure the quantity of a product of polymerase chain reaction. It is preferably done in real-time, thus it is an indirect method for quantitatively measuring starting amounts of DNA, complementary DNA or ribonucleic acid (RNA). This is commonly used for the purpose of determining whether a genetic sequence is present or not, and if it is present the number of copies in the sample. There are 3 methods which vary in difficulty and detail. Like other forms of polymerase chain reaction, the process is used to amplify DNA samples, using thermal cycling and a thermostable DNA polymerase.
  • Agarose gel electrophoresis is the simplest method, but also often slow and less accurate then other methods, depending on the running of an agarose gel via electrophoresis. It cannot give results in real time.
  • the unknown sample and a known sample are prepared with a known concentration of a similarly sized section of target DNA for amplification. Both reactions are run for the same length of time in identical conditions (preferably using the same primers, or at least primers of similar annealing temperatures).
  • Agarose gel electrophoresis is used to separate the products of the reaction from their original DNA and spare primers.
  • the relative quantities of the known and unknown samples are measured to determine the quantity of the unknown. This method is generally used as a simple measure of whether the probe target sequences are present or not, and rarely as " true " Q-PCR.
  • SYBR Green dye is more accurate than the gel method, and gives results in real time.
  • a DNA binding dye binds all newly synthesized double stranded (ds)DNA and an increase in fluorescence intensity is measured, thus allowing initial concentrations to be determined.
  • SYBR Green will label all dsDNA including any unexpected PCR products as well as primer dimers, leading to potential complications and artefacts.
  • the reaction is prepared as usual, with the addition of fluorescent dsDNA dye. The reaction is run, and the levels of fluorescence are monitored; the dye only fluoresces when bound to the dsDNA. With reference to a standard sample or a standard curve, the dsDNA concentration in the PCR can be determined.
  • the fluorescent reporter probe method is the most accurate and most reliable of the methods. It uses a sequence-specific nucleic acid based probe so as to only quantify the probe sequence and not all double stranded DNA. It is commonly carried out with DNA based probes with a fluorescent reporter and a quencher held in adjacent positions, so-called dual-labelled probes. The close proximity of the reporter to the quencher prevents its fluorescence; it is only on the breakdown of the probe that the fluorescence is detected. This process depends on the 5' to 3' exonuclease activity of the polymerase involved. The real-time quantitative PCR reaction is prepared with the addition of the dual-labelled probe.
  • the probe On denaturation of the double-stranded DNA template, the probe is able to bind to its complementary sequence in the region of interest of the template DNA (as the primers will too).
  • the polymerase starts synthesizing the complementary strand to the primed single stranded template DNA.
  • the polymerisation continues it reaches the probe bound to its complementary sequence, which is then hydro lysed due to the 5 '-3' exonuclease activity of the polymerase thereby separating the fluorescent reporter and the quencher molecules. This results in an increase in fluorescence, which is detected.
  • the increase in fluorescence as released from the hydrolysed dual-labelled probe in each PCR cycle is monitored, which allows accurate determination of the final, and so initial, quantities of DNA.
  • a preferred embodiment of the present disclosure includes the real-time quantitative RT-PCR method, based on the use of either SYBR Green dye or a dual-labelled probe for the detection and quantification of nucleic acids according to the herein described.
  • An aspect of the present disclosure includes the detection of the nucleic acid molecules herein disclosed by techniques such as Northern blot analysis. Many variations of the protocol exist.
  • An aspect of the present disclosure includes a method of predicting actute Graft versus Host Disease (GVHD) in a subject comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and predicting the subject as having an increased risk for development of a GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • GVHD actute Graft versus Host Disease
  • the miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * .
  • the miRNA biomarker can consist of miR-423.
  • the miRNA biomarker can consist of miR- 199a-3p .
  • the miRNA biomarker consist of miR-377.
  • the miRNA biomarker can consist of miR-93 * .
  • the amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the method can further include administering an appropriate anti-GVHD therapy to the subject.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a method of diagnosing a GVDV in a subject comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and diagnosing the subject as having the GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • the miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * .
  • the miRNA biomarker can consist of miR-423.
  • the miRNA biomarker can consist of miR- 199a-3 .
  • the miRNA biomarker consist of miR-377.
  • the miRNA biomarker can consist of miR-93 * .
  • the amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
  • Northern blot analysis and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the method can further include administering an appropriate anti-GVHD therapy to the subject.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • the miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers can include miR-423, miR-377, and miR-93*.
  • the miRNA biomarkers can consist of miR-423, miR-377, and miR-93*.
  • the miRNA biomarker can consist of miR-423.
  • the miRNA biomarker consist of miR-377.
  • the miRNA biomarker can consist of miR-93*.
  • the amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
  • Northern blot analysis and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the method can further include administering an appropriate anti-GVHD therapy to the subject.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a method for determining the efficacy of a GVHD treatment regime in a subject comprising: determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; administering to the subject an anti-GVHD therapy regime; and redetermining the expression level of the miRNA biomarker(s) in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression level(s) is correlated with the efficacy of the anti-GVHD therapy regime.
  • the miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * .
  • the miRNA biomarker can consist of miR-423.
  • the miRNA biomarker can consist of miR- 199a-3p .
  • the miRNA biomarker consist of miR-377.
  • the miRNA biomarker can consist of miR-93 * .
  • the amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
  • Northern blot analysis and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the method can further include administering an appropriate anti-GVHD therapy to the subject.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a kit for predicting GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • the kit can further include one or more hybridization probes specific for the miRNA biomarker(s).
  • the kit can further include a solid support having the one or more hybridization probes attached thereto.
  • the kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
  • the miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarker of the kit can consist of miR-423.
  • the miRNA biomarker of the kit can consist of miR-199a-3p.
  • the miRNA biomarker of the kit can consist of miR-377.
  • the miRNA biomarker of the kit can consist of miR-93*.
  • the expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a kit for diagnosing GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for diagnosing the subject as having GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • the kit can further include one or more hybridization probes specific for the miRNA biomarker(s).
  • the kit can further include a solid support having the one or more hybridization probes attached thereto.
  • the kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
  • the miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarker of the kit can consist of miR-423.
  • the miRNA biomarker of the kit can consist of miR-199a-3p.
  • the miRNA biomarker of the kit can consist of miR-377.
  • the miRNA biomarker of the kit can consist of miR-93*.
  • the expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
  • the kit can further include one or more hybridization probes specific for the miRNA biomarker(s).
  • the kit can further include a solid support having the one or more hybridization probes attached thereto.
  • the kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
  • the miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
  • the miRNA biomarkers of the kit can include miR-423, miR-377, and miR-93*.
  • the miRNA biomarkers of the kit can consist of miR-423, miR-377, and miR-93*.
  • the miRNA biomarker of the kit can consist of miR-423.
  • the miRNA biomarker of the kit can consist of miR-377.
  • the miRNA biomarker of the kit can consist of miR-93*.
  • the expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
  • the biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
  • the biological sample can be selected from the group consisting of blood, serum, and plasma.
  • the biological sample can consist of plasma.
  • the biological sample can be derived from the subject prior to symptoms of the GVHD.
  • the subject can be a mammal.
  • the subject can be a human.
  • An aspect of the present disclosure includes a method of predicting actute Graft versus Host Disease (GVHD) in a subject comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and predicting the subject as having an increased risk for development of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • GVHD actute Graft versus Host Disease
  • An aspect of the present disclosure includes a method of diagnosing a GVDV in a subject comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consists of miR-423, miR-199a-3p, miR-377, and miR-93*; and diagnosing the subject as having the GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93 *; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a method for determining the efficacy of a GVHD treatment regime in a subject comprising: determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; administering to the subject an anti-GVHD therapy regime; and redetermining the expression level of the miRNA biomarkers in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression levels is correlated with the efficacy of the anti-GVHD therapy regime.
  • An aspect of the present disclosure includes a kit for predicting GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a kit for diagnosing GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for diagnosing the subject as having GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
  • Plasma miRNA profiling and signature in GVHD patients To identify a diagnostic plasma miRNA signature for GVHD, real-time PGR based high throughput miRNAs array was performed to compare the plasma miRNA profiles from 4 GVHD patients with the profiles from 3 non-GVHD patients at 6 weeks after HCT. A distinct miRNA signature was identified including a set of 24 differentially expressed miRNAs in GVHD compared with non-GVHD patients, including 8 upregulated and 16 downregulated miRNAs (see FIG 1). Hierarchical clustering analysis showed that the plasma miRNA signature can distinguish GVHD from non-GVHD subjects (see FIG 1). The miRNA's shown in FIG 1 are listed in Table 1 herein above and the PCR primers used in the experiment are shown in Table 2 below.
  • miR-206 28 TGG AAT GTA AGG AAG TG
  • let-7g 45 AGG TAG TAG TTT GTA C
  • the realtime PCR results of miRNAs were normalized to the spike-in cel-miR-39.
  • Table 3 shows Cox regression analysis for the estimation of risk prediction of GVHD in a training cohort.
  • Table 4 shows multivariate Cox regression analysis for the estimation of miRNA panel with overall survival in a training cohort.
  • Plasma microRNA signature as non-invasive biomarker for acute graft-versus-host disease.
  • Acute graft-versus-host disease GVHD
  • HCT allogeneic hematopoietic cell transplantation
  • GVHD Approximately 35%— 50% of HCT recipients develop GVHD; however, there is no validated diagnostic and predictive blood biomarkers for GVHD in clinical use.
  • a model is developed including 4 miR As (miR-423, miR-199a-3p, miR-93*, and miR-377) that can predict the probability of GVHD with AUC of 0.80.
  • GVHD Acute graft-versus-host disease
  • HCT allogeneic hematopoietic cell transplantation
  • GI gastrointestinal
  • MicroRNAs are a class of small non-coding RNA that negatively regulate gene expression by translational repression or induction of mRNA degradation 8 .
  • miRNAs are present in plasma, serum, saliva, urine, or other body fluid in a remarkably stable form that is protected from endogenous RNase activity 9"11 .
  • Circulating miRNAs have potential to serve as novel, non-invasive biomarkers for various diseases such as cancer, cardiovascular diseases, sepsis, organ transplantation, liver injury, ectopic pregnancy, diabetes, and infection " .
  • those elevated miRNAs can be detected before a GVHD diagnosis and high expression of these miRNAs is associated with poor survival.
  • the GVHD miRNA signature was not detected in plasma of lung-transplanted or sepsis patients.
  • the study population consisted of 196 human subjects who underwent allogeneic HCT performed between 2008 and 2012 at Duke University Medical Center.
  • the discovery set consisted of 4 HCT patients who developed a GVHD and 3 HCT patients who never developed GVHD (non-GVHD).
  • the training set consisted of 59 GVHD and 19 non-GVHD patients, and the validation and test set consisted of 41 GVHD and 70 non-GVHD patients.
  • 45 patients who underwent lung transplantation 38 patients who had sepsis with confirmed pathogens, and 10 healthy donors were enrolled as controls.
  • EDTA-anticoagulated blood was drawn at 2 or 6 weeks after transplantation.
  • GVHD GVHD-free plasma
  • GVHD was graded on the basis of severity of involvement of target organs 21 . All research samples were collected after obtaining written informed consent for participation in accordance with the Declaration of Helsinki on protocols approved by the Duke University Medical Center Institutional Review Board. Patient characteristics are summarized in Table 3 shown below.
  • RNA extraction from plasma Total RNAs were extracted from 400 ⁇ of plasma using the mirVana PARIS Kit (Ambion) according to the manufacturer's instructions. Since no known endogenous miRNA in human plasma can be used as normalization control, synthetic Caenorhabditis elegans miRNA (cel-miR-39) was used as spiked-in control. 2 ⁇ 1 of 5 nM synthetic cel-miR-39 (synthesized by Integrated DNA Technologies) was added to each denatured sample after combining the plasma sample with denaturing solution. RNAs were eluted with 105 ⁇ of pre-heated elution solution.
  • qRT-PCR quantitative reverse-transcriptase polymerase chain reaction
  • Real-time qPCR based high throughput miRNAs array Real-time qPCR based high throughput miRNA array was performed which contained 345 human
  • Plasma IL-2Ra was determined using an IL-2Ra ELISA kit (R&D Systems) according to the manufacturer's instruction. Plasma samples in 4-fold dilution and standards were measured in duplicates. Absorbance was measured with Molecular Devices Emax and results were analyzed by SoftMax Pro 4.8 software (Molecular Devices).
  • Statistical analysis Hierarchical clustering analysis was performed using Cluster 3.0. The Mann- Whitney test was used to compare the differences in plasma expression between a GVHD and non-GVHD group. A two-sided chi-square test was used to compare the differences in patient clinical characteristics. Receiver-operating characteristic (ROC) curves and the area under the ROC curve (AUC) were used to assess the sensitivity and specificity of miRNA biomarkers for the diagnosis of GVHD. Logistic regression was used to develop a combined miRNA panel to predict the probability of developing GVHD. Overall survival was analyzed using Kaplan-Meier curve. Cox regression was performed to determine the predictive value of miRNA signature for diagnosis and survival of GVHD. Spearman correlation analysis was performed to test whether expression of the four miRNAs are correlated with each other. All statistical analysis was performed using SPSS 16.0 software and graphs were generated using GraphPad Prism 5.0 (Graphpad Software Inc).
  • Plasma miRNA profiling and signature in GVHD patients To identify diagnostic plasma miRNA signature for GVHD, real-time PGR based high throughput miRNAs array was performed to compare the plasma miRNA profiles from 4 GVHD patients with the profiles from 3 non-GVHD patients at 6 weeks after HCT. A distinct miRNA signature was identified including a set of 24 differentially expressed miRNAs in GVHD compared with non-GVHD patients, including 8 upregulated and 16 downregulated miRNAs (see FIG 1 and Table 6 below). Hierarchical clustering analysis showed that the plasma miRNA signature can distinguish GVHD from non-GVHD subjects.
  • miRNA qPCR was performed in an independent training set consisting of 59 GVHD patients and 19 non-GVHD controls.
  • 24 candidate miRNAs 6 plasma miRNAs including miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a were significantly up-regulated in GVHD patients compared with non-GVHD controls in training phase (see FIG's 2A-2H).
  • the ROC curves show AUC (area under the curve) of 0.76 (95% CI, 0.64-0.87) for miR-423, 0.76 (95% CI, 0.65-0.87) for miR-199a-3p, 0.78 (95% CI, 0.67-0.89) for miR-93* and 0.81 (95% CI, 0.71-0.91) for miR-377 (see FIG's 2A-2F, respectively).
  • the AUC for the combined miRNA biomarker panel of miR-423, miR-199a-3p, miR-93* and miR377 is 0.85 (95% CI, 0.76-0.93) (P ⁇ 0.0001) (see FIG 2G).
  • sIL-2Ra is a potential biomarker for GVHD, with the highest AUC value among a panel of protein biomarkers including sIL-2Ra, IL-8, HGF,
  • the plasma levels of sIL-2Ra were compared in these groups of GVHD and non-GVHD patients.
  • the plasma levels of sIL-2Ra were not significantly different between GVHD and non-GVHD patients at 6 weeks after transplantation (FIG 2H).
  • the data suggest that the plasma miR A panel may be a non-invasive biomarker for GVHD.
  • miRNA signature as prediction factor for GVHD.
  • An ideal miRNA biomarker should allow for identification of GVHD before the onset of symptoms of GVHD.
  • FIG's 5A-50 are graphs showing the predictive value of the miRNA signature for GVHD.
  • (I-L) The expression of the 4-miRNA panel at 2 weeks after HCT in plasma of GVHD and non-GVHD patients.
  • (M) ROC curve of the 4-miRNA panel at 2 weeks after HCT when predicting GVHD.
  • N Plasma concentration of sIL-2Ra at 2 weeks after HCT.
  • O ROC curve of sIL-2Ra at 2 weeks after HCT when predicting GVHD.
  • FIG. 27 28 not achieved statistical significance (FIG's 5I-5L). Consistent with published results ' , the plasma levels of sIL-2R at 2 weeks after HCT were significantly higher in GVHD patients than that in non-GVHD group (FIG 5N). However, AUC for the miRNA signature including miR-423, miR-199a-3p, miR-93*, and miR-377 was higher than AUC for sIL-2Ra at 2 weeks after HCT (0.86 vs 0.76) (FIG's 5M and 50). This result suggests that measurement of miRNA signature will increase the accuracy of diagnosis for GVHD, especially for patients who show symptoms at the later time (> 2-3 weeks after HCT).
  • the levels of the miRNA signature were measured in a set of 9 patients before disease onset (at 2 weeks after HCT) and after onset (at 6 weeks after HCT).
  • the levels of miR-423, miR-199a, and miR-93* were significantly upregulated in the post-diagnosis samples compared to the pre-diagnosis samples (see FIG's 6G-6L).
  • Receiver Operating Characteristic (ROC) curve analysis was performed for each of 6 miRNA's individually (miR-423, miR-199a-3p, miR-377, miR-93*, miR-155, and miR-30a) to evaluate the sensitivity and selectivity of the miRNAs as a diagnostic biomarker for GVHD and the data are shown in FIG's 10A-10F.
  • the time point was 6 weeks after HCT in plasma samples for 34 grade 1-2 GVHD patients, 25 grade 3-4 GVHD patients, and 19 non-GVHD controls.
  • plasma miRNAs may serve as biomarkers for GVHD. It was found that the expression of 6 miRNAs, miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a, was significantly upregulated in the plasma of GVHD patients when compared with non-GVHD patients.
  • a model was developed including 4 miRNAs to predict the probability of GVHD with AUC of 0.80. The levels of miRNA biomarkers were positively associated with GVHD severity. Moreover, the elevated miRNAs were detected before onset of GVHD and were not found in lung transplanted patients or patients with sepsis. In addition, it was found that high expression of a 4-miRNA panel was associated with poor survival. Taken together, these data show that the plasma miRNA signature is an independent predictive, diagnostic, and prognostic factor for GVHD.
  • the levels of sIL-2Ra are also elevated during infection .
  • measurement of the expression levels of the miRNA signature for GVHD clearly demonstrates that it is not only elevated in 2-6 week plasma of the GVHD patients but also not detected in other diseases as sepsis and lung transplantation.
  • the miRNA panel can provide a predictive role for GVHD. It was found that the levels of the plasma miRNA signature were elevated in GVHD patients at 16 days before the diagnosis of GVHD. In contrast, the plasma levels of sIL-2Ra in these samples were not significantly elevated. The low relative abundance of protein may render its detection difficult. However, the change in the expression levels of the miRNA signature prior to GVHD diagnosis can be detected by qPCR. Cox regression analysis indicates that the miRNA signature containing 4 miRNAs, miR-423, miR-199a-3p, miR-93*, and miR-377 has the best predictive value for GVHD. Predicting GVHD development is essential in early identification of high-risk individuals who need individualized treatment.
  • prognostic factors that can be identified at the onset of GVHD remain largely elusive. If patients who are likely to have poor outcome can be predicted at the onset of GVHD, early administration of tailored therapy may change the outcome of these patients. Moreover, once GVHD occurs, the most important predictor of long-term survival is the primary response to therapy. In patients who are resistant to initial therapy, the risk of morbidity and mortality increases significantly 6 ' 7 . Thus, utilization of the plasma miRNAs signature as potential biomarkers for predicting response of GVHD to therapy will improve the treatment outcome.
  • miRNAs identified in the plasma of GVHD patients are involved in inflammation, tissue damage, cell proliferation regulation and tissue repair.
  • miR-423 may serve
  • miR-155 plays a key role in inflammation
  • miR-155 is upregulated in effector T cells of mice with GVHD and miR-155 expression in lymphocytes is essential for lethal GVHD in mice 26 .
  • miR-199a-3p was reported to play a role in hepatocytes injury and hepatocellular carcinoma 23 ' 39 .
  • miR-93 regulates cell proliferation 40 while miR-30a is associated with autophagy and apoptosis 41 ' 42 .
  • Circulating miRNAs may be selectively included into multivesicular body (MVB) or exosomes, which originate from the endosome, then fuse with plasma membrane 43 .
  • MBV multivesicular body
  • circulating miRNAs can be transferred in exosome-independent manner, and miRNAs can be stably exported in conjunction with RNA-binding protein, such as nucleophosmin 1(NPM1) 44 , Argonaute2 (Ago2) 45 , and high-density lipoprotein (HDL) 46 .
  • NPM1 nucleophosmin 1
  • Ago2 Argonaute2
  • HDL high-density lipoprotein
  • Van Lint MT Milone G, Leotta S, et al. Treatment of acute graft-versus-host disease with prednisolone: significant survival advantage for day +5 responders and no advantage for nonresponders receiving anti-thymocyte globulin. Blood. 2006;107:4177-4181. Deeg HJ. How I treat refractory acute GVHD. Blood. 2007;109:4119-4126.
  • Serum microRNA profiles serve as novel biomarkers for HBV infection and diagnosis of HBV-positive hepatocarcinoma. Cancer research.
  • MicroRNA fingerprints identify miR-150 as a plasma prognostic marker in patients with sepsis. PloS one. 2009;4:e7405.
  • Hori T, Naishiro Y, Sohma H, et al. CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 2008;111 :4403-4412.
  • microRNA-protective protein by mammalian cells. Nucleic acids research.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides miRNA biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of conditions such as GVHD in a subject.

Description

MICRORNA BIOMARKERS FOR GRAFT VERSUS HOST DISEASE
CROSS REFERNCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. provisional application number 61/825,609 filed May 21, 2013 and U.S. provisional application number 61/735,600 filed December 11, 2012, the disclosures of which are each hereby incorporated by reference in their entireties.
FEDERAL FUNDING LEGEND
[0002] The invention was made with government support under Grant No. AI074944 titled "Autophagy in T Lymphocyte Function" awared by the National Institute of Health. The government has certain rights in the invention.
TECHNICAL FIELD
[0003] The presently disclosed subject matter relates to miRNA biomarkers for monitoring, predicting, diagnosising, and prognosing Graft versus Host Disease (GVHD).
BACKGROUND
[0004] MicroRNAs (miRNAs) constitute an evolutionary conserved class of
endogenously expressed small non-coding RNAs of 20-25 nucleotides (nt) in size that can mediate the expression of target mRNAs and thus-since their discovery about ten years ago-have been implicated with critical functions in cellular development, differentiation, proliferation, and apoptosis. miRNAS are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another R ase III termed Dicer cleaves of the loop of the pre-miR A hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miR A into a miR A-protein (miRNP). The miRNA guides the miRNPs to their target mRNAs where they exert their function (reviewed, e.g. in Bartel, D. P. (2004) Cell 23, 281-292; He, L. and Hannon, G. J. (2004) Nat. Rev. Genet. 5, 522-531). Increasing evidence suggests that miRNAs are present in plasma, serum, saliva, urine and other bodily fluids in a remarkably stable form that is protected from endogenous RNase activity. Several publications have demonstrated that circulating miRNA may have potential use as a biomarker for cancer, cardiovascular diseases, ectoptic pregnancy, liver injury and the like.
[0005] Acute graft-versus-host disease (GVHD) is a common complication after allgeneic hematopoietic cell transplantation (HCT), affecting the skin, liver and gastrointestinal tract and contributing to transplant related morbidity and mortality. Approximately half of patients following HCT will develop GVHD and require systemic treatment. The diagnosis of acute GVHD is based on clinical criteria that may be confirmed by biopsy of one of the three (3) target organs: skin, gastrointestinal tract, and/or liver. Intensive studies have been devoted to identifying blood biomarkers for GVHD to improve the diagnosis and individualized treatment, and the majority of the work was focused on whole proteins or polypeptide. However, to date, there is no validated diagnostic blood biomarker for GVHD. In addition, resistance to GVHD therapy is associated with high transplant-related mortality and low overall survival. Accurate and timely diagnosis is essential to improve the efficiency of GVHD treatment. The reported potential protein biomarkers for GVHD have several drawbacks: First, these biomarkers are often elevated during inflammation such as bacterial infection and veno-occlusive disease, thus not specific for GVHD. Published analyses testing these protein biomarkers often excluded patients with other
inflammation conditions such as sepsis, idiopathic pneumonia syndrome, and veno-occlusive disease. Second, comparing to quantitative polymerase chain reaction-based assay (qPCR-based assay), the methods for protein detection either have a relatively low sensitivity or are too complicated. Third, most reported protein biomarkers for GVHD could aid diagnosis but their predictive and prognostic values remain to be established.
[0006] Therefore, there is a pressing need to identify improved diagnostic and prognostic biomarkers for GVHD.
SUMMARY OF THE DISCLOSURE
[0007] One aspect of the present disclosure provides a method of determining the risk of, prognosis of, and/or diagnosis of GVHD in a subject comprising, consisting of, or consisting essentially of quantifying the amount of at least one biomarker present in a biological sample derived from the subject, wherein the biomarker comprises, consists of, or consists essentially of an miR A associated with GVHD.
[0008] Another aspect of the present disclosure provides a method of diagnosing GVHD in a subject comprising, consisting of, or consisting essentially of: obtaining a biological sample from a subject; determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and (d) administering appropriate anti-GVHD therapy if one or more of the biomarkers are expressed.
[0009] Another aspect of the present disclosure provides a method of determining the risk of a subject developing GVHD comprising, consisting of, or consisting essentially of:
obtaining a biological sample from a subject; determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and administering an appropriate prophylactic anti-GVHD therapy if one or more of the biomarkers are expressed.
[0010] Another aspect of the present disclosure provides a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising, consisting of, or consisting essentially of: obtaining a biological sample from a subject; determining the expression level of one or more miRNA biomarkers that are associated with GVHD in the biological sample; comparing the expression level of the miRNA biomarkers in the biological sample with that of a control, wherein the presence of one or more of the biomarkers in the sample that is in an amount greater than that of the control indicates GVHD; and administering an appropriate anti-GVHD therapy or altering an already administered anti-GVHD therapy, if one or more of the biomarkers are expressed.
[0011] Another aspect of the present disclosure provides a method determining the efficacy of an GVHD treatment regime in a subject comprising, consisting of, or consisting essentially of: determining a baseline value for the expression of one or more miRNA biomarkers associated with GVHD; administering to the subject an anti-GVHD therapy regime; and redetermining the expression levels of one or more biomarkers in the subject, wherein observed decreases in one or more of the miRNA biomarker expression levels is correlated with the efficacy of the therapeutic regimen.
[0012] Another aspect of the present disclosure provides a composition of matter comprising, consisting of, or consisting essentially of: a probe array for determining an miRNA level in a sample, the array comprising of a plurality of probes that hybridizes to one or more miRNAs that are associated with GVHD; or a kit for determining an miRNA level in a sample, comprising the probe array of and instructions for carrying out the determination of miRNA expression level in the sample. In certain embodiments the probe array of further comprises a solid support with the plurality of probes attached thereto.
[0013] In one embodiment, the biomarker is selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and combinations thereof. In certain embodiments the biomarker comprises miR-423, miR-199a-3p, miR-93*, miR-377 and combinations thereof.
[0014] In some embodiments, the subject is a mammal. In other embodiments, the subject is a human.
[0015] In other embodiments, the biological sample is selected from the group consisting of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. In certain embodiments, the sample comprises plasma.
[0016] Yet another aspect of the present disclosure provides all that is disclosed and illustrated herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The foregoing aspects and other features of the disclosure are explained in the following description, taken in connection with the accompanying drawings, wherein:
[0018] FIG 1 shows the hierarchical clustering analysis of differentially expressed miRNAs in plasma of acute GVDH patients. miRNA profiling in plasma from 4 GVHD patients and 3 non-GVHD patients was performed by using quantitative RT-PCR based high throughput miRNA array.
[0019] FIG's 2A-2H are graphs showing expression of plasma miRNA signature for GVHD diagnosis in a training set. Expression of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-155, and (F) miR-30a in plasma of GVHD (n=59) and non-GVHD patients (n=19) at 6 weeks after HCT. P values were based on Mann- Whitney test. Receiver Operating Characteristic (ROC) curve analysis for individual miRNA and combined miRNA panel. (G) Logistic regression determined that a linear combination of values for miR-423, miR-199a-3p, miR-93*, and miR-377 produced the best model for GVHD diagnosis. (H) Comparison of sIL-2Ra protein levels in plasma between GVHD and non-GVHD patients at 6 weeks after HCT. P values were based on Mann- Whitney test.
[0020] FIG's 3A-3I are graphs showing expression of plasma miR A signature for GVHD diagnosis at 6 weeks after HCT in a validation set. Expression of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-155, and (F) miR-30a in plasma of GVHD (n=57) and non-GVHD patients (n=33) at 6 weeks after HCT. (G) ROC curve analysis for individual miRNA and combined miRNA signature including miR-423, miR-199a-3p, miR-93*, and miR-377. (H) Comparison of sIL-2Ra protein levels in plasma between GVHD and non-GVHD patients at 6 weeks after HCT. (I) ROC curve of the 4-miRNA panel derived from analyzing all 168 samples from training and validation sets.
[0021] FIG's 4A-4F are graphs showing expression of plasma miRNA signature for GVHD before HCT. Expression of (A) miR-423, (B) miR-199a-3p, (C) miR-377, (D) miR-93*, (E) miR-30a, and (F) miR-155 in plasma of GVHD (n=28) and non-GVHD patients (n=28) before HCT.
[0022] FIG's 5A-50 are graphs showing the predictive value of the miRNA signature for GVHD. The expression of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-1 5 and (F) miR-30a in the plasma of GVHD patients prior to GVHD diagnosis, with a median of 16 days before diagnosis. (G) ROC curve of the 4-miRNA panel (miR-423, miR-199a-3p, miR-93*, miR-377) at 6 weeks when predicting GVHD before onset. (H) Plasma concentration of sIL-2Ra at 6 weeks after HCT in non-GVHD and GVHD patients before GVHD diagnosis. (I-L) The expression of the 4-miRNA panel at 2 weeks after HCT in plasma of GVHD and non-GVHD patients. (M) ROC curve of the 4-miRNA panel at 2 weeks after HCT when predicting GVHD. (N) Plasma concentration of sIL-2Ra at 2 weeks after HCT. (O) ROC curve of sIL-2Ra at 2 weeks after HCT when predicting GVHD.
[0023] FIG's 6A-6L are graphs showing correlation of the miRNA signature with GVHD severity. Expression levels of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-155 and (F) miR-30a in GVHD patients with different grade (grade 1-2 vs grade 3-4). P values were based on Mann-Whitney test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. The kinetic expression of the miRNA signature in a set of 9 patients before disease onset (at 2 weeks after HCT) and after onset (at 6 weeks after HCT) is shown in (G) miR-423, (H)
miR-199a-3p, (I) miR-93*, (J) miR-377, (K) miR-30a and (L) miR-155. P values were based on paired T test.
[0024] FIG 7 is a graph showing correlation of the expression of the 4 miRNA panel and overall survival of GVHD patients. All GVHD patients were divided into 2 groups (high and low risk) based on the predicted probabilities for developing GVHD using the 4 miRNA panel.
Overall survival was detrmined by Kapian-Meier Curve. P values were based on log-rank test
[0025] FIG's 8A-8B are graphs showing Spearman correlation analysis to test whether the expression of the four miRNAs are correlated with each other. (A) Correlation analysis of miR-199a-3p and miR-423. (B) Correlation analysis of miR-93* and miR-377.
[0026] FIG's 9A-9L are graphs showing expression of the GVHD miRNA signature in sepsis or lung transplanted patients. Expression levels of the GVHD miRNA signature including (A) miR-423, (B) miR-199a-3p, (C) miR-377, (D) miR-93*, (E) miR-30a and (F) miR-155 in plasma of lung transplanted patients with acute rejection (n=17) and non-rejection (n=28).
Expression levels of the GVHD miRNA signature in plasma of sepsis patients (n=38) and healthy donors (n=10) (G) miR-199a-3p, (H) miR-377, (I) miR-93*, (J) miR-423, (K) miR-30a, and (L) miR-155.
[0027] FIG's 10A-10F are graphs showing ROC curve analysis for each of 6 miRNA's individually (A) miR-423, (B) miR-199a-3p, (C) miR-377, (D) miR-93*, (E) miR-155, and (F) miR-30a to evaluate the sensitivity and selectivity of the miRNAs as a diagnostic biomarker for GVHD.
DETAILED DESCRIPTION OF THE DISCLOSURE [0028] For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the disclosure relates.
[0029] Articles "a" and "an" are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, "an element" means at least one element and can include more than one element.
[0030] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0031] Definitions
[0032] As used herein, the term "miR A" or "miR" or "microR A" refers to a non-coding RNA between 10 and 30 nucleotides in length which hybridizes to and regulates the expression of a coding RNA (see, Zeng and Cullen, RNA, 9(1): 112-123, 2003; Kidner and Martienssen Trends Genet, 19(1): 13-6, 2003; Dennis C, Nature, 420(6917):732, 2002; Couzin J, Science 298(5602):2296-7, 2002, each of which is incorporated by reference herein). A 10 to 30 nucleotide miRNA molecule can be obtained from a miRNA precursor through natural processing means (e.g., using intact cells or cell lysates) or by synthetic processing routes (e.g., using isolated processing enzymes, such as isolated Dicer, Argonaut, or RNAse III). It is understood that the 10 to 30 nucleotide RNA molecule can also be produced directly or by biological or chemical synthesis, without having been processed from a miR precursor.
Included within this definition is natural miRNA molecules, pre-miRNA, pri-miRNA, miRNA molecules identical in nucleic acid sequence to the natural forms as well as nucleic acid sequences, wherein one or more nucleic acids has been replaced or is represented by one or more DNA nucleotides and/or nucleic acid analogue. miRNA molecules in the present specification are occasionally referred to as a nucleic acid molecule(s) encoding a miR A or simply nucleic acid molecule(s).
[0033] As used herein, the term "biomarker" refers to a naturally occurring biological molecule present in a subject at varying concentrations useful in predicting the risk or incidence of a disease or a condition, such as GVHD. For example, the biomarker can be an miRNA present in higher or lower amounts in a subject at risk for GVHD. The biomarker can include nucleic acids, ribonucleic acids, or a polypeptide used as an indicator or marker for GVHD in a cell, tissue or subject. In certain embodiments, the biomarker is an miRNA.
[0034] As used herein, the terms "acute graft-versus-host disease (GVHD)" and "GVHD" are used interchangeable and refer to the acute or fulminant form of GVHD that is normally observed within the first 100 days post-transplantation.
[0035] "About" is used to provide flexibility to a numerical range endpoint by providing that a given value may be "slightly above" or "slightly below" the endpoint without affecting the desired result.
[0036] As used herein, "treatment," "therapy" and/or "therapy regimen" refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. "Treatments" refer to one or both of therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented. Treatment/therapy regimens will be different for each subject depending on several factors, including age/health of subject, stage of disease, etc. and can be readily determined by one skilled in the art (e.g., attending physician). For example, possible treatment/therapys include, but are not limited to, administration of immunosuppressive drugs (e.g., mycophenolate mofetil, Alemtuzumab [Campath], ATG, Sirolimus, etc.), selective depletion of alloreactive T lymphocytes, use of monoclonal antibodies (e.g., anti-CD3, anti-CD5, IL-2 antibodies) etc. As used herein, the term "prophylactic treatments" refer to those therapies that are used to prevent the occurrence of a condition such as GVHD from happening. Suitable prophylactic treatments may include prophylactic treatment with immunosuppressive drugs, use of umbilical cord blood as the source of donor cells, closer HLA matching between donor and patients, etc.
[0037] The term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.
[0038] Detailed Description
[0039] The present disclosure provides miRNA biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of GVHD in a subject. The present disclosure also provides methods of using such miRNA expression profiles to monitor a subject's response to treatment (e.g., efficacy of a treatment or therapy regimen) for conditions such as GVHD.
[0040] Advantageously, the methods of the present disclosure are noninvasive, highly specific, and sensistive.
[0041] In one embodiment, the present disclosure profiles circulating miRNA as biomarkers for the diagnosis and prognosis of GVHD.
[0042] In one embodiment, the present disclosure identifies plasma or tissue miRNA profiles as biomarkers for determining the risk of, prognosis of, and/or diagnosis of conditions such as GVHD. miRNAs are key epigenetic regulators of gene expression, and their expression is highly regulated. Therefore, deregulation of miRNAs can play an important role in the development and progression of various conditions, such as GVHD.
[0043] The inventors have determined that miRNAs are directly involved in the development and progression of GVHD, and their expression pattern in plasma can be associated with the pathophysiological status of GVHD. It was discovered that miRNA expression patterns in subjects with GVHD are distinctly different from that of normal controls. Plasma miR As are stable under harsh conditions, including freezing and thawing, high temperature storage (up to 37°C), acidic conditions, and RNase digestion.
[0044] One aspect of the present disclosure provides miRNA biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of conditions such as GVHD. In one embodiment, the present disclosure provides miRNA biomarkers that are differentially expressed, such as upregulated, down-regulated, or disregulated in a condition such as GVHD, as compared to normal populations who do not have the condition, such as GVHD.
[0045] In one embodiment, the biomarkers of the present disclosure are selected from one or any combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363. In certain embodiments, the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377 and combinations thereof. The biomarkers are shown in Table 1 below.
Table 1. Sequence of miRNA Biomarkers.
miRNA SEQ ID NO: miRNA Sequence miR-377 1 AUCACACAAAGGCAACUUUUGU
miR-466d-3p 2 UAUACAUACACGCACACAUAG
miR-423 3 UGAGGGGCAGAGAGCGAGACUUU
miR-206 4 UGGAAUGUAAGGAAGUGUGUGG
miR- 155 5 UUAAUGCUAAUCGUGAUAGGGGU
miR-93* 6 ACUGCUGAGCUAGCACUUCCCG
miR- 199a-3p 7 ACAGUAGUCUGCACAUUGGUUA
miR-30a 8 UGUAAACAUCCUCGACUGGAAG
miR-26a 9 UUCAAGUAAUCCAGGAUAGGCU
miR- 191 10 CAACGGAAUCCCAAAAGCAGCUG
miR- 15b 1 1 UAGCAGCACAUCAUGGUUUACA
miR-744 12 UGCGGGGCUAGGGCUAACAGCA
miR-337-3p 13 UUCAGCUCCUAUAUGAUGCCU miR-146a 14 UGAGAACUGAAUUCCAUGGGUU
miR- 199a-5p 15 CCCAGUGUUCAGACUACCUGUUC
miR- 107 16 AGCAGCAUUGUACAGGGCUAUCA
miR-30b 17 UGUAAACAUCCUACACUCAGCU
miR-30a* 18 CUUUCAGUCGGAUGUUUGCAGC
miR-30c 19 UGUAAACAUCCUACACUCUCAGC
let-7a 20 UGAGGUAGUAGGUUGUAUAGUU
let-7g 21 UGAGGUAGUAGUUUGUACAGUU
let-7b 22 UGAGGUAGUAGGUUGUGUGGUU
miR-363 23 AAUUGCACGGUAUCCAUCUGUA
miR- 186 24 CAAAGAAUUCUCCUUUUGGGCU
[0046] In some embodiments, the biomarkers are selected from one or more miRNAs that are up-regulated or over-expressed in GVHD. In some embodiments, the biomarkers for GVHD are selected from miR-423, miR-199a-3p, miR-93*, miR-377 or any combination thereof, wherein the up-regulation or over-expression of one or more aforementioned miRNA biomarkers in the subject's biological sample, when compared to a control, indicates that the subject has GVHD.
[0047] In some specific embodiments, the biomarkers are selected from one or more miRNAs up-regulated or over-expressed more than 50-fold, 40-fold, 30-fold, 20-fold, 15-fold, 10-fold, 9-fold, 8-fold, 7-fold, 6-fold, 5-fold, 4-fold, 3-fold, 2-fold, or 1-fold in GVHD subjects, when compared to a control in GVHD. In some embodiments, the biomarkers for GVHD are selected from miR-423, miR-199a-3p, miR-93*, miR-377 , or any combination thereof, wherein the up-regulation or over-expression of the the one or more aforementioned miRNA biomarkers in the subject's biological sample, when compared to a control, indicates that the subject has GVHD.
[0048] In one embodiment, the present disclosure provides a method for diagnosing condition such as GVHD in a subject comprising, consisting of, or consisting essentially of:
[0049] (a) determining a miRNA expression profile (expression level) in a biological sample from the subject;
[0050] (b) characterizing the subject's miRNA profile; and
[0051] (c) comparing the subject's miRNA profile with the miRNA profile of a control miRNA profile from subjects that do not have GVHD; and
[0052] (d) administering an appropriate anti-GVHD therapy if one or more of the biomarkers are expressed.
[0053] In another embodiment, the present disclosure provides a method for determining the risk of a subject developing a condition such as GVHD comprising, consisting of, or consisting essentially of:
[0054] (a) determining a miRNA expression profile (expression level) in a biological sample from the subject;
[0055] (b) characterizing the subject's miRNA profile; and
[0056] (c) comparing the subject's miRNA profile with the miRNA profile of a control miRNA profile from subjects that do not have GVHD; and
[0057] (d) administering an appropriate prophylactic anti-GVHD therapy if one or more of the biomarkers are expressed.
[0058] In yet another embodiment, the present disclosure provides a method for determining the prognosis of a subject developing, or having already developed, a condition such as GVHD comprising, consisting of, or consisting essentially of:
[0059] (a) determining a miRNA expression profile (expression level) in a biological sample from the subject;
[0060] (b) characterizing the subject's miRNA profile; and
[0061] (c) comparing the subject's miRNA profile with the miRNA profile of a control miRNA profile from subjects that do not have GVHD; and
[0062] (d) administering appropriate anti-GVHD therapy or altering an already existing anti-GVHD therapy if one or more of the biomarkers are expressed. [0063] In one embodiment, the method further includes obtaining the biological sample from the subject. In one embodiment, the diagnosis and/or prognosis of a condition such as GVHD can be determined by comparing the subjects miRNA profile to a reference miRNA profile, such as one that corresponds to biological samples obtained froma normal population that do not have a condition such as GVHD, or that corresponds to biological samples obtained from a population that have a condition such as GVHD. Optionally, the reference profile comprises multiple miRNA expression profiles, with each corresponding to a different stage of a condition such as GVHD.
[0064] As used herein, the term "subject" and "patient" are used interchangeably herein and refer to both human and nonhuman animals. The term "nonhuman animals" of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like. Preferably, the subject is a human patient.
[0065] The term "biological sample" as used herein includes, but is not limited to, a sample containing tissues, cells, and/or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus and tears. In one embodiment, the biological sample is a blood sample (such as a plasma sample). A biological sample may be obtained directly from a subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary, such as a healthcare provider or lab technician).
[0066] In some embodiments, the present disclosure provides methods for diagnosing a condition such as GVHD by characterizing one or a combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any
combinations thereof. In some embodiments, the present disclosure provides methods for diagnosing conditions such as GVHD by characterizing miR A selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any
combinations thereof, wherein the up-regulation or over-expression of one or more of the aforementioned miRNA, when compared to a control, indicates that the subject has a condition such as GVHD. In certain embodiments, the biomarkers include miR-423, miR-1 9a-3p, miR-93*, miR-377 and any combinations thereof.
[0067] In other embodiments, the present disclosure provides methods for determining the risk of a subject developing a condition such as GVHD by characterizing one or a
combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof. In some embodiments, the present disclosure provides methods for determining the risk of a subject developing a condition such as GVHD by characterizing miRNA selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof, wherein the up-regulation or over-expression of one or more of the aforementioned miRNA, when compared to a control, indicates that the subject has a condition such as GVHD. In certain embodiments, the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377 and any combinations thereof.
[0068] In yet other embodiments, the present disclosure provides methods for
determining the prognosis of a subject having a condition such as GVHD by characterizing one or a combination of biomarkers selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let- 7b, miR-30c, miR-363 and any combinations thereof. In some embodiments, the present disclosure provides methods for determining the prognosis of a subject having a condition such as GVHD by characterizing miRNA selected from the group consisting of miR-377, miR-206, miR-155, miR-466d-3p, miR-423, miR-93*, miR-30a, miR-199a-3p, miR-337-3p, miR-15b, miR-744, let-7g, miR-26a, miR-199a-5p, miR-30a*, let-7a, miR-191, miR-30b, miR-186, miR-146a, miR-107, let-7b, miR-30c, miR-363 and any combinations thereof, wherein the up-regulation or over-expression of one or more of the aforementioned miRNA, when compared to a control, indicates that the subject has a condition such as GVHD. In certain embodiments, the biomarkers include miR-423, miR-199a-3p, miR-93*, miR-377 and any combinations thereof.
[0069] Another aspect of the present disclosure provides for methods for monitoring the treatment of conditions such as GVHD. In one embodiment, the method comprises a method of determining the efficacy of an GVHD treatment regime in a subject comprising, consisting of, or consisting essentially of: (a) determining a baseline value for the expression of one or more miRNA baiomarkers associated with GVHD; (b) administering to the subject an anti-GVHD therapy regime; and (c) reetermining the expression levels of one or more biomarkers in the subject, wherein observed decreases in one or more or the miRNA biomarker expression levels is correlated with the efficacy of the therapeutic regimen.
[0070] In instances where a decrease in the miRNA expression is not seen, a change in treatment may be warranted. Such a determination, and the different type of treatment to employ, can be made readily determined by one skilled in the art.
[0071] Another aspect of the present disclosure provides a composition of matter comprising, consisting of, or consisting essentially of: (a) a probe array for determining an miRNA level in a sample, the array comprising of a plurality of probes that hybridizes to one or more miRNAs that are associated with GVHD; or (b) a kit for determining an miRNA level in a sample, comprising the probe array of (a) and instructions for carrying out the determination of miRNA expression level in the sample. In certain embodiments the probe array of (a) further comprises a solid support with the plurality of probes attached thereto.
[0072] The present disclosure provides a method of determining the risk of, prognosis of, and/or diagnosis of a condition such as GVHD on at least one sample obtained from an individual. The individual may be any mammal, but is preferably a human.
[0073] The present disclosure may involve obtaining more than one sample, such as two samples, such as three samples, four samples or more from individuals, and preferably the same individual. This allows the relative comparison of expression both as in the presence or absence of at least one nucleic acid and/or the level of expression of the at least one nucleic acid between the two samples. Alternatively, a single sample may be compared against a "standardized" sample, such a sample comprising material or data from several samples, preferably also from several individuals.
[0074] Before analyzing the sample, it will often be desirable to perform one or more sample preparation operations upon the sample. Typically, these sample preparation operations will include such manipulations as concentration, suspension, extraction of intracellular material, e.g., nucleic acids from tissue/whole cell samples and the like, amplification of nucleic acids, fragmentation, transcription, labelling and/or extension reactions.
[0075] Nucleic acids, especially RNA and specifically miRNA can be isolated using any techniques known in the art. There are two main methods for isolating RNA: phenol-based extraction and silica matrix or glass fiber filter (GFF)-based binding. Phenol-based reagents contain a combination of denaturants and RNase inhibitors for cell and tissue disruption and subsequent separation of RNA from contaminants. Phenol-based isolation procedures can recover RNA species in the 10-200-nucleotide range e.g., miRNAs, 5S rRNA, 5.8S rRNA, and Ul snRNA. If a sample of "total" RNA was purified by the popular silica matrix column or GFF procedure, it may be depleted in small RNAs. Extraction procedures such as those using Trizol or TriReagent, however will purify all RNAs, large and small, and are the recommended methods for isolating total RNA from biological samples that will contain miRNAs/siRNAs.
[0076] Any method required for the processing of a sample prior to detection by any of the methods noted herein falls within the scope of the present disclosure. These methods are typically well known by a person skilled in the art.
[0077] It is within the general scope of the present disclosure to provide methods for the detection of miRNA. An aspect of the present disclosure relates to the detection of the miRNA sequences as described in the plots and graphs of the figures contained herein. As used herein, the term "detect" or "determine the presence of refers to the qualitiative measurement of undetectable, low, normal, or high concentrations of one or more biomarkers such as, for example, nucleic acids, ribonucleic acids, or polypeptides and other biological molecules.
Detection may include 1) detection in the sense of presence versus absence of one or more miRNAs as well as 2) the registration/quantification of the level or degree of expression of one or more miRNAs, depending on the method of detection employed. The term "quantify" or "quantification" may be used interchangeable, and refer to a process of determining the quantity or abundance of a substance in a sample (e.., a biomarker), whether relative or absolute. For example, quantification may be determined by methods including but not limited to, micro-array analysis, qRT-PCR, band intensity on a Northern or Western blot, or by various other methods known in the art.
[0078] The detection of one or more nucleic acid molecules allows for the classification, diagnosis and prognosis of a condition such as GVHD. The classification of such conditions is of relevance both medically and scientifically and may provide important information useful for the diagnosis, prognosis and treatment of the condition. The diagnosis of a condition such as a GVHD is the affirmation of the presence of the disease based, as is the object of the present disclosure, on the expression of at least one miRNA herein also referred to as a nucleic acid molecule. Prognosis is the estimate or prediction of the probable outcome of a condition such as a GVHD and the prognosis of such is greatly facilitated by increasing the amount of information on the particular condition. The method of detection is thus a central aspect of the present disclosure.
[0079] Any method of detection falls within the general scope of the present disclosure. The detection methods may be generic for the detection of nucleic acids especially RNA, or be optimized for the detection of small RNA species, as both mature and precursor miRNAs fall into this category or be specially designed for the detection of miRNA species. The detection methods may be directed towards the scoring of a presence or absence of one or more nucleic acid molecules or may be useful in the detection of expression levels.
[0080] The detection methods can be divided into two categories herein referred to as in situ methods or screening methods. The term in situ method refers to the detection of nucleic acid molecules in a sample wherein the structure of the sample has been preserved. This may thus be a biopsy wherein the structure of the tissue is preserved. In situ methods are generally histological i.e. microscopic in nature and include but are not limited to methods such as: in situ hybridization techniques and in situ PCR methods.
[0081] Screening methods generally employ techniques of molecular biology and most often require the preparation of the sample material in order to access the nucleic acid molecules to be detected. Screening methods include, but are not limited to methods such as: Array systems, affinity matrices, Northern blotting and PCR techniques, such as real-time quantitative RT-PCR.
[0082] One aspect of the present disclosure is to provide a probe which can be used for the detection of a nucleic acid molecule as defined herein. A probe as defined herein is a specific sequence of a nucleic acid used to detect nucleic acids by hybridization. A nucleic acid is also here any nucleic acid, natural or synthetic such as DNA, RNA, LNA or PNA. A probe may be labeled, tagged or immobilized or otherwise modified according to the requirements of the detection method chosen. A label or a tag is an entity making it possible to identify a compound to which it is associated. It is within the scope of the present disclosure to employ probes that are labeled or tagged by any means known in the art such as but not limited to: radioactive labeling, fluorescent labeling and enzymatic labeling. Furthermore the probe, labeled or not, may be immobilized to facilitate detection according to the detection method of choice and this may be accomplished according to the preferred method of the particular detection method.
[0083] Another aspect of the present disclosure regards the detection of nucleic acid molecules by any method known in the art. In the following are given examples of various detection methods that can be employed for this purpose, and the present disclosure includes all the mentioned methods, but is not limited to any of these.
[0084] In situ hybridization (ISH) applies and extrapolates the technology of nucleic acid hybridization to the single cell level, and, in combination with the art of cytochemistry, immunocytochemistry and immunohistochemistry, permits the maintenance of morphology and the identification of cellular markers to be maintained and identified, allows the localization of sequences to specific cells within populations, such as tissues and blood samples. ISH is a type of hybridization that uses a complementary nucleic acid to localize one or more specific nucleic acid sequences in a portion or section of tissue (in situ), or, if the tissue is small enough, in the entire tissue (whole mount ISH). DNA ISH can be used to determine the structure of chromosomes and the localization of individual genes and optionally their copy numbers. Fluorescent DNA ISH (FISH) can for example be used in medical diagnostics to assess chromosomal integrity. RNA ISH is used to assay expression and gene expression patterns in a tissue/across cells, such as the expression of miRNAs/nucleic acid molecules as herein described. Sample cells are treated to increase their permeability to allow the probe to enter the cells, the probe is added to the treated cells, allowed to hybridize at pertinent temperature, and then excess probe is washed away. A complementary probe is labeled with a radioactive, fluorescent or antigenic tag, so that the probe's location and quantity in the tissue can be determined using autoradiography, fluorescence microscopy or immunoassay, respectively. The sample may be any sample as herein described. The probe is likewise a probe according to any probe based upon the miRNAs mentioned herein. [0085] An aspect of the present disclosure includes the method of detection by in situ hybridization as described herein.
[0086] In situ PCR is the PCR based amplification of the target nucleic acid sequences prior to ISH. For detection of RNA, an intracellular reverse transcription (RT) step is introduced to generate complementary DNA from RNA templates prior to in situ PCR. This enables detection of low copy RNA sequences.
[0087] Prior to in situ PCR, cells or tissue samples are fixed and permeabilized to preserve morphology and permit access of the PCR reagents to the intracellular sequences to be amplified. PCR amplification of target sequences is next performed either in intact cells held in suspension or directly in cytocentrifuge preparations or tissue sections on glass slides. In the former approach, fixed cells suspended in the PCR reaction mixture are thermally cycled using conventional thermal cyclers. After PCR the cells are cytocentrifugated onto glass slides with visualization of intracellular PCR products by ISH or immunohistochemistry. In situ PCR on glass slides is performed by overlaying the samples with the PCR mixture under a coverslip which is then sealed to prevent evaporation of the reaction mixture. Thermal cycling is achieved by placing the glass slides either directly on top of the heating block of a conventional or specially designed thermal cycler or by using thermal cycling ovens. Detection of intracellular PCR-products is achieved by one of two entirely different techniques. In indirect in situ PCR by ISH with PCR-product specific probes, or in direct in situ PCR without ISH through direct detection of labelld nucleotides (e.g. digoxigenin- 11 -dUTP, fluorescein-dUTP, H-CTP or biotin- 16-dUTP) which have been incorporated into the PCR products during thermal cycling.
[0088] An embodiment of the present disclosure concerns the method of in situ PCR as mentioned herein above for the detection of nucleic acid molecules as detailed herein.
[0089] Microarray
[0090] A microarray is a microscopic, ordered array of nucleic acids, proteins, small molecules, cells or other substances that enables parallel analysis of complex biochemical samples. A DNA microarray consists of different nucleic acid probes, known as capture probes that are chemically attached to a solid substrate, which can be a microchip, a glass slide or a microsphere-sized bead. Microarrays can be used e.g. to measure the expression levels of large numbers of mRNAs/miRNAs simultaneously.
[0091] Microarrays can be fabricated using a variety of technologies, including printing with fine-pointed pins onto glass slides, photolithography using pre -made masks,
photolithography using dynamic micromirror devices, ink-jet printing, or electrochemistry on microelectrode arrays.
[0092] An aspect of the present disclosure regards the use of microarrays for the expression profiling of miR As in conditions such as GVHD. For this purpose, and by way of example, RNA is extracted from a cell or tissue sample, the small RNAs (18-26-nucleotide RNAs) are size-selected from total RNA using denaturing polyacrylamide gel electrophoresis (PAGE). Then oligonucleotide linkers are attached to the 5' and 3' ends of the small RNAs and the resulting ligation products are used as templates for an RT-PCR reaction with 10 cycles of amplification. The sense strand PCR primer has a Cy3 fluorophore attached to its 5' end, thereby fluorescently labelling the sense strand of the PCR product. The PCR product is denatured and then hybridized to the microarray. A PCR product, referred to as the target nucleic acid that is complementary to the corresponding miRNA capture probe sequence on the array will hybridize, via base pairing, to the spot at which the capture probes are affixed. The spot will then fluoresce when excited using a microarray laser scanner. The fluorescence intensity of each spot is then evaluated in terms of the number of copies of a particular miRNA, using a number of positive and negative controls and array data normalization methods, which will result in assessment of the level of expression of a particular miRNA.
[0093] Several types of microarrays can be employed such as spotted oligonucleotide microarrays, pre-fabricated oligonucleotide microarrays or spotted long oligonucleotide arrays.
[0094] In spotted oligonucleotide microarrays the capture probes are oligonucleotides complementary to miRNA sequences. This type of array is typically hybridized with amplified PCR products of size-selected small RNAs from two samples to be compared that are labelled with two different fluorophores. Alternatively, total RNA containing the small RNA fraction (including the miRNAs) is extracted from the abovementioned two samples and used directly without size-selection of small RNAs, and 3' end labeled using T4 RNA ligase and short RNA linkers labelled with two different fluorophores. The samples can be mixed and hybridized to one single microarray that is then scanned, allowing the visualization of up-regulated and down-regulated miRNA genes in one go. The downside of this is that the absolute levels of gene expression cannot be observed, but the cost of the experiment is reduced by half. Alternatively, a universal reference can be used, comprising of a large set of fluorophore-labelled
oligonucleotides, complementary to the array capture probes.
[0095] In pre-fabricated oligonucleotide microarrays or single-channel microarrays, the probes are designed to match the sequences of known or predicted miRNAs. There are commercially available designs that cover complete genomes from companies such as Affymetrix, or Agilent. These microarrays give estimations of the absolute value of gene expression and therefore the comparison of two conditions requires the use of two separate microarrays.
[0096] Spotted long oligonucleotide arrays are composed of 50 to 70-mer oligonucleotide capture probes, and are produced by either ink-jet or robotic printing. Short Oligonucleotide Arrays are composed of 20-25 -mer oligonucleotide probes, and are produced by photolithographic synthesis (Affymetrix) or by robotic printing. More recently, Maskless Array Synthesis from NimbleGen Systems has combined flexibility with large numbers of probes. Arrays can contain up to 390,000 spots, from a custom array design.
[0097] An embodiment of the present disclosure concerns the method of microarray use and analysis as described herein.
[0098] The terms "PCR reaction", "PCR amplification", "PCR", "pre-PCR", "Q-PCR", "real-time quantitative PCR" and "real-time quantitative RT-PCR" are interchangeable terms used to signify use of a nucleic acid amplification system, which multiplies the target nucleic acids being detected. Examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system. Other methods recently described and known to the person of skill in the art are the nucleic acid sequence based amplification and Q Beta Replicase systems. The products formed by said amplification reaction may or may not be monitored in real time or only after the reaction as an end-point measurement.
[0099] Real-time quantitative RT-PCR is a modification of polymerase chain reaction used to rapidly measure the quantity of a product of polymerase chain reaction. It is preferably done in real-time, thus it is an indirect method for quantitatively measuring starting amounts of DNA, complementary DNA or ribonucleic acid (RNA). This is commonly used for the purpose of determining whether a genetic sequence is present or not, and if it is present the number of copies in the sample. There are 3 methods which vary in difficulty and detail. Like other forms of polymerase chain reaction, the process is used to amplify DNA samples, using thermal cycling and a thermostable DNA polymerase.
[00100] The three commonly used methods of quantitative polymerase chain reaction are through agarose gel electrophoresis, the use of SYBR Green, a double stranded DNA dye, and the fluorescent reporter probe. The latter two of these three can be analysed in real-time, constituting real-time polymerase chain reaction method.
[00101] Agarose gel electrophoresis is the simplest method, but also often slow and less accurate then other methods, depending on the running of an agarose gel via electrophoresis. It cannot give results in real time. The unknown sample and a known sample are prepared with a known concentration of a similarly sized section of target DNA for amplification. Both reactions are run for the same length of time in identical conditions (preferably using the same primers, or at least primers of similar annealing temperatures). Agarose gel electrophoresis is used to separate the products of the reaction from their original DNA and spare primers. The relative quantities of the known and unknown samples are measured to determine the quantity of the unknown. This method is generally used as a simple measure of whether the probe target sequences are present or not, and rarely as "true" Q-PCR.
[00102] Using SYBR Green dye is more accurate than the gel method, and gives results in real time. A DNA binding dye binds all newly synthesized double stranded (ds)DNA and an increase in fluorescence intensity is measured, thus allowing initial concentrations to be determined. However, SYBR Green will label all dsDNA including any unexpected PCR products as well as primer dimers, leading to potential complications and artefacts. The reaction is prepared as usual, with the addition of fluorescent dsDNA dye. The reaction is run, and the levels of fluorescence are monitored; the dye only fluoresces when bound to the dsDNA. With reference to a standard sample or a standard curve, the dsDNA concentration in the PCR can be determined.
[00103] The fluorescent reporter probe method is the most accurate and most reliable of the methods. It uses a sequence-specific nucleic acid based probe so as to only quantify the probe sequence and not all double stranded DNA. It is commonly carried out with DNA based probes with a fluorescent reporter and a quencher held in adjacent positions, so-called dual-labelled probes. The close proximity of the reporter to the quencher prevents its fluorescence; it is only on the breakdown of the probe that the fluorescence is detected. This process depends on the 5' to 3' exonuclease activity of the polymerase involved. The real-time quantitative PCR reaction is prepared with the addition of the dual-labelled probe. On denaturation of the double-stranded DNA template, the probe is able to bind to its complementary sequence in the region of interest of the template DNA (as the primers will too). When the PCR reaction mixture is heated to activate the polymerase, the polymerase starts synthesizing the complementary strand to the primed single stranded template DNA. As the polymerisation continues it reaches the probe bound to its complementary sequence, which is then hydro lysed due to the 5 '-3' exonuclease activity of the polymerase thereby separating the fluorescent reporter and the quencher molecules. This results in an increase in fluorescence, which is detected. During thermal cycling of the real-time PCR reaction, the increase in fluorescence, as released from the hydrolysed dual-labelled probe in each PCR cycle is monitored, which allows accurate determination of the final, and so initial, quantities of DNA.
[00104] Any method of PCR that can determine the expression of a nucleic acid molecule as defined herein falls within the scope of the present disclosure. A preferred embodiment of the present disclosure includes the real-time quantitative RT-PCR method, based on the use of either SYBR Green dye or a dual-labelled probe for the detection and quantification of nucleic acids according to the herein described.
[00105] An aspect of the present disclosure includes the detection of the nucleic acid molecules herein disclosed by techniques such as Northern blot analysis. Many variations of the protocol exist.
[00106] An aspect of the present disclosure includes a method of predicting actute Graft versus Host Disease (GVHD) in a subject comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and predicting the subject as having an increased risk for development of a GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00107] The miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * . The miRNA biomarker can consist of miR-423. The miRNA biomarker can consist of miR- 199a-3p . The miRNA biomarker consist of miR-377. The miRNA biomarker can consist of miR-93 * . The amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00108] The quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s). [00109] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD.
[00110] The method can further include administering an appropriate anti-GVHD therapy to the subject. The subject can be a mammal. The subject can be a human.
[00111] An aspect of the present disclosure includes a method of diagnosing a GVDV in a subject comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and diagnosing the subject as having the GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00112] The miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * . The miRNA biomarker can consist of miR-423. The miRNA biomarker can consist of miR- 199a-3 . The miRNA biomarker consist of miR-377. The miRNA biomarker can consist of miR-93 * . The amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00113] The quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
[00114] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD.
[00115] The method can further include administering an appropriate anti-GVHD therapy to the subject. The subject can be a mammal. The subject can be a human.
[00116] An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00117] The miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers can include miR-423, miR-377, and miR-93*. The miRNA biomarkers can consist of miR-423, miR-377, and miR-93*. The miRNA biomarker can consist of miR-423. The miRNA biomarker consist of miR-377. The miRNA biomarker can consist of miR-93*. The amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00118] The quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
[00119] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD.
[00120] The method can further include administering an appropriate anti-GVHD therapy to the subject. The subject can be a mammal. The subject can be a human.
[00121] An aspect of the present disclosure includes a method for determining the efficacy of a GVHD treatment regime in a subject comprising: determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarker comprises one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; administering to the subject an anti-GVHD therapy regime; and redetermining the expression level of the miRNA biomarker(s) in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression level(s) is correlated with the efficacy of the anti-GVHD therapy regime.
[00122] The miRNA biomarkers can include miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers can consist of miR-423, miR-199a-3p, miR-377, and miR-93 * . The miRNA biomarker can consist of miR-423. The miRNA biomarker can consist of miR- 199a-3p . The miRNA biomarker consist of miR-377. The miRNA biomarker can consist of miR-93 * . The amount of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00123] The quantifying can include one or a combination of miRNA array, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s).
[00124] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD.
[00125] The method can further include administering an appropriate anti-GVHD therapy to the subject. The subject can be a mammal. The subject can be a human. [00126] An aspect of the present disclosure includes a kit for predicting GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00127] The kit can further include one or more hybridization probes specific for the miRNA biomarker(s). The kit can further include a solid support having the one or more hybridization probes attached thereto. The kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
[00128] The miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*. The miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarker of the kit can consist of miR-423. The miRNA biomarker of the kit can consist of miR-199a-3p. The miRNA biomarker of the kit can consist of miR-377. The miRNA biomarker of the kit can consist of miR-93*. The expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00129] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD. The subject can be a mammal. The subject can be a human.
[00130] An aspect of the present disclosure includes a kit for diagnosing GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for diagnosing the subject as having GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00131] The kit can further include one or more hybridization probes specific for the miRNA biomarker(s). The kit can further include a solid support having the one or more hybridization probes attached thereto. The kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
[00132] The miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*. The miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarker of the kit can consist of miR-423. The miRNA biomarker of the kit can consist of miR-199a-3p. The miRNA biomarker of the kit can consist of miR-377. The miRNA biomarker of the kit can consist of miR-93*. The expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00133] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD. The subject can be a mammal. The subject can be a human.
[00134] An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers comprise one or a combination of miR-423, miR-199a-3p, miR-377, miR-93*, miR-30a, and miR-155; and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
[00135] The kit can further include one or more hybridization probes specific for the miRNA biomarker(s). The kit can further include a solid support having the one or more hybridization probes attached thereto. The kit can further include reagents for quantifying the expression level of the miRNA biomarker(s).
[00136] The miRNA biomarkers of the kit can include miR-423, miR- 199a-3p, miR-377, and miR-93*. The miRNA biomarkers of the kit can consist of miR-423, miR-199a-3p, miR-377, and miR-93*. The miRNA biomarkers of the kit can include miR-423, miR-377, and miR-93*. The miRNA biomarkers of the kit can consist of miR-423, miR-377, and miR-93*. The miRNA biomarker of the kit can consist of miR-423. The miRNA biomarker of the kit can consist of miR-377. The miRNA biomarker of the kit can consist of miR-93*. The expression level of the miRNA biomarker(s) can be higher by a factor of 2-fold or greater.
[00137] The biological sample can include one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The biological sample can be selected from the group consisting of blood, serum, and plasma. The biological sample can consist of plasma. The biological sample can be derived from the subject prior to symptoms of the GVHD. The subject can be a mammal. The subject can be a human.
[00138] An aspect of the present disclosure includes a method of predicting actute Graft versus Host Disease (GVHD) in a subject comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and predicting the subject as having an increased risk for development of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00139] An aspect of the present disclosure includes a method of diagnosing a GVDV in a subject comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consists of miR-423, miR-199a-3p, miR-377, and miR-93*; and diagnosing the subject as having the GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00140] An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00141] An aspect of the present disclosure includes a method of determining the prognosis of a subject developing, or having already developed, GVHD comprising: quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93 *; and identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00142] An aspect of the present disclosure includes a method for determining the efficacy of a GVHD treatment regime in a subject comprising: determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; administering to the subject an anti-GVHD therapy regime; and redetermining the expression level of the miRNA biomarkers in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression levels is correlated with the efficacy of the anti-GVHD therapy regime. [00143] An aspect of the present disclosure includes a kit for predicting GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00144] An aspect of the present disclosure includes a kit for diagnosing GVHD in a subject, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for diagnosing the subject as having GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00145] An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00146] An aspect of the present disclosure includes a kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93*; and instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
[00147] The following examples are offered by way of illustration and not by way of limitation.
EXAMPLES
[00148] Plasma miRNA profiling and signature in GVHD patients. To identify a diagnostic plasma miRNA signature for GVHD, real-time PGR based high throughput miRNAs array was performed to compare the plasma miRNA profiles from 4 GVHD patients with the profiles from 3 non-GVHD patients at 6 weeks after HCT. A distinct miRNA signature was identified including a set of 24 differentially expressed miRNAs in GVHD compared with non-GVHD patients, including 8 upregulated and 16 downregulated miRNAs (see FIG 1). Hierarchical clustering analysis showed that the plasma miRNA signature can distinguish GVHD from non-GVHD subjects (see FIG 1). The miRNA's shown in FIG 1 are listed in Table 1 herein above and the PCR primers used in the experiment are shown in Table 2 below.
Table 2. Sequence of Primers for miRNA Biomarkers.
miRNA SEQ ID NO: Specific Primer miR-377 25 GGA TCA CAC AAA GGC A
miR-466d-3p 26 GGT ATA CAT ACA CGC AC
miR-423 27 TGA GGG GCA GAG AGC GAG AC
miR-206 28 TGG AAT GTA AGG AAG TG
miR-155 29 ATG CTA ATT GTG ATA GGG
miR-93* 30 TGC TGA GCT AGC ACT TCC C
miR-199a-3p 31 AGT AGT CTG CAC ATT GG
miR-30a 32 GGG TGT AAA CAT CCT C miR-26a 33 CAA GTA ATC CAG GAT AGG C
miR-191 34 CAA CGG AAT CCC AAA AGC AG
miR-15b 35 GCA GCA CAT CAT GGT TTA C
miR-744 36 GCG GGG CTA GGG CTA ACA G
miR-337-3p 37 CAG CTC CTA TAT GAT GC
miR-146a 38 GAG AAC TGA ATT CCA TGG GT
miR-199a-5p 39 GCC CAG TGT TCA GAC TAC
miR-107 40 AGC ATT GTA CAG GGC TAT C
miR-30b 41 GTA AAC ATC CTA CAC TCA G
miR-30a* 42 CTT TCA GTC GGA TGT TTG
miR-30c 43 GTA AAC ATC CTA CAC TCT C
let-7a 44 GAG GTA GTA GGT TGT ATA
let-7g 45 AGG TAG TAG TTT GTA C
let-7b 46 GAG GTA GTA GGT TGT GTG
miR-363 47 GGA ATT GCA CGG TAT CCA
miR-186 48 CAA AGA ATT CTC CTT TTG GG
[00149] In another experiment, miRNA-423, miR-199-3p, miR-93* and miR-377 were shown to be significantly upregulated in plasma of GVHD pateints (n=6) compared to non-GVHD patients (n=16) in the training set (data not shown). The realtime PCR results of miRNAs were normalized to the spike-in cel-miR-39.
[00150] In another experiment, the expression of miRNA biomarkers was shown to be positively associated with GVHD severity. By using real-time PCR, the levels of miR-423, miR-199-3p, miR-93* and miR-3777 in GVHD patients diagnosed with grade 3 GVHD were shown to be significantly upregulated compared to patients diagnosed with grade 1-2 GVHD (data not shown). The p-values ranged from p<0.05, p<0.01, and p<0.001.
[00151] In another experiment, Receiver Operating Characteristic (ROC) curve analysis was performed for the 4 iindividual miRNA 's described above and also for the combined 4 miRNA panel. Logistic regression determined that a linear combination of values for miR-423, miR-199a-3p, miR-93*, and miR-377 produced the best model to predict the occurrence of GVHD. Combined miRNAs panel = 6.650 + 0.426 x miR-423 + 0.104 x miR-93* - 0.462 x miR-199 - 0.794 x miR-377 yielded an AUC = 0.85 and a p<0.001 (data not shown). Individually, miR-423 yielded an AUC = 0.76 and a p<0.002; miR-199a-3p yielded an AUC = 0.808 and a p<0.001; miR-93* yielded an AUC = 0.808 and a p<0.001; and miR-377 yielded an AUC = 0.808 and a p<0.001 (data not shown).
[00152] In another experiment, the expression of miR-423, miR-199a-3p, miR-93*, and miR-377 was measured using using real-time PCR and was shown to be significantly upregulated in plasma of GVHD patients before symptom occurrence. The p-values ranged from p<0.05, p<0.01, and p<0.001 (data not shown).
[00153] In another experiment, Kaplan-Meir survival curves showed that high expression of miR-423, miR-93*, and miR-3777 are associated with poor survival in the training cohort (data not shown). In this experiment, miR A expression was measured by real-time PCR and coverted into discrete variable by division of samples into 2 classes (low and high) based on median values as the threshold. P values ranged from p<0.05, p<0.01, and p<0.001 and were based on log-rank test.
[00154] Table 3 below shows Cox regression analysis for the estimation of risk prediction of GVHD in a training cohort.
Table 3. Cox regression analysis for the estimation of risk for developing GVHD.
Univariate analysis Multivariate analysis
Hazard ratio(95% CI) P Hazard ratto(95%CI} P
Age 1.004 0.72 1.007 0.590
Maligna nt{Yes/No) 0.342 0-.13? 0.590 0.516
Risk Scoreflow/high} 0.495 0.01S. 0.670 0.209
Donor typ*{Related/Unrelated) 0.630 0.134 0.609 0.126
Regimen Type 0.585 0.073 0.772 0.469 {ten yeloablative/ Myefoablaltve)
miftNAs panel 1.534 0.001 1.524 0.004 [00155] Table 4 below shows multivariate Cox regression analysis for the estimation of miRNA panel with overall survival in a training cohort.
Table 4. Multivariate Cox regression analysis for the miRNA panel with overall survival.
Hazard ratlo{S5% CI) P
Age 0J70 0265
Malignant 0,000 0.987
Risk Score! bw/high) 0,735 0.629
Donor type| elated/U reiated) 2.697 0.107
Regimen Type 1*522 0.451
( on yeiosblative/ Myeloabiative)
miRNAs pane! 2.110 0,010
[00156] Plasma microRNA signature as non-invasive biomarker for acute graft-versus-host disease. Acute graft-versus-host disease (GVHD) is the leading cause of morbidity and mortality after allogeneic hematopoietic cell transplantation (HCT).
Approximately 35%— 50% of HCT recipients develop GVHD; however, there is no validated diagnostic and predictive blood biomarkers for GVHD in clinical use. Here, it is shown that plasma from GVHD patients have distinct microRNA expression profiles. It was found that 6 miRNAs, including miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a, were significantly upregulated in the plasma of GVHD patients (n=116) when compared with non-GVHD patients (n=52) in training and validation phases. A model is developed including 4 miR As (miR-423, miR-199a-3p, miR-93*, and miR-377) that can predict the probability of GVHD with AUC of 0.80. Moreover, these elevated miRNAs were detected before onset of GVHD. In addition, the levels of the miRNA signatures were positively associated with GVHD severity, and high expression of the miRNA panel was associated with poor overall survival. Furthermore, the miRNA signature for GVHD was not found in plasmas of lung-transplanted as well as sepsis patients. These results have identified a specific plasma miRNA signature that may serve as an independent biomarker for prediction, diagnosis, and prognosis of GVHD.
[00157] Acute graft-versus-host disease (GVHD) is a common complication after allogeneic hematopoietic cell transplantation (HCT), affecting the skin, liver, and gastrointestinal (GI) tract and contributing to transplant related morbidity and mortality. Approximately half of
1-3
patients following HCT will develop GVHD and require systemic treatment " . Accurate and timely biomarker for GVHD can improve diagnosis and prognosis and help guide therapeutic interventions. Currently, the diagnosis of GVHD is based on clinical symptoms in one or more of the main target organs and biopsy. So far, there is no validated diagnostic and predictive blood biomarker for GVHD in clinical use4,5. Moreover, once GVHD occurs, the most important predictor of long-term survival is the primary response to therapy. In patients who are resistant to initial therapy, the risk of morbidity and mortality increases significantly6'7. Thus, there is a pressing need to identify non-invasive biomarkers to predict not only GVHD development but also the survival and treatment outcome of GVHD.
[00158] MicroRNAs (miRNAs) are a class of small non-coding RNA that negatively regulate gene expression by translational repression or induction of mRNA degradation8.
Increasing evidences show that miRNAs are present in plasma, serum, saliva, urine, or other body fluid in a remarkably stable form that is protected from endogenous RNase activity9"11. Circulating miRNAs have potential to serve as novel, non-invasive biomarkers for various diseases such as cancer, cardiovascular diseases, sepsis, organ transplantation, liver injury, ectopic pregnancy, diabetes, and infection " .
[00159] In this study, a group of plasma miR As were identified as biomarkers for GVHD. It was found that 6 miRNAs, including miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a, were significantly upregulated in the plasma of GVHD patients when compared with non-GVHD patients after HCT. A model was developed including 4 miRNAs, miR-423, miR-199a-3p, miR-93*, and miR-377, to predict the probability of a GVHD. The levels of miRNA biomarkers are positively associated with a GVHD severity. Moreover, those elevated miRNAs can be detected before a GVHD diagnosis and high expression of these miRNAs is associated with poor survival. Importantly, the GVHD miRNA signature was not detected in plasma of lung-transplanted or sepsis patients. These results suggest that a panel of 4 circulating miRNAs can serve as an independent biomarker for the prediction, diagnosis, and prognosis of GVHD.
[00160] Methods
[00161] Patients and samples. The study population consisted of 196 human subjects who underwent allogeneic HCT performed between 2008 and 2012 at Duke University Medical Center. The discovery set consisted of 4 HCT patients who developed a GVHD and 3 HCT patients who never developed GVHD (non-GVHD). The training set consisted of 59 GVHD and 19 non-GVHD patients, and the validation and test set consisted of 41 GVHD and 70 non-GVHD patients. Additionally, 45 patients who underwent lung transplantation, 38 patients who had sepsis with confirmed pathogens, and 10 healthy donors were enrolled as controls. EDTA-anticoagulated blood was drawn at 2 or 6 weeks after transplantation. Cell-free plasma was isolated from all blood samples using a two-step protocol (2,000 rpm for 10 min, 12,000 rpm for 3 min) to prevent contamination by cellular nucleic acids. The diagnosis of GVHD was based on the clinical criteria and histologically confirmed by biopsy in the target organs.
GVHD was graded on the basis of severity of involvement of target organs21. All research samples were collected after obtaining written informed consent for participation in accordance with the Declaration of Helsinki on protocols approved by the Duke University Medical Center Institutional Review Board. Patient characteristics are summarized in Table 3 shown below.
Table 5. Clinical Characteristics of Patients Recruited in the Study
Figure imgf000043_0001
[00162] RNA extraction from plasma. Total RNAs were extracted from 400 μΐ of plasma using the mirVana PARIS Kit (Ambion) according to the manufacturer's instructions. Since no known endogenous miRNA in human plasma can be used as normalization control, synthetic Caenorhabditis elegans miRNA (cel-miR-39) was used as spiked-in control. 2μ1 of 5 nM synthetic cel-miR-39 (synthesized by Integrated DNA Technologies) was added to each denatured sample after combining the plasma sample with denaturing solution. RNAs were eluted with 105 μΐ of pre-heated elution solution.
[00163] qRT-PCR of plasma miRNAs. The quantification of plasma miRNAs was performed using SYBR Green-based quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) as previously described22. Mature miRNAs were polyadenylated at the 3' end by Poly(A) Polymerase Tailing Kit (Epicentre Biotechnologies), then converted into cDNA by reverse transcriptase Superscript III (life technologies) using oligo-dT primer with universal tag. With this universal tag, qRT-PCR was performed with miRNA-specific forward primer, universal primer mix (UPM) containing two primers (long and short, molar ratio 1 :5) to eliminate the non-specific priming and Power SYBR® Green Master Mix (life technologies).
[00164] Real-time qPCR based high throughput miRNAs array. Real-time qPCR based high-throughput miRNA array was performed which contained 345 human
well-characterized miRNAs primers as previous described23, to compare the plasma miRNA profiles from 4 GVHD and 3 non-GVHD patients. Cel-miR-39 was used for normalization to obtain relative miRNA expression.
[00165] Assay of plasma IL-2Ra. Plasma IL-2Ra was determined using an IL-2Ra ELISA kit (R&D Systems) according to the manufacturer's instruction. Plasma samples in 4-fold dilution and standards were measured in duplicates. Absorbance was measured with Molecular Devices Emax and results were analyzed by SoftMax Pro 4.8 software (Molecular Devices).
[00166] Statistical analysis. Hierarchical clustering analysis was performed using Cluster 3.0. The Mann- Whitney test was used to compare the differences in plasma expression between a GVHD and non-GVHD group. A two-sided chi-square test was used to compare the differences in patient clinical characteristics. Receiver-operating characteristic (ROC) curves and the area under the ROC curve (AUC) were used to assess the sensitivity and specificity of miRNA biomarkers for the diagnosis of GVHD. Logistic regression was used to develop a combined miRNA panel to predict the probability of developing GVHD. Overall survival was analyzed using Kaplan-Meier curve. Cox regression was performed to determine the predictive value of miRNA signature for diagnosis and survival of GVHD. Spearman correlation analysis was performed to test whether expression of the four miRNAs are correlated with each other. All statistical analysis was performed using SPSS 16.0 software and graphs were generated using GraphPad Prism 5.0 (Graphpad Software Inc).
[00167] Results
[00168] Plasma miRNA profiling and signature in GVHD patients. To identify diagnostic plasma miRNA signature for GVHD, real-time PGR based high throughput miRNAs array was performed to compare the plasma miRNA profiles from 4 GVHD patients with the profiles from 3 non-GVHD patients at 6 weeks after HCT. A distinct miRNA signature was identified including a set of 24 differentially expressed miRNAs in GVHD compared with non-GVHD patients, including 8 upregulated and 16 downregulated miRNAs (see FIG 1 and Table 6 below). Hierarchical clustering analysis showed that the plasma miRNA signature can distinguish GVHD from non-GVHD subjects.
Table 6. Fold change and P value for a set of 24 differentially expressed miRNAs in GVHD compared with non-GVHD patients.
miR-377 3,79 0.02
m\R~2m 0.08
miR-155 3,19 ,09
3,20 0.05
miR-423 3,01 0.0S
miR~03* 2,76 0.05
rni -30 2,0 0,10
miR~19Sa»3p 2,3S 0,04
miR»337«3p 0.46 0,05
Figure imgf000046_0001
0.62: Q. t Q ii¾R"199a~S:p 0,45 0.07
U O
0.60 0.10
msR-19 0.35 0.02
0,45 0.04
miR*186 0.50 0.09
0.21 o.oe
m1R~l07 0.50 0,08
M&W 0.10
tR~30e 0.72 0.09
mif¾~383 0,80 0,0§
[00169] To verify the differentially expressed plasma miRNAs identified from the discovery phase, miRNA qPCR was performed in an independent training set consisting of 59 GVHD patients and 19 non-GVHD controls. Among the 24 candidate miRNAs, 6 plasma miRNAs including miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a were significantly up-regulated in GVHD patients compared with non-GVHD controls in training phase (see FIG's 2A-2H). The fold of change in their expression levels for these 6 miRNAs was 2.8 (miR-423), 3.5 (miR-199a-3p), 3.2 (miR-93), 4.0 (miR-377), 4.6 (miR-155), and 2.4 (miR-30a). These 6 miRNAs were chosen for further analysis. FIG's 2A-2H are graphs showing expression of plasma miRNA signature for GVHD diagnosis in a training set. Expression of miR-423 (A), miR-199a-3p (B), miR-93* (C), miR-377 (D), miR-155 (E), and miR-30a (F) in plasma of GVHD (n=59) and non-GVHD patients (n=19) at 6 weeks after HCT. P values were based on Mann- Whitney test. ROC curve analysis for individual miRNA (A-F) and combined miRNA panel (G). Logistic regression determined that a linear combination of values for miR-423, miR-199a-3p, miR-93*, and miR-377 produced the best model for GVHD diagnosis (G). Comparison of sIL-2Ra protein levels in plasma between GVHD and non-GVHD patients at 6 weeks after HCT (H). P values were based on Mann- Whitney test.
[00170] Development of a diagnostic panel containing 4 plasma miRNAs. The sensitivity and specificity of the 4 miRNAs described in FIG's 2A-2G in GVHD diagnosis were evaluated using receiver operating characteristic (ROC) analysis. Logistic regression determined that a linear combination of the expression levels for miR-423, miR-199a-3p, miR-93*, and miR-377 produced the best model to predict the diagnosis of GVHD (see Table 7 below). The ROC curves show AUC (area under the curve) of 0.76 (95% CI, 0.64-0.87) for miR-423, 0.76 (95% CI, 0.65-0.87) for miR-199a-3p, 0.78 (95% CI, 0.67-0.89) for miR-93* and 0.81 (95% CI, 0.71-0.91) for miR-377 (see FIG's 2A-2F, respectively). The AUC for the combined miRNA biomarker panel of miR-423, miR-199a-3p, miR-93* and miR377 is 0.85 (95% CI, 0.76-0.93) (P< 0.0001) (see FIG 2G).
Table 7. The Equations used in the Model of Logistic Regression in Training and Validation Set.
Equation
Training set Combined miRNA panel=5.514 + 0.255 x miR-423 - 0.427 x miR-199a-3p +
0.522 x miR-93* - 1.161 x miR-377
Validation set Combined miRNA panel= 11.059-0.19*miR-423+0.175*miR-199a-3p- 0.04*miR-377-0.89*miR-377
Predicted probability= Exp (combined miRNA panel) / [1+Exp (combined miRNA panel)]
[00171] Previous studies suggest that sIL-2Ra is a potential biomarker for GVHD, with the highest AUC value among a panel of protein biomarkers including sIL-2Ra, IL-8, HGF,
27-29
and TNFR1 " . The plasma levels of sIL-2Ra were compared in these groups of GVHD and non-GVHD patients. The plasma levels of sIL-2Ra were not significantly different between GVHD and non-GVHD patients at 6 weeks after transplantation (FIG 2H). Taken together, the data suggest that the plasma miR A panel may be a non-invasive biomarker for GVHD.
[00172] Validation and blinded test of the miRNA signature for GVHD. The expression levels of the 6 miRNAs were further validated in an independent validation study, consisting of 57 GVHD patients and 33 non-GVHD controls. The upregulation of the 6 miRNAs in the plasmas of GVHD patients was validated. The AUC for the 4-miRNA biomarker panel including miR-423, miR-199a-3p, miR-93*, and miR-377 was 0.76 (95% CI, 0.65-0.86) (P< 0.0001) (FIG's 3A-3I, Table 8). No significant difference in plasma sIL-2Ra levels was found between GVHD and non-GVHD groups at 6 weeks after transplantation (FIG 3H). AUC value was 0.80 when data from all the 168 samples in training and validation sets were analyzed (FIG 31).
Table 8. Spearman Correlation Analysis for miRNAPanel by SPSS 16.0.
Figure imgf000048_0001
[00173] To determine whether the different miRNA expression levels between GVHD and non-GVHD groups existed prior to HCT, the levels of miRNAs were analyzed in plasmas taken before transplantation. No significant difference was found in the expression of the 6 miRNAs in plasmas of GVHD and non-GVHD patients before HCT (FIG's 4A-4F), suggesting that the elevated miRNA expression in GVHD plasmas was not due to high expression levels in the patients before transplantation.
[00174] Next the diagnostic value of miRNA signature was tested in a blinded study (n=21). Based on the model developed in the validation phase, a signature composed of the 4 miRNAs (miR-423, miR-199a-3p, miR-93 and miR-377) correctly discriminated 12 of 13 GVHD samples (92% sensitivity). Taken together, the data suggest that the 4-miRNA panel can function as a non-invasive biomarker for GVHD.
[00175] miRNA signature as prediction factor for GVHD. An ideal miRNA biomarker should allow for identification of GVHD before the onset of symptoms of GVHD. The miRNA panel provided herein was analyzed in plasmas of GVHD patients collected before GVHD diagnosis (median=16 days before diagnosis). Significantly elevated expression of the 6 miRNAs was observed in plasma of GVHD patients compared with non-GVHD controls prior to GVHD diagnosis. FIG's 5A-50 are graphs showing the predictive value of the miRNA signature for GVHD. The expression of (A) miR-423, (B) miR-199a-3p, (C) miR-93*, (D) miR-377, (E) miR-155 and (F) miR-30a in the plasma of GVHD patients prior to GVHD diagnosis, with a median of 16 days before diagnosis. (G) ROC curve of the 4-miRNA panel (miR-423, miR-199a-3p, miR-93*, miR-377) at 6 weeks when predicting GVHD before onset. (H) Plasma concentration of sIL-2Ra at 6 weeks after HCT in non-GVHD and GVHD patients before GVHD diagnosis. (I-L) The expression of the 4-miRNA panel at 2 weeks after HCT in plasma of GVHD and non-GVHD patients. (M) ROC curve of the 4-miRNA panel at 2 weeks after HCT when predicting GVHD. (N) Plasma concentration of sIL-2Ra at 2 weeks after HCT. (O) ROC curve of sIL-2Ra at 2 weeks after HCT when predicting GVHD.
[00176] To predict the onset of GVHD development as early as possible, the expression was further analyzed of the miRNA panel in plasmas taken 2 weeks after HCT. The levels of miR-423 and miR-93* were significantly up-regulated in the plasma of GVHD patients compared with non-GVHD, while the levels of miR-199a-3p and miR-377 were also higher but
27 28 not achieved statistical significance (FIG's 5I-5L). Consistent with published results ' , the plasma levels of sIL-2R at 2 weeks after HCT were significantly higher in GVHD patients than that in non-GVHD group (FIG 5H). However, AUC for the miRNA signature including miR-423, miR-199a-3p, miR-93*, and miR-377 was higher than AUC for sIL-2Ra at 2 weeks after HCT (0.86 vs 0.76). This result suggests that measurement of miRNA signature will increase the accuracy of diagnosis for GVHD, especially for patients who show symptoms at the later time (> 2-3 weeks after HCT).
[00177] When miR-423, miR-199a-3p, miR-93* and miR-377 were combined as the miRNA signature to predict GVHD, AUC was 0.76 (95% CI, 0.68-0.85) (P< 0.0001) (FIG 5G). In contrast, sIL-2Ra levels were not significantly different in plasmas of GVHD patients before diagnosis and non-GVHD patients (FIG 50).
[00178] To predict the onset of GVHD development as early as possible, the expression was further analyzed of the miRNA panel in plasmas taken 2 weeks after HCT. The levels of miR-423 and miR-93 * were significantly up-regulated in the plasma of GVHD patients compared with non-GVHD, while the levels of miR-199a-3p and miR-377 were also higher but
27 28 not achieved statistical significance (FIG's 5I-5L). Consistent with published results ' , the plasma levels of sIL-2R at 2 weeks after HCT were significantly higher in GVHD patients than that in non-GVHD group (FIG 5N). However, AUC for the miRNA signature including miR-423, miR-199a-3p, miR-93*, and miR-377 was higher than AUC for sIL-2Ra at 2 weeks after HCT (0.86 vs 0.76) (FIG's 5M and 50). This result suggests that measurement of miRNA signature will increase the accuracy of diagnosis for GVHD, especially for patients who show symptoms at the later time (> 2-3 weeks after HCT).
[00179] Subsequently, Cox regression analysis was performed when considering the diagnosis of GVHD as the endpoint to evaluate if the 4-miRNA panel can predict the probability of GVHD. Univariate Cox analysis with the 4-miRNA panel and clinical factor (age, malignant, risk score, donor type and regimen type) revealed that the 4-miRNA panel had predictive value for GVHD in training or validation set ( =0.001, hazard ratio 1.534 in training phase; =0.000, hazard ratio 1.481 in validation phase; Table 9). Furthermore, multivariate Cox regression analysis of each of these parameters suggests that the expression of the 4-miRNA panel was an independent predictor for GVHD after adjusted for age, malignant, risk score, donor type and regimen type ( =0.000, hazard ratio 1.481 in training phase; =0.000, hazard ratio 1.478 in validation phase; Table 9).
Table 9. Cox Regression Analysis for the Estimation of Risk Prediction of GVHD in Training Phase and Validation Phase.
Figure imgf000051_0001
[00180] Correlation of the miRNA biomarker with GVHD severity. Whether plasma miRNA levels are correlated with the severity of GVHD (grade 1-4) was determined. All GVHD patients were divided into two groups based on GVHD grade: low-grade (1-2) and high-grade (3-4). The expression of miR-423, miR-93*, and miR-377 was elevated significantly in high-grade GVHD patients compared with low-grade GVHD patients, whereas no significant difference in the expression of miR-199a-3p, miR-155, and miR-30a was found in plasmas of high-grade and low-grade GVHD patients (FIG's 6A-6F). To investigate whether the miR A expression is associated with the development of GVHD, the levels of the miRNA signature were measured in a set of 9 patients before disease onset (at 2 weeks after HCT) and after onset (at 6 weeks after HCT). The levels of miR-423, miR-199a, and miR-93* were significantly upregulated in the post-diagnosis samples compared to the pre-diagnosis samples (see FIG's 6G-6L).
[00181] Correlation of the miRNA biomarker with overall survival of GVHD.
Whether the 4-miRNA panel can be used for prognosis of GVHD patients was evaluated. In the training set, 44 GVHD patients with updated follow-up information were divided into two groups (high- and low-risk) based on the predicted probabilities for developing GVHD using the 4-miRNA panel. Kaplan-Meier survival analysis showed that the high-risk patients according to the expression of miR-423, miR-199a-3p, miR-93*, and miR-377 were associated with poor survival (Ρ=0.02) (FIG 7). Subsequently, multivariate Cox regression analysis with the
4-miRNA panel and clinical characteristics including age, malignant, risk score, donor type and regimen type indicated that the 4-miRNA panel was an independent unfavorable prognostic factor for GVHD overall survival (P=0.0\, hazard ratio 2.110; Table 10).
Table 10. Multivariate Cox Regression Analysis for the Estimation of the miRNA Panel with Overall Survival.
Hazard ratio P
Age 0.970 0.265
Malignant (Yes/No) 0.000 0.987
Risk Score (low/high) 0.735 0.629
Donor type 2.697 0.107 (Related/Unrelated)
Regimen Type 1.522 0.451
(Non-Myeloablative/ Myeloablative) miRNA signature 2.110 0.010
[00182] Expression correlation within the 4-miRNA panel. Multivariate logistic regression analysis showed that use of the 4-miRNA panel improved the distinction between GVHD and non-GVHD patients more than use of individual miRNAs. Spearman correlation analysis was performed to test whether the expression of the four miRNAs are correlated with each other. The plasma levels of miR-423 and miR-199a-3p as well as miR-93* and miR-377 were significantly positively correlated, with R-squared values of 0.822 and 0.932, respectively, P< 0.001(FIG's 8A-8B). In addition, Spearman correlation analysis showed that the expression of the 4-miRNA panel (miR-423, miR-199a-3p, miR-93* and miR-377) was significantly positively correlated with each other, with all P values < 0.001. These results further support the overlapping of the diagnostic values of above four miRNAs. However, the expression of each single miRNA was not correlated with the sIL-2Ra level, indicating that the miRNA panel is an independent biomarker for GVHD (data not shown).
[00183] Disease specificity of the 6 miRNAs. To determine the disease specificity of the 6 miRNAs identified from GVHD, patients were enrolled having acute rejection after lung transplantation or without acute rejection after lung transplantation, and patients with or without sepsis, as non-HCT disease controls. No significant difference was found in the expression of the 6 miRNAs in plasma of acute rejection (n=17) and non-rejection (n=28) lung transplanted patients (FIG's 9A-9F). Sepsis is one of the post-transplantation complications associated with a significant rise of inflammation related markers including sIL-2Ra28. The expression of the 6 miRNAs was compared in plasma of 38 sepsis patients and 10 healthy donors. The expression of 5 miRNAs, miR-199a-3p, miR-93*, miR-377, miR-30a and miR-155, was comparable between sepsis patients and healthy controls; however, the level of miR-423 was higher in sepsis patients than healthy donors (FIG's 9G-9L). The data suggest that the 5 miRNAs among the signature are related to the development of GVHD and miR-423 may be involved in inflammation regulation. [00184] Receiver Operating Characteristic (ROC) curve analysis was performed for each of 6 miRNA's individually (miR-423, miR-199a-3p, miR-377, miR-93*, miR-155, and miR-30a) to evaluate the sensitivity and selectivity of the miRNAs as a diagnostic biomarker for GVHD and the data are shown in FIG's 10A-10F. The time point was 6 weeks after HCT in plasma samples for 34 grade 1-2 GVHD patients, 25 grade 3-4 GVHD patients, and 19 non-GVHD controls. Logistic regression determined that individually, (FIG 1 OA) miR-423 yielded an AUC = 0.76 and a p<0.0008; (FIG10B) miR-199a-3p yielded an AUC = 0.76 and a p<0.0008; (FIGIOC) miR-377 yielded an AUC = 0.81 and a p<0.0001; (FIG10D) miR-93* yielded an AUC = 0.78 and a p<0.0003; (FIG10E) miR-155 yielded an AUC = 0.78 and a p<0.0003; and (FIG10F) miR-30a yielded an AUC = 0.72 and a p<0.005.
[00185] Recent publications demonstrate that circulating miRNAs may serve as
12-20
non-invasive biomarkers for many different diseases " . Here, it was shown that plasma miRNAs may serve as biomarkers for GVHD. It was found that the expression of 6 miRNAs, miR-423, miR-199a-3p, miR-93*, miR-377, miR-155, and miR-30a, was significantly upregulated in the plasma of GVHD patients when compared with non-GVHD patients. A model was developed including 4 miRNAs to predict the probability of GVHD with AUC of 0.80. The levels of miRNA biomarkers were positively associated with GVHD severity. Moreover, the elevated miRNAs were detected before onset of GVHD and were not found in lung transplanted patients or patients with sepsis. In addition, it was found that high expression of a 4-miRNA panel was associated with poor survival. Taken together, these data show that the plasma miRNA signature is an independent predictive, diagnostic, and prognostic factor for GVHD.
[00186] The data suggest that the plasma miRNA panel as biomarkers for GVHD has excellent sensitivity and specificity. The results show that compared to sIL-2Ra, a promising biomarker with the highest AUC value in a panel of protein biomarkers for GVHD29, the plasma miRNA signature provided herein has obvious advantages. The levels of sIL-2Ra peak at 2-3 week after HCT and decline rapidly to baseline level at 6 weeks after HCT ' . Furthermore, the levels of sIL-2Ra are also elevated during infection . Thus, it is not clear whether the elevated sIL-2Ra is due to infection or GVHD. In contrase, measurement of the expression levels of the miRNA signature for GVHD clearly demonstrates that it is not only elevated in 2-6 week plasma of the GVHD patients but also not detected in other diseases as sepsis and lung transplantation.
[00187] These results show that the miRNA panel can provide a predictive role for GVHD. It was found that the levels of the plasma miRNA signature were elevated in GVHD patients at 16 days before the diagnosis of GVHD. In contrast, the plasma levels of sIL-2Ra in these samples were not significantly elevated. The low relative abundance of protein may render its detection difficult. However, the change in the expression levels of the miRNA signature prior to GVHD diagnosis can be detected by qPCR. Cox regression analysis indicates that the miRNA signature containing 4 miRNAs, miR-423, miR-199a-3p, miR-93*, and miR-377 has the best predictive value for GVHD. Predicting GVHD development is essential in early identification of high-risk individuals who need individualized treatment.
[00188] The data suggest that the plasma miRNA signature is associated with poor survival in GVHD patients and is a prognostic factor for predicting the outcome of GVHD patients. The severity and outcome of GVHD is heterogeneous among patients. Growing evidences show that diverse clinical factors such as age, HLA-match, intensity of conditioning,
37 and the intensity of post-transplant immunosuppression may be associated with GVHD ;
however, prognostic factors that can be identified at the onset of GVHD remain largely elusive. If patients who are likely to have poor outcome can be predicted at the onset of GVHD, early administration of tailored therapy may change the outcome of these patients. Moreover, once GVHD occurs, the most important predictor of long-term survival is the primary response to therapy. In patients who are resistant to initial therapy, the risk of morbidity and mortality increases significantly6'7. Thus, utilization of the plasma miRNAs signature as potential biomarkers for predicting response of GVHD to therapy will improve the treatment outcome.
[00189] The six miRNAs identified in the plasma of GVHD patients are involved in inflammation, tissue damage, cell proliferation regulation and tissue repair. miR-423 may serve
24
as a potential circulating biomarker for heart failure . miR-155 plays a key role in inflammation
38
regulation and immune response . Interestingly, a recent report show that miR- 155 is upregulated in effector T cells of mice with GVHD and miR-155 expression in lymphocytes is essential for lethal GVHD in mice26. miR-199a-3p was reported to play a role in hepatocytes injury and hepatocellular carcinoma 23'39. miR-93 regulates cell proliferation40 while miR-30a is associated with autophagy and apoptosis41'42. These findings suggest that the elevated miRNAs in plasma of GVHD patients may be associated with immune responses and organ damage during GVHD. The mechanism underlying the secretion of the plasma miRNAs remains to be investigated. Circulating miRNAs may be selectively included into multivesicular body (MVB) or exosomes, which originate from the endosome, then fuse with plasma membrane43. However, recent work indicates that circulating miRNAs can be transferred in exosome-independent manner, and miRNAs can be stably exported in conjunction with RNA-binding protein, such as nucleophosmin 1(NPM1)44, Argonaute2 (Ago2)45, and high-density lipoprotein (HDL)46.
Therefore the origin of the miRNA signature of GVHD requires further investigation.
References
1. Chao NJ, Chen BJ. Prophylaxis and treatment of acute graft-versus-host disease. Seminars in hematology. 2006;43:32-41.
2. Ferrara JL, Levine JE, Reddy P, Holler E. Graft-versus-host disease. Lancet.
2009;373:1550-1561.
3. Blazar BR, Murphy WJ, Abedi M. Advances in graft-versus-host disease biology and therapy.
Nature reviews Immunology. 2012;12:443-458.
4. Chen YB, Cutler CS. Biomarkers for acute GVHD: can we predict the unpredictable? Bone marrow transplantation. 2012.
5. Paczesny S. Discovery and validation of graft-versus-host disease biomarkers. Blood.
2013;121 :585-594.
6. Van Lint MT, Milone G, Leotta S, et al. Treatment of acute graft-versus-host disease with prednisolone: significant survival advantage for day +5 responders and no advantage for nonresponders receiving anti-thymocyte globulin. Blood. 2006;107:4177-4181. Deeg HJ. How I treat refractory acute GVHD. Blood. 2007;109:4119-4126.
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215-233. Weber JA, Baxter DH, Zhang S, et al. The microRNA spectrum in 12 body fluids. Clinical chemistry. 2010;56: 1733-1741.
Kosaka N, Iguchi H, Ochiya T. Circulating microRNA in body fluid: a new potential biomarker for cancer diagnosis and prognosis. Cancer science. 2010;101 :2087-2092.
Mitchell PS, Parkin RK, Kroh EM, et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proceedings of the National Academy of Sciences of the United States of America. 2008;105: 10 13-10 18.
Ng EK, Chong WW, Jin H, et al. Differential expression of microRNAs in plasma of patients with colorectal cancer: a potential marker for colorectal cancer screening. Gut.
2009;58: 1375-1381.
Zhao Z, Zhao Q, Warrick J, et al. Circulating microRNA miR-323-3p as a biomarker of ectopic pregnancy. Clinical chemistry. 2012;58:896-905.
Li LM, Hu ZB, Zhou ZX, et al. Serum microRNA profiles serve as novel biomarkers for HBV infection and diagnosis of HBV-positive hepatocarcinoma. Cancer research.
2010;70:9798-9807.
Zampetaki A, Kiechl S, Drozdov I, et al. Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes. Circulation research.
2010;107:810-817.
Montgomery RL, Hullinger TG, Semus HM, et al. Therapeutic inhibition of miR-208a improves cardiac function and survival during heart failure. Circulation.
2011;124:1537-1547.
Kuwabara Y, Ono K, Horie T, et al. Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage. Circulation Cardiovascular genetics. 2011;4:446-454.
Vasilescu C, Rossi S, Shimizu M, et al. MicroRNA fingerprints identify miR-150 as a plasma prognostic marker in patients with sepsis. PloS one. 2009;4:e7405.
Mas VR, Dumur CI, Scian MJ, Gehrau RC, Maluf DG. MicroRNAs as Biomarkers in Solid Organ Transplantation. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2012.
Starkey Lewis PJ, Dear J, Piatt V, et al. Circulating microRNAs as potential markers of human drug-induced liver injury. Hepatology. 2011;54:1767-1776.
Przepiorka D, Weisdorf D, Martin P, et al. 1994 Consensus Conference on Acute GVHD Grading. Bone marrow transplantation. 1995;15:825-828.
Jiang S, Li C, Olive V, et al. Molecular dissection of the miR-17-92 cluster's critical dual roles in promoting Thl responses and preventing inducible Treg differentiation. Blood. 2011;118:5487-5497.
Zhang ZN, Xu JJ, Fu YJ, et al. Transcriptomic Analysis of Peripheral Blood Mononuclear Cells in Rapid Progressors in Early HIV Infection Identifies a Signature Closely Correlated with Disease Progression. Clinical chemistry. 2013.
Tijsen AJ, Creemers EE, Moerland PD, et al. MiR423-5p as a circulating biomarker for heart failure. Circulation research. 2010;106:1035-1039.
Lee CG, Kim YW, Kim EH, et al. Farnesoid X receptor protects hepatocytes from injury by repressing miR-199a-3p, which increases levels of LKBl . Gastroenterology.
2012;142:1206-1217 el207.
Ranganathan P, Heaphy CE, Costinean S, et al. Regulation of acute graft-versus-host disease by microRNA- 155. Blood. 2012;119:4786-4797.
Grimm J, Zeller W, Zander AR. Soluble interleukin-2 receptor serum levels after allogeneic bone marrow transplantations as a marker for GVHD. Bone marrow transplantation.
1998;21 :29-32.
Foley R, Couban S, Walker I, et al. Monitoring soluble interleukin-2 receptor levels in related and unrelated donor allogenic bone marrow transplantation. Bone marrow
transplantation. 1998;21 :769-773.
Paczesny S, Krijanovski OI, Braun TM, et al. A biomarker panel for acute graft-versus-host disease. Blood. 2009;113:273-278.
Hori T, Naishiro Y, Sohma H, et al. CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 2008;111 :4403-4412.
Srinivasan R, Daniels J, Fusaro V, et al. Accurate diagnosis of acute graft-versus-host disease using serum proteomic pattern analysis. Experimental hematology. 2006;34:796-801.
Chen X, Ba Y, Ma L, et al. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell research. 2008;18:997-1006. Chang J, Guo JT, Jiang D, Guo H, Taylor JM, Block TM. Liver-specific microRNA miR-122 enhances the replication of hepatitis C virus in nonhepatic cells. Journal of virology.
2008;82:8215-8223.
Ji X, Takahashi R, Hiura Y, Hirokawa G, Fukushima Y, Iwai N. Plasma miR-208 as a biomarker of myocardial injury. Clinical chemistry. 2009;55:1944-1949.
Zhao Y, Samal E, Srivastava D. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature. 2005;436:214-220.
Boeri M, Verri C, Conte D, et al. MicroRNA signatures in tissues and plasma predict development and prognosis of computed tomography detected lung cancer. Proceedings of the National Academy of Sciences of the United States of America. 2011;108:3713-3718. Harris AC, Ferrara JL, Levine JE. Advances in predicting acute GVHD. British journal of haematology. 2013;160:288-302.
Tili E, Croce CM, Michaille JJ. miR-1 5: on the crosstalk between inflammation and cancer. International reviews of immunology. 2009;28:264-284.
Hou J, Lin L, Zhou W, et al. Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer cell. 2011;19:232-243.
40. Liu S, Patel SH, Ginestier C, et al. MicroR A93 regulates proliferation and differentiation of normal and malignant breast stem cells. PLoS genetics. 2012;8:el 002751.
41. Zou Z, Wu L, Ding H, et al. MicroR A-30a sensitizes tumor cells to cis-platinum via
suppressing beclin 1 -mediated autophagy. The Journal of biological chemistry.
2012;287:4148-4156.
42. Baraniskin A, Birkenkamp-Demtroder K, Maghnouj A, et al. MiR-30a-5p suppresses tumor growth in colon carcinoma by targeting DTL. Carcinogenesis. 2012;33:732-739.
43. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. Exosome-mediated
transfer of mRNAs and microR As is a novel mechanism of genetic exchange between cells. Nature cell biology. 2007;9:654-659.
44. Wang , Zhang S, Weber J, Baxter D, Galas DJ. Export of microRNAs and
microRNA-protective protein by mammalian cells. Nucleic acids research.
2010;38:7248-7259.
45. Arroyo JD, Chevillet JR, Kroh EM, et al. Argonaute2 complexes carry a population of
circulating microRNAs independent of vesicles in human plasma. Proceedings of the
National Academy of Sciences of the United States of America. 2011;108:5003-5008.
46. Vickers C, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nature cell biology. 2011;13:423-433.
[00190] Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and
publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[00191] One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.

Claims

A method of predict! ng actute Graft versus Ho st Di sease (GVHD) in a subj ect comprising: quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological samplederivedfromasubject, whereinthe mi R Abiomarkercomprisesoneor acombinationofmiR-423,miR-199a-3p,miR 77,miR-93*,miR-30a,aridmiR-155;and predicting the subject as having an increased risk for development of a GVHD if the amount ofthe miRN Abiomarker(s)is higherinthe biological sample derived fromthe subject compared to a reference control.
The methodof claim 1, whereinthe miRN A biomarkers comprise miR-423, miR-199a-3p, miR-377, andmiR-93*.
The methodofclaim 1, whereinthe miRNAbiomarkersconsistof miR-423, miR-199a-3p, miR-377, andmiR-93*.
The methodofclaim 1, whereinthe miRNA biomarker consists of miR-423.
The method of claim 1, whereinthe miRNAbiomarkerconsists of miR-199a-3p.
The methodofclaim 1, whereinthe miRNA biomarker consists of miR-377.
The methodofclaim 1, whereinthe miRNA biomarker consists of miR-93*.
The methodofclaim 1, whereinthe quantifying comprisesone oracombinationof miRNA array, Reverse Transcriptase -Polymerase Chain Reaction (RT-PCR), Northern blot analysis, and in situ hybridization to determine an expression level of the one or the combination of the miRgene product(s).
The method of claim 1, whereinthe biological sample comprisesone or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. The method of claim 1, wherein the biological sample is selected from the group consisting of blood, serum, and plasma.
The method of claim 1, wherein the biological sample consists of plasma.
The method of claim 1, wherei the biological sample is derived from the subject prior to symptoms of the GVHD.
13. The methodof claim 1, wherein the amount of the miRNA biomarker(s) is higher by a factor of 2-fold or greater.
14. The method of claim 1, further comprising administering an appropriate anti-GVHD therapy to the subject.
15. The method of claim 1, wherein the subject is a mammal.
16. The method of claim 1, wherein the subject is a human.
17. A methodof diagnosing a GVDV in a subject comprising:
quantifying the amount of one or more miR A biomarkers for GVHD present in a biological samplederivedfromasubject,whereinthemiKNAbiomarkercomprisesoneor acombinationofmiR-423, miR-199a-3p, miR-377, miR-93* miR-30a, andmiR-155; and diagnosing the subject as having the GVHD if the amount of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
18. The methodof claim 17,whereinthemiRNAbiomarkerscomprisemiR-423,miR-19 a-3p, miR-377, and miR-93*.
19. The method of claim 17, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
20. The method of claim 17, wherein the miRNA biomarker consists of miR-423.
21. The method of claim 17, wherein the miRNA biomarker consists of miR- 199a- 3p.
22. The method of claim 17, wherein the miRNA biomarker consists of miR-377.
23. The method of claim 17, wherein the miRNA biomarker consists of miR-93*.
24. The method of claim 17, wherein the quantifying comprises one or a combination of miRNAan-ay,ReverseTranscriptase-PolymeraseCh
analysis, and in situ hybridization to determine an expression level of the one or the combination of the miR gene product(s) .
25. The method of claim 17, wherein the biological sample comprisesoneoracombinationof tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, andtears.
26. The method of claim 17, wherein the biological sample is selected from the group consisting of Hood, serum, and plasma.
27. The method of claim 17, wherein the biological sample consists of plasma.
28. The method of claim 17, wherein the amount ofthe miRNA biomarker(s)ishigherbya factor of 2-fold or greater.
29. The method of claim 17, further comprising administering an appropriate anti-GVHD therapy to the subj ect.
30. The method of claim 17, wherein the subject is a mammal.
31. The method of claim 17, wherein the subject is a human.
32. A method of determining the prognosis of a subject developing, or having already developed, GVHD comprising:
quantifying the amount of one or more miRNA biomarkers for GVHD present in a biological samplederivedfromasubject, whereinthe miRNA biomarkercomprisesoneor acombinationofmiR-423, miR-I99a-3p,miR-377, miR-93* miR-30a, andmiR-155; and identifying the subject as having a poor chance of survival of a GVHD if the amount ofthe miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control .
33. Themethodofclaim32,whereinthemiRNAbiomarkerscomprisemiR-423,miR-199a-3p, miR-377, andmiR-93*
34. The method of claim 32, wherein the miRNA biomarkers consist of miR-423, miR- 199a-3p, miR-377, andmiR-93*.
35. The method of claim 32, whereinthe miRNA biomarkers comprise miR-423, miR-377, and miR-93*.
36. The method of claim 32, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93*.
37. The method of claim 32, wherein the miRNAbiomarkerconsistsofmiR-423.
38. The method of claim 32, wherein the miRNA biomarker consists of miR-377.
39. The method of claim 32, wherein the miRNA biomarker consists of miR-93*.
40. The method of claim 32, wherein the quantifying comprises one or a combination of nu'RNAaiTay,ReverseTranscriptase-PoIymeraseChai
analysis, and in situ hybridization to determine an expression level of the one or the combination of the mi gene produces).
41. The methodof claim 32, wherein the biological sample comprisesoneoracombinationof tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
42. The method of claim 32, wherein the biological sample is selected from the group consisting of blood, serum, and plasma.
43. The method of claim 32, wherein the biological sample consists of plasma.
44. The methodof claim 32, wherein the biological sample is derived from the subject priorto symptoms of the GVHD.
45. The method of claim 32, further comprising administering an appropriate anti-GVHD therapy to the subj ect or altering an already administered anti -GVHD therapy.
46. The methodof claim 32, wherein the subject is a mammal.
47. The method of claim 32, wherein the subject is a human.
48. A method for determining the efficacy of a GVHD treatment regime in a subject comprising:
determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkecomprises one or a combination of miR-423,miR-199a-3p, miR-377, miR-93*, miR-30a, andmiR-155;
administering to the subject an anti-GVHD therapy regime; and redetermining the expression level of the miRNA biomarker(s) in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression level(s) is correlated with the efficacy of the anti-GVHD therapy regime.
49. Themethodofelaim48, whereinthemiRNAbiomarkers comprise miR-423, rniR-199a-3p, miR-377, andmiR-93*.
50. The method of claim 48, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, andmiR-93*.
51. The method of claim 48, wherein the miRNA biomarker consists of miR-423.
52. The method of claim48, wherein the miRNA biomarker consists of miR-199a-3p.
53. The method of claim 48, wherein the miRNA biomarker consists of miR-377.
54. The method of claim 48, wherein the miRNA biomarker consists of miR-93*.
55. The method of claim 48, wherein the quantifying comprises one or a combination of iruRNAarray,ReverseTranscriptase-PolymeraseChair^
analysis, and in situ hybridization to determine an expression level of the one or the combination of the miRgene product(s).
56. The method of claim 48, wherein the biological sample comprisesoneoracombinationof tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
57. The method of claim 48, wherein the biological sample is selected from the group consisting of blood, serum, and plasma.
58. The method of claim 48, wherein the biological sample consists of plasma.
59. The method of claim 48, wherein the biological sample isderivedfrom the subject priorto symptoms of the GVHD.
60. The method of claim 48, wherein the amount of the miRNA biomarker s) is higher by a factor of 2-fold or greater.
61. The method of claim 48, wherein the subject is a mammal.
62. The method of claim 48, wherein the subject is a human.
63. A kitfor redicting GVHD in a subject, the kit comprising:
primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological samplederivedfromasubject,whereinthemiRNAbiomarfcerscompriseoneor acombinationofmiR-423, miR-199a-3p, miR-377, miR-93* miR-30a, andmiR-155;and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expressionlevel of the miRNA biomarker(s) ishigherinthe biological sample derived from the subject compared to a reference control.
64. The kit of claim 63, further comprising one or more hybridization probes specific for the miRNA biomarker(s).
65. Thekitofclaim64,furthercomprisingasolidsuprx>rt
66. The kit of claim 63, further comprising reagents for quantifying the expression level of the miRNA biomarker(s).
67. The kit of claim 63, wherein the miRNA biomarkers comprise miR-423, miR-199a-3p, miR-377, andmiR-93*
68. The kit of claim 63, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, andmiR-93*.
69. The kit of claim 63, whereinthemiRNAbiomarkerconsistsofmiR-423.
70. The kit of claim 63, wherein the miRNA biomarker consists of miR- 199a-3p.
71. The kitof claim 61, wherein the miRNA biomarker consists of miR-377.
72. The kit of claim 63,whereinthemiRNAbiomarkerconsistsofmiR-93*.
73. The kit of claim 63, wherein the biological sample comprises one or a combinationof tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
74. The kitof claim63, wherein the biological sample isselectedfromthegroupconsistingof blood, serum, and plasma.
75. The kitof claim 63, wherein the biological sample consists of plasma.
76. The kit of claim 63, wherein the biological sample is derived from the subject prior to symptoms of the GVHD.
77. The kit of claim 63, wherein the expression level of the miRNA biomarker(s) is higher by a factor of 2-fold or greater.
78. The kit of claim 63, wherein the subject is a mammal.
79. The kit of claim 63, wherein the subject is a human.
80. A kit for diagnosing GVHD in a subject, the kit comprising:
primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological samplederivedfromasubject,whereinthemiRNAbiomarkerscompriseoneor acombinationofmiR-423, miR-199a-3p,miR-377, miR-93* miR-3Qa, andmiR-155;and instructions for quantifying the expression level of the miRNA biomarker(s) in the biological sample and for diagnosing the subject as having GVHD if the expressionlevel of the miRNA biomarker(s) is higher in the biological sample derived from the subject compared to a reference control.
81. The kit of claim 80, further comprising one or more hybridization probes specific for the miRNA biomarker(s).
82. The kit of claim 81 , furthercomprisingasolidsupporthavingthe probe(s)attachedthereto.
83. The kit of claim 80, further comprising reagents for quantifyingthe expression level of the miRNA biomarker(s).
84. The kitof claim 80, wherein the miRNA biomarkers comprise miR-423, miR-199a-3p, miR-377, and miR-93*.
85. The kit of claim 80, whereinthe miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*.
86. The kit of claim 80,whereinthemiRNAbiomarkerconsistsofmiR-423.
87. The kit of claim claim 80,whereinthemiRNAbiomarkerconsistsofmiR-199a-3p.
88. The kit of claim claim 80, wherein the miRNA biomarkerconsistsof miR-377.
89. The kit of claim 80,whereinthemiRNAbiomarkerconsistsofmiR-93*.
90. The kit of claim 80, wherein the biological sample comprises one or a combination of tissues, cells, biopsies, blood, lymph, serum, plasma, urine,saliva,mucus,andtears.
91. The kitofclaim 80, wherein the biological sample is selected from the group consisting of blood, serum, and plasma.
92. The kit of claim 80, wherein the biological sample consists of plasma.
93. The kit of claim 80, wherein the biological sample is derived from the subject prior to symptoms of the GVHD.
94. The kitofclaim 80, whereintheexpressionlevelofthemiRNAbiomarker(s)ishigherbya factor of 2-fold or greater.
95. The kit of claim 80, wherein the subject is a mammal.
96. The kit of claim 80, wherein the subject is a human.
97. A kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising:
primersforreversetranscribingoneormoremiRNAbiomarkersfor GVHD in a biological samplederivedfromasubjec^whereinthemiRNAbiomarkerscompriseoneor acombinationofmiR-423, miR-l99a-3p,miR-377, miR-93* miR-30a, andmiR-155;and instructions for quantifying the expression level of the miRN A. biomaTker(s) in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRN A biomarker(s) is higher in the biological sample derived from the subject compared to a reference control .
98. The kit of claim 97, furthercomprising one or more hybridization probes specific for the miRNA biomarkei(s).
99. The kit of claim 98, further comprising a solid support having the probe(s) attached thereto.
100. The kit of claim 97, furthercomprising reagents for quantifying the expression level of the miRNA biomarker(s).
101. The kit of claim 97, whereinthe miRNA biomarkers comprise miR-423, miR-l99a-3p, miR-377, andt R-93* .
102. The kit of claim 97, wherein the miRNA biomarkersconsistofmiR-423, miR-199a-3p, miR-377, and miR-93*
103. The kit of claim 97, wherein the miRNA biomarkers comprise miR-423, miR-377, and miR-93*.
104. The kit of claim 97, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93*.
105. The kit of claim 97, whereinthemiRNAbiomarkerconsistsofmiR-423.
106. The kitofclaim 7,whereinthemiRNAbiomarkerconsistsofmiR-377.
107. The kitof claim97,whereinthemiRNAbiomarkerc nsistsofmiR-93*.
108. The kit of claim 97, wherein the biological sample comprisesoneoracombinationof tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus, and tears.
109. The kit of claim 97, wherein the biological sample is selected from the groupconsistingof blood, serum, and plasma.
110. The kit of claim 97, wherein the biological sample consists of plasma.
111. The kit of claim 97, whereinthe biological sample is derived from the subject prior to symptoms of the GVHD.
112. The kit of claim 97, wherein the subject is a mammal.
113. The kit of claim 97, wherein the subject is a human.
114. AmemodofpredictingachiteGraftversusHostIXsease(GVHD)inasubjectcomprising:
quantifying the amount of miRNA biomarkers for GVHD present in a biological samplederived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and
predicting the subj ect as having an increased risk for development of a GVHD if the amount of the miRNA. biomarkers is higher in the biological sample derived from the subject compared to a reference control.
115. Amethodof diagnosing aGVDV in a sutgect comprising:
quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consists of miR-423, miR-199a-3p, miR-377, andmiR-93*; and
diagnosing the subject as having the GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
116. A method of determining the prognosis of a subject developing, or having already developed, GVHD comprising:
quantifying the amount of miRNA biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and
identifying the subject as having a poor chance of survival of a GVHD if the amount of the miR biomarkers is higher in. the biological sample derived from the subject compared to a reference control.
117. A method of determining the prognosis of a subject developing, or having already developed, GVHD comprising:
quantifying the amount of miR A biomarkers for GVHD present in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, and miR-93*; and
identifying the subject as having a poor chance of survival of a GVHD if the amount of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
118. A method for determining the efficacy of a GVHD treatment regime in a subject comprising:
determining a baseline value for the expression level of one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR- 23,miR-19 a-3p, miR-377, andmiR-93*;
administering to the subject an anti-GVHD therapy regime; and
redetermining the expression level of the miRNAbiomarkers in the biological sample derived from the subject, wherein an observed decrease in the redetermined expression levels is correlated with the efficacy of the anti-GVHD therapy regime.
119. A kit for predicting GVHD in a subject, the kit comprising:
primers for reverse transcribingoneormore miRNA biomarkers forGVHDina biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, and miR-93*; and
instructions for quantifying the expression level of the miRNA biomarkers inthe biological sample and for predicting the subject as having an increased risk for development of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived f om the subject compared to a reference control.
120. A kit for diagnosing GVHD in a subject, the kit comprising:
primers for reverse transcribing one ormore miRNA biomarkers for GVHDin a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-199a-3p, miR-377, andmiR-93*; and
instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for diagnosing the subject as having GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
121. A kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising: primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers biomarkers consist of miR-423, miR-199a-3p, miR-377, andmiR-93*; and
instructions for quantifying the expression level of the miR A biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higher in the biological sample derived from the subject compared to a reference control.
122. A kit for determining the prognosis of a subject developing, or having already developed, GVHD, the kit comprising:
primers for reverse transcribing one or more miRNA biomarkers for GVHD in a biological sample derived from a subject, wherein the miRNA biomarkers consist of miR-423, miR-377, andmiR-93*; and
instructions for quantifying the expression level of the miRNA biomarkers in the biological sample and for identifying the subject as having a poor chance of survival of a GVHD if the expression level of the miRNA biomarkers is higherinthe biological sample derived from the subject compared to a reference control.
PCT/US2013/074426 2012-12-11 2013-12-11 Microrna biomarkers for graft versus host disease Ceased WO2014093504A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261735600P 2012-12-11 2012-12-11
US61/735,600 2012-12-11
US201361825609P 2013-05-21 2013-05-21
US61/825,609 2013-05-21

Publications (1)

Publication Number Publication Date
WO2014093504A1 true WO2014093504A1 (en) 2014-06-19

Family

ID=50934924

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/074426 Ceased WO2014093504A1 (en) 2012-12-11 2013-12-11 Microrna biomarkers for graft versus host disease

Country Status (1)

Country Link
WO (1) WO2014093504A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019204730A1 (en) * 2018-04-19 2019-10-24 Duke University Compositions and methods for donor selection and prognosis of acute graft-versus-host disease
EP3835787A1 (en) * 2016-02-16 2021-06-16 CellTrend GmbH Anti-cxc chemokine receptor antibodies and c-x-c chemokines for the prognosis of acute graft-versus-host disease
CN119925411A (en) * 2025-01-10 2025-05-06 中国人民解放军总医院第一医学中心 Application of miR-let-7 in the preparation of drugs for treating dendritic cell necroptosis

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2341145A1 (en) * 2009-12-30 2011-07-06 febit holding GmbH miRNA fingerprint in the diagnosis of diseases
US20110171664A1 (en) * 2006-05-02 2011-07-14 O'brien Peter J Methods and reagents for detecting susceptibility to graft versus host disease or transplant related mortality
US20120101001A1 (en) * 2009-03-13 2012-04-26 Manikkam Suthanthiran Method to assess human allograft status from microrna expression levels

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110171664A1 (en) * 2006-05-02 2011-07-14 O'brien Peter J Methods and reagents for detecting susceptibility to graft versus host disease or transplant related mortality
US20120101001A1 (en) * 2009-03-13 2012-04-26 Manikkam Suthanthiran Method to assess human allograft status from microrna expression levels
EP2341145A1 (en) * 2009-12-30 2011-07-06 febit holding GmbH miRNA fingerprint in the diagnosis of diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RANGANATHAN ET AL.: "Regulation of acute graft-versus-host disease by microRNA-155", BLOOD, vol. 119, no. 20, 17 May 2012 (2012-05-17), pages 4786 - 4797 *
SPIEGEL ET AL.: "Role of microRNAs in immunity and organ transplantation", EXPERT REVIEWS IN MOLECULAR MEDICINE, vol. 13, no. E37, 2011, pages 1 - 10 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3835787A1 (en) * 2016-02-16 2021-06-16 CellTrend GmbH Anti-cxc chemokine receptor antibodies and c-x-c chemokines for the prognosis of acute graft-versus-host disease
WO2019204730A1 (en) * 2018-04-19 2019-10-24 Duke University Compositions and methods for donor selection and prognosis of acute graft-versus-host disease
CN119925411A (en) * 2025-01-10 2025-05-06 中国人民解放军总医院第一医学中心 Application of miR-let-7 in the preparation of drugs for treating dendritic cell necroptosis

Similar Documents

Publication Publication Date Title
CN113930503B (en) Application of combination of miR-126 and miR-152 in preparing reagents or kits for diagnosing and predicting lung cancer
EP3506912B1 (en) Micrornas as biomarkers for endometriosis
Gorur et al. Determination of plasma microRNA for early detection of gastric cancer
CN103620019B (en) miRNA-based Universal Screening Test (UST)
US9493832B2 (en) Methods of detecting sepsis
CN104651521B (en) Plasma microRNA for early colorectal cancer detection
US20190376143A1 (en) Microrna assay for detection and management of pancreatic cancer precursors
JP5755569B2 (en) How to detect lung cancer
US20150011414A1 (en) Microrna for diagnosis of pancreatic cancer and/or prognosis of patients with pancreatic cancer by blood samples
AU2018202963B2 (en) Biomarkers useful for detection of types, grades and stages of human breast cancer
EP3122905B1 (en) Circulating micrornas as biomarkers for endometriosis
WO2016186987A1 (en) Biomarker micrornas and method for determining tumor burden
WO2011012074A1 (en) Detection markers of liver cancer and detection methods, kits and biochips thereof
CN106676191B (en) A molecular marker for colon adenocarcinoma
EP3529376A1 (en) Biomarkers of oral, pharyngeal and laryngeal cancers
WO2014093504A1 (en) Microrna biomarkers for graft versus host disease
US20150247202A1 (en) Microrna based method for diagnosis of colorectal tumors and of metastasis
CN104131113A (en) miRNA detection kit and application thereof
KR102096499B1 (en) MicroRNA-3960 for diagnosing or predicting recurrence of colorectal cancer and use thereof
US20160208346A1 (en) Method and composition for detection of oncogenic hpv
HK40049419A (en) Circulating micrornas as biomarkers for endometriosis
CN112004944A (en) Compositions and methods for donor selection and prognosis of acute graft versus host disease
HK40011172A (en) Micrornas as biomarkers for endometriosis
HK40011172B (en) Micrornas as biomarkers for endometriosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13861711

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13861711

Country of ref document: EP

Kind code of ref document: A1