WO2014093351A1 - Dna 5-methyl cytosine demethylation activity of vertebrate dna methyltransferases - Google Patents

Dna 5-methyl cytosine demethylation activity of vertebrate dna methyltransferases Download PDF

Info

Publication number
WO2014093351A1
WO2014093351A1 PCT/US2013/074141 US2013074141W WO2014093351A1 WO 2014093351 A1 WO2014093351 A1 WO 2014093351A1 US 2013074141 W US2013074141 W US 2013074141W WO 2014093351 A1 WO2014093351 A1 WO 2014093351A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
test agent
methylated
demethyiation
demethylation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/074141
Other languages
French (fr)
Inventor
Che-Kun James SHEN
Chang-Chung CHEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Academia Sinica
Original Assignee
Academia Sinica
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Academia Sinica filed Critical Academia Sinica
Priority to CN201380063876.4A priority Critical patent/CN104919053B/en
Priority to US14/647,816 priority patent/US9695463B2/en
Publication of WO2014093351A1 publication Critical patent/WO2014093351A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/91005Transferases (2.) transferring one-carbon groups (2.1)
    • G01N2333/91011Methyltransferases (general) (2.1.1.)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates generally to D A demethylation activity of D.N A
  • DNA methyiation occurs primarily at the 5-position of cytosine (C) in CpG dyads and their genomic methyiation patterns are established/maintained by the DNA (C ⁇ 5) ⁇ methyl transferases, or DNMTs.
  • C cytosine
  • DNMT1 shows a substrates preference for hemi -methylated DNA and maintains the methylation patterns during DNA
  • DN.MT3A and DNMT3B show equal C-5 methyiation activities toward unmethylated and hemi-methylated DNA in vitro, and the ⁇ - are essential for de novo genomic DNA methyiation as well development of the early embryos.
  • the vertebrate DNA methyiation system comprising the above three essential DNMTs is indispensible for the establishment of the genomic DNA
  • methyiation patterns globally and locally, and consequently the processes of gene expression, neuropJastictty, differentiation, carcinogenesis, imprinting, X-inactivation and development.
  • the invention relates to a method for identifying a test agent for a compound) as a modulator of the active DNA demethylation activity of a DNA methyitransferase.
  • the method comprises:
  • test agent comparing the extents of the demethylation in the presence and absence of the test agent, and thereby identify the test agent as a modulator of the DNA demethylation activity of the DNA methyliransferase; wherein the test agent is identified as an inhibitor of the active DNA demeth lation activity of the DNA meihyUransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA memyltransferase when the extent of demethylation is more in the presence of the test agent.
  • the analyzing step is performed by a technique selected from the group consisting of a restriction digestion-polymer chain reaction (PCR) assay,
  • hydrolysis-thin layer chromatography assay an antibody-based analysis, scintillation counting, autoradiography, dot blotting, a liquid chromatography-based analysis, and a Na bisuifite-based analysis.
  • the demethylation reaction occurs in the presence of a calcium ion concentration of around 10 ⁇ to 1 mM.
  • the DNA methyltransferase is an isolated vertebrate
  • the vertebraie DN A methyltransferase, the nuclear extract, or the cellular extract may be prepared from cells selected from the group consisting of vertebrate cell cultures, vertebrate tissues, insect cells, worm cells, insect tissues, worm tissues, plant cells, plant tissues, yeast cells, and bacterial ceils.
  • the nuclear extract may be a sperm extract.
  • the methylated DNA comprises a labeled methyl group.
  • the methyl grou in the methylated DNA may be radioactive-labeled.
  • the methylated DNA provided in step (a) is a methylated reporter gene operably linked to a constitutive promoter and is present in a cell;
  • step (b) the DNA methyltransferase provided in step (b) is operably linked to a constitutive promoter and is also present in the cell, or is endogenous!? present, in the cell as an endogenous DN A methy I transferase;
  • the demethy l ted DNA product generated in step (c) is a demethy lated reporter gene, which expresses a reporter protein in the cell.
  • the analyzing step is performed by a technique selected from the group consisting of:
  • methyltransferase are present in the cell via trans.fection.
  • the D A methyltransferase is an endogenous enzyme present in the cell.
  • the cell is transfected with the methylated reporter gene, and the DNA methyltransferase may be an exogenouse enzyme transfected into the same cell, or may be an endogenous enzyme already present in the same cell.
  • the methylated reporter gene and the DNA may be an exogenouse enzyme transfected into the same cell, or may be an endogenous enzyme already present in the same cell.
  • methyhransferase are co-iransfected into the ceil.
  • the test agent is introduced into the cell or added to a culture medium bathing the cell
  • the methylated reporter gene comprises a DNA sequence of a gene selected from the group consisting of a fluorescent protein-encoding gene, a luciferase gene, a drug-resistant gene, and genes of cell survivals.
  • the methylated DNA comprises 5-meihyleytosine (5mC) ⁇ coniaining DNA.
  • step (c) is performed under a. condition that is fee of a reducing agent or under a non-reducing condition.
  • the DNA methyl transferase may be a modified form of a wild-type DNA methyl transferase, said modified form retaining the cti e D A demeihy lation activity of the wild-type DNA
  • the DN A methyltransferase may be selected from the group consisting of DN A
  • metbyliransferase 1 DNA melhyltiansferase 3 A, DNA methyl transferase 3B, and any combination thereof.
  • the constitutive promoter may be, but not limited to, a cytomegalovirus promoter.
  • the invention relates to a method for identifying a test agent as a modulator of the active DNA demethylation activity of a DNA methyltransferase, in which the method comprises:
  • test agent is identified as an inhibitor of the active DNA demethylation activity of the D A methyitransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA methyitransferase when the extent of demethylation is more in the presence of the test agent; or (II)
  • test agent is identified as an inhibitor of the active DNA demethylation acti vity of the DNA methyitransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA methyl transferase when the extent of demethylation is more in the presence of the test agent.
  • the wild-type DNA methyitransferase may be selected from the group consisting of DNA methyitransferase 1 , DNA methyitransferase 3 A, and DNA methyitransferase 3B.
  • FIG. 1 shows DNA.5-mC demethylation activities of the .mammalian DN Ts.
  • the 5-mC- containing DNA substrates were subjected to incubation in 2 3T nuclear extracts in buffer B with 10 tti Cat3 ⁇ 4 that contained the exogenously expressed EGFP (lanes 1 and 2), mouse DN 1 (lanes 3 and 4), DNMT3A (lanes 5 and 6), DNMT3B ⁇ lanes 7 and 8), and their site-directed mutants (lanes 9- 14), respectively.
  • the extents of conversion of 5-mC to C were analyzed by hydrolysis-TLC assay and quantitatively shown in the histogram.
  • the amounts of the exogenous wild type enzyme in lanes 4, 6, and 8 were similar to those of the mutant enzymes in lanes 10, 12, and 14, respectively
  • FIG, 2A shows calcium-dependence of the DNA 5-mC demethyiation activities of recombinant DNMTs.
  • the DNA demethyi tion acti vity of the recombinant mouse DNMT3B was assayed by incubation of 40 nM 5- mC containing DNA substrate with 40 nM of the enzyme in buffer B containing 100 pg/ml BSA and increasing concentrations (0, 10 ⁇ , 100 ⁇ , 1 mM, 5 mM and 10 mM) of CaC1 ⁇ 2.
  • the incubations were all at 37°C for 4h.
  • the quantitative results are presented in the histogram.
  • FIG. 2B shows a comparison of the DNA demethyiation activities of recombinant hDNMTl, hDNMT3A and DNMT3B by hydrolysis-TLC assay.
  • the 5-mC containing substrate was incubated at 37T for 4h with 40 nM of each of the recombinant hDNMTl (lane 2).
  • the quantitative analysis is presented in the histogram.
  • M mock control without incubation; R. with incubation. Error bars indicate S.D. *, > ⁇ 0.05; ***. / 0.005 by t-test comparing bars 2-4 to bar 1.
  • FIG. 3A The 5-mC containing DNA substrate was subjected to the demethyiation reactions with 40 nM recombinant DNMT3B in buffer B containing 100 ug/ml BSA with or without the inclusion, of ! mM CaCL, 5 mM DT ' L or 160 ⁇ SAM.. After incubation at 37'C for 4h. the DNA products were analyzed by the hydrolysis-TLC assay. The results are
  • FIG. 3B Unmeihylaied pMRJ -8 plasmid D A was incubated with 40 nM recombinant D.NMT3.B in buffer B containing 100 ⁇ ig/ml BSA with or without 1 mM CaCL, 5 mM DTT, or 160 ⁇ SAM. After incubation at 37"C for 4h, the extents of C methylation of the DNAs from the different reactions were determined by hydroiysis-TLC assay mid quantitatively compared in the histogram. Error bars indicate S.D.
  • FIGs. 4A-B show Reversibility of the DMA demethyiation and methylation reactions in vitro, FIG. 4A; Strategy of a series of reactions testing the reversibility of DNA demethyiation and methylation (see text for more details). Briefly. 5-mC containing DNA substrate was incubated at 37°C for 2h with 40 nM recombinant DNMT3B in buffer 8 containing 100 ttg/m! BSA and 1 mM. CaCl;; (reaction 1). Then. 160 ⁇ SAM were added and the incubation was continued for another Ih (reaction 2). Finally, 1 mM H2O2 was added to the reaction mixture and the incubation continued for another 2h (reaction 3).
  • FIG. 4B The DNA products from, the 3 reactions outlined in 4A were purified and analyzed by hydrolysis-TLC assay. The data are quantitatively compared in the histogram. M, mock control without incubation. Error bars indicate S.D.. *, /> ⁇ 0.05; ***, /? ⁇ 0.005,
  • FIGs. A-B show Experimental strategies for assay of theTnter-com ersions of 5-mC and C.
  • FIG. 5 A Schematic diagram illustrating the stepwise processes of restriction digestion-PCR assay. This assay was used to estimate the extents of demethylation of methylated plasmid upon incubation with the porcine sperm nuclear extract under different conditions (FIG. 6). 20 ng of the 5-mC containing plasmid pMRl-8, with or without DNA demethylation reactions in the sperm nuclear extract, was digested b Hpali overnight at 37°C, and purified with Qiaquick Nucleotide Removal Kit (Qiagen).
  • Qiaquick Nucleotide Removal Kit Qiaquick Nucleotide Removal Kit
  • FIG. 5B Schematic diagram
  • the double-stranded DNA substrates were digested by Mspl at 37°C overnight and then dephosphorylated with calf intestine phosphatase (New England Biolabs) followed by purification by Qiaquick Nucleotide Removal Kit (Qiagen).
  • the purified DNAs were end-labeled by using y' ⁇ P-ATP and T4 polynucleotide kinase (Ne England Biolabs), and then digested by snake venom phosphodiesterase (Worthington) and DNasel (Roche) overnight.
  • hydrol zates were loaded onto PEL cellulose plates (Merck) and separated in the buffer isobutyric acid: water: ammonia (66: 18:3) for 1.6-18h. Autoradiography of the plates was carried out and the signals o the plates were quantitated using the Alpha. Imaging 2200 (Alpha lfmotech Crop.),
  • FIGs. 6A-C show the DNA demethylation activity of porcine sperm extracts.
  • FIG. 6A Fully methylated plasmid DNA pMR.1-8 was incubated at 37°C for 2h in the porcine sperm nuclear extract with increasing concentrations (0 mask 10 ⁇ , ⁇ . mM and lOmM) of Ca €1 ⁇ 2 (lanes 1 -5), MgC (lanes 6-10) or FeCNHiSOi)?. (lanes I 1- 15). After the reactions, the extent of DNA demethylation of the plasmid DNA was analyzed by the restriction digestion-PCR assay outlined in FIG. 5 A. The histograms sho the relative proportions of the plasmid DNA resistant to Hpali cleavage. For comparison of bars 2-5 to bar 1 , *, /x0.05; **, 0.01 by the t-test.
  • FIG. 6B Effects of BER inhibitors on the demethylation activities of the porcine sperm nuclear extract.
  • demethylation reactions were carried out by incubating fully-methylated plasmid DNA MR.1 -8 and sperm nuclear extract containing 10 mM CaCfe. and increasing concentrations of APE-i (0. 1 0 ⁇ . ⁇ , 100 ⁇ . ⁇ , and 1 mM, lanes 2-6) or 3-AB (0, 5 ⁇ , 50 ⁇ , 5 mM, and 50mM, lanes 8-12).
  • APE-i 0. 1 0 ⁇ . ⁇ , 100 ⁇ . ⁇ , and 1 mM, lanes 2-6) or 3-AB (0, 5 ⁇ , 50 ⁇ , 5 mM, and 50mM, lanes 8-12).
  • FIG. 6C Effect of the CDA inhibitor THU on the demethylation reaction in the porcine sperm nuclear extract.
  • the fully-methylated pMRl -8 D A was subjected to incubation in the extract at 37°C for 2h containing increasing concentrations of THU (0, 30 ⁇ . 100 ⁇ and I rnM, lanes 1 -4).
  • the extents of demethylation of the plasmid DNA were analyzed by the restriction digestion-PCR assay.
  • the histogram shows the relative proportions of plasmid DNA resistant to Hpall cleavage. M, mock control without incubation. Error bars indicate S.D..
  • FIG. 7 shows the results of SDS-PAGE analyses.
  • the recombinant human hD ' NMTl 500 ng
  • human hDN T3A 250 ng
  • mouse D T3B ⁇ 250 ng
  • the arrows indicate the expected hands of the three DNMTs, respectively. Protein markers were loaded in the M lanes.
  • FIG. 8 shows D A demethylation by recombinant DNMT38 in the presence of 3 ⁇ 4-SAM
  • the reaction conditions were the same as those described in FIG.3 A, except that ⁇ ⁇ ⁇ -SA was also included in each of the reaction mixtures.
  • the mixtures were further inciibated with 100 pi ofO.SN NaOH at 55 for 10 mins and neutralized with 100 ⁇ of lM Tris-Cl pH7.0.
  • the D A substrates were then preci itated with 1 % trichloroacetic acid (TCA) in 5 mM a pyrophosphate on ice for 15 mins, and loaded onto DE-81 ion-exchange papers followed by air drying.
  • TCA trichloroacetic acid
  • SmC refers t the 5 position of cytosine.
  • agent refers to any matter, substance or thing producing or used for obtaining specific results, which includes, but not limited to, compounds, co-factors, etc.
  • the invention relates to the discovery that mammalian DNMTs, including DNMXL DNMT3A, and DNMT3B cart actively and directly convert 5-mC on DNA into € biochemical reaction. See Chen et at (2013) THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL, 288, NO. 13, pp. 9084- 9091 , which is incorporated herein by reference in its entirety.
  • the invention relates to the discovery that in in vitro reactions, the mouse and/or hitman DNMTl , DNMT3 A, and DNMT3B all could act as an active DNA demeth iase, removing the methyl group from 5-mC on DNA in an Ca" ' ion and redox state-dependent manner.
  • the invention also relates to the discovery of the DNA 5-mC demethylaiion activities of DNMTs that could be used to screen, identity, and design reagents, including chemical compounds and therapeutic agents, which would modulate the DNA 5-mC demethyiation activities of DNMTs and their modified forms/ derivatives, for the purpose of regulating the different cellular processes including gene expression, chromosome structure, carcinogenesis (metastasis), cell division, cell motility, neuronal plasticity, etc,
  • DNMTl Homo spaims ⁇ SEQ ID NO:4; DNMT1 [Mm musc l s] SE ID NO: 5; DNMTS A [Homo - sp iens) SEQ ID NO: 6: DNMT3A ⁇ M s muscui l SEQ ID NO: ?; DNMT3B ⁇ Homo spaiens] SEQ ID NO: 8: DNMT3B ⁇ Mus musculus] SEQ !D NO: 9.
  • modified forms of human DNMTl is DNMT i (1 1 -1620),
  • DNMT1(21-1620) S DNMTl (31-1620) , . . , etc.
  • DNMTl may be modified by deletion of ihe internal 10 amino acid of the full length DNMTl , and the modified forms are DNMT 1( ⁇ 1 1 -20), DNMTl ( ⁇ 21 -30), DNMTl (A31-40) . . . . etc.
  • modifications may be used to generate deletion modified forms of DNMT3A and DNMT3B.
  • DNMTs To screen, identify, and/or design reagents that modulate the DNA 5-raC demethyiation activities of DNMTs, several assays can be used, which include in vitro and in vivo assays.
  • the DNMTs and 5-raC containing DNA substrates are incubated with the test agents under proper reaction conditions.
  • the DNMTs used may be in the forms of either recombinant wildly pe/modified/ genetically engineered enzymes or as ectopically expressed wild type/ modified/ genetically engineered enzymes in cellular or nuclear extracts prepared from vertebrate cell cultures/ tissues, yeast cells, or bacterial cells.
  • the methyl group on the 5 -mC -containing DNA substrates can be radioactive, or labeled by other methods.
  • the DNA substrates are isolated manually or automatically, and the content of inethylatioii/demethyiatioii is determined by several methods, such as restriction digestion-based analysis, antibody-based analysis, Scintillation counting, autoradiography, dot blotting, liquid chromatography-based analysis, Na bisulfite-based analysis and hydrolysis-TLC (Ihin. layer chromatography).
  • restriction digestion-based analysis antibody-based analysis
  • Scintillation counting autoradiography
  • dot blotting liquid chromatography-based analysis
  • Na bisulfite-based analysis and hydrolysis-TLC (Ihin. layer chromatography).
  • the effect of each test agent on the DNA 5-mC demethyiation activities of the DNMT enzv mes is determined by comparison of the content of 5-mC on the DNA substrate with the control (mock), before and after the in vitro reaction.
  • the reporte DN As methylated at 5-C are introduced into cells containing either the endogenous DNMTs alone or with exogenous! ⁇ ' expressed wild type/modified/ genetically engineered DNMTs.
  • the reagents to he tested are added into the cell cuHuring medium, or sent into the cells, before triggering the DNA demethyiatiort activities of the DNMTs.
  • the methylated reporter DNAs cany genes, such as different fluorescence genes, luciferase gene, drug-resistant gene, or genes of cell survivals etc, the expression levels of which can. indicate the methylation/demethylation status of the DNA substrates.
  • the methylated report DN As can be isolated manually or automatically, and analyzed with respect to their 5-raC content by methods described above.
  • DNMTl -PSC, DNMT3A-PS and DNMT3.B-PS were generated by insertion of a serine residue before the Cys-1229 at the catalytic site of DNMT l or by replacing the cy steine residue Cys-706 and Cys-657 in the catalytic domains of DN T3A and DNMT3B, respectively, with a serine residue.
  • DNMTs including hDNMT! (purity -78%), hDNMT3A (purity-90%), and mouse DNMT3B (purit -50%) (FIG. 7), were purchased from BPS Bioscience.
  • the nuclear extracts were prepared from the porcine sperms and 293T cells, respectively, by a modified method. Briefly, the porcine semen was washed three- times by PBS buffer and the sperm pellet isolated with FICQLL®. The pellet, was resuspended in a hypotonic buffer (l O M Tris-HCK pH7A 10mM NaCL 10 mM EDTA and EDTA-free protease inhibitors) on ice for 15 minutes. The resuspended sperms were passed through a G21 needle 10 times and then, centrifuged at 1 ,200 rpm at 4°C for 10 min.
  • a hypotonic buffer l O M Tris-HCK pH7A 10mM NaCL 10 mM EDTA and EDTA-free protease inhibitors
  • the supernatant was removed, and the pellet of the nuclei was resuspended in a resuspension buffer ( 10 niM Tns-HCL pH7.4, 10 raM NaCi, 1.5 niM MgCIj and EDTA-free protease inhibitors), and an equal volume of 1 M NaCl was added for 30 min incubation on ice.
  • the solution was centrifuged at 13.200 rpm at 4°C for 30 min and the supernatant (nuclear extract) was dialyzed at 4°C in buffer B ( l OmM Tris-HCI, pH7.4 owned 50 mM. NaCl, 1.5 m MgC!? and EDTA-free protease inhibitors) overnight with 2 changes of the dialysis buffer.
  • the preparation of nuclear extract from 293T ceils followed the procedures described above.
  • the transtected cells were washed 3 times with PBS and resuspended in the hypotonic buffer on ice for 1.0 mars.
  • the solution was centrifuged at 4,000 rpm for 10 rains and the supernatant were removed.
  • the nuclear pellet was resuspended in the resuspension buffer and then an equal volume of 1 M NaCl was added for 30 mm incubation on ice.
  • the lysate was centrifuged ai 13,200 rpm at 4 tt C for 30 min and the supernatant was collected as a nuclear extract, which was then dialyzed at 4"C in buffer B overnight.
  • C-5 methylated double-stranded DNA substrate was used in the demethy lation reactions with 293T nuclear extract or the recombinant DNMTs (see below), and then analyzed by the hydrolysis- TLC assay.
  • the 5-mC -containing DNA substrate was prepared b PGR amplification of a 561 bp fragment from the pMRl-8 plasmid containing spl/Hpaii sites (SEQ ID NO: 1 ).
  • SEQ ID NO: 1 a 5-mC-containing dNTP mix (Zymo Research) was used.
  • Primers for PCR were: pMRl-8 F, 5 * - aaagataccaggcgtttccccc -3 ' (SEQ ID NO: 2); and pMRl-8 R. 5'- gagffltcgttccactgagcgtc -3' (SEQ I D NO: 3).
  • the DNA demethylase activities of the 3 mouse DNMTs were greatly diminished, by approximately 73% to 88%, when amino acid substitutions or insertion were introduced into the known catalytic sites ofC-5 methylation of these enzymes (compare lanes 10, 12, 14 to 4. 6, 8, respectively, FIG.1).
  • the data of FIG. 1 suggested that the two de novo DNMTs as well as the maintenance DNMTl could act as active DNA 5-mC demelhyJases under appropriate conditions.
  • the de novo DNMTs. DNMT3A and DNMT3.B can transfer the methyl-group to DNA which do not contain any DNA methyl ti on on both strands. After de novo methylation. the DNA is methylated on both DNA strands.
  • the maintenance DNMTl can methylaie the hems -methylated (one of double strands is methylated) DN A during the DNA replications.
  • the DNA demethylation activities of the DNMTs appeared to be affected by the redox state of the enzymes.
  • preincubation of the enzyme with the reducing dithiothreitol (DTT) greatly decreased the extent of conversion of 5-mC to C (compare lane 5 to lane 3, FIG. 3 A), although addition of H3 ⁇ 40-> as high as 10 mM to the reaction mixture did not affect the DNA demethylation activity of the enzyme (data not shown), in contrasi to 5-mC demethylation, the 5-C meth lation reaction of DNMTs did not require Ca 2 " , nor was it affected by DTT (compare lane 6 to lane 4, FIG. 3B).
  • FIG. 4 A the double-stranded DNA substrate containing 5-mC was first incubated with the recombinant DNMT3B in a demethylation buffer for 2h. S AM was then added and the incubation continued for lb. Finally. t3 ⁇ 40?, which was known to inhibit the methylation reaction, was added and the reaction continued for another 2b. As exemplified in the TLC plate and statistically presented in the histogram of FIG. 4B, approximately 60% of 5-mC on the DNA.
  • Radioactive-labeled methylated DNA substrate Two different methods were used to generate radioactive-labeled methylated DNA as follows: The unmethylated DNA is incubated with M.SSSI and radioactive SAM, such as TI-SAM or f C-SAM. After the incubation and DNA isolation, the radioactive signal of the DNA was determined by autoradiography or scintillation counting to quantitate methylated DNA. Optionally, the extent of the meth lation of the DNA may be observed by Hpaii digestion followed by gel electrophoresis.
  • PCR amplification is performed by using dNTP mix containing 5-[ ' TT]-m.ethyl ⁇ dCTP or S- ⁇ U C j-methyl-dCTP.
  • the extent of methylation of the DNA is analyzed by radioactive signal autoradiography or scintillation counting, and optionally observed the methylation level by Hpaii digestion followed by gel electrophoresis.
  • Methylated reporter gene DNA substrate A plasmid containing a reporter gene expressing a reporter protein such as EGFP or GFP (e.g., commercial available pEGFP-C i) was highly methylated by the enzyme MSSSI in the presence of SAM using a method described above. Then the highly methylated and unmethyiated reporter plasmids were transfected into 293T cell by
  • the cells co-transfecied with methylated EGFP plasmids and DNMT3B-expression plasmid without an chemical or virus treatment showed 2-3 folds of EGFP-positive ceil population comparing to the cells co-trausfected with methylated EGFP plasmids and control plasmids (without DNMTs) without any chemical or virus treatment
  • the compound (test agent) or genetically modified virus could affect the DNA demethylation, the population of EGFP-positive cells will be changed.
  • a compound (a test agent) which may enhance DNA demethylation (i.e., increasing GFP-positive cell population) or reduce the DNA demethylaiion (decreasing GFP-positive cell population).
  • reporter EGFP
  • EGFP reporter
  • the DNA methylation level of the reporter plasmids could also be determined by an in vitro method. After chemical or virus treatments, the meth lated plasniids are isolated from the 293 cells. The DNA methylation level of isolated reporter plasmids can he determined by the several methods described above, such as a restriction digestion-polymer chain reaction. (PCR) assay, a hydrolysis- thin layer chromatography assay, antibody-based analysis, scintillation counting, autoradiography, dot blotting, liquid chromatography -based analysis, a bisulfite-based analysis.
  • PCR restriction digestion-polymer chain reaction.
  • Neomycin -resi stance gene which can keep the cell survive under Neomycin (G41.8) treatment
  • Puromyctn resistance gene The cell with expression of this gene can survive under ' Puromycin treatment
  • Blasticidin resistance gene which can make cell survive under Blastindin selection
  • Luciferase gene- pGL3 reporter vector Promega.
  • the firefly (Photinus pyralis) luciferase can catalyze the two-step oxidation reaction to yield light (550-57 nm); (5) Red Fluorescence gene-pDsRed-Ci .
  • the protein is red fluorescence protein (exc aiion-55?mn, emission- 592nm); and (6) Green fluorescent protein (GFP)-encoding gene,
  • Antibody-hase nalysis DNAs with different .methyl aiion levels are immunoprecipitaied by the 5-mC antibody.
  • the precipitated DNA may be analyzed by PCR or pyro-sequencing to determine the relative methylation level.
  • DNAs with different meihylation levels are loaded onto NC membranes in serial diluted amounts and cross-linked by UV.
  • the membranes are hybridized with 5-mC antibody and exposed with X ⁇ Ray films.
  • the strong dot signal indicates a strong methylati n level on the D A.
  • a Scintillation counter is a common-used instrument thai can measure ionizing radiation.
  • a radioactive-labelled DNA such as ⁇ or 5 C methylated DNA. is load into a container containig a scintillation cocktail. The radioactive signal is determined with a Scintillation, counter by detection of light emssion.
  • radioactive-labelled DN A may be load into a gel or on a NC membrane, and exposed with an X-Ray film.
  • the DNA methylation level can be analyzed by sequencing, PCR ampiiiication with site-specific primers, HRM (high resolution melt), restriction digestion (COBRA), non-denaturing gel(MS-SSCA), or MALDI-TOF.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Methods for identifying a test agent as a modulator of the active DNA demethylation activity of a DNA methyltransferase are disclosed. The method comprises: a) providing a methylated DNA; b) providing the DNA methyltransferase; c) allowing the methylated DNA to react with the DNA methyltransferase for a sufficient time to perform a demethylation reaction and generate a demethylated DNA product in the presence or absence of a test agent; d) analyzing the extent of demethylation; and d) comparing the extents of the demethylation in the presence and absence of the test agent, and thereby identify the test agent as a modulator of the DNA demethylation activity of the DNA methyltransferase.

Description

DNA 5-METHYL CYTOSiNE DE METHYLATION ACTIVITY OF VERTEBRATE DNA
ETHYLTRANSFERASES
FIELD OF THE INVENTION
The present invention relates generally to D A demethylation activity of D.N A
methyltransferases, therapeutic and diagnostic uses thereof.
BACKGROUND OF THE INVENTION
In vertebrates, DNA methyiation occurs primarily at the 5-position of cytosine (C) in CpG dyads and their genomic methyiation patterns are established/maintained by the DNA (C~5)~ methyl transferases, or DNMTs. Of the known vertebrate DNMTs, DNMT1 shows a substrates preference for hemi -methylated DNA and maintains the methylation patterns during DNA
replication. DN.MT3A and DNMT3B show equal C-5 methyiation activities toward unmethylated and hemi-methylated DNA in vitro, and the}- are essential for de novo genomic DNA methyiation as well development of the early embryos. The vertebrate DNA methyiation system comprising the above three essential DNMTs is indispensible for the establishment of the genomic DNA
methyiation patterns, globally and locally, and consequently the processes of gene expression, neuropJastictty, differentiation, carcinogenesis, imprinting, X-inactivation and development.
It has remained elusive in literature before 2012 whether there exists enzyme(s) in vertebrates that could actively and directly convert 5~mC on DNA into C.
SUMMARY OF THE INVENTION
In one aspect, the invention relates to a method for identifying a test agent for a compound) as a modulator of the active DNA demethylation activity of a DNA methyitransferase. The method comprises:
a) providing a methylated DNA;
b) providing a. DNA methyliransferase;
c) allowing the meth lated DNA to react with the DNA methyliransferase for a sufficient time to perform a demethylation reaction and generate a demethylated DN A product in the presence or absence of a test agent;
d) analyzing the extent of demethylation; and
d) comparing the extents of the demethylation in the presence and absence of the test agent, and thereby identify the test agent as a modulator of the DNA demethylation activity of the DNA methyliransferase; wherein the test agent is identified as an inhibitor of the active DNA demeth lation activity of the DNA meihyUransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA memyltransferase when the extent of demethylation is more in the presence of the test agent.
In one embodiment of the invention, the analyzing step is performed by a technique selected from the group consisting of a restriction digestion-polymer chain reaction (PCR) assay,
hydrolysis-thin layer chromatography assay, an antibody-based analysis, scintillation counting, autoradiography, dot blotting, a liquid chromatography-based analysis, and a Na bisuifite-based analysis.
In another embodiment of the i n vention, the demethylation reaction occurs in the presence of a calcium ion concentration of around 10 μΜ to 1 mM.
In another embodiment of the invention, the DNA methyltransferase is an isolated vertebrate
DNA methyltransferase, or a recombinant DNA methyltransferase, or is present in a nuclear extract or is present in a cellular extract. The vertebraie DN A methyltransferase, the nuclear extract, or the cellular extract may be prepared from cells selected from the group consisting of vertebrate cell cultures, vertebrate tissues, insect cells, worm cells, insect tissues, worm tissues, plant cells, plant tissues, yeast cells, and bacterial ceils. The nuclear extract may be a sperm extract.
In another embodiment of the invention, the methylated DNA comprises a labeled methyl group.
The methyl grou in the methylated DNA .may be radioactive-labeled.
In another embodiment of the invention, the aforementioned method steps (a) to (d) possess the
.following technical features: wherein:
(a) the methylated DNA provided in step (a) is a methylated reporter gene operably linked to a constitutive promoter and is present in a cell;
(b) the DNA methyltransferase provided in step (b) is operably linked to a constitutive promoter and is also present in the cell, or is endogenous!? present, in the cell as an endogenous DN A methy I transferase;
(c) the demethy l ted DNA product generated in step (c) is a demethy lated reporter gene, which expresses a reporter protein in the cell.
(d) the analyzing step is performed by a technique selected from the group consisting of:
(i) analyzing the signal of the reporter protein encoded by the demethy lated reporter gene in the cell;
(ii) analyzing the reporter protein expression by Wester blot; and
(iii) isolating the methylated and demethylated reporter gene and analyzing the extent of demeth lation by a restriction digestion-polymer chain reaction (PCR) assay, a hydrolysis- thin layer chromatography assay, an antibody-based analysis, scintillation counting, autoradiography, dot blotting, a liquid chromatograph -based analysis, or Na bisulfUe- based analysis.
In one embodimeni of the in vention, the methylated reporter gene and the DNA
methyltransferase are present in the cell via trans.fection. Alternatively, the D A methyltransferase is an endogenous enzyme present in the cell.
The cell is transfected with the methylated reporter gene, and the DNA methyltransferase may be an exogenouse enzyme transfected into the same cell, or may be an endogenous enzyme already present in the same cell. In one embodiment, the methylated reporter gene and the DNA
methyhransferase are co-iransfected into the ceil.
In one embodiment of the invention, the test agent is introduced into the cell or added to a culture medium bathing the cell
In another embodiment of the invention, the methylated reporter gene comprises a DNA sequence of a gene selected from the group consisting of a fluorescent protein-encoding gene, a luciferase gene, a drug-resistant gene, and genes of cell survivals.
In another embodiment of the invention, the methylated DNA comprises 5-meihyleytosine (5mC)~coniaining DNA.
In another embodiment of the invention, step (c) is performed under a. condition that is fee of a reducing agent or under a non-reducing condition.
The DNA methyl transferase may be a modified form of a wild-type DNA methyl transferase, said modified form retaining the cti e D A demeihy lation activity of the wild-type DNA
methy l trans f er as e.
The DN A methyltransferase may be selected from the group consisting of DN A
metbyliransferase 1 , DNA melhyltiansferase 3 A, DNA methyl transferase 3B, and any combination thereof.
The constitutive promoter may be, but not limited to, a cytomegalovirus promoter.
In another aspect, the invention relates to a method for identifying a test agent as a modulator of the active DNA demethylation activity of a DNA methyltransferase, in which the method comprises:
(I)
a) admixtng a first composition comprising a methylated DNA with a second composition comprising the DNA me&yltransferase in the presence or absence of a test agent;
b) allowing a demethylation reaction to occur by reacting the methylated DN A with the DNA methyhransferase for a sufficient time to generate a demethy!ated DNA product;
c) analyzing the extent of demethylation; and d) comparing the extents of the demethylation in the presence and absence of the test agent, and thereby identify the test agent for modulating active DNA demethylation activity of the DNA methy Itransf erase;
wherein the test agent is identified as an inhibitor of the active DNA demethylation activity of the D A methyitransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA methyitransferase when the extent of demethylation is more in the presence of the test agent; or (II)
1) providing a ceil culture medium containing cells transfected with reporter gene that is methylated and operably linked to a. constitutive promoter, said cells containing an endogenous DNA methy Itransf erase or exogenous y expressing a wild-type, a modified or a genetically engineered DNA methyitransferase;
2) exposing the cells to a test agent;
3) allowing a demethylation reaction to occur to generate a demethylated reporter gene, which expresses a reporter protein hi the cells; and
4) analyzing the extent of demethylation of the reporter gene by examining the signal intensity of the reporter protein expressed by the demethylated reporter gene in the cells,
5) comparing the extents of the demethyl tion of the reporter gene in the presence and absence of the test agent, and thereby identify the test agent as a modulator of the DNA
demethylation activity of the DNA methyitransferase;
wherein the test agent is identified as an inhibitor of the active DNA demethylation acti vity of the DNA methyitransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA methyl transferase when the extent of demethylation is more in the presence of the test agent.
The wild-type DNA methyitransferase may be selected from the group consisting of DNA methyitransferase 1 , DNA methyitransferase 3 A, and DNA methyitransferase 3B.
The accompanying drawings illustrate one or more embodiments of the invention and, together with the written description:, serve to explain the principles of the invention. Wherever possible, the same reference numbers are used throughout the drawings to refer to the same or like elements of an embodiment,
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows DNA.5-mC demethylation activities of the .mammalian DN Ts. The 5-mC- containing DNA substrates were subjected to incubation in 2 3T nuclear extracts in buffer B with 10 tti Cat¾ that contained the exogenously expressed EGFP (lanes 1 and 2), mouse DN 1 (lanes 3 and 4), DNMT3A (lanes 5 and 6), DNMT3B {lanes 7 and 8), and their site-directed mutants (lanes 9- 14), respectively. The extents of conversion of 5-mC to C were analyzed by hydrolysis-TLC assay and quantitatively shown in the histogram. The amounts of the exogenous wild type enzyme in lanes 4, 6, and 8 were similar to those of the mutant enzymes in lanes 10, 12, and 14, respectively
(Western blotting dat not shown). M, mock control without incubation; R, with incubation. Error bars indicate S.D..* /K0.05 by {-test comparing bars 4, 6, and 8 to bar 2,
FIG, 2A shows calcium-dependence of the DNA 5-mC demethyiation activities of recombinant DNMTs. Hydrolysis-TLC assay of conversion of 5-mC to C by recombinant DN T3B. The DNA demethyi tion acti vity of the recombinant mouse DNMT3B was assayed by incubation of 40 nM 5- mC containing DNA substrate with 40 nM of the enzyme in buffer B containing 100 pg/ml BSA and increasing concentrations (0, 10 μΜ, 100 μΜ, 1 mM, 5 mM and 10 mM) of CaC½. The incubations were all at 37°C for 4h. The quantitative results are presented in the histogram. M. mock control without incubation. Error bars indicate S.D. *5 p<0.05: **, / <().01 by West comparing bars 3-7 to bar 2.
FIG. 2B shows a comparison of the DNA demethyiation activities of recombinant hDNMTl, hDNMT3A and DNMT3B by hydrolysis-TLC assay. The 5-mC containing substrate was incubated at 37T for 4h with 40 nM of each of the recombinant hDNMTl (lane 2). hDN T3A (lane 3) and DNMT3B (lane 4) in buffer B containing 100 ug/ml BS A and 1 mM of CaC½- and then analyzed by hydrolysis-TLC assay. The quantitative analysis is presented in the histogram. M, mock control without incubation; R. with incubation. Error bars indicate S.D. *, ><0.05; ***. / 0.005 by t-test comparing bars 2-4 to bar 1.
FlGs. 3A-B show the effects of a reducing condition and SAM on the D A demethyiation and methyl ation activities of DNMT3B. FIG. 3A: The 5-mC containing DNA substrate was subjected to the demethyiation reactions with 40 nM recombinant DNMT3B in buffer B containing 100 ug/ml BSA with or without the inclusion, of ! mM CaCL, 5 mM DT'L or 160 μΜ SAM.. After incubation at 37'C for 4h. the DNA products were analyzed by the hydrolysis-TLC assay. The results are
quantitatively presented in the histogram. Error bars indicate S.D.. *, p<0. 5 by t-test comparing bars 2-4 to bar 1. FIG. 3B: Unmeihylaied pMRJ -8 plasmid D A was incubated with 40 nM recombinant D.NMT3.B in buffer B containing 100 ^ig/ml BSA with or without 1 mM CaCL, 5 mM DTT, or 160 μΜ SAM. After incubation at 37"C for 4h, the extents of C methylation of the DNAs from the different reactions were determined by hydroiysis-TLC assay mid quantitatively compared in the histogram. Error bars indicate S.D.
FIGs. 4A-B show Reversibility of the DMA demethyiation and methylation reactions in vitro, FIG. 4A; Strategy of a series of reactions testing the reversibility of DNA demethyiation and methylation (see text for more details). Briefly. 5-mC containing DNA substrate was incubated at 37°C for 2h with 40 nM recombinant DNMT3B in buffer 8 containing 100 ttg/m! BSA and 1 mM. CaCl;; (reaction 1). Then. 160 μΜ SAM were added and the incubation was continued for another Ih (reaction 2). Finally, 1 mM H2O2 was added to the reaction mixture and the incubation continued for another 2h (reaction 3). x, reactions. FIG. 4B: The DNA products from, the 3 reactions outlined in 4A were purified and analyzed by hydrolysis-TLC assay. The data are quantitatively compared in the histogram. M, mock control without incubation. Error bars indicate S.D.. *, /><0.05; ***, /?<0.005,
FIGs. A-B show Experimental strategies for assay of theTnter-com ersions of 5-mC and C. FIG. 5 A: Schematic diagram illustrating the stepwise processes of restriction digestion-PCR assay. This assay was used to estimate the extents of demethylation of methylated plasmid upon incubation with the porcine sperm nuclear extract under different conditions (FIG. 6). 20 ng of the 5-mC containing plasmid pMRl-8, with or without DNA demethylation reactions in the sperm nuclear extract, was digested b Hpali overnight at 37°C, and purified with Qiaquick Nucleotide Removal Kit (Qiagen). The proportion ofBpali-insensjtive DNA substrate was analysed by 12-15 cycles of PCR using a primer set bracketing the Hpali restriction cutting sites followed by the gel electrophoresis. The band intensities were further quantitatively estimated and compared. FIG. 5B: Schematic diagram
illustrating the stepwise processes of hydroly sis-TLC assay. The double-stranded DNA substrates were digested by Mspl at 37°C overnight and then dephosphorylated with calf intestine phosphatase (New England Biolabs) followed by purification by Qiaquick Nucleotide Removal Kit (Qiagen). The purified DNAs were end-labeled by using y'^P-ATP and T4 polynucleotide kinase (Ne England Biolabs), and then digested by snake venom phosphodiesterase (Worthington) and DNasel (Roche) overnight. The hydrol zates were loaded onto PEL cellulose plates (Merck) and separated in the buffer isobutyric acid: water: ammonia (66: 18:3) for 1.6-18h. Autoradiography of the plates was carried out and the signals o the plates were quantitated using the Alpha. Imaging 2200 (Alpha lfmotech Crop.),
FIGs. 6A-C show the DNA demethylation activity of porcine sperm extracts. FIG. 6A: Fully methylated plasmid DNA pMR.1-8 was incubated at 37°C for 2h in the porcine sperm nuclear extract with increasing concentrations (0„ 10 μΜ, ΙΟΟμ . mM and lOmM) of Ca€½ (lanes 1 -5), MgC (lanes 6-10) or FeCNHiSOi)?. (lanes I 1- 15). After the reactions, the extent of DNA demethylation of the plasmid DNA was analyzed by the restriction digestion-PCR assay outlined in FIG. 5 A. The histograms sho the relative proportions of the plasmid DNA resistant to Hpali cleavage. For comparison of bars 2-5 to bar 1 , *, /x0.05; **, 0.01 by the t-test. FIG. 6B: Effects of BER inhibitors on the demethylation activities of the porcine sperm nuclear extract. The DNA
demethylation reactions were carried out by incubating fully-methylated plasmid DNA MR.1 -8 and sperm nuclear extract containing 10 mM CaCfe. and increasing concentrations of APE-i (0. 1 0 μ.Μ, 100 μ.Μ, and 1 mM, lanes 2-6) or 3-AB (0, 5 μΜ, 50 μΜ, 5 mM, and 50mM, lanes 8-12). After the reactions, the extents of demethylation of the plasmid DNA were analyzed by the restriction digestion-PCR assay. FIG. 6C: Effect of the CDA inhibitor THU on the demethylation reaction in the porcine sperm nuclear extract. The fully-methylated pMRl -8 D A was subjected to incubation in the extract at 37°C for 2h containing increasing concentrations of THU (0, 30 μΜ. 100 μΜ and I rnM, lanes 1 -4). The extents of demethylation of the plasmid DNA were analyzed by the restriction digestion-PCR assay. The histogram shows the relative proportions of plasmid DNA resistant to Hpall cleavage. M, mock control without incubation. Error bars indicate S.D..
FIG. 7 shows the results of SDS-PAGE analyses. The recombinant human hD'NMTl (500 ng), human hDN T3A (250 ng), and mouse D T3B {250 ng) were subjected to SDS-PAGE followed by the coomassie blue staining. The arrows indicate the expected hands of the three DNMTs, respectively. Protein markers were loaded in the M lanes.
FIG. 8 shows D A demethylation by recombinant DNMT38 in the presence of ¾-SAM, The reaction conditions were the same as those described in FIG.3 A, except that ί μϋί Ή-SA was also included in each of the reaction mixtures. After the reactions, the mixtures were further inciibated with 100 pi ofO.SN NaOH at 55 for 10 mins and neutralized with 100 μΐ of lM Tris-Cl pH7.0. The D A substrates were then preci itated with 1 % trichloroacetic acid (TCA) in 5 mM a pyrophosphate on ice for 15 mins, and loaded onto DE-81 ion-exchange papers followed by air drying. The DE-81 papers were washed 5 times with 5% TCA in 5 mM Na pyrophosphate, twee with 100% EtOH, air dried, and the ¾ counts on DN A were determined in a liquid scintillation counter.
DETAILED DESCRIPTION OF TH E INVENTION
The present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art. Various embodiments of the invention are now described in detail. Referring to the drawings, like numbers indicate like components throughout the views. As used in the description herein and throughout the claims that follow; the meaning of Ύ, " n", and "the" includes plural eference unless the context clearly dictates otherwise. Also, as used in the description herein and throughout the claims that follow, the meaning of "in" includes "in" and ""on" unless the context clearly dictates otherwise. Moreover, titles or subtitles may he used in the s ecification for the convenience of a reader, which shall ha no influence on the scope of the present invention. Additionally, some terms used in this specification are more specifically defined below. DEFINITIONS
The lerms use in this specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Certain terms that are used to describe the invention are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the invention. For convenience, certain terras may be highlighted, for example using italics and/or quotation marks. The use of highlighting has no influence on the scope and meaning of a term; the scope and meaning of a term is the same, in the same context whether or not it is highlighted. It will be appreciated thai same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms di scussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are pro ded, A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and in no way l imits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to various embodiments given in this specification.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document including definitions will control.
As used herein, "around", "about" or '"approximately" shall generally mean within 20 percent preferably within 10 percent, and more preferably within 5 percent of a given value or range.
Numerical quantities given herein are approximate, meaning thai the term "around", "about" ' or "approximately" can be inferred if not expressly stated.
The term "SmC" refers t the 5 position of cytosine.
The term "agent' refers to any matter, substance or thing producing or used for obtaining specific results, which includes, but not limited to, compounds, co-factors, etc.
The invention relates to the discovery that mammalian DNMTs, including DNMXL DNMT3A, and DNMT3B cart actively and directly convert 5-mC on DNA into€ biochemical reaction. See Chen et at (2013) THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL, 288, NO. 13, pp. 9084- 9091 , which is incorporated herein by reference in its entirety.
Specifically, the invention relates to the discovery that in in vitro reactions, the mouse and/or hitman DNMTl , DNMT3 A, and DNMT3B all could act as an active DNA demeth iase, removing the methyl group from 5-mC on DNA in an Ca"' ion and redox state-dependent manner.
The invention also relates to the discovery of the DNA 5-mC demethylaiion activities of DNMTs that could be used to screen, identity, and design reagents, including chemical compounds and therapeutic agents,, which would modulate the DNA 5-mC demethyiation activities of DNMTs and their modified forms/ derivatives, for the purpose of regulating the different cellular processes including gene expression, chromosome structure, carcinogenesis (metastasis), cell division, cell motility, neuronal plasticity, etc,
The protein sequences of DNMTs are as follows: DNMTl [Homo spaims} SEQ ID NO:4; DNMT1 [Mm musc l s] SE ID NO: 5; DNMTS A [Homo - sp iens) SEQ ID NO: 6: DNMT3A \M s muscui l SEQ ID NO: ?; DNMT3B {Homo spaiens] SEQ ID NO: 8: DNMT3B \Mus musculus] SEQ !D NO: 9.
To generate modified DNMTs, we serially deleted 1 amino acids from N-terminal. of the full- length DNMTs. For example, the modified forms of human DNMTl is DNMT i (1 1 -1620),
DNMT1(21-1620)S DNMTl (31-1620) , . . , etc. Ail the deletion-modi fied DNMTl s are tested for DNA methylatioii and demethyiation activities in vitro and in vivo. In addition, DNMTl may be modified by deletion of ihe internal 10 amino acid of the full length DNMTl , and the modified forms are DNMT 1(Λ1 1 -20), DNMTl (Λ21 -30), DNMTl (A31-40) . . . . etc. The same deletion
modifications may be used to generate deletion modified forms of DNMT3A and DNMT3B.
To screen, identify, and/or design reagents that modulate the DNA 5-raC demethyiation activities of DNMTs, several assays can be used, which include in vitro and in vivo assays.
( ! ) In vitro
The DNMTs and 5-raC containing DNA substrates are incubated with the test agents under proper reaction conditions. The DNMTs used may be in the forms of either recombinant wildly pe/modified/ genetically engineered enzymes or as ectopically expressed wild type/ modified/ genetically engineered enzymes in cellular or nuclear extracts prepared from vertebrate cell cultures/ tissues, yeast cells, or bacterial cells. The methyl group on the 5 -mC -containing DNA substrates can be radioactive, or labeled by other methods.
After the reaction, the DNA substrates are isolated manually or automatically, and the content of inethylatioii/demethyiatioii is determined by several methods, such as restriction digestion-based analysis, antibody-based analysis, Scintillation counting, autoradiography, dot blotting, liquid chromatography-based analysis, Na bisulfite-based analysis and hydrolysis-TLC (Ihin. layer chromatography). The effect of each test agent on the DNA 5-mC demethyiation activities of the DNMT enzv mes is determined by comparison of the content of 5-mC on the DNA substrate with the control (mock), before and after the in vitro reaction.
(2) In vivo
The reporte DN As methylated at 5-C are introduced into cells containing either the endogenous DNMTs alone or with exogenous!}' expressed wild type/modified/ genetically engineered DNMTs. The reagents to he tested are added into the cell cuHuring medium, or sent into the cells, before triggering the DNA demethyiatiort activities of the DNMTs.
The methylated reporter DNAs cany genes, such as different fluorescence genes, luciferase gene, drug-resistant gene, or genes of cell survivals etc, the expression levels of which can. indicate the methylation/demethylation status of the DNA substrates. Alternativel , the methylated report DN As can be isolated manually or automatically, and analyzed with respect to their 5-raC content by methods described above.
EXAMPLES
MATERIALS AMD METHODS
Recombinant Plasmids and Recombinant Proteins. Constructions of expression plasmids used in this study were described in Chen et al. (J Biol Chem. VOL. 287. pp. 331 16-33121, 2012. i t is incorporated herein by reference in lis entirety), which included plasmids for exogenously expressing D MTl, DN T3A, and DNMT3B. The DNA methyiation-inactive mutants of the DNMTs, i.e. DNMTl -PSC, DNMT3A-PS and DNMT3.B-PS, were generated by insertion of a serine residue before the Cys-1229 at the catalytic site of DNMT l or by replacing the cy steine residue Cys-706 and Cys-657 in the catalytic domains of DN T3A and DNMT3B, respectively, with a serine residue.
Ail of the recombinant enzymes DNMTs, including hDNMT! (purity -78%), hDNMT3A (purity-90%), and mouse DNMT3B (purit -50%) (FIG. 7), were purchased from BPS Bioscience.
Cell Culture and DNA. Tramfection The human embryonic kidney 2 3T cells were cultured under 5% CO?, at 3TC in DMEM medium supplemented with 10% FBS and 1 % Penicillin- Streptomycin. For DNA transfections, different expression plasmids were delivered into ceils using either LIPOFECTAM1NBD 2000 or MAXIf EC*FM. The transfected cells were collected 2 days afterwards for further experimentation.
Pro ation ofNuclmr Extracts. The nuclear extracts were prepared from the porcine sperms and 293T cells, respectively, by a modified method. Briefly, the porcine semen was washed three- times by PBS buffer and the sperm pellet isolated with FICQLL®. The pellet, was resuspended in a hypotonic buffer (l O M Tris-HCK pH7A 10mM NaCL 10 mM EDTA and EDTA-free protease inhibitors) on ice for 15 minutes. The resuspended sperms were passed through a G21 needle 10 times and then, centrifuged at 1 ,200 rpm at 4°C for 10 min. The supernatant was removed, and the pellet of the nuclei was resuspended in a resuspension buffer ( 10 niM Tns-HCL pH7.4, 10 raM NaCi, 1.5 niM MgCIj and EDTA-free protease inhibitors), and an equal volume of 1 M NaCl was added for 30 min incubation on ice. The solution was centrifuged at 13.200 rpm at 4°C for 30 min and the supernatant (nuclear extract) was dialyzed at 4°C in buffer B ( l OmM Tris-HCI, pH7.4„ 50 mM. NaCl, 1.5 m MgC!? and EDTA-free protease inhibitors) overnight with 2 changes of the dialysis buffer.
The preparation of nuclear extract from 293T ceils followed the procedures described above. The transtected cells were washed 3 times with PBS and resuspended in the hypotonic buffer on ice for 1.0 mars. The solution was centrifuged at 4,000 rpm for 10 rains and the supernatant were removed. The nuclear pellet was resuspended in the resuspension buffer and then an equal volume of 1 M NaCl was added for 30 mm incubation on ice. The lysate was centrifuged ai 13,200 rpm at 4ttC for 30 min and the supernatant was collected as a nuclear extract, which was then dialyzed at 4"C in buffer B overnight.
DNA Substrates for In vitro DNA detnethy!ation assay. The 5~mC-contaioing substrate for DNA demethylation assay of the porcine sperm nuclear extract w as prepared from the 2, 819 bp pMRl-8 plasmid containing 1 5 CpG dyads and .1 .1 Mspl restriction sites. The unmodified pMRl -8 plasmid was amplified in the SCSI 10 bacteria and then methylated by the bacterial methyl transferase M.SSS .1 in NEB buffer 2 supplemented with 1 0 μΜ SAM (S-adenosylmethionine). Hie extent of
meth 'lation of the plasmid was checked by HpaH digestion.
C-5 methylated double-stranded DNA substrate was used in the demethy lation reactions with 293T nuclear extract or the recombinant DNMTs (see below), and then analyzed by the hydrolysis- TLC assay.
in Vitro Reactions qf'5-mC to C Conversion on DNA. For DNA demethylation reactions. 40 ng of the methylated pMRl-8 plasmid DNA or 5-mC containing double-stranded DNA substrate was incubated with 100 of the nuclear extracts or 40 oM recombinant DNMTs proteins in 50 μΐ of buffer B containing 1 0 pg/ral BSA at 37°C up to 4b. When needed, 1.0 μΜ-10 mM of three di v alent cations (Caf', Mg2*, or Fe2' 10 μΜ-l mM CRT0044876 (APE-i), 0.5 μΜ-50 mM 3- aminobenzamide (3~AB 30 μΜ \ mM tetrahydrouridsne (ΤϊΤϋ). 5 mM DTT, or 160 μΜ SAM was included in the reaction mixtures. To assay the effect of redox-state of the enzymes, 40 oM recombinant DNMTs was pre- reaied with 1 μ -10 mM HjC in 50 u3 of buffer B containing 100 pg ml BSA at 15°C for 30 min. Forty ng of the 5-mC containing double stranded DNA substrate was then added and the reaction mixtures were incubated at 37*C for 4h.
All reactions were stopped by .1.3% SDS and treated with proteinase K at 50 .for 20 min. The DNA substrates and demethylaied products at the end of the reaction were isolated using the
Qiaquick Nucleotide Removal Kit, and subjected to restrictions digestion-PCR assay or hydrolysis- TLC assay (see below).
C-5 methylated douhk-stranded DNA substrate preparation. The 5-mC -containing DNA substrate was prepared b PGR amplification of a 561 bp fragment from the pMRl-8 plasmid containing spl/Hpaii sites (SEQ ID NO: 1 ). During ihe PCR amplification, a 5-mC-containing dNTP mix (Zymo Research) was used. Primers for PCR were: pMRl-8 F, 5*- aaagataccaggcgtttcccc -3' (SEQ ID NO: 2); and pMRl-8 R. 5'- gagffltcgttccactgagcgtc -3' (SEQ I D NO: 3).
/« i¾ro Reactions ofC to 5-mC Conversion on DNA, Methylation in vitro of unmodified pMRl- 8 p!asmid DNA by Ihe DNMTs were carried out and analyzed by the hydrolysis-TLC assay. When needed, .1 mM CaC ? or 5 mM DTI was also included in the reaction mixture.
Restriction Digesfion-fiCR Assay qfC-5 methylation on Double-Strand DNA Substr tefs). The procedures are as described previously (Chen et aL 2012. ibid). See FIG. 5A legend for more details.
Hydrolysis-TLC (Thin Layer Chromatography) assay ofS-mC, 5-hmC, and C on DNA. The procedures were similar to those described in Chen et ai. (201:2). ibid. See FIG. 5B legend for details. RESULTS
In vitro DNA dem thyhtion by porcine sperm extract. We performed in vitro DNA C-5 demethylation reactions using the nuclear extract prepared from porcine sperms. The effect of Ca" 1 ion were also tested. Remarkably, inclusion of 1-10 niM of C iV, but not Mg''÷ (compare lanes 7-10 to lane 6) or Fe2<" (compare lanes 12-15 to lane I i, FIG. 6A), significantly reduced the extent of
DNA methyl ati on by 20-50% (compare lanes 4 and 5 to lane L FIG. 6A). Furthermore, inclusion of inhibitors of either the BER pathway. CRT0044876 (APE-i) and 3-ammobenzamide (3-AB), or the cytidine-deaminase (CD A). {etrahydrouridine ίΤΗϋ). in the reactions had little effect on the in vitro DNA demethylati n activity of the sperm nuclear extract (FIGs. 6A and 6B). The data of FIGs. 6A-B suggested that Ca^ ton stimulated a BER-independent and CDA-independent D A demethylation. activi ty in the nuclear extract of the porcine sperms.
It was not trivial to purify the facioF(s)/enzyrae(s) in the nuclear extract of the porcine sperms that was responsible for the in vitro conversion of 5-mC to C on DNA. Since the porcine sperm nuclear extract contained DNMT1/DNMT3A D MT3.B (data not shown) and die murine human orthologs of the latter two DNMTs acted in vitro as DN A 5-hydroxymethylcytosine (5-hmC) dehydroxymethylases under oxidative conditions in the absence of SAM, we suspected that under appropriate conditions, these DNMTs might also be capable to convert, other modified forms of cyiosine, e.g.. 5-mC. to C.
In view of the data of FIG. 6, we performed in vitro DNA demethylation reactions in the presence of 10 mM of Ca7". 5 -m -containing double-stranded DNA substrate was incubated with nuclear extracts prepared from 293T cells transfected with plasmids overexpressing EGFP (a negative control), mouse DNMT1 , mouse DNMT A, mouse DNMT3B, as well as their mutants, respectively. After the reactions, the DNA products were hydrolyzed as depicted in FIG. 5B and the nucleotides were analyzed by TLC (FIG. 1). As shown, under the reaction conditions tested, the nuclear extracts containing the exogenously expressed D MTl (lane 4, FIG. 1), DN T3A (lane 6, FIG. 1), and DNMT3B (lanes 8, FIG. 1) all could remove the 5-meihyl group from approximately 30% of the 5-mC residues on the DNA substrates.
Remarkably, the DNA demethylase activities of the 3 mouse DNMTs were greatly diminished, by approximately 73% to 88%, when amino acid substitutions or insertion were introduced into the known catalytic sites ofC-5 methylation of these enzymes (compare lanes 10, 12, 14 to 4. 6, 8, respectively, FIG.1). The data of FIG. 1 suggested that the two de novo DNMTs as well as the maintenance DNMTl could act as active DNA 5-mC demelhyJases under appropriate conditions. The de novo DNMTs. DNMT3A and DNMT3.B can transfer the methyl-group to DNA which do not contain any DNA methyl ti on on both strands. After de novo methylation. the DNA is methylated on both DNA strands. The maintenance DNMTl can methylaie the hems -methylated (one of double strands is methylated) DN A during the DNA replications.
Ct ' -and redox state-dependent DNA S-mC demethylase activities of partially purified recombinant DNMl's. To further confirm the result of FIG. I, recombinant mouse DNMT3B, human DNMTl (hDNMTl ), and human DNMT3A (faDNMT A) partially purified from recombinant baculovirus-infected Sf insect ceils were examined for their DNA demethylation activities. First, the ecombinant mouse DNMT3B (-50% purity. FIG. 7) was subjected to incubation with 5-mC- containing DN A substrate in buffer B containing increasing concentrations (0, 10 μΜ, 100 μ'Μ, 1 mM, 5 M and 10 mM) of CaC (FIG.2A). As seen, the recombinant DNMT3B exhibited significant DNA demethylalion activity only in the presence of Ca2: (compare lanes 3-7 to lane 2, FIG.2A), with the activity highest in the presence of 1 mM Ca2 ' (lane 5, F1G.2.A). We tested and compared the DNA demethylation activities of DNMT3B, hDNMTl (- 70% purity, FIG. 7) and hDNMT3A (-90% purity, FIG 7) in buffer B containing 1 mM Cat¾ (F1G.2B), Both hDNMTl and DNMT3B exhibited high DNA demethylation activity, converting at least 50% of 5-mC on DNA to C (lanes 2 and 4, FIG. 2.B), while the recombinant HDNMT3A showed relatively lower activity {approximately 20% conversion, lane 3 of FIG, 2B). Demethylation reaction by the recombinant mouse DNMT3B also removed the Hpall resistance of the methylated DNA substrate (data not shown). These data together demonstrated that mammalian DNMTs could function as active D A demethylases in vitro,
The DNA demethylation activities of the DNMTs appeared to be affected by the redox state of the enzymes. As exemplified by DNMT3B, preincubation of the enzyme with the reducing dithiothreitol (DTT) greatly decreased the extent of conversion of 5-mC to C (compare lane 5 to lane 3, FIG. 3 A), although addition of H¾0-> as high as 10 mM to the reaction mixture did not affect the DNA demethylation activity of the enzyme (data not shown), in contrasi to 5-mC demethylation, the 5-C meth lation reaction of DNMTs did not require Ca2 ", nor was it affected by DTT (compare lane 6 to lane 4, FIG. 3B).
Reversibility of the DNA 5-mC demethylation and 5-C methylation reactions catalyzed by DNMTs. As exemplified for D MT3B in FIG. 3 A, the inclusion of SAM, the methyl donors needed for DNA. 5-C methylation by the DNMTs, in the reaction mixture greatly reduced the extent of conversion of 5-mC to C (compare lanes 4 and 6 to lane 3, FIG. 3A). This could be due to the inhibition of the demethylation activity of the DNMTs by SAM. Alternatively, the presence of SAM in the demethylation reaction might favor the methyl ation function, of DNMTs. thus pushing the demeth lation backwards. The latter scenario was confirmed with inclusion of radioactive "Ή-SAM in the reaction mixtures and quantitation of 'TMabled-CHg on DNA after the reactions (lanes 4 and 6, FIG. 8). This result suggested that the DNA 5-raC demethylation reaction was reversible, with the presence SAM pushing the DNMT3B to re-methyfate the demeth lated cytosine on the DNA substrate.
The reversibility of the DNA methylation-deniethylation reactions as catalysed b the
mammalian DNMTs was further studied by an analysis of the dynamic changes of the DNA
methyl ation in vitro. In FIG. 4 A, the double-stranded DNA substrate containing 5-mC was first incubated with the recombinant DNMT3B in a demethylation buffer for 2h. S AM was then added and the incubation continued for lb. Finally. t¾0?, which was known to inhibit the methylation reaction, was added and the reaction continued for another 2b. As exemplified in the TLC plate and statistically presented in the histogram of FIG. 4B, approximately 60% of 5-mC on the DNA.
substrate were demethylated by DNMT3B at the end. of the first reaction (compare lane l bar I to lane bar M. FIG. 4B). The continued I h incubation in the presence of SAM converted more than 60% of the C back to 5-mC (compare lane 2/har 2 to lane 1 /bar 1 , FIG. 4B). Finally, the addition of H2O2 led to the switch of the enzyme activity of D.NMT3B from methylation to demethylation again (compare lane 3/bar 3 to lane 2 bar 2, FIG. 4B), presumably due to loss the DNA methylation function of the oxidized enzy me. The data of FIGs. 3 and 4 altogether suggested that the switch of the catalytic functions of the DNMTs in between DNA methylation and demethylation was flexible, subjecting to the regulation by a range of factors including the local concentration of Ca~\ the presence of SAM, and the redox-state of the DNMTs.
Generation oj' Radioactive-labeled methylated DNA substrate. Two different methods were used to generate radioactive-labeled methylated DNA as follows: The unmethylated DNA is incubated with M.SSSI and radioactive SAM, such as TI-SAM or f C-SAM. After the incubation and DNA isolation, the radioactive signal of the DNA was determined by autoradiography or scintillation counting to quantitate methylated DNA. Optionally, the extent of the meth lation of the DNA may be observed by Hpaii digestion followed by gel electrophoresis. Alternatively, to make radioactive methylated DNA, PCR amplification is performed by using dNTP mix containing 5-['TT]-m.ethyl~ dCTP or S-\UC j-methyl-dCTP. After purification of the PCR product, the extent of methylation of the DNA is analyzed by radioactive signal autoradiography or scintillation counting, and optionally observed the methylation level by Hpaii digestion followed by gel electrophoresis.
Methylated reporter gene DNA substrate. A plasmid containing a reporter gene expressing a reporter protein such as EGFP or GFP (e.g., commercial available pEGFP-C i) was highly methylated by the enzyme MSSSI in the presence of SAM using a method described above. Then the highly methylated and unmethyiated reporter plasmids were transfected into 293T cell by
Upofectamine 2000, respectively. To detect expression of the reporter gene, the transfected ceils were analyzed by a fluorescence microscopy and FACS flow cytometry- The results showed that the unmethylaled EGFP reporter gene could strongly express the EGFP protein in the cells, hut the highly methylated EGFP reporter gene expression of the EGFP protein was severely suppressed.
Based on the correlation between the DNA methylation level of the reporter gene and gene expression, we eo-transfect the highly methylated reporter plasmid EGFP and the D Ts- expression plasniids to 293 cells by Upofectamine 2000, After 24h, the transfected cells are treated with different test agents (chemical compounds) or different genetically modified viruses transduced with exogenous c'DNA encoding a known protein of interest.
The cells co-transfecied with methylated EGFP plasmids and DNMT3B-expression plasmid without an chemical or virus treatment showed 2-3 folds of EGFP-positive ceil population comparing to the cells co-trausfected with methylated EGFP plasmids and control plasmids (without DNMTs) without any chemical or virus treatment
If the compound (test agent) or genetically modified virus could affect the DNA demethylation, the population of EGFP-positive cells will be changed. By comparing the EGFP-positive cell populations in the presence and absence of chemical (or virus) treatment, it is .feasible to identify a compound (a test agent) which may enhance DNA demethylation (i.e., increasing GFP-positive cell population) or reduce the DNA demethylaiion (decreasing GFP-positive cell population).
In addition, the expression of reporter (EGFP) can be analyzed by western blotting.
The DNA methylation level of the reporter plasmids could also be determined by an in vitro method. After chemical or virus treatments, the meth lated plasniids are isolated from the 293 cells. The DNA methylation level of isolated reporter plasmids can he determined by the several methods described above, such as a restriction digestion-polymer chain reaction. (PCR) assay, a hydrolysis- thin layer chromatography assay, antibody-based analysis, scintillation counting, autoradiography, dot blotting, liquid chromatography -based analysis, a bisulfite-based analysis. Other candidate genes for reporters m y be used, for example: (1 ) Neomycin -resi stance gene, which can keep the cell survive under Neomycin (G41.8) treatment; (2) Puromyctn resistance gene. The cell with expression of this gene can survive under 'Puromycin treatment; (3) Blasticidin resistance gene, which can make cell survive under Blastindin selection; (4) Luciferase gene- pGL3 reporter vector (Promega). The firefly (Photinus pyralis) luciferase can catalyze the two-step oxidation reaction to yield light (550-57 nm); (5) Red Fluorescence gene-pDsRed-Ci . The protein is red fluorescence protein (exc aiion-55?mn, emission- 592nm); and (6) Green fluorescent protein (GFP)-encoding gene,
Antibody-hase nalysis. DNAs with different .methyl aiion levels are immunoprecipitaied by the 5-mC antibody. The precipitated DNA may be analyzed by PCR or pyro-sequencing to determine the relative methylation level.
Dot b lting. DNAs with different meihylation levels are loaded onto NC membranes in serial diluted amounts and cross-linked by UV. The membranes are hybridized with 5-mC antibody and exposed with X~Ray films. The strong dot signal indicates a strong methylati n level on the D A.
Scintillation coimting. autoradiography. A Scintillation counter is a common-used instrument thai can mesure ionizing radiation. A radioactive-labelled DNA, such as Ή or 5 C methylated DNA. is load into a container containig a scintillation cocktail. The radioactive signal is determined with a Scintillation, counter by detection of light emssion. in addition, radioactive-labelled DN A may be load into a gel or on a NC membrane, and exposed with an X-Ray film.
Liquid ch omaiography-hased analysis. The affinity of each deoxymtciesides (dC, dmC, dT, dG, and dA) to bind a C IS column is different. In this assay, DNA is degradated by DNasel and Nuclease P 1 to generate deoxynucleasides. The degradated mixture is subjected to an HPLC sy stem with a C- .1 8 column. After injection of the mixture, deoxynucleasides are eluted individually at different time points by a hydrophilic buffer.
Na htsulfite-hased analysis. D As wit different methylation levels are treated with Na- bisulfilte. The unmethylated cytosine is deaminated to uracil, but not the methylated DNA. The bisulfite treated DNAs are further amplified by PCR and sequenced by cloning, in the final sequence result the original un-methylated cytosine will present * ", and the original methylated cytosine will present "C". Based on this bisulfite-generated polymorphisms, the DNA methylation level can be analyzed by sequencing, PCR ampiiiication with site-specific primers, HRM (high resolution melt), restriction digestion (COBRA), non-denaturing gel(MS-SSCA), or MALDI-TOF.
The current study has revealed a totally unexpected characteristic of mammalian DN Ts, likely those of the vertebrates in general. That is. the vertebrate DNMTs, in addition lo converting C to 5- mC on DNA, can a!so actively demethviate 5-mC on DN A under specific conditions (FIGs. 1 and 2), in particular in the presence ofCa*'r ion and under non-redwing condition (F G. 3). in other words, the covalent addition of the methyl group to the C~5 position of cytokine on DNA, as catalyzed by DNMTs, is reversible {FIG. 4), The loss of the DNA demethyiation activities of the mutant forms in comparison to the wild type enzymes (FIG. .1 ) also suggests that each of the 3 DNMTs utilizes the same domai or overlapping domains to catalyticaJ!y methylate and demethylate D A.
Based on our data presented above, in particular the Caa~ dependence of the DNA demethyiation activities of the 3 DNMTs and in the porcine sperm nuclear extract we suggest that in addition to other pathways,, e.g. the conversion of 5-mC to 5-hmC by TET and 5-hmC to C by DNMT3A and DNMT3B, direct conversion of 5-mC to C by the active DNA demethyiation activities of the 3 DNMTs also play a major role in the genome-wide demethyiation during early embryonic development of the vertebrates.
In summary, we have discovered that the mammalian DNMT'l, DNMT3A, and DNMT3B. contrary to the conventional thought of their being mainly DNA methyitransferases, also act in vtiro as active DNA demethyfases in a Ca?* ion- and redox state-dependent manner.

Claims

CLAIMS at is claimed is:
A method for identifying a test agent as a modulator of the active DNA derneUrylation activity of a DNA methyl transferase, comprising:
a) providing a methylated DNA:
b) providing the DNA raethyliransferase;
c) allowing the methylated DN A to react with the DNA meth {transferase for a sufficient time to perform a demethylation reaction and generate a demethylated DNA product in the presence or absence of a test agent;
d) nalyzing the extent of demethylation: and
d) comparing the extents of the demethylation in the presence and absence of the test agent, and thereby identify the test agent as a modulator of the DNA demethylation activity of the
DN A methyltransferase ;
wherein the test agent is identified as an inhibitor of the active DNA demethylation activity of the DNA methyltransferase when the extent of the demethylation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethylation activity of the DNA methyl transferase when the extent of demethylation is more in the presence of the test agent
The method of claim 1 , wherein the analyzing step is performed by a technique selected from the group consisting of a restriction digestion-polymer chain reaction (PCR) assay, a hydrolysis-thin layer chromatography assay, an ami body-based analysis, scintillation, counting, autoradiography, dot blotting, a liquid chromatography-based anal sis, and a Na bisulfite-based analysis.
The method of claim L wherein the demethylation reaction occurs in. the presence of a calcium ion concentration of around 10 μ to 10 m'M.
The method of claim 1 , wherein the DNA methyltransferase is an isolated vertebrate DNA methy {transferase or a recombinant DNA methyltransferase, or is present in a nuclear extract or present in a cellular extract.
The method of claim 4, wherein the vertebrate DNA methy {transferase, the nuclear extract, or the cellular extract is prepared from cells selected from the group consisting of vertebrate cell cultures, vertebrate tissues, insect cells, worm ceils, insect tissues, worm tissues, plant cells, plant tissues, yeast ceils, and bacterial, cells.
'line method of claim 4. wherein the nuclear extract is a sperm extract.
The method of claim 1, wherein the methylated DNA comprises a labeled methyl group.
The method of claim 7, wherein the methyl group in the methylated DNA is radioactive- labeled.
The method of claim 1. wherein:
(a) the methylated D A provided in step (a) is a methylated reporter gene operabiy linked to a constitutive promoter and is present in a cell;
<b) the DNA methyltransferase provided in step (b) is operabSy linked to a constitutive promoter and is also present in the cell:
(c) the demethylated D A product generated in step (c) is a demethylated reporter gene, which expresses a reporter protein in the cell; and
(d) the analyzing step is performed by a technique selected from the group consisting of:
(i) analyzing the signal of the reporter protein encoded b the demethylaied reporter gene in the cell;
(ii) analyzing the reporter protein expression by Western blot; and
(hi) isolating the methylated and demethylated reporter gene and analyzing the extent of dememylalion by a restriction digestion-polymer chain reaction (PCR) assay, a hydrolysis- thin layer chromatography assay, an antibody -based analysis,, scintillation counting, autoradiography, dot blotting, a liquid chromatography-based analy sis, or a a bisulfite- based analysis.
The method of claim 9, wherein the methylated reporter gene and the DNA methyltramferase are present in the cell via transfection.
The method of claim 1 , wherein:
(a) the meth lated DNA provided in step ia) is a methylated reporter gene operabiy linked to a constitutive promoter and is present in a cell having an endogenous DNA memyltransferase
(b) the DNA methyltransferase provided in step (b) is endogenously present in the cell as the endogenous DNA raethyliraiisferase;
(c) the demethyl ted DNA product generated in step (c) is a derneihylated reporter gene, which expresses a reporter protein in the cell,
(d) the analyzing step is performed by a technique selected from the group consisting of. (i) anal zing the signal of the reporter protein encoded by the demethyiated reporter gene in the cell;
(ii) analyzing the reporter protein expression by Western blot; and
(iii) isolating the methylated and demethyiated reporter gene and analyzing the extent of demethyiation by a restriction digestion-polymer chain reaction (PC.R) assay, a hydrolysis- thin layer chromatography assay, an ami bod -based analysis, scintillation counting, autoradiography, dot blotting, a liquid chromatography-based analysis, or a Na bisulfite- based analysis.
12. A method as claimed in any one of claims 9 to 11, wherein the test agent is introduced into the eel! or added to a culture medium bathing the celi.
13. A method as claimed in any one of claims 9 to 1.1, wherein the methylated reporter gene comprises a DN A sequence of a gene selected from the group consisting of a fluorescent protein- encoding gene, a luciferase gene, a drug-resistant gene, and genes of cell survivals.
14. A method as claimed in any one of claims 1 to .1.1 , wherein the methylated DNA comprises 5- methylcytosine (SmC)-containing DNA.
15. A method as claimed in any one of claims I to 10, wherein the DNA methyl transferase is a modified form of a wild-type DNA raethy! transferase, said modified form retaining the active DNA demethyiation activity of the wild-type DNA methyltransferase.
.16. A method as claimed in any one of claims I to 11, wherein the DNA methyltransferase is selected from the group consisting of DNA methyltransferase 1 , DNA methyl transferase 3 A, DNA methyltransferase 38, and any combination thereof.
17. A method as claimed in any one of claims 9 to 1 L wherein the constitutive promoter is a cytomegalovirus promoter.
1.8. A method for identifying a test agent as a modulator of the active DNA demethyiation activi ty of a DNA methyltransferase, comprising:
(!)
a) admixing a first composition comprising a methylated DNA with a second composition comprising the DN A methyltransferase in the presence or absence of a test agent;
b) allowing a demethyiation reaction to occur by reacting the methylated DNA with the DNA methyltransferase for a sufficient time to generate a demethySaied DNA product
c) anaiyxina the extent of demethyiation; and d) comparing the extents of the demethyiation in the presence and absence of the test agent, and thereby identity the test agent for modulating active DNA demethyiation activity of the DNA methy 1 transferase;
wherein the test agent is identified as an inhibitor of the active DNA demethyiation activity of the DNA methyl transferase when the extent of the demethyiation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethyiation activity of the DNA methyltransferase when the extent of demethyiation is more in the presence of the test agent:
or
(II)
1 ) providing a cell culture medium containing cells transfecied with a reporter gene that is methylated and operably linked to a constitutive promoter, said cells containing an
endogenous DNA methyltransferase or exogenous.!}' expressing a wild-type, a modified or a genetically engineered DNA methyltransferase;
2) exposing the cells to a test agent;
3) allowing a demethyiation reaction to occur to generate a demethylated reporter gene, which expresses a reporter protein in the cells; and
4) analyzing the extent of demethyiation of the reporter gene by examining the signal intensity of the reporter protein expressed by the demethylated reporter gene in the cells:
5) comparing the extents of the demeth iation of the reporter gene in the presence and absence of the test agent and (hereby identify the test agent as a modulator of the DNA demethyjalion activity of the DNA methyltransferase;
wherein the test agent is identified as an inhibitor of the active DNA demethyiation activity of the DNA methyltransferase when the extent of the demethyiation is less in the presence of the test agent; or the test agent is identified as a stimulator of the active DNA demethyiation activity of the DNA methyltransferase when the extent of demethyiation is more in the presence of the test agent.
1 . The method of claim 18, wherein the wild-type DNA methyltransferase is selected from the group consisting of DNA methyltransferase 1 , DNA jnethyltransferase 3 A, and DNA
methyltransferase 3B.
20. A method as claimed in any one of claims I to 10, wherein step (c) is performed under a condition mat is free of a reducing agent or under a non-reducing condition.
PCT/US2013/074141 2012-12-12 2013-12-10 Dna 5-methyl cytosine demethylation activity of vertebrate dna methyltransferases Ceased WO2014093351A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201380063876.4A CN104919053B (en) 2012-12-12 2013-12-10 DNA 5‑methylcytosine demethylation activity of vertebrate DNA methyltransferases
US14/647,816 US9695463B2 (en) 2012-12-12 2013-12-10 DNA 5-methyl cytosine demethylation activity of vertebrate DNA methyltransferases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261736180P 2012-12-12 2012-12-12
US61/736,180 2012-12-12

Publications (1)

Publication Number Publication Date
WO2014093351A1 true WO2014093351A1 (en) 2014-06-19

Family

ID=50934896

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/074141 Ceased WO2014093351A1 (en) 2012-12-12 2013-12-10 Dna 5-methyl cytosine demethylation activity of vertebrate dna methyltransferases

Country Status (4)

Country Link
US (1) US9695463B2 (en)
CN (1) CN104919053B (en)
TW (1) TWI545322B (en)
WO (1) WO2014093351A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015073360A2 (en) * 2013-11-12 2015-05-21 New England Biolabs Inc. Dnmt inhibitors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060166909A1 (en) * 2002-06-20 2006-07-27 Moshe Szyf Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050003378A1 (en) * 2002-12-19 2005-01-06 Moshe Szyf Inhibitor of demethylase, antitumorigenic agent, and an in vitro assay for demethylase inhibitors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060166909A1 (en) * 2002-06-20 2006-07-27 Moshe Szyf Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Technical Bulletin: pC1 and pS1 Mammalian Expression Vectors. Instructions for Use Of Products E1721 And E1731.", PROMEGA, July 2009 (2009-07-01), Retrieved from the Internet <URL:https://www.promega.com/resources/protocols/technical-bulletins/0/pci-and-psi-mammalian-expression-vectors-protocol/>> *
CHEN, CC ET AL.: "The Mammalian de Novo DNA Methyltransferases DNMT3A and DNMT3B Are Also DNA 5-Hydroxymethylctosine Dehydroxymethylases.", J BIOL CHEM., vol. 287, no. 40, 16 August 2012 (2012-08-16), pages 33116 - 33121 *
JOST, JP ET AL.: "5-Methyideoxycytidine monophosphate Deaminase and 5-methylcytidyl-DNA Deaminase Activities Are Present In Human Mature Sperm Cells.", FEBS LETT., vol. 519, 22 May 2002 (2002-05-22), pages 128 - 134 *

Also Published As

Publication number Publication date
TWI545322B (en) 2016-08-11
CN104919053B (en) 2017-07-04
US20150315628A1 (en) 2015-11-05
US9695463B2 (en) 2017-07-04
CN104919053A (en) 2015-09-16
TW201441614A (en) 2014-11-01

Similar Documents

Publication Publication Date Title
Malley et al. A distinct region of the MGMT CpG island critical for transcriptional regulation is preferentially methylated in glioblastoma cells and xenografts
CN111328343B (en) RNA targeting methods and compositions
Richa et al. Hydroxymethylation of DNA: an epigenetic marker
JP4727149B2 (en) Method and apparatus for determining tissue specificity for free floating DNA in body fluids
Hesson et al. Frequent epigenetic inactivation of RASSF1A and BLU genes located within the critical 3p21. 3 region in gliomas
Bai et al. RETRACTED: DNA Methyltransferase 3b Regulates Nerve Growth Factor-Induced Differentiation of PC12 Cells by Recruiting Histone Deacetylase 2
WO2015167959A1 (en) Epigenetic modification of mammalian genomes using targeted endonucleases
CN107475366B (en) Composition for detecting diseases and kit and application thereof
HUE027240T2 (en) Improved method for bisulfite treatment
Kweon et al. Erasure of Tet-oxidized 5-methylcytosine by a SRAP nuclease
JP5431351B2 (en) Enzymes for amplifying and copying bisulfite modified nucleic acids
AU2005293703A1 (en) A method for the carry-over protection in DNA amplification systems targeting methylation analysis achieved by a modified pre-treatment of nucleic acids
Lalić et al. Disruption of macrodomain protein SCO6735 increases antibiotic production in Streptomyces coelicolor
Levy et al. Messenger RNA sequence complexity and homology in developmental stages of Drosophila
Vilain et al. DNA methylation and chromosome instability in breast cancer cell lines
Shen et al. Enzymatic analysis of Tet proteins: key enzymes in the metabolism of DNA methylation
US20260015677A1 (en) Methylation method
US20070292866A1 (en) Diagnosing human diseases by detecting DNA methylation changes
CN114555830A (en) Method for detecting target nucleic acid, method for detecting nucleic acid binding molecule, and method for evaluating nucleic acid binding ability
WO2014093351A1 (en) Dna 5-methyl cytosine demethylation activity of vertebrate dna methyltransferases
Braem et al. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus
Kim et al. MS2 labeling of endogenous beta-actin mRNA does not result in stabilization of degradation intermediates
Weinberger et al. Quantitation of Epstein–Barr virus mRNA using reverse transcription and real‐time PCR
KR20220096382A (en) Method and kits for detecting methylation of gene using non-methylation specific probe
Pawar et al. Pitfalls in mitochondrial epigenetics

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13861997

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14647816

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13861997

Country of ref document: EP

Kind code of ref document: A1