A GENETIC ASSAY TO DETERMINE PROGNOSIS IN
POLYCYTHEMIA VERA PATIENTS
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.
61/724,707, filed November 9, 2012, which is incorporated herein by reference in its entirety.
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with United States government support under
P01CA108671 awarded by the National Institutes of Health (NIH) and W81XWH-05- 1-0347 awarded by the Department of Defense (DOD). The U.S. government has certain rights in the invention. BACKGROUND
Polycythemia vera (PV) is a hematopoietic stem cell disorder characterized by the increased production of red cells, white cells and platelets and complicated by thrombotic and hemorrhagic events, extramedullary hematopoiesis, and
transformation to myelofibrosis or acute leukemia (AML), albeit at variable frequencies (FIG. 1) (Spivak, 2002), and many of these clinical features are shared in common with its companion myeloproliferative disorder, primary myelofibrosis (PMF). PV is unique since with phlebotomy alone its natural history can be measured in decades. However, not all PV patients enjoy substantial longevity or freedom from significant complications but, in contrast to PMF, no satisfactory clinical criteria exist for stratification with respect to the risk of disease transformation, and usually no cytogenetic or molecular markers predictive of disease transformation are present before the event (Gaidano et al, 1997). Although JAK2 V617F is expressed in both PV and PMF, these are stem cell disorders and hematopoietic stem cells are not dependent on this tyrosine kinase for either survival or proliferation (Spivak, 2010), nor has the extent of JAK2 V617F expression been useful for prognostic purposes
(Barbui et al, 201 1). Bone marrow transplantation is the only curative therapy for PV (Kerbauy et al, 2007) and pegylated interferon is the only drug that can induce a molecular remission, although not in all patients (Kiladjian et al., 2008). Both have
significant toxicities, while all chemotherapeutic drugs employed to suppress marrow and extramedullary hematopoiesis as supportive therapy can increase the rate of leukemic transformation ten-fold (Najean and Rain, 1997; Berk et al, 1981).
For many malignancies, gene expression profiling (GEP) has been a useful approach for risk stratifying cancer patients with a shared clinical or histologic phenotype (Radich et al, 2006), and for developing predictors of disease behavior irrespective of the clinical phenotype (Lenz et al, 2008).
SUMMARY
The presently disclosed subject matter provides a genetic assay and kits to determine the prognosis in Polycythemia Vera (PV) patients with an indolent form of PV. The presently disclosed assay involves measuring certain messenger RNAs (mRNAs) in blood cells. These mRNA levels are inserted into an algorithm that yields a predictive score of the risk of PV in the patient transforming from an indolent form to an aggressive form.
In one aspect, the presently disclosed subject matter provides a method for determining the likelihood of an indolent form of Polycythemia Vera (PV) transforming to an aggressive form of PV in a subject, the method comprising: (a) measuring the gene products of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9 in a biological sample comprising blood cells obtained from the subject; (b) making the following comparisons of the gene product levels measured in (a) and recording a score of 1 for a true result and a score of 0 for a false result: PCNA > IFI30; TSN > CTSA; SMC4 > CDKN1A; PCNA > CTTN; SON > CTTN; TIAl > MYL9; (c) adding the scores together to obtain an added score and calculating a ratio of the added score/6 to calculate a total score; and (d) using the total score to predict if the indolent form of PV in the subject is likely to transform to an aggressive form of PV in the subject. In some embodiments, the blood cells are white blood cells. In other embodiments, the blood cells are CD34+ cells.
Accordingly, in some aspects, a total score of 5/6 or 6/6 predicts that the indolent form of PV in a subject is likely to transform to an aggressive form of PV in a subject. In other aspects, a total score of less than 5/6 predicts that the indolent form of PV in a subject is not likely to transform to an aggressive form of PV in the subject.
In another aspect, the presently disclosed subject matter provides a diagnostic kit for determining whether an indolent form of PV in a subject is likely to transform to an aggressive form of PV, the kit comprising a means for measuring the gene product levels of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 and a set of instructions comprising an algorithm for predicting if the indolent form of PV in the subject is likely to transform to an aggressive form of PV.
Certain aspects of the presently disclosed subject matter having been stated hereinabove, which are addressed in whole or in part by the presently disclosed subject matter, other aspects will become evident as the description proceeds when taken in connection with the accompanying Examples and Figures as best described herein below.
BRIEF DESCRIPTION OF THE FIGURES
Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying Figures, which are not necessarily drawn to scale, and wherein:
FIG. 1 shows the natural history of PV as shown by the evolution of PV over time with transformation to myelofibrosis and acute leukemia in 273 PV patients;
FIG 2 shows quantitative real-time polymerase chain reaction (Q-RT-PCR) confirmation of PV CD34+ cell gene expression using the primers described in Table i ;
FIGS. 3A-3B show representative KEGG pathway analysis for: A) male and B) female patient groups;
FIG. 4 shows a representative Venn diagram of the genes differentially expressed by the 8 men and 1 1 women PV patients illustrating the number of genes concordantly differentially regulated by both sexes;
FIG. 5 shows a representative dendrogram and heat map for the unsupervised hierarchical clustering of the 19 PV patients using the 102 genes concordantly deregulated by both sexes. The green color bar indicates the normal controls; the blue and red color bars indicate the PV patients. For the heat map, red indicates decreased gene expression and green increased gene expression;
FIG. 6 shows a representative dendrogram and heat map for the supervised clustering of the 19 PV patients using 30 genes identified by top scoring pair analysis.
The blue color bar indicates the 12 PV patients with indolent disease and the red color bar the 7 PV patients with aggressive disease. For the heat map, red indicates decreased gene expression and green increased gene expression;
FIG. 7 shows a representative dendrogram and heat map for supervised clustering of the 19 PV patients in blue and the normal controls in red using 21 genes identified by top scoring pair analysis from the 102 core gene set; with the 21 genes the PV patients could be separated almost completely from the normal controls. For the heat map, red indicates decreased gene expression and green increased gene expression;
FIG. 8 shows a representative dendrogram and heat map for the unsupervised hierarchical clustering of the 19 PV patients using the 16 gene "stromal signature." The blue color bar indicates the indolent patient group and the red color bar aggressive patient group. For the heat map, red indicates decreased gene expression and green increased gene expression;
FIGS. 9A-9B show a representative KEGG pathway analysis for: A) indolent and B) aggressive patient groups;
FIG. 10 shows a representative test using standards for copy number calculations (absolute quantitation). Standard curves were based on log dilutions (lO^lO1) of plasmids containing targeted regions of known length of each gene. Copy numbers were determined using calculations based upon the assumption that the average weight of a base pair (bp) is 650 Daltons (g/mol). By utilizing Avogadro's number and converting grams to nanograms, the number of copies of plasmid per weight in ng was calculated by the equation: number of copies = (amount * 6.022 x 1023)/(length * 1 χ 109 * 650);
FIGS. 1 lA-1 IB show: A) ROC curve for the probability score assay using the test set and B) regression and correlation for the probability and clinical scores for the 30 PV patient test set; and
FIGS. 12A-12B show: A) serial probability scores over time in 5 PV patients, with none changing from an indolent to aggressive score; and B) serial probability scores over time in 2 PV patients with an indolent score, with progression to an aggressive score over time in association with leukocytosis and increasing splenomegaly in one, and transformation to acute leukemia in the other without any other clinical change.
DETAILED DESCRIPTION
The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying Figures, in which some, but not all embodiments of the presently disclosed subject matter are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated Figures. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims.
I. PREDICTIVE METHODS FOR PV TRANSFORMATION
PV is complicated by extramedullary hematopoiesis, myelofibrosis and acute leukemia. An explanation for this clinical phenotype was provided by the discovery of an activating mutation (V617F) in JAK2 (James et al, 2005), a tyrosine kinase utilized for signal transduction by the receptors for erythropoietin, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor and thrombopoietin. However, the same mutation occurs in essential thrombocytosis (ET) and primary myelofibrosis (PMF), diseases with overlapping phenotypes but distinctly different natural histories (Jones et al, 2005). While it is undisputed that JAK2 V617F can produce a myeloproliferative phenotype, how this mutation could be responsible for the pathogenesis of three different diseases is a conundrum not explainable by the JAK2 V617F allele burden since it overlaps substantially amongst them (Stein et al, 2010). Several lines of evidence suggest that additional genetic and epigenetic events are involved. For example, in PV and ET, gene expression in CD34+ marrow cells was not different in JAK2 V617F-positive and JAK2 V617F- negative patients (Berkofsky-Fessler et al, 2010; Catani et al, 2009), while PV clonal
granulocytes do not always express JAK2 V617F (Nussenzveig et al, 2007).
Furthermore, JAK2 V617F expression, regardless of its allelic burden, did not influence signal transduction in circulating PV CD34+ cells (Anand et al, 201 1). Finally, PV is more common in women (Stein et al, 2010; Ridell et al, 2000) in whom it presents earlier (Ranjan et al, 2013), more often with splenomegaly
(Videbaek, 1950), masked erythrocytosis (Lamy et al, 1997), hepatic vein thrombosis (Stein et al, 2011 ; Smalberg et al, 2012) and a lower JAK2 V617F neutrophil allele burden than men (Stein et al, 2010).
None of the observations should be surprising since myeloproliferative disorders (MPD) are hematopoietic stem cell disorders and animal studies indicate that, unlike committed erythroid and megakaryocyte progenitor cells, primitive hematopoietic stem cells do not require JAK2 or its primary substrate, STAT5, for either survival or self renewal. Further, clonal dominance is a characteristic feature of the MPD, but expansion of the involved JAK2 V617 CD34+ cell population occurs more slowly than that of committed hematopoietic progenitor cell populations, at a different rate in each of the MPD, and independently oiJAK2 V617F homozygosity. Importantly in this regard, clonal dominance at the CD34+ cell level correlated better with splenomegaly, leukocytosis and anemia than did the neutrophil JAK2 V17F allele burden and was disease-specific. Finally, gene expression studies of JAK2 V617F-positive PV CD34+ marrow cells indicated dysregulation oiJAK2- independent genes, while in ET, gene expression in CD34+ marrow cells did not differ between JAK2 V617F-positive and JAK2 V617F -negative ET patients.
Accordingly, to further define the molecular abnormalities in PV at the stem cell level, gene expression in circulating CD34+ cells from nineteen JAK2 V617F- positive PV patients controlling for gender as a possible confounder was examined. It was observed that CD34+ cell gene expression not only differed between the PV patients and the controls, but also differed between men and women patients. Based on these differences, 102 genes were identified that concordantly differentially regulated by both men and women, which likely represent a core set of genes involved in the pathogenesis of PV.
Using this gene set and several clustering algorithms, the nineteen patients could be separated into two groups that differed significantly with respect to hemoglobin level, thrombosis frequency, splenomegaly, splenectomy, chemotherapy
exposure, leukemic transformation and survival. One group had a more aggressive disease with a lower hemoglobin level, more thromboembolic events, larger spleens, a greater frequency of chemotherapy and splenectomy and a higher mortality rate despite having a JAK2 V617F allelic burden similar to the other group. Using a supervised approach, a 19 gene profile was defined, which also segregated the PV patients with aggressive disease from those with a more indolent phenotype with 100 % accuracy.
Based on these 19 genes, a smaller gene panel was derived consisting of the 10 genes (PCNA, IF130, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1 and MYL9) for establishing the probability that a PV patient has an aggressive or indolent form of the disease using Q-RT-PCR and scoring 1 for true and 0 for false. If PCNA
> IF30; TSN > CTSA; SMC4 > CDKN1A; PCNA > CTTN; SON > CTTN; and TIA1
> MYL9, the probability that the disease is aggressive is the total score/6. After developing absolute copy number standard Ct curves for the 10 genes, the behavior of this screen on the training set PV patients was verified.
Further, the predictability of the screen was tested using CD34+ cell RNA from twenty-three PV patients. The presently disclosed subject matter provides a molecular method for risk stratification in PV that reflects clinical phenotype and anticipates disease transformation with a high degree of certainty. The data herein indicate that it is now possible to use gene expression to identify those PV patients most likely to benefit from early institution of definitive therapy.
Accordingly, in some embodiments, the presently disclosed subject matter provides a method for determining the likelihood of an indolent form of Polycythemia Vera (PV) transforming to an aggressive form of PV in a subject, the method comprising: (a) measuring the gene products of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9 in a biological sample comprising blood cells obtained from the subject; (b) making the following comparisons of the gene product levels measured in (a) and recording a score of 1 for a true result and a score of 0 for a false result: PCNA > IFI30; TSN > CTSA; SMC4 > CDKN1A; PCNA > CTTN; SON > CTTN; TIAl > MYL9; (c) adding the scores together to obtain an added score and calculating a ratio of the added score/6 to calculate a total score; and (d) using the total score to predict if the indolent form of PV in the subject is likely to transform to an aggressive form of PV in the subject.
In such embodiments, a total score of 5/6 or 6/6 predicts that the indolent form of PV in a subject is likely to transform to an aggressive form of PV in the subject. A total score of less than 5/6 predicts that the indolent form of PV in a subject is not likely to transform to an aggressive form of PV in the subject.
The presently disclosed subject matter provides a 10 gene screening panel comprised of PCNA (proliferating cell nuclear antigen), TSN (translin), CDKN1A (cyclin-dependent kinase inhibitor 1A (p21, Cipl)), MYL9 (myosin, light chain 9, regulatory), IFI30 (interferon, gamma-inducible protein 30), CTSA (cathepsin A), SMC4 (structural maintenance of chromosomes 4), CTTN (cortactin), SON (SON DNA binding protein), and TIAl (TIA1 cytotoxic granule-associated RNA binding protein).
The biomarkers of the presently disclosed subject matter can be used in diagnostic tests to assess or determine whether an indolent form of PV in a patient will transform to an aggressive form of PV. In other embodiments, the biomarkers may be used to determine if a patient has PV.
The indolent form of PV is characterized by the unregulated production of red cells, white cells and platelets. PV patients afflicted with the indolent form of PV may be asymptomatic or may show milder symptoms of the disease. In contrast, patients with the aggressive form show more severe symptoms, such as thrombotic and hemorrhagic events, extramedullary hematopoiesis, myelofibrosis and acute leukemia, albeit at varying frequencies.
The blood cells can be obtained from different sources in a subject. In some embodiments, the biological sample comprises peripheral blood or bone marrow. In some embodiments, the blood cells are white blood cells. In other embodiments, the blood cells are CD34+ cells.
In some embodiments, the subject is mammalian. In other embodiments, the subject is human.
In further embodiments, the expression products of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9 are measured. In other embodiments, one or more of these expression products are substituted with other expression products that have both correlated expression and the same category of biological function.
In some embodiments, the expression products of the relevant genes are measured by determining RNA levels. In further embodiments, the expression products are measured by determining mRNA expression levels. Generally, in a first step, the total RNA is isolated from a biological sample. The methods for RNA extraction are well known in the art.
Methods for measuring mRNA levels include methods based on hybridization analysis of polynucleotides as well as methods based on sequencing of
polynucleotides. These methods include, but are not limited to, northern blotting, in situ hybridization, RNase protection assays, reverse transcription polymerase chain reaction (RT-PCR), real-time PCR (QPCR), antibodies that can recognize specific duplexes (DNA duplexes, RNA duplexes, DNA-RNA hybrid duplexes, DNA-protein duplexes, for example), sequence-based gene expression analysis including Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).
In some embodiments, the mRNA expression levels are measured by using reverse transcription PCR (RT-PCR). Commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers. The RT-PCR reaction reverse transcribes the RNA template into cDNA.
In still further embodiments, the mRNA expression levels are measured by using reverse transcription PCR (RT-PCR) followed by real-time PCR (Q-PCR). In the Q-PCR reaction, the cDNA produced from the RT-PCR is amplified and simultaneously quantified. The PCR step can use a variety of thermostable DNA- dependent DNA polymerases, such as Taq DNA polymerase, which has a 5 '-3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity. Two oligonucleotide primers are used to generate a PCR product. A third oligonucleotide, or probe, is designed to detect the PCR product.
Generally, primer design or determining which sequences to use for making a primer is well known in the art. Computer programs are available to determine if a set of nucleotides in a polynucleotide is optimal for initiating a PCR reaction.
Therefore, different primers can be used to initiate a PCR reaction and to detect a specific gene product. As such, the expression products of the presently disclosed
subject matter can be detected using different primers and the presently disclosed subject matter is not limited to a specific set of primers.
In other embodiments, the expression products of PCNA, IFI30, TSN, CTSA, SMC4, CDK IA, CTTN, SON, TIAl, and MYL9 are measured by determining protein expression levels. Examples of detection methods for proteins include, but are not limited to, immunohistochemical assays, Western blot analyses, ELISAs, polyacrylamide gels, and protein activity assays. Other detection methods are well known in the art and include methods that are not and need not be stated here.
In some embodiments, the expression products are expression products of variants or fragments of PCNA, IFI30, TSN, CTSA, SMC4, CDKNIA, CTTN, SON, TIAl, or MYL9. Therefore, a gene or gene product comprising variants of polynucleotides according to the presently disclosed subject matter include, but are not limited to, nucleotide sequences which are at least 70% identical, e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of PCNA, IFI30, TSN, CTSA, SMC4, CDKNIA, CTTN, SON, TIAl, or MYL9may be substituted for PCNA, IFI30, TSN, CTSA, SMC4, CDKNIA, CTTN, SON, TIAl, or MYL9. In other embodiments, more than one gene may be substituted.
The biological samples used to obtain the RNA of the relevant genes can be any part of a subject that comprises blood cells. In some embodiments, the biological sample comprises peripheral blood or bone marrow. In other embodiments, the biological sample comprises blood cells that are white blood cells. In still other embodiments, the biological sample is comprised of unpurified white blood cells. In further embodiments, the biological sample is comprised of CD34+ cells isolated from unpurified circulating white blood cells. In still further embodiments, circulating CD34+ cells are quantitated clinically by flow cytometry in a pretest step.
In some embodiments, the RNA from a subject is not purified before being used in the presently disclosed methods. In other embodiments, total RNA, such as from unseparated peripheral blood mononuclear cells or from isolated neutrophils, is used in the presently disclosed assays without being purified. In the former case, with respect to the issue of sample dilution and assay sensitivity, the rate limiting step would still be the number of circulating CD34+ cells.
The indolent form of PV in a subject is characterized by many symptoms, both general and specific for the disease. A particular subject may have one or more than one of the symptoms. In some embodiments, the indolent form of PV is characterized by at least one of symptom selected from the group consisting of increased production of red cells, increased production of white cells, increased production of platelets, itching, gouty arthritis peptic ulcer disease, enlarged liver or spleen, elevated hemoglobin levels, and low erythropoietin levels in a subject.
The aggressive form of PV in a subject is generally characterized by more serious symptoms, some of which are life threatening. In some embodiments, the aggressive form of PV is characterized by at least one symptom selected from the group consisting of thrombosis, heart attack, stroke, Budd-Chiari syndrome, myelofibrosis and acute leukemia (AML) in a subject.
PV is chronic disorder, which has a very variable clinical course depending on the host response to the malignant clone (Spivak, 2002). In many patients, the disease remains indolent with only a requirement for phlebotomy therapy to control red cell mass expansion and prevent thrombotic events. In other patients, there is inexorable expansion of the malignant clone with massive splenomegaly for which the treatment options include bone marrow transplantation, interferon or potentially leukemogenic chemotherapy, of which the latter is at best palliative and may actually shorten survival (Berk et al, 1981 ; Gruppo, 1995). To date, there is no way to anticipate how the disease will evolve clinically. However, the presently disclosed methods can anticipate disease transformation and, based on this, are useful for determining which PV patients would most benefit from the institution of definitive therapy, such as interferon or bone marrow transplantation before clonal expansion is too far advanced. Currently the only curative therapy for PV is bone marrow transplantation and the only therapy capable of inducing molecular remission is pegylated interferon, both of which have significant toxicities. All chemotherapeutic drugs used to
suppress marrow and extramedullary hematopoiesis increase the basal rate of leukemic transformation ten- fold or greater. For example, despite the lack of evidence-based data (Spivak, 2002; Spivak and Hasselbalch, 201 1), hydroxyurea is considered to be the first-line drug of choice for PV management, particularly in patients older than 65 years of age (Barbui et al, 201 1). Unfortunately, hydroxyurea is leukemogenic (Najean and Rain, 1997; Kiladjian et al, 201 1) and both age over 60 (McNally et al, 1997) and PV predispose to acute leukemia (Berk et al, 1981), creating a triply dangerous situation for older PV patients since, in contrast to sickle cell disease, a nonclonal disorder in which hydroxyurea improves survival, hydroxyurea neither prevents major vessel arterial or venous thrombosis (Harrison et al, 2005) nor improves survival in PV (Najean and Rain, 1997). Therefore, the presently disclosed methods, which identify PV patients with nonaggressive disease can improve patient safety as well as reduce drug costs. In this regard, the presently disclosed methods can also be used to screen patients for the appropriate use of ruxolitinib when that drug is approved for therapy in PV. Thus, a method to predict transformation risk is very useful to avoid unnecessary exposure to toxic therapies. In some embodiments, the presently disclosed methods are used more than once with a patient to follow PV in the patient. For example, the assay can be used for the first time as a baseline test and then can be used longitudinally as clinically indicated by a rising leukocyte count or advancing splenomegaly, two signs of potentially aggressive behavior in PV. In other embodiments, the presently disclosed methods display a sensitivity of at least 80% and a specificity of at least 90%. In some embodiments, the method further comprises informing the subject or a treating physician of the likelihood of the indolent form of PV transforming to an aggressive form of PV in the subject. In other embodiments, the method is used to determine if a subject should undergo further therapy for PV. In still other embodiments, the method further comprises treating the patient with further therapy for PV. In further embodiments, the therapy is selected from the group consisting of bone marrow transplantation, pegylated interferon, chemotherapy, and ruxolitinib.
II. KITS FOR PREDICTING PV TRANSFORMATION
The presently disclosed subject matter also relates to kits for determining if the indolent PV in a subject will transform to an aggressive form of
PV. In general, a presently disclosed kit contains some or all of the components, reagents, supplies, and the like to practice a method according to the presently disclosed subject matter. In some embodiments, the term "kit" refers to any intended any article of manufacture (e.g., a package or a container) comprising a means for detecting the gene products of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 and a set of particular instructions for practicing the methods of the presently disclosed subject matter. In other embodiments, the set of particular instructions includes the algorithm for predicting whether the indolent PV in a subject will transform to aggressive PV. In some embodiments, the kit comprises components that detect the levels of RNA transcripts, such as mRNA transcripts. For example, the kit may comprise the primers necessary to detect the mRNA levels of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9, the enzymes necessary to perform reverse transcription and PCR amplification, such as a polymerase and a reverse transcriptase, deoxynucleotides, and a buffer. In other embodiments, the kit comprises components that detect the protein expression levels of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9. The kit provided may be an ELISA kit comprising antibodies to the biomarkers of the presently disclosed subject matter. In still other embodiments, the kit is a diagnostic kit that determines whether an indolent form of PV in a subject is likely to transform to an aggressive form of PV, the kit comprising a means for measuring the gene product levels of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIAl, and MYL9 and a set of instructions comprising an algorithm for predicting if the indolent form of PV in the subject is likely to transform to an aggressive form of PV. III. DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs.
As used herein, the term "biomarker" refers to any gene, RNA or protein whose level of expression in a cell or tissue is altered in some way compared to that of a normal or healthy cell or tissue. In some embodiments, the amount of biomarker may be changed. In other embodiments, the biomarker may be differentially modified
in some way. Biomarkers of the presently disclosed subject matter are selective for PV.
As used herein, the term "level of expression" of a biomarker refers to the amount of biomarker detected. Levels of biomarker can be detected at the transcriptional level, the translational level, and the post-translational level, for example. "mRNA expression levels" refers to the amount of mRNA detected in a sample and "protein expression levels" refers to the amount of protein detected in a sample.
As used herein, the term "microarray" refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate.
As used herein, the term "polynucleotide" generally refers to any
polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
As used herein, the term "oligonucleotide" refers to a relatively short polynucleotide. This includes, without limitation, single-stranded
deoxyribonucleotides, single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs.
As used herein, the term "gene product" refers to biochemical material, such as RNA or protein, resulting from expression of a gene. A measurement of the amount of gene product is sometimes used to infer how active a gene is at a particular time.
The term "percent identity," as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux,
J., eds.) Stockton Press, New York (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences may be performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5: 151-153) with the default parameters, including default parameters for pairwise alignments. Useful examples of percent sequence identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any of the sequence analysis software described herein.
The term "sequence analysis software" refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. "Sequence analysis software" may be commercially available or independently developed. Typical sequence analysis software will include but is not limited to the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.), BLASTP, BLASTN, BLASTX (Altschul et al. (1990) J. Mol. Biol. 215:403-410, and DNASTAR (DNASTAR, Inc., Madison, Wis.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified. As used herein "default values" will mean any set of values or parameters which originally load with the software when first initialized.
The term "primer" denotes a specific oligonucleotide sequence which is complementary to a target nucleotide sequence and used to hybridize to the target nucleotide sequence. A primer serves as an initiation point for nucleotide
polymerization catalyzed by DNA polymerase, RNA polymerase, or reverse transcriptase.
The term "probe" denotes a defined nucleic acid segment which can be used to identify a specific polynucleotide sequence present in samples, wherein the nucleic acid segment comprises a nucleotide sequence complementary to the specific polynucleotide sequence to be identified.
The terms "complementary" or "complement thereof are used herein to refer to the sequences of polynucleotides that are capable of forming Watson & Crick base pairing with another specified polynucleotide throughout the entirety of the complementary region. For the purpose of the presently disclosed subject matter, a first polynucleotide is deemed to be complementary to a second polynucleotide when each base in the first polynucleotide is paired with its complementary base.
Complementary bases are, generally, A and T (or A and U), or C and G.
"Complement" is used herein as a synonym from "complementary polynucleotide," "complementary nucleic acid" and "complementary nucleotide sequence". These terms are applied to pairs of polynucleotides based solely upon their sequences and not any particular set of conditions under which the two polynucleotides would actually bind.
The terms "base paired" and "Watson & Crick base paired" are used interchangeably herein to refer to nucleotides which can be hydrogen bonded to one another by virtue of their sequence identities in a manner like that found in double- helical DNA with thymine or uracil residues linked to adenine residues by two hydrogen bonds and cytosine and guanine residues linked by three hydrogen bonds (See Berg et al. (201 1) Biochemistry, 7th revised international ed., ISBN- 10: 1429276355).
Variants of polynucleotides, as the term is used herein, are polynucleotides that differ from a reference polynucleotide. A variant of a polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally. Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms. Generally, differences are limited so that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.
A polynucleotide fragment refers to a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over the common portion, a nucleotide sequence identical to the reference nucleic acid. Such a nucleic acid fragment according to the presently disclosed subject matter may be, where appropriate, included in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length
from at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80, 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the presently disclosed subject matter.
Such fragments may be "free-standing," i.e. not part of or fused to other polynucleotides, or they may be comprised within a single larger polynucleotide of which they form a part or region. Indeed, several of these fragments may be present within a single larger polynucleotide.
The term "predictive" or "predictability" is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to therapy. Therapy includes, but is not limited to, drugs, surgical intervention, chemotherapy, radiation therapy, and bone marrow transplants.
As used herein, the terms "treat," "treating," "treatment," and the like, are meant to decrease, suppress, attenuate, diminish, arrest, the underlying cause of a disease, disorder, or condition, or to stabilize the development or progression of a disease, disorder, condition, and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disease, disorder or condition does not require that the disease, disorder, condition or symptoms associated therewith be completely eliminated.
As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment" and the like refer to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.
As used herein, the term "diagnosing" refers to the process of attempting to determine or identify a disease or disorder.
As used herein, the term "comparing" refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of the corresponding one or more biomarkers in a standard or control sample. For example, "comparing" may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, or different from the proportion, level, or cellular localization of the corresponding one or more biomarkers in standard or control sample. More
specifically, the term may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, different from or otherwise corresponds (or not) to the proportion, level, or cellular localization of predefined biomarker levels that correspond to, for example, a patient having an indolent form of PV that is likely to transform to an aggressive form of PV, not having an indolent form of PV that is likely to transform to an aggressive form of PV, is responding to treatment for PV, is not responding to treatment for PV, is/is not likely to respond to a particular PV treatment, or having /not having another disease or condition. In a specific embodiment, the term
"comparing" refers to assessing whether the level of one or more biomarkers of the presently disclosed subject matter in a sample from a patient is the same as, more or less than, different from other otherwise correspond (or not) to levels of the same biomarkers in a control sample (e.g., predefined levels that correlate to uninfected individuals, standard PV levels, and the like).
As used herein, the term "transform" means that the condition that is being transformed changes in some way. For example, the indolent form of PV can change to the aggressive form of PV.
As used herein, the terms "indicates" or "correlates" (or "indicating" or "correlating," or "indication" or "correlation," depending on the context) in reference to a parameter, e.g., a modulated proportion, level, or cellular localization in a sample from a patient, may mean that the patient has an indolent form of PV that is likely to transform to an aggressive form of PV. In specific embodiments, the parameter may comprise the level of one or more biomarkers of the presently disclosed subject matter. A particular set or pattern of the amounts of one or more biomarkers may indicate that a patient has an indolent form of PV that is likely to transform to an aggressive form of PV (i.e., an indolent form of PV that is likely to transform to an aggressive form of PV). In other embodiments, a particular set or pattern of the amounts of one or more biomarkers may be correlated to a patient being unaffected (i.e., indicates a patient does not have an indolent form of PV that is likely to transform to an aggressive form of PV). In certain embodiments, "indicating," or "correlating," as used according to the presently disclosed subject matter, may be by any linear or non-linear method of quantifying the relationship between levels of biomarkers to a standard, control or comparative value for the assessment of the
diagnosis, prediction of PV progression or transformation, assessment of efficacy of clinical treatment, identification of a patient that may respond to a particular treatment regime or pharmaceutical agent, monitoring of the progress of treatment, and in the context of a screening assay, for the identification of an anti-PV therapeutic.
The terms "patient," "individual," or "subject" are used interchangeably herein, and refer to a mammal, particularly, a human. A "subject" can include a patient afflicted with or suspected of being afflicted with a condition or disease. The patient may have mild, intermediate or severe disease. The patient may be treatment naive, responding to any form of treatment, or refractory. The patient may be an individual in need of treatment or in need of diagnosis based on particular symptoms or family history. In some cases, the terms may refer to treatment in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects.
As used herein, the term "subject at risk" of getting a disease refers to estimating that a subject will have a disease or disorder in the future based on the subject's current symptoms, family history, lifestyle choices, and the like.
As used herein, the term "disease" refers to any condition, dysfunction or disorder that damages or interferes with the normal function of a cell, tissue, or organ.
The term "training set" refers to a group of patients that is used to develop the assay. The testing set is a different group of patients with the same disease used to validate the assay (i.e. reproduce the results).
The terms "measuring" and "determining" are used interchangeably throughout, and refer to methods which include obtaining a patient sample and/or detecting the level of a biomarker(s) in a sample. In one embodiment, the terms refer to obtaining a patient sample and detecting the level of one or more biomarkers in the
sample. In another embodiment, the terms "measuring" and "determining" mean detecting the level of one or more biomarkers in a patient sample. Measuring can be accomplished by methods known in the art and those further described herein. The term "measuring" is also used interchangeably throughout with the term "detecting." As used herein, the term "indicative" or "likely" means that the event referred to is probable. For example, if the methods of the presently disclosed subject matter result in a conclusion that the indolent form of PV in a subject is likely to
transforming to an aggressive form of PV in the subject, then that means it is probable that the indolent form of PV in the subject will transform to an aggressive form of PV.
The terms "sample," "patient sample," "biological sample," and the like, encompass a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic or monitoring assay. The patient sample may be obtained from a healthy subject, a diseased patient or a patient having associated symptoms of PV. Moreover, a sample obtained from a patient can be divided and only a portion may be used for diagnosis. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis. The definition specifically encompasses blood and other liquid samples of biological origin
(including, but not limited to, peripheral blood, serum, plasma, cerebrospinal fluid, urine, saliva, stool and synovial fluid), solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. In a specific embodiment, a sample comprises a blood sample. In another embodiment, a serum sample is used. The definition also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations. The terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by immunohistochemistry.
Various methodologies of the instant invention include a step that involves comparing a value, level, feature, characteristic, property, and the like, to a "suitable control," referred to interchangeably herein as an "appropriate control" or a "control sample." A "suitable control," "appropriate control" or a "control sample" is any
control or standard familiar to one of ordinary skill in the art useful for comparison purposes. In one embodiment, a "suitable control" or "appropriate control" is a value, level, feature, characteristic, property, and the like, determined in a cell, organ, or patient, e.g., a control or normal cell, organ, or patient, exhibiting, for example, normal traits. For example, the biomarkers of the presently disclosed subject matter may be assayed for levels in a sample from an unaffected individual (UI) or a normal control individual (NC) (both terms are used interchangeably herein). In another embodiment, a "suitable control" or "appropriate control" is a value, level, feature, characteristic, property, and the like, determined prior to performing a therapy (e.g., a PV treatment) on a patient. In yet another embodiment, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, and the like, can be determined prior to, during, or after administering a therapy into a cell, organ, or patient. In a further embodiment, a "suitable control" or "appropriate control" is a predefined value, level, feature, characteristic, property, and the like. A "suitable control" can be a profile or pattern of levels of one or more biomarkers of the presently disclosed subject matter that correlates to the presence of an indolent form of PV that is likely to transform to an aggressive form of PV, to which a patient sample can be compared. The patient sample can also be compared to a negative control, i.e., a profile that correlates to not having an indolent form of PV that is likely to transform to an aggressive form of PV.
Following long-standing patent law convention, the terms "a," "an," and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a subject" includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth.
Throughout this specification and the claims, the terms "comprise,"
"comprises," and "comprising" are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term "include" and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items.
For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, parameters, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as
being modified in all instances by the term "about" even though the term "about" may not expressly appear with the value, amount or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and/or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term "about," when referring to a value can be meant to encompass variations of, in some embodiments, ± 100% in some embodiments ± 50%, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ±1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions.
Further, the term "about" when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range.
EXAMPLES
The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods.
EXAMPLE 1
Methods
The study protocol was approved by the Johns Hopkins University
Institutional Review Board and written informed consent was obtained from each patient in accordance with the Helsinki Declaration. Patients were undergoing diagnostic or therapeutic phlebotomy. The diagnosis of PV was based on the Polycythemia Vera Study Group criteria (Wasserman, 1971). Patient accrual was solely predicated on obtaining sufficient peripheral blood CD34+ cells for analysis. Clinical data including cell counts, spleen size, history of thromboembolic events, chemotherapy and splenectomy were extracted from patient medical records at study entry and termination. Splenomegaly was considered present if the spleen was palpable on physical examination and is reported as centimeters (cm) below the left costal margin.
Neutrophil isolation and DNA preparation were performed as described previously (Williams et al, 2007). Peripheral blood CD34+ cells from PV patients were isolated from Ficoll Paque-processed buffy coats (G5 Healthcare, St. Louis, MO) with a purity of greater than 95 % and a viability of 98 % using
immunomagnetic beads (Miltenyi, Auburn, CA) according to the manufacturer's instructions, and frozen at -80 °C in 10 % DMSO and 90 % FBS until studied.
The CD34+ cells were analyzed for CD34, CD38, CD33, CD41 and glycophorin expression using commercially available fluorescent-labeled antibodies. Fluorescence of at least 10,000 cells was measured on a FACS Caliber and analyzed with Cellquest and Paint-a-gate software (BD Biosciences, San Jose, CA). Similar to published reports of the peripheral blood CD34+ cell immunophenotype in normal individuals and MPD patients, CD34+ cells from both sources were greater than 98% CD38-positive and 85 % CD33 -positive; CD41 was expressed on less than 3 % of CD34+ cells from both sources, while glycophorin was not expressed by either CD34+ cell population. Cell cycle analysis by flow cytometry using propidium iodide revealed that 91 % of the PV and 90 % of the mobilized normal CD34+ cells were in Go/Gi (data not shown).
JAK2 V617F analysis was performed using an allele-specific, quantitative real-time PCR assay sensitive to 5% of either the wild-type or mutant allele (Stein et al, 2010).
For CD34+ cell isolation and analysis, peripheral blood CD34+ cells from PV patients were isolated from Ficoll Paque (G5 Healthcare, St. Louis, MO)-processed buffy coats with a purity of greater than 95 % and a viability of 98 % using immunomagnetic beads (Miltenyi, Auburn, CA) according to the manufacturer's instructions, and frozen at -80 °C in 10% DMSO and 90% fetal bovine serum until studied. As controls, G-CSF mobilized peripheral blood CD34+ cells from three normal men and three normal women were obtained from commercial sources (AllCell Technologies LLC, Chicago, IL and StemCell Technologies Inc, Vancouver, BC).
The CD34+ cells were analyzed for CD34, CD38, CD33, CD41 and glycophorin expression using commercially available fluorescent-labeled antibodies (Becton Dickinson, San Jose CA). Fluorescence of at least 10,000 cells was measured on a FACS Caliber and analyzed with Cellquest and Paint-a-gate software (BD Biosciences, San Jose, CA). Similar to published reports of the peripheral blood CD34+ cell immunophenotype in normal individuals and MPD patients (Barosi et al, 2001 ; Andreasson et al, 1997), CD34+ cells from both sources were greater than 98% CD38-positive and 85 % CD33 -positive; CD41 was expressed on less than 3% of CD34+ cells from both sources, while glycophorin was not expressed by either CD34+ cell population. Cell cycle analysis by flow cytometry using propidium iodide revealed that 91 % of the PV and 90% of the mobilized normal CD34+ cells were in Go/Gi (data not shown).
Total CD34+ cell RNA was isolated by the R easy technique (Qiagen, Valencia, CA) with an added DNAse step according to the manufacturer's instructions. To confirm sample quality, duplex RT-PCR was employed to assess RNA integrity (Sugita et al, 2001), and the Agilent Bioanalyzer Lab on a Chip
(Agilent Technologies, Inc., Santa Clara, CA ) was used to confirm that all samples had an optimal rRNA ratio (1 :2, for 18S and 28S, respectively), and clean run patterns before microarray analysis.
For oligonucleotide microarray analysis, total RNA samples were processed using the Affymetrix two-round RNA amplification protocol (Affymetrix, Santa
Clara, CA). Briefly, lOOng of starting total RNA were used to synthesize first strand cDNA using oligonucleotide probes with 24 oligo-dT plus T7 promoter as primer (Proligo LLC, Boulder, CO ), and the Superscript Choice System (Invitrogen,
Carlsbad, CA). Following the double stranded cDNA synthesis, the product was purified by Affymetrix sample clean up columns, and unlabeled ribonucleotides were used in a first round of in vitro transcription cRNA amplification (MegaScript, Ambion, Austin, TX). The following cycle of cDNA synthesis was started with random primers, and the oligo-dT with T7 promoter was again used as primer at the second strand cDNA synthesis step. The ds cDNA product was again column purified. Subsequently, biotinylated anti-sense cRNA was generated through in vitro transcription using the BioArray RNA High Yield Transcript Labeling kit (ENZO Life Sciences Inc, Plymouth Meeting, PA). 15ug of the biotinylated labeled cRNA was fragmented at 94°C for 35 min (lOOmM Tris-acetate, pH 8.2, 500mM KOAc, 150mM MgOAC), and lOug of total fragmented cRNA was hybridized to the Affymetrix human genome GeneChip array U133A for 16 hr at 45°C with constant rotation (60 rpm). The Affymetrix Fluidics Station 450 was then used to wash and stain the chips, remove the non-hybridized target and incubate with a streptavidin- phycoerythrin conjugate to stain the biotinylated cRNA. The staining was amplified using goat IgG as blocking reagent and biotinylated goat streptavidin antibody, followed by a second staining step with a streptavidin-phycoerythrin conjugate.
Fluorescence was detected using the Affymetrix GS3000 GeneArray Scanner and image analysis of each GeneChip was done with the GeneChip Operating System software from Affymetrix (GCOS 1.1.1), using the standard default settings. For comparison between different chips, global scaling was used, scaling all probe sets to a user-defined target intensity of 150. To assess the QC of the hybridization, chip image, and comparison between chips, the following parameters were studied: the scaling factor, related to the overall intensity of the chip, to confirm the similar signal intensity and staining throughout the samples; background estimation of nonspecific or cross-hybridization; percentage of transcripts that were considered significantly hybridized to the chip (present) by the algorithm; RNA integrity by measurement of the ratio of 3' to 5' regions for the housekeeping gene GAPDH, since its presence in the chip and a ratio close to 1 indicates good integrity of the target sample; spikes (BioB/BioC), to confirm the detection level and sensitivity after hybridization.
To assess quality control between replicates, the percentage of differential calls (up or down regulated) was analyzed between pair-wise comparisons, and scatter plot analyses from the different replicates was also conducted to demonstrate
reproducibility amongst the experiments. Consistently, the Pearson's correlation coefficients obtained in these studies were between 0.80 and 0.95 for different comparative analyses, and between 0.97 and 0.99 for all duplicate samples. The differences in gene expression associated with RNA amplification as opposed to the analysis of unamplified RNA were also assessed because of the difficulty in obtaining sufficient CD34+ cell RNA for microarray analysis. The results of this analysis indicated that 72% of the present calls were conserved following amplification.
Using the default algorithms for image analysis provided by Affymetrix, approximately 30%-45% of genes represented in the chips were recorded as present in the RNA samples, indicating good quality data. To achieve gene expression signal intensity estimates with a higher precision and a lower false discovery rate (FDR) in differential gene expression analysis, RMA (Robust Multiarray Analysis) was used to improve the Affymetrix default algorithms. RMA also performs quantile
normalization to reduce the obscuring variation between microarrays, which might be introduced during the processes of sample preparation, manufacture, fluorescence labeling, hybridization and scanning. With the expression signals estimated as above, a parametric empirical Bayes statistical modeling method, which uses a hierarchical mixture model to account for differences amongst genes in their average expression levels and measurement fluctuations, was employed for differential gene expression analysis between the PV samples and the normal controls. Based on this method, posterior probabilities were obtained, from which inferences regarding differential expression patterns could be made. Specifically, the standard rule of a posterior probability of >0.5 was taken to assert significance in differential gene expression and minimize the false discovery rate.
For Q-RT-PCR validation of the microarray results, additional CD34+ cell samples were analyzed from a subset of the patients by real-time PCR (Q-RT-PCR) without prior RNA amplification. For the mRNA transcripts, first-strand cDNA synthesis was carried out on RNA extracted from the cells with the TaqMan Reverse Transcription Reagents kit (Applied Biosystems, Carlsbad, CA) using the oligo d (T)i6 RT primer following the manufacturer's suggested protocol. To quantitate miR- 21 expression, CD34+ cell RNA was isolated using the mirVana miRNA Isolation Kit (Applied Biosystems) following the manufacturer's procedure for total RNA isolation. The TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems)
was used as directed to generate cDNA. Q-RT-PCR was carried out using the gene expression GEX or microRNA assays (Applied Biosystems) listed in Table 1.
Duplicate 20 μΐ reactions were set up using the TaqMan® Universal PCR Master Mix, No AmpErase® UNG (2X), and performed on an Applied Biosystems 7500 sequence detection system using the default "standard 7500" PCR conditions (95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute). For each GEX primer/probe set, a standard curve with known relative concentrations of RNA from either a patient or normal control sample was used to calculate reaction efficiency and quantitate the reaction products. GAPDH reactions were run in parallel samples on the same assay plate. All the GEX Q-RT-PCR results were calculated using the "Standard Curve Assay" program of the 7500 SDS system (Applied Biosystems) and normalized to the GAPDH (glyceraldehyde-3 -phosphate dehydrogenase) and the data are shown in FIG. 2. For the miR-21 primer/probe set, relative quantitation using the AACT calculation method was utilized rather than a standard curve. U6 RNA was the reference RNA.
For supervised analysis, EBarrays analysis was performed for male and female patients separately. The 549 probes that showed a posterior probability greater than 0.5 of differential expression between aggressive and indolent phenotypes in both male and female patients were retained for further analysis. Further analysis of these 549 probes included both genders.
Top-scoring pair analysis (Tan et al, 2005) was run on the 549 probes and the top 30 top-scoring pairs (TSPs) were retained. As some genes had duplicate probes, the R limma package was used, an empirical Bayes test was applied to this data (now both genders), and the highest scoring probe for each gene was retained. The list of TSPs was sorted by the average difference between aggressive and indolent phenotype for that TSP and the six best TSPs were retained. The validation cohort was analyzed using Q-RT-PCR with probes designed to the genes in the retained TSPs. ROC analysis was performed. The AUC for all cases was 0.94, while the AUC excluding AML cases was 0.925. The best point for calls in both cases was setting the call of aggressive phenotype at 5 positive TSP calls, with sensitivity of 0.9 and 0.875 and specificity of 1.0 and 1.0, respectively. The PPV at this threshold was 1.0 in both cases, and the NPV was 0.95 in both cases. A similar approach was used for the supervised analysis of the 19 PV patients and the 6 normal controls.
Gene annotations were developed by collating data from the following data bases: OMIM, Gene, KEGG, AceView, GO Ontology and IPA (Ingenuity Systems, Redwood City, CA). The microarray data were deposited in the Gene Expression Omnibus MIAME compliant database (Series number GSE47018) (Edgar et al, 2002).
EXAMPLE 2
Characteristics of Patients
The clinical features of the 19 patients are listed in Tables 2 and 3. Median age and disease duration were not different between the men and women. All patients expressed JAK2 V617F and the median neutrophil allele burdens in men (94 %) and women (100%) were also similar; in 13, the median CD34+ cell JAK2 V617F allele burden was 82% (range 50 -100%, data not shown), indicating clonal dominance at both the progenitor cell and neutrophil levels (Moliterno et al, 2008; Stein et al., 2011). The two groups differed significantly (p = 0.016) only with respect to their platelet counts, with men having a lower median platelet count (421,000 x 103/μΕ) than the women (948,000 x 103/μΕ), which may reflect a gender-related difference (Segal and Moliterno, 2006). EXAMPLE 3
Gene Expression in Men and Women Patients
Given the differences in disease behavior between men and women PV patients, it was hypothesized that there could be gender-specific differences in gene expression independent of JAK2 V617F expression. Therefore, patient gene expression was compared with controls of the corresponding gender and it was found that there was differential gene expression in women patients compared to men, with 251 genes differentially regulated (126 up and 109 down) in women (Table 4) compared to 535 genes (486 up and 85 down) in the men (Table 5). Despite a smaller number of deregulated genes, KEGG analysis revealed that over three times as many molecular pathways were activated in the women patients, including one, the pentose phosphate pathway, which was not activated in any male patient (FIGS. 3A-3B).
EXAMPLE 4
Identification of Concordantly Deregulated Genes by the Men and Women
Patients
Subtracting genes whose expression was gender-specific left 102 genes (68 up regulated and 34 down regulated), whose differential expression was concordant in both men and women (FIG. 4), and could represent a core set of genes involved in the pathogenesis of PV. Gene expression was validated for 8 of the 102 genes by Q-RT- PCR (Table 1) using CD34+ cells from a subset of the patients, and there was good correlation between the observed microarray gene expression changes and the Q-RT- PCR measurements (FIG. 2).
EXAMPLE 5
Unsupervised Hierarchical Clustering using the 102 Concordantly Deregulated Genes
Unsupervised hierarchical clustering was employed to determine if the 102 core gene set segregated the PV patients from the normal controls. As shown in FIG. 5, the PV patients clustered into two distinct groups, one of which clustered independently from the controls and demonstrated heterogeneity with respect to core gene expression, while the other was more homogeneous and overlapped with the controls. Table 6 lists the clinical features of the two patient groups, which did not differ with respect to age, JAK2 V617F neutrophil allele burden, leukocyte and platelet counts or clonal dominance. However, they did differ statistically with respect to disease duration, hemoglobin level, thromboembolic events, palpable splenomegaly, splenectomy, chemotherapy exposure, leukemic transformation and survival, indicating that disease behavior was aggressive in one group and indolent in the other.
To validate the unsupervised hierarchical clustering, a supervised approach based on top-scoring pairs was used (Tan et al., 2005). A 30 gene set was identified, none of which were in the 102 core gene set, which segregated the patients into the same aggressive and indolent clinical groups with 100% accuracy, validating the unsupervised hierarchical clustering results (FIG. 6).
EXAMPLE 6
Annotation of the 102 Concordantly Deregulated Genes
Annotation of the 102 genes is provided in Table 7. Of note, there was differential regulation of the stem cell maintenance genes HES1, HOXA9, PTGER4 and NR4A2, the master transcription factor SOX4 and the oncogenes SETBP1 and miR-21. Eight antiapoptotic genes, LEPR, CKAP4, RRAS2, TIMPl, IER3, THSBl, POSTN, and LGALS3, were up regulated while five proapoptotic genes, EIF5A, EMP1, ZFP36L2, LUC7L3, HLF and HOPX and three tumor suppressor genes, SSBP2, TLE4 and KLF6 were down regulated.
Importantly, consistent with the propensity for myelofibrosis in PV, there was up regulation of 16 extracellular matrix genes, including six collagen genes
(COL1A1, COL1A2, COL3A1, COL4A1, COL4A2 and COL6A3), and the matricellular genes SPARC, POSTN, TIMPl, THBS 1, HSPE, F 1, S100A9, EFEMP 1, LGALS3, and LTBP3, essentially comprising a "stromal gene signature". Furthermore, given the inflammatory milieu that characterizes the MPD (Slezak et al, 2009; Verstovsek et al, 2010), there was increased expression of 10 cytokine and inflammatory mediator genes, CCL3 (MIP 1 -a), CCL5 (RANTES), CXCL5,
SERPINEl (PAI-1), S 100A9, LCN2, PTX3, PF4V1, FCN1 and CFD, similarly comprising a "cytokine gene signature".
Given the striking dysregulation of extracellular matrix protein genes, unsupervised hierarchical clustering was used to determine whether stromal gene expression segregated with a particular clinical phenotype. As shown in FIG. 8, the stromal gene set also separated the aggressive and indolent groups, with the latter showing the same heterogeneity seen using the 102 core gene classifier (FIG. 5).
EXAMPLE 7
Gene Expression in the Aggressive and Indolent Patient Groups
Analysis of differential gene expression in the aggressive and indolent groups reinforced the importance of JAK2 V617F-independent expression of disease phenotype-modifying genes. For example, although there was no difference in the JAK2 V617F allelic burdens between the two groups (Table 6), gene expression differed markedly with 707 genes differently regulated (248 up and 459 down regulated) in the indolent group as compared to the controls (Table 8), while only 149 genes were differentially regulated (68 up and 81 down regulated) in the aggressive group (Table 9). Furthermore, the two groups also differed markedly with respect to
expression of the 102 core genes (Tables 10 and 11). KEGG analysis (FIGS. 9A-9B) emphasized the predominance of deregulated molecular pathways involving DNA and RNA metabolism and function in both groups but histone gene deregulation predominated in the aggressive group.
EXAMPLE 8
Expression of PV Core Genes in the Chronic and Blast Crisis Phases of
Chronic Myelogenous Leukemia
Finally, to determine if the gene expression changes in the 102 core genes were unique to PV or a nonspecific consequence of constitutive tyrosine kinase activation, the expression of these genes was examined in the chronic and blast crisis phases of chronic myelogenous leukemia (CML) (Bruns et al, 2009; Diaz-Bianco et al, 2007; Graham et al, 2007; Nowicki et al, 2003; Zheng et al, 2006; Yamamoto- Sugitani et al, 2011; Nakahara et al, 2010), a disease characterized by constitutive tyrosine kinase signaling in which STAT5 phosphorylation has a central role in disease pathogenesis (Horita et al, 2000; Hantschel et al, 2012). As shown in Table 12, there was concordant up regulation of 16 PV core genes in chronic phase CML, with concordant down regulation of 9. This pattern was reversed in CML blast crisis, with up regulation of 6 down regulated PV core genes, including the oncogene SETBP1, and down regulation of 11 up regulated PV core genes. Listed are 55 genes from the 102 core PV gene set showing their regulation in chronic phase and blast phase CML (Bruns et al, 2009; Diaz-Bianco et al, 2007; Graham et al, 2007;
Nowicki et al, 2003; Zheng et al, 2006; Yamamoto-Sugitani et al, 2011; Nakahara et al, 2010). White background indicates concordant regulation in P and grey background indicates discordant regulation in PV.
EXAMPLE 9
Discussion of Gene Expression Profiling in PV
PV has been scrutinized scientifically for decades but its molecular basis remains an enigma. In contrast to CML with its characteristic t(9; 22)(q34; ql 1) translocation and resulting BCR-ABL fusion tyrosine kinase gene, no genetic defect or protein marker specific for PV has yet been identified despite the use of high
resolution techniques such as oligonucleotide array comparative genomic
hybridization and high resolution single nucleotide polymorphism array karyotyping.
Central to the success of the strategy disclosed herein was the choice of an informative target cell population, a control cell population matched with respect to origin and phenotype, and avoidance of confounding effects on gene expression.
Since PV is a stem cell disorder, CD34+ cells were studied. Because myelofibrosis is part of its natural history, to ensure inclusive patient representation, as well as easy access for the repeated harvests necessary to obtain sufficient cells for analysis, peripheral blood CD34+ cells were chosen rather than their marrow counterparts. At the same time, without being bound to any one particular theory, there is no reason to believe that there would be distinctly different gene expression patterns in blood and marrow CD34+ cells since this has not been the case for either acute myelogenous leukemia or CML.
The approach used herein was facilitated by the characteristic constitutive mobilization of CD34+ cells in PV, which represents an endogenous purification step with respect to residual nonclonal marrow CD34+ cells. Although the presence of circulating nonclonal CD34+ cells is still a potential confounder, clonal dominance is another feature of PV that results in suppression of polyclonal hematopoiesis and serves as an additional endogenous purification step.
As demonstrated by the quantitative JAK2 V617F neutrophil allelic burden in all 19 patients, and in CD34+ cells in thirteen, clonal dominance was present in all patients, reducing or eliminating contamination of patient CD34+ cells by normal CD34+ cells. Additionally, since only 6 patients (26 %) were receiving chemotherapy at the time of study and five of these were taking hydroxyurea, which only affects dividing cells, it is unlikely that drug effects were a significant confounder with respect to CD34+ cell gene expression.
G-CSF mobilized peripheral blood CD34+ cells from normal subjects as the control study population were chosen because they have not been found to differ from their steady state peripheral blood counterparts with respect to cell cycle activity, immunophenotype and gene expression, while differing significantly from marrow CD34+ cells with regards to these and gene expression, as well. Both G-CSF mobilized normal CD34+ cells and PV peripheral blood CD34+ cells were similar with respect to immunophenotype and cell cycle activity, with both largely in Go/Gi
in contrast to marrow CD34+ cells, which are actively cycling. Furthermore, and most importantly, G-CSF exposure was unlikely to be a confounder with respect to CD34+ cell gene expression because these cells do not express G-CSF receptors, PV neutrophils are also already constitutively activated by virtue oiJAK2 V617F expression, and plasma G-CSF is also increased in this disorder.
Given the number of CD34+ cells required to obtain sufficient mRNA for analysis, no attempt was made to fractionate patient or control peripheral blood CD34+ cells on the basis of immunophenotype before microarray analysis. This has clinical relevance since the data herein establishes that unfractionated patient peripheral blood CD34+ cells can serve as an informative cell population for analyzing clinical risk assessment at the molecular level.
Because of the differences in disease frequency, disease manifestations, disease complications and JAK2 V617F expression between men and women PV patients, it was hypothesized that gender might also be a confounder with respect to gene expression and analyzed each patient individually with a gender-specific control. As shown in FIG. 4, sex was, indeed, an important confounder; women patients differentially up or down regulated only 251 genes compared to 535 genes for the men. The biological basis for this difference is unknown but it fits with the observed suppression of the myeloproliferative clone during pregnancy, and thus could have an epigenetic, hormonal or immunologic basis.
The importance of these genes in the disease process was substantiated by the fact that they could be used to segregate a disorder perceived to be monolithic into two groups with distinctly different clinical features and complication rates that were independent of sex as well as the JAK2 V617F allelic burden (Table 2). Although the study population was small, the aggressive group fits the clinical phenotype of the 10- 15 % of PV patients who develop the post-poly cythemia myelofibrosis syndrome, and these are the same patients who are at risk of the spontaneous evolution of a JAK2 V617F-positive acute leukemia. In this regard, it is of interest that with gene expression profiling it was possible to identify those CML patients in the chronic phase of the disease who were at risk of early transformation, or who had already transformed at the molecular level despite a chronic phase clinical phenotype.
In contrast to primary myelofibrosis, for which there are well-validated prognostic factors for risk stratification at diagnosis and during disease progression, to
date no such prognostic factors have been identified under either circumstance for PV and, as the data herein indicate, neither the JAK2 V617F allelic burden nor clonal dominance per se are useful in this regard. However, the data suggest that differential gene expression could be useful. Since gene expression appeared largely fixed from disease diagnosis for the indolent group, it is possible that acquisition of new genetic lesions in the aggressive group, whether spontaneous or treatment-related was responsible for disease transformation. The latter appeared to be the case in one indolent group patient, who developed therapy-related acute leukemia associated with the acquisition of a 5q- abnormality while taking hydroxyurea. Thus, the presently disclosed 30 gene classifier can be used to identify during the course of the disease, those patients who might benefit from early therapeutic intervention with pegylated interferon or allogeneic stem cell transplantation, while sparing other patients the side effects of unnecessary treatment.
Gene expression was examined in circulating PV CD34+ cells after removing gender as a potential confounder. This led to the identification of 102 genes whose importance in the disease process was substantiated by the fact that they could be used to segregate the PV patients into two groups with distinctly different clinical features independent of the JAK2 V617F allelic burden, leukocyte and platelet counts. The aggressive group fit the phenotype of PV patients who develop the post-polycythemia myelofibrosis syndrome (Silverstein, 1974; Passamonti et al., 2008), and are at risk of spontaneous leukemic transformation (Beer et al, 2009). In this regard, during chronic phase CML, it was possible using gene expression to identify patients who were at risk of early transformation, or who had already transformed at the molecular level (Radich et al, 2006). Thus, given the low frequency of cytogenetic
abnormalities in PV before disease transformation (Gangat et al, 2008; Stein et al, 2011), gene expression profiling could have prognostic relevance in PV.
With respect to disease specificity, it was informative to examine the expression of the 102 PV core genes in chronic and blast phase CML CD34+ cells (Bruns et al, 2009; Diaz-Bianco et al, 2007; Graham et al, 2007; Nowicki et al, 2003; Zheng et al, 2006; Yamamoto-Sugitani et al, 2011; Nakahara et al, 2010). Fifty-five of the 102 PV core genes were dysregulated in CML, with concordant dysregulation of 25 in chronic phase CML.
However, with blast crisis, there was a reversal of the up or down regulation of 17 PV core genes, providing a window into the genetic mechanisms that govern the clinical behavior of these two disorders and the potential relevance of specific genes or pathways in maintaining normal differentiation or promoting leukemic
transformation. Interestingly, the gene expression profile of the aggressive group, as in CML blast crisis patients, was closest to that of normal CD34+ cells (Radich et al, 2006).
The mechanisms driving differential gene deregulation in PV are unknown but rather than behaving like canaries in a mine shaft, gene expression appeared to be cell autonomous, a contention supported by the comparison with CML CD34+ cell gene expression (Table 12). The extent to which JAK2 V617F contributed to gene expression remains undefined but no significant differences in gene expression were observed in a study of PV CD34+ marrow cells from JAK2 V617F-positive and negative patients (Berkofsky-Fessler). In this study, the JAK2 V617F allelic burdens were not different between the aggressive and indolent groups even though their gene expression patterns differed both globally (Tables 8 and 9), as well as with respect to the 102 core gene set (Tables 10 and 11), supporting an important role for other signaling pathways in PV pathogenesis.
The 102 core gene list provides ample evidence for this contention and for synergistic interactions amongst these pathways as well. For example, HES1 up regulation suggests activation of either the Notch or Hedgehog pathways and couples these pathways with JAK2-STAT3 signaling, and NF-κΒ and HIF-Ια activation (Kamakura et al, 2004; Wall et al, 2009; Lee et al, 2009; Espinosa et al., 2010). LEPR, LGALS3, LTBP3 and THBS1 activate TGF-βΙ (Wang et al, 2009;
Mackinnon et al, 2012; Koli et al, 2008; Daniel et al, 2004), whose target genes include SOX4, SPARC, SERPINE1 (PAI-1) and miR-21 (Scharer et al, 2009;
Shibata and Ishiyama, 2013; Baricos et al, 1999; Patel and Noureddine, 2012).
SOX4 is also associated with activation of the Wnt, Notch and Hedgehog pathways (Scharer et al., 2009) and up regulation of HOXA9 (Scharer et al., 2009; Ikushima et al, 2009); which in turn enhances the transcriptional activity of SOX4 and STAT5 (Huang et al, 2012). LGALS3 also enhances Wnt pathway activity (Song et al, 2009); TIMP1 and SOX4 activate the PI3-K/AKT pathway (Scharer et al, 2009;
Ridnour et al., 2012), while RRAS2 activates the RAF/MAPK/ERK and PI-3K/AKT pathways (Rosario et al, 2001 ; Rosario et al, 1999).
Other striking abnormalities were the up regulation of 16 genes encoding important matricellular proteins, essentially comprising a stromal signature similar to that described in lymphomas and breast cancer (Lenz et al, 2008; Bergamaschi et al, 2008), and 10 inflammatory cytokine genes, comprising a cytokine signature. The stromal signature identified genes probably involved in PV myelofibrosis (Tripodo et al, 2012) as well as in CML myelofibrosis (Yamamoto-Sugitani et al, 2011), and confirms the importance of malignant CD34+ cells in marrow stem cell niche maintenance and remodeling (Schepers et al, 2013). The cytokine signature not only adds new members to those previously identified as involved in PV (Slezak et al, 2009; Verstovsek et al, 2010), but also identifies genes linking inflammation with coagulation such as the complement-activating genes, CFD, FC 1 and PTX3. In addition, the data suggest a potential prothrombotic role for PF4V1, SERPTNEl (PAI- 1), HSPE and THSB l, which antagonizes both nitric oxide (Isenberg et al, 2005) and ADAMTS 13 (Bonnefoy and Hoylaerts, 2008), and the prothrombinase, FGL2 (Yuwaraj et al, 2001), a gene not previously identified as up regulated in PV.
The CD34+ cell population is diverse, and, although for technical reasons the cells could not be further fractionated, the study disclosed herein confirms that analysis of unfractionated circulating CD34+ cells has clinical utility (Radich et al, 2006). Gene expression, of course, only represents one component of the complex process from gene transcription to protein product and is subject to epigenetic as well as genetic influences not controlled for in this study. Nevertheless, the data provide new insights into the molecular abnormalities of PV, establish a molecular basis for disease heterogeneity, identify genes and pathways for targeted therapy outside the canonical JAK2 signaling pathway, as well as previously unrecognized genes potentially involved in promoting myelofibrosis, inflammation and thrombosis.
This study has identified a number of important genes that may be worthy of consideration for targeted therapy. They include HES1, a transcriptional repressor that negatively regulates the tumor suppressor PTEN, SPARC a multifunctional, antiadhesive matricellular protein that regulates extracellular matrix organization and up regulates osteopontin, a protein responsible for stem cell niche maintenance, and LGALS3 and TIMP1, the cognate ligand for CD36, which promotes platelet
aggregation, antagonizes nitric oxide and activates TGF-β. In addition to TIMP1, the up regulation of a number of previously recognized coagulation genes that may contribute to the thrombotic diathesis that complicates PV were also identified. These include the fibrinolysis inhibitor PAI-1 and the prothrombinase FGL2, as well as the gene PTX3.
Hematopoietic stem cells do not require JAK2 for either survival or proliferation and no difference was found between the size of the hematopoietic stem cell compartment between PV, ET and normal controls in vivo or their behavior in vitro. This is not surprising since JAK2 expression and activation in a JAK2-nab/Q cell line did not appear to alter global gene transcript above that observed with unactivated JAK2 expression. Furthermore, no significant changes in gene expression were observed in a study of PV CD34+ marrow cells from JAK2 V617F-positive and negative patients, nor was a significant difference observed when the gene expression in PV CD34+ marrow cells was compared with that following overexpression of wild type JAK2 in normal CD34+ cells. Similar observations have been made with CD34+ marrow cells from JAK2 V617F-positive and negative ET patients. At the same time, it is well documented that in the nucleus, JAK2 directly modifies gene transcription and enhances mitotic recombination and promotes genetic instability by altering histone phosphorylation and methylation and damaging DNA by generating reactive oxygen species, which may be its most important contributions to PV stem cell behavior. In addition to the influence oiJAK2 V617F, our data indicate activation of a number of other signal transduction pathways. For example, HES1 expression is dependent on either the Notch or Hedgehog pathways and HES 1 itself activates STAT3 through either SRC or JAK2 signaling.
A striking abnormality was up regulation of genes encoding matricellular proteins and inflammatory cytokines. Whether such signals are the consequence of constitutive JAK2 activation involving stem cell cytokine receptors is unclear but with respect to the genes whose expression is normally influenced by JAK2, only two genes, SPARC and PTX, the latter a gene normally down regulated by JAK2, were up regulated in the PV CD34+ cells, suggesting that gene expression in these cells was driven by signal pathways primarily unrelated to JAK2. This contention is supported by the upregulation of genes involved in Notch or Hh signaling such as HES1, genes involved in NFK-β signaling such as NR4A2, IER3, and RRAS2, genes involved in
Wnt signaling such as LGALS3, GAS2, SPARC and S100A9, and genes involved in TGF-β signaling such as LGALS3, TIMP1, THSB1 and LEPR.
With respect to the specificity of gene expression associated with JAK2 signaling in PV CD34+ cells, it was informative to compare their gene expression profiles with those of chronic phase CML CD34+ cells, since constitutive tyrosine kinase signaling involving STAT5 is a central feature of both disorders and both share a similar clinical phenotype with respect to leukocytosis, thrombocytosis, extramedullary hematopoiesis, myelofibrosis and transformation to acute leukemia, although at differing frequencies, possibly because BCR-ABL signaling is ectopic while signaling by JAK2 V617F occurs through physiologic pathways.
As shown in Table 12, there was concordant dysregulation of 28 of the PV 105 core gene set in chronic phase CML, which is compatible with the observation that STAT5 is activated by BCR-ABL signaling. By contrast, however, in CML blast crisis, there was a reversal in the up or down regulation of 17 PV core set genes, providing a window into the genetic mechanisms that govern the different clinical courses of these two disorders and the potential relevance of specific genes or pathways in maintaining normal differentiation or promoting leukemic
transformation. In this regard, it is interesting to note that the gene expression profile of both the aggressive patient group and those CML patients who developed blast crisis was not only different from the indolent group or chronic phase CML patients respectively, but also closer to that of normal CD34+ cells.
This study provides a snap shot of gene expression in a heterogenous stem cell population of a chronic disorder characterized by phenotypic variability over time. The data provide insight into the molecular abnormalities of PV, identify new candidate genes for targeted therapy outside the canonical JAK2 signaling pathway and as well as previously unrecognized genes that may be involved in promoting thrombosis in PV patients.
The molecular behavior of PV CD34+ cells has been exposed in this study. The data indicate that PV can no longer be considered a monolithic disorder with bone marrow failure as an inevitable event, that patients with an aggressive form of the disorder can be identified early in the course of their disease and that, as has been previously argued, women PV patients cannot be treated as small men, and this should be true both in clinical trials and in pregnancy. Whether controlling for sex as
a potential confounder is applicable to gene expression analysis in other hematologic malignancies is worthy of evaluation given the remarkable insights described here.
Recent studies have suggested that in PV, as well as in CML, the disease may arise in a later stage progenitor cell, and, in particular, one with a predilection for erythroid differentiation. While the data herein do not directly speak to this contention, in keeping with it, six globin genes were upregulated in PV CD34+ cells. However, it is noteworthy that in chronic phase CML there was up regulation of the α2, β, δ and j2 globin genes as well as an increase in the MEP population despite the fact that CML is phenotypically myeloid-restricted, while PV is not. Therefore, without wishing to be bound to any one particular theory, it is believed that as opposed to being associated with CD34+ maturation status, these gene expression changes may merely reflect nonspecific up regulation of gene expression by JAK2 activation in both disorders, or aberrant activation of multiple genetic pathways in a transformed pluripotent stem cell as can be seen in biphenotypic leukemias. The up regulation of both embryonic and fetal globin genes supports this latter contention, as does the observation that in vivo, the balance between erythroid and myeloid progenitor cell pools in PV was not different from normal.
EXAMPLE 10
10 Gene Screening Panel for Predicting Aggressive Forms of PV
Since PV is a stem cell disorder, PV CD34+ cells were examined for constructing a gene
screening panel for PV. Specifically, to avoid repeated marrow aspirations to collect these cells, circulating CD34+ cells were studied. This was also technically advantageous because an increase in the number of circulating CD34+ cells is a feature of PV, and because of clonal dominance, which is also a feature of PV, the bulk of the circulating CD34+ cells were likely to be from the malignant clone (Adamson et al., 1976). Mobilized normal circulating CD34+ cells, which are immunophenotypically similar and have the same cell cycle status, were used as the control cell population, and, because female PV patients have different clinical features than male patients (Stein et al, 2010; Stein et al, 2011 ; Videbaek, 1950), each patient was compared with a gender-specific control. Using oligonucleotide microarray technology, it was found that women differentially regulated 251 genes
and men 535 genes, but both concordantly differentially regulated 102 genes (FIG. 4). Using this 102 core gene set and unsupervised hierarchical clustering, PV patients were able to be segregated into two groups (FIG. 5), with one group having a more aggressive disease with lower hemoglobin levels, more thromboembolic events, a higher frequency of splenomegaly, larger spleens, a greater frequency of
chemotherapy and splenectomy, more leukemic transformation and a higher mortality rate, despite having a JAK2 V617F allelic burden similar to the other group (Table 6). Using a supervised approach, top scoring pairs, a 29 gene profile was defined, which also segregated the PV patients with aggressive disease from those with a more indolent phenotype with 100 % accuracy (FIG. 6).
Based on these 19 genes, a smaller gene panel was derived consisting of 10 genes (PCNA, IF 130, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1 and MYL9) for establishing the probability that a PV patient has an aggressive or indolent form of the disease. Using qRT-PCR and scoring 1 for true and 0 for false. If PCNA > IF30; TSN > CTSA; SMC4 > CDKN1A; PCNA > CTTN; SON > CTTN; and TIA1 > MYL9, the probability that the disease is aggressive is the total score/6. After developing absolute copy number standard curves for the 10 genes (FIG. 10), the behavior of this screen on seven patients was verified in the initial training set and its predictability examined in a blinded fashion using CD34+ cell RNA from 30 additional PV patients as described herein below.
For biomarker association with clinical measures, patient probability scores were correlated with the presence or absence of clinical complications as defined from the training set aggressive PV group and calculated as a clinical score (0-6). These clinical complications were: anemia, palpable splenomegaly or history of
splenectomy, spleen size, major vessel thrombosis, chemotherapy or
immunomodulatory therapy and leukemic transformation. Of the 30 patients, 8 had clinical features compatible with the aggressive form of PV with a median clinical score of 3.0 (range, 2-4) and a median probability score of 5/6 (range, 5-6) using the 10 gene panel. In these 8 patients, each of the clinical complications occurred at a significantly higher frequency than in the indolent group. Of the 22 patients who did not have an aggressive clinical phenotype, the median clinical score was 1 (range 0-3) and the median probability score was 3/6 (range 0-4) (Table 13). The difference in clinical scores between the two groups was statistically significant (p< 0.001), and the
probability score was also significantly different between the groups at p < 0.001 with a ROC curve with an AUC of 0.94 (FIG. 11A). There was good correlation between the probability score and the clinical score in this group of patients (p = 0.002; FIG. 1 IB). Median disease duration was 15.5 years (range, 9-39) in the aggressive group and 7.0 years (range, 1-27; p =0.01 1) in the indolent group (p = 0.003), while the median JAK2 V617F allelic burden was not different in the aggressive group compared to the indolent group (94 % vs 81 %), though 5 of the indolent group, but none of the aggressive group, had allele burdens of 50 % or less. In 7 patients, it was possible to obtain repeat measurements over a period of 3-5 years and in 5, the probability score remained constant at 4/6 or less with similar JAK2 V617F allelic burdens and clinical scores (FIG. 12A). In one patient with a probability score of 1- 2/6, the probability score increased to 5/6 in advance of AML transformation in one (FIG. 12B).
Table 14 discloses the genes and context sequences (probe sequences; Applied Biosystems primer/probe kits) comprising the 10 gene screening panel for the presently disclosed methods. Table 15 shows representative NCBI Accession numbers for each gene and Table 16 discloses the probes (Life Technologies, Carlsbad, CA) used to detect each gene.
After cloning the appropriate probes and developing absolute copy number standard Ct curves for the 10 genes, the behavior of this screen on PV patients in the training set was verified. The predictability of this screen was examined using CD34+ cell R A from a test set of 23 PV patients (Tables 18 and 19). Patient probability scores were correlated with the presence or absence of clinical features defined by the training set aggressive PV group and calculated as a clinical score. Of the 23 patients, 7 had clinical features compatible with the aggressive form of PV with a median clinical score of 3.0 (range, 1-6) and a median probability score of 6/6 (range, 3-6), with one patient having a score of 3/6. Of the 16 patients who did not have an aggressive clinical phenotype, the median clinical score was 0 (range 0-1) and the median probability score was 3/6 (range 1-4). The difference in clinical scores between the two groups was statistically significant (p< 0.001) and the probability score was also significantly different between the groups at p =0.001. Median disease duration was 13.0 years (range, 9-39) in the aggressive group and 6.0 years (range, 1- 17) in the indolent group (p = 0.003), while the median JAK2 V617F allelic burden
was greater in the aggressive group (95 % vs 82.5 %; p=0.04) with 5 of the indolent group, but none of the aggressive group, having allele burdens of 50 % or less. In 2 patients, it was possible to obtain repeat measurements over a period of 3-5 years and in both the probability score remained constant at 4/6 with similar Jak2 V617F allelic burdens and clinical scores. In one patient with a probability score of 3/6, the score increased to 6/6 in advance of AML transformation. ROC (Receiver Operating Characteristic) analysis revealed that the AUC for all cases was 0.94, while the AUC excluding AML cases was 0.925. The best point for calls in both cases was setting the call of aggressive phenotype at 5 positive TSP calls, with sensitivity of 0.9 and 0.875 and specificity of 1.0 and 1.0, respectively. The PPV at this threshold was 1.0 in both cases, and the NPV was 0.95 in both cases. (AUC = area under the curve; FN = falsely negative; FP = falsely positive; TP = total positives; TN = total negatives).
The power of a diagnostic test to correctly predict status is commonly measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve. Sensitivity is the percentage of true positives that are predicted by a test to be positive, while specificity is the percentage of true negatives that are predicted by a test to be negative. A ROC curve provides the sensitivity of a test as a function of 1 -specificity. The greater the area under the ROC curve, the more powerful the predictive value of the test. Positive predictive value is the percentage of people who test positive that are actually positive. Negative predictive value is the percentage of people who test negative that are actually negative.
Relevant equations are defined below:
Sensitivity = TP/(TP+FN)
Specificity = TN/(TN+FP)
PPV (positive predictive value) = TP/(TP+FP)
NPV (negative predictive value) = TN/(TN+FN)
The positive predictive value is often reported as it gives the probability that a patient who tests positive is truly positive for a phenotype, and therefore is an indication of how much the test can be trusted clinically to reflect the phenotype. The sensitivity gives the probability that a patient who is positive actually tests positive.
In summary, a molecular method for risk stratification in PV that reflects clinical phenotype but also anticipates disease transformation has been identified.
The presently disclosed subject matter provides a clinical assay that uses gene expression (Table 14) and a specific algorithm (Table 17) to identify those PV patients most likely to benefit from early institution of definitive therapy.
Example 11
Embodiment of a 10 Gene Panel Assay
The starting tissue can be either peripheral blood collected in standard EDTA vacutainer tubes or buffy coat cells isolated from a unit of whole blood.
For CD34+ cell isolation, peripheral blood mononuclear cells (PBMCs) are isolated from fresh samples by Ficoll- Paque (GE Healthcare Cat. No. 17-1440-03) density gradient centrifugation. CD34+ cells are isolated from the PBMCs using the Miltenyi Biotech CD34 Microbead Kit (Cat. No. 130-097-047) following the manufacturer's instructions. In an embodiment, the required amount of CD34+ cells is approximately 1-4 x 106.
For optional CD34+ cell storage, purified CD34+ cells can be resuspended in freezing media (10% DMSO (Sigma Cat. No. D2650) 90% Fetal Bovine Serum
(Gibco Cat. No. 26140)) and stored frozen at -80°C using a slow cooling freezing unit (Thermo Scientific Cat. No. 5100-0001). Cells can also be transferred to liquid nitrogen for long term storage. Before RNA isolation, the cells are washed in Phosphate Buffered Saline pH 7.4 (Gibco Cat No. 10010-023) to remove all media.
For RNA isolation, RNA is extracted using the Qiagen RNeasy mini kit (Cat.
No. 74104) with the QIAshredder (Cat. No. 79654) and on-column DNase treatment (Cat. No. 79254) following the manufacturer's instructions. Beta Actin levels (ACTB endogenous control; Applied Biosystems, Cat. No. 4333762F) for each sample are measured to determine if the concentration and quality was acceptable for further analysis. This assay is based upon a 10 gene signature and an algorithm (Table 17) which stratifies PV patients into indolent and aggressive forms of the disease. A qRT-PCR probability score of 5 or 6 indicates an aggressive form of PV. Each of the six described ratios must always be > 2 to be scored as positive. Scores of 5/6 or 6/6 are considered indicative of an aggressive PV phenotype based on the supervised analysis of our initial gene expressing profiling results using top scoring pairs.
Transcript expression levels are measured (in absolute copy numbers). The assay can be performed with a plurality of samples using a high throughput qRT-PCR platform.
Because this assay compares different genes within a single patient sample, absolute quantitation calculations are performed rather than compare relative expression levels. Therefore, plasmids containing either full length or partial cDNA of the targeted region for each gene are cloned and used to generate standard curves (FIG. 10). Once optimized, three standard dilutions can be chosen to use in the assay based upon the observed expression range of each gene. Copy numbers are calculated based on the known size and concentration of each plasmid. In addition to the standard curves and no template control, at least one patient sample with a previously determined qRT-PCR probability score is included in each run as a quality control.
Intra-assay precision is assessed by running all samples in duplicate.
Replicate Ct values with standard deviations of greater than 0.5 are re-evaluated. Inter-assay precision is assessed by performing replicate assays on different days with fresh template cDNA from the same RNA sample of separate patients. In an example, the applied algorithm on samples from 8 patients generated the same call, either >4/6 or <5/6. In another example, four sets of patient samples using RNA extracted from CD34+ samples isolated from separate blood draws within the same twelve month period were run with no reported disease progression. Again, in each case there was no difference in the stratification of the patients using the methods of the presently disclosed subject matter.
In an example, the clinical sensitivity of the assay using 5-6/6 as indicative of an aggressive phenotype was 0.9. The clinical specificity of the assay using 5-6/6 as indicative of an aggressive phenotype was 1.0. The PPV at this threshold was 1.0 and the NPV was 0.95.
REFERENCES
All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that
any of these documents forms part of the common general knowledge in the art.
Adamson JW, Fialkow PJ, Murphy S, Prchal JF, Steinmann L. Polycythemia vera: stem-cell and probable clonal origin of the disease. N. Engl. J. Med.
1976;295:913-916.
Anand S, Stedham F, Gudgin E et al. Increased basal intracellular signaling patterns do not correlate with JAK2 genotype in human myeloproliferative neoplasms. Blood 201 1 ; 118(6) : 1610- 1621.
Andreasson B, Swolin B, Kutti J. Increase of CD34 positive cells in polycythaemia vera. Eur. J. Haematol. 1997;59(3): 171-176.
Barbui T, Barosi G, Birgegard G et al. Philadelphia-negative classical myeloproliferative
neoplasms:critical concepts and management recommendations from European LeukemiaNet. J.
Clin. Oncol. 2011 ;29:761-770.
Baricos WH, Cortez SL, Deboisblanc M, Xin S. Transforming growth factor- beta is a potent inhibitor of extracellular matrix degradation by cultured human mesangial cells. J. Am. Soc. Nephrol. 1999; 10(4):790-795.
Barosi G, Viarengo G, Pecci A et al. Diagnostic and clinical relevance of the number of circulating CD34+ cells in myelofibrosis and myeloid metaplasia. Blood 2001 ;98(12):3249-3255.
Beer PA, Delhommeau F, Le Couedic JP et al. Two routes to leukemic transformation following a JAK2 mutation-positive myeloproliferative neoplasm. Blood 2009; 1 15:2891-2900.
Bergamaschi A, Tagliabue E, Sorlie T et al. Extracellular matrix signature identifies breast cancer subgroups with different clinical outcome. J. Pathol.
2008;214(3):357-367.
Berk PD, Goldberg JD, Silverstein MN et al. Increased incidence of acute leukemia in polycythemia vera associated with chlorambucil therapy. N. Engl. J. Med. 1981 ;304:441-447.
Berkofsky-Fessler W, Buzzai M, Kim MK et al. Transcriptional profiling of polycythemia vera identifies gene expression patterns both dependent and independent from the action of JAK2V617F. Clin. Cancer Res. 2010; 16(17):4339- 4352.
Bonnefoy A, Hoylaerts MF. Thrombospondin- 1 in von Willebrand factor function. Curr Drug Targets 2008;9(10):822-832.
Bruns I, Czibere A, Fischer JC et al. The hematopoietic stem cell in chronic phase CML is characterized by a transcriptional profile resembling normal myeloid progenitor cells and reflecting loss of quiescence. Leukemia 2009;23(5):892-899.
Catani L, Zini R, Sollazzo D et al. Molecular profile of CD34+
stem/progenitor cells according to JAK2V617F mutation status in essential thrombocythemia. Leukemia 2009;23(5):997-1000.
Daniel C, Wiede J, Krutzsch HC et al. Thrombospondin- 1 is a major activator of TGF-beta in fibrotic renal disease in the rat in vivo. Kidney Int 2004;65(2):459- 468.
Diaz-Bianco E, Bruns I, Neumann F et al. Molecular signature of CD34(+) hematopoietic stem and progenitor cells of patients with CML in chronic phase. Leukemia 2007;21(3):494-504.
Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res.
2002;30(1):207-210.
Espinosa L, Cathelin S, D'Altri T et al. The Notch/Hes l pathway sustains NF- kappaB activation through CYLD repression in T cell leukemia. Cancer Cell 2010; 18(3):268-281.
Gaidano G, Pastore C, Santini V et al. Genetic lesions associated with blastic transformation of polycythemia vera and essential thrombocythemia. Genes
Chromosomes.
Cancer 1997; 19:250-255.
Gangat N, Strand J, Lasho TL et al. Cytogenetic studies at diagnosis in polycythemia vera: clinical and JAK2V617F allele burden correlates. Eur. J.
Haematol. 2008;80(3): 197-200.
Graham SM, Vass JK, Holyoake TL, Graham GJ. Transcriptional analysis of quiescent and proliferating CD34+ human hemopoietic cells from normal and chronic myeloid leukemia sources. Stem Cells 2007;25(12):311 1-3120.
Gruppo Italiano Studio Policitemia. Polycythemia vera: the natural history of 1213 patients followed for 20 years. Ann. Intern. Med. 1995; 123 :656-664.
Hantschel O, Warsch W, Eckelhart E et al. BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia. Nat. Chem. Biol.
2012;8(3):285-293.
Harrison CN, Campbell PJ, Buck G et al. Hydroxyurea compared with anagrelide in high-risk essential thrombocythemia. N. Engl. J. Med. 2005;353(1):33- 45.
Horita M, Andreu EJ, Benito A et al. Blockade of the Bcr-Abl kinase activity induces apoptosis of chronic myelogenous leukemia cells by suppressing signal transducer and activator of transcription 5-dependent expression of Bcl-xL. J. Exp. Med. 2000; 191(6):977-984.
Huang Y, Sitwala K, Bronstein J et al. Identification and characterization of Hoxa9 binding sites in hematopoietic cells. Blood 2012; 119(2):388-398.
Ikushima H, Todo T, Ino Y, Takahashi M, Miyazawa K, Miyazono K.
Autocrine TGF-beta signaling maintains tumorigenicity of glioma-initiating cells through Sry-related HMG-box factors. Cell Stem Cell 2009;5(5):504-514.
Isenberg JS, Ridnour LA, Perruccio EM, Espey MG, Wink DA, Roberts DD. Thrombospondin-1 inhibits endothelial cell responses to nitric oxide in a cGMP- dependent manner. Proc. Natl. Acad. Sci. U.S.A. 2005; 102(37): 13141-13146.
James C, Ugo V, Le Couedic JP et al. A unique clonal JAK2 mutation leading to constitutive signaling causes polycythaemia vera. Nature 2005;434(7037): 1 144- 1148.
Jones AV, Kreil S, Zoi K et al. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood 2005; 106:2162-2168.
Kamakura S, Oishi K, Yoshimatsu T, Nakafuku M, Masuyama N, Gotoh Y. Hes binding to STAT3 mediates crosstalk between Notch and JAK-STAT signaling. Nat. Cell. Biol. 2004;6(6):547-554.
Kerbauy DM, Gooley TA, Sale GE et al. Hematopoietic cell transplantation as curative
therapy for idiopathic myelofibrosis, advanced polycythemia vera, and essential thrombocythemia. Biol. Blood Marrow Transplant. 2007; 13 :355-365.
Kiladjian JJ, Cassinat B, Chevret S et al. Pegylated interferon-alfa-2a induces complete
hematologic and molecular responses with low toxicity in polycythemia vera. Blood 2008; 112:3065-3072.
Kiladjian JJ, Chevret S, Dosquet C, Chomienne C, Rain JD. Treatment of polycythemia vera with hydroxyurea and pipobroman: final results of a randomized trial initiated in 1980. J. Clin. Oncol. 2011 ;29:3907-3913.
Koli K, Ryynanen MJ, Keski-Oja J. Latent TGF-beta binding proteins
(LTBPs)-l and -3 coordinate proliferation and osteogenic differentiation of human mesenchymal stem cells. Bone 2008;43(4):679-688.
Lamy T, Devillers A, Bernard M et al. Inapparent polycythemia vera: an unrecognized diagnosis. Am. J. Med. 1997;102(1): 14-20.
Lee JH, Suk J, Park J et al. Notch signal activates hypoxia pathway through
HES 1 -dependent SRC/signal transducers and activators of transcription 3 pathway. Mol. Cancer Res. 2009;7(10): 1663-1671.
Lenz G, Wright G, Dave SS et al. Stromal gene signatures in large-B-cell lymphomas. N. Engl. J. Med. 2008;359(22):2313-2323.
Lenz G, Wright GW, Emre NC et al. Molecular subtypes of diffuse large B- cell lymphoma arise by distinct genetic pathways. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 13520-13525.
Mackinnon AC, Gibbons MA, Farnworth SL et al. Regulation of transforming growth factor-beta 1 -driven lung fibrosis by galectin-3. Am. J. Respir. Crit. Care Med. 2012; 185(5):537-546.
McNally RJ, Rowland D, Roman E, Cartwright RA. Age and sex distributions of hematological malignancies in the U.K. Hematol. Oncol. 1997; 15: 173-189.
Moliterno AR, Williams DM, Rogers O, Isaacs MA, Spivak JL. Phenotypic variability within the JAK2 V617F-positive MPD: Roles of progenitor cell and neutrophil allele burdens. Exp. Hematol. 2008;36(11): 1480-1486.
Najean Y, Rain J. Treatment of Polycythemia Vera: The use of Hydroxyurea and Pipobroman in 292 Patients Under the Age of 65 Years. Blood 1997;90:3370- 3377.
Nakahara F, Sakata-Yanagimoto M, Komeno Y et al. Hesl immortalizes committed
progenitors and plays a role in blast crisis transition in chronic myelogenous leukemia. Blood
2010; 115(14):2872-2881.
Nowicki MO, Pawlowski P, Fischer T, Hess G, Pawlowski T, Skorski T. Chronic myelogenous leukemia molecular signature. Oncogene 2003;22(25):3952- 3963.
Nussenzveig RH, Swierczek SI, Jelinek J et al. Polycythemia vera is not initiated by JAK2V617F mutation. Exp. Hematol. 2007;35(l):32-38.
Passamonti F, Rumi E, Caramella M et al. A dynamic prognostic model to predict survival in post-polycythemia vera myelofibrosis. Blood 2008; 11 1(7):3383- 3387.
Patel V, Noureddine L. MicroRNAs and fibrosis. Curr. Opin. Nephrol.
Hypertens. 2012;21(4):410-416.
Radich JP, Dai H, Mao M et al. Gene expression changes associated with progression and response in chronic myeloid leukemia. Proc. Natl. Acad. Sci. U.S.A. 2006; 103(8):2794-2799.
Ranjan A, Penninga E, Jelsig AM, Hasselbalch HC, Bjerrum OW. Inheritance of the chronic myeloproliferative neoplasms. A systematic review. Clin. Genet. 2013;83(2):99-107.
Ridell B, Carneskog J, Wedel H et al. Incidence of chronic myeloproliferative disorders in the city of Goteborg, Sweden 1983-1992. Eur. J. Haematol.
2000;65(4):267-271.
Ridnour LA, Barasch KM, Windhausen AN et al. Nitric oxide synthase and breast cancer: role of TIMP- 1 in NO-mediated Akt activation. PLoS ONE
2012;7(9):e44081.
Rosario M, Paterson HF, Marshall CJ. Activation of the Raf/MAP kinase cascade by the Ras-related protein TC21 is required for the TC21 -mediated transformation ofNIH 3T3 cells. EMBO J. 1999; 18(5): 1270-1279.
Rosario M, Paterson HF, Marshall CJ. Activation of the Ral and
phosphatidylinositol 3' kinase signaling pathways by the ras-related protein TC21. Mol. Cell. Biol. 2001 ;21(1 1):3750-3762.
Scharer CD, McCabe CD, Ali-Seyed M, Berger MF, Bulyk ML, Moreno CS. Genome-wide promoter analysis of the SOX4 transcriptional network in prostate cancer cells. Cancer Res. 2009;69(2):709-717.
Schepers K, Pietras EM, Reynaud D et al. Myeloproliferative Neoplasia Remodels the Endosteal Bone Marrow Niche into a Self-Reinforcing Leukemic Niche. Cell Stem Cell 2013.
Segal JB, Moliterno AR. Platelet counts differ by sex, ethnicity, and age in the United States. Ann. Epidemiol. 2006; 16(2): 123 -130.
Shibata S, Ishiyama J. Secreted protein acidic and rich in cysteine (SPARC) is upregulated
by transforming growth factor (TGF)-beta and is required for TGF -beta-induced hydrogen peroxide production in fibroblasts. Fibrogenesis Tissue Repair 2013;6(1):6.
Silverstein MN. Postpolycythemia myeloid metaplasia. Arch. Intern. Med. 1974; 134(1): 1 13-1 17.
Slezak S, Jin P, Caruccio L et al. Gene and microRNA analysis of neutrophils from
patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a. J. Transl. Med. 2009;7:39.
Smalberg JH, Arends LR, Valla DC, Kiladjian JJ, Janssen HL, Leebeek FW. Myeloproliferative neoplasms in Budd-Chiari syndrome and portal vein thrombosis: a meta-analysis. Blood 2012; 120(25):4921-4928.
Song S, Mazurek N, Liu C et al. Galectin-3 mediates nuclear beta-catenin accumulation and Wnt signaling in human colon cancer cells by regulation of glycogen synthase kinase-3beta activity. Cancer Res. 2009;69(4): 1343-1349.
Spivak JL. Polycythemia vera:myths, mechanisms, and management. Blood 2002; 100:4272-4290.
Spivak JL. Narrative review: Thrombocytosis, polycythemia vera, and JAK2 mutations: The phenotypic mimicry of chronic myeloproliferation. Ann. Intern. Med. 2010; 152:300-306.
Spivak JL, Hasselbalch H. Hydroxycarbamide: a user's guide for chronic myeloproliferative disorders. Expert. Rev. Anticancer Ther. 2011 ; 11 :403-414.
Stein BL, Rademaker A, Spivak JL, Moliterno AR. Gender and Vascular Complications in the JAK2 V617F-Positive Myeloproliferative Neoplasms.
Thrombosis 201 1;201 1 :874146.
Stein BL, Williams DM, O'Keefe C et al. Disruption of the ASXL1 gene is frequent in primary, post-essential thrombocytosis and post-polycythemia vera myelofibrosis, but not essential thrombocytosis or polycythemia vera: analysis of molecular genetics and clinical phenotypes. Haematologica 201 1;96(10): 1462-1469.
Stein BL, Williams DM, Rogers O, Isaacs MA, Spivak JL, Moliterno AR. Disease burden at the progenitor level is a feature of primary myelofibrosis: a multivariable analysis of 164 JAK2 V617F-positive myeloproliferative neoplasm patients. Exp. Hematol. 201 1;39(1):95-101.
Stein BL, Williams DM, Wang NY et al. Sex differences in the JAK2 V617F allele burden in chronic myeloproliferative disorders. Haematologica
2010;95(7): 1090-1097.
Sugita M, Haney JL, Gemmill RM, Franklin WA. One-step duplex reverse transcription- polymerase chain reaction for quantitative assessment of RNA degradation. Anal. Biochem.
2001 ;295(1): 1 13-1 16.
Tan AC, Naiman DQ, Xu L, Winslow RL, Geman D. Simple decision rules for classifying human cancers from gene expression profiles. Bioinformatics 2005;21(20):3896-3904.
Tripodo C, Sangaletti S, Guarnotta C et al. Stromal SPARC contributes to the detrimental fibrotic changes associated with myeloproliferation whereas its deficiency favors myeloid cell expansion. Blood 2012; 120(17):3541-3554.
Verstovsek S, Kantarjian H, Mesa RA et al. Safety and efficacy of
INCBO 18424, a JAKl
and JAK2 inhibitor, in myelofibrosis. N. Engl. J. Med. 2010;363(12): 1 117-1 127.
Videbaek A. Polycythemia Vera. Course and Prognosis. Acta Med. Scand. 1950; 138: 179-187.
Wall DS, Mears AJ, McNeill B et al. Progenitor cell proliferation in the retina is dependent on Notch- independent Sonic hedgehog/Hesl activity. J. Cell. Biol. 2009; 184(1): 101-1 12.
Wang J, Leclercq I, Brymora JM et al. Kupffer cells mediate leptin-induced liver fibrosis. Gastroenterology 2009; 137(2):713-723.
Wasserman L. The Management of Polycythemia Vera. British Journal of Hematology 1971;21 :371-376.
Williams DM, Kim AH, Rogers O, Spivak JL, Moliterno AR. Phenotypic variations and new mutations in JAK2 V617F-negative polycythemia vera, erythrocytosis, and idiopathic myelofibrosis. Exp. Hematol. 2007;35(11): 1641-1646.
Yamamoto-Sugitani M, Kuroda J, Ashihara E et al. Galectin-3 (Gal-3) induced by leukemia microenvironment promotes drug resistance and bone marrow lodgment in chronic myelogenous leukemia. Proc. Natl. Acad. Sci. U.S.A.
2011 ; 108(42): 17468- 17473.
Yuwaraj S, Ding J, Liu M, Marsden PA, Levy GA. Genomic characterization, localization, and functional expression of FGL2, the human gene encoding fibroleukin: a novel human procoagulant. Genomics 2001 ;71(3):330-338.
Zheng C, Li L, Haak M et al. Gene expression profiling of CD34+ cells identifies a molecular signature of chronic myeloid leukemia blast crisis. Leukemia 2006;20(6): 1028-1034.
Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.
TABLES
Table 1. QPCR using the Gene Expression GEX Assays
Table 2. Polycythemia Vera Study Population Demographics
significantly different
=0.016
Table 3. Demographics and Clinical Features of the 19 Polycythemia Vera Patients at Study Entry
Table 4. Gene Expression in Women Patients
Entrez
Symbol (Na32
Gene Title (Na32 consensus GenelD Adjusted
ProbesetID consensus Log2(FC) P-Value
Marl3) (consensus P-Value Marl3)
Mar-13)
204805_s_at H1FX HI histone family, member X 8971 1.91935 0.00114 0.1019 alanyl (membrane)
202888_s_at ANPEP 290 1.43197 0.001209 0.1019 aminopeptidase
vesicle-associated membrane
213326_at VAMP1 6843 1.380311 0.001564 0.1019 protein 1 (synaptobrevin 1)
212543_at AIM1 absent in melanoma 1 202 1.689059 0.002053 0.1019
201427_s_at SEPP1 selenoprotein P, plasma, 1 6414 1.427475 0.003366 0.125981
206674_at FLT3 fms-related tyrosine kinase 3 2322 1.701119 0.003846 0.125981 ankyrin 3, node of Ranvier
206385_s_at AN 3 288 1.257882 0.004488 0.125981
(ankyrin G)
RNA binding protein with
209487_at RBPMS 11030 1.23478 0.00567 0.125981 multiple splicing
219871_at FLJ13197 uncharacterized FLJ13197 79667 1.301817 0.005704 0.125981
RNA binding protein with
209488_s_at RBPMS 11030 1.275396 0.006845 0.125981 multiple splicing
221645_s_at ZNF83 zinc finger protein 83 55769 1.200283 0.007674 0.125981
KN motif and ankyrin repeat
213005_s_at KAN 1 23189 1.707475 0.008166 0.125981 domains 1
interleukin-1 receptor-
213817_at IRA 3 11213 1.218239 0.010346 0.125981 associated kinase 3
202039_at MY018A myosin XVIII A 399687 1.175294 0.011058 0.125981 leukocyte-associated
210644_s_at LAIR1 immunoglobulin-like receptor 3903 1.348313 0.011154 0.125981
1
TNF receptor-associated factor
204352_at TRAF5 7188 1.125428 0.012268 0.125981
5
214290_s_at HIST2H2AA4 histone cluster 2, H2aa4 723790 1.879605 0.013116 0.125981
222146_s_at TCF4 transcription factor 4 6925 1.385756 0.013155 0.125981
59375_at MY015B myosin XVB pseudogene 80022 1.108123 0.013372 0.125981
206486_at LAG3 lymphocyte-activation gene 3 3902 0.994363 0.014533 0.125981
212794_s_at IAA1033 KIAA1033 23325 1.287389 0.014972 0.125981 neural proliferation,
218086_at NPDC1 56654 1.013593 0.015204 0.125981 differentiation and control, 1
218280_x_at HIST2H2AA4 histone cluster 2, H2aa4 723790 1.830191 0.01535 0.125981 tyrosine 3- monooxygenase/tryptophan 5-
213655_at YWHAE 7531 -1.40323 0.015549 0.125981 monooxygenase activation
protein, epsilon polypeptide
219173_at MY015B myosin XVB pseudogene 80022 1.147267 0.016111 0.127919 protein tyrosine phosphatase,
212587_s_at PTPRC 5788 1.942028 0.016627 0.128539 receptor type, C
zinc finger and SCAN domain
218312_s_at ZSCAN18 65982 1.539329 0.017836 0.128539 containing 18
RNA binding protein with
207836_s_at RBPMS 11030 1.091491 0.018254 0.128539 multiple splicing
tumor necrosis factor (ligand)
207426_s_at TNFSF4 7292 1.381424 0.019204 0.129221 superfamily, member 4
transcription factor 7-like 2 (T-
212762_s_at TCF7L2 6934 1.046634 0.019813 0.129892 cell specific, HMG-box)
209398_at HIST1H1C histone cluster 1, Hlc 3006 1.60555 0.020228 0.129892
MyoD family inhibitor domain
211675_s_at MDFIC 29969 1.155886 0.020685 0.129892 containing
206133_at XAF1 XIAP associated factor 1 54739 1.158372 0.020857 0.129892
218966_at MY05C myosin VC 55930 1.536923 0.02094 0.129892
214455_at HIST1H2BC histone cluster 1, H2bc 8347 1.482403 0.023205 0.131273 dachshund homolog 1
205471_s_at DACH1 1602 0.95962 0.023854 0.131273
(Drosophila)
218346_s_at SESN1 sestrin 1 27244 1.057229 0.024057 0.131273
ATP -binding cassette, sub¬
209993_at ABCB1 family B (MDR/TAP), member 5243 1.012543 0.024783 0.131273
1
erythrocyte membrane protein
206710_s_at EPB41L3 23136 0.977202 0.024885 0.131273 band 4.1-like 3
202708_s_at HIST2H2BE histone cluster 2, H2be 8349 1.769114 0.02667 0.131273 serpin peptidase inhibitor,
200986_at SERPING1 clade G (CI inhibitor), member 710 1.048714 0.026758 0.131273
1
egf-like module containing,
207111_at EMR1 mucin-like, hormone receptor2015 1.04867 0.026977 0.131273 like 1
chromosome X open reading
219355_at CXorf57 55086 0.956366 0.027482 0.131273 frame 57
adeno sylmethionine
201196_s_at AMD1 262 1.127364 0.02763 0.131273 decarboxylase 1
O-linked N-acetylglucosamine
207564_x_at OGT 8473 1.180955 0.027642 0.131273
(GlcNAc) transferase
202686_s_at AXL AXL receptor tyrosine kinase 558 -1.17476 0.027808 0.131273
ADAM metallopeptidase
208268_at ADAM28 10863 1.222576 0.028106 0.131273 domain 28
215307_at ZNF529 zinc finger protein 529 57711 1.029099 0.028782 0.132865
219571_s_at ZNF12 zinc finger protein 12 7559 1.033403 0.030225 0.136525
ATP -binding cassette, sub¬
209994_s_at ABCB1 family B (MDR/TAP), member 5243 0.988532 0.030956 0.136933
1
sortilin-related receptor,
212560_at SORL1 L(DLR class) A repeats 6653 1.232375 0.031193 0.136933 containing
205767_at EREG epiregulin 2069 1.576209 0.032309 0.137923
A kinase (PRKA) anchor
221718_s_at AKAP13 11214 0.990575 0.033371 0.139481 protein 13
214472_at HIST1H2AD histone cluster 1 , H2ad 3013 1.221696 0.034306 0.139481 spectrin repeat containing,
209447_at SYNE1 23345 1.026492 0.034672 0.139481 nuclear envelope 1
thymocyte selection associated
207571_x_at THEMIS2 9473 1.23688 0.035236 0.139481 family member 2
thymocyte selection associated
210785_s_at THEMIS2 9473 1.258674 0.035631 0.139481 family member 2
209543_s_at CD34 CD34 molecule 947 1.31764 0.037479 0.144458 pleckstrin homology domain
220952_s_at PLEKHA5 54477 1.059186 0.039091 0.147854 containing, family A member 5
TIA1 cytotoxic granule-
201448_at TIA1 associated RNA binding 7072 1.289342 0.039105 0.147854 protein
221543_s_at ERLIN2 ER lipid raft associated 2 11160 1.019463 0.040859 0.150196
206715_at TFEC transcription factor EC 22797 1.291151 0.042627 0.153844 multiple C2 domains,
220122_at MCTP1 79772 1.025269 0.043486 0.155532 transmembrane 1
pleiomorphic adenoma gene¬
209318_x_at PLAGL1 5325 1.315505 0.046285 0.160061 like 1
core-binding factor, runt
208056_s_at CBFA2T3 domain, alpha subunit 2; 863 1.116738 0.04637 0.160061 translocated to, 3
2'-5'-oligoadenylate synthetase
204972_at OAS2 4939 1.090829 0.046707 0.160061
2, 69/71kDa
201236_s_at BTG2 BTG family, member 2 7832 1.091134 0.046768 0.160061
X inactive specific transcript
214218_s_at XI ST 7503 1.3244 0.04853 0.163276
(non-protein coding)
220940_at ANKRD36B ankyrin repeat domain 36B 57730 1.168735 0.049352 0.163699 nuclear factor (erythroid-
209930_s_at NFE2 4778 1.331755 0.050315 0.163699 derived 2), 45kDa
205239_at AREG amphiregulin 374 1.205571 0.051692 0.163838 zinc finger and SCAN domain
217593_at ZSCAN18 65982 0.840704 0.054078 0.167551 containing 18
222067_x_at HIST1H2BD histone cluster 1 , H2bd 3017 1.198697 0.063984 0.189566
213094_at GPR126 G protein-coupled receptor 126 57211 1.17747 0.06522 0.191029
212775_at OBSL1 obscurin-like 1 23363 1.331391 0.065586 0.191029 family with sequence similarity
221249_s_at FAM117A 81558 1.637593 0.066403 0.191029
117, member A
210172_at SF1 splicing factor 1 7536 0.997588 0.067011 0.191391 membrane-spanning 4-
207496_at MS4A2 domains, subfamily A, member 2206 0.772601 0.069284 0.193702
2
lysophosphatidic acid receptor
218589_at LPAR6 10161 1.080018 0.071983 0.199841
6
nucleosome assembly protein
204749_at NAP1L3 4675 1.296406 0.073554 0.202786
1-like 3
phosphodiesterase 4B, cAMP-
211302_s_at PDE4B 5142 0.858839 0.076239 0.207306 specific
215779_s_at HIST1H2BG histone cluster 1 , H2bg 8339 0.902184 0.076987 0.207917
213293_s_at TRIM22 tripartite motif containing 22 10346 1.468514 0.077535 0.207984 regulator of chromosome
condensation (RCC1) and BTB
218352_at RCBTB1 55213 1.08448 0.082823 0.214891
(POZ) domain containing
protein 1
RUNX1 intronic transcript 1
220918_at RUNX1-IT1 80215 1.110688 0.083008 0.214891
(non-protein coding)
204116_at IL2RG interleukin 2 receptor, gamma 3561 0.892953 0.085322 0.217134
membrane-spanning 4-
210254_at MS4A3 domains, subfamily A, member 932 1.032003 0.088393 0.223517
3 (hematopoietic cell-specific)
DEAD (Asp-Glu-Ala-Asp) box
213998_s_at DDX17 10521 1.29709 0.090384 0.225675 helicase 17
prostaglandin E receptor 2
20663 l_at PTGER2 5732 0.863461 0.094568 0.233189
(subtype EP2), 53kDa
219737_s_at PCDH9 protocadherin 9 5101 1.423384 0.095952 0.235143
206067_s_at WT1 Wilms tumor 1 7490 -0.97509 0.097098 0.235189
212813_at JAM3 junctional adhesion molecule 3 83700 0.851683 0.097156 0.235189 phosphodiesterase 4B, cAMP-
203708_at PDE4B 5142 1.258787 0.098941 0.236778 specific
WD repeat and SOCS box
213734_at WSB2 55884 -1.03595 0.103178 0.243147 containing 2
212382_at TCF4 transcription factor 4 6925 1.222721 0.103506 0.243147
212044_s_at RPL27A ribosomal protein L27a 6157 -1.30359 0.11014 0.255203 chemokine (C-X-C motif)
209774_x_at CXCL2 2920 -1.35733 0.111447 0.255748 ligand 2
204420_at FOSL1 FOS-like antigen 1 8061 0.777712 0.125065 0.28372
HECT and RLD domain
219352_at HERC6 containing E3 ubiquitin protein 55008 0.731325 0.126978 0.286421 ligase family member 6
219371_s_at KLF2 Kruppel-like factor 2 (lung) 10365 0.952494 0.133808 0.29512
208436_s_at IRF7 interferon regulatory factor 7 3665 0.817301 0.142117 0.308309
208490_x_at HIST1H2BF histone cluster 1, H2bf 8343 0.823714 0.153384 0.325493 homocysteine-inducible,
endoplasmic reticulum stress-
217168_s_at HERPUD1 9709 -1.02032 0.153554 0.325493 inducible, ubiquitin-like
domain member 1
218723_s_at RGCC regulator of cell cycle 28984 1.178353 0.16831 0.347202
221943_x_at RPL38 ribosomal protein L38 6169 -0.87537 0.169666 0.347202
202912_at ADM adrenomedullin 133 -0.90139 0.175228 0.356746 myxovirus (influenza virus)
202086_at MX1 resistance 1 , interferon- 4599 1.082812 0.179388 0.362009 inducible protein p78 (mouse)
204794_at DUSP2 dual specificity phosphatase 2 1844 -1.05607 0.185851 0.370769 endothelial PAS domain
200878_at EPAS1 2034 -0.94127 0.187138 0.371469 protein 1
eukaryotic translation
elongation factor 1 delta
214395_x_at EEF1D 1936 -0.75421 0.221404 0.418581
(guanine nucleotide exchange
protein)
39248_at AQP3 aquaporin 3 (Gill blood group) 360 -1.0387 0.221416 0.418581
201590_x_at ANXA2 annexin A2 302 -0.83364 0.224539 0.422475
202087_s_at CTSL1 cathepsin LI 1514 -0.72277 0.227535 0.426091
CDC28 protein kinase
201897_s_at C S1B 1163 -0.75777 0.23559 0.436077 regulatory subunit IB
2'-5'-oligoadenylate synthetase
202869_at OAS1 4938 0.645604 0.239395 0.44 l, 40/46kDa
20435 l_at S100P SI 00 calcium binding protein P 6286 -1.19041 0.248298 0.447645 hydroxycarboxylic acid
205220_at HCAR3 8843 -0.75269 0.248929 0.447645 receptor 3
cysteine-rich, angiogenic
201289_at CYR61 3491 -0.94996 0.249241 0.447645 inducer, 61
twist basic helix-loop-helix
213943_at TWIST 1 7291 -0.76051 0.251394 0.447645 transcription factor 1
inhibitor of DNA binding 2,
201566_x_at ID2 dominant negative helix-loop- 3398 0.738645 0.252916 0.448249 helix protein
phorbol- 12-myristate- 13-
204286_s_at PMAIP1 5366 0.658217 0.254968 0.449876 acetate-induced protein 1
protein tyrosine phosphatase,
203038_at PTPR 5796 -0.89732 0.259282 0.450102 receptor type,
caveolin 1, caveolae protein,
212097_at CAV1 857 -0.8953 0.259704 0.450102
22kDa
prolyl 4 -hydroxylase, alpha
202733_at P4HA2 8974 -0.88547 0.260765 0.450102 polypeptide II
coxsackie virus and adenovirus
203917_at CXADR 1525 -0.70323 0.261975 0.450233 receptor
chemokine (C-C motif) ligand
204103_at CCL4 6351 -0.93799 0.264919 0.453331
4
202458_at PRSS23 protease, serine, 23 11098 -0.75062 0.266945 0.454838
CD3d molecule, delta (CD3-
213539_at CD3D 915 -0.74368 0.268679 0.455836
TCR complex)
granzyme H (cathepsin G-like
210321_at GZMH 2999 -0.6763 0.279967 0.472525
2, protein h-CCPX)
214453_s_at IFI44 interferon-induced protein 44 10561 0.80743 0.280897 0.472525
aminolevulinate, delta-,
211560_s_at ALAS2 212 -0.96058 0.293731 0.486931 synthase 2
201744_s_at LUM lumican 4060 -0.72481 0.298238 0.491288 melanoma cell adhesion
211340_s_at MCAM 4162 -0.77567 0.306814 0.499201 molecule
myeloid cell nuclear
204959_at MNDA 4332 -0.90022 0.316701 0.504456 differentiation antigen
202587_s_at AK1 adenylate kinase 1 203 -0.63641 0.317949 0.504456
218959_at HOXC10 homeobox CIO 3226 -0.61573 0.319085 0.504456
205495_s_at ONLY granulysin 10578 -0.68517 0.320209 0.504456
221958_s_at WLS wntless homolog (Drosophila) 79971 -0.70884 0.324929 0.50696 tumor necrosis factor (ligand)
202688_at TNFSF10 8743 0.618043 0.325629 0.50696 superfamily, member 10
melanoma cell adhesion
209087_x_at MCAM 4162 -0.81432 0.326954 0.507034 molecule
209210_s_at FERMT2 fermitin family member 2 10979 -1.11824 0.329723 0.50854 granzyme A (granzyme 1 ,
205488_at GZMA cytotoxic T-lymphocyte- 3001 -0.59006 0.330487 0.50854 associated serine esterase 3)
serum/glucocorticoid regulated
201739_at SG 1 6446 -1.0293 0.335357 0.508988 kinase 1
211506_s_at IL8 interleukin 8 3576 -0.69682 0.336251 0.508988
204962_s_at CENPA centromere protein A 1058 -0.67424 0.336317 0.508988
212698_s_at 10-Sep sep tin 10 151011 -0.74724 0.337188 0.508988
33322_i_at SFN strati fin 2810 -0.75401 0.341463 0.509458
218705_s_at SNX24 sorting nexin 24 28966 -0.57987 0.342374 0.509458
2'-5'-oligoadenylate synthetase
205552_s_at OAS1 4938 0.50836 0.344124 0.509458 l, 40/46kDa
transforming growth factor,
201506_at TGFBI 7045 -0.66233 0.345804 0.509458 beta-induced, 68kDa
20201 l_at TJP1 tight junction protein 1 7082 -0.64431 0.347774 0.509458 peptidylprolyl isomerase C
204517_at PPIC 5480 -0.59936 0.349374 0.509458
(cyclophilin C)
nuclear protein, transcriptional
209230_s_at NUP 1 26471 -0.65323 0.350449 0.509458 regulator, 1
oxysterol binding protein-like
219073_s_at OSBPL10 114884 -0.59261 0.351262 0.509458
10
chemokine (C-C motif) ligand
205476_at CCL20 6364 -0.6399 0.357651 0.512993
20
221577_x_at GDF15 growth differentiation factor 15 9518 -0.65491 0.364519 0.516042 insulin-like growth factor
202718_at IGFBP2 3485 -0.57195 0.365259 0.516042 binding protein 2, 36kDa
cyclin-dependent kinase
207039_at CDKN2A 1029 -0.71306 0.36807 0.517873 inhibitor 2A
carbamoyl-phosphate synthase
204920_at CPS1 1373 -0.81774 0.369164 0.517873
1, mitochondrial
laminin, gamma 1 (formerly
20077 l_at LAMC1 3915 -0.65676 0.37062 0.518085
LAMB 2)
219454_at EGFL6 EGF-like-domain, multiple 6 25975 -0.56974 0.374512 0.518966
LIM and calponin homology
212328_at LIMCH1 22998 -0.72538 0.37555 0.518966 domains 1
207076_s_at ASS1 argininosuccinate synthase 1 445 -0.96506 0.376479 0.518966 epidermal growth factor
201983_s_at EGFR 1956 -0.56631 0.379717 0.519326 receptor
203438_at STC2 stanniocalcin 2 8614 -0.54868 0.385726 0.520981 peroxidasin homolog
212012_at PXDN 7837 -0.69905 0.3859 0.520981
(Drosophila)
interferon-induced protein with
203153_at IFIT1 3434 0.55537 0.389138 0.520981 tetratricopeptide repeats 1
killer cell lectin-like receptor
206785_s_at KLRC1 3821 -0.5784 0.393476 0.520981 subfamily C, member 1
carbamoyl-phosphate synthase
217564_s_at CPS1 1373 -0.79731 0.394672 0.520981
1, mitochondrial
202052_s_at RAI14 retinoic acid induced 14 26064 -0.5724 0.3967 0.520981
204992_s_at PFN2 profilin 2 5217 -0.772 0.396957 0.520981
Fc fragment of IgG, low
204007_at FCGR3B 2215 -0.64158 0.397187 0.520981 affinity Illb, receptor (CD 16b)
insulin-like growth factor
210095_s_at IGFBP3 3486 -0.60033 0.397625 0.520981 binding protein 3
myeloid cell leukemia
200798_x_at MCL1 4170 0.540947 0.39956 0.521124 sequence 1 (BCL2-related)
212364_at MY01B myosin IB 4430 -0.55526 0.401476 0.521124 calmodulin regulated spectrin-
212765_at CAMSAP2 associated protein family, 23271 -0.56269 0.401672 0.521124 member 2
protein phosphatase 1,
204284_at PPP1R3C 5507 -0.54464 0.406184 0.523753 regulatory subunit 3C
201976_s_at MYO10 myosin X 4651 -0.55951 0.406337 0.523753
208079_s_at AURKA aurora kinase A 6790 -0.65513 0.408025 0.524226
219959_at MOCOS molybdenum cofactor sulfurase 55034 -0.85667 0.410521 0.525731
213139_at SNAI2 snail homolog 2 (Drosophila) 6591 -0.55315 0.414603 0.526676 topoisomerase (DNA) II alpha
201292_at TOP2A 7153 -0.61773 0.41473 0.526676
170kDa
209101_at CTGF connective tissue growth factor 1490 -0.63969 0.416358 0.526676
210587_at INHBE inhibin, beta E 83729 -0.61908 0.419791 0.526676
FBJ murine osteosarcoma viral
202768_at FOSB 2354 0.785327 0.421407 0.526676 oncogene homolog B
219148_at PB PDZ binding kinase 55872 -0.62389 0.422616 0.526676
201505_at LAMB 1 laminin, beta 1 3912 -0.59203 0.422812 0.526676 interferon-induced protein 44-
204439_at IFI44L 10964 0.779572 0.423198 0.526676 like
204688_at SGCE sarcoglycan, epsilon 8910 -0.53807 0.427632 0.530004
210274_at MAGEA8 melanoma antigen family A, 8 4107 -0.55437 0.440077 0.53411
2'-5'-oligoadenylate synthetase
218400_at OAS3 4940 0.401878 0.441825 0.53411
3, lOOkDa
thyroid hormone receptor
204033_at TRIP 13 9319 -0.53242 0.443536 0.53411 interactor 13
205033_s_at DEFA1 defensin, alpha 1 1667 -0.68446 0.443688 0.53411 solute carrier family 7 (anionic
20992 l_at SLC7A11 amino acid transporter light 23657 -0.67363 0.443971 0.53411 chain, xc- system), member 11
interferon, alpha-inducible
204415_at IFI6 2537 0.448113 0.446822 0.53412 protein 6
met proto-oncogene
203510_at MET (hepatocyte growth factor 4233 -0.59266 0.449267 0.53412 receptor)
33323_r_at SFN strati fin 2810 -0.63466 0.450623 0.53412 major histocompatibility
212671_s_at HLA-DQA1 3117 -0.73617 0.45086 0.53412 complex, class II, DQ alpha 1
asparagine synthetase
205047_s_at ASNS 440 -0.62208 0.454871 0.534967
(glutamine-hydrolyzing)
200606_at DSP desmoplakin 1832 -0.6615 0.455463 0.534967
205573_s_at SNX7 sorting nexin 7 51375 -0.50744 0.460196 0.538931
204684_at NPTX1 neuronal pentraxin I 4884 -0.48978 0.463571 0.540181
204483_at EN03 enolase 3 (beta, muscle) 2027 -0.57582 0.463984 0.540181 alanine-glyoxylate
221008_s_at AGXT2L1 64850 -0.59789 0.471814 0.545637 aminotransferase 2-like 1
200795_at SPARCL1 SPARC-like 1 (hevin) 8404 -0.50481 0.475562 0.546517
211618_s_at ALPI alkaline phosphatase, intestinal 248 -0.48827 0.477352 0.546517
207140_at ALPI alkaline phosphatase, intestinal 248 -0.90959 0.477868 0.546517 sorbin and SH3 domain
204288_s_at SORBS2 8470 -0.52462 0.481567 0.546517 containing 2
discs, large homolog 5
201681_s_at DLG5 9231 -0.47202 0.48294 0.546517
(Drosophila)
203881_s_at DMD dystrophin 1756 -0.49504 0.483193 0.546517 eiikaryotic translation initiation
219599_at EIF4B 1975 -0.53684 0.487369 0.548489 factor 4B
midline 1 (Opitz/BBB
203636_at MIDI 4281 -0.45754 0.488315 0.548489 syndrome)
214240_at GAL galanin/GMAP prepropeptide 51083 -0.50116 0.489081 0.548489 dimethylarginine
209094_at DDAH1 23576 -0.51772 0.495452 0.554068 dimethylaminohydrolase 1
21863 l_at AVPI1 arginine vasopressin-induced 1 60370 -0.49809 0.500208 0.556142 eiikaryotic translation
204540_at EEF1A2 1917 -0.42637 0.500471 0.556142 elongation factor 1 alpha 2
myelin transcription factor 1 -
210016_at MYT1L 23040 -0.55739 0.502376 0.556142 like
205289_at BMP2 bone morphogenetic protein 2 650 -0.51385 0.50342 0.556142
20575 l_at SH3GL2 SH3 -domain GRB2-like 2 6456 -0.43617 0.50431 0.556142 chromosome 8 open reading
218541_s_at C8orf4 56892 -0.52893 0.509174 0.559951 frame 4
dickkopf 3 homolog (Xenopus
214247_s_at DKK3 27122 -0.51465 0.511216 0.560643 laevis)
214212_x_at FERMT2 fermitin family member 2 10979 -0.44903 0.514141 0.562297 complement component 4
208209_s_at C4BPB 725 -0.49739 0.518251 0.565235 binding protein, beta
phosphodiesterase 1A,
208396_s_at PDE1A 5136 -0.46854 0.526142 0.571827 calmodulin-dependent
209942_x_at MAGEA3 melanoma antigen family A, 3 4102 -0.58148 0.5289 0.572135
214612_x_at MAGEA6 melanoma antigen family A, 6 4105 -0.60458 0.532798 0.57304 acyl-CoA synthetase long-
201660_at ACSL3 2181 -0.42544 0.533497 0.57304 chain family member 3
204975_at EMP2 epithelial membrane protein 2 2013 -0.47324 0.536232 0.57304 gap junction protein, alpha 1 ,
201667_at GJA1 2697 -0.55978 0.536604 0.57304
43kDa
topoisomerase (DNA) II alpha
201291_s_at TOP2A 7153 -0.51625 0.536954 0.57304
170kDa
transcription factor AP-2 alpha
204653_at TFAP2A (activating enhancer binding 7020 -0.43406 0.544838 0.579895 protein 2 alpha)
205132_at ACTC1 actin, alpha, cardiac muscle 1 70 -0.38632 0.55232 0.584901 cystathionase (cystathionine
217127_at CTH 1491 -0.44229 0.552489 0.584901 gamma-lyase)
leucine rich repeat containing
20538 l_at LR C17 10234 -0.39955 0.554073 0.585019
17
cAMP responsive element
209967_s_at CREM 1390 -0.45103 0.557616 0.587198 modulator
202672_s_at ATF3 activating transcription factor 3 467 0.490404 0.560082 0.587586
G protein-coupled receptor 37
20963 l_s_at GPR37 (endothelin receptor type B- 2861 -0.44217 0.560945 0.587586 like)
221730_at COL5A2 collagen, type V, alpha 2 1290 -0.40443 0.562469 0.587632 melanoma antigen family A,
210467_x_at MAGEA12 4111 -0.46503 0.566943 0.590752
12
203083_at THBS2 thrombospondin 2 7058 -0.37936 0.569007 0.59135 transmembrane 4 L six family
215034_s_at TM4SF1 4071 -0.4484 0.571318 0.592202 member 1
206377_at FOXF2 forkhead box F2 2295 -0.36443 0.585328 0.605143
213131_at OLFM1 olfactomedin 1 10439 -0.35953 0.610643 0.629676
Rho-related BTB domain
202976_s_at RHOBTB3 22836 -0.3467 0.614674 0.63219 containing 3
DNA-damage-inducible
202887_s_at DDIT4 54541 -0.45548 0.618537 0.63452 transcript 4
caspase 9, apoptosis-related
203984_s_at CASP9 842 -0.35376 0.632586 0.647259 cysteine peptidase
205290_s_at BMP2 bone morphogenetic protein 2 650 -0.47882 0.640799 0.653977 regulator of G-protein
204337_at RGS4 5999 -0.26477 0.708833 0.717874 signaling 4
beta-site APP-cleaving enzyme
217867_x_at BACE2 25825 -0.2906 0.71423 0.721499
2
LIM and calponin homology
212327_at LIMCH1 22998 -0.28139 0.723086 0.728591 domains 1
brain abundant, membrane
20239 l_at BASP1 10409 0.338672 0.73503 0.738752 attached signal protein 1
Table 5. Gene Expression in Men Patients
serine/arginine-rich splicing
212266_s_at S SF5 6430 1.814328 0.012914 0.22461 factor 5
201489_at PPIF peptidylprolyl isomerase F 10105 -1.57807 0.013197 0.22461
Rap guanine nucleotide
203096_s_at RAPGEF2 9693 -1.90184 0.013308 0.22461 exchange factor (GEF) 2
prostaglandin-endoperoxide
205128_x_at PTGS1 synthase 1 (prostaglandin G/H 5742 -1.98263 0.013941 0.22461 synthase and cyclooxygenase)
coactosin-like 1
221059_s_at COTL1 23406 -2.38475 0.014419 0.22461
(Dictyostelium)
serpin peptidase inhibitor, clade
212268_at SERPINB 1 1992 1.576065 0.015209 0.22461
B (ovalbumin), member 1
201012_at ANXA1 annexin Al 301 1.431866 0.015821 0.22461
207808_s_at PROS1 protein S (alpha) 5627 -2.54684 0.01834 0.22461 nudix (nucleoside diphosphate
206302_s_at NUDT4 11163 -1.35819 0.01853 0.22461 linked moiety X)-type motif 4
203320_at SH2B3 SH2B adaptor protein 3 10019 -1.48125 0.019452 0.22461
RAD52 homolog (S.
205647_at RAD52 5893 1.244884 0.019524 0.22461 cerevisiae)
FYN oncogene related to SRC,
210105_s_at FYN 2534 -1.57809 0.020057 0.22461
FGR, YES
heat shock protein 90kDa beta
200598_s_at HSP90B1 7184 -1.77815 0.020317 0.22461
(Grp94), member 1
ubiquitin-like modifier
200964_at UBA1 7317 -1.39778 0.020397 0.22461 activating enzyme 1
221493_at TSPYL1 TSPY-like 1 7259 1.744517 0.021178 0.22461 protein phosphatase 6, catalytic
206174_s_at PPP6C 5537 -1.35248 0.021364 0.22461 subunit
cyclin-dependent kinase
202284_s_at CDKN1A 1026 -2.00033 0.023319 0.22461 inhibitor 1Α (ρ21, Cipl)
206207_at CLC Charcot-Leyden crystal protein 1178 -1.88811 0.023511 0.22461 glycoprotein lb (platelet), beta
206655_s_at GP1BB 2812 -2.92989 0.023514 0.22461 polypeptide
mitogen-activated protein
206571_s_at MAP4 4 9448 -1.25865 0.02388 0.22461 kinase kinase kinase kinase 4
transforming growth factor beta
20965 l_at TGFB1I1 7041 -2.18243 0.024567 0.22461
1 induced transcript 1
hematopoietically expressed
204689_at HHEX 3087 1.462027 0.024863 0.22461 homeobox
205067_at IL1B interleukin 1, beta 3553 1.255404 0.025653 0.22461 serine/arginine-rich splicing
203380_x_at S SF5 6430 1.503237 0.025756 0.22461 factor 5
lectin, galactoside-binding,
200923_at LGALS3BP 3959 -1.56076 0.025836 0.22461 soluble, 3 binding protein
202949_s_at FHL2 four and a half LIM domains 2 2274 -1.37209 0.026399 0.22461 purine nucleoside
201695_s_at PNP 4860 -1.41068 0.026458 0.22461 phosphorylase
220748_s_at ZNF580 zinc finger protein 580 51157 -1.34215 0.028123 0.22461
217901_at DSG2 desmoglein 2 1829 1.320976 0.028803 0.22461 methylphosphate capping
219798_s_at MEPCE 56257 -1.33001 0.029245 0.22461 enzyme
splicing factor 3a, subunit 2,
20938 l_x_at SF3A2 8175 -1.41034 0.029259 0.22461
66kDa
204222_s_at GLIPR1 GLI pathogenesis-related 1 11010 1.439903 0.030437 0.22461
221004_s_at ITM2C integral membrane protein 2C 81618 1.219859 0.030753 0.22461 selectin P (granule membrane
206049_at SELP 6403 -2.17111 0.031111 0.22461 protein 140kDa, antigen CD62)
37966_at PARVB parvin, beta 29780 -2.06542 0.031383 0.22461
RAB 11 family interacting
219681_s_at RAB11FIP1 80223 -1.35248 0.031529 0.22461 protein 1 (class I)
212242_at TUBA4A tubulin, alpha 4a 7277 -2.39641 0.03153 0.22461 solute carrier family 38,
218237_s_at SLC38A1 81539 1.547237 0.032294 0.22461 member 1
213726_x_at TUBB4B tubulin, beta 4B class IVb 10383 -1.30164 0.032486 0.22461
39402_at IL1B interleukin 1, beta 3553 1.235287 0.032639 0.22461
209820_s_at TBL3 transducin (beta)-like 3 10607 -1.20712 0.032649 0.22461
212312_at BCL2L1 BCL2-like 1 598 -1.39562 0.033632 0.22461 protein tyrosine phosphatase,
211600_at PTPRO 5800 -1.45225 0.03416 0.22461 receptor type, 0
214783_s_at ANXA11 annexin Al l 311 -1.22688 0.034175 0.22461
200616_s_at MLEC malectin 9761 -1.20495 0.034386 0.22461 myosin, heavy chain 9, non-
211926_s_at MYH9 4627 -1.2641 0.034926 0.22461 muscle
karyopherin alpha 1 (importin
202059_s_at KPNA1 3836 -1.12248 0.034962 0.22461 alpha 5)
NEDD4 binding protein 2-like
221899_at N4BP2L2 10443 1.316587 0.035008 0.22461
2
B-cell CLL/lymphoma 11 A
210347_s_at BCL11A 53335 1.273905 0.035019 0.22461
(zinc finger protein)
221748_s_at TNS1 tensin 1 7145 -1.4894 0.035747 0.22461
203940_s_at VASH1 vasohibin 1 22846 -1.35628 0.037032 0.22461 coiled-coil domain containing
204610_s_at CCDC85B 11007 -1.5951 0.037663 0.22461
85B
leucine rich repeat containing
22223 l_s_at LR C59 55379 -1.11855 0.038092 0.22461
59
PNN-interacting
212177_at PNIS 25957 1.175547 0.038211 0.22461 serine/ arginine-rich protein
sigma non-opioid intracellular
201692_at SIGMAR1 10280 -1.06876 0.038307 0.22461 receptor 1
202112_at VWF von Willebrand factor 7450 -1.36382 0.039327 0.22461 serine peptidase inhibitor,
206310_at SPINK2 azal type 2 (acrosin-trypsin 6691 1.568851 0.039466 0.22461 inhibitor)
brain and acute leukemia,
218899_s_at BAALC 79870 1.51143 0.039771 0.22461 cytoplasmic
208308_s_at GPI glucose-6-phosphate isomerase 2821 -1.24247 0.040139 0.22461
221834_at LONP2 Ion peptidase 2, peroxisomal 83752 1.261036 0.040303 0.22461
210719_s_at HMG20B high mobility group 20B 10362 -1.39762 0.040525 0.22461
200808_s_at ZYX zyxin 7791 -1.54764 0.041293 0.22461 glycogen synthase kinase 3
209945_s_at GS 3B 2932 -1.28118 0.041713 0.22461 beta
208637_x_at ACTN1 actinin, alpha 1 87 -1.74284 0.041994 0.22461
209088_s_at UBN1 ubinuclein 1 29855 -1.14187 0.042143 0.22461
211005_at LAT linker for activation of T cells 27040 -1.83145 0.042364 0.22461
GATA zinc finger domain
218131_s_at GATAD2A 54815 -1.22531 0.042653 0.22461 containing 2A
latent transforming growth
202729_s_at LTBP1 4052 -1.87245 0.042694 0.22461 factor beta binding protein 1
219357_at GTPBP1 GTP binding protein 1 9567 -1.11964 0.042776 0.22461
201980_s_at RSU1 Ras suppressor protein 1 6251 -1.33636 0.043967 0.22461 nuclear receptor subfamily 3,
211671_s_at NR3C1 group C, member 1 2908 1.257541 0.044183 0.22461
(glucocorticoid receptor)
203007_x_at LYPLA1 lysophospholipase I 10434 -1.24485 0.04487 0.22461
210299_s_at FHL1 four and a half LIM domains 1 2273 1.459962 0.045279 0.22461
C-type lectin domain family
210783_x_at CLEC11A 6320 -1.14617 0.045531 0.22461
11, member A
Taxi (human T-cell leukemia
209154_at TAX1BP3 30851 -1.80171 0.045558 0.22461 virus type I) binding protein 3
212279_at TMEM97 transmembrane protein 97 27346 -1.20825 0.046373 0.22461
202102_s_at BRD4 bromodomain containing 4 23476 -1.31832 0.046377 0.22461
S-phase kinase-associated
200719_at SKP1 6500 -1.18511 0.046416 0.22461 protein 1
integrin, alpha 4 (antigen
213416_at ITGA4 CD49D, alpha 4 subunit of 3676 1.500306 0.046971 0.22461
VLA-4 receptor)
201251_at P M pyruvate kinase, muscle 5315 -1.61415 0.04732 0.22461 coiled-coil domain containing
220094_s_at CCDC90A 63933 -1.33066 0.048464 0.22461
90A
glucose-6-phosphate
202275_at G6PD 2539 -1.46785 0.04883 0.22461 dehydrogenase
pro-platelet basic protein
214146_s_at PPBP (chemokine (C-X-C motif) 5473 -2.44242 0.049566 0.22461 ligand 7)
neurogranin (protein kinase C
204081_at NRGN 4900 -2.56374 0.049579 0.22461 substrate, RC3)
RNA binding motif, single
209868_s_at RBMS1 5937 1.165728 0.050155 0.22461 stranded interacting protein 1
211922_s_at CAT catalase 847 1.232958 0.051088 0.22461
SR-related CTD-associated
222310_at SCAF4 57466 1.077534 0.05119 0.22461 factor 4
200697_at H 1 hexokinase 1 3098 -1.1627 0.051949 0.22461 lipopolysaccharide-induced
200706_s_at LITAF 9516 1.091394 0.052104 0.22461
TNF factor
RAB IB, member RAS
220964_s_at RAB1B 81876 -1.24067 0.052429 0.22461 oncogene family
210215_at TFR2 transferrin receptor 2 7036 -1.65926 0.052589 0.22461
201260_s_at SYPL1 synaptophysin-like 1 6856 1.519931 0.052716 0.22461
221771_s_at MPHOSPH8 M-phase phosphoprotein 8 54737 1.277564 0.053033 0.22461
210986_s_at TPM1 tropomyosin 1 (alpha) 7168 -1.54226 0.053308 0.22461
203674_at HELZ helicase with zinc finger 9931 1.115528 0.053318 0.22461 protein tyrosine phosphatase,
207238_s_at PTPRC 5788 1.189131 0.053365 0.22461 receptor type, C
201864_at GDI1 GDP dissociation inhibitor 1 2664 -1.17328 0.053513 0.22461
pinin, desmosome associated
212036_s_at PNN 5411 1.514285 0.053837 0.22461 protein
protein tyrosine phosphatase,
213521_at PTPN18 non-receptor type 18 (brain- 26469 -1.32436 0.05412 0.22461 derived)
tumor necrosis factor, alpha-
202644_s_at TNFAIP3 7128 -1.72075 0.054213 0.22461 induced protein 3
solute carrier family 24
219090_at SLC24A3 (sodium/potassium/calcium 57419 -1.33752 0.054392 0.22461 exchanger), member 3
209117_at WBP2 WW domain binding protein 2 23558 -1.30969 0.054585 0.22461 aldo-keto reductase family 1,
209160_at A R1C3 8644 1.332339 0.054731 0.22461 member C3
transforming growth factor,
203085_s_at TGFB1 7040 -1.75422 0.055437 0.22461 beta 1
adaptor-related protein
200613_at AP2M1 1173 -1.26768 0.05634 0.22461 complex 2, mu 1 subunit
protein-L-isoaspartate (D-
212406_s_at PCMTD2 aspartate) O-methyltransferase 55251 1.40919 0.057779 0.22461 domain containing 2
212281_s_at TMEM97 transmembrane protein 97 27346 -1.25212 0.058007 0.22461 epidermal growth factor
222113_s_at EPS15L1 receptor pathway substrate 15- 58513 -1.22321 0.058228 0.22461 like 1
chromosome 9 open reading
41047_at C9orfl6 79095 -1.3784 0.058369 0.22461 frame 16
202083_s_at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -1.60251 0.058462 0.22461
43544_at MED 16 mediator complex subunit 16 10025 -1.37264 0.059358 0.22461
208398_s_at TBPL1 TBP-like 1 9519 -1.09285 0.060353 0.22461
20000 l_at CAPNS1 calpain, small subunit 1 826 -1.38469 0.060708 0.22461
203321_s_at ADNP2 ADNP homeobox 2 22850 -1.14224 0.060952 0.22461
214752_x_at FLNA filamin A, alpha 2316 -1.51816 0.061564 0.22461 eukaryotic translation initiation
221539_at EIF4EBP1 1978 -1.09846 0.062496 0.22461 factor 4E binding protein 1
alpha thalassemia/mental
208860_s_at ATRX 546 1.305128 0.06313 0.22461 retardation syndrome X-linked
hematopoietically expressed
215933_s_at HHEX 3087 1.399528 0.063251 0.22461 homeobox
NEDD4 binding protein 2-like
214753_at N4BP2L2 10443 1.043575 0.063268 0.22461
2
208284_x_at GGT1 gamma-glutamyltransferase 1 2678 -1.13931 0.063281 0.22461 katanin p80 (WD repeat
203163_at KATNB1 10300 -1.04468 0.06434 0.22461 containing) subunit B 1
209301_at CA2 carbonic anhydrase II 760 -1.80993 0.064349 0.22461 chromosome 9 open reading
204480_s_at C9orfl6 79095 -1.50337 0.064729 0.22461 frame 16
205668_at LY75 lymphocyte antigen 75 4065 1.143917 0.064806 0.22461 adaptor-related protein
211047_x_at AP2S1 1175 -1.1541 0.065359 0.22461 complex 2, sigma 1 subunit
201563_at SORD sorbitol dehydrogenase 6652 -1.02865 0.066229 0.225836
214246_x_at MINK1 misshapen-like kinase 1 50488 -1.37631 0.066383 0.225836
212563_at BOP1 block of proliferation 1 23246 -1.07647 0.067055 0.226454
215706_x_at ZYX zyxin 7791 -1.14429 0.067478 0.226454
215116_s_at DNM1 dynamin 1 1759 -1.02496 0.067568 0.226454 splicing factor 3b, subunit 4,
209044_x_at SF3B4 10262 -1.14403 0.069176 0.227703
49kDa
208977_x_at TUBB4B tubulin, beta 4B class IVb 10383 -1.06783 0.069385 0.227703
203175_at RHOG ras homolog family member G 391 -1.12466 0.07026 0.227703
NME/NM23 nucleoside
212739_s_at NME4 4833 -1.18 0.070482 0.227703 diphosphate kinase 4
200734_s_at ARF3 ADP-ribosylation factor 3 377 -1.10487 0.070887 0.227703
ATPase, Ca++ transporting,
213036_x_at ATP2A3 489 -1.21253 0.07161 0.227703 ubiquitous
hepatocyte growth factor-
210428_s_at HGS regulated tyrosine kinase 9146 -1.08114 0.071709 0.227703 substrate
S-phase response (cyclin
206272_at SPHAR 10638 -1.37986 0.071711 0.227703 related)
200742_s_at TPP1 tripeptidyl peptidase I 1200 -1.44492 0.071977 0.227703
N-acetylgalactosaminidase,
202944_at NAGA 4668 -1.0861 0.073258 0.229457 alpha- superoxide dismutase 2,
216841_s_at SOD2 6648 -1.07023 0.073344 0.229457 mitochondrial
monocyte to macrophage
203414_at MMD 23531 -1.57415 0.073626 0.229457 differentiation-associated
215438_x_at GSPT1 Gl to S phase transition 1 2935 -1.03476 0.074204 0.229457
dynein, light chain, roadblock-
217918_at DYNLRB1 83658 -1.21177 0.07474 0.229995 type 1
integrin, beta 3 (platelet
204628_s_at ITGB3 glycoprotein Ilia, antigen 3690 -1.70942 0.076434 0.233122
CD61)
214450_at CTSW cathepsin W 1521 -1.09904 0.076703 0.233122 family with sequence similarity
203262_s_at FAM50A 9130 -1.05318 0.077683 0.233565
50, member A
integrin, alpha 2b (platelet
216956_s_at ITGA2B glycoprotein lib of Ilb/IIIa 3674 -2.02417 0.07797 0.233565 complex, antigen CD41)
cleavage and polyadenylation
201639_s_at CPSF1 29894 -1.05345 0.079365 0.234598 specific factor 1, 160kDa
v-maf musculoaponeurotic
3671 l_at MAFF fibrosarcoma oncogene 23764 -2.66779 0.079702 0.234598 homolog F (avian)
210910_s_at POMZP3 POM121 and ZP3 fusion 22932 -0.98043 0.080921 0.234598
206390_x_at PF4 platelet factor 4 5196 -2.17632 0.081141 0.234598
218443_s_at DAZAP1 DAZ associated protein 1 26528 -0.99013 0.081405 0.234598 proteasome (prosome,
201052_s_at PSMF1 macropain) inhibitor subunit 1 9491 -1.17083 0.081493 0.234598
(PI31)
Rho GDP dissociation inhibitor
211716_x_at ARHGDIA 396 -1.05994 0.081516 0.234598
(GDI) alpha
200839_s_at CTSB cathepsin B 1508 -1.23855 0.081791 0.234598
Fc fragment of IgG, low
203561_at FCGR2A 2212 -1.50392 0.082039 0.234598 affinity Ila, receptor (CD32)
21861 l_at IER5 immediate early response 5 51278 -1.41626 0.082127 0.234598 procollagen-lysine, 2-
202619_s_at PLOD2 5352 -1.06567 0.082911 0.234625 oxoglutarate 5-dioxygenase 2
integrin, beta 3 (platelet
204627_s_at ITGB3 glycoprotein Ilia, antigen 3690 -2.11954 0.083412 0.234625
CD61)
serine/arginine repetitive
201224_s_at SRRM1 10250 -1.23842 0.08352 0.234625 matrix 1
eukaryotic translation initiation
217736_s_at EIF2A 1 27102 -1.07432 0.083557 0.234625 factor 2-alpha kinase 1
200649_at NUCB1 nucleobindin 1 4924 -1.0434 0.085339 0.23596
CD36 molecule
209555_s_at CD36 948 -1.82889 0.086873 0.23596
(thrombospondin receptor)
SWI/SNF related, matrix
associated, actin dependent
212520_s_at SMARCA4 6597 -1.12786 0.086976 0.23596 regulator of chromatin,
subfamily a, member 4
209367_at STXBP2 syntaxin binding protein 2 6813 -1.12693 0.087289 0.23596
2-oxoglutarate and iron-
53071_s_at OGFOD3 dependent oxygenase domain 79701 -1.02384 0.087372 0.23596 containing 3
matrix metallopeptidase 24
221953_s_at MMP24 10893 -1.14292 0.087422 0.23596
(membrane-inserted)
protein tyrosine phosphatase-
212640_at PTPLB like (proline instead of catalytic 201562 1.184144 0.087703 0.23596 arginine), member b
201797_s_at VARS valyl-tRNA synthetase 7407 -0.95792 0.087831 0.23596
Fc fragment of IgE, high
204232_at FCER1G affinity I, receptor for; gamma 2207 -1.72735 0.088324 0.236346 polypeptide
biliverdin reductase B (flavin
20220 l_at BLVRB 645 -1.03625 0.088981 0.236552 reductase (NADPH))
ATP -binding cassette, sub¬
203192_at ABCB6 family B (MDR/TAP), member 10058 -1.03424 0.090022 0.237141
6
221829_s_at TNPOl transportin 1 3842 -1.16481 0.090459 0.237366 bobby sox homolog
213016_at BBX 56987 -1.01796 0.091007 0.237691
(Drosophila)
growth arrest and DNA-
207574_s_at GADD45B 4616 -1.53642 0.091507 0.237691 damage-inducible, beta
tryptase beta 2
207134_x_at TPSB2 64499 -1.2023 0.092025 0.237791
(gene/pseudogene)
ZFP36 ring finger protein-like
211962_s_at ZFP36L1 677 -1.08806 0.094727 0.239603
1
low density lipoprotein
201412_at LRPIO 26020 -1.16907 0.095687 0.239603 receptor-related protein 10
200859_x_at FLNA filamin A, alpha 2316 -1.28906 0.09598 0.239603
WD repeat and SOCS box
201760_s_at WSB2 55884 -0.9579 0.097393 0.239603 containing 2
UDP-N-acetyl-alpha-D- galactosamine:polypeptide N-
212256_at GALNT10 55568 -0.9355 0.097486 0.239603 acetylgalactosaminyltransferase
10 (GalNAc-TIO)
interferon, alpha-inducible
20241 l_at IFI27 3429 -1.2038 0.097807 0.239603 protein 27
diaphanous homolog 1
209190_s_at DIAPH1 1729 -1.03246 0.097812 0.239603
(Drosophila)
coiled-coil domain containing
212886_at CCDC69 26112 -1.0779 0.098162 0.239603
69
chromosome 15 open reading
215087_at C15orG9 56905 -1.19136 0.09937 0.239603 frame 39
211417_x_at GGT1 gamma-glutamyltransferase 1 2678 -0.97792 0.09942 0.239603 nucleolar and spindle
218039_at NUSAP1 51203 -1.16811 0.100201 0.239603 associated protein 1
l-acylglycerol-3 -phosphate O-
215535_s_at AGP ATI 10554 -1.14266 0.10071 0.239603 acyltransferase 1
proline-serine-threonine
219938_s_at PSTPIP2 phosphatase interacting protein 9050 -1.02201 0.100884 0.239603
2
213746_s_at FLNA filamin A, alpha 2316 -1.37828 0.100915 0.239603
20061 l_s_at WDR1 WD repeat domain 1 9948 -1.08654 0.101143 0.239603 protein tyrosine phosphatase
208615_s_at PTP4A2 8073 -1.16457 0.101287 0.239603 type IVA, member 2
208002_s_at ACOT7 acyl-CoA thioesterase 7 11332 -0.98943 0.101855 0.239603
Dab, mitogen-responsive
201280_s_at DAB 2 phosphoprotein, homolog 2 1601 -1.47352 0.10199 0.239603
(Drosophila)
ORAI calcium release-
217529_at ORAI2 80228 -0.94855 0.102013 0.239603 activated calcium modulator 2
214054_at DOK2 docking protein 2, 56kDa 9046 -1.44148 0.102476 0.239603
222043_at CLU clusterin 1191 -1.34754 0.102489 0.239603
201059_at CTTN cortactin 2017 -1.75221 0.102546 0.239603
220239_at KLHL7 kelch-like family member 7 55975 -1.04556 0.102824 0.239603 capping protein (actin filament)
201950_x_at CAPZB 832 -0.9793 0.10316 0.239603 muscle Z-line, beta
207196_s_at TNIP1 TNFAIP3 interacting protein 1 10318 -1.00708 0.103374 0.239603
211160_x_at ACTN1 actinin, alpha 1 87 -1.26927 0.103783 0.239603
209350_s_at GPS2 G protein pathway suppressor 2 2874 -1.10209 0.103921 0.239603
B-cell scaffold protein with
219667_s_at BAN 1 55024 -1.00308 0.104821 0.239603 ankyrin repeats 1
membrane-associated ring
210075_at MARCH2 finger (C3HC4) 2, E3 ubiquitin 51257 -1.43742 0.104896 0.239603 protein ligase
basic helix-loop-helix family,
201170_s_at BHLHE40 8553 -1.52602 0.105204 0.239603 member e40
vitamin D (1,25-
204254_s_at VDR 7421 -1.04354 0.10546 0.239603 dihydroxy vitamin D3) receptor
210128_s_at LTB4R leukotriene B4 receptor 1241 -0.92553 0.105789 0.239603
N-acetylneuraminate pyruvate
221210_s_at NPL lyase (dihydrodipicolinate 80896 -1.20989 0.105822 0.239603 synthase)
vascular endothelial growth
210512_s_at VEGFA 7422 -1.15461 0.10674 0.240343 factor A
solute carrier family 2
202499_s_at SLC2A3 (facilitated glucose 6515 -1.58321 0.106858 0.240343 transporter), member 3
201125_s_at ITGB5 integrin, beta 5 3693 -1.33107 0.107555 0.24035
ArfGAP with SH3 domain,
206414_s_at ASAP2 ankyrin repeat and PH domain 8853 -1.34473 0.107572 0.24035
2
201360_at CST3 cystatin C 1471 -1.68937 0.108964 0.242661
215047_at TRIM58 tripartite motif containing 58 25893 -0.99092 0.11023 0.243627
BH3 interacting domain death
204493_at BID 637 -0.9825 0.110478 0.243627 agonist
latent transforming growth
202728_s_at LTBP1 4052 -1.27115 0.113678 0.246714 factor beta binding protein 1
signal transducer and activator
209969_s_at STAT1 6772 -1.15673 0.113691 0.246714 of transcription 1, 91kDa
SC02 cytochrome c oxidase
205241_at SC02 9997 -1.4845 0.114175 0.246714 assembly protein
synovial sarcoma, X breakpoint
203017_s_at SSX2IP 117178 -0.94238 0.114827 0.246714
2 interacting protein
203833_s_at TGOLN2 trans-golgi network protein 2 10618 -0.93445 0.115059 0.246714 lymphocyte cytosolic protein 2
205269_at LCP2 (SH2 domain containing 3937 -0.97027 0.115226 0.246714 leukocyte protein of 76kDa)
209522_s_at CRAT carnitine O-acetyltransferase 1384 -1.01234 0.116038 0.246714
204629_at PARVB parvin, beta 29780 -1.33625 0.116976 0.246714
200609_s_at WDR1 WD repeat domain 1 9948 -0.99605 0.11718 0.246714 protein kinase, cAMP-
203680_at PRKAR2B dependent, regulatory, type II, 5577 -1.23212 0.117344 0.246714 beta
208918_s_at NAD NAD kinase 65220 -1.16887 0.119342 0.248598
213716_s_at SECTM1 secreted and transmembrane 1 6398 -1.08088 0.119767 0.248718
SH3 domain binding glutamic
221269_s_at SH3BGRL3 83442 -1.35229 0.120323 0.24911 acid-rich protein like 3
lysine ( )-specific demethylase
212492_s_at KDM4B 23030 -0.91067 0.121784 0.251366
4B
209729_at GAS2L1 growth arrest-specific 2 like 1 10634 -1.27348 0.12433 0.255074 solute carrier family 10
204928_s_at SLC10A3 (sodium/bile acid cotransporter 8273 -1.17192 0.124419 0.255074 family), member 3
205390_s_at AN 1 ankyrin 1 , erythrocytic 286 -0.88253 0.124711 0.255074
211795_s_at FYB FYN binding protein 2533 -1.18122 0.125242 0.255154
E74-like factor 4 (ets domain
31845_at ELF4 2000 -0.94729 0.125919 0.255154 transcription factor)
endonuclease domain
212573_at ENDOD1 23052 -1.40577 0.126395 0.255154 containing 1
delta-like 1 homolog
209560_s_at DL 1 8788 -1.19672 0.126533 0.255154
(Drosophila)
201095_at DAP death-associated protein 1611 -1.11419 0.126929 0.255154
212840_at UBXN7 UBX domain protein 7 26043 -1.01058 0.127011 0.255154 family with sequence similarity
221267_s_at FAM108A1 81926 -1.01634 0.128163 0.256705
108, member Al
adaptor-related protein
208074_s_at AP2S1 1175 -0.99964 0.128569 0.256758 complex 2, sigma 1 subunit
200990_at TRIM28 tripartite motif containing 28 10155 -1.00558 0.129664 0.257321
209839_at DNM3 dynamin 3 26052 -1.34338 0.130264 0.257321
201714_at TUBG1 tubulin, gamma 1 7283 -0.88297 0.130361 0.257321
200752_s_at CAPN1 calpain 1, (mu/I) large subunit 823 -0.92096 0.131139 0.258085 fatty acid hydroxylase domain
22075 l_s_at FAXDC2 10826 -1.32403 0.132172 0.258731 containing 2
210357_s_at SMOX spermine oxidase 54498 -1.03467 0.132612 0.258731 coiled-coil domain containing
218175_at CCDC92 80212 -1.09884 0.132796 0.258731
92
guanine nucleotide binding
204000_at GNB5 10681 -1.19778 0.133164 0.258731 protein (G protein), beta 5
217748_at ADIPO 1 adiponectin receptor 1 51094 -0.93144 0.13362 0.258731 glycoprotein lb (platelet), alpha
207389_at GP1BA 2811 -1.24025 0.134051 0.258731 polypeptide
EF-hand domain family,
217992_s_at EFHD2 79180 -1.0245 0.134143 0.258731 member D2
200884_at CKB creatine kinase, brain 1152 -0.88314 0.13483 0.259317
206145_at RHAG Rh-associated glycoprotein 6005 -1.17935 0.13531 0.259504
220757_s_at UBXN6 UBX domain protein 6 80700 -0.88851 0.136128 0.259746
213274_s_at CTSB cathepsin B 1508 -0.90565 0.136204 0.259746
6 -pho spho fructo -2-
202464_s_at PFKFB3 kinase/fructose-2,6- 5209 -1.06242 0.137167 0.26039 biphosphatase 3
WAS/WASL interacting
202665_s_at WIPF1 7456 -1.08477 0.13731 0.26039 protein family, member 1
CD36 molecule
206488_s_at CD36 948 -1.53958 0.138985 0.260645
(thrombospondin receptor)
212089_at LMNA lamin AJC 4000 -0.92285 0.140733 0.261597
205436_s_at H2AFX H2A histone family, member X 3014 -1.00358 0.140821 0.261597
206834_at HBD hemoglobin, delta 3045 -1.42844 0.141235 0.261597
209919_x_at GGT1 gamma-glutamyltransferase 1 2678 -0.89741 0.141427 0.261597
20774 l_x_at TP SAB 1 tryptase alpha/beta 1 7177 -1.06406 0.142116 0.261597
31874_at GAS2L1 growth arrest-specific 2 like 1 10634 -1.54272 0.142456 0.261597
201700_at CCND3 cyclin D3 896 -0.99741 0.142709 0.261597
205683_x_at TP SAB 1 tryptase alpha/beta 1 7177 -1.01525 0.142713 0.261597
201061_s_at STOM stomatin 2040 -1.01078 0.14297 0.261597 synovial sarcoma, X breakpoint
203016_s_at SSX2IP 1 17178 -0.95396 0.143425 0.261722
2 interacting protein
C-type lectin domain family 1,
220496_at CLEC1B 51266 -1.54811 0.14406 0.262175 member B
inhibitor of kappa light
209929_s_at IKBKG polypeptide gene enhancer in 8517 -0.89402 0.145589 0.262942
B-cells, kinase gamma
protein phosphatase 1,
37028_at PPP1R15A 23645 -1.05228 0.14582 0.262942 regulatory subunit 15 A
transducin-like enhancer of
212769_at TLE3 split 3 (E(spl) homo log, 7090 -0.90676 0.14604 0.262942
Drosophila)
RAB4A, member RAS
203581_at RAB4A 5867 -1.01651 0.146743 0.262942 oncogene family
213956_at CEP350 centrosomal protein 350kDa 9857 -0.85883 0.146813 0.262942 tryptase beta 2
215382_x_at TPSB2 64499 -0.977 0.148064 0.263547
(gene/pseudogene)
neuroepithelial cell
201830_s_at NET1 10276 -0.9677 0.148301 0.263547 transforming 1
201693_s_at EGR1 early growth response 1 1958 -1.15545 0.148318 0.263547 mitogen-activated protein
215498_s_at MAP2 3 5606 -1.08177 0.149281 0.264012 kinase kinase 3
ZW10 interactor, kinetochore
204026_s_at ZWINT 11130 -1.12549 0.149413 0.264012 protein
209170_s_at GPM6B glycoprotein M6B 2824 0.976338 0.14975 0.264012
22121 l_s_at MAP3 7CL MAP3 7 C-terminal like 56911 -1.30326 0.150281 0.264261
203045_at NINJ1 ninjurin 1 4814 -1.13628 0.15069 0.264293
210084_x_at TP SAB 1 tryptase alpha/beta 1 7177 -0.99706 0.151879 0.264649
207945_s_at CSN 1D casein kinase 1, delta 1453 -0.90784 0.152234 0.264649
T-cell, immune regulator 1,
204158_s_at TCIRG1 ATPase, H+ transporting, 10312 -1.17593 0.152276 0.264649 lysosomal V0 subunit A3
200766_at CTSD cathepsin D 1509 -0.93104 0.153066 0.265027
215819_s_at RHCE Rh blood group, CcEe antigens 6006 -0.9917 0.154157 0.266177
203485_at RTN1 reticulon 1 6252 -1.21235 0.154517 0.266177 integrin, beta 3 (platelet
215240_at ITGB3 glycoprotein Ilia, antigen 3690 -1.44118 0.156 0.267603
CD61)
methylenetetrahydrofolate
dehydrogenase (NADP+
201761_at MTHFD2 dependent) 2, 10797 -0.98494 0.156692 0.267603 methenyltetrahy dro fol ate
cyclohydrolase
CTD (carboxy-terminal
domain, RNA polymerase II,
201904_s_at CTDSPL 10217 -0.91323 0.156796 0.267603 polypeptide A) small
phosphatase-like
CTD (carboxy-terminal
domain, RNA polymerase II,
201906_s_at CTDSPL 10217 -0.94383 0.156925 0.267603 polypeptide A) small
phosphatase-like
203854_at CFI complement factor I 3426 0.869863 0.158526 0.268092 cystinosin, lysosomal cystine
204925_at CTNS 1497 -0.97532 0.158632 0.268092 transporter
CD 151 molecule (Raph blood
204306_s_at CD151 977 -0.94181 0.158669 0.268092 group)
206380_s_at CFP complement factor properdin 5199 -1.1026 0.158939 0.268092
204961_s_at NCF1 neutrophil cytosolic factor 1 653361 -1.43048 0.159385 0.268092
SH3 -domain binding protein 5
201810_s_at SH3BP5 9467 -1.02141 0.159588 0.268092
(BT -associated)
204192_at CD37 CD37 molecule 951 -1.01901 0.162409 0.270814
202082_s_at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -0.89139 0.163106 0.271309 protein regulator of cytokinesis
218009_s_at PRC1 9055 -1.11022 0.16572 0.274981
1
microtubule-associated protein
218522_s_at MAP I S 55201 -0.95913 0.166988 0.275781
I S
RAS guanyl releasing protein 2
214369_s_at RASGRP2 10235 -0.91512 0.167017 0.275781
(calcium and DAG-regulated)
RUN and FYVE domain
218243_at RUFY1 80230 -1.00705 0.168966 0.278235 containing 1
spermatogenesis associated 2-
214965_at SPATA2L 124044 -0.97367 0.169324 0.278235 like
212027_at RBM25 RNA binding motif protein 25 58517 -1.0829 0.17147 0.279943
218148_at CENPT centromere protein T 80152 -0.88627 0.171898 0.279943
203234_at UPP1 uridine phosphorylase 1 7378 -1.02931 0.172377 0.279943
200661_at CTSA cathepsin A 5476 -1.40173 0.172629 0.279943
210793_s_at NUP98 nucleoporin 98kDa 4928 -1.01125 0.173817 0.279943
Taxi (human T-cell leukemia
215464_s_at TAX1BP3 30851 -1.07322 0.174266 0.279943 virus type I) binding protein 3
204482_at CLDN5 claudin 5 7122 -1.19654 0.174447 0.279943 runt-related transcription factor
204198_s_at RUNX3 864 -0.98615 0.174457 0.279943
3
interleukin 6 signal transducer
212195_at IL6ST 3572 -0.93935 0.174626 0.279943
(gpl30, oncostatin M receptor)
growth arrest and DNA-
209304_x_at GADD45B 4616 -0.99482 0.174913 0.279943 damage-inducible, beta
tyrosylprotein sulfotransferase
204079_at TPST2 8459 -1.11621 0.177613 0.283594
2
Rho GTPase activating protein
206167_s_at ARHGAP6 395 -1.27531 0.178208 0.283875
6
220336_s_at GP6 glycoprotein VI (platelet) 51206 -1.06098 0.183391 0.290763
CDC42 binding protein kinase
214464_at CDC42BPA 8476 -0.96701 0.186028 0.292695 alpha (DMP -like)
polymerase (RNA) II (DNA
213887_s_at POLR2E 5434 -0.91232 0.186513 0.292695 directed) polypeptide E, 25kDa
integrin, beta 3 (platelet
216261_at ITGB3 glycoprotein Ilia, antigen 3690 -1.19784 0.187072 0.292695
CD61)
WD repeat domain,
213836_s_at WIPI1 55062 -1.00273 0.187347 0.292695 phosphoinositide interacting 1
218032_at SNN stannin 8303 -1.21538 0.189158 0.293378
20093 l_s_at VCL vinculin 7414 -0.92232 0.190234 0.294037
220110_s_at NXF3 nuclear RNA export factor 3 56000 -0.84883 0.194112 0.298064
219998_at LGALSL lectin, galactoside-binding-like 29094 -0.88669 0.19416 0.298064
200648_s_at GLUL glutamate-ammonia ligase 2752 -0.885 0.196266 0.300615
NLR family, pyrin domain
207075_at NLRP3 114548 -1.04141 0.196978 0.300727 containing 3
hexamethylene bis-acetamide
202814_s_at HEXIM1 10614 -0.86963 0.197227 0.300727 inducible 1
211582_x_at LST1 leukocyte specific transcript 1 7940 -0.89977 0.198407 0.301846 solute carrier family 24
57588_at SLC24A3 (sodium/potassium/calcium 57419 -0.8268 0.199252 0.301985 exchanger), member 3
209881_s_at LAT linker for activation of T cells 27040 -0.84958 0.199391 0.301985 major histocompatibility
213537_at HLA-DPA1 3113 -1.00128 0.200355 0.302768 complex, class II, DP alpha 1
neutrophil cytosolic factor 1C
214084_x_at NCF1C 654817 -1.32671 0.201691 0.303721 pseudogene
202555_s_at MYL myosin light chain kinase 4638 -1.35821 0.201883 0.303721
A kinase (PRKA) anchor
222024_s_at AKAP13 11214 -0.9453 0.20348 0.305445 protein 13
ATPase, Ca++ transporting,
207522_s_at ATP2A3 489 -0.86192 0.204597 0.305832 ubiquitous
202228_s_at NPTN neuroplastin 27020 -0.94477 0.204641 0.305832
G protein-coupled receptor
204396_s_at G 5 2869 -1.18973 0.205515 0.306089 kinase 5
214073_at CTTN cortactin 2017 -1.42385 0.205717 0.306089
RAB31, member RAS
217764_s_at RAB31 11031 -1.28868 0.206889 0.306253 oncogene family
208792_s_at CLU clusterin 1191 -1.32868 0.207424 0.306253
218945_at METTL22 methy transferase like 22 79091 -0.81822 0.207478 0.306253 mannosidase, alpha, class 2B,
209166_s_at MAN2B1 4125 -0.87235 0.207908 0.306253 member 1
family with sequence similarity
221856_s_at FAM63A 55793 -0.90737 0.208242 0.306253
63, member A
calmodulin 3 (phosphorylase
200622_x_at CALM3 808 -1.05371 0.208541 0.306253 kinase, delta)
regulator of G-protein signaling
216834_at RGS1 5996 -1.58039 0.209603 0.307146
1
201234_at ILK integrin-linked kinase 3611 -0.893 0.210231 0.307401 polypyrimidine tract binding
212016_s_at PTBP1 5725 -0.82271 0.214043 0.311628 protein 1
ATP -binding cassette, sub¬
203196_at ABCC4 family C (CFTR/MRP), 10257 -0.94809 0.215339 0.312842 member 4
204838_s_at MLH3 mutL homolog 3 (E. coli) 27030 -1.17819 0.217494 0.314178 tumor necrosis factor (ligand)
210314_x_at TNFSF13 8741 -0.85424 0.217651 0.314178 superfamily, member 13
221027_s_at PLA2G12A phospholipase A2, group XIIA 81579 -1.0047 0.219833 0.31622
207206_s_at ALOX12 arachidonate 12-lipoxygenase 239 -1.20411 0.221481 0.316376
336_at TBXA2R thromboxane A2 receptor 6915 -0.9854 0.221852 0.316376
208924_at RNF11 ring finger protein 11 26994 -0.85227 0.222362 0.316376
204440_at CD83 CD83 molecule 9308 -0.86406 0.222738 0.316376
FYN oncogene related to SRC,
216033_s_at FYN 2534 -0.86181 0.222912 0.316376
FGR, YES
proprotein convertase
207414_s_at PCSK6 5046 -1.24651 0.224243 0.317072 subtilisin/kexin type 6
protein phosphatase 1,
202014_at PPP1R15A 23645 -0.9299 0.224339 0.317072 regulatory subunit 15 A
204256_at ELOVL6 ELOVL fatty acid elongase 6 79071 -0.916 0.225463 0.317997 tryptase beta 2
216474_x_at TPSB2 64499 -0.84525 0.227141 0.319076
(gene/pseudogene)
200696_s_at GSN gelsolin 2934 -0.94992 0.227466 0.319076 apolipoprotein B mRNA
206632_s_at APOBEC3B editing enzyme, catalytic 9582 -1.04605 0.228843 0.320097 polypeptide-like 3B
221496_s_at TOB2 transducer of ERBB2, 2 10766 -0.78204 0.231572 0.323245
219630_at PDZK1IP1 PDZ 1 interacting protein 1 10158 -1.15529 0.234788 0.326336
MIR22 host gene (non-protein
214696_at MIR22HG 84981 -0.82752 0.235232 0.326336 coding)
213275_x_at CTSB cathepsin B 1508 -0.98223 0.235914 0.326614 coiled-coil domain containing
215343_at CCDC88C 440193 -0.83997 0.23881 0.328606
88C
205347_s_at TMSB15A thymosin beta 15a 11013 -0.82645 0.241173 0.329982
213093_at PR CA protein kinase C, alpha 5578 -0.92248 0.241407 0.329982
218217_at SCPEP1 serine carboxypeptidase 1 59342 -0.82069 0.2415 0.329982
201490_s_at PPIF peptidylprolyl isomerase F 10105 -0.81917 0.242498 0.329982 guanosine monophosphate
204187_at GMPR 2766 -0.83239 0.248436 0.336382 reductase
RAB31, member RAS
217762_s_at RAB31 11031 -1.02517 0.252078 0.339954 oncogene family
204790_at SMAD7 SMAD family member 7 4092 -0.76543 0.253693 0.341452
TCR gamma alternate reading
209813_x_at TARP 445347 -0.85554 0.256336 0.344324 frame protein
QKI, KH domain containing,
212636_at Q I 9444 -0.79642 0.257784 0.344583
RNA binding
serpin peptidase inhibitor, clade
211429_s_at SERPINA1 A (alpha- 1 antiproteinase, 5265 -1.37823 0.258343 0.344583 antitrypsin), member 1
pre-B-cell leukemia homeobox
205253_at PBX1 5087 -0.76555 0.258565 0.344583
1
chloride channel, voltage-
201735_s_at CLCN3 1182 -0.94043 0.260503 0.346484 sensitive 3
205950_s_at CA1 carbonic anhydrase I 759 -0.96583 0.262137 0.347974
Rho guanine nucleotide
201334_s_at ARHGEF12 23365 -0.77329 0.264462 0.350312 exchange factor (GEF) 12
210987_x_at TPM1 tropomyosin 1 (alpha) 7168 -0.82871 0.265224 0.350312
209806_at HIST1H2B histone cluster 1 , H2bk 85236 -0.86055 0.266486 0.350312 pre T-cell antigen receptor
215492_x_at PTCRA 171558 -0.904 0.271153 0.355069 alpha
chemokine (C-C motif)
205099_s_at CCR1 1230 -0.80241 0.275833 0.359113 receptor 1
202007_at NIDI nidogen 1 4811 -0.78832 0.278249 0.361563 plasminogen activator,
210845_s_at PLAUR 5329 -0.82653 0.280926 0.364343 urokinase receptor
non-SMC condensin I
218662_s_at NCAPG 64151 -0.73805 0.281927 0.364942 complex, subunit G
4-aminobutyrate
209459_s_at ABAT 18 -0.83695 0.28286 0.365451 aminotransferase
ATP -binding cassette, sub¬
208161_s_at ABCC3 family C (CFTR/MRP), 8714 -0.87352 0.283451 0.365517 member 3
210429_at RHD Rh blood group, D antigen 6007 -1.02292 0.285289 0.365856
208791_at CLU clusterin 1191 -1.10749 0.285331 0.365856 cystinosin, lysosomal cystine
36566_at CTNS 1497 -0.72179 0.285335 0.365856 transporter
21871 l_s_at SDPR serum deprivation response 8436 -0.86687 0.285908 0.365897 chloride channel, voltage-
201732_s_at CLCN3 1182 -0.82971 0.287865 0.367365 sensitive 3
endonuclease domain
212570_at ENDOD1 23052 -0.73257 0.289756 0.368708 containing 1
20341 l_s_at LMNA lamin AJC 4000 -0.7781 0.290282 0.368708 pre T-cell antigen receptor
211252_x_at PTCRA 171558 -0.8545 0.29161 1 0.369032 alpha
204908_s_at BCL3 B-cell CLL/lymphoma 3 602 -0.87358 0.292902 0.369953
218935_at EHD3 EH-domain containing 3 30845 -0.93363 0.293563 0.370097
219983_at HRASLS HRAS-like suppressor 57110 -0.72599 0.298402 0.374935 solute carrier family 2
22009 l_at SLC2A6 (facilitated glucose 1 1182 -0.7439 0.298508 0.374935 transporter), member 6
interleukin 1 receptor
212657_s_at IL1RN 3557 -0.78633 0.300604 0.376172 antagonist
cyclin-dependent kinase
210240_s_at CDKN2D inhibitor 2D (pi 9, inhibits 1032 -0.7304 0.304949 0.380904
CD 4)
transmembrane protein 158
213338_at TMEM158 25907 -0.83724 0.308131 0.382561
(gene/pseudogene)
v-maf musculoaponeurotic
218559_s_at MAFB fibrosarcoma oncogene 9935 -1.05359 0.308532 0.382561 homolog B (avian)
221050_s_at GTPBP2 GTP binding protein 2 54676 -0.69663 0.308832 0.382561 cadherin 1, type 1, E-cadherin
201131_s_at CDH1 999 -0.70327 0.3091 0.382561
(epithelial)
216253_s_at PARVB parvin, beta 29780 -0.85494 0.309748 0.382663 regulator of G-protein signaling
202988_s_at RGS1 5996 -1.01339 0.312601 0.385484
1
mtegrm, alpha M (complement
205786_s_at ITGAM component 3 receptor 3 3684 -0.83414 0.314385 0.386979 subunit)
Dab, mitogen-responsive
210757_x_at DAB 2 phosphoprotein, homolog 2 1601 -0.74514 0.315103 0.387159
(Drosophila)
212723_at JMJD6 jumonji domain containing 6 23210 -0.75129 0.319118 0.391333 proteoglycan 2, bone marrow
(natural killer cell activator,
211743_s_at PRG2 5553 -0.78462 0.319656 0.391333 eosinophil granule major basic
protein)
adhesion molecule with Ig-like
222108_at AMIG02 347902 -0.67947 0.320818 0.392046 domain 2
structural maintenance of
204240_s_at SMC2 10592 -0.70057 0.322141 0.392954 chromosomes 2
RAB31, member RAS
217763_s_at RAB31 11031 -0.86003 0.327317 0.397715 oncogene family
synuclein, alpha (non A4
204467_s_at SNCA component of amyloid 6622 -0.70464 0.327807 0.397715 precursor)
216063_at HBBP1 hemoglobin, beta pseudogene 1 3044 -0.94717 0.329519 0.399078
202581_at HSPA1A heat shock 70kDa protein 1 A 3303 -0.98594 0.331291 0.40042
210169_at SEC14L5 SEC14-like 5 (S. cerevisiae) 9717 -0.74193 0.33181 0.40042 low density lipoprotein
57082_at LDLRAP1 26119 -0.8255 0.333963 0.402301 receptor adaptor protein 1
217022_s_at IGH immunoglobulin heavy locus 3492 -0.84526 0.336016 0.404055
210734_x_at MAX MYC associated factor X 4149 -0.69037 0.337578 0.405064
SWI/SNF related, matrix
associated, actin dependent
204099_at SMARCD3 6604 -0.66865 0.338052 0.405064 regulator of chromatin,
subfamily d, member 3
denticleless E3 ubiquitin
218585_s_at DTL protein ligase homolog 51514 -0.76574 0.338678 0.405098
(Drosophila)
220968_s_at TSPAN9 tetraspanin 9 10867 -0.64905 0.342149 0.408528 guanine nucleotide binding
204993_at GNAZ protein (G protein), alpha z 2781 -0.77214 0.343386 0.409282 polypeptide
Fc fragment of IgG, low
210992_x_at FCGR2C affinity lie, receptor for 9103 -0.70674 0.344048 0.409351
(CD32) (gene/pseudogene)
RAB38, member RAS
219412_at RAB38 23682 -0.70456 0.345526 0.410051 oncogene family
transmembrane 6 superfamily
219892_at TM6SF1 53346 -0.67737 0.345848 0.410051 member 1
chemokine (C-C motif)
205098_at CC 1 1230 -0.67251 0.348407 0.411654 receptor 1
206883_x_at GP9 glycoprotein IX (platelet) 2815 -0.93388 0.348416 0.411654
204546_at KIAA0513 KIAA0513 9764 -0.6776 0.354075 0.416884 calmodulin 1 (phosphorylase
211984_at CALM1 801 -0.67903 0.356016 0.418443 kinase, delta)
erythrocyte membrane protein
212681_at EPB41L3 23136 -0.74882 0.363256 0.426212 band 4.1 -like 3
209586_s_at PRUNE prune homolog (Drosophila) 58497 -0.71365 0.365133 0.427673
TYRO protein tyrosine kinase
204122_at TYROBP 7305 -0.98164 0.368409 0.429921 binding protein
C-type lectin domain family 7,
221698_s_at CLEC7A 64581 -0.72388 0.368957 0.429921 member A
guanylate binding protein 1 ,
202269_x_at GBP1 2633 -0.72489 0.374443 0.434817 interferon-inducible
37965_at PARVB parvin, beta 29780 -0.73203 0.378544 0.438076 spectrin, alpha, erythrocytic 1
206937_at SPTA1 6708 -0.63911 0.379343 0.438252
(elliptocytosis 2)
SI 00 calcium binding protein
205863_at S100A12 6283 -0.76877 0.385662 0.443766
A12
acyl-CoA synthetase
206465_at ACSBG1 23205 -0.69391 0.386083 0.443766 bubblegum family member 1
208601_s_at TUBB 1 tubulin, beta 1 class VI 81027 -0.7751 0.38836 0.445627 growth factor independent IB
208501_at GFI1B 8328 -0.69445 0.391518 0.44802 transcription repressor
regulator of G-protein signaling
204319_s_at RGS10 6001 -0.66481 0.391769 0.44802
10
guanine nucleotide binding
204115_at GNG11 2791 -0.85973 0.396611 0.450473 protein (G protein), gamma 11
RRN3 RNA polymerase I
222204_s_at RRN3 transcription factor homolog 54700 -0.6018 0.396615 0.450473
(S. cerevisiae)
204446_s_at ALOX5 arachidonate 5-lipoxygenase 240 -0.88998 0.397241 0.450473 tumor necrosis factor receptor
203508_at TNFRSF1B 7133 -0.6867 0.398463 0.451103 superfamily, member IB
coagulation factor XIII, Al
203305_at F13A1 2162 -0.84164 0.401077 0.453304 polypeptide
Gardner -Rasheed feline
208438_s_at FGR sarcoma viral (v-fgr) oncogene 2268 -0.62594 0.406618 0.458801 homolog
platelet-derived growth factor
205463_s_at PDGFA 5154 -0.67628 0.408281 0.459911 alpha polypeptide
SI 00 calcium binding protein
202917_s_at S100A8 6279 -1.20152 0.411847 0.463156
A8
207156_at HIST1H2AG histone cluster 1 , H2ag 8969 -0.70408 0.413233 0.463944 serpin peptidase inhibitor, clade
202833_s_at SERPINA1 A (alpha- 1 antiproteinase, 5265 -0.91706 0.413994 0.46403 antitrypsin), member 1
207315_at CD226 CD226 molecule 10666 -0.62666 0.418074 0.466595
204971_at CSTA cystatin A (stefin A) 1475 -0.89766 0.418207 0.466595 actin related protein 2/3
201954_at ARPC1B 10095 -0.64277 0.41835 0.466595 complex, subunit IB, 41kDa
206254_at EGF epidermal growth factor 1950 -0.61118 0.425271 0.472756 matrix metallopeptidase 1
204475_at MMP1 4312 -0.79765 0.427481 0.474434
(interstitial collagenase)
coagulation factor C homolog,
205229_s_at COCH 1690 -0.53396 0.432368 0.479072 cochlin (Limulus polyphemus)
prostaglandin-endoperoxide
205127_at PTGS1 synthase 1 (prostaglandin G/H 5742 -0.54531 0.44234 0.488522 synthase and cyclooxygenase)
kinesin heavy chain member
203087_s_at KIF2A 3796 -0.59853 0.443634 0.488965
2A
complement component 1 , q
202953_at C1QB 713 -0.82302 0.444186 0.488965 subcomponent, B chain
218656_s_at LHFP lipoma HMGIC fusion partner 10186 -0.56539 0.445989 0.489822
Fc fragment of IgG, high
21451 l_x_at FCGR1B 2210 -0.69072 0.446411 0.489822 affinity lb, receptor (CD64)
208406_s_at GRAP2 GRB2-related adaptor protein 2 9402 -0.68765 0.451229 0.492736
SID1 transmembrane family,
56256_at SIDT2 51092 -0.74229 0.451977 0.492736 member 2
209204_at LM04 LIM domain only 4 8543 -0.52105 0.454155 0.494314
205612_at MMR 1 multimerin 1 22915 -0.58072 0.457551 0.496919
206116_s_at TPM1 tropomyosin 1 (alpha) 7168 -0.61863 0.458017 0.496919
204858_s_at TYMP thymidine phosphorylase 1890 -0.62323 0.459985 0.497869 tectonin beta-propeller repeat
204308_s_at TECPR2 9895 -0.56607 0.460363 0.497869 containing 2
synuclein, alpha (non A4
204466_s_at SNCA component of amyloid 6622 -0.60596 0.461512 0.498316 precursor)
guanylate binding protein 1 ,
202270_at GBP1 2633 -0.55471 0.469505 0.505333 interferon-inducible
pleckstrin homology domain
218223_s_at PLEKHOl 51177 -0.63829 0.474253 0.509634 containing, family 0 member 1
leukocyte immunoglobulin-like
206881_s_at LILRA3 receptor, subfamily A (without 11026 -0.61236 0.483816 0.518375
TM domain), member 3
paired immunoglobin-like type
222218_s_at PILRA 29992 -0.60956 0.483919 0.518375
2 receptor alpha
ribonuclease, R ase A family,
213566_at RNASE6 6039 -0.53861 0.485481 0.519227 k6
221160_s_at CABP5 calcium binding protein 5 56344 -0.52004 0.487926 0.521019
N-acetyltransferase 8B (GCN5-
206964_at NAT8B related, putative, 51471 -0.52553 0.491589 0.523279 gene/p seudogene)
immunoglobulin superfamily,
206420_at IGSF6 10261 -0.58815 0.495872 0.52701 member 6
219386_s_at SLAMF8 SLAM family member 8 56833 -0.64079 0.500574 0.531173
209949_at NCF2 neutrophil cytosolic factor 2 4688 -0.64425 0.501391 0.531207
206110_at HIST1H3H histone cluster 1, H3h 8357 -0.78197 0.502267 0.531304 leukocyte immunoglobulin-like
210660_at LILRA1 receptor, subfamily A (with 11024 -0.51819 0.518847 0.547986
TM domain), member 1
gamma-glutamyl hydrolase
(conjugase,
203560_at GGH 8836 -0.53164 0.520075 0.548428 folylpolygammaglutamyl
hydrolase)
immunoglobulin lambda light
214677_x_at CYAT1 100290481 -0.49954 0.537027 0.564546 chain-like
calmodulin 1 (phosphorylase
211985_s_at CALM1 801 -0.5249 0.539781 0.566561 kinase, delta)
SI 00 calcium binding protein
200660_at S100A11 6282 -0.57564 0.542655 0.568696
Al l
Dab, mitogen-responsive
201279_s_at DAB 2 phosphoprotein, homolog 2 1601 -0.47879 0.546344 0.571676
(Drosophila)
zinc finger protein 185 (LIM
203585_at ZNF185 7739 -0.5405 0.548693 0.573249 domain)
203140_at BCL6 B-cell CLL/lymphoma 6 604 -0.48632 0.5566 0.580552
202295_s_at CTSH cathepsin H 1512 -0.54025 0.557399 0.580552 leukocyte immunoglobulin-like
receptor, subfamily B (with
210146_x_at LILRB2 10288 -0.42185 0.572195 0.593923
TM and ITIM domains),
member 2
potassium channel
212188_at CTD12 tetramerisation domain 115207 -0.40898 0.572868 0.593923 containing 12
CCAAT/enhancer binding
203973_s_at CEBPD 1052 -0.50468 0.574596 0.594804 protein (C/EBP), delta
solute carrier family 7 (amino
204588_s_at SLC7A7 acid transporter light chain, 9056 -0.52401 0.57568 0.595016 y+L system), member 7
complement component 1 , q
218232_at C1QA 712 -0.45679 0.578484 0.597002 subcomponent, A chain
219159_s_at SLAMF7 SLAM family member 7 57823 -0.41122 0.581677 0.599384
HIV-1 Tat interactive protein 2,
209448_at HTATIP2 10553 -0.4519 0.584526 0.601404
30kDa
lectin, galactoside-binding,
208450_at LGALS2 3957 -0.61288 0.591141 0.607288 soluble, 2
leukocyte immunoglobulin-like
207857_at LILRA2 receptor, subfamily A (with 11027 -0.38829 0.612701 0.626584
TM domain), member 2
complement component 5 a
220088_at C5AR1 728 -0.41369 0.614585 0.627563 receptor 1
204912_at IL10RA interleukin 10 receptor, alpha 3587 -0.36301 0.677582 0.688773
201005_at CD 9 CD9 molecule 928 -0.46299 0.696997 0.707447
205119_s_at FPR1 formyl peptide receptor 1 2357 -0.34184 0.703731 0.713213 major histocompatibility
21383 l_at HLA-DQA1 3117 -0.41115 0.757666 0.766726 complex, class II, DQ alpha 1
chemokine (C-X3-C motif)
205898_at CX3CR1 1524 -0.2373 0.789441 0.797689 receptor 1
interferon, gamma-
201422_at IFI30 10437 0.793548 0.800643
inducible protein 30 0.26145
H2B histone family,
208579_x_at H2BFS member S 54145 0.82651 0.83266
0.20818
(pseudogene)
potassium channel
212192_at CTD12 tetramerisation 115207 0.828056 0.832977
0.19775
domain containing 12
cat eye syndrome
219505_at CEC 1 chromosome region, 51816 0.84442 0.848178
0.18017
candidate 1
histone cluster 1 ,
215071_s_at HIST1H2AC 8334 0.864886 0.867448
H2ac 0.16128
Table 6. Clinical Features of the Polycythemia Vera Patients Segregated by Unsupervised Hierarchical
Clustering
Spleen size (median, cm below costal
20 2 0.005** margin)
(range) (5-32) (0-14)
Splenectomy (n) 4/7 0/12 0.007**
Chemotherapy (n) 5/7 2/12 0.029**
Transformation to acute leukemia (n) 4/7 1/12 0.037**
Surviving (n) 1/7 11/12 0.001 **
* Student t test
**Fisher exact probability test
Table 7. Annotation of the 102 Concordantly Deregulated Genes
204848_x_at HBG1 /// hemoglobin, gamma A 3047 -1.4219 0.077286 0.470938 HBG2
211980_at COL4A1 collagen, type IV, alpha 1 1282 1.083935 0.081985 0.470938
209116_x_at HBB hemoglobin, beta 3043 -1.47367 0.087602 0.470938
213515_x_at HBG1 /// hemoglobin, gamma A 3047 -1.72304 0.089471 0.470938
HBG2
201842_s_at EFEMP1 EGF containing fibulin-like 2202 1.153114 0.09001 0.470938 extracellular matrix protein
1
204897_at PTGER4 prostaglandin E receptor 4 5734 0.979697 0.094157 0.470938
(subtype EP4)
209183_s_at ClOorflO chromosome 10 open 11067 0.631696 0.094188 0.470938 reading frame 10
204419_x_at HBG1 /// hemoglobin, gamma A 3047 -1.4151 0.105888 0.509076
HBG2
211696_x_at HBB hemoglobin, beta 3043 -1.18995 0.11201 0.513618
204141_at TUBB2A tubulin, beta 2A class Ila 7280 1.288228 0.115961 0.513618
211699_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.21697 0.122356 0.513618
HBA2
209458_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.38137 0.130596 0.513618
HBA2
221760_at MAN1A1 mannosidase, alpha, class 4121 0.85605 0.130744 0.513618
1A, member 1
204018_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.23966 0.131486 0.513618
HBA2
213350_at RPS11 ribosomal protein SI 1 6205 0.933771 0.136499 0.515634
215772_x_at SUCLG2 succinate-CoA ligase, GDP- 8801 -0.64738 0.145938 0.515634 forming, beta subunit
217414_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.27841 0.149825 0.515634
HBA2
205382_s_at CFD complement factor D 1675 -0.8048 0.157142 0.515634
(adipsin)
201890_at RRM2 ribonucleotide reductase M2 6241 -0.95289 0.158408 0.515634
208960_s_at KLF6 Kruppel-like factor 6 1316 0.571081 0.15952 0.515634
206157_at PTX3 pentraxin 3, long 5806 0.825089 0.160878 0.515634
205237_at FCN1 ficolin (collagen/fibrinogen 2219 -1.15146 0.170172 0.516857 domain containing) 1
204834_at FGL2 fibrinogen-like 2 10875 -0.90858 0.17194 0.516857
211745_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.33507 0.173664 0.516857
HBA2
209803_s_at PHLDA2 pleckstrin homology-like 7262 0.879169 0.180046 0.520921 domain, family A, member
2
200629_at WARS tryptophanyl-tRNA 7453 -0.69785 0.183988 0.520921 synthetase
219602_s_at PIEZ02 piezo-type 63895 -0.56733 0.187531 0.520921 mechanosensitive ion
channel component 2
205848_at GAS2 growth arrest-specific 2 2620 -0.77375 0.196517 0.527987
210487_at DNTT deoxynucleotidyltransferase, 1791 0.622562 0.198523 0.527987 terminal
214414_x_at HBA1 /// hemoglobin, alpha 1 3039 -1.40997 0.215516 0.561241
HBA2
209374_s_at IGHM immunoglobulin heavy 3507 0.614952 0.226098 0.576781 constant mu
201110_s_at THBS1 thrombospondin 1 7057 0.617073 0.251014 0.58604
220377_at KIAA0125 KIAA0125 9834 0.553273 0.25106 0.58604
213524_s_at G0S2 G0/G1 switch 2 50486 -0.85706 0.265596 0.58604
204304_s_at PROM1 prominin 1 8842 0.705885 0.270019 0.58604
20896 l_s_at LF6 Kruppel-like factor 6 1316 0.50248 0.272895 0.58604
203787_at SSBP2 single-stranded DNA 23635 0.483855 0.27435 0.58604 binding protein 2
212952_at LOC100507328 hypothetical 100507328 0.637258 0.276535 0.58604
LOC100507328
209763_at CHRDL1 chordin-like 1 91851 0.393371 0.278706 0.58604
202600_s_at NRIP1 nuclear receptor interacting 8204 0.586587 0.279182 0.58604 protein 1
209290_s_at NFIB nuclear factor I/B 4781 -0.55308 0.280861 0.58604
214041_x_at RPL37A ribosomal protein L37a 6168 0.490226 0.283497 0.58604
202237_at NNMT nicotinamide N- 4837 0.748218 0.285987 0.58604 methyltransferase
211074_at FOLR1 folate receptor 1 (adult) 2348 0.905935 0.306067 0.617071
204872_at TLE4 transducin-like enhancer of 7091 0.422998 0.331335 0.65741 split 4 (E(spl) homolog,
Drosophila)
217683_at HBE1 hemoglobin, epsilon 1 3046 -0.47414 0.366576 0.687129
205933_at SETBP1 SET binding protein 1 26040 0.325978 0.36816 0.687129
204430_s_at SLC2A5 solute carrier family 2 6518 0.430164 0.378886 0.687129
(facilitated glucose/fructose
transporter), member 5
209894_at LEPR leptin receptor 3953 -0.51789 0.379001 0.687129
221556_at CDC14B cell division cycle 14B 8555 0.488325 0.379135 0.687129
202870_s_at CDC20 cell division cycle 20 991 -0.50504 0.379295 0.687129
204755_x_at HLF hepatic leukemia factor 3131 0.315735 0.425921 0.750089
209576_at GNAI1 guanine nucleotide binding 2770 0.312521 0.442731 0.750089 protein (G protein), alpha
inhibiting activity
polypeptide 1
204030_s_at IQCJ-SCHIP1 IQCJ-SCHIP1 readthrough 100505385 0.349599 0.447391 0.750089
213979_s_at — — — 0.43757 0.448237 0.750089
203535_at S100A9 S100 calcium binding 6280 -0.55271 0.46106 0.750089 protein A9
216248_s_at NR4A2 nuclear receptor subfamily 4929 -0.44972 0.465048 0.750089
4, group A, member 2
211597_s_at HOPX HOP homeobox 84525 0.403732 0.466948 0.750089
204622_x_at NR4A2 nuclear receptor subfamily 4929 -0.37372 0.468699 0.750089
4, group A, member 2
220990_s_at MIR21 microRNA 21 406991 0.336172 0.469644 0.750089
213668_s_at SOX4 SRY (sex determining 6659 0.449329 0.474056 0.750089 region Y)-box 4
205984_at CRHBP corticotropin releasing 1393 0.377363 0.518506 0.807842 hormone binding protein
209773_s_at RRM2 ribonucleotide reductase M2 6241 -0.42832 0.528182 0.807842
201058_s_at MYL9 myosin, light chain 9, 10398 0.492397 0.538149 0.807842 regulatory
201631_s_at IER3 immediate early response 3 8870 0.438819 0.542829 0.807842
219777_at GIMAP6 GTPase, IMAP family 474344 0.266496 0.54879 0.807842 member 6
212077_at CALD1 caldesmon 1 800 0.443992 0.549332 0.807842
210873_x_at APOBEC3A apolipoprotein B mRNA 200315 -0.3463 0.599089 0.852599 editing enzyme, catalytic
polypeptide-like 3A
201669_s_at MARC S myristoylated alanine-rich 4082 -0.26494 0.60049 0.852599 protein kinase C substrate
206478_at KIAA0125 KIAA0125 9834 0.32879 0.609726 0.852599
201666_at TIMP1 TIMP metallopeptidase 7076 0.267758 0.619744 0.852599 inhibitor 1
219304_s_at PDGFD platelet derived growth 80310 0.204115 0.624045 0.852599 factor D
21253 l_at LCN2 lipocalin 2 3934 0.323764 0.624556 0.852599
212589_at RRAS2 related RAS viral (r-ras) 22800 -0.24032 0.62995 0.852599 oncogene homolog 2
206698_at X X-linked Kx blood group 7504 -0.27856 0.634334 0.852599
(McLeod syndrome)
209069_s_at H3F3B H3 histone, family 3B 3021 0.19436 0.64152 0.853085
(H3.3B)
213593_s_at TRA2A transformer 2 alpha 29896 0.256365 0.650412 0.855806 homolog (Drosophila)
222044_at PCIF1 PDXl C -terminal inhibiting 63935 0.1951 0.667828 0.861405 factor 1
201798_s_at MYOF myoferlin 26509 0.273459 0.66845 0.861405
201369_s_at ZFP36L2 ZFP36 ring finger protein678 0.230642 0.684623 0.869074 like 2
211998_at H3F3B H3 histone, family 3B 3021 0.193469 0.693161 0.869074
(H3.3B)
214974_x_at CXCL5 chemokine (C-X-C motif) 6374 -0.26165 0.695259 0.869074 ligand 5
200999_s_at CKAP4 cytoskeleton-associated 10970 0.213798 0.708966 0.876694 protein 4
208180_s_at HIST1H4H histone cluster 1 , H4h 8365 0.215184 0.725551 0.876694
214651_s_at HOXA9 homeobox A9 3205 0.201432 0.727565 0.876694
204563_at SELL selectin L 6402 0.218847 0.72941 0.876694
74694_s_at RABEP2 rabaptin, RAB GTPase 79874 0.156251 0.74234 0.879603 binding effector protein 2
209112_at CD N1B cyclin-dependent kinase 1027 -0.16341 0.746336 0.879603 inhibitor lB (p27, Kipl)
220416_at ATP8B4 ATPase, class I, type 8B, 79895 0.16502 0.75294 0.879603 member 4
1405_i_at CCL5 chemokine (C-C motif) 6352 -0.25823 0.790224 0.895478 ligand 5
201195_s_at SLC7A5 solute carrier family 7 8140 -0.13019 0.797734 0.895478
(amino acid transporter light
chain, L system), member 5
205442_at MFAP3L micro fibrillar-associated 9848 0.165446 0.798221 0.895478 protein 3 -like
21491 l_s_at BRD2 bromodomain containing 2 6046 0.126061 0.802554 0.895478
203395_s_at HES1 hairy and enhancer of split 3280 -0.15322 0.808284 0.895478
1, (Drosophila)
213757_at EIF5A eukaryotic translation 1984 0.139559 0.810552 0.895478 initiation factor 5A
204655_at CCL5 chemokine (C-C motif) 6352 -0.23378 0.816676 0.895478 ligand 5
208892_s_at DUSP6 dual specificity phosphatase 1848 0.125339 0.839353 0.91234
6
214805_at EIF4A1 eukaryotic translation 1973 0.086848 0.847057 0.912777 initiation factor 4A1
208835_s_at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 0.092821 0.854388 0.912807
205114_s_at CCL3 /// chemokine (C-C motif) 414062 0.116024 0.882607 0.934965
CCL3L1 /// ligand 3 -like 3
CCL3L3
219922_s_at LTBP3 latent transforming growth 4054 -0.06412 0.893898 0.936218 factor beta binding protein 3
207815_at PF4V1 platelet factor 4 variant 1 5197 -0.10475 0.898769 0.936218
208949_s_at LGALS3 lectin, galactoside-binding, 3958 -0.06541 0.917534 0.941056 soluble, 3
203394_s_at HES1 hairy and enhancer of split 3280 -0.06134 0.922933 0.941056
1, (Drosophila)
204753_s_at HLF hepatic leukemia factor 3131 0.037675 0.933009 0.941056
219410_at TMEM45A transmembrane protein 45A 55076 0.044462 0.933528 0.941056
219403_s_at HPSE heparanase 10855 -0.01752 0.978683 0.978683
Table 8. Genes Differently Regulated in the Indolent Group as Compared to the Controls
201666_at TIMP1 TIMP metallopeptidase inhibitor 1 7076 -1.63942 2.35E-05 0.004281
203045_at NINJ1 ninjurin 1 4814 -1.5136 2.55E-05 0.004462
203455_s_at SAT1 spermidine/spermine Nl- 6303 -1.25184 2.78E-05 0.004519 acetyltransferase 1
202912_at ADM adrenomedullin 133 -1.55855 3.02E-05 0.004672
201058_s_at MYL9 myosin, light chain 9, regulatory 10398 -2.74637 3.07E-05 0.004672
207815_at PF4V1 platelet factor 4 variant 1 5197 -2.82239 5.35E-05 0.005828
1405_i_at CCL5 chemokine (C-C motif) ligand 5 6352 -3.32637 5.85E-05 0.006036
21421 l_at FTH1 ferritin, heavy polypeptide 1 2495 -1.47129 8.74E-05 0.006826
201422_at IFI30 interferon, gamma-inducible 10437 -2.1056 0.000104 0.00745 protein 30
210845_s_at PLAU plasminogen activator, urokinase 5329 -1.48981 0.000116 0.007613 receptor
214020_x_at ITGB5 integrin, beta 5 3693 -1.08903 0.000121 0.007815
204115_at GNG11 guanine nucleotide binding protein 2791 -2.43614 0.000123 0.007906
(G protein), gamma 11
213524_s_at G0S2 G0/G1 switch 2 50486 -2.65615 0.000126 0.007998
201125_s_at ITGB5 integrin, beta 5 3693 -1.67473 0.000134 0.008224
209154_at TAX1BP3 Taxi (human T-cell leukemia virus 30851 -1.71214 0.000155 0.008862 type I) binding protein 3
201631_s_at IER3 immediate early response 3 8870 -2.29781 0.000169 0.009257
213988_s_at SAT1 spermidine/spermine Nl- 6303 -1.26095 0.000171 0.009309 acetyltransferase 1
20087 l_s_at PSAP prosaposin 5660 -1.0306 0.000195 0.009761
20066 l_at CTSA cathepsin A 5476 -1.96591 0.000218 0.010227
204440_at CD83 CD83 molecule 9308 -1.34989 0.000228 0.010503
214073_at CTTN cortactin 2017 -2.15431 0.000231 0.010534
204655_at CCL5 chemokine (C-C motif) ligand 5 6352 -3.23424 0.000234 0.010534
219622_at RAB20 RAB20, member RAS oncogene 55647 -1.10241 0.000283 0.011722 family
204546_at KIAA0513 KIAA0513 9764 -1.19275 0.000321 0.012541
209304_x_at GADD45B growth arrest and DNA-damage- 4616 -1.51931 0.000364 0.013369 inducible, beta
203535_at S100A9 SI 00 calcium binding protein A9 6280 -2.4352 0.00037 0.013372
210075_at MARCH2 membrane-associated ring finger 51257 -1.72415 0.00043 0.014432
(C3HC4) 2, E3 ubiquitin protein
ligase
213716_s_at SECTM1 secreted and transmembrane 1 6398 -1.05168 0.000482 0.015364
209398_at HIST1H1C histone cluster 1, Hlc 3006 -1.53845 0.000487 0.015374
214246_x_at MINK1 misshapen-like kinase 1 50488 -1.16871 0.000487 0.015374
204482_at CLDN5 claudin 5 7122 -1.62602 0.000494 0.015531
206110_at HIST1H3H histone cluster 1 , H3h 8357 -2.52014 0.000496 0.015566
200736_s_at GPX1 glutathione peroxidase 1 2876 -1.14943 0.000508 0.015789
31874_at GAS2L1 growth arrest-specific 2 like 1 10634 -1.87076 0.00052 0.016031
217764_s_at RAB31 RAB31, member RAS oncogene 11031 -2.01066 0.000564 0.016422 family
AFFX- STAT1 signal transducer and activator of 6772 -1.37938 0.000621 0.016996 HUMISGF3 transcription 1, 91kDa
A/M97935_
MA_at
212501_at CEBPB CCAAT/enhancer binding protein 1051 -1.54731 0.000671 0.017573
(C/EBP), beta
212077_at CALD1 caldesmon 1 800 -2.04255 0.000688 0.017825
201108_s_at THBS1 thrombospondin 1 7057 -2.12731 0.000718 0.018258
212647_at RRAS related RAS viral (r-ras) oncogene 6237 -1.08906 0.000785 0.019036 homolog
205463_s_at PDGFA platelet-derived growth factor 5154 -1.5857 0.000872 0.020261 alpha polypeptide
202083_s_at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -1.38339 0.000926 0.020823
22121 l_s_at MAP3 7CL MAP3 7 C-terminal like 56911 -1.90471 0.000937 0.020912
221059_s_at COTL1 coactosin-like 1 (Dictyostelium) 23406 -1.53392 0.000965 0.021237
201743_at CD 14 CD 14 molecule 929 -2.10963 0.00106 0.022456
218999_at TMEM140 transmembrane protein 140 55281 -1.58682 0.001078 0.022646
218032_at SNN stannin 8303 -1.79738 0.001083 0.022694
201739_at SG 1 serum/glucocorticoid regulated 6446 -2.23217 0.001109 0.02284 kinase 1
203234_at UPP1 uridine phosphorylase 1 7378 -1.24029 0.001155 0.023122
215071_s_at HIST1H2A histone cluster 1, H2ac 8334 -2.0219 0.001169 0.02321
c
202497_x_at SLC2A3 solute carrier family 2 (facilitated 6515 -1.11253 0.001169 0.02321 glucose transporter), member 3
207574_s_at GADD45B growth arrest and DNA-damage- 4616 -1.91282 0.001288 0.024289 inducible, beta
AFFX- STAT1 signal transducer and activator of 6772 -1.22837 0.001313 0.024575 HUMISGF3 transcription 1, 91kDa
A/M97935_
MB at
203414_at MMD monocyte to macrophage 23531 -1.96502 0.001341 0.024732 differentiation-associated
204081_at NRGN neurogranin (protein kinase C 4900 -2.55869 0.001354 0.024788 substrate, RC3)
212242_at TUBA4A tubulin, alpha 4a 7277 -1.98963 0.001384 0.025003
211600_at PTPRO protein tyrosine phosphatase, 5800 -1.25519 0.001385 0.025003 receptor type, 0
211252_x_at PTCRA pre T-cell antigen receptor alpha 171558 -1.20925 0.001454 0.025618
210357_s_at SMOX spermine oxidase 54498 -1.0824 0.00148 0.025958
214696_at MIR22HG MIR22 host gene (non-protein 84981 -1.24889 0.001532 0.026408 coding)
201506_at TGFBI transforming growth factor, beta- 7045 -1.47238 0.001571 0.026812 induced, 68kDa
215464_s_at TAX1BP3 Taxi (human T-cell leukemia virus 30851 -1.19481 0.001588 0.026937 type I) binding protein 3
203585_at ZNF185 zinc finger protein 185 (LIM 7739 -1.63846 0.001619 0.027302 domain)
214752_x_at FLNA filamin A, alpha 2316 -1.19726 0.001669 0.027658
216261_at ITGB3 integrin, beta 3 (platelet 3690 -1.42557 0.001715 0.028036 glycoprotein Ilia, antigen CD61)
209729_at GAS2L1 growth arrest-specific 2 like 1 10634 -1.29217 0.001761 0.02833
217763_s_at RAB31 RAB31, member RAS oncogene 11031 -1.57464 0.001927 0.029492 family
201565_s_at ID2 inhibitor of DNA binding 2, 3398 -2.05847 0.001931 0.029494 dominant negative helix-loop-helix
protein
202499_s_at SLC2A3 solute carrier family 2 (facilitated 6515 -1.76034 0.001995 0.030069 glucose transporter), member 3
200859_x_at FLNA filamin A, alpha 2316 -1.14829 0.001998 0.030073
214054_at DOK2 docking protein 2, 56kDa 9046 -1.44762 0.002111 0.030716
209959_at NR4A3 nuclear receptor subfamily 4, 8013 -1.06248 0.002113 0.030716 group A, member 3
222043_at CLU clusterin 1191 -1.24582 0.002133 0.030796
204057_at IRF8 interferon regulatory factor 8 3394 -1.20508 0.002179 0.031039
210873_x_at APOBEC3A apolipoprotein B mRNA editing 200315 -1.7692 0.002336 0.032102 enzyme, catalytic polypeptide-like
3A
204794_at DUSP2 dual specificity phosphatase 2 1844 -1.69252 0.002377 0.032376
204232_at FCER1G Fc fragment of IgE, high affinity I, 2207 -1.80094 0.002409 0.032561
receptor for; gamma polypeptide
208792_s_at CLU clusterin 1191 -1.89367 0.002436 0.032794
207414_s_at PCS 6 proprotein convertase 5046 -1.66589 0.00258 0.034033 subtilisin/kexin type 6
202295_s_at CTSH cathepsin H 1512 -1.47757 0.002604 0.034228
208078_s_at SIK1 salt-inducible kinase 1 150094 -1.38923 0.002612 0.034234
204446_s_at ALOX5 arachidonate 5 -lipoxygenase 240 -1.78576 0.002664 0.034597
205863_at S100A12 SlOO calcium binding protein A12 6283 -1.44064 0.002691 0.034786
21253 l_at LCN2 lipocalin 2 3934 -1.74945 0.002916 0.036334
204698_at ISG20 interferon stimulated exonuclease 3669 -1.01523 0.003089 0.037574 gene 20kDa
213338_at TMEM158 transmembrane protein 158 25907 -1.19059 0.00326 0.038684
(gene/p seudogene)
215492_x_at PTCRA pre T-cell antigen receptor alpha 171558 -1.15689 0.003318 0.038883
204838_s_at MLH3 mutL homolog 3 (E. coli) 27030 -1.4825 0.00334 0.039
336_at TBXA2R thromboxane A2 receptor 6915 -1.13899 0.003359 0.039168
203140_at BCL6 B-cell CLL/lymphoma 6 604 -1.30948 0.003569 0.040549
22075 l_s_at FAXDC2 fatty acid hydroxylase domain 10826 -1.36 0.003658 0.041081 containing 2
205495_s_at ONLY granulysin 10578 -1.10567 0.003705 0.041271
200660_at S100A11 SlOO calcium binding protein Al 1 6282 -1.62087 0.003733 0.041423
211429_s_at SERPINA1 serpin peptidase inhibitor, clade A 5265 -1.9862 0.003781 0.041543
(alpha- 1 antiproteinase,
antitrypsin), member 1
202917_s_at S100A8 SlOO calcium binding protein A8 6279 -2.98812 0.003874 0.041998
205114_s_at CCL3L3 chemokine (C-C motif) ligand 3- 414062 -2.11268 0.003894 0.041998 like 3
212509_s_at MXRA7 matrix-remodeling associated 7 439921 -1.13262 0.003902 0.042016
204627_s_at ITGB3 integrin, beta 3 (platelet 3690 -2.30401 0.003953 0.042268 glycoprotein Ilia, antigen CD61)
203922_s_at CYBB cytochrome b-245, beta 1536 -1.0925 0.004058 0.043079 polypeptide
208180_s_at HIST1H4H histone cluster 1 , H4h 8365 -1.58615 0.004083 0.043185
205237_at FCN1 ficolin (collagen/fibrinogen 2219 -2.31794 0.004143 0.043449 domain containing) 1
204628_s_at ITGB3 integrin, beta 3 (platelet 3690 -1.63546 0.004208 0.043687 glycoprotein Ilia, antigen CD61)
201810_s_at SH3BP5 SH3 -domain binding protein 5 9467 -1.35593 0.004294 0.044285
(BT -associated)
20462 l_s_at NR4A2 nuclear receptor subfamily 4, 4929 -1.13205 0.004407 0.044874 group A, member 2
214414_x_at HBA1 hemoglobin, alpha 1 3039 -2.92562 0.004429 0.044949
203305_at F13A1 coagulation factor XIII, Al 2162 -2.17585 0.004493 0.045292 polypeptide
209803_s_at PHLDA2 pleckstrin homology-like domain, 7262 -1.71861 0.00466 0.046283 family A, member 2
208161_s_at ABCC3 ATP -binding cassette, sub-family 8714 -1.21045 0.004758 0.046709
C (CFTR/MRP), member 3
208406_s_at GRAP2 GRB2-related adaptor protein 2 9402 -1.26529 0.004845 0.047046
209806_at HIST1H2B histone cluster 1 , H2bk 85236 -1.21587 0.004905 0.047465
217028_at CXCR4 chemokine (C-X-C motif) receptor 7852 -1.25222 0.005221 0.04911
4
218454_at PLBD1 phospholipase B domain 79887 -1.3316 0.005298 0.049397 containing 1
202833_s_at SERPINA1 serpin peptidase inhibitor, clade A 5265 -1.72053 0.005347 0.049661
(alpha- 1 antiproteinase,
antitrypsin), member 1
205220_at HCAR3 hydroxycarboxylic acid receptor 3 8843 -1.11127 0.005534 0.050489
201438_at COL6A3 collagen, type VI, alpha 3 1293 -1.45596 0.005536 0.050489
221731_x_at VCAN versican 1462 -2.02316 0.005573 0.050668
201360_at CST3 cystatin C 1471 -1.47347 0.005761 0.051649
AFFX- STAT1 signal transducer and activator of 6772 -1.22821 0.005786 0.051736 HUMISGF3 transcription 1, 91kDa
A/M97935_
5_at
204858_s_at TYMP thymidine phosphorylase 1890 -1.19053 0.005857 0.052078
205547_s_at TAGLN transgelin 6876 -1.89687 0.006205 0.053812
20879 l_at CLU clusterin 1191 -1.6535 0.006231 0.053824
209383_at DDIT3 DNA-damage-inducible transcript 1649 -1.19919 0.00626 0.053842
3
217022_s_at IGH immunoglobulin heavy locus 3492 -1.26043 0.006498 0.054967
201280_s_at DAB2 Dab, mitogen-responsive 1601 -1.35685 0.006817 0.056659 phosphoprotein, homolog 2
(Drosophila)
AFFX- -1.10207 0.007018 0.057621 DapX-M_at
211074_at FOLR1 folate receptor 1 (adult) 2348 -2.335 0.007106 0.057921
221556_at CDC14B cell division cycle 14B 8555 -1.35463 0.007226 0.058222
212723_at JMJD6 jumonji domain containing 6 23210 -1.10344 0.007325 0.058511
211745_x_at HBA1 hemoglobin, alpha 1 3039 -2.39195 0.007372 0.058683
204141_at TUBB2A tubulin, beta 2A class Ila 7280 -2.1393 0.007748 0.060237
208579_x_at H2BFS H2B histone family, member S 54145 -1.4314 0.008655 0.063919
(pseudogene)
203973_s_at CEBPD CCAAT/enhancer binding protein 1052 -1.24524 0.008766 0.064315
(C/EBP), delta
201170_s_at BHLHE40 basic helix-loop-helix family, 8553 -1.48301 0.008896 0.064843 member e40
205119_s_at FPR1 formyl peptide receptor 1 2357 -1.27582 0.009081 0.065557
20496 l_s_at NCF1 neutrophil cytosolic factor 1 653361 -1.3618 0.009093 0.06559
201616_s_at CALD1 caldesmon 1 800 -1.10576 0.009118 0.065687
204018_x_at HBA1 hemoglobin, alpha 1 3039 -1.98013 0.009214 0.066107
213539_at CD3D CD3d molecule, delta (CD3-TCR 915 -1.04108 0.009761 0.067714 complex)
202388_at RGS2 regulator of G-protein signaling 2, 5997 -1.46404 0.009794 0.06779
24kDa
201798_s_at MYOF myoferlin 26509 -1.51466 0.009894 0.068217
203708_at PDE4B phosphodiesterase 4B, cAMP- 5142 -1.38481 0.01 0.068731 specific
214084_x_at NCF1C neutrophil cytosolic factor 1C 654817 -1.39567 0.010409 0.070394 pseudogene
209458_x_at HBA1 hemoglobin, alpha 1 3039 -2.13257 0.010802 0.071832
217762_s_at RAB31 RAB31, member RAS oncogene 11031 -1.34439 0.010983 0.072433 family
208022_s_at CDC14B cell division cycle 14B 8555 -1.06029 0.011035 0.072627
204790_at SMAD7 SMAD family member 7 4092 -1.18892 0.011176 0.072876
217414_x_at HBA1 hemoglobin, alpha 1 3039 -2.04967 0.011779 0.075213
204480_s_at C9orfl6 chromosome 9 open reading frame 79095 -1.0583 0.01178 0.075213
16
204908_s_at BCL3 B-cell CLL/lymphoma 3 602 -1.12158 0.011802 0.075244
206883_x_at GP9 glycoprotein IX (platelet) 2815 -1.39492 0.012283 0.076763
211964_at COL4A2 collagen, type IV, alpha 2 1284 -1.30407 0.012296 0.076763
AFFX- GAPDH glyceraldehyde-3 -phosphate 2597 -1.07979 0.012327 0.076822 HUMGAPD dehydrogenase
H/M33197_
5_at
202887_s_at DDIT4 DNA-damage-inducible transcript 54541 -1.42927 0.012333 0.076822
4
AFFX- GAPDH glyceraldehyde-3 -phosphate 2597 -1.25641 0.012335 0.076822 HUMGAPD dehydrogenase
H/M33197_
M_at
204588_s_at SLC7A7 solute carrier family 7 (amino acid 9056 -1.19903 0.012402 0.077024 transporter light chain, y+L
system), member 7
206655_s_at GP1BB glycoprotein lb (platelet), beta 2812 -2.09441 0.0128 0.078521 polypeptide
221841_s_at KLF4 Kruppel-like factor 4 (gut) 9314 -1.65198 0.012861 0.078835
212657_s_at IL1RN interleukin 1 receptor antagonist 3557 -1.14627 0.013221 0.080181
204620_s_at VCAN versican 1462 -1.51568 0.013307 0.080358
205442_at MFAP3L micro fibrillar-associated protein 3- 9848 -1.52051 0.013437 0.080854 like
200665_s_at SPARC secreted protein, acidic, cysteine- 6678 -1.75861 0.01347 0.080865 rich (osteonectin)
204396_s_at GR 5 G protein-coupled receptor kinase 2869 -1.28375 0.013822 0.082085
5
202207_at ARL4C ADP-ribosylation factor-like 4C 10123 -1.06368 0.014043 0.082963
AFFX- ACTB actin, beta 60 -1.37822 0.014382 0.0839 HSAC07/X0
0351_3_at
214974_x_at CXCL5 chemokine (C-X-C motif) ligand 5 6374 -1.55942 0.014408 0.083963
213275_x_at CTSB cathepsin B 1508 -1.09109 0.014496 0.084285
214677_x_at CYAT1 immunoglobulin lambda light 100290481 -1.19702 0.014517 0.084316 chain-like
218559_s_at MAFB v-maf musculoaponeurotic 9935 -1.60023 0.014906 0.085665 fibrosarcoma oncogene homolog B
(avian)
208527_x_at HIST1H2BE histone cluster 1 , H2be 8344 -1.0534 0.015738 0.08838
202310_s_at COL1A1 collagen, type I, alpha 1 1277 -1.87619 0.016831 0.091891
208601_s_at TUBB1 tubulin, beta 1 class VI 81027 -1.17222 0.017934 0.095324
219403_s_at HPSE heparanase 10855 -1.31934 0.018497 0.096806
200622_x_at CALM3 calmodulin 3 (phosphorylase 808 -1.04785 0.018549 0.096942 kinase, delta)
212667_at SPARC secreted protein, acidic, cysteine- 6678 -1.34731 0.018812 0.097654 rich (osteonectin)
209949_at NCF2 neutrophil cytosolic factor 2 4688 -1.34905 0.01953 0.099726
204122_at TYROBP TYRO protein tyrosine kinase 7305 -1.58727 0.019681 0.100052 binding protein
20181 l_x_at SH3BP5 SH3 -domain binding protein 5 9467 -1.02097 0.020101 0.101165
(BT -associated)
214469_at HIST1H2AE histone cluster 1, H2ae 3012 -1.04742 0.020232 0.101492
200999_s_at CKAP4 cytoskeleton-associated protein 4 10970 -1.1494 0.020405 0.101743
204319_s_at RGS10 regulator of G-protein signaling 10 6001 -1.05791 0.020642 0.102328
37966_at PARVB parvin, beta 29780 -1.18316 0.020871 0.102995
AFFX- STAT1 signal transducer and activator of 6772 -1.13562 0.022192 0.106109 HUMISGF3 transcription 1, 91kDa
A/M97935_
3_at
208546_x_at HIST1H2B histone cluster 1 , H2bh 8345 -1.03067 0.022452 0.106776
H
204834_at FGL2 fibrinogen-like 2 10875 -1.4682 0.022775 0.107256
216442_x_at FN1 fibronectin 1 2335 -1.90726 0.023141 0.108166
204103_at CCL4 chemokine (C-C motif) ligand 4 6351 -1.0683 0.02465 0.111906
221269_s_at SH3BGRL3 SH3 domain binding glutamic 83442 -1.17357 0.024677 0.111906 acid-rich protein like 3
201842_s_at EFEMP1 EGF containing fibulin-like 2202 -1.50062 0.024795 0.112138 extracellular matrix protein 1
208450_at LGALS2 lectin, galactoside-binding, soluble, 3957 -1.55709 0.025744 0.114214
2
212464_s_at FN1 fibronectin 1 2335 -1.96353 0.025831 0.114387
204971_at CSTA cystatin A (stefin A) 1475 -1.4559 0.026275 0.115382
211719_x_at FN1 fibronectin 1 2335 -2.20582 0.026796 0.116477
210495_x_at FN1 fibronectin 1 2335 -1.90768 0.026965 0.116845
216248_s_at NR4A2 nuclear receptor subfamily 4, 4929 -1.17499 0.028238 0.119726 group A, member 2
204912_at IL10RA interleukin 10 receptor, alpha 3587 -1.05258 0.02903 0.121428
211699_x_at HBA1 hemoglobin, alpha 1 3039 -1.60002 0.029162 0.121623
AFFX- ACTB actin, beta 60 -1.04373 0.029941 0.123368 HSAC07/X0
0351_5_at
218280_x_at HIST2H2A histone cluster 2, H2aa4 723790 -1.035 0.029948 0.123368
A4
215240_at ITGB3 integrin, beta 3 (platelet 3690 -1.18589 0.030708 0.124841 glycoprotein Ilia, antigen CD61)
219630_at PDZ 1IP1 PDZ 1 interacting protein 1 10158 -1.16143 0.031505 0.126922
56256_at SIDT2 SID1 transmembrane family, 51092 -1.06356 0.03192 0.127917 member 2
214146_s_at PPBP pro-platelet basic protein 5473 -2.2804 0.032189 0.128506
(chemokine (C-X-C motif) ligand
7)
217683_at HBE1 hemoglobin, epsilon 1 3046 -1.01632 0.03275 0.12959
202627_s_at SERPINE1 serpin peptidase inhibitor, clade E 5054 -1.24155 0.035257 0.134957
(nexin, plasminogen activator
inhibitor type 1), member 1
218223_s_at PLEKHOl pleckstrin homology domain 51177 -1.02949 0.035417 0.13521 containing, family 0 member 1
203394_s_at HES1 hairy and enhancer of split 1, 3280 -1.19137 0.036252 0.137146
(Drosophila)
21451 l_x_at FCG 1B Fc fragment of IgG, high affinity 2210 -1.00332 0.036916 0.1385
lb, receptor (CD64)
211980_at COL4A1 collagen, type IV, alpha 1 1282 -1.2568 0.037235 0.139094
215076_s_at COL3A1 collagen, type III, alpha 1 1281 -1.43307 0.038584 0.141774
218723_s_at RGCC regulator of cell cycle 28984 -1.35285 0.038884 0.142295
201465_s_at JUN jun proto-oncogene 3725 -1.23554 0.039397 0.143388
206493_at ITGA2B integrin, alpha 2b (platelet 3674 -1.40259 0.040966 0.146453 glycoprotein lib of Ilb/IIIa
complex, antigen CD41)
20965 l_at TGFB1I1 transforming growth factor beta 1 7041 -1.18925 0.043241 0.150602 induced transcript 1
202403_s_at COL1A2 collagen, type I, alpha 2 1278 -1.44055 0.046503 0.156448
213975_s_at LYZ lysozyme 4069 -1.35445 0.046533 0.156457
202391_at BASP1 brain abundant, membrane 10409 -1.21789 0.050925 0.164058 attached signal protein 1
200897_s_at PALLD palladin, cytoskeletal associated 23022 -1.19733 0.054484 0.169794 protein
207206_s_at ALOX12 arachidonate 12-lipoxygenase 239 -1.13633 0.054626 0.170045
202404_s_at COL1A2 collagen, type I, alpha 2 1278 -1.71166 0.056539 0.173313
210809_s_at POSTN periostin, osteoblast specific factor 10631 -1.70047 0.059219 0.177986
217572_at — — -1.0617 0.061496 0.181515
20435 l_at SI OOP S100 calcium binding protein P 6286 -1.10416 0.061934 0.182039
202953_at C1QB complement component 1 , q 713 -1.04337 0.061996 0.182121 subcomponent, B chain
3671 l_at MAFF v-maf musculoaponeurotic 23764 -2.07111 0.062874 0.183657 fibrosarcoma oncogene homolog F
(avian)
214290_s_at HIST2H2A histone cluster 2, H2aa4 723790 -1.00017 0.063196 0.184141
A4
220496_at CLEC1B C-type lectin domain family 1, 51266 -1.26133 0.068125 0.192398 member B
202628_s_at SERPINE1 serpin peptidase inhibitor, clade E 5054 -1.0038 0.068895 0.193543
(nexin, plasminogen activator
inhibitor type 1), member 1
201852_x_at COL3A1 collagen, type III, alpha 1 1281 -1.06074 0.069846 0.19499
209210_s_at FERMT2 fermitin family member 2 10979 -1.18848 0.071118 0.197
208937_s_at ID1 inhibitor of DNA binding 1, 3397 -1.06464 0.076912 0.204982 dominant negative helix-loop-helix
protein
202644_s_at TNFAIP3 tumor necrosis factor, alpha- 7128 -1.11193 0.077731 0.206126 induced protein 3
202555_s_at MYL myosin light chain kinase 4638 -1.20646 0.078352 0.206861
207808_s_at PROS1 protein S (alpha) 5627 -1.05757 0.080762 0.210082
202237_at NNMT nicotinamide N-methyltransferase 4837 -1.16906 0.084988 0.216541
204959_at MNDA myeloid cell nuclear differentiation 4332 -1.11553 0.099265 0.237052 antigen
206390_x_at PF4 platelet factor 4 5196 -1.56272 0.105914 0.246063
207076_s_at ASS1 argininosuccinate synthase 1 445 -1.01934 0.110808 0.252682
206494_s_at ITGA2B integrin, alpha 2b (platelet 3674 -1.21162 0.118492 0.262217 glycoprotein lib of Ilb/IIIa
complex, antigen CD41)
207140_at ALPI alkaline phosphatase, intestinal 248 -1.14253 0.12301 0.267727
216834_at RGS1 regulator of G-protein signaling 1 5996 -1.34806 0.15206 0.303847
202988_s_at RGS1 regulator of G-protein signaling 1 5996 -1.08916 0.188906 0.346892
213515_x_at HBG1 hemoglobin, gamma A 3047 -1.06377 0.246664 0.407885
212671_s_at HLA-DQA1 major histocompatibility complex, 3117 1.097239 0.126891 0.272796 class II, DQ alpha 1
211734_s_at FCER1A Fc fragment of IgE, high affinity I, 2205 1.009251 0.078698 0.207233 receptor for; alpha polypeptide
210982_s_at HLA-DRA major histocompatibility complex, 3122 1.194665 0.07091 0.196595 class II, DR alpha
202016_at MEST mesoderm specific transcript 4232 1.10616 0.05007 0.162642
209773_s_at RRM2 ribonucleotide reductase M2 6241 1.272153 0.049561 0.161602
202946_s_at BTBD3 BTB (POZ) domain containing 3 22903 1.045621 0.04313 0.150497
208894_at HLA-DRA major histocompatibility complex, 3122 1.34853 0.028179 0.119545
class II, DR alpha
213376_at ZBTB1 zinc finger and BTB domain 22890 1.088786 0.026552 0.116003 containing 1
206310_at SPIN 2 serine peptidase inhibitor, azal 6691 1.055612 0.024944 0.112515 type 2 (aero sin-tryp sin inhibitor)
203817_at GUCY1B3 guanylate cyclase 1 , soluble, beta 3 2983 1.163996 0.024688 0.111906
209392_at ENPP2 ectonucleotide 5168 1.030545 0.023369 0.108718 pyrophosphatase/phosphodiesteras
e 2
216640_s_at PDIA6 protein disulfide isomerase family 10130 1.19128 0.020388 0.10174
A, member 6
212588_at PTPRC protein tyrosine phosphatase, 5788 1.226601 0.019819 0.100488 receptor type, C
209894_at LEPR leptin receptor 3953 1.184929 0.018148 0.09595
218039_at NUSAP1 nucleolar and spindle associated 51203 1.157405 0.017634 0.094469 protein 1
213129_s_at GCSHP5 glycine cleavage system protein H 100329108 1.10714 0.01585 0.088615 pseudogene 5
201577_at NME1 NME/NM23 nucleoside 4830 1.034901 0.015518 0.087753 diphosphate kinase 1
214741_at ZNF131 zinc finger protein 131 7690 1.072298 0.015265 0.086843
212498_at — — 1.007129 0.014477 0.084233
200953_s_at CCND2 cyclin D2 894 1.083456 0.014299 0.083701
207668_x_at PDIA6 protein disulfide isomerase family 10130 1.075588 0.014187 0.083288
A, member 6
208639_x_at PDIA6 protein disulfide isomerase family 10130 1.148925 0.013925 0.082576
A, member 6
212749_s_at RCHY1 ring finger and CFIY zinc finger 25898 1.154346 0.013753 0.081884 domain containing 1, E3 ubiquitin
protein ligase
213599_at OIP5 Opa interacting protein 5 11339 1.034915 0.013279 0.080287
218477_at TMEM14A transmembrane protein 14A 28978 1.038055 0.01243 0.077084
209160_at AKR1C3 aldo-keto reductase family 1, 8644 1.050868 0.012306 0.076764 member C3
207165_at HMMR hyaluronan-mediated motility 3161 1.12524 0.012278 0.076763 receptor (RHAMM)
200750_s_at RAN RAN, member RAS oncogene 5901 1.196145 0.012173 0.076447 family
200853_at H2AFZ H2A histone family, member Z 3015 1.133212 0.012107 0.076162
211762_s_at KPNA2 karyopherin alpha 2 (RAG cohort 3838 1.122517 0.011697 0.074903
1, importin alpha 1)
202591_s_at SSBP1 single-stranded DNA binding 6742 1.079587 0.011546 0.074317 protein 1 , mitochondrial
212224_at ALDH1A1 aldehyde dehydrogenase 1 family, 216 1.532805 0.011256 0.073081 member Al
202157_s_at CELF2 CUGBP, Elav-like family member 10659 1.345852 0.011153 0.072851
2
201018_at EIF1AX eukaryotic translation initiation 1964 1.07069 0.011072 0.072653 factor 1A, X-linked
214359_s_at HSP90AB1 heat shock protein 90kDa alpha 3326 1.611725 0.010493 0.070756
(cytosolic), class B member 1
202266_at TDP2 tyrosyl-DNA phosphodiesterase 2 51567 1.168396 0.009941 0.068453
204023_at RFC4 replication factor C (activator 1) 4, 5984 1.161476 0.009896 0.068217
37kDa
208852_s_at CANX calnexin 821 1.147782 0.009836 0.067995
208990_s_at HNR PH3 heterogeneous nuclear 3189 1.022691 0.009773 0.067735 ribonucleoprotein H3 (2H9)
201193_at IDH1 isocitrate dehydrogenase 1 3417 1.109705 0.009675 0.067345
(NADP+), soluble
204444_at KIF11 kinesin family member 11 3832 1.052307 0.009568 0.06712
202899_s_at S SF3 serine/arginine-rich splicing factor 6428 1.121111 0.009554 0.067103
3
206834_at HBD hemoglobin, delta 3045 1.603183 0.009504 0.066927
213241_at PLXNC1 plexin CI 10154 1.098497 0.009355 0.066441
208783_s_at CD46 CD46 molecule, complement 4179 1.009037 0.009253 0.066184 regulatory protein
204905_s_at EEF1E1 eukaryotic translation elongation 9521 1.018486 0.009203 0.06606 factor 1 epsilon 1
203755_at BUB IB BUB 1 mitotic checkpoint 701 1.106693 0.009061 0.065504 serine/threonine kinase B
201462_at SCR 1 secernin 1 9805 1.089176 0.008825 0.064512
207238_s_at PTPRC protein tyrosine phosphatase, 5788 1.002292 0.00794 0.060948 receptor type, C
202469_s_at CPSF6 cleavage and polyadenylation 11052 1.017757 0.007655 0.05992 specific factor 6, 68kDa
218350_s_at GMNN geminin, DNA replication inhibitor 51053 1.289682 0.007592 0.059577
201653_at CNIH cornichon homolog (Drosophila) 10175 1.024747 0.007566 0.059412
210759_s_at PSMA1 proteasome (prosome, macropain) 5682 1.025107 0.007534 0.05925
subunit, alpha type, 1
218984_at PUS7 pseudouridylate synthase 7 54517 1.092719 0.007372 0.058683 homolog (S. cerevisiae)
213541_s_at ERG v-ets erythroblastosis virus E26 2078 1.268671 0.007213 0.058222 oncogene homolog (avian)
214214_s_at C1QBP complement component 1 , q 708 1.081512 0.006939 0.057298 subcomponent binding protein
218883_s_at MLF1IP MLF1 interacting protein 79682 1.002951 0.006546 0.05522
204798_at MYB v-myb myeloblastosis viral 4602 1.33907 0.006372 0.054414 oncogene homolog (avian)
214710_s_at CCNB1 cyclin B 1 891 1.30622 0.006365 0.05438
200892_s_at TRA2B transformer 2 beta homolog 6434 1.059953 0.006225 0.053824
(Drosophila)
201084_s_at BCLAF1 BCL2-associated transcription 9774 1.042614 0.006038 0.053075 factor 1
219306_at KIF15 kinesin family member 15 56992 1.005174 0.005933 0.052485
209180_at RABGGTB Rab geranylgeranyltransferase, 5876 1.030791 0.00587 0.05217 beta subunit
201829_at NET1 neuroepithelial cell transforming 1 10276 1.16411 0.005759 0.051649
213047_x_at SET SET nuclear oncogene 6418 1.072575 0.005512 0.05039
201241_at DDX1 DEAD (Asp-Glu-Ala-Asp) box 1653 1.20415 0.005509 0.05039 helicase 1
209728_at HLA-DRB4 major histocompatibility complex, 3126 2.396871 0.005479 0.050353 class II, DR beta 4
201890_at RRM2 ribonucleotide reductase M2 6241 1.743456 0.005295 0.049397
201477_s_at RRMl ribonucleotide reductase Ml 6240 1.259059 0.005293 0.049397
200728_at ACTR2 ARP2 actin-related protein 2 10097 1.079756 0.005255 0.049248 homolog (yeast)
212250_at MTDH metadherin 92140 1.112188 0.005254 0.049248
200996_at ACTR3 ARP3 actin-related protein 3 10096 1.167525 0.005078 0.048328 homolog (yeast)
203405_at PSMG1 proteasome (prosome, macropain) 8624 1.002781 0.005039 0.048111 assembly chaperone 1
200877_at CCT4 chaperonin containing TCP 1 , 10575 1.134112 0.004843 0.047046 subunit 4 (delta)
210438_x_at TROVE2 TROVE domain family, member 2 6738 1.075252 0.004643 0.046201
201417_at SOX4 SRY (sex determining region Y)- 6659 1.240673 0.004546 0.045582 box 4
201014_s_at PAICS phosphoribosylaminoimidazole 10606 1.325476 0.004523 0.045413
carboxylase,
phosphoribosylaminoimidazole
succinocarboxamide synthetase
200064_at HSP90AB1 heat shock protein 90kDa alpha 3326 1.128671 0.004413 0.044877
(cytosolic), class B member 1
202268_s_at NAE1 NEDD8 activating enzyme El 8883 1.117633 0.004311 0.044378 subunit 1
211137_s_at ATP2C1 ATPase, Ca++ transporting, type 27032 1.024207 0.004133 0.04339
2C, member 1
218694_at ARMCX1 armadillo repeat containing, X- 51309 1.240431 0.004091 0.043202 linked 1
201676_x_at PSMA1 proteasome (prosome, macropain) 5682 1.034639 0.00406 0.043079 subunit, alpha type, 1
217987_at ASNSD1 asparagine synthetase domain 54529 1.242982 0.004059 0.043079 containing 1
219563_at LINC00341 long intergenic non-protein coding 79686 1.115324 0.004051 0.043037
RNA 341
201240_s_at LOC653566 signal peptidase complex subunit 2 653566 1.053758 0.004022 0.042778 homolog (S. cerevisiae)
pseudogene
204146_at RAD51AP1 RAD51 associated protein 1 10635 1.156331 0.004016 0.042729
209757_s_at MYCN v-myc myelocytomatosis viral 4613 1.210293 0.003996 0.042614 related oncogene, neuroblastoma
derived (avian)
209095_at DLD dihydrolipoamide dehydrogenase 1738 1.319642 0.003935 0.042191
211971_s_at LRPPRC leucine-rich pentatricopeptide 10128 1.113512 0.003889 0.041998 repeat containing
211746_x_at PSMA1 proteasome (prosome, macropain) 5682 1.018568 0.003854 0.041914 subunit, alpha type, 1
200052_s_at ILF2 interleukin enhancer binding factor 3608 1.0667 0.003851 0.041914
2
212640_at PTPLB protein tyrosine phosphatase-like 201562 1.131425 0.003826 0.041838
(proline instead of catalytic
arginine), member b
200774_at FAM120A family with sequence similarity 23196 1.114974 0.003738 0.04145
120A
209318_x_at PLAGL1 pleiomorphic adenoma gene-like 1 5325 1.23893 0.003682 0.04125
201180_s_at GNAI3 guanine nucleotide binding protein 2773 1.037392 0.003621 0.040838
(G protein), alpha inhibiting
activity polypeptide 3
215933_s_at HHEX hematopoietically expressed 3087 1.279779 0.003597 0.040702 homeobox
200807_s_at HSPD1 heat shock 60kDa protein 1 3329 1.015247 0.00358 0.040641
(chaperonin)
202539_s_at HMGC 3 -hydro xy-3 -methylglutaryl-CoA 3156 1.103166 0.003517 0.040158 reductase
200072_s_at HNRNPM heterogeneous nuclear 4670 1.402849 0.00349 0.040028 ribonucleoprotein M
204373_s_at CEP350 centrosomal protein 350kDa 9857 1.185706 0.003481 0.040028
203209_at RFC5 replication factor C (activator 1) 5, 5985 1.113492 0.00338 0.039333
36.5kDa
211935_at ARL6IP1 ADP-ribosylation factor-like 6 23204 1.159268 0.003341 0.039 interacting protein 1
203566_s_at AGL amylo-alpha-1, 6-glucosidase, 4- 178 1.046125 0.003305 0.038871 alpha-glucanotransferase
201549_x_at DM5B lysine ( )-specific demethylase 5B 10765 1.065448 0.003285 0.038786
208029_s_at LAPTM4B lysosomal protein transmembrane 55353 1.253963 0.003231 0.038501
4 beta
218585_s_at DTL denticleless E3 ubiquitin protein 51514 1.350603 0.003194 0.03822 ligase homolog (Drosophila)
212893_at ZZZ3 zinc finger, ZZ-type containing 3 26009 1.08034 0.003179 0.038151
215440_s_at BEX4 brain expressed, X-linked 4 56271 1.274266 0.00308 0.037537
200020_at TARDBP TAR DNA binding protein 23435 1.100346 0.002966 0.036705
213293_s_at TRIM22 tripartite motif containing 22 10346 1.403817 0.00295 0.036579
205612_at MMR 1 multimerin 1 22915 1.21464 0.002937 0.036484
201930_at MCM6 minichromosome maintenance 4175 1.051838 0.002935 0.036484 complex component 6
208910_s_at C1QBP complement component 1 , q 708 1.40182 0.00291 0.036295 subcomponent binding protein
218870_at ARHGAP15 Rho GTPase activating protein 15 55843 1.442188 0.002874 0.036047
204236_at FLU Friend leukemia virus integration 1 2313 1.290793 0.002863 0.036016
211784_s_at SRSF1 serine/arginine-rich splicing factor 6426 1.027483 0.002853 0.035922
1
212215_at PREPL prolyl endopeptidase-like 9581 1.016567 0.002832 0.03582
201713_s_at RANBP2 RAN binding protein 2 5903 1.15906 0.002829 0.035812
201589_at SMC1A structural maintenance of 8243 1.429532 0.002826 0.035794 chromosomes 1A
201327_s_at CCT6A chaperonin containing TCP 1 , 908 1.110939 0.002792 0.035561
subunit 6A (zeta 1)
214949_at — — 1.096897 0.002708 0.034908
213222_at PLCB1 phospholipase C, beta 1 23236 1.045277 0.002634 0.03437
(phosphoinositide-specific)
20505 l_s_at KIT v-kit Hardy -Zuckerman 4 feline 3815 1.349599 0.002631 0.034353 sarcoma viral oncogene homolog
201652_at COPS5 COP9 constitutive 10987 1.133169 0.002622 0.034334 photomorphogenic homolog
subunit 5 (Arabidopsis)
208767_s_at LAPTM4B lysosomal protein transmembrane 55353 1.125608 0.002597 0.034178
4 beta
204026_s_at ZWINT ZW10 interactor, kinetochore 11130 1.36409 0.002574 0.033989 protein
211615_s_at LRPPRC leucine-rich pentatricopeptide 10128 1.077666 0.002524 0.03353 repeat containing
206332_s_at IFI16 interferon, gamma-inducible 3428 1.04713 0.002479 0.033114 protein 16
213605_s_at — — 1.301604 0.002445 0.032816
219054_at NPR3 natriuretic peptide receptor 4883 1.079574 0.002372 0.032376
C/guanylate cyclase C
(atrionatriuretic peptide receptor C)
212867_at NCOA2 nuclear receptor coactivator 2 10499 1.169646 0.002371 0.032376
208828_at POLE3 polymerase (DNA directed), 54107 1.189315 0.002289 0.031795 epsilon 3, accessory subunit
204127_at RFC3 replication factor C (activator 1) 3, 5983 1.217624 0.002267 0.031632
38kDa
202599_s_at NRIPl nuclear receptor interacting protein 8204 1.485341 0.002258 0.03152
1
212557_at ZNF451 zinc finger protein 451 26036 1.087217 0.002254 0.031489
210766_s_at CSE1L CSE1 chromosome segregation 1- 1434 1.038634 0.002233 0.031297 like (yeast)
211922_s_at CAT catalase 847 1.262699 0.002221 0.031297
205345_at BARD1 BRCA1 associated RING domain 580 1.097185 0.002218 0.031297
1
201197_at AMD1 adenosylmethionine decarboxylase 262 1.147451 0.002213 0.031264
1
204689_at HHEX hematopoietically expressed 3087 1.069023 0.002165 0.030957 homeobox
201624_at DARS aspartyl-tRNA synthetase 1615 1.026982 0.002159 0.030955
212766_s_at ISG20L2 interferon stimulated exonuclease 81875 1.137911 0.002146 0.030863 gene 20kDa-like 2
201112_s_at CSE1L CSE1 chromosome segregation 1- 1434 1.11844 0.002142 0.030838 like (yeast)
212038_s_at VDAC1 voltage -dependent anion channel 1 7416 1.422303 0.002135 0.030796
211953_s_at IP05 importin 5 3843 1.242501 0.002132 0.030796
212612_at RCO 1 REST corepressor 1 23186 1.102759 0.002126 0.030796
218715_at UTP6 UTP6, small subunit (SSU) 55813 1.287375 0.002119 0.030758 processome component, homolog
(yeast)
217957_at C16orf80 chromosome 16 open reading 29105 1.235392 0.002104 0.030707 frame 80
208666_s_at ST13 suppression of tumorigenicity 13 6767 1.060002 0.00206 0.030421
(colon carcinoma) (Hsp70
interacting protein)
201054_at HNR PAO heterogeneous nuclear 10949 1.042824 0.002053 0.030384 ribonucleoprotein AO
208863_s_at SRSF1 serine/arginine-rich splicing factor 6426 1.155243 0.002024 0.03021
1
221942_s_at GUCY1A3 guanylate cyclase 1, soluble, alpha 2982 1.274671 0.002022 0.030194
3
203380_x_at SRSF5 serine/arginine-rich splicing factor 6430 1.094125 0.002013 0.030181
5
204439_at IFI44L interferon-induced protein 44-like 10964 1.917025 0.002005 0.030152
202119_s_at CPNE3 copine III 8895 1.240924 0.001996 0.030069
202491_s_at IKBKAP inhibitor of kappa light polypeptide 8518 1.162396 0.001995 0.030069 gene enhancer in B-cells, kinase
complex-associated protein
200816_s_at PAFAH1B1 platelet-activating factor 5048 1.041005 0.001981 0.029948 acetylhydrolase lb, regulatory
subunit 1 (45kDa)
20301 l_at IMPA1 inositol(myo)-l(or 4)- 3612 1.283329 0.001971 0.029877 monophosphatase 1
202613_at CTPS1 CTP synthase 1 1503 1.114581 0.001955 0.0297
206937_at SPTA1 spectrin, alpha, erythrocytic 1 6708 1.151575 0.001936 0.029531
(elliptocytosis 2)
212037_at PNN pinin, desmosome associated 5411 1.494883 0.001917 0.029474 protein
206052_s_at SLBP stem-loop binding protein 7884 1.082828 0.001906 0.029434
201013_s_at PAICS phosphoribosylaminoimidazole 10606 1.121467 0.00186 0.029062 carboxylase,
phosphoribosylaminoimidazole
succinocarboxamide synthetase
209642_at BUB1 BUB 1 mitotic checkpoint 699 1.034101 0.001808 0.028585 serine/threonine kinase
210425_x_at GOLGA8B golgin A8 family, member B 440270 1.211965 0.001808 0.028585
20986 l_s_at METAP2 methionyl aminopeptidase 2 10988 1.173435 0.001784 0.0285
221547_at PRPF18 PRP18 pre-mRNA processing 8559 1.010609 0.001784 0.0285 factor 18 homolog (S. cerevisiae)
203138_at HAT1 histone acetyltransferase 1 8520 1.697742 0.001772 0.028447
209630_s_at FBXW2 F-box and WD repeat domain 26190 1.00777 0.001755 0.028286 containing 2
201330_at RARS arginyl-tRNA synthetase 5917 1.048926 0.001753 0.028265
211727_s_at COX 11 cytochrome c oxidase assembly 1353 1.104041 0.001747 0.028216 homolog 11 (yeast)
212287_at SUZ12 suppressor of zeste 12 homolog 23512 1.060589 0.001742 0.028189
(Drosophila)
208802_at SRP72 signal recognition particle 72kDa 6731 1.080033 0.001713 0.028028
200978_at MDH1 malate dehydrogenase 1, NAD 4190 1.102564 0.001677 0.027682
(soluble)
203373_at SOCS2 suppressor of cytokine signaling 2 8835 1.193044 0.001676 0.027682
218263_s_at ZBED5 zinc finger, BED-type containing 5 58486 1.068226 0.001674 0.027682
202303_x_at SMARCA5 SWI/SNF related, matrix 8467 1.013631 0.001653 0.02757 associated, actin dependent
regulator of chromatin, subfamily
a, member 5
201472_at VBP1 von Hippel-Lindau binding protein 7411 1.093136 0.001639 0.027452
1
212825_at PAXIP1 PAX interacting (with 22976 1.152279 0.001534 0.026427 transcription-activation domain)
protein 1
217993_s_at MAT2B methionine adenosyltransferase II, 27430 1.083589 0.001528 0.02639 beta
202113_s_at SNX2 sorting nexin 2 6643 1.270036 0.001506 0.02616
209330_s_at HNRNPD heterogeneous nuclear 3184 1.161084 0.001504 0.02616 ribonucleoprotein D (AU-rich
element RNA binding protein 1 ,
37kDa)
206958_s_at UPF3A UPF3 regulator of nonsense 65110 1.374126 0.001456 0.025618 transcripts homolog A (yeast)
201478_s_at D C1 dyskeratosis congenita 1, dyskerin 1736 1.420645 0.00145 0.025591
210260_s_at TNFAIP8 tumor necrosis factor, alpha- 25816 1.079476 0.001424 0.025305 induced protein 8
205394_at CHE 1 checkpoint kinase 1 1111 1.025967 0.001414 0.025236
208966_x_at IFI16 interferon, gamma-inducible 3428 1.261519 0.001413 0.025236 protein 16
202227_s_at BRD8 bromodomain containing 8 10902 1.211398 0.001397 0.025152
202983_at HLTF helicase-like transcription factor 6596 1.292442 0.001395 0.025148
218966_at MY05C myosin VC 55930 1.153543 0.001385 0.025003
208787_at MRPL3 mitochondrial ribosomal protein 11222 1.176304 0.001376 0.02497
L3
203427_at ASF1A ASF1 anti -silencing function 1 25842 1.059991 0.001373 0.02497 homolog A (S. cerevisiae)
201260_s_at SYPL1 synaptophysin-like 1 6856 1.204425 0.001372 0.02497
212652_s_at SNX4 sorting nexin 4 8723 1.052201 0.001368 0.024963
217850_at GNL3 guanine nucleotide binding 26354 1.41406 0.00135 0.024754 protein-like 3 (nucleolar)
212435_at TRIM33 tripartite motif containing 33 51592 1.036739 0.001348 0.024743
210983_s_at MCM7 minichromosome maintenance 4176 1.380913 0.001341 0.024732 complex component 7
204510_at CDC7 cell division cycle 7 8317 1.373466 0.001299 0.024412
201970_s_at NASP nuclear autoantigenic sperm 4678 1.246396 0.00128 0.024202 protein (histone-binding)
214043_at PTPRD protein tyrosine phosphatase, 5789 1.253071 0.001271 0.02415 receptor type, D
209572_s_at EED embryonic ectoderm development 8726 1.058266 0.00127 0.02415
202890_at MAP7 microtubule-associated protein 7 9053 1.299804 0.001265 0.02408
201129_at SRSF7 serine/arginine-rich splicing factor 6432 1.119633 0.001254 0.023956
7
201699_at PSMC6 proteasome (prosome, macropain) 5706 1.503145 0.00122 0.023629
26S subunit, ATPase, 6
212266_s_at SRSF5 serine/arginine-rich splicing factor 6430 1.41576 0.001217 0.023629
5
206544_x_at SMARCA2 SWI/SNF related, matrix 6595 1.067396 0.001209 0.023601 associated, actin dependent
regulator of chromatin, subfamily
a, member 2
209049_s_at ZMYND8 zinc finger, MYND-type 23613 1.006778 0.001203 0.023563 containing 8
213313_at RABGAP1 RAB GTPase activating protein 1 23637 1.398753 0.001197 0.0235
222204_s_at RR 3 RRN3 RNA polymerase I 54700 1.07798 0.001196 0.0235 transcription factor homolog (S.
cerevisiae)
203362_s_at MAD2L1 MAD2 mitotic arrest deficient-like 4085 1.334952 0.001171 0.02321
1 (yeast)
221264_s_at TARDBP TAR DNA binding protein 23435 1.148261 0.00117 0.02321
204009_s_at RAS v- i-ras2 Kirsten rat sarcoma viral 3845 1.15051 0.001169 0.02321 oncogene homolog
213416_at ITGA4 integrin, alpha 4 (antigen CD49D, 3676 1.585393 0.00116 0.023183 alpha 4 subunit of VLA-4 receptor)
200993_at IP07 importin 7 10527 1.052977 0.001144 0.023074
20291 l_at MSH6 mutS homolog 6 (E. coli) 2956 1.406267 0.00114 0.023016
201619_at PRDX3 peroxiredoxin 3 10935 1.166794 0.001136 0.02301
203743_s_at TDG thymine-DNA glycosylase 6996 1.30963 0.00113 0.022997
212199_at MRFAP1L1 Morf4 family associated protein 1- 114932 1.630757 0.001123 0.022952 like 1
202164_s_at CNOT8 CCR4-NOT transcription complex, 9337 1.199704 0.001118 0.022906 subunit 8
204809_at CLPX ClpX caseinolytic peptidase X 10845 1.04299 0.001099 0.02276 homolog (E. coli)
206542_s_at SMARCA2 SWI/SNF related, matrix 6595 1.42069 0.001047 0.022288 associated, actin dependent
regulator of chromatin, subfamily
a, member 2
203948_s_at MPO myeloperoxidase 4353 1.629289 0.001047 0.022288
200927_s_at RAB14 RAB 14, member RAS oncogene 51552 1.113603 0.001045 0.022285 family
20596 l_s_at PSIP1 PC4 and SFRSl interacting protein 11168 1.119456 0.001035 0.022115
1
203139_at DAP 1 death-associated protein kinase 1 1612 1.135088 0.001004 0.021669
219485_s_at PSMD10 proteasome (prosome, macropain) 5716 1.237831 0.000994 0.021584
26S subunit, non-ATPase, 10
202169_s_at AASDHPPT aminoadipate-semialdehyde 60496 1.491517 0.000983 0.021447 dehydrogenase- phosphopantetheinyl transferase
213761_at MDM1 Mdml nuclear protein homolog 56890 1.12881 0.000976 0.02135
(mouse)
212544_at ZNHIT3 zinc finger, HIT-type containing 3 9326 1.294137 0.000971 0.0213
201368_at ZFP36L2 ZFP36 ring finger protein-like 2 678 1.289879 0.000961 0.021237
218882_s_at WDR3 WD repeat domain 3 10885 1.059399 0.000955 0.021 168
20243 l_s_at MYC v-myc myelocytomatosis viral 4609 1.493528 0.000946 0.02101 oncogene homolog (avian)
217828_at SLTM SAFB-like, transcription modulator 7981 1 1.1 18355 0.000938 0.020912
2011 11_at CSE1L CSE1 chromosome segregation 1- 1434 1.623491 0.000932 0.020833 like (yeast)
203474_at IQGAP2 IQ motif containing GTPase 10788 1.614975 0.000922 0.020814 activating protein 2
217906_at LHDC2 kelch domain containing 2 23588 1.142864 0.00092 0.020814
20353 l_at CUL5 cullin 5 8065 1.096581 0.000891 0.020435
202746_at ITM2A integral membrane protein 2A 9452 1.66401 1 0.000885 0.020363
209421_at MSH2 mutS homolog 2, colon cancer, 4436 1.490121 0.00088 0.020343 nonpolyposis type 1 (E. coli)
213698_at ZMYM6NB ZMYM6 neighbor 100506144 1.042591 0.00087 0.020236
218605_at TFB2M transcription factor B2, 64216 1.183958 0.000854 0.02007 mitochondrial
201947_s_at CCT2 chaperonin containing TCP1, 10576 1.143067 0.000853 0.02007 subunit 2 (beta)
202602_s_at HTATSF1 HIV-1 Tat specific factor 1 27336 1.187599 0.000849 0.020015
202930_s_at SUCLA2 succinate-CoA ligase, ADP- 8803 1.176902 0.000838 0.019818 forming, beta subunit
201277_s_at HNRNPAB heterogeneous nuclear 3182 1.014906 0.000822 0.019567 ribonucleoprotein AJB
208798_x_at GOLGA8A golgin A8 family, member A 23015 1.082102 0.000821 0.019567
202413_s_at USP1 ubiquitin specific peptidase 1 7398 1.360578 0.000801 0.01926
201742_x_at SRSF1 serine/arginine-rich splicing factor 6426 1.198562 0.000799 0.01924
1
218014_at NUP85 nucleoporin 85kDa 79902 1.180004 0.000796 0.019229
204240_s_at SMC2 structural maintenance of 10592 1.406601 0.000787 0.01907 chromosomes 2
209337_at PSIP1 PC4 and SFRSl interacting protein 1 1168 1.241851 0.000784 0.019026
1
201273_s_at SRP9 signal recognition particle 9kDa 6726 1.202073 0.000784 0.019026
222303_at — — 1.254922 0.000781 0.019002
212330_at TFDP1 transcription factor Dp-1 7027 1.341814 0.00078 0.019002
203432_at TMPO thymopoietin 7112 1.068195 0.000768 0.01881
203493_s_at CEP57 centrosomal protein 57kDa 9702 1.03691 0.000766 0.018788
202330_s_at UNG uracil-DNA glycosylase 7374 1.326002 0.000761 0.018729
209814_at ZNF330 zinc finger protein 330 27309 1.444996 0.000758 0.018729
203560_at GGH gamma-glutamyl hydrolase 8836 1.446967 0.00075 0.018617
(conjugase,
folylpolygammaglutamyl
hydrolase)
209112_at CDKN1B cyclin-dependent kinase inhibitor 1027 1.181993 0.000749 0.018617
IB (p27, Kipl)
35974_at LRMP lymphoid-restricted membrane 4033 1.001783 0.000732 0.018537 protein
208643_s_at XRCC5 X-ray repair complementing 7520 1.057033 0.000731 0.018525 defective repair in Chinese hamster
cells 5 (double-strand-break
rejoining)
214651_s_at HOXA9 homeobox A9 3205 1.466349 0.000687 0.017825
204767_s_at FEN1 flap structure-specific 2237 1.47296 0.000685 0.017799 endonuclease 1
202658_at PEX11B peroxisomal biogenesis factor 11 8799 1.013624 0.000684 0.017799 beta
218989_x_at SLC30A5 solute carrier family 30 (zinc 64924 1.011398 0.000683 0.017799 transporter), member 5
212740_at PI 3R4 phosphoinositide-3 -kinase, 30849 1.016978 0.000678 0.017687 regulatory subunit 4
212378_at GART pho sphoribo sylglycin amide 2618 1.210756 0.000671 0.017573 formyltransferase,
phosphoribosylglycinamide
synthetase,
phosphoribosylaminoimidazole
synthetase
221931_s_at SEH1L SEHl-like (S. cerevisiae) 81929 1.151366 0.000671 0.017573
201830_s_at NET1 neuroepithelial cell transforming 1 10276 1.193353 0.000654 0.017314
202174_s_at PCM1 pericentriolar material 1 5108 1.195075 0.000641 0.017181
202717_s_at CDC 16 cell division cycle 16 8881 1.000687 0.000632 0.017087
204720_s_at DNAJC6 DnaJ (Hsp40) homolog, subfamily 9829 1.165169 0.00063 0.017071
C, member 6
202503_s_at KIAA0101 KIAA0101 9768 1.410664 0.000627 0.01707
212513_s_at USP33 ubiquitin specific peptidase 33 23032 1.349055 0.000623 0.01703
203583_at UNC50 unc-50 homolog (C. elegans) 25972 1.021413 0.000607 0.016773
209199_s_at MEF2C myocyte enhancer factor 2C 4208 1.384786 0.000605 0.016755
203949_at MPO myeloperoxidase 4353 2.09466 0.0006 0.016728
213088_s_at DNAJC9 DnaJ (Hsp40) homolog, subfamily 23234 1.165365 0.0006 0.016728
C, member 9
201873_s_at ABCE1 ATP -binding cassette, sub-family 6059 1.123959 0.000598 0.016728
E (OABP), member 1
201518_at CBX1 chromobox homolog 1 10951 1.118253 0.000591 0.016699
221771_s_at MPHOSPH8 M-phase phosphoprotein 8 54737 1.003732 0.000588 0.016642
218236_s_at PRKD3 protein kinase D3 23683 1.039419 0.00058 0.016542
218979_at RMI1 RMI1, RecQ mediated genome 80010 1.012559 0.000577 0.016542 instability 1, homolog (S.
cerevisiae)
201532_at PSMA3 proteasome (prosome, macropain) 5684 1.445319 0.000575 0.016531 subunit, alpha type, 3
212653_s_at EHBP1 EH domain binding protein 1 23301 1.032735 0.000566 0.016422
210338_s_at HSPA8 heat shock 70kDa protein 8 3312 1.574514 0.000564 0.016422
218642_s_at CHCHD7 coiled-coil-helix-coiled-coil-helix 79145 1.029917 0.000561 0.016422 domain containing 7
221970_s_at NOL11 nucleolar protein 11 25926 1.054307 0.00056 0.016422
202741_at PRKACB protein kinase, c AMP -dependent, 5567 1.048386 0.000557 0.016422 catalytic, beta
209905_at HOXA9 homeobox A9 3205 1.24736 0.000554 0.016422
202589_at TYMS thymidylate synthetase 7298 1.65426 0.000548 0.01628
200071_at SMNDC1 survival motor neuron domain 10285 1.034914 0.000544 0.016265 containing 1
201303_at EIF4A3 eukaryotic translation initiation 9775 1.17097 0.000539 0.016206 factor 4A3
205632_s_at PIP5 1B phosphatidylinositol-4-phosphate 8395 1.175229 0.000533 0.016113
5-kinase, type I, beta
215380_s_at GGCT gamma-glutamylcyclotransferase 79017 1.189841 0.000531 0.016099
203765_at GCA grancalcin, EF-hand calcium 25801 1.046003 0.00053 0.016099 binding protein
220865_s_at PDSS1 prenyl (decaprenyl) diphosphate 23590 1.074485 0.000525 0.016054 synthase, subunit 1
202446_s_at PLSCR1 phospholipid scramblase 1 5359 1.327281 0.000524 0.01605
200970_s_at SERP1 stress-associated endoplasmic 27230 1.075633 0.000512 0.015879 reticulum protein 1
216920_s_at TARP TCR gamma alternate reading 445347 1.485156 0.000485 0.015374 frame protein
212693_at MDN1 MDN1, midasin homolog (yeast) 23195 1.087501 0.000484 0.015374
213359_at HNR PD heterogeneous nuclear 3184 1.09076 0.000478 0.015321 ribonucleoprotein D (AU-rich
element RNA binding protein 1 ,
37kDa)
206102_at GINS1 GINS complex subunit 1 (Psfl 9837 1.575105 0.000474 0.015221 homolog)
202950_at C YZ crystallin, zeta (quinone reductase) 1429 1.315997 0.000472 0.015221
202395_at NSF N-ethylmaleimide-sensitive factor 4905 1.021689 0.000471 0.015221
220615_s_at FAR2 fatty acyl CoA reductase 2 55711 1.050613 0.000469 0.015212
211700_s_at TRO trophinin 7216 1.068948 0.000465 0.015212
206095_s_at SRSF10 serine/arginine-rich splicing factor 10772 1.179453 0.000464 0.015212
10
208694_at PR DC protein kinase, DNA-activated, 5591 1.097773 0.000458 0.015075 catalytic polypeptide
214141_x_at SRSF7 serine/arginine-rich splicing factor 6432 1.331333 0.000439 0.014608
7
203517_at MTX2 metaxin 2 10651 1.225852 0.000439 0.014608
205857_at SLC18A2 solute carrier family 18 (vesicular 6571 1.065076 0.000431 0.014432 monoamine), member 2
203856_at VR 1 vaccinia related kinase 1 7443 1.237886 0.00043 0.014432
203372_s_at SOCS2 suppressor of cytokine signaling 2 8835 1.09312 0.00042 0.014308
221652_s_at ASUN asunder, spermatogenesis regulator 55726 1.363988 0.000412 0.014181
212690_at DDHD2 DDHD domain containing 2 23259 1.236377 0.000412 0.014181
208808_s_at HMGB2 high mobility group box 2 3148 1.445021 0.000402 0.014069
212896_at S IV2L2 superkiller viralicidic activity 2- 23517 1.098253 0.000395 0.013905 like 2 (S. cerevisiae)
221622_s_at TMEM126B transmembrane protein 126B 55863 1.103945 0.000394 0.013871
218303_x_at KRCC1 lysine-rich coiled-coil 1 51315 1.054683 0.000393 0.013857
201479_at D C1 dyskeratosis congenita 1, dyskerin 1736 1.261576 0.00039 0.013806
203156_at AKAP11 A kinase (PRKA) anchor protein 11215 1.181561 0.000384 0.013683
11
201756_at RPA2 replication protein A2, 32kDa 6118 1.039715 0.000379 0.013533
209903_s_at ATR ataxia telangiectasia and Rad3 545 1.074716 0.000376 0.013488 related
206976_s_at HSPH1 heat shock 105kDa/l lOkDa protein 10808 1.254331 0.000376 0.013488
1
219454_at EGFL6 EGF-like-domain, multiple 6 25975 1.30877 0.000367 0.013369
211144_x_at TARP TCR gamma alternate reading 445347 1.365625 0.000366 0.013369
frame protein
205133_s_at HSPE1 heat shock lOkDa protein 1 3336 1.081382 0.000365 0.013369
(chaperonin 10)
202429_s_at PPP3CA protein phosphatase 3, catalytic 5530 1.056462 0.000363 0.013369 subunit, alpha isozyme
210038_at PR CQ protein kinase C, theta 5588 1.046788 0.000358 0.013295
205668_at LY75 lymphocyte antigen 75 4065 1.075449 0.000357 0.013295
201515_s_at TSN translin 7247 1.30897 0.000349 0.01317
221825_at ANGEL2 angel homolog 2 (Drosophila) 90806 1.010739 0.000347 0.013115
212168_at RBM12 R A binding motif protein 12 10137 1.209363 0.000346 0.013115
201555_at MCM3 minichromosome maintenance 4172 1.057831 0.000343 0.013089 complex component 3
208766_s_at HNR PR heterogeneous nuclear 10236 1.04567 0.000341 0.013032 ribonucleoprotein R
213294_at EIF2AK2 eukaryotic translation initiation 5610 1.224521 0.000339 0.012995 factor 2-alpha kinase 2
217956_s_at ENOPH1 enolase-phosphatase 1 58478 1.13057 0.000325 0.012646
21221 l_at ANKRD17 ankyrin repeat domain 17 26057 1.06166 0.000321 0.012541
218396_at VPS13C vacuolar protein sorting 13 54832 1.169643 0.000315 0.012391 homolog C (S. cerevisiae)
202020_s_at LANCL1 LanC lantibiotic synthetase 10314 1.265915 0.000314 0.012374 component C-like 1 (bacterial)
213304_at FAM179B family with sequence similarity 23116 1.05681 0.000311 0.01229
179, member B
214093_s_at FUBP1 far upstream element (FUSE) 8880 1.19343 0.000311 0.01229 binding protein 1
221761_at ADSS adenylosuccinate synthase 159 1.010834 0.000308 0.012252
201386_s_at DHX15 DEAH (Asp-Glu-Ala-His) box 1665 1.650845 0.000306 0.012244 polypeptide 15
221505_at ANP32E acidic (leucine-rich) nuclear 81611 1.183054 0.000303 0.012139 phosphoprotein 32 family, member
E
218127_at NFYB nuclear transcription factor Y, beta 4801 1.104339 0.00029 0.011904
219303_at R F219 ring finger protein 219 79596 1.119496 0.000279 0.011636
218133_s_at NIF3L1 NIF3 NGGl interacting factor 3- 60491 1.192936 0.000269 0.011358 like 1 (S. cerevisiae)
203428_s_at ASF1A ASF1 anti -silencing function 1 25842 1.128273 0.000268 0.011351 homolog A (S. cerevisiae)
219037_at RRP15 ribosomal RNA processing 15 51018 1.057006 0.000267 0.011351
homolog (S. cerevisiae)
218889_at NOC3L nucleolar complex associated 3 64318 1.366019 0.000262 0.011306 homolog (S. cerevisiae)
201413_at HSD17B4 hydro xysteroid (17-beta) 3295 1.140766 0.000255 0.011131 dehydrogenase 4
212526_at SPG20 spastic paraplegia 20 (Troyer 23111 1.026783 0.000251 0.01101 syndrome)
20802 l_s_at RFC1 replication factor C (activator 1) 1, 5981 1.039138 0.00025 0.010974
145kDa
213253_at SMC2 structural maintenance of 10592 1.034612 0.000246 0.010839 chromosomes 2
218713_at NARG2 NMDA receptor regulated 2 79664 1.010022 0.000244 0.010824
209092_s_at GLOD4 glyoxalase domain containing 4 51031 1.452265 0.000233 0.010534
208634_s_at MACF1 microtubule-actin crosslinking 23499 1.053724 0.000229 0.010503 factor 1
202854_at HPRT1 hypoxanthine 3251 1.377438 0.000227 0.010458 phosphoribosyltransferase 1
202345_s_at FABP5 fatty acid binding protein 5 2171 1.412774 0.000223 0.010332
(psoriasis-associated)
217832_at SYNCRIP synaptotagmin binding, 10492 1.449861 0.000222 0.010305 cytoplasmic RNA interacting
protein
220742_s_at NGLY1 N-glycanase 1 55768 1.055086 0.00022 0.010287
202318_s_at SENP6 SUMOl/sentrin specific peptidase 26054 1.021802 0.000214 0.010126
6
202892_at CDC23 cell division cycle 23 8697 1.142138 0.000212 0.010103
201964_at SETX senataxin 23064 1.253372 0.000211 0.010103
209056_s_at CDC5L cell division cycle 5-like 988 1.214199 0.000208 0.010028
214047_s_at MBD4 methyl-CpG binding domain 8930 1.011612 0.000208 0.010028 protein 4
201603_at PPP1R12A protein phosphatase 1, regulatory 4659 1.089584 0.000204 0.00993 subunit 12A
208716_s_at TMCOl transmembrane and coiled-coil 54499 1.113356 0.000202 0.009867 domains 1
218710_at TTC27 tetratricopeptide repeat domain 27 55622 1.090229 0.000201 0.009867
216221_s_at PUM2 pumilio homolog 2 (Drosophila) 23369 1.105518 0.000201 0.009867
202107_s_at MCM2 minichromosome maintenance 4171 1.506995 0.000201 0.009867 complex component 2
214453_s_at IFI44 interferon-induced protein 44 10561 1.719005 0.0002 0.009867
208775_at XPOl exportin 1 (CRM1 homolog, yeast) 7514 1.473631 0.000198 0.009851
211929_at HNR PA3 heterogeneous nuclear 220988 1.257569 0.000198 0.009839 ribonucleoprotein A3
212406_s_at PCMTD2 protein-L-isoaspartate (D- 55251 1.452466 0.000196 0.009776 aspartate) O-methyltransferase
domain containing 2
204354_at POT1 protection of telomeres 1 25913 1.126965 0.000194 0.009746
218323_at RHOT1 ras homolog family member Tl 55288 1.007825 0.000186 0.009582
200994_at IP07 importin 7 10527 1.001576 0.000186 0.009582
201773_at ADNP activity-dependent neuroprotector 23394 1.388566 0.000183 0.009532 homeobox
202060_at CTR9 Ctr9, Pafl/RNA polymerase II 9646 1.453326 0.00018 0.00945 complex component, homolog (S.
cerevisiae)
209218_at SQLE squalene epoxidase 6713 1.758399 0.000177 0.009364
209580_s_at MBD4 methyl-CpG binding domain 8930 1.160508 0.000174 0.009336 protein 4
202633_at TOPBP1 topoisomerase (DNA) II binding 11073 1.197566 0.000173 0.009336 protein 1
213106_at ATP8A1 ATPase, aminophospholipid 10396 1.20933 0.000168 0.009246 transporter (APLT), class I, type
8A, member 1
212058_at U2SURP U2 snRNP-associated SURP 23350 1.398897 0.000168 0.009246 domain containing
212408_at TOR1AIP1 torsin A interacting protein 1 26092 1.153349 0.000163 0.009063
203067_at PDHX pyruvate dehydrogenase complex, 8050 1.024437 0.00016 0.009007 component X
202184_s_at NUP133 nucleoporin 133kDa 55746 1.163427 0.000156 0.008893
204749_at NAP1L3 nucleosome assembly protein 1 - 4675 1.756608 0.000149 0.008702 like 3
212621_at TMEM194A transmembrane protein 194A 23306 1.117235 0.000148 0.008702
200723_s_at CAPRIN1 cell cycle associated protein 1 4076 1.360735 0.000145 0.008669
219008_at C2orf43 chromosome 2 open reading frame 60526 1.160627 0.000144 0.008657
43
202220_at KIAA0907 KIAA0907 22889 1.542705 0.000144 0.008657
211987_at TOP2B topoisomerase (DNA) II beta 7155 1.023919 0.000143 0.008633
180kDa
20244 l_at ERLIN1 ER lipid raft associated 1 10613 1.221226 0.000141 0.008533
218171_at VPS4B vacuolar protein sorting 4 homolog 9525 1.099892 0.000138 0.008402
B (S. cerevisiae)
209974_s_at BUB 3 BUB3 mitotic checkpoint protein 9184 1.177194 0.000136 0.008296
219412_at RAB38 RAB38, member RAS oncogene 23682 1.455958 0.000133 0.008144 family
205474_at CRLF3 cytokine receptor-like factor 3 51379 1.012784 0.000132 0.008144
22220 l_s_at CASP8AP2 caspase 8 associated protein 2 9994 1.164562 0.00013 0.008097
208838_at CAND1 cullin-associated and neddylation- 55832 1.071114 0.000128 0.007998 dissociated 1
204521_at FAM216A family with sequence similarity 29902 1.272748 0.000124 0.007921
216, member A
213506_at F2RL1 coagulation factor II (thrombin) 2150 1.465639 0.000123 0.007906 receptor-like 1
214988_s_at SON SON DNA binding protein 6651 1.293714 0.00012 0.007803
218005_at ZNF22 zinc finger protein 22 7570 1.363822 0.000117 0.007673
202798_at SEC24B SEC24 family, member B (S. 10427 1.217371 0.000115 0.007613 cerevisiae)
203519_s_at UPF2 UPF2 regulator of nonsense 26019 1.021857 0.000114 0.007613 transcripts homolog (yeast)
213227_at PGRMC2 progesterone receptor membrane 10424 1.088092 0.000114 0.007613 component 2
212918_at RECQL RecQ protein-like (DNA helicase 5965 1.204724 0.000111 0.007613
Ql-like)
218842_at RPAP3 RNA polymerase II associated 79657 1.007012 0.000109 0.007613 protein 3
218370_s_at S100PBP SI OOP binding protein 64766 1.040583 0.000107 0.007601
209043_at PAPSS1 3'-phosphoadenosine 5'- 9061 1.266585 0.000106 0.007558 phosphosulfate synthase 1
213374_x_at HIBCH 3 -hydro xyisobutyryl-Co A 26275 1.37257 0.000104 0.00745 hydrolase
201202_at PCNA proliferating cell nuclear antigen 5111 1.874541 0.000102 0.00739
208925_at CLDND1 claudin domain containing 1 56650 1.035219 0.000101 0.007343
208986_at TCF12 transcription factor 12 6938 1.13518 9.80E-05 0.00719
202706_s_at UMPS uridine monophosphate synthetase 7372 1.021819 9.71E-05 0.007147
222209_s_at TMEM135 transmembrane protein 135 65084 1.139737 9.39E-05 0.007017
202956_at ARFGEF1 ADP-ribosylation factor guanine 10565 1.048197 9.25E-05 0.006996 nucleotide-exchange factor 1
(brefeldin A-inhibited)
208877_at PAK2 p21 protein (Cdc42/Rac)-activated 5062 1.095691 9.02E-05 0.006891 kinase 2
212454_x_at HNRPDL heterogeneous nuclear 9987 1.012227 8.99E-05 0.006891 ribonucleoprotein D-like
201832_s_at USOl USO 1 vesicle transport factor 8615 1.196724 8.58E-05 0.006807
218104_at TEX 10 testis expressed 10 54881 1.063963 8.48E-05 0.006794
209585_s_at MINPP1 multiple inositol-polyphosphate 9562 1.5483 8.34E-05 0.006749 phosphatase 1
204160_s_at ENPP4 ectonucleotide 22875 1.023317 8.15E-05 0.006724 pyrophosphatase/phosphodiesteras
e 4 (putative)
201872_s_at ABCE1 ATP -binding cassette, sub-family 6059 1.056302 7.77E-05 0.006497
E (OABP), member 1
203608_at ALDH5A1 aldehyde dehydrogenase 5 family, 7915 1.567849 7.76E-05 0.006497 member Al
201177_s_at UBA2 ubiquitin-like modifier activating 10054 1.011771 7.72E-05 0.006497 enzyme 2
201663_s_at SMC4 structural maintenance of 10051 1.397017 7.58E-05 0.006462 chromosomes 4
206478_at KIAA0125 KIAA0125 9834 1.699586 7.39E-05 0.006369
209259_s_at SMC3 structural maintenance of 9126 1.536331 7.36E-05 0.006369 chromosomes 3
201491_at AHSA1 AHA1, activator of heat shock 10598 1.017409 7.09E-05 0.006348
90kDa protein ATPase homolog 1
(yeast)
200050_at ZNF146 zinc finger protein 146 7705 1.112747 6.82E-05 0.006137
212798_s_at ANKMY2 ankyrin repeat and MYND domain 57037 1.282009 6.82E-05 0.006137 containing 2
200597_at EIF3A eukaryotic translation initiation 8661 1.15333 6.58E-05 0.006137 factor 3, subunit A
220416_at ATP8B4 ATPase, class I, type 8B, member 79895 1.319886 6.56E-05 0.006137
4
218352_at RCBTB1 regulator of chromosome 55213 1.401043 6.56E-05 0.006137 condensation (RCC1) and BTB
(POZ) domain containing protein 1
208954_s_at LARP4B La ribonucleoprotein domain 23185 1.035215 6.55E-05 0.006137 family, member 4B
200754_x_at SRSF2 serine/arginine-rich splicing factor 6427 1.189498 6.53E-05 0.006137
2
213094_at GPR126 G protein-coupled receptor 126 57211 1.723615 6.36E-05 0.006137
201726_at ELAVL1 ELAV (embryonic lethal, 1994 1.210067 6.33E-05 0.006137
abnormal vision, Drosophila)-like
1 (Hu antigen R)
202797_at SACM1L SAC1 suppressor of actin 22908 1.068996 6.19E-05 0.006092 mutations 1 -like (yeast)
218932_at ZNHIT6 zinc finger, HIT-type containing 6 54680 1.533903 6.11E-05 0.006036
205909_at POLE2 polymerase (DNA directed), 5427 1.13581 6.10E-05 0.006036 epsilon 2, accessory subunit
201493_s_at PUM2 pumilio homolog 2 (Drosophila) 23369 1.045091 6.09E-05 0.006036
203605_at SRP54 signal recognition particle 54kDa 6729 1.336501 6.08E-05 0.006036
213737_x_at GOLGA8H golgin A8 family, member H 728498 1.276782 5.98E-05 0.006036
205848_at GAS2 growth arrest-specific 2 2620 1.882946 5.69E-05 0.005965
207483_s_at CAND1 cullin-associated and neddylation- 55832 1.101083 5.60E-05 0.005911 dissociated 1
219497_s_at BCL11A B-cell CLL/lymphoma 11A (zinc 53335 1.051534 5.48E-05 0.00586 finger protein)
201664_at SMC4 structural maintenance of 10051 1.810802 5.39E-05 0.005828 chromosomes 4
209362_at MED21 mediator complex subunit 21 9412 1.351739 5.36E-05 0.005828
201458_s_at BUB 3 BUB3 mitotic checkpoint protein 9184 1.194027 5.30E-05 0.005828
203804_s_at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 1.117694 5.28E-05 0.005828
206316_s_at KNTC1 kinetochore associated 1 9735 1.132251 5.10E-05 0.00579
204030_s_at IQCJ- IQCJ-SCHIP1 readthrough 100505385 1.123787 5.04E-05 0.005746
SCHIP1
218437_s_at LZTFL1 leucine zipper transcription factor54585 1.226372 4.98E-05 0.005732 like 1
202502_at ACADM acyl-CoA dehydrogenase, C-4 to 34 1.024159 4.94E-05 0.005732
C-12 straight chain
204256_at ELOVL6 ELOVL fatty acid elongase 6 79071 1.533869 4.93E-05 0.005732
215165_x_at UMPS uridine monophosphate synthetase 7372 1.104322 4.89E-05 0.005732
217814_at CCDC47 coiled-coil domain containing 47 57003 1.430862 4.63E-05 0.005622
212944_at SLC5A3 solute carrier family 5 6526 1.422266 4.48E-05 0.005619
(sodium/myo-inositol
cotransporter), member 3
20886 l_s_at ATRX alpha thalassemia/mental 546 1.174112 4.47E-05 0.005619 retardation syndrome X-linked
208848_at ADH5 alcohol dehydrogenase 5 (class 128 1.350061 4.32E-05 0.005587
III), chi polypeptide
209813_x_at TARP TCR gamma alternate reading 445347 1.675539 4.27E-05 0.005556 frame protein
208860_s_at ATRX alpha thalassemia/mental 546 1.385939 4.22E-05 0.005556 retardation syndrome X-linked
216199_s_at MAP3 4 mitogen-activated protein kinase 4216 1.101219 4.03E-05 0.005398 kinase kinase 4
218577_at LRRC40 leucine rich repeat containing 40 55631 1.237191 3.99E-05 0.005382
208955_at DUT deoxyuridine triphosphatase 1854 1.439155 3.92E-05 0.005311
203614_at UTP14C UTP14, U3 small nucleolar 9724 1.05731 3.86E-05 0.005287 ribonucleoprotein, homolog C
(yeast)
202540_s_at HMGCR 3 -hydro xy-3 -methylglutaryl-CoA 3156 1.149998 3.83E-05 0.005286 reductase
209025_s_at SYNCRIP synaptotagmin binding, 10492 1.11864 3.81E-05 0.005286 cytoplasmic RNA interacting
protein
221884_at MECOM MDS1 and EVIl complex locus 2122 1.313552 3.58E-05 0.005097
213677_s_at PMS1 PMS1 postmeiotic segregation 5378 1.319836 3.48E-05 0.004995 increased 1 (S. cerevisiae)
203482_at FAM178A family with sequence similarity 55719 1.006684 3.46E-05 0.004994
178, member A
205395_s_at MRE11A MRE11 meiotic recombination 11 4361 1.047297 3.44E-05 0.004994 homolog A (S. cerevisiae)
205541_s_at GSPT2 Gl to S phase transition 2 23708 1.302983 3.23E-05 0.004813
2131 l l_at PIKFYVE phosphoinositide kinase, FYVE 200576 1.505014 3.21E-05 0.004813 finger containing
203406_at MFAP1 microfibrillar-associated protein 1 4236 1.105243 2.95E-05 0.004627
212648_at DHX29 DEAH (Asp-Glu-Ala-His) box 54505 1.181102 2.90E-05 0.004616 polypeptide 29
212905_at CSTF2T cleavage stimulation factor, 3 ' pre- 23283 1.012536 2.79E-05 0.004519
RNA, subunit 2, 64kDa, tau variant
203102_s_at MGAT2 mannosyl (alpha-1,6-)- 4247 1.02975 2.78E-05 0.004519 glycoprotein beta-l,2-N- acetylglucosaminyltransferase
212407_at METTL13 methyltransferase like 13 51603 1.183202 2.73E-05 0.004519
212584_at AQR aquarius homolog (mouse) 9716 1.131181 2.71E-05 0.004519
221522_at AN RD27 ankyrin repeat domain 27 (VPS9 84079 1.408053 2.46E-05 0.004336 domain)
215143_at DPY19L2P2 dpy-19-like 2 pseudogene 2 (C. 349152 1.163809 2.42E-05 0.004298 elegans)
212402_at ZC3H13 zinc finger CCCH-type containing 23091 1.411241 2.40E-05 0.004298
13
213005_s_at KANKl KN motif and ankyrin repeat 23189 1.420285 2.37E-05 0.004281 domains 1
201086_x_at SON SON DNA binding protein 6651 1.303827 2.37E-05 0.004281
205885_s_at ITGA4 integrin, alpha 4 (antigen CD49D, 3676 1.152728 2.32E-05 0.004281 alpha 4 subunit of VLA-4 receptor)
218957_s_at PAAF1 proteasomal ATPase-associated 80227 1.082321 2.32E-05 0.004281 factor 1
209409_at GRB 10 growth factor receptor-bound 2887 1.411903 2.31E-05 0.004281 protein 10
218428_s_at REVl REVl, polymerase (DNA directed) 51455 1.014141 2.30E-05 0.004281
212982_at ZDHHC17 zinc finger, DHHC-type containing 23390 1.24448 2.23E-05 0.004281
17
206854_s_at MAP3 7 mitogen-activated protein kinase 6885 1.362632 2.14E-05 0.004215 kinase kinase 7
213164_at SLC5A3 solute carrier family 5 6526 1.12656 2.14E-05 0.004215
(sodium/myo-inositol
cotransporter), member 3
209662_at CETN3 centrin, EF-hand protein, 3 1070 1.780447 2.13E-05 0.004215
213092_x_at DNAJC9 DnaJ (Hsp40) homolog, subfamily 23234 1.281922 2.11E-05 0.004215
C, member 9
219130_at TRMT13 tRNA methyltransferase 13 54482 1.054729 2.09E-05 0.004215 homolog (S. cerevisiae)
218096_at AGPAT5 l-acylglycerol-3 -phosphate 0- 55326 1.046759 2.05E-05 0.004215 acyltransferase 5
200783_s_at STMN1 stathmin 1 3925 1.021197 1.99E-05 0.004183
202763_at CASP3 caspase 3, apoptosis-related 836 1.113632 1.97E-05 0.004167 cysteine peptidase
206874_s_at SL STE20-like kinase 9748 1.508576 1.95E-05 0.004162
215806_x_at TARP TCR gamma alternate reading 445347 1.699601 1.94E-05 0.004162 frame protein
218139_s_at AP5M1 adaptor -related protein complex 5, 55745 1.213838 1.93E-05 0.004162 mu 1 subunit
21273 l_at ANKRD46 ankyrin repeat domain 46 157567 1.139853 1.87E-05 0.004117
217317_s_at HERC2P2 hect domain and RLD 2 400322 1.063595 1.62E-05 0.003764 pseudogene 2
212176_at PNISR PNN-interacting serine/arginine- 25957 1.0103 1.62E-05 0.003764 rich protein
218313_s_at GALNT7 UDP-N-acetyl-alpha-D- 51809 1.507414 1.62E-05 0.003764
galactosamine:polypeptide N- acetylgalactosaminyltransferase 7
(GalNAc-T7)
219083_at SHQ1 SHQ1, H/ACA ribonucleoprotein 55164 1.675814 1.53E-05 0.003721 assembly factor
203302_at DC deoxycytidine kinase 1633 1.276653 1.43E-05 0.003616
218515_at PAXBP1 PAX3 and PAX7 binding protein 1 94104 1.243818 1.43E-05 0.003616
213391_at DPY19L4 dpy-19-like 4 (C. elegans) 286148 1.187053 1.29E-05 0.003444
202907_s_at NBN nibrin 4683 1.588244 1.26E-05 0.003444
217886_at EPS 15 epidermal growth factor receptor 2060 1.345925 1.23E-05 0.003411 pathway substrate 15
218622_at NUP37 nucleoporin 37kDa 79023 1.261215 1.22E-05 0.003411
208654_s_at CD 164 CD 164 molecule, sialomucin 8763 1.456204 1.21E-05 0.003411
219035_s_at R F34 ring finger protein 34, E3 ubiquitin 80196 1.187459 1.15E-05 0.003369 protein ligase
220044_x_at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 1.199028 1.15E-05 0.003369
218768_at NUP107 nucleoporin 107kDa 57122 1.457543 1.14E-05 0.003369
208405_s_at CD 164 CD 164 molecule, sialomucin 8763 1.103873 1.11E-05 0.003369
212675_s_at CEP68 centrosomal protein 68kDa 23177 1.33608 1.11E-05 0.003369
209200_at MEF2C myocyte enhancer factor 2C 4208 1.964319 1.10E-05 0.003369
209476_at TMX1 thioredoxin-related transmembrane 81542 1.209672 1.07E-05 0.003369 protein 1
212474_at AVL9 AVL9 homolog (S. cerevisiase) 23080 1.128401 9.17E-06 0.003236
203306_s_at SLC35A1 solute carrier family 35 (CMP- 10559 1.184632 9.10E-06 0.003236 sialic acid transporter), member Al
219405_at TRIM68 tripartite motif containing 68 55128 1.092848 8.27E-06 0.003067
217954_s_at PHF3 PHD finger protein 3 23469 1.096771 8.00E-06 0.003017
201448_at TIA1 TIA1 cytotoxic granule-associated 7072 1.364827 7.61E-06 0.002919
RNA binding protein
202918_s_at MOB4 MOB family member 4, phocein 25843 1.281577 7.60E-06 0.002919
201503_at G3BP1 GTPase activating protein (SH3 10146 1.400871 7.40E-06 0.002919 domain) binding protein 1
221606_s_at HMGN5 high mobility group nucleosome 79366 1.041186 7.16E-06 0.002919 binding domain 5
212179_at PNISR PNN-interacting serine/arginine- 25957 1.659487 7.06E-06 0.002919 rich protein
207943_x_at PLAGL1 pleiomorphic adenoma gene-like 1 5325 1.02225 6.80E-06 0.002919
219002_at FASTKD1 FAST kinase domains 1 79675 1.139996 6.78E-06 0.002919
219649_at ALG6 ALG6, alpha- 1,3 - 29929 1.318705 6.36E-06 0.002919
glucosyltransferase
218593_at RBM28 R A binding motif protein 28 55131 1.095331 6.00E-06 0.002867
218152_at HMG20A high mobility group 20A 10363 1.329726 5.52E-06 0.002834
218108_at UBR7 ubiquitin protein ligase E3 55148 1.468044 4.88E-06 0.002649 component n-recognin 7 (putative)
212959_s_at GNPTAB N-acetylglucosamine- 1 -phosphate 79158 1.108946 4.43E-06 0.002528 transferase, alpha and beta subunits
213653_at METTL3 methyltransferase like 3 56339 1.135123 4.23E-06 0.002528
201218_at CTBP2 C-terminal binding protein 2 1488 1.622964 4.00E-06 0.002528
202520_s_at MLH1 mutL homolog 1, colon cancer, 4292 1.112927 3.95E-06 0.002528 nonpolyposis type 2 (E. coli)
209022_at STAG2 stromal antigen 2 10735 1.149995 3.82E-06 0.002528
218343_s_at GTF3C3 general transcription factor IIIC, 9330 1.144191 3.71E-06 0.002528 polypeptide 3, 102kDa
219960_s_at UCHL5 ubiquitin carboxyl-terminal 51377 1.108112 3.64E-06 0.002528 hydrolase L5
209175_at SEC23IP SEC23 interacting protein 11196 1.255797 3.63E-06 0.002528
218170_at ISOC1 isochorismatase domain containing 51015 1.24304 3.49E-06 0.002528
1
209265_s_at METTL3 methyltransferase like 3 56339 1.227046 3.29E-06 0.002528
222127_s_at EXOC1 exocyst complex component 1 55763 1.394408 2.86E-06 0.002528
207002_s_at PLAGL1 pleiomorphic adenoma gene-like 1 5325 1.171723 2.49E-06 0.002309
204168_at MGST2 microsomal glutathione S- 4258 1.037395 1.79E-06 0.001991 transferase 2
205609_at ANGPT1 angiopoietin 1 284 1.547029 1.71E-06 0.001991
209537_at EXTL2 exostosin-like glycosyltransferase 2135 1.05732 7.39E-07 0.001096
2
209748_at SPAST spastin 6683 1.096487 6.60E-07 0.001049
218397_at FANCL Fanconi anemia, complementation 55120 1.889757 4.53E-07 0.000871 group L
210621_s_at RASA1 RAS p21 protein activator 5921 1.39113 3.67E-07 0.000871
(GTPase activating protein) 1
201687_s_at API5 apoptosis inhibitor 5 8539 1.055434 1.84E-07 0.000682
212828_at SYNJ2 synaptojanin 2 8871 1.111098 1.84E-07 0.000682
209007_s_at Clorf63 chromosome 1 open reading frame 57035 1.046263 8.11E-08 0.000601
63
218361_at GOLPH3L golgi phosphoprotein 3 -like 55204 1.174016 5.59E-08 0.000601
219913_s_at CRNKL1 crooked neck pre-mR A splicing 51340 1.468407 2.17E-08 0.000482 factor-like 1 (Drosophila)
Table 9. Genes Differently Regulated in the Aggressive Group as Compared to the Controls
Probeset ID Symbol (Na32 Gene Title (Na32 consensus Marl3) Entrez Log2(FC) P-Value Adjusted consensus GenelD P-Value
MarB) (consensus
Mar-13)
209763_at CHRDL1 chordin-like 1 91851 -1.17606 5.21E-09 6.67E-05
210487_at DNTT deoxynucleotidyltransferase, terminal 1791 -1.91383 6.00E-09 6.67E-05
205933_at SETBP1 SET binding protein 1 26040 -1.1773 1.51E-08 0.000112
202723_s_at FOXOl forkhead box 01 2308 -1.10201 4.34E-06 0.024108
201324_at EMP1 epithelial membrane protein 1 2012 -1.73635 6.04E-06 0.026802
201325_s_at EMP1 epithelial membrane protein 1 2012 -1.00997 1.48E-05 0.029925
209398_at HISTimC histone cluster 1, Hlc 3006 -2.26773 3.33E-05 0.061697
212827_at IGHM immunoglobulin heavy constant mu 3507 -1.62695 0.000114 0.134692
206385_s_at AN 3 ankyrin 3, node of Ranvier (ankyrin G) 288 -1.01371 0.000117 0.134692
209183_s_at ClOorflO chromosome 10 open reading frame 10 11067 -1.07496 0.000131 0.139056
209374_s_at IGHM immunoglobulin heavy constant mu 3507 -1.78678 0.000238 0.21202
204430_s_at SLC2A5 solute carrier family 2 (facilitated 6518 -1.13053 0.00026 0.213741 glucose/fructose transporter), member 5
200872_at S100A10 S100 calcium binding protein A10 6281 -1.47658 0.000279 0.215629
209069_s_at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.18661 0.000318 0.221129
210592_s_at SAT1 spermidine/spermine Nl- 6303 -1.08035 0.000376 0.227751 acetyltransferase 1
207111_at EMR1 egf-like module containing, mucin-like, 2015 -1.08619 0.000401 0.227751 hormone receptor-like 1
204304_s_at PROM1 prominin 1 8842 -1.82999 0.00042 0.227751
205984_at CRHBP corticotropin releasing hormone binding 1393 -1.68559 0.000482 0.239161 protein
218280_x_at HIST2H2AA4 histone cluster 2, H2aa4 723790 -2.04755 0.000661 0.271413
211997_x_at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.22595 0.000753 0.293064
211998_at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.37161 0.001101 0.376554
214290_s_at HIST2H2AA4 histone cluster 2, H2aa4 723790 -2.10063 0.001825 0.399532
202888_s_at ANPEP alanyl (membrane) aminopeptidase 290 -1.09433 0.001827 0.399532
210785_s_at THEMIS2 thymocyte selection associated family 9473 -1.40909 0.001958 0.412534 member 2
205402_x_at PRSS2 protease, serine, 2 (trypsin 2) 5645 -1.05383 0.002001 0.412534
220990_s_at MIR21 microRNA 21 406991 -1.16662 0.002023 0.412534
201369_s_at ZFP36L2 ZFP36 ring finger protein -like 2 678 -1.42932 0.002729 0.450281
20757 l_x_at THEMIS2 thymocyte selection associated family 9473 -1.3478 0.0028 0.450281 member 2
212543_at AIM1 absent in melanoma 1 202 -1.12719 0.002817 0.450281
204698_at ISG20 interferon stimulated exonuclease gene 3669 -1.19993 0.002841 0.450281
20kDa
204872_at TLE4 transducin-like enhancer of split 4 7091 -1.08661 0.004743 0.516178
(E(spl) homolog, Drosophila)
211597_s_at HOPX HOP homeobox 84525 -1.35699 0.004787 0.516178
220377_at KIAA0125 KIAA0125 9834 -1.15785 0.004957 0.516178
202708_s_at HIST2H2BE histone cluster 2, H2be 8349 -1.73994 0.00501 0.516178
222258_s_at SH3BP4 SH3 -domain binding protein 4 23677 -1.25738 0.006817 0.549162
202748_at GBP2 guanylate binding protein 2, interferon- 2634 -1.47788 0.007224 0.557788 inducible
222067_x_at HIST1H2BD histone cluster 1, H2bd 3017 -1.3732 0.007682 0.562835
204805_s_at H1FX HI histone family, member X 8971 -1.45025 0.012357 0.587079
214472_at HIST1H2AD histone cluster 1 , H2ad 3013 -1.33457 0.016968 0.609599
215071_s_at HIST1H2AC histone cluster 1 , H2ac 8334 -1.59794 0.020339 0.631601
204057_at IRF8 interferon regulatory factor 8 3394 -1.01328 0.021285 0.631601
221760_at MAN1A1 mannosidase, alpha, class 1A, member 4121 -1.18372 0.02233 0.632753
1
208490_x_at HIST1H2BF histone cluster 1, H2bf 8343 -1.14111 0.027318 0.639545
221556_at CDC14B cell division cycle 14B 8555 -1.26289 0.028048 0.64494
210387_at HIST1H2BG histone cluster 1 , H2bg 8339 -1.14146 0.02951 0.651733
201416_at SOX4 SRY (sex determining region Y)-box 4 6659 -1.05187 0.032258 0.65293
208579_x_at H2BFS H2B histone family, member S 54145 -1.30549 0.035551 0.658786
(pseudogene)
208527_x_at HIST1H2BE histone cluster 1, H2be 8344 -1.05374 0.035992 0.658786
203708_at PDE4B phosphodiesterase 4B, cAMP-specific 5142 -1.26501 0.039076 0.662929
212488_at COL5A1 collagen, type V, alpha 1 1289 -1.01422 0.041826 0.666611
203140_at BCL6 B-cell CLL/lymphoma 6 604 -1.00963 0.04395 0.666724
208546_x_at HIST1H2BH histone cluster 1, H2bh 8345 -1.02623 0.048771 0.677506
214455_at HIST1H2BC histone cluster 1 , H2bc 8347 -1.16847 0.051456 0.680853
218999_at TMEM140 transmembrane protein 140 55281 -1.01862 0.053069 0.682752
208018_s_at HC hemopoietic cell kinase 3055 -1.13981 0.05449 0.684183
204897_at PTGER4 prostaglandin E receptor 4 (subtype 5734 -1.13843 0.058834 0.692792
EP4)
201565_s_at ID2 inhibitor of DNA binding 2, dominant 3398 -1.33513 0.06594 0.694022 negative helix-loop-helix protein
212587_s_at PTPRC protein tyrosine phosphatase, receptor 5788 -1.10126 0.080672 0.719636
type, C
200897_s_at PALLD palladin, cytoskeletal associated protein 23022 -1.24085 0.085951 0.722194
20889 l_at DUSP6 dual specificity phosphatase 6 1848 -1.07107 0.098612 0.730122
20239 l_at BASP1 brain abundant, membrane attached 10409 -1.1892 0.099272 0.730445 signal protein 1
201743_at CD14 CD 14 molecule 929 -1.11579 0.106127 0.731069
221841_s_at KLF4 Kruppel-like factor 4 (gut) 9314 -1.20574 0.106845 0.731355
206110_at HIST1H3H histone cluster 1 , H3h 8357 -1.19698 0.116318 0.738259
213975_s_at LYZ lysozyme 4069 -1.22513 0.117821 0.738667
218723_s_at GCC regulator of cell cycle 28984 -1.01755 0.173123 0.764957
202917_s_at S100A8 S100 calcium binding protein A8 6279 -1.01114 0.365329 0.843162
209774_x_at CXCL2 chemokine (C-X-C motif) ligand 2 2920 1.127083 0.184971 0.770504
206488_s_at CD36 CD36 molecule (thrombospondin 948 1.062242 0.179158 0.767834 receptor)
206049_at SELP selectin P (granule membrane protein 6403 1.027039 0.142209 0.749649
140kDa, antigen CD62)
20258 l_at HSPA1A heat shock 70kDa protein 1 A 3303 1.07338 0.141805 0.749649
212671_s_at HLA-DQA1 major histocompatibility complex, class 3117 1.256994 0.134567 0.747232
II, DQ alpha 1
207808_s_at PROS1 protein S (alpha) 5627 1.076302 0.125868 0.743062
204419_x_at HBG1 hemoglobin, gamma A 3047 1.666375 0.091429 0.723603
204848_x_at HBG1 hemoglobin, gamma A 3047 1.565419 0.086123 0.722194
209839_at DNM3 dynamin 3 26052 1.130837 0.075473 0.711904
217388_s_at YNU kynureninase 8942 1.468314 0.069766 0.703289
214710_s_at CCNB 1 cyclin B 1 891 1.019442 0.057837 0.692792
202729_s_at LTBP1 latent transforming growth factor beta 4052 1.205454 0.056194 0.689409 binding protein 1
205950_s_at CA1 carbonic anhydrase I 759 1.154113 0.05527 0.686498
201014_s_at PAICS phosphoribosylaminoimidazole 10606 1.001269 0.054655 0.684183 carboxylase,
phosphoribosylaminoimidazole
succinocarboxamide synthetase
215813_s_at PTGS1 prostaglandin-endoperoxide synthase 1 5742 1.093699 0.054246 0.684183
(prostaglandin G/H synthase and
cyclooxygenase)
216063_at HBBP1 hemoglobin, beta pseudogene 1 3044 1.237304 0.051626 0.680853
209290_s_at NFIB nuclear factor I/B 4781 1.089323 0.047583 0.675495
212224_at ALDH1A1 aldehyde dehydrogenase 1 family, 216 1.365131 0.047481 0.675495 member Al
207165_at HMMR hyaluronan-mediated motility receptor 3161 1.035451 0.04372 0.666724
(RHAMM)
207668_x_at PDIA6 protein disulfide isomerase family A, 10130 1.01888 0.042673 0.666611 member 6
208639_x_at PDIA6 protein disulfide isomerase family A, 10130 1.087019 0.04232 0.666611 member 6
201202_at PCNA proliferating cell nuclear antigen 5111 1.025175 0.040518 0.664974
202705_at CCNB2 cyclin B2 9133 1.000457 0.037459 0.658786
202870_s_at CDC20 cell division cycle 20 991 1.339489 0.036577 0.658786
217232_x_at HBB hemoglobin, beta 3043 1.819046 0.034587 0.658786
218009_s_at PRC1 protein regulator of cytokinesis 1 9055 1.316131 0.032297 0.65293
213515_x_at HBG1 hemoglobin, gamma A 3047 2.417287 0.029879 0.651733
218350_s_at GMNN geminin, DNA replication inhibitor 51053 1.197599 0.02966 0.651733
209728_at HLA-DRB4 major histocompatibility complex, class 3126 2.147596 0.028176 0.645955
II, DR beta 4
204023_at RFC4 replication factor C (activator 1) 4, 5984 1.139793 0.027395 0.640611
37kDa
203755_at BUB IB BUB 1 mitotic checkpoint 701 1.078262 0.026537 0.639024 serine/threonine kinase B
202760_s_at AKAP2 A kinase (PRKA) anchor protein 2 11217 1.132676 0.023696 0.635738
201477_s_at RRM1 ribonucleotide reductase Ml 6240 1.170464 0.02268 0.635738
218039_at NUSAP1 nucleolar and spindle associated protein 51203 1.296022 0.022485 0.634539
1
209773_s_at RRM2 ribonucleotide reductase M2 6241 1.767338 0.021614 0.631601
206632_s_at APOBEC3B apolipoprotein B mRNA editing 9582 1.217919 0.021271 0.631601 enzyme, catalytic polypeptide-like 3B
201563_at SORD sorbitol dehydrogenase 6652 1.003384 0.021071 0.631601
211696_x_at HBB hemoglobin, beta 3043 1.960803 0.020716 0.631601
201490_s_at PPIF peptidylprolyl isomerase F 10105 1.068584 0.02005 0.62633
209969_s_at STAT1 signal transducer and activator of 6772 1.033433 0.018323 0.612297 transcription 1, 91kDa
202112_at VWF von Willebrand factor 7450 1.065252 0.017067 0.610194
211005_at LAT linker for activation of T cells 27040 1.441264 0.016468 0.605865
206102_at GINS1 GINS complex subunit 1 (Psfl 9837 1.19856 0.014854 0.595174 homolog)
206698_at X X-linked Kx blood group (McLeod 7504 1.473769 0.014747 0.595174 syndrome)
201761_at MTHFD2 methylenetetrahydrofolate 10797 1.176486 0.01448 0.595174 dehydrogenase (NADP+ dependent) 2,
methenyltetrahydrofolate
cyclohydrolase
202589_at TYMS thymidylate synthetase 7298 1.284352 0.014339 0.594132
203362_s_at MAD2L1 MAD2 mitotic arrest deficient-like 1 4085 1.12377 0.014136 0.591776
(yeast)
204146_at RAD51AP1 RAD51 associated protein 1 10635 1.138009 0.013242 0.587079
202814_s_at HEXIM1 hexamethylene bis-acetamide inducible 10614 1.018846 0.011855 0.587079
1
211953_s_at IP05 importin 5 3843 1.1663 0.010926 0.587079
212589_at RRAS2 related RAS viral (r-ras) oncogene 22800 1.248922 0.010896 0.587079 homolog 2
201897_s_at C S1B CDC28 protein kinase regulatory 1163 1.237742 0.010699 0.587079 subunit IB
201829_at NET1 neuroepithelial cell transforming 1 10276 1.249173 0.010403 0.58573
212459_x_at SUCLG2 succinate-CoA ligase, GDP-forming, 8801 1.16554 0.009868 0.58573 beta subunit
201930_at MCM6 mmichromosome maintenance complex 4175 1.046236 0.009628 0.582356 component 6
209116_x_at HBB hemoglobin, beta 3043 2.529691 0.008816 0.568066
218585_s_at DTL denticleless E3 ubiquitin protein ligase 51514 1.376897 0.008767 0.568066 homolog (Drosophila)
206937_at SPTA1 spectrin, alpha, erythrocytic 1 6708 1.114075 0.008321 0.566014
(elliptocytosis 2)
218883_s_at MLF1IP MLF 1 interacting protein 79682 1.136186 0.008177 0.566014
215772_x_at SUCLG2 succinate-CoA ligase, GDP-forming, 8801 1.175819 0.008054 0.566014 beta subunit
213088_s_at DNAJC9 DnaJ (Hsp40) homolog, subfamily C, 23234 1.00079 0.007957 0.565327 member 9
206145_at RHAG Rh-associated glycoprotein 6005 1.393541 0.006392 0.547427
204695_at CDC25A cell division cycle 25A 993 1.084134 0.006299 0.547427
204240_s_at SMC2 structural maintenance of chromosomes 10592 1.294656 0.005936 0.540991
2
202107_s_at MCM2 mmichromosome maintenance complex 4171 1.222252 0.005761 0.536001 component 2
222204_s_at RRN3 RRN3 RNA polymerase I transcription 54700 1.042118 0.005729 0.536001 factor homolog (S. cerevisiae)
203560_at GGH gamma-glutamyl hydrolase (conjugase, 8836 1.340214 0.00547 0.526569 folylpolygammaglutamyl hydrolase)
202613_at CTPS1 CTP synthase 1 1503 1.14984 0.005331 0.526569
208955_at DUT deoxyuridine triphosphatase 1854 1.03421 0.005157 0.523702
212282_at TMEM97 transmembrane protein 97 27346 1.011374 0.004822 0.516178
219412_at RAB38 RAB38, member RAS oncogene family 23682 1.168702 0.004753 0.516178
202503_s_at KIAA0101 KIAA0101 9768 1.309228 0.00471 0.516178
204767_s_at FEN1 flap structure-specific endonuclease 1 2237 1.381621 0.004647 0.516178
205394_at CHE 1 checkpoint kinase 1 1111 1.045411 0.004442 0.516178
201489_at PPIF peptidylprolyl isomerase F 10105 1.118185 0.004062 0.507454
201890_at RRM2 ribonucleotide reductase M2 6241 2.141038 0.00366 0.47601
219306_at KIF15 kinesin family member 15 56992 1.266139 0.003389 0.461859
211144_x_at TARP TCR gamma alternate reading frame 445347 1.260002 0.003285 0.456931 protein
206834_at HBD hemoglobin, delta 3045 2.172202 0.003266 0.456931
203476_at TPBG trophoblast glycoprotein 7162 1.132385 0.002991 0.450281
212281_s_at TMEM97 transmembrane protein 97 27346 1.2802 0.002875 0.450281
206067_s_at WT1 Wilms tumor 1 7490 1.247746 0.002812 0.450281
208694_at PRKDC protein kinase, DNA-activated, catalytic 5591 1.067872 0.002544 0.438543 polypeptide
206118_at STAT4 signal transducer and activator of 6775 1.012186 0.002506 0.438543 transcription 4
216920_s_at TARP TCR gamma alternate reading frame 445347 1.474096 0.002252 0.428068 protein
202949_s_at FHL2 four and a half LIM domains 2 2274 1.107316 0.002224 0.428068
22220 l_s_at CASP8AP2 caspase 8 associated protein 2 9994 1.054149 0.001764 0.399532
204026_s_at ZWINT ZW10 interactor, kinetochore protein 11130 1.720113 0.001341 0.397293
209894_at LEPR leptin receptor 3953 2.015714 0.001141 0.380525
213092_x_at DNAJC9 DnaJ (Hsp40) homolog, subfamily C, 23234 1.090583 0.000823 0.310206 member 9
219454_at EGFL6 EGF-like-domain, multiple 6 25975 1.45589 0.000616 0.258418
213262_at SACS spastic ataxia of Charlevoix-Saguenay 26278 1.042232 0.00059 0.252396
(sacsin)
204256_at ELOVL6 ELOVL fatty acid elongase 6 79071 1.448618 0.000559 0.252191
215806_x_at TARP TCR gamma alternate reading frame 445347 1.534041 0.000427 0.227751 protein
209813_x_at TARP TCR gamma alternate reading frame 445347 1.665423 0.000291 0.215629 protein
201830_s_at NET1 neuroepithelial cell transforming 1 10276 1.530152 0.000251 0.213741
219615_s_at CN 5 potassium channel, subfamily , 8645 1.04543 0.000225 0.21202 member 5
219602_s_at PIEZ02 piezo-type mechanosensitive ion 63895 1.504577 7.50E-05 0.117928
channel component 2
219000_s_at DSCC1 defective in sister chromatid cohesion 1 79075 1.081581 4.67E-05 0.079813 homolog (S. cerevisiae)
205848_at GAS2 growth arrest-specific 2 2620 2.492596 1.11E-05 0.02744
Table 10. Gene Expression in the Aggressive Group of the Core 102 Genes
204755_x_at HLF hepatic leukemia factor 3131 -0.61251884 0.013936253 0.5899467
209576_at GNAI1 guanine nucleotide binding 2770 -0.63080373 0.015529376 0.6015332 protein (G protein), alpha
inhibiting activity polypeptide 1
204753_s_at HLF hepatic leukemia factor 3131 -0.70807109 0.021022562 0.6316009
221760_at MAN1A1 mannosidase, alpha, class 1A, 4121 -1.18371513 0.022329984 0.6327526 member 1
206478_at KIAA0125 KIAA0125 9834 -0.99597623 0.02539777 0.6372958
221556_at CDC14B cell division cycle 14B 8555 -1.26288843 0.028047825 0.6449399
214805_at EIF4A1 eukaryotic translation initiation 1973 -0.67982725 0.028070099 0.6449399 factor 4A1
220416_at ATP8B4 ATPase, class I, type 8B, 79895 -0.73256572 0.031829237 0.6529304 member 4
208835_s_at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 -0.90441159 0.042521869 0.666611
204030_s_at IQCJ-SCHIP1 IQCJ-SCHIP1 readthrough 100505385 -0.57342 0.042715691 0.666611
204897_at PTGER4 prostaglandin E receptor 4 5734 -1.13842542 0.058834073 0.6927923
(subtype EP4)
208949_s_at LGALS3 lectin, galactoside-binding, 3958 -0.78834036 0.075957894 0.7119044 soluble, 3
20896 l_s_at LF6 Kruppel-like factor 6 1316 -0.79400193 0.078101123 0.7129149
209112_at CD N1B cyclin-dependent kinase 1027 -0.57998283 0.119332543 0.7386668 inhibitor IB (p27, Kipl)
204563_at SELL selectin L 6402 -0.97868544 0.120606528 0.7393127
21465 l_s_at HOXA9 homeobox A9 3205 -0.56640825 0.211940371 0.7838234
208892_s_at DUSP6 dual specificity phosphatase 6 1848 -0.85096752 0.235607663 0.7928467
213524_s_at G0S2 G0/G1 switch 2 50486 -0.82501945 0.239215682 0.7948695
203535_at S100A9 S100 calcium binding protein 6280 -0.80627992 0.254346668 0.8015736
A9
213668_s_at SOX4 SRY (sex determining region 6659 -0.82323589 0.260556623 0.802741
Y)-box 4
222044_at PCIF1 PDX1 C-terminal inhibiting 63935 -0.49806168 0.282560332 0.8109941 factor 1
213593_s_at TRA2A transformer 2 alpha homolog 29896 -0.60971572 0.344365936 0.8383152
(Drosophila)
214041_x_at RPL37A ribosomal protein L37a 6168 -0.39653673 0.407444152 0.8568069
205442_at MFAP3L microfibrillar-associated protein 9848 -0.51285589 0.449796577 0.8725199
3 -like
214974_x_at CXCL5 chemokine (C-X-C motif) ligand 6374 -0.41826978 0.551543186 0.9009074
5
213979_s_at — — -0.35065846 0.599848748 0.9149341
21491 l_s_at BRD2 bromodomain containing 2 6046 -0.27608523 0.611740131 0.9174215
211074_at FOLR1 folate receptor 1 (adult) 2348 -0.45112625 0.632000886 0.9246948
208180_s_at HIST1H4H histone cluster 1 , H4h 8365 -0.2778544 0.639528185 0.9257406
207815_at PF4V1 platelet factor 4 variant 1 5197 -0.30911148 0.651979155 0.9286903
205547_s_at TAGLN transgelin 6876 -0.28088743 0.708017145 0.9439304
205237_at FCN1 ficolin (collagen/fibrinogen 2219 -0.32136788 0.711156716 0.944669 domain containing) 1
219922_s_at LTBP3 latent transforming growth factor 4054 -0.18060244 0.723881126 0.9484945 beta binding protein 3
204141_at TUBB2A tubulin, beta 2A class Ila 7280 -0.29534658 0.735081772 0.9498889
212952_at LOC100507328 hypothetical LOC100507328 100507328 -0.22415499 0.743954062 0.9528039
209803_s_at PHLDA2 pleckstrin homology -like 7262 -0.19751659 0.762353226 0.9568355 domain, family A, member 2
204834_at FGL2 fibrinogen-like 2 10875 -0.20803456 0.771018008 0.9582727
213350_at RPS11 ribosomal protein SI 1 6205 -0.21555457 0.772923808 0.9589509
211964_at COL4A2 collagen, type IV, alpha 2 1284 -0.15879898 0.78084214 0.9613311
205114_s_at CCL3L3 chemokine (C-C motif) ligand 3- 414062 -0.20519345 0.793565216 0.9626063 like 3
202310_s_at COL1A1 collagen, type I, alpha 1 1277 -0.22272495 0.796823974 0.9633788
217683_at HBE1 hemoglobin, epsilon 1 3046 -0.12978731 0.806948287 0.964919
201842_s_at EFEMP1 EGF containing fibulin-like 2202 -0.17500966 0.813572867 0.9663992 extracellular matrix protein 1
20163 l_s_at IER3 immediate early response 3 8870 -0.12662907 0.836432308 0.9684535
201798_s_at MYOF myoferlin 26509 -0.12987194 0.839316831 0.9692311
1405_i_at CCL5 chemokine (C-C motif) ligand 5 6352 -0.16353025 0.840439597 0.9695199
201058_s_at MYL9 myosin, light chain 9, regulatory 10398 -0.11665284 0.854796069 0.9731863
215076_s_at COL3A1 collagen, type III, alpha 1 1281 -0.11954993 0.877410108 0.9785103
202403_s_at COL1A2 collagen, type I, alpha 2 1278 -0.11102553 0.891268391 0.9806744
210809_s_at POSTN periostin, osteoblast specific 10631 -0.1111146 0.912911705 0.9851423 factor
21253 l_at LCN2 lipocalin 2 3934 -0.02914052 0.962852347 0.9923439
210873_x_at APOBEC3A apolipoprotein B mRNA editing 200315 -0.02534114 0.967184016 0.9940037 enzyme, catalytic polypeptide- like 3A
211980_at COL4A1 collagen, type IV, alpha 1 1282 -0.01874739 0.977820792 0.9959916
201438_at COL6A3 collagen, type VI, alpha 3 1293 0.009703779 0.9863171 0.9970689
74694_s_at RABEP2 rabaptin, RAB GTPase binding 79874 0.011843173 0.981583585 0.9961445 effector protein 2
211719_x_at FN1 fibronectin 1 2335 0.037210894 0.973177363 0.9950096
202404_s_at COL1A2 collagen, type I, alpha 2 1278 0.034227062 0.972988883 0.9950096
204655_at CCL5 chemokine (C-C motif) ligand 5 6352 0.038628831 0.965309914 0.9935003
216442_x_at FN1 fibronectin 1 2335 0.054191701 0.95355946 0.9912349
210495_x_at FN1 fibronectin 1 2335 0.058226728 0.951550365 0.9910374
212464_s_at FNl fibronectin 1 2335 0.081392657 0.933688332 0.988994
211161_s_at COL3A1 collagen, type III, alpha 1 1281 0.056146834 0.930500411 0.9881951
212667_at SPARC secreted protein, acidic, 6678 0.058151732 0.926810399 0.9875364 cysteine-rich (osteonectin)
202627_s_at SERPINE1 serpin peptidase inhibitor, clade 5054 0.130825837 0.842575178 0.9702264
E (nexin, plasminogen activator
inhibitor type 1), member 1
213757_at EIF5A eukaryotic translation initiation 1984 0.138314467 0.836269539 0.9684535 factor 5A
202600_s_at NRIP1 nuclear receptor interacting 8204 0.146667606 0.81125437 0.9660204 protein 1
202237_at NNMT nicotinamide N- 4837 0.357137196 0.643404225 0.9262055 methyltransferase
201666_at TIMP1 TIMP metallopeptidase inhibitor 7076 0.178832267 0.632222051 0.9248966
1
204018_x_at HBA1 hemoglobin, alpha 1 3039 0.503353692 0.544752592 0.8986814
200999_s_at CKAP4 cytoskeleton-associated protein 10970 0.335798499 0.541539556 0.8965721
4
204622_x_at NR4A2 nuclear receptor subfamily 4, 4929 0.334447219 0.497538974 0.8848345 group A, member 2
203394_s_at HES1 hairy and enhancer of split 1 , 3280 0.443814733 0.487186309 0.8828267
(Drosophila)
206157_at PTX3 pentraxin 3, long 5806 0.494269798 0.426649316 0.8638802
205382_s_at CFD complement factor D (adipsin) 1675 0.493713983 0.395763648 0.8528093
217414_x_at HBA1 hemoglobin, alpha 1 3039 0.792680859 0.377115905 0.8469171
211745_x_at HBA1 hemoglobin, alpha 1 3039 0.872403284 0.371311295 0.8441546
214414_x_at HBA1 hemoglobin, alpha 1 3039 0.997898457 0.369791698 0.8441546
211699_x_at HBA1 hemoglobin, alpha 1 3039 0.740693292 0.368184583 0.844099
209458_x_at HBA1 hemoglobin, alpha 1 3039 0.850433299 0.356237193 0.8404624
212077_at CALD1 caldesmon 1 800 0.588320285 0.348578502 0.8401911
216248_s_at NR4A2 nuclear receptor subfamily 4, 4929 0.570789503 0.342393968 0.8375489 group A, member 2
219403_s_at HPSE heparanase 10855 0.691038194 0.269546864 0.8062958
201110_s_at THBS1 thrombospondin 1 7057 0.670401219 0.251133297 0.8008466
203395_s_at HES1 hairy and enhancer of split 1 , 3280 0.85070808 0.193692 0.7743035
(Drosophila)
200629_at WARS tryptophanyl-tRNA synthetase 7453 0.666045516 0.186006457 0.7721508
201669_s_at MARC S myristoylated alanine-rich 4082 0.759568605 0.132720593 0.7472316 protein kinase C substrate
201195_s_at SLC7A5 solute carrier family 7 (amino 8140 0.824741527 0.116329142 0.7382591 acid transporter light chain, L
system), member 5
204419_x_at HBG1 hemoglobin, gamma A 3047 1.666375122 0.09142905 0.723603
204848_x_at HBG1 hemoglobin, gamma A 3047 1.565419124 0.086123226 0.7221941
219410_at TMEM45A transmembrane protein 45A 55076 0.991276475 0.082130669 0.7221941
217388_s_at YNU kynureninase 8942 1.468313974 0.069766007 0.7032894
209290_s_at NFIB nuclear factor I/B 4781 1.089323355 0.04758335 0.6754948
202870_s_at CDC20 cell division cycle 20 991 1.339488946 0.036576735 0.658786
217232_x_at HBB hemoglobin, beta 3043 1.819045943 0.03458682 0.658786
213515_x_at HBG1 hemoglobin, gamma A 3047 2.417286959 0.029878597 0.651733
209773_s_at RRM2 ribonucleotide reductase M2 6241 1.767337745 0.021613828 0.6316009
211696_x_at HBB hemoglobin, beta 3043 1.960802898 0.020715624 0.6316009
206698_at X X-linked Kx blood group 7504 1.473769082 0.01474655 0.5951742
(McLeod syndrome)
212589_at RRAS2 related RAS viral (r-ras) 22800 1.248921748 0.010895573 0.5870789 oncogene homolog 2
209116_x_at HBB hemoglobin, beta 3043 2.529691269 0.008815809 0.5680662
215772_x_at SUCLG2 succinate-CoA ligase, GDP- 8801 1.175819449 0.008054348 0.5660139 forming, beta subunit
201890_at RRM2 ribonucleotide reductase M2 6241 2.141037934 0.003660296 0.4760098
209894_at LEPR leptin receptor 3953 2.015713837 0.00114085 0.3805249
219602_s_at PIEZ02 piezo-type mechanosensitive ion 63895 1.504577032 7.50E-05 0.1179278 channel component 2
205848_at GAS2 growth arrest-specific 2 2620 2.492595762 1.11E-05 0.0274403
Table 11. Gene Expression in the Indolent Group of the Core 102 Genes
201058_s_at MYL9 myosin, light chain 9, regulatory 10398 -2.74636917 3.07E-05 0.0046717
207815_at PF4V1 platelet factor 4 variant 1 5197 -2.82238801 5.35E-05 0.0058277
1405_i_at CCL5 chemokine (C-C motif) ligand 5 6352 -3.32636522 5.85E-05 0.0060359
213524_s_at G0S2 G0/G1 switch 2 50486 -2.65614662 0.0001262 0.007998
201631_s_at IER3 immediate early response 3 8870 -2.29780898 0.000169 0.009257
204655_at CCL5 chemokine (C-C motif) ligand 5 6352 -3.23424391 0.0002336 0.0105336
203535_at S100A9 SI 00 calcium binding protein A9 6280 -2.4351969 0.0003703 0.0133722
212077_at CALD1 caldesmon 1 800 -2.04255108 0.0006877 0.0178246
210873_x_at APOBEC3A apolipoprotein B mRNA editing 200315 -1.76920321 0.0023357 0.032102 enzyme, catalytic polypeptide- like 3A
212531_at LCN2 lipocalin 2 3934 -1.74944593 0.0029164 0.0363335
205114_s_at CCL3L3 chemokine (C-C motif) ligand 3- 414062 -2.11268057 0.0038941 0.0419976 like 3
208180_s_at HIST1H4H histone cluster 1 , H4h 8365 -1.58614736 0.0040832 0.0431848
205237_at FCN1 ficolin (collagen/fibrinogen 2219 -2.31794481 0.0041427 0.0434495 domain containing) 1
214414_x_at HBA1 hemoglobin, alpha 1 3039 -2.92561932 0.0044286 0.0449487
209803_s_at PHLDA2 pleckstrin homology-like 7262 -1.71861099 0.0046599 0.0462831 domain, family A, member 2
201438_at COL6A3 collagen, type VI, alpha 3 1293 -1.45596175 0.0055357 0.0504893
205547_s_at TAGLN transgelin 6876 -1.89686803 0.0062053 0.0538116
211074_at FOLR1 folate receptor 1 (adult) 2348 -2.33500441 0.0071061 0.0579213
221556_at CDC14B cell division cycle 14B 8555 -1.35462909 0.0072261 0.0582223
211745_x_at HBA1 hemoglobin, alpha 1 3039 -2.39194906 0.0073721 0.0586827
204141_at TUBB2A tubulin, beta 2A class Ila 7280 -2.13929618 0.0077476 0.0602366
204018_x_at HBA1 hemoglobin, alpha 1 3039 -1.9801303 0.0092138 0.0661068
201798_s_at MYOF myoferlin 26509 -1.51465891 0.009894 0.0682173
209458_x_at HBA1 hemoglobin, alpha 1 3039 -2.13257405 0.0108016 0.071832
217414_x_at HBA1 hemoglobin, alpha 1 3039 -2.0496731 0.0117787 0.0752125
211964_at COL4A2 collagen, type IV, alpha 2 1284 -1.30406638 0.0122956 0.0767626
205442_at MFAP3L micro fibrillar-associated protein 9848 -1.52050559 0.0134371 0.0808545
3-like
214974_x_at CXCL5 chemokine (C-X-C motif) ligand 6374 -1.55942048 0.0144079 0.083963
5
202310_s_at COL1A1 collagen, type I, alpha 1 1277 -1.87618778 0.0168309 0.0918907
219403_s_at HPSE heparanase 10855 -1.31934206 0.0184966 0.0968056
212667_at SPARC secreted protein, acidic, cysteine- 6678 -1.34731184 0.0188123 0.0976538
rich (osteonectin)
200999_s_at CKAP4 cytoskeleton-associated protein 4 10970 -1.14939507 0.0204052 0.1017426
204834_at FGL2 fibrinogen-like 2 10875 -1.46819648 0.0227746 0.1072555
216442_x_at FN1 fibronectin 1 2335 -1.90725545 0.023141 0.1081658
201842_s_at EFEMP1 EGF containing fibulin-like 2202 -1.50062086 0.0247947 0.1121383 extracellular matrix protein 1
212464_s_at FN1 fibronectin 1 2335 -1.96352838 0.0258307 0.1143867
211719_x_at FN1 fibronectin 1 2335 -2.20581999 0.0267964 0.1164775
210495_x_at FN1 fibronectin 1 2335 -1.90768224 0.026965 0.1168453
216248_s_at NR4A2 nuclear receptor subfamily 4, 4929 -1.17498747 0.0282382 0.1197257 group A, member 2
211699_x_at HBA1 hemoglobin, alpha 1 3039 -1.60001534 0.0291616 0.1216234
217683_at HBE1 hemoglobin, epsilon 1 3046 -1.01631722 0.0327501 0.1295902
202627_s_at SERPINE1 serpin peptidase inhibitor, clade 5054 -1.241552 0.0352569 0.1349566
E (nexin, plasminogen activator
inhibitor type 1), member 1
203394_s_at HES1 hairy and enhancer of split 1, 3280 -1.1913737 0.0362517 0.1371457
(Drosophila)
211980_at COL4A1 collagen, type IV, alpha 1 1282 -1.25680354 0.0372348 0.139094
204622_x_at NR4A2 nuclear receptor subfamily 4, 4929 -0.91072954 0.037958 0.1405444 group A, member 2
215076_s_at COL3A1 collagen, type III, alpha 1 1281 -1.43307205 0.0385845 0.1417739
202403_s_at COL1A2 collagen, type I, alpha 2 1278 -1.44054881 0.0465026 0.1564484
202404_s_at COL1A2 collagen, type I, alpha 2 1278 -1.71166248 0.0565387 0.1733135
210809_s_at POSTN periostin, osteoblast specific 10631 -1.70047318 0.0592192 0.1779858 factor
200629_at WARS tryptophanyl-tRNA synthetase 7453 -0.81407303 0.0632647 0.1842488
205382_s_at CFD complement factor D (adipsin) 1675 -0.93430533 0.0674121 0.1911642
21 U61_s_at COL3A1 collagen, type III, alpha 1 1281 -0.97790719 0.0849171 0.216434
202237_at NNMT nicotinamide N- 4837 -1.16905976 0.0849883 0.216541 methyltransferase
206157_at PTX3 pentraxin 3, long 5806 -0.8886965 0.1017166 0.2401657
222044_at PCIF1 PDX1 C-terminal inhibiting 63935 -0.59010446 0.1405898 0.2902372 factor 1
203395_s_at HES1 hairy and enhancer of split 1, 3280 -0.82856755 0.1406431 0.2902934
(Drosophila)
214041_x_at RPL37A ribosomal protein L37a 6168 -0.49636026 0.2288142 0.3892891
213668_s_at SOX4 SRY (sex determining region Y)- 6659 -0.74126503 0.2366512 0.397241 box 4
21491 l_s_at BRD2 bromodomain containing 2 6046 -0.55589849 0.237402 0.3980366
213515_x_at HBG1 hemoglobin, gamma A 3047 -1.06377 0.2466641 0.407885
204419_x_at HBG1 hemoglobin, gamma A 3047 -0.908371 0.2734668 0.4340414
208892_s_at DUSP6 dual specificity phosphatase 6 1848 -0.62624686 0.3054404 0.4659019
201669_s_at MARC S myristoylated alanine-rich 4082 -0.4343098 0.308411 0.4689854 protein kinase C substrate
201324_at EMP1 epithelial membrane protein 1 2012 -0.26518451 0.3157697 0.476429
204848_x_at HBG1 hemoglobin, gamma A 3047 -0.73774161 0.3338994 0.4939304
213350_at RPS11 ribosomal protein SI 1 6205 -0.59851213 0.3525386 0.5113994
213593_s_at TRA2A transformer 2 alpha homolog 29896 -0.51180921 0.3529863 0.5117818
(Drosophila)
209374_s_at IGHM immunoglobulin heavy constant 3507 -0.31785029 0.3800608 0.5367239 mu
213979_s_at — — — -0.40184672 0.4828663 0.6262323
201110_s_at THBS1 thrombospondin 1 7057 -0.32862948 0.50663 0.645676
212952_at LOC100507328 hypothetical LOCI 00507328 100507328 -0.3705879 0.5288342 0.6639313
213757_at EIF5A eukaryotic translation initiation 1984 -0.30685777 0.5926473 0.7155269 factor 5A
201195_s_at SLC7A5 solute carrier family 7 (amino 8140 -0.21795555 0.6192996 0.7368622 acid transporter light chain, L
system), member 5
217232_x_at HBB hemoglobin, beta 3043 -0.28037802 0.690155 0.7905057
206698_at X X-linked Kx blood group 7504 -0.15354275 0.7519213 0.8333529
(McLeod syndrome)
209116_x_at HBB hemoglobin, beta 3043 -0.22011194 0.7745612 0.8490507
208960_s_at LF6 Kruppel-like factor 6 1316 -0.0669692 0.8198308 0.8804886
211696_x_at HBB hemoglobin, beta 3043 -0.11853666 0.8626478 0.9090874
212589_at RRAS2 related RAS viral (r-ras) 22800 -0.03039679 0.9381282 0.9597619 oncogene homolog 2
74694_s_at RABEP2 rabaptin, RAB GTPase binding 79874 -0.02974959 0.9459227 0.9655037 effector protein 2
205933_at SETBP1 SET binding protein 1 26040 -0.00557713 0.9639004 0.976948
219410_at TMEM45A transmembrane protein 45A 55076 -0.01300971 0.9780245 0.9864563
209183_s_at ClOorflO chromosome 10 open reading 11067 0.053999237 0.7924264 0.8612892 frame 10
217388_s_at YNU kynureninase 8942 0.220147884 0.7422951 0.8265151
204872_at TLE4 transducin-like enhancer of split 7091 0.119923227 0.6919854 0.7913794
4 (E(spl) homolog, Drosophila)
209290_s_at NFIB nuclear factor I/B 4781 0.179441546 0.6912758 0.7909339
209069_s_at H3F3B H3 histone, family 3B (H3.3B) 3021 0.099846114 0.6841093 0.7862131
209763_at CHRDL1 chordin-like 1 91851 0.050254159 0.6660676 0.7731502
20896 l_s_at LF6 Kruppel-like factor 6 1316 0.203610948 0.5862653 0.7103285
219922_s_at LTBP3 latent transforming growth factor 4054 0.265731289 0.5441646 0.676381 beta binding protein 3
210487_at DNTT deoxynucleotidyltransferase, 1791 0.159844182 0.4049727 0.5588841 terminal
202600_s_at NRIP1 nuclear receptor interacting 8204 0.470263901 0.374044 0.5310937 protein 1
211998_at H3F3B H3 histone, family 3B (H3.3B) 3021 0.303014616 0.3488911 0.5083632
219304_s_at PDGFD platelet derived growth factor D 80310 0.277596346 0.298783 0.4593071
204897_at PTGER4 prostaglandin E receptor 4 5734 0.607994686 0.2274529 0.3875045
(subtype EP4)
202870_s_at CDC20 cell division cycle 20 991 0.762009765 0.1538922 0.3060777
220990_s_at MIR21 microRNA 21 406991 0.435464726 0.1444477 0.2949163
220377_at KIAA0125 KIAA0125 9834 0.487203922 0.1414233 0.2913494
215772_x_at SUCLG2 succinate-CoA ligase, GDP- 8801 0.540170913 0.1340248 0.2820253 forming, beta subunit
204563_at SELL selectin L 6402 0.910468161 0.0926084 0.2277875
211597_s_at HOPX HOP homeobox 84525 0.686080974 0.0787633 0.2073318
205984_at CRHBP corticotropin releasing hormone 1393 0.67956433 0.0697279 0.1948001 binding protein
208835_s_at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 0.690777363 0.0676605 0.1915926
221760_at MAN1A1 mannosidase, alpha, class 1A, 4121 0.824262339 0.0582629 0.1763029 member 1
201369_s_at ZFP36L2 ZFP36 ring finger protein-like 2 678 0.748937338 0.0520224 0.1657888
209773_s_at RRM2 ribonucleotide reductase M2 6241 1.272153164 0.0495607 0.1616025
204304_s_at PROM1 prominin 1 8842 0.925426909 0.0237482 0.1095213
209894_at LEPR leptin receptor 3953 1.184929139 0.0181485 0.0959498
203787_at SSBP2 single-stranded DNA binding 23635 0.75811153 0.0063777 0.0544303 protein 2
201890_at RRM2 ribonucleotide reductase M2 6241 1.743455889 0.0052954 0.0493966
219602_s_at PIEZ02 piezo-type mechano sensitive ion 63895 0.949014365 0.0017907 0.0285001 channel component 2
204755_x_at HLF hepatic leukemia factor 3131 0.692860181 0.0017806 0.0285001
204753_s_at HLF hepatic leukemia factor 3131 0.867266686 0.0016555 0.0275765
209576_at GNAI1 guanine nucleotide binding 2770 0.736228442 0.0015849 0.0269254 protein (G protein), alpha
inhibiting activity polypeptide 1
214805_at EIF4A1 eukaryotic translation initiation 1973 0.894052441 0.001431 0.025337 factor 4A1
2091 12_at CD N1B cyclin-dependent kinase inhibitor 1027 1.181992974 0.0007491 0.0186168 lB (p27, Kipl)
21465 l_s_at HOXA9 homeobox A9 3205 1.466348689 0.0006873 0.0178246
219777_at GIMAP6 GTPase, IMAP family member 6 474344 0.787293816 0.000565 0.016422
204430_s_at SLC2A5 solute carrier family 2 (facilitated 6518 0.916940276 0.0004539 0.0149986 glucose/fructose transporter),
member 5
206478_at KIAA0125 KIAA0125 9834 1.699585816 7.39E-05 0.0063689
220416_at ATP8B4 ATPase, class I, type 8B, 79895 1.319886477 6.56E-05 0.0061373 member 4
205848_at GAS2 growth arrest-specific 2 2620 1.882945739 5.69E-05 0.0059648
204030_s_at IQCJ-SCHIP1 IQCJ-SCHIP1 readthrough 100505385 1.123786747 5.04E-05 0.0057459
Table 12. Regulation of 16 PV Core Genes in Chronic Phase CML
Table 13. 10 Gene Screen Probability Score: 30 Test PV Cohort
Spleen size 14 3.5 0.033
Chemotherapy 7/8 7/22 0.012
Median Probability Score
5.0 (5-6) 2.5 (0-4) <0.001 (range)
Median Clinical Score
3.0 (2-4) 0 (0-3) <0.001 (range)
Table 14. Ten Gene Screening Panel
RNA binding
protein
Beta actin 1
(Endogenous
ACTB control)
Table 15. Ten Gene Screenin Panel NCBI Gene Accession Nos.
Table 16. Gene Expression Assay Reagents
CTSA Hs01563956_gl CAGAAGATGGAGGTGCAGCGCCGGC 16 4351372
SMC4 Hs00909708_gl AAAAGAAGGAAGAATTGTATTTGCA 17 4351372
CTTN Hs01124227_ml CTACCAGGCTGCGGGCGATGATGAG 18 4351372
SON Hs01066142_gl CAAACATTTTCTCTTTAGGGTATTG 19 4351372
TIA1 Hs01046922_ml CCCGTGCAACAGCAGAATCAAATTG 20 4351372
ACTB N/A N/A 4333762F
Table 17. Algorithm for PV Patient Stratification
Ten Gene Screening Panel
For the following gene level comparisons:
If TRUE (and >2 fold difference) score 1
If FALSE (or <2 fold difference) score 0
A score of >4 out of 6 indicates an aggressive form of PV
PCNA > IFI30
TSN > CTSA
SMC4 > CDKN1A
PCNA > CTTN SON >
CTTN TIA1 > MYL9
Table 18. 10 Gene Screening Data from Indolent PV Patients
564 PV 11 4 1
645 PV 11 2 1
914 PV 10 3 1
1045 PV 9 2 1
1073 PV 8 4 1
1092 PV 7 2 1
1125 PV 27 4 3
1191 PV 10 4 1
1267 PV 4 2 0
1308 PV 10 4 1
1370 PV 4 1 2
1418 PV 7 4 2
1428 PV 1 3 0
1428 PV 4 4 1
1433 PV 3 4 0
1438 PV 3 4 2
1439 PV 3 3 1
1459 PV 4 3 2
1529 PV 2.5 3 0
1542 PV 1 3 0
1542 PV 1 2 0
1552 PV 1 2 0
1552 PV 2 1 0
1574 PV 13 2 3
1574 PV 2 2 0
1578 PV 7 4 0
1585 PV 1.5 2 0
1591 PV 3 3 1
1599 PV 8 1 0
1635 PV 1.5 2 0
1127 PV 11 3 0
Average 2.651163 0.906977
Median 3 1
Mann-Whitney U Statistic p O.001 p <0.001 compared to PV Aggressive
Table 19. 10 Gene Screening Data from Aggressive PV Patients