WO2014074785A1 - Methods of predicting outcome and treating breast cancer - Google Patents
Methods of predicting outcome and treating breast cancer Download PDFInfo
- Publication number
- WO2014074785A1 WO2014074785A1 PCT/US2013/069084 US2013069084W WO2014074785A1 WO 2014074785 A1 WO2014074785 A1 WO 2014074785A1 US 2013069084 W US2013069084 W US 2013069084W WO 2014074785 A1 WO2014074785 A1 WO 2014074785A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- breast cancer
- eso
- expression
- immunotherapy
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- CT antigens are classified into two groups, CT-X and non-X CT antigens.
- CT-X antigens expression are restricted to human germ line.
- Genes encoding CT-X antigens are mapped to the X chromosome and are part of multigene families (AJG Simpson 2005 Nature Reviews Cancer 5, 615-625 (1 August 2005)).
- CT-X genes are exclusively present in cells of the germ cell lineage, although there is variation in the moment of expression during different stages of sperm development [3,9,10,11]. However, their expression can become activated in various malignancies [1].
- Promoter methylation status and histone deacetylation seem to be the main regulators of their specific expression pattern [8].
- Breast cancer can be considered as a set of different diseases, which present a diverse range of histological patterns and treatment sensitivities.
- Breast cancers are classified as non-invasive or invasive.
- Non-invasive breast cancer is an abnormal growth of cells that begins with an increase in the number of breast cells (hyperplasia) to the emergence of atypical breast cells (atypical hyperplasia) followed by carcinoma in situ (non-invasive cancer).
- hyperplasia hyperplasia
- non-invasive cancer carcinoma in situ
- the present study analyzed expression of other CT antigens, the non-CT-X antigens in invasive breast cancer and correlates the findings with a series of clinicopahtological factors to identify non-CT-X antigens that have both prognostic and predictive value and have the potential to inform treatment.
- Our result pointed to a highly prevalent and restricted expression of non-CT-X antigen, including CT-46 and a combination of CT-46 and NY- ESO-1, in a subset of ER negative invasive breast tumors and triple negative breast cancer.
- a therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring tumor infiltrating lymphocytes (TILs) in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), and low levels of tumor infiltrating lymphocytes (TILs), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- CT46+ CT46
- TILs tumor infiltrating lymphocytes
- the phrase "low levels of tumor infiltrating lymphocytes (TILs)” as used herein refers to a tumor sample comprising the presence of TILs in less than 25% of the tumor sample.
- high levels of tumor infiltrating lymphocytes refers to a tumor sample comprising the presence of TILs in greater than or equal to 25% of the tumor sample.
- therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), absence of expression of NY-ESO-1 (NY-ESO-1-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- a therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-1+), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy and NY-ESO-1 immunotherapy.
- the regimen(s) optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample, and for a subject with a breast cancer characterized by expression of CT46 (CT46+), low levels of TIL' s, and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- ER expression analysis is performed first, to identify ER- cancers in which to further screen for CT46 expression.
- therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- a therapeutic regimen for breast cancer comprising administering an immunotherapy to a human subject with breast cancer that has been laboratory-typed as any of the following: (a) ER-negative and CT46-positive; (b) ER- negative, NY-ESO-1 -negative, and CT46-positive; (c) ER-negative, NY-ESO-1 -positive, and CT46-positive; (d) types (a), (b) or (c) that further are PR-negative; (e) types (a), (b), (c) or (d) that further are HER2-negative; (f) types (a), (b), (c), (d) or (e) that further have low levels of tumor infiltrating lymphocytes; wherein the immunotherapy comprises
- CT46 antigen immunotherapy optionally in combination with NY-ESO-1 antigen immunotherapy.
- the mammalian subject is preferably human.
- the breast cancer tissue sample is from a primary and/or secondary metastatic breast tumor from the subject.
- a method of evaluating the likelihood that a human subject suffering from triple negative breast cancer would benefit from CT46 immunotherapy comprising (a) measuring a breast tumor tissue sample from the subject for one or more biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs); and (b) diagnosing likelihood that the subject would benefit from CT46 immunotherapy optionally in combination with NY-ESO-1 immunotherapy based on the biomarkers measured according to step (a).
- the presence of CT46 and the absence of NY-ESO-1 in the sample is indicative that the subject would likely benefit from CT46 immunotherapy.
- the presence of CT46, the presence of NY-ESO-1 and the presence of low levels of TILs in the sample is indicative that the subject would likely benefit from a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy.
- the presence of NY-ESO-1 is indicative that the subject would likely benefit from NY-ESO-1 immunotherapy.
- the methods described herein optionally further comprise diagnosing the subject as unlikely to benefit from treatment with CT46 immunotherapy if CT46 is absent from the tumor tissue sample of the subject. In some embodiments, the methods described herein optionally further comprise diagnosing the subject as unlikely to benefit from treatment with CT46 and NY-ESO-1 immunotherapy if the CT46 and NY-ESO- 1 are absent from the tumor tissue sample of the subject.
- Various methods are also provided that provide personalized medicine to a subject suffering from breast cancer.
- described herein is method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative.
- the method optionally further comprises measuring NY-ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO- 1+), or as unlikely to benefit from the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is CT-46-negative and NY-ESO-1 - negative.
- the method optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative and ER-positive.
- ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
- the method optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 and NY- ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO-1+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46- negative, NY-ESO-1 negative and ER-positive.
- ER estrogen receptor
- a method for personalizing therapy for a human subject that has been diagnosed with breast cancer comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating lymphocytes (TILs) in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of TILs, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive.
- CT46+ CT46
- ER- absence of ER expression
- ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
- the methods optionally further comprise measuring NY- ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-1+), low levels of TIL's, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, or NY-ESO-1 -negative, or ER-positive.
- ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
- a method for personalizing therapy for a human subject that has been diagnosed with breast cancer comprising:
- CT46 expression in a breast cancer tissue sample from a mammalian subject measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), absence of NY-ESO-1 expression (NY-ESO-1-), and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, NY-ESO-1 - positive, or ER-positive.
- ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
- the breast cancer is optionally triple negative breast cancer.
- CT46 and/or NY- ESO-1 expression in the sample is measured by measuring CT46 or NY-ESO-1 mRNA by, for example, an RT-PCR assay.
- the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
- AGAACAGGAAAAAAACCCTGCAT (SEQ ID NO: 3)
- the RT-PCR assay comprises the use of at least one primer selected from the group consisting of TGAAGGAGTTCACTGTGTCC (SEQ ID NO: 1) and
- the therapeutic regimens or methods described herein comprise the step of measuring tumor infiltrating T-lymphocytes in the sample.
- Methods of measuring tumor infiltrating T-lymphocytes are known in the art and, in some embodiments, comprises measuring CD8-expressing cells in the breast cancer tissue sample.
- An exemplary method for measuring of TILs comprises contacting the breast cancer tissue sample with a binding partner that specifically binds a protein expressed by TIL. The presence or absence of TILs in the sample is determined, for example, by immunohistochemical staining of the tissue sample with the binding partner.
- Exemplary proteins expressed by TILs include, but are not limited to CD3 and CD8.
- Exemplary binding partners include, but are not limited to, anti-CD3 and anti-CD8 antibodies and combinations thereof.
- the regimen(s) optionally further comprise measuring progesterone receptor (PR) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample further tests negative for PR expression (PR-).
- PR progesterone receptor
- the therapeutic regimen(s) or methods described herein optionally further comprise comprising measuring human epidermal growth factor 2 receptor (HER2) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample further tests negative for HER2 expression (HER2-).
- HER2 human epidermal growth factor 2 receptor
- the therapeutic regimens or methods described herein optionally further comprise prescribing or administering one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-GITR, anti-CTLA4, anti-PDl, anti-OXA4, anti- TGFbetal, PD1 ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF), interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells, cytokines and dexamethasone.
- TLR3 poly I:C
- MPL/LipidA (TLR4) imiquimod
- R848 (TLR8) CpG (TLR9)
- anti-GITR anti-CTLA4, anti-PDl, anti-OXA4, anti- TGFbetal
- the therapeutic regimens or methods described herein optionally further comprise prescribing a standard-of-care therapy to a mammalian subject if the presence of CT46 is absent from the tumor tissue sample.
- aspects of the invention that are described as methods can alternatively be described as uses or materials, and vice versa.
- the measurement of CT46 antigen expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the CT46 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), tumor infiltrating T lymphocytes, and NY-ESO-1.
- reagents e.g., primers
- CT46 antigen expression and NY-ESO-1 expression in another aspect, described herein is the use of a measurement of CT46 antigen expression and NY-ESO-1 expression in a breast cancer tissue sample from a human subject for predicting the therapeutic benefit of a combination of CT46 immunotherapy and NY- ESO-1 immunotherapy in the subject.
- the measurement of CT46 antigen expression and NY-ESO-1 expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), and tumor infiltrating T lymphocytes.
- ER estrogen receptor
- PR progesterone receptor
- HER2 human epidermal growth factor receptor 2
- TIL tumor infiltrating lymphocytes
- the system comprises (a) at least one processor; (b) at least one computer-readable medium; (c) at least one database operatively coupled to a computer-readable medium of the system and containing population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans; (d) a measurement tool that receives an input about the human subject and generates information from the input about the presence or absence or measurements of the biological markers in a breast cancer tissue sample from the human subject; and (e) an analysis tool or routine that: (i) is operatively coupled to the database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the population information in the treatment database and generate a conclusion
- the biological markers for use in the systems described herein include, but are not limited to, a marker selected from the group consisting of human estrogen receptor (ER), human progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2).
- ER estrogen receptor
- PR human progesterone receptor
- HER2 human epidermal growth factor receptor 2
- the analysis tool generates a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy or a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy. In some embodiments, the analysis tool generates a prognosis conclusion with respect to the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer.
- the system described herein optionally further comprises a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to communicate to the subject, or to a medical practitioner for the subject, the conclusion(s) generated by the analysis tool, or enable the subject or medical practitioner to access the conclusion(s).
- a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to communicate to the subject, or to a medical practitioner for the subject, the conclusion(s) generated by the analysis tool, or enable the subject or medical practitioner to access the conclusion(s).
- th measurement tool comprises a tool stored on a computer readable medium of the system and adapted to be executed by a processor of the system to receive a data input about a subject and determine information about the presence or absence or measurements of the biological markers from the data.
- the input about the human subject is, in some embodiments, a breast cancer tissue sample from the subject.
- the measurement tool comprises a tool to measure the presence, absence, or quantity of the biological markers in the breast cancer tissue sample, thereby generating information about the presence, absence, or quantity of the biological markers.
- the measurement tool includes a polymerase chain reaction thermocycler and at least one primer for amplifying CT46 mRNA and/orNY- ESO-1 mRNA. Use of primer pairs is specifically contemplated.
- the invention provides an isolated oligonucleotide with a length of 10-50 nucleotides, wherein the nucleic acid comprises a sequence selected from the group consisting of (a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), (b) 5' -AGCTGCTGGAGACAGGAGCT-3' (NY-ESO-l-R, SEQ ID NO: 2), (c) 5 ' - AGAACAGGAAAAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), (d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), (e) 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO:
- the isolated oligonucleotide comprises at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of any of SEQ ID NOs: 1-6. In some embodiments, the isolated oligonucleotide comprises a nucleotide sequence consisting of any one of SEQ ID NOs: 1-6.
- the oligonucleotides described herein preferably selectively hybridize to human mRNA or human cDNA from human NY-ESO-1, human CT46, or human TBP under PCR annealing conditions in a PCR reaction containing human mRNA and/or human cDNA.
- nucleotide sequence of the oligonucleotide is identical to, or fully complementary to, an mRNA from human NY-ESO-1, human CT46, or human TBP.
- the oligonucleotide further comprises a detectable label.
- Kits and compositions comprising the oligonucleotides described herein are also provided.
- the invention provides a kit comprising at least two, four or six oligonucleotides described herein, wherein the oligonucleotides are packaged together, wherein the oligonucleotides comprise one or more pairs of oligonucleotides selected from the group consisting of (a) 5 '-TGAAGGAGTTCACTGTGTCC-3' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and 5'- AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides; (b) 5' -AGAACAGGAAAAAAACCCTGCAT-3' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least
- the kit comprises at least four oligonucleotides, wherein two of the at least four oligonucleotides comprise: 5'- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -CTGGACTTTCTTTAGACCTC ATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
- kits comprising at least four oligonucleotides, wherein the oligonucleotides are comprise nucleotide sequence set forth in SEQ ID NOs: 1, 2, 5 and 6.
- kits described herein optionally further comprises deoxynucleotide triphospates (dNTP's), MgCl 2 and a thermostable DNA polymerase.
- the kit optionally further comprises one or more reagents for measuring tumor infiltrating lymphocytes in a tissue sample; and/or at least one reagent for measuring at least one receptor selected from estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor 2 (HER2) expressed by a cell.
- ER estrogen receptor
- PR progesterone receptor
- HER2 human epidermal growth factor receptor 2
- compositions comprising any one or more of the oligonucleotides described herein are also provided.
- Embodiments where the composition comprises two, four of six oligonucleotides described herein are specifically contemplated.
- a method of measuring CT46 gene expression in a tissue sample from a human subject comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human CT46, and measuring amplicons corresponding to human CT46 in the PCR reaction products.
- PCR polymerase chain reaction
- the method comprises performing the PCR with a primer pair described herein for selectively amplifying CT46 mRNA.
- the methods comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO- 1 in the PCR reaction products.
- the method optionally further comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO-1 mRNA.
- a method of measuring NY-ESO-1 gene expression in a tissue sample from a human subject comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products.
- the method comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO-1 mRNA.
- the method comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human TBP, and measuring amplicons corresponding to human TBP in the PCR reaction products.
- TBP is a particularly useful control for assays described herein.
- the methods described herein optionally further comprise performing the PCR with a primer pair described herein for selectively amplifying TBP mRNA.
- amplicons corresponding to human NY-ESO-1 or human CT46 produced according to the PCR methods described herein.
- the amplicon(s) is/are at least 20, or at least 30, or at least 40, or at least 50 or at least 60, or at least 70, or at least 80, or at least 90 or at least 100 nucleotides in length.
- the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations defined by specific paragraphs above.
- certain aspects of the invention that are described as a genus, and it should be understood that every member of a genus is, individually, an aspect of the invention.
- aspects described as a genus or selecting a member of a genus should be understood to embrace combinations of two or more members of the genus.
- Figure 1 Kaplan-Meier survival estimates for recurrence free survival according to Lymphovascular invasion (A), Her2 status (B), Tumor size (C), ER status (D), presence of axillary node metastasis (E), age (F), Ethnicity (G), Tumor grade (H), Triple Negative status (I) and Tumor infiltrating lymphocytes (J) in the Miami dataset.
- Figure 2 Detection of CT46/HORMAD 1 and NY-ESO- 1 expression in FFPE tissues. Representative ethidium-bromide stained agarose gel showing PCR amplicons derived from 17 archival biopsy specimens (lanes 3 to 19). (A). Amplicons from
- CT46/HORM AD 1 primers and endogenous control TBP (B) Amplicons from NY-ESO- 1 primers and endogenous control TBP.
- the position of the 100 bp size marker in each gel is indicated (first lane).
- black arrows in the right margin indicate the position amplicons derived from genomic DNA (gDNA) or cDNA.
- testis cDNA was included as control (second lane).
- Figure 3 IHC staining of normal adult testis using mAb LX119#2 showing intense nuclear staining of intratubular germ cells undergoing meiosis (brown) and no staining of interstitial tissue and intratubular Sertoli cells.
- CT46/HORM AD 1 and NY-ESO- 1 expression for disease-free survival (A) NY-ESO- 1 expression alone, (B) CT46/HORMAD1 expression alone, (C) Combination of the expression of both genes.
- Figure 5 Kaplan-Meier survival estimates in the Miami dataset for disease- free survival according to CT46/HORMAD1 and NY-ESO-1 expression and TIL density. (A) CT46/HORMAD1 and (B) NY-ESO-1 expression..
- Figure 6 Representative immunohistochemistry (IHC) staining of CD8 (brown membrane staining, original magnification, x200) demonstrating low (A) and dense intratumoral infiltration (B) of CD8+ TILs.
- IHC immunohistochemistry
- Figure 7 Kaplan-Meier survival estimates in the ER- negative population in the Miami dataset for recurrence free survival according to CD8+ infiltration (A) and
- CT46/HORM AD 1 expression and CT46/HORMAD 1 expression and CD8+ density (B). High intratumoral infiltration is represented by TILs >1+ and low intratumoral infiltration is represented by ⁇ 1+.
- Figure 8 Kaplan-Meier survival estimates for recurrence free survival according to CT46/HORM AD 1 expression (A), TILs infiltration (B) and a combination of both (C) in the TCGA database .
- Figure 9 Kaplan-Meier survival estimates in the Miami dataset for disease-free survival according to CD8+ infiltration. (A) and CT46/HORMAD1 expression and
- CT46/HORMAD1 expression and CD8+ density (B). High intratumoral infiltration is represented by TILs >1+ and low intratumoral infiltration is represented by ⁇ 1+.
- Figure 10 Kaplan-Meier survival estimates for overall survival according to CT46/HORMAD1 expression.
- A TIL infiltration
- B TIL infiltration
- C C
- Figure 11 Kaplan-Meier survival estimates for disease-free survival according to lymphovascular invasion.
- A Her2 status
- B tumor size
- C tumor size
- D ER status
- E presence of axillary node metastasis
- E age
- G tumor stage
- H tumor grade
- I Triple Negative status
- J tumor infiltrating lymphocytes
- Figure 12 is an exemplary system comprising exemplary computer components.
- Figure 13 is a flow chart depicting system components and operation.
- Figure 14 is another flow chart depicting system components and operation.
- the invention is based in part on new analysis of CT antigens in breast cancer and on the discovery that genetic markers whose expression patterns correlate with important characteristics of mammalian breast cancer tumors, i.e., presence of CT46 gene expression, presence of NY-ESO-1 gene expression, correlate with the likelihood of relapse (i.e., distant metastasis or poor prognosis) in the mammalian subject.
- CT cancer/testis
- CT46/HORM AD 1 a non- CT-X gene
- the present disclosure describes the use of various genetic markers to determine appropriate treatment for a subject having a breast cancer cell expression the marker(s).
- the genetic marker is human CT46 also known as HORMAD1.
- CT46/HORMAD1 is a cancer- testis antigen and is present in two isoforms (Chen et al., Cancer Immunity, 5:9-16, 2005, the disclosure of which is incorporated herein by reference).
- the human CT46 isoform 1 mRNA sequence is set forth in SEQ ID NO: 7 (Genbank Accession No. NM-032132) and the corresponding acid sequence is set for in SEQ ID NO: 8 (Genbank Accession No. NP_115508.2).
- the CT46 isoform 2 mRNA sequence is set forth in SEQ ID NO: 9 (Genbank Accession No. NM_001199829) and the corresponding amino acid sequence is set forth in SEQ ID NO: 10 (Genbank Accession No. NP_001186758).
- the genetic marker is NY-ESO-1.
- NY-ESO-1 is also a CT antigen and is described in, e.g., U.S. Pat. Nos. 5,804,381; 6,274,145; 6,252,052; and 6,525,177; Chen, et al., Proc. Natl. Acad. Sci. USA, 94: 1914-1918 (1997); and Jungbluth, et al., Int. J. Cane, 92:856-860 (2001), all of which are incorporated by reference.
- the human NY-ESO-1 mRNA sequence is set forth in SEQ ID NO: 11 (Genbank Accession No.
- the methods described herein optionally comprise detecting one or more additional markers such as, for example, estrogen receptor (ER), progesterone receptor (PR) and/or HER2.
- ER estrogen receptor
- PR progesterone receptor
- HER2 human mRNA and amino acid sequences for ER can be found in Genbank Accession Nos. NM_000125 and NP_000116, respectively.
- the human mRNA and amino acid sequences for PR can be found in Genbank Accession Nos.:
- the methods described herein further optionally describe detecting one or more cell surface marker such as, for example, CD3 (e.g., Genbank Accession Nos. NM_000733.3 and NM_000724.1) and/or CD8 (e.g., Genbank Accession Nos.: NM_001145873.1,
- CD3 e.g., Genbank Accession Nos. NM_000733.3 and NM_000724.1
- CD8 e.g., Genbank Accession Nos.: NM_001145873.1
- expression of CT antigens of interest is evaluated at the nucleic acid level, by measuring CT antigen mRNA in breast cancer tissue.
- oligonucleotides capable of selectively or specifically hybridizing to human mRNA or human cDNA from human NY-ESO- 1, human CT46, or human TATA Box Binding Protein (TBP; Genbank Accession No. BC109053) under PCR annealing conditions in a PCR reaction containing human mRNA and/or human cDNA and methods of using the oligonucleotides described herein to detect CT46, NY-ESO- 1 or TBD gene expression in a sample from a human subject, for example, a breast cancer tissue sample and including samples that may have been formalin-fixed and/or paraffin- embedded.
- the oligonucleotide comprises a nucleic acid sequence having a length of about 10 to about 50 nucleotides, wherein the nucleic acid comprises a sequence selected from the group consisting of 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY- ESO- 1-F, SEQ ID NO: 1), 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO- 1-R, SEQ ID NO: 2), 5 ' - AGAAC AGGAAAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3(, 5'- CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), 5'- TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), and at least 10 (or
- the oligonucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.
- a pair of oligonucleotides (e.g., SEQ ID NOs: 1 and 2; or SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6) amplifies an amplicon comprising a nucleotide sequence having between 10 and 100 nucleotides in length.
- the amplicon comprises a nucleotide sequence having a length ranging from about 10 to about 100 nucleotides in length, or about 10 to about 80 nucleotides in length, or about 20 to about 90 nucleotides in length, or about 20 to about 75 nucleotides in length, or about 10 to about 75 nucleotides in length or about 50 to about 75 nucleotides in length or about 25 to about 75 nucleotides in length.
- the amplicon comprises a nucleotide sequence having a length of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 nucleotides in length.
- the oligonucleotide optionally comprises a nucleic acid sequence having a length ranging from about 10 to about 40 nucleotides, or about 10 to about 30 nucleotides in length, or about 10 to about 20 nucleotides in length, or about 15 to about 40 nucleotides in length, or about 15 to about 30 nucleotides in length, or about 15 to about 20 nucleotides in length.
- the oligonucleotide comprises a nucleic acid sequence having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length.
- the oligonucleotide comprises a nucleic acid sequence having a length of 20 nucleotides. When sequences longer than those presented in SEQ ID NOs: 1-6 are employed, the additional nucleotides are selected to provide sufficient complementarity to the target mRNA or cDNA sequence to facilitate use as a PCR primer or hybridization probe.
- the oligonucleotide optionally comprises a nucleotide sequence that is identical to, or fully complementary to, an mRNA from human NY-ESO-1, human CT46, or human TBP.
- the property of selective or specific hybridization refers to the ability of the oligonucleotide to hybridize to a target mRNA or cDNA of interest (e.g., CT46, NY-ESO-1 or TBP) in a mixture of human nucleic acids under laboratory assay annealing conditions without significant cross-hybridization to mRNA or cDNA from other human genes, to permit identification in a hybridization assay or selective amplification in an amplification assay (as described in, for example, "Current Protocols in Molecular Biology" (F.
- the "level” or “measure” of a nucleic acid (i.e., CT46 and/or NY-ESO-1 and/or TBP) detected in the methods described herein is the amount of the nucleic acid or its activity as measured by standard laboratory methods described below.
- the term includes the amount of nucleic acid (e.g., concentration or total amount) detected in a sample, e.g., by northern blot or microarray analysis or quantitative RT-PCR methods, as well as detection of the presence or absence of the nucleic acid.
- the measurement is a relative measurement, e.g., a measurement relative to a control that also is measured in the sample.
- the level of a CT46 and/or NY-ESO-1 ucleic acid is measured using an amplification method such as quantitative real-time PCR (Q-PCR).
- Q-PCR quantitative real-time PCR
- TBP mRNA is measured as a control for the quality of the mRNA in the sample.
- amplification methods will use primers complementary to at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50) bases of (a) the nucleic acid of any of SEQ ID NO: 7 (CT46) or SEQ ID NO: 8 (NY-ESO-1) or SEQ ID NO: 9 (TBP); or (b) the full complement thereof.
- CT46 nucleic acid of any of SEQ ID NO: 7
- SEQ ID NO: 8 NY-ESO-1
- SEQ ID NO: 9 TBP
- a complementary sequence need not be an exact complement, and that it is within the scope of the present invention to employ oligonucleotide fragments, fragments of
- An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid corresponding to a biomarker described herein in a breast tumor tissue sample comprises contacting the tissue sample with a compound or an agent capable of detecting the polypeptide marker itself or nucleic acid (e.g., mRNA, genomic DNA, or cDNA) corresponding to the biomarker.
- a compound or an agent capable of detecting the polypeptide marker itself or nucleic acid e.g., mRNA, genomic DNA, or cDNA
- the detection methods described herein can thus be used to detect and/or measure mRNA or protein, for example, in a tissue sample, or quantitatively measure cDNA as an indirect measurement of mRNA or protein expression level in the tissue.
- in vitro techniques for detection of mRNA include Northern hybridizations and in situ hybridizations.
- in vitro techniques for detection of a polypeptide corresponding to a biomarker described herein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
- In vitro techniques for detection of genomic DNA include Southern hybridizations.
- in vivo techniques for detection of a polypeptide corresponding to a biomarker described herein include introducing into a subject a labeled antibody directed against the polypeptide.
- the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
- kits which contain two or more of the reagents that are useful to carry out the assays and/or therapies of the present invention.
- the two or more reagents are packaged together, usually with instructions for use of the reagents.
- the reagents are packaged together but not in admixture, e.g., each reagent is in its own package, vial, etc.
- reagents that will be used in the same reaction are pre-mixed.
- the kit comprises at least two of the oligonucleotides described herein, wherein the at least two oligonucleotides are packaged together but not in admixture, and wherein the at least two oligonucleotides comprise (a) 5'- TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and 5' -AGCTGCTGGAGACAGGAGCT-3' (NY- ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides; or (b) 5 ' - AGAAC AGGAAAA AAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -CTGGACTTTCTTTAGACCTC ATA-3 ' (CT46-
- kits comprising at least four oligonucleotides described herein, wherein the at least four oligonucleotides are packaged together but not in admixture, and wherein two of the at least four oligonucleotides comprise 5'-
- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 '-CTGGACTTTCTTTAGACCTC ATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
- the invention is kit comprising at least six oligonucleotides described herein, wherein the at least six oligonucleotides are packaged together but not in admixture, and wherein two of the at least six oligonucleotides comprise 5'- ACGAACCACGGCACTGATTTTCA-3' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -TGCTGCC AGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
- kits described herein optionally further comprise deoxynucleotide triphospates (dNTP's), MgCl 2 and a thermostable DNA polymerase and/or a reverse transcriptase.
- dNTP's deoxynucleotide triphospates
- MgCl 2 MgCl 2
- thermostable DNA polymerase and/or a reverse transcriptase dNTP's
- kits further comprise one or more reagents for measuring tumor infiltrating lymphocytes in a tissue sample.
- the one or more reagents for measuring tumor infiltrating lymphocytes in some embodiments, comprise an antibody with specificity for CD8 protein.
- kits comprises reagents useful to determine the receptors expressed by a breast cancer cell.
- the kits described herein optionally comprise at least one reagent for measuring at least one receptor selected from estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor 2 (HER2) expressed by a cell.
- ER estrogen receptor
- PR progesterone receptor
- HER2 human epidermal growth factor receptor 2
- kits which contain the necessary reagents to carry out the assays of the present invention.
- the invention provides a compartment kit to receive, in close confinement, one or more containers which comprises a means of detecting a change in the presence or level CT46 nucleic acid optionally in combination with NY-ESO-1 nucleic acid in a tumor tissue sample from a mammalian subject.
- the kit comprises a sample collection component with specific tubes and buffers, a nucleic acid extraction component, nucleic acid reverse transcription and/or labeling components (as appropriate), and a component with appropriate primers or customized specific CT46 (and/or NY-ESO-1) hybridization components.
- the kit comprises one or more microarrays comprising probes capable of specifically detecting the nucleic acids described herein, and includes the additional components for detection that may include chemical, electrical, and/or optical detection methods.
- the term "specifically hybridize” as used herein means that the probes in the kit hybridize under assay conditions (e.g., hybridization assay or PCR annealing conditions) to the nucleic acid of interest but not substantially to other nucleic acids (e.g., other human mRNA or cDNA) of non-target proteins.
- the kit comprises one or more microarrays comprising probes capable of specifically detecting any of the nucleic acids described herein.
- the kit comprises a means for sample collection (e.g., collection tubes and buffers for maintaining nucleic acid integrity in the sample); instructions and materials for the extraction of nucleic acid from the sample; instructions and appropriate buffers, substrates and enzymes for nucleic acid reverse transcription; and instructions and materials (e.g., DNA polymerase, nucleotide substrates, PCR buffer, detection components and PCR primers universal or microRNA specific PCR primers) for nucleic acid
- a means for sample collection e.g., collection tubes and buffers for maintaining nucleic acid integrity in the sample
- instructions and materials for the extraction of nucleic acid from the sample e.g., instructions and appropriate buffers, substrates and enzymes for nucleic acid reverse transcription
- instructions and materials e.g., DNA polymerase, nucleotide substrates, PCR buffer, detection components and PCR primers universal or microRNA specific PCR primers
- a method of measuring CT46 gene expression in a tissue sample from a human subject comprises performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human CT46, and measuring amplicons corresponding to human CT46 in the PCR reaction products.
- the PCR reaction is an RT-PCR reaction using, as a template, total RNA or mRNA isolated from tumor tissue. RNA from testis tissue is used as a control, in some variations.
- the method comprises performing the PCR with a primer pair for selectively amplifying CT46 mRNA, wherein the primer pair comprises 5'- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3) and 5'- CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 3 or SEQ ID NO: 4.
- the method optionally comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products.
- the PCR reaction is an RT-PCR reaction using, as a template, total RNA or mRNA isolated from tumor tissue. RNA from testis tissue is used as a control, in some variations.
- the method comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO-1 mRNA, wherein the primer pair comprises 5 ' -TG AAGGAGTTC ACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), 5'- AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2.
- a method of measuring NY-ESO-1 gene expression in a tissue sample from a human subject comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an
- the method comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO- 1 mRNA, wherein the primer pair comprises 5 '-TGAAGGAGTTC ACTGTGTCC-3' (NY- ESO-l-F, SEQ ID NO: 1), 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2.
- the method optionally comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human TBP, and measuring amplicons corresponding to human TBP in the PCR reaction products.
- the method comprises performing the PCR with a primer pair described herein for selectively amplifying TBP mRNA, wherein the primer pair comprises 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), 5'- TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6. Measuring TBP serves as a useful control in assays described herein.
- the detection methods described herein optionally employ conventional techniques of molecular biology (including recombinant techniques), immunology, microbiology, cell biology, and biochemistry, which are within the skill of the art.
- molecular biology including recombinant techniques
- immunology immunology
- microbiology cell biology
- biochemistry biochemistry
- Such techniques are described in the literature, such as, "Molecular Cloning: A Laboratory Manual", 2 nd edition (Sambrook et al, 1989); “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture” (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Handbook of Experimental Immunology", 4 th edition (D. M. Weir & C. C.
- the nucleic acid in the sample may be detected by contacting a sample comprising the nucleic acid with a biochip comprising an attached oligonucleotide probe sufficiently complementary to the nucleic acid and detecting hybridization to the probe above control levels.
- Hybridization of the specific oligonucleotide probes may be detected using Northern Blot analysis, slot-blot analysis or in situ hybridization analysis and any other methods known in the art, such as those techniques described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratories (New York, 1989).
- Hybridization means contacting two or more nucleic acids under conditions suitable for base pairing.
- Hybridization includes interaction between partially or perfectly complementary nucleic acids. Suitable hybridization conditions are well known to those of skill in the art. In certain applications, it is appreciated that lower stringency conditions may be required. Under these conditions, hybridization may occur even though the sequences of the interacting strands are not perfectly complementary, being mismatched at one or more positions. Conditions may be rendered less stringent by adjusting conditions in accordance with the knowledge in the art, e.g., increasing salt concentration and/or decreasing temperature. Suitable hybridization conditions are those conditions that allow the detection of gene expression from identifiable expression units such as genes.
- Preferred hybridization conditions are stringent hybridization conditions, such as hybridization at 42°C in a solution (i.e., a hybridization solution) comprising 50% formamide, 1% SDS, 1 M NaCl, 10% dextran sulfate, and washing for 30 minutes at 65°C in a wash solution comprising 1 X SSC and 0.1% SDS. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration, as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10.
- Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guano sine/cyto sine (GC) base pairing of the probe.
- the hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (2d. Ed.; 1989), pp. 9.47 to 9.51.
- the oligonucleotides may be labeled for detection of hybridization with the RNA extracted from the biological sample, or the RNA may be labeled for detection.
- Labels include a radioactive label such as 3 H, 14 C, 32 P, 35 S, or 125 I.
- the labels may be a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate,
- the labels may be enzymes such as alkaline phosphatase, ⁇ -galactosidase, biotin and avidin or horseradish peroxidase (Bayer et al., Meth. Enz., 184: 138-163 (1990)).
- the oligonucleotides may be attached to solid substrates such as membranes, beads, filters, glass, silicon, metal, metal-alloy, anopore, polymeric, nylon or plastic.
- the substrates may be chemically treated with chemical prior to attaching probes to enhance binding or to inhibit nonspecific binding during use. Exemplary treatments include coating glass slides with coating of aminoalkyl silanes or polymeric materials such as acrylamide or proteins.
- the oligonucleotides may be covalently or non-covalently attached to the substrate.
- CT46 and/or NY-ESO-1 gene expression may be detected by immobilizing RNA from the tumor tissue sample on a solid support such as nylon membranes and hybridizing a labeled probe with the sample.
- the nucleic acid may also be detected by
- the label may be detected.
- These assays can be direct hybridization assays or can include the use of multiple probes, as is generally outlined in U.S. Pat. Nos. 5,681,702; 5,597,909; 5,545,730; 5,594,117; 5,591,584; 5,571,670; 5,580,731; 5,571,670; 5,591,584; 5,624,802; 5,635,352; 5,594,118; 5,359,100; 5,124,246; and 5,681,697, each of which is hereby incorporated by reference.
- methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides.
- the most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)).
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
- Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS) and RNA- sequencing (RNA-seq).
- RT-PCR reverse transcriptase PCR
- the first step is the isolation of mRNA from a target sample.
- the starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively.
- RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors.
- Breast cancer samples are especially contemplated.
- mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.
- testis tissue may be used as a source of mRNA for a control assay.
- RNA isolation can be performed using purification kit, buffer set and protease from commercial sources
- RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns.
- Other commercially available RNA isolation kits include MasterPure.TM. Complete DNA and RNA Purification Kit (EPICENTRE®., Madison, Wis.), and Paraffin Block RNA Isolation Kit (Ambion, Inc.).
- Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel- Test).
- RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
- RNA cannot serve as a template for PCR
- the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction.
- the two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT).
- AMV-RT avilo myeloblastosis virus reverse transcriptase
- MMLV-RT Moloney murine leukemia virus reverse transcriptase
- the reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling.
- extracted RNA can be reverse-transcribed using a Gene Amp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions.
- the derived cDNA can then be used as a template
- the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5' proofreading endonuclease activity.
- TaqMan® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
- Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction.
- a third oligonucleotide, or probe is designed to detect nucleotide sequence located between the two PCR primers.
- the probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
- the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner.
- the resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore.
- One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
- TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700TM Sequence Detection SystemTM (Perkin-Elmer- Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular Materials).
- 5'-Nuclease assay data are initially expressed as C t , or the threshold cycle.
- C t the threshold cycle.
- fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction.
- the point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (C t ).
- nucleic acid measurements are based on the normalized expression level of the biomarker of interest.
- RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3- phosphate-dehydrogenase (GAPDH) and ⁇ -actin. This normalization allows the comparison of the expression level in one sample, e.g., a patient sample, to another sample, e.g., a non- breast cancer sample, or between samples from different sources.
- the TATA box binding protein (TBP) mRNA is used as a control for the quality and/or quantity of mRNA.
- the expression level can be provided as a relative expression level.
- the level of expression of the marker is determined for 10, 20, 30, 40 or 50 or more samples of normal versus cancer cell isolates, prior to the determination of the expression level for the sample in question.
- the mean expression level of each of the genes assayed in the larger number of samples is determined and this is used as a baseline expression level for the marker.
- the expression level of the marker determined for the test sample (absolute level of expression) is then divided by the mean expression value obtained for that marker. This provides a relative expression level.
- RT-PCR A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan® probe).
- Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
- real time quantitative PCR measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan® probe).
- Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
- RNA isolation, purification, primer extension and amplification are given in various published journal articles (for example: T. E. Godfrey et al., J. Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J. Pathol. 158: 419-29 [2001]).
- a representative process starts with cutting about 10 ⁇ thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR.
- PCR amplified inserts of cDNA clones are applied to a substrate in a dense array.
- Preferably at least 10,000 nucleotide sequences are applied to the substrate.
- the microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions.
- Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array.
- the chip After stringent washing to remove non- specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes.
- Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.
- Serial analysis of gene expression is a method that allows the
- a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript.
- many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously.
- the expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997).
- the MassARRAY (Sequenom, San Diego, Calif.) technology is an automated, high-throughput method of gene expression analysis using mass spectrometry (MS) for detection.
- MS mass spectrometry
- the cDNAs are subjected to primer extension.
- the cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre-loaded with the components needed for MALTI-TOF MS sample preparation.
- the various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained.
- Gene expression analysis by massively parallel signature sequencing is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 ⁇ diameter microbeads.
- a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3xl0 6 microbeads/cm 2 ).
- RNA-seq technology described by Wang Z et al., Nature Review Genetic, 10(1):57 - 63 (2009), is a sequencing approach that provides a method for mapping and quantifying transcriptomes. The approach is based on high throughput sequencing of cDNA converted from total RNA isolated from a sample.
- the detection methods described herein optionally further comprise screening the breast cancer cells for estrogen receptor expression and/or progesterone receptor expression and/or HER2 expression.
- the screening comprises contacting the tissue sample with an antibody capable of binding to a polypeptide of interest, the antibody optionally comprising a detectable label, and detecting the presence (or absence) of the polypeptide.
- Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab') 2 ) can be used.
- labeled with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled.
- indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
- Proteins from breast cells can be isolated using techniques that are well known to those of skill in the art.
- the protein isolation methods employed can, for example, be such as those described in Harlow and Lane (Harlow and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- a variety of formats can be employed to determine whether a sample contains a protein that binds to a given antibody.
- formats include, but are not limited to, enzyme immunoassay (EIA), radioimmunoassay (RIA), Western blot analysis and enzyme linked immunoabsorbant assay (ELISA).
- EIA enzyme immunoassay
- RIA radioimmunoassay
- ELISA enzyme linked immunoabsorbant assay
- antibodies, or antibody fragments can be used in methods such as Western blots or immunofluorescence techniques to detect the expressed proteins.
- Suitable solid phase supports or carriers include any support capable of binding an antigen or an antibody.
- Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
- protein isolated from breast cells can be run on a polyacrylamide gel electrophoresis and immobilized onto a solid phase support such as nitrocellulose.
- the support can then be washed with suitable buffers followed by treatment with the detectably labeled antibody.
- the solid phase support can then be washed with the buffer a second time to remove unbound antibody.
- the amount of bound label on the solid support can then be detected by
- Methods of detecting the presence (or absence) of estrogen receptor expression and/or progesterone receptor expression and/or HER2 expression in a breast cancer cell or tissue sample comprising breast cancer cells are known in the art, some of which are described, for example, in J. Clin. Oncol, 25: 118 (2007).
- Exemplary methods include, but are not limited to, fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), silver-enhanced in situ hybridization (SISH), differential (PCR), Western blotting, ELISA, immunohistochemistry (IHC), Northern blotting and RT-PCR.
- the tissue sample comprises estrogen receptor negative (ER-) breast cancer cells, and/or progesterone receptor negative (PR-) breast cancer cells and/or human epidermal growth factor receptor 2 negative (HER2-) breast cancer cells.
- ER- estrogen receptor negative
- PR- progesterone receptor negative
- HER2- human epidermal growth factor receptor 2 negative
- estrogen receptor positive breast cancer refers to tumors determined to be positive for estrogen receptor.
- ER levels of greater than or equal to 10 fmol/mg and/or an
- progesterone receptor positive breast cancer refers to tumors determined to be positive for progesterone receptor.
- PR levels of greater than or equal to 10 fmol/mg and/or an immunohistochemical observation of greater than or equal to 10% positive nuclei is considered to be PR-positive.
- Breast cancer that does not fulfill the criteria of being PR positive is defined herein as "PR-negative” or "progesterone receptor-negative”.
- triple negative breast cancer refers to a breast cancer that lacks expression of the estrogen receptor, the progesterone receptor and HER2 (i.e., ER “ , PR “ and HER2 " ).
- the detection methods described herein further comprise measuring tumor infiltrating lymphocytes in the tumor tissue sample.
- Tumor infiltrating lymphocytes e.g., CD8-expressing (CD8+) lymphocytes
- TILs tumor infiltrating lymphocytes
- CD8+ lymphocytes can be measured using methods known in the art, such as immunohistochemistry using anti-CD8 antibodies to detect the presence of CD8+ lymphocytes in the sample.
- the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells. In some embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), estrogen receptor- negative (ER-) breast cancer cells.
- the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells and low levels of tumor infiltrating lymphocytes. In still other embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), estrogen receptor-negative (ER-) breast cancer cells and low levels of tumor infiltrating lymphocytes.
- the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative breast cancer cells.
- the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative, estrogen receptor-negative (ER-) breast cancer cells.
- the method comprises measuring a breast tumor tissue sample from the subject for one or more biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs); diagnosing likelihood that the subject would benefit from CT46 immunotherapy and/or NY-ESO-1 immunotherapy based on the biomarkers measured according to the measuring step.
- biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs)
- TILs tumor infiltrating lymphocytes
- the tissue sample comprises breast cancer tissue.
- breast cancer includes any clinical diagnosis of breast cancer, including, but not limited to: invasive ductal, invasive lobular, tubular, or as otherwise invasive or mixed invasive, medullary, DCIS (Ductal Carcinoma In-Situ), LCIS (Lobular Carcinoma In- situ), or otherwise non-invasive; Invasive breast cancer, including stage 0, stage 1, stage 2 (including stage 2a and stage 2b), stage 3 (including stage 3a, stage 3b and stage 3c) and stage 4 breast cancer.
- Cancerous tissue from a solid tumor can be obtained by using conventional tumor biopsy instruments and procedures. Endoscopic biopsy, excisional biopsy, incisional biopsy, fine needle biopsy, punch biopsy, shave biopsy and skin biopsy are examples of recognized medical procedures that can be used by those of skill in the art to obtain tumor samples for use in practicing the methods described herein. Samples of cancerous lesions may be obtained by resection, bronchoscopy, fine needle aspiration, bronchial brushings, or from sputum, pleural fluid or blood. In some variations, a tumor or tumor biopsy is obtained from a subject and fluid from the tumor is removed, e.g., by centrifugation, and the tumor fluid is used as the sample for measuring CT46 and/or NY-ESO-1.
- the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- the therapeutic regimen optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- the therapeutic regimen optionally further comprises measuring tumor infiltrating lymphocytes (TIL' s) in the breast cancer tissue sample, and for a subject with a breast cancer characterized by expression of CT46 (CT46 + ), low levels of TIL' s, and absence of ER expression (ER ), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- TIL' s tumor infiltrating lymphocytes
- the therapeutic regimen optionally further comprises measuring progesterone receptor (PR) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of PR expression (PR-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy
- PR progesterone receptor
- the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), absence of expression of NY-ESO-1 (NY-ESO-1-), and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
- CT46+ CT46
- NY-ESO-1- NY-ESO-1
- ER- absence of ER expression
- the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), presence of expression of NY-ESO-1 (NY-ESO-1+), and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy and NY-ESO-1 immunotherapy.
- ER estrogen receptor
- the therapeutic regimen comprises administering an immunotherapy to a human subject with breast cancer that has been laboratory-typed as any of the following: ER-negative and CT46-positive; ER-negative, NY-ESO-1 negative, and CT46-positive; ER-negative, PR-negative and CT46-positive; and ER-negative, PR-negative, HER2-negative and CT46 positive; wherein the immunotherapy comprises administering CT46 antigen immunotherapy (as described elsewhere herein).
- the breast cancer has been laboratory-typed as having low levels of tumor infiltrating T- lymphocytes (e.g., CD8+ lymphocytes).
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46- negative.
- this method is performed on a subject whose breast cancer has been predetermined to be ER-negative, or ER-negative/PR-negative, or ER-negative/HER2- negative, or triple negative (ER7PR7HER2 ).
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive.
- ER estrogen receptor
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating lymphocytes (TIL's) in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of TIL's, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive or has high levels of TIL.
- CT46+ CT46
- ER- tumor infiltrating lymphocytes
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating T-lymphocytes in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of tumor-infiltrating T- lymphocytes, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive or has high levels of tumor-infiltrating T-lymphocytes.
- CT46+ CT46
- ER- ER expression
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is
- CT46+ characterized by expression of CT46 (CT46+), absence of NY-ESO-1 expression (NY-ESO- 1-), and absence of ER expression (ER-), or as unlikely to benefit from the CT46
- the breast cancer tissue sample is CT46-negative, NY-ESO- 1-positive, or ER-positive.
- the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject, measuring NY-ESO-1 in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination therapy comprising CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and expression of NY-ESO-1, or as unlikely to benefit from the combination therapy if the breast cancer tissue sample is CT46-negative and NY-ESO-1 -negative.
- a therapeutic regimen that includes a combination therapy comprising CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and expression of NY-ESO-1, or as unlikely to benefit from the combination therapy if the breast cancer tissue sample is CT46-negative and NY-ESO-1 -negative.
- the breast cancer tissue sample is, in some variations, from a primary breast tumor from the subject. In other variations, the breast cancer tissue sample is from a secondary tumor from the subject.
- Table A provides exemplary patient prognosis and proposed treatment guidelines based on the presence or absence in the breast cancer of the various markers described above, particularly in an ER-negative breast cancer tissue sample from a subject.
- CT46 + /TIL(CD8) Low Higher risk of breast cancer CT46 immunotherapy is
- CT46 + /TIL(CD8) High Good prognosis CT46 immunotherapy is
- CT46 + /NY-ESO-l + Good prognosis CT46 immunotherapy is
- CT46 /TIL(CD8) Low Higher risk of breast cancer CT46 immunotherapy is not recurrence recommended
- the invention also involves the use human CT46 and/or human NY-ESO-1 as disclosed herein to "immunize” subjects or as “vaccines".
- the use of human CT46 and/or human NY-ESO-1 nucleic acid or amino acid sequence in the immunotherapy is specifically contemplated.
- Human CT46 isoform 1 mRNA sequence is set forth in SEQ ID NO: 7 (Genbank Accession No. NM-032132) and the corresponding acid sequence is set for in SEQ ID NO: 8 (Genbank Accession No. NP_115508.2).
- the CT46 isoform 2 mRNA sequence is set forth in SEQ ID NO: 9 (Genbank Accession No. NM_001199829) and the corresponding amino acid sequence is set forth in SEQ ID NO: 10 (Genbank Accession No.
- NY-ESO- is described in, e.g., U.S. Pat. Nos. 5,804,381; 6,274,145; 6,252,052; and 6,525,177; Chen, et al., Proc. Natl. Acad. Sci. USA, 94: 1914-1918 (1997); and Jungbluth, et al., Int. J. Cane, 92:856-860 (2001), all of which are incorporated by reference.
- the human NY-ESO-1 mRNA sequence is set forth in SEQ ID NO: 11 (Genbank Accession No. NM_001327), and the corresponding amino acid sequence is set forth in SEQ ID NO: 12 (Genbank Accession No. NP_001318.1).
- immunosens means increasing or activating an immune response against an antigen. It does not require elimination or eradication of a condition but rather contemplates the clinically favorable enhancement of an immune response toward an antigen.
- Generally accepted animal models can be used for testing of immunization against cancer using a cancer-testis nucleic acid such as CT46 or NY-ESO-1.
- a cancer-testis nucleic acid such as CT46 or NY-ESO-1.
- human cancer cells can be introduced into a mouse to create a tumor, and one or more cancer-testis antigen nucleic acids, proteins, or peptides can be delivered by the methods described herein.
- the immunotherapy includes, or is combined with, one or more adjuvants and/or cytokines to boost the immune response.
- Methods for immunization have been developed with other antigens (and antigen- encoding nucleic acids), including formulation of a vaccine composition and selection of doses, route of administration and the schedule of administration (e.g. primary and one or more booster doses), and it is contemplated that such methods will be adapted for CT46 or NY-ESO-1.
- the tests also can be performed in humans, where the end point is to test for the presence of enhanced levels of circulating CTLs against cells bearing the antigen, to test for levels of circulating antibodies against the antigen, to test for the presence of cells expressing the antigen, and so forth.
- CT46 and/or NY-ESO-1 and/or an immunogenic fragments thereof is/are administered with one or more adjuvants to induce an immune response or to increase an immune response.
- immunotherapy contect is a substance incorporated into or administered with antigen which potentiates the immune response.
- Adjuvants may enhance the immunological response by providing a reservoir of antigen (extracellularly or within macrophages), activating macrophages and stimulating specific sets of lymphocytes.
- Adjuvants of many kinds are well known in the art. Specific examples of adjuvants include monophosphoryl lipid A (MPL, SmithKline Beecham), a congener obtained after purification and acid hydrolysis of
- Salmonella minnesota Re 595 lipopolysaccharide including QS21 (SmithKline Beecham), a pure QA-21 saponin purified from Quillja saponaria extract; DQS21, described in PCT application W096/33739 (SmithKline Beecham), ISCOM (CSL Ltd., Parkville, Victoria, Australia) derived from the bark of the QuiUaia saponaria molina tree; QS-7, QS-17, QS-18, and QS-L1 (So et al., Mol. Cells.
- the antigens are administered mixed with a combination of DQS21/MPL.
- the ratio of DQS21 to MPL typically will be about 1: 10 to 10: 1, preferably about 1:5 to 5: 1 and more preferably about 1: 1.
- DQS21 and MPL will be present in a vaccine formulation in the range of about 1 ⁇ g to about 100 ⁇ g.
- adjuvants are known in the art and can be used in the invention (see, e.g. Goding, Monoclonal Antibodies: Principles and Practice, 2nd Ed., 1986). Methods for the preparation of mixtures or emulsions of polypeptide and adjuvant are well known to those of skill in the art of vaccination.
- cytokines are also useful in vaccination protocols as a result of their lymphocyte regulatory properties.
- Many other cytokines useful for such purposes will be known to one of ordinary skill in the art, including interleukin-12 (IL-12), which has been shown to enhance the protective effects of vaccines (see, e.g., Science 268: 1432-1434, 1995), GM-CSF, IL-18 and IL-15 (Klebanoff et al. Proc. Natl. Acad. Sci. USA 2004 101: 1969-74).
- IL-12 interleukin-12
- cytokines can be administered in conjunction with antigens and adjuvants to increase the immune response to the antigens.
- immune response potentiating compounds that can be used in vaccination protocols. These include co- stimulatory molecules provided in either protein or nucleic acid form. Such co-stimulatory molecules include the B7-1 and B7-2 (CD80 and CD86 respectively) molecules which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cell. This interaction provides co- stimulation (signal 2) to an antigen/MHC/TCR stimulated (signal 1) T cell, increasing T cell proliferation and effector function.
- co-stimulatory molecules include the B7-1 and B7-2 (CD80 and CD86 respectively) molecules which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cell. This interaction provides co- stimulation (signal 2) to an antigen/MHC/TCR stimulated (signal 1) T cell, increasing T cell proliferation and effector function.
- B7 also interacts with CTLA4 (CD 152) on T cells and studies involving CTLA4 and B7 ligands indicate that the B7-CTLA4 interaction can enhance antitumor immunity and CTL proliferation (Zheng P., et al. Proc. Natl. Acad. Sci. USA 95 (11):6284- 6289 (1998)).
- B7 typically is not expressed on tumor cells so they are not efficient antigen presenting cells (APCs) for T cells. Induction of B7 expression would enable the tumor cells to stimulate more efficiently CTL proliferation and effector function.
- a combination of B7/IL-6/IL-12 co-stimulation has been shown to induce IFN-gamma and a Thl cytokine profile in the T cell population leading to further enhanced T cell activity (Gajewski et al., J. Immunol, 154:5637-5648 (1995)).
- Tumor cell transfection with B7 has been discussed in relation to in vitro CTL expansion for adoptive transfer immunotherapy by Wang et al., (J. Immunol., 19: 1-8 (1986)).
- B7 molecule delivery mechanisms for the B7 molecule would include nucleic acid (naked DNA) immunization (Kim J., et al. Nat. Biotechnol., 15:7:641-646 (1997) ) and recombinant viruses such as adeno and pox (Wendtner et al., Gene Ther., 4:7:726-735 (1997)).
- nucleic acid naked DNA
- recombinant viruses such as adeno and pox
- adeno and pox Wang et al., Gene Ther., 4:7:726-735 (1997).
- these delivery systems can be used for induction of the appropriate molecules in vitro and for in vivo vaccination situations.
- the use of anti-CD28 antibodies to directly stimulate T cells in vitro and in vivo could also be considered.
- the inducible co- stimulatory molecule ICOS which induces T cell responses to foreign antigen could be modulated, for example, by use of anti-ICOS antibodies (Hutloff et al., Nature 397:263-266, 1999).
- Lymphocyte function associated antigen-3 (LFA-3) is expressed on APCs and some tumor cells and interacts with CD2 expressed on T cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Parra et al., J. Immunol., 158:637-642 (1997), Fenton et al., J. Immunother., 21:2:95-108 (1998)).
- LFA-1 Lymphocyte function associated antigen- 1
- ICAM-1 expressed on APCs and some tumor cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Fenton et al., J. Immunother., 21:2:95-108 (1998)).
- LFA-1 is thus a further example of a costimulatory molecule that could be provided in a vaccination protocol in the various ways discussed above for B7.
- Th cell help through the interaction between the Th cell CD40L (CD40 ligand) molecule and the CD40 molecule expressed by DCs (Ridge et al., Nature, 393:474 (1998), Bennett et al., Nature, 393:478
- GITR Glucocorticoid-lnduced TNFR-Related (GITR) protein belongs to tumor necrosis factor receptor/tumor necrosis factor superfamily and stimulates both the acquired and innate immunity.
- the invention contemplates delivery of nucleic acids, polypeptides or fragments thereof for vaccination. Delivery of polypeptides and fragments thereof can be accomplished according to standard vaccination protocols known in the art. In another embodiment, the delivery of nucleic acid is accomplished by ex vivo methods, e.g., by removing a cell from a subject, genetically engineering the cell to include a cancer-testis polypeptide-encoding gene (or modifying the cell to express an endogenous gene), and reintroducing the engineered cell into the subject.
- ex vivo methods e.g., by removing a cell from a subject, genetically engineering the cell to include a cancer-testis polypeptide-encoding gene (or modifying the cell to express an endogenous gene), and reintroducing the engineered cell into the subject.
- a cancer-testis polypeptide-encoding gene or modifying the cell to express an endogenous gene
- a viral vector is used for delivering a nucleic acid encoding a cancer-testis polypeptide to cells of a subject.
- exemplary viral vectors include adenoviruses, adeno-associated viruses, poxviruses including vaccinia viruses and attenuated poxviruses, Semliki Forest virus, Venezuelan equine encephalitis virus, retroviruses, Sindbis virus, and Ty virus-like particle.
- replication-defective adenoviruses e.g., Xiang et al., Virology 219:220-227, 1996; Eloit et al., J. Virol. 7:5375-5381, 1997; Chengalvala et al., Vaccine 15:335-339,
- a preferred virus vector is an adenovirus.
- nucleic acid delivery vectors (1) contain exogenous genetic material that can be transcribed and translated in a mammalian cell and that can induce an immune response in a host, and (2) contain on a surface a ligand that selectively binds to a receptor on the surface of a target cell, such as a mammalian cell, and thereby gains entry to the target cell.
- nucleic acids of the invention may be introduced in vitro or in vivo in a host.
- Such techniques include transfection of nucleic acid-CaP0 4 precipitates, transfection of nucleic acids associated with DEAE, transfection or infection with the foregoing viruses including the nucleic acid of interest, liposome mediated transfection, and the like.
- a vehicle used for delivering a nucleic acid of the invention into a cell e.g., a retrovirus, or other virus; a liposome
- a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or incorporated within the nucleic acid delivery vehicle.
- Preferred antibodies include antibodies which selectively bind a cancer-testis antigen, alone or as a complex with a MHC molecule.
- monoclonal antibodies are employed.
- proteins which bind to a surface membrane protein associated with endocytosis may be incorporated into the liposome formulation for targeting and/or to facilitate uptake.
- proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like.
- Polymeric delivery systems also have been used successfully to deliver nucleic acids into cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.
- the CT46-immunotherapy and/or NY-ESO-1 -immunotherapy described herein is combined with standard of care chemotherapy/radiation and regimens based on the tumor biology and tumor subtypes. It is contemplated that the vaccine, administered in an adjuvant setting, can be used prior to or post surgery, in combination with chemotherapy/radiation or following one to three months after chemotherapy.
- Standard of care regimens for patients with invasive breast cancer include, but are not limited to, therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel.
- therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel.
- Fluorouracil, eirubicin, and cyclophosphamide or Flourouracil, doxorubicin, and cyclophosphamide are therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel.
- Fluorouracil, eirubicin, and cyclophosphamide or Flourouracil, doxorubicin, and cyclophosphamide are examples of therapies for the treatment of HER2 negative disease such as doxorubin, cyclophos
- Docetaxel, doxorubicin, and cyclophosphamide or docetaxel, cyclophosphamide is another choice of combination of chemotherapy.
- the regimens optionally further comprise prescribing or administering one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-CTLA4, anti-PDl, anti-OXA4, anti-TGFbetal, PD1 ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF), interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells, cytokines and dexamethasone.
- the therapeutic regimens described herein optionally further comprise prescribing or administering a standard-of-care therapy to a mammalian subject if the presence of CT46 is absent from the tumor tissue sample.
- Exemplary standard-of-care therapy includes, but is not limited to, chemotherapeutic agents, radiotherapeutic agents, immunotherapeutic agents, inhibitors of cellular proliferation, regulators of programmed cell death, surgery and other agents.
- chemotherapy may be administered, as is typical, in regular cycles.
- Standard of care chemotherapeutic regimens for patients with invasive breast cancer include, but are not limited to, therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel.
- therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel.
- cyclophosphamide Docetaxel, doxorubicin, and cyclophosphamide or docetaxel,
- cyclophosphamide is another choice of combination of chemotherapy.
- a cycle may involve one dose, after which several days or weeks without treatment ensues for normal tissues to recover from the drug's side effects. Doses may be given several days in a row, or every other day for several days, followed by a period of rest. If more than one drug is used, the treatment plan will specify how often and exactly when each drug should be given. The number of cycles a person receives may be determined before treatment starts (based on the type and stage of cancer) or may be flexible, in order to take into account how quickly the tumor is shrinking. Certain serious side effects may also require doctors to adjust chemotherapy plans to allow the patient time to recover.
- Chemotherapeutic agents contemplated for use with the methods described herein include, but are not limited, to erlotinib (TARCEVA®, Genentech/OSI Pharm.), docetaxel (TAXOTERE®, Sanofi-Aventis), 5-FU (fluorouracil, 5-fluorouracil, CAS No. 51-21-8), gemcitabine (GEMZAR®, Lilly), PD-0325901 (CAS No. 391210-10-9, Pfizer), cisplatin (cis-diamine, dichloroplatinum(II), CAS No. 15663-27-1), carboplatin (CAS No.
- paclitaxel TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.J.
- bevacizumab AVASTIN®, Genentech
- trastuzumab HERCEPTIN®, Genentech
- pertuzumab paclitaxel
- temozolomide (4-methyl-5-oxo-2,3,4,6,8- pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carbox- amide, CAS No. 85622-93-1,
- TEMODAR® TEMODAL®, Schering Plough
- tamoxifen (Z)-2-[4-(l,2-diphenylbut-l- enyl)phenoxy]-N,N-dimethyl-ethanam- ine
- NOLVADEX® NOLVADEX®
- ISTUBAL® VALODEX®
- doxorubicin ADRIAM YCIN®
- Akti-1/2 Akti-1/2
- HPPD rapamycin
- lapatinib TYKERB®, Glaxo SmithKline
- oxaliplatin ELOXATIN®, Sanofi
- bortezomib VELCADE®
- alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); a
- camptothecin including the synthetic analog topotecan
- bryostatin including the synthetic analog topotecan
- callystatin including its adozelesin, carzelesin and bizelesin synthetic analogs
- cryptophycins including the synthetic analog topotecan
- nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, calicheamicin gammall, calicheamicin omegall, dynemicin, dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzino statin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin,
- antibiotics such as the enediyne antibiotics (e.g., calicheamicin, calicheamicin gammall, calicheamicin omegall, dynemicin, dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as
- etoglucid gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine;
- razoxane rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol;
- pipobroman gacytosine; arabinoside ("Ara-C”); cyclophosphamide; thiotepa; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin;
- vinblastine etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine
- NAVELBINE® novantrone
- teniposide teniposide
- edatrexate daunomycin
- aminopterin
- ibandronate CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; and pharmaceutically acceptable salts, acids and derivatives of any of the above.
- DMFO difluoromethylornithine
- retinoids such as retinoic acid
- Radiotherapeutic agents may also be used in accordance with the methods described herein. Such factors that cause DNA damage and have been used extensively include what are commonly known as 7 -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
- Immunotherapeutics may also be employed for the treatment of cancer.
- Immunotherapeutics generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
- the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
- the antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing.
- the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
- the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
- Various effector cells include cytotoxic T cells and NK cells.
- the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells.
- Exemplary tumor markers include, but are not limited to, CT46, NY-ESO-1, estrogen receptor, progesterone receptor, and HER2.
- the tumor suppressor oncogenes function to inhibit excessive cellular proliferation.
- the inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation.
- the tumor suppressors are described below.
- pl6 Another inhibitor of cellular proliferation is pl6.
- the major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK'S.
- CDK cyclin-dependent kinase 4
- the activity of this enzyme may be to phosphorylate Rb at late Gl.
- the activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl61NK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et al., 1995). Since the pl61NK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. pl6 also is known to regulate the function of CDK6.
- pl61NK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, pl9, p21WAFl, and p27KIPl.
- the pl61NK4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl61NK4 gene are frequent in human tumor cell lines. This evidence suggests that the pl61NK4 gene is a tumor suppressor gene.
- genes that may be employed include Rb, mda-7, APC, DCC, NF- 1 , NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1/PTEN, DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.
- angiogenesis e.g., VEGF, FGF, thrombospondin
- Apoptosis or programmed cell death, is an essential process in cancer therapy (Kerr et al., 1972).
- the Bcl-2 family of proteins and ICE-like proteases have been
- the Bcl- 2 protein plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986).
- the evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists.
- Bcl-2 that function to promote cell death such as, Bax, Bak, Bik, Bim, Bid, Bad and Harakiri, are contemplated for use in combination with HDACi and a hormonal therapy agent thereof in treating cancer.
- a surgical procedure may be employed in the present invention.
- Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery.
- Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed.
- Tumor resection refers to physical removal of at least part of a tumor.
- treatment by surgery includes laser surgery, cryosurgery, electro surgery, and miscopically controlled surgery (Mohs' surgery).
- the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
- a cavity may be formed in the body.
- Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy.
- Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months.
- These treatments may be of varying dosages as well.
- agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment.
- additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, or agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers.
- Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-lbeta, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells.
- cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments.
- Inhibitors of cell adhesion are also contemplated to improve the efficacy of treatment. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin.
- compositions containing the nucleic acid molecules, proteins, and binding polypeptides of the invention are provided.
- the compositions contain any of the foregoing nucleic acid molecules, proteins, and binding polypeptides (as therapeutic agents) in an optional pharmaceutically acceptable carrier.
- the invention provides a method for forming a medicament that involves placing a therapeutically effective amount of the therapeutic agent in the pharmaceutically acceptable carrier to form one or more doses.
- the effectiveness of treatment or prevention methods of the invention can be determined using standard diagnostic methods described herein.
- the therapeutic compositions of the present invention are administered in pharmaceutically acceptable preparations.
- Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines, and optionally other therapeutic agents.
- the term "pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
- physiologically acceptable refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
- the characteristics of the carrier will depend on the route of administration.
- Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art.
- the term denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- the components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
- the therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time.
- the administration may, for example, be oral, intravenous, intratumoral, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal.
- a preferred route of administration is by pulmonary aerosol.
- Techniques for preparing aerosol delivery systems containing antibodies are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the antibodies, such as the paratope binding capacity (see, for example, Sciarra and Cutie, "Aerosols," in Remington's Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712).
- Those of skill in the art can readily determine the various parameters and conditions for producing antibody aerosols without undue experimentation. When using antisense preparations of the invention, slow intravenous administration is preferred.
- compositions of the invention are administered in effective amounts.
- An "effective amount" with respect to a CT antigen according to the teachings herein is that amount of a cancer-testis polypeptide composition that alone, or together with further doses, produces the desired response, e.g., increases an immune response to the cancer-testis polypeptide and results in an immune response in the subject that results in tumor shrinkage and/or slowed tumor growth and/or prevention or delay of relapse.
- the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or can be monitored according to diagnostic methods of the invention discussed herein.
- the desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.
- Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
- the pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of cancer-testis polypeptide or nucleic acid encoding cancer-testis polypeptide for producing the desired response in a unit of weight or volume suitable for administration to a patient.
- the response can, for example, be measured by determining the immune response following administration of the cancer-testis antigen polypeptide composition via a reporter system by measuring downstream effects such as gene expression, or by measuring the physiological effects of the cancer-testis polypeptide composition, such as regression of a tumor or decrease of disease symptoms.
- Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response.
- cancer-testis polypeptide compositions e.g., polypeptide, peptide, antibody, cell or nucleic acid
- administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
- cancer-testis antigen for treatments for eliciting or increasing an immune response, are formulated and administered in doses between 1 ng and 1 mg, and preferably between 10 ng and 100 ⁇ g, according to any standard procedure in the art. Where nucleic acids encoding cancer-testis polypeptides or variants thereof are employed, doses of between 1 ng and 0.1 mg generally will be formulated and administered according to standard procedures. Other protocols for the administration of cancer-testis polypeptide compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration (e.g., intra-tumoral) and the like vary from the foregoing.
- cancer-testis polypeptide compositions to mammals other than humans, e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
- modes of administration which effectively deliver the cancer-testis polypeptide and adjuvant, such that an immune response to the polypeptide is increased, can be used.
- preferred methods include intradermal, intravenous, intratumoral, intramuscular and subcutaneous administration. Although these are preferred embodiments, the invention is not limited by the particular modes of administration disclosed herein. Standard references in the art (e.g., Remington's Pharmaceutical Sciences, 18th edition, 1990) provide modes of administration and formulations for delivery of immunogens with adjuvant or in a non-adjuvant carrier.
- the pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- suitable buffering agents including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
- suitable preservatives such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
- compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound.
- Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
- compositions for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, and lactated Ringer's or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte
- replenishers such as those based on Ringer's dextrose), and the like.
- Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases, and the like.
- Another aspect of the invention is a system that is capable of receiving one or more inputs about a human subject that has had a breast cancer diagnosis and processing the input(s) to generate a prognosis and/or a treatment protocol individualized for the subject.
- a system of the invention is capable of carrying out a part or all of a method of the invention, or carrying out a variation of a method of the invention as described herein in greater detail.
- Some systems use materials or kits of the invention.
- Exemplary systems include, as one or more components, computing systems, environments, and/or
- a system of the invention includes one or more machines used for analysis of biological material (e.g., genetic material), as described herein. In some variations, this analysis of the biological material involves a chemical analysis and/or a nucleic acid amplification.
- biological material e.g., genetic material
- the system comprises data acquisition modules for detecting one or more detectable biological marker(s) described herein.
- the biomolecular probes of such a data acquisition module can include any that are appropriate for detecting the biological marker, e.g., oligonucleotide probes, proteins, aptamers, antibodies, etc.
- sample handlers e.g., fluid handlers
- robotics e.g., microfluidic systems
- nucleic acid or protein purification modules e.g., nucleic acid arrays
- detectors e.g., thermocyclers or combinations thereof, e.g., for acquiring samples, diluting or aliquoting samples, purifying marker materials (e.g., nucleic acids or proteins), amplifying marker nucleic acids, detecting amplified marker nucleic acids, and the like.
- purifying marker materials e.g., nucleic acids or proteins
- amplifying marker nucleic acids e.g., amplifying marker nucleic acids, detecting amplified marker nucleic acids, and the like.
- the common ORCA® robot which is used in a variety of laboratory systems, e.g., for microtiter tray manipulation, is also commercially available, e.g., from Beckman Coulter, Inc. (Fullerton, Calif.).
- commercially available microfluidic systems that can be used as system components in the present invention include those from Agilent technologies and Caliper Technologies.
- patent and technical literature includes numerous examples of microfluidic systems, including those that can interface directly with microwell plates for automated fluid handling.
- any of a variety of liquid handling and/or array configurations can be used in the systems described herein.
- One common format for use in the systems herein is a microtiter plate, in which the array or liquid handler includes a microtiter tray.
- Such trays are commercially available and can be ordered in a variety of well sizes and numbers of wells per tray, as well as with any of a variety of functionalized surfaces for binding of assay or array components.
- Common trays include the ubiquitous 96 well plate, with 384 and 1536 well plates also in common use. Samples can be processed in such trays, with all of the processing steps being performed in the trays. Samples can also be processed in microfluidic apparatus, or combinations of microtiter and microfluidic apparatus.
- components can be stored in or analyzed on solid phase arrays. These arrays fix materials in a spatially accessible pattern (e.g., a grid of rows and columns) onto a solid substrate such as a membrane (e.g., nylon or nitrocellulose), a polymer or ceramic surface, a glass or modified silica surface, a metal surface, or the like.
- a solid substrate such as a membrane (e.g., nylon or nitrocellulose), a polymer or ceramic surface, a glass or modified silica surface, a metal surface, or the like.
- Components can be accessed, e.g., by hybridization, by local rehydration (e.g., using a pipette or other fluid handling element) and fluidic transfer, or by scraping the array or cutting out sites of interest on the array.
- the system can also include detection apparatus that is used to detect genetic information, using any of the approaches described herein.
- a detector configured to detect real-time PCR products (e.g., a light detector, such as a fluorescence detector) or an array reader can be incorporated into the system.
- the detector can be configured to detect a light emission from a hybridization or amplification reaction comprising an allele of interest, wherein the light emission is indicative of the presence or absence of the allele.
- an operable linkage between the detector and a computer that comprises the system instructions noted above is provided, allowing for automatic input of detected allele- specific information to the computer, which can, e.g., store the database information and/or execute the system instructions to compare the detected allele specific information to the look up table.
- Probes that are used to generate information detected by the detector can also be incorporated within the system, along with any other hardware or software for using the probes to detect the amplicon. These can include thermocycler elements (e.g., for performing PCR or LCR amplification of the allele to be detected by the probes), arrays upon which the probes are arrayed and/or hybridized, or the like.
- thermocycler elements e.g., for performing PCR or LCR amplification of the allele to be detected by the probes
- arrays upon which the probes are arrayed and/or hybridized, or the like can be used for moving sample materials (e.g., template nucleic acids and/or proteins to be detected) primers, probes, amplicons, or the like into contact with one another.
- the system can include a set of marker probes or primers configured to detect at least biological marker described herein (e.g., CT46 and/or NY-ESO-1).
- the detector module is configured to detect one or more signal outputs from the set of marker probes or primers, or an amplicon produced from the set of marker probes or primers, thereby identifying the presence or absence of the biological marker.
- the sample to be analyzed is optionally part of the system, or can be considered separate from it.
- the sample optionally includes e.g., genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, proteins, etc., as noted herein.
- the sample is derived from a mammal such as a human patient having breast cancer.
- the sample is a human breast cancer tissue sample.
- system components for interfacing with a user are provided.
- the systems can include a user viewable display for viewing an output of computer- implemented system instructions, user input devices (e.g., keyboards or pointing devices such as a mouse) for inputting user commands and activating the system, etc.
- user input devices e.g., keyboards or pointing devices such as a mouse
- the system of interest includes a computer, wherein the various computer-implemented system instructions are embodied in computer software, e.g., stored on computer readable media.
- Standard desktop applications such as word processing software (e.g., Microsoft WordTM or Corel WordPerfectTM) and database software (e.g., spreadsheet software such as Microsoft ExcelTM, Corel Quattro ProTM, or database programs such as Microsoft AccessTM or SequelTM, OracleTM, ParadoxTM) can be adapted to the present invention by inputting a character string corresponding to an allele herein, or an association between an allele and a phenotype.
- the systems can include software having the appropriate character string information, e.g., used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh or LINUX system) to manipulate strings of characters.
- Specialized sequence alignment programs such as BLAST can also be
- nucleic acids or proteins e.g., for identifying and relating multiple alleles.
- systems can include a computer with an appropriate database and an allele sequence or correlation of the invention.
- Software for aligning sequences, as well as data sets entered into the software system comprising any of the sequences herein can be a feature of the invention.
- the computer can be, e.g., a PC (Intel x86 or Pentium chip- compatible DOSTM, OS2TM WINDOWSTM, WINDOWS NTTM, WINDOWS95TM,
- WINDOWS98TM WINDOWS2000, WINDOWSME, or LINUX based machine, a
- MACINTOSHTM MACINTOSHTM
- Power PC or a UNIX based (e.g., SUNTM work station or LINUX based machine) or other commercially common computer which is known to one of skill.
- Software for entering and aligning or otherwise manipulating sequences is available, e.g., BLASTP and BLASTN, or can easily be constructed by one of skill using a standard programming language such as Visualbasic, Fortran, Basic, Java, or the like.
- an exemplary system of the invention which may be used to implement one or more steps of methods of the invention, includes a computing device in the form of a computer 110.
- Components shown in dashed outline are not technically part of the computer 110, but are used to illustrate the exemplary embodiment of Fig. 10.
- Components of computer 110 may include, but are not limited to, a processor 120, a system memory 130, a memory/graphics interface 121, also known as a Northbridge chip, and an 170 interface 122, also known as a Southbridge chip.
- the system memory 130 and a graphics processor 190 may be coupled to the memory/graphics interface 121.
- a monitor 191 or other graphic output device may be coupled to the graphics processor 190.
- a series of system busses may couple various system components including a high speed system bus 123 between the processor 120, the memory/graphics interface 121 and the 170 interface 122, a front- side bus 124 between the memory/graphics interface 121 and the system memory 130, and an advanced graphics processing (AGP) bus 125 between the memory/graphics interface 121 and the graphics processor 190.
- the system bus 123 may be any of several types of bus structures including, by way of example, and not limitation, such architectures include Industry Standard Architecture (ISA) bus, Micro Channel Architecture (MCA) bus and Enhanced ISA (EISA) bus.
- ISA Industry Standard Architecture
- MCA Micro Channel Architecture
- EISA Enhanced ISA
- the computer 110 typically includes a variety of computer-readable media.
- Computer-readable media can be any available media that can be accessed by computer 110 and includes both volatile and nonvolatile media, removable and non-removable media.
- computer readable media may comprise computer storage media.
- Computer storage media includes both volatile and nonvolatile, removable and non-removable media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data.
- Computer storage media includes, but is not limited to, RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disks (DVD) or other optical disk storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other physical medium which can be used to store the desired information and which can accessed by computer 110.
- the system memory 130 includes computer storage media in the form of volatile and/or nonvolatile memory such as read only memory (ROM) 131 and random access memory (RAM) 132.
- the system ROM 131 may contain permanent system data 143, such as identifying and manufacturing information.
- a basic input/output system (BIOS) may also be stored in system ROM 131.
- RAM 132 typically contains data and/or program modules that are immediately accessible to and/or presently being operated on by processor 120.
- Fig. 13 illustrates operating system 134, application programs 135, other program modules 136, and program data 137.
- the I/O interface 122 may couple the system bus 123 with a number of other busses 126, 127 and 128 that couple a variety of internal and external devices to the computer 110.
- a serial peripheral interface (SPI) bus 126 may connect to a basic input/output system (BIOS) memory 133 containing the basic routines that help to transfer information between elements within computer 110, such as during start-up.
- BIOS basic input/output system
- a super input/output chip 160 may be used to connect to a number of 'legacy' peripherals, such as floppy disk 152, keyboard/mouse 162, and printer 196, as examples.
- the super I/O chip 160 may be connected to the I/O interface 122 with a bus 127, such as a low pin count (LPC) bus, in some embodiments.
- LPC low pin count
- bus 128 may be a Peripheral Component Interconnect (PCI) bus, or a variation thereof, may be used to connect higher speed peripherals to the I/O interface 122.
- PCI Peripheral Component Interconnect
- a PCI bus may also be known as a Mezzanine bus.
- Variations of the PCI bus include the Peripheral Component Interconnect-Express (PCI-E) and the Peripheral
- bus 128 may be an advanced technology attachment (ATA) bus, in the form of a serial ATA bus (SATA) or parallel ATA (PATA).
- ATA advanced technology attachment
- SATA serial ATA bus
- PATA parallel ATA
- the computer 110 may also include other removable/non-removable,
- Fig. 12 illustrates a hard disk drive 140 that reads from or writes to non-removable, nonvolatile magnetic media.
- the hard disk drive 140 may be a conventional hard disk drive..
- Removable media such as a universal serial bus (USB) memory 153, firewire (IEEE 1394), or CD/DVD drive 156 may be connected to the PCI bus 128 directly or through an interface 150.
- a storage media 154 may coupled through interface 150.
- Other removable/non-removable, volatile/nonvolatile computer storage media that can be used in the exemplary operating environment include, but are not limited to, magnetic tape cassettes, flash memory cards, digital versatile disks, digital video tape, solid state RAM, solid state ROM, and the like.
- the drives and their associated computer storage media discussed above and illustrated in Fig. 12, provide storage of computer readable instructions, data structures, program modules and other data for the computer 110.
- hard disk drive 140 is illustrated as storing operating system 144, application programs 145, other program modules 146, and program data 147. Note that these components can either be the same as or different from operating system 134, application programs 135, other program modules 136, and program data 137.
- Operating system 144, application programs 145, other program modules 146, and program data 147 are given different numbers here to illustrate that, at a minimum, they are different copies.
- a user may enter commands and information into the computer 20 through input devices such as a mouse/keyboard 162 or other input device combination.
- Other input devices may include a microphone, joystick, game pad, satellite dish, scanner, or the like. These and other input devices are often connected to the processor 120 through one of the I/O interface busses, such as the SPI 126, the LPC 127, or the PCI 128, but other busses may be used. In some embodiments, other devices may be coupled to parallel ports, infrared interfaces, game ports, and the like (not depicted), via the super I/O chip 160.
- the computer 110 may operate in a networked environment using logical connections to one or more remote computers, such as a remote computer 180 via a network interface controller (NIC) 170, .
- the remote computer 180 may be a personal computer, a server, a router, a network PC, a peer device or other common network node, and typically includes many or all of the elements described above relative to the computer 110.
- the logical connection between the NIC 170 and the remote computer 180 depicted in Fig. 12 may include a local area network (LAN), a wide area network (WAN), or both, but may also include other networks.
- LAN local area network
- WAN wide area network
- Such networking environments are commonplace in offices, enterprise-wide computer networks, intranets, and the Internet.
- the remote computer 180 may also represent a web server supporting interactive sessions with the computer 110, or in the specific case of location-based applications may be a location server or an application server.
- the network interface may use a modem (not depicted) when a broadband connection is not available or is not used. It will be appreciated that the network connection shown is exemplary and other means of establishing a communications link between the computers may be used.
- the invention is a system for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast cancer.
- the system includes tools for performing at least one step, preferably two or more steps, and in some aspects all steps of a method of the invention, where the tools are operably linked to each other.
- Operable linkage describes a linkage through which components can function with each other to perform their purpose.
- a system of the invention is a system for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast cancer, the system comprising:
- At least one database operatively coupled to a computer-readable medium of the system and containing population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans;
- (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the population information in the treatment database and generate a conclusion with respect to prognosis of the patient with respect to the breast cancer or likelihood that the human subject will benefit from a cancer therapy, wherein the biological markers comprise:
- CT46 antigen and at least one of tumor- infiltrating lymphocytes and NY-ESO-1 antigen.
- markers and traditional factors described herein including but not limited to ER, PR, HER2, age, race or ethnicity (as self-reported by the patient), tumor size, lymph node infiltration, nuclear grade, and so on, may be included in the analysis by the system to refine results obtained with CT46 and lymphocytes and/or NY-ESO-1.
- Exemplary processors include all variety of microprocessors and other processing units used in computing devices. Exemplary computer-readable media are described above. When two or more components of the system involve a processor or a computer-readable medium, the system generally can be created where a single processor and/or computer readable medium is dedicated to a single component of the system; or where two or more functions share a single processor and/or share a single computer readable medium, such that the system contains as few as one processor and/or one computer readable medium. In some variations, it is advantageous to use multiple processors or media, for example, where it is convenient to have components of the system at different locations.
- some components of a system may be located at a testing laboratory dedicated to biological sample or data analysis, whereas other components, including components (optional) for supplying input information or obtaining an output communication, may be located at a medical treatment or counseling facility (e.g., doctor's office, health clinic, HMO, pharmacist, geneticist, hospital) and/or at the home or business of the human subject (patient) for whom the testing service is performed.
- a medical treatment or counseling facility e.g., doctor's office, health clinic, HMO, pharmacist, geneticist, hospital
- an exemplary system includes a database 208 that is operatively coupled to a computer-readable medium of the system and that contains population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans.
- the database contains 208 data relating to the level of the biological markers described herein observed in cancer cells of a population of humans with (or who have been previously diagnosed with and treated for) the cancer and information about the prognosis of the cancer, e.g., obtained by following the progression free survival or recurrence/progression of the cancer over time. Such data provides an indication as to the potential of developing cancer recurrence for a human subject that is identified as one or more of the biological markers described herein.
- the database optionally includes similar data with respect to a level of tumor-infiltrating lymphocytes in a breast tumor tissue sample.
- the database includes additional quantitative personal, medical, or genetic information about the individuals in the database with CT46- positive, CT46-negative cancers (or control individuals free of the cancer).
- the system that uses the database becomes a more powerful statistical tool for comparing an input with respect to a subject and making a prediction as to whether there is potential for breast cancer recurrence or whether the subject would likely benefit from a cancer therapy (e.g., CT46 immunotherapy).
- Such information includes, but is not limited to, information about parameters such as age, sex, ethnicity, race, medical history, weight, diabetes status, blood pressure, family history of the cancer, smoking history, and alcohol use in humans and impact of the at least one parameter on metastatic potential of the cancer.
- race or ethinicity is self-reported by the subject.
- race/ethnicity is scored using genetic markers indicative of racial/ethnic ancestry.
- the system further includes a measurement tool 206 programmed to receive an input 204 from or about the human subject and generate an output that contains information about the presence or absence or measurements of the biological markers from the data.
- the input 204 is not part of the system per se but is illustrated in the schematic Figure 13.
- the input 204 can contain a specimen (e.g., breast cancer tissue sample from the human subject), a specimen component (such as nucleic acid, RNA, or protein isolated from the specimen) or contain data derived from which the presence or absence or measurement of a biological marker in the specimen can be directly read, or analytically determined.
- the input 204 from the human subject contains data that is unannotated or insufficiently annotated with respect to the biological markers, requiring analysis by the measurement tool 206.
- the input can be raw data measurements from experiments designed to evaluate the presence or absence or measurement of the biological markers.
- the measurement tool 206 comprises a tool, preferably stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to receive a data input about a subject and determine information about the presence or absence or measurements of the biological markers from the data.
- the measurement tool 206 contains instructions, preferably executable on a processor of the system, for analyzing the unannotated input data and determining the level of mRNA or protein marker from a cancer in the human subject.
- Exemplary data analysis includes measuring the intensity of a signal, evaluating a percentage of cells that score positive or negative, comparing a signal to a control or doing other relative analysis, etc.
- the input 204 from the human subject comprises a breast cancer tissue sample from the subject
- the measurement tool comprises a tool to measure the presence, absence, or quantity of the biological markers in the breast cancer tissue sample, thereby generating information about the presence, absence, or quantity of the biological markers.
- an exemplary measurement tool 206 includes laboratory equipment for processing and analyzing the sample to determine the presence, absence, or quantity of the biological markers in the breast cancer tissue sample.
- the measurement tool 206 includes: a polymerase chain reaction thermocycler and at least one primer for amplifying CT46 mRNA; and an analysis tool stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to determine the likelihood that the human subject will benefit from CT46 immunotherapy based on the immunoassay and/or PCR data.
- the exemplary system further includes an analysis tool or routine 210 that: is operatively coupled to the database 208 and operatively coupled to the measurement tool 206, is stored on a computer-readable medium of the system, is adapted to be executed on a processor of the system to compare the information about the human subject with the population information in the database 208 and generate a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy or generate a conclusion with respect to the likelihood of breast cancer recurrence following standard-of- care therapy for the breast cancer.
- an analysis tool or routine 210 that: is operatively coupled to the database 208 and operatively coupled to the measurement tool 206, is stored on a computer-readable medium of the system, is adapted to be executed on a processor of the system to compare the information about the human subject with the population information in the database 208 and generate a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy or generate a conclusion with respect to the likelihood of breast cancer recurrence following standard-of- care therapy for
- the analysis tool 210 looks at the presence, absence or quantity of the biological markers identified by the measurement tool 206 for the human subject, and compares this information to the database 208, to determine the likelihood that the subject would benefit from CT46 immunotherapy or the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer.
- the susceptibility can be based on the single parameter (presence, absence or quantity of biomarker in the sample), or can involve a calculation based on other genetic and non-genetic data, as described above, that is collected and included as part of the input 204 from the human subject, and that also is stored in the database 208 with respect to a population of other humans.
- each parameter of interest is weighted to provide a conclusion with respect to the likelihood that the subject would benefit from CT46
- the system as just described further includes a communication tool 212.
- the communication tool is operatively connected to the analysis routine 210 and comprises a routine stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to: generate a communication containing the conclusion; and to transmit the communication to the human subject 200 or the medical practitioner 202, and/or enable the subject or medical practitioner to access the communication.
- the subject and medical practitioner are depicted in the schematic Fig. 14, but are not part of the system per se, though they may be considered users of the system.
- the communication tool 212 provides an interface for communicating to the subject, or to a medical practitioner for the subject (e.g., doctor, nurse, genetic counselor), the conclusion generated by the analysis tool 210 with respect to the likelihood that the subject would benefit from CT46 immunotherapy or the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer.
- a medical practitioner for the subject (e.g., doctor, nurse, genetic counselor)
- the communication is obtained by or delivered to the medical practitioner 202, the medical practitioner will share the communication with the human subject 200 and/or counsel the human subject about the medical significance of the communication.
- the communication is provided in a tangible form, such as a printed report or report stored on a computer readable medium such as a flash drive or optical disk.
- the communication is provided electronically with an output that is visible on a video display or audio output (e.g., speaker).
- the communication is transmitted to the subject or the medical practitioner, e.g., electronically or through the mail.
- the system is designed to permit the subject or medical practitioner to access the communication, e.g., by telephone or computer.
- the system may include software residing on a memory and executed by a processor of a computer used by the human subject or the medical practitioner, with which the subject or practitioner can access the communication, preferably securely, over the internet or other network connection.
- this computer will be located remotely from other components of the system, e.g., at a location of the human subject's or medical practitioner's choosing.
- the system as described further includes components that add a treatment or prophylaxis utility to the system.
- value is added to a determination of likelihood that a subject will benefit from CT46 immunotherapy when a medical practitioner can prescribe or administer CT46 immunotherapy to boost the subject's immune response to the breast cancer cells.
- Exemplary medicinal and surgical intervention protocols include administration of pharmaceutical agents for prophylaxis; and surgery, including in extreme cases surgery to remove a tissue or organ before the cancer within the organ metastasizes.
- Exemplary diagnostic protocols include non-invasive and invasive imaging; monitoring metabolic biomarkers; and biopsy screening.
- the system further includes a medical protocol database 214 operatively connected to a computer-readable medium of the system and containing information correlating the presence, absence or quantity of the biological markers and medical protocols for human subjects with the breast cancer.
- medical protocols include any variety of medicines, lifestyle changes, diagnostic tests, increased frequencies of diagnostic tests, and the like that are designed to achieve effective therapy with minimum side effects.
- Two-hundred breast cancer samples were obtained from the University of Miami/ Sylvester Cancer Center Tumor Bank Core Facility. They consisted of a group of formalin-fixed paraffin- embedded primary breast cancers obtained from Jackson Memorial Hospital and the Sylvester Cancer Center. From breast cancer cases diagnosed between 1979 and 1996, samples were selected for which the following clinicopathologic data were available: age at diagnosis, race, ethnicity, date of diagnosis, tumor grade, stage which included tumor size, lymph node status and presence or absence of metastasis, lymph- vascular invasion, date and location of recurrence, vital status, and whether there was postoperative chemotherapy, radiation therapy or hormone therapy, date and location of first recurrence and vital status. The cases were divided into 4 groups that were Estrogen
- ER Receptor
- ER status was based on initial evaluation of the specimen using the dextran charcoal method.
- Clinical data were obtained from medical records and the Tumor Registry.
- Pathology data were obtained from the pathology reports and reevaluation of slides. Cases were restaged using the American Joint Committee on Cancer/Union for International Cancer Control 7th edition.
- ER and Progesterone receptor (PR) were performed by immunohistochemistry (IHC) at the University of Miami and some cases were reclassified according to the IHC results.
- Clinical samples were de-identified and obtained without individual consent under a protocol approved by the Institutional Review Board of University of Miami.
- Table 1 List of non-X CTs analyzed in this study
- cDNA was prepared with the Omniscript RT Kit using 1 microgram of total RNA. TBP was amplified as an endogenous control gene in all samples. PCR primers optimized for use on FFPE material were designed for all genes tested
- JumpStart REDTaq ReadyMix PCR Reaction Mix (Sigma, St. Louis, MO), was used for PCR amplifications after the addition of 5 pmoles of each primer and one ⁇ of the cDNA solution in 25 ⁇ .
- the PCR conditions were 95°C for 3 minutes followed by 42 cycles at 95°C for 15 seconds and 60°C for 30 seconds and 72°C for 30 seconds, followed by a final 7-min extension.
- Controls without DNA and with cDNA prepared from FFPE testis were carried out for each set of reaction.
- PCR products were loaded onto 2% agarose gels, stained with ethidium bromide and visualized by UV illumination. Bands from testis cDNA were excised from the gels and purified with Wizard® SV Gel and PCR Clean-Up (Promega, Madison, WI) and subjected to Sanger sequencing with the PCR primers to confirm the identity of the amplicon.
- Incubation consisted of the following: ER - FLEX Estrogen Receptor alpha, MxH (1D5) for 30 minutes; PR - FLEX Progesterone Receptor, MxH (636) for 20 minutes; Her-2 for 15 minutes.
- En Vision FLEX+ Mouse (LINKER) was utilized for the ER, PR assays for 15 minutes.
- En Vision FLEX/HRP was used as the chromogen and ranged from 15-30 minutes for the various antibodies.
- Substrate Working Solution (mix) was applied for 10 minutes and slides were counter stained with 1% cupric sulfate to enhance nuclear staining and counterstained with 0.2% fast green for ER and PR, the remainder were counterstained with hematoxylin.
- ER and PR staining were recorded as positive as any positive nuclear reaction in tumor cells irrespective of the percentage of the reactive cells.
- the intensity of positive nuclear reactions was evaluated against the reaction in respective internal controls whenever available, or the external positive control.
- Negative reactions for ER were validated against the positive reaction of the internal control in mammary epithelium whenever possible.
- Her-2 staining was considered positive when there was strong complete membrane staining in > 30% cells.
- Tumor Infiltrating Lymphocytes were evaluated by a pathologist (CM) who was blinded to the clinical characteristics and outcomes of the patients as follows : negative, when no lymphocytic infiltrate was found within the tumor; 1+ sparse to moderately dense collections of lymphocytes in ⁇ 25% of the tumor, 2+ moderately dense collections of lymphocytes in 25 - ⁇ 50% of the tumor, 3+ moderately dense collections of lymphocytes in 50 - ⁇ 75% of the tumor and 4+ dense collections of lymphocytes in at least 75% of the tumor.
- CM pathologist
- CD8 staining paraffin embedded tissue sections (5 ⁇ ) were sequentially deparaffinized and rehydrated.
- Antigen unmasking was performed by boiling the sections in antigen retrieval citrate solution (Biogenex, San Ramon, CA, USA) for one hour in a pressure cooker. Next, sections were blocked and incubated with primary antibody (monoclonal antibody against human CD8, clone C8/144B, dilution 1: 100), followed by incubation with biotinylated secondary antibody and streptavidin-conjugated HRP (Super Sensitive Detection System, Biogenex). Sections were stained with DAB chromogen and counterstained with hematoxylin. CD8+ TILs were visually scored by a pathologist (AMN) who was blinded to the clinical characteristics and outcomes of the patients using the same criteria for TILs as described above.
- APN pathologist
- TCGA breast cancer dataset processing Level 3 RNA-seq data (containing data on gene expression) and associated clinical data for breast invasive carcinoma were downloaded from The Cancer Genome Atlas (TCGA) data portal (www.tcga- data.nci.nih.gov/tcga/dataAccessMatrix.htm) by the end of January 2012. RPKM (Reads per Kilobase of exon per Million mapped reads) in the gene.txt file was used for measurement of gene expression. HER status is based on comparison of mRNA expression levels between tumor and normal breast samples in the dataset. Expression level of ERBB2 in the normal breast (102 samples) excluding the top 5% outlier was calculated as base level cutoff for calling HER2 positivity in cancer patients. Although this is different from
- IHC immunohistochemistry
- Non-X CTs Analysis of the expression of Non-X CTs in a publicly available Oncomine microarray dataset: We have previously shown that the CT-X genes are more frequently expressed in the ER negative and basal-like subsets of breast cancer [13,14]. We further investigated if the non-X CTs are expressed in the same subsets of breast tumors. For this, we analyzed the expression of 104 Non-X CTs, as defined by the CT database
- Bittner_Breast dataset include estrogen receptor, progesterone receptor, ERBB2 status, grade, stage, TNM staging, and other clinicopathological features. Significant correlations of the expression of non-X CTs expression were mined in this dataset. Interestingly, we found 16 Non-X CTs (Table 3) to be significantly highly expressed in the triple negative subset of breast tumors.
- Table 3 Differential expression of selected Non-X CTs in triple negative breast tumors Bittner Breast database from the Oncomine website.
- CT46/HORMAD1 was ranked at the top of the list.
- the non-X CTs are known to present a less restricted pattern of expression in normal tissues [19], which decreases their utility as vaccine targets.
- CT46/ HORMADl was the only non-X CT found to have expression restricted to testis only and not in any normal somatic tissue tested, very similar to the CT-X genes, we decided to analyze further its expression in breast tumors.
- Table 4 Characteristics of the patients included in the study (University of Miami dataset).
- Figure 1 shows Kaplan-Meier recurrence-free survival curves for all patients for clinico-pathological characteristics (age, ethnicity, ER, HER2 and triple negative status, tumor grade, axillary lymph nodes
- RNAs from FFPE tissues prepared from the 200 patients detailed in Table 4 were used for evaluating the expression of NY-ESO-1 and CT46/HORMAD 1 by regular RT-PCR.
- FFPE specimens One hundred seventy-one FFPE specimens (85.5%) presented detectable levels of the endogenous control TBP and were analyzed further for NY-ESO-1 and CT46/HORM AD 1 expression.
- a representative RT-PCR result is shown in Figure 2. The identity of the PCR products was confirmed by Sanger sequencing of the purified amplicon from several samples.
- CT46/HORMAD1 primers also amplified an extra band (174bp, gDNA in Figure 2), which was identified by Sanger sequencing to be the amplification containing the intron between exons 11 and 12 in NM_032132. This was due to the co-purification of genomic DNA with RNA and served as an additional internal PCR control. CT46 pseudogene on chromosome 6 cannot be amplified with these primers because of significant differences between the primer sequences and the pseudogene sequence. NY-ESO-1 expression was detected in 29 patients
- CT46/HORMAD1 expression was significantly correlated with
- a P value of less than 0.05 was considered statistically significant.
- CD8+ cytotoxic T lymphocytes are critical components of tumor-specific cellular adaptive immunity, we decided to investigate their prognostic value in breast cancer combined with the expression of CT46/HORMAD1 and NY-ESO-1.
- the density of intra-tumoral CD8+ T cells was evaluated using the same criteria described in material and methods for the evaluation of immune cell infiltration by hematoxylin and eosin staining.
- CD8+ T cells exhibited membranous staining but cancer or stromal cells were not stained by the antibody.
- Figure 6 shows examples of cases with low ( ⁇ 1+ (i.e., TILs present in less than or equal to 25% of the tumor sample), Figure 6A) and high (>1+ (i.e., TILs present in greater than 25% of the tumor sample), Figure 6B) CD8+ cell density.
- ⁇ 1+ i.e., TILs present in less than or equal to 25% of the tumor sample
- >1+ i.e., TILs present in greater than 25% of the tumor sample
- Figure 6B CD8+ cell density.
- the frequency of CT46/HORMAD1 expression was higher in cases presenting high CD8+ density (24/63, 38%) compared with cases with low CD8+ infiltration (19/103, 18.4%).
- the frequency of NY-ESO-1 expression was not different between cases with low and high CD8+ infiltration levels.
- High levels of intratumoral CD8+ T cells were not significantly associated with patient survival in the total population (not shown) or in the ER negative population ( Figure 7A).
- Our findings are consistent with a hypothesis that the expression of CT46/HORMAD1 leads to a high quality immunological response, which may give rise to better tumor control.
- CT46/HORMAD1 CT46/HORMAD1
- NY-ESO-1 RNAseq data
- Table 7 Table 7.
- T cell markers CD 8, CD27, CD247, IFNG, GZMB, GNLY and TBX21
- CD79 B cell marker
- indices was compared with a 70- gene group. It was found that the four indices -ER, PgR, EGFR and Ki67 -were as effective prognosticators as the gene groupings [22].
- a further prognostic index namely two CT antigens-NY-ESO-1 and CT46/HORMAD1 - which individually and together statistically are independent factors in a multivariate analyses and predict improved disease free survival in breast cancer.
- CT46/HORMAD1 with TILs infiltration highlights a group of lesion for which there is a significantly improved outcome (Fig. 5).
- HEV high endothelial venules
- T-helper 1 adaptive immunity and T-cell cytotoxicity genes related to T-helper 1 adaptive immunity and T-cell cytotoxicity [28] .
- high densities of tumor HEVs correlated with longer metastasis-free, disease-free, and overall survival rates, indicating that they may function as major gateways for lymphocyte infiltration into tumors[28].
- Association of TILs and CT antigen expression was previously described in breast cancer.
- Expression of NY-ESO-1 was evaluated in 1,444 primary breast cancers by immunohistochemistry [29].
- NY-ESO-1 -protein detected in 2.1% invasive breast cancer and the associated in situ components, was more frequently expressed in high grade lesions.
- CT cancer/testis
- CTs have been shown to be capable of eliciting cellular and/or humoral immune responses that make them ideal antigens for cancer tumor immunotherapy [3]. Although they are not unique to cancer cells, but rather shared with germ line cells, which lack MHC-I molecules, and therefore are not subjected to class-I restricted cytotoxic pathways.
- MAGEA3 or NY-ESO-1 To evaluate CT antigens as therapeutic cancer vaccine targets, multiple clinical trials worldwide have been carried out or are underway against either MAGEA3 or NY-ESO-1.
- TCR T-cell receptor
- Ipilimumab which has been shown to improve survival in patients with advanced metastatic melanoma, also enhanced immunity to NY-ESO-1, in a subset of patients with melanoma [33].
- These NY- ESO-1 -seropositive patients had a greater likelihood of experiencing clinical benefit 24 weeks after ipilimumab treatment than NY-ESO-l-seronegative patients.
- CT46/HORMAD1 is a valuable prognostic marker combined with the presence of TILs for clinical use in predicting patient outcomes and to facilitate individualization of therapy for breast cancer patients.
- patients with tumors expressing CT46/HORMAD1 but without detectable lymphocytic infiltration may benefit from therapeutic cancer vaccines based on this CT antigen combined with modulators of immunossupression to increase the effective immune response to this antigen.
- Neoplasia 6 1-6.
- Neoplasia 9 166-180.
- CTdatabase a knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res 37: D816-819.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Described herein are materials, methods and therapeutic regimens associated with the treatment of breast cancer. In some embodiments, the methods and therapeutic regimens described herein comprise measuring one or more biomarkers selected from the group consisting of CT46, NY-ESO-1, tumor infiltrating lymphocytes, estrogen receptor, progesterone receptorand HER2.
Description
METHODS OF PREDICTING OUTCOME AND TREATING BREAST CANCER
BACKGROUND OF THE INVENTION
[0001] During the last decade, many genes encoding cancer-testis (CT) antigens have been discovered using various approaches, including the screening of cDNA expression libraries from human tumors with serum antibody (SEREX) [4,5], database mining to identify tissue- restricted gene products expressed in cancer [6] and transcriptome sequencing methods such as massively parallel signature sequencing (MPSS) [7]. CT antigens are classified into two groups, CT-X and non-X CT antigens. CT-X antigens expression are restricted to human germ line. Genes encoding CT-X antigens are mapped to the X chromosome and are part of multigene families (AJG Simpson 2005 Nature Reviews Cancer 5, 615-625 (1 August 2005)). For example, in testis, CT-X genes are exclusively present in cells of the germ cell lineage, although there is variation in the moment of expression during different stages of sperm development [3,9,10,11]. However, their expression can become activated in various malignancies [1].
[0002] Differences between non-CT-X antigens and CT-X antigens include their chromosomal location and their restricted tissue expression. The genes for non-X CT antigens map to non-X chromosomes and their expression is not restricted to germ cell lineage [AJG Simpson 2005 Nature Reviews Cancer 5, 615-625 (1 August 2005)].
Promoter methylation status and histone deacetylation seem to be the main regulators of their specific expression pattern [8].
[0003] Breast cancer can be considered as a set of different diseases, which present a diverse range of histological patterns and treatment sensitivities. Breast cancers are classified as non-invasive or invasive. Non-invasive breast cancer is an abnormal growth of cells that begins with an increase in the number of breast cells (hyperplasia) to the emergence of atypical breast cells (atypical hyperplasia) followed by carcinoma in situ (non-invasive cancer). When breast cancer cells spread into the surrounding breast tissue from the ducts or lobules, the cancer has become invasive. The migration of breast cancer cells to distant organs gives rise to distant metastasis. In the last decade, the biologic heterogeneity of breast cancers has become evident with the gene expression profiling studies that identified molecular 'intrinsic' subtypes of breast cancer, related to differences in biological behavior [12]. Correct identification of disease extent by further characterization of the molecular
subtypes may allow implementation of individualized treatment, with an impact on mortality rates.
SUMMARY OF THE INVENTION
[0004] There remains a need to identify tumor markers that are prevalent in tumor tissue, absent in normal tissue, and have both prognostic and predictive value to guide selection of appropriate treatment. To date, a few studies have looked at the expression patterns of CT antigens to profile the different types of breast cancers and their association with higher grade lesions was inferred. The lesions studied were restricted in number and were concerned with CT-X antigens, MAGE- A and NY-ESO-1. One drawback to the use of MAGE-A and NY- ESO-1 expression in breast cancer is their low prevalence of expression. Grigoriadis et al reported only a small fraction of ER-negative (ER-) breast cancer expresses these antigens (Grigoriadis A et al 2009 PNAS).
[0005] The present study analyzed expression of other CT antigens, the non-CT-X antigens in invasive breast cancer and correlates the findings with a series of clinicopahtological factors to identify non-CT-X antigens that have both prognostic and predictive value and have the potential to inform treatment. Our result pointed to a highly prevalent and restricted expression of non-CT-X antigen, including CT-46 and a combination of CT-46 and NY- ESO-1, in a subset of ER negative invasive breast tumors and triple negative breast cancer.
[0006] In one aspect, described herein is a therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring tumor infiltrating lymphocytes (TILs) in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), and low levels of tumor infiltrating lymphocytes (TILs), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy. The phrase "low levels of tumor infiltrating lymphocytes (TILs)" as used herein refers to a tumor sample comprising the presence of TILs in less than 25% of the tumor sample. In contrast, "high levels of tumor infiltrating lymphocytes" refers to a tumor sample comprising the presence of TILs in greater than or equal to 25% of the tumor sample.
[0007] In another aspect, described herein is therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46
(CT46+), absence of expression of NY-ESO-1 (NY-ESO-1-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
[0008] In another aspect, described herein is a therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-1+), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy and NY-ESO-1 immunotherapy.
[0009] In any of the therapeutic regimens described herein, the regimen(s) optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample, and for a subject with a breast cancer characterized by expression of CT46 (CT46+), low levels of TIL' s, and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy. In some variations, the ER expression analysis is performed first, to identify ER- cancers in which to further screen for CT46 expression.
[0010] In another aspect, described herein is therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
[0011] In another aspect, described herein is a therapeutic regimen for breast cancer comprising administering an immunotherapy to a human subject with breast cancer that has been laboratory-typed as any of the following: (a) ER-negative and CT46-positive; (b) ER- negative, NY-ESO-1 -negative, and CT46-positive; (c) ER-negative, NY-ESO-1 -positive, and CT46-positive; (d) types (a), (b) or (c) that further are PR-negative; (e) types (a), (b), (c) or (d) that further are HER2-negative; (f) types (a), (b), (c), (d) or (e) that further have low levels of tumor infiltrating lymphocytes; wherein the immunotherapy comprises
administering CT46 antigen immunotherapy optionally in combination with NY-ESO-1 antigen immunotherapy.
[0012] In any of the therapeutic regimens described herein, the mammalian subject is preferably human.
[0013] In some embodiments, the breast cancer tissue sample is from a primary and/or secondary metastatic breast tumor from the subject.
[0014] In another aspect, described herein is a method of evaluating the likelihood that a human subject suffering from triple negative breast cancer would benefit from CT46 immunotherapy, the method comprising (a) measuring a breast tumor tissue sample from the subject for one or more biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs); and (b) diagnosing likelihood that the subject would benefit from CT46 immunotherapy optionally in combination with NY-ESO-1 immunotherapy based on the biomarkers measured according to step (a).
[0015] In some embodiments, the presence of CT46 and the absence of NY-ESO-1 in the sample is indicative that the subject would likely benefit from CT46 immunotherapy. In some embodiments, the presence of CT46, the presence of NY-ESO-1 and the presence of low levels of TILs in the sample is indicative that the subject would likely benefit from a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy. In some
embodiments, the presence of NY-ESO-1 is indicative that the subject would likely benefit from NY-ESO-1 immunotherapy.
[0016] In some embodiments, the methods described herein optionally further comprise diagnosing the subject as unlikely to benefit from treatment with CT46 immunotherapy if CT46 is absent from the tumor tissue sample of the subject. In some embodiments, the methods described herein optionally further comprise diagnosing the subject as unlikely to benefit from treatment with CT46 and NY-ESO-1 immunotherapy if the CT46 and NY-ESO- 1 are absent from the tumor tissue sample of the subject.
[0017] Various methods are also provided that provide personalized medicine to a subject suffering from breast cancer. In one aspect, described herein is method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative. In some embodiments, the method optionally further comprises measuring NY-ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a
combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO- 1+), or as unlikely to benefit from the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is CT-46-negative and NY-ESO-1 - negative.
[0018] In some embodiments, the method optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative and ER-positive. In some variations, ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
[0019] In some embodiments, the method optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 and NY- ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO-1+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46- negative, NY-ESO-1 negative and ER-positive.
[0020] In another aspect, described herein is a method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating lymphocytes (TILs) in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of TILs, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive. In some variations, ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
[0021] In some embodiments, the methods optionally further comprise measuring NY- ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to
benefit from a therapeutic regimen that includes a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-1+), low levels of TIL's, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, or NY-ESO-1 -negative, or ER-positive. In some variations, ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
[0022] In another aspect, described herein is a method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising:
measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), absence of NY-ESO-1 expression (NY-ESO-1-), and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, NY-ESO-1 - positive, or ER-positive. In some variations, ER expression is evaluated first, and CT46 expression is evaluated if the cancer is ER-negative.
[0023] In any of the embodiments described herein, the breast cancer is optionally triple negative breast cancer.
[0024] Expression of the biological markers described above can be measured by methods known in the art and described elsewhere herein. In some embodiments, CT46 and/or NY- ESO-1 expression in the sample is measured by measuring CT46 or NY-ESO-1 mRNA by, for example, an RT-PCR assay. With respect CT46, in some embodiments, the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
AGAACAGGAAAAAAACCCTGCAT (SEQ ID NO: 3) and
CTGGACTTTCTTTAGACCTCATA (SEQ ID NO: 4). With respect to NY-ESO-1, in some embodiments, the RT-PCR assay comprises the use of at least one primer selected from the group consisting of TGAAGGAGTTCACTGTGTCC (SEQ ID NO: 1) and
AGCTGCTGGAGACAGGAGCT (SEQ ID NO: 2). Variations of these primer pairs described herein, also are contemplated for practicing such methods.
[0025] The therapeutic regimens or methods described herein, in some embodiments, comprise the step of measuring tumor infiltrating T-lymphocytes in the sample. Methods of measuring tumor infiltrating T-lymphocytes are known in the art and, in some embodiments, comprises measuring CD8-expressing cells in the breast cancer tissue sample. An exemplary method for measuring of TILs comprises contacting the breast cancer tissue sample with a binding partner that specifically binds a protein expressed by TIL. The presence or absence of TILs in the sample is determined, for example, by immunohistochemical staining of the tissue sample with the binding partner. Exemplary proteins expressed by TILs include, but are not limited to CD3 and CD8. Exemplary binding partners include, but are not limited to, anti-CD3 and anti-CD8 antibodies and combinations thereof.
[0026] In any of the therapeutic regimens or methods described herein, the regimen(s) optionally further comprise measuring progesterone receptor (PR) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample further tests negative for PR expression (PR-).
[0027] The therapeutic regimen(s) or methods described herein optionally further comprise comprising measuring human epidermal growth factor 2 receptor (HER2) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample further tests negative for HER2 expression (HER2-).
[0028] In some embodiments, the therapeutic regimens or methods described herein optionally further comprise prescribing or administering one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-GITR, anti-CTLA4, anti-PDl, anti-OXA4, anti- TGFbetal, PD1 ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF), interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells, cytokines and dexamethasone.
[0029] In some embodiments, the therapeutic regimens or methods described herein optionally further comprise prescribing a standard-of-care therapy to a mammalian subject if the presence of CT46 is absent from the tumor tissue sample.
[0030] Aspects of the invention that are described as methods can alternatively be described as uses or materials, and vice versa.
[0031] Also provided is the use of a measurement of CT46 antigen expression in a breast cancer tissue sample from a human subject for predicting the therapeutic benefit of CT46 immunotherapy in the subject. In some embodiments, the measurement of CT46 antigen expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the CT46 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), tumor infiltrating T lymphocytes, and NY-ESO-1. Such aspects alternatively can be described as uses of reagents (e.g., primers) for making the measurements.
[0032] In another aspect, described herein is the use of a measurement of CT46 antigen expression and NY-ESO-1 expression in a breast cancer tissue sample from a human subject for predicting the therapeutic benefit of a combination of CT46 immunotherapy and NY- ESO-1 immunotherapy in the subject. In some embodiments, the measurement of CT46 antigen expression and NY-ESO-1 expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), and tumor infiltrating T lymphocytes.
[0033] Systems for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast cancer also are provided. In one aspect, the system comprises (a) at least one processor; (b) at least one computer-readable medium; (c) at least one database operatively coupled to a computer-readable medium of the system and containing population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans; (d) a measurement tool that receives an input about the human subject and generates information from the input about the presence or absence or measurements of the biological markers in a breast cancer tissue sample from the human subject; and (e) an analysis tool or routine that: (i) is operatively coupled to the database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the population information in the treatment
database and generate a conclusion with respect to prognosis of the patient with respect to the breast cancer or likelihood that the human subject will benefit from a cancer therapy, wherein the biological markers comprise: CT46 antigen; and at least one of tumor-infiltrating lymphocytes and NY-ESO-1 antigen. In some embodiments, the tumor infiltrating lymphocytes are T-lymphocytes.
[0034] The biological markers for use in the systems described herein include, but are not limited to, a marker selected from the group consisting of human estrogen receptor (ER), human progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2).
[0035] In some embodiments, the analysis tool generates a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy or a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy. In some embodiments, the analysis tool generates a prognosis conclusion with respect to the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer.
[0036] The system described herein optionally further comprises a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to communicate to the subject, or to a medical practitioner for the subject, the conclusion(s) generated by the analysis tool, or enable the subject or medical practitioner to access the conclusion(s).
[0037] In some embodiments, th measurement tool comprises a tool stored on a computer readable medium of the system and adapted to be executed by a processor of the system to receive a data input about a subject and determine information about the presence or absence or measurements of the biological markers from the data.
[0038] The input about the human subject is, in some embodiments, a breast cancer tissue sample from the subject. In some embodiments, the measurement tool comprises a tool to measure the presence, absence, or quantity of the biological markers in the breast cancer tissue sample, thereby generating information about the presence, absence, or quantity of the biological markers. In some embodiments, the measurement tool includes a polymerase chain reaction thermocycler and at least one primer for amplifying CT46 mRNA and/orNY- ESO-1 mRNA. Use of primer pairs is specifically contemplated.
[0039] Isolated oligonucleotides useful to practice the therapeutic regimens, methods and systems described herein are also provided. In one aspect, the invention provides an isolated oligonucleotide with a length of 10-50 nucleotides, wherein the nucleic acid comprises a
sequence selected from the group consisting of (a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), (b) 5' -AGCTGCTGGAGACAGGAGCT-3' (NY-ESO-l-R, SEQ ID NO: 2), (c) 5 ' - AGAACAGGAAAAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), (d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), (e) 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), (f) 5'- TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), and (g) contiguous 10 nucleotide segments of any of SEQ ID NOs: 1-6. In some embodiments, the isolated oligonucleotide comprises at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of any of SEQ ID NOs: 1-6. In some embodiments, the isolated oligonucleotide comprises a nucleotide sequence consisting of any one of SEQ ID NOs: 1-6.
[0040] The oligonucleotides described herein preferably selectively hybridize to human mRNA or human cDNA from human NY-ESO-1, human CT46, or human TBP under PCR annealing conditions in a PCR reaction containing human mRNA and/or human cDNA. In some embodiments, nucleotide sequence of the oligonucleotide is identical to, or fully complementary to, an mRNA from human NY-ESO-1, human CT46, or human TBP.
[0041] In some embodiments, the oligonucleotide further comprises a detectable label.
[0042] Kits and compositions comprising the oligonucleotides described herein are also provided. In one aspect, the invention provides a kit comprising at least two, four or six oligonucleotides described herein, wherein the oligonucleotides are packaged together, wherein the oligonucleotides comprise one or more pairs of oligonucleotides selected from the group consisting of (a) 5 '-TGAAGGAGTTCACTGTGTCC-3' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and 5'- AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides; (b) 5' -AGAACAGGAAAAAAACCCTGCAT-3' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 '-CTGGACTTTCTTTAGACCTCATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides; and (c) 5 ' -ACGAACCACGGCACTGATTTTCA- 3' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides. In some embodiments, the kit comprises at least four oligonucleotides, wherein two of the at least four oligonucleotides comprise: 5'- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous
segment thereof of at least 10 nucleotides; and 5 ' -CTGGACTTTCTTTAGACCTC ATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
[0043] Also provided is a kit comprising at least four oligonucleotides, wherein the oligonucleotides are comprise nucleotide sequence set forth in SEQ ID NOs: 1, 2, 5 and 6.
[0044] The kits described herein optionally further comprises deoxynucleotide triphospates (dNTP's), MgCl2 and a thermostable DNA polymerase. In some embodiments, the kit optionally further comprises one or more reagents for measuring tumor infiltrating lymphocytes in a tissue sample; and/or at least one reagent for measuring at least one receptor selected from estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor 2 (HER2) expressed by a cell.
[0045] Compositions comprising any one or more of the oligonucleotides described herein are also provided. Embodiments where the composition comprises two, four of six oligonucleotides described herein are specifically contemplated.
[0046] In another aspect, described herein is a method of measuring CT46 gene expression in a tissue sample from a human subject, comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human CT46, and measuring amplicons corresponding to human CT46 in the PCR reaction products. In some
embodiments, the method comprises performing the PCR with a primer pair described herein for selectively amplifying CT46 mRNA. In some embodiments, the methods comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO- 1 in the PCR reaction products.
[0047] In some embodiments, the method optionally further comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO-1 mRNA.
[0048] In another aspect, described herein is a method of measuring NY-ESO-1 gene expression in a tissue sample from a human subject, comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products. In some embodiments, the method comprises performing the PCR with a
primer pair described herein for selectively amplifying NY-ESO-1 mRNA. In some embodiments, the method comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human TBP, and measuring amplicons corresponding to human TBP in the PCR reaction products. TBP is a particularly useful control for assays described herein.
[0049] In some embodiments, the methods described herein optionally further comprise performing the PCR with a primer pair described herein for selectively amplifying TBP mRNA.
[0050] In another aspect, amplicons corresponding to human NY-ESO-1 or human CT46 produced according to the PCR methods described herein. In some embodiments, the amplicon(s) is/are at least 20, or at least 30, or at least 40, or at least 50 or at least 60, or at least 70, or at least 80, or at least 90 or at least 100 nucleotides in length.
[0051] The foregoing summary is not intended to define every aspect of the invention, and additional aspects are described in other sections, such as the Detailed Description. The entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document.
[0052] In addition to the foregoing, the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations defined by specific paragraphs above. For example, certain aspects of the invention that are described as a genus, and it should be understood that every member of a genus is, individually, an aspect of the invention. Also, aspects described as a genus or selecting a member of a genus, should be understood to embrace combinations of two or more members of the genus. Although the applicant(s) invented the full scope of the invention described herein, the applicants do not intend to claim subject matter described in the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicant(s) by a Patent Office or other entity or individual, the applicant(s) reserve the right to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory
prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0053] Figure 1 : Kaplan-Meier survival estimates for recurrence free survival according to Lymphovascular invasion (A), Her2 status (B), Tumor size (C), ER status (D), presence of axillary node metastasis (E), age (F), Ethnicity (G), Tumor grade (H), Triple Negative status (I) and Tumor infiltrating lymphocytes (J) in the Miami dataset.
[0054] Figure 2: Detection of CT46/HORMAD 1 and NY-ESO- 1 expression in FFPE tissues. Representative ethidium-bromide stained agarose gel showing PCR amplicons derived from 17 archival biopsy specimens (lanes 3 to 19). (A). Amplicons from
CT46/HORM AD 1 primers and endogenous control TBP, (B) Amplicons from NY-ESO- 1 primers and endogenous control TBP. The position of the 100 bp size marker in each gel is indicated (first lane). In A, black arrows in the right margin indicate the position amplicons derived from genomic DNA (gDNA) or cDNA. In all amplification assays testis cDNA was included as control (second lane).
[0055] Figure 3: IHC staining of normal adult testis using mAb LX119#2 showing intense nuclear staining of intratubular germ cells undergoing meiosis (brown) and no staining of interstitial tissue and intratubular Sertoli cells.
[0056] Figure 4: Kaplan-Meier survival curves presenting the association of
CT46/HORM AD 1 and NY-ESO- 1 expression for disease-free survival (A) NY-ESO- 1 expression alone, (B) CT46/HORMAD1 expression alone, (C) Combination of the expression of both genes.
[0057] Figure 5: Kaplan-Meier survival estimates in the Miami dataset for disease- free survival according to CT46/HORMAD1 and NY-ESO-1 expression and TIL density. (A) CT46/HORMAD1 and (B) NY-ESO-1 expression..
[0058] Figure 6: Representative immunohistochemistry (IHC) staining of CD8 (brown membrane staining, original magnification, x200) demonstrating low (A) and dense intratumoral infiltration (B) of CD8+ TILs.
[0059] Figure 7: Kaplan-Meier survival estimates in the ER- negative population in the Miami dataset for recurrence free survival according to CD8+ infiltration (A) and
CT46/HORM AD 1 expression and CT46/HORMAD 1 expression and CD8+ density (B).
High intratumoral infiltration is represented by TILs >1+ and low intratumoral infiltration is represented by <1+.
[0060] Figure 8: Kaplan-Meier survival estimates for recurrence free survival according to CT46/HORM AD 1 expression (A), TILs infiltration (B) and a combination of both (C) in the TCGA database .
[0061] Figure 9: Kaplan-Meier survival estimates in the Miami dataset for disease-free survival according to CD8+ infiltration. (A) and CT46/HORMAD1 expression and
CT46/HORMAD1 expression and CD8+ density (B). High intratumoral infiltration is represented by TILs >1+ and low intratumoral infiltration is represented by <1+.
[0062] Figure 10: Kaplan-Meier survival estimates for overall survival according to CT46/HORMAD1 expression. (A), TIL infiltration (B) and a combination of both (C) in a subset of 106 patients with long-term clinical follow-up from the TCGA database.
[0063] Figure 11 : Kaplan-Meier survival estimates for disease-free survival according to lymphovascular invasion. (A), Her2 status (B), tumor size (C), ER status (D), presence of axillary node metastasis (E), age (F), tumor stage (G), tumor grade (H), Triple Negative status (I) and tumor infiltrating lymphocytes (J) in the Miami dataset.
[0064] Figure 12 is an exemplary system comprising exemplary computer components.
[0065] Figure 13 is a flow chart depicting system components and operation.
[0066] Figure 14 is another flow chart depicting system components and operation.
DETAILED DESCRIPTION
[0067] The invention is based in part on new analysis of CT antigens in breast cancer and on the discovery that genetic markers whose expression patterns correlate with important characteristics of mammalian breast cancer tumors, i.e., presence of CT46 gene expression, presence of NY-ESO-1 gene expression, correlate with the likelihood of relapse (i.e., distant metastasis or poor prognosis) in the mammalian subject. As described in the Example, it was determined that both NY-ESO-1 (a cancer/testis (CT) gene) and CT46/HORM AD 1 (a non- CT-X gene) are most frequently expressed in ER-negative and high grade tumors. The study also demonstrates that NY-ESO-1 and CT46/HORMAD1 expression in a primary breast cancer tumor sample predict longer disease-free survival in breast cancer patients that exhibit a presence of tumor-infiltrating lymphocytes.
[0068] Grigoriatis et al. reported that while a minority of unselected breast cancers presented CT-X transcripts, a significantly higher expression frequency was detected in estrogen (ER) and progesterone receptor (PR) negative breast cancer cell lines and primary breast carcinomas [13]. A coordinated pattern of CT-X antigen expression was observed, with MAGEA and NY-ESO-1 being the most prevalent antigens. Immunohistochemical staining confirmed the correlation of CT-X antigen expression and ER negativity in breast tumors and demonstrated a trend for their coexpression with basal cell markers [13]. In a further immunohistochemical study, Chen et al. investigated the expression of eight CT-X genes in 454 invasive ductal carcinomas, including 225 triple-negative carcinomas [14], and reported significantly more frequent expression of all eight CT-X in ER-negative cancers, and five of them— MAGEA, CT7, NY-ESO-1, CT10 and CT45, were expressed in 12-24% of ER-negative cancers, versus 2-6% of ER-positive cancers. In comparison, GAGE, SAGEl and NXF2 were only expressed in 3-5% of ER-negative and 0-2% of ER-positive cancers. In that study, we also show that ER-negative cancers were more likely to co-express simultaneously multiple CT genes.
I. Genetic Markers for Use in the Methods Described Herein
[0069] The present disclosure describes the use of various genetic markers to determine appropriate treatment for a subject having a breast cancer cell expression the marker(s). In some embodiments, the genetic marker is human CT46 also known as HORMAD1.
CT46/HORMAD1 is a cancer- testis antigen and is present in two isoforms (Chen et al., Cancer Immunity, 5:9-16, 2005, the disclosure of which is incorporated herein by reference). The human CT46 isoform 1 mRNA sequence is set forth in SEQ ID NO: 7 (Genbank Accession No. NM-032132) and the corresponding acid sequence is set for in SEQ ID NO: 8 (Genbank Accession No. NP_115508.2). The CT46 isoform 2 mRNA sequence is set forth in SEQ ID NO: 9 (Genbank Accession No. NM_001199829) and the corresponding amino acid sequence is set forth in SEQ ID NO: 10 (Genbank Accession No. NP_001186758).
[0070] In some embodiments, the genetic marker is NY-ESO-1. NY-ESO-1 is also a CT antigen and is described in, e.g., U.S. Pat. Nos. 5,804,381; 6,274,145; 6,252,052; and 6,525,177; Chen, et al., Proc. Natl. Acad. Sci. USA, 94: 1914-1918 (1997); and Jungbluth, et al., Int. J. Cane, 92:856-860 (2001), all of which are incorporated by reference. The human NY-ESO-1 mRNA sequence is set forth in SEQ ID NO: 11 (Genbank Accession No.
NM_001327), and the corresponding amino acid sequence is set forth in SEQ ID NO: 12 (Genbank Accession No. NP_001318.1).
[0071] In some embodiments, the methods described herein optionally comprise detecting one or more additional markers such as, for example, estrogen receptor (ER), progesterone receptor (PR) and/or HER2. The human mRNA and amino acid sequences for ER can be found in Genbank Accession Nos. NM_000125 and NP_000116, respectively. The human mRNA and amino acid sequences for PR can be found in Genbank Accession Nos.:
AY382151.1 and AAQ96833. The human mRNA and amino acid sequences for HER2 can be found in Genbank Accession Nos.: Ml 1730.1 and AAA78493, respectively.
[0072] The methods described herein further optionally describe detecting one or more cell surface marker such as, for example, CD3 (e.g., Genbank Accession Nos. NM_000733.3 and NM_000724.1) and/or CD8 (e.g., Genbank Accession Nos.: NM_001145873.1,
NP_001139345.1, NM_001768.6 and NP_001759.3).
II. Oligonucleotides
[0073] In some variations of the invention, expression of CT antigens of interest is evaluated at the nucleic acid level, by measuring CT antigen mRNA in breast cancer tissue.
[0074] In one aspect, described herein are oligonucleotides capable of selectively or specifically hybridizing to human mRNA or human cDNA from human NY-ESO- 1, human CT46, or human TATA Box Binding Protein (TBP; Genbank Accession No. BC109053) under PCR annealing conditions in a PCR reaction containing human mRNA and/or human cDNA and methods of using the oligonucleotides described herein to detect CT46, NY-ESO- 1 or TBD gene expression in a sample from a human subject, for example, a breast cancer tissue sample and including samples that may have been formalin-fixed and/or paraffin- embedded. In some embodiments, the oligonucleotide comprises a nucleic acid sequence having a length of about 10 to about 50 nucleotides, wherein the nucleic acid comprises a sequence selected from the group consisting of 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY- ESO- 1-F, SEQ ID NO: 1), 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO- 1-R, SEQ ID NO: 2), 5 ' - AGAAC AGGAAAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3(, 5'- CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), 5'- TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), and at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of any of SEQ ID NOs: 1-6. In other embodiments, the oligonucleotide comprises a nucleic acid sequence selected from the group consisting of
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.
[0075] In some embodiments, a pair of oligonucleotides (e.g., SEQ ID NOs: 1 and 2; or SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6) amplifies an amplicon comprising a nucleotide sequence having between 10 and 100 nucleotides in length. In some
embodiments, the amplicon comprises a nucleotide sequence having a length ranging from about 10 to about 100 nucleotides in length, or about 10 to about 80 nucleotides in length, or about 20 to about 90 nucleotides in length, or about 20 to about 75 nucleotides in length, or about 10 to about 75 nucleotides in length or about 50 to about 75 nucleotides in length or about 25 to about 75 nucleotides in length. In some embodiments, the amplicon comprises a nucleotide sequence having a length of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 nucleotides in length.
[0076] The oligonucleotide optionally comprises a nucleic acid sequence having a length ranging from about 10 to about 40 nucleotides, or about 10 to about 30 nucleotides in length, or about 10 to about 20 nucleotides in length, or about 15 to about 40 nucleotides in length, or about 15 to about 30 nucleotides in length, or about 15 to about 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a nucleic acid sequence having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, the oligonucleotide comprises a nucleic acid sequence having a length of 20 nucleotides. When sequences longer than those presented in SEQ ID NOs: 1-6 are employed, the additional nucleotides are selected to provide sufficient complementarity to the target mRNA or cDNA sequence to facilitate use as a PCR primer or hybridization probe.
[0077] The oligonucleotide optionally comprises a nucleotide sequence that is identical to, or fully complementary to, an mRNA from human NY-ESO-1, human CT46, or human TBP. The property of selective or specific hybridization refers to the ability of the oligonucleotide to hybridize to a target mRNA or cDNA of interest (e.g., CT46, NY-ESO-1 or TBP) in a mixture of human nucleic acids under laboratory assay annealing conditions without significant cross-hybridization to mRNA or cDNA from other human genes, to permit identification in a hybridization assay or selective amplification in an amplification assay (as described in, for example, "Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987). With respect to CT46, primer sequences are selected to avoid hybridization or amplification of a CT46 pseudogene on human chromosome 6 (SEQ ID NO: 13).
[0078] The "level" or "measure" of a nucleic acid (i.e., CT46 and/or NY-ESO-1 and/or TBP) detected in the methods described herein is the amount of the nucleic acid or its activity as measured by standard laboratory methods described below. The term includes the amount of nucleic acid (e.g., concentration or total amount) detected in a sample, e.g., by northern blot or microarray analysis or quantitative RT-PCR methods, as well as detection of the presence or absence of the nucleic acid. In some variations, the measurement is a relative measurement, e.g., a measurement relative to a control that also is measured in the sample. In one embodiment, the level of a CT46 and/or NY-ESO-1 ucleic acid is measured using an amplification method such as quantitative real-time PCR (Q-PCR). In some variations, TBP mRNA is measured as a control for the quality of the mRNA in the sample. Such
amplification methods will use primers complementary to at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50) bases of (a) the nucleic acid of any of SEQ ID NO: 7 (CT46) or SEQ ID NO: 8 (NY-ESO-1) or SEQ ID NO: 9 (TBP); or (b) the full complement thereof. One of ordinary skill in the art will appreciate that a complementary sequence need not be an exact complement, and that it is within the scope of the present invention to employ oligonucleotide fragments, fragments of
complement sequences, or sequences which are similar (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical) to the oligonucleotide or its complement.
[0079] An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid corresponding to a biomarker described herein in a breast tumor tissue sample (e.g., CT46, NY-ESO-1, TBP (control), estrogen receptor (ER), progesterone receptor (PR) or HER2) comprises contacting the tissue sample with a compound or an agent capable of detecting the polypeptide marker itself or nucleic acid (e.g., mRNA, genomic DNA, or cDNA) corresponding to the biomarker. The detection methods described herein can thus be used to detect and/or measure mRNA or protein, for example, in a tissue sample, or quantitatively measure cDNA as an indirect measurement of mRNA or protein expression level in the tissue. For example, in vitro techniques for detection of mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of a polypeptide corresponding to a biomarker described herein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of genomic DNA include Southern hybridizations. Furthermore, in
vivo techniques for detection of a polypeptide corresponding to a biomarker described herein include introducing into a subject a labeled antibody directed against the polypeptide. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
VIII. Kits
[0080] Also provided herein are kits which contain two or more of the reagents that are useful to carry out the assays and/or therapies of the present invention. In the kit, the two or more reagents are packaged together, usually with instructions for use of the reagents. In some variations, the reagents are packaged together but not in admixture, e.g., each reagent is in its own package, vial, etc. In some variations, reagents that will be used in the same reaction are pre-mixed.
[0081] In some embodiments, the kit comprises at least two of the oligonucleotides described herein, wherein the at least two oligonucleotides are packaged together but not in admixture, and wherein the at least two oligonucleotides comprise (a) 5'- TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and 5' -AGCTGCTGGAGACAGGAGCT-3' (NY- ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides; or (b) 5 ' - AGAAC AGGAAAA AAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -CTGGACTTTCTTTAGACCTC ATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides; or (c) (e) 5 ' - ACGAACC ACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
[0082] Also provided is a kit comprising at least four oligonucleotides described herein, wherein the at least four oligonucleotides are packaged together but not in admixture, and wherein two of the at least four oligonucleotides comprise 5'-
AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 '-CTGGACTTTCTTTAGACCTC ATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
[0083] In some embodiments, the invention is kit comprising at least six oligonucleotides described herein, wherein the at least six oligonucleotides are packaged together but not in admixture, and wherein two of the at least six oligonucleotides comprise 5'-
ACGAACCACGGCACTGATTTTCA-3' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -TGCTGCC AGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
[0084] The kits described herein optionally further comprise deoxynucleotide triphospates (dNTP's), MgCl2 and a thermostable DNA polymerase and/or a reverse transcriptase.
[0085] In some embodiments, the kits further comprise one or more reagents for measuring tumor infiltrating lymphocytes in a tissue sample. The one or more reagents for measuring tumor infiltrating lymphocytes, in some embodiments, comprise an antibody with specificity for CD8 protein.
[0086] In certain variations, the kits comprises reagents useful to determine the receptors expressed by a breast cancer cell. For example, in some embodiments, the kits described herein optionally comprise at least one reagent for measuring at least one receptor selected from estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor 2 (HER2) expressed by a cell.
[0087] In another embodiment, kits are provided which contain the necessary reagents to carry out the assays of the present invention. In one embodiment, the invention provides a compartment kit to receive, in close confinement, one or more containers which comprises a means of detecting a change in the presence or level CT46 nucleic acid optionally in combination with NY-ESO-1 nucleic acid in a tumor tissue sample from a mammalian subject. In some embodiments, the kit comprises a sample collection component with specific tubes and buffers, a nucleic acid extraction component, nucleic acid reverse transcription and/or labeling components (as appropriate), and a component with appropriate primers or customized specific CT46 (and/or NY-ESO-1) hybridization components. One or more containers comprising probes or arrays of probes capable of specifically hybridizing to a CT46 nucleic acid (and/or NY-ESO-1 nucleic acid). In other embodiments, the kit comprises one or more microarrays comprising probes capable of specifically detecting the nucleic acids described herein, and includes the additional components for detection that may include chemical, electrical, and/or optical detection methods. The term "specifically hybridize" as used herein means that the probes in the kit hybridize under assay conditions (e.g., hybridization assay or PCR annealing conditions) to the nucleic acid of interest but not substantially to other nucleic acids (e.g., other human mRNA or cDNA) of non-target
proteins. In other embodiments, the kit comprises one or more microarrays comprising probes capable of specifically detecting any of the nucleic acids described herein.
[0088] In some embodiments, the kit comprises a means for sample collection (e.g., collection tubes and buffers for maintaining nucleic acid integrity in the sample); instructions and materials for the extraction of nucleic acid from the sample; instructions and appropriate buffers, substrates and enzymes for nucleic acid reverse transcription; and instructions and materials (e.g., DNA polymerase, nucleotide substrates, PCR buffer, detection components and PCR primers universal or microRNA specific PCR primers) for nucleic acid
amplification and quantification.
[0089] Nucleic Acid Detection Methods
[0090] In one aspect, described herein is a method of measuring CT46 gene expression in a tissue sample from a human subject, the method comprises performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human CT46, and measuring amplicons corresponding to human CT46 in the PCR reaction products. In some variations, the PCR reaction is an RT-PCR reaction using, as a template, total RNA or mRNA isolated from tumor tissue. RNA from testis tissue is used as a control, in some variations. In some embodiments, the method comprises performing the PCR with a primer pair for selectively amplifying CT46 mRNA, wherein the primer pair comprises 5'- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3) and 5'- CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 3 or SEQ ID NO: 4.
[0091] The method optionally comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products. In some variations, the PCR reaction is an RT-PCR reaction using, as a template, total RNA or mRNA isolated from tumor tissue. RNA from testis tissue is used as a control, in some variations. In some embodiments, the method comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO-1 mRNA, wherein the primer pair
comprises 5 ' -TG AAGGAGTTC ACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), 5'- AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2.
[0092] In another aspect, described herein is a method of measuring NY-ESO-1 gene expression in a tissue sample from a human subject, the method comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an
oligonucleotide according described herein that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products. In some embodiments, the method comprises performing the PCR with a primer pair described herein for selectively amplifying NY-ESO- 1 mRNA, wherein the primer pair comprises 5 '-TGAAGGAGTTC ACTGTGTCC-3' (NY- ESO-l-F, SEQ ID NO: 1), 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2.
[0093] The method optionally comprises simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide described herein that selectively hybridizes to human mRNA or human cDNA from human TBP, and measuring amplicons corresponding to human TBP in the PCR reaction products. In some embodiments, the method comprises performing the PCR with a primer pair described herein for selectively amplifying TBP mRNA, wherein the primer pair comprises 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), 5'- TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a primer pair comprising oligonucleotides that comprise at least 10 (or at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) contiguous nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6. Measuring TBP serves as a useful control in assays described herein.
[0094] The detection methods described herein optionally employ conventional techniques of molecular biology (including recombinant techniques), immunology, microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are described in the literature, such as, "Molecular Cloning: A Laboratory Manual", 2nd edition (Sambrook
et al, 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology", 4th edition (D. M. Weir & C. C. Blackwell, eds., Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian Cells" Miller & M. P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987); and "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994).
[0095] The nucleic acid in the sample may be detected by contacting a sample comprising the nucleic acid with a biochip comprising an attached oligonucleotide probe sufficiently complementary to the nucleic acid and detecting hybridization to the probe above control levels. Hybridization of the specific oligonucleotide probes may be detected using Northern Blot analysis, slot-blot analysis or in situ hybridization analysis and any other methods known in the art, such as those techniques described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratories (New York, 1989). Hybridization means contacting two or more nucleic acids under conditions suitable for base pairing.
Hybridization includes interaction between partially or perfectly complementary nucleic acids. Suitable hybridization conditions are well known to those of skill in the art. In certain applications, it is appreciated that lower stringency conditions may be required. Under these conditions, hybridization may occur even though the sequences of the interacting strands are not perfectly complementary, being mismatched at one or more positions. Conditions may be rendered less stringent by adjusting conditions in accordance with the knowledge in the art, e.g., increasing salt concentration and/or decreasing temperature. Suitable hybridization conditions are those conditions that allow the detection of gene expression from identifiable expression units such as genes. Preferred hybridization conditions are stringent hybridization conditions, such as hybridization at 42°C in a solution (i.e., a hybridization solution) comprising 50% formamide, 1% SDS, 1 M NaCl, 10% dextran sulfate, and washing for 30 minutes at 65°C in a wash solution comprising 1 X SSC and 0.1% SDS. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration, as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guano sine/cyto sine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (2d. Ed.; 1989), pp. 9.47 to 9.51.
[0096] The oligonucleotides may be labeled for detection of hybridization with the RNA extracted from the biological sample, or the RNA may be labeled for detection. Labels include a radioactive label such as 3 H, 14 C, 32 P, 35 S, or 125 I. In addition, the labels may be a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate,
phycoerythrin, rhodamine, or luciferin. The labels may be enzymes such as alkaline phosphatase, β-galactosidase, biotin and avidin or horseradish peroxidase (Bayer et al., Meth. Enz., 184: 138-163 (1990)). The oligonucleotides may be attached to solid substrates such as membranes, beads, filters, glass, silicon, metal, metal-alloy, anopore, polymeric, nylon or plastic. The substrates may be chemically treated with chemical prior to attaching probes to enhance binding or to inhibit nonspecific binding during use. Exemplary treatments include coating glass slides with coating of aminoalkyl silanes or polymeric materials such as acrylamide or proteins. The oligonucleotides may be covalently or non-covalently attached to the substrate.
[0097] CT46 and/or NY-ESO-1 gene expression may be detected by immobilizing RNA from the tumor tissue sample on a solid support such as nylon membranes and hybridizing a labeled probe with the sample. Similarly, the nucleic acid may also be detected by
immobilizing the labeled probe to the solid support and hybridizing the tissue sample comprising the nucleic acid to the probe. Following washing to remove the non-specific hybridization, the label may be detected.
[0098] These assays can be direct hybridization assays or can include the use of multiple probes, as is generally outlined in U.S. Pat. Nos. 5,681,702; 5,597,909; 5,545,730; 5,594,117; 5,591,584; 5,571,670; 5,580,731; 5,571,670; 5,591,584; 5,624,802; 5,635,352; 5,594,118; 5,359,100; 5,124,246; and 5,681,697, each of which is hereby incorporated by reference.
[0099] In general, methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)).
Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS) and RNA- sequencing (RNA-seq).
[00100] Of the techniques listed above, the most sensitive and most flexible quantitative method is reverse transcriptase PCR (RT-PCR), which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.
[00101] The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. Breast cancer samples are especially contemplated. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples. For the analysis of CT antigens, testis tissue may be used as a source of mRNA for a control assay.
[00102] General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andres et al., BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial
manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPure.TM. Complete DNA and RNA Purification Kit (EPICENTRE®., Madison, Wis.), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel- Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
[00103] As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a Gene Amp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.
[00104] Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5' proofreading endonuclease activity. Thus, TaqMan® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
[00105] TaqMan® RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700™ Sequence Detection System™ (Perkin-Elmer- Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular
Biochemicals, Mannheim, Germany).
[00106] 5'-Nuclease assay data are initially expressed as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the
amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct).
[00107] In some embodiments, nucleic acid measurements are based on the normalized expression level of the biomarker of interest. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3- phosphate-dehydrogenase (GAPDH) and β-actin. This normalization allows the comparison of the expression level in one sample, e.g., a patient sample, to another sample, e.g., a non- breast cancer sample, or between samples from different sources. In some variations, the TATA box binding protein (TBP) mRNA is used as a control for the quality and/or quantity of mRNA.
[00108] Alternatively, the expression level can be provided as a relative expression level. To determine a relative expression level of a marker, the level of expression of the marker is determined for 10, 20, 30, 40 or 50 or more samples of normal versus cancer cell isolates, prior to the determination of the expression level for the sample in question. The mean expression level of each of the genes assayed in the larger number of samples is determined and this is used as a baseline expression level for the marker. The expression level of the marker determined for the test sample (absolute level of expression) is then divided by the mean expression value obtained for that marker. This provides a relative expression level.
[00109] A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan® probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996).
[00110] The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles (for example: T. E. Godfrey et al., J. Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J. Pathol. 158: 419-29 [2001]). Briefly, a representative process starts with cutting about 10 μιη thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or
amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR.
[00111] Differential gene expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin- fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.
[00112] In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non- specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(2): 106-149 (1996)).
Microarray analysis can be performed by commercially available equipment, following
manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.
[00113] Serial analysis of gene expression (SAGE) is a method that allows the
simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997).
[00114] The MassARRAY (Sequenom, San Diego, Calif.) technology is an automated, high-throughput method of gene expression analysis using mass spectrometry (MS) for detection. According to this method, following the isolation of RNA, reverse transcription and PCR amplification, the cDNAs are subjected to primer extension. The cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre-loaded with the components needed for MALTI-TOF MS sample preparation. The various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained.
[00115] Gene expression analysis by massively parallel signature sequencing (MPSS), described by Brenner et al., Nature Biotechnology 18:630-634 (2000), is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 μιη diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3xl06 microbeads/cm2). The free ends of the cloned templates on each microbead are analyzed simultaneously, using a fluorescence -based signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library.
[00116] Additionally, differential gene expression can be identified, or confirmed using the RNA-seq technology. RNA-seq technology described by Wang Z et al., Nature Review Genetic, 10(1):57 - 63 (2009), is a sequencing approach that provides a method for mapping and quantifying transcriptomes. The approach is based on high throughput sequencing of cDNA converted from total RNA isolated from a sample.
[00117] Protein Detection Methods
[00118] The detection methods described herein optionally further comprise screening the breast cancer cells for estrogen receptor expression and/or progesterone receptor expression and/or HER2 expression. In some embodiments, the screening comprises contacting the tissue sample with an antibody capable of binding to a polypeptide of interest, the antibody optionally comprising a detectable label, and detecting the presence (or absence) of the polypeptide. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used. The term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
[00119] Proteins from breast cells can be isolated using techniques that are well known to those of skill in the art. The protein isolation methods employed can, for example, be such as those described in Harlow and Lane (Harlow and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[00120] A variety of formats can be employed to determine whether a sample contains a protein that binds to a given antibody. Examples of such formats include, but are not limited to, enzyme immunoassay (EIA), radioimmunoassay (RIA), Western blot analysis and enzyme linked immunoabsorbant assay (ELISA). A skilled artisan can readily adapt known protein/antibody detection methods for use in determining whether breast cells express a marker of the present invention.
[00121] In one format, antibodies, or antibody fragments, can be used in methods such as Western blots or immunofluorescence techniques to detect the expressed proteins. In such uses, it is generally preferable to immobilize either the antibody or proteins on a solid
support. Suitable solid phase supports or carriers include any support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
[00122] One skilled in the art will know many other suitable carriers for binding antibody or antigen, and will be able to adapt such support for use with the present invention. For example, protein isolated from breast cells can be run on a polyacrylamide gel electrophoresis and immobilized onto a solid phase support such as nitrocellulose. The support can then be washed with suitable buffers followed by treatment with the detectably labeled antibody. The solid phase support can then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the solid support can then be detected by
conventional means.
[00123] Methods of detecting the presence (or absence) of estrogen receptor expression and/or progesterone receptor expression and/or HER2 expression in a breast cancer cell or tissue sample comprising breast cancer cells are known in the art, some of which are described, for example, in J. Clin. Oncol, 25: 118 (2007). Exemplary methods include, but are not limited to, fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), silver-enhanced in situ hybridization (SISH), differential (PCR), Western blotting, ELISA, immunohistochemistry (IHC), Northern blotting and RT-PCR.
[00124] In some embodiments, the tissue sample comprises estrogen receptor negative (ER-) breast cancer cells, and/or progesterone receptor negative (PR-) breast cancer cells and/or human epidermal growth factor receptor 2 negative (HER2-) breast cancer cells.
[00125] The term "estrogen receptor positive breast cancer", or "ER-positive breast cancer", as described herein, refers to tumors determined to be positive for estrogen receptor. In the present context, ER levels of greater than or equal to 10 fmol/mg and/or an
immunohistochemical observation of greater than or equal to 10% positive nuclei is considered to be ER-positive. Breast cancer that does not fulfill the criteria of being ER- positive is defined herein as "ER-negative" or "estrogen receptor- negative".
[00126] The term "progesterone receptor positive breast cancer", or "PR-positive breast cancer", as described herein, refers to tumors determined to be positive for progesterone receptor. In the present context, PR levels of greater than or equal to 10 fmol/mg and/or an immunohistochemical observation of greater than or equal to 10% positive nuclei is
considered to be PR-positive. Breast cancer that does not fulfill the criteria of being PR positive is defined herein as "PR-negative" or "progesterone receptor-negative".
[00127] The term "triple negative breast cancer" as used herein refers to a breast cancer that lacks expression of the estrogen receptor, the progesterone receptor and HER2 (i.e., ER", PR" and HER2").
[00128] In some embodiments, the detection methods described herein further comprise measuring tumor infiltrating lymphocytes in the tumor tissue sample. Tumor infiltrating lymphocytes (TILs) (e.g., CD8-expressing (CD8+) lymphocytes) can be measured using methods known in the art, such as immunohistochemistry using anti-CD8 antibodies to detect the presence of CD8+ lymphocytes in the sample.
[00129] As described herein, including the Example, the presence of CT46 in a sample from a human subject is indicative that the subject may benefit from treatment with CT46 immunotherapy. Thus, in some embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells. In some embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), estrogen receptor- negative (ER-) breast cancer cells. In still other embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells and low levels of tumor infiltrating lymphocytes. In still other embodiments, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), estrogen receptor-negative (ER-) breast cancer cells and low levels of tumor infiltrating lymphocytes.
[00130] In another variation, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative breast cancer cells.
[00131] In yet another variation, the detection methods described herein further comprise prescribing or administering CT46 immunotherapy to the human subject if the subject is
determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative, estrogen receptor-negative (ER-) breast cancer cells.
IV. Prognosis and Therapeutic Methods
[00132] Also described herein are methods of evaluating the likelihood that a mammalian subject suffering from a estrogen receptor-negative (ER~) cancer would benefit from CT46 immunotherapy. In some embodiments, the method comprises measuring a breast tumor tissue sample from the subject for one or more biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs); diagnosing likelihood that the subject would benefit from CT46 immunotherapy and/or NY-ESO-1 immunotherapy based on the biomarkers measured according to the measuring step. Table A, below, provides guidance concerning which subjects are expected to benefit from CT46 and/or NY- ESO-1 immunotherapy based on these markers.
[00133] In some embodiments, the tissue sample comprises breast cancer tissue. Various diagnoses and categories of the breast cancer phenotype are within scope of the present invention. In its broadest sense, the invention relates to any breast cancer phenotype. Breast cancer, in certain embodiments, includes any clinical diagnosis of breast cancer, including, but not limited to: invasive ductal, invasive lobular, tubular, or as otherwise invasive or mixed invasive, medullary, DCIS (Ductal Carcinoma In-Situ), LCIS (Lobular Carcinoma In- Situ), or otherwise non-invasive; Invasive breast cancer, including stage 0, stage 1, stage 2 (including stage 2a and stage 2b), stage 3 (including stage 3a, stage 3b and stage 3c) and stage 4 breast cancer.
[00134] Cancerous tissue from a solid tumor can be obtained by using conventional tumor biopsy instruments and procedures. Endoscopic biopsy, excisional biopsy, incisional biopsy, fine needle biopsy, punch biopsy, shave biopsy and skin biopsy are examples of recognized medical procedures that can be used by those of skill in the art to obtain tumor samples for use in practicing the methods described herein. Samples of cancerous lesions may be obtained by resection, bronchoscopy, fine needle aspiration, bronchial brushings, or from sputum, pleural fluid or blood. In some variations, a tumor or tumor biopsy is obtained from a subject and fluid from the tumor is removed, e.g., by centrifugation, and the tumor fluid is used as the sample for measuring CT46 and/or NY-ESO-1.
[00135] In another aspect, described herein are therapeutic regimens for treating breast cancer in a mammalian subject based on marker measurements such as the CT46 and/or NY-
ESO-1 gene expression measurements obtained by a detection method described herein. In some embodiments, the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy. The therapeutic regimen optionally further comprises measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy. In some embodiments, the therapeutic regimen optionally further comprises measuring tumor infiltrating lymphocytes (TIL' s) in the breast cancer tissue sample, and for a subject with a breast cancer characterized by expression of CT46 (CT46+), low levels of TIL' s, and absence of ER expression (ER ), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy. In still other embodiments, the therapeutic regimen optionally further comprises measuring progesterone receptor (PR) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of PR expression (PR-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy
[00136] In another aspect, the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), absence of expression of NY-ESO-1 (NY-ESO-1-), and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
[00137] In another aspect, the therapeutic regimen comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), presence of expression of NY-ESO-1 (NY-ESO-1+), and absence of ER expression (ER-), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy and NY-ESO-1 immunotherapy.
[00138] In yet another aspect, the therapeutic regimen comprises administering an immunotherapy to a human subject with breast cancer that has been laboratory-typed as any
of the following: ER-negative and CT46-positive; ER-negative, NY-ESO-1 negative, and CT46-positive; ER-negative, PR-negative and CT46-positive; and ER-negative, PR-negative, HER2-negative and CT46 positive; wherein the immunotherapy comprises administering CT46 antigen immunotherapy (as described elsewhere herein). In some embodiments, the breast cancer has been laboratory-typed as having low levels of tumor infiltrating T- lymphocytes (e.g., CD8+ lymphocytes).
[00139] Methods of personalizing therapy for a human subject that has been diagnosed with breast cancer are also provided. In one aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46- negative. In some variations, this method is performed on a subject whose breast cancer has been predetermined to be ER-negative, or ER-negative/PR-negative, or ER-negative/HER2- negative, or triple negative (ER7PR7HER2 ).
[00140] In another aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive.
[00141] In yet another aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating lymphocytes (TIL's) in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of TIL's, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive or has high levels of TIL.
[00142] In yet another aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER)
expression in the breast cancer tissue sample; measuring tumor infiltrating T-lymphocytes in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of tumor-infiltrating T- lymphocytes, and absence of ER expression (ER-), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative or ER-positive or has high levels of tumor-infiltrating T-lymphocytes.
[00143] In another aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is
characterized by expression of CT46 (CT46+), absence of NY-ESO-1 expression (NY-ESO- 1-), and absence of ER expression (ER-), or as unlikely to benefit from the CT46
immunotherapy if the breast cancer tissue sample is CT46-negative, NY-ESO- 1-positive, or ER-positive.
[00144] In another aspect, the method comprises measuring CT46 expression in a breast cancer tissue sample from a mammalian subject, measuring NY-ESO-1 in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination therapy comprising CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and expression of NY-ESO-1, or as unlikely to benefit from the combination therapy if the breast cancer tissue sample is CT46-negative and NY-ESO-1 -negative.
[00145] In any of the personalized medicine methods described herein, the breast cancer tissue sample is, in some variations, from a primary breast tumor from the subject. In other variations, the breast cancer tissue sample is from a secondary tumor from the subject.
[00146] Table A provides exemplary patient prognosis and proposed treatment guidelines based on the presence or absence in the breast cancer of the various markers described above, particularly in an ER-negative breast cancer tissue sample from a subject.
CT46+/TIL(CD8)Low Higher risk of breast cancer CT46 immunotherapy is
recurrence recommended
CT46+/NY-ES 0- Γ Higher risk of breast cancer CT46 immunotherapy is
recurrence recommended
CT46+/TIL(CD8)High Good prognosis CT46 immunotherapy is
recommended
CT46+/NY-ESO-l+ Good prognosis CT46 immunotherapy is
recommended
CT46 /TIL(CD8)Higtl Higher risk of breast cancer CT46 immunotherapy is not recurrence recommended
CT46 /TIL(CD8)Low Higher risk of breast cancer CT46 immunotherapy is not recurrence recommended
CT46 /NY-ESO-1" Higher risk of breast cancer CT46 immunotherapy is not recurrence recommended
VI. Immunotherapy
[00148] The invention also involves the use human CT46 and/or human NY-ESO-1 as disclosed herein to "immunize" subjects or as "vaccines". The use of human CT46 and/or human NY-ESO-1 nucleic acid or amino acid sequence in the immunotherapy is specifically contemplated. Human CT46 isoform 1 mRNA sequence is set forth in SEQ ID NO: 7 (Genbank Accession No. NM-032132) and the corresponding acid sequence is set for in SEQ ID NO: 8 (Genbank Accession No. NP_115508.2). The CT46 isoform 2 mRNA sequence is set forth in SEQ ID NO: 9 (Genbank Accession No. NM_001199829) and the corresponding amino acid sequence is set forth in SEQ ID NO: 10 (Genbank Accession No.
NP_001186758). NY-ESO- is described in, e.g., U.S. Pat. Nos. 5,804,381; 6,274,145; 6,252,052; and 6,525,177; Chen, et al., Proc. Natl. Acad. Sci. USA, 94: 1914-1918 (1997); and Jungbluth, et al., Int. J. Cane, 92:856-860 (2001), all of which are incorporated by reference. The human NY-ESO-1 mRNA sequence is set forth in SEQ ID NO: 11 (Genbank Accession No. NM_001327), and the corresponding amino acid sequence is set forth in SEQ ID NO: 12 (Genbank Accession No. NP_001318.1).
[00149] As used herein, "immunization" or "vaccination" means increasing or activating an immune response against an antigen. It does not require elimination or eradication of a condition but rather contemplates the clinically favorable enhancement of an immune response toward an antigen. Generally accepted animal models can be used for testing of immunization against cancer using a cancer-testis nucleic acid such as CT46 or NY-ESO-1. For example, human cancer cells can be introduced into a mouse to create a tumor, and one or more cancer-testis antigen nucleic acids, proteins, or peptides can be delivered by the
methods described herein. The effect on the cancer cells (e.g., reduction of tumor size) or on rate of progression of the cancer can be assessed as a measure of the effectiveness of the cancer-testis nucleic acid immunization. In some variations, the immunotherapy includes, or is combined with, one or more adjuvants and/or cytokines to boost the immune response.
[00150] Methods for immunization have been developed with other antigens (and antigen- encoding nucleic acids), including formulation of a vaccine composition and selection of doses, route of administration and the schedule of administration (e.g. primary and one or more booster doses), and it is contemplated that such methods will be adapted for CT46 or NY-ESO-1. The tests also can be performed in humans, where the end point is to test for the presence of enhanced levels of circulating CTLs against cells bearing the antigen, to test for levels of circulating antibodies against the antigen, to test for the presence of cells expressing the antigen, and so forth.
[00151] As part of the immunization compositions, CT46 and/or NY-ESO-1 and/or an immunogenic fragments thereof is/are administered with one or more adjuvants to induce an immune response or to increase an immune response. An adjuvant as used in the
immunotherapy contect is a substance incorporated into or administered with antigen which potentiates the immune response. Adjuvants may enhance the immunological response by providing a reservoir of antigen (extracellularly or within macrophages), activating macrophages and stimulating specific sets of lymphocytes. Adjuvants of many kinds are well known in the art. Specific examples of adjuvants include monophosphoryl lipid A (MPL, SmithKline Beecham), a congener obtained after purification and acid hydrolysis of
Salmonella minnesota Re 595 lipopolysaccharide; saponins including QS21 (SmithKline Beecham), a pure QA-21 saponin purified from Quillja saponaria extract; DQS21, described in PCT application W096/33739 (SmithKline Beecham), ISCOM (CSL Ltd., Parkville, Victoria, Australia) derived from the bark of the QuiUaia saponaria molina tree; QS-7, QS-17, QS-18, and QS-L1 (So et al., Mol. Cells. 7: 178-186, 1997); incomplete Freund's adjuvant; complete Freund's adjuvant; montanide; alum; CpG oligonucleotides (see e.g. Kreig et al., Nature 374:546-9, 1995; U.S. Pat. No. 6,207,646) and other immuno stimulatory
oligonucleotides; various water-in-oil emulsions prepared from biodegradable oils such as squalene and/or tocopherol; and factors that are taken up by the so-called toll-like receptor on certain immune cells that are found in the outside part of the skin, such as imiquimod (3M, St. Paul, Minn.). Preferably, the antigens are administered mixed with a combination of DQS21/MPL. The ratio of DQS21 to MPL typically will be about 1: 10 to 10: 1, preferably
about 1:5 to 5: 1 and more preferably about 1: 1. Typically for human administration, DQS21 and MPL will be present in a vaccine formulation in the range of about 1 μg to about 100 μg. Other adjuvants are known in the art and can be used in the invention (see, e.g. Goding, Monoclonal Antibodies: Principles and Practice, 2nd Ed., 1986). Methods for the preparation of mixtures or emulsions of polypeptide and adjuvant are well known to those of skill in the art of vaccination.
[00152] Other agents which stimulate the immune response of the subject can also be administered to the subject. For example, other cytokines are also useful in vaccination protocols as a result of their lymphocyte regulatory properties. Many other cytokines useful for such purposes will be known to one of ordinary skill in the art, including interleukin-12 (IL-12), which has been shown to enhance the protective effects of vaccines (see, e.g., Science 268: 1432-1434, 1995), GM-CSF, IL-18 and IL-15 (Klebanoff et al. Proc. Natl. Acad. Sci. USA 2004 101: 1969-74). Thus cytokines can be administered in conjunction with antigens and adjuvants to increase the immune response to the antigens.
[00153] There are a number of immune response potentiating compounds that can be used in vaccination protocols. These include co- stimulatory molecules provided in either protein or nucleic acid form. Such co-stimulatory molecules include the B7-1 and B7-2 (CD80 and CD86 respectively) molecules which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cell. This interaction provides co- stimulation (signal 2) to an antigen/MHC/TCR stimulated (signal 1) T cell, increasing T cell proliferation and effector function. B7 also interacts with CTLA4 (CD 152) on T cells and studies involving CTLA4 and B7 ligands indicate that the B7-CTLA4 interaction can enhance antitumor immunity and CTL proliferation (Zheng P., et al. Proc. Natl. Acad. Sci. USA 95 (11):6284- 6289 (1998)).
[00154] B7 typically is not expressed on tumor cells so they are not efficient antigen presenting cells (APCs) for T cells. Induction of B7 expression would enable the tumor cells to stimulate more efficiently CTL proliferation and effector function. A combination of B7/IL-6/IL-12 co-stimulation has been shown to induce IFN-gamma and a Thl cytokine profile in the T cell population leading to further enhanced T cell activity (Gajewski et al., J. Immunol, 154:5637-5648 (1995)). Tumor cell transfection with B7 has been discussed in relation to in vitro CTL expansion for adoptive transfer immunotherapy by Wang et al., (J. Immunol., 19: 1-8 (1986)). Other delivery mechanisms for the B7 molecule would include nucleic acid (naked DNA) immunization (Kim J., et al. Nat. Biotechnol., 15:7:641-646
(1997) ) and recombinant viruses such as adeno and pox (Wendtner et al., Gene Ther., 4:7:726-735 (1997)). These systems are all amenable to the construction and use of expression cassettes for the coexpression of B7 with other molecules of choice such as the antigens or fragment(s) of antigens discussed herein (including polytopes) or cytokines.
[00155] These delivery systems can be used for induction of the appropriate molecules in vitro and for in vivo vaccination situations. The use of anti-CD28 antibodies to directly stimulate T cells in vitro and in vivo could also be considered. Similarly, the inducible co- stimulatory molecule ICOS which induces T cell responses to foreign antigen could be modulated, for example, by use of anti-ICOS antibodies (Hutloff et al., Nature 397:263-266, 1999).
[00156] Lymphocyte function associated antigen-3 (LFA-3) is expressed on APCs and some tumor cells and interacts with CD2 expressed on T cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Parra et al., J. Immunol., 158:637-642 (1997), Fenton et al., J. Immunother., 21:2:95-108 (1998)).
[00157] Lymphocyte function associated antigen- 1 (LFA-1) is expressed on leukocytes and interacts with ICAM-1 expressed on APCs and some tumor cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Fenton et al., J. Immunother., 21:2:95-108 (1998)). LFA-1 is thus a further example of a costimulatory molecule that could be provided in a vaccination protocol in the various ways discussed above for B7.
[00158] Complete CTL activation and effector function requires Th cell help through the interaction between the Th cell CD40L (CD40 ligand) molecule and the CD40 molecule expressed by DCs (Ridge et al., Nature, 393:474 (1998), Bennett et al., Nature, 393:478
(1998) , Schoenberger et al., Nature, 393:480 (1998)). This mechanism of this costimulatory signal is likely to involve upregulation of B7 and associated IL-6/IL-12 production by the DC (APC). The CD40-CD40L interaction thus complements the signal 1 (antigen/MHC-TCR) and signal 2 (B7-CD28) interactions.
[00159] The use of anti-CD40 antibodies to stimulate DC cells directly, would be expected to enhance a response to tumor antigens which are normally encountered outside of an inflammatory context or are presented by non-professional APCs (tumor cells). In these situations, Th help and B7 co-stimulation signals are not provided.
[00160] GITR, Glucocorticoid-lnduced TNFR-Related (GITR) protein belongs to tumor necrosis factor receptor/tumor necrosis factor superfamily and stimulates both the acquired and innate immunity. It has been reported that in vivo GITR ligation using an agonist anti- GITR mAb, DTA-1, can augment anti-tumor T-cell responses and induce tumor rejection in B16 melanoma and other murine models (Cohen AD, Diab A, Perales MA, Wolchok JD, Rizzuto G, et al. (2006) Agonist Anti-GITR Antibody Enhances Vaccine-Induced CD8+ T- Cell Responses and Tumor Immunity. Cancer Res 66: 4904-4912). The use of anti-GITR antibodies would be expected to augment T-cell response to tumor antigens.
[00161] The invention contemplates delivery of nucleic acids, polypeptides or fragments thereof for vaccination. Delivery of polypeptides and fragments thereof can be accomplished according to standard vaccination protocols known in the art. In another embodiment, the delivery of nucleic acid is accomplished by ex vivo methods, e.g., by removing a cell from a subject, genetically engineering the cell to include a cancer-testis polypeptide-encoding gene (or modifying the cell to express an endogenous gene), and reintroducing the engineered cell into the subject. One example of such a procedure is outlined in U.S. Pat. No. 5,399,346 and in exhibits submitted in the file history of that patent, all of which are publicly available documents. In general, it involves introduction in vitro of a functional copy of a gene into a cell(s) of a subject, and returning the genetically engineered cell(s) to the subject. The functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell(s). Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in PCT application WO95/00654. In vivo nucleic acid delivery using vectors such as viruses and targeted liposomes also is contemplated according to the invention.
[00162] In some variations, a viral vector is used for delivering a nucleic acid encoding a cancer-testis polypeptide to cells of a subject. Exemplary viral vectors include adenoviruses, adeno-associated viruses, poxviruses including vaccinia viruses and attenuated poxviruses, Semliki Forest virus, Venezuelan equine encephalitis virus, retroviruses, Sindbis virus, and Ty virus-like particle. Examples of viruses and virus-like particles which have been used to deliver exogenous nucleic acids include: replication-defective adenoviruses (e.g., Xiang et al., Virology 219:220-227, 1996; Eloit et al., J. Virol. 7:5375-5381, 1997; Chengalvala et al., Vaccine 15:335-339, 1997), a modified retrovirus (Townsend et al., J. Virol. 71:3365-3374, 1997), a nonreplicating retrovirus (Irwin et al., J. Virol. 68:5036-5044, 1994), a replication
defective Semliki Forest virus (Zhao et al, Proc. Natl. Acad. Sci. USA 92:3009-3013, 1995), canarypox virus and highly attenuated vaccinia virus derivative (Paoletti, Proc. Natl. Acad. Sci. USA 93: 11349-11353, 1996), non-replicative vaccinia virus (Moss, Proc. Natl. Acad. Sci. USA 93: 11341-11348, 1996), replicative vaccinia virus (Moss, Dev. Biol. Stand. 82:55- 63, 1994), Venzuelan equine encephalitis virus (Davis et al., J. Virol. 70:3781-3787, 1996), Sindbis virus (Pugachev et al., Virology 212:587-594, 1995), and Ty virus-like particle (Allsopp et al., Eur. J. Immunol 26: 1951-1959, 1996). A preferred virus vector is an adenovirus.
[00163] Preferably the foregoing nucleic acid delivery vectors: (1) contain exogenous genetic material that can be transcribed and translated in a mammalian cell and that can induce an immune response in a host, and (2) contain on a surface a ligand that selectively binds to a receptor on the surface of a target cell, such as a mammalian cell, and thereby gains entry to the target cell.
[00164] Various techniques may be employed for introducing nucleic acids of the invention into cells, depending on whether the nucleic acids are introduced in vitro or in vivo in a host. Such techniques include transfection of nucleic acid-CaP04 precipitates, transfection of nucleic acids associated with DEAE, transfection or infection with the foregoing viruses including the nucleic acid of interest, liposome mediated transfection, and the like. For certain uses, it is preferred to target the nucleic acid to particular cells. In such instances, a vehicle used for delivering a nucleic acid of the invention into a cell (e.g., a retrovirus, or other virus; a liposome) can have a targeting molecule attached thereto. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or incorporated within the nucleic acid delivery vehicle. Preferred antibodies include antibodies which selectively bind a cancer-testis antigen, alone or as a complex with a MHC molecule. Especially preferred are monoclonal antibodies. Where liposomes are employed to deliver the nucleic acids of the invention, proteins which bind to a surface membrane protein associated with endocytosis may be incorporated into the liposome formulation for targeting and/or to facilitate uptake. Such proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like.
Polymeric delivery systems also have been used successfully to deliver nucleic acids into
cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.
[00165] Combination Therapy
[00166] Although therapeutic cancer vaccines have been frequently evaluated as monotherapies, their full potential may be actually enhanced in combination therapies with a range of therapeutic modalities. It is contemplated that a CT46-based and/or NY-ESO-1- based vaccine could be incorporated into the current breast cancer treatment regimens and that its effectiveness could be enhanced by continued booster vaccinations. Preclinical studies and early clinical evidence is emerging that multiple forms of therapy can be used concurrently with cancer vaccines or after cancer vaccine therapy with additive or synergistic effects (Schlom J., J Natl Cancer Inst 2012 104(8):599-613). In some embodiments, the CT46-immunotherapy and/or NY-ESO-1 -immunotherapy described herein is combined with standard of care chemotherapy/radiation and regimens based on the tumor biology and tumor subtypes. It is contemplated that the vaccine, administered in an adjuvant setting, can be used prior to or post surgery, in combination with chemotherapy/radiation or following one to three months after chemotherapy.
[00167] Decision making about treatment with an immunotherapy described herein preferably is individualized, balancing the anticipated benefits with the risks and side effects. Guidance for choice of chemotherapy can be ascertained at the national comprehensive cancer network (NCCN) site, www.nccn.org.
[00168] Standard of care regimens for patients with invasive breast cancer include, but are not limited to, therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel. Alternatively Fluorouracil, eirubicin, and cyclophosphamide or Flourouracil, doxorubicin, and cyclophosphamide.
Docetaxel, doxorubicin, and cyclophosphamide or docetaxel, cyclophosphamide is another choice of combination of chemotherapy.
[00169] In any of the therapeutic regimens described herein, the regimens optionally further comprise prescribing or administering one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-CTLA4, anti-PDl, anti-OXA4, anti-TGFbetal, PD1 ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF), interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells,
cytokines and dexamethasone. In some embodiments, the therapeutic regimens described herein optionally further comprise prescribing or administering a standard-of-care therapy to a mammalian subject if the presence of CT46 is absent from the tumor tissue sample.
Exemplary standard-of-care therapy includes, but is not limited to, chemotherapeutic agents, radiotherapeutic agents, immunotherapeutic agents, inhibitors of cellular proliferation, regulators of programmed cell death, surgery and other agents.
[00170] A. Chemotherapeutic Agents
[00171] In some embodiments, chemotherapy may be administered, as is typical, in regular cycles. Standard of care chemotherapeutic regimens for patients with invasive breast cancer include, but are not limited to, therapies for the treatment of HER2 negative disease such as doxorubin, cyclophosphamide or same regime followed by paclitaxel. Alternatively
Fluorouracil, eirubicin, and cyclophosphamide or Flourouracil, doxorubicin, and
cyclophosphamide. Docetaxel, doxorubicin, and cyclophosphamide or docetaxel,
cyclophosphamide is another choice of combination of chemotherapy.
[00172] A cycle may involve one dose, after which several days or weeks without treatment ensues for normal tissues to recover from the drug's side effects. Doses may be given several days in a row, or every other day for several days, followed by a period of rest. If more than one drug is used, the treatment plan will specify how often and exactly when each drug should be given. The number of cycles a person receives may be determined before treatment starts (based on the type and stage of cancer) or may be flexible, in order to take into account how quickly the tumor is shrinking. Certain serious side effects may also require doctors to adjust chemotherapy plans to allow the patient time to recover.
[00173] Chemotherapeutic agents contemplated for use with the methods described herein, include, but are not limited, to erlotinib (TARCEVA®, Genentech/OSI Pharm.), docetaxel (TAXOTERE®, Sanofi-Aventis), 5-FU (fluorouracil, 5-fluorouracil, CAS No. 51-21-8), gemcitabine (GEMZAR®, Lilly), PD-0325901 (CAS No. 391210-10-9, Pfizer), cisplatin (cis-diamine, dichloroplatinum(II), CAS No. 15663-27-1), carboplatin (CAS No. 41575-94- 4), paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.J.), bevacizumab (AVASTIN®, Genentech), trastuzumab (HERCEPTIN®, Genentech), pertuzumab
(OMNITARG®, rhuMab 2C4, Genentech), temozolomide (4-methyl-5-oxo-2,3,4,6,8- pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carbox- amide, CAS No. 85622-93-1,
TEMODAR®, TEMODAL®, Schering Plough), tamoxifen ((Z)-2-[4-(l,2-diphenylbut-l-
enyl)phenoxy]-N,N-dimethyl-ethanam- ine, NOLVADEX®, ISTUBAL®, VALODEX®), doxorubicin ( ADRIAM YCIN® ) , Akti-1/2, HPPD, rapamycin, and lapatinib (TYKERB®, Glaxo SmithKline); oxaliplatin (ELOXATIN®, Sanofi), bortezomib (VELCADE®,
Millennium Pharm.), sutent (SUNITINIB®, SU11248, Pfizer), letrozole (FEMARA®, Novartis), imatinib mesylate (GLEEVEC®, Novartis), XL-518 (MEK inhibitor, Exelixis, WO 2007/044515), ARRY-886 (MEK inhibitor, AZD6244, Array BioPharma, Astra Zeneca), SF-1126 (PI3K inhibitor, Semafore Pharmaceuticals), BEZ-235 (PI3K inhibitor, Novartis), XL- 147 (PI3K inhibitor, Exelixis), ABT-869 (multi-targeted inhibitor of VEGF and PDGF family receptor tyrosine kinases, Abbott Laboratories and Genentech), ABT-263 (Bcl-2/Bcl-xL inhibitor, Abbott Laboratories and Genentech), PTK787/ZK 222584
(Novartis), fulvestrant (FASLODEX®, AstraZeneca), leucovorin (folinic acid), lonafarnib (SARASAR.TM., SCH 66336, Schering Plough), sorafenib (NEXAVAR®, BAY43-9006, Bayer Labs), gefitinib (IRESSA®, AstraZeneca), irinotecan (CAMPTOSAR®, CPT-11, Pfizer), tipifarnib (ZARNESTRA.TM., Johnson & Johnson), capecitabine (XELODA®, Roche), ABRAXANE.TM. (Cremophor-free), albumin-engineered nanoparticle formulations of paclitaxel (American Pharmaceutical Partners, Schaumberg, 111.), vandetanib (rINN, ZD6474, ZACTIMA®, AstraZeneca), chloranmbucil, AG1478, AG1571 (SU 5271; Sugen), temsirolimus (TORISEL®, Wyeth), pazopanib (GlaxoSmithKline), canfosfamide
(TELCYTA®, Telik), thiotepa and cyclosphosphamide (CYTOXAN®, NEOSAR®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); a
camptothecin (including the synthetic analog topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogs); cryptophycins
(particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogs, KW-2189 and CBI-TMI); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlomaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, calicheamicin gammall, calicheamicin omegall, dynemicin, dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzino statin chromophore and related
chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin,
authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone;
etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine;
pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.);
razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol;
pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin;
vinblastine; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine
(NAVELBINE®); novantrone; teniposide; edatrexate; daunomycin; aminopterin;
ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; and pharmaceutically acceptable salts, acids and derivatives of any of the above.
[00174] B. Radiotherapeutic Agents
[00175] Radiotherapeutic agents may also be used in accordance with the methods described herein. Such factors that cause DNA damage and have been used extensively
include what are commonly known as 7 -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
[00176] C. Other Immunotherapeutic Agents
[00177] Immunotherapeutics may also be employed for the treatment of cancer.
Immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells.
[00178] Generally, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Exemplary tumor markers include, but are not limited to, CT46, NY-ESO-1, estrogen receptor, progesterone receptor, and HER2.
[00179] D. Inhibitors of Cellular Proliferation
[00180] The tumor suppressor oncogenes (p53, pl6 and C-CAM ) function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors are described below.
[00181] Another inhibitor of cellular proliferation is pl6. The major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK'S. One CDK, cyclin- dependent kinase 4 (CDK4), regulates progression through the Gl. The activity of this
enzyme may be to phosphorylate Rb at late Gl. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl61NK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et al., 1995). Since the pl61NK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. pl6 also is known to regulate the function of CDK6.
[00182] pl61NK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, pl9, p21WAFl, and p27KIPl. The pl61NK4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl61NK4 gene are frequent in human tumor cell lines. This evidence suggests that the pl61NK4 gene is a tumor suppressor gene. This interpretation has been challenged, however, by the observation that the frequency of the pl61NK4 gene alterations is much lower in primary uncultured tumors than in cultured cell lines (Caldas et al., 1994; Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et al., 1995).
Restoration of wild-type p61NK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995).
[00183] Other genes that may be employed include Rb, mda-7, APC, DCC, NF- 1 , NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1/PTEN, DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.
[00184] E. Regulators of Programmed Cell Death
[00185] Apoptosis, or programmed cell death, is an essential process in cancer therapy (Kerr et al., 1972). The Bcl-2 family of proteins and ICE-like proteases have been
demonstrated to be important regulators and effectors of apoptosis in other systems. The Bcl- 2 protein, discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved Bcl-2 protein now is recognized to
be a member of a family of related proteins, which can be categorized as death agonists or death antagonists.
[00186] Members of the Bcl-2 that function to promote cell death such as, Bax, Bak, Bik, Bim, Bid, Bad and Harakiri, are contemplated for use in combination with HDACi and a hormonal therapy agent thereof in treating cancer.
[00187] F. Surgery
[00188] It is further contemplated that a surgical procedure may be employed in the present invention. Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electro surgery, and miscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
[00189] Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.
[00190] G. Other Agents
[00191] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, or agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers.
Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-lbeta, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL would potentiate the apoptotic inducing abilities of the present invention by establishment of an
autocrine or paracrine effect on hyperproliferative cells. Increased intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are also contemplated to improve the efficacy of treatment. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin.
Pharmaceutical Composition and Routes of Administration
[00192] According to a further aspect of the invention, compositions containing the nucleic acid molecules, proteins, and binding polypeptides of the invention are provided. The compositions contain any of the foregoing nucleic acid molecules, proteins, and binding polypeptides (as therapeutic agents) in an optional pharmaceutically acceptable carrier. Thus, in a related aspect, the invention provides a method for forming a medicament that involves placing a therapeutically effective amount of the therapeutic agent in the pharmaceutically acceptable carrier to form one or more doses. The effectiveness of treatment or prevention methods of the invention can be determined using standard diagnostic methods described herein.
[00193] When administered, the therapeutic compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines, and optionally other therapeutic agents.
[00194] As used herein, the term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term "physiologically acceptable" refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The characteristics of the carrier will depend on the route of administration. Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art. The term denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other,
in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
[00195] The therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intratumoral, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal. When antibodies are used therapeutically, a preferred route of administration is by pulmonary aerosol. Techniques for preparing aerosol delivery systems containing antibodies are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the antibodies, such as the paratope binding capacity (see, for example, Sciarra and Cutie, "Aerosols," in Remington's Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712). Those of skill in the art can readily determine the various parameters and conditions for producing antibody aerosols without undue experimentation. When using antisense preparations of the invention, slow intravenous administration is preferred.
[00196] The compositions of the invention are administered in effective amounts. An "effective amount" with respect to a CT antigen according to the teachings herein is that amount of a cancer-testis polypeptide composition that alone, or together with further doses, produces the desired response, e.g., increases an immune response to the cancer-testis polypeptide and results in an immune response in the subject that results in tumor shrinkage and/or slowed tumor growth and/or prevention or delay of relapse. In the case of treating a particular disease or condition characterized by expression of one or more cancer-testis polypeptides, such as cancer, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or can be monitored according to diagnostic methods of the invention discussed herein. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.
[00197] Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound
medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
[00198] The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of cancer-testis polypeptide or nucleic acid encoding cancer-testis polypeptide for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining the immune response following administration of the cancer-testis antigen polypeptide composition via a reporter system by measuring downstream effects such as gene expression, or by measuring the physiological effects of the cancer-testis polypeptide composition, such as regression of a tumor or decrease of disease symptoms. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response.
[00199] The doses of cancer-testis polypeptide compositions (e.g., polypeptide, peptide, antibody, cell or nucleic acid) administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
[00200] In general, for treatments for eliciting or increasing an immune response, doses of cancer-testis antigen are formulated and administered in doses between 1 ng and 1 mg, and preferably between 10 ng and 100 μg, according to any standard procedure in the art. Where nucleic acids encoding cancer-testis polypeptides or variants thereof are employed, doses of between 1 ng and 0.1 mg generally will be formulated and administered according to standard procedures. Other protocols for the administration of cancer-testis polypeptide compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration (e.g., intra-tumoral) and the like vary from the foregoing. Administration of cancer-testis polypeptide compositions to mammals other than humans, e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
[00201] Where cancer-testis polypeptides are used for vaccination, modes of administration which effectively deliver the cancer-testis polypeptide and adjuvant, such that an immune response to the polypeptide is increased, can be used. For administration of a cancer-testis polypeptide in adjuvant, preferred methods include intradermal, intravenous, intratumoral, intramuscular and subcutaneous administration. Although these are preferred embodiments, the invention is not limited by the particular modes of administration disclosed herein. Standard references in the art (e.g., Remington's Pharmaceutical Sciences, 18th edition, 1990) provide modes of administration and formulations for delivery of immunogens with adjuvant or in a non-adjuvant carrier.
[00202] The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
[00203] The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
[00204] The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
[00205] Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
[00206] Compositions for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, and lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte
replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other
additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases, and the like.
IX. Diagnostic Systems
[00207] Another aspect of the invention is a system that is capable of receiving one or more inputs about a human subject that has had a breast cancer diagnosis and processing the input(s) to generate a prognosis and/or a treatment protocol individualized for the subject. In some variations, a system of the invention is capable of carrying out a part or all of a method of the invention, or carrying out a variation of a method of the invention as described herein in greater detail. Some systems use materials or kits of the invention. Exemplary systems include, as one or more components, computing systems, environments, and/or
configurations that may be suitable for use with the methods and include, but are not limited to, personal computers, server computers, hand-held or laptop devices, multiprocessor systems, microprocessor-based systems, set top boxes, programmable consumer electronics, network PCs, minicomputers, mainframe computers, distributed computing environments that include any of the above systems or devices, and the like. In some variations, a system of the invention includes one or more machines used for analysis of biological material (e.g., genetic material), as described herein. In some variations, this analysis of the biological material involves a chemical analysis and/or a nucleic acid amplification.
[00208] In some embodiments, the system comprises data acquisition modules for detecting one or more detectable biological marker(s) described herein. The biomolecular probes of such a data acquisition module can include any that are appropriate for detecting the biological marker, e.g., oligonucleotide probes, proteins, aptamers, antibodies, etc.
These can include sample handlers (e.g., fluid handlers), robotics, microfluidic systems, nucleic acid or protein purification modules, arrays (e.g., nucleic acid arrays), detectors, thermocyclers or combinations thereof, e.g., for acquiring samples, diluting or aliquoting samples, purifying marker materials (e.g., nucleic acids or proteins), amplifying marker nucleic acids, detecting amplified marker nucleic acids, and the like.
[00209] For example, automated devices that can be incorporated into the systems herein have been used to assess a variety of biological phenomena, including, e.g., expression levels of genes in response to selected stimuli (Service (1998) "Microchips Arrays Put DNA on the Spot" Science 282:396-399), high throughput DNA genotyping (Zhang et al. (1999)
"Automated and Integrated System for High-Throughput DNA Genotyping Directly from
Blood" Anal. Chem. 71: 1138-1145) and many others. Similarly, integrated systems for performing mixing experiments, DNA amplification, DNA sequencing and the like are also available. See, e.g., Service (1998) "Coming Soon: the Pocket DNA Sequencer" Science 282: 399-401. A variety of automated system components are available, e.g., from Caliper Technologies (Hopkinton, Mass.), which utilize various Zymate systems, which typically include, e.g., robotics and fluid handling modules. Similarly, the common ORCA® robot, which is used in a variety of laboratory systems, e.g., for microtiter tray manipulation, is also commercially available, e.g., from Beckman Coulter, Inc. (Fullerton, Calif.). Similarly, commercially available microfluidic systems that can be used as system components in the present invention include those from Agilent technologies and Caliper Technologies.
Furthermore, the patent and technical literature includes numerous examples of microfluidic systems, including those that can interface directly with microwell plates for automated fluid handling.
[00210] Any of a variety of liquid handling and/or array configurations can be used in the systems described herein. One common format for use in the systems herein is a microtiter plate, in which the array or liquid handler includes a microtiter tray. Such trays are commercially available and can be ordered in a variety of well sizes and numbers of wells per tray, as well as with any of a variety of functionalized surfaces for binding of assay or array components. Common trays include the ubiquitous 96 well plate, with 384 and 1536 well plates also in common use. Samples can be processed in such trays, with all of the processing steps being performed in the trays. Samples can also be processed in microfluidic apparatus, or combinations of microtiter and microfluidic apparatus.
[00211] In addition to liquid phase arrays, components can be stored in or analyzed on solid phase arrays. These arrays fix materials in a spatially accessible pattern (e.g., a grid of rows and columns) onto a solid substrate such as a membrane (e.g., nylon or nitrocellulose), a polymer or ceramic surface, a glass or modified silica surface, a metal surface, or the like. Components can be accessed, e.g., by hybridization, by local rehydration (e.g., using a pipette or other fluid handling element) and fluidic transfer, or by scraping the array or cutting out sites of interest on the array.
[00212] The system can also include detection apparatus that is used to detect genetic information, using any of the approaches described herein. For example, a detector configured to detect real-time PCR products (e.g., a light detector, such as a fluorescence detector) or an array reader can be incorporated into the system. For example, the detector
can be configured to detect a light emission from a hybridization or amplification reaction comprising an allele of interest, wherein the light emission is indicative of the presence or absence of the allele. Optionally, an operable linkage between the detector and a computer that comprises the system instructions noted above is provided, allowing for automatic input of detected allele- specific information to the computer, which can, e.g., store the database information and/or execute the system instructions to compare the detected allele specific information to the look up table.
[00213] Probes that are used to generate information detected by the detector can also be incorporated within the system, along with any other hardware or software for using the probes to detect the amplicon. These can include thermocycler elements (e.g., for performing PCR or LCR amplification of the allele to be detected by the probes), arrays upon which the probes are arrayed and/or hybridized, or the like. The fluid handling elements noted above for processing samples, can be used for moving sample materials (e.g., template nucleic acids and/or proteins to be detected) primers, probes, amplicons, or the like into contact with one another. For example, the system can include a set of marker probes or primers configured to detect at least biological marker described herein (e.g., CT46 and/or NY-ESO-1). The detector module is configured to detect one or more signal outputs from the set of marker probes or primers, or an amplicon produced from the set of marker probes or primers, thereby identifying the presence or absence of the biological marker.
[00214] The sample to be analyzed is optionally part of the system, or can be considered separate from it. The sample optionally includes e.g., genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, proteins, etc., as noted herein. In some embodiments, the sample is derived from a mammal such as a human patient having breast cancer. In some embodiments, the sample is a human breast cancer tissue sample.
[00215] Optionally, system components for interfacing with a user are provided. For example, the systems can include a user viewable display for viewing an output of computer- implemented system instructions, user input devices (e.g., keyboards or pointing devices such as a mouse) for inputting user commands and activating the system, etc. Typically, the system of interest includes a computer, wherein the various computer-implemented system instructions are embodied in computer software, e.g., stored on computer readable media.
[00216] Standard desktop applications such as word processing software (e.g., Microsoft Word™ or Corel WordPerfect™) and database software (e.g., spreadsheet software such as
Microsoft Excel™, Corel Quattro Pro™, or database programs such as Microsoft Access™ or Sequel™, Oracle™, Paradox™) can be adapted to the present invention by inputting a character string corresponding to an allele herein, or an association between an allele and a phenotype. For example, the systems can include software having the appropriate character string information, e.g., used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh or LINUX system) to manipulate strings of characters. Specialized sequence alignment programs such as BLAST can also be
incorporated into the systems of the invention for alignment of nucleic acids or proteins (or corresponding character strings) e.g., for identifying and relating multiple alleles.
[00217] As noted, systems can include a computer with an appropriate database and an allele sequence or correlation of the invention. Software for aligning sequences, as well as data sets entered into the software system comprising any of the sequences herein can be a feature of the invention. The computer can be, e.g., a PC (Intel x86 or Pentium chip- compatible DOS™, OS2™ WINDOWS™, WINDOWS NT™, WINDOWS95™,
WINDOWS98™, WINDOWS2000, WINDOWSME, or LINUX based machine, a
MACINTOSH™, Power PC, or a UNIX based (e.g., SUN™ work station or LINUX based machine) or other commercially common computer which is known to one of skill. Software for entering and aligning or otherwise manipulating sequences is available, e.g., BLASTP and BLASTN, or can easily be constructed by one of skill using a standard programming language such as Visualbasic, Fortran, Basic, Java, or the like.
[00218] With reference to Fig. 12, an exemplary system of the invention, which may be used to implement one or more steps of methods of the invention, includes a computing device in the form of a computer 110. Components shown in dashed outline are not technically part of the computer 110, but are used to illustrate the exemplary embodiment of Fig. 10. Components of computer 110 may include, but are not limited to, a processor 120, a system memory 130, a memory/graphics interface 121, also known as a Northbridge chip, and an 170 interface 122, also known as a Southbridge chip. The system memory 130 and a graphics processor 190 may be coupled to the memory/graphics interface 121. A monitor 191 or other graphic output device may be coupled to the graphics processor 190.
[00219] A series of system busses may couple various system components including a high speed system bus 123 between the processor 120, the memory/graphics interface 121 and the 170 interface 122, a front- side bus 124 between the memory/graphics interface 121 and the system memory 130, and an advanced graphics processing (AGP) bus 125 between the
memory/graphics interface 121 and the graphics processor 190. The system bus 123 may be any of several types of bus structures including, by way of example, and not limitation, such architectures include Industry Standard Architecture (ISA) bus, Micro Channel Architecture (MCA) bus and Enhanced ISA (EISA) bus. As system architectures evolve, other bus architectures and chip sets may be used but often generally follow this pattern. For example, companies such as Intel and AMD support the Intel Hub Architecture (IHA) and the
Hypertransport™ architecture, respectively.
[00220] The computer 110 typically includes a variety of computer-readable media.
Computer-readable media can be any available media that can be accessed by computer 110 and includes both volatile and nonvolatile media, removable and non-removable media. By way of example, and not limitation, computer readable media may comprise computer storage media. Computer storage media includes both volatile and nonvolatile, removable and non-removable media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data. Computer storage media includes, but is not limited to, RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disks (DVD) or other optical disk storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other physical medium which can be used to store the desired information and which can accessed by computer 110.
[00221] The system memory 130 includes computer storage media in the form of volatile and/or nonvolatile memory such as read only memory (ROM) 131 and random access memory (RAM) 132. The system ROM 131 may contain permanent system data 143, such as identifying and manufacturing information. In some embodiments, a basic input/output system (BIOS) may also be stored in system ROM 131. RAM 132 typically contains data and/or program modules that are immediately accessible to and/or presently being operated on by processor 120. By way of example, and not limitation, Fig. 13 illustrates operating system 134, application programs 135, other program modules 136, and program data 137.
[00222] The I/O interface 122 may couple the system bus 123 with a number of other busses 126, 127 and 128 that couple a variety of internal and external devices to the computer 110. A serial peripheral interface (SPI) bus 126 may connect to a basic input/output system (BIOS) memory 133 containing the basic routines that help to transfer information between elements within computer 110, such as during start-up.
[00223] A super input/output chip 160 may be used to connect to a number of 'legacy' peripherals, such as floppy disk 152, keyboard/mouse 162, and printer 196, as examples. The super I/O chip 160 may be connected to the I/O interface 122 with a bus 127, such as a low pin count (LPC) bus, in some embodiments. Various embodiments of the super I/O chip 160 are widely available in the commercial marketplace.
[00224] In one embodiment, bus 128 may be a Peripheral Component Interconnect (PCI) bus, or a variation thereof, may be used to connect higher speed peripherals to the I/O interface 122. A PCI bus may also be known as a Mezzanine bus. Variations of the PCI bus include the Peripheral Component Interconnect-Express (PCI-E) and the Peripheral
Component Interconnect - Extended (PCI-X) busses, the former having a serial interface and the latter being a backward compatible parallel interface. In other embodiments, bus 128 may be an advanced technology attachment (ATA) bus, in the form of a serial ATA bus (SATA) or parallel ATA (PATA).
[00225] The computer 110 may also include other removable/non-removable,
volatile/nonvolatile computer storage media. By way of example only, Fig. 12 illustrates a hard disk drive 140 that reads from or writes to non-removable, nonvolatile magnetic media. The hard disk drive 140 may be a conventional hard disk drive..
[00226] Removable media, such as a universal serial bus (USB) memory 153, firewire (IEEE 1394), or CD/DVD drive 156 may be connected to the PCI bus 128 directly or through an interface 150. A storage media 154 may coupled through interface 150. Other removable/non-removable, volatile/nonvolatile computer storage media that can be used in the exemplary operating environment include, but are not limited to, magnetic tape cassettes, flash memory cards, digital versatile disks, digital video tape, solid state RAM, solid state ROM, and the like.
[00227] The drives and their associated computer storage media discussed above and illustrated in Fig. 12, provide storage of computer readable instructions, data structures, program modules and other data for the computer 110. In Fig. 12, for example, hard disk drive 140 is illustrated as storing operating system 144, application programs 145, other program modules 146, and program data 147. Note that these components can either be the same as or different from operating system 134, application programs 135, other program modules 136, and program data 137. Operating system 144, application programs 145, other program modules 146, and program data 147 are given different numbers here to illustrate
that, at a minimum, they are different copies. A user may enter commands and information into the computer 20 through input devices such as a mouse/keyboard 162 or other input device combination. Other input devices (not shown) may include a microphone, joystick, game pad, satellite dish, scanner, or the like. These and other input devices are often connected to the processor 120 through one of the I/O interface busses, such as the SPI 126, the LPC 127, or the PCI 128, but other busses may be used. In some embodiments, other devices may be coupled to parallel ports, infrared interfaces, game ports, and the like (not depicted), via the super I/O chip 160.
[00228] The computer 110 may operate in a networked environment using logical connections to one or more remote computers, such as a remote computer 180 via a network interface controller (NIC) 170, . The remote computer 180 may be a personal computer, a server, a router, a network PC, a peer device or other common network node, and typically includes many or all of the elements described above relative to the computer 110. The logical connection between the NIC 170 and the remote computer 180 depicted in Fig. 12 may include a local area network (LAN), a wide area network (WAN), or both, but may also include other networks. Such networking environments are commonplace in offices, enterprise-wide computer networks, intranets, and the Internet. The remote computer 180 may also represent a web server supporting interactive sessions with the computer 110, or in the specific case of location-based applications may be a location server or an application server.
[00229] In some embodiments, the network interface may use a modem (not depicted) when a broadband connection is not available or is not used. It will be appreciated that the network connection shown is exemplary and other means of establishing a communications link between the computers may be used.
[00230] In some variations, the invention is a system for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast cancer. For example, in one variation, the system includes tools for performing at least one step, preferably two or more steps, and in some aspects all steps of a method of the invention, where the tools are operably linked to each other. Operable linkage describes a linkage through which components can function with each other to perform their purpose.
[00231] In some variations, a system of the invention is a system for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast
cancer, the system comprising:
(a) at least one processor;
(b) at least one computer-readable medium;
(c) at least one database operatively coupled to a computer-readable medium of the system and containing population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans;
(d) a measurement tool that receives an input about the human subject and generates information from the input about the presence or absence or measurements of the biological markers in a breast cancer tissue sample from the human subject; and
(e) an analysis tool or routine that:
(i) is operatively coupled to the database and the measurement tool,
(ii) is stored on a computer-readable medium of the system,
(iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the population information in the treatment database and generate a conclusion with respect to prognosis of the patient with respect to the breast cancer or likelihood that the human subject will benefit from a cancer therapy, wherein the biological markers comprise:
CT46 antigen; and at least one of tumor- infiltrating lymphocytes and NY-ESO-1 antigen.
[00232] Other markers and traditional factors described herein, including but not limited to ER, PR, HER2, age, race or ethnicity (as self-reported by the patient), tumor size, lymph node infiltration, nuclear grade, and so on, may be included in the analysis by the system to refine results obtained with CT46 and lymphocytes and/or NY-ESO-1.
[00233] Exemplary processors (processing units) include all variety of microprocessors and other processing units used in computing devices. Exemplary computer-readable media are described above. When two or more components of the system involve a processor or a computer-readable medium, the system generally can be created where a single processor and/or computer readable medium is dedicated to a single component of the system; or where two or more functions share a single processor and/or share a single computer readable medium, such that the system contains as few as one processor and/or one computer readable medium. In some variations, it is advantageous to use multiple processors or media, for
example, where it is convenient to have components of the system at different locations. For instance, some components of a system may be located at a testing laboratory dedicated to biological sample or data analysis, whereas other components, including components (optional) for supplying input information or obtaining an output communication, may be located at a medical treatment or counseling facility (e.g., doctor's office, health clinic, HMO, pharmacist, geneticist, hospital) and/or at the home or business of the human subject (patient) for whom the testing service is performed.
[00234] Referring to Figure 13, an exemplary system includes a database 208 that is operatively coupled to a computer-readable medium of the system and that contains population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans.
[00235] In a simple variation, the database contains 208 data relating to the level of the biological markers described herein observed in cancer cells of a population of humans with (or who have been previously diagnosed with and treated for) the cancer and information about the prognosis of the cancer, e.g., obtained by following the progression free survival or recurrence/progression of the cancer over time. Such data provides an indication as to the potential of developing cancer recurrence for a human subject that is identified as one or more of the biological markers described herein. In another variation, the database optionally includes similar data with respect to a level of tumor-infiltrating lymphocytes in a breast tumor tissue sample. In still another variation, the database includes additional quantitative personal, medical, or genetic information about the individuals in the database with CT46- positive, CT46-negative cancers (or control individuals free of the cancer). As the database becomes more populated with patient data, the system that uses the database becomes a more powerful statistical tool for comparing an input with respect to a subject and making a prediction as to whether there is potential for breast cancer recurrence or whether the subject would likely benefit from a cancer therapy (e.g., CT46 immunotherapy). Such information includes, but is not limited to, information about parameters such as age, sex, ethnicity, race, medical history, weight, diabetes status, blood pressure, family history of the cancer, smoking history, and alcohol use in humans and impact of the at least one parameter on metastatic potential of the cancer. In some variations, race or ethinicity is self-reported by the subject. In some variations, race/ethnicity is scored using genetic markers indicative of racial/ethnic ancestry. These more robust databases can be used by an analysis routine 210 to calculate a
combined score with respect to potential for a breast cancer recurrence or the potential to generate a conclusion with respect to the likelihood that the subject will benefit from CT46 immunotherapy.
[00236] In addition to the database 208, the system further includes a measurement tool 206 programmed to receive an input 204 from or about the human subject and generate an output that contains information about the presence or absence or measurements of the biological markers from the data. (The input 204 is not part of the system per se but is illustrated in the schematic Figure 13.) Thus, the input 204 can contain a specimen (e.g., breast cancer tissue sample from the human subject), a specimen component (such as nucleic acid, RNA, or protein isolated from the specimen) or contain data derived from which the presence or absence or measurement of a biological marker in the specimen can be directly read, or analytically determined.
[00237] In another variation, the input 204 from the human subject contains data that is unannotated or insufficiently annotated with respect to the biological markers, requiring analysis by the measurement tool 206. For example, the input can be raw data measurements from experiments designed to evaluate the presence or absence or measurement of the biological markers. In such variations, the measurement tool 206 comprises a tool, preferably stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to receive a data input about a subject and determine information about the presence or absence or measurements of the biological markers from the data. For example, the measurement tool 206 contains instructions, preferably executable on a processor of the system, for analyzing the unannotated input data and determining the level of mRNA or protein marker from a cancer in the human subject. Exemplary data analysis includes measuring the intensity of a signal, evaluating a percentage of cells that score positive or negative, comparing a signal to a control or doing other relative analysis, etc.
[00238] In yet another variation, the input 204 from the human subject comprises a breast cancer tissue sample from the subject, and wherein the measurement tool comprises a tool to measure the presence, absence, or quantity of the biological markers in the breast cancer tissue sample, thereby generating information about the presence, absence, or quantity of the biological markers. In this variation, an exemplary measurement tool 206 includes laboratory equipment for processing and analyzing the sample to determine the presence, absence, or quantity of the biological markers in the breast cancer tissue sample.
[00239] In some variations the measurement tool 206 includes: a polymerase chain reaction thermocycler and at least one primer for amplifying CT46 mRNA; and an analysis tool stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to determine the likelihood that the human subject will benefit from CT46 immunotherapy based on the immunoassay and/or PCR data.
[00240] The exemplary system further includes an analysis tool or routine 210 that: is operatively coupled to the database 208 and operatively coupled to the measurement tool 206, is stored on a computer-readable medium of the system, is adapted to be executed on a processor of the system to compare the information about the human subject with the population information in the database 208 and generate a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy or generate a conclusion with respect to the likelihood of breast cancer recurrence following standard-of- care therapy for the breast cancer. In simple terms, the analysis tool 210 looks at the presence, absence or quantity of the biological markers identified by the measurement tool 206 for the human subject, and compares this information to the database 208, to determine the likelihood that the subject would benefit from CT46 immunotherapy or the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer. The susceptibility can be based on the single parameter (presence, absence or quantity of biomarker in the sample), or can involve a calculation based on other genetic and non-genetic data, as described above, that is collected and included as part of the input 204 from the human subject, and that also is stored in the database 208 with respect to a population of other humans. Generally speaking, each parameter of interest is weighted to provide a conclusion with respect to the likelihood that the subject would benefit from CT46
immunotherapy or the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer. Such a conclusion is expressed in any statistically useful form, for example, as an odds ratio or a probability that the subject would likely benefit from CT46 immunotherapy.
[00241] In some variations, the system as just described further includes a communication tool 212. For example, the communication tool is operatively connected to the analysis routine 210 and comprises a routine stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to: generate a communication containing the conclusion; and to transmit the communication to the human subject 200 or the medical practitioner 202, and/or enable the subject or medical practitioner to access the
communication. (The subject and medical practitioner are depicted in the schematic Fig. 14, but are not part of the system per se, though they may be considered users of the system. The communication tool 212 provides an interface for communicating to the subject, or to a medical practitioner for the subject (e.g., doctor, nurse, genetic counselor), the conclusion generated by the analysis tool 210 with respect to the likelihood that the subject would benefit from CT46 immunotherapy or the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer. Usually, if the communication is obtained by or delivered to the medical practitioner 202, the medical practitioner will share the communication with the human subject 200 and/or counsel the human subject about the medical significance of the communication. In some variations, the communication is provided in a tangible form, such as a printed report or report stored on a computer readable medium such as a flash drive or optical disk. In some variations, the communication is provided electronically with an output that is visible on a video display or audio output (e.g., speaker). In some variations, the communication is transmitted to the subject or the medical practitioner, e.g., electronically or through the mail. In some variations, the system is designed to permit the subject or medical practitioner to access the communication, e.g., by telephone or computer. For instance, the system may include software residing on a memory and executed by a processor of a computer used by the human subject or the medical practitioner, with which the subject or practitioner can access the communication, preferably securely, over the internet or other network connection. In some variations of the system, this computer will be located remotely from other components of the system, e.g., at a location of the human subject's or medical practitioner's choosing.
[00242] In some variations, the system as described (including embodiments with or without the communication tool) further includes components that add a treatment or prophylaxis utility to the system. For instance, value is added to a determination of likelihood that a subject will benefit from CT46 immunotherapy when a medical practitioner can prescribe or administer CT46 immunotherapy to boost the subject's immune response to the breast cancer cells. Exemplary medicinal and surgical intervention protocols include administration of pharmaceutical agents for prophylaxis; and surgery, including in extreme cases surgery to remove a tissue or organ before the cancer within the organ metastasizes. Exemplary diagnostic protocols include non-invasive and invasive imaging; monitoring metabolic biomarkers; and biopsy screening.
[00243] For example, in some variations, the system further includes a medical protocol database 214 operatively connected to a computer-readable medium of the system and containing information correlating the presence, absence or quantity of the biological markers and medical protocols for human subjects with the breast cancer. Such medical protocols include any variety of medicines, lifestyle changes, diagnostic tests, increased frequencies of diagnostic tests, and the like that are designed to achieve effective therapy with minimum side effects.
[00244] All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
[00245] The invention may be more readily understood by reference to the following example, which are given to illustrate the invention and not in any way to limit its scope.
EXAMPLE
[00246] Material and Methods
[00247] Patient and samples: Two-hundred breast cancer samples were obtained from the University of Miami/ Sylvester Cancer Center Tumor Bank Core Facility. They consisted of a group of formalin-fixed paraffin- embedded primary breast cancers obtained from Jackson Memorial Hospital and the Sylvester Cancer Center. From breast cancer cases diagnosed between 1979 and 1996, samples were selected for which the following clinicopathologic data were available: age at diagnosis, race, ethnicity, date of diagnosis, tumor grade, stage which included tumor size, lymph node status and presence or absence of metastasis, lymph- vascular invasion, date and location of recurrence, vital status, and whether there was postoperative chemotherapy, radiation therapy or hormone therapy, date and location of first recurrence and vital status. The cases were divided into 4 groups that were Estrogen
Receptor (ER) positive and ER negative with and without recurrence with at least 5 years of follow up or death occurring within 5 years. ER status was based on initial evaluation of the specimen using the dextran charcoal method. Clinical data were obtained from medical records and the Tumor Registry. Pathology data were obtained from the pathology reports and reevaluation of slides. Cases were restaged using the American Joint Committee on Cancer/Union for International Cancer Control 7th edition. ER and Progesterone receptor (PR) were performed by immunohistochemistry (IHC) at the University of Miami and some
cases were reclassified according to the IHC results. Clinical samples were de-identified and obtained without individual consent under a protocol approved by the Institutional Review Board of University of Miami.
[00248] Data Mining: The Oncomine cancer microarray database[ 17] (ONCOMINE 4.4.3, Q2 2012 Data Release, http://www.oncomine.com) was used to analyze the expression of non-X CTs in one breast cancer dataset (Bittner_Breast). Non-X CTs were selected from the CT database (www.cta.lncc.br) and are listed in Table 1.
Table 1: List of non-X CTs analyzed in this study
Chromosomal
Gene family Family member CT identifier
localization
BAGE BAGE5 21pl l . l CT2.5
SYCP1 SYCP1 Ipl3-pl2 CT8
BRDT BRDT lp22.1 CT9
HAGE DDX43 6ql2-ql3 CT13
ADAM2 ADAM2 8pl l .2 CT15
LIPI LIPI 21ql l .2 CT17
TSP50 TSP50 3pl4-pl2 CT20
CTAGE-1 CTAGE5 14ql3.3 CT21.3
SPA17 SPA 17 l lq24.2 CT22
ACRBP ACRBP 12pl3.31 CT23
MMA1 DSCR8 21q22.2 CT25.1a
BORIS CTCFL 20ql3.31 CT27
AF15ql4 CASC5 15ql4 CT29
J ARID IB J ARID IB lq32.1 CT31
LDHC LDHC I lpl5.5-pl5.3 CT32
MORC MORC1 3ql3 CT33
SGY-1 DKKL1 19ql3.33 CT34
SPOl l SPOl l 20ql3.2-ql3.3 CT35
TPX1 CRISP2 6p21-qter CT36
TDRD1 TDRD1 10q25.3 CT41.1
TEX 15 TEX 15 8pl2 CT42
TPTE TPTE 21pl l CT44
HORMAD1 HORMAD1 lq21.2 CT46
SLC06A1 SLC06A1 5q21.1 CT48
TAG TAG 5pl5.2 CT49
LEMD1 LEMD1 lq32.1 CT50
HSPB9 HSPB9 17q21.2 CT51
CCDC110 CCDC110 4q35.1 CT52
ZNF165 ZNF165 6p21.3 CT53
SPACA3 SPACA3 17ql l .2 CT54
THEG THEG 19pter-pl3 CT56
ACTL8 ACTL8 Ip36.2-p35 CT57
NLRP4 NLRP4 19ql3.42 CT58
COX6B2 COX6B2 19ql3.42 CT59
LOC348120 LOC348120 15ql l .2 CT60
CCDC33 CCDC33 15q24.1 CT61
LOCI 96993 LOCI 96993 15q23 CT62
LOC647107 LOC647107 3q26.1 CT64
TULP2 TULP2 19ql3.1 CT65
CT66 ! CT66/AA884595 i 7q l 1.22 CT66
PRSS54 PRSS54 16q21 CT67
RBM46 RBM46 4q32.1 CT68
CT69 \ CT69/BC040308 i 6q23.2 CT69
CT70 ! ( Ί 70/1518 18097 i Unknown CT70
SPINLW1 SPINLW1 20ql2-ql3.2 CT71
TSSK6 TSSK6 19pl3.11 CT72
ADAM29 ADAM29 4q34 CT73
CCDC36 CCDC36 3p21.31 CT74
LOC440934 LOC440934 2q36.1 CT75
SYCE1 SYCE1 10q26.3 CT76
TSPY1 TSPY1E Ypl l .2
TSGA10 TSGA10 2q l 1.2 CT79
PIWIL2 PIWIL2 8p21.3 CT80
ARMC3 ARMC3 Kip 12. 1 CT81
AKAP3 AKAP3 12pl3.3 CT82
PBK PBK 8p21.2 CT84
C21orf99 C21orf 9 21ql l .2 CT85
OIP5 OIP5 15ql5.1 CT86
CEP290 CEP290 12q21.32 CT87
CABYR CABYR 18ql l .2 CT88
SPAG9 SPAG9 17q21.33 CT89
MPHOSPH1 MPHOSPH1 10q23.31 CT90
ROPN1 ROPN1 3q21.1 CT91
CALR3 CALR3 19pl3.11 CT93
PRM PRM1 16pl3.2 CT94.1
PRM PRM2 16pl3.2 CT94.2
CAGE1 CAGE1 6p24.3 CT95
CT96 TTK 6ql3-q21 CT96
LY6K LY6K 8q24.3 CT97
IMP-3 IMP-3 7pll CT98
DPPA2 DPPA2 3ql3.13 CT100I A AO 100/MLA A-
KIAA0100 17qll.2 CT 101
22
DCAF12 DCAF12 9pl3.3 CT102
SEMG1 SEMG1 20ql2-ql3.2 CT103
POTE POTEH 22qll.l CT 104.7
GOLGAGL2 FA \ GOLGAGL2 FA i 15qll.2 CT105
NUF2/CDCA1 CDCA1 lq23.3 CT106
OTOA OTOA 16pl2.2 CT108
CCDC62 CCDC62 12q24.31 CT 109
GPATCH2 GPATCH2 lq41 CT110
CEP55 CEP55 10q23.33 CT 111
TEX 14 TEX 14 17q22 CT113
CTNNA2 CTNNA2 2pl2-pll.l CT114
LYPD6B LOCI 30576 2q23.1-q23.2 CT116
ANKRD45 ANKRD45 lq25.1 CT117
ELOVL4 ELOVL4 6ql4 CT118
IGSF11 IGSF11 3ql3.32 CT119
TMEFF TMEFF2 2q32.3 CT 120.2
SPEF2 SPEF2 5pl3.2 CT 122
GPAT2 GPAT2 2qll.l CT 123
TMEM108 TMEM108 3q21 CT 124
NOL4 NOL4 18ql2 CT 125
PTPN20A PTPN20A 10qll.22 CT 126
SPAG4 SPAG4 20qll.21 CT 127
MAEL MAEL lq24.1 CT128
RQCD1 ROCD1 2q35 CT 129
PRAME PRAME 22q 11.22 CT130
TEX101 TEX101 19ql3.31 CT131
SPATA19 SPATA19 llq25 CT132
ODF1 ODF1 8q22.3 CT133
ODF2 ODF2 9q34.11 CT134
ODF3 ODF3 l lpl5.5 CT135
ODF4 ODF4 17pl3.1 CT136
ATAD2 ATAD2 8q24.13 CT137
[00249] The correlation between Non-X CT expression levels and the clinical variables of interest was examined. The data obtained is processed by the Oncomine team prior to export. Expression values are log-transformed and median-centered per array. Differential expression is identified by a permutation test with shrinkage to reduce the noise in the data, and false discovery rates (Q-value = NP/R, where P is the p-value, N is the total number of genes analyzed, and R is the sorted rank of P) are calculated to correct for multiple testing[18].
[00250] Reverse trans cription-PCR Total RNA was extracted from formalin-fixed paraffin embedded (FFPE) tumor tissues and testis as a control. Briefly, RNA was extracted using RecoverAll Total Nucleic Acid Isolation kit (Applied Biosystems). Tissue samples were deparaffinized in xylene, subjected to protease digestion, and RNA was captured on a glass-fiber filter and eluted using 60 microliters of nuclease-free water after ethanol wash. Total RNA concentrations were measured with a NanoDrop 8000 spectrophotometer
(NanoDrop, Wilmington, DE). cDNA was prepared with the Omniscript RT Kit using 1 microgram of total RNA. TBP was amplified as an endogenous control gene in all samples. PCR primers optimized for use on FFPE material were designed for all genes tested
(HORMAD1, NY-ESO-1 and TBP). Primer sequences and expected amplicon sizes are listed in Table 2.
Supplementary Table 2: Primer sequences used in this study
[00251] JumpStart REDTaq ReadyMix PCR Reaction Mix (Sigma, St. Louis, MO), was used for PCR amplifications after the addition of 5 pmoles of each primer and one μΐ of the cDNA solution in 25 μΐ. The PCR conditions were 95°C for 3 minutes followed by 42 cycles at 95°C for 15 seconds and 60°C for 30 seconds and 72°C for 30 seconds, followed by a final
7-min extension. Controls without DNA and with cDNA prepared from FFPE testis were carried out for each set of reaction. PCR products were loaded onto 2% agarose gels, stained with ethidium bromide and visualized by UV illumination. Bands from testis cDNA were excised from the gels and purified with Wizard® SV Gel and PCR Clean-Up (Promega, Madison, WI) and subjected to Sanger sequencing with the PCR primers to confirm the identity of the amplicon.
[00252] Immunohistochemistry For ER, PR and Her-2, slides were deparaffinized for 30 minutes either in a 58°C oven or overnight in a 37 oC oven, dewaxed in xylene and rehydrated in decreasing ethanol grades. The remainder steps were carried out utilizing the Autostainer Plus, Dako and all washes and dilutions were made with TBS (Dako, S1968). Slides were rinsed between steps with Buffer solution. Peroxidase activity was blocked with En Vision Flex Peroxidase-Blocking Reagent for 5 minutes. Primary antibodies were from Dako. Incubation consisted of the following: ER - FLEX Estrogen Receptor alpha, MxH (1D5) for 30 minutes; PR - FLEX Progesterone Receptor, MxH (636) for 20 minutes; Her-2 for 15 minutes. En Vision FLEX+ Mouse (LINKER) was utilized for the ER, PR assays for 15 minutes. En Vision FLEX/HRP was used as the chromogen and ranged from 15-30 minutes for the various antibodies. Substrate Working Solution (mix) was applied for 10 minutes and slides were counter stained with 1% cupric sulfate to enhance nuclear staining and counterstained with 0.2% fast green for ER and PR, the remainder were counterstained with hematoxylin. ER and PR staining were recorded as positive as any positive nuclear reaction in tumor cells irrespective of the percentage of the reactive cells. The intensity of positive nuclear reactions was evaluated against the reaction in respective internal controls whenever available, or the external positive control. Negative reactions for ER were validated against the positive reaction of the internal control in mammary epithelium whenever possible. Her-2 staining was considered positive when there was strong complete membrane staining in > 30% cells. Tumor Infiltrating Lymphocytes (TILs) were evaluated by a pathologist (CM) who was blinded to the clinical characteristics and outcomes of the patients as follows : negative, when no lymphocytic infiltrate was found within the tumor; 1+ sparse to moderately dense collections of lymphocytes in < 25% of the tumor, 2+ moderately dense collections of lymphocytes in 25 - <50% of the tumor, 3+ moderately dense collections of lymphocytes in 50 - <75% of the tumor and 4+ dense collections of lymphocytes in at least 75% of the tumor. For CD8 staining, paraffin embedded tissue sections (5 μιη) were sequentially deparaffinized and rehydrated. Antigen unmasking was performed by boiling
the sections in antigen retrieval citrate solution (Biogenex, San Ramon, CA, USA) for one hour in a pressure cooker. Next, sections were blocked and incubated with primary antibody (monoclonal antibody against human CD8, clone C8/144B, dilution 1: 100), followed by incubation with biotinylated secondary antibody and streptavidin-conjugated HRP (Super Sensitive Detection System, Biogenex). Sections were stained with DAB chromogen and counterstained with hematoxylin. CD8+ TILs were visually scored by a pathologist (AMN) who was blinded to the clinical characteristics and outcomes of the patients using the same criteria for TILs as described above.
[00253] TCGA breast cancer dataset processing: Level 3 RNA-seq data (containing data on gene expression) and associated clinical data for breast invasive carcinoma were downloaded from The Cancer Genome Atlas (TCGA) data portal (www.tcga- data.nci.nih.gov/tcga/dataAccessMatrix.htm) by the end of January 2012. RPKM (Reads per Kilobase of exon per Million mapped reads) in the gene.txt file was used for measurement of gene expression. HER status is based on comparison of mRNA expression levels between tumor and normal breast samples in the dataset. Expression level of ERBB2 in the normal breast (102 samples) excluding the top 5% outlier was calculated as base level cutoff for calling HER2 positivity in cancer patients. Although this is different from
immunohistochemistry (IHC) -based clinicopathological classification, it assumes a good correlation between gene expression and protein production. However, it could also reduce the bias from heterogeneity of cell populations within a tumor sample at IHC staining.
Clustering of gene expression was done using the Cluster and Tree View software
(www.rana.lbl.gov/EisenSoftware.htm).
[00254] Statistical analysis: Statistical analyses were performed with SPSS version 20.0 (SPSS Inc, Chicago, IL, USA) and with GraphPad Prism 5. Differences between specific patient groups regarding clinicopathological characteristics such as lymph node metastasis, ER, progesterone receptor (PR), and expression of CTs to were determined using Fisher's exact test. Differences among survival curves were assessed using Logrank statistical analyses. The Kaplan-Meier method was used to determine survival curves, and the log-rank test was used to investigate differences between life tables. The survival intervals were measured from the time of surgery to the survival endpoint that was relapse free survival (RFS), which included both local and distant recurrence. Multivariate analysis was based on a time-dependent Cox regression model. A two-tailed P < 0.05 was considered statistically significant.
Results:
[00255] Analysis of the expression of Non-X CTs in a publicly available Oncomine microarray dataset: We have previously shown that the CT-X genes are more frequently expressed in the ER negative and basal-like subsets of breast cancer [13,14]. We further investigated if the non-X CTs are expressed in the same subsets of breast tumors. For this, we analyzed the expression of 104 Non-X CTs, as defined by the CT database
(http://www.cta.lncc.br) (See Table 1 above) in 336 breast carcinoma samples that were analyzed on Affymetrix U133 Plus 2.0 microarray (Bittner_Breast dataset,
www.oncomine.com, Compendia biosciences, Ann Arbor, MI, USA). Data in the
Bittner_Breast dataset include estrogen receptor, progesterone receptor, ERBB2 status, grade, stage, TNM staging, and other clinicopathological features. Significant correlations of the expression of non-X CTs expression were mined in this dataset. Interestingly, we found 16 Non-X CTs (Table 3) to be significantly highly expressed in the triple negative subset of breast tumors.
Table 3: Differential expression of selected Non-X CTs in triple negative breast tumors Bittner Breast database from the Oncomine website.
Over- Expression
Ct Chromosomal P- Fold
Gene name expression in somatic identifier location value change
gene rank tissues (n)*
HORMAD1 CT46 1Q21.2 141 9.95E-08 8.4 0
ROPN1 CT91 3Q21.1 93 3.08E-08 6.044 14
LY6K CT97 8Q24.3 545 1.18E-05 2.945 9
TTK CT96 6Q13-Q21 25 5.25E-10 2.836 13
LEMD1 CT50 1Q32.1 453 6.42E-06 2.834 1
ELOVL4 CT118 6Q14 869 5.16E-05 2.656 7
NUF2 CT106 1Q23.3 215 3.87E-07 2.425 14
CEP55 CT111 10Q23.33 265 9.30E-07 2.196 7
PBK CT84 8P21.2 584 1.44E-05 2.093 NA
ANKRD45 CT117 1Q25.1 1811 7.77E-04 2.049 11
NOL4 CT125 18Q12 1286 2.13E-04 1.843 NA
OIP5 CT86 15Q15.1 676 2.28E-05 1.838 3
TMEFF1 CT120 9Q31 39 2.39E-09 1.809 9
ATAD2 CT137 8Q24.13 279 7.30E-06 1.595 19
CASC5 CT29 15Q14 724 2.78E-05 1.565 5
RQCD1 CT129 2Q35 698 2.51E-05 1.448 19
Number of normal somatic tissues presenting expression (collected from the CT database website (www.cta.lncc.br))
[00256] When these genes were ranked according to the significance of the overexpression in triple negative tumors compared to samples with other biomarker status, and then
according to the fold-changes, we found that CT46/HORMAD1 was ranked at the top of the list. The non-X CTs are known to present a less restricted pattern of expression in normal tissues [19], which decreases their utility as vaccine targets. For this reason, we next examined the expression of the 16 genes found overexpressed in triple negative samples in a panel of 22 normal tissues, including testis (http://www.cta.lncc.br). As CT46/ HORMADl was the only non-X CT found to have expression restricted to testis only and not in any normal somatic tissue tested, very similar to the CT-X genes, we decided to analyze further its expression in breast tumors.
[00257] Clinical Characteristics of Breast Cancer Patients: To investigate CT46/ HORMADl frequency of expression and its impact in the outcome of breast cancer patients, we investigated a dataset comprising 200 breast cancer patients, which included ER positive and negative patients that had either recurrence or were recurrence free. Table 2 summarizes the clinical characteristics of the 200 patients in the cohort. Median age was 54 years old (range: 27-87 years), approximately 70% of the patients in the study cohort were treated before 1987, 54% were node positive, as detailed in Table 4.
Table 4: Characteristics of the patients included in the study (University of Miami dataset).
3 27 24 13 10 74
Present 29 7 32 13 81
LVI
Absent 18 33 21 47 119
Radiation Given 5 11 15 12 43 therapy Not given 40 27 32 43 142
Chemotherapy 27 17 23 15 82
Adjuvant Endocrine
5 3 10 22 40 systemic therapy
therapy Endocrine
0 0 0 4 4 +chemotherapy
Treatment Before 1987 33 25 45 36 139 year After 1987 14 15 8 24 61
ER: Estrogen receptor
LVI: Lymph-vascular invasion
[00258] Median follow-up in this cohort was 111 months. Figure 1 shows Kaplan-Meier recurrence-free survival curves for all patients for clinico-pathological characteristics (age, ethnicity, ER, HER2 and triple negative status, tumor grade, axillary lymph nodes
involvement, tumor grade, tumor size and the presence of tumor infiltrating lymphocytes).
Univariate analysis of the potential prognostic impact of clinical and histopathological parameters identified the presence of lymphovascular infiltration, tumor size, HER2 and ER status and the involvement of axillary lymph nodes as significantly associated criteria with shorter relapse free survival (RFS).
[00259] Detection of CT46/HORMAD1 and NY-ESO-1 expression in Breast Tissues by RT- PCR: RNAs from FFPE tissues prepared from the 200 patients detailed in Table 4 were used for evaluating the expression of NY-ESO-1 and CT46/HORMAD 1 by regular RT-PCR. One hundred seventy-one FFPE specimens (85.5%) presented detectable levels of the endogenous control TBP and were analyzed further for NY-ESO-1 and CT46/HORM AD 1 expression. A representative RT-PCR result is shown in Figure 2. The identity of the PCR products was confirmed by Sanger sequencing of the purified amplicon from several samples.
CT46/HORMAD1 primers also amplified an extra band (174bp, gDNA in Figure 2), which was identified by Sanger sequencing to be the amplification containing the intron between exons 11 and 12 in NM_032132. This was due to the co-purification of genomic DNA with
RNA and served as an additional internal PCR control. CT46 pseudogene on chromosome 6 cannot be amplified with these primers because of significant differences between the primer sequences and the pseudogene sequence. NY-ESO-1 expression was detected in 29 patients
(16.9%), 20 of which are ER negative patients. CT46/HORMAD1 expression was detected in 43 patients (25.2%), 27 of which were ER negative. A monoclonal antibody that was
generated using full length CT46/HORMAD1 was available and produced intense and
specific staining of spermatocytes undergoing meiosis (Figure 3). However, staining of
tumor samples, even when high levels of CT46/HORMAD1 could be demonstrated by RT- PCR was not achieved (data not shown). We speculate that CT46/HORMAD1 may not
accumulate in cancer cells, which could explain these results.
[00260] Association between the expression of CT46/HORMAD1 and NY-ESO-1 and
cUnico-pathological characteristics and their prognostic relevance: Comparisons of
CT46/HORMAD1 and NY-ESO-1 expression with known clinico-pathological factors
showed that the expression of both CTs correlated with negative estrogen and progesterone receptor and triple negative status (Table 5).
Table 5. Relationship between expression of NY-ESO-1 and CT46/HORMAD1 expression
and clinicopathological characteristics of breast cancer.
Clinico-pathological NY-ESO- NY-ESO-1 CT46 CT46
1 positive negative positive negative
Parameter V V
(N=29) (N=142) (N=43) (N=130)
Age (years) 0.0630 0.7236
< 50, no. (%) 17 (23.6) 55 (76.4) 19 (26.4) 53(73.6)
> 50, no. (%) 12 (12.1) 87 (87.9) 24 (23.8) 77 (76.2)
Ethnicity 0.0283 0.3497
Non-black, no. (%) 14 (12.2) 101(87.8) 26 (22.4) 90 (77.6)
Black, no. (%) 15 (26.8) 41 (73.2) 17 (30.4) 40 (71.6)
Estrogen receptor
0.0071 0.0039 status
Positive, no. (%) 9 (9.7) 84 (90.3) 15 (15.6) 81 (84.4)
Negative, no. (%) 20 (26.0) 57 (74.0) 27 (35.5) 49 (64.5)
Progesterone receptor
0.0137 0.0041 status
Positive, no. (%) 9 (10.1) 80 (89.9) 14 (15.4) 77 (84.6)
Negative, no. (%) 20 (25.0) 60 (75.0) 28 (35.0) 52 (65.0)
HER2 status 0.3728 1.0000
Positive, no. (%) 2 (8.7) 21(91.3) 5 (22.7) 17 (77.3)
Negative, no. (%) 26 (18.3) 116 (81.7) 37 (25.5) 108 (74.5)
Triple negative status 0.0056 0.0007
Positive, no. (%) 16 (30.2) 37 (69.8) 23 (42.6) 31(57.4)
Negative, no. (%) 9 (10.5) 77 (89.5) 14 (15.9) 74 (84.1)
Tumor size (cm) 0.6585 0.1715
< 2, no. (%) 7 (14.6) 41(85.4) 16 (32.7) 33(67.3)
> 2, no. (%) 22 (17.9) 101(82.1) 27 (21.8) 97 (78.2)
Positive Lymph Nodes 0.3037 0.1095
0, no. (%) 9 (13.0) 60 (87.0) 22 (31.4) 48 (68.6)
> l, no. (%) 20 (19.6) 82 (80.4) 21(20.4) 82 (79.6)
Nuclear Grade 0.4033 0.0036 l or 2, no. (%) 16 (15.0) 91 (85.0) 18 (16.8) 89 (83.2)
3, no. (%) 13 (20.3) 51 (79.7) 25 (37.9) 41(62.1)
LVI 1.0000 0.2865
Present, no. (%) 12 (16.4) 61 (83.6) 15 (20.3) 59 (79.7)
Absent, no. (%) 17 (17 3) 81 (82.7) 28 (28.3) 71 (71.7)
Tumor infiltrating
. . 0.8223 0.0147 lymphocytes
< l+, no. (%) 20 (17.2) 96 (82.8) 22 (18.6) 96 (81.4)
> l+, no. (%) 9 (19.2) 38 (80.8) 18 (38.3) 29 (61.7)
Recurrence 0.0148 0.0002
Positive, no. (%) 9 (10.1) 80 (89.8) 12 (13.0) 80 (87.0)
Negative, no. (%) 20 (24.4) 62 (75.6) 31 (38.3) 50 (62.7)
Two-tailed P values obtained from Fisher's exact test by GraphPad Prism 5. Significant P- values (<0.05) are given in bold.
LVI: Lymph-vascular invasion
[00261] In addition, CT46/HORMAD1 expression was significantly correlated with
nuclear grade and with the presence of tumor infiltrating lymphocytes. Moreover, expression of both CTs was found to be associated with improved RFS (P= 0.0148 and 0.0002, for NY- ESO-1 and CT46/HORM AD 1 , respectively). The correlation of CT46/HORMAD1 and NY- ESO-1 expression and RFS was determined using Kaplan-Meier analysis. CT46/HORMAD1 expression was found associated with significantly longer RFS (log-rank P = 0.0003), as well
as lower hazard ratio (HR = 0.4374, 95% CI = 0.2791-0.6854) in this subset of breast cancers, compared to tumors that lack CT46/HORMAD1 expression. Presence of NY-ESO-1 expression was also found associated with significantly longer RFS (log-rank P = 0.0221), as well as lower hazard ratio (HR = 0.5416, 95% CI = 0.3203-0.9159) (Figures 4A and 4B). Subsequently, multivariate Cox regression models using tumor grade, ER/PR, HER2 status, nodal status, tumor size and lymphocytic infiltration in 156 patients for which data from all these parameters were available, revealed that CT46/HORMAD1 and NY-ESO-1 expression remained as independent prognostic factors (RFS, P = 0.003, HR = 0.327, 95% CI: 0.155- 0.688 and P < 0.001, HR = 0.283, 95% CI: 0.141-0.565, respectively for NY-ESO-1 and CT46/HORM AD 1 ) (Table 6).
Table 6: Multivariate model of breast cancer event free survival
Recurrence Hazard ratio (95%
Variable
events (n) CI)
CT46/HORMAD1 expression
Negative 73 1.00 < 0.001 Positive 10 0.283 (0.144-0.578)
NY-ESO-1 expression
Negative 1.00 0.003 Positive 0.327 (0.155-0.688)
Tumor size
< 2 cm 17 1.00 0.030 > 2 cm 66 1.941 (1.065-3.538) Axillary node
Negative 22 1.00 0.003 Positive 61 2.279 (1.334-3.893) Lymphovascular invasion
Negative 31 1.00 0.002 Positive 52 2.143 (1.330-3.453) Tumor grade
1 and 2 52 1.00 0.045 3 31 1.679 (1.013-2.783)
Estrogen receptor status
Positive 85 42 1.00 0.001
Negative 71 41 4.364 (1.836-10.373)
Her2 status
Negative 134 66 1.00 0.171
Positive 22 17 1.485 (0.843-2.617)
Tumor infiltrating
lymphocytes
<1+ 109 62 1.00 0.060
>1+ 47 21 0.580 (0.329-1.023)
HR, hazard ratio; 95 % CI, 95 % confidence interval; P, P value
A P value of less than 0.05 was considered statistically significant.
[00262] We next evaluated the effects of simultaneous expression of both CT antigens in the outcome of breast cancer patients in this cohort. The simultaneous expression of NY- ESO-1 and CT46/HORM AD 1 could be detected in nine patients. In this subset, eight patients had ER negative tumors, while one was ER positive, but none of them recurred. Figure 4C shows the survival curves of patients categorized by the expression of both antigens. While there is no significant difference in survival of the patients with no detectable expression of the CTs when compared with the patients that express NY-ESO-1 alone, the patients expressing both antigens or CT46/HORMAD1 alone present longer recurrence free survival (P=0.0022 and P=0.019, respectively) .
[00263] Correlation between expression of NY-ESO-1 and CT46/HORMAD1, TIL density and patient survival: To verify if the association of NY-ESO-1 and CT46/HORMAD1 expression with improved outcome was related to the immune response to these antigens, we studied the correlation between TILs infiltration levels and survival by Kaplan-Meier survival analysis in patients stratified by the expression of these antigens. We observed that higher levels of immune cell infiltration, analyzed by hematoxylin and eosin staining (>1+; i.e., TILs present in more than 25% of the tumor sample), and concurrent expression of
CT46/HORMAD1 helped to identify samples with favorable prognostic features (P= 0.0026, obtained by log rank test for trend) (Figure 5A). However, the curves for CT46/HORMAD1 negative patients are collapsed, indicating that the presence of high levels of immune cell infiltration does not influence the outcome in this set of patients. Although the same analysis
undertaken with NY-ESO-1 expression does not show significance (P= 0.1154, obtained by log rank test for trend), there was a clear tendency of patients expressing NY-ESO-1 with high TILs infiltration to present better outcome (Figure 5B).
[00264] Because tumor-infiltrating CD8+ cytotoxic T lymphocytes are critical components of tumor- specific cellular adaptive immunity, we decided to investigate their prognostic value in breast cancer combined with the expression of CT46/HORMAD1 and NY-ESO-1. The density of intra-tumoral CD8+ T cells was evaluated using the same criteria described in material and methods for the evaluation of immune cell infiltration by hematoxylin and eosin staining. CD8+ T cells exhibited membranous staining but cancer or stromal cells were not stained by the antibody. Figure 6 shows examples of cases with low (<1+ (i.e., TILs present in less than or equal to 25% of the tumor sample), Figure 6A) and high (>1+ (i.e., TILs present in greater than 25% of the tumor sample), Figure 6B) CD8+ cell density. Of the 170 cases analyzed for infiltration of CD8+ T cells, 65 (38%) were considered to present high levels of infiltration (>1+). High density CD8+ intratumoral infiltration was significantly correlated with high grade (P<0.0001), ER negative tumors (P=0.0104) and with
CT46/HORM AD 1 expression (P=0.0063). The frequency of CT46/HORMAD1 expression was higher in cases presenting high CD8+ density (24/63, 38%) compared with cases with low CD8+ infiltration (19/103, 18.4%). The frequency of NY-ESO-1 expression was not different between cases with low and high CD8+ infiltration levels. High levels of intratumoral CD8+ T cells were not significantly associated with patient survival in the total population (not shown) or in the ER negative population (Figure 7A). However, the combination of CD8+ counts and positive CT46/HORMAD1 expression in the ER negative population identified a subset of patients presenting longer RFS (P= 0.0015 obtained by log rank test for trend) (Figure 7B). Our findings are consistent with a hypothesis that the expression of CT46/HORMAD1 leads to a high quality immunological response, which may give rise to better tumor control.
[00265] Association of CT46/HORMAD1 expression with cUnico-pathological parameters and patient survival in the TCGA dataset: To consolidate our findings in the dataset from the University of Miami, we analyzed the TCGA RNASeq breast cancer dataset, which is the largest publicly available breast cancer dataset
(www.cancergenome.nih.gov/cancersselected/breastductal). Initially, we validated the expression of CT46/HORMAD1 and NY-ESO-1 and their association with clinic- pathological characteristics by using RNAseq data in TCGA's 753 breast cancer samples.
CT46/HORM AD 1 expression was found in 136 patients (18%), while NY-ESO-1 expression was found in 49 (6.5%). We found that expression of both CT46/HORM AD 1 and NY-ESO- 1 is significantly enriched in estrogen and progesterone negative receptor and triple negative groups in the TCGA breast cancer dataset, as shown in Table 7.
Table 7. Relationship between NY-ESO-1 and CT46/HORMAD1 expression, hormone
receptor and HER2 status of breast cancer in the TCGA dataset
Clinico-pathological NY-ESO- NY-ESO-1 CT46 CT46
„ 1 positive negative P positive negative
(N=42) (N=626) (N=124) (N=544)
Estrogen receptor
<0.0001
status (n=722)
Positive, no. (%) 17 (3.0) 540 (97.0) 37 (6.7) 520 (93.3)
Negative, no. (%) 28 (17.0) 137 (83.0) 94 (57.0) 71 (43.0)
Progesterone receptor
<0.0001 <0.0001 status (n=714)
Positive, no. (%) 14 (3.0) 465 (97.0) 27 (5.6) 452 (94.4)
Negative, no. (%) 29 (12.3) 206 (87.7) 101 (43.0) 134 (57.0)
HER2 status (n=753) 1 000 0.0009
Positive, no. (%) 10 (6.5) 144 (93.5) 14 (9.1) 140 (90.9)
Negative, no. (%) 39 (6.5) 560 (93.5) 122 (20.4) 477 (79.6)
Triple negative status
<0.0001 <0.0001 (n=714)
Positive, no. (%) 23 (18) 105 (82) 84 (70.0) 36 (30)
Negative, no. (%) 19 (3 5) 521 (96.5) 44 (7.4) 550 (92.6)
Two-tailed P values obtained from Fisher's exact test by GraphPad Prism 5. Significant P- values (<0.05) are given in bold.
[00266] Long-term clinical follow-up (> 60 months) was available for 105 patients in the
TCGA dataset. These patients do not significantly differ from the full cohort of 753 patients in their clinicohistological parameters, such as tumor grade, ER, PR, HER2 status or in their frequency of CT expression. We evaluated the prognostic value of CT46/HORMAD1 on the overall survival in this set of patients. Similarly to the results with the Miami cohort,
CT46/HORMAD1 mRNA expression was associated with longer survival (log-rank P =
0.0309), as well as lower hazard ratio (HR = 0.4208, 95% CI = 0.1918 to 0.9234) in this
subset of breast cancers, compared to tumors that lack CT46/HORMAD1 expression (Figure
8). To evaluate the role of the immune response on the overall survival benefit, we
performed gene expression profiling of T cell and B cell molecular markers to identify samples with tumor infiltration lymphocytes. Unsupervised clustering of gene expression
levels (RPKM) of T cell markers (CD 8, CD27, CD247, IFNG, GZMB, GNLY and TBX21) and a B cell marker (CD79) classified 753 tumors into two groups: high expressing and low expressing, which were then designated as TILs+ and TILs- groups, respectively. As
expected, expression of both CT46/HORMAD1 and NY-ESO-1 are significantly enriched in
TILs+ patient population (Table 8).
Table 8. Relationship between NY-ESO-1 and CT46/HORMAD1 expression and TILs cancer in the TCGA breast cancer dataset
NY-ESO- NY-ESO-1 CT46 CT46
TILs 1 positive negative p positive negative p
(N=42) (N=626) (N=124) (N=544)
<0.0001 0.0076
High, no. (%) 35 (8.8) 364 (91.2) 93 (23.3) 306 (93.3)
Low, no. (%) 14 (3.9) 340 (96.1) 43 (12.1) 311 (87.9)
Two-tailed P values obtained from Fisher's exact test by GraphPad Prism 5. Significant P- values (<0.05) are given in bold.
[00267] Moreover, while no correlation with overall survival could be observed between
TILs+ and TILs- patients in the 105 patients from of the TCGA dataset with longer follow-up (Figure 8B), the expression of CT46/HORMAD1 could identify a subset of the TILs positive patients that presented a significant better outcome (log-rank P = 0.019), as well as lower
hazard ratio (HR = 0.2732, 95% CI = 0.09165 to 0.8146) (Figure 8C).
Discussion
[00268] In the clinic, elucidating breast cancer prognosis has largely depended or relied on pathological features including tumor size and grade, lymph node status and certain
functional parameters such as steroid receptor and Her-2 expression[20]. However, such
indices individually or collectively do not accurately predict disease outcome even when used within tumors grouped by histology and /or node status. Improved prognostic factors would benefit the breast cancer patients and the medical professionals that treat them. Many have been proposed including the search for micrometastases, serum markers and more recently described groups of genes included in two prognostic biomarker tests, a 70-gene
MammaPrint® signature and a 21 -gene Oncotype DX panel, which are currently being used in clinical practice[21]. Of interest, however, is the recent note where the use of four IHC
indices was compared with a 70- gene group. It was found that the four indices -ER, PgR,
EGFR and Ki67 -were as effective prognosticators as the gene groupings [22]. We here now add a further prognostic index, namely two CT antigens-NY-ESO-1 and CT46/HORMAD1 - which individually and together statistically are independent factors in a multivariate analyses and predict improved disease free survival in breast cancer. Moreover, we demonstrate that the expression of these genes and in particular CT46/HORMAD1 with TILs infiltration highlights a group of lesion for which there is a significantly improved outcome (Fig. 5).
[00269] The interaction between malignant tissues and the immune system has been shown to be critical in tumor growth and metastasis. In the last few years, several studies have revealed the prognostic and predictive impact of the immune infiltrates in several cancer types [23]. However, the prognostic impact of the presence and composition of TILs in breast cancer has been controversial. Recently, a systematic review of the literature examining the evidence for the role of the tumor inflammatory general cell infiltrate in and/or around the tumor in predicting recurrence and survival in patients with primary operable breast cancer was undertaken [24]. This review identified 13 published studies, comprising data on 9821 patients, in which a pronounced general inflammatory cell infiltrate was associated with an improved outcome in primary breast cancer. In four studies, comprising data on 2241 patients, no association between inflammatory cells infiltrate and survival in breast cancer was reported. In contrast, seven published studies, comprising data on 4442 patients, reported that a pronounced general inflammatory cell infiltrate was associated with a poorer outcome in primary breast cancer[24] . In addition, there were conflicting results from several studies that examined the role of different immune cell subtypes in breast cancer survival in patients with primary operable breast cancer[24]. Nevertheless, some studies, including our own data (Table 7) had shown that the association between tumor inflammatory infiltrate and survival may be dependent on ER status, molecular subtype and histological grade [25,26,27], and therefore the immunologic microenvironment may vary in different categories of breast cancer. Furthermore, high endothelial venules (HEV), blood vessels found in lymphoid tissues, were identified in breast tumors in areas with upregulation of genes related to T-helper 1 adaptive immunity and T-cell cytotoxicity [28] . In these patients, high densities of tumor HEVs correlated with longer metastasis-free, disease-free, and overall survival rates, indicating that they may function as major gateways for lymphocyte infiltration into tumors[28]. Association of TILs and CT antigen expression was previously described in breast cancer. Expression of NY-ESO-1 was evaluated in 1,444 primary breast cancers by immunohistochemistry [29]. NY-ESO-1 -protein, detected in 2.1% invasive breast
cancer and the associated in situ components, was more frequently expressed in high grade lesions. In that study, presence of tumor-infiltrating CD8+ T-cells correlated with NY-ESO-1 expression on the tissue microarray [29]. Our results show no association between the presence of inflammatory infiltrate, evaluated either by HE or CD8+ staining or by an immune gene signature in the TCGA database and outcome. However, and importantly, the combination of lymphocytic infiltration and CT antigen expression (Figures 5, 7B and 8C) detected by RT-PCR was shown to be a valuable biomarker in predicting outcome in breast cancer patients.
[00270] Our results strongly suggest that the use of CT-based vaccination as a novel therapeutic strategy for treatment of breast cancer could be beneficial for the treatment of this disease.
[00271] Manipulating the immune system for inducing antitumor activity is a promising area of cancer therapeutics [30]. Development of strategies to artificially activate the immune system against the tumor could potentially amplify pre-existing responses or induce de novo reactions to eliminate neoplastic cells, thus inhibiting tumor development. For this, cancer- specific vaccine targets will be potentially more effective if their expression is restricted to cancer cells. The cancer/testis (CT) proteins represent a unique class of cancer antigens, which are expressed by germ cells, normally silenced in somatic cells, but activated in a wide variety of cancer types [1,3]. So far, more than 150 CT genes or gene families have been described in the literature and detailed information about them was assembled in a comprehensive database [31]. Importantly, the CTs have been shown to be capable of eliciting cellular and/or humoral immune responses that make them ideal antigens for cancer tumor immunotherapy [3]. Although they are not unique to cancer cells, but rather shared with germ line cells, which lack MHC-I molecules, and therefore are not subjected to class-I restricted cytotoxic pathways. To evaluate CT antigens as therapeutic cancer vaccine targets, multiple clinical trials worldwide have been carried out or are underway against either MAGEA3 or NY-ESO-1. A recent clinical trial conducted at the National Cancer Institute with a T-cell receptor (TCR)-based gene therapy directed against NY-ESO-1 showed promise for patients with synovial sarcoma. Objective clinical responses were observed in four out of six patients refractory to all standard therapies [32]. Importantly, Ipilimumab, which has been shown to improve survival in patients with advanced metastatic melanoma, also enhanced immunity to NY-ESO-1, in a subset of patients with melanoma [33]. These NY- ESO-1 -seropositive patients had a greater likelihood of experiencing clinical benefit 24
weeks after ipilimumab treatment than NY-ESO-l-seronegative patients. These data provide a strong rationale for the clinical use of modulators of immunosuppression with concurrent approaches to favor tumor antigen- specific immune responses, such as vaccines or adoptive transfer, in patients with cancer [33].
[00272] In conclusion, although the precise mechanisms are unclear at present, we propose that CT46/HORMAD1 is a valuable prognostic marker combined with the presence of TILs for clinical use in predicting patient outcomes and to facilitate individualization of therapy for breast cancer patients. Moreover, patients with tumors expressing CT46/HORMAD1 but without detectable lymphocytic infiltration may benefit from therapeutic cancer vaccines based on this CT antigen combined with modulators of immunossupression to increase the effective immune response to this antigen.
References
1. Simpson AJ, Caballero OL, Jungbluth A, Chen YT, Old LJ (2005) Cancer/testis antigens, gameto genesis and cancer. Nat Rev Cancer 5: 615-625.
2. Scanlan MJ, Gure AO, Jungbluth AA, Old LJ, Chen YT (2002) Cancer/testis antigens: an expanding family of targets for cancer immunotherapy. Immunol Rev 188: 22- 32.
3. Caballero OL, Chen YT (2009) Cancer/testis (CT) antigens: potential targets for immunotherapy. Cancer Sci 100: 2014-2021.
4. Scanlan MJ, Gordan JD, Williamson B, Stockert E, Bander NH, et al. (1999) Antigens recognized by autologous antibody in patients with renal-cell carcinoma. Int J Cancer 83: 456-464.
5. Lee SY, Obata Y, Yoshida M, Stockert E, Williamson B, et al. (2003) Immunomic analysis of human sarcoma. Proc Natl Acad Sci U S A 100: 2651-2656.
6. Scanlan MJ, Gordon CM, Williamson B, Lee SY, Chen YT, et al. (2002)
Identification of cancer/testis genes by database mining and mRNA expression analysis. Int J Cancer 98: 485-492.
7. Chen YT, Scanlan MJ, Venditti CA, Chua R, Theiler G, et al. (2005) Identification of cancer/testis-antigen genes by massively parallel signature sequencing. Proc Natl Acad Sci U S A 102: 7940-7945.
8. Wischnewski F, Pantel K, Schwarzenbach H (2006) Promoter demethylation and histone acetylation mediate gene expression of MAGE-A1, -A2, -A3, and -A 12 in human cancer cells. Mol Cancer Res 4: 339-349.
9. Jungbluth AA, Chen YT, Stockert E, Busam KJ, Kolb D, et al. (2001)
Immunohistochemical analysis of NY-ESO-1 antigen expression in normal and malignant human tissues. Int J Cancer 92: 856-860.
10. Takahashi K, Shichijo S, Noguchi M, Hirohata M, Itoh K (1995) Identification of MAGE-1 and MAGE-4 proteins in spermatogonia and primary spermatocytes of testis.
Cancer Res 55: 3478-3482.
11. Alsheimer M, Drewes T, Schutz W, Benavente R (2005) The cancer/testis antigen CAGE-1 is a component of the acrosome of spermatids and spermatozoa. Eur J Cell Biol 84: 445-452.
12. Prat A, Perou CM Deconstructing the molecular portraits of breast cancer. Mol Oncol 5: 5-23.
13. Grigoriadis A, Caballero OL, Hoek KS, da Silva L, Chen YT, et al. (2009) CT-X antigen expression in human breast cancer. Proc Natl Acad Sci U S A 106: 13493-13498.
14. Chen YT, Ross DS, Chiu R, Zhou XK, Chen YY, et al. Multiple cancer/testis antigens are preferentially expressed in hormone-receptor negative and high-grade breast cancers. PLoS One 6: el7876.
15. Tyagi P, Mirakhur B (2009) MAGRIT: the largest-ever phase III lung cancer trial aims to establish a novel tumor- specific approach to therapy. Clin Lung Cancer 10: 371-374.
16. Nicholaou T, Chen W, Davis ID, Jackson HM, Dimopoulos N, et al.
Immunoediting and persistence of antigen- specific immunity in patients who have previously been vaccinated with NY-ESO-1 protein formulated in ISCOMATRIX. Cancer Immunol Immunother 60: 1625-1637.
17. Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, et al. (2004) ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 6: 1-6.
18. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Varambally R, Yu J, et al. (2007) Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 9: 166-180.
19. Hofmann O, Caballero OL, Stevenson BJ, Chen YT, Cohen T, et al. (2008) Genome- wide analysis of cancer/testis gene expression. Proc Natl Acad Sci U S A 105: 20422-20427.
20. Reis-Filho JS, Pusztai L Gene expression profiling in breast cancer:
classification, prognostication, and prediction. Lancet 378: 1812-1823.
21. Kim C, Paik S Gene-expression-based prognostic assays for breast cancer. Nat Rev Clin Oncol 7: 340-347.
22. Gevensleben H, Gohring UJ, Buttner R, Heukamp LC, Kunz G, et al.
Comparison of MammaPrint and TargetPrint results with clinical parameters in German patients with early stage breast cancer. Int J Mol Med 26: 837-843.
23. Fridman WH, Galon J, Pages F, Tartour E, Sautes-Fridman C, et al. Prognostic and predictive impact of intra- and peritumoral immune infiltrates. Cancer Res 71: 5601- 5605.
24. Mohammed ZM, Going JJ, Edwards J, McMillan DC The role of the tumour inflammatory cell infiltrate in predicting recurrence and survival in patients with primary operable breast cancer. Cancer Treat Rev.
25. Baker K, Lachapelle J, Zlobec I, Bismar TA, Terracciano L, et al. Prognostic significance of CD8+ T lymphocytes in breast cancer depends upon both oestrogen receptor status and histological grade. Histopathology 58: 1107-1116.
26. Liu S, Lachapelle J, Leung S, Gao D, Foulkes WD, et al. CD8+ lymphocyte infiltration is an independent favorable prognostic indicator in basal-like breast cancer. Breast Cancer Res 14: R48.
27. Krell J, Frampton AE, Stebbing J The clinical significance of tumor infiltrating lymphoctyes in breast cancer: does subtype matter? BMC Cancer 12: 135.
28. Martinet L, Garrido I, Filleron T, Le Guellec S, Bellard E, et al. Human solid tumors contain high endothelial venules: association with T- and B-lymphocyte infiltration and favorable prognosis in breast cancer. Cancer Res 71: 5678-5687.
29. Theurillat JP, Ingold F, Frei C, Zippelius A, Varga Z, et al. (2007) NY-ESO-1 protein expression in primary breast carcinoma and metastases: correlation with CD8+ T-cell and CD79a+ plasmacytic/B-cell infiltration. Int J Cancer 120: 2411-2417.
30. Kirkwood JM, Butterfield LH, Tarhini AA, Zarour H, Kalinski P, et al.
Immunotherapy of cancer in 2012. CA Cancer J Clin.
31. Almeida LG, Sakabe NJ, deOliveira AR, Silva MC, Mundstein AS, et al. (2009) CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res 37: D816-819.
32. Robbins PF, Morgan RA, Feldman SA, Yang JC, Sherry RM, et al. Tumor regression in patients with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes reactive with NY-ESO-1. J Clin Oncol 29: 917-924.
33. Yuan J, Adamow M, Ginsberg BA, Rasalan TS, Ritter E, et al. Integrated NY- ESO-1 antibody and CD8+ T-cell responses correlate with clinical benefit in advanced melanoma patients treated with ipilimumab. Proc Natl Acad Sci U S A 108: 16723-16728.
Claims
1. A therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring tumor infiltrating lymphocytes (TIL's) in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), and low levels of tumor infiltrating lymphocytes (TILs), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
2. The therapeutic regimen of claim 1, further comprising measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), low levels of TIL's, and absence of ER expression (ER ), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
3. A therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+) and absence of ER expression (ER ), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
4. A therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and
for a subject with a breast cancer characterized by expression of CT46 (CT46+), absence of expression of NY-ESO-1 (NY-ESO-Γ), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy.
5. A therapeutic regimen for treating breast cancer in a mammalian subject comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring NY-ESO-1 expression in the breast cancer tissue sample; and for a subject with a breast cancer characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-l+), prescribing and/or administering a therapeutic regimen that includes CT46 immunotherapy and NY-ESO-1 immunotherapy.
6. The therapeutic regimen of claim 4 or claim 5, further comprising measuring estrogen receptor (ER) expression in the breast cancer tissue sample.
7. A therapeutic regimen for breast cancer comprising administering an immunotherapy to a human subject with breast cancer that has been laboratory-typed as any of the following:
(a) ER-negative and CT46-positive;
(b) ER-negative, NY-ESO-1 -negative, and CT46-positive;
(c) ER-negative, NY-EDO- 1 -positive, and CT46-positive;
(d) types (a), (b) or (c) that further are PR-negative;
(e) types (a), (b), (c) or (d) that further are HER2-negative;
(f) types (a), (b), (c), (d) or (e) that further have low levels of tumor infiltrating lymphocytes; wherein the immunotherapy comprises administering CT46 antigen immunotherapy optionally in combination with NY-ESO-1 antigen immunotherapy.
8. The therapeutic regimen of any one of claims 1-7, wherein the mammalian subject is human.
9. The therapeutic regimen of any one of claims 1-8, wherein the breast cancer tissue sample is from a primary and/or secondary breast tumor from the subject.
10. The method of any one of claims 1-7, wherein CT46 expression is measured by measuring CT46 mRNA.
11. The therapeutic regimen of claim 10, wherein CT46 expression is measured using an RT-PCR assay.
12. The therapeutic regimen of claim 10 or 11, wherein the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
AGAACAGGAAAAAAACCCTGCAT (SEQ ID NO: 3) and
CTGGACTTTCTTTAGACCTCATA (SEQ ID NO: 4).
13. The therapeutic regimen of any one of claims 4, 5 and 7, wherein NY-ESO-1 expression is measured by measuring NY-ESO-1 mRNA.
14. The therapeutic regimen of claim 13, wherein NY-ESO-1 expression is measured using an RT-PCR assay.
15. The therapeutic regimen of claim 13 or 14, wherein the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
TGAAGGAGTTCACTGTGTCC (SEQ ID NO: 1) and AGCTGCTGGAGACAGGAGCT (SEQ ID NO: 2).
16. The therapeutic regimen of claim 1 or claim 7, wherein the measuring of tumor infiltrating T-lymphocytes comprises measuring CD3-expressing cells in the breast cancer tissue sample.
17. The therapeutic regimen of claim 16, wherein the measuring of TILs comprises contacting the breast cancer tissue sample with a binding partner that specifically binds a protein expressed by TIL.
18. The therapeutic regimen of claim 17, wherein the protein expressed by the TIL is CD8.
19. The therapeutic regimen of claim A10, wherein the binding partner comprises an anti-CD8 antibody.
20. The therapeutic regimen according to any one of claims 1-19, further comprising measuring progesterone receptor (PR) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy or a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample further tests negative for PR expression (PR-).
21. The therapeutic regimen according to claim 20, further comprising measuring human epidermal growth factor 2 receptor (HER2) expression in the breast cancer tissue sample; and prescribing or administering the therapeutic regimen that includes CT46 immunotherapy or a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample further tests negative for HER2 expression (HER2-).
22. The therapeutic regiment according to any one of claims 1-21, therapeutic regimen further comprises prescribing or administering one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-GITR, anti-CTLA4, anti-PDl, anti-OXA4, anti- TGFbetal, PDl ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF), interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells, cytokines and dexamethasone.
23. The therapeutic regimen of any one of claims 1-22, further comprising prescribing a standard-of-care therapy to a mammalian subject if the presence of CT46 and optionally the presence of NY-ESO-1 is absent from the tumor tissue sample.
24. A method of evaluating the likelihood that a human subject suffering from triple negative breast cancer would benefit from CT46 immunotherapy, the method comprising
(a) measuring a breast tumor tissue sample from the subject for one or more biomarkers selected from the group consisting of: CT46, NY-ESO-1, and tumor infiltrating lymphocytes (TILs);
(b) diagnosing likelihood that the subject would benefit from CT46 immunotherapy and/or NY-ESO-1 immunotherapy based on the biomarkers measured according to step (a).
25. The method of claim 24, wherein the presence of CT46, the absence of NY- ESO-1 and the presence of TILs in the sample is indicative that the subject would likely benefit from CT46 immunotherapy.
26. The method of claim 24, wherein the presence of CT46, the presence of NY- ESO-1 and the absence of TILs in the sample is indicative that the subject would likely benefit from a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy.
27. the method of claim 24, wherein the presence of NY-ESO-1 and the presence of TILs in the sample is indicative that the subject would likely benefit from NY-ESO-1 immunotherapy.
28. The method of any one of claims 24-27, wherein the breast cancer is triple negative breast cancer.
29. The method of claim 24, wherein the presence of CT46 in the tissue sample is determined by an RT-PCR assay.
30. The method of claim 29, wherein the RT-PCR assay comprises the use of primers selected from the group consisting of AGAACAGGAAAAAAACCCTGCAT (SEQ ID NO: 3) and CTGGACTTTCTTTAGACCTCATA (SEQ ID NO: 4).
31. The method of claim 24, wherein the level of NY-ESO-1 in the tissue sample is determined by an RT-PCR assay.
32. The method of claim 31, wherein the RT-PCR assay comprises the use of primers selected from the group consisting of TGAAGGAGTTCACTGTGTCC (SEQ ID NO: 1) and AGCTGCTGGAGACAGGAGCT (SEQ ID NO: 2).
33. The method of claim 24, wherein the presence or absence of TILs in the sample is determined by contacting the sample with a binding partner that specifically binds a protein expressed by the TIL.
34. The method of claim 33, wherein the protein expressed by the TIL is selected from the group consisting of CD3 and CD8.
35. The method of claim 34, wherein the binding partner comprises an antibody selected from the group consisting of an anti-CD3 antibody, an anti-CD8 antibody and combinations thereof.
36. The method of claim 33, wherein the presence or absence of TILs in the sample is determined by immunohistochemical staining of the tissue sample with the binding partner.
37. The method of claim 24, wherein the CT46 immunotherapy and/or NY-ESO-1 immunotherapy optionally further comprises one or more immune modulators selected from the group consisting of as poly I:C (TLR3), MPL/LipidA (TLR4), imiquimod (TLR7), R848 (TLR8), CpG (TLR9), anti-GITR, anti-CTLA4, anti-PDl, anti-OXA4, anti-TGFbetal, PD1 ligand, CTLA4 ligand, OXA4 ligand and interleukins, tumor necrosis factor (TNF),
interleukin-2 (IL2) or other growth factors, colony stimulating factors, modulators of CD7+ T cells, cytokines and dexamethasone.
38. The method of claim 24, comprising diagnosing the subject as unlikely to benefit from treatment with CT46 immunotherapy if the CT46 is absent from the tumor tissue sample of the subject.
39. The method of claim 24, comprising diagnosing the subject as unlikely to benefit from treatment with CT46 and NY-ESO-1 immunotherapy if the CT46 and NY-ESO- 1 are absent from the tumor tissue sample of the subject.
40. A method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative.
41. The method of claim 40, further comprising measuring NY-ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO- 1+), or as unlikely to benefit from the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy if the breast cancer tissue sample is CT-46-negative and NY-ESO-1 -negative.
42. The method of claim 40, comprising measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and absence of ER expression (ER ), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative and ER-positive.
43. The method of claim 41, comprising measuring estrogen receptor (ER) expression in the breast cancer tissue sample; and
identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 and NY-ESO-1 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+) and NY-ESO-1 (NY-ESO-l+) and absence of ER expression (ER ), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, NY-ESO-1 negative and ER-positive.
44. A method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring tumor infiltrating lymphocytes (TILs) in the breast cancer tissue sample; and identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), low levels of TIL's, and absence of ER expression (ER ), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, or ER-positive.
45. The method of claim 44, comprising measuring NY-ESO-1 expression in the breast cancer tissue sample and identifying the subject as likely to benefit from a therapeutic regimen that includes a combination of CT46 immunotherapy and NY-ESO-1
immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), expression of NY-ESO-1 (NY-ESO-1+), low levels of TIL's, and absence of ER expression (ER ), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, or NY-ESO-1 -negative, or ER-positive.
46. A method for personalizing therapy for a human subject that has been diagnosed with breast cancer, the method comprising: measuring CT46 expression in a breast cancer tissue sample from a mammalian subject; measuring estrogen receptor (ER) expression in the breast cancer tissue sample; measuring NY-ESO-1 expression in the breast cancer tissue sample; and
identifying the subject as likely to benefit from a therapeutic regimen that includes CT46 immunotherapy if the breast cancer tissue sample is characterized by expression of CT46 (CT46+), absence of NY-ESO-1 expression (NY-ESO-Γ), and absence of ER expression (ER ), or as unlikely to benefit from the CT46 immunotherapy if the breast cancer tissue sample is CT46-negative, NY-ESO-1 -positive, or ER-positive.
47. The method of any one of claims 40-46, wherein the breast cancer tissue sample is from a primary breast tumor and or secondary metastatic breast tumor from the subject.
48. The method of any one of claims 40-46, wherein CT46 expression is measured by measuring CT46 mRNA.
49. The method of claim 48, wherein CT46 expression is measured using an RT- PCR assay.
50. The method of claim 48 or 49, wherein the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
AGAACAGGAAAAAAACCCTGCAT (SEQ ID NO: 3) and
CTGGACTTTCTTTAGACCTCATA (SEQ ID NO: 4).
51. The method of claim 41, 45 or 46, wherein NY-ESO-1 expression is measured by measuring NY-ESO-1 mRNA.
52. The method of claim 51, wherein NY-ESO-1 expression is measured using an RT-PCR assay.
53. The method of claim 51 or claim 52, wherein the RT-PCR assay comprises the use of at least one primer selected from the group consisting of
TGAAGGAGTTCACTGTGTCC (SEQ ID NO: 1) and AGCTGCTGGAGACAGGAGCT (SEQ ID NO: 2).
54. The use of a measurement of CT46 antigen expression in a breast cancer tissue sample from a human subject for predicting the therapeutic benefit of CT46 immunotherapy in the subject.
55. The use according to claim 54, wherein the measurement of CT46 antigen expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the CT46 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER),
progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), tumor infiltrating T lymphocytes, and NY-ESO-1.
56. The use according to claim 54 or 55, wherein the measurement of CT46 antigen expression is a measurement of CT46 antigen mRNA.
57. The use of a measurement of CT46 antigen expression and NY-ESO-1 expression in a breast cancer tissue sample from a human subject for predicting the therapeutic benefit of a combination of CT46 immunotherapy and NY-ESO-1
immunotherapy in the subject.
58. The use according to claim 57, wherein the measurement of CT46 antigen expression and NY-ESO-1 expression is used in combination with measurements of one or more additional biomarkers for predicting the therapeutic benefit of the combination of CT46 immunotherapy and NY-ESO-1 immunotherapy, wherein the one or more additional biomarkers are selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), tumor infiltrating lymphocytes (TIL), and tumor infiltrating T lymphocytes.
59. A system for evaluating prognosis or selecting a therapy protocol for a human subject who has been diagnosed with a breast cancer, the system comprising:
(a) at least one processor;
(b) at least one computer-readable medium;
(c) at least one database operatively coupled to a computer-readable medium of the system and containing population information that correlates the presence or absence or measurements of biological markers measured in breast cancer tissue and prognosis or therapy outcome with respect to breast cancer in a population of humans
(d) a measurement tool that receives an input about the human subject and generates information from the input about the presence or absence or measurements of the biological markers in a breast cancer tissue sample from the human subject; and
(e) an analysis tool or routine that:
(i) is operatively coupled to the database and the measurement tool,
(ii) is stored on a computer-readable medium of the system,
(iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the population information in the treatment database and generate a conclusion with respect to prognosis of the patient with respect to the breast cancer or likelihood that the human subject will benefit from a cancer therapy, wherein the biological markers comprise:
CT46 antigen; and at least one of tumor- infiltrating lymphocytes and NY-ESO-1 antigen.
60. The system according to claim 59, wherein the tumor infiltrating lymphocytes are T-lymphocytes.
61. The system according to claim 59 or 60, wherein the biological markers further comprise a marker selected from the group consisting of human estrogen receptor (ER), human progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2).
62. The system according to any one of claims 59-61, wherein the analysis tool generates a conclusion with respect to the likelihood that the human subject will benefit from CT46 immunotherapy.
63. The system according to any one of claims 59-61, wherein the analysis too generates a conclusion with respect to the likelihood that the human subject will benefit from a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy.
64. The system according to any one of claims 59-63, wherein the analysis tool generates a prognosis conclusion with respect to the likelihood of breast cancer recurrence following standard of care therapy for the breast cancer.
65. The system according to any one of claims 59-64, further including a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to
communicate to the subject, or to a medical practitioner for the subject, the conclusion(s) generated by the analysis tool, or enable the subject or medical practitioner to access the conclusion(s).
66. The system according to any one of claims 59-65, wherein the measurement tool comprises a tool stored on a computer readable medium of the system and adapted to be executed by a processor of the system to receive a data input about a subject and determine
information about the presence or absence or measurements of the biological markers from the data.
67. The system according to any one of claims 59-65, wherein the input about the human subject is a breast cancer tissue sample from the subject, and wherein the
measurement tool comprises a tool to measure the presence, absence, or quantity of the biological markers in the breast cancer tissue sample, thereby generating information about the presence, absence, or quantity of the biological markers.
68. The system according to claim 67, wherein the measurement tool includes a polymerase chain reaction thermocycler and at least one primer for amplifying CT46 mRNA.
69. The system according to claim 68, wherein the measurement tool further comprises at least one primer for amplifying NY-ESO-1 mRNA.
70. An isolated oligonucleotide with a length of 10-50 nucleotides, wherein the nucleic acid comprises a sequence selected from the group consisting of:
(a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1),
(b) 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-1 -R, SEQ ID NO: 2),
(c) 5 ' - AGAAC AGGAA AAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3),
(d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4),
(e) 5 ' - ACGAACC ACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5),
(f) 5 ' -TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), and
(g) contiguous 10 nucleotide segments of any of (a) - (f).
71 The isolated oligonucleotide according to claim 70, comprising at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of any of (a) - (f).
72. The isolated oligonucleotide according to claim 70 or 71, having a nucleotide sequence consisting of any one of (a) - (f).
73. The isolated oligonucleotide according to any of one claims 70-72, wherein the oligonucleotide selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, human CT46, or human TBP under PCR annealing conditions in a PCR reaction containing human mRNA and/or human cDNA.
74. The isolated oligonucleotide according to any one of claims 70-73, wherein the nucleotide sequence of the oligonucleotide is identical to, or fully complementary to, an mRNA from human NY-ESO-1, human CT46, or human TBP.
75. The isolated oligonucleotide according to any one of claims 70-74, wherein the oligonucleotide further comprises a detectable label.
76. The isolated oligonucloetide according to any one of claims 70-75, comprising:
(c) 5 ' - AGAACAGGAAAAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 2),
(d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 3), or a contiguous segment of (c) or (d) of at least 10 nucleotides.
77. A kit comprising at least two oligonucleotides according to any one of claims 70-76, wherein the at least two oligonucleotides are packaged together but not in admixture, and wherein the at least two oligonucleotides comprise:
(a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-1 -F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and
(b) 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-1 -R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides.
78. A kit comprising at least two oligonucleotides according to any one of claims 70-76, wherein the at least two oligonucleotides are packaged together but not in admixture, and wherein the at least two oligonucleotides comprise:
(c) 5 '-AGAACAGGAAAAAAACCCTGCAT-3' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and
(d) 5 '-CTGGACTTTCTTTAGACCTCATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
79. A kit comprising at least two oligonucleotides according to any one of claims 70-76, wherein the at least two oligonucleotides are packaged together but not in admixture, and wherein the at least two oligonucleotides comprise:
(e) 5 ' - ACGAACC ACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and
(f) 5 ' -TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
80. A kit according to claim 77 or 78 comprising at least four oligonucleotides according to any one of claims 70-76, wherein the at least four oligonucleotides are packaged together but not in admixture, and wherein two of the at least four oligonucleotides comprise:
(c) 5 ' - AGAAC AGGAA AAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and
(d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
81. A kit according to claim 80 comprising at least six oligonucleotides according to any one of claims 70-76, wherein the at least six oligonucleotides are packaged together but not in admixture, and wherein two of the at least six oligonucleotides comprise:
(e) 5 ' - ACGAACC ACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and
(f) 5 '-TGCTGCCAGTCTGGACTGTTCT-3' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
82. A kit comprising at least four oligonucleotides according to any one of claims 70-76, wherein the at least four oligonucleotides are packaged together but not in admixture, and wherein the four oligonucleotides comprise:
(a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides;
(b) 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides;
(c) 5 ' - AGAAC AGGAA AAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and
(d) 5 '-CTGGACTTTCTTTAGACCTCATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
83. The kit according to any one of claims 77-82, further comprising
deoxynucleotide triphospates (dNTP's).
84. The kit according to claim 83, further comprising MgC12 and a thermostable DNA polymerase.
85. The kit according to any one of claims 77-84, further comprising one or more reagents for measuring tumor infiltrating lymphocytes in a tissue sample.
86. The kit according to claim 85, wherein the one or more reagents for measuring tumor infiltrating lymphocytes comprises an antibody with specificity for CD3 protein or CD 8 protein.
87. The kit according to any one of claims 77-86, further comprising at least one reagent for measuring at least one receptor selected from the group consisting of estrogen receptor (ER), progesterone receptor (PR), and the human epidermal growth factor receptor 2 (HER2) expressed by a cell.
88. A composition comprising at least two oligonucleotides according to claim 70- 76 in admixture, wherein the at least two oligonucleotides comprise 5'- TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides.
89. A composition comprising at least two oligonucleotides according to any one of claims 70-76 in admixture, wherein the at least two oligonucleotides comprise 5'- AGAACAGGA AAAAA ACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -CTGGACTTTCTTTAGACCTC ATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
90. A composition comprising at least two oligonucleotides according to any one of claims 70-76 in admixture, wherein the at least two oligonucleotides comprise 5'- ACGAACCACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and 5 ' -TGCTGCC AGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
91. A composition comprising at least four oligonucleotides according to any one of claims 70-76, wherein the at least four oligonucleotides are in admixture, and wherein the four oligonucleotides comprise:
(a) 5 ' -TGAAGGAGTTCACTGTGTCC-3 ' (NY-ESO-l-F, SEQ ID NO: 1), or a contiguous segment thereof of at least 10 nucleotides;
(b) 5 ' - AGCTGCTGGAGACAGGAGCT-3 ' (NY-ESO-l-R, SEQ ID NO: 2), or a contiguous segment thereof of at least 10 nucleotides;
(c) 5 ' - AGAAC AGGAA AAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and
(d) 5 ' -CTGGACTTTCTTTAGACCTCATA-3 ' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
92. A composition comprising at least four oligonucleotides according to any one of claims 70-76, wherein the at least four oligonucleotides are in admixture, and wherein the four oligonucleotides comprise:
(a) 5 ' - AGAAC AGGAA AAAAACCCTGCAT-3 ' (CT46-F, SEQ ID NO: 3), or a contiguous segment thereof of at least 10 nucleotides; and
(b) 5 '-CTGGACTTTCTTTAGACCTCATA-3' (CT46-R, SEQ ID NO: 4), or a contiguous segment thereof of at least 10 nucleotides.
(c) 5 ' - ACGAACC ACGGCACTGATTTTC A-3 ' (TBP-F, SEQ ID NO: 5), or a contiguous segment thereof of at least 10 nucleotides; and
(d) 5 ' -TGCTGCCAGTCTGGACTGTTCT-3 ' (TBP-R, SEQ ID NO: 6), or a contiguous segment thereof of at least 10 nucleotides.
93. The composition according to any one of claims 87-92, further comprising deoxynucleotide triphospates (dNTP's).
94. The composition according to claim 93, further comprising MgC12 and a thermostable DNA polymerase.
95. A method of measuring CT46 gene expression in a tissue sample from a human subject, comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide according to any one of claims 70-76 that selectively hybridizes to human mRNA or human cDNA from human CT46, and measuring amplicons corresponding to human CT46 in the PCR reaction products.
96. The method of claim 95, comprising performing the PCR with a primer pair according to any one of claims 70-76 for selectively amplifying CT46 mRNA, or a kit according to any one of claims 78, 80 and 82 containing the primer pair.
97. The method according to claim 95 or 96, comprising simultaneously or separately performing a PCR assay with nucleic acid from the sample and an oligonucleotide according to any one of claims 70-76 that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products.
98. The method according to claim 97, comprising performing the PCR with a primer pair according to any one of claims 70-76 for selectively amplifying NY-ESO-1 mRNA, or a kit according to claim 77 or 82 comprising the primer pair.
99. A method of measuring NY-ESO-1 gene expression in a tissue sample from a human subject, comprising performing a polymerase chain reaction (PCR) assay with nucleic acid from the sample and an oligonucleotide according to any one of claims 70-76 that selectively hybridizes to human mRNA or human cDNA from human NY-ESO-1, and measuring amplicons corresponding to human NY-ESO-1 in the PCR reaction products.
100. The method of claim 99, comprising performing the PCR with a primer pair according to any one of claims 70-76 for selectively amplifying NY-ESO-1 mRNA, or a kit according to any one of claims 77 or 82 containing the primer pair.
101. The method according to any one of claims 95-100 comprising simultaneously or separately performing a PCR assay with nucleic acid from the sample and an
oligonucleotide according to any one of claims 70-76 that selectively hybridizes to human mRNA or human cDNA from human TBP, and measuring amplicons corresponding to human TBP in the PCR reaction products.
102. The method according to claim 101 comprising performing the PCR with a primer pair according to any one of claims 70-76 for selectively amplifying TBP mRNA, or a kit according to any one of claims 77 or 82 comprising the primer pair.
103. The method according to any one of claims 95-102, wherein the tissue sample comprises cancer cells.
104. The method according to claim 103, wherein the tissue sample comprises breast cancer cells.
105. The method according to claim 104, wherein the tissue sample comprises estrogen receptor negative (ER-) breast cancer cells.
106. The method according to claim 104, further comprising screening the breast cancer cells for estrogen receptor expression.
107. The method according to any one of claims 103-106, wherein the human tissue sample comprises progesterone receptor negative (PR-) breast cancer cells.
108. The method according to any one of claims 103-107, further comprising screening the breast cancer cells for progesterone receptor expression.
109. The method according to any one of claims 103-108, wherein the human tissue sample comprises human epidermal growth factor receptor 2 negative (HER2-) breast cancer cells.
110. The method according to any one of claims 103-109, further comprising screening the breast cancer cells for HER2 expression.
111. The method according to any one of claims 103- 110, further comprising measuring tumor infiltrating lymphocytes in the cancer.
112. The method according to claim 111, comprising measuring CD8-expressing (CD8+) lymphocytes in the cancer.
113. The method according to any one of claims 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells.
114. The method according to any one of claims 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), estrogen receptor- negative (ER-) breast cancer cells.
115. The method according to any one of 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+) breast cancer cells and low levels of tumor infiltrating lymphocytes.
116. The method according to any one of claims 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is
determined according to the method to have CT46-positive (CT46+), estrogen receptor- negative (ER-) breast cancer cells and low levels of tumor infiltrating lymphocytes.
117. The method according to any one of claims 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative breast cancer cells.
118. The method according to any one of claims 95-112, further comprising prescribing or administering CT46 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 negative, estrogen receptor-negative (ER-) breast cancer cells.
119. The method according to any one of claims 95-112, further comprising prescribing or administering a combination of CT46 immunotherapy and NY-ESO-1 immunotherapy to the human subject if the subject is determined according to the method to have CT46-positive (CT46+), NY-ESO-1 -positive (NY-ESO-1+) breast cancer cells.
120. An amplicon corresponding to human NY-ESO-1 or human CT46 produced according to a method of any one of claims 95-112, wherein the amplicon has at least 20, or at least 30, or at least 40, or at least 50 or at least 60, or at least 70, or at least 80, or at least 90 or at least 100 nucleotides in length.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261724269P | 2012-11-08 | 2012-11-08 | |
| US61/724,269 | 2012-11-08 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014074785A1 true WO2014074785A1 (en) | 2014-05-15 |
Family
ID=49640203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/069084 Ceased WO2014074785A1 (en) | 2012-11-08 | 2013-11-08 | Methods of predicting outcome and treating breast cancer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014074785A1 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016187656A1 (en) * | 2015-05-22 | 2016-12-01 | La Trobe University | Method of diagnosis of breast cancer |
| WO2017181149A1 (en) * | 2016-04-15 | 2017-10-19 | Blaze Bioscience, Inc. | Methods of treating breast cancer |
| WO2018148180A3 (en) * | 2017-02-07 | 2018-09-27 | Immune Design Corp. | Materials and methods for identifying and treating cancer patients |
| WO2020153800A3 (en) * | 2019-01-24 | 2020-12-10 | 주식회사 네오젠티씨 | Composition for preventing or treating triple negative breast cancer, containing tumor infiltrating lymphocytes as active ingredient |
| RU2757590C1 (en) * | 2021-04-12 | 2021-10-19 | Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии имени Н.Н. Блохина" Министерства здравоохранения Российской Федерации (ФГБУ "НМИЦ онкологии им. Н.Н. Блохина" Минздрава России) | Method for determining the prognosis of the effectiveness of breast cancer therapy |
| WO2022122938A1 (en) * | 2020-12-09 | 2022-06-16 | The Institute Of Cancer Research | Hormad1 therapeutics |
| WO2023200929A1 (en) * | 2022-04-15 | 2023-10-19 | Instil Bio, Inc. | Tumor-infiltrating lymphocyte (til) compositions and uses thereof |
| RU2806299C1 (en) * | 2022-06-23 | 2023-10-30 | Государственное бюджетное учреждение здравоохранения города Москвы "Московский клинический научно-практический центр имени А.С. Логинова Департамента здравоохранения города Москвы" | Method of diagnosing regression of breast cancer after neoadjuvant drug therapy |
Citations (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5124246A (en) | 1987-10-15 | 1992-06-23 | Chiron Corporation | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| US5359100A (en) | 1987-10-15 | 1994-10-25 | Chiron Corporation | Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers |
| WO1995000654A1 (en) | 1993-06-18 | 1995-01-05 | Beth Israel Hospital Association | Mesothelial cell gene therapy |
| US5399346A (en) | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5594117A (en) | 1994-08-25 | 1997-01-14 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties and associated methods of synthesis and use |
| US5635352A (en) | 1993-12-08 | 1997-06-03 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise |
| US5681702A (en) | 1994-08-30 | 1997-10-28 | Chiron Corporation | Reduction of nonspecific hybridization by using novel base-pairing schemes |
| US5804381A (en) | 1996-10-03 | 1998-09-08 | Cornell Research Foundation | Isolated nucleic acid molecule encoding an esophageal cancer associated antigen, the antigen itself, and uses thereof |
| WO2000000642A1 (en) * | 1998-06-26 | 2000-01-06 | Ludwig Institute For Cancer Research | Methods for determining breast cancer and melanoma by assaying for a plurality of antigens associated therewith |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6252052B1 (en) | 1996-10-03 | 2001-06-26 | Cornell Research Foundation, Inc | Antibodies which bind to NY-ESO-1 cancer associated proteins, and hybridomas which produce these antibodies |
| WO2006002114A2 (en) * | 2004-06-17 | 2006-01-05 | Mannkind Corporation | Tumor-associated antigen profiles in cancer diagnostics and immunotherapy |
| WO2007044515A1 (en) | 2005-10-07 | 2007-04-19 | Exelixis, Inc. | Azetidines as mek inhibitors for the treatment of proliferative diseases |
| WO2011066265A1 (en) * | 2009-11-25 | 2011-06-03 | Ludwig Institute For Cancer Research Ltd. | Cancer testis antigens as biomarkers in non-small cell lung cancer |
-
2013
- 2013-11-08 WO PCT/US2013/069084 patent/WO2014074785A1/en not_active Ceased
Patent Citations (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5624802A (en) | 1987-10-15 | 1997-04-29 | Chiron Corporation | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| US5594118A (en) | 1987-10-15 | 1997-01-14 | Chiron Corporation | Modified N-4 nucleotides for use in amplified nucleic acid hybridization assays |
| US5359100A (en) | 1987-10-15 | 1994-10-25 | Chiron Corporation | Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers |
| US5571670A (en) | 1987-10-15 | 1996-11-05 | Chiron Corporation | Nucleic acid probes useful in detecting Chlamydia trachomatis and amplified nucleic acid hybridization assays using same |
| US5124246A (en) | 1987-10-15 | 1992-06-23 | Chiron Corporation | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| US5399346A (en) | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| WO1995000654A1 (en) | 1993-06-18 | 1995-01-05 | Beth Israel Hospital Association | Mesothelial cell gene therapy |
| US5635352A (en) | 1993-12-08 | 1997-06-03 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise |
| US5681697A (en) | 1993-12-08 | 1997-10-28 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5594117A (en) | 1994-08-25 | 1997-01-14 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties and associated methods of synthesis and use |
| US5681702A (en) | 1994-08-30 | 1997-10-28 | Chiron Corporation | Reduction of nonspecific hybridization by using novel base-pairing schemes |
| WO1996033739A1 (en) | 1995-04-25 | 1996-10-31 | Smithkline Beecham Biologicals S.A. | Vaccines containing a saponin and a sterol |
| US6525177B2 (en) | 1996-10-03 | 2003-02-25 | Cornell Research Foundation, Inc. | Truncated forms of NY-ESO-1 protein |
| US5804381A (en) | 1996-10-03 | 1998-09-08 | Cornell Research Foundation | Isolated nucleic acid molecule encoding an esophageal cancer associated antigen, the antigen itself, and uses thereof |
| US6252052B1 (en) | 1996-10-03 | 2001-06-26 | Cornell Research Foundation, Inc | Antibodies which bind to NY-ESO-1 cancer associated proteins, and hybridomas which produce these antibodies |
| US6274145B1 (en) | 1996-10-03 | 2001-08-14 | Ludwig Institute For Cancer Research | Isolated nucleic acid molecule encoding cancer associated antigen, the antigen itself, and uses thereof |
| WO2000000642A1 (en) * | 1998-06-26 | 2000-01-06 | Ludwig Institute For Cancer Research | Methods for determining breast cancer and melanoma by assaying for a plurality of antigens associated therewith |
| WO2006002114A2 (en) * | 2004-06-17 | 2006-01-05 | Mannkind Corporation | Tumor-associated antigen profiles in cancer diagnostics and immunotherapy |
| WO2007044515A1 (en) | 2005-10-07 | 2007-04-19 | Exelixis, Inc. | Azetidines as mek inhibitors for the treatment of proliferative diseases |
| WO2011066265A1 (en) * | 2009-11-25 | 2011-06-03 | Ludwig Institute For Cancer Research Ltd. | Cancer testis antigens as biomarkers in non-small cell lung cancer |
Non-Patent Citations (109)
| Title |
|---|
| "Animal Cell Culture", 1987 |
| "Current Protocols in Molecular Biology", 1987 |
| "Gene Transfer Vectors for Mammalian Cells", 1987 |
| "Handbook of Experimental Immunology", 1987, BLACKWELL SCIENCE INC. |
| "Methods in Enzymology", ACADEMIC PRESS, INC. |
| "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, pages: 9.47 - 9.51 |
| "Oligonucleotide Synthesis", 1984 |
| "PCR: The Polymerase Chain Reaction", 1994 |
| "Protocols in Molecular Biology", 1994, JOHN WILEY & SONS, pages: 6.0.3 - 6.4.10 |
| "Remington's Pharmaceutical Sciences", 1990 |
| A. GRIGORIADIS ET AL: "CT-X antigen expression in human breast cancer", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 106, no. 32, 11 August 2009 (2009-08-11), pages 13493 - 13498, XP055102095, ISSN: 0027-8424, DOI: 10.1073/pnas.0906840106 * |
| AJG SIMPSON, NATURE REVIEWS CANCER, vol. 5, 1 August 2005 (2005-08-01), pages 615 - 625 |
| ALLSOPP ET AL., EUR. J. IMMUNOL, vol. 26, 1996, pages 1951 - 1959 |
| ALMEIDA LG; SAKABE NJ; DEOLIVEIRA AR; SILVA MC; MUNDSTEIN AS ET AL.: "CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens", NUCLEIC ACIDS RES, vol. 37, 2009, pages D816 - 819 |
| ALSHEIMER M; DREWES T; SCHUTZ W; BENAVENTE R: "The cancer/testis antigen CAGE-1 is a component of the acrosome of spermatids and spennatozoa", EUR J CELL BIOL, vol. 84, 2005, pages 445 - 452, XP025312732, DOI: doi:10.1016/j.ejcb.2004.11.003 |
| AUSUBEL ET AL.: "Current Protocols of Molecular Biology", 1997, JOHN WILEY AND SONS |
| BAKER K; LACHAPELLE J; ZLOBEC I; BISMAR TA; TERRACCIANO L ET AL.: "Prognostic significance of CD8+ T lymphocytes in breast cancer depends upon both oestrogen receptor status and histological grade", HISTOPATHOLOGY, vol. 58, pages 1107 - 1116 |
| BAYER ET AL., METH. ENZ., vol. 184, 1990, pages 138 - 163 |
| BENNETT ET AL., NATURE, vol. 393, 1998, pages 478 |
| BRENNER ET AL., NATURE BIOTECHNOLOGY, vol. 18, 2000, pages 630 - 634 |
| CABALLERO OL; CHEN YT: "Cancer/testis (CT) antigens: potential targets for immunotherapy", CANCER SCI, vol. 100, 2009, pages 2014 - 2021 |
| CHEN ET AL., CANCER IMMUNITY, vol. 5, 2005, pages 9 - 16 |
| CHEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 1914 - 1918 |
| CHEN YAO-TSENG ET AL: "Identification of CT46/HORMAD1, an immunogenic cancer/testis antigen encoding a putative meiosis-related protein", CANCER IMMUNITY, ACADEMY OF CANCER IMMUNOLOGY, CH, vol. 5, 7 July 2005 (2005-07-07), pages 9, XP002380625, ISSN: 1424-9634 * |
| CHEN YT; ROSS DS; CHIU R; ZHOU XK; CHEN YY ET AL.: "Multiple cancer/testis antigens are preferentially expressed in hormone-receptor negative and high-grade breast cancers", PLOS ONE, vol. 6, pages E17876 |
| CHEN YT; SCANLAN MJ; VENDITTI CA; CHUA R; THEILER G ET AL.: "Identification of cancer/testis-antigen genes by massively parallel signature sequencing", PROC NATL ACAD SCI U S A, vol. 102, 2005, pages 7940 - 7945, XP002368175, DOI: doi:10.1073/pnas.0502583102 |
| CHENGALVALA ET AL., VACCINE, vol. 15, 1997, pages 335 - 339 |
| DATABASE EMBL [Online] 18 April 2011 (2011-04-18), "WO 2005116204-A/41605: Double strand polynucleotides generating RNA interference.", XP002721543, retrieved from EBI accession no. EM_PAT:FW635079 Database accession no. FW635079 * |
| DATABASE Geneseq [Online] 28 May 2009 (2009-05-28), "Human CTAG1B targeting siRNA sense strand.", XP002721542, retrieved from EBI accession no. GSN:AWI87030 Database accession no. AWI87030 * |
| DAVIS ET AL., J. VIROL., vol. 70, 1996, pages 3781 - 3787 |
| DE ANDRES ET AL., BIOTECHNIQUES, vol. 18, 1995, pages 42044 |
| ELOIT ET AL., J. VIROL., vol. 7, 1997, pages 5375 - 5381 |
| FENTON ET AL., J. IMMUNOTHER., vol. 21, no. 2, 1998, pages 95 - 108 |
| FRIDMAN WH; GALON J; PAGES F; TARTOUR E; SAUTES-FLIDMAN C ET AL.: "Prognostic and predictive impact of intra- and peritumoral immune infiltrates", CANCER RES, vol. 71, pages 5601 - 5605 |
| GAJEWSKI ET AL., J. IMMUNOL, vol. 154, 1995, pages 5637 - 5648 |
| GEVENSLEBEN H; GOHRING UJ; BUTTNER R; HEUKAMP LC; KUNZ G ET AL.: "Comparison of MammaPrint and TargetPrint results with clinical parameters in German patients with early stage breast cancer", INT J MOL MED, vol. 26, pages 837 - 843 |
| GODING: "Monoclonal Antibodies: Principles and Practice", 1986 |
| GRIGORIADIS A ET AL., PNAS, 2009 |
| GRIGORIADIS A; CABALLERO OL; HOEK KS; DA SILVA L; CHEN YT ET AL.: "CT-X antigen expression in human breast cancer", PROC NATL ACAD SCI USA, vol. 106, 2009, pages 13493 - 13498, XP055102095, DOI: doi:10.1073/pnas.0906840106 |
| HELD ET AL., GENOME RESEARCH, vol. 6, 1996, pages 986 - 994 |
| HOD, BIOTECHNIQUES, vol. 13, 1992, pages 852 - 854 |
| HOFMANN 0; CABALLERO OL; STEVENSON BJ; CHEN YT; COHEN T ET AL.: "Genome-wide analysis of cancer/testis gene expression", PROC NATL ACAD SCI USA, vol. 105, 2008, pages 20422 - 20427 |
| HUTLOFF ET AL., NATURE, vol. 397, 1999, pages 263 - 266 |
| IRWIN ET AL., J. VIROL, vol. 68, 1994, pages 5036 - 5044 |
| J. CLIN. ONCOL, vol. 25, 2007, pages 118 |
| JAEGER ELKE ET AL: "Recombinant vaccinia/fowipox NY-ESO-1 vaccines induce both humoral and cellular NY-ESO-1-specific immune responses in cancer patients", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 103, no. 39, 26 September 2006 (2006-09-26), pages 14453 - 14458, XP002564179, ISSN: 0027-8424, DOI: 10.1073/PNAS.0606512103 * |
| JEAN-PHILIPPE THEURILLAT ET AL: "NY-ESO-1 protein expression in primary breast carcinoma and metastases-correlation with CD8+ T-cell and CD79a+ plasmacytic/B-cell infiltration", INTERNATIONAL JOURNAL OF CANCER, vol. 120, no. 11, 1 June 2007 (2007-06-01), pages 2411 - 2417, XP055102109, ISSN: 0020-7136, DOI: 10.1002/ijc.22376 * |
| JUNGBLUTH AA; CHEN YT; STOCKERT E; BUSAM KJ; KOLB D ET AL.: "Immunohistochemical analysis of NY-ESO-1 antigen expression in normal and malignant human tissues", INT J CANCER, vol. 92, 2001, pages 856 - 860 |
| JUNGBLUTH ET AL., INT. J. CANC., vol. 92, 2001, pages 856 - 860 |
| K. SPECHT ET AL., AM. J. PATHOL., vol. 158, 2001, pages 419 - 29 |
| KIM C; PAIK S: "Gene-expression-based prognostic assays for breast cancer", NAT REV CLIN ONCOL, vol. 7, pages 340 - 347 |
| KIM J. ET AL., NAT. BIOTECHNOL., vol. 15, no. 7, 1997, pages 641 - 646 |
| KIRKWOOD JM; BUTTERFIELD LH; TARHINI AA; ZAROUR H; KALINSKI P ET AL.: "Immunotherapy of cancer", CA CANCER J CLIN, 2012 |
| KLEBANOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 101, 2004, pages 1969 - 74 |
| KREIG ET AL., NATURE, vol. 374, 1995, pages 546 - 9 |
| KRELL J; FRAMPTON AE; STEBBING J: "The clinical significance of tumor infiltrating lymphoctyes in breast cancer: does subtype matter?", BMC CANCER, vol. 12, pages 135, XP021124923, DOI: doi:10.1186/1471-2407-12-135 |
| LEE SY; OBATA Y; YOSHIDA M; STOCKERT E; WILLIAMSON B ET AL.: "Immunomic analysis of human sarcoma", PROC NATL ACAD SCI USA, vol. 100, 2003, pages 2651 - 2656 |
| LIU S; LACHAPELLE J; LEUNG S; GAO D; FOULKES WD ET AL.: "CD8+ lymphocyte infiltration is an independent favorable prognostic indicator in basal-like breast cancer", BREAST CANCER RES, vol. 14, pages R48, XP021124503, DOI: doi:10.1186/bcr3148 |
| MARTINET L; GARRIDO I; FILLERON T; LE GUELLEC S; BELLARD E ET AL.: "Human solid tumors contain high endothelial venules: association with T- and B-lymphocyte infiltration and favorable prognosis in breast cancer", CANCER RES, vol. 71, pages 5678 - 5687 |
| MISCHO AXEL ET AL: "Prospective study on the expression of cancer testis genes and antibody responses in 100 consecutive patients with primary breast cancer", INTERNATIONAL JOURNAL OF CANCER, JOHN WILEY & SONS, INC, US, vol. 118, no. 3, 1 March 2006 (2006-03-01), pages 696 - 703, XP002564181, ISSN: 0020-7136, [retrieved on 20050810], DOI: 10.1002/IJC.21352 * |
| MOHAMMED ZM; GOING JJ; EDWARDS J; MCMILLAN DC: "The role of the tumour inflammatory cell infiltrate in predicting recurrence and survival in patients with primary operable breast cancer", CANCER TREAT REV. |
| MOSS, DEV. BIOL. STAND., vol. 82, 1994, pages 55 - 63 |
| MOSS, PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11341 - 11348 |
| NICHOLAOU T; CHEN W; DAVIS ID; JACKSON HM; DIMOPOULOS N ET AL.: "Immunoediting and persistence of antigen-specific immunity in patients who have previously been vaccinated with NY-ESO-1 protein formulated in ISCOMATRIX", CANCER IMMUNOL IMMUNOTHER, vol. 60, pages 1625 - 1637, XP019967532, DOI: doi:10.1007/s00262-011-1041-3 |
| PAOLETTI, PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11349 - 11353 |
| PARKER; BARNES, METHODS IN MOLECULAR BIOLOGY, vol. 106, 1999, pages 247 - 283 |
| PARRA, J. IMMUNOL., vol. 158, 1997, pages 637 - 642 |
| PRAT A; PEROU CM: "Deconstructing the molecular portraits of breast cancer", MOL ONCOL, vol. 5, pages 5 - 23, XP028127402, DOI: doi:10.1016/j.molonc.2010.11.003 |
| PUGACHEV ET AL., VIROLOGY, vol. 212, 1995, pages 587 - 594 |
| REIS-FILHO JS; PUSZTAI L: "Gene expression profiling in breast cancer: classification, prognostication, and prediction", LANCET, vol. 378, pages 1812 - 1823 |
| RHODES DR; KALYANA-SUNDARAM S; MAHAVISNO V; VARAMBALLY R; YU J ET AL.: "Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles", NEOPLASIA, vol. 9, 2007, pages 166 - 180 |
| RHODES DR; YU J; SHANKER K; DESHPANDE N; VARAMBALLY R ET AL.: "ONCOMINE: a cancer microarray database and integrated data-mining platform", NEOPLASIA, vol. 6, 2004, pages 1 - 6, XP008153360, DOI: doi:10.1016/S1476-5586(04)80047-2 |
| RIDGE ET AL., NATURE, vol. 393, 1998, pages 474 |
| ROBBINS PF; MORGAN RA; FELDMAN SA; YANG JC; SHERRY RM ET AL.: "Tumor regression in patients with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes reactive with NY-ESO-1", J CLIN ONCOL, vol. 29, pages 917 - 924, XP002705979, DOI: doi:10.1200/JCO.2010.32.2537 |
| RUPP; LOCKER, LAB INVEST., vol. 56, 1987, pages A67 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRINGS HARBOR LABORATORIES |
| SCANLAN MJ; GORDAN JD; WILLIAMSON B; STOCKERT E; BANDER NH ET AL.: "Antigens recognized by autologous antibody in patients with renal-cell carcinoma", INT J CANCER, vol. 83, 1999, pages 456 - 464 |
| SCANLAN MJ; GORDON CM; WILLIAMSON B; LEE SY; CHEN YT ET AL.: "Identification of cancer/testis genes by database mining and mRNA expression analysis", INT J CANCER, vol. 98, 2002, pages 485 - 492, XP002514555, DOI: doi:10.1002/IJC.10276 |
| SCANLAN MJ; GURE AO; JUNGBLUTH AA; OLD LJ; CHEN YT: "Cancer/testis antigens: an expanding family of targets for cancer immunotherapy", IMMUNOL REV, vol. 188, 2002, pages 22 - 32, XP002978062, DOI: doi:10.1034/j.1600-065X.2002.18803.x |
| SCHENA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, no. 2, 1996, pages 106 - 149 |
| SCHLOM J., J NATL CANCER INST, vol. 104, no. 8, 2012, pages 599 - 613 |
| SCHOENBERGER ET AL., NATURE, vol. 393, 1998, pages 480 |
| SCIARRA; CUTIE: "Remington's Pharmaceutical Sciences", 1990, article "Aerosols", pages: 1694 - 1712 |
| SCIENCE, vol. 268, 1995, pages 1432 - 1434 |
| SERVICE: "Coming Soon: the Pocket DNA Sequencer", SCIENCE, vol. 282, 1998, pages 399 - 401 |
| SERVICE: "Microchips Arrays Put DNA on the Spot", SCIENCE, vol. 282, 1998, pages 396 - 399, XP002955988, DOI: doi:10.1126/science.282.5388.396 |
| SHAUNA H YUAN ET AL: "Cell-Surface Marker Signatures for the Isolation of Neural Stem Cells, Glia and Neurons Derived from Human Pluripotent Stem Cells", vol. 6, no. 3, 1 March 2011 (2011-03-01), pages e17540.1 - e17540.16, XP002696784, ISSN: 1932-6203, Retrieved from the Internet <URL:http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0017540> DOI: 10.1371/JOURNAL.PONE.0017540 * |
| SIMPSON AJ; CABALLERO OL; JUNGBLUTH A; CHEN YT; OLD LJ: "Cancer/testis antigens, gametogenesis and cancer", NAT REV CANCER, vol. 5, 2005, pages 615 - 625 |
| SO ET AL., MOL. CELLS, vol. 7, 1997, pages 178 - 186 |
| SUGITA YURIKA ET AL: "NY-ESO-1 expression and immunogenicity in malignant and benign breast tumors", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 64, no. 6, 15 March 2004 (2004-03-15), pages 2199 - 2204, XP002355501, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-03-3070 * |
| T. E. GODFREY ET AL., J. MOLEC. DIAGNOSTICS, vol. 2, 2000, pages 84 - 91 |
| TAKAHASHI K; SHICHIJO S; NOGUCHI M; HIROHATA M; ITOH K: "Identification of MAGE-1 and MAGE-4 proteins in spermatogonia and primary spermatocytes of testis", CANCER RES, vol. 55, 1995, pages 3478 - 3482 |
| THEURILLAT JP; INGOLD F; FREI C; ZIPPELIUS A; VARGA Z ET AL.: "NY-ESO-1 1 protein expression in primary breast carcinoma and metastases: correlation with CD8+ T-cell and CD79a+ plasmacytic/B-cell infiltration", INT J CANCER, vol. 120, 2007, pages 2411 - 2417, XP055102109, DOI: doi:10.1002/ijc.22376 |
| TOWNSEND ET AL., J. VIROL., vol. 71, 1997, pages 3365 - 3374 |
| TYAGI P; MIRAKHUR B: "MAGRIT: the largest-ever phase III lung cancer trial aims to establish a novel tumor-specific approach to therapy", CLIN LUNG CANCER, vol. 10, pages 371 - 374 |
| VELCULESCU ET AL., CELL, vol. 88, 1997, pages 243 - 51 |
| VELCULESCU ET AL., SCIENCE, vol. 270, 1995, pages 484 - 487 |
| WANG ET AL., J. IMMUNOL., vol. 19, 1986, pages 1 - 8 |
| WANG Z ET AL., NATURE REVIEW GENETIC, vol. 10, no. 1, 2009, pages 57 - 63 |
| WEIS ET AL., TRENDS IN GENETICS, vol. 8, 1992, pages 263 - 264 |
| WENDTNER ET AL., GENE THER., vol. 4, no. 7, 1997, pages 726 - 735 |
| WISCHNEWSKI F; PANTEL K; SCHWARZENBACH H: "Promoter demethylation and histone acetylation mediate gene expression of MAGE-A1, -A2, -A3, and -A12 in human cancer cells", MOL CANCER RES, vol. 4, 2006, pages 339 - 349 |
| WOLCHOK JD; RIZZUTO G ET AL.: "Agonist Anti-GITR Antibody Enhances Vaccine-Induced CD8+ T-Cell Responses and Tumor Immunity", CANCER RES, vol. 66, 2006, pages 4904 - 4912, XP055049643, DOI: doi:10.1158/0008-5472.CAN-05-2813 |
| XIANG ET AL., VIROLOGY, vol. 219, 1996, pages 220 - 227 |
| YUAN J; ADAMOW M; GINSBERG BA; RASALAN TS; RITTER E ET AL.: "Integrated NY-ESO-1 antibody and CD8+ T-cell responses correlate with clinical benefit in advanced melanoma patients treated with ipilimumab", PROC NATL ACAD SCI USA, vol. 108, pages 16723 - 16728, XP055067032, DOI: doi:10.1073/pnas.1110814108 |
| ZHANG ET AL.: "Automated and Integrated System for High-Throughput DNA Genotyping Directly from Blood", ANAL. CHEM., vol. 71, 1999, pages 1138 - 1145, XP000831550, DOI: doi:10.1021/ac981139j |
| ZHAO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 3009 - 3013 |
| ZHENG P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 11, 1998, pages 6284 - 6289 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016187656A1 (en) * | 2015-05-22 | 2016-12-01 | La Trobe University | Method of diagnosis of breast cancer |
| US11243205B2 (en) | 2015-05-22 | 2022-02-08 | Peter Maccallum Cancer Institute | Method of diagnosis of breast cancer |
| WO2017181149A1 (en) * | 2016-04-15 | 2017-10-19 | Blaze Bioscience, Inc. | Methods of treating breast cancer |
| US12048732B2 (en) | 2016-04-15 | 2024-07-30 | Blaze Bioscience, Inc. | Methods of treating breast cancer |
| WO2018148180A3 (en) * | 2017-02-07 | 2018-09-27 | Immune Design Corp. | Materials and methods for identifying and treating cancer patients |
| WO2020153800A3 (en) * | 2019-01-24 | 2020-12-10 | 주식회사 네오젠티씨 | Composition for preventing or treating triple negative breast cancer, containing tumor infiltrating lymphocytes as active ingredient |
| WO2022122938A1 (en) * | 2020-12-09 | 2022-06-16 | The Institute Of Cancer Research | Hormad1 therapeutics |
| RU2757590C1 (en) * | 2021-04-12 | 2021-10-19 | Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии имени Н.Н. Блохина" Министерства здравоохранения Российской Федерации (ФГБУ "НМИЦ онкологии им. Н.Н. Блохина" Минздрава России) | Method for determining the prognosis of the effectiveness of breast cancer therapy |
| WO2023200929A1 (en) * | 2022-04-15 | 2023-10-19 | Instil Bio, Inc. | Tumor-infiltrating lymphocyte (til) compositions and uses thereof |
| RU2806299C1 (en) * | 2022-06-23 | 2023-10-30 | Государственное бюджетное учреждение здравоохранения города Москвы "Московский клинический научно-практический центр имени А.С. Логинова Департамента здравоохранения города Москвы" | Method of diagnosing regression of breast cancer after neoadjuvant drug therapy |
| RU2824957C1 (en) * | 2023-06-06 | 2024-08-16 | Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии имени Н.Н. Петрова" Министерства здравоохранения Российской Федерации | Method for assessing histological material obtained using vacuum-assisted biopsy for removal of tumour bed in patients diagnosed with breast cancer her2-positive or thrice-negative subtype after neoadjuvant systemic therapy |
| RU2846532C1 (en) * | 2025-02-25 | 2025-09-08 | Светлана Анатольевна Шевченко | Method for determining molecular-biological subtype of breast cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11676731B2 (en) | Diagnostic and therapeutic methods for the treatment of breast cancer | |
| Ding et al. | Prognostic biomarkers of cutaneous melanoma | |
| TWI710642B (en) | Methods of treating cancer patients with farnesyltransferase inhibitors | |
| EP3368683B1 (en) | Method for the quantification of pd-l1 | |
| US20110189670A1 (en) | Circulating Tumor and Tumor Stem Cell Detection Using Genomic Specific Probes | |
| US11447830B2 (en) | Gene signatures to predict drug response in cancer | |
| Alistar et al. | Dual roles for immune metagenes in breast cancer prognosis and therapy prediction | |
| WO2014074785A1 (en) | Methods of predicting outcome and treating breast cancer | |
| Jovčevska | Sequencing the next generation of glioblastomas | |
| US8980557B2 (en) | Marker for determination of sensitivity to triplet combination anti-cancer agent | |
| US12590335B2 (en) | Targeted measure of transcriptional activity related to hormone receptors | |
| US11851712B2 (en) | Replication stress response biomarkers for immunotherapy response | |
| US20140329714A1 (en) | Stat3 activation as a marker for classification and prognosis of dlbcl patients | |
| Wei et al. | Prognostic value and immunological role of FOXM1 in human solid tumors | |
| US20120237931A1 (en) | Identification and monitoring of circulating cancer stem cells | |
| US20230266325A1 (en) | Methods for detecting lung cancer | |
| EP3050975A1 (en) | Method for predicting the response to chemotherapy treatment in patients suffering from colorectal cancer | |
| Furukawa et al. | Genetic alterations in lung adenocarcinoma with a micropapillary component | |
| Jain | Personalized therapy of cancer | |
| Mo et al. | Pan-cancer analysis to provide a reliable basis for the clinical use of TIM-3 immunosuppressants | |
| Chang et al. | Analysis of mutational spectra in metastatic colorectal carcinoma: KRAS as an indicator of oxaliplatin-based chemotherapy | |
| Hardell | Prognosis based classification and tumor biology of uterine sarcomas | |
| Murphy et al. | Pharmacogenetics and pharmacogenomics I: linking diagnostic classification to therapeutic decisions | |
| BR112018072286B1 (en) | IN VITRO METHOD TO DETERMINE TUMOR ENDOCRINE SENSITIVITY OF AN INDIVIDUAL WITH BREAST CANCER |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13795382 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13795382 Country of ref document: EP Kind code of ref document: A1 |

