WO2014067534A1 - Vanillin synthase - Google Patents

Vanillin synthase Download PDF

Info

Publication number
WO2014067534A1
WO2014067534A1 PCT/DK2013/050357 DK2013050357W WO2014067534A1 WO 2014067534 A1 WO2014067534 A1 WO 2014067534A1 DK 2013050357 W DK2013050357 W DK 2013050357W WO 2014067534 A1 WO2014067534 A1 WO 2014067534A1
Authority
WO
WIPO (PCT)
Prior art keywords
vanillin
ferulic acid
plant
synthase
microbial organism
Prior art date
Application number
PCT/DK2013/050357
Other languages
French (fr)
Inventor
Birger LINDBERG MØLLER
Esben HALKJÆR HANSEN
Jørgen Hansen
Nethaji JANESHAWARI GALLAGE
Original Assignee
Evolva Sa
University Of Copenhagen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Evolva Sa, University Of Copenhagen filed Critical Evolva Sa
Priority to CA2888636A priority Critical patent/CA2888636C/en
Priority to BR112015009849A priority patent/BR112015009849A2/en
Priority to US14/438,200 priority patent/US10689672B2/en
Priority to EP13791920.5A priority patent/EP2914733A1/en
Priority to AU2013339881A priority patent/AU2013339881B2/en
Priority to CN201380057126.6A priority patent/CN104769121B/en
Priority to JP2015541015A priority patent/JP6594205B2/en
Publication of WO2014067534A1 publication Critical patent/WO2014067534A1/en
Priority to HK16101658.3A priority patent/HK1213943A1/en
Priority to AU2017265117A priority patent/AU2017265117B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/24Preparation of oxygen-containing organic compounds containing a carbonyl group
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/20Synthetic spices, flavouring agents or condiments
    • A23L27/24Synthetic spices, flavouring agents or condiments prepared by fermentation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • C12N9/1051Hexosyltransferases (2.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/44Preparation of O-glycosides, e.g. glucosides
    • C12P19/46Preparation of O-glycosides, e.g. glucosides having an oxygen atom of the saccharide radical bound to a cyclohexyl radical, e.g. kasugamycin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/03038Vanillyl-alcohol oxidase (1.1.3.38)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y204/00Glycosyltransferases (2.4)
    • C12Y204/01Hexosyltransferases (2.4.1)
    • C12Y204/01126Hydroxycinnamate 4-beta-glucosyltransferase (2.4.1.126)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/02Aldehyde-lyases (4.1.2)
    • C12Y401/02041Vanillin synthase (4.1.2.41)

Definitions

  • Vanillin synthase Field of invention The present invention relates to methods for production of vanillin as well as to host organisms, such as microbial organisms or plants useful for such production.
  • vanilla is the world's most popular flavor compound and used in numerous commercial products including many foods. Natural vanilla is obtained from the pods of the epiphytic climbing orchids Vanilla planifolia Andrews and Vanilla tahitensis belonging to the genus Vanilla included in the order Orchidales within the monocotyledonous plants. Vanillin (3-methoxy-4-hydroxybenzaldehyde) is the main flavor compound in the vanilla extract obtained from fermented vanilla pods. In high concentrations, vanillin is toxic to living cells. In the pod it accumulates as the non-toxic phytoanticipin vanillin glucoside, which upon tissue damage is converted into the active defense compound.
  • vanillin glucoside During fermentation and curing of the vanilla pods for use as flavor ingredient, a major part of the vanillin glucoside is hydrolyzed to provide free vanillin.
  • the estimated total world market for vanillin is 10500 tons per annum.
  • Production of natural vanillin from the vanilla pods is a laborious, slow and costly process.
  • Production of 1 kilogram of vanillin requires approximately 500 kilograms of vanilla pods, corresponding to the pollination of approximately 40,000 flowers.
  • vanilla pods Most majority is produced synthetically from different fossil hydrocarbons like eugenol or by acid hydrolysis of lignin.
  • vanillin has been produced in yeast, fungi, bacteria and in in vitro cell cultures by expressing genes from other organisms which encode enzymes that in combination would form vanillin from exogenously added substrates structurally related to vanillin.
  • Phenylalanine-derived volatiles are categorized as Ce-C ⁇ C 6 -C 2 , C 6 -C 3 compounds based on their carbon skeleton. Both vanillin glucoside and p-hydroxybenzaldehyde glucoside, the two most abundant compounds found in mature vanilla pods, are C 6 -Ci compounds.
  • the two major aroma compounds in natural vanilla are p-hydroxybenzaldehyde and vanillin. Because p-hydroxybenzaldehyde contains some of the same structural elements of vanillin, it has been thought of as a precursor for vanillin. The pathway from vanillin has been postulated to constitute a metabolic grid of metabolites all derived from phenylalanine. US2003/0070188 describes methods for possible p- hydroxybenzaldehyde production in embryogenic cell cultures from Vanilla planifolia.
  • Podstolski et al., 2002 describes that 4-hydroxy-benzaldehyde synthase (4-HBS) converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement.
  • 4-HBS 4-hydroxy-benzaldehyde synthase
  • the present invention provides an enzyme (herein designated vanillin synthase), which is capable of converting ferulic acid or a ferulic acid derivative to vanillin.
  • This enzyme may be employed in the production of vanillin in a number of different host organisms as well as in vitro.
  • the invention provides methods of producing vanillin from ferulic acid, wherein the methods involve use of a host organism expressing vanillin synthase, and wherein the ferulic acid may be added to said host organism or said host organism is capable of producing ferulic acid. Accordingly, the invention provides methods of producing vanillin, said methods comprising
  • i. is capable of producing ferulic acid
  • ii. comprises a heterologous nucleic acid encoding vanillin synthase
  • VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith;
  • the invention also provides methods of producing vanillin, vanillyl alcohol, vanillin glucoside and/or vanillyl alcohol glucoside, said methods comprising
  • i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding a vanillin synthase,
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin;
  • i. is capable of producing ferulic acid
  • ii. comprises a heterologous nucleic acid encoding vanillin synthase
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. VpVAN of SEQ ID NO: 1
  • NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith.
  • It is also an aspect of the invention to provide methods of producing vanillin said method comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g.
  • VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith;
  • Figure 1 shows a LC-MS chromatogram from in vitro feedings of 1/pVAN.
  • the figure shows that the enzyme is able to catalyze carbon two cleavage of ferulic acid to vanillin. This reaction does not require CoASH, ATP and NAD+ as co-factors.
  • VAN is able to catalyze carbon two cleavage of ferulate CoA to vanillin in the presence of ATP, NAD + .
  • Figure 2 shows formation of vanillin glucoside by yeast strains having 1/pVAN stably integrated into the yeast chromosome together with Arabidopsis thaliana UGT72E2.
  • the yeast strains were grown in Delft medium supplemented with 8% molasses before metabolite profiles were determined by LC-MS. (EIC 317 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22)
  • FIG. 3 shows the result of biosynthetic studies carried out with yeast harboring stably integrated Wt l/pVAN, 1/pVAN codon optimized for yeast expression, truncated l/pVAN devoid of the signal peptide (wt vp Asp van) and with truncated l/pVAN devoid of the signal peptide and codon optimized for yeast expression, (vp Asp van).
  • the yeast strains were incubated with different putative substrates for 72h in synthetic media before metabolite profiles were determined by LC-MS. Formation of vanillin glucoside was observed with yeast fed with ferulic acid. (EIC 337 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22).
  • Figure 4 shows Substrate specificity of 1/pVAN tested with ferulic acid and ferulic acid glucoside.
  • LC-MS extracted ion chromatograms show that l/pVAN is able to catalyze the chain cleavage of both ferulic acid and ferulic acid glucoside.
  • EIC 337 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22).
  • VpVAN VpUGT72U1 fed with ferulic acid
  • VpVAN : JGT72E2 fed with ferulic acid
  • Figure 5 shows biological activity of vanillin synthase after a transient expression in Nicotiana benthamiana.
  • l/pVAN was transferred to Agrobacterium tumefaciens and co- infiltrated with an A. tumefaciens strain harboring the p19 gene silencing suppressor in N. benthamiana leaves.
  • Four days after inoculation the infiltrated tobacco leaves were harvested and subjected to metabolite profiling by LC-MS.
  • the profiling showed l/pVAN dependent formation of vanillyl alcohol glucoside. (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22).
  • Figure 6 shows a LC-MS chromatogram from in vitro coupled transcription and translation (TNT) assays. The figure shows generation of significant amounts of vanillin glucoside (peak at 6 min.) after in vitro incubation with ferulic acid glucoside.
  • Figure 7A shows biological activity of vanillin synthase after transient expression in Nicotiana benthamiana leaves.
  • the Nicotiana benthamiana has been transformed with nucleic acids encoding:
  • the figure shows formation of vanillyl alcohol glucoside. (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22) in extracts expressing vanillin synthase or truncated vanillin synthase.
  • Figure 7B shows biological activity of a chimeric vanillin synthase compared to wild type 1/pVAN after transient expression in Nicotiana benthamiana leaves.
  • the Nicotiana benthamiana has been transformed with nucleic acids encoding:
  • the figure shows formation of most vanillyl alcohol glucoside in a) (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22) in extracts expressing vanillin synthase or truncated vanillin synthase.
  • Figure 8 shows biological activity of a vanillin synthase of Glechoma hederacea (G AN) after a transient expression in Nicotiana benthamiana leaves.
  • the Nicotiana benthamiana has been transformed with nucleic acids encoding G AN (upper panel).
  • Lower panel shows a negative control.
  • the figure shows formation of vanillin alcohol glucoside.
  • Figure 9 shows 4-vinylguaiacol glucoside production in yeast expressing 1/pVAN (SEQ ID NO:1 ) and absence of this unwanted side product in yeast expressing 1/pVAN (SEQ ID NO:1 ) and lacking the padl and fadl genes.
  • Figure 10 shows an alignment between Cysteine protease of Nicotiana benthamiana and vanillin synthase of Vanilla planifora (VpVAN). The consensus sequence between the two sequences is given below. Non-conserved amino acids are marked by * .
  • Figure 1 1 shows an alignment between Vanillin synthase of Glechoma hederacea
  • Figure 12 shows that yeast cells expressing Arabidopsis thaliana UGT72E2 (SEQ ID NO:3) synthesizes ferulic acid glucoside when grown on synthetic media comprising 2.5 mM ferulic acid.
  • the present invention relates to vanillin synthase and uses thereof.
  • the invention in particular relates to methods of producing vanillin or vanillin glucoside using a host organism expressing vanillin synthase according to the invention.
  • the host organism may be any of the microbial organisms described herein below in the section "Microbial organism” or the host organism may be any of the plants described herein below in the section "Plants”.
  • the host organism will contain a heterologous nucleic acid encoding vanillin synthase and optionally also one or more additional heterologous nucleic acids as described herein below.
  • the vanillin synthase according to the present invention is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin.
  • the vanillin synthase according to the present invention is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin in vivo in a plant.
  • the vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin in vivo in microbial organisms.
  • the term herein refers to 3-methoxy-4-hydroxybenzaldehyde of the
  • ferulic acid The structure of ferulic acid is provided herein below in the section "ferulic acid”.
  • the vanillin synthase to be used with the present invention may be vanillin synthase from any suitable origin, preferably the vanillin synthase is vanillin synthase of a plant, wherein said plant naturally produces vanillin, vanillyl alcohol, vanillin glycoside and/or vanillyl alcohol glycoside.
  • the vanillin synthase is vanillin synthase of Vanilla planifolia.
  • a preferred vanillin synthase to be used with the invention is vanillin synthase of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the vanillin synthase is vanillin synthase of SEQ ID NO:1 .
  • sequence identity is preferably calculated as described herein below in the section "Sequence identity”.
  • sequence identity A functional homologue of a vanillin synthase of a given sequence shares above-mentioned sequence identity and is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
  • Additional useful vanillin synthases may be identified by any suitable method known to the skilled person, for example by a method comprising the steps of
  • nucleic acids e.g. DNA or cDNA
  • nucleic acid encoding a polypeptide having a sequence with at least 50%, such as at least 60%, for example at least 70% sequence identity to SEQ ID NO:1 d) testing whether the polypeptide encoded by said nucleic acid is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
  • the method may also comprise the steps of
  • polypeptide as tested in any of the steps d) described above is capable of catalysing side chain cleavage of ferulic acid to form vanillin, then said polypeptide is a vanillin synthase, which may be useful with the present invention.
  • vanillin synthase to be used with the invention is vanillin synthase of SEQ ID NO:21 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the vanillin synthase is vanillin synthase of SEQ ID NO:21 .
  • sequence identity is preferably calculated as described herein below in the section "Sequence identity”.
  • sequence identity A functional homologue of a vanillin synthase of a given sequence shares above-mentioned sequence identity and is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
  • functional homologues retain as many of the amino acids conserved amongst different vanillin synthases.
  • functional homologues of SEQ ID NO:1 comprises at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids of the consensus sequence of figure 1 1 , for example at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids not marked by * in the alignment shown in figure 1 1 .
  • functional homologues of SEQ ID NO:21 comprises at least 90%, more preferably at tleast 95%, yet more preferably at least 98%, such as all of the amino acids of the consensus sequence of figure 1 1 , for example at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids not marked by * in the alignment shown in figure 1 1 .
  • the vanillin synthase to be used with the present invention may also be vanillin synthase devoid of the signal peptide. This is in particular the case in embodiments of the invention where the nucleic acid sequence encoding vanillin synthase is introduced into microbial cells.
  • the vanillin synthase to be used with the present invention is vanillin synthase lacking all or at least part of the signal peptide, which directs the protein to the endoplasmatic reticulum of plants.
  • the vanillin synthase may comprise at least or even consist of aa 22 to 356 of SEQ ID NO:1 or a functional homologue thereof sharing at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98% sequence identity therewith.
  • the vanillin synthase to be used with the present invention is vanillin synthase of SEQ ID NO:17 or a functional homologue thereof sharing at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the vanillin synthase to be used with the present invention may also be a truncated vanillin synthase, which is capable of catalyzing side chain cleavage of ferulic acid to form vanillin.
  • the vanillin synthase may lack one or more N-terminal amino acids, for example the vanillin synthase maybe
  • Vanillin synthase of SEQ ID NO:1 lacking the 21 most N-terminal amino acids g) Vanillin synthase of SEQ ID NO:1 lacking the 61 most N-terminal amino acids h) Vanillin synthase of SEQ ID NO:1 lacking the 137 most N-terminal amino acids i) Vanillin synthase of SEQ ID NO:21 lacking the 21 most N-terminal amino acids j) Vanilline synthase of SEQ ID NO:21 lacking the 140 most N-terminal amino acid k) a functional homologue of any of a) to j) sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
  • the truncated vanillin synthase may be a) vanillin synthase comprising or consisting of aa 22 to 356 of SEQ ID NO:1 b) vanillin synthase comprising or consisting of aa 138 to 356 of SEQ ID NO:1 c) vanillin synthase comprising or consisting of aa 22 to 359 of SEQ ID NO:21 d) vanillin synthase comprising or consisting of aa 141 to 359 of SEQ ID NO:21 e) a functional homologue of any of a) to d) sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
  • the vanillin synthase is a chimeric protein containing sequences from a naturally occurring vanillin synthase as well as other sequences.
  • the vanillin synthase may be a polypeptide of the following formula:
  • the signal peptide may be any signal peptide.
  • the skilled person will be able to identify a signal peptide, for example using the SignalP 4.1 . software, which is readily available from Center for Biological Sequence analysis at the Technical University of Denmark.
  • the signal peptide is a signal peptide endogenous to the host organism (i.e. the host organism containing a heterologous nucleic acid encoding said vanillin synthase). More preferably, the signal peptide is a signal peptide from a cysteine protease endogenous to the host organism. Even more preferably, the signal peptide is a signal peptide from a cysteine protease belonging to the Clan CA, more preferably to the Family C1 , even more preferably to the Subfamily A, wherein said cysteine protease is endogenous to the host organism. Said clan, family and subfamily is as defined by MEROPS Database.
  • the cysteine protease may be a cysteine protease belonging to the class of aleurain cysteine proteases.
  • signal peptide being from a cysteine protease is in particular applicable in embodiments of the invention where the host organism is a plant.
  • the signal peptide may thus be identified by a method comprising the steps of
  • nucleic acids encoding polypeptides or sequence information of polypeptides of the host organism
  • X may be any linker sequence linking the signal peptide and the cleavage site.
  • said linker sequence X may be a sequence from a naturally occurring vanillin synthase.
  • X may be aa 22 to 134 of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith over the entire length.
  • the cleavage site may be any protease cleavage site. In particular, it is preferred that the cleavage site is endogenous to the host organism.
  • the cleavage site is a cleavage site from a cysteine protease endogenous to the host organism. Even more preferably, the cleavage site is a cleavage site from a cysteine protease belonging to the Clan CA, more preferably to the Family C1 , even more preferably to the Subfamily A, wherein said cysteine protease is endogenous to the host organism. Said clan, family and subfamily is as defined by MEROPS Database.
  • the cysteine protease may be a cysteine protease belonging to the class of aleurain cysteine proteases. Aforementioned regarding the cleavage site being from a cysteine protease is in particular applicable in embodiments of the invention where the host organism is a plant.
  • the cleavage site may be identified by a method comprising the steps of
  • nucleic acids encoding polypeptides or sequence information of polypeptides of the host organism
  • the truncated vanillin synthase may be any of the truncated vanillin synthases described herein above.
  • the truncated vanillin synthase may comprise or consists of aa 142 to 356 of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith over the entire length.
  • the heterologous nucleic acid may be any heterologous nucleic acid encoding a vanillin synthase described in this section.
  • the heterologous nucleic acid may be a nucleic acid comprising SEQ ID NO:2 or a nucleic acid capable of hybridizing to the complementary sequence of SEQ ID NO:2.
  • the heterologous nucleic acid encoding vanillin synthase has been fully or partly codon optimized for the particular microbial organism comprising the heterologous nucleic acid.
  • Optimizer which is described in Puigbo et al., 2007, OPTIMIZER: A web server for optimizing the codon usage of DNA sequences, Nucleic Acids Research, 35:W126-W131 and Puigbo et al., 2008, HEG-DB: a database of predict highly expressed genes in prokaryotic complete genomes under translational selection, Nucleic Acids Research.
  • the heterologous nucleic acid encoding vanillin synthase may be codon optimised for the particular microbial organism used.
  • the heterologous nucleic acid encoding vanillin synthase may be partly codon optimised for the particular microbial organism used, or the heterologous nucleic acid encoding vanillin synthase may be fully codon optimised for the particular microbial organism used.
  • the heterologous nucleic acid encoding vanillin synthase may be codon optimised for use in yeast, such as for use in S. cerevisiae, for example the heterologous nucleic acid encoding vanillin synthase may comprise or even consist of SEQ ID NO: 18.
  • the present invention relates to methods for the production of vanillin.
  • the methods involve use of vanillin synthase, which may be any of the vanillin synthases described herein above in the section "vanillin synthase".
  • the methods involve use of a host organism expressing a vanillin synthase.
  • the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said method comprising the steps of a) Providing a microbial organism, wherein said microbial organism
  • i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding vanillin synthase,
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and
  • the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism”.
  • Said microbial organism is capable of producing ferulic acid or a ferulic acid derivative (e.g. ferulic acid glucoside).
  • the microbial organism is capable of producing ferulic acid.
  • the microbial organism may contain nucleic acid sequences encoding one or more enzymes involved in synthesis of ferulic acid, such as any of the enzymes described herein below in the section "Enzymes involved in synthesis of ferulic acid”.
  • the nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". It is preferred that the methods are methods of preparing vanillin.
  • the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said methods comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and cultivating said microbial organism in the presence of ferulic acid or a ferulic acid derivative in culture medium supporting growth of said microbial organism
  • the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism”.
  • the nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase”.
  • the culture medium may comprise ferulic acid originating from any suitable source, and/or the culture medium may comprise a ferulic acid derivative, e.g. ferulic acid glucoside.
  • the ferulic acid may be provided in any of the ways described herein below in the section "Ferulic acid”.
  • the method is a method of producing vanillin.
  • the invention relates to methods of producing vanillin, said method comprising the steps of a) Providing a microbial organism, wherein said microbial organism
  • i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding vanillin synthase,
  • vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and
  • iii. is capable of glucosylating vanillin
  • the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism”.
  • Said microbial organism is capable of producing ferulic acid or a ferulic acid derivative (e.g. ferulic acid glucoside).
  • the microbial organism is capable of producing ferulic acid.
  • the microbial organism may contain nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid, such as any of the enzymes described herein below in the section "Enzymes involved in synthesis of ferulic acid”.
  • Said microbial organism is also capable of glucosylating vanillin. This may be achieved in various ways.
  • the microbial organism may contain a nucleic acid sequence encoding a glucosyl transferase, preferably the microbial organism contains a nucleic acid sequence encoding any of the glucosyl transferases described herein below in the section "Glycosyl transferases”.
  • the nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase”. Deglucosylating said vanillin glucoside may be performed as described herein below.
  • the invention relates to a method of producing vanillin, wherein the method comprises the steps of a) providing a microbial organism, wherein said microbial organism
  • i. comprises a heterologous nucleic acid sequence encoding vanillin
  • vanillin synthase wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g.
  • VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith;
  • iii. is capable of glucosylating vanillin
  • the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism”.
  • the nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase”.
  • the culture medium may comprise ferulic acid and/or ferulic acid derivative (e.g. ferulic acid glucoside).
  • the culture medium contains ferulic acid.
  • Said ferulic acid may originate from any suitable source, in particular the ferulic acid may be provided in any of the ways described herein below in the section "Ferulic acid”. Deglucosylating said vanillin glucoside may be performed as described herein below.
  • the microbial organism may be cultivated in any culture medium suitable for cultivating microbial organism.
  • the skilled person will be able to select a suitable culture medium depending on the particular microbial organism.
  • the growth conditions should be selected so that the vanillin synthase is expressed in said microbial organism.
  • the microbial organism may be grown in a fed batch or continuous process. Typically, the microbial organism is grown in a fermentor at a defined temperature(s) for a desired period of time.
  • other heterologous nucleic acids encoding enzymes involved in synthesis of ferulic acid and/or glucoside transferases may also be present and expressed.
  • vanillin or vanillin glucoside can be produced using whole cells that are fed ferulic acid and/or a ferulic acid derivative, which may be provided in any of the ways described herein below in the section "Ferulic acid".
  • the ferulic acid be contained in the culture medium, it may be fed during cell growth or after cell growth.
  • the culture medium comprises ferulic acid.
  • the microbial organism may be grown in suspension or immobilized. In embodiments of the invention where the microbial organism is bacteria or fungi, such as yeast, then preferably the microbial organism is grown in suspension.
  • the culture medium does not contain high levels of coumaric acid, for example the culture medium may contain at the most 1 mM, such as at the most 0.5mM, for example at the most 0.01 mM, such as no detectable coumaric acid.
  • the vanillin is produced under conditions, which are not too reducing. According, in one embodiment it is preferred that the culture medium comprises less than 5 mM, preferably less than 3 mM DTT. In embodiments of the invention where vanillin is prepared in vitro it is preferred that ferulic acid and/or the ferulic acid derivative is incubated with vanillin synthase in the presence of at the most 5 mM, preferably at the most 3 mM DTT.
  • the method relates to production of vanillin or vanillin glucoside, said vanillin glucoside is preferably vanillin beta-D-glucoside.
  • the amount of vanillin or vanillin glucoside produced can be from about 1 mg/l to about 1 ,500 mg/L, or higher.
  • longer culture times will lead to greater amounts of product.
  • the microbial organism can be cultured for from 1 day to 7 days, from 1 day to 5 days, from 3 days to 5 days, about 3 days, wherein
  • vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside can then be recovered from the culture using any useful techniques known in the art.
  • methods for isolating vanillin and/or vanillin glucoside may comprisethe percolation technique or supercritical carbon dioxide extraction and reverse osmosis for concentration.
  • Vanillin and/or vanillin glucoside may also be recovered by methods involving isolation and purification by extraction, vacuum distillation and multi-stage re- crystallization from aqueous solutions and ultrafiltration (e.g. as described by
  • Two-phase extraction processes employing either sulphydryl compounds, such as dithiothreitol, dithioerythritol, glutathione, or L-cysteine (US Patent No. 5,128,253), or alkaline KOH solutions (WO 94/13614), may also be used in the recovery of vanillin and/or vanillin glucoside as well as for its separation from other aromatic substances. Vanillin adsorption and pervaporation from
  • bioconverted media using polyether- polyamide copolymer membranes may also be employed for isolating vanillin and/or vanillin glucoside (e.g. as described by Boddeker, et al. (1997) supra; or Zucchi, et al. (1998) J. Microbiol. Biotechnol. 8 : 719- '22).
  • Macroporous adsorption resins with crosslinked-polystyrene framework may also been used to recover dissolved vanillin and/or vanillin glucoside from aqueous solutions (Zhang, et al . (2008) Eur. Food Res. Technol. 226:377-383).
  • Ultrafiltration and membrane contactor (MC) techniques may also be useful to recover vanillin and/or vanillin glucoside (Zabkova, et al. (2007) J. Membr. Sci. 301 :221 -237; Scuibba, et al. (2009) Desalination 241 :357-364).
  • conventional techniques such as percolation or supercritical carbon dioxide extraction and reverse osmosis for concentration could be used. If the recombinant host is a plant or plant cells, vanillin or vanillin glucoside can be extracted from the plant tissue using various techniques known in the art.
  • the vanillin or vanillin glucoside is isolated and purified to homogeneity ⁇ e.g., at least 90%, 92%, 94%, 96%, or 98% pure).
  • the vanillin or vanillin glucoside is provided as an extract from a microbial organism. In this respect, vanillin or vanillin glucoside may be isolated, but not necessarily purified to homogeneity.
  • Extracts of isolated, and optionally purified, vanillin or vanillin glucoside for example find use in flavoring consumables such as food products, dietary supplements, nutraceuticals, pharmaceutical compositions, dental hygienic compositions, and cosmetic products.
  • the method may frequently also contain a step of
  • This step may be performed prior to isolation of the vanillin glucoside or subsequently to isolation of vanillin glucoside.
  • glucosylation can e.g. be achieved first by recovering vanillin glucoside for instance by extracting it in a suitable solvent, e.g. methanol, or by collecting it after excretion from the producing microbial organism or plant. Secondly, the glucosylated intermediate may be purified and exposed to a beta-glucosidase in vitro or to an adequate chemical hydrolysis.
  • the glucosidase may be provided in various forms, for example the glucosidase may be provided in form of a microbial organism expressing said glucosidase and preferably excreting said glucosidase. Such a microbial organism may be co-cultured together with the microbial organism comprising the vanillin synthase of the invention.
  • the glucosidase may also be provided in the form of an extract of an organism expressing the glucosidase. Said extract may be a crude extract or a partly purified extract.
  • the glucosidase may also be provided as the purified enzyme.
  • the glucosidase may be added directly to the culture medium during cultivation of the microbial organism comprising the vanillin synthase. However, preferably it is added after cultivation. Thus it may be added directly to the culture medium after cultivation of the microbial organism comprising the vanillin synthase or it may be added to partly purified vanillin glucoside or even to purified vanillin glucoside. Thus, the isolated vanillin glucoside may be treated with said extract, said partly purified extract or said purified glucosidase.
  • Glucosylation of vanillin may also facilitate isolation: Hydrophobic impurities in the culture medium accumulating vanillin glucoside can be removed by two phase partitioning where vanillin glucoside will partition to the aqueous phase while hydrophobic impurities may partition to the organic phase. Following degycosylation, for example by beta-glucosidase treatment, the two phase partitioning process may be repeated to achieve removal of hydrophilic contaminants.
  • the purification may comprise the steps of:
  • the organic phase may be any useful organic phase, e.g. the organic phase may be composed of hexane, diethylether, ethylacetate or chloroform.
  • the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said method comprising
  • the plant may be any of the plants described herein below in the section "Plant”.
  • the nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase”.
  • the method is a method for producing vanillin.
  • the invention relates to methods of producing vanillin glucosides, said method comprising
  • the plant may be cultivated in any manner suitable for culturing the specific plant.
  • the skilled person will be able to select suitable conditions for cultivating a particular plant.
  • the vanillin, vanillyl alcohol and/or vanillin glucoside may be isolated from any useful part of the plant, for example from the leaves, from the fruits, from the seeds, from the roots, or from the stems. Frequently, vanillin, vanillyl alcohol or vanillin glucoside will be isolated from leaves, seeds or fruits of the plant. For example in embodiments of the invention, where the plant is Nicotiana tabacum, then vanillin or vanillin glucoside may be isolated from the leaves.
  • the isolation in general comprises a step of extraction, which may then optionally be followed by one or more purification steps, for example any of the purification steps described herein above in this section. Deglucosylation of vanillin glucoside may also be performed as described herein above in this section.
  • said plant producing at least 3 times, such as at least 4 times, for example at least 5 times, such as at least 10 times more vanillin compared to an identical plant, which does not comprise said heterologous nucleic acid encoding vanillin synthase.
  • Extracts comprising vanillin or isolated vanillin prepared as described by the present invention e.g. find use in flavouring consumables, such as food products, dietary supplements, nutraceuticals, pharmaceutical compositions, dental hygienic
  • the present invention relates to microbial organisms comprising a heterologous nucleic acid encoding vanillin synthase, which may be any of the vanillin synthases described herein above in the section "vanillin synthase” as well as use thereof in the production of vanillin and/or vanillin glucoside.
  • the microbial organism may in addition to the heterologous nucleic acid encoding vanillin synthase also comprise additional heterologous nucleic acids, for example heterologous nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid (for example any of the enzymes involved in the synthesis of ferulic acid described herein below in the section "Enzymes involved in synthesis of ferulic acid”) or a glucosyl transferase (for example any of the glucosyl transferases described herein below in the section "Glucosyl transferase").
  • additional heterologous nucleic acids for example heterologous nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid (for example any of the enzymes involved in the synthesis of ferulic acid described herein below in the section "Enzymes involved in synthesis of ferulic acid”) or a glucosyl transferase (for example any of the glucosyl transferases described herein below in
  • one microbial organism may contain one or more heterologous nucleic acid encoding an enzyme involved in the synthesis of ferulic acid, rendering said microbial organism capable of producing ferulic acid, whereas another microbial organism may comprise the heterologous nucleic acid encoding vanillin synthase.
  • a plurality of microbial organisms they can be grown in a mixed culture to produce vanillin and/or vanillin glucoside. In such cases the co-expression of suitable transporters may be advantageous to export intermediates into the growth medium and to facilitate uptake into the microbial organism producing vanillin or vanillin glucoside.
  • the microbial cell of the present invention can be any cell suitable for expression of heterologous nucleic acids.
  • the microbial cell of the invention is a eukaryotic cell.
  • the host cell is a prokaryotic cell.
  • the host cell is a fungal cell such as a yeast or filamentous fungus.
  • the host cell may be a yeast cell.
  • the yeast cell is selected from the group consisting of
  • Saccharomyces cerevisiae Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Ashbya gossypii, Cyberlindnera jadinii, and Candida albicans.
  • yeasts and fungi are excellent microbial cells to be used with the present invention. They offer a desired ease of genetic manipulation and rapid growth to high cell densities on inexpensive media. For instance yeasts grow on a wide range of carbon sources and are not restricted to glucose.
  • the microbial organism to be used with the present invention may be selected from the group of yeasts described below:
  • Arxula adeninivorans (Blastobotrys adeninivorans) is a dimorphic yeast (it grows as a budding yeast like the baker's yeast up to a temperature of 42 °C, above this threshold it grows in a filamentous form) with unusual biochemical characteristics. It can grow on a wide range of substrates and can assimilate nitrate. It has successfully been applied to the generation of strains that can produce natural plastics or the development of a biosensor for estrogens in environmental samples.
  • Candida boidinii s a methylotrophic yeast (it can grow on methanol). Like other methylotrophic species such as Hansenula polymorpha and Pichia pastoris, it provides an excellent platform for the production of heterologous proteins. Yields in a multigram range of a secreted foreign protein have been reported.
  • a computational method, IPRO recently predicted mutations that experimentally switched the cofactor specificity of Candida boidinii xylose reductase from NADPH to NADH. Details on how to download the software implemented in Python and experimental testing of predictions are outlined in the following paper.
  • Hansenula polymorpha is another methylotrophic yeast (see Candida boidinii). It can furthermore grow on a wide range of other substrates; it is thermo- tolerant and can assimilate nitrate (see also Kluyveromyces lactis). It has been applied to the production of hepatitis B vaccines, insulin and interferon alpha-2a for the treatment of hepatitis C, furthermore to a range of technical enzymes.
  • Kluyveromyces lactis is a yeast regularly applied to the production of kefir. It can grow on several sugars, most importantly on lactose which is present in milk and whey. It has successfully been applied among others to the production of chymosin (an enzyme that is usually present in the stomach of calves) for the production of cheese.
  • chymosin an enzyme that is usually present in the stomach of calves
  • Pichia pastoris is a methylotrophic yeast (see Candida boidinii and Hansenula polymorpha). It provides an efficient platform for the production of foreign proteins. Platform elements are available as a kit and it is worldwide used in academia for the production of proteins. Strains have been engineered that can produce complex human N-glycan (yeast glycans are similar but not identical to those found in humans).
  • Saccharomyces cerevisiae is the traditional baker's yeast known for its use in brewing and baking and for the production of alcohol. As protein factory it has successfully been applied to the production of technical enzymes and of pharmaceuticals like insulin and hepatitis B vaccines.
  • Yarrowia lipolytica is a dimorphic yeast (see Arxula adeninivorans) that can grow on a wide range of substrates. It has a high potential for industrial applications but there are no recombinant products commercially available yet.
  • the host cell is a microalgae such as Chlorella and Prototheca.
  • the host cell is a filamentous fungus, for example Aspergillus.
  • the host cell is a plant cell.
  • the host cell may be a cell of a higher plant, but the host cell may also be cells from organisms not belonging to higher plants for example cells from the moss Physcomitrella patens.
  • the host cell is a mammalian cell, such as a human, feline, porcine, simian, canine, murine, rat, mouse or rabbit cell.
  • the host cell may also be selected from the group consisting of CHO, CHO-K1 , HEI193T, HEK293, COS, PC12, HiB5, RN33b, BHK cells.
  • the host cell can also be a prokaryotic cell such as a bacterial cell. If the cell is a prokaryotic cell the cell may be selected from, but not limited to E. coli, Corynebacterium, Bacillus, Pseudomonas and Streptomyces cells.
  • the nucleic acids encoding the vanillin synthase of the invention are introduced into plants or plant cells to achieve production of vanillin or vanillin glucoside or vanillyl alcohol or vanillyl alcohol glucoside in said plant or plant cells.
  • the nucleic acids may be introduced into plants other than Vanilla planifolia to obtain production of vanillin in these plants.
  • the plant may in addition to the heterologous nucleic acid encoding vanillin synthase also comprise additional heterologous nucleic acids, for example heterologous nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid or a glucosyl transferase.
  • a plant or plant cell can be transformed by having a heterologous nucleic acid integrated into its genome, i.e., it can be stably transformed.
  • Stably transformed cells typically retain the introduced nucleic acid with each cell division.
  • a plant or plant cell can also be transiently transformed such that the recombinant gene is not integrated into its genome.
  • Transiently transformed cells typically lose all or some portion of the introduced nucleic acid with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a certain number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.
  • Plant cells comprising a nucleic acid encoding a vanillin synthase used in methods described herein can constitute part or all of a whole plant. Such plants can be grown in a manner suitable for the species under consideration, either in a growth chamber, a greenhouse, or in a field. Plants may also be progeny of an initial plant comprising a nucleic acid encoding a vanillin synthase provided the progeny inherits the
  • heterologous nucleic acid seeds produced by a transgenic plant can be grown and then selfed (or outcrossed and selfed) to obtain seeds homozygous for the nucleic acid construct.
  • the plants to be used with the invention can be grown in suspension culture, or tissue or organ culture.
  • solid and/or liquid tissue culture techniques can be used.
  • plant cells can be placed directly onto the medium or can be placed onto a filter that is then placed in contact with the medium.
  • transgenic plant cells can be placed onto a flotation device, e.g., a porous membrane that contacts the liquid medium.
  • a reporter sequence encoding a reporter polypeptide having a reporter activity can be included in the transformation procedure and an assay for reporter activity or expression can be performed at a suitable time after transformation.
  • a suitable time for conducting the assay typically is about 1 -21 days after transformation, e.g., about 1 -14 days, about 1 -7 days, or about 1 - 3 days.
  • the use of transient assays is particularly convenient for rapid analysis in different species, or to confirm expression of a heterologous polypeptide whose expression has not previously been confirmed in particular recipient cells.
  • nucleic acids into monocotyledonous and dicotyledonous plants are known in the art, and include, without limitation, Agrobacterium- mediated transformation, viral vector-mediated transformation, electroporation and particle gun transformation, U.S. Patent Nos 5,538,880; 5,204,253; 6,329,571 ; and 6,013,863. If a cell or cultured tissue is used as the recipient tissue for transformation, plants can be regenerated from transformed cultures if desired, by techniques known to those skilled in the art.
  • Heterologous nucleic acids encoding vanillin synthase may be introduced into cereal plants, such as barley as described by Hebelstrup et al., (2010) UCE: A uracil excision (USER (TM))-based toolbox for transformation of cereals. Plant Methods, 6:15 or by Holme et al. (2012) Cisgenic barley with improved phytase activity. Plant Biotechnol J 10, 237-247.
  • a population of plants can be screened and/or selected for those members of the population that carry the heterologous nucleic acid encoding vanillin synthase. For example, a population of progeny of a single transformation event can be screened for those plants having a desired level of expression of the vanillin synthase. Physical and biochemical methods can be used to identify expression levels. These include
  • Southern analysis or PCR amplification for detection of a polynucleotide Northern blots, S1 RNase protection, primer-extension, or RT-PCR amplification for detecting RNA transcripts; enzymatic assays for detecting enzyme or ribozyme activity of polypeptides and polynucleotides; and protein gel electrophoresis, Western blots, immunoprecipitation, and enzyme-linked immunoassays to detect polypeptides.
  • Other techniques such as in situ hybridization, enzyme staining, and immunostaining also can be used to detect the presence or expression of polypeptides and/or nucleic acids. Methods for performing all of the referenced techniques are known.
  • a population of plants comprising independent transformation events can be screened for those plants carrying all and/or expressing all the different heterologous nucleic acids. Selection and/or screening can be carried out over one or more generations, and/or in more than one geographic location. In some cases, the plants can be grown and selected under conditions which induce a desired phenotype or are otherwise necessary to produce a desired phenotype in the plant. In addition, selection and/or screening can be applied during a particular developmental stage in which the heterologous nucleic acid is expected to be expressed by the plant.
  • Selection and/or screening can be carried out to choose those transgenic plants having a statistically significant difference in vanillin or vanillin beta-D-glucoside level relative to a control plant that lacks the heterologous nucleic acid encoding vanillin synthase.
  • Plants which include a plant cell according to the invention are also provided as are seeds produced by said plants.
  • the plant comprising a heterologous nucleic acid encoding vanillin synthase to be used with the present invention may for example be selected from: corn (Zea.
  • canola Brassica napus, Brassica rapa ssp.
  • alfalfa Medicago sativa
  • rice Oryza sativa
  • rye Secale cerale
  • sorghum Sorghum bicolor, Sorghum vulgare
  • sunflower Helianthus annuas
  • wheat Tritium aestivum and other species
  • Triticale Rye (Secale) soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Impomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citrus (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senens
  • the plant is a plant comprising edible parts.
  • the plant may be a plant with a taste, where a combination with vanilla taste can be envisioned to be desirable.
  • the plant may be a plant comprising an edible fruit, wherein it is desired that said fruit in addition to the natural taste of said fruit also contains a vanilla flavour.
  • a vanilla flavour is tomato.
  • plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea, sugar beets, sugar cane, soybean, oilseed rape, sunflower and other root, tuber or seed crops.
  • crop plants for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea, sugar beets, sugar cane, soybean, oilseed rape, sunflower and other root, tuber or seed crops.
  • Other important plants maybe fruit trees, crop trees, forest trees or plants grown for their use as spices or pharmaceutical products (Mentha spp, clove,
  • Horticultural plants which may be used with the present invention may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, carrots, and carnations and geraniums.
  • the plant may also be selected from the group consisting of tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper and Chrysanthemum.
  • the plant may also be a grain plants for example oil-seed plants or leguminous plants.
  • Seeds of interest include grain seeds, such as corn, wheat, barley, sorghum, rye, etc.
  • Oil-seed plants include cotton soybean, saff lower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
  • Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mung bean, lima bean, fava been, lentils, chickpea.
  • said plant is selected from the following group: maize, rice, wheat, sugar beet, sugar cane, tobacco, oil seed rape, potato and soybean.
  • the plant may for example be rice.
  • the whole genome of Arabidopsis thaliana plant has been sequenced (Paquette, S. et al, Phytochemistry 62 (2003) 399-413). Consequently, very detailed knowledge is available for this plant and it may therefore be a useful plant to work with.
  • one plant which may be used with the present invention is an Arabidopsis and in particular an Arabidopsis thaliana.
  • the present invention demonstrates that even plants quite distinct from Vanilla planifolia can be engineered to produce vanillin, vanillyl alchol and/or vanillin glucoside.
  • Vanilla planifolia is a monocot, and more specifically an epiphytic climbing orchid
  • the invention surprisingly demonstrates that even dicots are capable of producing vanillin, vanillyl alchol and/or vanillin glucoside.
  • the host organism is a dicot.
  • the plant is a plant of the order Solanales.
  • the plant may be a plant of the genus Nicotiana, for example the plant may be Nicotiana tobaccum.
  • the invention relates to a plant comprising a heterologous nucleic acids encoding the vanillin synthase of the invention, wherein the plant is a plant used as animal feed. It may be advantageous for plants used as animal feed to comprise vanillin, because vanillin may induce appetite in animals and also may improve palability of feed prepared from the plants, thereby inducing increased feed uptake by animals. Furthermore, interestingly, plants comprising a heterologous nucleic acid encoding the vanillin synthase of the invention may also have reduced lignin content or lignin with a different composition offering favourable traits e.g. physical strength or biodegradability. Without being bound by theory it is speculated that expression of vanillin synthase according to the invention reduces the pool of ferulic acid available for biosynthesis of lignin, because at least part of the ferulic acid is converted to vanillin.
  • the plant used as animal feed may be any plant useful as animal feed.
  • said plant may be a herbaceous plant, such as grass or legumes.
  • Said grass may be any graminoids, such as "true grasses" of the Poaceae or Gramineae family, as well as the sedges of the Cyperaceae family or rushes of the Juncaceae family.
  • useful true grasses include cereals, bamboo and the grasses of lawns (turf) and grassland, for example Switch grass.
  • the plant is a plant of a plant species with a high endogenous content of ferulic acid and/or a ferulic acid derivative.
  • the plant may be of a plant species with a high endogenous content of ferulic acid and/or ferulic acid glucoside.
  • the plant is of a plant species accumulating high levels of free and/or accessible ferulic acid or ferulic acid glucoside.
  • the primary cell wall of the commelinoid order of monocots and the Chenopodiaceae e.g. sugar beet and spinach
  • the plant may be a plant of the commelimoid order of monocots or a chenopodiaceae.
  • the plant is a plant comprising at least 50 ⁇ g, for example at least 100 ⁇ g, such as at least 200 ⁇ g ferulic acid and/or ferulic acid derivative per g dry matter
  • the plant is not Vanilla planifolia. It may also be preferred that the plant is not Creeping Bentgrass.
  • the microbial organism comprising a heterologous nucleic acid encoding a vanillin synthase may also be capable of glucosylating vanillin.
  • Most microbial organisms, such as bacteria and fungi are not natively capable of glucosylating vanillin.
  • the microbial organism may comprise at least one heterologous nucleic acid encoding a glucosyl transferase, preferably a glucosyl transferase able to efficiently catalyse glucosylation of vanillin.
  • Similar the plant comprising a heterologous nucleic acid encoding a vanillin synthase may also be capable of glucosylating vanillin.
  • Said plant may comprise an endogenous glucosyl transferase activity capable of glucosylating vanillin.
  • the plant may comprise at least a heterologous nucleic acid encoding a glucosyl transferase, preferably a glucosyl transferase able to efficiently catalyse glucosylation of vanillin .
  • Vanillin ⁇ -D-glucoside is the storage form of vanillin found in the vanilla pod. It is non-toxic to most organisms, including yeast, and has a higher solubility in water, as compared to vanillin. In contrast vanillin may be toxic to many hosts. In addition, the formation of vanillin ⁇ -D-glucoside most likely pulls the biosynthesis further in the direction of vanillin production. In addition, glucosylation of vanillin may facilitate isolation.
  • the glucosyl transferase may be any glucosyl transferase capable of catalysing glucosylation of vanillin, i.e. capable of catalysing conjugation a glucose residue to vanillin.
  • the glucosyl transferease may be a UDP-Glucose:Aglycon- Glucosyltransferase.
  • the glucosyl transferase can catalyze the glucosylation of vanillin to produce vanillin beta-D-glucoside.
  • the glucosyl transferase may be a Family 1 glucosyl transferease.
  • Preferred glucosyl transferases according to the invention are enzymes classified under EC 2.4.1 .
  • Suitable glucosyl transferases include the UGT71 C2, UGT72B1 , UGT72E2, UGT84A2, UGT89B1 , UGT85B1 , and arbutin synthase polypeptides.
  • the glucosyl transferase to be used with the present invention may for example be any of the glucosyl transferases having
  • the recombinant host may comprise a heterologous nucleic acid encoding the UGT71 C2, UGT72B1 , UGT72E2, UGT84A2, UGT89B1 , UGT85B1 , or arbutin synthase or a functional homologue of any of the aforementioned sharing at least 80%, such as at least 85%, for example at least 90%, such as at least 95%, for example at least 98% sequence identity therewith.
  • Other useful UGTs are described in WO 01 /40491 , for example on page 2-5 of WO 01 /40491 .
  • UGT72E2 The Arabidopsis thaliana UGT72E2 is particularly useful. UGT72E2 exhibits high substrate specificity towards vanillin. In concordance with this observation, its expression in the vanillin producing yeast results in almost all vanillin being converted into vanillin ⁇ -D-glucoside. The ability to turn vanillin into vanillin ⁇ -D-glucoside in vivo is important, because microbial production of non-glucosylated vanillin beyond the 0.5- 1 g/liter scale would be hampered by the toxicity of free vanillin. Glucosylation serves to circumvent the inhibitory effect.
  • the glucosyl transferase may be UGT72E2 of SEQ ID NO:3 or a functional homologue thereof sharing at least 80%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of UGT72E2 is also capable of catalysing glucosylation of vanillin to form vanillin-beta-D- glucoside.
  • Glycosyltransferases catalysing the transfer of other sugars than glucose e.g. galactose, arabinose, rhamnose and xylose are also known and may also be introduced to obtain new sugar derivatives of vanillin.
  • the present invention relates to methods of producing vanillin from ferulic acid with the aid of vanillin synthase.
  • the methods may employ use of a microbial organism or a plant, which produces ferulic acid, or ferulic acid may be added exogenously to the microbial organism or the plant.
  • the methods may comprise contacting said bacteria or fungi with ferulic acid, for example by adding ferulic acid to the growth medium.
  • the said bacteria or fungi may be engineered to express one or more enzymes involved in the synthesis of ferulic acid.
  • one microbial organism engineered to express one or more enzymes involved in the synthesis of ferulic acid may be used together with the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase, for example, they may be co- cultured.
  • the invention relates to microbial organisms and methods of using said microbial organism, wherein the microbial organism comprises at least one heterologous nucleic acid encoding an enzyme involved in synthesis of ferulic acid.
  • the enzyme involved in synthesis of ferulic acid may for example be selected from the group consisting of phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, tyrosine ammonia-lyase, 4-coumaryl-3-hydroxylase, caffeate O-methyltransferase, phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, coumarate-CoA ligase, shikimate O-hydroxycinnamoyltransferase, 4-coumaryl-3-hydroxylase, caffeoyl- CoA O-methyltransferase, caffeate O-methyltransferase and flavone 3'-0- methyltransferase.
  • phenylalanine ammonia-lyase trans-cinnamate 4-monooxygenase
  • tyrosine ammonia-lyase 4-coumaryl-3
  • ferulic acid pathway 1 ferulic acid pathway 1
  • Step 1 Phenylalanine ammonia-lyase, which may be any of the phenylalanine ammonia lyases described herein below.
  • Step 2 trans-cinnamate 4-monooxygenase (cinnamate 4-hydroxylase), which may be any of the trans-cinnamate 4-monooxygenase described herein below.
  • Step 3 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
  • Step 4 caffeate O-methyltransferase or flavone 3'-0-methyltransferase, which may be any of the caffeate O-methyltransferases or flavone 3'-0-methyltransferases described herein below.
  • the microbial organism of the invention for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 1 , such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 1 , for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 1 .
  • the microbial organism for example the yeast cell or the bacteria may contain 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 1 .
  • ferulic acid pathway 2 Another pathway (herein designated ferulic acid pathway 2) for the biosynthesis ferulic acid contains the following enzymes:
  • Step 1 +2 tyrosine ammonia-lyase, which may be any of the tyrosine ammonia lyases described herein below.
  • Step 3 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
  • Step 4 caffeate O-methyltransferase or flavone 3'-0-methyltransferase, which may be any of the caffeate O-methyltransferases or flavone 3'-0-methyltransferases described herein below.
  • the microbial organism of the invention for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of pathway 2, such as at least two heterologous nucleic acids each encoding a different enzyme of pathway 2.
  • the microbial organism for example the yeast cell or the bacteria may contain 3 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 2.
  • ferulic acid pathway 3 for the biosynthesis ferulic acid contains the following enzymes: Step 1 : phenylalanine ammonia-lyase, which may be any of the phenylalanine ammonia-lyases described herein below. Step 2: trans-cinnamate 4-monooxygenase (cinnamate 4-hydroxylase), which may be any of the trans-cinnamate 4-monooxygenases described herein below.
  • Step 3 4-coumarate-CoA ligase, which may be any of the 4-coumarate-CoA ligases described herein below.
  • Step 4 shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
  • Step 5 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
  • Step 6 shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
  • Step 7 caffeoyl-CoA O-methyltransferase, which may be any of the caffeoyl-CoA O- methyltransferases described herein below.
  • the microbial organism of the invention may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 3, such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3, for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 3, such as at least 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3, for example at least 5 nucleic acids each encoding a different enzyme of ferulic acid pathway 3, such as at least 6 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3.
  • one enzyme of ferulic acid pathway 3 such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3, for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 3, such as at least 4 heterologous nucleic acids each encoding a different enzyme of
  • ferulic acid pathway 4 for the biosynthesis ferulic acid contains the following enzymes:
  • Step 1 +2 tyrosine ammonia-lyase, which may be any of the tyrosine ammonia-lyases described herein below.
  • Step 3 4-coumarate-CoA ligase, which may be any of the 4-coumarate-CoA ligases described herein below.
  • Step 4 shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
  • Step 5 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
  • Step 6 shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
  • Step 7 caffeoyl-CoA O-methyltransferase, which may be any of the caffeoyl-CoA O- methyltransferases described herein below.
  • Still another pathway (herein designated ferulic acid pathway 5) for the biosynthesis ferulic acid contains the following enzymes:
  • VAO Vanillyl-alcohol oxidase
  • the microbial organism if the microbial organism does not synthesize eugenol, then it is preferred that the microbial organism is cultured in the presence of eugenol.
  • the microbial organism preferably comprises an enzyme capable of catalysing conversion of coniferyl alcohol to form ferulic acid. Such an enzyme is endogenously present in may microbial organisms, for example in S.
  • the microbial organism of the invention for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 4, such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4, for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 4, such as at least 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4, for example at least 5 nucleic acids each encoding a different enzyme of ferulic acid pathway 4.
  • the microbial organism for example the yeast cell or the bacteria may contain 6 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4.
  • the phenylalanine ammonia-lyase to be used with the present invention may be any phenylalanine ammonia-lyase known to the skilled person.
  • the phenylalanine ammonia-lyase known to the skilled person.
  • the phenylalanine ammonia-lyase known to the skilled person.
  • phenylalanine ammonia-lyase may be an enzyme classified under EC 4.3.1 .24.
  • the phenylalanine ammonia-lyase according to the present invention is preferably an enzyme capable of catalysing the following reaction:
  • the phenylalanine ammonia-lyase may be phenylalanine ammonia-lyase from a variety of sources, for example from plants. Examples of useful phenylalanine ammonia-lyases are described in Vannelli et al., 2006 and Shin et al 2012.
  • the phenylalanine ammonia-lyase may be phenylalanine ammonia-lyase of SEQ ID NO:4 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of a phenylalanine ammonia-lyase is also capable of catalysing the following reaction: L-phenylalanine trans-cinnamate + NH 3 trans-cinnamate 4-monooxyqenase
  • trans-cinnamate 4-monooxygenase to be used with the present invention may be any trans-cinnamate 4-monooxygenase known to the skilled person.
  • trans-Cinnamate 4-monooxygenase may also be designated cinnamate 4-hydroxylase.
  • the trans-cinnamate 4-monooxygenase may be any enzyme classified under EC
  • trans-cinnamate 4-monooxygenase is preferably an enzyme capable of catalysing the following reaction: trans-cinnamate + NADPH + H + + + 0 2 4-hydroxycinnamate + NADP+ + H 2 0
  • the trans-cinnamate 4-monooxygenase may be trans-cinnamate 4-monooxygenase from a variety of sources, for example from plants.
  • a useful trans- cinnamate 4-monooxygenase is Arabidopsis thaliana CYP73A5 (GenBank accession number: U37235).
  • trans-cinnamate 4-monooxygenase may be trans-cinnamate 4-monooxygenase of SEQ ID NO:5 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • trans-cinnamate 4-monooxygenase A functional homologue of a trans-cinnamate 4-monooxygenase is also capable of catalysing the following reaction: trans-cinnamate + NADPH + H + + + 0 2 — 4-hydroxycinnamate + NADP+ + H 2 0
  • the tyrosine ammonia-lyase to be used with the present invention may be any tyrosine ammonia-lyase known to the skilled person.
  • the tyrosine ammonia-lyase may be any enzyme classified under EC 4.3.1 .23.
  • tyrosine ammonia-lyase is preferably an enzyme capable of catalysing the following reaction:
  • the tyrosine ammonia-lyase may be tyrosine ammonia-lyase from a variety of sources, for example from plants. Examples of useful tyrosine ammonia-lyase are described in Vannelli et al 2006 and Shin et al 2012. Also tyrosine ammonia-lyase from various slime molds may be used with the invention.
  • tyrosine ammonia-lyase may be tyrosine ammonia-lyase of SEQ ID NO:6 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of a tyrosine ammonia-lyase is also capable of catalysing the following reaction:
  • the 4-coumaryl-3-hydroxylase to be used with the present invention may be any 4- coumaryl-3-hydroxylase known to the skilled person.
  • the 4-coumaryl-3- hydroxylase may be any enzyme classified under EC 1 .14.-.-.
  • the 4-coumaryl-3-hydroxylase may be 4-coumaryl-3-hydroxylase from a variety of sources, for example from plants.
  • Examples of useful 4-coumaryl-3-hydroxylase includes Red clover coumarate 3'-hydroxylase (CYP98A44), Arabidopsis thaliana p- coumarate 3-hydroxylase (CYP98A3)(SEQ ID NO:7), CYP98A8 p-coumarate 3- hydroxylase of Arabidopsis thaliana (SEQ ID NO:8) or CYP98A9 p-coumarate 3- hydroxylase of Arabidopsis thaliana (SEQ ID NO:9).
  • CYP98A44 Red clover coumarate 3'-hydroxylase
  • CYP98A3 Arabidopsis thaliana p- coumarate 3-hydroxylase
  • SEQ ID NO:8 CYP98A8 p-coumarate 3- hydroxylase of Arabidopsis thaliana
  • SEQ ID NO:9 CY
  • 4-coumaryl-3-hydroxylase may be 4-coumaryl-3-hydroxylase of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or a functional homologue of any of the aforementioned sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity”.
  • the caffeate O-methyltransferase to be used with the present invention may be any caffeate O-methyltransferase known to the skilled person.
  • the caffeate O- methyltransferase may be any enzyme classified under EC 2.1 .1 .68.
  • caffeate O- methyltransferase is preferably an enzyme capable of catalysing the following reaction:
  • the flavone 3'-0-methyltransferase to be used with the present invention may be any flavone 3'-0-methyltransferase known to the skilled person.
  • the flavone 3'- O-methyltransferase may be any enzyme classified under EC 2.1 .1 .42.
  • flavone 3'-0-methyltransferase is preferably an enzyme capable of catalysing the following reaction:
  • the 4-coumarate-CoA ligase to be used with the present invention may be any 4- coumarate-CoA ligase known to the skilled person.
  • the 4-coumarate-CoA ligase may be any enzyme classified under EC 6.2.1 .12.
  • 4-coumarate-CoA ligase is preferably an enzyme capable of catalysing the following reaction:
  • the 4-coumarate-CoA ligase may be 4-coumarate-CoA ligase from a variety of sources, for example from plants.
  • Examples of useful 4-coumarate-CoA ligases include Arabidopsis thaliana 4-coumarate:CoA ligase 3 (SEQ ID NO:10) or 4- coumarate:coenzyme A ligase of Nicotiana tabacum (SEQ ID NO:1 1 ).
  • 4-coumarate-CoA ligase may be 4-coumarate-CoA ligase of SEQ ID NO:10, SEQ ID NO:1 1 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of a 4-coumarate-CoA ligase is also capable of catalysing the following reaction:
  • the shikimate O-hydroxycinnamoyltransferase to be used with the present invention may be any shikimate O-hydroxycinnamoyltransferase known to the skilled person.
  • the shikimate O-hydroxycinnamoyltransferase may be any enzyme classified under EC 2.3.1 .133.
  • shikimate O-hydroxycinnamoyltransferase is preferably an enzyme capable of catalysing the following reaction:
  • the shikimate O-hydroxycinnamoyltransferase may be shikimate O- hydroxycinnamoyltransferase from a variety of sources, for example from plants.
  • Examples of useful shikimate O-hydroxycinnamoyltransferase include Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (SEQ ID NO:12), Coffea arabica hydroxycinnamoyi transferase (SEQ ID NO:13) or Populus trichocarpa hydroxycinnamoyi CoA shikimate/quinate hydroxycinnamoyltransferase (SEQ ID NO:14).
  • shikimate O-hydroxycinnamoyltransferase may be shikimate O- hydroxycinnamoyltransferase of SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 or a functional homologue of any of the aforementioned sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of a shikimate O-hydroxycinnamoyltransferase is also capable of catalysing the following reaction: 4-coumaroyl-CoA + shikimate CoA + 4-coumaroylshikimate
  • Caffeoyl-CoA 0-methyltransferase The caffeoyl-CoA O-methyltransferase to be used with the present invention may be any caffeoyl-CoA O-methyltransferase known to the skilled person.
  • the caffeoyl-CoA O-methyltransferase may be any enzyme classified under EC 2.1 .1 .104.
  • caffeoyl-CoA O-methyltransferase is preferably an enzyme capable of catalysing the following reaction:
  • the caffeoyl-CoA O-methyltransferase may be caffeoyl-CoA O-methyltransferase from a variety of sources, for example from plants.
  • Examples of useful caffeoyl-CoA O- methyltransferase includes Arabidopsis thaliana caffeoyl-CoA O-methyltransferase (SEQ ID NO:15) or caffeoyl-CoA O-methyltransferase of Nicotiana tabacum (SEQ ID NO: 16).
  • caffeoyl-CoA O-methyltransferase may be caffeoyl-CoA O-methyltransferase of SEQ ID NO:6 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • a functional homologue of a caffeoyl-CoA O-methyltransferase is also capable of catalysing the following reaction:
  • the vanillyl-alcohol oxidase (VAO) to be used with the present invention may be any VAO known to the skilled person.
  • the VAO may be any enzyme classified under EC 1 .1 .3.38.
  • the VAO may be VAO from a variety of sources, for example from fungi. Examples of useful VAO includes Penicillium simplicissimum VAO.
  • VAO may be the VAO of the sequence with reference number CAA75722 of the NCBI database (as available on 5 November 2013) or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
  • the sequence identity is preferably calculated as described herein below in the section "Sequence identity".
  • Sequence identity A high level of sequence identity indicates likelihood that the first sequence is derived from the second sequence.
  • Amino acid sequence identity requires identical amino acid sequences between two aligned sequences.
  • a candidate sequence sharing 80% amino acid identity with a reference sequence requires that, following alignment, 80% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence.
  • Identity according to the present invention is determined by aid of computer analysis, such as, without limitations, the ClustalW computer alignment program (Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., Gibson T.J., 1994.
  • CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
  • the cell of the present invention comprises a nucleic acid sequence coding, as define herein. Promoter sequence
  • the present invention relates to microbial organisms and plants comprising a heterologous nucleic acid encoding vanillin synthase and optionally also one or more additional heterologous nucleic acid sequences encoding enzyme(s) involved in synthesis of ferulic acid and/or a glucosyl transferase.
  • said coding heterologous nucleic acids are in general operably linked to a promoter sequence directing expression in the microbial cell or the plant.
  • a promoter is a region of DNA that facilitates the transcription of a particular gene.
  • Promoters are located near the genes they regulate, on the same strand and typically upstream (towards the 5' region of the sense strand). In order for the transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. Promoters contain specific DNA sequences and response elements which provide a secure initial binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase. These transcription factors have specific activator or repressor sequences of corresponding nucleotides that attach to specific promoters and regulate gene expressions. The promoter sequence may in general be positioned immediately adjacent to the coding heterologous nucleic acid.
  • the promoter sequence according to the present invention in general comprises at least a core promoter, which is the minimal portion of the promoter required to properly initiate transcription.
  • the promoter sequence may comprise one or more of the following promoter elements:
  • the microbial organism or the plant expresses a high level of enzymes using ferulic acid as substrate, it may be advantageous to reduce the expression of such enzymes.
  • Certain microbial organisms, such as yeast expresses ferulic acid decarboxylase, which is capable of catalysing decarboxylation of ferulic acid to obtain 4-vinyl guaiacol. Accordingly, it is preferred that if the microbial organism expresses ferulic acid decarboxylase then the expression of said ferulic acid decarboxylase is reduced. Reduced expression may be achieved using various conventional techniques known to the skilled person. For example, nucleic acids, e.g.
  • antisense nucleic acids that inhibit expression of ferulic acid decarboxylase may be included in a recombinant construct that is transformed into the microbial organism.
  • PCR based mutagenesis techniques can be used to generate mutants in the gene for ferulic acid decarboxylase or the entire ferulic acid carboxylase gene may be deleted using PCR based gene deletion strategy, for example adapted from the strategy described by Baudin et al., 1993. Briefly, PCR-generated DNA molecules consisting of a marker cassette with short flanking homology regions to the genomic ferulic acid decarboxylase gene are introduced into the microbial organism and integrated into the genome by homologous recombination.
  • the genomic sequence of the ferulic acid decarboxylase gene from various organisms is available. For example the genomic sequence of the ferulic acid decarboxylase gene is available under the GenBank accession number BK006938.2.
  • ferulic acid refers to a compound of the structure:
  • the methods for producing vanillin and/or vanillin glucoside involves contacting the producing microbial organism or plant with ferulic acid and/or a ferulic acid derivative. It is preferred that said microbial organism or plant is contacted with ferulic acid. In particular, this is relevant in embodiments of the invention where the microbial organism or the plant is not capable of producing ferulic acid. Most bacteria and fungi are not capable of producing ferulic acid. Thus it may be in particular relevant to contact the microbial organism with ferulic acid and/or a ferulic acid derivative in embodiments of the invention where the microbial organism is bacteria or fungi, for example yeast.
  • said microbial organism is cultivated in the presence of ferulic acid
  • the culture medium may comprise ferulic acid.
  • the culture medium may preferably comprise at least 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid.
  • said microbial organism is cultivated in the presence of ferulic acid derivative or a mixture of ferulic acid and ferulic acid derivative
  • the culture medium may comprise ferulic acid derivative and/or ferulic acid.
  • the culture medium may preferably comprise at least 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid and/or ferulic acid derivative.
  • the invention relates to preparing vanillin in vitro by contacting ferulic acid and/or a ferulic acid derivative with vanillin synthase, which may be any of the vanillin synthases described herein above in the section "Vanillin synthase".
  • vanillin synthase may be provided in a purified form or in an extract, for example an extract prepared from a microbial organism expressing vanillin synthase, such as any of the microbial organisms described herein above in the section "Microbial organism”.
  • concentration of ferulic acid and/or ferulic acid derivative may be used, for example the concentration of ferulic acid and/or ferulic acid derivative may be 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid/ferulic acid derivative.
  • the ferulic acid may be provided in any useful form.
  • molasses in general contains large amounts of ferulic acid and thus the culture medium may comprise or even consist of molasses.
  • the molasses may for example be molasses of sugar beet or sugar cane.
  • the ferulic acid may also be provided by providing plants or plant part comprising ferulic acid or extract thereof.
  • ferulic acid may be provided in the form of asafetida, the dried latex from the giant fennel or as an extract thereof.
  • the ferulic acid may also be provided as seeds of coffee, apple, artichoke, peanut, or orange or as extracts thereof.
  • Ferulic acid may also be provided as a commelinid plant or part thereof. Said commelinid plant may for example be rice, wheat, oat, Chinese water chestnut or pineapple.
  • the ferulic acid may also be provided in the form of Agai oil.
  • Ferulic acid may also be purified ferulic acid, which for example may be purified from any of the aforementioned sources, or ferulic acid may be prepared by organic chemistry procedures.
  • the ferulic acid may also be provided from a microbial organism capable of producing ferulic acid.
  • microbial organism may preferably contain one or more heterologous nucleic acids encoding enzymes involved in synthesis of ferulic acid, for example said microbial organism may comprise nucleic acids encoding the enzymes as described herein above in the section "Enzymes involved in synthesis of ferulic acid".
  • the microbial organism capable of producing ferulic acid may be co-cultured together with the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase.
  • crude culture medium or partly purified or purified culture medium from cultivation of the microbial organism capable of producing ferulic acid may be added to the culture medium for growing the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase.
  • the ferulic acid derivative may be any derivative of ferulic acid, which may serve as a substrate for vanillin synthase.
  • the ferulic acid derivative is a compound of the general formula
  • R for example may be an alkyl, such as an C ⁇ g-alkyl, an alkoxy, such as C 1-6 alkoxy, a glycose ester, a glycoside, S-CoA, shikimate or quinate.
  • Said glycoside ester may be comprise any sugar, such as glucose.
  • the glycoside is preferably glucoside.
  • the ferulic acid derivative may for example be selected from the group consisting of Ferulic acid glucose ester, ferulic acid glucoside, Feruloyl-CoA, Ferulic acid shikimate and feruloyl-quinate.
  • SEQ ID N0:1 1 4-coumarate:coenzyme A ligase of Nicotiana tabacum
  • SEQ ID N0:16 caffeoyl-CoA O-methyltransferase of Nicotiana tabacum
  • SEQ ID NO:24 DNA sequence encoding chimeric vanillin synthase
  • VpVAN Vanillin synthase
  • the TNT Quick Coupled Transcription/Translation PROMEGA kit for PCR-generated DNA was used to produce protein from an isolated 4-HBS PCR-generated gene (the expressed protein was labelled with S35 to check for successful in vitro translation.
  • the substrate specificity of this enzyme 2.5 mM of p-coumaric acid, ferulic acid and caffeic acid were tested as putative substrates in a feeding experiment. After administrating protein solutions with putative substrates for 1 h and 24h respectively, the resulting metabolic profile in the presence and absence of 4-HBS was analyzed by LC-MS.
  • FIG. 1 (a) shows extracted ion chromatogram of the protein solution fed with 5 mM of ferulic acid for 1 h in 400mM Tris/HCI, pH8, 20 mM MgCI 2 , 2.5mM of dithiothreitol (DTT) at 30 degree celcius. Vanillin peak is observed at 7.5 min which is not present in negative control where protein solution without 4-HBS was treated under the same conditions (see figure 1 (b).
  • Figure 1 (c) shows extracted ion chromatogram of the protein solution fed 5 mM of ferulate CoA for 1 h in 2.5 mM DTT, 0.1 mM ATP and 0.1 mM NAD + at 30 °C. Also here a vanillin peak is observed, which is absent in the negative control (see figure 1 (d).
  • Figure 1 (e) shows the Vanillin fragmentation pattern at 7.5 min.
  • This example describes biosynthesis in yeast of vanillin glucoside from ferulic acid by the heterologous expression of V. planifolia VpVAN.
  • the substrate specificity of vanillin synthase was further confirmed by transient and stable expression in S. cerevisiae strain Fsb99.
  • Yeast was transformed with a nucleic acid encoding VpVAN of SEQ ID NO:1 inserted into the Gal-induced yeast expression vector p416 TEF (said cells also referred to as VpVAN-transformed yeast herein). yeast was grown in synthetic media containing galactose and 5mM of putative substrates. Vanillin formation was observed following administration of ferulic acid while no metabolism of p-coumaric acid and caffeic acid was observed.
  • VpVAN of SEQ ID NO:1 was expressed in yeast together with Arabidopsis thaliana UGT72E2 (SEQ ID NO:3).Arabidopsis thaliana UGT72E2 catalyzes glucosylation of ferulic acid enabling testing of the ability of vanillin synthase to use ferulic acid glucoside as a substrate.
  • Figure 12 shows that yeast cells expressing Arabidopsis thaliana UGT72E2 (SEQ ID NO:3) synthesizes ferulic acid glucoside when grown on synthetic media comprising 2.5 mM ferulic acid (see Figure 12).
  • the substrate specificity of 1/pVAN was furthermore tested with ferulic acid and ferulic acid glucoside. This experiment performed to detect formation of vanillin glucoside.
  • ⁇ /pUGT72U1 is able to glycosylate vanillin but not able to glycosylate ferulic acid while AfUGT72E2 is able to glycosylate both ferulic acid and vanillin.
  • ⁇ /pUGT72U1 included yeast constructs enable to test the 1/pVAN substrate specificity to ferulic acid and ferulic acid glucoside.
  • LC-MS extracted ion chromatograms show that 1/pVAN is able to catalyze the chain cleavage of both ferulic acid and ferulic acid glucoside (see figure 4)
  • VpVAN activity in a plant different from V. planifolia was assessed by transient expression in Nicotiana benthamiana leaves.
  • Gene expression constructs encoding VpVAN of SEQ ID NO:1 were transferred to Agrobacterium tumefaciens and co-infiltrated with an A. tumefaciens strain harbouring the p19 gene silencing suppressor into N. benthamiana leaves.
  • VpVAN SEQ ID NO:1
  • A. thaliana UGT72E2 SEQ ID NO:3
  • a nucleic acid encoding UGT72E2 of SEQ ID NO:3 is cloned into the multiple cloning site of a plant transformation vector such as one from the pCAMBIA series, which enables expression of the genes in the plant under the control of the strong, constitutive cauliflower mosaic virus CaMV35S promoter.
  • the vector harbors both a bacterial selection gene and a plant selection gene.
  • the vector harboring the nucleic acid encoding UGT72E2 of SEQ ID NO:3 is transformed into Agrobacterium tumefaciens C58C1 /pGV3850 by electroporation as described in Wen-Jun et al., 1983. The A.
  • tumefaciens cells are grown on selective medium and positive transformants are grown over night. Bacteria from plate is suspended in 20ml_ of Minimal A medium, density is adjusted to an OD600 of 0.9-1 .0 and ca. 20 0.5 cm N. tabacum leaf squares (4-5 week old tissue culture grown plants) are transferred to bacterial solution (deep well Petri dish). Leaf squares are swirled in solution and left for 5 minutes, after which they are removed and blotted dry, then transferred with adaxial side onto solid RMOP, about 10 pieces per plate. The plates are incubated in dark at 28 °C for: 2-3 days A.
  • tumefaciens 5 days after which the leaf pieces are transferred onto solid RMOP-TCH, with abaxial surface in contact with media, then incubated for 2-3 weeks in the light at 28 °C, with 16 hours daylight per day.
  • the material is sub-cultured every 2 weeks or so until shoots appear, then plantlets are transferred to MST-TCH pots and incubated with 16 hours daylight for 1 -2 weeks, and when roots form the plants are transferred to soil in the glasshouse. Plant material from the UGT72E2-expressing transgenic tobacco plants are used for the next transformation.
  • Nucleic acid encoding VpVAN of SEQ ID NO:1 is cloned into a plant expression vector as described above, and the whole procedure is repeated, to finally obtain transgenic tobacco plants co-expressing UGT72E2 and VpVAN. Plant material from the final transgenic plants is harvested and lysed and vanillin glucoside content is determined in the leaf material from the transgenic plant. No vanillin glucoside is seen in wildtype tobacco plants.
  • S. cerevisiae ferulic acid decarboxylase belongs to superfamily PAD and catalyzes the transformation of ferulic acid to 4- vinylguaiacol via non-oxidative decarboxylation.
  • the FADase gene is knocked out in VpVAN- transformed yeast using conventional technology.
  • the FADase gene is knocked out in the yeast strains described herein above in Example 2.
  • the adjacent PAD1 and FDC1 genes of S. cerevisiae are disrupted by PCR amplifying Klyveromyces lactis LEU2 (leucine auxotrophic selection marker) using primers with 74-77 bp tails homologous to the front and back end of PAD1 and FDC1 , respectively.
  • the yeast strain is then transformed with the PCR product, resulting in transformants having no PAD1 and FDC1 activity and able to grow on plates not supplemented with leucine.
  • VpVAN+AtUGt72E2 has high expression.
  • VpVAN-transformed yeast is further transformed with nucleic acids encoding the enzymes involved in synthesis of ferulic acid.
  • Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (GenBank accession number Q8GSM7)
  • Arabidopsis thaliana caffeoyl-CoA O-methyltransferase (GenBank accession number Q9C5D7) Strain 2
  • cerevisiae transformed with a nucleic acid encoding VpVAN of SEQ ID NO:1 and a nucleic acid encoding Arabidopsis thaliana UGT72E2 of SEQ ID NO:3 prepared as described in Example 3 with the following nucleic acids each under control of a promoter directing expression in S. cerevisiae:
  • Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (GenBank accession number Q8GSM7)
  • Arabidopsis thaliana p-coumarate 3-hydroxylase (CYP98A3)(SEQ ID NO:7)
  • the transformed yeast cells are grown in synthetic media containing galactose and vanillin glucoside is isolated from the growth medium.
  • the TNT® Quick Coupled Transcription/ Translation kit for PCR-generated DNA was used to produce proteins of interest directly from PCR products.
  • L- [ 35 S]-Methionine was included to permit monitoring of the radiolabeled proteins formed following separation by SDS-PAGE and visualized by incubating dried gels for 48h on phosphorimager screens which were scanned with a STORM 860 molecular imager (Molecular Dynamics).
  • Proteins produced in coupled in vitro transcription/translation assays were analyzed for their enzyme catalytic abilities by incubation of aliquots (10 ⁇ ) with 0.5 mM to 5 mM of the following substrates: ferulic acid (Sigma), p-coumaric acid (Sigma), caffeic acid (Sigma), ferulic acid glucoside, p-coumaric acid glucoside, caffeic acid glucoside, caffeoyl-Coenzyme A (MicroCombiChem e.K.), p-coumaryl-Coenzyme A (MicroCombiChem e.K.), feruloyl-Coenzyme A (MicroCombiChem e.K.) or sinapyl- Coenzyme A (MicroCombiChem e.K.) in 400 mM Tris/HCI (pH 8), 20 mM MgCI 2 and 2.5 mM dithiothreitol
  • Enzyme assays were carried out in the presence and absence of 2.5 mM dithiothreitol (DTT), 0.1 mM ATP and 0.1 mM NAD + . Aliquots (10 ⁇ ) were withdrawn at specific time points and enzyme activity stopped by MeOH addition (25 ⁇ , 25% (v/v)) and heating (45 ° C, 15 min). Samples were cooled on ice (30 min), centrifuged (10.000 rpm, 10 min) in microtiter filter plates (Merck Millipore) and the filtrate was finally analyzed by LC-MS.
  • tumefaciens strain harbouring the p19 gene silencing suppressor.
  • LC-MS profiling showed 1/pVAN-dependent formation of vanillyl alcohol glucoside.
  • the vanillyl alcohol glucoside arises by reduction of vanillin by an alcohol dehydrogenase (E.C.1 .1 .1 .1 ) and subsequent glucosylation of the primary alcohol group of vanillyl alcohol.
  • E.C.1 .1 .1 .1 alcohol dehydrogenase
  • said host organism co- expresses a UGT that effectively glucosylates the free vanillin formed into the corresponding glucoside before its reduction into vanillyl alcohol.
  • wt vp ⁇ 137 van encodes aa 138 to 356 of SEQ ID NO:1
  • wt vp ⁇ 66 van encodes aa 67 to 356 of SEQ ID NO:1
  • tumefaciens strains were used to co-infiltrate leaves of 3-weeks-old Nicotiana benthamiana plants grown at 24 ° C (day) and 17 ° C (night). After 4 or 5 days, leaf discs (1 cm diameter) were stamped out from the infiltrated leaves and metabolites extracted in 60% (v/v) MeOH for LC-MS analysis. The results are shown in figure 7A).
  • the 1/pVan sequence showed high sequence identity to proteins belonging to the family cysteine proteinases (see above).
  • An alignment was prepared (see fig. 10).
  • a construct was prepared where the 1/pVAN signal peptide (aa 1 to 21 of SEQ ID NO:1 ) was replaced the signal peptide of SEQ ID NO:22 identified using signalP 4.1 software (available from Center for Biological Sequence analysis, Technical University of Denmark). This signal peptide is aa 1 to 21 of SEQ ID NO:22.
  • a cleavage site was identified at aa 135 to 141 of SEQ ID NO:1 with cleavage after position residue 137 (DGV/LPVT).
  • the amino acids of SEQ ID NO:22 corresponding to aa 135 to 141 of SEQ ID NO:1 were identified to be aa 140 to 146 of SEQ ID NO:22 using the alignment of figure 10 and aa 135-141 of SEQ ID NO:1 were replaced with aa 140 to 146 of SEQ ID NO:22.
  • the signal peptide and the protease cleavage site were replaced with signal peptide and a protease cleavage site from the tobacco cysteine protease.
  • the resulting polypeptide consists of [aa 1 to 21 of SEQ ID NO:22]-[aa 22 to 134 of SEQ ID NO:1 -[aa 140 to 146 of SEQ ID NO:22]-[aa 142 to 356 of SE ID N01 ].
  • the nucleic acid encoding this protein is termed vp nb Asp Ativan herein and is provided as SEQ ID NO:24.
  • This gene construct was transferred to A. tumefaciens and infiltrated to tobacco essentially as described in this example above for wild type VpVAN and vanillin alcohol glucoside production was analysed by LC-MS profiling. The results are shown in figure 7B.
  • GftVAN vanillin synthase from Glechoma hederacea
  • the 1/pVan sequence was found to show 71 % amino acid sequence identity to G /AN, a novel gene cloned from Glechoma hederacea (Ground ivy) belonging to the Lamiaceae family.
  • the sequence of GhVAN is provided as SEQ ID NO:21 ).
  • a study of volatile constituents released by G. hederacea showed that this plant release traces of vanillin (N Radulovic 2010).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Fodder In General (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

The invention relates to methods for producing vanillin and related compounds. The methods involve use of a vanillin synthase capable of catalyzing side chain cleavage of ferulic acid to form vanillin. The invention also relates to host organisms expressing such vanillin synthases useful in the methods.

Description

Vanillin synthase Field of invention The present invention relates to methods for production of vanillin as well as to host organisms, such as microbial organisms or plants useful for such production.
Background of invention Vanilla is the world's most popular flavor compound and used in numerous commercial products including many foods. Natural vanilla is obtained from the pods of the epiphytic climbing orchids Vanilla planifolia Andrews and Vanilla tahitensis belonging to the genus Vanilla included in the order Orchidales within the monocotyledonous plants. Vanillin (3-methoxy-4-hydroxybenzaldehyde) is the main flavor compound in the vanilla extract obtained from fermented vanilla pods. In high concentrations, vanillin is toxic to living cells. In the pod it accumulates as the non-toxic phytoanticipin vanillin glucoside, which upon tissue damage is converted into the active defense compound. During fermentation and curing of the vanilla pods for use as flavor ingredient, a major part of the vanillin glucoside is hydrolyzed to provide free vanillin. The estimated total world market for vanillin is 10500 tons per annum. Production of natural vanillin from the vanilla pods is a laborious, slow and costly process. Production of 1 kilogram of vanillin requires approximately 500 kilograms of vanilla pods, corresponding to the pollination of approximately 40,000 flowers. Nowadays, only 3% of the global vanillin production is derived from vanilla pods. The vast majority is produced synthetically from different fossil hydrocarbons like eugenol or by acid hydrolysis of lignin. Biotechnological production of vanillin in microorganisms using heterologous expression of the genes encoding the pathway in vanilla orchids has not been achieved because none of the genes have been identified. Instead, vanillin has been produced in yeast, fungi, bacteria and in in vitro cell cultures by expressing genes from other organisms which encode enzymes that in combination would form vanillin from exogenously added substrates structurally related to vanillin.
Phenylalanine-derived volatiles are categorized as Ce-C^ C6-C2, C6-C3 compounds based on their carbon skeleton. Both vanillin glucoside and p-hydroxybenzaldehyde glucoside, the two most abundant compounds found in mature vanilla pods, are C6-Ci compounds.
The two major aroma compounds in natural vanilla are p-hydroxybenzaldehyde and vanillin. Because p-hydroxybenzaldehyde contains some of the same structural elements of vanillin, it has been thought of as a precursor for vanillin. The pathway from vanillin has been postulated to constitute a metabolic grid of metabolites all derived from phenylalanine. US2003/0070188 describes methods for possible p- hydroxybenzaldehyde production in embryogenic cell cultures from Vanilla planifolia. One method described in US2003/0070188 takes advantage of a 4-hydroxybenzaldehyde synthase (4-HBS), which is described as being capable of catalyzing chain shortening of p-coumaric acid to yield p-hydroxybenzaldehyde. The document further describes expression of 4-HBS in creeping bentgrass, however no information regarding the outcome of such expression is provided. It is also described that no 4- hydroxybenzaldehyde could be detected in yeast expressing 4-HBS.
Podstolski et al., 2002 describes that 4-hydroxy-benzaldehyde synthase (4-HBS) converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement.
Summary of invention
Accordingly, there is a need for methods for production of vanillin, and in particular for methods of producing vanillin in plants or microbial organisms.
The present invention provides an enzyme (herein designated vanillin synthase), which is capable of converting ferulic acid or a ferulic acid derivative to vanillin. This enzyme may be employed in the production of vanillin in a number of different host organisms as well as in vitro.
Thus, it is one aspect of the present invention to provide methods of producing vanillin from ferulic acid, wherein the methods involve use of a host organism expressing vanillin synthase, and wherein the ferulic acid may be added to said host organism or said host organism is capable of producing ferulic acid. Accordingly, the invention provides methods of producing vanillin, said methods comprising
a) providing a microbial organism, wherein said microbial organism
i. is capable of producing ferulic acid; and
ii. comprises a heterologous nucleic acid encoding vanillin synthase
(VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said microbial organism in culture medium supporting growth of said microbial organism
c) Isolating vanillin and/or vanillin glucoside from the microbial organism and/or from the culture medium.
The invention also provides methods of producing vanillin, vanillyl alcohol, vanillin glucoside and/or vanillyl alcohol glucoside, said methods comprising
a) providing a microbial organism, wherein said microbial organism
i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding a vanillin synthase,
wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said microbial organism in culture medium supporting growth of said microbial organism
c) Isolating vanillin and/or vanillin glucoside from the microbial organism and/or from the culture medium. It is also an aspect of the invention to provide microbial organisms, wherein said microbial organism
i. is capable of producing ferulic acid; and
ii. comprises a heterologous nucleic acid encoding vanillin synthase,
wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. VpVAN of SEQ ID
NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith.
It is also an aspect of the invention to provide methods of producing vanillin said method comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said microbial organism in the presence of ferulic acid and/or a ferulic acid derivative in culture medium supporting growth of said microbial organism; and
c) Isolating vanillin and/or vanillin glucoside from the microbial organism and/or from the culture medium.
It is also an aspect of the invention to provide methods of producing vanillin, vanillyl alcohol, vanillin glucoside and/or vanillyl alcohol glucoside, said method comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said microbial organism in the presence of ferulic acid and/or a ferulic acid derivative in culture medium supporting growth of said microbial organism; and
c) Isolating vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside from the microbial organism and/or from the culture medium.
It is furthermore an aspect of the invention to provide methods for producing vanillin, said methods comprising
a) providing ferulic acid and/or a ferulic acid derivative
b) contacting said ferulic acid and/or ferulic acid derivative with a vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g.
(VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith
thereby producing vanillin. It is also an aspect of the present invention to provide methods of producing vanillin, said methods comprising
a) Providing a plant comprising a heterologous nucleic acid encoding VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said plant; and
c) Isolating vanillin from the plant
It is also an aspect of the present invention to provide methods of producing vanillin, vanilly alcohol, vanillin glucoside and/or vanillyl alcohol glucoside, said methods comprising
a) Providing a plant comprising a heterologous nucleic acid encoding a vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said plant; and
c) Isolating vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside from the plant.
It is furthermore an aspect of the invention to provide methods of producing animal feed, said methods comprising
a) Providing a plant comprising a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said plant; and
c) processing the plant into animal feed.
It is also an aspect of the invention to provide methods of producing food product, said method comprising
a) Providing a plant comprising edible parts, wherein said plant comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and b) cultivating said plant; and
c) harvesting said edible parts;
thereby obtaining a food product with vanillin palate.
Description of drawings
Figure 1 shows a LC-MS chromatogram from in vitro feedings of 1/pVAN. The figure shows that the enzyme is able to catalyze carbon two cleavage of ferulic acid to vanillin. This reaction does not require CoASH, ATP and NAD+ as co-factors. Ion chromatograms of a protein solution with 1/pVAN fed with 5mM of ferulic acid for 1 h in 2.5mM DTT in 30°C. Furthermore, VAN is able to catalyze carbon two cleavage of ferulate CoA to vanillin in the presence of ATP, NAD+. Extracted ion chromatogram of a protein solution with VAN fed with 5mM of ferulate CoA for 1 h in 2.5mM DTT, 0,1 mM ATP and 0,1 mM NAD+ in 30°C. (EIC 153: Extracted ion chromatogram m/z (vanillin mw + FT)
(a) 1/pVAN fed with ferulic acid Negative control fed with ferulic acid
(b) 1/pVAN fed withferulate CoANegative control fed with ferulate CoA
(c) Vanillin fragmentation pattern at 7.5 min.
Figure 2 shows formation of vanillin glucoside by yeast strains having 1/pVAN stably integrated into the yeast chromosome together with Arabidopsis thaliana UGT72E2. The yeast strains were grown in Delft medium supplemented with 8% molasses before metabolite profiles were determined by LC-MS. (EIC 317 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22)
(a) Wt 1/pVAN
(b) 1/pVAN yeast codon optimized
(c) Negative control (yeast strain Y06460) Figure 3 shows the result of biosynthetic studies carried out with yeast harboring stably integrated Wt l/pVAN, 1/pVAN codon optimized for yeast expression, truncated l/pVAN devoid of the signal peptide (wt vp Asp van) and with truncated l/pVAN devoid of the signal peptide and codon optimized for yeast expression, (vp Asp van). The yeast strains were incubated with different putative substrates for 72h in synthetic media before metabolite profiles were determined by LC-MS. Formation of vanillin glucoside was observed with yeast fed with ferulic acid. (EIC 337 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22).
(a) Wt VpVAN
(b) 1/pVAN codon optimized for yeast expression
(c) wt vp Asp van - Wt l/pVAN devoid of the signal peptide
(d) vp Asp van - 1/pVAN devoid of the signal peptide and codon optimized for yeast expression
(e) Negative control (Yeast strain Y06460)
Figure 4 shows Substrate specificity of 1/pVAN tested with ferulic acid and ferulic acid glucoside. LC-MS extracted ion chromatograms show that l/pVAN is able to catalyze the chain cleavage of both ferulic acid and ferulic acid glucoside. (EIC 337 - Extracted ion chromatogram m/z Vanillin glucoside mw + 22).
(a) Negative control fed with ferulic acid
(b) VpVAN:: VpUGT72U1 fed with ferulic acid
(c) 1/pVAN fed with ferulic acid
(d) VpVAN:: JGT72E2 fed with ferulic acid
(e) Negative control fed with ferulic acid glucoside
(f) l/pVAN:: \/pUGT72 fed with ferulic acid glucoside
(g) l/pVAN fed with ferulic acid glucoside
(h) \/pVAN::^fUGT72E2 fed with ferulic acid glucoside
Figure 5 shows biological activity of vanillin synthase after a transient expression in Nicotiana benthamiana. l/pVAN was transferred to Agrobacterium tumefaciens and co- infiltrated with an A. tumefaciens strain harboring the p19 gene silencing suppressor in N. benthamiana leaves. Four days after inoculation, the infiltrated tobacco leaves were harvested and subjected to metabolite profiling by LC-MS. The profiling showed l/pVAN dependent formation of vanillyl alcohol glucoside. (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22). Figure 6 shows a LC-MS chromatogram from in vitro coupled transcription and translation (TNT) assays. The figure shows generation of significant amounts of vanillin glucoside (peak at 6 min.) after in vitro incubation with ferulic acid glucoside.
(a) Wt VpVAN (SEQ ID NO:1 )
(b) wt vp Asp van (aa 22-356 of SEQ ID NO:1 ) (c) vp Δ 137 van (aa 138-356 of SEQ ID NO:1 )
(d) vp Δ61 van (aa 62-356 of SEQ ID NO:1 )
(e) Negative control
Figure 7A) shows biological activity of vanillin synthase after transient expression in Nicotiana benthamiana leaves. The Nicotiana benthamiana has been transformed with nucleic acids encoding:
a) Wt VpVAN (SEQ ID NO:1 )
b) wt vp Δ 137 van (aa 138-356 of SEQ ID NO: 1 )
c) wt νρ Δ66 van (aa 138-356 of SEQ ID NO:1 )
d) Negative control (p19 infiltrated tobacco leaf)
The figure shows formation of vanillyl alcohol glucoside. (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22) in extracts expressing vanillin synthase or truncated vanillin synthase.
Figure 7B shows biological activity of a chimeric vanillin synthase compared to wild type 1/pVAN after transient expression in Nicotiana benthamiana leaves.The Nicotiana benthamiana has been transformed with nucleic acids encoding:
a) Chimeric vanillin synthase {vp nb Asp Δ137 van) (see Example 8)
b) Wt VpVAN (SEQ ID NO:1 )
c) Negative control (p19 infiltrated tobacco leaf)
The figure shows formation of most vanillyl alcohol glucoside in a) (EIC 339 - Extracted ion chromatogram m/z Vanillin alcohol glucoside mw + 22) in extracts expressing vanillin synthase or truncated vanillin synthase.
Figure 8 shows biological activity of a vanillin synthase of Glechoma hederacea (G AN) after a transient expression in Nicotiana benthamiana leaves.The Nicotiana benthamiana has been transformed with nucleic acids encoding G AN (upper panel). Lower panel shows a negative control. The figure shows formation of vanillin alcohol glucoside. Figure 9 shows 4-vinylguaiacol glucoside production in yeast expressing 1/pVAN (SEQ ID NO:1 ) and absence of this unwanted side product in yeast expressing 1/pVAN (SEQ ID NO:1 ) and lacking the padl and fadl genes. Figure 10 shows an alignment between Cysteine protease of Nicotiana benthamiana and vanillin synthase of Vanilla planifora (VpVAN). The consensus sequence between the two sequences is given below. Non-conserved amino acids are marked by *. Figure 1 1 shows an alignment between Vanillin synthase of Glechoma hederacea
(GhVAN) and vanillin synthase of Vanilla planifora (VpVAN). The consensus sequence between the two sequences is given below. Non-conserved amino acids are marked by
*
Figure 12 shows that yeast cells expressing Arabidopsis thaliana UGT72E2 (SEQ ID NO:3) synthesizes ferulic acid glucoside when grown on synthetic media comprising 2.5 mM ferulic acid.
Detailed description of invention Vanillin synthase
The present invention relates to vanillin synthase and uses thereof. Thus, the invention in particular relates to methods of producing vanillin or vanillin glucoside using a host organism expressing vanillin synthase according to the invention. The host organism may be any of the microbial organisms described herein below in the section "Microbial organism" or the host organism may be any of the plants described herein below in the section "Plants". In general the host organism will contain a heterologous nucleic acid encoding vanillin synthase and optionally also one or more additional heterologous nucleic acids as described herein below.
The vanillin synthase according to the present invention is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin. In particular, it is preferred that the vanillin synthase according to the present invention is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin in vivo in a plant. It is also preferred that the vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin in vivo in microbial organisms. The term herein refers to 3-methoxy-4-hydroxybenzaldehyde of the
structure:
Figure imgf000011_0001
The structure of ferulic acid is provided herein below in the section "ferulic acid".
The vanillin synthase to be used with the present invention may be vanillin synthase from any suitable origin, preferably the vanillin synthase is vanillin synthase of a plant, wherein said plant naturally produces vanillin, vanillyl alcohol, vanillin glycoside and/or vanillyl alcohol glycoside. Thus, in one embodiment the vanillin synthase is vanillin synthase of Vanilla planifolia.
Thus, a preferred vanillin synthase to be used with the invention is vanillin synthase of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. Preferably, the vanillin synthase is vanillin synthase of SEQ ID NO:1 . The sequence identity is preferably calculated as described herein below in the section "Sequence identity".A functional homologue of a vanillin synthase of a given sequence shares above-mentioned sequence identity and is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
Additional useful vanillin synthases may be identified by any suitable method known to the skilled person, for example by a method comprising the steps of
a) providing a plant, which produces vanillin, vanillyl alcohol, vanillin glycoside and/or vanillyl alcohol glycoside
b) obtaining nucleic acids (e.g. DNA or cDNA) from said plant
c) identifying a nucleic acid encoding a polypeptide having a sequence with at least 50%, such as at least 60%, for example at least 70% sequence identity to SEQ ID NO:1 d) testing whether the polypeptide encoded by said nucleic acid is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
The method may also comprise the steps of
b) providing sequence information of nucleic acids from a plant, which produces vanillin, vanillyl alcohol, vanillin glycoside and/or vanillyl alcohol glycoside
c) identifying a nucleic acid encoding a polypeptide having a sequence with at least 50%, such as at least 60%, for example at least 70% sequence identity to SEQ ID NO:1
d) testing whether the polypeptide encoded by said nucleic acid is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
If the polypeptide as tested in any of the steps d) described above is capable of catalysing side chain cleavage of ferulic acid to form vanillin, then said polypeptide is a vanillin synthase, which may be useful with the present invention.
Another vanillin synthase to be used with the invention is vanillin synthase of SEQ ID NO:21 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. Preferably, the vanillin synthase is vanillin synthase of SEQ ID NO:21 . The sequence identity is preferably calculated as described herein below in the section "Sequence identity".A functional homologue of a vanillin synthase of a given sequence shares above-mentioned sequence identity and is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
In addition to sharing above mentioned sequence identity, then it is also preferred that functional homologues retain as many of the amino acids conserved amongst different vanillin synthases. Thus, it is preferred that functional homologues of SEQ ID NO:1 comprises at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids of the consensus sequence of figure 1 1 , for example at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids not marked by * in the alignment shown in figure 1 1 . Similarly, it is preferred that functional homologues of SEQ ID NO:21 comprises at least 90%, more preferably at tleast 95%, yet more preferably at least 98%, such as all of the amino acids of the consensus sequence of figure 1 1 , for example at least 90%, more preferably at least 95%, yet more preferably at least 98%, such as all of the amino acids not marked by * in the alignment shown in figure 1 1 .
The vanillin synthase to be used with the present invention may also be vanillin synthase devoid of the signal peptide. This is in particular the case in embodiments of the invention where the nucleic acid sequence encoding vanillin synthase is introduced into microbial cells. Thus, in a preferred embodiment the vanillin synthase to be used with the present invention is vanillin synthase lacking all or at least part of the signal peptide, which directs the protein to the endoplasmatic reticulum of plants. Accordingly, the vanillin synthase may comprise at least or even consist of aa 22 to 356 of SEQ ID NO:1 or a functional homologue thereof sharing at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98% sequence identity therewith. In one embodiment, the vanillin synthase to be used with the present invention is vanillin synthase of SEQ ID NO:17 or a functional homologue thereof sharing at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith.
The vanillin synthase to be used with the present invention may also be a truncated vanillin synthase, which is capable of catalyzing side chain cleavage of ferulic acid to form vanillin. Thus, the vanillin synthase may lack one or more N-terminal amino acids, for example the vanillin synthase maybe
a) vanillin synthase of SEQ ID NO:1 lacking in the range of 1 to 150 of the most N- terminal amino acids
b) vanillin synthase of SEQ ID NO:1 lacking in the range of 21 to 137 of the most N-terminal amino acids
c) Vanillin synthase of SEQ ID NO:1 lacking in the range of 120 to 140 of the most N-terminal amino acids
d) Vanillin synthase of SEQ ID NO:1 lacking in the range of 130 to 140 of the most N-terminal amino acids e) Vanillin synthase of SEQ ID NO:21 lacking in the range of 21 to 140 of the most N-terminal amino acids
f) Vanillin synthase of SEQ ID NO:1 lacking the 21 most N-terminal amino acids g) Vanillin synthase of SEQ ID NO:1 lacking the 61 most N-terminal amino acids h) Vanillin synthase of SEQ ID NO:1 lacking the 137 most N-terminal amino acids i) Vanillin synthase of SEQ ID NO:21 lacking the 21 most N-terminal amino acids j) Vanilline synthase of SEQ ID NO:21 lacking the 140 most N-terminal amino acid k) a functional homologue of any of a) to j) sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
It is also comprised within the invention that the truncated vanillin synthase may be a) vanillin synthase comprising or consisting of aa 22 to 356 of SEQ ID NO:1 b) vanillin synthase comprising or consisting of aa 138 to 356 of SEQ ID NO:1 c) vanillin synthase comprising or consisting of aa 22 to 359 of SEQ ID NO:21 d) vanillin synthase comprising or consisting of aa 141 to 359 of SEQ ID NO:21 e) a functional homologue of any of a) to d) sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
In another embodiment of the invention the vanillin synthase is a chimeric protein containing sequences from a naturally occurring vanillin synthase as well as other sequences. In such embodiments of the invention the vanillin synthase may be a polypeptide of the following formula:
[Signal peptide]-X-[cleavage site]-[truncated vanillin synthase] The signal peptide may be any signal peptide. The skilled person will be able to identify a signal peptide, for example using the SignalP 4.1 . software, which is readily available from Center for Biological Sequence analysis at the Technical University of Denmark.
In particular, it is preferred that the signal peptide is a signal peptide endogenous to the host organism (i.e. the host organism containing a heterologous nucleic acid encoding said vanillin synthase). More preferably, the signal peptide is a signal peptide from a cysteine protease endogenous to the host organism. Even more preferably, the signal peptide is a signal peptide from a cysteine protease belonging to the Clan CA, more preferably to the Family C1 , even more preferably to the Subfamily A, wherein said cysteine protease is endogenous to the host organism. Said clan, family and subfamily is as defined by MEROPS Database. For example the cysteine protease may be a cysteine protease belonging to the class of aleurain cysteine proteases.
Aforementioned regarding the signal peptide being from a cysteine protease is in particular applicable in embodiments of the invention where the host organism is a plant.
The signal peptide may thus be identified by a method comprising the steps of
a) providing nucleic acids encoding polypeptides or sequence information of
nucleic acids encoding polypeptides or sequence information of polypeptides of the host organism
b) identifying a polypeptide having a sequence identity with SEQ ID NO:1 of at least 50%, such as at least 60%, for example at least 70%, and which is a cysteine protease
c) identifying the signal peptide of said cysteine protease, for example using the SignalP 4.1 . software
thereby identifying the signal peptide.
X may be any linker sequence linking the signal peptide and the cleavage site. In one embodiment said linker sequence X may be a sequence from a naturally occurring vanillin synthase. Thus, for example X may be aa 22 to 134 of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith over the entire length. The cleavage site may be any protease cleavage site. In particular, it is preferred that the cleavage site is endogenous to the host organism. More preferably, the cleavage site is a cleavage site from a cysteine protease endogenous to the host organism. Even more preferably, the cleavage site is a cleavage site from a cysteine protease belonging to the Clan CA, more preferably to the Family C1 , even more preferably to the Subfamily A, wherein said cysteine protease is endogenous to the host organism. Said clan, family and subfamily is as defined by MEROPS Database. For example the cysteine protease may be a cysteine protease belonging to the class of aleurain cysteine proteases. Aforementioned regarding the cleavage site being from a cysteine protease is in particular applicable in embodiments of the invention where the host organism is a plant.
The cleavage site may be identified by a method comprising the steps of
a) providing nucleic acids encoding polypeptides or sequence information of
nucleic acids encoding polypeptides or sequence information of polypeptides of the host organism
b) identifying a polypeptide having a sequence identity with SEQ ID NO:1 of at least 50%, such as at least 60%, for example at least 70%, and which is a cysteine protease
c) preparing an alignment between SEQ ID NO:1 and said polypeptide identified under b)
d) identifying the amino acids of said polypeptide corresponding to amino acids 135 to 141 of SEQ ID NO:1 , wherein the amino acids corresponding to amino acids 135 to 141 of SEQ ID NO:1 are the cleavage site.
The truncated vanillin synthase may be any of the truncated vanillin synthases described herein above. In particular the truncated vanillin synthase may comprise or consists of aa 142 to 356 of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith over the entire length.
The heterologous nucleic acid may be any heterologous nucleic acid encoding a vanillin synthase described in this section. For example the heterologous nucleic acid may be a nucleic acid comprising SEQ ID NO:2 or a nucleic acid capable of hybridizing to the complementary sequence of SEQ ID NO:2.
However, in preferred embodiments of the invention, the heterologous nucleic acid encoding vanillin synthase has been fully or partly codon optimized for the particular microbial organism comprising the heterologous nucleic acid. Several software packages are publicly available for this purpose for example Optimizer", which is described in Puigbo et al., 2007, OPTIMIZER: A web server for optimizing the codon usage of DNA sequences, Nucleic Acids Research, 35:W126-W131 and Puigbo et al., 2008, HEG-DB: a database of predict highly expressed genes in prokaryotic complete genomes under translational selection, Nucleic Acids Research. 36:D524-7 or "JCat", which is described in Grote et al., 2005, JCat: a novel tool to adapt codon usage of a target gene to its potential expression host, Nucleic Acids Research, Volume 33, Issue suppl 2, Pp. W526-W531 or "INCA" as described in Supek F and Vlahovicek K:
Comparison of codon usage measures and their applicability in prediction of microbial gene expressivity; BMC Bioinformatics (2005) 6:182.
Thus, in embodiments of the invention relating to use of microbial organisms, the heterologous nucleic acid encoding vanillin synthase may be codon optimised for the particular microbial organism used. Thus, the heterologous nucleic acid encoding vanillin synthase may be partly codon optimised for the particular microbial organism used, or the heterologous nucleic acid encoding vanillin synthase may be fully codon optimised for the particular microbial organism used. For example, in embodiments of the invention relating to use of yeast, such as S. cerevisiae, then the heterologous nucleic acid encoding vanillin synthase may be codon optimised for use in yeast, such as for use in S. cerevisiae, for example the heterologous nucleic acid encoding vanillin synthase may comprise or even consist of SEQ ID NO: 18.
Methods
In one aspect, the present invention relates to methods for the production of vanillin. The methods involve use of vanillin synthase, which may be any of the vanillin synthases described herein above in the section "vanillin synthase". In general the methods involve use of a host organism expressing a vanillin synthase. Thus, in one embodiment the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said method comprising the steps of a) Providing a microbial organism, wherein said microbial organism
i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding vanillin synthase,
wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and
b) cultivating said microbial organism in culture medium supporting growth of said microbial organism
c) Isolating vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside from the microbial organism and/or from the culture medium.
In this embodiment the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism". Said microbial organism is capable of producing ferulic acid or a ferulic acid derivative (e.g. ferulic acid glucoside). Preferably, the microbial organism is capable of producing ferulic acid. This may be achieved in various ways. For example the microbial organism may contain nucleic acid sequences encoding one or more enzymes involved in synthesis of ferulic acid, such as any of the enzymes described herein below in the section "Enzymes involved in synthesis of ferulic acid". The nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". It is preferred that the methods are methods of preparing vanillin.
In another embodiment the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said methods comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and cultivating said microbial organism in the presence of ferulic acid or a ferulic acid derivative in culture medium supporting growth of said microbial organism
Isolating vanillin and/or vanillin glucoside from the microbial organism and/or from the culture medium.
In this embodiment the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism". The nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". The culture medium may comprise ferulic acid originating from any suitable source, and/or the culture medium may comprise a ferulic acid derivative, e.g. ferulic acid glucoside. In particular the ferulic acid may be provided in any of the ways described herein below in the section "Ferulic acid". Preferably, the method is a method of producing vanillin.
In yet another embodiment, the invention relates to methods of producing vanillin, said method comprising the steps of a) Providing a microbial organism, wherein said microbial organism
i. is capable of producing ferulic acid and/or a ferulic acid derivative; and ii. comprises a heterologous nucleic acid encoding vanillin synthase,
wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g. (VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80% sequence identity therewith; and
iii. is capable of glucosylating vanillin; and
b) cultivating said microbial organism in culture medium supporting growth of said microbial organism
c) Isolating vanillin glucoside from the microbial organism and/or from the
culture medium; and
d) Deglucosylating said vanillin glucoside.
In this embodiment, the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism". Said microbial organism is capable of producing ferulic acid or a ferulic acid derivative (e.g. ferulic acid glucoside). Preferably the microbial organism is capable of producing ferulic acid. This may be achieved in various ways. For example the microbial organism may contain nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid, such as any of the enzymes described herein below in the section "Enzymes involved in synthesis of ferulic acid". Said microbial organism is also capable of glucosylating vanillin. This may be achieved in various ways. For example the microbial organism may contain a nucleic acid sequence encoding a glucosyl transferase, preferably the microbial organism contains a nucleic acid sequence encoding any of the glucosyl transferases described herein below in the section "Glycosyl transferases". The nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". Deglucosylating said vanillin glucoside may be performed as described herein below.
In a further embodiment the invention relates to a method of producing vanillin, wherein the method comprises the steps of a) providing a microbial organism, wherein said microbial organism
i. comprises a heterologous nucleic acid sequence encoding vanillin
synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin, e.g.
(VpVAN) of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
iii. is capable of glucosylating vanillin; and
b) cultivating said microbial organism in the presence of ferulic acid and/or ferulic acid derivative in culture medium supporting growth of said microbial organism
c) Isolating vanillin glucoside from the microbial organism and/or from the culture medium; and
d) Deglucosylating said vanillin glucoside.
In this embodiment, the microbial organism may be any of the microbial organisms described herein below in the section "microbial organism". The nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". The culture medium may comprise ferulic acid and/or ferulic acid derivative (e.g. ferulic acid glucoside). Preferably the culture medium contains ferulic acid. Said ferulic acid may originate from any suitable source, in particular the ferulic acid may be provided in any of the ways described herein below in the section "Ferulic acid". Deglucosylating said vanillin glucoside may be performed as described herein below.
The microbial organism may be cultivated in any culture medium suitable for cultivating microbial organism. The skilled person will be able to select a suitable culture medium depending on the particular microbial organism. In particular, the growth conditions should be selected so that the vanillin synthase is expressed in said microbial organism. The microbial organism may be grown in a fed batch or continuous process. Typically, the microbial organism is grown in a fermentor at a defined temperature(s) for a desired period of time. Depending on the particular microbial organism used in the method, other heterologous nucleic acids encoding enzymes involved in synthesis of ferulic acid and/or glucoside transferases may also be present and expressed.
In some embodiments, vanillin or vanillin glucoside can be produced using whole cells that are fed ferulic acid and/or a ferulic acid derivative, which may be provided in any of the ways described herein below in the section "Ferulic acid". The ferulic acid be contained in the culture medium, it may be fed during cell growth or after cell growth. Preferably, the culture medium comprises ferulic acid. The microbial organism may be grown in suspension or immobilized. In embodiments of the invention where the microbial organism is bacteria or fungi, such as yeast, then preferably the microbial organism is grown in suspension.
In one embodiment of the invention it is preferred that the culture medium does not contain high levels of coumaric acid, for example the culture medium may contain at the most 1 mM, such as at the most 0.5mM, for example at the most 0.01 mM, such as no detectable coumaric acid.
In one embodiment of the invention it is preferred that the vanillin is produced under conditions, which are not too reducing. According, in one embodiment it is preferred that the culture medium comprises less than 5 mM, preferably less than 3 mM DTT. In embodiments of the invention where vanillin is prepared in vitro it is preferred that ferulic acid and/or the ferulic acid derivative is incubated with vanillin synthase in the presence of at the most 5 mM, preferably at the most 3 mM DTT. The method relates to production of vanillin or vanillin glucoside, said vanillin glucoside is preferably vanillin beta-D-glucoside. The amount of vanillin or vanillin glucoside produced can be from about 1 mg/l to about 1 ,500 mg/L, or higher. For example, about 1 to about 10 mg/L, about 3 to about 10 mg/L, about 5 to about 20 mg/L, about 10 to about 50 mg/L, about 10 to about 100 mg/L, about 25 to about 500 mg/L, about 100 to about 1 ,500 mg/L, or about 200 to about 1 ,000 mg/L of vanillin or vanillin glucoside, or about 250 to about 5,000 mg/L, about 1 ,000 to about 15,000 mg/L, or about 2,000 to about 10,000 mg/L, about 2000 to about 50000 mg/L or even from about 2,000 to about 100000 mg/L, or even from about 5000 to 200,000 mg/L can be produced. In general, longer culture times will lead to greater amounts of product. Thus, the microbial organism can be cultured for from 1 day to 7 days, from 1 day to 5 days, from 3 days to 5 days, about 3 days, about 4 days, or about 5 days.
After the microbial organism has been grown in culture for the desired period of time, vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside can then be recovered from the culture using any useful techniques known in the art. For example, methods for isolating vanillin and/or vanillin glucoside may comprisethe percolation technique or supercritical carbon dioxide extraction and reverse osmosis for concentration. Vanillin and/or vanillin glucoside may also be recovered by methods involving isolation and purification by extraction, vacuum distillation and multi-stage re- crystallization from aqueous solutions and ultrafiltration (e.g. as described by
Boddeker, et al. (1997) J. Membrane Sci. 137:155-158; Borges da Silva, et al. (2009) Chem. Eng. Des . 87:1276-1292). Two-phase extraction processes, employing either sulphydryl compounds, such as dithiothreitol, dithioerythritol, glutathione, or L-cysteine (US Patent No. 5,128,253), or alkaline KOH solutions (WO 94/13614), may also be used in the recovery of vanillin and/or vanillin glucoside as well as for its separation from other aromatic substances. Vanillin adsorption and pervaporation from
bioconverted media using polyether- polyamide copolymer membranes may also be employed for isolating vanillin and/or vanillin glucoside (e.g. as described by Boddeker, et al. (1997) supra; or Zucchi, et al. (1998) J. Microbiol. Biotechnol. 8 : 719- '22).
Macroporous adsorption resins with crosslinked-polystyrene framework may also been used to recover dissolved vanillin and/or vanillin glucoside from aqueous solutions (Zhang, et al . (2008) Eur. Food Res. Technol. 226:377-383). Ultrafiltration and membrane contactor (MC) techniques may also be useful to recover vanillin and/or vanillin glucoside (Zabkova, et al. (2007) J. Membr. Sci. 301 :221 -237; Scuibba, et al. (2009) Desalination 241 :357-364). Alternatively, conventional techniques such as percolation or supercritical carbon dioxide extraction and reverse osmosis for concentration could be used. If the recombinant host is a plant or plant cells, vanillin or vanillin glucoside can be extracted from the plant tissue using various techniques known in the art.
In some embodiments, the vanillin or vanillin glucoside is isolated and purified to homogeneity {e.g., at least 90%, 92%, 94%, 96%, or 98% pure). In other embodiments, the vanillin or vanillin glucoside is provided as an extract from a microbial organism. In this respect, vanillin or vanillin glucoside may be isolated, but not necessarily purified to homogeneity.
Extracts of isolated, and optionally purified, vanillin or vanillin glucoside for example find use in flavoring consumables such as food products, dietary supplements, nutraceuticals, pharmaceutical compositions, dental hygienic compositions, and cosmetic products.
In embodiments of the invention, wherein the microbial organism is capable of glucosylating vanillin, then the method may frequently also contain a step of
deglucosylating said vanillin glucoside. This step may be performed prior to isolation of the vanillin glucoside or subsequently to isolation of vanillin glucoside.
This may be done by chemical hydrolysis according to known methods in the art or enzymatically by e.g. use of an enzyme with glucosidase activity. In particular a beta- glucosidase may be used. Numerous suitable beta-glycosidases are known to the skilled person. Deglucosylation can e.g. be achieved first by recovering vanillin glucoside for instance by extracting it in a suitable solvent, e.g. methanol, or by collecting it after excretion from the producing microbial organism or plant. Secondly, the glucosylated intermediate may be purified and exposed to a beta-glucosidase in vitro or to an adequate chemical hydrolysis.
The glucosidase may be provided in various forms, for example the glucosidase may be provided in form of a microbial organism expressing said glucosidase and preferably excreting said glucosidase. Such a microbial organism may be co-cultured together with the microbial organism comprising the vanillin synthase of the invention. The glucosidase may also be provided in the form of an extract of an organism expressing the glucosidase. Said extract may be a crude extract or a partly purified extract. The glucosidase may also be provided as the purified enzyme. In embodiments where the glucosidase is provided as an extract, a crude extract or as a purified enzyme, then the glucosidase may be added directly to the culture medium during cultivation of the microbial organism comprising the vanillin synthase. However, preferably it is added after cultivation. Thus it may be added directly to the culture medium after cultivation of the microbial organism comprising the vanillin synthase or it may be added to partly purified vanillin glucoside or even to purified vanillin glucoside. Thus, the isolated vanillin glucoside may be treated with said extract, said partly purified extract or said purified glucosidase.
Glucosylation of vanillin may also facilitate isolation: Hydrophobic impurities in the culture medium accumulating vanillin glucoside can be removed by two phase partitioning where vanillin glucoside will partition to the aqueous phase while hydrophobic impurities may partition to the organic phase. Following degycosylation, for example by beta-glucosidase treatment, the two phase partitioning process may be repeated to achieve removal of hydrophilic contaminants.
Thus, the purification may comprise the steps of:
a) Obtaining culture medium and/or extract of the microbial organism comprising vanillin glucoside after cultivation and/or extract of a plant comprising vanillin glucoside; and
b) Contacting and mixing said culture medium or extract with an organic phase c) Separating the aqueous phase from the organic phase; and
d) Discarding the organic phase; and
e) Deglucosylating the vanillin glucoside, e.g. by glucosidase treatment, such as glucosidase treatment as described herein above, thereby obtaining a liquid comprising vanillin; and
f) Contacting and mixing said liquid comprising vanillin with an organic phase; and g) Recovering the organic phase, which comprises vanillin; and
h) Optionally further purifying vanillin from said organic phase The organic phase may be any useful organic phase, e.g. the organic phase may be composed of hexane, diethylether, ethylacetate or chloroform.
In one embodiment the invention relates to methods of producing vanillin, vanillyl alcohol and/or glucosides thereof, said method comprising
a) Providing a plant comprising a heterologous nucleic acid encoding VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said plant; and
c) Isolating vanillin, vanillyl alcohol and/or glucosides thereof from the plant.
In this embodiment the plant may be any of the plants described herein below in the section "Plant". The nucleic acid encoding vanillin synthase may encode any of the vanillin synthases described herein above in the section "Vanillin synthase". In a preferred embodiment the method is a method for producing vanillin.
In another embodiment the invention relates to methods of producing vanillin glucosides, said method comprising
a) Providing a plant comprising a heterologous nucleic acid encoding VpVAN of SEQ ID NO:1 or a functional homologue thereof sharing at least 80% sequence identity therewith; and
b) cultivating said plant; and
c) Isolating vanillin glucosides from the plant,
d) Deglucosylating said vanillin glucoside.
The plant may be cultivated in any manner suitable for culturing the specific plant. The skilled person will be able to select suitable conditions for cultivating a particular plant.
The vanillin, vanillyl alcohol and/or vanillin glucoside may be isolated from any useful part of the plant, for example from the leaves, from the fruits, from the seeds, from the roots, or from the stems. Frequently, vanillin, vanillyl alcohol or vanillin glucoside will be isolated from leaves, seeds or fruits of the plant. For example in embodiments of the invention, where the plant is Nicotiana tabacum, then vanillin or vanillin glucoside may be isolated from the leaves. The isolation in general comprises a step of extraction, which may then optionally be followed by one or more purification steps, for example any of the purification steps described herein above in this section. Deglucosylation of vanillin glucoside may also be performed as described herein above in this section.
In one embodiment it is preferred that said plant producing at least 3 times, such as at least 4 times, for example at least 5 times, such as at least 10 times more vanillin compared to an identical plant, which does not comprise said heterologous nucleic acid encoding vanillin synthase.
Extracts comprising vanillin or isolated vanillin prepared as described by the present invention e.g. find use in flavouring consumables, such as food products, dietary supplements, nutraceuticals, pharmaceutical compositions, dental hygienic
compositions and cosmetic products. Useful examples of such consumables are described in WO2013/022881 in the sections [0030] to [0046]. WO2013/022881 is incorporated by reference herein.
Microbial organism
In one aspect the present invention relates to microbial organisms comprising a heterologous nucleic acid encoding vanillin synthase, which may be any of the vanillin synthases described herein above in the section "vanillin synthase" as well as use thereof in the production of vanillin and/or vanillin glucoside.
The microbial organism may in addition to the heterologous nucleic acid encoding vanillin synthase also comprise additional heterologous nucleic acids, for example heterologous nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid (for example any of the enzymes involved in the synthesis of ferulic acid described herein below in the section "Enzymes involved in synthesis of ferulic acid") or a glucosyl transferase (for example any of the glucosyl transferases described herein below in the section "Glucosyl transferase").
It will be appreciated that the various genes and modules discussed herein can be present in two or more microbial organisms rather than a single microbial organism. Thus, for example one microbial organism may contain one or more heterologous nucleic acid encoding an enzyme involved in the synthesis of ferulic acid, rendering said microbial organism capable of producing ferulic acid, whereas another microbial organism may comprise the heterologous nucleic acid encoding vanillin synthase. When a plurality of microbial organisms is used, they can be grown in a mixed culture to produce vanillin and/or vanillin glucoside. In such cases the co-expression of suitable transporters may be advantageous to export intermediates into the growth medium and to facilitate uptake into the microbial organism producing vanillin or vanillin glucoside.
The microbial cell of the present invention can be any cell suitable for expression of heterologous nucleic acids. In one embodiment the microbial cell of the invention is a eukaryotic cell. In another embodiment the host cell is a prokaryotic cell.
In a preferred embodiment, the host cell is a fungal cell such as a yeast or filamentous fungus. In particular the host cell may be a yeast cell. In a further embodiment the yeast cell is selected from the group consisting of
Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Ashbya gossypii, Cyberlindnera jadinii, and Candida albicans.
In general, yeasts and fungi are excellent microbial cells to be used with the present invention. They offer a desired ease of genetic manipulation and rapid growth to high cell densities on inexpensive media. For instance yeasts grow on a wide range of carbon sources and are not restricted to glucose. Thus, the microbial organism to be used with the present invention may be selected from the group of yeasts described below: Arxula adeninivorans (Blastobotrys adeninivorans) is a dimorphic yeast (it grows as a budding yeast like the baker's yeast up to a temperature of 42 °C, above this threshold it grows in a filamentous form) with unusual biochemical characteristics. It can grow on a wide range of substrates and can assimilate nitrate. It has successfully been applied to the generation of strains that can produce natural plastics or the development of a biosensor for estrogens in environmental samples.
Candida boidinii s a methylotrophic yeast (it can grow on methanol). Like other methylotrophic species such as Hansenula polymorpha and Pichia pastoris, it provides an excellent platform for the production of heterologous proteins. Yields in a multigram range of a secreted foreign protein have been reported. A computational method, IPRO, recently predicted mutations that experimentally switched the cofactor specificity of Candida boidinii xylose reductase from NADPH to NADH. Details on how to download the software implemented in Python and experimental testing of predictions are outlined in the following paper.
Hansenula polymorpha (Pichia angusta) is another methylotrophic yeast (see Candida boidinii). It can furthermore grow on a wide range of other substrates; it is thermo- tolerant and can assimilate nitrate (see also Kluyveromyces lactis). It has been applied to the production of hepatitis B vaccines, insulin and interferon alpha-2a for the treatment of hepatitis C, furthermore to a range of technical enzymes.
Kluyveromyces lactis is a yeast regularly applied to the production of kefir. It can grow on several sugars, most importantly on lactose which is present in milk and whey. It has successfully been applied among others to the production of chymosin (an enzyme that is usually present in the stomach of calves) for the production of cheese.
Production takes place in fermenters on a 40,000 L scale.
Pichia pastoris is a methylotrophic yeast (see Candida boidinii and Hansenula polymorpha). It provides an efficient platform for the production of foreign proteins. Platform elements are available as a kit and it is worldwide used in academia for the production of proteins. Strains have been engineered that can produce complex human N-glycan (yeast glycans are similar but not identical to those found in humans).
Saccharomyces cerevisiae is the traditional baker's yeast known for its use in brewing and baking and for the production of alcohol. As protein factory it has successfully been applied to the production of technical enzymes and of pharmaceuticals like insulin and hepatitis B vaccines.
Yarrowia lipolytica is a dimorphic yeast (see Arxula adeninivorans) that can grow on a wide range of substrates. It has a high potential for industrial applications but there are no recombinant products commercially available yet.
In another embodiment the host cell is a microalgae such as Chlorella and Prototheca. In another embodiment of the invention the host cell is a filamentous fungus, for example Aspergillus.
In further yet another embodiment the host cell is a plant cell. The host cell may be a cell of a higher plant, but the host cell may also be cells from organisms not belonging to higher plants for example cells from the moss Physcomitrella patens.
In another embodiment the host cell is a mammalian cell, such as a human, feline, porcine, simian, canine, murine, rat, mouse or rabbit cell.
The host cell may also be selected from the group consisting of CHO, CHO-K1 , HEI193T, HEK293, COS, PC12, HiB5, RN33b, BHK cells.
As mentioned, the host cell can also be a prokaryotic cell such as a bacterial cell. If the cell is a prokaryotic cell the cell may be selected from, but not limited to E. coli, Corynebacterium, Bacillus, Pseudomonas and Streptomyces cells.
Plant In some embodiments, the nucleic acids encoding the vanillin synthase of the invention are introduced into plants or plant cells to achieve production of vanillin or vanillin glucoside or vanillyl alcohol or vanillyl alcohol glucoside in said plant or plant cells. In particular, the nucleic acids may be introduced into plants other than Vanilla planifolia to obtain production of vanillin in these plants.
The plant may in addition to the heterologous nucleic acid encoding vanillin synthase also comprise additional heterologous nucleic acids, for example heterologous nucleic acids encoding one or more enzymes involved in synthesis of ferulic acid or a glucosyl transferase.
A plant or plant cell can be transformed by having a heterologous nucleic acid integrated into its genome, i.e., it can be stably transformed. Stably transformed cells typically retain the introduced nucleic acid with each cell division. A plant or plant cell can also be transiently transformed such that the recombinant gene is not integrated into its genome. Transiently transformed cells typically lose all or some portion of the introduced nucleic acid with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a certain number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.
Plant cells comprising a nucleic acid encoding a vanillin synthase used in methods described herein can constitute part or all of a whole plant. Such plants can be grown in a manner suitable for the species under consideration, either in a growth chamber, a greenhouse, or in a field. Plants may also be progeny of an initial plant comprising a nucleic acid encoding a vanillin synthase provided the progeny inherits the
heterologous nucleic acid. Seeds produced by a transgenic plant can be grown and then selfed (or outcrossed and selfed) to obtain seeds homozygous for the nucleic acid construct. The plants to be used with the invention can be grown in suspension culture, or tissue or organ culture. For the purposes of this invention, solid and/or liquid tissue culture techniques can be used. When using solid medium, plant cells can be placed directly onto the medium or can be placed onto a filter that is then placed in contact with the medium. When using liquid medium, transgenic plant cells can be placed onto a flotation device, e.g., a porous membrane that contacts the liquid medium.
When transiently transformed plant cells are used, a reporter sequence encoding a reporter polypeptide having a reporter activity can be included in the transformation procedure and an assay for reporter activity or expression can be performed at a suitable time after transformation. A suitable time for conducting the assay typically is about 1 -21 days after transformation, e.g., about 1 -14 days, about 1 -7 days, or about 1 - 3 days. The use of transient assays is particularly convenient for rapid analysis in different species, or to confirm expression of a heterologous polypeptide whose expression has not previously been confirmed in particular recipient cells.
Techniques for introducing nucleic acids into monocotyledonous and dicotyledonous plants are known in the art, and include, without limitation, Agrobacterium- mediated transformation, viral vector-mediated transformation, electroporation and particle gun transformation, U.S. Patent Nos 5,538,880; 5,204,253; 6,329,571 ; and 6,013,863. If a cell or cultured tissue is used as the recipient tissue for transformation, plants can be regenerated from transformed cultures if desired, by techniques known to those skilled in the art. Heterologous nucleic acids encoding vanillin synthase may be introduced into cereal plants, such as barley as described by Hebelstrup et al., (2010) UCE: A uracil excision (USER (TM))-based toolbox for transformation of cereals. Plant Methods, 6:15 or by Holme et al. (2012) Cisgenic barley with improved phytase activity. Plant Biotechnol J 10, 237-247.
A population of plants can be screened and/or selected for those members of the population that carry the heterologous nucleic acid encoding vanillin synthase. For example, a population of progeny of a single transformation event can be screened for those plants having a desired level of expression of the vanillin synthase. Physical and biochemical methods can be used to identify expression levels. These include
Southern analysis or PCR amplification for detection of a polynucleotide; Northern blots, S1 RNase protection, primer-extension, or RT-PCR amplification for detecting RNA transcripts; enzymatic assays for detecting enzyme or ribozyme activity of polypeptides and polynucleotides; and protein gel electrophoresis, Western blots, immunoprecipitation, and enzyme-linked immunoassays to detect polypeptides. Other techniques such as in situ hybridization, enzyme staining, and immunostaining also can be used to detect the presence or expression of polypeptides and/or nucleic acids. Methods for performing all of the referenced techniques are known. As an alternative, a population of plants comprising independent transformation events can be screened for those plants carrying all and/or expressing all the different heterologous nucleic acids. Selection and/or screening can be carried out over one or more generations, and/or in more than one geographic location. In some cases, the plants can be grown and selected under conditions which induce a desired phenotype or are otherwise necessary to produce a desired phenotype in the plant. In addition, selection and/or screening can be applied during a particular developmental stage in which the heterologous nucleic acid is expected to be expressed by the plant. Selection and/or screening can be carried out to choose those transgenic plants having a statistically significant difference in vanillin or vanillin beta-D-glucoside level relative to a control plant that lacks the heterologous nucleic acid encoding vanillin synthase.
Plants which include a plant cell according to the invention are also provided as are seeds produced by said plants. The plant comprising a heterologous nucleic acid encoding vanillin synthase to be used with the present invention may for example be selected from: corn (Zea. mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuas), wheat (Tritium aestivum and other species), Triticale, Rye (Secale) soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Impomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citrus (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Primus amygdalus), apple (Malus spp), Pear (Pyrus spp), plum and cherry tree (Prunus spp), Ribes (currant etc.), Vitis, Jerusalem artichoke (Helianthemum spp), non-cereal grasses (Grass family), sugar and fodder beets (Beta vulgaris), chicory, oats, barley, vegetables, and ornamentals.
In one embodiment of the invention the plant is a plant comprising edible parts. In particular, the plant may be a plant with a taste, where a combination with vanilla taste can be envisioned to be desirable. Thus, the plant may be a plant comprising an edible fruit, wherein it is desired that said fruit in addition to the natural taste of said fruit also contains a vanilla flavour. One non-limiting example of such a plant is tomato.
For example, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea, sugar beets, sugar cane, soybean, oilseed rape, sunflower and other root, tuber or seed crops. Other important plants maybe fruit trees, crop trees, forest trees or plants grown for their use as spices or pharmaceutical products (Mentha spp, clove,
Artemesia spp, Thymus spp, Lavendula spp, Allium spp., Hypericum, Catharanthus spp, Vinca spp, Papaver spp., Digitalis spp, Rawolfia spp., Vanilla spp., Petrusilium spp., Eucalyptus, tea tree, Picea spp, Pinus spp, Abies spp, Juniperus spp,.
Horticultural plants which may be used with the present invention may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, carrots, and carnations and geraniums. The plant may also be selected from the group consisting of tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper and Chrysanthemum.
The plant may also be a grain plants for example oil-seed plants or leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, sorghum, rye, etc. Oil-seed plants include cotton soybean, saff lower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mung bean, lima bean, fava been, lentils, chickpea.
In a further embodiment of the invention said plant is selected from the following group: maize, rice, wheat, sugar beet, sugar cane, tobacco, oil seed rape, potato and soybean. Thus, the plant may for example be rice. The whole genome of Arabidopsis thaliana plant has been sequenced (Paquette, S. et al, Phytochemistry 62 (2003) 399-413). Consequently, very detailed knowledge is available for this plant and it may therefore be a useful plant to work with.
Accordingly, one plant, which may be used with the present invention is an Arabidopsis and in particular an Arabidopsis thaliana.
Interestingly, the present invention demonstrates that even plants quite distinct from Vanilla planifolia can be engineered to produce vanillin, vanillyl alchol and/or vanillin glucoside. Thus, whereas Vanilla planifolia is a monocot, and more specifically an epiphytic climbing orchid, then the invention surprisingly demonstrates that even dicots are capable of producing vanillin, vanillyl alchol and/or vanillin glucoside. Thus, in one embodiment of the invention, the host organism is a dicot. In a preferred embodiment of the invention, the plant is a plant of the order Solanales. In particular, the plant may be a plant of the genus Nicotiana, for example the plant may be Nicotiana tobaccum.
In one embodiment the invention relates to a plant comprising a heterologous nucleic acids encoding the vanillin synthase of the invention, wherein the plant is a plant used as animal feed. It may be advantageous for plants used as animal feed to comprise vanillin, because vanillin may induce appetite in animals and also may improve palability of feed prepared from the plants, thereby inducing increased feed uptake by animals. Furthermore, interestingly, plants comprising a heterologous nucleic acid encoding the vanillin synthase of the invention may also have reduced lignin content or lignin with a different composition offering favourable traits e.g. physical strength or biodegradability. Without being bound by theory it is speculated that expression of vanillin synthase according to the invention reduces the pool of ferulic acid available for biosynthesis of lignin, because at least part of the ferulic acid is converted to vanillin.
The plant used as animal feed may be any plant useful as animal feed. In general said plant may be a herbaceous plant, such as grass or legumes. Said grass may be any graminoids, such as "true grasses" of the Poaceae or Gramineae family, as well as the sedges of the Cyperaceae family or rushes of the Juncaceae family. Examples of useful true grasses include cereals, bamboo and the grasses of lawns (turf) and grassland, for example Switch grass. In one preferred embodiment of the invention, the plant is a plant of a plant species with a high endogenous content of ferulic acid and/or a ferulic acid derivative. In particular, the plant may be of a plant species with a high endogenous content of ferulic acid and/or ferulic acid glucoside. In one embodiment of the invention, the plant is of a plant species accumulating high levels of free and/or accessible ferulic acid or ferulic acid glucoside. The primary cell wall of the commelinoid order of monocots and the Chenopodiaceae (e.g. sugar beet and spinach) contains substantial amounts of free phenylpropanoids in their non-lignified cell walls. A major fraction of these
phenylpropanoids is ferulic acid. Thus, in one embodiment the plant may be a plant of the commelimoid order of monocots or a chenopodiaceae. In one embodiment the plant is a plant comprising at least 50 μg, for example at least 100 μg, such as at least 200 μg ferulic acid and/or ferulic acid derivative per g dry matter
It may be preferred that the plant is not Vanilla planifolia. It may also be preferred that the plant is not Creeping Bentgrass.
Glucosyl transferase
The microbial organism comprising a heterologous nucleic acid encoding a vanillin synthase may also be capable of glucosylating vanillin. Most microbial organisms, such as bacteria and fungi are not natively capable of glucosylating vanillin. Thus, the microbial organism may comprise at least one heterologous nucleic acid encoding a glucosyl transferase, preferably a glucosyl transferase able to efficiently catalyse glucosylation of vanillin. Similar the plant comprising a heterologous nucleic acid encoding a vanillin synthase may also be capable of glucosylating vanillin. Said plant may comprise an endogenous glucosyl transferase activity capable of glucosylating vanillin. However, preferably the plant may comprise at least a heterologous nucleic acid encoding a glucosyl transferase, preferably a glucosyl transferase able to efficiently catalyse glucosylation of vanillin .
Glucosylation of vanillin is particularly useful. Vanillin^-D-glucoside is the storage form of vanillin found in the vanilla pod. It is non-toxic to most organisms, including yeast, and has a higher solubility in water, as compared to vanillin. In contrast vanillin may be toxic to many hosts. In addition, the formation of vanillin^-D-glucoside most likely pulls the biosynthesis further in the direction of vanillin production. In addition, glucosylation of vanillin may facilitate isolation.
The glucosyl transferase may be any glucosyl transferase capable of catalysing glucosylation of vanillin, i.e. capable of catalysing conjugation a glucose residue to vanillin. In particular, the glucosyl transferease may be a UDP-Glucose:Aglycon- Glucosyltransferase. Preferably the glucosyl transferase can catalyze the glucosylation of vanillin to produce vanillin beta-D-glucoside. Thus, the glucosyl transferase may be a Family 1 glucosyl transferease. Preferred glucosyl transferases according to the invention are enzymes classified under EC 2.4.1 . Suitable glucosyl transferases include the UGT71 C2, UGT72B1 , UGT72E2, UGT84A2, UGT89B1 , UGT85B1 , and arbutin synthase polypeptides. Thus, the glucosyl transferase to be used with the present invention may for example be any of the glucosyl transferases having
GenBank Accession Nos. AC0005496, NM_1 16337 or NM_126067. Thus, the recombinant host may comprise a heterologous nucleic acid encoding the UGT71 C2, UGT72B1 , UGT72E2, UGT84A2, UGT89B1 , UGT85B1 , or arbutin synthase or a functional homologue of any of the aforementioned sharing at least 80%, such as at least 85%, for example at least 90%, such as at least 95%, for example at least 98% sequence identity therewith. Other useful UGTs are described in WO 01 /40491 , for example on page 2-5 of WO 01 /40491 . The Arabidopsis thaliana UGT72E2 is particularly useful. UGT72E2 exhibits high substrate specificity towards vanillin. In concordance with this observation, its expression in the vanillin producing yeast results in almost all vanillin being converted into vanillin^-D-glucoside. The ability to turn vanillin into vanillin^-D-glucoside in vivo is important, because microbial production of non-glucosylated vanillin beyond the 0.5- 1 g/liter scale would be hampered by the toxicity of free vanillin. Glucosylation serves to circumvent the inhibitory effect. Thus, the glucosyl transferase may be UGT72E2 of SEQ ID NO:3 or a functional homologue thereof sharing at least 80%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity". A functional homologue of UGT72E2 is also capable of catalysing glucosylation of vanillin to form vanillin-beta-D- glucoside. Glycosyltransferases catalysing the transfer of other sugars than glucose e.g. galactose, arabinose, rhamnose and xylose are also known and may also be introduced to obtain new sugar derivatives of vanillin.
Enzymes involved in synthesis of ferulic acid
The present invention relates to methods of producing vanillin from ferulic acid with the aid of vanillin synthase. The methods may employ use of a microbial organism or a plant, which produces ferulic acid, or ferulic acid may be added exogenously to the microbial organism or the plant.
Some microorganisms and many plants naturally produce and accumulate ferulic acid. However, other microbial organisms for example most bacteria or fungi do not naturally produce ferulic acid. Thus, in embodiments of the invention relating to bacteria or fungi not naturally expressing the genes encoding all the required enzymes for endogenous production of ferulic acid, the methods may comprise contacting said bacteria or fungi with ferulic acid, for example by adding ferulic acid to the growth medium. In other embodiments of the invention relating to bacteria or fungi not naturally producing ferulic acid, the said bacteria or fungi may be engineered to express one or more enzymes involved in the synthesis of ferulic acid. It is also comprised within the invention that one microbial organism engineered to express one or more enzymes involved in the synthesis of ferulic acid may be used together with the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase, for example, they may be co- cultured.
Thus, in one embodiment, the invention relates to microbial organisms and methods of using said microbial organism, wherein the microbial organism comprises at least one heterologous nucleic acid encoding an enzyme involved in synthesis of ferulic acid.
The enzyme involved in synthesis of ferulic acid may for example be selected from the group consisting of phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, tyrosine ammonia-lyase, 4-coumaryl-3-hydroxylase, caffeate O-methyltransferase, phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, coumarate-CoA ligase, shikimate O-hydroxycinnamoyltransferase, 4-coumaryl-3-hydroxylase, caffeoyl- CoA O-methyltransferase, caffeate O-methyltransferase and flavone 3'-0- methyltransferase. Each of these enzymes are described in more detail herein below.
Different pathways to obtain ferulic acid are known. A number of pathways to obtain ferulic acid are described in figure 6 of Schoch et al., 2006, Environ Chem Lett, 4:127- 136 (hereby incorporated by reference herein). Thus, the host organisms may comprise all the enzymes of one of the pathways to obtain ferulic acid shown in figure 6 of Schoch et al., 2006. One pathway (herein designated ferulic acid pathway 1 ) for the biosynthesis of ferulic acid contains the following enzymes:
Step 1 : Phenylalanine ammonia-lyase, which may be any of the phenylalanine ammonia lyases described herein below.
Step 2: trans-cinnamate 4-monooxygenase (cinnamate 4-hydroxylase), which may be any of the trans-cinnamate 4-monooxygenase described herein below.
Step 3: 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below. Step 4: caffeate O-methyltransferase or flavone 3'-0-methyltransferase, which may be any of the caffeate O-methyltransferases or flavone 3'-0-methyltransferases described herein below.
The microbial organism of the invention, for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 1 , such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 1 , for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 1 . In particular the microbial organism, for example the yeast cell or the bacteria may contain 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 1 .
Another pathway (herein designated ferulic acid pathway 2) for the biosynthesis ferulic acid contains the following enzymes:
Step 1 +2: tyrosine ammonia-lyase, which may be any of the tyrosine ammonia lyases described herein below. Step 3: 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
Step 4: caffeate O-methyltransferase or flavone 3'-0-methyltransferase, which may be any of the caffeate O-methyltransferases or flavone 3'-0-methyltransferases described herein below.
The microbial organism of the invention, for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of pathway 2, such as at least two heterologous nucleic acids each encoding a different enzyme of pathway 2. In particular the microbial organism, for example the yeast cell or the bacteria may contain 3 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 2.
Yet another pathway (herein designated ferulic acid pathway 3) for the biosynthesis ferulic acid contains the following enzymes: Step 1 : phenylalanine ammonia-lyase, which may be any of the phenylalanine ammonia-lyases described herein below. Step 2: trans-cinnamate 4-monooxygenase (cinnamate 4-hydroxylase), which may be any of the trans-cinnamate 4-monooxygenases described herein below.
Step 3: 4-coumarate-CoA ligase, which may be any of the 4-coumarate-CoA ligases described herein below.
Step 4: shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
Step 5: 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
Step 6: shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below. Step 7: caffeoyl-CoA O-methyltransferase, which may be any of the caffeoyl-CoA O- methyltransferases described herein below.
The microbial organism of the invention, for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 3, such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3, for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 3, such as at least 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3, for example at least 5 nucleic acids each encoding a different enzyme of ferulic acid pathway 3, such as at least 6 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3. In particular the microbial organism, for example the yeast cell or the bacteria may contain 7 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 3. Even another pathway (herein designated ferulic acid pathway 4) for the biosynthesis ferulic acid contains the following enzymes:
Step 1 +2: tyrosine ammonia-lyase, which may be any of the tyrosine ammonia-lyases described herein below.
Step 3: 4-coumarate-CoA ligase, which may be any of the 4-coumarate-CoA ligases described herein below. Step 4: shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
Step 5: 4-coumaryl-3-hydroxylase, which may be any of the 4-coumaryl-3-hydroxylases described herein below.
Step 6: shikimate O-hydroxycinnamoyltransferase, which may be any of the shikimate O-hydroxycinnamoyltransferases described herein below.
Step 7: caffeoyl-CoA O-methyltransferase, which may be any of the caffeoyl-CoA O- methyltransferases described herein below.
Still another pathway (herein designated ferulic acid pathway 5) for the biosynthesis ferulic acid contains the following enzymes:
1 ) Vanillyl-alcohol oxidase (VAO), which may be any of the VAO described herein below
This pathway starts from eugenol. Thus, if the microbial organism does not synthesize eugenol, then it is preferred that the microbial organism is cultured in the presence of eugenol. In addition to VAO, the microbial organism preferably comprises an enzyme capable of catalysing conversion of coniferyl alcohol to form ferulic acid. Such an enzyme is endogenously present in may microbial organisms, for example in S.
cerevisiae. Detail regarding ferulic acid pathway 5 is provided in Lambert et al., 2013, Flavor and Fragrance Journal, DOI 10.1002/ffj.3171 ).
The microbial organism of the invention, for example the yeast cell or the bacteria may comprise at least one heterologous nucleic acid encoding one enzyme of ferulic acid pathway 4, such as at least two heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4, for example at least 3 nucleic acids each encoding a different enzyme of ferulic acid pathway 4, such as at least 4 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4, for example at least 5 nucleic acids each encoding a different enzyme of ferulic acid pathway 4. In particular the microbial organism, for example the yeast cell or the bacteria may contain 6 heterologous nucleic acids each encoding a different enzyme of ferulic acid pathway 4.
Phenylalanine ammonia-lyase
The phenylalanine ammonia-lyase to be used with the present invention may be any phenylalanine ammonia-lyase known to the skilled person. In particular the
phenylalanine ammonia-lyase may be an enzyme classified under EC 4.3.1 .24. Thus the phenylalanine ammonia-lyase according to the present invention is preferably an enzyme capable of catalysing the following reaction:
L-phenylalanine trans-cinnamate + NH3 The phenylalanine ammonia-lyase may be phenylalanine ammonia-lyase from a variety of sources, for example from plants. Examples of useful phenylalanine ammonia-lyases are described in Vannelli et al., 2006 and Shin et al 2012.
Thus, the phenylalanine ammonia-lyase may be phenylalanine ammonia-lyase of SEQ ID NO:4 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
A functional homologue of a phenylalanine ammonia-lyase is also capable of catalysing the following reaction: L-phenylalanine trans-cinnamate + NH3 trans-cinnamate 4-monooxyqenase
The trans-cinnamate 4-monooxygenase to be used with the present invention may be any trans-cinnamate 4-monooxygenase known to the skilled person. trans-Cinnamate 4-monooxygenase may also be designated cinnamate 4-hydroxylase. In particular, the trans-cinnamate 4-monooxygenase may be any enzyme classified under EC
1 .14.13.1 1 . Thus, trans-cinnamate 4-monooxygenase is preferably an enzyme capable of catalysing the following reaction: trans-cinnamate + NADPH + H+ + 02 4-hydroxycinnamate + NADP+ + H20
The trans-cinnamate 4-monooxygenase may be trans-cinnamate 4-monooxygenase from a variety of sources, for example from plants. One example of a useful trans- cinnamate 4-monooxygenase is Arabidopsis thaliana CYP73A5 (GenBank accession number: U37235). Thus, trans-cinnamate 4-monooxygenase may be trans-cinnamate 4-monooxygenase of SEQ ID NO:5 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity". A functional homologue of a trans-cinnamate 4-monooxygenase is also capable of catalysing the following reaction: trans-cinnamate + NADPH + H+ + 02— 4-hydroxycinnamate + NADP+ + H20
Tyrosine ammonia-lyase
The tyrosine ammonia-lyase to be used with the present invention may be any tyrosine ammonia-lyase known to the skilled person. In particular, the tyrosine ammonia-lyase may be any enzyme classified under EC 4.3.1 .23. Thus, tyrosine ammonia-lyase is preferably an enzyme capable of catalysing the following reaction:
L-tyrosine trans-p-hydroxycinnamate + NH3
The tyrosine ammonia-lyase may be tyrosine ammonia-lyase from a variety of sources, for example from plants. Examples of useful tyrosine ammonia-lyase are described in Vannelli et al 2006 and Shin et al 2012. Also tyrosine ammonia-lyase from various slime molds may be used with the invention.
Thus, tyrosine ammonia-lyase may be tyrosine ammonia-lyase of SEQ ID NO:6 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
A functional homologue of a tyrosine ammonia-lyase is also capable of catalysing the following reaction:
L-tyrosine trans-p-hydroxycinnamate + NH3 4-coumaryl-3-hvdroxylase
The 4-coumaryl-3-hydroxylase to be used with the present invention may be any 4- coumaryl-3-hydroxylase known to the skilled person. In particular, the 4-coumaryl-3- hydroxylase may be any enzyme classified under EC 1 .14.-.-.
The 4-coumaryl-3-hydroxylase may be 4-coumaryl-3-hydroxylase from a variety of sources, for example from plants. Examples of useful 4-coumaryl-3-hydroxylase includes Red clover coumarate 3'-hydroxylase (CYP98A44), Arabidopsis thaliana p- coumarate 3-hydroxylase (CYP98A3)(SEQ ID NO:7), CYP98A8 p-coumarate 3- hydroxylase of Arabidopsis thaliana (SEQ ID NO:8) or CYP98A9 p-coumarate 3- hydroxylase of Arabidopsis thaliana (SEQ ID NO:9). Thus, 4-coumaryl-3-hydroxylase may be 4-coumaryl-3-hydroxylase of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or a functional homologue of any of the aforementioned sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity". Caffeate O-methyltransferase
The caffeate O-methyltransferase to be used with the present invention may be any caffeate O-methyltransferase known to the skilled person. In particular, the caffeate O- methyltransferase may be any enzyme classified under EC 2.1 .1 .68. Thus, caffeate O- methyltransferase is preferably an enzyme capable of catalysing the following reaction:
S-adenosyl-L-methionine + 3,4-dihydroxy-frans-cinnamate
S-adenosyl-L-homocysteine + 3-methoxy-4-hydroxy-frans-cinnamate
Flavone 3'-0-methyltransferase
The flavone 3'-0-methyltransferase to be used with the present invention may be any flavone 3'-0-methyltransferase known to the skilled person. In particular, the flavone 3'- O-methyltransferase may be any enzyme classified under EC 2.1 .1 .42. Thus, flavone 3'-0-methyltransferase is preferably an enzyme capable of catalysing the following reaction:
S-adenosyl-L-methionine + 3'-hydroxyflavone τ~- S-adenosyl-L-homocysteine + 3'- methoxyflavone
4-coumarate-CoA ligase
The 4-coumarate-CoA ligase to be used with the present invention may be any 4- coumarate-CoA ligase known to the skilled person. In particular, the 4-coumarate-CoA ligase may be any enzyme classified under EC 6.2.1 .12. Thus, 4-coumarate-CoA ligase is preferably an enzyme capable of catalysing the following reaction:
ATP + 4-coumarate + CoA AMP + diphosphate + 4-coumaroyl-CoA The 4-coumarate-CoA ligase may be 4-coumarate-CoA ligase from a variety of sources, for example from plants. Examples of useful 4-coumarate-CoA ligases include Arabidopsis thaliana 4-coumarate:CoA ligase 3 (SEQ ID NO:10) or 4- coumarate:coenzyme A ligase of Nicotiana tabacum (SEQ ID NO:1 1 ).
Thus, 4-coumarate-CoA ligase may be 4-coumarate-CoA ligase of SEQ ID NO:10, SEQ ID NO:1 1 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
A functional homologue of a 4-coumarate-CoA ligase is also capable of catalysing the following reaction:
ATP + 4-coumarate + CoA AMP + diphosphate + 4-coumaroyl-CoA
Shikimate O-hydroxycinnamoyltransferase
The shikimate O-hydroxycinnamoyltransferase to be used with the present invention may be any shikimate O-hydroxycinnamoyltransferase known to the skilled person. In particular, the shikimate O-hydroxycinnamoyltransferase may be any enzyme classified under EC 2.3.1 .133. Thus, shikimate O-hydroxycinnamoyltransferase is preferably an enzyme capable of catalysing the following reaction:
4-coumaroyl-CoA + shikimate 2^ CoA + 4-coumaroylshikimate
The shikimate O-hydroxycinnamoyltransferase may be shikimate O- hydroxycinnamoyltransferase from a variety of sources, for example from plants.
Examples of useful shikimate O-hydroxycinnamoyltransferase are described include Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (SEQ ID NO:12), Coffea arabica hydroxycinnamoyi transferase (SEQ ID NO:13) or Populus trichocarpa hydroxycinnamoyi CoA shikimate/quinate hydroxycinnamoyltransferase (SEQ ID NO:14). Thus, shikimate O-hydroxycinnamoyltransferase may be shikimate O- hydroxycinnamoyltransferase of SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 or a functional homologue of any of the aforementioned sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
A functional homologue of a shikimate O-hydroxycinnamoyltransferase is also capable of catalysing the following reaction: 4-coumaroyl-CoA + shikimate CoA + 4-coumaroylshikimate
Caffeoyl-CoA 0-methyltransferase The caffeoyl-CoA O-methyltransferase to be used with the present invention may be any caffeoyl-CoA O-methyltransferase known to the skilled person. In particular, the caffeoyl-CoA O-methyltransferase may be any enzyme classified under EC 2.1 .1 .104. Thus, caffeoyl-CoA O-methyltransferase is preferably an enzyme capable of catalysing the following reaction:
S-adenosyl-L-methionine + caffeoyl-CoA ^S-adenosyl-L-homocysteine + feruloyl-CoA
The caffeoyl-CoA O-methyltransferase may be caffeoyl-CoA O-methyltransferase from a variety of sources, for example from plants. Examples of useful caffeoyl-CoA O- methyltransferase includes Arabidopsis thaliana caffeoyl-CoA O-methyltransferase (SEQ ID NO:15) or caffeoyl-CoA O-methyltransferase of Nicotiana tabacum (SEQ ID NO: 16).
Thus, caffeoyl-CoA O-methyltransferase may be caffeoyl-CoA O-methyltransferase of SEQ ID NO:6 or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
A functional homologue of a caffeoyl-CoA O-methyltransferase is also capable of catalysing the following reaction:
S-adenosyl-L-methionine + caffeoyl-CoA ^S-adenosyl-L-homocysteine + feruloyl-CoA
Vanillyl-alcohol oxidase
The vanillyl-alcohol oxidase (VAO) to be used with the present invention may be any VAO known to the skilled person. In particular, the VAO may be any enzyme classified under EC 1 .1 .3.38. The VAO may be VAO from a variety of sources, for example from fungi. Examples of useful VAO includes Penicillium simplicissimum VAO.
Thus, VAO may be the VAO of the sequence with reference number CAA75722 of the NCBI database (as available on 5 November 2013) or a functional homologue thereof sharing at least 70%, for example at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity therewith. The sequence identity is preferably calculated as described herein below in the section "Sequence identity".
Sequence identity A high level of sequence identity indicates likelihood that the first sequence is derived from the second sequence. Amino acid sequence identity requires identical amino acid sequences between two aligned sequences. Thus, a candidate sequence sharing 80% amino acid identity with a reference sequence, requires that, following alignment, 80% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence. Identity according to the present invention is determined by aid of computer analysis, such as, without limitations, the ClustalW computer alignment program (Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., Gibson T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680), and the default parameters suggested therein. The ClustalW software is available from as a ClustalW WWW Service at the European Bioinformatics Institute h tip :// yi/yyyy .ebi.ac.uk/clus'alw. Using this program with its default settings, the mature (bioactive) part of a query and a reference polypeptide are aligned. The number of fully conserved residues are counted and divided by the length of the reference polypeptide. The ClustalW algorithm may similary be used to align nucleotide sequences. Sequence identities may be calculated in a similar way as indicated for amino acid sequences. In one important embodiment, the cell of the present invention comprises a nucleic acid sequence coding, as define herein. Promoter sequence
The present invention relates to microbial organisms and plants comprising a heterologous nucleic acid encoding vanillin synthase and optionally also one or more additional heterologous nucleic acid sequences encoding enzyme(s) involved in synthesis of ferulic acid and/or a glucosyl transferase. In order to ensure proper expression of said heterologous nucleic acids, said coding heterologous nucleic acids are in general operably linked to a promoter sequence directing expression in the microbial cell or the plant. A promoter is a region of DNA that facilitates the transcription of a particular gene.
Promoters are located near the genes they regulate, on the same strand and typically upstream (towards the 5' region of the sense strand). In order for the transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. Promoters contain specific DNA sequences and response elements which provide a secure initial binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase. These transcription factors have specific activator or repressor sequences of corresponding nucleotides that attach to specific promoters and regulate gene expressions. The promoter sequence may in general be positioned immediately adjacent to the coding heterologous nucleic acid.
The promoter sequence according to the present invention in general comprises at least a core promoter, which is the minimal portion of the promoter required to properly initiate transcription. In addition the promoter sequence may comprise one or more of the following promoter elements:
o Transcription Start Site (TSS)
o A binding site for RNA polymerase
o General transcription factor binding sites
o Proximal promoter sequence upstream of the gene that tends to contain primary regulatory elements
o Specific transcription factor binding sites
o distal promoter sequence upstream of the gene that may contain additional regulatory elements, often with a weaker influence than the proximal promoter
o Binding sites for repressor proteins
Reduced expression of phenyl acrylate decarboxylase
In embodiments of the invention where the microbial organism or the plant expresses a high level of enzymes using ferulic acid as substrate, it may be advantageous to reduce the expression of such enzymes. Certain microbial organisms, such as yeast expresses ferulic acid decarboxylase, which is capable of catalysing decarboxylation of ferulic acid to obtain 4-vinyl guaiacol. Accordingly, it is preferred that if the microbial organism expresses ferulic acid decarboxylase then the expression of said ferulic acid decarboxylase is reduced. Reduced expression may be achieved using various conventional techniques known to the skilled person. For example, nucleic acids, e.g. antisense nucleic acids that inhibit expression of ferulic acid decarboxylase may be included in a recombinant construct that is transformed into the microbial organism. Alternatively, PCR based mutagenesis techniques can be used to generate mutants in the gene for ferulic acid decarboxylase or the entire ferulic acid carboxylase gene may be deleted using PCR based gene deletion strategy, for example adapted from the strategy described by Baudin et al., 1993. Briefly, PCR-generated DNA molecules consisting of a marker cassette with short flanking homology regions to the genomic ferulic acid decarboxylase gene are introduced into the microbial organism and integrated into the genome by homologous recombination. The genomic sequence of the ferulic acid decarboxylase gene from various organisms is available. For example the genomic sequence of the ferulic acid decarboxylase gene is available under the GenBank accession number BK006938.2.
Ferulic acid
As used herein the term ferulic acid refers to a compound of the structure:
Figure imgf000050_0001
In certain embodiments of the invention, the methods for producing vanillin and/or vanillin glucoside involves contacting the producing microbial organism or plant with ferulic acid and/or a ferulic acid derivative. It is preferred that said microbial organism or plant is contacted with ferulic acid. In particular, this is relevant in embodiments of the invention where the microbial organism or the plant is not capable of producing ferulic acid. Most bacteria and fungi are not capable of producing ferulic acid. Thus it may be in particular relevant to contact the microbial organism with ferulic acid and/or a ferulic acid derivative in embodiments of the invention where the microbial organism is bacteria or fungi, for example yeast.
Preferably, said microbial organism is cultivated in the presence of ferulic acid, for example the culture medium may comprise ferulic acid. Thus, the culture medium may preferably comprise at least 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid.
Alternative, said microbial organism is cultivated in the presence of ferulic acid derivative or a mixture of ferulic acid and ferulic acid derivative, for example the culture medium may comprise ferulic acid derivative and/or ferulic acid. Thus, the culture medium may preferably comprise at least 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid and/or ferulic acid derivative.
In one embodiment, the invention relates to preparing vanillin in vitro by contacting ferulic acid and/or a ferulic acid derivative with vanillin synthase, which may be any of the vanillin synthases described herein above in the section "Vanillin synthase". Said vanillin synthase may be provided in a purified form or in an extract, for example an extract prepared from a microbial organism expressing vanillin synthase, such as any of the microbial organisms described herein above in the section "Microbial organism". Any useful concentration of ferulic acid and/or ferulic acid derivative may be used, for example the concentration of ferulic acid and/or ferulic acid derivative may be 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid/ferulic acid derivative.
The ferulic acid may be provided in any useful form. For example molasses in general contains large amounts of ferulic acid and thus the culture medium may comprise or even consist of molasses. The molasses may for example be molasses of sugar beet or sugar cane.
The ferulic acid may also be provided by providing plants or plant part comprising ferulic acid or extract thereof. For example ferulic acid may be provided in the form of asafetida, the dried latex from the giant fennel or as an extract thereof. The ferulic acid may also be provided as seeds of coffee, apple, artichoke, peanut, or orange or as extracts thereof. Ferulic acid may also be provided as a commelinid plant or part thereof. Said commelinid plant may for example be rice, wheat, oat, Chinese water chestnut or pineapple. The ferulic acid may also be provided in the form of Agai oil.
Ferulic acid may also be purified ferulic acid, which for example may be purified from any of the aforementioned sources, or ferulic acid may be prepared by organic chemistry procedures. The ferulic acid may also be provided from a microbial organism capable of producing ferulic acid. Such as microbial organism may preferably contain one or more heterologous nucleic acids encoding enzymes involved in synthesis of ferulic acid, for example said microbial organism may comprise nucleic acids encoding the enzymes as described herein above in the section "Enzymes involved in synthesis of ferulic acid". The microbial organism capable of producing ferulic acid may be co-cultured together with the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase. Alternatively, crude culture medium or partly purified or purified culture medium from cultivation of the microbial organism capable of producing ferulic acid may be added to the culture medium for growing the microbial organism comprising a heterologous nucleic acid encoding vanillin synthase.
The ferulic acid derivative may be any derivative of ferulic acid, which may serve as a substrate for vanillin synthase. Preferably, the ferulic acid derivative is a compound of the general formula
Figure imgf000052_0001
wherein R for example may be an alkyl, such as an C^g-alkyl, an alkoxy, such as C1-6 alkoxy, a glycose ester, a glycoside, S-CoA, shikimate or quinate.
Said glycoside ester may be comprise any sugar, such as glucose. The glycoside is preferably glucoside.
Thus the ferulic acid derivative may for example be selected from the group consisting of Ferulic acid glucose ester, ferulic acid glucoside, Feruloyl-CoA, Ferulic acid shikimate and feruloyl-quinate.
Sequence listing
SEQ ID NO:1 Protein sequence of vanillin synthase of Vanilla planifolia
(VpVAN)
SEQ ID NO:2 Coding sequence of Vp VAN WTgene
SEQ ID NO:3 Protein sequence of UGT72E2 of A. thaliana
SEQ ID NO:4 phenylalanine ammonia-lyase
SEQ ID NO:5 Arabidopsis thaliana CYP73A5 (GenBank accession
number: U37235)
SEQ ID NO:6 Tyrosine ammonia-lyase SEQ ID NO:7 Arabidopsis thaliana p-coumarate 3-hydroxylase
(CYP98A3) (GenBank accession number: AEC09893.1 )
SEQ ID NO:8 CYP98A8 p-coumarate 3-hydroxylase of Arabidopsis
thaliana (GenBank accession number: AEE35607.1 )
SEQ ID NO:9 CYP98A9 p-coumarate 3-hydroxylase of Arabidopsis
thaliana (Genbank accession number AEE35608.1 .)
SEQ ID NO:10 Arabidopsis thaliana 4-coumarate:CoA ligase 3 (GenBank accession number AF106088_1 )
SEQ ID N0:1 1 4-coumarate:coenzyme A ligase of Nicotiana tabacum
(GenBank accession number AAB18637)
SEQ ID N0:12 Nicotiana tabacum Shikimate 0- hydroxycinnamoyltransferase (GenBank accession number Q8GSM7)
SEQ ID N0:13 Coffea arabica hydroxycinnamoyl transferase (GenBank accession number CAJ40778.1 )
SEQ ID N0:14 Populus trichocarpa hydroxycinnamoyl CoA
shikimate/quinate hydroxycinnamoyltransferase (GenBank accession number XP_002332068.1 )
SEQ ID N0:15 Arabidopsis thaliana caffeoyl-CoA O-methyltransferase
(GenBank accession number Q9C5D7)
SEQ ID N0:16 caffeoyl-CoA O-methyltransferase of Nicotiana tabacum
(GenBank accession number CAA91228)
SEQ ID N0:17 Protein sequence of VpVAN lacking signal peptide.
SEQ ID N0:18 Coding sequence for Vp VAN WTgene codon optimized for expression in yeast
SEQ ID N0:19 Forward primer
SEQ ID NO:20 Reverse primer
SEQ ID N0:21 Protein sequence of vanillin synthase of Glechoma
hederacea (GhVAN)
SEQ ID NO:22 Cysteine protease of Nicotiana benthamiana
SEQ ID NO:23 DNA sequence encoding GhVAN
SEQ ID NO:24 DNA sequence encoding chimeric vanillin synthase
Examples Example 1
Vanillin synthase (VpVAN) Based on sequence information available from US2003/0070188, the coding sequence of 4-HBS was obtained (SEQ ID NO:2).
The TNT Quick Coupled Transcription/Translation PROMEGA kit for PCR-generated DNA was used to produce protein from an isolated 4-HBS PCR-generated gene (the expressed protein was labelled with S35 to check for successful in vitro translation. To investigate the substrate specificity of this enzyme 2.5 mM of p-coumaric acid, ferulic acid and caffeic acid were tested as putative substrates in a feeding experiment. After administrating protein solutions with putative substrates for 1 h and 24h respectively, the resulting metabolic profile in the presence and absence of 4-HBS was analyzed by LC-MS. It could clearly be seen that 4-HBS catalyzed chain shortening of ferulic acid to vanillin but was not able to catalyze chain shortening of neither p-coumaric acid nor caffeic acid. Figure 1 (a) shows extracted ion chromatogram of the protein solution fed with 5 mM of ferulic acid for 1 h in 400mM Tris/HCI, pH8, 20 mM MgCI2, 2.5mM of dithiothreitol (DTT) at 30 degree celcius. Vanillin peak is observed at 7.5 min which is not present in negative control where protein solution without 4-HBS was treated under the same conditions (see figure 1 (b). Figure 1 (c) shows extracted ion chromatogram of the protein solution fed 5 mM of ferulate CoA for 1 h in 2.5 mM DTT, 0.1 mM ATP and 0.1 mM NAD+ at 30 °C. Also here a vanillin peak is observed, which is absent in the negative control (see figure 1 (d). Figure 1 (e) shows the Vanillin fragmentation pattern at 7.5 min.
Accordingly we renamed 4-HBS to Vanillin Synthase, or VpVAN. Example 2.
Expression of VpVAN in yeast to make vanillin glucoside from ferulic acid
This example describes biosynthesis in yeast of vanillin glucoside from ferulic acid by the heterologous expression of V. planifolia VpVAN. The substrate specificity of vanillin synthase was further confirmed by transient and stable expression in S. cerevisiae strain Fsb99. Yeast was transformed with a nucleic acid encoding VpVAN of SEQ ID NO:1 inserted into the Gal-induced yeast expression vector p416 TEF (said cells also referred to as VpVAN-transformed yeast herein).
Figure imgf000055_0001
yeast was grown in synthetic media containing galactose and 5mM of putative substrates. Vanillin formation was observed following administration of ferulic acid while no metabolism of p-coumaric acid and caffeic acid was observed. In an independent approach, VpVAN of SEQ ID NO:1 was expressed in yeast together with Arabidopsis thaliana UGT72E2 (SEQ ID NO:3).Arabidopsis thaliana UGT72E2 catalyzes glucosylation of ferulic acid enabling testing of the ability of vanillin synthase to use ferulic acid glucoside as a substrate. Figure 12 shows that yeast cells expressing Arabidopsis thaliana UGT72E2 (SEQ ID NO:3) synthesizes ferulic acid glucoside when grown on synthetic media comprising 2.5 mM ferulic acid (see Figure 12). Biosynthetic studies were carried out with yeast harboring stably integrated VAN codon optimized for yeast expression or with truncated VAN devoid of the signal peptide (SEQ ID NO:17; herein also designated vp Asp van) or with truncated VAN devoid of the signal peptide codon optimized for yeast expression (Figure 3). The yeast strains were incubated with different putative substrates for 72h before metabolite profiles were determined by LC- MS. Formation of vanillin glucoside was observed with ferulic acid as substrate and with both versions of VAN tested. Highest conversion was obtained using the truncated version of Asp van. In no case was carbon chain shortening of caffeic acid or p- coumaric acid observed. The results are shown in figure 3. Administrating yeast with ferulic aicd also resulted in production of aroma compound 4-vinylguaiacol glucoside. Thus it is possible to make vanillin glucoside in two steps in yeast by feeding with or production of ferulic acid. In the production of sugar from sugar beets, sugar cane or sorghum, molasses are obtained as viscous by-products. Molasses are known to contain hydroxycinnamic acids including ferulic acid. To examine whether this cheap waste product could be used as a starting material for vanillin glucoside production, yeasts harboring stably integrated VAN codon optimized for yeast (i.e. encoding VpVAN of SEQ ID NO:1 ) was grown on molasses. Vanillin glucoside formation was observed highlighting the potential of this enzyme for industrial natural vanillin glucoside production using inexpensive starting materials (Figure 2).
The substrate specificity of 1/pVAN was furthermore tested with ferulic acid and ferulic acid glucoside. This experiment performed to detect formation of vanillin glucoside. \/pUGT72U1 is able to glycosylate vanillin but not able to glycosylate ferulic acid while AfUGT72E2 is able to glycosylate both ferulic acid and vanillin. \/pUGT72U1 included yeast constructs enable to test the 1/pVAN substrate specificity to ferulic acid and ferulic acid glucoside. LC-MS extracted ion chromatograms show that 1/pVAN is able to catalyze the chain cleavage of both ferulic acid and ferulic acid glucoside (see figure 4)
Example 3
Transient expression of VpVAN in Nicotiana benthamiana to make vanillin from inherent ferulic acid This example describes that it is possible to use VpVAN for production of vanillin in plants which do not normally produce vanillin. VpVAN activity in a plant different from V. planifolia was assessed by transient expression in Nicotiana benthamiana leaves. Gene expression constructs encoding VpVAN of SEQ ID NO:1 were transferred to Agrobacterium tumefaciens and co-infiltrated with an A. tumefaciens strain harbouring the p19 gene silencing suppressor into N. benthamiana leaves. Four days after inoculation, the infiltrated tobacco leaves were harvested and subjected to metabolite profiling by LC-MS. The results are shown in figure 5. The profiling showed formation of vanillyl alcohol glucoside only in tobacco leaves from plants transfected with gene expression constructs encoding VpVAN. Vanillyl alcohol is a known metabolite of vanillin in living cells, likely produced in order to reduce cellular toxicity of the aldehyde vanillin. These results thus show that vanillin can be produced from ferulic acid in other plants than V. planifolia.
Example 4
Stable expression of VpVAN in Tobacco for vanillin glucoside production
This example describes de novo formation of vanillin glucoside in stably transformed lines of Tobacco, Nicotiana tabacum. In order to ensure accumulation of vanillin glucoside rather than vanillyl alcohol glucoside in a plant it is preferable to co-express the VpVAN enzyme with an appropriate highly efficient vanillin glycosyltransf erase enzyme. VpVAN (SEQ ID NO:1 ) is therefore stably co-expressed with A. thaliana UGT72E2 (SEQ ID NO:3) in a transformant line of N. tabacum. Firstly, a nucleic acid encoding UGT72E2 of SEQ ID NO:3 is cloned into the multiple cloning site of a plant transformation vector such as one from the pCAMBIA series, which enables expression of the genes in the plant under the control of the strong, constitutive cauliflower mosaic virus CaMV35S promoter. The vector harbors both a bacterial selection gene and a plant selection gene. The vector harboring the nucleic acid encoding UGT72E2 of SEQ ID NO:3 is transformed into Agrobacterium tumefaciens C58C1 /pGV3850 by electroporation as described in Wen-Jun et al., 1983. The A. tumefaciens cells are grown on selective medium and positive transformants are grown over night. Bacteria from plate is suspended in 20ml_ of Minimal A medium, density is adjusted to an OD600 of 0.9-1 .0 and ca. 20 0.5 cm N. tabacum leaf squares (4-5 week old tissue culture grown plants) are transferred to bacterial solution (deep well Petri dish). Leaf squares are swirled in solution and left for 5 minutes, after which they are removed and blotted dry, then transferred with adaxial side onto solid RMOP, about 10 pieces per plate. The plates are incubated in dark at 28 °C for: 2-3 days A. tumefaciens 5 days, after which the leaf pieces are transferred onto solid RMOP-TCH, with abaxial surface in contact with media, then incubated for 2-3 weeks in the light at 28 °C, with 16 hours daylight per day. The material is sub-cultured every 2 weeks or so until shoots appear, then plantlets are transferred to MST-TCH pots and incubated with 16 hours daylight for 1 -2 weeks, and when roots form the plants are transferred to soil in the glasshouse. Plant material from the UGT72E2-expressing transgenic tobacco plants are used for the next transformation. Nucleic acid encoding VpVAN of SEQ ID NO:1 is cloned into a plant expression vector as described above, and the whole procedure is repeated, to finally obtain transgenic tobacco plants co-expressing UGT72E2 and VpVAN. Plant material from the final transgenic plants is harvested and lysed and vanillin glucoside content is determined in the leaf material from the transgenic plant. No vanillin glucoside is seen in wildtype tobacco plants.
Example 5
Increased production of vanillin Administrating yeast with ferulic acid as described in Example 2 also resulted in production of aroma compound 4-vinylguaiacol in high concentrations due to yeast ferulate decarboxylase activity. S. cerevisiae ferulic acid decarboxylase (FADase) belongs to superfamily PAD and catalyzes the transformation of ferulic acid to 4- vinylguaiacol via non-oxidative decarboxylation. In order to increase vanillin production the FADase gene is knocked out in VpVAN- transformed yeast using conventional technology. In particular, the FADase gene is knocked out in the yeast strains described herein above in Example 2.
The adjacent PAD1 and FDC1 genes of S. cerevisiae are disrupted by PCR amplifying Klyveromyces lactis LEU2 (leucine auxotrophic selection marker) using primers with 74-77 bp tails homologous to the front and back end of PAD1 and FDC1 , respectively. The yeast strain is then transformed with the PCR product, resulting in transformants having no PAD1 and FDC1 activity and able to grow on plates not supplemented with leucine.
The following primers are used: LEU2Apad1 Afad1_F
AACATAATGCTGCAAATATAGATTGATTTCAATCTACGGAGTCCAACGCATTGAGC AGCTTCAATTGAGTAGATatgtctaagaatatcgttgtcctaccgg (SEQ ID NO:19)
LEU2Apad1 Afad1_R
CGTGGAGTATAAAAGTTCGGAAAATTTTATTTAAAATCTGATTATATGGTTTTTCTT CCGTAGAAAGTCTATGGCAAttaagccaagatttccttgacagccttggcgatagc (SEQ ID NO:20)
Production of 4-vinylguaiacol glucoside in yeast expressing both VpVAN (SEQ ID NO:1 ) and UGT72E2 (SEQ ID NO:3) but having disrupted the PAD1 and FDC1 genes (this yeast strain is also named VpVAN+AtUGt72E2 Apadl Afadl herein) was determined. Results are provided in figure 9. It is clear that VpVAN+AtUGt72E2 Apadl Afadl yeast strain does not produce 4-vinylguaiacol glucoside, whereas yeast expressing VpVAN (SEQ ID NO:1 ) and UGT72E2 (SEQ ID NO:3)(named
VpVAN+AtUGt72E2) has high expression. Example 6
Production of vanillin in yeast
In order to enable production of vanillin without addition of ferulic acid to the medium the VpVAN-transformed yeast is further transformed with nucleic acids encoding the enzymes involved in synthesis of ferulic acid. Strain 1
S. cerevisiae transformed with a nucleic acid encoding VpVAN of SEQ ID NO:1 and nucleic acid encoding Arabidopsis thaliana UGT72E2 of SEQ ID NO:3 prepared as described in Example 3 with the following nucleic acids each under control of a promoter directing expression in S. cerevisiae:
1 . phenylalanine ammonia-lyase (Vannelli et al 2006, Shin et al 2012)
2. Arabidopsis thaliana CYP73A5 (GenBank accession number: U37235) 3. tyrosine ammonia-lyase (Vannelli et al 2006, Shin et al 2012)
4. 4-coumarate-CoA ligase Arabidopsis thaliana 4-coumarate:CoA ligase 3 (GenBank accession number AF106088_1 )
5. Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (GenBank accession number Q8GSM7)
6. Arabidopsis thaliana p-coumarate 3-hydroxylase (CYP98A3) (GenBank
accession number: AEC09893.1 )
7. Arabidopsis thaliana caffeoyl-CoA O-methyltransferase (GenBank accession number Q9C5D7) Strain 2
5. cerevisiae transformed with a nucleic acid encoding VpVAN of SEQ ID NO:1 and a nucleic acid encoding Arabidopsis thaliana UGT72E2 of SEQ ID NO:3 prepared as described in Example 3 with the following nucleic acids each under control of a promoter directing expression in S. cerevisiae:
1 . phenylalanine ammonia-lyase (Vannelli et al 2006, Shin et al 2012)
2. Arabidopsis thaliana CYP73A5 (GenBank accession number: U37235)
3. 4-coumarate-CoA ligase Arabidopsis thaliana 4-coumarate:CoA ligase 3 (GenBank accession number AF106088_1 )
4. Nicotiana tabacum Shikimate O-hydroxycinnamoyltransferase (GenBank accession number Q8GSM7)
5. Arabidopsis thaliana p-coumarate 3-hydroxylase (CYP98A3) (GenBank
accession number: AEC09893.1 )
6. Arabidopsis thaliana p-coumarate 3-hydroxylase (CYP98A3)(SEQ ID NO:7), The transformed yeast cells are grown in synthetic media containing galactose and vanillin glucoside is isolated from the growth medium.
Example 7
The catalytic activity of vanillin synthase in the presence and absence of a putative pre-peptide
A general sequence identity search using GenBank showed that the 1/pVan sequence showed a high sequence identity to cysteine proteinases. Highest sequence identity (77 %) was found to the E!aeis guineensis cysteine proteinase belonging to the aleurain class of cysteine proteinases (MEROPS-the peptidase database). Interestingly, alignments unequivocally demonstrated that the 1/pVan sequence contained the three key active site residues required for proteinase activity (Fan, J. et al. Expression of a senescence-associated cysteine protease gene related to peel pitting of navel orange (Citrus sinensis L. Osbeck. Plant Cell Tiss Org 98, 281 -289 (2009)). To test whether the activity of the enzyme enhances in the absence of the pre peptide or if it changes the substrate specificity, we have truncated first 137aa from l/pVan (vp Δ137 van) and first 61 aa from l/pVAN. The activity of the enzymes were tested in vitro using coupled transcription/translation (TNT) assay. Thus, Wt VpVAN encodes the polypeptide of SEQ ID NO:1 , wt vp Asp van encodes the polypeptide of SEQ ID NO:17, vp Δ137 van encodes aa 138 to 356 of SEQ ID NO:1 and vp Δ61 van encodes aa 62 to 356 of SEQ ID NO:1 . The TNT® Quick Coupled Transcription/ Translation kit for PCR-generated DNA (Promega) was used to produce proteins of interest directly from PCR products. L- [35S]-Methionine was included to permit monitoring of the radiolabeled proteins formed following separation by SDS-PAGE and visualized by incubating dried gels for 48h on phosphorimager screens which were scanned with a STORM 860 molecular imager (Molecular Dynamics).
Proteins produced in coupled in vitro transcription/translation assays were analyzed for their enzyme catalytic abilities by incubation of aliquots (10 μΙ) with 0.5 mM to 5 mM of the following substrates: ferulic acid (Sigma), p-coumaric acid (Sigma), caffeic acid (Sigma), ferulic acid glucoside, p-coumaric acid glucoside, caffeic acid glucoside, caffeoyl-Coenzyme A (MicroCombiChem e.K.), p-coumaryl-Coenzyme A (MicroCombiChem e.K.), feruloyl-Coenzyme A (MicroCombiChem e.K.) or sinapyl- Coenzyme A (MicroCombiChem e.K.) in 400 mM Tris/HCI (pH 8), 20 mM MgCI2 and 2.5 mM dithiothreitol (DTT) (total volume: 50 μΙ). Enzyme assays were carried out in the presence and absence of 2.5 mM dithiothreitol (DTT), 0.1 mM ATP and 0.1 mM NAD+. Aliquots (10 μΙ) were withdrawn at specific time points and enzyme activity stopped by MeOH addition (25 μΙ, 25% (v/v)) and heating (45°C, 15 min). Samples were cooled on ice (30 min), centrifuged (10.000 rpm, 10 min) in microtiter filter plates (Merck Millipore) and the filtrate was finally analyzed by LC-MS.
The results are shown in figure 6. The experiments show that processing of 1/pVan by removal of an N-terminal sequence is not necessary for activity towards ferulic acid glucoside (see figure 6).
Example 8
The catalytic activity of vanillin synthase in the presence and absence of a putative pre-peptide in vivo as analyzed following transient expression in tobacco
The biological activity observed following expression of 1/pVAN (including the ER- targeting signal peptide) was also assessed in vivo by transient expression in leaves of N. benthamiana in the absence of any exogenously added substrates. Gene constructs were transferred to Agrobacterium tumefaciens and co-infiltrated with an A.
tumefaciens strain harbouring the p19 gene silencing suppressor. LC-MS profiling showed 1/pVAN-dependent formation of vanillyl alcohol glucoside. The vanillyl alcohol glucoside arises by reduction of vanillin by an alcohol dehydrogenase (E.C.1 .1 .1 .1 ) and subsequent glucosylation of the primary alcohol group of vanillyl alcohol. For biotechnological production of vanillin glucoside in plants other than Vanilla sp. by introduction of vanillin synthase, then it is preferred that said host organism co- expresses a UGT that effectively glucosylates the free vanillin formed into the corresponding glucoside before its reduction into vanillyl alcohol. Moreover, wt vp Δ137 van (encodes aa 138 to 356 of SEQ ID NO:1 ) and wt vp Δ66 van (encodes aa 67 to 356 of SEQ ID NO:1 ) were also included in this study to investigate the importance of secondary modifications of VAN. The transient expression of 1/pVAN and the truncated versions thereof described above in leaves of Nicotiana benthamiana was obtained as follows. Overnight cultures of an Agrobacterium tumefaciens strain AGL1 containing the recombined pJAM1502 vector harboring the cDNA of interest (Wt VpVAN or wt vp Δ137 van or wt vp Δ61 van) and A. tumefaciens strain AGL1 carrying the recombined pJAM1502 vector harboring the gene silencing inhibitor protein 19 (p19) were harvested by centrifugation and resuspended (OD600 = 2.0) in 10 mM MES pH 5.5, 10 mM MgCI2 and 100 μΜ acetosyringone. After incubation (4 h, RT), the two A. tumefaciens strains were used to co-infiltrate leaves of 3-weeks-old Nicotiana benthamiana plants grown at 24°C (day) and 17°C (night). After 4 or 5 days, leaf discs (1 cm diameter) were stamped out from the infiltrated leaves and metabolites extracted in 60% (v/v) MeOH for LC-MS analysis. The results are shown in figure 7A).
Introduction of all three constructs was found to result in vanillyl alcohol glucoside production.
The 1/pVan sequence showed high sequence identity to proteins belonging to the family cysteine proteinases (see above). We identified a protein belonging to the family of cysteine proteinases in tobacco in which the amino acid sequence identity to l/pVan is 71 % (SEQ ID NO:22). An alignment was prepared (see fig. 10). A construct was prepared where the 1/pVAN signal peptide (aa 1 to 21 of SEQ ID NO:1 ) was replaced the signal peptide of SEQ ID NO:22 identified using signalP 4.1 software (available from Center for Biological Sequence analysis, Technical University of Denmark). This signal peptide is aa 1 to 21 of SEQ ID NO:22. A cleavage site was identified at aa 135 to 141 of SEQ ID NO:1 with cleavage after position residue 137 (DGV/LPVT). The amino acids of SEQ ID NO:22 corresponding to aa 135 to 141 of SEQ ID NO:1 were identified to be aa 140 to 146 of SEQ ID NO:22 using the alignment of figure 10 and aa 135-141 of SEQ ID NO:1 were replaced with aa 140 to 146 of SEQ ID NO:22. Thus, the signal peptide and the protease cleavage site were replaced with signal peptide and a protease cleavage site from the tobacco cysteine protease. Thus the resulting polypeptide consists of [aa 1 to 21 of SEQ ID NO:22]-[aa 22 to 134 of SEQ ID NO:1 -[aa 140 to 146 of SEQ ID NO:22]-[aa 142 to 356 of SE ID N01 ]. The nucleic acid encoding this protein is termed vp nb Asp Ativan herein and is provided as SEQ ID NO:24. This gene construct was transferred to A. tumefaciens and infiltrated to tobacco essentially as described in this example above for wild type VpVAN and vanillin alcohol glucoside production was analysed by LC-MS profiling. The results are shown in figure 7B.
Example 9
The catalytic activity of GftVAN (vanillin synthase from Glechoma hederacea) monitored in vivo following transient expression in tobacco
The 1/pVan sequence was found to show 71 % amino acid sequence identity to G /AN, a novel gene cloned from Glechoma hederacea (Ground ivy) belonging to the Lamiaceae family. The sequence of GhVAN is provided as SEQ ID NO:21 ). A study of volatile constituents released by G. hederacea showed that this plant release traces of vanillin (N Radulovic 2010).
Transient expression of GhVkU in tobacco performed essentially as descried in Example 8 demonstrated that expression of this gene results in accumulation of vanillin alcohol glucoside in tobacco i.e. the enzyme has similar functional property to 1/pVAN (see figure 8).
References Radulovic N, Dordevic N, Markovic M, Palic R. Volatile constituents of Glechoma hirsute Waldst. & Kit. and G. hederacea L. (Lamiaceae). Bulletin of the Chemical Society of Ethiopia 24: 67-76
Podstolski A, Havkin-Frenkel D, Malinowski J, Blount JW, Kourteva G and Dixon RA. Unusual 4-hydroxybenzaldehyde synthase activity from tissue cultures of the vanilla orchid Vanilla planifolia.
Phytochemistry 61 (2002) 61 1 -620.
Shin SY, Jung SM, Kim MD, Han NS, Seo JH. Production of resveratrol from tyrosine in metabolically engineered Saccharomyces cerevisiae.
Enzyme Microb Technol. 2012 Sep 10;51 (4):21 1 -6. Epub 2012 Jun 28. Vannelli T, Wei Qi W, Sweigard J, Gatenby AA, Sariaslani FS. Production of p- hydroxycinnamic acid from glucose in Saccharomyces cerevisiae and Escherichia coli by expression of heterologous genes from plants and fungi.
Metab Eng. 2007 Mar;9(2):142-51 . Epub 2006 Nov 15.
Wen-Jun S., Forde B. G. (1983) Nucleic Acids Res. 17:8385.

Claims

Claims
A method of producing vanillin, vanillyl alcohol, vanillin glucoside and/or vanillyl alcohol glucoside, said method comprising
a) providing a microbial organism, wherein said microbial organism
i. is capable of producing ferulic acid and/or ferulic acid glucoside; and ii. comprises a heterologous nucleic acid encoding a vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said microbial organism in culture medium supporting growth of said microbial organism
c) Isolating vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside from the microbial organism and/or from the culture medium.
The method according to claim 1 , wherein the culture medium contains at the most 1 mM, such as at the most 0.5mM, for example at the most 0.01 mM, such as no detectable coumaric acid.
A microbial organism wherein said microbial organism
i. is capable of producing ferulic acid; and
ii. comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin .
The method or the microbial organism according to any one of the preceding claims, wherein the microbial organism is selected from the group consisting of bacteria and fungi.
The method or the microbial organism according to any one of the preceding claims, wherein the microbial organism is a yeast.
6. The method or the microbial organism according to any one of the preceding claims, wherein the microbial organism comprises at least one heterologous nucleic acid encoding an enzyme involved in synthesis of ferulic acid.
The method or the cell according to claim 6, wherein the enzyme involved in synthesis of ferulic acid is selected from the group consisting of phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, tyrosine ammonia-lyase, 4- coumaryl-3-hydroxylase, caffeate O-methyltransferase, phenylalanine ammonia- lyase, trans-cinnamate 4-monooxygenase, coumarate-CoA ligase, shikimate O- hydroxycinnamoyltransferase, 4-coumaryl-3-hydroxylase, caffeoyl-CoA O- methyltransferase, caffeate O-methyltransferase and flavone 3'-0- methyltransferase.
The method according to any one of claims or the cell according to any one of claims, wherein the enzyme involved in synthesis of ferulic acid is Vanillhyl alcohol oxidase.
The method according to claim 8, wherein the method comprises cultivating said microbial organism in a culture medium comprising eugenol.
A method of producing vanillin said method comprising the steps of a) providing a microbial organism, wherein said microbial organism comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said microbial organism in the presence of ferulic acid and/or a ferulic acid derivative in culture medium supporting growth of said microbial organism; and
c) Isolating vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside from the microbial organism and/or from the culture medium.
The method according to claim 10, wherein step b) comprises cultivating said microbial organism in the presence of ferulic acid.
12. The method according to any one of claims 8 to 9, wherein said culture medium comprises at least 1 mM, preferably at least 3 mM, for example at least 5 mM ferulic acid.
13. The method according to any one of claims 8 to 10, wherein said medium comprises or consists of molasses.
14. A method for producing vanillin and/or a vanillin derivative, said method
comprising
a) providing ferulic acid and/or a ferulic acid derivative
b) contacting said ferulic acid and/or ferulic acid derivative with vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillinthereby producing vanillin and/or a vanillin derivative.
15. The method according to claim 18, wherein the method is performed in vitro.
16. The method according to any one of claims, wherein the ferulic acid derivative is ferulic acid glucoside and the vanillin derivative is vanillin glucoside.
17. A method of producing vanillin, vanillyl alcohol, vanillyl alcohol glucoside and/or vanillin glucoside, said method comprising
a) Providing a plant comprising a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said plant; and
c) Isolating vanillin from the plant.
18. A plant comprising a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin and a heterologous encoding a glucosyl transferase.
19. The method according to claim 17 or the plant according to claim 18, wherein the plant is a dicot
20. The method or the plant according to any one of claims 17 to 19, wherein the plant is Nicotiana tabacum.
21 . The method or the plant according to any one of claims 17 to 19, wherein the plant is selected from the group consisting of commelinoids and chenopodiaceae.
22. A method of producing animal feed, said method comprising a) Providing a plant comprising a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said plant; and
c) processing the plant into animal feed.
23. The method according to claim 22, wherein the plant is of the Poaceae or
Gramineae family.
24. A method of producing food product, said method comprising
a) Providing a plant comprising edible parts, wherein said plant comprises a heterologous nucleic acid encoding vanillin synthase, wherein said vanillin synthase is an enzyme capable of catalyzing side chain cleavage of ferulic acid to form vanillin; and
b) cultivating said plant; and
c) harvesting said edible parts;
thereby obtaining a food product with vanillin palate.
25. The method according to claim 24, wherein the plant is tomato.
26. The method, the microbial organism or the plant according to any one of the preceding claims, wherein the vanillin synthase is vanillin synthase of SEQ ID NO:1 or a functional homologue thereof sharing at least 70%, such as at least 80%, for example at least 85%, such as at least 90%, for example at least 95% sequence identity therewith.
27. The method, the plant or the microbial organism according to any one of claims 1 to 25, wherein the vanillin synthase is vanillin synthase of SEQ ID NO:21 or a functional homologue thereof sharing at least 70%, such as at least 80%, for example at least 85%, such as at least 90%, for example at least 95% sequence identity therewith.
28. The method, the plant or the microbial organism according to any one of claims 1 to 25, wherein vanillin synthase is a truncated vanillin synthase, which is capable of catalyzing side chain cleavage of ferulic acid to form vanillin and wherein the truncated vanillin synthase is
a. vanillin synthase of SEQ ID NO:1 lacking in the range of 1 to 150 of the most N-terminal amino acids
b. vanillin synthase of SEQ ID NO:1 lacking in the range of 21 to 137 of the most N-terminal amino acids
c. Vanillin synthase of SEQ ID NO:1 lacking in the range of 120 to 140 of the most N-terminal amino acids
d. Vanillin synthase of SEQ ID NO:1 lacking in the range of 130 to 140 of the most N-terminal amino acids
e. Vanillin synthase of SEQ ID NO:21 lacking in the range of 21 to 140 of the most N-terminal amino acids
f. Vanillin synthase of SEQ ID NO:1 lacking the 21 most N-terminal amino acids
g. Vanillin synthase of SEQ ID NO:1 lacking the 61 most N-terminal amino acids
h. Vanillin synthase of SEQ ID NO:1 lacking the 137 most N-terminal amino acids
i. Vanillin synthase of SEQ ID NO:21 lacking the 21 most N-terminal amino acids
j. Vanillin synthase of SEQ ID NO:21 lacking the 140 most N-terminal amino acid
k. a functional homologue of any of a) to j) sharing at least 70%, for example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
29. The method, the plant or the microbial organism according to any one of claims 1 to 25, wherein vanillin synthase is a truncated vanillin synthase, which is capable of catalyzing side chain cleavage of ferulic acid to form vanillin and wherein the truncated vanillin synthase is
a) vanillin synthase comprising or consisting of aa 22 to 356 of SEQ ID NO:1 b) vanillin synthase comprising or consisting of aa 138 to 356 of SEQ ID NO:1 c) vanillin synthase comprising or consisting of aa 22 to 359 of SEQ ID NO:21
d) vanillin synthase comprising or consisting of aa 141 to 359 of SEQ ID NO:21
e) a functional homologue of any of a) to d) sharing at least 70%, for
example at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% sequence identity therewith, wherein said functional homologue is capable of catalysing side chain cleavage of ferulic acid to form vanillin.
30. The method, the plant or the microbial organism according to any one of claims 1 to 25, wherein the vanillin synthase is a polypeptide of the following formula:
[Signal peptide]-X-[cleavage site]-[truncated vanillin synthase] wherein X is a linker sequence.
31 . The method, the plant or the microbial organism according to claim 30, wherein the truncated vanillin synthase is as defined in any one of claims 27 to 28.
32. The method, the plant or the microbial organism according any one of claims 30 to
31 , wherein the signal peptide is a signal peptide of a protein endogenous to the host organism.
33. The method, the plant or the microbial organism according any one of claims 30 to
32, wherein the cleavage site is a cleavage site of a protein endogenous to the host organism.
34. The method, the plant or the microbial organism according to any one of the preceding claims, wherein the microbial organism or the plant also comprises a heterologous nucleic acid encoding a glucosyl transferase.
35. The method, the plant or the microbial organism according to claim 34, wherein the glucosyl transferase is an UDP-Glucose:Aglycon-Glucosyltransferase.
36. The method, the plant or the microbial organism according to any one of claims 34 to 35, wherein the glucosyl transferase is a glucosyl transferase capable of catalyzing transfer of glucose to vanillin thereby forming vanillin glucoside.
37. The method or the microbial organism according to claim 34, wherein the glucosyl transferase is UGT72E2 of SEQ ID NO:3 or a functional homologue thereof sharing at least 80% sequence identity therewith.
38. The method according to any one of claims 1 to 2, 4 to 17 and 19 to 37, wherein the method is a method of producing vanillin.
39. The method according to any one of claims 1 to 2, 4 to 17 and 19 to 38, wherein the method comprises a step of isolating vanillin glucoside from the microbial organism and/or from the culture medium and/or from the plant and wherein the method comprises the further step of deglucosylating said vanillin glucoside.
40. The method according to claim 39, wherein the step of deglucosylating vanillin glucoside involves contacting the vanillin glucoside with a glucosidase.
41 . The method according to claim 40, wherein the glucosidase is a beta-glucosidase.
42. The method according to any one of claims 1 to 2, 4 to 17 and 19 to 37, wherein the method is a method of producing vanillin glucoside.
PCT/DK2013/050357 2012-11-05 2013-11-05 Vanillin synthase WO2014067534A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CA2888636A CA2888636C (en) 2012-11-05 2013-11-05 Vanillin synthase
BR112015009849A BR112015009849A2 (en) 2012-11-05 2013-11-05 vanillin synthase
US14/438,200 US10689672B2 (en) 2012-11-05 2013-11-05 Vanillin synthase
EP13791920.5A EP2914733A1 (en) 2012-11-05 2013-11-05 Vanillin synthase
AU2013339881A AU2013339881B2 (en) 2012-11-05 2013-11-05 Vanillin synthase
CN201380057126.6A CN104769121B (en) 2012-11-05 2013-11-05 Vanillin synthase
JP2015541015A JP6594205B2 (en) 2012-11-05 2013-11-05 Vanillin synthase
HK16101658.3A HK1213943A1 (en) 2012-11-05 2016-02-16 Vanillin synthase
AU2017265117A AU2017265117B2 (en) 2012-11-05 2017-11-23 Vanillin synthase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261722513P 2012-11-05 2012-11-05
US61/722,513 2012-11-05

Publications (1)

Publication Number Publication Date
WO2014067534A1 true WO2014067534A1 (en) 2014-05-08

Family

ID=49585248

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2013/050357 WO2014067534A1 (en) 2012-11-05 2013-11-05 Vanillin synthase

Country Status (9)

Country Link
US (1) US10689672B2 (en)
EP (1) EP2914733A1 (en)
JP (1) JP6594205B2 (en)
CN (1) CN104769121B (en)
AU (2) AU2013339881B2 (en)
BR (1) BR112015009849A2 (en)
CA (1) CA2888636C (en)
HK (1) HK1213943A1 (en)
WO (1) WO2014067534A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704070B2 (en) 2015-03-03 2020-07-07 The Regents Of The University Of California Protecting group chemistry for clean, reductant-free dyeing
WO2022087527A1 (en) * 2020-10-23 2022-04-28 Elo Life Systems, Inc. Methods for producing vanilla plants with improved flavor and agronomic production

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112015015594B1 (en) * 2012-12-27 2022-07-05 Rhodia Operations YEAST CELL, PRODUCTION METHOD OF A YEAST CELL, USE OF A YEAST CELL AND METHOD OF HETEROLOGOUS BIOSYNTHESIS OF A VALINOID
DK3330374T3 (en) 2013-12-18 2022-03-07 Univ Danmarks Tekniske GLYCOSYLTRANSFERASE GLYCOSYLING FLAVOKER ACID AND / OR KERM ACID
JP7063332B2 (en) 2016-10-26 2022-05-09 味の素株式会社 Manufacturing method of target substance
WO2018079684A1 (en) 2016-10-26 2018-05-03 Ajinomoto Co., Inc. Method for producing objective substance
WO2018079687A1 (en) 2016-10-26 2018-05-03 Ajinomoto Co., Inc. Method for producing objective substance
CN109890972B (en) 2016-10-26 2022-11-08 味之素株式会社 Method for producing target substance
EP3532631A1 (en) 2016-10-26 2019-09-04 Ajinomoto Co., Inc. Method for producing l-methionine or metabolites requiring s-adenosylmethionine for synthesis
CN109890960B (en) 2016-10-27 2023-02-17 味之素株式会社 Process for producing aldehyde
US10858676B2 (en) 2017-05-22 2020-12-08 Ajinomoto Co., Inc. Method for producing objective substance
US11680279B2 (en) 2017-11-29 2023-06-20 Ajinomoto Co., Inc. Method for producing objective substance
WO2020027251A1 (en) 2018-08-03 2020-02-06 Ajinomoto Co., Inc. Method for producing objective substance
CN110241146B (en) * 2019-06-27 2021-04-06 杭州唯铂莱生物科技有限公司 Method for preparing 3, 4-dihydroxycinnamic acid by using combined enzyme method and 3, 4-dihydroxycinnamic acid produced by method
CN111019995B (en) 2019-12-31 2021-04-27 厦门欧米克生物科技有限公司 Method for producing vanillin by fermentation with eugenol as substrate
WO2023159017A1 (en) * 2022-02-15 2023-08-24 Evolva Sa Process for recovering and purifying vanillin

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5128253A (en) 1991-05-31 1992-07-07 Kraft General Foods, Inc. Bioconversion process for the production of vanillin
US5204253A (en) 1990-05-29 1993-04-20 E. I. Du Pont De Nemours And Company Method and apparatus for introducing biological substances into living cells
WO1994013614A1 (en) 1992-12-10 1994-06-23 Quest International B.V. Production of vanillin
US5538880A (en) 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US6013863A (en) 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US6133003A (en) * 1995-09-01 2000-10-17 Haarmann & Reimer Gmbh Process for the preparation of vanillin and microorganisms suitable therefor
US6235507B1 (en) * 1997-06-19 2001-05-22 Givaudan Roure (International) Sa Microbiological process for producing vanillin
WO2001040491A2 (en) 1999-12-01 2001-06-07 Luminis Pty, Limited Udp-glucose:aglycon-glucosyltransferase
US6329571B1 (en) 1996-10-22 2001-12-11 Japan Tobacco, Inc. Method for transforming indica rice
US20030070188A1 (en) 1997-07-15 2003-04-10 Daphna Havkin-Frenkel Vanillin biosynthetic pathway enzyme from Vanilla planifolia
US20030092143A1 (en) * 1999-12-14 2003-05-15 Jurgen Rabenhorst Enzymes and genes used for producing vanillin
WO2013022881A1 (en) 2011-08-08 2013-02-14 International Flavors & Fragrances Inc. Compositions and methods for the biosynthesis of vanillin or vanillin beta-d-glucoside

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19649655A1 (en) * 1996-11-29 1998-06-04 Haarmann & Reimer Gmbh Synthetic enzymes for the production of coniferyl alcohol, coniferyl aldehyde, ferulic acid, vanillin and vanillic acid and their use
GB9904251D0 (en) * 1999-02-24 1999-04-21 Zylepsis Ltd Flavour/aroma materials and their preparation
FR2792334B1 (en) * 1999-04-14 2003-03-07 Agronomique Inst Nat Rech PROCESS FOR OBTAINING CULTURES OF A. NIGER AND THEIR USES FOR THE PRODUCTION OF FERULIC ACID AND VANILLIC ACID
CN101165168B (en) 2006-10-20 2010-05-12 上海爱普香料有限公司 Streptomycete and method for producing vanillin by using the same to biologically transform ferulic acid
MX2008012689A (en) * 2007-04-19 2009-04-17 Biokab S A De C V Process for producing vanilin from microorganisms immobilized by surface cuture.

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5538880A (en) 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US6013863A (en) 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US5204253A (en) 1990-05-29 1993-04-20 E. I. Du Pont De Nemours And Company Method and apparatus for introducing biological substances into living cells
US5128253A (en) 1991-05-31 1992-07-07 Kraft General Foods, Inc. Bioconversion process for the production of vanillin
WO1994013614A1 (en) 1992-12-10 1994-06-23 Quest International B.V. Production of vanillin
US6133003A (en) * 1995-09-01 2000-10-17 Haarmann & Reimer Gmbh Process for the preparation of vanillin and microorganisms suitable therefor
US6329571B1 (en) 1996-10-22 2001-12-11 Japan Tobacco, Inc. Method for transforming indica rice
US6235507B1 (en) * 1997-06-19 2001-05-22 Givaudan Roure (International) Sa Microbiological process for producing vanillin
US20030070188A1 (en) 1997-07-15 2003-04-10 Daphna Havkin-Frenkel Vanillin biosynthetic pathway enzyme from Vanilla planifolia
WO2001040491A2 (en) 1999-12-01 2001-06-07 Luminis Pty, Limited Udp-glucose:aglycon-glucosyltransferase
US20030092143A1 (en) * 1999-12-14 2003-05-15 Jurgen Rabenhorst Enzymes and genes used for producing vanillin
WO2013022881A1 (en) 2011-08-08 2013-02-14 International Flavors & Fragrances Inc. Compositions and methods for the biosynthesis of vanillin or vanillin beta-d-glucoside

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
"HEG-DB: a database of predict highly expressed genes in prokaryotic complete genomes under translational selection", NUCLEIC ACIDS RESEARCH, vol. 36, 2008, pages D524 - 7
ARJAN NARBAD ET AL: "Metabolism of ferulic acid via vanillin using a novel CoA-dependent pathway in a newly- isolated strain of Pseudornonas fluorescens", MICROBIOLOGY, 1 January 1998 (1998-01-01), pages 1397 - 1405, XP055090035, Retrieved from the Internet <URL:http://mic.sgmjournals.org/content/144/5/1397.full.pdf> [retrieved on 20131125] *
BODDEKER ET AL., J. MEMBRANE SCI., vol. 137, 1997, pages 155 - 158
BORGES DA SILVA ET AL., CHEM. ENG. DES ., vol. 87, 2009, pages 1276 - 1292
DESALINATION, vol. 241, 2009, pages 357 - 364
ENZYME MICROB TECHNOL., vol. 51, no. 4, 28 June 2012 (2012-06-28), pages 211 - 6
ESBEN H HANSEN ET AL: "De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae)", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 75, no. 9, 1 May 2009 (2009-05-01), pages 2765 - 2774, XP002666446, ISSN: 0099-2240, [retrieved on 20090301], DOI: 10.1128/AEM.02681-08 *
GASSON M J ET AL: "Metabolism of ferulic acid to vanillin", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 273, no. 7, 13 February 1998 (1998-02-13), pages 4163 - 4170, XP002139585, ISSN: 0021-9258, DOI: 10.1074/JBC.273.7.4163 *
GROTE ET AL.: "JCat: a novel tool to adapt codon usage of a target gene to its potential expression host", NUCLEIC ACIDS RESEARCH, vol. 33, no. 2, 2005, pages W526 - W531, XP009081066, DOI: doi:10.1093/nar/gki376
HEBELSTRUP ET AL.: "UCE: A uracil excision (USER (TM))-based toolbox for transformation of cereals", PLANT METHODS, vol. 6, 2010, pages 15, XP021081130, DOI: doi:10.1186/1746-4811-6-15
HIGGINS D.; THOMPSON J.; GIBSON T.; THOMPSON J.D.; HIGGINS D.G.; GIBSON T.J.: "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice", NUCLEIC ACIDS RES., vol. 22, 1994, pages 4673 - 4680, XP002956304
HOLME ET AL.: "Cisgenic barley with improved phytase activity", PLANT BIOTECHNOL J, vol. 10, 2012, pages 237 - 247
L. OSBECK: "Citrus sinensis", PLANT CELL TISS ORG, vol. 98, 2009, pages 281 - 289
LAMBERT ET AL., FLAVOR AND FRAGRANCE JOURNAL, 2013
METAB ENG., vol. 9, no. 2, 15 November 2006 (2006-11-15), pages 142 - 51
PAQUETTE, S. ET AL., PHYTOCHEMISTRY, vol. 62, 2003, pages 399 - 413
PHYTOCHEMISTRY, vol. 61, 2002, pages 611 - 620
PUIGB6 ET AL.: "OPTIMIZER: A web server for optimizing the codon usage of DNA sequences", NUCLEIC ACIDS RESEARCH, vol. 35, 2007, pages W126 - W131, XP002509075, DOI: doi:10.1093/NAR/GKM219
RADULOVIC N; DORDEVIC N; MARKOVIC M; PALIC R.: "Volatile constituents of Glechoma hirsute Waldst. & Kit. and G. hederacea L. (Lamiaceae", BULLETIN OF THE CHEMICAL SOCIETY OF ETHIOPIA, vol. 24, pages 67 - 76
SCHOCH ET AL., ENVIRON CHEM LETT, vol. 4, 2006, pages 127 - 136
See also references of EP2914733A1
SUPEK F; VLAHOVICEK K: "Comparison of codon usage measures and their applicability in prediction of microbial gene expressivity", BMC BIOINFORMATICS, vol. 6, 2005, pages 182, XP021000779, DOI: doi:10.1186/1471-2105-6-182
WEN-JUN S.; FORDE B. G., NUCLEIC ACIDS RES., vol. 17, 1983, pages 8385
ZABKOVA ET AL., J. MEMBR. SCI., vol. 301, 2007, pages 221 - 237
ZHANG ET AL., EUR. FOOD RES. TECHNOL., vol. 226, 2008, pages 377 - 383
ZUCCHI ET AL., J. MICROBIOL. BIOTECHNOL., vol. 8, 1998, pages 719 - 22

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704070B2 (en) 2015-03-03 2020-07-07 The Regents Of The University Of California Protecting group chemistry for clean, reductant-free dyeing
US11203774B2 (en) 2015-03-03 2021-12-21 The Regents Of The University Of California Protecting group chemistry for clean, reductant-free dyeing
WO2022087527A1 (en) * 2020-10-23 2022-04-28 Elo Life Systems, Inc. Methods for producing vanilla plants with improved flavor and agronomic production

Also Published As

Publication number Publication date
JP2015535181A (en) 2015-12-10
CN104769121B (en) 2021-06-01
AU2017265117A1 (en) 2017-12-14
US10689672B2 (en) 2020-06-23
AU2017265117B2 (en) 2019-10-17
AU2013339881A1 (en) 2015-04-16
EP2914733A1 (en) 2015-09-09
CN104769121A (en) 2015-07-08
CA2888636A1 (en) 2014-05-08
US20150267227A1 (en) 2015-09-24
AU2013339881B2 (en) 2017-08-24
HK1213943A1 (en) 2016-07-15
BR112015009849A2 (en) 2017-12-05
CA2888636C (en) 2022-11-29
JP6594205B2 (en) 2019-10-23

Similar Documents

Publication Publication Date Title
AU2017265117B2 (en) Vanillin synthase
EP3303601B1 (en) Biosynthesis of phenylpropanoids and phenylpropanoid derivatives
US20150059018A1 (en) Methods and compositions for producing drimenol
US10240173B2 (en) Biosynthesis of forskolin and related compounds
KR20170041768A (en) Method for producing acetoin
US20180265897A1 (en) Production of macrocyclic diterpenes in recombinant hosts
WO2018083338A1 (en) Production of steviol glycosides in recombinant hosts
US8476492B2 (en) Method of utilizing the pts gene and anti-sense ads to increase patchouli alcohol content in Artemisia annua L
CN106574269A (en) Improved selectivity of the production of vanilloids in a recombinant unicellular host
WO2016070885A1 (en) Biosynthesis of oxidised 13r-mo and related compounds
US8476491B2 (en) Method of utilizing the PTS gene and RNA interference of the ads gene to increase patchouli alcohol content in Artemisia annua L.
US20140249301A1 (en) Methods for enabling farnesene accumulation in plants and related compositions
CN1849390A (en) High level production of arbutin in green plants and microbes
JP2023514687A (en) Glycosyltransferases, polynucleotides encoding them and methods of use
WO2018015512A1 (en) Biosynthesis of 13r-manoyl oxide derivatives
US20180112243A1 (en) Biosynthesis of acetylated 13r-mo and related compounds
KR20140028655A (en) Method for producing transgenic plant with inhibited photorespiration and increased resistance to stress using the gene from cyanobacteria and the plant thereof
Class et al. Patent application title: METHODS FOR ENABLING FARNESENE ACCUMULATION IN PLANTS AND RELATED COMPOSITIONS Inventors: John C. Steffens (Chapel Hill, NC, US) Assignees: Chromatin, Inc.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13791920

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2013791920

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013339881

Country of ref document: AU

Date of ref document: 20131105

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2888636

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14438200

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2015541015

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015009849

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112015009849

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015009849

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150430