WO2014067005A1 - Novel marker for mental disorders - Google Patents

Novel marker for mental disorders Download PDF

Info

Publication number
WO2014067005A1
WO2014067005A1 PCT/CA2013/050824 CA2013050824W WO2014067005A1 WO 2014067005 A1 WO2014067005 A1 WO 2014067005A1 CA 2013050824 W CA2013050824 W CA 2013050824W WO 2014067005 A1 WO2014067005 A1 WO 2014067005A1
Authority
WO
WIPO (PCT)
Prior art keywords
snp
subject
disorder
psychiatric disorder
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2013/050824
Other languages
French (fr)
Inventor
Alexandre BUREAU
Yvon CHAGNON
Michel Maziade
Chantal MÉRETTE
Marc-André ROY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Laval
Original Assignee
Universite Laval
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Laval filed Critical Universite Laval
Publication of WO2014067005A1 publication Critical patent/WO2014067005A1/en
Priority to US14/703,089 priority Critical patent/US20150292016A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention generally relates to mental disorders. More specifically, the present invention relates to the detection of a predisposition to, and diagnosis of, psychiatric disorders such as schizophrenia (SZ), bipolar disorder (BP) and Tourette's syndrome (TS).
  • SZ schizophrenia
  • BP bipolar disorder
  • TS Tourette's syndrome
  • Schizophrenia and related disorders such as brief psychotic disorder, delusional disorder, schizoaffective disorder, and schizophreniform disorder, are characterized by psychotic symptoms.
  • Psychotic symptoms include delusions, hallucinations, disorganized thinking and speech, and playful and inappropriate behavior.
  • Schizophrenia is characterized by psychosis (loss of contact with reality), hallucinations (false perceptions), delusions (false beliefs), disorganized speech and behavior, flattened affect (restricted range of emotions), cognitive deficits (impaired reasoning and problem solving), and occupational and social dysfunction. Diagnosis is typically based on the patient's self-reported experiences and observed behavior. No laboratory test for schizophrenia currently exists.
  • Bipolar disorders are characterized by episodes of mania and depression, which may alternate, although many patients have a predominance of one or the other.
  • Gilles de la Tourette Syndrome or Tourette's syndrome is a neuropsychiatric disorder characterized by chronic intermittent motor and vocal tics with an onset in childhood.
  • the diagnosis of psychiatric disorders typically requires evaluation by a trained mental- health professional and usually an interview, administration of a variety of personality tests (and in some cases, neuropsychological tests), and gathering of background (including medical) information about the individual.
  • the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on said identity.
  • SNP single nucleotide polymorphism
  • the present invention provides a method for determining the risk that a subject suffers from a psychiatric disorder or has a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that the subject suffers from a psychiatric disorder or has a predisposition thereto based on said identity.
  • SNP single nucleotide polymorphism
  • the present invention provides a method for determining the risk that a subject develops major psychosis before the age of about 26, said method comprising determining the number of thymine (T)-containing alleles of SNP rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that a subject develops major psychosis before the age of about 26 based on said number of thymine (T)-containing alleles of SNP rs1 156026.
  • the present invention provides a kit for diagnosing a psychiatric disorder or a predisposition thereto in a subject, or for determining the risk that a subject develops major psychosis before the age of about 26, the kit comprising (i) at least one reagent for determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from the subject.
  • the kit further comprises (ii) a container.
  • the above-mentioned psychiatric disorder is major psychosis.
  • the presence of one or two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from major psychosis, or has a predisposition thereto (or has a higher risk of suffering from a psychiatric disorder or having a predisposition thereto, relative to a subject not having one or two thymine (T)-containing alleles of SNP rs1 156026).
  • the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from major psychosis, or has a predisposition thereto (or has a higher risk of suffering from a psychiatric disorder or having a predisposition thereto, relative to a subject not having two thymine (T)-containing alleles of SNP rs1 156026).
  • the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject has a predisposition to develop said psychiatric disorder before the age of about 26.
  • the major psychosis is schizophrenia (SZ) or bipolar disorder (BP).
  • the major psychosis is SZ.
  • the major psychosis is BP.
  • the above-mentioned method further comprises measuring an episodic memory parameter in said subject.
  • the above-mentioned episodic memory parameter is verbal episodic memory (VEM), visual episodic memory (VisEM), or both.
  • the episodic memory parameter is VEM.
  • the episodic memory parameter is VisEM.
  • the episodic memory parameter is VEM and VisEM.
  • the above-mentioned psychiatric disorder is Tourette's syndrome (TS).
  • TS Tourette's syndrome
  • the presence of one or two cytosine (C)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from TS, or has a predisposition thereto (or has a higher risk of suffering from TS or having a predisposition thereto, relative to a subject not having one or two cytosine (C)-containing alleles of SNP rs1 156026).
  • the method further comprises determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and/or rs9567343 (SEQ ID NO: 8) in a biological sample from said subject.
  • the presence of (i) one or two adenosine (A)-containing alleles of SNP rs1323142 (SEQ ID NO: 6), (ii) one or two thymine (T)- containing alleles of SNP rs883877 (SEQ ID NO: 7), and/or (iii) one or two guanine (G)- containing alleles of SNP rs9567343 (SEQ ID NO: 8) is indicative that said subject suffers from TS, or has a predisposition thereto (or has a higher risk of suffering from TS or having a predisposition thereto, relative to a subject not having the above-mentioned alleles of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and/or rs9567343 (SEQ ID NO: 8)).
  • the above-mentioned kit further comprises instructions for using the kit for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP) before the age of about 26.
  • SZ schizophrenia
  • SAD schizo-affective disorder
  • BP bipolar disorder
  • the above-mentioned kit further comprises at least one reagent for determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from said subject.
  • the above-mentioned at least one reagent is one or more oligonucleotides.
  • the identity of SNP rs1 156026 is determined by sequencing a region encompassing SNP rs1 156026 in a nucleic acid present in said sample.
  • the nucleic acid is genomic DNA or cDNA, in yet a further embodiment genomic DNA.
  • FIG. 1 shows a projection of the cases (darker grey “+”) and controls (lighter grey “x”) on the first two principal components defined from autosomal single nucleotide polymorphism (SNP) genotypes;
  • SNP single nucleotide polymorphism
  • FIG. 2 shows the observed vs. expected distribution of -log 10 p-values in the case- control analysis of the SNPs in the candidate region.
  • the results of the analyses under the allelic, dominant and recessive models are pooled together.
  • MAF minor allele frequency
  • HWE Hardy-Weinberg equilibrium
  • FIG. 3 shows the association to genotyped SNPs in the region defined around the linkage signal at 13q13-q14. Results of the Fisher exact test are shown. Mb: megabases;
  • FIG. 4 shows the association of SNP alleles and haplotypes with the narrow definition of schizophrenia
  • FIG. 5 shows a global association tests with haplotypes consisting of three SNPs within 200 kb on either side of rs1 156026.
  • 1 rs1 156026 - rs2657099 - rs1008913 triplet
  • 2 rs2120753 - rs2657100 - rs1 156026 triplet
  • 3 rs2657100 - rs1 156026 - rs2657099 triplet
  • 1 rs1 156026 - rs2657099 - rs1008913 triplet
  • 2 rs2120753 - rs2657100 - rs1 156026 triplet
  • 3 rs2657100 - rs1 156026 - rs2657099 triplet
  • FIG. 6 shows the linkage disequilibrium between rs1 156026 and neighbouring SNPs, measured by the squared correlation in the data from the 1000 Genomes project (Phase I version 3, Aug. 2012 update)
  • FIG. 7 shows the association of SNP alleles considering either all cases or early-onset cases only for schizophrenia, bipolar disorder and the common locus phenotype in the kindred sample
  • FIG. 8 shows a distribution of the age of onset of (a) the common locus, (b) the schizophrenia and (c) the bipolar disorder phenotypes for the three genotypes of rs1 156026. The distribution is shown for the narrow version of each phenotype.
  • FIG. 9 shows the genes at 13q14.1 1-13q 14.2 that showed association with SZ (arrows) or surrounding rs1 156026 (which is identified by a black square). Positions are in Mb (Build 37.3).
  • DGKH diacylglycerol kinase, eta
  • DNAJC15 DnaJ (Hsp40) homolog, subfamily C, member 15
  • ENOX1 ecto-NOX disulfide-thiol exchanger 1
  • HTR2A 5-hydroxytryptamine (serotonin) receptor 2A;
  • FIGs. 10A and 10B show the receiver operating curve (ROC) curves for two logistic models: one with factors visual episodic memory (VisEM) and SNP (rs1 156026), FIG. 10A; the other with only factor VisEM, FIG. 10B;
  • ROC receiver operating curve
  • FIGs. 11A and 11 B show the ROC curves for two logistic models: one with factors verbal episodic memory (VEM) and SNP (rs1 156026), FIG. 1 1 A; the other with only factor VEM, FIG. 1 1 B;
  • VEM verbal episodic memory
  • SNP rs1 156026
  • FIG. 12 shows the results of the likelihood ratio test of the association of the 45 SNPs genotyped at 13q13-q 14 with Tourette's syndrome
  • FIGs. 13A to 13K show the sequence corresponding to nucleotides 43683486 to 43733602 of NCBI Reference Sequence NC_000013.10 (or nucleotides 24663486 to 24713602 of NCBI Reference Sequence: NT_024524.14).
  • the sequence corresponding to SNP rs1 156026 is underlined in FIG. 13J, with the C/T polymorphism between brackets.
  • predisposition or “susceptibility” refers to the likelihood to develop a disorder or disease.
  • An individual with a predisposition or susceptibility to a disorder or disease is more likely to develop the disorder or disease than an individual without the predisposition to the disorder or disease, or is more likely to develop the disorder or disease than members of a relevant general population under a given set of environmental conditions (diet, physical activity regime, geographic location, etc.).
  • polymorphism refers to the occurrence of two or more genetically determined variant forms (alleles) of a particular nucleic acid at a frequency where the rarer (or rarest) form could not be maintained by recurrent mutation alone.
  • a single nucleotide polymorphism (SNP) or single nucleotide variant (SNV) results from a single base difference between related alleles at the same genetic locus.
  • Exemplary nucleotide polymorphisms include the C/T polymorphism of SNP rs1 156026 set forth in SEQ ID NO: 1.
  • the term “homozygous” refers to an individual having two identical alleles of a certain polymorphism.
  • a non-limiting example is an individual having the TT genotype of SNP rs1 156026. This individual is referred to as a homozygote for this SNP.
  • the term “heterozygous” refers to an individual having two different alleles of a certain polymorphism. For example, an individual having the CT genotype of SNP rs1 156026 is referred as a heterozygote individual for this SNP.
  • psychiatric disorder refers to a mental disorder or illness that interferes with the way a person behaves, interacts with others, and functions in daily life.
  • disorders include, but are not limited to Anxiety Disorders, Attention Deficit Hyperactivity Disorder (ADHD), Eating Disorders, Manic-Depressive Illness, Schizophrenia (SZ), Schizoaffective Disorder (SAD), Schizoid Personality Disorder, Schizophreniform Disorder, Schizotypal Personality Disorder, Tourette's Syndrome (TS), Obsessive Compulsive Disorder (OCD), Panic Disorder, Post Traumatic Stress Disorder (PTSD), phobias, borderline personality disorder, Bipolar Disorder, sleep disorders, Acute Stress Disorder, Adjustment Disorder, Antisocial Personality Disorder, Asperger's Disorder, Avoidant Personality Disorder, Brief Psychotic Disorder, Bulimia Nervosa, Conduct Disorder, Cyclothymic Disorder, Delirium, Delusional Disorder, Dependent Personality Disorder, Dysthymic Disorder, Generalized Anxiety Disorders, Attention Defic
  • the psychiatric disorder is a psychotic disorder, for example Schizophrenia, Schizoaffective Disorder, Schizoid Personality Disorder, Schizophreniform Disorder, Schizotypal Personality Disorder, Shared psychotic disorder or Paraphrenia.
  • a psychotic disorder for example Schizophrenia, Schizoaffective Disorder, Schizoid Personality Disorder, Schizophreniform Disorder, Schizotypal Personality Disorder, Shared psychotic disorder or Paraphrenia.
  • SNP rs1 156026 is associated with psychiatric disorders. More specifically, they have demonstrated that the T allele of rs1 156026 is associated with SZ and with early onset (e.g., before the age of about 26) SZ, BP and SAD, whereas the C allele is associated with Tourette's syndrome (TS). Finally, combining measures of episodic memory with the SNP rs1 156026 T allele was shown to improve the prediction of SZ.
  • the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 alleles set forth in SEQ ID NO: 1 in a biological sample (i.e. determining which allele(s) is/are present in the sample at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )) from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
  • SNP single nucleotide polymorphism
  • the present invention provides a method for screening a subject for susceptibility or predisposition to a psychiatric disorder, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 alleles set forth in SEQ ID NO: 1 in a biological sample from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
  • SNP single nucleotide polymorphism
  • the present inventors have shown that the age of onset in carriers of the TT genotype of SNP rs1 156026 was on average approximately 5 years earlier than in carriers of the CC genotype for SZ, BP and for major psychosis globally, comprising SZ, BP and schizo-affective disorder (SAD).
  • the present invention also provides a method for determining the risk that a subject develops early onset schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP), said method comprising determining the number of thymine (T)-containing alleles of SNP rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that a subject develops early onset schizophrenia (SZ), bipolar disorder (BP) or schizo-affective disorder (SAD) based on said number of thymine (T)-containing alleles of SNP rs1 156026.
  • the detection of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that the subject has a higher risk of developing early onset SZ, SAD or BP relative to a subject in which no or one thymine (T)-containing alleles of SNP rs1 156026 is detected.
  • SNP rs1 156026 (which is identical to SNP rs58530358) is located at a position corresponding to nucleotide 43 726 345 in Homo sapiens chromosome 13, GRCh37.p9 Primary Assembly (NCBI Reference Sequence: NC_000013.10).
  • SNP rs1 156026 is located in a coding region from a yet uncharacterized gene, which spans nucleotides 43683486 to 43733602 of NCBI Reference Sequence NC_000013.10 (corresponding to nucleotides 24663486 to 24713602 of NCBI Reference Sequence: NT_024524.14). The sequence of this gene is depicted in FIGs. 13A-13K (SEQ ID NO: 9).
  • This gene comprises about 50 kb of genomic DNA positioned between DNAJC15 and ENOX1 , and comprises 5 putative exons making a total of about 5 kb of coding DNA.
  • SNP rs1 156026 is located in putative exon 3 of the gene, which spans nucleotides 43726126 to 43726400 of NCBI Reference Sequence NC_000013.10.
  • the sequence of rs1 156026 provided in the NCBI SNP database is: CATAAGGACACTTTGAGGAAGACCCA[C/T]TTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO: 1 ). This sequence is underlined in FIG. 13J.
  • the psychiatric disorder is Schizophrenia, Schizophrenia-related disorders (e.g., SAD), bipolar disorder or Tourette's Syndrome.
  • the psychiatric disorder is major psychosis, such as schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP).
  • the psychiatric disorder is Schizophrenia or bipolar disorder.
  • the onset of said Schizophrenia, schizo-affective disorder or bipolar disorder is at or before the age of about 26.
  • the onset of said bipolar disorder is at or before the age of about 31.
  • the determination of the sequence of SNP rs1 156026 in a biological sample may be performed by a number of methods which are known in the art (see, e.g., Syvanen, Nat Rev Genet. 2001 Dec; 2(12):930-42).
  • suitable methods for determining sequences and polymorphisms at the nucleic acid level include sequencing of the nucleic acid sequence encompassing SNP rs1 156026, e.g., in the genomic DNA; hybridization of a nucleic acid probe capable of specifically hybridizing to a nucleic acid sequence comprising one of the alleles and not to (or to a lesser extent to) a corresponding nucleic acid sequence comprising the other allele (under comparable hybridization conditions, such as stringent hybridization conditions) (e.g., molecular beacons); amplification of a nucleic acid fragment comprising the SNP rs1 156026 using a primer specific for one of the allele (targeted allele), wherein the primer produces an amplified product if the targeted allele is present and does not produce the same amplified product when a nucleic acid sequence not comprising the targeted allele (comprising the other allele) is used as a template for amplification (e.g., allele-specific PCR
  • nucleic acid sequence based amplification Nasba
  • primer extension assay FLAP endonuclease assay
  • FLAP endonuclease assay Invader assay, Olivier M. (2005). Mutat Res. 573(1 -2): 103- 10
  • 5' nuclease assay McGuigan F.E. and Ralston S.H. (2002) Psychiatr Genet. 12(3):133-6
  • oligonucleotide ligase assay Other methods include in situ hybridization analyses, single- stranded conformational polymorphism analyses, temperature gradient gel electrophoresis (TGGE), denaturing high performance liquid chromatography (DHPLC).
  • TGGE temperature gradient gel electrophoresis
  • DPLC denaturing high performance liquid chromatography
  • the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising sequencing a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject to determine the identity of SNP rs1 156026 alleles (i.e. to determine which allele(s) is/are present in the sample at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )), and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
  • SNP rs1 156026 may be performed "indirectly” by determining the identity (e.g., sequence) of the reverse complement of SEQ ID NO: 1 in the biological sample, using for example any of the above-noted SNP genotyping methods.
  • microarrays e.g., SNP microarrays
  • antibody microarrays e.g., using anti-DNA antibodies capable of specifically binding to one of the allele
  • tissue microarrays e.g., E-arrays
  • electronic biochip see Schena M., Microarray Biochip Technology, Eaton Publishing, Natick, Mass., 2000.
  • nucleic acid-containing sequences may be amplified prior to or in conjunction with the detection methods noted herein.
  • the design of various primers for such amplification is known in the art.
  • a nucleic acid e.g., genomic DNA
  • a nucleic acid comprising the SNP may be amplified using primers hybridizing to sequences upstream and downstream of SNP rs1 156026 (see FIGs. 13A-13K, particularly FIG. 13J), to amplify a nucleic acid encompassing SNP rs1 156026 (a nucleic acid of any length, for example from about 100 to 1000 nucleotides).
  • Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods.
  • amplification is carried out using PCR.
  • PCR Polymerase chain reaction
  • a nucleic acid sample e.g., in the presence of a heat stable DNA polymerase
  • An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith.
  • the extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers.
  • the sample is analyzed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out for example by visualization following Ethidium Bromide (EtBr) staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like.
  • EtBr Ethidium Bromide
  • the identity of the SNP may be detected using a detectable (labeled) probe, for example.
  • Ligase chain reaction is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et ai, 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
  • SDA Strand displacement amplification
  • Nucleic acid hybridization refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York,) and are commonly known in the art.
  • Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHP0 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
  • hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP0 4 , 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C (see Ausubel, et al. (eds), 1989, supra).
  • a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe specific to one or the other two alleles in a solution containing 50% formamide, high salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 ⁇ g/ml denatured carrier DNA (i.e.
  • the non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency).
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York).
  • the selected temperature is based on the melting temperature (Tm) of the DNA hybrid (Sambrook et al. 1989, supra). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, (ii) determining the identity of SNP rs1 156026 alleles in the sample comprising the amplified product (i.e.
  • the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ).
  • An example of a pair of primers suitable to amplify a region encompassing SNP rs1 156026 is 5'-GCCCTGCCTAATGCACTTTCTGATG-3' (SEQ ID NO: 10, forward primer) and 5'-CTTTTATAATCC AAATTATTATGG C-3' (SEQ ID NO: 1 1 , reverse primer), which generates an amplified product of about 170-180 (e.g., 176) base pairs.
  • the sequences corresponding to SEQ ID NO: 10, and to the reverse complement of SEQ ID NO: 1 1 are italicized in FIG. 13J.
  • the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, (ii) (ii) sequencing the amplified product, or a portion thereof encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject to determine the identity of SNP rs1 156026 alleles (i.e.
  • the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ).
  • the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) contacting a nucleic acid in a sample from the subject with a probe capable of specifically hybridizing to one of the alleles of SNP rs1 156026, (ii) determining which allele(s) is/are present in the sample based on the presence or absence of hybridization between the probe and the nucleic acid, and (iii) diagnosing said psychiatric disorder or predisposition thereto based on the identity of the allele(s) present in the sample.
  • the method further comprises amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, and contacting the amplified product with the probe.
  • the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ).
  • the above-noted method further comprises selecting a subject suspected of suffering from a psychiatric disorder, or suspected of being predisposed to developing a psychiatric disorder (e.g., based on family antecedents and/or other risk factors, for example).
  • the above-noted method further comprises obtaining or collecting a biological sample from a subject.
  • the above-noted sample can be from any source that contains biological material suitable for the detection of the SNP, such as genomic DNA, for example a tissue or body fluid from the subject (blood, immune cells (e.g., lymphocytes), epithelia, a neural cell sample, etc.
  • the sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (e.g., genomic DNA).
  • the method may be performed on an isolated nucleic acid sample, such as isolated genomic DNA.
  • the biological sample may be collected using any methods for collection of a biological fluid, tissue or cell sample, such as venous puncture for collection of blood-derived samples (e.g., whole blood, peripheral blood mononuclear cells (PBMCs), etc.).
  • blood-derived samples e.g., whole blood, peripheral blood mononuclear cells (PBMCs), etc.
  • PBMCs peripheral blood mononuclear cells
  • the above-mentioned method is an aid for the diagnosis of psychiatric disorders (e.g., SZ, BP).
  • the above-mentioned methods may be performed in combination with other assays, methods or markers for diagnosing psychiatric disorders, for example evaluation by a trained mental-health professional, administration of a variety of personality tests and neuropsychological tests, neurocognitive measurements, gathering of background (including medical) information about the individual (e.g., patient's self- reported experiences, behavior reported by relatives or friends), presence of biological and/or other genetic markers associated with the psychiatric disorder, electroretinographic (ERG) measurements (see, U.S. provisional application No. 61/781 ,520), etc.
  • ERP electroretinographic
  • the above- mentioned method may be combined with the criteria set forth in the Diagnostic and Statistical Manual of Mental Disorders 5 th Edition (DSM-V), or the World Health Organization's International Classification of Diseases and Related Health Problems (ICD-10), or with any other biological markers (e.g., other SNPs or blood biomarkers) known to be associated with a psychiatric disorder or a predisposition thereto (see, e.g., Chan et al., Int Rev Neurobiol. 201 1 ; 101 :95-144).
  • the disorder is SZ, a SZ-related disorder or bipolar disorder and the method further comprises measuring an episodic memory parameter in the subject.
  • the episodic memory parameter is verbal episodic memory (VEM), visual episodic memory (VisEM), or both.
  • the disorder is TS and the method further comprises determining the sequence of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from said subject.
  • the method further comprises determining the sequence of SNP rs9567343 (SEQ ID NO: 8) in a biological sample from the subject, in yet a further embodiment the method comprises determining the sequence of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from the subject.
  • the invention further provides an oligonucleotide (e.g., a probe or a primer), capable of specifically hybridizing to a nucleotide sequence corresponding to one of the alleles and not to (or to a lesser extent to) a nucleic acid sequence corresponding to the other allele (under comparable hybridization conditions).
  • an oligonucleotide e.g., a probe or a primer
  • Such hybridization may be under moderately stringent, or preferably stringent, conditions, as noted herein.
  • Such an oligonucleotide may in embodiments be attached to a solid substrate, as noted herein.
  • Such oligonucleotides may be used to specifically detect the presence of a nucleic acid (genomic DNA, cDNA) corresponding to one of the alleles in a sample.
  • such an oligonucleotide hybridizes to a portion of the nucleic acid of SEQ ID NO: 1 encompassing the SNP, or to its complement
  • the oligonucleotide specifically hybridizes to the following nucleotide sequence or a portion thereof encompassing the T underlined therein CATAAGGACACTTTGAGGAAGACCCATTTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO: 2) , or to the complement thereof (ACTTCATCCTGCTTGCCTGCAGGAAATGGGTCTTCCTCAAAGTGTCCTTATG, SEQ ID NO:
  • the oligonucleotide specifically hybridizes to the following nucleotide sequence or a portion thereof encompassing the C underlined therein CATAAGGACACTTTGAGGAAGACCCACTTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO:
  • Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted sequences employed.
  • the oligonucleotide probes or primers are at least about 6 nucleotides in length, in an embodiment at least about 12 nucleotides in length, preferably from about 12 to about 100 nucleotides in length, in embodiments from about 12 to about 50, from about 12 to about 30, or from about 15 to about 24 nucleotides in length. They may be adapted to be especially suited to a chosen nucleic acid amplification system.
  • the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hybridization thereof with its targeted sequence (see below and in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2 nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
  • Probes or primers of the invention can be utilized with naturally-occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic Acids Res., 14:5019. Probes or primers of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • Probes can be labeled according to numerous well-known methods (Sambrook et al., 1989, supra).
  • detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies.
  • Other detectable markers for use with probes which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will be understood by the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
  • radioactive nucleotides can be incorporated into probes by several methods.
  • Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32 P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (e.g., uniformly labeled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
  • radioactive dNTP e.g., uniformly labeled DNA probe using random oligonucleotide primers in low-melt gels
  • the method comprises contacting a sample from the subject, the sample comprising a nucleic acid (genomic DNA), with one or more oligonucleotides (probes and/or primers) as defined herein to determine the identity of single nucleotide polymorphism (SNP) SNP rs1 156026 (set forth in SEQ ID NO: 1 ).
  • SNP single nucleotide polymorphism
  • the present invention also relates to a kit for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops schizophrenia (SZ), schizo-affective disorder (SAD) or early onset (e.g., before the age of about 26) SZ, SAD or BP, the kit comprising one or more suitable reagents to detect a nucleic acid comprising SNP rs1 156026, such as a probe, primer (or primer pair).
  • a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper.
  • Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross- contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
  • Such containers may for example include a container which will accept the test sample (e.g., DNA and/or cells), a container which contains the primers used in the assay, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to perform the method and/or detect the indicator products (buffers, solutions, enzymes, etc.).
  • the kit further comprises instructions for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops early onset schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP), using the above-mentioned methods.
  • SZ early onset schizophrenia
  • SAD schizo-affective disorder
  • BP bipolar disorder
  • the methods of the present invention further comprise sending the diagnostic results (i.e., whether or not the subject has a psychiatric disorder or a predisposition thereto) to a clinician, e.g., a psychiatrist or a general practitioner.
  • a clinician e.g., a psychiatrist or a general practitioner.
  • the above-mentioned methods further comprise selecting and/or administering a course of therapy or prophylaxis to said subject in accordance with the diagnostic result. Accordingly, in another aspect, the present invention provides a method for preventing or treating a psychiatric disorder, said method comprising
  • course of therapy includes any therapeutic approach taken to relieve and/or prevent one or more symptoms associated with a psychiatric disorder.
  • the term encompasses administering any compound, drug, therapeutic agent, procedure, or regimen useful for improving the health of a subject with a psychiatric disorder.
  • the course of therapy or prophylaxis comprises administration of a psychotropic medication.
  • Psychotropic medication refers to drugs used for the management of mental and emotional disorders such as psychiatric disorders, and includes for example antidepressants, stimulants, antipsychotics, mood stabilizers, anxiolytics.
  • the psychotropic medication comprises an antipsychotic medication.
  • one or more steps of the above-mentioned methods are performed using or by a computer (e.g., using computer/computing algorithms), using a suitably programmed computer.
  • the method can further comprise determining the identity of SNP rs1 156026 set forth in SEQ ID NO: 1 in a subject.
  • the data obtained can subsequently be stored in a computer in a suitable computer readable form.
  • the computer can subsequently be used to analyze the data and compare them to a control, determine an algorithm, apply the algorithm, etc.
  • the data or results can then be displayed, for example, on a monitor, and/or printed.
  • the methods further comprise transmitting the data or results over a communication network.
  • the data or results may be transferred from a laboratory testing facility (e.g., diagnostic laboratory) to a health care provider, who may analyse the data/results and/or choose the appropriate course of action based on the data/results (e.g., initiate therapy, continue therapy, interrupt therapy, modify the therapy, etc.).
  • a laboratory testing facility e.g., diagnostic laboratory
  • a health care provider who may analyse the data/results and/or choose the appropriate course of action based on the data/results (e.g., initiate therapy, continue therapy, interrupt therapy, modify the therapy, etc.).
  • the methods of the present invention can include processing or converting the raw target detection data (e.g., mathematically, statistically or otherwise) using a statistical method (e.g., logistic or logit regression, cluster analysis, ANCOVA) that takes into account subject data or other data.
  • Subject data may include (but is not limited to): age; race; disease stage/phase, medication, family history, etc.
  • the algorithm may also take into account factors such as the presence, diagnosis and/or prognosis of a subject's condition other than the major psychiatric disorder.
  • numerous combinations of data parameters and/or factors may be used by the algorithm or algorithms encompassed herein, to obtain the desired output.
  • the term "subject” means an individual. In an embodiment, the subject is a human. As used herein, a “subject” is the same as a “patient,” and the terms can be used interchangeably. In an embodiment, the subject is suspected of suffering from, or of having a predisposition to, the psychiatric disorder.
  • the case-control sample consisted of 247 unrelated SZ cases and 250 unrelated normal controls without any psychiatric diagnosis from the Eastern Quebec population. All subjects were Caucasian of French-Canadian ancestry. The proportion of males was 79 percent among the cases and 78 percent among the controls. Controls were adults, with a median age of 45 at the time of psychiatric evaluation. Among cases, the median age of onset of SZ was 24 and the interquartile range 20 - 29.5. A lifetime best-estimate DSM-IV diagnosis was made for the unrelated SZ cases and the kindred members using personal interview, information from relatives and extensive medical records.
  • the kindred sample consisted of 48 multigenerational families of which 21 were mainly affected by BP ( ⁇ 15% of the affected family members had SZ), 15 mainly affected by a SZ spectrum disorder ( ⁇ 15% had BP) and 12 were mixed pedigrees, i.e. affected almost equally by SZ and BP.
  • a narrow SZ definition restricted to SZ and a broad definition comprising SZ narrow plus schizophreniform disorder and schizotypal personality was used as phenotype.
  • the BP narrow phenotype was restricted to BP I, and the broad definition included BP I, BP II, and recurrent major depression.
  • a narrow and broad "common locus" (CL) phenotype was also defined.
  • the narrow CL phenotype included BP narrow, SZ narrow and schizoaffective disorder (SAD).
  • SAD schizoaffective disorder
  • the broad CL definition included the broad definitions of BP and SZ, in addition to SAD.
  • the number of affected subjects for each phenotype definition is reported in Table 1.
  • a comparison group for the association analyses with the 467 genotyped non affected subjects from the family sample satisfying the following criteria was formed: A) no diagnosis in the broad definition of CL, B) age greater or equal to 25 years and C) not a parent of a CL case. These subjects are referred to as non-affected adult relatives (NAARs). In total, 845 subjects were included in the association analyses.
  • Table 1 Number of affected subjects for each phenotype definition.
  • Candidate region definition A wide region was encompassed, given the uncertainty in the boundaries of linkage signals for complex traits.
  • Genotyping and CNV detection were analyzed using the mini-sequencing approach of the llluminaTM genotyping platform with a customized array including the HumanHap300 BeadChipTM and 57,000 additional SNPs, for a total of 375,174 SNPs. All subjects had a genotype called for at least 97 percent of the SNPs.
  • the region of interest derived from the linkage evidence in our kindred sample contained 2,150 SNPs.
  • SNPs were analyzed using an in house minisequencing approach (Sun, X., et al., Nucleic Acids Research, 2000. 28(12): p.
  • e68 adapted for the LiCorTM sequencers, where genotypes are called automatically using the software SAGATM (LICOR).
  • SAGATM LICOR
  • a melting temperature procedure with a cold oligonucleotide probe specific to one of the two nucleotides of the SNP was also used with High ResolutionTM Melting kit and a real time PCR (480 LightCyclerTM), both from Roche. Mendelian inheritance was checked using the computer software PedCheckTM (O'Connell, J.R. and D.E. Weeks, American Journal of Human Genetics, 1998. 63: p. 259-266), and 10% blind replicates were included for genotyping quality control.
  • Copy number variants were inferred using the hidden Markov model implemented in PennCNVTM (Wang, K., et al., Genome Res, 2007. 17(1 1 ): p. 1665-74), which uses the log R ratio and B allele frequency produced by the lllumina BeadStudioTM software to infer hidden states corresponding to copy number. Population frequencies of the B allele were estimated from our sample and other model parameters were set to the values estimated by Wang et al. (2007, supra).
  • Genotyping quality criteria in the case-control sample Only SNPs with a minimum call rate of 98 percent and minor allele frequency above one percent in the combined case- control sample were retained. SNPs with Hardy-Weinberg equilibrium chi-square test p-value less than 2.5 x 10 "5 , corresponding to a 0.05 significance level divided by the number of SNPs in the region, were discarded. This left 2,081 SNPs to be included in the analysis. Only 2 discordant genotypes were observed at these 2,081 SNPs among 30 subjects genotyped in duplicate, for a concordance rate of 99.997 percent.
  • allelic association with genotyped SNPs was tested using Fisher exact tests in the 2x2 table of alleles x case-control status, as well as Cochran-Armitage trend tests in the 3x2 table of genotype x case-control status. Fisher exact tests were also performed with genotype frequencies under the dominant and recessive models.
  • Two complementary approaches were applied: imputation of genotypes at untyped SNPs and global tests of haplotypes (frequency > 1 %) over short windows of SNPs (Huang, B.E. , C.I. Amos, and D.Y.
  • Genotype imputation was performed using genotype data from the 1000 Genomes Project (June 201 1 data release, www.1000genomes.org, The 1000 Genomes Project Consortium, Nature 2010 vol. 467: 1061 - 73) using IMPUTETM version 2 (Howie, B.N., P. Donnelly, and J. Marchini PLoS Genet, 2009. 5(6): p. e1000529, mathgen.stats.ox.ac.uk/impute/impute.html).
  • association with the imputed SNP genotypes was then tested using a score test derived from the missing data likelihood under a logistic model implemented in SNPTESTTM version 2.2 (mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html; J. Marchini, et al. (2007). Nature Genetics 39: 906-913). Association to both genotyped and imputed SNPs was also tested conditionally on genotypes and on allele counts of the genotyped SNPs showing the strongest association. We used the score test under a logistic model implemented in SNPTESTTM. Haplotype association tests were performed on sliding windows of three and five consecutive SNPs.
  • the logistic regression model included a term for the allele count of a SNP and a term for the sample of origin (case-control vs. family) to adjust for differences in allele frequency between the samples.
  • the model was estimated using GEE as for the analysis in the family sample, with the subjects from the case-control sample treated as one-member families.
  • Example 2 Matching of cases to controls on ancestry.
  • FIG. 1 shows the near perfect overlap between the two groups on the first two PCs.
  • the inflation factor estimated by the genomic control method applied to the genotype data was only 1.006.
  • the good fit of the observed distribution of p-values to the expected one in the candidate region can be seen on a quantile- quantile plot (FIG. 2).
  • FOG. 2 quantile- quantile plot
  • the SNP rs1 156026 was the only SNP associated to SZ with a FDR ⁇ 0.05 in the primary analysis of the SNPs individually using Fisher's exact test, with an OR of 1.81 for the T allele (FIGs. 3 and 4) and 2.63 (95% confidence interval (CI) [1.74, 4.00]) for the TT genotype against the others. Results with the Cochran-Armitage trend test were nearly identical to the Fisher exact allelic test. When the subset of 60 cases with positive family history of SZ, psychosis or paranoia in first, second or third degree relatives was compared to the control group, rs1 156026 remained the SNP with the lowest p-value in the region.
  • case sample was restricted to the 133 cases with onset of SZ before age 26 rs1 156026 was again the SNP with the lowest p-value in the region.
  • the ORs remained about the same as in the primary analysis of the full case group and the p-value was less significant because of the lower power provided by a smaller sample.
  • SNP rs1 156026 is located about 500 kb from D13S1297, the marker where the linkage signal peaked in the kindred sample.
  • the sequence of SNP rs1 156026 is:
  • Example 4 Association with untyped variants Imputation of SNPs located within 200 kb of rs1 156026 using the 1000 Genome Project data revealed no other SNP with stronger association. The lowest p-value obtained was 2.9 x 10 ⁇ 5 , with rs26571 16. Over the same interval, the two windows of three consecutive SNPs showing the strongest association to SZ in global haplotype association tests included rs1 156026 (FIG. 5). Windows of five consecutive SNPs yielded no p-value below 10 ⁇ 4 .
  • the odds ratio for the AT haplotype raised to 2.84.
  • the uncorrected p-value of the score test of the AT haplotype versus all others is close to 10 "7 .
  • the LD between rs1 156026 and other neighboring frequent SNPs was examined in subjects of European ancestry in the 1000 Genomes Project to interpret the association results in the present dataset and other studies. Only 8 SNPs and one insertion/deletion (indel) are correlated at a r 2 > 0.1 with rs1 156026 and all are within 25 kb (FIG. 6). Among them, only rs2120753 was genotyped, and the r ⁇ with rs1 156026 in the control sample is similar to the 1000 Genomes estimate.
  • CNVs were detected in 245 cases and 137 controls genotyped in the same batch, to ensure that genotyping signal intensities were comparable.
  • the region from rs1998697 to rs9574453 spanning 6 kb is deleted in one case and duplicated in another.
  • a deletion spanning 10 kb from rs1407608 to rs9646096 has been detected in a control.
  • Overlapping duplications and deletions have been reported in the Database of Genomic Variants (DGV) (Zhang, J., et al., Cytogenet Genome Res, 2006. 115(3-4): p. 205-14, projects. tcag.ca/variation).
  • a duplication spanning 9 kb from rs1 1619167 to rs223421 1 detected in a case has not been reported in the DGV.
  • Example 8 Replication of the SNP association in the kindred sample
  • FIG. 4 shows the results of the GEE analysis for the narrow SZ phenotype (results for the broad SZ phenotype were similar).
  • the estimated OR of 1.54 increased to 2.03 when the analysis was restricted to the sample of families where SZ was the predominant disorder, and the statistical significance of the GEE Wald test also improved from 0.012 to 8.8 x 10 ⁇ 4 .
  • the age of onset in carriers of the TT genotype was on average approximately 5 years earlier than in carriers of the CC genotype for both SZ and BP, and therefore also CL.
  • Example 10 Prediction of schizophrenia by combining measures of episodic memory with the SNP rs1156026 T allele
  • NAARs Nonaffected Adult Relatives
  • the adult members affected by SZ came from the same large densely affected multigenerational kindreds and from the sample of unrelated SZ cases.
  • the inclusion criteria were (1 ) a definite DSM-IV SZ or a BP diagnosis, (2) having undergone a neuropsychological evaluation before age 55, and (3) being in a clinical status allowing a reliable cognitive assessment.
  • the exclusion criteria were a brain disorder, trauma, and metabolic disorder known to cause neuropsychological impairments.
  • VEM Neuropsychological Assessments. In this study, we focused on the free recall measures of tests because they showed the largest ESs in the comparison of offspring with controls.
  • VEM was assessed with the California Verbal Learning Test (CVLT) (Delis, D.C., et al., California Verbal Learning Test Manual, 1987, San Antonio, TX: Psychological Corporation) "total and delayed recalls" in which subjects had to learn a series of words presented orally over 5 trials, and to immediately recall them after each presentation (total recall of 5 trials), or with a 20-min delay (delayed recall).
  • RVF Rey Complex Figure Test
  • VEM and VisEM test results were converted into percentiles based on age and gender specific published scales. An impairment on VEM or VisEM was defined as a test result below the 16 th percentile.
  • Logistic regression was used to model the association of VEM or VisEM impairment and the number of rs1 156026 T alleles with SZ diagnosis, separately in univariate analyses and in bivariate analyses of one memory impairment with the SNP (models with more than two variables were not fitted due to sample size constraints).
  • the interaction term between the memory impairment and the SNP was tested. Interaction terms that were not significant at the 0.05 level were removed from the model, leaving only the independent main effect terms. Odds ratios (ORs) between two combinations of levels of the variables estimated from the logistic models approximate the relative risk of SZ between the two combinations due to the low prevalence of SZ.
  • the predictive power of the logistic models was measured by the area under the receiver operating curve (ROC) produced by the model.
  • ROC receiver operating curve
  • the ROC curve shows the sensitivity of the model SZ prediction against its false positive rate (one minus the specificity), for all thresholds of the predicted probability of SZ above which a prediction of SZ would be issued.
  • the area under the ROC curve varies from 0.5 (no predictive power) to 1 (perfect prediction).
  • Table 4 Logistic regression modeling of schizophrenia (SZ) diagnosis as a function of the number of SNP rs1 156026 T alleles and VisEM deficits (either delayed recall or immediate recall) in a sample of 51 SZ cases and 91 unaffected adult relatives.
  • variable rs1 156026 Only Variable VisEM only
  • variable rs1 156026 Only Variable VisEM only
  • Table 5 Logistic regression modeling of schizophrenia (SZ) diagnosis as a function of the number of SNP rs1 156026 T alleles and VEM deficits (either delayed recall or total recall) in a sample of 51 SZ cases and 92 unaffected adult relatives.
  • variable rs1 156026 Only Variable VEM only
  • variable rs1 156026 Only Variable VEM only
  • FIGs. 10A and 10B The ROC curve for the bivariate models and the model with the memory impairment only are displayed on FIGs. 10A and 10B for VisEM immediate recall and on FIGs. 1 1A and 1 1 B for VEM total recall.
  • the area under the ROC curve improves from 0.58 to 0.79 when adding the T allele of rs1 156026 to the logistic model.
  • the corresponding improvement is from 0.66 to 0.76.
  • a diagnostic test involving VisEM immediate recall and the SNP rs1 156026 would have a sensitivity of 70.6% and a specificity of 80.2%.
  • the corresponding figures are a sensitivity of 56.9% and a specificity of 83.7%.
  • Example 11 Association of SNPs genotyped at 13q13-14 and Tourette syndrome Association analyses were performed on a sample of 91 nuclear families (81 trios, 8 dyads and 2 families) in which 93 subjects are affected by Tourette's syndrome (TS). Likelihood ratio tests of association and odds ratio (OR) estimates were obtained for SNP alleles and haplotypes of selected SNPs by maximizing the likelihood function of Dudbridge (Hum Hered 2008; 66: 87-98) using the Unphased package (http://unphased.sourceforge.net/), which handles partially missing parental genotypes and multiple siblings. Linkage disequilibrium (LD) coefficients between SNPs were estimated from parental haplotypes using the Family Based Association Testing (FBAT) software package.
  • FBAT Family Based Association Testing
  • rs1 156026-rs 1323142-rs883877-rs9567343 with Tourette syndrome.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Methods and kits for diagnosing a psychiatric disorder such as schizophrenia, schizo- affective disorder, bipolar disorder or Tourette syndrome, or a predisposition thereto, in a subject, are disclosed. The methods and kits are based on the detection of the presence of SNP rs1156026 in a biological sample from the subject.

Description

NOVEL MARKER FOR MENTAL DISORDERS
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No. 61/722,424 filed November 5, 2012, which is incorporated herein by reference in its entirety. TECHNICAL FIELD
The present invention generally relates to mental disorders. More specifically, the present invention relates to the detection of a predisposition to, and diagnosis of, psychiatric disorders such as schizophrenia (SZ), bipolar disorder (BP) and Tourette's syndrome (TS).
BACKGROUND ART
Schizophrenia and related disorders such as brief psychotic disorder, delusional disorder, schizoaffective disorder, and schizophreniform disorder, are characterized by psychotic symptoms. Psychotic symptoms include delusions, hallucinations, disorganized thinking and speech, and bizarre and inappropriate behavior. Schizophrenia is characterized by psychosis (loss of contact with reality), hallucinations (false perceptions), delusions (false beliefs), disorganized speech and behavior, flattened affect (restricted range of emotions), cognitive deficits (impaired reasoning and problem solving), and occupational and social dysfunction. Diagnosis is typically based on the patient's self-reported experiences and observed behavior. No laboratory test for schizophrenia currently exists.
Bipolar disorders are characterized by episodes of mania and depression, which may alternate, although many patients have a predominance of one or the other.
Gilles de la Tourette Syndrome or Tourette's syndrome (TS) is a neuropsychiatric disorder characterized by chronic intermittent motor and vocal tics with an onset in childhood.
The diagnosis of psychiatric disorders typically requires evaluation by a trained mental- health professional and usually an interview, administration of a variety of personality tests (and in some cases, neuropsychological tests), and gathering of background (including medical) information about the individual.
There is thus a need for the development of novel markers and methods for the detection of a predisposition to, and/or for the diagnosis of, psychiatric disorders, in subjects.
The present description refers to a number of documents, the content of which are herein incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
In a first aspect, the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on said identity.
In another aspect, the present invention provides a method for determining the risk that a subject suffers from a psychiatric disorder or has a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that the subject suffers from a psychiatric disorder or has a predisposition thereto based on said identity.
In another aspect, the present invention provides a method for determining the risk that a subject develops major psychosis before the age of about 26, said method comprising determining the number of thymine (T)-containing alleles of SNP rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that a subject develops major psychosis before the age of about 26 based on said number of thymine (T)-containing alleles of SNP rs1 156026.
In another aspect, the present invention provides a kit for diagnosing a psychiatric disorder or a predisposition thereto in a subject, or for determining the risk that a subject develops major psychosis before the age of about 26, the kit comprising (i) at least one reagent for determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from the subject. In an embodiment, the kit further comprises (ii) a container.
In an embodiment, the above-mentioned psychiatric disorder is major psychosis.
In an embodiment, the presence of one or two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from major psychosis, or has a predisposition thereto (or has a higher risk of suffering from a psychiatric disorder or having a predisposition thereto, relative to a subject not having one or two thymine (T)-containing alleles of SNP rs1 156026). In an embodiment, the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from major psychosis, or has a predisposition thereto (or has a higher risk of suffering from a psychiatric disorder or having a predisposition thereto, relative to a subject not having two thymine (T)-containing alleles of SNP rs1 156026). In an embodiment, the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject has a predisposition to develop said psychiatric disorder before the age of about 26. In an embodiment, the major psychosis is schizophrenia (SZ) or bipolar disorder (BP). In a further embodiment, the major psychosis is SZ. In yet a further embodiment, the major psychosis is BP.
In an embodiment, the above-mentioned method further comprises measuring an episodic memory parameter in said subject. In a further embodiment, the above-mentioned episodic memory parameter is verbal episodic memory (VEM), visual episodic memory (VisEM), or both. In an embodiment, the episodic memory parameter is VEM. In another embodiment, the episodic memory parameter is VisEM. In another embodiment, the episodic memory parameter is VEM and VisEM.
In another embodiment, the above-mentioned psychiatric disorder is Tourette's syndrome (TS). In a further embodiment, the presence of one or two cytosine (C)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from TS, or has a predisposition thereto (or has a higher risk of suffering from TS or having a predisposition thereto, relative to a subject not having one or two cytosine (C)-containing alleles of SNP rs1 156026). In an embodiment, the method further comprises determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and/or rs9567343 (SEQ ID NO: 8) in a biological sample from said subject. In an embodiment, the presence of (i) one or two adenosine (A)-containing alleles of SNP rs1323142 (SEQ ID NO: 6), (ii) one or two thymine (T)- containing alleles of SNP rs883877 (SEQ ID NO: 7), and/or (iii) one or two guanine (G)- containing alleles of SNP rs9567343 (SEQ ID NO: 8) is indicative that said subject suffers from TS, or has a predisposition thereto (or has a higher risk of suffering from TS or having a predisposition thereto, relative to a subject not having the above-mentioned alleles of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and/or rs9567343 (SEQ ID NO: 8)).
In an embodiment, the above-mentioned kit further comprises instructions for using the kit for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP) before the age of about 26.
In an embodiment, the above-mentioned kit further comprises at least one reagent for determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from said subject.
In a further embodiment, the above-mentioned at least one reagent is one or more oligonucleotides.
In an embodiment, the identity of SNP rs1 156026 is determined by sequencing a region encompassing SNP rs1 156026 in a nucleic acid present in said sample. In a further embodiment, the nucleic acid is genomic DNA or cDNA, in yet a further embodiment genomic DNA.
Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
BRIEF DESCRIPTION OF DRAWINGS
In the appended drawings: FIG. 1 shows a projection of the cases (darker grey "+") and controls (lighter grey "x") on the first two principal components defined from autosomal single nucleotide polymorphism (SNP) genotypes;
FIG. 2 shows the observed vs. expected distribution of -log10 p-values in the case- control analysis of the SNPs in the candidate region. The results of the analyses under the allelic, dominant and recessive models are pooled together. MAF, minor allele frequency; HWE, Hardy-Weinberg equilibrium;
FIG. 3 shows the association to genotyped SNPs in the region defined around the linkage signal at 13q13-q14. Results of the Fisher exact test are shown. Mb: megabases;
FIG. 4 shows the association of SNP alleles and haplotypes with the narrow definition of schizophrenia;
FIG. 5 shows a global association tests with haplotypes consisting of three SNPs within 200 kb on either side of rs1 156026. 1 : rs1 156026 - rs2657099 - rs1008913 triplet, 2: rs2120753 - rs2657100 - rs1 156026 triplet, 3: rs2657100 - rs1 156026 - rs2657099 triplet;
FIG. 6 shows the linkage disequilibrium between rs1 156026 and neighbouring SNPs, measured by the squared correlation in the data from the 1000 Genomes project (Phase I version 3, Aug. 2012 update)
FIG. 7 shows the association of SNP alleles considering either all cases or early-onset cases only for schizophrenia, bipolar disorder and the common locus phenotype in the kindred sample;
FIG. 8 shows a distribution of the age of onset of (a) the common locus, (b) the schizophrenia and (c) the bipolar disorder phenotypes for the three genotypes of rs1 156026. The distribution is shown for the narrow version of each phenotype.
FIG. 9 shows the genes at 13q14.1 1-13q 14.2 that showed association with SZ (arrows) or surrounding rs1 156026 (which is identified by a black square). Positions are in Mb (Build 37.3). DGKH: diacylglycerol kinase, eta; DNAJC15: DnaJ (Hsp40) homolog, subfamily C, member 15; ENOX1 : ecto-NOX disulfide-thiol exchanger 1 ; HTR2A: 5-hydroxytryptamine (serotonin) receptor 2A;
FIGs. 10A and 10B show the receiver operating curve (ROC) curves for two logistic models: one with factors visual episodic memory (VisEM) and SNP (rs1 156026), FIG. 10A; the other with only factor VisEM, FIG. 10B;
FIGs. 11A and 11 B show the ROC curves for two logistic models: one with factors verbal episodic memory (VEM) and SNP (rs1 156026), FIG. 1 1 A; the other with only factor VEM, FIG. 1 1 B;
FIG. 12 shows the results of the likelihood ratio test of the association of the 45 SNPs genotyped at 13q13-q 14 with Tourette's syndrome; FIGs. 13A to 13K show the sequence corresponding to nucleotides 43683486 to 43733602 of NCBI Reference Sequence NC_000013.10 (or nucleotides 24663486 to 24713602 of NCBI Reference Sequence: NT_024524.14). The sequence corresponding to SNP rs1 156026 is underlined in FIG. 13J, with the C/T polymorphism between brackets. DISCLOSURE OF INVENTION
Terms and symbols of genetics, molecular biology, biochemistry and nucleic acids used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991 ); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like. All terms are to be understood with their typical meanings established in the relevant art.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
As used herein, the term "predisposition" or "susceptibility" refers to the likelihood to develop a disorder or disease. An individual with a predisposition or susceptibility to a disorder or disease is more likely to develop the disorder or disease than an individual without the predisposition to the disorder or disease, or is more likely to develop the disorder or disease than members of a relevant general population under a given set of environmental conditions (diet, physical activity regime, geographic location, etc.).
The term "polymorphism" refers to the occurrence of two or more genetically determined variant forms (alleles) of a particular nucleic acid at a frequency where the rarer (or rarest) form could not be maintained by recurrent mutation alone. A single nucleotide polymorphism (SNP) or single nucleotide variant (SNV) results from a single base difference between related alleles at the same genetic locus. Exemplary nucleotide polymorphisms include the C/T polymorphism of SNP rs1 156026 set forth in SEQ ID NO: 1.
The term "homozygous" refers to an individual having two identical alleles of a certain polymorphism. A non-limiting example is an individual having the TT genotype of SNP rs1 156026. This individual is referred to as a homozygote for this SNP. The term "heterozygous" refers to an individual having two different alleles of a certain polymorphism. For example, an individual having the CT genotype of SNP rs1 156026 is referred as a heterozygote individual for this SNP.
As used herein, the term "psychiatric disorder" refers to a mental disorder or illness that interferes with the way a person behaves, interacts with others, and functions in daily life. Examples of such disorders include, but are not limited to Anxiety Disorders, Attention Deficit Hyperactivity Disorder (ADHD), Eating Disorders, Manic-Depressive Illness, Schizophrenia (SZ), Schizoaffective Disorder (SAD), Schizoid Personality Disorder, Schizophreniform Disorder, Schizotypal Personality Disorder, Tourette's Syndrome (TS), Obsessive Compulsive Disorder (OCD), Panic Disorder, Post Traumatic Stress Disorder (PTSD), phobias, borderline personality disorder, Bipolar Disorder, sleep disorders, Acute Stress Disorder, Adjustment Disorder, Antisocial Personality Disorder, Asperger's Disorder, Avoidant Personality Disorder, Brief Psychotic Disorder, Bulimia Nervosa, Conduct Disorder, Cyclothymic Disorder, Delirium, Delusional Disorder, Dependent Personality Disorder, Dysthymic Disorder, Generalized Anxiety Disorder, Histrionic Personality Disorder, Major Depressive Disorder, Paranoid Personality Disorder and Shared Psychotic Disorder. In an embodiment, the psychiatric disorder is a psychotic disorder, for example Schizophrenia, Schizoaffective Disorder, Schizoid Personality Disorder, Schizophreniform Disorder, Schizotypal Personality Disorder, Shared psychotic disorder or Paraphrenia.
In the studies described herein, the present inventors have shown that SNP rs1 156026 is associated with psychiatric disorders. More specifically, they have demonstrated that the T allele of rs1 156026 is associated with SZ and with early onset (e.g., before the age of about 26) SZ, BP and SAD, whereas the C allele is associated with Tourette's syndrome (TS). Finally, combining measures of episodic memory with the SNP rs1 156026 T allele was shown to improve the prediction of SZ.
Accordingly, in a first aspect, the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 alleles set forth in SEQ ID NO: 1 in a biological sample (i.e. determining which allele(s) is/are present in the sample at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )) from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
In another aspect, the present invention provides a method for screening a subject for susceptibility or predisposition to a psychiatric disorder, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 alleles set forth in SEQ ID NO: 1 in a biological sample from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
The present inventors have shown that the age of onset in carriers of the TT genotype of SNP rs1 156026 was on average approximately 5 years earlier than in carriers of the CC genotype for SZ, BP and for major psychosis globally, comprising SZ, BP and schizo-affective disorder (SAD). Accordingly, in another aspect, the present invention also provides a method for determining the risk that a subject develops early onset schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP), said method comprising determining the number of thymine (T)-containing alleles of SNP rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from said subject, and determining the risk that a subject develops early onset schizophrenia (SZ), bipolar disorder (BP) or schizo-affective disorder (SAD) based on said number of thymine (T)-containing alleles of SNP rs1 156026. In an embodiment, the detection of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that the subject has a higher risk of developing early onset SZ, SAD or BP relative to a subject in which no or one thymine (T)-containing alleles of SNP rs1 156026 is detected.
SNP rs1 156026 (which is identical to SNP rs58530358) is located at a position corresponding to nucleotide 43 726 345 in Homo sapiens chromosome 13, GRCh37.p9 Primary Assembly (NCBI Reference Sequence: NC_000013.10). SNP rs1 156026 is located in a coding region from a yet uncharacterized gene, which spans nucleotides 43683486 to 43733602 of NCBI Reference Sequence NC_000013.10 (corresponding to nucleotides 24663486 to 24713602 of NCBI Reference Sequence: NT_024524.14). The sequence of this gene is depicted in FIGs. 13A-13K (SEQ ID NO: 9). This gene comprises about 50 kb of genomic DNA positioned between DNAJC15 and ENOX1 , and comprises 5 putative exons making a total of about 5 kb of coding DNA. SNP rs1 156026 is located in putative exon 3 of the gene, which spans nucleotides 43726126 to 43726400 of NCBI Reference Sequence NC_000013.10. The sequence of rs1 156026 provided in the NCBI SNP database is: CATAAGGACACTTTGAGGAAGACCCA[C/T]TTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO: 1 ). This sequence is underlined in FIG. 13J.
In an embodiment, the psychiatric disorder is Schizophrenia, Schizophrenia-related disorders (e.g., SAD), bipolar disorder or Tourette's Syndrome. In an embodiment, the psychiatric disorder is major psychosis, such as schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP). In a further embodiment, the psychiatric disorder is Schizophrenia or bipolar disorder. In yet a further embodiment, the onset of said Schizophrenia, schizo-affective disorder or bipolar disorder is at or before the age of about 26. In an further embodiment, the onset of said bipolar disorder is at or before the age of about 31.
The determination of the sequence of SNP rs1 156026 in a biological sample may be performed by a number of methods which are known in the art (see, e.g., Syvanen, Nat Rev Genet. 2001 Dec; 2(12):930-42). Examples of suitable methods for determining sequences and polymorphisms at the nucleic acid level include sequencing of the nucleic acid sequence encompassing SNP rs1 156026, e.g., in the genomic DNA; hybridization of a nucleic acid probe capable of specifically hybridizing to a nucleic acid sequence comprising one of the alleles and not to (or to a lesser extent to) a corresponding nucleic acid sequence comprising the other allele (under comparable hybridization conditions, such as stringent hybridization conditions) (e.g., molecular beacons); amplification of a nucleic acid fragment comprising the SNP rs1 156026 using a primer specific for one of the allele (targeted allele), wherein the primer produces an amplified product if the targeted allele is present and does not produce the same amplified product when a nucleic acid sequence not comprising the targeted allele (comprising the other allele) is used as a template for amplification (e.g., allele-specific PCR), allele specific ligation, dynamic allele-specific hybridization (DASH) genotyping (Howell W., et al. (1999) Nat Biotechnol. 17(1 ):87-8), nucleic acid sequence based amplification (Nasba), primer extension assay, FLAP endonuclease assay (Invader assay, Olivier M. (2005). Mutat Res. 573(1 -2): 103- 10), 5' nuclease assay (McGuigan F.E. and Ralston S.H. (2002) Psychiatr Genet. 12(3):133-6), oligonucleotide ligase assay. Other methods include in situ hybridization analyses, single- stranded conformational polymorphism analyses, temperature gradient gel electrophoresis (TGGE), denaturing high performance liquid chromatography (DHPLC). Several SNP genotyping platforms are commercially available. Additional methods will be apparent to one of skill in the art.
In an embodiment, the present invention provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising sequencing a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject to determine the identity of SNP rs1 156026 alleles (i.e. to determine which allele(s) is/are present in the sample at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )), and diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP.
The skilled person would understand that the determination of the identity of SNP rs1 156026 may be performed "indirectly" by determining the identity (e.g., sequence) of the reverse complement of SEQ ID NO: 1 in the biological sample, using for example any of the above-noted SNP genotyping methods.
All these detection techniques may also be employed in the format of microarrays (e.g., SNP microarrays), antibody microarrays (e.g., using anti-DNA antibodies capable of specifically binding to one of the allele), tissue microarrays, electronic biochip (see Schena M., Microarray Biochip Technology, Eaton Publishing, Natick, Mass., 2000).
Further, nucleic acid-containing sequences may be amplified prior to or in conjunction with the detection methods noted herein. The design of various primers for such amplification is known in the art. For example, a nucleic acid (e.g., genomic DNA) comprising the SNP may be amplified using primers hybridizing to sequences upstream and downstream of SNP rs1 156026 (see FIGs. 13A-13K, particularly FIG. 13J), to amplify a nucleic acid encompassing SNP rs1 156026 (a nucleic acid of any length, for example from about 100 to 1000 nucleotides). Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14-25. Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the <3β replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1 173-1 177; Lizardi et al., 1988, BioTechnology 6:1 197-1202; Malek et ai, 1994, Methods Mol. Biol., 28:253-260; and Sambrook ei a/., 1989, supra). In an embodiment, amplification is carried out using PCR.
Polymerase chain reaction (PCR) may be carried out in accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188. In general, PCR involves a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analyzed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out for example by visualization following Ethidium Bromide (EtBr) staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al. Eds, Acad. Press, 1990). The identity of the SNP may be detected using a detectable (labeled) probe, for example.
Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et ai, 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
"Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York,) and are commonly known in the art. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C (see Ausubel, et al. (eds), 1989, supra). In other examples of hybridization, a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe specific to one or the other two alleles in a solution containing 50% formamide, high salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 μg/ml denatured carrier DNA (i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). The selected temperature is based on the melting temperature (Tm) of the DNA hybrid (Sambrook et al. 1989, supra). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
In an embodiment, the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, (ii) determining the identity of SNP rs1 156026 alleles in the sample comprising the amplified product (i.e. to determine which allele(s) is/are present in the sample comprising the amplified product at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )), and (iii) diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP. In an embodiment, the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ). An example of a pair of primers suitable to amplify a region encompassing SNP rs1 156026 is 5'-GCCCTGCCTAATGCACTTTCTGATG-3' (SEQ ID NO: 10, forward primer) and 5'-CTTTTATAATCC AAATTATTATGG C-3' (SEQ ID NO: 1 1 , reverse primer), which generates an amplified product of about 170-180 (e.g., 176) base pairs. The sequences corresponding to SEQ ID NO: 10, and to the reverse complement of SEQ ID NO: 1 1 , are italicized in FIG. 13J. In an embodiment, the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, (ii) (ii) sequencing the amplified product, or a portion thereof encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject to determine the identity of SNP rs1 156026 alleles (i.e. to determine which allele(s) is/are present in the sample at the polymorphic nucleotide position of SNP rs1 156026 (SEQ ID NO: 1 )), and (iii) diagnosing said psychiatric disorder or predisposition thereto based on the identity of said SNP. In an embodiment, the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ).
In an embodiment, the present invention also provides a method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising (i) contacting a nucleic acid in a sample from the subject with a probe capable of specifically hybridizing to one of the alleles of SNP rs1 156026, (ii) determining which allele(s) is/are present in the sample based on the presence or absence of hybridization between the probe and the nucleic acid, and (iii) diagnosing said psychiatric disorder or predisposition thereto based on the identity of the allele(s) present in the sample. In an embodiment, the method further comprises amplifying a region of a nucleic acid encompassing SNP rs1 156026 (SEQ ID NO: 1 ) in a sample from the subject, and contacting the amplified product with the probe. In a further embodiment, the amplifying comprises contacting the nucleic acid with a set of primers, and under conditions, allowing amplification of the region encompassing SNP rs1 156026 (SEQ ID NO: 1 ).
In an embodiment, the above-noted method further comprises selecting a subject suspected of suffering from a psychiatric disorder, or suspected of being predisposed to developing a psychiatric disorder (e.g., based on family antecedents and/or other risk factors, for example).
In another embodiment, the above-noted method further comprises obtaining or collecting a biological sample from a subject. In various embodiments, the above-noted sample can be from any source that contains biological material suitable for the detection of the SNP, such as genomic DNA, for example a tissue or body fluid from the subject (blood, immune cells (e.g., lymphocytes), epithelia, a neural cell sample, etc. The sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (e.g., genomic DNA). Accordingly, in an embodiment, the method may be performed on an isolated nucleic acid sample, such as isolated genomic DNA. The biological sample may be collected using any methods for collection of a biological fluid, tissue or cell sample, such as venous puncture for collection of blood-derived samples (e.g., whole blood, peripheral blood mononuclear cells (PBMCs), etc.). In an embodiment, the above-mentioned method is an aid for the diagnosis of psychiatric disorders (e.g., SZ, BP). Accordingly, the above-mentioned methods may be performed in combination with other assays, methods or markers for diagnosing psychiatric disorders, for example evaluation by a trained mental-health professional, administration of a variety of personality tests and neuropsychological tests, neurocognitive measurements, gathering of background (including medical) information about the individual (e.g., patient's self- reported experiences, behavior reported by relatives or friends), presence of biological and/or other genetic markers associated with the psychiatric disorder, electroretinographic (ERG) measurements (see, U.S. provisional application No. 61/781 ,520), etc. For example, the above- mentioned method may be combined with the criteria set forth in the Diagnostic and Statistical Manual of Mental Disorders 5th Edition (DSM-V), or the World Health Organization's International Classification of Diseases and Related Health Problems (ICD-10), or with any other biological markers (e.g., other SNPs or blood biomarkers) known to be associated with a psychiatric disorder or a predisposition thereto (see, e.g., Chan et al., Int Rev Neurobiol. 201 1 ; 101 :95-144). In an embodiment, the disorder is SZ, a SZ-related disorder or bipolar disorder and the method further comprises measuring an episodic memory parameter in the subject. In a further embodiment, the episodic memory parameter is verbal episodic memory (VEM), visual episodic memory (VisEM), or both.
In an embodiment, the disorder is TS and the method further comprises determining the sequence of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from said subject. In a further embodiment, the method further comprises determining the sequence of SNP rs9567343 (SEQ ID NO: 8) in a biological sample from the subject, in yet a further embodiment the method comprises determining the sequence of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from the subject.
The invention further provides an oligonucleotide (e.g., a probe or a primer), capable of specifically hybridizing to a nucleotide sequence corresponding to one of the alleles and not to (or to a lesser extent to) a nucleic acid sequence corresponding to the other allele (under comparable hybridization conditions). Such hybridization may be under moderately stringent, or preferably stringent, conditions, as noted herein. Such an oligonucleotide may in embodiments be attached to a solid substrate, as noted herein. Such oligonucleotides may be used to specifically detect the presence of a nucleic acid (genomic DNA, cDNA) corresponding to one of the alleles in a sample. In an embodiment, such an oligonucleotide hybridizes to a portion of the nucleic acid of SEQ ID NO: 1 encompassing the SNP, or to its complement.
In an embodiment, the oligonucleotide specifically hybridizes to the following nucleotide sequence or a portion thereof encompassing the T underlined therein CATAAGGACACTTTGAGGAAGACCCATTTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO: 2) , or to the complement thereof (ACTTCATCCTGCTTGCCTGCAGGAAATGGGTCTTCCTCAAAGTGTCCTTATG, SEQ ID NO:
3) , but not to (or to a lesser extent to) a corresponding sequence or portion thereof wherein the T underlined is replaced with a C, or to the complement thereof.
In another embodiment, the oligonucleotide specifically hybridizes to the following nucleotide sequence or a portion thereof encompassing the C underlined therein CATAAGGACACTTTGAGGAAGACCCACTTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO:
4) , or to the complement thereof (ACTTCATCCTGCTTGCCTGCAGGAAGTGGGTCTTCCTCAAAGTGTCCTTATG, SEQ ID NO: 5), but not to (or to a lesser extent to) a corresponding sequence or portion thereof wherein the C underlined is replaced with a T (e.g., SEQ ID NO: 2), or to the complement thereof (e.g., SEQ ID NO: 3).
Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted sequences employed. In general, the oligonucleotide probes or primers are at least about 6 nucleotides in length, in an embodiment at least about 12 nucleotides in length, preferably from about 12 to about 100 nucleotides in length, in embodiments from about 12 to about 50, from about 12 to about 30, or from about 15 to about 24 nucleotides in length. They may be adapted to be especially suited to a chosen nucleic acid amplification system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hybridization thereof with its targeted sequence (see below and in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
Probes or primers of the invention can be utilized with naturally-occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic Acids Res., 14:5019. Probes or primers of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial for the detection of SNPs. Furthermore, it enables automation. Probes can be labeled according to numerous well-known methods (Sambrook et al., 1989, supra). Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will be understood by the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
As commonly known, radioactive nucleotides can be incorporated into probes by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (e.g., uniformly labeled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
In an embodiment, the method comprises contacting a sample from the subject, the sample comprising a nucleic acid (genomic DNA), with one or more oligonucleotides (probes and/or primers) as defined herein to determine the identity of single nucleotide polymorphism (SNP) SNP rs1 156026 (set forth in SEQ ID NO: 1 ).
The present invention also relates to a kit for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops schizophrenia (SZ), schizo-affective disorder (SAD) or early onset (e.g., before the age of about 26) SZ, SAD or BP, the kit comprising one or more suitable reagents to detect a nucleic acid comprising SNP rs1 156026, such as a probe, primer (or primer pair). For example, a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross- contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers may for example include a container which will accept the test sample (e.g., DNA and/or cells), a container which contains the primers used in the assay, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to perform the method and/or detect the indicator products (buffers, solutions, enzymes, etc.). In an embodiment, the kit further comprises instructions for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops early onset schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP), using the above-mentioned methods.
In certain embodiments, the methods of the present invention further comprise sending the diagnostic results (i.e., whether or not the subject has a psychiatric disorder or a predisposition thereto) to a clinician, e.g., a psychiatrist or a general practitioner.
In an embodiment, the above-mentioned methods further comprise selecting and/or administering a course of therapy or prophylaxis to said subject in accordance with the diagnostic result. Accordingly, in another aspect, the present invention provides a method for preventing or treating a psychiatric disorder, said method comprising
identifying a subject suffering from a psychiatric disorder or a predisposition thereto using a method defined above; and
administering a course of therapy or prophylaxis to said subject.
The term "course of therapy" or "therapy" includes any therapeutic approach taken to relieve and/or prevent one or more symptoms associated with a psychiatric disorder. The term encompasses administering any compound, drug, therapeutic agent, procedure, or regimen useful for improving the health of a subject with a psychiatric disorder. In an embodiment, the course of therapy or prophylaxis comprises administration of a psychotropic medication. Psychotropic medication as used herein refers to drugs used for the management of mental and emotional disorders such as psychiatric disorders, and includes for example antidepressants, stimulants, antipsychotics, mood stabilizers, anxiolytics. In an embodiment, the psychotropic medication comprises an antipsychotic medication.
In an embodiment, one or more steps of the above-mentioned methods are performed using or by a computer (e.g., using computer/computing algorithms), using a suitably programmed computer. According to various embodiments, the method can further comprise determining the identity of SNP rs1 156026 set forth in SEQ ID NO: 1 in a subject. In an embodiment, the data obtained can subsequently be stored in a computer in a suitable computer readable form. The computer can subsequently be used to analyze the data and compare them to a control, determine an algorithm, apply the algorithm, etc. The data or results can then be displayed, for example, on a monitor, and/or printed. In embodiments, the methods further comprise transmitting the data or results over a communication network. For example, the data or results may be transferred from a laboratory testing facility (e.g., diagnostic laboratory) to a health care provider, who may analyse the data/results and/or choose the appropriate course of action based on the data/results (e.g., initiate therapy, continue therapy, interrupt therapy, modify the therapy, etc.).
In another embodiment, the methods of the present invention can include processing or converting the raw target detection data (e.g., mathematically, statistically or otherwise) using a statistical method (e.g., logistic or logit regression, cluster analysis, ANCOVA) that takes into account subject data or other data. Subject data may include (but is not limited to): age; race; disease stage/phase, medication, family history, etc. The algorithm may also take into account factors such as the presence, diagnosis and/or prognosis of a subject's condition other than the major psychiatric disorder. As will be clear to the skilled artisan to which the present invention pertains, from above and below, numerous combinations of data parameters and/or factors may be used by the algorithm or algorithms encompassed herein, to obtain the desired output. As used herein, the term "subject" means an individual. In an embodiment, the subject is a human. As used herein, a "subject" is the same as a "patient," and the terms can be used interchangeably. In an embodiment, the subject is suspected of suffering from, or of having a predisposition to, the psychiatric disorder. MODE(S) FOR CARRYING OUT THE INVENTION
The present invention is illustrated in further details by the following non-limiting examples.
Example 1 : Methods
Study subjects and phenotype definition. The case-control sample consisted of 247 unrelated SZ cases and 250 unrelated normal controls without any psychiatric diagnosis from the Eastern Quebec population. All subjects were Caucasian of French-Canadian ancestry. The proportion of males was 79 percent among the cases and 78 percent among the controls. Controls were adults, with a median age of 45 at the time of psychiatric evaluation. Among cases, the median age of onset of SZ was 24 and the interquartile range 20 - 29.5. A lifetime best-estimate DSM-IV diagnosis was made for the unrelated SZ cases and the kindred members using personal interview, information from relatives and extensive medical records. A stringent diagnosis procedure outlined in previous reports (Maziade, M., et al., Am J Psychiatry, 1992. 149(12): p. 1674-86; Roy, M.A., et al., Am J Psychiatry, 1997. 154(12): p. 1726-33) was applied. In brief, all available information across lifetime from different sources (all medical records, family informant interviews, personal structured interview) was reviewed blindly by four research diagnosticians. The board of diagnosticians also specified the presence or absence of psychotic features in BP patients according to DS/W-IV. Family history of mental disorders of the SZ unrelated cases was also obtained from the same sources. The kindred sample consisted of 48 multigenerational families of which 21 were mainly affected by BP (<15% of the affected family members had SZ), 15 mainly affected by a SZ spectrum disorder (< 15% had BP) and 12 were mixed pedigrees, i.e. affected almost equally by SZ and BP. In the kindred sample, a narrow SZ definition restricted to SZ and a broad definition comprising SZ narrow plus schizophreniform disorder and schizotypal personality was used as phenotype. The BP narrow phenotype was restricted to BP I, and the broad definition included BP I, BP II, and recurrent major depression. A narrow and broad "common locus" (CL) phenotype was also defined. The narrow CL phenotype included BP narrow, SZ narrow and schizoaffective disorder (SAD). The broad CL definition included the broad definitions of BP and SZ, in addition to SAD. The number of affected subjects for each phenotype definition is reported in Table 1. A comparison group for the association analyses with the 467 genotyped non affected subjects from the family sample satisfying the following criteria was formed: A) no diagnosis in the broad definition of CL, B) age greater or equal to 25 years and C) not a parent of a CL case. These subjects are referred to as non-affected adult relatives (NAARs). In total, 845 subjects were included in the association analyses.
Table 1 : Number of affected subjects for each phenotype definition.
Phenotypes
CL SZ BP
narrow broad narrow broad narrow broad
281 378 125 136 120 205
Abbreviations: SZ, schizophrenia; BP, bipolar; CL refers to
the "common locus" phenotype as defined above.
Candidate region definition. A wide region was encompassed, given the uncertainty in the boundaries of linkage signals for complex traits. The two markers delimiting the linkage region with a -log10 (p-value) above 3.0 in the kindred sample, D13S1491 and D13S1272, were taken as anchor points (Maziade, M., et al., Eur J Hum Genet, 2009. 17(8): p. 1034-42), and the candidate region was defined as extending 5 Mb proximal from D13S1491 to 5 Mb distal from D13S1272. The interval corresponds to coordinates 33.564 to 50.086 Mb in human genome assembly build GRCH37.3.
Genotyping and CNV detection. In the case-control sample, SNPs were analyzed using the mini-sequencing approach of the lllumina™ genotyping platform with a customized array including the HumanHap300 BeadChip™ and 57,000 additional SNPs, for a total of 375,174 SNPs. All subjects had a genotype called for at least 97 percent of the SNPs. The region of interest derived from the linkage evidence in our kindred sample contained 2,150 SNPs. For replication in the kindred sample, SNPs were analyzed using an in house minisequencing approach (Sun, X., et al., Nucleic Acids Research, 2000. 28(12): p. e68) adapted for the LiCor™ sequencers, where genotypes are called automatically using the software SAGA™ (LICOR). A melting temperature procedure with a cold oligonucleotide probe specific to one of the two nucleotides of the SNP was also used with High Resolution™ Melting kit and a real time PCR (480 LightCycler™), both from Roche. Mendelian inheritance was checked using the computer software PedCheck™ (O'Connell, J.R. and D.E. Weeks, American Journal of Human Genetics, 1998. 63: p. 259-266), and 10% blind replicates were included for genotyping quality control. Copy number variants (CNVs) were inferred using the hidden Markov model implemented in PennCNV™ (Wang, K., et al., Genome Res, 2007. 17(1 1 ): p. 1665-74), which uses the log R ratio and B allele frequency produced by the lllumina BeadStudio™ software to infer hidden states corresponding to copy number. Population frequencies of the B allele were estimated from our sample and other model parameters were set to the values estimated by Wang et al. (2007, supra).
Genotyping quality criteria in the case-control sample. Only SNPs with a minimum call rate of 98 percent and minor allele frequency above one percent in the combined case- control sample were retained. SNPs with Hardy-Weinberg equilibrium chi-square test p-value less than 2.5 x 10"5, corresponding to a 0.05 significance level divided by the number of SNPs in the region, were discarded. This left 2,081 SNPs to be included in the analysis. Only 2 discordant genotypes were observed at these 2,081 SNPs among 30 subjects genotyped in duplicate, for a concordance rate of 99.997 percent.
Assessment of population substructure. A principal component (PC) analysis of the genotypes of the 339,228 autosomal SNPs was performed with Eigensoft™ version 3.0 (Patterson, N., A.L. Price, and D. Reich, PLoS Genet, 2006. 2(12): p. e190, genepath.med.harvard.edu/~reich/Software.htm) to investigate population substructure in our case-control sample. Ancestry differences between the case and control samples were tested by comparing the two groups on the first ten PCs using a Tracy-Widom statistic implemented in Eigensoft. The software was also used to estimate the inflation factor λ based on the genomic control method (Devlin, B., K. Roeder, and L. Wasserman, Genomic control, a new approach to genetic-based association studies. Theor Popul Biol, 2001 . 60(3): p. 155-66).
Association analysis in the case-control sample. Standard allelic, trend and genotypic tests under a dominant and an additive model were performed and allelic and genotypic odds ratios were estimated on the genotyped SNPs and on untyped SNPs imputed using genotype data from the 1000 Genomes Project. Association to both genotyped and imputed SNPs was also tested conditionally on genotypes and on allele counts of the genotyped SNPs showing the strongest association. Haplotype association tests were performed on sliding windows of three and five consecutive SNPs.
More specifically, allelic association with genotyped SNPs was tested using Fisher exact tests in the 2x2 table of alleles x case-control status, as well as Cochran-Armitage trend tests in the 3x2 table of genotype x case-control status. Fisher exact tests were also performed with genotype frequencies under the dominant and recessive models. We tested association with untyped variants in the region extending 200 kb on either side of the association signal detected using genotyped SNPs in an attempt to better characterize the association. Two complementary approaches were applied: imputation of genotypes at untyped SNPs and global tests of haplotypes (frequency > 1 %) over short windows of SNPs (Huang, B.E. , C.I. Amos, and D.Y. Lin, Genet Epidemiol, 2007. 31 (8): p. 803-12). Genotype imputation was performed using genotype data from the 1000 Genomes Project (June 201 1 data release, www.1000genomes.org, The 1000 Genomes Project Consortium, Nature 2010 vol. 467: 1061 - 73) using IMPUTE™ version 2 (Howie, B.N., P. Donnelly, and J. Marchini PLoS Genet, 2009. 5(6): p. e1000529, mathgen.stats.ox.ac.uk/impute/impute.html). Association with the imputed SNP genotypes was then tested using a score test derived from the missing data likelihood under a logistic model implemented in SNPTEST™ version 2.2 (mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html; J. Marchini, et al. (2007). Nature Genetics 39: 906-913). Association to both genotyped and imputed SNPs was also tested conditionally on genotypes and on allele counts of the genotyped SNPs showing the strongest association. We used the score test under a logistic model implemented in SNPTEST™. Haplotype association tests were performed on sliding windows of three and five consecutive SNPs. Association to any haplotype formed by the SNPs in each window and to individual haplotypes was tested using score tests accounting for missing phase information and missing genotypes at a subset of markers using the haplo. score R function (Schaid, D.J., et al. , Am J Hum Genet, 2002. 70(2): p. 425-34). ORs attached to haplotypes were estimated under the generalized linear model with missing phase information of Lake et al. (Lake, S.L., et al. , Hum Hered, 2003. 55(1 ): p. 56-65) using the haplo. cc R function.
Association analysis in the family sample. Allelic log-odds ratios (ORs) were estimated and Wald tests of association were performed under a logistic model estimated using generalized estimating equations (GEEs) with an independence working correlation structure between the subjects in the same family and an empirical variance estimate robust to intra- familial correlation (Zeger, S.L., K.Y. Liang, and P.S. Albert, Biometrics, 1988. 44(4): p. 1049-6). The same approach was then applied to the combined case-control and family samples. The generalized disequilibrium test (GDT) (Chen, W.M., A. Manichaikul, and S.S. Rich, Am J Hum Genet, 2009. 85(3): p. 364-76), a score test robust to population stratification, was also applied to confirm the GEE Wald test results. For haplotypic association, the most likely haplotype pair for each subject given the genotype data on the entire kindred was inferred by maximum likelihood using Superlink (Fishelson, M., N. Dovgolevsky, and D. Geiger, Hum Hered, 2005. 59(1 ): p. 41 -60, cbl-fog.cs.technion.ac.il/superlink/) and haplotypes were recoded as alleles of a multi-allelic marker for the analysis. All statistical tests were two-sided.
Association analysis in the combined case-control and family samples. The logistic regression model included a term for the allele count of a SNP and a term for the sample of origin (case-control vs. family) to adjust for differences in allele frequency between the samples. The model was estimated using GEE as for the analysis in the family sample, with the subjects from the case-control sample treated as one-member families.
Evaluation of linkage disequilibrium (LD). The squared correlation and the Lewontin's D' coefficient among pairs of genotyped SNPs were estimated in the control sample using standard algorithms implemented in the R function LD. Age of onset. First, the mean age of onset between genotypes in patients was compared. Second, genetic association in the kindred sample was tested by comparing the patients with onset before age 26 to the NAARs. Age 26 was chosen based on the median age of first definitive episode of SZ in the kindred sample. In the case-control sample the SZ patients with onset before age 26 were compared to the controls.
Example 2: Matching of cases to controls on ancestry.
Comparison of the case and control groups along the first ten PCs revealed no important difference (p-values between 0.033 and 0.72). FIG. 1 shows the near perfect overlap between the two groups on the first two PCs. The inflation factor estimated by the genomic control method applied to the genotype data was only 1.006. The good fit of the observed distribution of p-values to the expected one in the candidate region can be seen on a quantile- quantile plot (FIG. 2). In consideration of this absence of evidence of population substructure differences between cases and controls, it was decided to not apply any correction.
Example 3: Association with genotyped SNPs in the case-control sample
The SNP rs1 156026 was the only SNP associated to SZ with a FDR < 0.05 in the primary analysis of the SNPs individually using Fisher's exact test, with an OR of 1.81 for the T allele (FIGs. 3 and 4) and 2.63 (95% confidence interval (CI) [1.74, 4.00]) for the TT genotype against the others. Results with the Cochran-Armitage trend test were nearly identical to the Fisher exact allelic test. When the subset of 60 cases with positive family history of SZ, psychosis or paranoia in first, second or third degree relatives was compared to the control group, rs1 156026 remained the SNP with the lowest p-value in the region. The SNP effect size was larger in this familial subset (T allele OR = 2.28, TT genotype OR = 3.10, 95% CI [1.64, 5.86]) but the greatly reduced number of cases resulted in a less significant association (Table 2, FIG. 4). When the case sample was restricted to the 133 cases with onset of SZ before age 26 rs1 156026 was again the SNP with the lowest p-value in the region. The ORs remained about the same as in the primary analysis of the full case group and the p-value was less significant because of the lower power provided by a smaller sample. There was no significant difference in mean age of onset between the three rs1 156026 genotypes. SNP rs1 156026 is located about 500 kb from D13S1297, the marker where the linkage signal peaked in the kindred sample. The sequence of SNP rs1 156026 is:
CATAAGGACACTTTGAGGAAGACCCA[C/T]TTCCTGCAGGCAAGCAGGATGAAGT (SEQ ID NO: 1 )
Example 4: Association with untyped variants Imputation of SNPs located within 200 kb of rs1 156026 using the 1000 Genome Project data revealed no other SNP with stronger association. The lowest p-value obtained was 2.9 x 10~5, with rs26571 16. Over the same interval, the two windows of three consecutive SNPs showing the strongest association to SZ in global haplotype association tests included rs1 156026 (FIG. 5). Windows of five consecutive SNPs yielded no p-value below 10~4. However, the examination of the association of individual haplotypes in the top two three-SNP windows revealed that the rs2120753 - rs2657100 - rs1 156026 AAT haplotype was associated to SZ with a p-value of 2 x 10~5 after correction for testing eight haplotypes, and that the AGT haplotype was also associated to SZ. This indicated that the association was driven by the rs2120753 - rs1 156026 AT haplotype. It was therefore tested association with haplotypes formed by these two correlated SNPs and obtained an odds ratio of 1.94 for the AT haplotype compared to the reference GC haplotype (Table 2, FIG. 4). When the subset of 60 cases with positive family history was compared to the control group, the odds ratio for the AT haplotype raised to 2.84. In both instances, the uncorrected p-value of the score test of the AT haplotype versus all others is close to 10"7.
Example 5: Conditional analysis
The association of the genotyped and imputed SNPs conditional on the T/T genotype and the allele count of rs1 156026 was tested to determine whether other SNPs are associated to SZ independently of rs1 156026. All p-values were non-significant considering multiple testing (p > 0.0005). The same conclusion was obtained when conditioning on the allele count at rs2120753 (p > 0.001 ), but it is noted that rs1 156026 ranked in first place.
Example 6: Linkage disequilibrium (LD)
The LD between rs1 156026 and other neighboring frequent SNPs was examined in subjects of European ancestry in the 1000 Genomes Project to interpret the association results in the present dataset and other studies. Only 8 SNPs and one insertion/deletion (indel) are correlated at a r2 > 0.1 with rs1 156026 and all are within 25 kb (FIG. 6). Among them, only rs2120753 was genotyped, and the r^with rs1 156026 in the control sample is similar to the 1000 Genomes estimate.
Example 7: Copy number variants (CNVs)
CNVs were detected in 245 cases and 137 controls genotyped in the same batch, to ensure that genotyping signal intensities were comparable. The region from rs1998697 to rs9574453 spanning 6 kb is deleted in one case and duplicated in another. A deletion spanning 10 kb from rs1407608 to rs9646096 has been detected in a control. Overlapping duplications and deletions have been reported in the Database of Genomic Variants (DGV) (Zhang, J., et al., Cytogenet Genome Res, 2006. 115(3-4): p. 205-14, projects. tcag.ca/variation). A duplication spanning 9 kb from rs1 1619167 to rs223421 1 detected in a case has not been reported in the DGV. Example 8: Replication of the SNP association in the kindred sample
A significant association of the T allele of SNP rs1 156026 to SZ was also detected in the kindred sample. FIG. 4 shows the results of the GEE analysis for the narrow SZ phenotype (results for the broad SZ phenotype were similar). The estimated OR of 1.54 increased to 2.03 when the analysis was restricted to the sample of families where SZ was the predominant disorder, and the statistical significance of the GEE Wald test also improved from 0.012 to 8.8 x 10~4. The GDT gave a similar result in the full sample (p=0.027) but a less significant one in the sub-sample of SZ families (p=0.072). The combination of the case-control sample with the sub- sample of SZ families gave the strongest overall evidence of association (p = 6.4 x 10~8). Contrary to the case-control sample, little association was observed with the rs2120753 A allele, and the rs2120753 - rs1 156026 AT haplotype was no more strongly associated to SZ than the T allele of SNP rs1 156026 by itself. Instead, the GC haplotype appeared protective against SZ. Also, there was less evidence of association under the recessive model in the kindred sample than in the case-control sample. The association to the narrow BP and CL phenotype was also examined, which gave linkage signals in the kindred sample (Maziade, M., et al., Eur J Hum Genet, 2009. 17(8): p. 1034-42). Neither rs2120753 nor rs1 156026 were significantly associated (Table 3, FIG. 7).
In the kindred sample the mean age at the first probable episode was 26.2 years (standard deviation (SD) = 7.8) for narrow SZ , which is close to reports in general samples of SZ (Hafner H, Maurer K, Loffler W, Riecher-Rossler A, Br J Psychiatry, 1993. 162:80-86. Kirkbride JB, Errazuriz A, Croudace TJ, Morgan C, Jackson D, Boydell J, et al. PLoS One, 2012. 7:e31660. Rajji TK, Ismail Z, Mulsant BH, Br J Psychiatry, 2009. 195:286-293). For narrow BP the mean onset age was 30.8 years (SD = 1 1 .8). Age of onset depended on rs1 156026 genotype for the narrow BP (p = 0.017) and CL (p = 1 .1 x 10~4) phenotypes in 2 df F tests comparing the three genotypes, driven mainly by an earlier onset in TT carriers (FIG. 8, panels a and b). For SZ, a linear decreasing trend in the mean age of onset with the number of T alleles was observed (-2 years per copy of the T allele, p = 0.034, FIG. 8, panel c). The age of onset in carriers of the TT genotype was on average approximately 5 years earlier than in carriers of the CC genotype for both SZ and BP, and therefore also CL. The case sample was then restricted to those with onset of their disorder before age 26 in the association analysis (excluding older onset cases from the analysis). For SZ, the OR for the T allele of rs1 1556026 increased to 2.40 (Table 3, FIG. 7). The enrichment in T alleles in BP with onset before age 26 was insufficient to obtain a significant association. Grouping together SZ, BP and SAD cases with onset before age 26 in the CL phenotype however revealed a significant association with the T allele (p = 8.1 x 10~5), with an OR = 1.87. Analysis of the haplotypes formed by rs2120753 and rs1 156026 did not improve the signal in any of the above analyses, the association being driven by the rs1 156026 T allele.
Example 9: Linkage to the associated SNPs
Parametric linkage analysis using the same model parameters as in previous reports (Maziade, M., et al., Molecular Psychiatry, 2005. 10(5): p. 486-99; Maziade, M., et al., Eur J Hum Genet, 2009. 17(8): p. 1034-42) revealed no evidence of linkage to rs2120753 and rs1 156026 either analyzed individually or together in a multipoint analysis. The maximized logarithm of the odds (MOD) score was equal to 0.6 for the broad CL phenotype and 0.21 for the broad SZ phenotype.
Example 10: Prediction of schizophrenia by combining measures of episodic memory with the SNP rs1156026 T allele
Young high-risk (HR) offspring of schizophrenia (SZ) or bipolar disorder (BP) parents share important deficits in both verbal episodic memory (VEM) and visual episodic memory (VisEM) (Maziade, M., et al., Schizophr Bull, 2009. 35(5): p. 919-30), in fact the largest differences with normal controls were for these 2 cognitive domains (effect sizes (ESs) of 0.8- 0.9). It was assessed in the studies herein whether the combined use of VEM or VisEM impairments and the SNP rs1 156026 T allele identified above may be used in the prediction of SZ.
Methods
Descriptions of samples and neuropsychological assessments are as described in Maziade et al., 2010 (Maziade, M., et al., Schizophr Bull, 2010. 37(6): p. 1218-28).
Nonaffected Adult Relatives (NAARs) Subsample. The inclusion criteria were (1 ) having a first-degree relative with a definite DSM-IV SZ or BP disorder and (2) having had a neuropsychological evaluation before being 55-year old.
Patients Subsample. The adult members affected by SZ came from the same large densely affected multigenerational kindreds and from the sample of unrelated SZ cases. The inclusion criteria were (1 ) a definite DSM-IV SZ or a BP diagnosis, (2) having undergone a neuropsychological evaluation before age 55, and (3) being in a clinical status allowing a reliable cognitive assessment. The exclusion criteria were a brain disorder, trauma, and metabolic disorder known to cause neuropsychological impairments.
Neuropsychological Assessments. In this study, we focused on the free recall measures of tests because they showed the largest ESs in the comparison of offspring with controls. VEM was assessed with the California Verbal Learning Test (CVLT) (Delis, D.C., et al., California Verbal Learning Test Manual, 1987, San Antonio, TX: Psychological Corporation) "total and delayed recalls" in which subjects had to learn a series of words presented orally over 5 trials, and to immediately recall them after each presentation (total recall of 5 trials), or with a 20-min delay (delayed recall). VisEM was assessed with the Rey Complex Figure Test (RCF) (Meyers, J.E. and K.R. Meyers, Rey Complex Figure Test and Recognition Trial (RCFT) 1995, Odessa, FL: Psychological Assessment Resources) immediate and delayed recalls. Subjects had to copy a figure and then recall it after 3 min (immediate recall) and 30 min (delayed recall). The tests were administered in the same order in all subjects. Subjects were individually assessed in a quiet room for a period of 3-4 h by certified psychologists or Ph.D. students who were blind to diagnoses and supervised by a senior neuropsychologist (N.R.). Pauses were offered when needed.
Statistical analysis. VEM and VisEM test results were converted into percentiles based on age and gender specific published scales. An impairment on VEM or VisEM was defined as a test result below the 16th percentile. Logistic regression was used to model the association of VEM or VisEM impairment and the number of rs1 156026 T alleles with SZ diagnosis, separately in univariate analyses and in bivariate analyses of one memory impairment with the SNP (models with more than two variables were not fitted due to sample size constraints). In the bivariate models, the interaction term between the memory impairment and the SNP was tested. Interaction terms that were not significant at the 0.05 level were removed from the model, leaving only the independent main effect terms. Odds ratios (ORs) between two combinations of levels of the variables estimated from the logistic models approximate the relative risk of SZ between the two combinations due to the low prevalence of SZ.
The predictive power of the logistic models was measured by the area under the receiver operating curve (ROC) produced by the model. The ROC curve shows the sensitivity of the model SZ prediction against its false positive rate (one minus the specificity), for all thresholds of the predicted probability of SZ above which a prediction of SZ would be issued. The area under the ROC curve varies from 0.5 (no predictive power) to 1 (perfect prediction).
Results
A total of 52 SZ cases and 93 NAARs underwent a neuropsychological assessment and were genotyped for the SNP rs1 156026. The interaction term was not statistically significant at the 0.05 level in any of the memory impairment - SNP combination tested. All bivariate models therefore contain only main effect terms for the rs1 156026 T allele and the memory impairments were similar in the univariate and bivariate analyses, indicating that the two factors were independently associated to SZ (Tables 4 and 5). Logistic models without interaction terms imply that ORs for two variables in the same model are multiplicative. This translates for instance in a risk of SZ 17.4 times greater in subjects with a VisEM impairment (immediate recall) and a CT genotype compared to no impairment and a CC genotype (Table 4) and a risk of SZ 18.1 times greater in subjects with a VEM impairment (total recall) compared to no impairment and a CC genotype (Table 5).
Table 4: Logistic regression modeling of schizophrenia (SZ) diagnosis as a function of the number of SNP rs1 156026 T alleles and VisEM deficits (either delayed recall or immediate recall) in a sample of 51 SZ cases and 91 unaffected adult relatives.
VisEM: immediate recall
Joint analysis model with variables rs1 156026 and VisEM: p-value of LR test =
3.1 e-06
rs1 156026 VisEM OR (95% CI)
CC No deficit 1.00 (NA)
CT No deficit 2.17 (1.12, 4.19)
CC deficit 8.04 (2.77, 23.36)
CT deficit 17.43 (4.91 , 61.82)
Models for marginal effects
variable rs1 156026 only Variable VisEM only
p-value of LR OR (95% CI) p-value of LR OR (95% CI)
test test
0.0064 2.39 (1.26, 4.2e-06 8.71 (3.06, 24.76)
4.54)
VisEM: delayed recall
Joint analysis model with variables rs1 156026 and VisEM : p-value of LR test =
0.00029
rs 1 156026 VisEM OR (95% CI)
CC No deficit 1.00 (NA)
CT No deficit 2.28 (1.18, 4.40)
CC deficit 4.06 (1.59, 10.38)
CT deficit 9.25 (2.89, 29.57)
Models for marginal effects
variable rs1 156026 only Variable VisEM only
p-value of LR OR (95% CI) p-value of LR OR (95% CI)
test test
0.0064 2.39 (1.26, 0.00092 4.36 (1.75, 10.85)
4.54) Table 5: Logistic regression modeling of schizophrenia (SZ) diagnosis as a function of the number of SNP rs1 156026 T alleles and VEM deficits (either delayed recall or total recall) in a sample of 51 SZ cases and 92 unaffected adult relatives.
VEM: total recall
Joint analysis model with variables rs1 156026 and VEM : p-value of LR test =
3.2e-5
rs1 156026 VEM OR (95% CI)
CC No deficit 1.00 (NA)
CT No deficit 2.12 (1.08, 4.19)
CC deficit 8.53 (2.58, 28.25)
CT deficit 18.1 1 (4.57, 71.8)
Models for marginal effects
variable rs1 156026 only Variable VEM only
p-value of LR OR (95% CI) p-value of LR OR (95% CI)
test test
0.0064 2.39 (1.26, 9.9e-5 8.79 (2.79, 27.73)
4.54)
VEM: delayed recall
Joint analysis model with variables rs1 156026 and VEM : p-value of LR test =
5.3e-5
rs 1 156026 VEM OR (95% CI)
CC No deficit 1.00 (NA)
CT No deficit 2.51 (1.28, 4.96)
CC deficit 5.26 (2.04, 13.62)
CT deficit 13.24 (3.82, 45.92)
Models for marginal effects
variable rs1 156026 only Variable VEM only
p-value of LR OR (95% CI) p-value of LR OR (95% CI)
test test
0.0064 2.39 (1.26, 0.00083 4.45 (1.83, 10.85)
4.54) The ROC curve for the bivariate models and the model with the memory impairment only are displayed on FIGs. 10A and 10B for VisEM immediate recall and on FIGs. 1 1A and 1 1 B for VEM total recall. For VisEM, the area under the ROC curve improves from 0.58 to 0.79 when adding the T allele of rs1 156026 to the logistic model. For VEM total recall, the corresponding improvement is from 0.66 to 0.76. At the point of highest discrimination, a diagnostic test involving VisEM immediate recall and the SNP rs1 156026 would have a sensitivity of 70.6% and a specificity of 80.2%. For VEM total recall and the SNP rs1 156026, the corresponding figures are a sensitivity of 56.9% and a specificity of 83.7%.
Example 11 : Association of SNPs genotyped at 13q13-14 and Tourette syndrome Association analyses were performed on a sample of 91 nuclear families (81 trios, 8 dyads and 2 families) in which 93 subjects are affected by Tourette's syndrome (TS). Likelihood ratio tests of association and odds ratio (OR) estimates were obtained for SNP alleles and haplotypes of selected SNPs by maximizing the likelihood function of Dudbridge (Hum Hered 2008; 66: 87-98) using the Unphased package (http://unphased.sourceforge.net/), which handles partially missing parental genotypes and multiple siblings. Linkage disequilibrium (LD) coefficients between SNPs were estimated from parental haplotypes using the Family Based Association Testing (FBAT) software package.
FIG. 12 shows the results of the association test with the 45 SNPs. Association to TS at the 0.05 level was detected with the C allele of rs1 156026 (OR = 1.6, p = 0.043) and the G allele of rs9567343 (OR = 1 .9, p = 0.016). There was a moderate level of LD between these two SNPs (D' = 0.26, r2 = 0.009). These two SNPs were selected with rs1323142 and rs883877, the two SNPs in between showing moderate LD (r2 < 0.03) with either rs1 156026 or rs9567343 to evaluate haplotypic association. It was observed that TS cases are more likely to receive any haplotype other than the T-G-C-A haplotype from SNPs rs1 156026-rs 1323142-rs883877- rs9567343 with an OR=3.2 (for all other haplotypes against T-G-C-A, p=0.004), implying T G C A as being a protective haplotype against TS (see Table 6).
Table 6: Association of the most frequent haplotypes (freq>0.5) of the SNPs
rs1 156026-rs 1323142-rs883877-rs9567343 with Tourette syndrome.
Haplotype Frequency T-Freq U-Freq OR (95% Cl)a p-valueb
T-A-C-A .210 .185 .229 0.70 (0.41 , 1 .21 ) 0.257
C-A-C-A .174 .212 .143 1 .74 (0.94, 3.20) 0.084
T-G-T-A .134 .093 .143 0.57 (0.26, 1.22) 0.140
T-G-C-A .098 .052 .165 0.32 (0.14, 0.73) 0.004
C-G-C-A .067 .082 .054 1 .57 (0.59. 4.23) 0.402
C-G-T-A .059 .064 .061 1 .04 (0.42, 2.60) 0.934 a Maximum likelihood estimate of the OR for the listed haplotype versus all others and its asymptotic 95% CI
P-value from score test of the haplotype versus all other haplotypes
Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.

Claims

WHAT IS CLAIMED IS:
1. A method for diagnosing a psychiatric disorder or a predisposition thereto in a subject, said method comprising determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample comprising a nucleic acid from said subject, and diagnosing said psychiatric disorder or predisposition thereto based on said identity.
2. The method of claim 1 , wherein the identity of SNP rs1 156026 is determined by sequencing a region encompassing SNP rs1 156026 in the nucleic acid present in said biological sample.
3. The method of claim 1 or 2, wherein said nucleic acid is genomic DNA.
4. The method of any one of claims 1 to 3, wherein said psychiatric disorder is major psychosis.
5. The method of claim 4, wherein said psychiatric disorder is schizophrenia (SZ).
6. The method of claim 4, wherein said psychiatric disorder is bipolar disorder (BD).
7. The method of any one of claims 4 to 6, wherein the presence of one or two thymine (T)- containing alleles of SNP rs1 156026 is indicative that said subject suffers from said psychiatric disorder, or has a predisposition thereto.
8. The method of claim 7, wherein the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from said psychiatric disorder, or has a predisposition thereto.
9. The method of claim 8, wherein the presence of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that said subject has a predisposition to develop said psychiatric disorder before the age of about 26.
10. The method of any one of claims 1 to 9, further comprising measuring an episodic memory parameter in said subject.
1 1. The method of claim 10, wherein said episodic memory parameter is verbal episodic memory (VEM), visual episodic memory (VisEM), or both.
12. The method of any one of claims 1 to 3, wherein said psychiatric disorder is Tourette's syndrome (TS).
13. The method of claim 12, wherein the presence of one or two cytosine (C)-containing alleles of SNP rs1 156026 is indicative that said subject suffers from TS, or has a predisposition thereto.
14. The method of claim 12 or 13, wherein said method further comprises determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343 (SEQ ID NO: 8) in a biological sample from said subject.
15. A kit for diagnosing a psychiatric disorder or a predisposition thereto in a subject, or for determining the risk that a subject develops major psychosis before the age of about 26, the kit comprising (i) at least one reagent, wherein said at least one reagent is for determining the identity of single nucleotide polymorphism (SNP) rs1 156026 set forth in SEQ ID NO: 1 in a biological sample from the subject, and (ii) a container.
16. The kit of claim 15, further comprising instructions for using the kit for diagnosing a psychiatric disorder or a predisposition thereto, or for determining the risk that a subject develops schizophrenia (SZ), schizo-affective disorder (SAD) or bipolar disorder (BP) before the age of about 26.
17. The kit of claim 15 or 16, wherein the identity of SNP rs1 156026 is determined by sequencing a region encompassing SNP rs1 156026 in a nucleic acid present in said sample.
18. The kit of claim 17, wherein said nucleic acid is genomic DNA.
19. The kit of any one of claims 15 to 18, wherein said psychiatric disorder is major psychosis.
20. The kit of claim 19, wherein said psychiatric disorder is schizophrenia (SZ).
21. The kit of any one of claims 15 to 19, wherein said psychiatric disorder is Tourette's syndrome (TS).
22. The kit of claim 21 , further comprising at least one reagent for determining the identity of one or more of SNPs rs1323142 (SEQ ID NO: 6), rs883877 (SEQ ID NO: 7) and rs9567343
(SEQ ID NO: 8) in a biological sample from said subject.
23. The kit of any one of claims 15 to 22, wherein said at least one reagent is one or more oligonucleotides.
24. A method for determining the risk that a subject develops major psychosis before the age of about 26, said method comprising determining the number of thymine (T)-containing alleles of SNP rs1 156026 set forth in SEQ ID NO: 1 in a biological sample comprising a nucleic acid from said subject, and determining the risk that a subject develops major psychosis before the age of about 26 based on said number of thymine (T)-containing alleles of SNP rs1 156026.
25. The method of claim 24, wherein the detection of two thymine (T)-containing alleles of SNP rs1 156026 is indicative that the subject has a higher risk of developing major psychosis before the age of about 26 relative to a subject in which no or one thymine (T)-containing alleles of SNP rs1 156026 is detected.
26. The method of claim 24 or 25, wherein the number of thymine (T)-containing alleles of SNP rs1 156026 is determined by sequencing a region encompassing SNP rs1 156026 in a nucleic acid present in said sample.
27. The method of any one of claims 24 to 26, wherein said nucleic acid is genomic DNA.
28. A method for preventing or treating a psychiatric disorder, said method comprising identifying a subject suffering from a psychiatric disorder or a predisposition thereto using the method of any one of claims 1 to 14; and administering a course of therapy or prophylaxis to said subject.
29. The method of claim 28, wherein the course of therapy or prophylaxis comprises administration of a psychotropic medication.
PCT/CA2013/050824 2012-11-05 2013-10-31 Novel marker for mental disorders Ceased WO2014067005A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/703,089 US20150292016A1 (en) 2012-11-05 2015-05-04 Novel markers for mental disorders

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261722424P 2012-11-05 2012-11-05
US61/722,424 2012-11-05

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/703,089 Continuation-In-Part US20150292016A1 (en) 2012-11-05 2015-05-04 Novel markers for mental disorders

Publications (1)

Publication Number Publication Date
WO2014067005A1 true WO2014067005A1 (en) 2014-05-08

Family

ID=50626259

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2013/050824 Ceased WO2014067005A1 (en) 2012-11-05 2013-10-31 Novel marker for mental disorders

Country Status (2)

Country Link
US (1) US20150292016A1 (en)
WO (1) WO2014067005A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016160484A1 (en) * 2015-03-27 2016-10-06 Myriad Genetics, Inc. Novel biomarkers for psychiatric disorders
CN111808943A (en) * 2020-06-18 2020-10-23 重庆浦洛通基因医学研究院有限公司 Gene detection method for individual medication of mental

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102110883B1 (en) 2018-12-10 2020-05-14 고려대학교산학협력단 Kmt2c snp marker for diagnosis of mental disorder
EP3935581A4 (en) 2019-03-04 2022-11-30 Iocurrents, Inc. Data compression and communication using machine learning

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060057564A1 (en) * 2001-08-10 2006-03-16 The Snp Consortium Identification and mapping of single nucleotide polymorphisms in the human genome

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060057564A1 (en) * 2001-08-10 2006-03-16 The Snp Consortium Identification and mapping of single nucleotide polymorphisms in the human genome

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BUREAU A ET AL.: "Follow-up of a major psychosis linkage site in 13q13-q14 reveals significant association in both case-control and family samples.", BIOLOGICAL PSYCHIATRY, vol. 74, no. 6, 15 September 2013 (2013-09-15), pages 444 - 450 *
LABBE A ET AL.: "Symptom dimensions as alternative phenotypes to address genetic heterogeneity in schizophrenia and bipolar disorder.", EUROPEAN J. OF HUMAN GENETICS, vol. 20, 25 April 2012 (2012-04-25), pages 1182 - 1188 *
MAZIADE M ET AL.: "Chromosome 13q13-q14 locus overlaps mood and psychotic disorders: the relevance for redifining phenotype.", EUROPEAN J. OF HUMAN GENETICS, vol. 17, 28 January 2009 (2009-01-28), pages 1034 - 1042 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016160484A1 (en) * 2015-03-27 2016-10-06 Myriad Genetics, Inc. Novel biomarkers for psychiatric disorders
CN111808943A (en) * 2020-06-18 2020-10-23 重庆浦洛通基因医学研究院有限公司 Gene detection method for individual medication of mental
CN111808943B (en) * 2020-06-18 2021-07-20 重庆浦洛通基因医学研究院有限公司 Gene detection method for individual medication of mental

Also Published As

Publication number Publication date
US20150292016A1 (en) 2015-10-15

Similar Documents

Publication Publication Date Title
Wheeler et al. Sequential use of transcriptional profiling, expression quantitative trait mapping, and gene association implicates MMP20 in human kidney aging
JP5620058B2 (en) Susceptibility gene for age-related macular degeneration (ARM) on chromosome 10q26
Tan et al. Genetic variation in BIN1 gene and Alzheimer's disease risk in Han Chinese individuals
US20210180129A1 (en) Methods of predicting the development of amd based on chromosome 1 and chromosome10
Wang et al. SORCS1 and APOE polymorphisms interact to confer risk for late-onset Alzheimer's disease in a Northern Han Chinese population
US20200239958A1 (en) Methods of predicting the development of complement-mediated disease
Saarela et al. PRKCA and multiple sclerosis: association in two independent populations
US20150292016A1 (en) Novel markers for mental disorders
Damgaard et al. No genetic linkage or molecular evidence for involvement of the PCSK9, ARH or CYP7A1 genes in the Familial Hypercholesterolemia phenotype in a sample of Danish families without pathogenic mutations in the LDL receptor and apoB genes
Johansson et al. Association analysis with microsatellite and SNP markers does not support the involvement of BCL-2 in systemic lupus erythematosus in Mexican and Swedish patients and their families
US20100112589A1 (en) Allele-allele interactions of mthfr gene variants, and uses thereof in predicting disease risk
WO2012018258A1 (en) Markers of febrile seizures and temporal lobe epilepsy
US20060003354A1 (en) Methods and compositions for the diagnosis of Cornelia de Lange Syndrome
US20140045717A1 (en) Single Nucleotide Polymorphism Biomarkers for Diagnosing Autism
US20090305246A1 (en) Schizophrenia associated genes and markers
CN105765077B (en) Detection method for determining risk of anti-thyroid drug-induced agranulocytosis and kit for determination
Ahmed et al. Homozygosity mapping of autosomal recessive intellectual disability loci in 11 consanguineous Pakistani families
WO2008093343A2 (en) Schizophrenia associated genes and markers
US20030211497A1 (en) Diagnosis of schizohprenia by linkage of a polymorphic marker to a segment of chromosome 1q22 bordered by d1s2705 and d1s1679
Kantojarvi Exploring genetic susceptibility to autism spectrum disorders
WO2009036513A1 (en) Diagnostic and therapeutic protocols
Wheeler et al. Sequential use of transcriptional profiling
AU2001249856A1 (en) Diagnosis of schizophrenia by linkage of a polymorphic marker to a segment of chromosome 1q22 bordered by D1S2705 and D1S1679
WO2001087231A2 (en) Methods and compositions for the diagnosis of schizophrenia
WO2001080719A2 (en) Methods and composition for the diagnosis of schizophrenia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13850947

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13850947

Country of ref document: EP

Kind code of ref document: A1