WO2014066404A2 - System and method for visualization of optimized protein expression - Google Patents

System and method for visualization of optimized protein expression Download PDF

Info

Publication number
WO2014066404A2
WO2014066404A2 PCT/US2013/066204 US2013066204W WO2014066404A2 WO 2014066404 A2 WO2014066404 A2 WO 2014066404A2 US 2013066204 W US2013066204 W US 2013066204W WO 2014066404 A2 WO2014066404 A2 WO 2014066404A2
Authority
WO
WIPO (PCT)
Prior art keywords
expression vector
stop codon
protein
context element
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/066204
Other languages
French (fr)
Other versions
WO2014066404A3 (en
Inventor
Jeffrey Rogers
Julia Fletcher
Kevin Lowitz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Life Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corp filed Critical Life Technologies Corp
Priority to US14/437,317 priority Critical patent/US20150267209A1/en
Publication of WO2014066404A2 publication Critical patent/WO2014066404A2/en
Publication of WO2014066404A3 publication Critical patent/WO2014066404A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2/00Peptides of undefined number of amino acids; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1086Preparation or screening of expression libraries, e.g. reporter assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • the present invention generally relates to the field of recombinant protein expression in host cells. More particularly, the invention relates to an expression cloning vector system and method of use that allows a user to select expression clones having a desired level of protein expression. The invention further relates to an expression cloning vector system and method that allows a user to readily detect protein expression in cells in real time.
  • FIG. 1 is a schematic depiction of an expression vector system according to some preferred though non-limiting embodiments.
  • FIG. 2 describes a typical method for producing a recombinant using an expression vector system according to some preferred though non-limiting embodiments.
  • the detailed methods and procedure employed to prepare and to use the expression vector system are set forth in the EXAMPLES section below.
  • modification or “modified” and their variants, as used herein with reference to a protein comprise any change in the structural, biological and/or chemical properties of the protein.
  • the modification can include a change in the amino acid sequence of the protein.
  • the modification can optionally include one or more amino acid mutations, including without limitation amino acid additions, deletions and substitutions (including both conservative and non-conservative substitutions).
  • amino acid mutation refers to an amino acid mutation wherein one or more amino acids is substituted by another amino acid having highly similar properties.
  • one or more amino acids comprising nonpolar or aliphatic side chains for example, glycine, alanine, valine, leucine, isoleucine or proline
  • one or more amino acids comprising polar, uncharged side chains for example, serine, threonine, cysteine, methionine, asparagine or glutamine
  • polar, uncharged side chains for example, serine, threonine, cysteine, methionine, asparagine or glutamine
  • amino acids comprising aromatic side chains for example, phenylalanine, tyrosine or tryptophan
  • amino acids comprising positively charged side chains for example, lysine, arginine or histidine
  • amino acids comprising negatively charged side chains for example, aspartic acid or glutamic acid
  • the modified polymerase is a variant that comprises one or more of these conservative amino acid substitutions, or any combination thereof.
  • conservative substitutions for leucine include: alanine, isoleucine, valine, phenylalanine, tryptophan, methionine, and cysteine.
  • conservative substitutions for asparagine include: arginine, lysine, aspartate, glutamate, and glutamine.
  • an expression vector system may include a vector backbone functionally linked to a promoter capable of driving transcription in a host cell,
  • the expression vector system many include one or more of a random ribosomal binding site (RRBS) functionally linked to and positioned downstream from the promoter, a stop codon context element having a stop codon and at least onel 3-nucleotide codon in frame with the stop codon, and at least a portion of a gene encoding a reporter protein downstream of and in-frame with the stop codon context element.
  • RRBS random ribosomal binding site
  • the expression vector backbone may be any vector backbone familiar to a practitioner having ordinary skill level in the art without limitation. The selection of a suitable vector backbone as well as the functional elements required in such a vector backbone is well known to such a person. In some preferred though non-limiting embodiments, a suitable vector backbone may be a pBAD vector backbone, or any suitable variant thereof.
  • an expression vector system may optionally include a gene of interest inserted between the RRBS and the stop codon context element.
  • the expression vector system may be adapted to allow a user to readily insert a gene of interest therein, optionally between the RRBS and the stop codon context element.
  • the expression vector system of the present embodiments will be particularly adapted such that expression of the gene of interest is promoted under suitable conditions in a host cell.
  • the gene of interest is in- frame with the stop codon context element and the portion of the gene encoding a reporter protein.
  • the gene of interest, the stop codon context element and the portion of the gene encoding the reporter protein may form an open reading frame.
  • and expression vector system may be particularly adapted to drive expression of a gene of interest in a host cell under suitable permissive conditions.
  • the host cell may be, in certain embodiments, a eukaryotic cell.
  • Suitable eukaryotic cells may include any eukaryotic cell capable of being cultured and expressing recombinant nucleic acids transferred to the cell interior.
  • Other suitable cells may include cells in tissue in an animal in vivo.
  • Suitable eukaryotic cells may include cultured eukaryotic cells, stable cell lines, primary cells, yeast cells, fungal cells, plant cells and the like, or may include cells in vivo in an organism.
  • the elements of the vector backbone may be selected such that expression of the gene of interest is optimized in the host cell.
  • a eukaryotic promoter may be selected as the promoter use in the expression vector system.
  • a host cell may a prokaryotic cell. Suitable prokaryotic cells may include any bacterial cell capable of being cultured and expressing recombinant nucleic acids transferred to the cell interior.
  • the elements of the vector backbone, including but not limited to the promoter may be selected such that expression of the gene of interest is optimized in the host prokaryotic cell.
  • a prokaryotic promoter may be selected as the promoter use in the expression vector system.
  • the cell may be an E. coli cell, such as, e.g., TOP10 or ⁇ cells.
  • the expression vector may be selected from the list consisting of SP6, T7, T3 and PBAD (araBAD).
  • an expression system may include an RRBS that forms all or at least a portion of the 5'-UTR of an mRNA transcript transcribed from the expression vector.
  • the RRBS may generally include the nucleotide sequence N 4 R 6 Nx, where N is A, T, G, or C, where R is A or G, and where X is an integer from 6 to 11.
  • an expression vector system may include the nucleotide sequence NNNNRRRRRRNNNNNN.
  • an RRBS may optionally include a translational initiation site. In other embodiments, a translational initiation site may be included in the user-provided gene of interest.
  • an expression vector system may optionally include or more cloning sites positioned between the RRBS and the stop codon context element.
  • the cloning sites may be adapted or selected to facilitate the introduction of a user-provided or defined gene of interest into the expression vector.
  • the optional cloning sites will preferably enable a user to introduce the gene of interest so that the gene forms an open reading frame with the stop codon context element and the portion of a gene encoding a reporter protein.
  • the expression vector system may optionally be adapted for blunt-end cloning of a user-provided or defined cDNA between the RRBS and the stop codon context element.
  • an expression vector system may be adapted for TOPO®-cloning, for GATEWAY® Cloning or for TOPO® GATEWAY® cloning.
  • and expression vector system may optionally include a nucleotide sequence encoding a Tag fusion protein.
  • the nucleotide sequence encoding a Tag fusion protein may be in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
  • Exemplary though non- limiting Tag-fusion proteins contemplated for use with the embodiments disclosed herein may include, though are not limited to, HIS 6 , HIS 8 , fflSio, MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc.
  • a Tag fusion protein may include one or more of HIS 6 , HISs, HISio, MYC, FLAG, GST, MBP and HA. Most preferably, a Tag fusion protein is one or more of HIS 6 , HISs and HISio-
  • an expression vector system may include a stop codon context element.
  • the stop codon context element may be selected such that up to about 10% of a protein, up to about 8% of a protein, up to about 5% of a protein, up to about 2% of a protein, up to about 1 % of a protein, up to about 0.5% of a protein, up to about 0.2% of a protein, or up to about 0.1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
  • the stop codon context element may be selected such that between about 1% to about 10% of a protein, between about 0.
  • 5% to about 5% of a protein between about 0.05% to about 0.5% of a protein, between about 0.01% to about 0.1% of a protein, or between about 0.01 % to about 1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
  • the nucleotide sequence of a stop codon context element for use in the embodiments described herein may be selected from the list consisting of the nucleotide sequences TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10%, up to about 5%, up to about 2%, up to about 1 %, up to about 0.5%, up to about 0.2%, or up to about 0.1% or between about 1% to about 10%, between about 0.5% to about 5%, between about 0.05% to about 0.5%, between about 0.01 % to about 0.1 %, or between about 0.01 % to about 1 % suppression of the stop codon.
  • the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
  • N is A, T, G or C
  • NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
  • the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
  • an expression vector system may include at least a portion of a gene encoding a reporter protein.
  • the reporter protein will be a fusion protein with the gene of interest and will be in-frame with the stop codon context element.
  • the reporter protein encoded by the gene may be a fluorescent protein or a fragment thereof, such as, e.g., GFP, RFP, YFP, or a functional derivative thereof.
  • a reporter protein particularly suited for use with the present expression vector system may be ⁇ -galactosidase or a portion thereof, such as, e.g., the C-terminal portion of ⁇ -galactosidase, such as, e.g., the C-terminal 30 amino acids of ⁇ -galactosidase.
  • the portion of the gene encoding the reporter protein may include the nucleotide sequence
  • GTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA or a functional equivalent thereof.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may- include the steps of obtaining an expression vector, the expression vector including a promoter capable of driving transcription in a host cell, a random ribosomal binding site (RRBS) functionally linked to and positioned downstream from the promoter, a stop codon context element comprising a stop codon and at least one 3-nucleotide codon in frame with the stop codon, and at least a portion of a gene encoding a reporter protein downstream of and in- frame with the stop codon context element.
  • RRBS random ribosomal binding site
  • Further steps may include inserting a gene of interest into the expression vector between the RRBS and the stop codon context element, and introducing the expression vector into a host cell, and culturing the host cell under conditions permissive to said host cell expressing the recombinant protein.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include inserting a gene of interest into the expression vector system so that the reading frame of the gene of interest is in- frame with the stop codon context element and the portion of the gene encoding a reporter protein.
  • the gene of interest that is inserted into the expression vector system, the stop codon context element, and the portion of the gene encoding the reporter protein form an open reading frame.
  • the host cell that the expression vector system containing the gene of interest is inserted into is a eukaryotic cell.
  • the host cell that the expression vector system containing the gene of interest is inserted into is a prokaryotic cell, such as, e.g., an E. coli cell.
  • the introduction of nucleic acids, including expression vectors, into eukaryotic and prokaryotic cells is a well-developed art and a variety of methods for doing so are well known to a fractioned possessing ordinary skill level in the art.
  • the promoter of the expression vector system inserted into the host cell may be a eukaryotic promoter when the expression vector system is adapted for use in eukaryotic cells.
  • Suitable eukaryotic promoters are known in the art and may include, though are not limited to, promoters such as CMV, MMTV, RSV and the like. Selecting a eukaryotic promoter for use in the present expression vector system is well within the purview of a practitioner having ordinary skill level in the art.
  • the promoter of the expression vector system inserted into the host cell may be a prokaryotic promoter when the expression vector system is adapted for use in prokaryotic cells.
  • Suitable prokaryotic promoters are known in the art and may include, though are not limited to, promoters such as SP6, T7, T3 and PBAD (araBAD) and the like. Selecting a prokaryotic promoter for use in the present expression vector system is well within the purview of a practitioner having ordinary skill level in the art.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include may include proving an expression vector having an RRBS that forms all or at least a portion of the 5'-UTR of an mRNA transcript transcribed from the expression vector.
  • the RRBS may generally include the nucleotide sequence N 4 R 6 Nx, where N is A, T, G, or C, where R is A or G, and where X is an integer from 6 to 11.
  • an expression vector system may include the nucleotide sequence NNNNRRRRRRNNNNNN.
  • an RRBS may optionally include a translational initiation site. In other embodiments, a translational initiation site may be included in the user-provided gene of interest.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include optionally providing one or more cloning sites positioned between the RRBS and the stop codon context element.
  • the cloning sites may be adapted or selected to facilitate the introduction of a user- provided or defined gene of interest into the expression vector.
  • the optional cloning sites will preferably enable a user to introduce the gene of interest so that the gene forms an open reading frame with the stop codon context element and the portion of a gene encoding a reporter protein.
  • the expression vector system may optionally be adapted for blunt-end cloning of a user-provided or defined cDNA between the RRBS and the stop codon context element.
  • an expression vector system may be adapted for TOPO®-cloning, for GATEWAY® Cloning or for TOPO® GATEWAY® cloning.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may optionally include providing a nucleotide sequence encoding a Tag fusion protein.
  • the nucleotide sequence encoding a Tag fusion protein may be in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
  • Exemplary though non- limiting Tag-fusion proteins contemplated for use with the embodiments disclosed herein may include, though are not limited to, HIS 6 , HIS 8 , HIS 10 , MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc.
  • a Tag fusion protein may include one or more of HIS 6 , HIS 8 , HIS 10, MYC, FLAG, GST, MBP and HA.
  • a Tag fusion protein is one or more of HIS 6 , HIS 8 and HISio-
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include providing an expression vector system having a stop codon context element.
  • the stop codon context element may be selected such that up to about 10% of a protein, up to about 8% of a protein, up to about 5% of a protein, up to about 2% of a protein, up to about 1% of a protein, up to about 0.5% of a protein, up to about 0.2% of a protein, or up to about 0.1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
  • the stop codon context element may be selected such that between about 1% to about 10% of a protein, between about 0. 5% to about 5% of a protein, between about 0.05% to about 0.5% of a protein, between about 0.01% to about 0.1% of a protein, or between about 0.01% to about 1% of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
  • the nucleotide sequence of a stop codon context element for use in the embodiments described herein may be selected from the list consisting of the nucleotide sequences TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10%, up to about 5%, up to about 2%, up to about 1 %, up to about 0.5%, up to about 0.2%, or up to about 0.1% or between about 1% to about 10%, between about 0.5% to about 5%, between about 0.05% to about 0.5%, between about 0.01 % to about 0.1 %, or between about 0.01 % to about 1 % suppression of the stop codon.
  • the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
  • N is A, T, G or C
  • NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
  • the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
  • methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include providing an expression vector system having at least a portion of a gene encoding a reporter protein.
  • the reporter protein will be a fusion protein with the gene of interest and will be in-frame with the stop codon context element.
  • the reporter protein encoded by the gene may be a fluorescent protein or a fragment thereof, such as, e.g., GFP, RFP, YFP, or a functional derivative thereof.
  • a reporter protein particularly suited for use with the present expression vector system may be ⁇ - galactosidase or a portion thereof, such as, e.g., the C-terminal portion of ⁇ -galactosidase, such as, e.g., the C-terminal 30 amino acids of ⁇ -galactosidase.
  • the portion of the gene encoding the reporter protein may include the nucleotide sequence
  • an expression vector system in accordance with the embodiments described herein may include a vector backbone. Any suitable vector backbone can be used in the practice of the present invention without limitation.
  • a eukaryotic expression vector may be used, although specific embodiments described herein are directed to prokaryotic expression vectors.
  • the vector used will be optimized for expression and/or propagation in a host cell.
  • an expression vector system in accordance with the presently described embodiments may be derived from a commercially available expression vector, such as, e.g., the pBad expression vector available from Life Technologies.
  • a suitable vector backbone will include, in additional to sepcviofc elements described here, one or more additional elements commonly associated with expression vectors.
  • a vector backbone may optionally include at least one selectable marker (not shown in FIG. 1), preferably more than one (e.g., Amp and/or Tet and/or Cam and/or araC).
  • a vector backbone may include at least one origin of replication (e.g., pBR322 ori).
  • the vector may contain a multi-cloning site.
  • the vector may be optimized for Topo-cloning, blunt end cloning, Gateway® cloning, or any other cloning system optimized or otherwise recognized by those skilled in the art as being capable of allowing the insertion of a gene or a gene fragment into an expression vector for the purpose of transcribing a gene and translating a protein from an open reading frame.
  • an expression vector system may include a promoter suitable for driving expression of a gene of interest.
  • a suitable eukaryotic promoter will be employed.
  • a variety of eukaryotic promoters are known in the art, and any may be used in the practice of the invention without limitation. Strong, moderate or weak promoters are acceptable.
  • a suitable bacterial promoter will be employed.
  • a variety of prokaryotic promoters are known in the art, and any may be used in the practice of the invention without limitation.
  • Exemplary bacterial promoters may include, e.g., T7, T3, SP6, PBAD (arciBAD) promoter etc.
  • an expression vector system as provided for herein may include a "random ribosomal binding site" (RRBS).
  • RRBS random ribosomal binding site
  • an expression vector system may be provided to a user as a vector library.
  • the RRBS is a random region of variable length within the 5'UTR region of the gene of interest.
  • the RRBS is designed to select clones that exhibit enhanced (or "optimized") translation. Those clones having an RRBS sequence that promotes enhanced translation of the GOI will be selected based on color (or other) indicia that demonstrate elevated translation (e.g., higher levels of omega-complementation result in more intensely blue colonies. These will be selected as high expressers.
  • the RRBS will generally contain at least the following elements: N 4 R 6 Nx; where N is A, T, G or C, R is a purine (A or G) and X is an integer from 6 to 11.
  • N is A, T, G or C
  • R is a purine (A or G) and X is an integer from 6 to 11.
  • a translational start codon may be included at the 3' end of the RRBS.
  • a translational start codon may be included immediately following the RRBS.
  • no start codon may be used as it may be provided as part of the user supplied Gene of Interest (GOI).
  • the GOI may be prepared as a restriction fragment, a synthetic polynucleotide, a PCR fragment, or the like.
  • an expression vector system may optionally contain a multiple cloning site.
  • the vector may be adapted to facilitate blunt-end cloning, Topo- cloning, Gateway cloning, or the like.
  • the expression vector will be adapted to allow a user to easily insert the GOI.
  • the vector may optionally contain a tag used for affinity purification, e.g., HIS 6 , MYC, FLAG etc.
  • the tag will be in- frame with the GOI.
  • Context codons Downstream of the optional tag fusion (or the GOI if the tag is absent) is an in-frame stop codon (preferably amber stop TAG, but it could be any of the three stop codons) followed by a 3 nucleotide "context codon".
  • the context codon is selected to make “leakiness” more permissive and “fine-tuned”. Any of the three stop codons can be used, and using routine experimentation and optimized "context codon" can be found that permits the desired leakiness in the context of the stop codon and the strain of bacteria used.
  • Context codons may be selected from the following High to Low
  • TAT or ATA w selected for the commercial embodiment for low read-through. In the case of co- complementation ATA was used because it is more permissive. E. coli strains have some natural ability for read through, but selecting the proper context codon can fine-tune read- through ability. With TAGATA, TOP10, DH5a and ⁇ seem to work well.
  • the fusion could be anything that is easily detectable in a culture or in colonies growing on plates. E.g., could be a fluorescent protein (GFR, RFP etc), lacZ or a mutant.
  • GFR fluorescent protein
  • lacZ lacZ
  • a short fusion of the C-terminal extremity of LacZ namely LacZ Ct-term 30 amino acids that can co- complement in E coli that are LacZ3'A.
  • the host cell must be able to express the reporter properly, especially in the case of lacZCT. co-complementation can only work in the appropriate host cell that has had endogenous or full-length LacZ knocked out and replaced with LacZAC.
  • the vector reporter fusion sequence is
  • RRE Random Ribsomal Element
  • a pBAD TOPO vector (Life Technologies) was re-circularized and digested with PME1 and BSA XI (New England Biolabs) to remove the ribosomal binding site, V5 epitope and TGA stop codon (Seq. 1).
  • the resulting plasmid,pBAD-CPm E was used as a template for generating the linear RRE vector library with XHO I and NCO I ends (Ylxn) using PCRwith pBAD XHOl forward primer,RBS NCO 1 reverse primer (Table 1) and Phusion DNA polymerase (New England Biolabs).
  • the resulting PCR product, Ylxn was digested with NCO I and XHO I (New England Biolabs) and treated with Calf Intestinal Phosphatase (Life Technologies) to create the final linear library, Yl.
  • YlCPm, CPm, aCPm insert with NCO I and XHO I ends Seq.
  • LacZ ⁇ 30 was generated by inserting an N-terminal fragment of Lac-Z (Seq. 4) between the NCO I, XHO I restriction sites in the pACYCDuet-1 vector (Novagen).
  • YlCPmand LacZ ⁇ 30 were electroporated into a ToplO strain (Life Technologies). The transformation was spread on Luria broth (LB) agar plates supplemented with lOOug/ml ampicillin (amp), 20ug/ml chloramphenicol (cm), 0.1 arabinose and 40ug/ml 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal) and grown overnight at 37°C. After 18 hours, dark blue colonies were picked and grown in 1ml cultures of LB supplemented with lOOug/ml ampicillin.
  • a 1 :100 dilution of one of the LB cultures was used to inoculate a new 1ml LB /100ug/ml amp culture, which was grown to an A600 OD of 0.8 then induced with 0.02 % arabinose overnight at 37°C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure describes a novel recombinant gene expression system and a method of its use. The recombinant gene expression system is adapted to enable a user to monitor the successful expression of a protein in real time by allowing a small portion (e.g., less than 10%) of the target protein to be expressed as a fusion with a readily detectable reporter. The recombinant gene expression system further allows a user to select a clone that exhibits high, medium or low expression by providing a random ribosomal binding site having the nucleotide sequence N4R6NX, where N is A, T, G, or C, where R is A or G, and where x is an integer from 6 to 11 upstream of the cloned gene. By selecting a clone exhibiting a desired relative level of reporter gene expression, a user can tailor the expression level of the desired protein.

Description

SYSTEM AND METHOD FOR VISUALIZATION OF OPTIMIZED PROTEIN
EXPRESSION
TECHNICAL FIELD OF THE INVENTION
[0001] The present invention generally relates to the field of recombinant protein expression in host cells. More particularly, the invention relates to an expression cloning vector system and method of use that allows a user to select expression clones having a desired level of protein expression. The invention further relates to an expression cloning vector system and method that allows a user to readily detect protein expression in cells in real time.
BACKGROUND OF THE INVENTION
[0002] The general principle of protein expression in cultured bacterial or eukaryotic cells or in whole animals by various gene transfer methods is well known and a key strategy in both basic research and biotechnological applications. For large-scale protein production and for many small-scale applications, efficient transient expression of a recombinant product is an absolute requirement. However, difficulties exist in identifying host cells that produce recombinant protein at sufficient levels and in identifying host cell clones that maintain expression levels during prolonged cultivation periods. Additionally, variability in the expression efficiencies of specific clones makes identifying and selecting clones with tailored levels of protein expression challenging.
[0003] The process of generating a clone that is optimized for optimized recombinant protein expression in cells can take several weeks or even months. Merely cloning a cDNA into an expression vector is no guarantee that desired protein will be expressed in host cells at a desired level, if at all. Currently, methods to visualize protein expression in E. coli in real-time require generating a fusion protein or expressing a reporter protein, and these methods come without options to select the clone that exhibits optimized expression characteristics.
[0004] There exists a need for an expression vector system that allows a user to select a clone that expresses a protein at a desired level. There also exists a need for an expression vector system that allows a user to determine whether a specific clone expresses a protein in real-time, without having to conduct time-consuming analysis and/or modification of the expressed clone. INCORPORATION BY REFERENCE
[0005] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] The above brief description as well as further objects, features and advantages of the methods and apparatus of the present invention will be more fully appreciated by reference to the following detailed description of presently preferred but nonetheless illustrative embodiments in accordance with the present invention when taken in conjunction with the accompanying drawings:
[0007] FIG. 1 is a schematic depiction of an expression vector system according to some preferred though non-limiting embodiments; and
[0008] FIG. 2 describes a typical method for producing a recombinant using an expression vector system according to some preferred though non-limiting embodiments. The detailed methods and procedure employed to prepare and to use the expression vector system are set forth in the EXAMPLES section below.
SUMMARY AND DETAILED DESCRIPTION OF THE INVENTION
[0009] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which these inventions belong. All patents, patent applications, published applications, treatises and other publications referred to herein, both supra and infra, are incorporated by reference in their entirety. If a definition and/or description is explicitly or implicitly set forth herein that is contrary to or otherwise inconsistent with any definition set forth in the patents, patent applications, published applications, and other publications that are herein incorporated by reference, the definition and/or description set forth herein prevails over the definition that is incorporated by reference.
[0010] The practice of the disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology and recombinant DNA techniques, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook, J., and Russell, D.W., 2001, Molecular Cloning: A Laboratory Manual, Third Edition; Ausubel, F.M., et al., eds., 2002, Short Protocols In Molecular Biology, Fifth Edition. [0011] Note that not all of the activities described in the general description or the examples are required, that a portion of a specific activity may not be required, and that one or more further activities may be performed in addition to those described. Still further, the order in which activities are listed are not necessarily the order in which they are performed.
[0012] In some instances, some concepts have been described with reference to specific embodiments. However, one of ordinary skill in the art appreciates that various modifications and changes can be made without departing from the scope of the invention as set forth in the claims below. Accordingly, the specification and figures are to be regarded in an illustrative rather than a restrictive sense, and all such modifications are intended to be included within the scope of invention.
[0013] As used herein, the terms "comprising" (and any form or variant of comprising, such as "comprise" and "comprises"), "having" (and any form or variant of having, such as "have" and "has"), "including" (and any form or variant of including, such as "includes" and
"include"), or "containing" (and any form or variant of containing, such as "contains" and "contain"), are inclusive or open-ended and do not exclude additional, unrecited additives, components, integers, elements or method steps. For example, a process, method, article, or apparatus that comprises a list of features is not necessarily limited only to those features but may include other features not expressly listed or inherent to such process, method, article, or apparatus.
[0014] Unless expressly stated to the contrary, "or" refers to an inclusive-or and not to an exclusive-or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
[0015] Benefits, other advantages, and solutions to problems have been described with regard to specific embodiments. However, such benefits, advantages, solutions to problems, and any feature(s) that may cause any benefit, advantage, or solution to occur or become more pronounced are not to be construed as a critical, required, or essential feature of any or all the claims.
[0016] After reading the specification, skilled artisans will appreciate that certain features that are, for clarity, described herein in the context of separate embodiments can also be provided in combination in a single embodiment. Conversely, various features that are, for brevity, described in the context of a single embodiment can also be provided separately or in any subcombination. Further, references to values stated in ranges include each value within that range. [0017] Also, the use of articles such as "a","an" or "the" are employed to describe elements and components described herein. This is done merely for convenience and to give a general sense of the scope of the invention. This description should be read to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise. Accordingly, the terms "a," "an," and "the" and similar referents used herein are to be construed to cover both the singular and the plural unless their usage in context indicates otherwise. Accordingly, the use of the word "a" or "an" or "the" when used in the claims or specification, including when used in conjunction with the term "comprising", may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."
[0018] The terms "modification" or "modified" and their variants, as used herein with reference to a protein comprise any change in the structural, biological and/or chemical properties of the protein. In some embodiments, the modification can include a change in the amino acid sequence of the protein. For example, the modification can optionally include one or more amino acid mutations, including without limitation amino acid additions, deletions and substitutions (including both conservative and non-conservative substitutions).
[0019] The term "conservative" and its variants, as used herein with reference to any change in amino acid sequence, refers to an amino acid mutation wherein one or more amino acids is substituted by another amino acid having highly similar properties. For example, one or more amino acids comprising nonpolar or aliphatic side chains (for example, glycine, alanine, valine, leucine, isoleucine or proline) can be substituted for each other. Similarly, one or more amino acids comprising polar, uncharged side chains (for example, serine, threonine, cysteine, methionine, asparagine or glutamine) can be substituted for each other. Similarly, one or more amino acids comprising aromatic side chains (for example, phenylalanine, tyrosine or tryptophan) can be substituted for each other. Similarly, one or more amino acids comprising positively charged side chains (for example, lysine, arginine or histidine) can be substituted for each other. Similarly, one or more amino acids comprising negatively charged side chains (for example, aspartic acid or glutamic acid) can be substituted for each other. In some
embodiments, the modified polymerase is a variant that comprises one or more of these conservative amino acid substitutions, or any combination thereof. In some embodiments, conservative substitutions for leucine include: alanine, isoleucine, valine, phenylalanine, tryptophan, methionine, and cysteine. In other embodiments, conservative substitutions for asparagine include: arginine, lysine, aspartate, glutamate, and glutamine. [0020] It is an object of the embodiments described herein to provide an expression vector system that enables a user to select clones that express a protein in host cells at a desired level. The system expression vector system described below is optimized to allow a user to select differentiate the level of protein expression between individual closes, thereby enabling the user to select clones that express the desired protein at high, medium or low levels.
[0021] It is a further object of the embodiments described herein to provide an expression vector system that enables a user to readily determine, in real-time, whether a selected clone is expressing a desired protein in culture, without the user having to process a sample or otherwise perform analysis of the expressed protein.
[0022] It is yet a further object of the embodiments described herein to provide an expression vector system that perform the above functions, without a user being required to subject the final expressed protein to rigorous downstream purification steps.
[0023] It is another object of the embodiments described herein to provide an expression vector system that enables partial suppression of a stop codon in a host cell so that less than about 10%, less than about 9%, les than about 8%, less than about 7%, less than about 6 %, less than about 5%, less than about 4%, less than about 3%, less than about 1%, less than about 0.5% or less than about 0.1% of a protein translated from the expression vector is fused to a detectable reporter protein located downstream of the partially suppressed stop codon.
[0024] It is a further object of the embodiments described herein to provide methods for using the embodied expression vectors systems to select clones that express a protein at a desired level.
[0025] It is a further object of the embodiments described herein to provide methods for using the embodied expression systems to determine whether a protein is being expressed from a cloned gene of interest in real-time, without having to isolate, prepare, process or analyze samples containing the protein of interest.
[0026] In some embodiments, an expression vector system may include a vector backbone functionally linked to a promoter capable of driving transcription in a host cell, The expression vector system many include one or more of a random ribosomal binding site (RRBS) functionally linked to and positioned downstream from the promoter, a stop codon context element having a stop codon and at least onel 3-nucleotide codon in frame with the stop codon, and at least a portion of a gene encoding a reporter protein downstream of and in-frame with the stop codon context element.
[0027] The expression vector backbone may be any vector backbone familiar to a practitioner having ordinary skill level in the art without limitation. The selection of a suitable vector backbone as well as the functional elements required in such a vector backbone is well known to such a person. In some preferred though non-limiting embodiments, a suitable vector backbone may be a pBAD vector backbone, or any suitable variant thereof.
[0028] In some embodiments, an expression vector system may optionally include a gene of interest inserted between the RRBS and the stop codon context element. In other embodiments, the expression vector system may be adapted to allow a user to readily insert a gene of interest therein, optionally between the RRBS and the stop codon context element. The expression vector system of the present embodiments will be particularly adapted such that expression of the gene of interest is promoted under suitable conditions in a host cell. In an embodiment, the gene of interest is in- frame with the stop codon context element and the portion of the gene encoding a reporter protein.
[0029] In some embodiments, the gene of interest, the stop codon context element and the portion of the gene encoding the reporter protein may form an open reading frame.
[0030] In some embodiments, and expression vector system may be particularly adapted to drive expression of a gene of interest in a host cell under suitable permissive conditions. The host cell may be, in certain embodiments, a eukaryotic cell. Suitable eukaryotic cells may include any eukaryotic cell capable of being cultured and expressing recombinant nucleic acids transferred to the cell interior. Other suitable cells may include cells in tissue in an animal in vivo. Suitable eukaryotic cells may include cultured eukaryotic cells, stable cell lines, primary cells, yeast cells, fungal cells, plant cells and the like, or may include cells in vivo in an organism. In such embodiments, the elements of the vector backbone, including but not limited to the promoter, may be selected such that expression of the gene of interest is optimized in the host cell. In embodiments where protein expression is to be carried out in eukaryotic cells, a eukaryotic promoter may be selected as the promoter use in the expression vector system. In some preferred though non-limiting embodiments, a host cell may a prokaryotic cell. Suitable prokaryotic cells may include any bacterial cell capable of being cultured and expressing recombinant nucleic acids transferred to the cell interior. In such embodiments, the elements of the vector backbone, including but not limited to the promoter, may be selected such that expression of the gene of interest is optimized in the host prokaryotic cell. In embodiments where protein expression is to be carried out in prokaryotic cells, a prokaryotic promoter may be selected as the promoter use in the expression vector system. In particularly preferred though non-limiting embodiments, the cell may be an E. coli cell, such as, e.g., TOP10 or ϋΗΙΟβ cells. In such embodiments, the expression vector may be selected from the list consisting of SP6, T7, T3 and PBAD (araBAD).
[0031] In an embodiment, an expression system may include an RRBS that forms all or at least a portion of the 5'-UTR of an mRNA transcript transcribed from the expression vector. The RRBS may generally include the nucleotide sequence N4R6Nx, where N is A, T, G, or C, where R is A or G, and where X is an integer from 6 to 11. In some non- limiting embodiments, an expression vector system may include the nucleotide sequence NNNNRRRRRRNNNNNN. In some embodiment, an RRBS may optionally include a translational initiation site. In other embodiments, a translational initiation site may be included in the user-provided gene of interest.
[0032] In some embodiments, an expression vector system may optionally include or more cloning sites positioned between the RRBS and the stop codon context element. The cloning sites may be adapted or selected to facilitate the introduction of a user-provided or defined gene of interest into the expression vector. The optional cloning sites will preferably enable a user to introduce the gene of interest so that the gene forms an open reading frame with the stop codon context element and the portion of a gene encoding a reporter protein. In some embodiments, the expression vector system may optionally be adapted for blunt-end cloning of a user-provided or defined cDNA between the RRBS and the stop codon context element. In other optional and non-limiting embodiments, an expression vector system may be adapted for TOPO®-cloning, for GATEWAY® Cloning or for TOPO® GATEWAY® cloning.
[0033] In some embodiments, and expression vector system may optionally include a nucleotide sequence encoding a Tag fusion protein. The nucleotide sequence encoding a Tag fusion protein may be in-frame with the stop codon context element and the portion of the gene encoding a reporter protein. Exemplary though non- limiting Tag-fusion proteins contemplated for use with the embodiments disclosed herein may include, though are not limited to, HIS6, HIS8, fflSio, MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc. In certain preferred though non- limiting embodiments, a Tag fusion protein may include one or more of HIS6, HISs, HISio, MYC, FLAG, GST, MBP and HA. Most preferably, a Tag fusion protein is one or more of HIS6, HISs and HISio-
[0034] In an embodiment, an expression vector system may include a stop codon context element. The stop codon context element may be selected such that up to about 10% of a protein, up to about 8% of a protein, up to about 5% of a protein, up to about 2% of a protein, up to about 1 % of a protein, up to about 0.5% of a protein, up to about 0.2% of a protein, or up to about 0.1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein. In some embodiments, the stop codon context element may be selected such that between about 1% to about 10% of a protein, between about 0. 5% to about 5% of a protein, between about 0.05% to about 0.5% of a protein, between about 0.01% to about 0.1% of a protein, or between about 0.01 % to about 1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
[0035] In some embodiments, the nucleotide sequence of a stop codon context element for use in the embodiments described herein may be selected from the list consisting of the nucleotide sequences TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10%, up to about 5%, up to about 2%, up to about 1 %, up to about 0.5%, up to about 0.2%, or up to about 0.1% or between about 1% to about 10%, between about 0.5% to about 5%, between about 0.05% to about 0.5%, between about 0.01 % to about 0.1 %, or between about 0.01 % to about 1 % suppression of the stop codon. In certain exemplary though non-limiting embodiments, the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT. In certain preferred though non-limiting
embodiments, the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
[0036] In some embodiments, an expression vector system may include at least a portion of a gene encoding a reporter protein. The reporter protein will be a fusion protein with the gene of interest and will be in-frame with the stop codon context element. In some embodiments, the reporter protein encoded by the gene may be a fluorescent protein or a fragment thereof, such as, e.g., GFP, RFP, YFP, or a functional derivative thereof. In some preferred though non- limiting embodiments, a reporter protein particularly suited for use with the present expression vector system may be β-galactosidase or a portion thereof, such as, e.g., the C-terminal portion of β-galactosidase, such as, e.g., the C-terminal 30 amino acids of β-galactosidase. In some embodiments, the portion of the gene encoding the reporter protein may include the nucleotide sequence
GGTGGCGACGACTCCTGGAC CCGTCAGTATCGGCGGAATTCCAGCTGAGCC :CG
GTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA, or a functional equivalent thereof.
[0037] In certain non-limiting embodiments, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may- include the steps of obtaining an expression vector, the expression vector including a promoter capable of driving transcription in a host cell, a random ribosomal binding site (RRBS) functionally linked to and positioned downstream from the promoter, a stop codon context element comprising a stop codon and at least one 3-nucleotide codon in frame with the stop codon, and at least a portion of a gene encoding a reporter protein downstream of and in- frame with the stop codon context element. Further steps may include inserting a gene of interest into the expression vector between the RRBS and the stop codon context element, and introducing the expression vector into a host cell, and culturing the host cell under conditions permissive to said host cell expressing the recombinant protein.
[0038] In an embodiment, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include inserting a gene of interest into the expression vector system so that the reading frame of the gene of interest is in- frame with the stop codon context element and the portion of the gene encoding a reporter protein. In some embodiments, the gene of interest that is inserted into the expression vector system, the stop codon context element, and the portion of the gene encoding the reporter protein form an open reading frame.
[0039] In an embodiment, the host cell that the expression vector system containing the gene of interest is inserted into is a eukaryotic cell. In alternate embodiments, the host cell that the expression vector system containing the gene of interest is inserted into is a prokaryotic cell, such as, e.g., an E. coli cell. The introduction of nucleic acids, including expression vectors, into eukaryotic and prokaryotic cells is a well-developed art and a variety of methods for doing so are well known to a fractioned possessing ordinary skill level in the art.
[0040] In an embodiment, the promoter of the expression vector system inserted into the host cell may be a eukaryotic promoter when the expression vector system is adapted for use in eukaryotic cells. Suitable eukaryotic promoters are known in the art and may include, though are not limited to, promoters such as CMV, MMTV, RSV and the like. Selecting a eukaryotic promoter for use in the present expression vector system is well within the purview of a practitioner having ordinary skill level in the art. In other embodiments, the promoter of the expression vector system inserted into the host cell may be a prokaryotic promoter when the expression vector system is adapted for use in prokaryotic cells. Suitable prokaryotic promoters are known in the art and may include, though are not limited to, promoters such as SP6, T7, T3 and PBAD (araBAD) and the like. Selecting a prokaryotic promoter for use in the present expression vector system is well within the purview of a practitioner having ordinary skill level in the art.
[0041] In an embodiment, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include may include proving an expression vector having an RRBS that forms all or at least a portion of the 5'-UTR of an mRNA transcript transcribed from the expression vector. The RRBS may generally include the nucleotide sequence N4R6Nx, where N is A, T, G, or C, where R is A or G, and where X is an integer from 6 to 11. In some non-limiting embodiments, an expression vector system may include the nucleotide sequence NNNNRRRRRRNNNNNN. In some embodiment, an RRBS may optionally include a translational initiation site. In other embodiments, a translational initiation site may be included in the user-provided gene of interest.
[0042] In some embodiments, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include optionally providing one or more cloning sites positioned between the RRBS and the stop codon context element. The cloning sites may be adapted or selected to facilitate the introduction of a user- provided or defined gene of interest into the expression vector. The optional cloning sites will preferably enable a user to introduce the gene of interest so that the gene forms an open reading frame with the stop codon context element and the portion of a gene encoding a reporter protein. In some embodiments the expression vector system may optionally be adapted for blunt-end cloning of a user-provided or defined cDNA between the RRBS and the stop codon context element. In other optional and non-limiting embodiments, an expression vector system may be adapted for TOPO®-cloning, for GATEWAY® Cloning or for TOPO® GATEWAY® cloning.
[0043] In some embodiments, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may optionally include providing a nucleotide sequence encoding a Tag fusion protein. The nucleotide sequence encoding a Tag fusion protein may be in-frame with the stop codon context element and the portion of the gene encoding a reporter protein. Exemplary though non- limiting Tag-fusion proteins contemplated for use with the embodiments disclosed herein may include, though are not limited to, HIS6, HIS8, HIS10, MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc. In certain preferred though non-limiting embodiments, a Tag fusion protein may include one or more of HIS6, HIS8, HIS 10, MYC, FLAG, GST, MBP and HA. Most preferably, a Tag fusion protein is one or more of HIS6, HIS8 and HISio-
[0044] In an embodiment, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include providing an expression vector system having a stop codon context element. The stop codon context element may be selected such that up to about 10% of a protein, up to about 8% of a protein, up to about 5% of a protein, up to about 2% of a protein, up to about 1% of a protein, up to about 0.5% of a protein, up to about 0.2% of a protein, or up to about 0.1 % of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein. In some embodiments, the stop codon context element may be selected such that between about 1% to about 10% of a protein, between about 0. 5% to about 5% of a protein, between about 0.05% to about 0.5% of a protein, between about 0.01% to about 0.1% of a protein, or between about 0.01% to about 1% of a protein translated from an mRNA produced in a cell using the expression vector system is expressed as a fusion protein with the reporter protein.
[0045] In some embodiments, the nucleotide sequence of a stop codon context element for use in the embodiments described herein may be selected from the list consisting of the nucleotide sequences TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10%, up to about 5%, up to about 2%, up to about 1 %, up to about 0.5%, up to about 0.2%, or up to about 0.1% or between about 1% to about 10%, between about 0.5% to about 5%, between about 0.05% to about 0.5%, between about 0.01 % to about 0.1 %, or between about 0.01 % to about 1 % suppression of the stop codon. In certain exemplary though non-limiting embodiments, the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT. In certain preferred though non-limiting
embodiments, the nucleotide sequence of a stop codon context element may be selected from the list of nucleotide sequences consisting of TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
[0046] In some embodiments, methods for producing a recombinant protein in a host cell using an expression vector system as described herein may include providing an expression vector system having at least a portion of a gene encoding a reporter protein. The reporter protein will be a fusion protein with the gene of interest and will be in-frame with the stop codon context element. In some embodiments, the reporter protein encoded by the gene may be a fluorescent protein or a fragment thereof, such as, e.g., GFP, RFP, YFP, or a functional derivative thereof. In some preferred though non-limiting embodiments, a reporter protein particularly suited for use with the present expression vector system may be β- galactosidase or a portion thereof, such as, e.g., the C-terminal portion of β-galactosidase, such as, e.g., the C-terminal 30 amino acids of β-galactosidase. In some embodiments, the portion of the gene encoding the reporter protein may include the nucleotide sequence
GGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCG GTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA, or a functional equivalent thereof.
[0047] An exemplary expression vector system in accordance with a preferred though non- limiting embodiment will be described in detail. It will be understood by those skilled in the art however, that the following description is merely for illustrative purposes only, and is not meant to unduly limit the scope of the invention solely to those specific embodiments described below. On the contrary, it will be readily apparent to those having ordinary skill level in the art that a variety of other embodiments not specifically described herein but which are within the purview of the skilled artisan without undue experimentation likewise fall within the scope of the present disclosure. Additionally, a number of elements described in the following embodiment may be considered optional only and are not necessarily required to practice the invention. Likewise, additional embodiments not specifically described below but which will readily apparent to those skilled in art without undue experimentation also fall within the spirit and scope of the invention.
[0048] Turning to FIG. 1, an expression vector system in accordance with the embodiments described herein may include a vector backbone. Any suitable vector backbone can be used in the practice of the present invention without limitation. Optionally a eukaryotic expression vector may be used, although specific embodiments described herein are directed to prokaryotic expression vectors. Preferably, the vector used will be optimized for expression and/or propagation in a host cell. In certain exemplary though non-limiting, an expression vector system in accordance with the presently described embodiments may be derived from a commercially available expression vector, such as, e.g., the pBad expression vector available from Life Technologies. In some embodiments, a suitable vector backbone will include, in additional to sepcviofc elements described here, one or more additional elements commonly associated with expression vectors. For example, a vector backbone mat optionally include at least one selectable marker (not shown in FIG. 1), preferably more than one (e.g., Amp and/or Tet and/or Cam and/or araC). Optionally, a vector backbone may include at least one origin of replication (e.g., pBR322 ori). Optionally, the vector may contain a multi-cloning site.
Alternatively, the vector may be optimized for Topo-cloning, blunt end cloning, Gateway® cloning, or any other cloning system optimized or otherwise recognized by those skilled in the art as being capable of allowing the insertion of a gene or a gene fragment into an expression vector for the purpose of transcribing a gene and translating a protein from an open reading frame.
[0049] Returning to FIG. 1 , an expression vector system according to some embodiments may include a promoter suitable for driving expression of a gene of interest. In embodiments where a eukaryotic expression vector is used, a suitable eukaryotic promoter will be employed. A variety of eukaryotic promoters are known in the art, and any may be used in the practice of the invention without limitation. Strong, moderate or weak promoters are acceptable. In embodiments where a prokaryotic expression vector is used, a suitable bacterial promoter will be employed. A variety of prokaryotic promoters are known in the art, and any may be used in the practice of the invention without limitation. Exemplary bacterial promoters may include, e.g., T7, T3, SP6, PBAD (arciBAD) promoter etc.
[0050] In some preferred embodiments, an expression vector system as provided for herein may include a "random ribosomal binding site" (RRBS). In an embodiment, an expression vector system may be provided to a user as a vector library. Typically, the RRBS is a random region of variable length within the 5'UTR region of the gene of interest. The RRBS is designed to select clones that exhibit enhanced (or "optimized") translation. Those clones having an RRBS sequence that promotes enhanced translation of the GOI will be selected based on color (or other) indicia that demonstrate elevated translation (e.g., higher levels of omega-complementation result in more intensely blue colonies. These will be selected as high expressers. Conversely, clones expressing low or intermediate amounts of protein may be selected if desired. The RRBS will generally contain at least the following elements: N4R6Nx; where N is A, T, G or C, R is a purine (A or G) and X is an integer from 6 to 11. Optionally a translational start codon may be included at the 3' end of the RRBS. Optionally, a translational start codon may be included immediately following the RRBS. Optionally, no start codon may be used as it may be provided as part of the user supplied Gene of Interest (GOI). The GOI may be prepared as a restriction fragment, a synthetic polynucleotide, a PCR fragment, or the like.
[0051] In some embodiments, an expression vector system may optionally contain a multiple cloning site. Optionally the vector may be adapted to facilitate blunt-end cloning, Topo- cloning, Gateway cloning, or the like. The expression vector will be adapted to allow a user to easily insert the GOI.
[0052] Downstream of the site in the vector where the GOI inserted, the vector may optionally contain a tag used for affinity purification, e.g., HIS6, MYC, FLAG etc. The tag will be in- frame with the GOI.
[0053] Downstream of the optional tag fusion (or the GOI if the tag is absent) is an in-frame stop codon (preferably amber stop TAG, but it could be any of the three stop codons) followed by a 3 nucleotide "context codon". The context codon is selected to make "leakiness" more permissive and "fine-tuned". Any of the three stop codons can be used, and using routine experimentation and optimized "context codon" can be found that permits the desired leakiness in the context of the stop codon and the strain of bacteria used. Context codons may be selected from the following High to Low
GAT>GCT>CGC>GTT/AAT/ACT>GAG>ATA>CAT/CGT>CCT>TAT/TCT>ATT. TAT or ATA w selected for the commercial embodiment for low read-through. In the case of co- complementation ATA was used because it is more permissive. E. coli strains have some natural ability for read through, but selecting the proper context codon can fine-tune read- through ability. With TAGATA, TOP10, DH5a and ϋΗΙΟβ seem to work well.
[0054] If-frame with the 2 codon "leaky" stop is a detectable reporter fusion. The fusion could be anything that is easily detectable in a culture or in colonies growing on plates. E.g., could be a fluorescent protein (GFR, RFP etc), lacZ or a mutant. In this case, we selected a short fusion of the C-terminal extremity of LacZ (namely LacZ Ct-term 30 amino acids that can co- complement in E coli that are LacZ3'A. NB, the host cell must be able to express the reporter properly, especially in the case of lacZCT. co-complementation can only work in the appropriate host cell that has had endogenous or full-length LacZ knocked out and replaced with LacZAC. In this specific embodiment, the vector reporter fusion sequence is
GGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCG GTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA [0055] The following non-limiting examples are provided purely by way of illustration of exemplary embodiments, and in no way limit the scope and spirit of the present invention described above. Furthermore, it is to be understood that any inventions disclosed or claimed herein encompass all variations, combinations, and permutations of any one or more features described herein. Any one or more features may be explicitly excluded from the claims even if the specific exclusion is not set forth explicitly herein. It should also be understood that disclosure of a reagent for use in a method is intended to be synonymous with (and provide support for) that method involving the use of that reagent, according either to the specific methods disclosed herein, or other methods known in the art unless one of ordinary skill in the art would understand otherwise. In addition, where the specification and/or claims disclose a method, any one or more of the reagents disclosed herein may be used in the method, unless one of ordinary skill in the art would understand otherwise.
EXAMPLES
EXAMPLE 1:
Plasmids:
[0056] To construct the Random Ribsomal Element (RRE) vector library, a pBAD TOPO vector (Life Technologies) was re-circularized and digested with PME1 and BSA XI (New England Biolabs) to remove the ribosomal binding site, V5 epitope and TGA stop codon (Seq. 1). A gene of interest (CPm) insert with an XHO I restriction site, 6-Histidine tag, TAGATA sequence and LacZ omega fragment (Seq. 2) at the C-terminal was cloned into Seq. 1 using GeneArt seamless cloning (Life Technologies). The resulting plasmid,pBAD-CPm E,was used as a template for generating the linear RRE vector library with XHO I and NCO I ends (Ylxn) using PCRwith pBAD XHOl forward primer,RBS NCO 1 reverse primer (Table 1) and Phusion DNA polymerase (New England Biolabs). The resulting PCR product, Ylxn, was digested with NCO I and XHO I (New England Biolabs) and treated with Calf Intestinal Phosphatase (Life Technologies) to create the final linear library, Yl. To create the expression constructs, YlCPm, CPm, aCPm insert with NCO I and XHO I ends (Seq. 3) was ligated into Yl using ExpressLink T4 DNA ligase (Life Technologies). The complementation plasmid, LacZ Δ30, was generated by inserting an N-terminal fragment of Lac-Z (Seq. 4) between the NCO I, XHO I restriction sites in the pACYCDuet-1 vector (Novagen).
Transformation and Expression:
[0057] To screen for expression, YlCPmand LacZ Δ30 were electroporated into a ToplO strain (Life Technologies). The transformation was spread on Luria broth (LB) agar plates supplemented with lOOug/ml ampicillin (amp), 20ug/ml chloramphenicol (cm), 0.1 arabinose and 40ug/ml 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal) and grown overnight at 37°C. After 18 hours, dark blue colonies were picked and grown in 1ml cultures of LB supplemented with lOOug/ml ampicillin. For expression a 1 :100 dilution of one of the LB cultures was used to inoculate a new 1ml LB /100ug/ml amp culture, which was grown to an A600 OD of 0.8 then induced with 0.02 % arabinose overnight at 37°C.
Ni-NTA Purification and Gel Analysis:
[0058] For purification of CPm, 100 ul of 10X FastBreak Cell Lysis Reagent (Promega) /Ni- NTA agarose (Life Technologies) slurry was added to the expression culture from above. The solution was incubated 1 hour at 4°C on a circular rotator. The agarose beads were pelleted at 3,000 X g for 1 minute, and the pellet washed twice with 1 X phosphate buffered saline (PBS), pH 7.4. CPm protein was eluted from the beads with 300 mM imidazole in 1 X PBS. Elution fractions were analyzed on a NuPAGE 4-12% Bis-Tris gel (Life Technologies) stained by Simply Blue Coomassie solution (Life Technologies).
[0059]
Table 1 - Primers
Figure imgf000017_0001
Sequence of pBAD-TOPO BSA XI/PME I digested fragment
[0060] TAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATT
AAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCT
GACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGA
GTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTG
TTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCA
ACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCAT
CCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATT
CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAA
ACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTC
AACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTT
CTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTAT
TCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGA
GAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGA
GGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAA CCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACG TTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAG GCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCT GGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATC GTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGT GCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAA CTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAA CGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTT TTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGAT CAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTT CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTA ATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAG GCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAAC GCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCG TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG CCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAG CGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGT ACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGG CTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTT ACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCG CGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAG CAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACA ACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGC ATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAG GCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGC TAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGC TGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTAT CCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTA TCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGA AATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCC ATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGAC GACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTC CCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTC GGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAA ACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAG AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAA CCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGC GTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCT ATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTG TTTCTCCATACCCGTTT
Sequence of CPm insert followed by Xhol, a 6X Histidine tag, TAGATA and LacZ 3' fragment - omega fragment.
[0061] ACTGTTTCTCCATACCCGTTTCAGGAGGAGAGGAGAGATATGAGTGTGATCGCTAAACAAAT
GACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGG
AAAGCCTTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGCGGACCTCTGCCATTTGCTTG GGATATTTTATCACCACAGTGTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGA CTATGTGAAGCAGTCATTCCCGGAGGGCTATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGT GTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACCATGTCAAGTTCTCTGGTTT GAACTTTCCTCCCAATGGACCTGTCATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCT CATTGCACGAGATGGAATGCTGCTAGGAAACAACTTTATGGCTCTGAAGTTAGAAGGAGGCGGTCACTA TTTGTGTGAATTCAAAACTACTTACAAGGCAAAGAAGCCTGTGGAGATGCCAGGGTATCACTATGTTGA CCGCAAACTGGATGTAACCAATCACAACAAGGATTACACTTCGGTTGAGCTGTGTGAAATTTCCATTGC ACGCAAACCTGTGGTCGCCCTCGAGCATCACCACCATCACCATTAGATAGATAGCGACGACTCCTGGAG CCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAA ATAATAA
Sequence of Ncol/spacer followed by CPm and Xhol.
[0062] CCATGGGGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAAT
GGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAAGCTC
ACTGTCACCAAGGGCGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACAGTGTCAGTACGGAAGC
ATACCATTCACCAAGTACCCTGAAGACATCCCTGACTATGTGAAGCAGTCATTCCCGGAGGGCTATACA
TGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGC
AACTGTTTCATCTACCATGTCAAGTTCTCTGGTTTGAACTTTCCTCCCAATGGACCTGTCATGCAGAAG
AAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCATTGCACGAGATGGAATGCTGCTAGGAAACAAC
TTTATGGCTCTGAAGTTAGAAGGAGGCGGTCACTATTTGTGTGAATTCAAAACTACTTACAAGGCAAAG
AAGCCTGTGGAGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAATCACAACAAGGAT
TACACTTCGGTTGAGCTGTGTGAAATTTCCATTGCACGCAAACCTGTGGTCGCCCTCGAG
Sequence of the N-terminal fragment of Lac-Z
[0063] ATGATAGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAA TCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTC CCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGTACCAGAAGCGGTGCCGGA AAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGG TTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGA GAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCG AATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCA GGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGT GATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTT CCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAA TGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACG GGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAAT TATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTG GAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGA AGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAA GCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCA GACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCC GAACCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGA AACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACG CGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATC AGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCA GTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGA AGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCG CCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCA GGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAA ATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCA GTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCA GCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCA TAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCC TCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGG GCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAG CGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCC GCATCTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCA GTCAGGCTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTT CACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGT CGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACT TGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCG GAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATAC ACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGG ATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATT GTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAA TTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGAT GGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATAT GGGGATTGGTG
[0064] While certain preferred though non-limiting embodiments of the present invention have been and described and exemplified herein, it will be readily apparent to those having ordinary skill level in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the spirit and the scope of the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

CLAIMS What is claimed is:
1. An expression vector comprising: a promoter capable of driving transcription in a host cell;
a random ribosomal binding site (RRBS) functionally linked to and positioned
downstream from the promoter;
a stop codon context element comprising a stop codon and at least onel 3 -nucleotide codon in frame with the stop codon; and
at least a portion of a gene encoding a reporter protein downstream of and in-frame with the stop codon context element.
2. The expression vector according to claim 1 , wherein the expression vector comprises a gene of interest inserted between the RRBS and the stop codon context element.
3. The expression vector according to claim 2, wherein the gene of interest is in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
4. The expression vector of claim 2, wherein the gene of interest, the stop codon context element and the portion of the gene encoding the reporter protein form an open reading frame.
5. The expression vector according to claim 3, therein the gene of interest forms an open reading frame with the stop codon contect element and the
6. The expression vector according to claim 1, wherein the expression vector is capable of driving the expression of a gene of interest in a host cell.
7. The expression vector according to claim 2, wherein the host cell is a eukaryotic cell.
8. The expression vector according to claim 2, wherein the host cell is a prokaryotic cell.
9. The expression vector according to claim 1, wherein the promoter is a eukaryotic
promoter.
10. The expression vector according to claim 1, wherein the promoter is a prokaryotic promoter.
1. The expression vector according to claim 10, wherein the prokaryotic promoter is selected from the list consisting of SP6, T7, T3 and PBAD (araBAD).
The expression vector according to claim 1 , wherein the expression vector is adapted to accept a gene of interest cloned into the vector between the RRBS and the stop codon context element.
The expression vector according to claim 1, wherein the RRBS forms at least a portion of the 5'-UTR of an mRNA transcript transcribed from the expression vector.
The expression vector according to claim 1, wherein the RRBS comprises the nucleotide sequence N4R6Nx, where N is A, T, G, or C, where R is A or G, and where X is an integer from 6 to 11.
The expression vector according to claim 14, wherein the RRBS comprises the nucleotide sequence NNNNRRRRRRNNNNNN.
The expression vector according to claim 1, wherein the RRBS comprises a translational initiation site.
The expression vector according to claim 2, wherein the gene of interest comprises a translational initiation site.
The expression vector according to claim 1 , wherein the expression vector comprises one or more cloning sites positioned between the RRBS and the stop codon context element.
The expression vector according to claim 1 , wherein the expression vector is adapted for blunt-end cloning of a cDNA between the RRBS and the stop codon context element.
The expression vector according to claim 1, wherein the expression vector is adapted for TOPO®-cloning.
The expression vector according to claim 1, wherein the expression vector is adapted for GATEWAY® Cloning.
The expression vector according to claim 1, wherein the expression vector comprises a nucleotide sequence encoding a Tag fusion protein.
23. The expression vector according to claim 22, wherein the nucleotide sequence encoding the Tag fusion protein is in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
24. The expression vector according to claim 22, wherein the tag fusion protein is selected from the list consisting of HIS6, HIS8, HISio, MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc.
25. The expression vector according to claim 22, wherein the tag fusion protein is selected from the list consisting of HIS6, HIS8, HIS10, MYC, FLAG, GST, MBP and HA.
26. The expression vector according to claim 22, wherein the tag fusion protein is selected from the list consisting of HIS6, HISs and HISio-
27. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 10% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
28. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 8% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
29. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
30. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 2% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
31. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
32. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 0.5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
33. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 0.2% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
34. The expression vector according to claim 1, wherein the stop codon context element is selected such that up to about 0.1 % of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
35. The expression vector according to claim 1, wherein the stop codon context element is selected such that between about 0.05% to about 0.5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
36. The expression vector according to claim 1, wherein the stop codon context element is selected such that between about 0.01% to about 0.1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
37. The expression vector according to claim 1, wherein the stop codon context element is selected such that between about 0.01% to about 1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
38. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10% suppression of the stop codon.
39. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 5% suppression of the stop codon.
40. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 2% suppression of the stop codon.
41. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 1% suppression of the stop codon.
42. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 0.5% suppression of the stop codon.
43. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 0.1% suppression of the stop codon.
44. The expression vector according to claim 1 , wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
45. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
46. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGATA.
47. The expression vector according to claim 1, wherein the stop codon context element comprises the nucleotide sequence TAGTAT.
48. The expression vector according to claim 1, wherein the gene encoding the reporter protein is a gene encoding at least a portion of a fluorescent protein.
49. The expression vector of claim 48, wherein the fluorescent protein is GFP, RFP, YFP, or a functional derivative thereof.
50. The expression vector according to claim 1, wherein the gene encoding the reporter protein is a gene encoding at least a portion of β-galactosidase.
51. The expression vector according to claim 1, wherein the gene encoding the reporter protein is a gene encoding the C-terminal portion of β-galactosidase.
52. The expression vector according to claim 1, wherein the gene encoding the reporter protein is a gene encoding the C-terminal 30 amino acids of β-galactosidase.
53. The expression vector according to claim 1, wherein the gene encoding the reporter protein comprises the nucleotide sequence
GGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAG
CGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA, or a functional equivalent thereof.
54. A method for producing a recombinant protein in a host cell, said method
comprising: obtaining an expression vector comprising:
a promoter capable of driving transcription in a host cell;
a random ribosomal binding site (RRBS) functionally linked to and positioned downstream from the promoter;
a stop codon context element comprising a stop codon and at least one 3- nucleotide codon in frame with the stop codon; and at least a portion of a gene encoding a reporter protein downstream of and in- frame with the stop codon context element;
inserting a gene of interest into the expression vector;
introducing the expression vector into a host cell; and
culturing the host cell under conditions permissive to said host cell expressing the recombinant protein.
55. The method according to claim 54, wherein said gene of interest is inserted between the RRBS and the stop codon context element.
56. The method according to claim 54, wherein said gene of interest is in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
57. The method according to claim 54, wherein the gene of interest, the stop codon context element and the portion of the gene encoding the reporter protein form an open reading frame.
58. The method according to claim 54, wherein the host cell is a eukaryotic cell.
59. The method according to claim 54, wherein the host cell is a prokaryotic cell.
60. The method according to claim 54, wherein the host cell is an E. coli cell.
61. The method according to claim 54, wherein the promoter is a eukaryotic promoter.
62. The method according to claim 54, wherein the promoter is a prokaryotic promoter.
63. The method according to claim 62, wherein the prokaryotic promoter is selected from the list consisting of SP6, T7, T3 and PBAD (araBAD).
64. The method according to claim 54, wherein the RRBS forms at least a portion of the 5'- UTR of an mRNA transcript transcribed from the expression vector.
65. The method according to claim 54, wherein the RRBS comprises the nucleotide
sequence N4R6Nx, where N is A, T, G, or C, where R is A or G, and where x is an integer from 6 to 11.
66. The method according to claim 54, wherein the RRBS comprises the nucleotide
sequence NNNNRRRRRRNNNNNN.
67. The method according to claim 54, wherein the RRBS comprises a translational
initiation site.
68. The method according to claim 54, wherein the gene of interest comprises a
translational initiation site.
69. The method according to claim 54, wherein the expression vector comprises one or more cloning sites positioned between the RRBS and the stop codon context element.
70. The method according to claim 54, wherein the expression vector is adapted for blunt- end cloning of a cDNA between the RRBS and the stop codon context element.
71. The method according to claim 54, wherein the expression vector is adapted for
TOPO®-cloning.
72. The method according to claim 54, wherein the expression vector is adapted for
GATEWAY® Cloning.
73. The method according to claim 54, wherein the expression vector comprises a nucleotide sequence encoding a Tag fusion protein.
74. The method according to claim 73, wherein the nucleotide sequence encoding the Tag fusion protein is in-frame with the stop codon context element and the portion of the gene encoding a reporter protein.
75. The method according to claim 73, wherein the tag fusion protein is selected from the list consisting of HIS6, HIS8, fflSio, MYC, FLAG, T7 Tag, GST, MBP, HA, S-Tag, V5 Epitope, Pel B, Xpress Epitope, NusA, CBP, GFP, Trx, Mistic, Sumo and DSCBc.
76. The method according to claim 73, wherein the tag fusion protein is selected from the list consisting of HIS6, HIS8, fflSio, MYC, FLAG, GST, MBP and HA.
77. The method according to claim 73, wherein the tag fusion protein is selected from the list consisting of HIS6, HISs and HISio-
78. The method according to claim 54, wherein the stop codon context element is selected such that up to about 10% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
79. The method according to claim 54, wherein the stop codon context element is selected such that up to about 8% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
80. The method according to claim 54, wherein the stop codon context element is selected such that up to about 5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
81. The method according to claim 54, wherein the stop codon context element is selected such that up to about 2% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
82. The method according to claim 54, wherein the stop codon context element is selected such that up to about 1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
83. The method according to claim 54, wherein the stop codon context element is selected such that up to about 0.5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
84. The method according to claim 54, wherein the stop codon context element is selected such that up to about 0.2% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
85. The method according to claim 54, wherein the stop codon context element is selected such that up to about 0.1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
86. The method according to claim 54, wherein the stop codon context element is selected such that between about 0.05% to about 0.5% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
87. The method according to claim 54, wherein the stop codon context element is selected such that between about 0.01% to about 0.1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
88. The method according to claim 54, wherein the stop codon context element is selected such that between about 0.01% to about 1% of a protein expressed from the expression vector is expressed as a fusion protein with the reporter protein.
89. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 10% suppression of the stop codon.
90. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 5% suppression of the stop codon.
91. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 2% suppression of the stop codon.
92. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 1% suppression of the stop codon.
93. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 0.5% suppression of the stop codon.
94. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected to allow up to about 0.1% suppression of the stop codon.
95. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from the list consisting of GAT, GCT, CGC, GTT, AAT, ACT, GAG, ATA, CAT, CGT, CCT, TAT, TCT, and ATT.
96. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGNNN, TAANNN or TGANNN, where N is A, T, G or C, and the nucleotide sequence NNN is selected from either TAT or ATA.
97. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGATA.
98. The method according to claim 54, wherein the stop codon context element comprises the nucleotide sequence TAGTAT.
99. The method according to claim 54, wherein the gene encoding the reporter protein is a gene encoding at least a portion of a fluorescent protein.
100. The method according to claim 99, wherein the fluorescent protein is GFP, RFP, YFP, or a functional derivative thereof.
101. The method according to claim 54, wherein the gene encoding the reporter protein is a gene encoding at least a portion of β-galactosidase.
102. The method according to claim 54, wherein the gene encoding the reporter protein is a gene encoding the C-terminal portion of β-galactosidase.
103. The method according to claim 54, wherein the gene encoding the reporter protein is a gene encoding the C-terminal 30 amino acids of β-galactosidase.
104. The method according to claim 54, wherein the gene encoding the reporter protein comprises the nucleotide sequence
GGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAG CGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA, or a functional equivalent thereof.
PCT/US2013/066204 2012-10-22 2013-10-22 System and method for visualization of optimized protein expression Ceased WO2014066404A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/437,317 US20150267209A1 (en) 2012-10-22 2013-10-22 System and Method for Visualization of Optimized Protein Expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261716951P 2012-10-22 2012-10-22
US61/716,951 2012-10-22

Publications (2)

Publication Number Publication Date
WO2014066404A2 true WO2014066404A2 (en) 2014-05-01
WO2014066404A3 WO2014066404A3 (en) 2014-08-07

Family

ID=49519129

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/066204 Ceased WO2014066404A2 (en) 2012-10-22 2013-10-22 System and method for visualization of optimized protein expression

Country Status (2)

Country Link
US (1) US20150267209A1 (en)
WO (1) WO2014066404A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021229473A1 (en) * 2020-05-14 2021-11-18 Glaxosmithkline Biologicals Sa Viral biosensors

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114822700B (en) * 2022-04-25 2023-02-17 至本医疗科技(上海)有限公司 Methods, devices and media for presenting rearranged or fused structural subtypes

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5846531A (en) * 1990-03-21 1998-12-08 University Of Maryland Marine mela gene
CA2068190C (en) * 1991-05-15 1996-12-17 Microgenics Corporation Methods and compositions for enzyme complementation assays using the omega region of beta-galactosidase
WO2003014361A1 (en) * 2001-08-02 2003-02-20 Altana Pharma Ag Novel recombinant gene expression method by stop codon suppression
DK1716233T3 (en) * 2004-01-30 2009-10-26 Maxygen Holdings Ltd Regulated stop codon readout
US20100093563A1 (en) * 2008-09-22 2010-04-15 Robert Anthony Williamson Methods and vectors for display of molecules and displayed molecules and collections

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021229473A1 (en) * 2020-05-14 2021-11-18 Glaxosmithkline Biologicals Sa Viral biosensors

Also Published As

Publication number Publication date
WO2014066404A3 (en) 2014-08-07
US20150267209A1 (en) 2015-09-24

Similar Documents

Publication Publication Date Title
Guan et al. Construction and development of an auto-regulatory gene expression system in Bacillus subtilis
DK2689015T3 (en) A process for the production of secreted polypeptides
Lee Development and characterization of expression vectors for Corynebacterium glutamicum
US10435716B2 (en) Hybrid proteins and uses thereof
WO2017176347A9 (en) Pathway integration and expression in host cells
Ferino et al. A promoter-probe vector-host system for the cyanobacterium, Synechocystis PCC6803
EP3503915A1 (en) Genetically engineered vibrio sp. and uses thereof
WO2014066404A2 (en) System and method for visualization of optimized protein expression
WO2019140328A1 (en) Recombination systems for high-throughput chromosomal engineering of bacteria
WO2024058155A1 (en) Double stranded circular dna vector, method for producing linear covalently closed dna, and fusion polypeptide containing protelomerase and endonuclease
JP6871544B2 (en) How to Produce a DNA Vector from a Molecular Component Containing a Sequence of Interest
SG178293A1 (en) Fermentation process
CN118374547A (en) A kind of non-antibiotic microplasmid and its preparation method and application
US10351890B2 (en) Method for preparing recombinant proteins through reduction of rnpA gene expression
CN106676125A (en) Maltose promoter-containing carrier and maltose promoter mutant
ES2758096T3 (en) Sensors for the detection and quantification of microbiological protein secretion
EP3083965B1 (en) A process for production of a protein of interest in a microbial host organism
US9284565B2 (en) Bacterial expression plasmid
TWI567197B (en) Expression element, expression cassette, and vector containing the same
US10876109B2 (en) Methods of identifying biologically active random peptides in prokaryotic cells and libraries of prokaryotic cells expressing candidate biologically active random peptides
PL216037B1 (en) Expression cassette, vector, host cell, the manner of obtaining polypeptide and application
KR101717214B1 (en) Method of Cell Surface Display of Enzyme Complex
WO2026090424A2 (en) Compositions and methods for microbial self-selection
WO2022269557A1 (en) Recombinant algae and production of spider silk protein from the recombinant algae
Cho et al. Cell-free synthesis of fluorescent proteins using ExiProgen™ automated protein synthesis system

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13786377

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 14437317

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 13786377

Country of ref document: EP

Kind code of ref document: A2