WO2014064237A1 - Abd binding polypeptide - Google Patents
Abd binding polypeptide Download PDFInfo
- Publication number
- WO2014064237A1 WO2014064237A1 PCT/EP2013/072359 EP2013072359W WO2014064237A1 WO 2014064237 A1 WO2014064237 A1 WO 2014064237A1 EP 2013072359 W EP2013072359 W EP 2013072359W WO 2014064237 A1 WO2014064237 A1 WO 2014064237A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- abd
- abd binding
- binding polypeptide
- polypeptide according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6827—Total protein determination, e.g. albumin in urine
Definitions
- This invention relates to polypeptides which bind to an albumin binding domain, ABD.
- the polypeptides have various industrial and pharmaceutical applications, for example use as an affinity ligand in separation technology or as a detection agent in molecular diagnostics.
- Serum albumin is the most abundant protein in mammalian sera (35-50 g/l, i.e. 0.53-0.75 mM, in humans) and several strategies to covalently couple a peptide or protein to carrier molecule that will allow in vivo association to serum albumin have been described e.g. in WO91/01743, in WO01/45746 and in Dennis et al (J Biol Chem 277:35035-43, 2002). WO91/01743 describes inter alia the use of albumin binding peptides or proteins derived from streptococcal protein G (SpG) for increasing the half-life of other proteins.
- SpG streptococcal protein G
- the idea is to fuse the bacterially derived, albumin binding peptide/protein to a therapeutically interesting peptide/protein, which has been shown to have a rapid elimination from blood.
- the generated fusion protein binds to serum albumin in vivo, and benefits from its longer half-life, which increases the net half-life of the fused therapeutically interesting peptide/protein.
- the half life of serum albumin is directly proportional to the size of the animal, where for example human serum albumin (HSA) has a half life of 19 days and rabbit serum albumin has a half life of about 5 days (McCurdy et al, J Lab Clin Med 143:1 15, 2004).
- Streptococcal protein G is a bi-functional receptor present on the surface of certain strains of streptococci and is capable of binding to both IgG and serum albumin (Bjorck et al, Mol Immunol 24:1 1 13, 1987).
- the structure is highly repetitive, with several structurally and functionally different domains (Guss et al, EMBO J 5:1567, 1986), more precisely three Ig-binding domains and three serum albumin binding domains (Olsson et al, Eur J Biochem 168:319, 1987).
- a 46 amino acid motif was defined as ABD (albumin binding c/omain) and has subsequently also been designated G148-GA3 (GA for protein G-related albumin binding and G148 from the strain of
- ABSD denotes these classes of albumin binding polypeptides, rather than a specified polypeptide with a specific amino acid sequence.
- a general strategy for purification of recombinantly expressed proteins would be to include a commonly used affinity tag such as a polyhistidine tag, a chitin binding protein (CBP), a maltose binding protein (MBP), a glutathione-S- transferase (GST)-tag or a FLAG-tag, and perform a classic affinity tag such as a polyhistidine tag, a chitin binding protein (CBP), a maltose binding protein (MBP), a glutathione-S- transferase (GST)-tag or a FLAG-tag, and perform a classic affinity tag such as a polyhistidine tag, a chitin binding protein (CBP), a maltose binding protein (MBP), a glutathione-S- transferase (GST)-tag or a FLAG-tag, and perform a classic affinity tag such as a polyhistidine tag, a chitin binding protein (CBP), a mal
- the end product must be homogeneous. Because the tag would need to be removed, e.g. by enzymatic or chemical cleavage, it is necessary to ensure complete cleavage to obtain a homogeneous product, or to suffer a loss of yield when removing incompletely cleaved product. Both of these issues serve to increase the production cost of the product. Therefore, a more motivated strategy would be to utilize the ABD moiety itself as a purification tag.
- albumin is a large natural carrier molecule with several interaction sites for different proteins, fatty acids, sterols, ions etc., and thus, the background binding of both specific and unspecific components may contaminate the recovered sample.
- recombinant human albumin has been developed, it is still expensive to include as an affinity ligand in large-scale production of therapeutics, in particular because it is incompatible with standard procedures for cleaning in place, that would have to be applied for the repeated use of the albumin- coupled matrix.
- harsher elution conditions may be required to recover molecules containing ABD variants with an exceptionally high affinity for albumin. Such conditions may be unfavorable also for the ABD-tagged molecule.
- Protein A from Staphylococcus aureus has long been used as an affinity ligand in the industrial production of monoclonal antibodies and Fc- fusion proteins, due to the native affinity of Protein A for the Fc portion of IgG. Protein A in its entirety, as well as the individual Fc-binding domains thereof, have subsequently served as starting points for the rational design of engineered affinity ligands with improved properties.
- For an introduction see the papers by Nord K and co-workers in Prot Eng (Nord et al, Prot Eng 8:601 - 608; 1995) and Nat Biotech (Nord et al, Nat Biotech 15:772-777; 1997). It is an object of the present disclosure to provide new ABD binding agents. It is moreover an object of the disclosure to provide new ABD binding agents for use in biotechnology for example in protein purification and separation applications. Description of the invention
- the disclosure provides an ABD binding polypeptide, comprising an ABD binding motif BM, which motif consists of an amino acid sequence selected from: i) EX 2 X3X 4 AX6X 7 EI X 10 X 1 1 LPNLXi 6 Xi 7 Xi8QX20 X21AFIX25X26LX28D wherein, independently from each other,
- X2 is selected from F, I and L;
- X 3 is selected from H, K, N, Q, R, S, T and V;
- X4 is selected from A, D, F, G, H, I, K, L, M, N, Q, R, S, T, V, W and Y;
- ⁇ is selected from F, I, L and Y;
- X 7 is selected from A, H, I, K, L, N, Q, R, S, T and V;
- X10 is selected from G, H, K, N, Q, R and S;
- X11 is selected from A, D, F, G, I, K, L, N, Q, R, S, T, V and Y;
- X16 is selected from N and T;
- Xi 7 is selected from F, H, L, S and T;
- X18 is selected from D, E, H, I, K, L, M, N, Q, R, S, T and V;
- X20 is selected from H, K and R;
- X21 is selected from I, L and V;
- X25 is selected from F, I, L, V and Y;
- X26 is selected from K and S;
- X28 is selected from D and E; and ⁇ ) an amino acid sequence which has at least 89 % identity to the
- ABD binding polypeptides corresponds to the target binding region of the parent scaffold, which region constitutes two alpha helices within a three- helical bundle protein domain.
- BM ABD binding motif
- the varied amino acid residues of the two BM helices constitute a binding surface for interaction with the constant Fc part of antibodies.
- the random variation of binding surface residues and subsequent selection of variants have replaced the Fc interaction capacity with a capacity for interaction with ABD.
- the ABD binding polypeptide disclosed herein exhibits a set of characteristics, which, for example when coupled to a solid support, makes it suitable as an affinity ligand for purification of molecules comprising ABD.
- the disclosed ABD binding polypeptide demonstrates the following advantages:
- the ABD binding polypeptide of the present disclosure may be useful at one or more of the different stages of purification. Thus, it may be used without limitation at either one or more of a first capture step, in any intermediate purification step or in a final polishing step.
- the skilled person will appreciate that successful purification of a target protein, using a resin comprising an ABD binding polypeptide according to the present disclosure may be achieved regardless of where in the target protein the ABD moiety is situated.
- the ABD moiety may be placed at the N- terminus or at the C-terminus of the target protein.
- the target protein may be a fusion protein which comprises an ABD moiety flanked by other protein moieties on both sides.
- ABSD refers to three-helix albumin binding domains from streptococcal protein G and their derivatives.
- “ABD” may refer to GA3-G148 (Johansson et al, supra, hereby incorporated by reference) or variants of GA3-G148 having improved affinity for albumin (WO2009/016043, hereby incorporated by reference), as well as high affinity variants with reduced immune stimulatory properties
- ABS denotes the classes of albumin binding
- polypeptides described in the referenced works rather than a specified polypeptide with a specific amino acid sequence.
- the function of any polypeptide is dependent on the tertiary structure of the polypeptide. It is therefore possible to make minor changes to the sequence of amino acids in a polypeptide without affecting the function thereof.
- the invention encompasses polypeptides comprising modified variants of the BM which are such that the resulting sequence is at least 89 % identical to a sequence defined by i).
- said modified variants of the BM are such that they are 93 % identical to a sequence defined by i).
- said BM variants are 96 % identical to a sequence defined by i).
- such changes may be made in all positions of the sequences of the ABD binding polypeptides as disclosed herein. In other embodiments, such changes may be made only in the non-variable positions, also denoted as scaffold amino acid residues. In such cases, changes are not allowed in the variable positions, i.e. positions denoted with an "X" in sequence i). For example, it is possible that an amino acid residue belonging to a certain functional grouping of amino acid residues (e.g. hydrophobic, hydrophilic, polar etc) could be exchanged for another amino acid residue from the same functional group.
- a certain functional grouping of amino acid residues e.g. hydrophobic, hydrophilic, polar etc
- % identity may be calculated as follows.
- the query sequence is aligned to the target sequence using the CLUSTAL W algorithm (Thompson et al, Nucleic Acids Research, 22: 4673- 4680 (1994)).
- a comparison is made over the window corresponding to the shortest of the aligned sequences.
- the shortest of the aligned sequences may in some instances be the target sequence. In other instances, the query sequence may constitute the shortest of the aligned sequences.
- the amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical correspondences in the target sequence is reported as % identity.
- X 2 in sequence i) is selected from F and L.
- X 2 in sequence i) is F.
- X 2 in sequence i) is L.
- X 3 in sequence i) is selected from H, K, R, T and
- X 3 in sequence i) is selected from H, K, R and V.
- X 3 in sequence i) is selected from H, K and V.
- X 3 in sequence i) is selected from K and R.
- X 3 in sequence i) is K.
- X 3 in sequence i) is R.
- X 3 in sequence i) is V.
- X4 in sequence i) is selected from A, H, I, L, N, V and W.
- X4 in sequence i) is selected from H, L, N and V.
- X4 in sequence i) is V.
- X4 in sequence i) is N.
- X4 in sequence i) is H.
- X4 in sequence i) is L.
- X4 in sequence i) is selected from A, L, N, V and w. In one embodinnent X4 in sequence i ) is selected from A, N, V and W.
- X4 in sequence i ) is selected from A, N and W.
- X 6 in sequence i ) is selected from F and L.
- X 6 in sequence i ) is F.
- X 6 in sequence i ) is L.
- X 7 in sequence i ) is selected from K, L, N, Q, R and S.
- X 7 in sequence i ) is selected from K, N, Q, R and
- X 7 in sequence i ) is selected from K, Q, R and S.
- X 7 in sequence i ) is selected from K and R.
- X 7 in sequence i ) is K.
- X 7 in sequence i ) is R.
- Xio in sequence i ) is selected from H, K, N, and F
- Xio in sequence i ) is selected from H, K and N.
- Xio in sequence i ) is selected from K, N and R.
- Xio in sequence i ) is selected from K and R.
- Xio in sequence i ) is N.
- Xio in sequence i ) is K.
- Xio in sequence i ) is R.
- Xio in sequence i ) is H.
- Xl 1 in sequence i ) is selected from A, F, L, R, T and Y.
- Xl 1 in sequence i ) is selected from A, F, T and Y.
- Xl 1 in sequence i ) is T.
- Xl 1 in sequence i ) is A.
- Xl 1 in sequence i ) is Y.
- Xl 1 in sequence i ) is F.
- Xl 1 in sequence i ) is selected from A, L, T and Y.
- Xl 1 in sequence i ) is selected from T and Y.
- Xl6 in sequence i ) is T.
- Xl 7 in sequence i ) is selected from F, H and L.
- Xl 7 in sequence i is selected from F and H. In one embodinnent Xl7 in sequence i ) is selected from H and L.
- Xl7 in sequence i ) is F.
- Xl7 in sequence i ) is H.
- Xl7 in sequence i ) is L.
- Xl8 in sequence i ) is selected from D, H, I, K ar ⁇
- Xl8 in sequence i ) is selected from D, H and Q
- Xl8 in sequence i ) is selected from H and Q.
- Xl8 in sequence i ) is H.
- Xl8 in sequence i ) is Q.
- Xl8 in sequence i ) is D.
- X20 in sequence i ) is selected from K and R.
- X20 in sequence i ) is selected from H and R.
- X20 in sequence i ) is R.
- X20 in sequence i ) is K.
- X21 in sequence i ) is selected from I and L.
- X21 in sequence i ) is I.
- X21 in sequence i ) is L.
- X25 in sequence i ) is selected from I, L and V.
- X25 in sequence i ) is selected from V and I.
- X25 in sequence i ) is I.
- X25 in sequence i ) is V.
- X25 in sequence i ) is L.
- X26 in sequence i ) is K.
- X28 in sequence i ) is D.
- sequence i) is defined as follows: independently from each other,
- X2 is selected from F and L;
- X3 is selected from H, K, R, T and V;
- X 4 is selected from A, H, I, L, N, V and W;
- Xe is selected from F and L;
- X 7 is selected from K, L, N, Q, R and S; ⁇ s selected from H, K, N, and R;
- Xl 1 s selected from A, F, L, R, T, and Y;
- Xl 7 s selected from F, H and L;
- Xl8 s selected from D, H, I, K and Q;
- X25 s selected from I, L and V;
- sequence i) is defined as follows: independently from each other,
- X2 is selected from F and L;
- Xs s selected from H, K, T and V;
- X4 s selected from H, L, N and V;
- X/ s selected from K, R, Q, and S;
- X10 s selected from H, K, and N;
- X11 s selected from A, F, T, and Y;
- Xl 7 s selected from F, H and L;
- Xl8 s selected from D, H and Q;
- X25 s selected from I, L and V;
- sequence i) fulfills at least four of the eight conditions l-VIII:
- X20 is selected from H and R
- V. X21 is selected from I and L;
- VI. X25 is selected from I and V;
- sequence i) fulfils at least five of the eight conditions l-VIII. More specifically, sequence i) may fulfill at least six of the eight conditions l-VIII, such at least seven of the eight conditions l-VIII, such as all of the eight conditions l-VIII.
- sequence i) fulfils at least five of the eight conditions l-VIII. More specifically, sequence i) may fulfill at least six of the eight conditions l-VIII, such at least seven of the eight conditions l-VIII, such as all of the eight conditions l-VIII.
- BM ABD binding motif
- sequence i) is selected from any one of SEQ ID NO:1 -52 . More specifically, sequence i) may be selected from any one of SEQ ID NO:1 -7, such as from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. In particular, sequence i) may be SEQ ID NO:1 .
- the BM as defined above "forms part of a three-helix bundle protein domain. This is understood to mean that the sequence of the BM is "inserted” into or “grafted” onto the sequence of the original three-helix bundle domain, such that the BM replaces a similar structural motif in the original domain.
- the BM is thought to constitute two of the three helices of a three-helix bundle, and can therefore replace such a two-helix motif within any three-helix bundle.
- the replacement of two helices of the three-helix bundle domain by the two BM helices has to be performed so as not to affect the basic structure of the polypeptide.
- the overall folding of the Ca backbone of the polypeptide according to this embodiment of the invention is substantially the same as that of the three-helix bundle protein domain of which it forms a part, e.g. having the same elements of secondary structure in the same order etc.
- a BM according to the invention "forms part" of a three-helix bundle domain if the polypeptide according to this embodiment of the invention has the same fold as the original domain, implying that the basic structural properties are shared, those properties e.g. resulting in similar CD spectra.
- the skilled person is aware of other parameters that are relevant.
- the ABD binding motif thus forms part of a three-helix bundle protein domain.
- the BM may essentially constitute two alpha helices with an interconnecting loop, within said three- helix bundle protein domain.
- said three-helix bundle protein domain is selected from domains of bacterial receptor proteins. Non-limiting examples of such domains are the five different three-helical domains of Protein A from Staphylococcus aureus, such as domain B, and derivatives thereof.
- the three-helical bundle protein domain is a variant of protein Z, which is derived from domain B of
- the ABD binding polypeptide of the invention forms part of a three-helix bundle protein domain
- polypeptide may comprise an amino acid sequence selected from: iii) K-[BM]-DPSQS X a X b LLX c EAKKL NDX d Q; wherein
- [BM] is an ABD binding motif as defined above;
- X a is selected from A and S;
- Xb is selected from N and E;
- X c is selected from A, S and C;
- X d is selected from A and S;
- sequence iv) has at least 83 %, such as at least 85 %, such as at least 87 %, such as at least 89 %, such as at least 91 %, such as at least 93 %, such as at least 95 %, such as at least 97 % identity to a sequence defined by iii).
- X a in sequence iii) is A. In an alternative embodiment, X a in sequence iii) is S.
- X b in sequence iii) is N.
- X b in sequence iii) is E.
- X c in sequence iii) is A. In an alternative embodiment, X c in sequence iii) is S. In yet another alternative embodiment, X c in sequence iii) is C.
- X d in sequence iii) is A.
- X d in sequence iii) is S.
- sequence iii) in the definition of ABD binding polypeptides above is selected from SEQ ID NO:53-104, in particular from SEQ ID NO:53-59.
- sequence iii) is selected from SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 and SEQ ID NO:56.
- sequence iii) may be SEQ ID NO:53.
- an ABD binding polypeptide as defined above which comprises an amino acid sequence selected from:
- [BM] is an ABD binding motif as defined above and X c is selected from S and C;
- an ABD binding polypeptide as defined above which comprises an amino acid sequence selected from: vii) YAK-[BM]-DPSQS SELLX C EAKKL NDAQA P;
- [BM] is an ABD binding motif as defined above and X c is selected from A and C;
- an ABD binding polypeptide as defined above which comprises an amino acid sequence selected from:
- [BM] is an ABD binding motif as defined above and X c is selected from A and C;
- x) an amino acid sequence which has at least 83 % identity to a sequence defined by ix).
- the ABD binding polypeptides as defined above may for example have a sequence which is at least 84 %, at least 86 %, at least 88 %, at least 90 %, at least 92 %, at least 94 %, at least 96 %, or at least 98 % identical to a sequence defined by v), vii) or ix).
- the ABD binding motif may form part of a polypeptide comprising an amino acid sequence selected from
- the ABD binding polypeptide comprises an amino acid sequence selected from:
- [BM] is an ABD binding motif as defined above;
- xii an amino acid sequence which has at least 84 % identity to the sequence defined in xi).
- the ABD binding polypeptides as defined above may for example have a sequence which is at least 86 %, at least 87 %, at least 89 %, at least 91 %, at least 93 %, at least 94 %, at least 96 %, or at least 98 % identical to the sequence defined by xi).
- Sequence xi) in such a polypeptide may be selected from any one of SEQ ID NO:105-156.
- sequence xi) may be selected from any one of SEQ ID NO:105-1 1 1 , such as selected from SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107 and SEQ ID NO:108.
- sequence xi) is SEQ ID NO:105.
- polypeptide of the invention may be in monomeric or multimeric forms.
- ABD binding is one embodiment of the present invention.
- polypeptide is present in multimeric form, comprising at least two ABD binding polypeptide monomer units, whose amino acid sequences may be the same or different.
- Multimeric forms of the polypeptide may be advantageous in that they may have enhanced binding properties.
- said ABD binding polypeptide monomer units are covalently coupled together.
- the ABD binding polypeptide monomer units are expressed as a fusion protein.
- polypeptides may be joined by covalent coupling using known organic chemistry methods, or expressed as one or more fusion polypeptides in a system for recombinant expression of polypeptides, or joined in any other fashion, either directly or via a linker, for example an amino acid linker.
- said ABD binding polypeptide is in dimeric form. Possible multimeric forms also include trimeric forms. Multimeric forms of the polypeptide may comprise a suitable number of polypeptide sequences as defined above.
- any ABD binding polypeptide disclosed herein may comprise further C-terminal and/or N-terminal amino acids.
- Such a polypeptide should be understood as a polypeptide having additional amino acid residues at the very first and/or the very last position in the polypeptide chain, i.e. at the N- and/or C-terminus.
- an ABD binding polypeptide may comprise any suitable number of additional amino acid residues, for example at least one additional amino acid residue. Each additional amino acid residue may individually or collectively be added in order to, for example, improve production,
- additional amino acid residues may comprise one or more amino acid residues added for the purpose of chemical coupling, which could for example allow coupling of the ABD binding polypeptide to a resin or matrix, for example a Sepharose-based resin or a SulfoLink coupling resin.
- a cysteine residue as an additional amino acid residue, or as one of a number of additional amino acid residues.
- the ABD binding polypeptide disclosed herein comprises a cysteine residue at the C-terminal end of the polypeptide, for example at the C-terminus.
- said cysteine is a part of a C-terminal additional tripeptide VDC.
- said cysteine is a lone C- terminal C.
- the ABD binding polypeptide comprises a dimer of two ABD binding domains as defined above, as well as a C-terminal cysteine residue.
- Such additional amino acid residues may also provide a "tag” for purification or detection of the polypeptide, such as a His6 tag or a "myc” (c- myc) tag or a "FLAG” tag for interaction with antibodies specific to the tag or immobilized metal affinity chromatography (IMAC) in the case of the His6-tag.
- a tag for purification or detection of the polypeptide, such as a His6 tag or a "myc” (c- myc) tag or a "FLAG” tag for interaction with antibodies specific to the tag or immobilized metal affinity chromatography (IMAC) in the case of the His6-tag.
- the further amino acids as discussed above may be coupled to the ABD binding polypeptide by means of chemical conjugation (using known organic chemistry methods) or by any other means, such as expression of the ABD binding polypeptide as a fusion protein.
- a polynucleotide encoding an ABD binding polypeptide as described above.
- An expression vector comprising such a polynucleotide may enable production of an ABD binding polypeptide, for example by expression in a host cell.
- Such tools for the expression of the ABD binding polypeptide disclosed herein are encompassed by the present disclosure, as well as methods using them for recombinant production of the ABD binding polypeptide.
- the detectable agent is selected from a fluorescent agent and a radioactive agent.
- Fluorescent detectable agents include fluorescent polypeptides, such as green fluorescent protein, red fluorescent protein, luciferase and variants thereof.
- Radioactive detectable agents useful in this context include for example radionuclides such as 3 H and 125 l.
- Figure 1 is a listing of the amino acid sequences of examples of ABD binding motifs comprised in ABD binding polypeptides of the invention (SEQ ID NO:1 -52), examples of 49-mer ABD binding polypeptides according to the invention (SEQ ID NO:53-104), examples of 58-mer ABD binding
- polypeptides according to the invention SEQ ID NO:105-156 as well as the sequences of albumin binding domain variants (SEQ ID NO:157-162) used for selection and screening, or used in fusion proteins for illustration of the invention.
- Figure 2 shows the response in ELISA for a selection of Z variants assayed with 2 g/ml of biotinylated PEP0791 1 , as described in Example 1 .
- the responses were normalized by dividing the absorbances with the signal from the positive control on the ELISA plate.
- Figure 3 shows the response for a selection of Z variants in a blocking ELISA assay, performed as described in Example 1 .
- Periplasm preparations of Z variants were tested against 0.2 g/ml PEP0791 1 with or without the addition of 10x excess HSA. Black bars correspond to samples without HSA and grey bars to samples with HSA added as blocking agent.
- Figure 4 shows the result from column study I described in Example 3.
- the bars in the diagram represent the relative amounts of the sample released from each of the ABD binding Z variant-coupled resins after the different wash and elution steps specified in Table 1 .
- Figure 5 shows the result from column study II described in Example 3.
- Figure 5A represents the relative amounts of sample released from each of the ABD binding Z variant-coupled resins, or from an HSA-Sepharose resin included as a reference, after a first (a) or second (b) elution with 0.1 M sodium citrate, pH 3.0 or 0.5 M HAc, pH 2.5, respectively.
- Figure 5B shows the result of SDS-PAGE analysis of the corresponding fractions eluted from the Z variant-coupled resin in Figure 5A.
- M refers to Novex Sharp Pre- stained Protein standard (Invitrogen; Mw: 216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa) and "Loaded sample” refers to the bacterial extract, containing PEP08515, initially loaded on each Z variant-coupled resin. 20 ⁇ of the eluate from the Z variant-coupled resins, 5 ⁇ of protein standard or bacterial extract were loaded in one lane each of the SDS-PAGE gel.
- Figure 5C shows the result of SDS-PAGE analysis of the corresponding fractions eluted from HSA Sepharose resin in Figure 5A.
- Lane 1 First elution with 0.1 M sodium citrate, pH 3.0 (pH 3 (a)).
- Lane 2 Second elution with 0.1 M sodium citrate, pH 3.0 (pH 3 (b)). Lane 3: First elution with 0.5 M HAc, pH 2.5 (pH 2.5 (a)). Lane 4: Second elution with 0.5 M HAc, pH 2.5 (pH 2.5 (b)). 20 ⁇ of each eluate were loaded on the SDS-PAGE gel. "M” refers to Novex Sharp Pre-stained Protein standard (Invitrogen; Mw: 216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa) of which 5 ⁇ were loaded.
- Figure 6 shows a chromatogram from affinity purification, carried out as described in Example 4, of an ABD-fusion protein on an EAH-Sepharose resin coupled with His6-(Z06677) 2 -Cys (solid line).
- Purification of an identical sample on a Sepharose resin coupled with HSA is included for reference. The sample injection point is indicated with an arrow.
- a and B indicate the flow-through fractions, and C and D the eluted fractions, from the His6-(Z06677) 2 -Cys-coupled resin and the HSA-coupled resin, respectively.
- Elution was performed with a linear pH gradient ranging from pH 5.5 to pH 2.3.
- the pH (dotted line) was monitored by the built-in pH meter of the HPLC system.
- Figure 7 shows the dynamic binding capacity of His6-(Z06677) 2 -Cys coupled to EAH-Sepharose resin (solid line), measured after repeated alkali incubations carried out as indicated and as further described in Example 4.
- the binding capacity of HSA coupled to Sepharose resin (broken line) is included for reference.
- Figure 8A shows a chromatogram from affinity purification of the ABD- fusion protein PEP10986 on anti-ABD agarose performed as described in Example 7.
- the sample injection point is indicated by an arrow.
- the absorbance signal at 280 nm is shown (solid line).
- FT and E refer to the flow- through fraction and eluted fraction, respectively. Elution was performed with 0.1 M HAc, pH 2.9 and the pH (dotted line) was monitored by the built-in pH meter of the HPLC system.
- Figure 8B shows the result of SDS-PAGE analysis of selected fractions from the purification described in Example 7.
- Lane 1 Clarified bacterial extract loaded on the column
- Lane 2 Fraction E1
- Lane 3 Fraction E2
- Lane 4 Fraction E3.
- M refers to Novex Sharp Pre-stained Protein standard (Invitrogen; Mw: 216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa). 5 ⁇ of each sample were loaded in respective lanes of the SDS-PAGE gel, except for lane 2 where 1 .25 ⁇ was loaded.
- Figure 9A shows a chromatogram from affinity purification of the ABD- fusion protein PEP03973 on anti-ABD agarose performed as described in Example 8.
- the sample injection point is indicated by an arrow.
- the absorbance signal at 280 nm is shown (solid line).
- FT and E refer to the flow- through fraction and eluted fraction, respectively. Elution was performed with 0.1 M HAc, pH 2.9 and the pH (dotted line) was monitored by the built-in pH meter of the HPLC system.
- Figure 9B shows the result of SDS-PAGE analysis of selected fractions from the purification described in Example 8.
- Lane 1 Clarified bacterial extract loaded on the column
- Lane 2 and Lane 3 Flow-through
- Lane 4 Fraction E1
- Lane 5 Fraction E2
- Lane 6 Fraction E3
- Lane 7 Fraction E4
- Lane 8 Fraction E5.
- M refers to Novex Sharp Pre-stained Protein standard (Invitrogen; Mw: 216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa). 5 ⁇ of each sample were loaded in respective lanes of the SDS-PAGE gel.
- Figure 10A shows a chromatogram from affinity purification of the
- ABD-fusion protein PEP06548 on anti-ABD agarose performed as described in Example 9.
- the sample injection point is indicated by an arrow.
- the absorbance signal at 280 nm is shown (solid line).
- FT and E refer to the flow- through fraction and eluted fraction, respectively. Elution was performed with 0.1 M HAc, pH 2.9 and the pH (dotted line) was monitored by the built-in pH meter of the HPLC system.
- Figure 10B shows the result of SDS-PAGE analysis of selected fractions from the purification described in Example 9.
- Lane 1 Clarified bacterial extract loaded on the column
- Lane 2 Fraction E1 .
- M refers to Novex Sharp Pre-stained Protein standard (Invitrogen; Mw: 216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa). 5 ⁇ were loaded in lane M and lane 1 and 5.8 ⁇ were loaded in lane 2 of the SDS-PAGE gel.
- Figure 1 1 A shows a chromatogram of the purification of the ABD- fusion protein PEP17081 on anti-ABD agarose performed as described in Example 10.
- FT and E refer to the flow-through fraction and eluted fraction, respectively.
- Figure 1 1 B shows the result of SDS-PAGE analysis of selected fractions from different stages of the purification described in Example 10.
- Lane M 5 ⁇ Novex Sharp Pre-stained Protein standard, Invitrogen (216, 160, 1 10, 80, 60, 50, 40, 30, 20, 15, 10, 3.5 kDa).
- Lane 1 5 ⁇ of the clarified, heat treated E. coli lysate that was loaded on the anti-ABD agarose column.
- Lane 2 5 ⁇ of the flow-through from the anti-ABD agarose column (FT in Figure 1 1A).
- Lane 3 3.6 ⁇ of the eluted pool from the anti-ABD agarose column (E in Figure 1 1 A).
- Lane 4 12 ⁇ of PEP17081 further purified by RPC (reversed phase chromatography) and buffer exchanged.
- Figure 12A shows a chromatogram from affinity purification of Protein
- Example 1 comprising ABD035 (SEQ ID NO:159) fused at its C-terminus to a protein hormone, on anti-ABD agarose performed as described in Example 1 1 .
- the sample injection point is indicated by an arrow.
- the absorbance signal at 280 nm (solid line) and the conductivity (dotted line) are shown.
- FT, W and E refer to the flow-through fraction, wash fractions and eluted fraction, respectively.
- First wash step, W1 was performed with 4 CV of TST and second wash step, W2, with 3 CV of 5 mM NH 4 Ac, pH 5.5.
- Figure 12B shows the result of SDS-PAGE analysis of selected fractions from the purification described in Example 1 1 .
- Lanes 1 -3 SEC purified protein: 10 g (1 ), 5 g (2) and 1 g (3).
- Lane 4 Protein sample loaded on the anti-ABD agarose column, i.e. SEC purified protein diluted 1 :10 in TST.
- Lane 5 FT concentrated 20 times.
- Lane 6 W1 concentrated 60 times.
- Lanes 7, 8 and 9 Eluted protein: 10 g (7), 5 g (8) and 1 g (9), respectively.
- Lanes marked with “M” were loaded with a protein molecular weight marker (Mw: 200, 1 16.3, 97.4, 66.3, 55.4, 36.5, 31 , 21 .5, 14.4, 6, 3.5, 2.5 kDa). Arrows indicate weak bands of contaminating proteins which were visible on the SDS-PAGE gel in samples purified by SEC only, but which were efficiently removed by purification on the anti-ABD agarose resin.
- Mw protein molecular weight marker
- Figure 13A shows a chromatogram from affinity purification of Protein 2, comprising ABD035 (SEQ ID NO:159) fused at its N-terminus to a peptide hormone, on anti-ABD agarose performed as described in Example 12.
- the sample injection point is indicated by an arrow.
- the absorbance signal at 280 nm (solid line) and the conductivity (dotted line) are shown.
- FT, W and E refer to the flow-through fraction, wash fractions and eluted fraction, respectively.
- First wash step, W1 was performed with 8 CV of TST and second wash step, W2, with 3 CV of 5 mM NH 4 Ac, pH 5.5.
- Figure 13B shows the result of SDS-PAGE analysis of selected fractions from the purification described in Example 12.
- Lane 1 Protein sample loaded on the anti-ABD agarose column.
- Lane 2 FT.
- Lanes 4-6 Wash fractions.
- Lanes 7-13 Eluted protein fractions within the double peak marked in figure 13A. Fractions corresponding to the first peak within the double peak were loaded in lanes 7-10. Lanes marked with "M” were loaded with a protein molecular weight marker (Mw: 200, 1 16.3, 97.4, 66.3, 55.4, 36.5, 31 , 21 .5, 14.4, 6, 3.5, 2.5 kDa).
- Mw protein molecular weight marker
- PEP07986 (SEQ ID NO:161 ) and PEP0791 1 (SEQ ID NO:162), produced essentially as described in WO2009/016043 or WO2012/004384.
- Biotinylation of target protein ABD001 with an N-terminal cysteine (C- ABD001 ; SEQ ID NO:158) and PEP0791 1 (SEQ ID NO:162) were
- Phage display selection of ABD binding Z variants A library of random variants of protein Z displayed on bacteriophage, constructed in phagemid pAY02047 essentially as described in Gronwall et al (J Biotechnol, 128:162- 183, 2007), was used to select ABD binding polypeptides.
- the library, Zlib004Naive.l utilizes the Taq DNA polymerase binding molecule Z03639 (described in Gunneriusson et al, Protein Eng 12:873-878, 1999, where it was denoted Z Taq si-i) as fusion partner.
- the library had an actual size of 1 .4 x 10 10 variants.
- Phage stocks were prepared in a 20 I fermenter.
- Cells from a glycerol stock containing the phagemid library Zlib004Naive.l were inoculated in 20 I of TSB-YE (Tryptic Soy Broth-Yeast Extract; 30 g/l TSB, 5 g/l yeast extract) supplemented with 2 % glucose and 100 g/ml ampicillin.
- the cultivations were grown at 37 °C in a fermenter (Belach Bioteknik, BR20). When the cells reached an optical density (OD) of 0.7-0.8, approximately 2.6 I of the cultivation was infected using a 10x molar excess of M13K07 helper phage (New England Biolabs, cat. no. N0315S). The cells were incubated for 30 min, whereupon the fermenter was filled up to 20 I with TSB-YE
- Phage stock preparation, selection procedure and amplification of phage between selection cycles were performed essentially as described for selection against another target in WO2009/077175.
- PBS supplemented with 0.1 % gelatine and 0.1 % Tween20 was used as selection buffer and the target-phage complexes were directly captured by
- ELISA screening of Z variants To verify that the selected Z variant molecules could indeed interact with different variants of ABD, ELISA assays were performed. The Z variants were produced by inoculating single colonies from the selections into 1 ml TSB-YE medium supplemented with 100 g/ml ampicillin and 0.1 mM IPTG in deep-well plates (Nunc, cat. no. 278752). The plates were incubated for 18-24 h at 37 °C. Cells were pelleted by
- periplasmic supernatant contained the Z variants as fusions to the Taq DNA polymerase binding molecule Z03639, expressed as AQHDEALE-[Z#####]-VDYV-[Z03639]-YVPG.
- Z##### refers to individual 58 amino acid residue Z variants.
- Half-area 96-well ELISA plates (Costar, cat. no. 3690) were coated with 50 ⁇ /well of coating buffer (50 mM sodium carbonate, pH 9.6) containing 4 g/ml of an antibody specific for Z variants (Affibody, cat. no.
- a periplasmic fraction containing a Z variant binding to an irrelevant but specified target protein and expressed as above was assayed against 5 ⁇ g ml of this target protein, biotinylated.
- negative control the same periplasmic preparation was assayed against PEP07986 or PEP0791 1 . Sequencing was performed for the clones with positive
- PCR fragments were amplified in two steps from single colonies using a standard PCR program and the primers AFFI-21 (5'- tgcttccggctcgtatgttgtgtg; SEQ ID NO:163) and AFFI-22 (5'- cggaaccagagccaccaccgg: SEQ ID NO:164). Sequencing of amplified fragments was performed using the biotinylated oligonucleotide AFFI-72 (5'- biotin-cggaaccagagccaccaccgg; SEQ ID NO:165) and a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, cat. no. 4336919), used in accordance with the manufacturer's protocol. The sequencing reactions were purified by binding to magnetic streptavidin coated beads (Detach
- Blocking ELISA A subset of clones from the initial ELISA screen were subjected to an ELISA blocking assay in order to elucidate if their target binding was affected by the presence of HSA. For the selected Z variants, the same periplasmic fractions as above were used. The ELISA blocking assay was run as the ELISA screening assay, with the following protocol
- HSA was mixed with the target protein before addition to the assay plate.
- 0.2 g/ml of biotinylated PEP0791 1 was mixed with a 10x molar excess of HSA and then incubated for 15 min at RT to allow complex formation before addition to the plate.
- positive control a periplasmic fraction containing a molecule binding an irrelevant target protein and expressed as above was assayed against 5 g/ml biotinylated specific target protein.
- negative control the same periplasmic preparation was assayed against biotinylated PEP0791 1 .
- PBSC was added instead of periplasmic preparation and biotinylated PEP0791 1 added as target. All controls were prepared as samples with and without addition of HSA in the same manner as above.
- Phage display selection of ABD binding Z variants Individual clones were obtained after three cycles of phage display selections against different variants of biotinylated ABD. The phage particle yield (phage particles out/phage particles in) increased for each cycle, indicating enrichment in target binding clones.
- ELISA screening of Z variants The clones obtained after three cycles of selection were produced in 96-well plates and screened for ABD binding activity in ELISA. The results of a selection of the positive clones (signals corresponding to at least 2x the negative control) assayed against PEP0791 1 are presented in Figure 2. The control molecule specific for an irrelevant protein gave a positive signal for the specific protein, whereas no signal was obtained against PEP07986 or PEP0791 1 .
- Blocking ELISA Clones positive for PEP07986 or PEP0791 1 were subjected to a blocking assay including HSA, to see if the Z variants had overlapping binding sites with the natural ligand HSA. For all tested clones, the binding signal to PEP0791 1 was completely extinguished by the presence of HSA, reaching the same level as the background ( Figure 3). The binding of the positive control was not affected by addition of an excess of HSA and the blank showed no background signal.
- Sequencing was performed for the clones with positive absorbance values against ABD in the ELISA screening. Each variant was given a unique identification number #####, and individual variants are referred to as Z#####.
- the amino acid sequences of the 58 amino acid residues long Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:105-156.
- the deduced ABD binding motifs of these Z variants are denoted BM##### and listed in Figure 1 and in the sequence listing as SEQ ID NO:1 -52.
- Z06608 (SEQ ID NO:107), Z06620 (SEQ ID NO:1 10), Z06638 (SEQ ID NO:106), Z06650 (SEQ ID NO:108), Z06677 (SEQ ID NO:105), Z06678 (SEQ ID NO:109) and Z06695 (SEQ ID NO:1 1 1 ), were amplified from the library vector pAY02047.
- a subcloning strategy for construction of dimeric Z variant molecules with N-terminal His6 tag and C-terminal Cys was applied using standard molecular biology techniques and as described in detail in
- WO 2009/077175 for Z variants binding another target.
- the Z gene fragments were subcloned into the expression vector pAY01449 resulting in the encoded sequence MGSSHHHHHHLQ-[Z#####][Z#####]-VDC.
- E. coli BL21 (DE3) cells (Novagen) were transformed with plasmids containing the dimeric gene fragment of each respective Z variant and cultivated at 37 °C in 1 I of TSB + YE medium (Tryptic Soy Broth with Yeast Extract) supplemented with 50 g/ml kanamycin.
- TSB + YE medium Teryptic Soy Broth with Yeast Extract
- 50 g/ml kanamycin 50 g/ml kanamycin.
- IPTG was added to induce protein expression at a final concentration of 0.17 mM and the cultivation was incubated at 37 °C for another 5 h. The cells were harvested by centrifugation.
- Contaminants were removed by washing with denaturing binding buffer, native binding buffer (20 mM sodium
- ABD binding Z variant was transferred to 10 mM NH HCO3 by size exclusion chromatography. Protein concentrations were determined by measuring the absorbance at 280 nm, using a NanoDrop® ND-1000 spectrophotometer, and using the extinction coefficient of the respective protein. The ABD binding Z variants were lyophilized and the purity of the final products was analyzed by SDS-PAGE stained with Coomassie Blue. The identity of each purified ABD binding Z variant was confirmed using HPLC-MS analysis.
- Reduced protein solutions were transferred to a coupling buffer (50 mM Tris-HCI, 5 mM EDTA, pH 8.5) including 50 mM DTT, using size exclusion chromatography, and then mixed with portions of 0.2 ml SulfoLink Coupling Resin (Thermo Fisher Scientific, cat. no. 20401 ).
- This procedure enables site-directed reaction between the thiol groups of the C-terminal cysteine residues of the ABD binding Z variants and the iodoacetyl groups of the resin, forming a covalent thioether bond.
- the coupling reaction was carried out according to the instructions by the manufacturer.
- the degree of coupling defined as mg of coupled ABD binding Z variant per ml of resin, was determined as follows: The amount of coupled ABD binding Z variant was calculated by subtracting the amount of uncoupled material from the original amount of sample, based on concentrations obtained by spectrophotometric measurements of the absorbance at 280 nm. The amount of coupled ABD binding Z variant in mg was then divided with the volume of the SulfoLink Coupling Resin.
- Factor Receptor beta binding variant of protein Z was transferred to spin columns packed with each respective ABD binding Z variant-coupled resin or HSA Sepharose. Flow-through was collected by centrifugation and reapplied twice to the columns. Different solutions, specified in Table 2, were added to
- Coupling efficiency of ABD binding polypeptides The degree of coupling of each ABD binding polypeptide to the SulfoLink Coupling Resin is shown in Table 3.
- the ABD binding Z variant-coupled resins appear to have a higher binding capacity as well as more favorable elution properties as judged both from the absorbance readings and the SDS-PAGE analysis.
- the difference in capacity cannot be due to differences in ligand density; in fact, the number of coupled HSA molecules on HSA Sepharose was approximately 1 .5 - 2.2 times higher compared to the ABD binding Z variant-coupled resins.
- Circular dichroism (CD) analysis was carried out to determine the melting point (Tm) of His6-(Z06677) 2 -Cys.
- the purified sample was diluted to 0.5 mg/ml in PBS.
- a variable temperature measurement (VTM) was performed, in which the absorbance at 220 nm was monitored during heating of the sample from 20 °C to 90 °C, with a temperature slope of 5 °C/min. Tm was
- the CD measurement was performed on a Jasco J-810 spectropolarimeter (Jasco Scandinavia AB) using a cell with an optical path length of 1 mm.
- EAH-Sepharose 4B activated EAH-Sepharose 4B (GE Healthcare, cat. no. 17- 0569-01 ). Activation and immobilization was carried out according to the manufacturer's instructions, and the degree of coupling was determined as described in Example 3.
- Activated EAH Sepharose contains an iodoacetyl group that enables site-directed coupling via the C-terminal cysteine of the affinity ligand. 0.43 ml of the resin was packed in a Tricorn 5/50 column (GE Healthcare). As a reference, 0.47 ml HSA Sepharose (see Example 3) was packed in the same kind of column.
- the elution experiment was performed using an AKTAexplorer 10 chromatography system (GE Healthcare). The two columns were attached to the system and equilibrated with PBS. 2 ml of a sample containing 1 mg PEP08519 (comprising the albumin binding domain PP013 (SEQ ID NO:160) fused at its N-terminus to a Taq polymerase binding variant of protein Z) was loaded on each column followed by wash with PBS and 0.1 M sodium citrate, 0.9 % NaCI, pH 5.5.
- Bound protein was eluted by a linear pH gradient ranging from pH 5.5 to pH 2.3 (using 0.1 M sodium citrate, 0.9 % NaCI, pH 5.5, and 0.1 M sodium citrate, 0.9 % NaCI, pH 2.3) over 16 column volumes (CV).
- the pH was monitored by the built-in pH meter of the AKTAexplorer system.
- the experiment was performed using an AKTAexplorer 10
- the columns were subjected to alkali treatment by applying 5 CV of 0.2 M NaOH at a flow-rate of 1 ml/min, followed by an incubation period without flow.
- the total incubation time in alkali was 25 min.
- Neutralization of the columns was performed by washing with 5 CV of PBS at 1 ml/min, followed by a new capacity measurement as described above. Two more alkali treatments followed by capacity measurements were carried out as above, but with the NaOH concentration increased to 0.5 M and, in the last alkali treatment, the incubation time was extended to 2 h.
- Circular dichroism analysis The melting point of His6-(Z06677) 2 -Cys was determined to be 54°C.
- PEP08519 from the column containing the His 6 -(Z06677) 2 -Cys resin appeared earlier in the gradient (i.e. at a higher pH) than from the column with the HSA Sepharose resin, which also showed lower binding capacity with a larger fraction emerging in the flow through.
- the dynamic binding capacity was determined by measuring the amount of sample loaded until 10 % breakthrough.
- the dynamic binding capacity of the His6-(Z06677) 2 -Cys column was determined to be 3.0 mg PEP08519 per ml resin.
- the corresponding capacity for the HSA Sepharose column was determined to 0.5 mg per ml resin.
- the difference in capacity cannot be explained by the difference in ligand density, since the number of immobilized HSA molecules were estimated to be twice the number of His6-(Z06677) 2 -Cys molecules on their respective resins.
- the dynamic binding capacity was re-measured after each alkali incubation. The results are shown in Figure 7.
- the His6-(Z06677) 2 -Cys column maintained its original capacity after all incubations. This indicates a high resistance to relatively harsh alkali conditions, which is an important feature for cleaning in place (CIP) procedures enabling repeated use of the column.
- CIP cleaning in place
- the HSA Sepharose column included as a reference, lost most of its capacity after 25 min in 0.2 M NaOH.
- the fourth resin assessed in this experiment was EAH Sepharose immobilized with His6-(Z06677) 2 -Cys as described in Example 4.
- the two Z molecules within the dimer bind a sample molecule each to a higher extent compared to His6-(Z06677) 2 -Cys coupled to EAH Sepharose resin.
- iodoacetyl resins makes the binding sites of the ABD binding Z variant more accessible to the sample molecules in the mobile phase.
- the dynamic binding capacity of the NHS resin was less than half compared with the CNBr resin, despite the fact that the NHS resin holds a spacer arm that would theoretically improve the capacity, by making the
- the dynamic binding capacities of the four different resins after alkali treatment with 0.5 M NaOH for 2 h are presented in Table 7.
- the dynamic binding capacities of the iodoacetyl-coupled resins were unaffected by the alkali incubation, while the capacities of the amine-coupled resins dropped by approximately 10 %.
- This Example describes a larger-scale production of the ABD binding Z variant Z006677 in a dimeric format and with an C-terminal Cys, i.e.
- the ABD binding Z variant Z06677 was subcloned as a dimer into an expression vector in which expression is regulated by a T7 promoter.
- the ABD binding polypeptide was expressed with the additional N-terminal amino acid sequence GSSLQ and the additional C-terminal amino acid sequence VDC.
- the expressed polypeptide has the sequence GSSLQ-[Z06677][Z06677]-VDC.
- E. coli BL21 (DE3) cells Novagen
- TSB + YE medium Trptic Soy Broth with Yeast Extract
- 50 g/ml kanamycin 50 g/ml kanamycin.
- IPTG at a final concentration of 0.17 mM, was added to induce protein expression and the cultivation was incubated at 37 °C for another 5 h.
- the cells were harvested by centrifugation.
- Acetonitrile (ACN) was added to the sample to a concentration of 2 % (v/v).
- the sample was loaded onto a FineLine 35 column (GE Healthcare) packed with 125 ml SOURCE 30 RPC (GE Healthcare) by use of an
- AKTAexplorer 100 chromatography system (GE Healthcare). The column was washed with 2 % ACN in Milli-Q water containing 0.1 % TFA (tri-fluoro acetic acid) followed by wash with an identical buffer containing 4 % of ACN. Bound protein was eluted by increasing the ACN concentration from 4 % to 25 % ACN over 15 CV. Eluted fractions were collected and analyzed by SDS- PAGE and LC-MS. Relevant fractions were pooled and transferred to coupling buffer (50 mM Tris-HCI, 5 mM EDTA, pH 8.5) by size exclusion chromatography using an XK-50 column (GE Healthcare) packed with 500 ml Sephadex G-25 (GE Healthcare). The buffer exchanged sample was analyzed spectrophotometrically by measuring the absorbance at 280 nm, and by SDS-PAGE, loading several different quantities of (Z06677) 2 -Cys, and subsequent staining with Comassie Blue.
- TFA tri
- the purified dimeric ABD binding Z variant (Z06677) 2 -Cys was analyzed in a spectrophotometer by measuring the absorbance at 280 nm and by SDS-PAGE.
- Z06677) 2 -Cys lacks tryptophans, resulting in low absorbance readings at 280 nm.
- the concentration of the Z variant molecule was therefore estimated from the SDS-PAGE analysis, which included several different quantities of (Z06677) 2 -Cys.
- Visual inspection of the SDS-PAGE gel estimated the concentration of (Z06677) 2 -Cys to 3.4 mg/ml at a purity of approximately 95 %.
- the produced (Z06677) 2 -Cys-coupled resin is further referred to as "anti-ABD agarose", and in the following Examples it was used to
- the ABD moiety may be placed at the N-terminus, at the C-terminus or even within a fusion protein such that it is flanked by other protein moieties on either side.
- PEP10986 (12.5 kDa), comprising an albumin binding domain (PP013, SEQ ID NO:160) fused at its N-terminus to a cytokine binding variant of protein Z, was purified using a column packed with anti- ABD agarose.
- Pelleted E. coli cells harboring soluble PEP10986 were suspended in TST-buffer (Tris, Saline, Tween: 25 mM Tris-HCI, 1 mM EDTA, 200 mM NaCI, 0.05 % Tween 20, pH 8.0) supplemented with 20 U/ml Benzonase®. Cells were disrupted by sonication and the cell debris removed by centrifugation. Chromatography was performed using an AKTAexplorer 100 system. The clarified sample was applied on an XK-50 column packed with 100 ml anti- ABD agarose (prepared as described in Example 6) and pre-equilibrated with TST.
- TST-buffer Tris, Saline, Tween: 25 mM Tris-HCI, 1 mM EDTA, 200 mM NaCI, 0.05 % Tween 20, pH 8.0
- the chromatogram from purification of PEP10986 on the anti-ABD agarose resin is presented in Figure 8A and the SDS-PAGE analysis of selected fractions is shown in Figure 8B.
- the correct mass of PEP10986 was verified by HPLC-MS analysis and the purity was estimated to be higher than 95 % as judged from SDS-PAGE analysis. According to spectrophotometrical analysis, the pool contained 908 mg of purified PEP10986, corresponding to a yield of approximately 90 %.
- PEP03973 (12.4 kDa), comprising the wild-type albumin binding domain (ABD001 , SEQ ID NO:157) fused at its N-terminus to a HER2 (Human Epidermal growth factor Receptor 2) binding variant of protein Z, was purified using a column packed with anti-ABD agarose.
- PEP06548 (20.3 kDa), comprising an albumin binding domain (ABD035, SEQ ID NO:159, with the C-terminal extension VDC) fused at its N-terminus to two moieties (i.e. a dimer) of a variant of protein Z binding to TNF-a (tumor necrosis factor alpha), was purified using a column packed with anti-ABD agarose.
- PEP06548 also comprises an N-terminal
- Pelleted E. coli cells harboring soluble PEP06548 were suspended in TST-buffer supplemented with 27 U/ml Benzonase®. Cells were disrupted by sonication and the cell debris removed by centrifugation. The C-terminal cysteines of the PEP06548 sample molecules were reduced by addition of DTT to a final concentration of 20 mM, followed by incubation for 30 min at RT. Chromatography was performed using an AKTAexplorer 100 system. The clarified and reduced sample was applied on an XK-16 column packed with 9 ml anti-ABD agarose and pre-equilibrated with TST.
- This batch of anti-ABD agarose was prepared essentially as described in Example 6, except for a lower ligand density of approximately 2.3 mg (Z06677) 2 -Cys per ml of resin.
- the column was washed with 5.5 CV of TST followed by 3.3 CV of 5 mM NH 4 Ac pH 5.5. Bound protein was eluted by applying 2.9 CV of 0.1 M HAc, pH 2.9. Fractions were collected for further analyses by SDS-PAGE and HPLC-MS.
- PEP17081 using anti-ABD agarose
- PEP17081 (18.6 kDa)
- PEP07986, SEQ ID NO:161 an albumin binding domain fused to two moieties of a cytokine binding variant of protein Z in the format Z-PEP07986-Z
- Pelleted E. coli cells harboring soluble PEP17081 were suspended in TST-buffer. Cells were disrupted by heat treatment in a water bath (83 °C, 10 min), followed by cooling on ice. Benzonase® was added to a final concentration of 15 U/ml to reduce viscosity caused by nucleic acids. Cell debris was removed by centrifugation and filtration (0.45 ⁇ filter).
- a first purification step was performed by anti-ABD agarose affinity chromatography using an AKTApurifier 100 system.
- the clarified sample was applied on an XK-26 column packed with 25 ml anti-ABD agarose and pre- equilibrated with 2x TST (i.e. TST buffer with all components at double concentration).
- the column was washed with 5 CV of 2x TST followed by 8 CV of 5 mM NH Ac, pH 5.5.
- Bound protein was eluted by applying 3 CV of 0.1 M HAc, pH 2.9. Fractions were collected for further analyses by SDS- PAGE and HPLC-MS.
- a second purification step was performed by RPC, using an
- AKTAexplorer 100 system.
- the protein eluted from the anti-ABD agarose column was supplemented with acetonitrile to a final concentration of 10 % and loaded on an HR-16 column (GE Healthcare) packed with 24 ml SOURCE 15 RPC (GE Healthcare) and pre-equilibrated with 10 %
- a third purification and buffer exchange step was performed by size exclusion chromatography (SEC) using an AKTAexplorer 100 system.
- Protein 1 (22.6 kDa; pi 10), comprising an albumin binding domain (ABD035, SEQ ID NO: 159) fused at its C-terminus to a protein hormone, was purified on an AKTAexplorer system using a column packed with anti-ABD agarose.
- Protein 1 was expressed in E.coli in the form of inclusion bodies. After solubilization and refolding of the inclusion bodies the material was run three times on size-exclusion chromatography (SEC) for buffer exchange and purification. 8 mg of the SEC purified Protein 1 , in PBS diluted 1 :10 in TST, was loaded at 0.5 ml/min on an XK 16/20 column (GE Healthcare) packed with 10-12 ml anti-ABD agarose and pre-equilibrated with TST. The column was washed with 4 CV of TST, followed by an additional 3 CV wash with 5 mM NH Ac, pH 5.5, at a flow rate of 1 ml/min.
- SEC size-exclusion chromatography
- Bound protein was eluted with 3 CV of 0.1 M HAc, pH 2.9, and then neutralized to pH 7 with 1 M Tris-HCI, pH 9 . Flow-through fractions, wash fractions and eluted fractions were collected for further analysis by SDS-PAGE. 4-12 % Bis-Tris NuPAGE gels (Invitrogen) were run non-reduced and the protein stained with Simply Blue (Life Technologies). The column was re-equilibrated with TST after elution and cleaned in place (CIP) with 3 CV of 0.5 M NaOH followed by 3 CV of TST. Between purifications, the resin was stored in TST + 20 % ethanol.
- Protein 2 (9.5 kDa, pi 6.6), comprising an albumin binding domain (ABD035, SEQ ID NO: 159) fused at its N-terminus to a peptide hormone, was expressed in Pichia Pink and purified in a single step on an AKTAexplorer system using a column packed with anti-ABD agarose.
- Bound protein was eluted with 3 CV of 0.1 M HAc, pH 2.9 and then adjusted to pH 4 with 1 M Tris-HCI, pH 9.
- the column was re-equilibrated with TST after elution followed by CIP and storage in TST + 20 % ethanol. Flow- through fractions, wash fractions and eluted fractions were collected for further analysis by SDS-PAGE.
- the chromatogram from purification of Protein 2 on the anti-ABD agarose resin is presented in Figure 13A and the SDS-PAGE analysis of selected fractions is shown in Figure 13B.
- the elution peak from the anti-ABD agarose column contained 3-5 mg of Protein 2, corresponding to a yield of approximately 75 % (estimated from a Western blot).
- the correct mass of the eluted Protein 2 was verified by HPLC-MS analysis. The purity was estimated to be higher than 98 % as judged from SDS-PAGE analysis followed by Simply Blue staining. No contaminating media proteins could be detected in the elution fractions (lanes 7-13, Figure 13B). It is recognized that Protein 2 runs smaller on SDS-PAGE gels as indicated by the molecular weight standards included on the gels.
- ABD binding polypeptide comprising an ABD binding motif BM, which motif consists of an amino acid sequence selected from: j) EX2X3X4AX6X7EIX 10 Xl lLPNLXi6Xl 7 Xl8QX20X2lAFIX2 5 X26LX28D wherein, independently from each other, X2 is selected from F, I and L;
- Xs s selected from H, K, N, Q, R, S, T and V;
- X4 s selected from A, D, F, G, H, I, K, L, M, N, Q, R, S, T, V, W and Y;
- Xe s selected from F, I, L and Y;
- X 7 s selected from A, H, I, K, L, N, Q, R, S, T and V;
- X10 s selected from G, H, K, N, Q, R and S;
- X11 s selected from A, D, F, G, I, K, L, N, Q, R, S, T, V and Y;
- Xl7 s selected from F, H, L, S and T;
- Xl8 s selected from D, E, H, I, K, L, M, N, Q, R, S, T and V;
- X20 s selected from H, K and R;
- X21 s selected from I, L and V;
- X25 s selected from F, I, L, V and Y;
- X28 s selected from D and E; and ii) an amino acid sequence which has at least 89 % identity to the
- ABD binding polypeptide according to item 1 wherein X 2 in sequence i) is selected from F and L. 3. ABD binding polypeptide according to item 2, wherein X 2 in sequence i) is F.
- ABD binding polypeptide according to item 2 wherein X 2 in sequence i) is L.
- ABD binding polypeptide according to item 1 1 wherein X4 in sequence i) is V.
- ABD binding polypeptide according to item 19 wherein X 7 in sequence i) is R. 22.
- ABD binding polypeptide according item 26 wherein Xio in sequence i) is K.
- ABD binding polypeptide according to item 41 wherein Xi 8 in sequence i) is Q.
- ABD binding polypeptide according to item 51 wherein X 25 in sequence i) is selected from V and I.
- X2 is F or L;
- X 20 is H or R
- V. X21 is I or L
- X 28 is D. 58. ABD binding polypeptide according to item 57, wherein sequence i) fulfills at least five of the eight conditions l-VIII.
- ABD binding polypeptide according to item 64 wherein sequence i) is SEQ ID NO:1 .
- ABD binding polypeptide according to any one of items 66-67, wherein said three-helix bundle protein domain is selected from bacterial receptor domains.
- ABD binding polypeptide according to any preceding item, which comprises an amino acid sequence selected from: iii) K-[BM]-DPSQS X a X b LLX c EAKKL NDX d Q; wherein
- [BM] is an ABD binding motif as defined in any one of items 1 -65; X a is selected from A and S;
- Xb is selected from N and E;
- X c is selected from A, S and C;
- Xd is selected from A and S; and iv) an amino acid sequence which has at least 81 % identity to a
- ABD binding polypeptide according to any one of items 70-72, wherein X b in sequence iii) is E.
- ABD binding polypeptide according to any one of items 70-77, wherein X d in sequence iii) is A.
- ABD binding polypeptide according to item 70 wherein, in sequence iii), X a is A; X b is N; X c is A and Xd is A.
- ABD binding polypeptide according to item 70 wherein, in sequence iii), X a is A; X b is N; X c is C and Xd is A. 82. ABD binding polypeptide according to item 70, wherein, in sequence iii), X a is S; Xb is E; X c is S and Xd is S.
- ABD binding polypeptide according to item 70 wherein, in sequence iii), X a is S; Xb is E; X c is C and Xd is S.
- ABD binding polypeptide according to item 70 wherein, in sequence iii), X a is S; Xb is E; X c is C and Xd is A.
- ABD binding polypeptide according to item 70 wherein, in sequence iii), X a is S; Xb is E; X c is A and Xd is A.
- ABD binding polypeptide according to any one of items 1 -70 which comprises an amino acid sequence selected from: v) YAK-[BM]-DPSQS SELLX C EAKKL NDSQA P; wherein [BM] is an ABD binding motif as defined in any one of items 1 -65 and Xc is selected from S and C; and vi) an amino acid sequence which has at least 83 % identity to a sequence defined by v).
- ABD binding polypeptide according to any one of items 1 -70, which comprises an amino acid sequence selected from: vii) YAK-[BM]-DPSQS SELLX C EAKKL NDAQA P; wherein [BM] is an ABD binding motif as defined in any one of items 1 -65 and X c is selected from A and C; and viii) an amino acid sequence which has at least 83 % identity to a
- ABD binding polypeptide according to any one of items 1 -70, which comprises an amino acid sequence selected from: ix) FNK-[BM/-DPSQS ANLLX C EAKKL NDAQA P; wherein [BM] is an ABD binding motif as defined in any one of items 1 -65 and Xc is selected from A and C; and x) an amino acid sequence which has at least 83 % identity to a sequence defined by ix).
- ABD binding polypeptide according to item 69 which comprises an amino acid sequence selected from:
- ABD binding polypeptide according to any preceding item, which comprises an amino acid sequence selected from: xi) VDAKYAK-[BM/- DPSQSSELLAEAKKLNDAQAPK; wherein [BM] is an ABD binding motif as defined in any one of items 1 -65; and xii) an amino acid sequence which has at least 84 % identity to the
- ABD binding polypeptide according to item 94 in which sequence xi) is selected from SEQ ID NO:105-156.
- sequence xi) is selected from SEQ ID NO 105-1 1 1 .
- sequence xi) is SEQ ID NO:105.
- ABD binding polypeptide according to item 99 wherein the ABD binding polypeptide monomer units are expressed as a fusion protein.
- ABD binding polypeptide according to any preceding items which further comprises a cysteine residue at the C-terminal end of the polypeptide, for example at the C-terminus.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK15111607.5A HK1210793B (en) | 2012-10-25 | 2013-10-25 | Albumin binding polypeptide |
| DK13783052.7T DK2912054T3 (en) | 2012-10-25 | 2013-10-25 | Albumin-binding polypeptide |
| EP13783052.7A EP2912054B1 (en) | 2012-10-25 | 2013-10-25 | Albumin binding polypeptide |
| AU2013336646A AU2013336646B2 (en) | 2012-10-25 | 2013-10-25 | ABD binding polypeptide |
| ES13783052.7T ES2639099T3 (en) | 2012-10-25 | 2013-10-25 | Albumin Binding Polypeptide |
| JP2015538457A JP6382826B2 (en) | 2012-10-25 | 2013-10-25 | Albumin binding polypeptide |
| KR1020157012851A KR102151289B1 (en) | 2012-10-25 | 2013-10-25 | Abd binding polypeptide |
| US14/437,623 US10011641B2 (en) | 2012-10-25 | 2013-10-25 | ABD binding polypeptide |
| CA2889037A CA2889037C (en) | 2012-10-25 | 2013-10-25 | Abd binding polypeptide |
| CN201380065194.7A CN104854127B (en) | 2012-10-25 | 2013-10-25 | Albumin binding polypeptides |
| IL238184A IL238184B (en) | 2012-10-25 | 2015-04-12 | Abd binding polypeptide and a composition comprising the polypeptide and a detectable agent |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261718238P | 2012-10-25 | 2012-10-25 | |
| EP12189932 | 2012-10-25 | ||
| US61/718,238 | 2012-10-25 | ||
| EP12189932.2 | 2012-10-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014064237A1 true WO2014064237A1 (en) | 2014-05-01 |
Family
ID=47115503
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/072359 Ceased WO2014064237A1 (en) | 2012-10-25 | 2013-10-25 | Abd binding polypeptide |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US10011641B2 (en) |
| EP (1) | EP2912054B1 (en) |
| JP (1) | JP6382826B2 (en) |
| KR (1) | KR102151289B1 (en) |
| CN (1) | CN104854127B (en) |
| AU (1) | AU2013336646B2 (en) |
| CA (1) | CA2889037C (en) |
| DK (1) | DK2912054T3 (en) |
| ES (1) | ES2639099T3 (en) |
| PL (1) | PL2912054T3 (en) |
| WO (1) | WO2014064237A1 (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015189431A1 (en) * | 2014-06-13 | 2015-12-17 | Affibody Ab | New polypeptide |
| WO2015189430A1 (en) * | 2014-06-13 | 2015-12-17 | Affibody Ab | New polypeptide |
| WO2016042083A1 (en) | 2014-09-17 | 2016-03-24 | Affibody Ab | New polypeptides |
| WO2016113246A1 (en) * | 2015-01-12 | 2016-07-21 | Affibody Ab | Il-17a-binding polypeptides |
| EP2971290A4 (en) * | 2013-03-14 | 2017-03-01 | The Governing Council Of The University Of Toronto | Scaffolded peptidic libraries and methods of making and screening the same |
| WO2018178392A1 (en) * | 2017-03-31 | 2018-10-04 | Swedish Orphan Biovitrum Ab (Publ) | Il-1r-i binding polypeptide |
| WO2019175176A1 (en) | 2018-03-13 | 2019-09-19 | Affibody Ab | Polypeptides based on a novel scaffold |
| US10562955B2 (en) | 2013-03-15 | 2020-02-18 | Affibody Ab | Polypeptides |
| EP3785726A1 (en) | 2019-09-02 | 2021-03-03 | Biotest AG | Factor viii protein with increased half-life |
| WO2021043757A1 (en) | 2019-09-02 | 2021-03-11 | Biotest Ag | Factor viii protein with increased half-life |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019126364A2 (en) * | 2017-12-19 | 2019-06-27 | The Scripps Research Institute | Compositions and methods related to nicotine addiction and cessation |
| CN109776653B (en) * | 2018-11-26 | 2022-05-17 | 上海华新生物高技术有限公司 | Human serum albumin adhesion peptide and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991001743A1 (en) | 1989-08-01 | 1991-02-21 | Cemu Bioteknik Ab | Stabilized protein or peptide conjugates |
| WO2001045746A2 (en) | 1999-12-24 | 2001-06-28 | Genentech, Inc. | Methods and compositions for prolonging elimination half-times of bioactive compounds |
| WO2009016043A2 (en) | 2007-07-31 | 2009-02-05 | Affibody Ab | New albumin binding compositions, methods and uses |
| WO2009019117A1 (en) * | 2007-08-03 | 2009-02-12 | Affibody Ab | Igf-1r binding polypeptides and their use |
| WO2009077175A1 (en) | 2007-12-19 | 2009-06-25 | Affibody Ab | Polypeptide derived from protein a and able to bind pdgf |
| EP2077272A1 (en) * | 2007-12-21 | 2009-07-08 | Affibody AB | Polypeptide libraries with a predetermined scaffold |
| WO2011056124A1 (en) * | 2009-11-04 | 2011-05-12 | Affibody Ab | Her3 binding polypeptides |
| WO2012004384A2 (en) | 2010-07-09 | 2012-01-12 | Affibody Ab | Polypeptides |
| WO2013126006A1 (en) * | 2012-02-20 | 2013-08-29 | Swedish Orphan Biovitrum Ab (Publ) | Polypeptides binding to human complement c5 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2739352C (en) | 2008-10-29 | 2021-07-13 | Wyeth Llc | Methods for purification of single domain antigen binding molecules |
| EP2912051B1 (en) | 2012-10-25 | 2018-04-18 | Affibody AB | Method for the separation of proteins containing an albumin-binding domain |
-
2013
- 2013-10-25 AU AU2013336646A patent/AU2013336646B2/en active Active
- 2013-10-25 US US14/437,623 patent/US10011641B2/en active Active
- 2013-10-25 ES ES13783052.7T patent/ES2639099T3/en active Active
- 2013-10-25 JP JP2015538457A patent/JP6382826B2/en active Active
- 2013-10-25 EP EP13783052.7A patent/EP2912054B1/en active Active
- 2013-10-25 KR KR1020157012851A patent/KR102151289B1/en active Active
- 2013-10-25 WO PCT/EP2013/072359 patent/WO2014064237A1/en not_active Ceased
- 2013-10-25 CN CN201380065194.7A patent/CN104854127B/en active Active
- 2013-10-25 DK DK13783052.7T patent/DK2912054T3/en active
- 2013-10-25 PL PL13783052T patent/PL2912054T3/en unknown
- 2013-10-25 CA CA2889037A patent/CA2889037C/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991001743A1 (en) | 1989-08-01 | 1991-02-21 | Cemu Bioteknik Ab | Stabilized protein or peptide conjugates |
| WO2001045746A2 (en) | 1999-12-24 | 2001-06-28 | Genentech, Inc. | Methods and compositions for prolonging elimination half-times of bioactive compounds |
| WO2009016043A2 (en) | 2007-07-31 | 2009-02-05 | Affibody Ab | New albumin binding compositions, methods and uses |
| WO2009019117A1 (en) * | 2007-08-03 | 2009-02-12 | Affibody Ab | Igf-1r binding polypeptides and their use |
| WO2009077175A1 (en) | 2007-12-19 | 2009-06-25 | Affibody Ab | Polypeptide derived from protein a and able to bind pdgf |
| EP2077272A1 (en) * | 2007-12-21 | 2009-07-08 | Affibody AB | Polypeptide libraries with a predetermined scaffold |
| WO2011056124A1 (en) * | 2009-11-04 | 2011-05-12 | Affibody Ab | Her3 binding polypeptides |
| WO2012004384A2 (en) | 2010-07-09 | 2012-01-12 | Affibody Ab | Polypeptides |
| WO2013126006A1 (en) * | 2012-02-20 | 2013-08-29 | Swedish Orphan Biovitrum Ab (Publ) | Polypeptides binding to human complement c5 |
Non-Patent Citations (29)
| Title |
|---|
| ANDERSEN ET AL., J BIOL CHEM, vol. 286, 2011, pages 5234 - 41 |
| BJORCK ET AL., MOLLMMUNOL, vol. 24, 1987, pages 1113 |
| BRAISTED A C ET AL: "Minimizing a binding domain from protein A", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 93, no. 12, 11 June 1996 (1996-06-11), pages 5688 - 5692, XP002555464, ISSN: 0027-8424, DOI: 10.1073/PNAS.93.12.5688 * |
| CRAMER ET AL: "Crystal structure of a bacterial albumin-binding domain at 1.4A resolution", FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 581, no. 17, 28 June 2007 (2007-06-28), pages 3178 - 3182, XP022133711, ISSN: 0014-5793, DOI: 10.1016/J.FEBSLET.2007.06.003 * |
| DE-CHÃTEAU ET AL: "Protein PAB, a mosaic albumin-binding bacterial protein representing the first contemporary example of module shuffling.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 16, 1 April 1994 (1994-04-01), pages 12147 - 12151, XP055047839, ISSN: 0021-9258 * |
| DENNIS ET AL., J BIOL CHEM, vol. 277, 2002, pages 35035 - 43 |
| E. WAHLBERG ET AL: "An affibody in complex with a target protein: Structure and coupled folding", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 100, no. 6, 18 March 2003 (2003-03-18), pages 3185 - 3190, XP055102112, ISSN: 0027-8424, DOI: 10.1073/pnas.0436086100 * |
| GOETSCH ET AL., CLIN DIAGN LAB IMMUNOL, vol. 10, 2003, pages 125 - 32 |
| GR6NWALL ET AL., J BIOTECHNOL, vol. 128, 2007, pages 162 - 183 |
| GUNNERIUSSON ET AL., PROTEIN ENG, vol. 12, 1999, pages 873 - 878 |
| GUSS ET AL., EMBO J, vol. 5, 1986, pages 1567 |
| HE YANAN ET AL: "An artificially evolved albumin binding module facilitates chemical shift epitope mapping of GA domain interactions with phylogenetically diverse albumins", PROTEIN SCIENCE, CAMBRIDGE UNIVERSITY PRESS, vol. 16, 13 June 2007 (2007-06-13), pages 1490 - 1494, XP002508987, ISSN: 0961-8368, DOI: 10.1110/PS.072799507 * |
| J. LÖFBLOM ET AL: "Affibody molecules: Engineered proteins for therapeutic, diagnostic and biotechnological applications", FEBS LETTERS, vol. 584, no. 12, 1 June 2010 (2010-06-01), pages 2670 - 2680, XP055054512, ISSN: 0014-5793, DOI: 10.1016/j.febslet.2010.04.014 * |
| JAWID N. AHMAD ET AL: "Novel high-affinity binders of human interferon gamma derived from albumin-binding domain of protein G", PROTEINS: STRUCTURE, FUNCTION, AND BIOINFORMATICS, vol. 80, no. 3, 24 March 2012 (2012-03-24), pages 774 - 789, XP055099184, ISSN: 0887-3585, DOI: 10.1002/prot.23234 * |
| JOHAN NILVEBRANT ET AL: "Engineering Bispecificity into a Single Albumin-Binding Domain", PLOS ONE, vol. 6, no. 10, 1 January 2011 (2011-01-01), pages e25791, XP055047771, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0025791 * |
| JOHANSSON ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 8114 - 20 |
| JONSSON ET AL., PROT ENG DES SEL, vol. 21, 2008, pages 515 - 27 |
| KARIN NORD; GUNNERIUSSON E; RINGDAHL J; STÅHL S; UHLÉN M; NYGREN P A: "Binding proteins selected from combinatorial libraries of an alpha-helical bacterial receptor domain.", NATURE BIOTECH., vol. 15, no. 8, 15 August 1997 (1997-08-15), pages 772 - 777, XP055099206, Retrieved from the Internet <URL:http://www.nature.com/nbt/journal/v15/n8/pdf/nbt0897-772.pdf> [retrieved on 20140129] * |
| KRAULIS ET AL., FEBS LETT, vol. 378, 1996, pages 190 |
| MCCURDY ET AL., J LAB CLIN MED, vol. 143, 2004, pages 115 |
| NORD ET AL., NAT BIOTECH, vol. 15, 1997, pages 772 - 777 |
| NORD ET AL., PROT ENG, vol. 8, 1995, pages 601 - 608 |
| NORD K, PROT ENG |
| NYGREN PER-AKE: "Alternative binding proteins: affibody binding proteins developed from a small three-helix bundle scaffold", FEBS JOURNAL, BLACKWELL PUBLISHING, LONDON, GB, vol. 275, no. 11, 1 June 2008 (2008-06-01), pages 2668 - 2676, XP002601623, ISSN: 1742-464X, DOI: 10.1111/J.1742-4658.2008.06438.X * |
| OLSSON ET AL., EUR J BIOCHEM, vol. 168, 1987, pages 319 |
| S. LEJON: "Crystal Structure and Biological Implications of a Bacterial Albumin Binding Module in Complex with Human Serum Albumin", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 41, 16 July 2004 (2004-07-16), pages 42924 - 42928, XP055090932, ISSN: 0021-9258, DOI: 10.1074/jbc.M406957200 * |
| TASHIRO M ET AL: "High-resolution solution NMR structure of the Z domain of staphylococcal protein A", JOURNAL OF MOLECULAR BIOLOGY, ACADEMIC PRESS, UNITED KINGDOM, vol. 272, no. 4, 3 October 1997 (1997-10-03), pages 573 - 590, XP004453779, ISSN: 0022-2836, DOI: 10.1006/JMBI.1997.1265 * |
| THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680 |
| TOVE ALM ET AL: "A small bispecific protein selected for orthogonal affinity purification", BIOTECHNOLOGY JOURNAL, vol. 5, no. 6, 1 June 2010 (2010-06-01), pages 605 - 617, XP055099189, ISSN: 1860-6768, DOI: 10.1002/biot.201000041 * |
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2971290A4 (en) * | 2013-03-14 | 2017-03-01 | The Governing Council Of The University Of Toronto | Scaffolded peptidic libraries and methods of making and screening the same |
| US10093921B2 (en) | 2013-03-14 | 2018-10-09 | The Governing Council Of The University Of Toronto | Scaffolded peptidic libraries and methods of making and screening the same |
| US10562955B2 (en) | 2013-03-15 | 2020-02-18 | Affibody Ab | Polypeptides |
| KR101787003B1 (en) | 2014-06-13 | 2017-10-18 | 애피바디 에이비 | New Polypeptide |
| WO2015189430A1 (en) * | 2014-06-13 | 2015-12-17 | Affibody Ab | New polypeptide |
| CN106488930A (en) * | 2014-06-13 | 2017-03-08 | 阿菲博迪公司 | Novel Peptides |
| JP2017518770A (en) * | 2014-06-13 | 2017-07-13 | アフィボディ アクティエボラーグ | Novel polypeptide |
| JP2017522864A (en) * | 2014-06-13 | 2017-08-17 | アフィボディ アクティエボラーグ | Novel polypeptide |
| WO2015189431A1 (en) * | 2014-06-13 | 2015-12-17 | Affibody Ab | New polypeptide |
| JP7028557B2 (en) | 2014-06-13 | 2022-03-02 | アフィボディ アクティエボラーグ | New polypeptide |
| US10669314B2 (en) | 2014-06-13 | 2020-06-02 | Affibody Ab | Polypeptide |
| JP2020203909A (en) * | 2014-06-13 | 2020-12-24 | アフィボディ アクティエボラーグ | New polypeptide |
| US10633423B2 (en) | 2014-06-13 | 2020-04-28 | Affibody Ab | IL-6-binding polypeptide complex |
| WO2016042083A1 (en) | 2014-09-17 | 2016-03-24 | Affibody Ab | New polypeptides |
| US10323066B2 (en) | 2014-09-17 | 2019-06-18 | Affibody Ab | Neonatal Fc receptor binding dimer and methods of use |
| EP3597661A1 (en) | 2014-09-17 | 2020-01-22 | Affibody AB | New polypeptides |
| EP3738976A1 (en) * | 2015-01-12 | 2020-11-18 | Affibody AB | Il-17a-binding polypeptides |
| WO2016113246A1 (en) * | 2015-01-12 | 2016-07-21 | Affibody Ab | Il-17a-binding polypeptides |
| US12221464B2 (en) | 2015-01-12 | 2025-02-11 | Affibody Ab | Methods of treatment of IL-17A associated conditions |
| EP4643955A3 (en) * | 2015-01-12 | 2026-01-14 | Affibody AB | Il-17a binding polypeptide |
| JP2023052258A (en) * | 2015-01-12 | 2023-04-11 | アフィボディ アクティエボラーグ | IL-17A binding polypeptide |
| US10934335B2 (en) | 2015-01-12 | 2021-03-02 | Affibody Ab | IL-17A-binding polypeptides |
| AU2016208161B2 (en) * | 2015-01-12 | 2020-01-16 | Affibody Ab | IL-17A-binding polypeptides |
| JP7456024B2 (en) | 2015-01-12 | 2024-03-26 | アフィボディ アクティエボラーグ | IL-17A binding polypeptide |
| JP2021073174A (en) * | 2015-01-12 | 2021-05-13 | アフィボディ アクティエボラーグ | Il-17a-binding polypeptides |
| JP2018508186A (en) * | 2015-01-12 | 2018-03-29 | アフィボディ アクティエボラーグ | IL-17A binding polypeptide |
| JP7208963B2 (en) | 2015-01-12 | 2023-01-19 | アフィボディ アクティエボラーグ | IL-17A binding polypeptide |
| WO2018178392A1 (en) * | 2017-03-31 | 2018-10-04 | Swedish Orphan Biovitrum Ab (Publ) | Il-1r-i binding polypeptide |
| US12116397B2 (en) | 2017-03-31 | 2024-10-15 | Swedish Orphan Biovitrum Ab (Publ) | IL-IR-I binding polypeptide |
| WO2019175176A1 (en) | 2018-03-13 | 2019-09-19 | Affibody Ab | Polypeptides based on a novel scaffold |
| WO2021043757A1 (en) | 2019-09-02 | 2021-03-11 | Biotest Ag | Factor viii protein with increased half-life |
| EP3785726A1 (en) | 2019-09-02 | 2021-03-03 | Biotest AG | Factor viii protein with increased half-life |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104854127A (en) | 2015-08-19 |
| US20150291668A1 (en) | 2015-10-15 |
| KR102151289B1 (en) | 2020-09-02 |
| JP2015534994A (en) | 2015-12-07 |
| CA2889037C (en) | 2021-06-22 |
| JP6382826B2 (en) | 2018-08-29 |
| US10011641B2 (en) | 2018-07-03 |
| PL2912054T3 (en) | 2017-11-30 |
| ES2639099T3 (en) | 2017-10-25 |
| HK1210793A1 (en) | 2016-05-06 |
| AU2013336646A1 (en) | 2015-05-28 |
| KR20150077447A (en) | 2015-07-07 |
| EP2912054B1 (en) | 2017-06-21 |
| CA2889037A1 (en) | 2014-05-01 |
| AU2013336646B2 (en) | 2016-07-14 |
| EP2912054A1 (en) | 2015-09-02 |
| DK2912054T3 (en) | 2017-09-11 |
| CN104854127B (en) | 2020-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2013336646B2 (en) | ABD binding polypeptide | |
| AU2008281913B2 (en) | New albumin binding compositions, methods and uses | |
| JP5677943B2 (en) | Polypeptide | |
| KR102497083B1 (en) | Binding polypeptides having a mutated scaffold | |
| EP2544785B1 (en) | Immunoglobulin g fc region binding polypeptide | |
| EP4491268A2 (en) | Fc binding proteins with cysteine in the c-terminal helical region | |
| US9745340B2 (en) | Method for the separation of proteins containing an albumin-binding | |
| KR20220002325A (en) | A method for isolating an antibody or antibody fragment lacking an Fc region capable of binding protein A | |
| JP2017522864A (en) | Novel polypeptide | |
| JP2019537425A (en) | Target binding polypeptide variants of an IgG binding polypeptide containing a metal binding motif | |
| JP2025539595A (en) | New ligands for affinity chromatography | |
| HK1210793B (en) | Albumin binding polypeptide | |
| JP7836119B2 (en) | High-affinity purification of ferritin | |
| Järver et al. | Chemical synthesis and evaluation of a backbone‐cyclized minimized 2‐helix Z‐domain | |
| Mersich et al. | Identification of a ligand for IgG‐Fc derived from a soluble peptide library based on fusion proteins secreted by S. cerevisiae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13783052 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 238184 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2889037 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14437623 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2015538457 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20157012851 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013783052 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013783052 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013336646 Country of ref document: AU Date of ref document: 20131025 Kind code of ref document: A |

