WO2014059544A1 - Transgenic cells for identifying gpcr signaling compound modulating gpcr signaling pathway and screening method thereof - Google Patents

Transgenic cells for identifying gpcr signaling compound modulating gpcr signaling pathway and screening method thereof Download PDF

Info

Publication number
WO2014059544A1
WO2014059544A1 PCT/CA2013/050783 CA2013050783W WO2014059544A1 WO 2014059544 A1 WO2014059544 A1 WO 2014059544A1 CA 2013050783 W CA2013050783 W CA 2013050783W WO 2014059544 A1 WO2014059544 A1 WO 2014059544A1
Authority
WO
WIPO (PCT)
Prior art keywords
pathway
gpcr
screening method
receptor
transgenic cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2013/050783
Other languages
French (fr)
Inventor
Jean-martin BEAULIEU
Thomas DEL GUIDICE
Claude LAMARE
Mohamed Chahine
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Laval
Original Assignee
Universite Laval
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Laval filed Critical Universite Laval
Publication of WO2014059544A1 publication Critical patent/WO2014059544A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH

Definitions

  • the present invention relates to transgenic cells for identifying GPCR signaling compounds modulating G-protein coupled receptor (GPCR) signaling pathway and a screening method for identifying such GPCR signaling compounds.
  • GPCR G-protein coupled receptor
  • Seven transmembrane domain receptors are the largest family of cell surface receptors encoded by the human genome and represent at least 25% of the molecular targets for existing drugs (Overington et al., 2006; Vassilatis et al., 2003). These receptors are known also as G protrein-coupled receptors (GPCRs) since they are believed to exert their major effects on cell signaling by activating heterotrimeric G proteins (Northup et al., 1983). However, beyond their role in regulating G proteins, 7TM also signal through G protein independent mechanisms (Galandrin et al., 2007; Luttrell et al., 1999; Luttrell and Gesty-Palmer, 2010; Premont and Gainetdinov, 2007).
  • the multifunctional signaling proteins beta-arrestin 1 and 2 ( ⁇ and ⁇ 2)— that were originally associated with the desensitization of G protein-mediated signaling (Ferguson et al., 1996; Lohse et al., 1990)— activate several signaling pathways downstream of 7TMs by acting as scaffolds for kinases and phosphatases (Beaulieu et al., 2009; Kovacs et al., 2009).
  • D2R dopamine D2 receptors
  • D2S dopamine D2 receptors
  • D2L dopamine D2 receptors
  • Strong evidence indicates that D2L mostly acts as an alloreceptor on striatal medium spiny neurons and other neurons receiving dopaminergic projections (Usiello et al., 2000).
  • the D2S would act principally as an autoreceptor on dopaminergic neurons.
  • D2R have classically been shown to couple to Gai/o to inhibit the synthesis of cyclic adenosine monophosphate (cAMP) (Kebabian and Calne, 1979). However, D2R also signals through a ⁇ 2 dependent mechanism that results in the formation of a protein complex comprised of ⁇ 2, the protein kinase Akt and protein phosphatase 2A (PP2A) (Beaulieu et al., 2005; Beaulieu et al., 2004).
  • cAMP cyclic adenosine monophosphate
  • the D2R is a major target of antipsychotic drugs (Roth et al., 2004; Seeman et al. 1976; Snyder, 1976).
  • ⁇ Arr2-mediated mechanisms downstream of D2L Misri et al., 2008.
  • the mood stabilizer drug lithium which is used for the treatments of mood disorders and psychosis, could regulate behavior in mice by disrupting the integrity of a Akt ⁇ Arr2/PP2A signaling complex (Beaulieu et al., 2008a; O'Brien et al., 201 1 ).
  • GPCR G protein coupled receptor
  • a transgenic cell co-expressing at least one cell surface ionic channel and at least one G protein coupled receptor (GPCR), wherein at least one GPCR signaling pathway is modulated by a GPCR signaling compound.
  • GPCR G protein coupled receptor
  • a screening method for identifying a GPCR signaling compound modulating at least one G protein coupled receptor (GPCR) signaling pathway comprising the steps of: a) contacting a transgenic cell with the GPCR signaling compound wherein the transgenic cell co-expresses at least one cell surface ionic channel and at least one GPCR; and b) determining the ability of the GPCR signaling compound to modulate the at least one GPCR signaling pathway; wherein determining modulation of the at least one GPCR signaling pathway relative to a control indicates that the GPCR signaling compound modulates the at least one GPCR signaling pathway.
  • GPCR G protein coupled receptor
  • AC adenylate cyclase
  • D Immunoblot analysis (D) and quantification (E) of pAkt (Thr-308) and pDARPP32 (Thr-34) in the striatum of WT C57BI6 mice treated chronically with lithium (LiCI, 0, 12% in water), lamotrigine (Lamo, 10 mg/kg i.p.) or valproate (Val, 10 mg per kg of chow) or respective vehicles.
  • lithium LiCI, 0, 12% in water
  • lamotrigine Li, 10 mg/kg i.p.
  • valproate valproate
  • F-l Immunoblot analysis (F) and quantification (G-l) of pAkt (Th308), pGSh ⁇ (Ser-9) and ⁇ -catenin levels in extracts prepared from the striatum or frontal cortex (FCx) of D2R-KO (F, H), ⁇ -2-KO (I) and WT littermates following chronic treatment with lamotrigine or valproate.
  • WT mice presented in G are littermates of D2R-KO mice.
  • Data for ⁇ 2- ⁇ WT littermates are presented in figure 2. For all analysis respective total protein signal were used as internal reference for phospho-proteins. Actin was used as a reference for the measurement of ⁇ -catenin levels.
  • FIG. 2 Supplement to regulation of ⁇ -2-mediated D2R signaling by lamotrigine and valproate.
  • A-D Western blot analysis (A) and quantification (B-D) of pAkt (Th308) (B), pGSh ⁇ (Ser-9) (C) and ⁇ -catenin (D) levels in extracts prepared from the frontal cortex and striatum of D2R-KO and WT littermates following chronic treatment with LiCI.
  • E-F Quantification of pAkt (Th308), ⁇ 8 ⁇ 3 ⁇ (Ser-9) and ⁇ -catenin levels in extracts prepared from the frontal cortex (FCx) (E) and striatum (stri) (F) of WT littermates from ⁇ 2- ⁇ following chronic treatment with lamotrigine or valproate.
  • Data (means ⁇ SEM) were normalized to average protein levels in vehicle treated animals from the same genotype.
  • Student double tailed, t-test (drug vs vehicle within each genotype). n 5 mice per group.
  • Fig. 3 pArr 2 is required for behavioral effects of chronic lamotrigine and valproate treatments
  • E-L Dark-light emergence test for ⁇ 2- ⁇ mice and WT littermates treated chronically with lamotrigine (E, G, I, K) or valporate (F, H, J, L). Behavior was scored as latency to first cross to the illuminated (light) compartment (E, F), time spent in the light compartment (G, H), activity in the illuminated (light) compartment (I, J) and total distance traveled in both compartments (K, L) for the whole duration of the 5 min test. Data are means ⁇ SEM. * p ⁇ 0.05, ** p ⁇ 0.01 , *** p ⁇ 0.005.
  • n 10 mice per group.
  • Fig. 4 Supplement to ⁇ 2 is required for behavioral effects of chronic lamotrigine and valproate treatments
  • Behavior was scored as latency to first cross to the illuminated (light) compartment, time spent in the light compartment, activity in the illuminated (light) compartment and total distance traveled in both compartments for the whole duration of the 5 min test. Data are means ⁇ SEM. * p ⁇ 0,05, ** p ⁇ 0,01 , *** p ⁇ 0,005.
  • One-way ANOVA with Bonferroni-corrected pairwise comparisons, n 10 mice per group.
  • Fig. 5 The dopamine D2 receptor forms a protein complex with brain neuronal voltage-gated sodium channels
  • Fig. 6 Co-expression of D2L with NaV1.6 abolishes cAMP-mediated signaling without affecting NaV1.6-mediated currents.
  • A) Voltage-dependence of activation of NaV1 .6 channels in NaV1 .6 cells and D2L;NaV1 .6 cells. The inset shows the voltage-clamp protocol. Currents were elicited by depolarizing steps between -100 and 90 mV in 10 mV increments for 50 ms. Cells were held at a holding potential of - 140 mV. The D2R caused no shift in the activation curve (P > 0.05), n 5.
  • EC50 for inhibition of cAMP by bromocriptine is 5.4 nM in D2L and 6.8 nM in D2S transfected HEK293 cells. No significant EC50 were measured in response to D2R ligands in cells expressing NaV1 .6. All alpha-screen measurements were replicated a minimum of three times in separate experiences.
  • Fig. 7 Supplement to co-expression of D2L with NaV1.6 abolishes cAMP- mediated signaling without affecting NaV1.6-mediated currents.
  • A-D Quantitative immuno-blot analysis of pAkt (Th308) and ⁇ 8 ⁇ 3 ⁇ (Ser9) levels in response to a 30 minute stimulation at 37 ⁇ with 20 ⁇ of the D2R agonist bromocriptine in (A) mock transfected HEK293, (B) NaV1 .6 HEK293, (C) HEK293 cells and (D) NaV1 .6 HEK293 cells transiently transfected with a D2L expression vector.
  • Veh vehicle
  • Bromo bromocriptine.
  • E, F Quantitative immunoblot analysis of ⁇ 8 ⁇ 3 ⁇ (Ser9) dephosphorylation in response to bromocriptine (Bromo) in D2L; NaV1 .6 double stable cells following a 60 min preincubation at 37 ⁇ with (E) the D2R antagonist haloperidol (0.1 ⁇ ) or (F) LiCI (2mM).
  • G Inhibition of ⁇ -2 expression in D2L; NaV1 .6 double stable cells transfected with an siRNA directed against human ⁇ 2.
  • NT. non-transfected cells.
  • H Effect of human ⁇ 2 siRNA on bromocriptine induced ⁇ 8 ⁇ 3 ⁇ activation/dephosphorylation in D2L; NaV1 .6 double stable cells.
  • F) Treatment with haloperidol (0.1 ⁇ , 37 , 60 min) or LiCI (2 mM, 37 ⁇ , 60 min) does not affect the co-immunoprecipit ation of NaV1 .6 with D2L in D2L;NaV1 .6 double stable cells.
  • FIG. 10 Working model of D2R regulated signaling pathways showing G protein and ⁇ -2-dependent mechanisms. When expressed alone, D2R would tend to signal preferentially through a G protein-mediated mechanism resulting in an inhibition of cAMP production. Interaction of D2R with NaV within a protein complex would "bias" D2R signaling toward a ⁇ Arr2-mediated mechanism resulting in the inactivation of Akt by PP2A and concomitant activation/dephosphorylation of GSK3.
  • the mood stabilizer lithium has previously been shown (Beaulieu et al., 2008a) to destabilize the interaction of Akt with ⁇ 2.
  • the anticonvulsant mood stabilizers lamotrigine and valproate would destabilize the NaV;D2R receptor complex, therefore exerting an "lithium-like" action on Akt/GSK3 signaling.
  • the non-biased D2R antagonist haloperidol can equally block D2R signaling along both G protein and ⁇ Arr2-dependent pathways by interacting with both the D2R and the NaV; D2R receptor complex.
  • Fig. 11 Regulation of 5HT2 ⁇ 2 dependent signaling by valproate Quantitative immunoblot analysis of pErk2 levels in the frontal cortex of WT mice treated with either vehicle or valproate (400mg/kg) administered along with MDL100,907 (0.1 mg/kg, i.p.) or SB242084 (3 mg/kg, i.p.). Mice were treated with MDL100,907 at 30 min or with SB242084 at 90 min after receiving either vehicle or valproate. Phospho-protein levels were quantified at 120 min after valproic acid treatment.
  • A-D Quantitative immuno-blot analysis of pErk2 levels in the frontal cortex of (C, D) ⁇ -2-KO mice or (A, B) WT littermates treated with (A, C) MDL100,907 or (B, D) SB242084.
  • E, F Treatment with valproate (10 ⁇ , 37 , 120 min) prevents the co- immunoprecipitation of NaV1 .6 with (E) 5HT2A or (F) 5HT2C in NaV1 .6 HEK293 transfected transiently with 5-HT receptor expression vectors. Co- immunoprecipitations were replicated a minimum of 5 times with identical results using separate batches of transfected cells.
  • Fig. 12 Disruption of the association between 5HT1 and NAV1.6 by valproate
  • transgenic cell refers to genetically engineered cells. Methods for genetically engineering cells are known such as molecular cloning and gene targeting.
  • cell co-expressing refers to a simultaneous expression of at least two genes of interest by the cell.
  • Methods for introducing a gene of interest within a cell are known such as transfection such as chemical-based transfection (chemical phosphate, dendrimer, liposome, cationic polymer), electroporation, sono-poration, optical transfection, gene electrotransfer, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral methods, nucleofection or heat shock.
  • a gene can be stably or transiently expressed depending on the method of gene transfection used.
  • the cell comprises at least one cell surface ionic channel.
  • At least one cell surface ionic channel refers to a pore-forming protein integrated within the cell wall helping and controling the voltage gradient across the plasma membrane of the cell by allowing the flow of ions down their electrochemical gradient.
  • Ionic channels are known such as voltage-gated, ligand-gated and other gating channels.
  • the ionic channel is a sodium channel (NaV).
  • NaV sodium channel
  • the expression “sodium channel (NaV)” refers to an integral membrane protein that forms an ion channel conducting sodium through the cell's plasma membrane.
  • the sodium channel is a voltage-gated sodium channel.
  • the expression "voltage-gated sodium channel” refers to a sodium channel which is activated by an ion.
  • Voltage-gated sodium channel normally comprises an alpha subunit that forms the ion conduction pore and one or two beta subunits that have several functions including modulation of channel gating.
  • expression of the alpha -subunit alone is sufficient to produce a functional channel.
  • the voltage-gated sodium channel comprises one alpha-subunit only. There are nine known alpha subunits having more than 50% identity in their amino acid sequence of the transmembrane segments and extracellular loop regions. The alpha- subunits are named NaV1.1 through NaV 1.9.
  • the cell comprises one of NaV 1.1 , 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8 or 1.9 alpha-subunit. In another embodiment, the cell comprises one of 1.1 , 1.2 or 1.6 alpha-subunit.
  • the nucleic acid and the amino acid sequences of these alpha-subunits are known.
  • the voltage-gated sodium channel comprises at least one beta- subunit.
  • beta-subunit refers to transmembrane glycoprotein with an extracellular N-terminus and a cytoplasmic C-terminus regulating the channel gating.
  • SCN1 B, SCN2B, SCN3B and SCN4B There are four disctinct beta subunits; SCN1 B, SCN2B, SCN3B and SCN4B. Beta 1 and 3 interact with the alpha-subunit non-covalently while beta 2 and 4 associate with alpha via disulfide bond.
  • the nucleic acid and the amino acid sequences of these beta- subunits are known.
  • the NaV channel is a ligand-gated voltage channel.
  • the expression "Ngand gated voltage channel” refers to a sodium channel activated by binding of a ligand.
  • Ligand-gated voltage channels as well as their nucleotide and amino acid sequences are known.
  • the ligand-gated channel may be glutamate NMDA receptor.
  • the ionic channel interacts with the GPCR.
  • the term “interacts” refers to the ionic channel cooperating with the GPCR.
  • the ionic channel binds to the GPCR.
  • the term “binds” refers to a physical contact between the GPCR and the ionic channel.
  • the GPCR can bind the ionic channel through transmembrane domain, through intracellular domain and/or through extracellular domain. Methods for determining the binding of proteins are known such as co- immunoprecipitation, western blot, immunofluorescence, site-directed mutagenesis or FRET.
  • G protein coupled receptor refers to a receptor having 7 transmembrane domains that senses molecule outside the cell and can activate intracellular signal transduction pathways.
  • GPCR can be grouped in 6 classes based in sequence homology; rhodopsin-like, secretin receptor family, metabotropic glutamate/pheromone, fungal mating pheromone receptor, cyclic AMP receptor and frizzled/smoothened.
  • the GPCR can be beta- adrenergic, alpha-adrenergic, angiotensin 1 , angiotensin 2, NK1 , Trace amine receptors, DREADDs (designer receptors exclusively activated by a designer drug), mu opioid receptor, delta opioid receptor, and all receptors listed in: Vassilatis, D.K., Hohmann, J.G., Zeng, H., Li, F., Collinsalis, J.E., Mortrud, M.T., Brown, A., Rodriguez, S.S., Weller, J.R., Wright, A.C., et al. (2003), The G protein-coupled receptor repertoires of human and mouse. Proc Natl Acad Sci U S A 100, 4903 ⁇ 1908.
  • the GPCR is a serotonin receptor.
  • serotonin receptor refers to GPCR activated by serotonin or analogues thereof.
  • the serotonin receptors are divided in subclasses such as 5-HT1A, 5-HT1 B, 5-HT2A, 5-HT2B, 5-HT2C, 5-HT4, 5-HT5A, 5-HT5B, 5-HT6 and 5-HT7.
  • the serotonin receptor is 5-HT1A, 5-HT2A and/or 5-HT2C.
  • the nucleic acid and the amino acid sequences of these receptors are known.
  • the GPCR receptor is a dopamine receptor.
  • dopamine receptor refers to a GPCR activated by dopamine or analogues thereof.
  • D1 -like family comprises D1 and D5 receptors
  • D2-like family comprises D2, D3 and D4 receptors.
  • the GPCR is D2 dopamine receptor.
  • D2 receptor exists under a short form (D2S) and a long form (D2L).
  • D2S short form
  • D2L long form
  • the nucleic acid and the amino acid sequences of these receptors are known.
  • the transgenic cell expresses dopamine and serotonin receptors.
  • At least one GPCR signaling pathway is modulated in the cell by a GPCR signaling compound.
  • GPCR signaling pathway refers to an intracellular modification triggered by the GPCR. GPCR are known to modulate G-protein- dependent signaling pathway as well as G-protein independent signaling pathway.
  • the GPCR signaling pathway is cAMP (Cyclic Adenosine Monophosphate)/ PKA (Protein Kinase-A) pathway, Ca2+/PKC (Protein Kinase- C) pathway, Ca2+/NFAT (Nuclear Factor of Activated T-cells) pathway, PLC (Phospholipase- C) pathway, PTK (Protein Tyrosine Kinase) pathway, PKC/MEK (MAPK/ERK1 ) pathway, p43/p44MAPK (Mitogen Activated Protein Kinase) pathway, p38 MAP pathway, PI3K (Phosphoinositide-3 Kinase) pathway, NO-cGMP pathway, Rho pathway, NF-KappaB (Nuclear Factor-Kappa B) pathway and JAK (Janus Kinase )/ STAT (Signal Transducers and Activators of Transcription Factors) pathway and/or beta-ar
  • the beta-arrestin pathway comprises Akt/GSK3 pathway and/or Akt/beta-arrestin/PP2A pathway (Louis M. Luttrell and Diane Gesty-Palmer, Beyond Desensitization: Physiological Relevance of Arrestin-Dependent Signaling Pharmacol Rev June 2010 62:305-330; published ahead of print April 28, 2010, doi: 10.1 124/pr.109.002436 and Beaulieu JM et al. Frontiers in Molecular Neuroscience, 201 1 , vol. 4, article 34, p. 1 -13).
  • the GPCR signaling pathway is the beta-arrestin pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway.
  • the proteins involve in these signaling pathways are known in the art.
  • beta-arrestin can be involved in the desensitisation of the GPCR and/or in the inhibition of Akt which can lead to an activation of GSK3 pathway.
  • GPCR coupled to Gas or Gai/o protein can either increase or inhibit the production of cAMP and consequently activate or inhibit PKA.
  • GPCR can for instance activate PKC/MEK (MAPK/ERK1 ) pathway following PLC activation.
  • the term “modulated” refers to an alteration in the activity of the signaling pathway.
  • the signaling pathway may be activated, enhanced, reduced or inhibited.
  • Methods for measuring a modulation in a GPCR signaling pathway are known such as phosphorylation assay, calcium assay, cAMP assay, co-immunoprecipitation, and dephosphorylation assay.
  • the expression "GPCR signaling compound” includes compounds such as small molecules, nucleic acids, antibodies or polypeptides capable of interacting with a biological target molecule, in particular with a protein, in such a way as to modify the biological activity thereof.
  • the GPCR signaling compound is a GPCR ligand.
  • GPCR ligand refers to a substance that forms a complex with a GPCR to serve a biological purpose.
  • the GPCR ligand can be for instance, dopamine, serotonin, endothelin, bradykinin, angiotensin, somatostatin, neuropeptide, opioids, leukotriens, vasopressin, neurotensin, calcitonin, secretin or functional analogues thereof.
  • the expression “functional analogues thereof refers to compound having similar structure, differing in respect to certain component but having the same or a similar biological function.
  • the cell is a HEK293 cell.
  • ⁇ 293 refers to Human Embryonic Kidney 293 cells line transformed with adenovirus 5 DNA.
  • HEK293 can be obtained from ATCC (ATCC number CRL-1573).
  • the activity of Akt pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway is reduced following stimulation with a GPCR signaling compound.
  • a reduction in the Akt activity pathway can be measured by a phosphorylation assay as known. For instance, phosphorylation of Akt and GSK3 can be reduced by at least 40% following stimulation with a GPCR signaling compound such as a dopamine receptor agonist.
  • the cAMP/PKA pathway which is a GPCR canonical G protein- mediated mechanism inhibiting cAMP production can be reduced following stimulation with a GPCR signaling compound such as dopamine.
  • Reduction of cAMP production can be measured by cAMP assay as known. For instance, the cAMP inhibition can be reduced by at least 50% relative to a control.
  • the PKC/MEK pathway can also be reduced following stimulation with a GPCR signaling compound such as serotonin.
  • Reduction of the PKC/MEK signaling pathway can be measured by a phosphorylation assay as known. Phosphorylation of Erk1 and/or Erk2 protein can be reduced.
  • the GPCR signaling can be biased away from the canonical G protein- mediated mechanism towards beta-arrestin signaling in a cell co-expressing at least one GPCR and at least one ionic channel.
  • the GPCR signaling compound is an ionic channel ligand.
  • ionic channel ligand refers to a substance that forms a complex with an ionic channel to serve a biological purpose.
  • the ionic channel ligand can be for instance lamotrigine, valproate or analogues thereof.
  • the GPCR signaling compound is a ionic channel ligand
  • the GPCR can be stimulated with a GPCR ligand in order to measure the effect of the ionic channel ligand on the GPCR signaling pathway.
  • a use of the cell as described herein for identifying a GPCR signaling compound which can modulate at least one GPCR signaling pathway is provided. Said cell can be used in a screening method.
  • a screening method for identifying a GPCR signaling compound capable of modulating at least one GPCR signaling pathway comprises the step of contacting a cell co-expressing at least one cell surface ionic channel and at least one GPCR as described above with the GPCR signaling compound.
  • the expression "contacting a transgenic cell” refers to allowing the GPCR signaling compound to be in close proximity with the cell.
  • the GPCR signaling compound can be added to a tissue culture media nourishing the cell.
  • the method further comprises the step of determining the ability of the GPCR signaling compound to modulate at least one GPCR signaling pathway.
  • determining the ability of the GPCR signaling compound to modulate refers to evaluate if the GPCR signaling compound can activate, enhance, reduce or inhibit at least one GPCR signaling pathway.
  • Methods for evaluating activation, enhancement, reduction or inhibition of a GPCR signaling pathway are known such as phosphorylation assay, calcium assay, cAMP assay, co-immunoprecipitation, and dephosphorylation assay.
  • determination of modulation of a GPCR signaling pathway is relative to a control.
  • control refers to determining the modulation of the GPCR signaling pathway in the absence of the GPCR signaling compound. If the GPCR signaling compound can activate, enhance, reduce or inhibit at least one GPCR signaling pathway it indicates that it modulates the at least one GPCR signaling pathway.
  • the beta-arrestin pathway is reduced or disrupted in the presence of the GPCR signaling compound following GPCR stimulation.
  • Reduction or disruption of beta-arrestin pathway can be measured by evaluating phosphorylation of Akt and/or GSK3 relative to a control such as in absence of the GPCR signaling compound. A reduction of phosphorylation or a prevention of Akt and/or GSK3 dephosphorylation indicates that the beta-arrestin pathway is reduced or disrupted.
  • the transgenic cells as described herein can be used for characterize and/or study a GPCR pathway.
  • the transgenic cells are contacted with a compound and the level of activity of the GPCR pathway is analysed compared to a control.
  • Methods for evaluating the activity of a GPCR pathway are known such as anaylising the level of proteins phosphorylation, immunoprecipitation, western blot.
  • D2R may exist in at least two different forms, one that is not associated to NaV and signals to Goci/o and another that is incorporated to D2R/NaV receptor complexes that signal through ⁇ 2 to inhibit Akt and activate GSK3 isoforms (Figure 10).
  • NaV.1 .6 is distributed unevenly in the neuronal dendritic compartment (Lorincz and Nusser, 2010) therefore supporting the idea that dendritic microdomains expressing D2R and NaV1 .6 differently may exist in vivo.
  • the present inventors have investigated the contribution of ⁇ Arr2-mediated D2R signaling in the regulation of the Akt/GSK3 pathway and associated behaviors by valproate and lamotrigine.
  • lamotrigine and valproate can disrupt ⁇ Arr2-mediated D2R signaling by preventing the formation of a receptor complex between D2R and voltage-gated sodium channels (NaV), a known direct molecular target of anticonvulsant mood stabilizers (Rogawski and Loscher, 2004b).
  • NaV voltage-gated sodium channels
  • co-expression of D2R with NaV results in a shift of D2R signaling from cAMP to ⁇ 2.
  • the inventors believe that this suggests a mechanism through which a farm illy of cell surface proteins can modulate 7TM coupling to G protein or ⁇ in vivo.
  • Both of these proteins have multiple transmembrane domains, seven single alpha helix domains for the D2R (Beaulieu and Gainetdinov, 201 1 ) and four repeated transmembrane domains each composed of 6 alpha helixes— for a total of 24 alpha helixes— for NaV (Chahine et al. , 2008).
  • valproate and lamotrigine are both binding to transmembrane domains within the different NaV oc-subunits (Liu et al. , 2003; Rogawski and Loscher, 2004a, b; Yang et al. , 2010).
  • valproate and lamotrigine also appear to modulate the production of prostaglandins, possibly as a downstream consequence of disrupted D2R signaling (Ramadan et al., 201 1 ).
  • Valproic acid is also a weak histone deacethylase inhibitor (Phiel et al., 2001 ), but the contribution of this effect to its clinical action on mood disorders remains unclear. Future studies in human are needed to establish the potential clinical relevance of a disruption of the D2R/NaV1 .6 receptor complex by these drugs.
  • valproate and lamotrigine would prevent the ⁇ Arr2-mediated signaling to Akt and GSK3 that is- mediated by this complex, therefore providing a signaling network for the shared action of antipsychotics, lithium and anticonvulsant mood stabilizers on brain Akt and GSK3 activity.
  • this model also suggests a close physical proximity between D2R/NaV receptor complexes targeted by valproate and lamotrigine and the Akt ⁇ Arr2/PP2A signaling complex that is targeted by lithium.
  • D2R are known to signal through at least two parallel pathways ( Figure 1A).
  • One of these is-mediated by Gai/o proteins that inhibit the production of cAMP. This results in a reduction of protein kinase A (PKA) activity and, thus, reduced phosphorylation of PKA substrates like the Thr34 of the dopamine and cAMP-regulated phosphoprotein MW 32 kD (DARPP-32)(Bateup et al., 2008; Hemmings et al., 1984).
  • PKA protein kinase A
  • the other pathway is-mediated by ⁇ 2 and results in a dephosphorylation/inactivation of Akt on Thr308 and in the activation of GSK3 isoforms following the dephosphorylation of their aminoterminal serine residues (Beaulieu and Gainetdinov, 201 1 ; Beaulieu et al., 2005; Beaulieu et al., 2004).
  • D2R antagonist haloperidol known to affect Akt/GSK3 signaling (Emamian et al., 2004; Manago et al., 2012) to validate the use of ⁇ 2 and D2R-KO mice in the assessment of differential effects of drugs on these two pathways in vivo.
  • the mood stabilizer drugs lithium, valproate and lamotrigine have all been reported to increase the phosphorylation of Akt and GSK3 isoforms when given chronically (Abelaira et al., 201 1 ; Beaulieu et al., 2008a; De Sarno et al., 2002). Furthermore, it has been shown (Beaulieu et al., 2008a; O'Brien et al., 201 1 ; Pan et al., 201 1 ) that in the case of lithium, this effect is-mediated by a disruption of ⁇ Arr2-mediated signaling, presumably downstream of D2R.
  • Reduction of spontaneous exploratory locomotor activity in a novel environment is a test with predictive validity for the identification of antimanic drugs and has been used extensively since the early days of the development of mood stabilizers (Beaulieu et al., 2004; Cade, 1949; Ralph-Williams et al., 2003).
  • Reduction of immobility time in the tail suspension test (TST) is a behavioral paradigm commonly used to evaluate "antidepressant-like" effects of drugs in rodents (Crowley et al., 2005; Crowley et al., 2004).
  • the dark-light emergence test is a lithium-responsive (Beaulieu et al., 2008a), behavioral assay that reveals the potential efficacy of antidepressants and anxiolytics in rodents.
  • DLET dark-light emergence test
  • mice are placed in a darkened compartment and allowed free exploration of the darkened and adjoining bright compartments (Beaulieu et al., 2008b; Crawley, 2008; Weisstaub et al., 2006).
  • Variation of several parameters such as a reduction of the latency to cross from the dark to the illuminated compartment as well as increased in time spent and locomotor activity in the illuminated compartment are used to assess drug efficacy.
  • this test provides an overall measurement of locomotor activity in both compartments that can be used as a separate measure of novelty- induced locomotor activity under environmental conditions that are different from those used in previous tests.
  • NaV1 .6 was also immunoprecipitated using D2R antibodies in NaV1 .6 stable cell lines that were transfected transiently with the D2L expression vector but not from cells that did not express the D2R ( Figure 5D).
  • immunoprecipitation of NaV1 .6 from the double stable cells led to a coimmunoprecipitation of the D2R ( Figure 5E).
  • D2R activation does not affect NaV1.6 channel currents
  • D2R have been shown to interact with at least two different types of neuronal ion channels (Beaulieu and Gainetdinov, 201 1 ).
  • Interaction of D2R with the NR2B subunit of the glutamate NMDA receptor (Liu et al. , 2006) or with N-type calcium channels (Kisilevsky and Zamponi, 2008) have both been shown to inhibit channel current following D2R activation.
  • HEK293 and HEK293 NaV1 .6 stable cell lines were transfected transiently with a vector expressing the human D2S.
  • the effect of bromocriptine on Akt and GSK3 phosphorylation was measured by immunoblotting of phospho-Akt (Thr308) and phospho-GSh ⁇ (Ser9).
  • bromocriptine had no effect on Akt or GSK3 phosphorylation on cells that did not express the D2R ( Figure 8A, B).
  • Lithium can antagonize D2R ⁇ Arr2-mediated signaling in vivo by interfering with the formation of the Akt ⁇ Arr2/PP2A signaling complex that mediates this cellular response (Beaulieu et al., 2008a; Beaulieu et al., 2005).
  • D2L;NaV1 .6 receptor complex As a first step to verify the involvement of ⁇ 2 in the regulation of GSK3 phosphorylation by the D2R/NaV1 .6 receptor complex, D2L;NaV1 .6 double stable cells were stimulated with bromocriptine in the presence and absence of lithium. Immunoblot analysis from these experiments revealed that the ⁇ 8 ⁇ 3 ⁇ (Ser9) dephosphorylation in these cells is antagonized by lithium (Figure 8F).
  • mice C57BL/6J and D2R-KO mice were obtained from The Jackson Laboratory (Bar Harbor, ME). pArr2-KO mice have been described previously (Beaulieu et al., 2005; Bohn et al., 1999). Animals were genotyped by PCR amplification from ear punch biopsy genomic DNA and genotypes were reconfirmed after experimentation. Respective WT littermates were used as controls for KO mice. All mice were used at 3-4 months of age and housed 4-5/cage with ad libitum access to food and water in a humidity-controlled room at 23 on a 12 h light- dark cycle. All experimental procedures were approved by the Universite Laval Institutional Animal Care Committee according to guidelines from the Canadian Council on Animal Care.
  • haloperidol (Sigma-Aldrich, Oakville, Ontario, Canada) was solubilized in a minimal volume of dimethyl sulfoxide (DMSO; Sigma-Aldrich) and brought to volume with distilled water as described (Emamian et al., 2004).
  • DMSO dimethyl sulfoxide
  • LiCI LiCI (Sigma-Aldrich) was added to the drinking water for a period of 15 days at a concentration of 0.12% (w/v), which produces brain lithium concentrations of ⁇ 0.8 mM in mice from the different genotypes without affecting water intake (Beaulieu et al., 2008a).
  • Valproate was administered for a period of 21 days in chow at a concentration of 10 mg/kg of chow as described (Hao et al., 2004; Leng et al., 2008).
  • Lamotrigine Tocris Bioscience, Bristol, UK
  • Lamotrigine was prepared as a suspension in a minimal amount of Tween-20 and brought to volume with distilled water. It was then administered once daily (10 mg/kg, i.p.) for a period of 21 days (Ahmad et al., 2004; Chang et al., 2009). All experiments were carried out 6 h after cessation of drug administration.
  • lamotrigine, haloperidol, forskolin (Sigma-Aldrich), bromocriptine (Tocris Bioscience) and spiperone (Sigma-Aldrich) were prepared in a minimal volume of DMSO and brought to volume in cell culture media.
  • Valproic acid and LiCI were prepared in phosphate buffered saline (PBS). Drugs were used at different concentrations and for different time periods as specified in figure legends.
  • the anti-phospho-GSK3p (Ser9), anti-p-catenin, anti ⁇ Arr2 and anti-DARPP32, were purchased from Cell Signaling Technology (Beverly, MA).
  • Anti-Phospho DARPP32 (Th34) antibodies were obtained from Phosphosolutions (Aurora, CO).
  • Anti-total- GSK3a/p clone 001 1 -A monoclonal antibodies and anti-phospho-Akt (Thr308) polyclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA).
  • Anti- total-Akt monoclonal antibodies were obtained from Biosources (San Diego, CA).
  • Anti-D2R(L/S) polyclonal and anti-actin clone c4 monoclonal antibodies were purchased from Millipore (Billerica, MA).
  • Anti-PAN NaV polyclonal was from Alomone Lab (Jerusalem, Israel).
  • Anti-NaV1 .6 monoclonal clone 4G7 was purchased from Sigma-Aldrich, anti-NaV1 .1 and anti-NaV1 .2 were purchased from UC Davis/NIH NeuroMab Facility (Davis, CA). Quantitative Immunoblots
  • mice were killed by decapitation, after which the heads were immediately cooled by immersion in liquid nitrogen for 6 sec.
  • the right hemistriatum and hemifrontal-cortex were rapidly dissected out (within 30 sec) on an ice-cold surface and frozen in liquid nitrogen before protein extraction.
  • Tissue samples were homogenized in boiling 1 % (v/v) SDS solution and boiled for 5 min. Protein concentration was measured using a DC-protein assay (Bio-Rad, Hercules, CA).
  • cells where frozen on liquid nitrogen and sonicated in boiling 1 % (v/v) SDS solution.
  • Protein extracts (25 or 50 g) were separated on 10% SDS/PAGE Tris-glycine gels (Life Technologies, Burlington, Ontario) and transferred to nitrocellulose membranes. Blots were immunostained overnight at 4 with prim ary antibodies. Immune complexes were revealed using appropriate IR dye labeled secondary antibodies from Licor Biotechnology (Lincoln, NE). Quantitative analyses of fluorescent IR dye signal were carried out using an Odyssey Imager (Licor Biotechnology). For quantification, actin was used as a loading control for the evaluation of total protein levels while respective total protein signals were used as loading controls for each phospho-protein signal. Results were further normalized to respective control conditions in order to allow for comparison between separate experiments. The gels shown in the figures correspond to representative experiments, where each lane corresponds to a separate animal. Separate gels are presented within separate frames and apparent signals may not be directly comparable between gels pictures.
  • HEK293-NaV1 .6 cells where described previously (Zhao et al. , 201 1 ) and were maintained as monolayer cultures at 37 in Dubelco 's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum heat-inactivated (FBS-HI), 2 mM L-glutamine, 400 ⁇ g/mL geneticin and penicillin/streptavidin.
  • Stable (D2L; NaV1 .6) cell lines co-expressing NaV1 .6 and D2L were derived from HEK293- NaV1 .6 cells.
  • the D2 receptor cDNA was inserted into and expression vector encoding an hygromycin resistance gene.
  • the full length coding region of mouse D2 long (D2L) dopamine receptor was amplified by PCR from a D2 L R-RLuc expression vector (Masri et al. , 2008) using the following primers: AAAAGCTAGCATGGATCCACTGAACCTGTCC (SEQ ID NO: 1 ) and AAAAGGTACCTCAGCAGTGCAGGATCTTCAT (SEQ ID NO:2) containing respectively a Nhe I and Kpn I restriction site.
  • the 1 .3 Kb PCR amplicon was cloned into a pcDNA3 + vector in which the neomycin-resistant cassette has been replaced by a hygromycin-resistant one.
  • the hygromycin-resistant gene was amplified by PCR using the following primers:
  • AAAACCTAGGATGAAAAAGCCTGAACTCACTCACC SEQ ID NO:3
  • AAAACCCGGGCTATTCCTTTGCCCTCGGACGAGTGCTG SEQ ID NO:4
  • HEK293 or HEK293-NaV1 .6 cells were transfected using calcium phosphate precipitates with15 ⁇ g (for a p-100 plate) of DNA encoding the mouse D2L or the short isoform of the human D2 receptor (D2S) (Kim et al., 2001 ). siRNA silencing of
  • siRNA (sense: AAGGACCGCAAAGUGUUUGUG (SEQ ID NO:5); antisense: CACAAACACUUUGCGGUCCUU (SEQ ID NO:6); Santa Cruz) directed against human ⁇ 2 and commercially available control siRNA (Santa Cruz) were introduced into D2L;NaV1 .6 cells using Lipofectamine 2000TM (Life Technologies) according to manufacturer protocol. A total of 480 pmol of siRNA per well of a 6-well plate were used on 50% confluent cells. Following transfection, cells were cultured at 37 for 48 h in regular media prior to stimulation .
  • cAMP assays were performed using AiphaScreenTM cAMP assay kit from PerkinElmer (Boston, MA) based on the competition between endogenous cAMP and exogenous added biotinylated cAMP. Briefly, a mix of cells and anti-cAMP Acceptor beads was stimulated with agonists at room temperature in an OptiPlate- 384 (PerkinElmer). After a 30 m in incubation, a lysis/detection mix was added and plates were read after 1 hour incubation using an AiphaScreen plate reader. Number of cells per well and forskolin (Sigma-Aldrich) dose response curve experiments were carried out first to determine the optimal assay conditions. Subsequently, cAMP measurements were assessed using 10 000 cells/well and a forskolin concentration of 10 ⁇ corresponding to the EC 8 o- When using antagonists, preincubation of 30 minutes was performed before cells stimulation.
  • Cells or striatum homogenates were incubated for 30 min at 4 with rotation and centr ifuged for 30 min at 4 (15,000 rpm). Immunoprecipitations were conducted overnight in a volume of 150 ⁇ at 4 in lysis buffer using 400 ⁇ g of supernatant proteins and either Anti-D2R(L/S) polyclonal (1/200) (Millipore, Billerica, MA) or Anti-Nav1 .6 monoclonal clone 4G7 (1/100) (Sigma-Aldrich). Immuno-labelled protein supernatant were incubated and rocked for 2 h with magnetic dynabeads protein A (Life Technologies) at 4 .
  • Dynabeads were separated from the supernatant with a magnetic wall, rinsed with lysis buffer and pellet were resuspended in pre-heated (95 ) Laemml i sample-buffer complemented with 5% ⁇ -mercaptoethanol. Purified proteins were boiled for 5 min. Protein extracts were analyzed by immunoblot. Immune complexes were detected using appropriate HRP peroxidase-conjugated secondary antibody (Jackson Immuno-Research, West Grove, PA) along with a chemoluminescent reagent (Super Signal West-Pico, Thermo Scientific). Luminescence was detected using Ultra Cruz autoradiography film blue (Santa Cruz Biotechnology, inc.). All experiments were replicated a minimum of 5 times with identical results using separate batches of transfected cells or brain extracts.
  • the whole cell configuration of the patch-clamp technique was used to record macroscopic Na + currents from HEK293 D2L;NaV1 .6 and HEK293 NaV1.6 stable cell lines.
  • the pipette solution was composed of 5 mM NaCI, 135 mM CsF, 10 mM EGTA, and 10 mM Cs-HEPES.
  • the pH was adjusted to 7.4 using 1 N CsOH.
  • the bath solution was composed of 150 mM NaCI, 2 mM KCI, 1 .5 mM CaCI 2 , 1 mM MgCI 2 , 10 mM glucose, and 10 mM HEPES.
  • the pH was adjusted to 7.4 with 1 N NaOH.
  • the recordings were taken exactly 5 min after the whole cell configuration was obtained to allow the current to stabilize and fully dialyze the cell with pipette solution.
  • the needle of a constantly running gravity-driven perfusion system was positioned close to the recorded cell and drug was applied by switching to bath solution containing the indicated concentration.
  • a series of test pulse at -10 mV for 50 ms every 5 s from a holding potential of -140 mV were recorded during the perfusion.
  • Na + currents were recorded at room temperature (22-23 ).
  • Command pulses were generated, and currents were recorded using pCLAMP software (version 8.0) and an Axopatch 200 amplifier (Molecular Devices, Sunnyvale, CA).
  • Patch electrodes were fashioned from borosilicate glass (Corning 8161 ) and coated with silicone elastomer (Sylgard, Dow- Corning, Midland, Ml) to minimize stray capacitance. Current recordings were taken using low-resistance electrodes ( ⁇ 1 ⁇ ), and the series resistance was compensated at values of >80% to minimize patch-clamp errors. Whole cell currents were filtered at 5 kHz, digitized at 10 kHz, and stored on a microcomputer equipped with an analog-to-digital converter (Digidata 1300, Molecular Devices).
  • mice were housed 4-5/cage in a humidity-controlled behavior tests room at 23 ⁇ on a 12 h light-dark cy cle for the duration of chronic drug treatment and then tested for 30 min without further drug injections as described above.
  • mice were tested for 6 min in a tail suspension apparatus (Med-Associates) as described (Beaulieu et al., 2008b; Crowley et al., 2004). Behavior was scored as time spent in immobility (sec) over the last 4 minutes of the test. The light-dark emergence test
  • the light-dark emergence test was performed for a period of 5 min with mice placed initially at the center of the dark chamber, as described (Beaulieu et al., 2008b; Weisstaub et al., 2006). Tests were conducted using an automated open field activity setup with light/dark insert (Med-Associates) with the light compartment illuminated at 600 lux. The total time spent in light compartments, the locomotor activity in the light compartment, the total distance traveled and the delay to cross from the dark to the light chamber for the first time, were used as parameters for analysis. Statistical analysis
  • a beta-arrestin 2 signaling complex mediates lithium action on behavior.
  • GPCR interacting proteins in the nervous system: Roles in physiology and pathologies. Annu Rev Pharmacol Toxicol 50, 89-109. Bohn, L.M., Lefkowitz, R.J., Gainetdinov, R.R., Peppel, K., Caron, M.G., and Lin, F.T. (1999). Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science 286, 2495-2498.
  • a beta-arrestin-biased agonist of the parathyroid hormone receptor promotes bone formation independent of G protein activation.
  • DARPP-32 a dopamine-regulated neuronal phosphoprotein, is a potent inhibitor of protein phosphatase-! Nature 310, 503-505.
  • Kebabian J.W., and Calne, D. B. (1979). Multiple receptors for dopamine. Nature 277, 93-96.
  • beta- Arrestin a protein that regulates beta-adrenergic receptor function. Science 248, 1547-1550.
  • AKT kinase activity is required for lithium to modulate mood-related behaviors in mice.
  • Neuropsychopharmacology official publication of the American College of Neuropsychopharmacology 36, 1397-141 1 .
  • Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen. J Biol Chem 276, 36734-36741.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

TRANSGENIC CELLS FOR IDENTIFYING GPCR SIGNALING COMPOUND MODULATING GPCR SIGNALING PATHWAY AND SCREENING METHOD
THEREOF
The present invention relates to transgenic cells for identifying GPCR signaling compounds modulating G-protein coupled receptor (GPCR) signaling pathway and a screening method for identifying such GPCR signaling compounds.
Seven transmembrane domain receptors (7TM) are the largest family of cell surface receptors encoded by the human genome and represent at least 25% of the molecular targets for existing drugs (Overington et al., 2006; Vassilatis et al., 2003). These receptors are known also as G protrein-coupled receptors (GPCRs) since they are believed to exert their major effects on cell signaling by activating heterotrimeric G proteins (Northup et al., 1983). However, beyond their role in regulating G proteins, 7TM also signal through G protein independent mechanisms (Galandrin et al., 2007; Luttrell et al., 1999; Luttrell and Gesty-Palmer, 2010; Premont and Gainetdinov, 2007). For instance, the multifunctional signaling proteins beta-arrestin 1 and 2 (βΑΓ and βΑΓΓ2)— that were originally associated with the desensitization of G protein-mediated signaling (Ferguson et al., 1996; Lohse et al., 1990)— activate several signaling pathways downstream of 7TMs by acting as scaffolds for kinases and phosphatases (Beaulieu et al., 2009; Kovacs et al., 2009). This multiplicity of signaling mechanisms downstream of 7TM has led to the development of functionally selective ligands, in the hope of reducing unwanted side effects by targeting cell signaling mechanisms more specifically (Beaulieu and Gainetdinov, 201 1 ; Kenakin and Miller, 2010; Rajagopal et al., 2010). However, still little is known about the determinants of G protein and βArr-mediated signaling in vivo. Indeed, it is possible that in addition to ligand functional selectivity, changes in protein-protein interactions or in cellular microenvironments may also contribute to the regulation of 7TM signaling (Bockaert et al., 2010). The dopamine D2 receptors (D2R) are prototypical 7TMs that exist under a short (D2S) and a long (D2L), alternate spliced isoforms (Beaulieu and Gainetdinov, 201 1 ; Giros et al., 1989). Strong evidence indicates that D2L mostly acts as an alloreceptor on striatal medium spiny neurons and other neurons receiving dopaminergic projections (Usiello et al., 2000). In contrast, the D2S would act principally as an autoreceptor on dopaminergic neurons. D2R have classically been shown to couple to Gai/o to inhibit the synthesis of cyclic adenosine monophosphate (cAMP) (Kebabian and Calne, 1979). However, D2R also signals through a βΑΓΓ2 dependent mechanism that results in the formation of a protein complex comprised of βΑΓΓ2, the protein kinase Akt and protein phosphatase 2A (PP2A) (Beaulieu et al., 2005; Beaulieu et al., 2004). Dephosphorylation of Akt on its activatory threonin 308 (Thr308) residue by PP2A within this complex results in Akt inactivation (Alessi et al., 1996; Beaulieu et al., 2005; Jacinto et al., 2006). This leads to a concomitant activation of glycogen syntase kinase 3 isoforms (GSK3oc and β), which are normally inactivated by Akt following the phosphorylation of regulatory amino-terminal serine residues— Ser 21 for GSK3oc and Ser9 for GSI^ (Cross et al., 1995; Kaidanovich- Beilin and Woodgett, 201 1 ). Importantly, inhibition of GSK3 has also been shown to antagonize several behavioral actions of dopamine, at least in rodents (Beaulieu and Gainetdinov, 201 1 ; Beaulieu et al., 2004; Gould et al., 2004; Kalinichev and Dawson, 201 1 ).
The D2R is a major target of antipsychotic drugs (Roth et al., 2004; Seeman et al. 1976; Snyder, 1976). Interestingly, recent in vitro characterization of the effects of several antipsychotics on cAMP levels and βΑΓΓ2 recruitment have suggested that some of these drugs can act as functionally selective antagonist of βArr2-mediated mechanisms downstream of D2L (Masri et al., 2008). In addition, the mood stabilizer drug lithium, which is used for the treatments of mood disorders and psychosis, could regulate behavior in mice by disrupting the integrity of a Akt^Arr2/PP2A signaling complex (Beaulieu et al., 2008a; O'Brien et al., 201 1 ). Disruption of this complex prevents the deactivation of Akt by PP2A, which restores the inhibition of GSK3 isoforms by Akt. Interestingly, the anticonvulsant mood stabilizer drugs valproate and lamotrigine have also been shown to activate Akt and inhibit GSK3 following chronic treatment in mice (Abelaira et al., 201 1 ; Beaulieu et al., 2009; De Sarno et al., 2002). However, the potential contribution of D2R and βΑΓΓ2 to the regulation of Akt/GSK3 signaling and behavior by these mood stabilizers has remained unexplored.
There is thus a need for an in vitro tool or screening methods that would allow identification of GPCR signaling pathway modulators reproducing at least partially in vivo biological responses.
The present inventors have surprisingly found that a G protein coupled receptor (GPCR) signaling pathway can be modulated by a cell co-expressing a cell surface ionic channel and a GPCR upon stimulation with a compound reproducing in vivo biological response. This transgenic cell can be used in a screening method for identifying compounds that have the capability of modulating a GPCR signaling pathway.
In one aspect, there is provided a transgenic cell co-expressing at least one cell surface ionic channel and at least one G protein coupled receptor (GPCR), wherein at least one GPCR signaling pathway is modulated by a GPCR signaling compound.
In one aspect, there is provided a screening method for identifying a GPCR signaling compound modulating at least one G protein coupled receptor (GPCR) signaling pathway, the method comprising the steps of: a) contacting a transgenic cell with the GPCR signaling compound wherein the transgenic cell co-expresses at least one cell surface ionic channel and at least one GPCR; and b) determining the ability of the GPCR signaling compound to modulate the at least one GPCR signaling pathway; wherein determining modulation of the at least one GPCR signaling pathway relative to a control indicates that the GPCR signaling compound modulates the at least one GPCR signaling pathway.
BRIEF DESCRIPTION OF THE FIGURES
Fig.1 Regulation of βΑπ-2-mediated D2R signaling by lamotrigine and valproate
A) Schematic representation of D2R regulated signaling pathways showing G protein and βArr2-mediated mechanisms. (AC: adenylate cyclase). B, C) Immunoblot analysis (B) and quantification (C) of pAkt (Thr-308) and pDARPP32 (Thr-34) in the striatum of βΑΓΓ2-ΚΟ, D2R-KO and respective WT littermates after acute treatment with haloperidol (Halo, 1 mg/kg, i.p.). Since G protein and βArr2-mediated responses occur with different dynamics, DARPP-32 and Akt phosphorylation were measured at 15 and 120 min respectively after haloperidol administration as described (Emamian et al. , 2004; Pozzi et al. , 2003). D, E) Immunoblot analysis (D) and quantification (E) of pAkt (Thr-308) and pDARPP32 (Thr-34) in the striatum of WT C57BI6 mice treated chronically with lithium (LiCI, 0, 12% in water), lamotrigine (Lamo, 10 mg/kg i.p.) or valproate (Val, 10 mg per kg of chow) or respective vehicles. F-l) Immunoblot analysis (F) and quantification (G-l) of pAkt (Th308), pGSh^ (Ser-9) and β-catenin levels in extracts prepared from the striatum or frontal cortex (FCx) of D2R-KO (F, H), βΑπ-2-KO (I) and WT littermates following chronic treatment with lamotrigine or valproate. WT mice presented in G are littermates of D2R-KO mice. Data for βΑΓΓ2-ΚΟ WT littermates are presented in figure 2. For all analysis respective total protein signal were used as internal reference for phospho-proteins. Actin was used as a reference for the measurement of β-catenin levels. Data (means± SEM) were normalized to average protein levels in vehicle treated animals from the same genotype. *p<0.05, **p<0.01 , ***p<0.005. Student double tailed, t-test (drug vs vehicle within each genotype). n= 5 mice per group. Detection and quantification of immunoblot signal were performed within a linear signal range using near infrared fluorescence and a LiCor Odyssey.
Fig. 2 Supplement to regulation of βΑπ-2-mediated D2R signaling by lamotrigine and valproate. A-D) Western blot analysis (A) and quantification (B-D) of pAkt (Th308) (B), pGSh^ (Ser-9) (C) and β-catenin (D) levels in extracts prepared from the frontal cortex and striatum of D2R-KO and WT littermates following chronic treatment with LiCI. E-F) Quantification of pAkt (Th308), ρΘ8Κ3β (Ser-9) and β-catenin levels in extracts prepared from the frontal cortex (FCx) (E) and striatum (stri) (F) of WT littermates from βΑΓΓ2-ΚΟ following chronic treatment with lamotrigine or valproate. Data (means± SEM) were normalized to average protein levels in vehicle treated animals from the same genotype. *p<0,05, **p<0,01 , ***p<0,005. Student double tailed, t-test (drug vs vehicle within each genotype). n= 5 mice per group.
Fig. 3 pArr 2 is required for behavioral effects of chronic lamotrigine and valproate treatments A, B) Locomotor activity in a novel environment for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with lamotrigine (A) or valporate (B). Locomotion was measured as total distance traveled for the duration of the test (30 min). C, D) Tail suspension tests for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with lamotrigine (C) or valporate (D). Behavior was scored as time spent in immobility (s) for the last 4 min of the test. E-L) Dark-light emergence test for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with lamotrigine (E, G, I, K) or valporate (F, H, J, L). Behavior was scored as latency to first cross to the illuminated (light) compartment (E, F), time spent in the light compartment (G, H), activity in the illuminated (light) compartment (I, J) and total distance traveled in both compartments (K, L) for the whole duration of the 5 min test. Data are means± SEM. *p<0.05, **p<0.01 , ***p<0.005. One-way AN OVA with Bonferroni-corrected pairwise comparisons, n= 10 mice per group.
Fig. 4 Supplement to βΑιτ 2 is required for behavioral effects of chronic lamotrigine and valproate treatments A) Locomotor activity in a novel environment for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with LiCI. Locomotion was measured as total distance traveled for the duration of the test (30 min). B) The tail suspension tests for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with LiCI. Behavior was scored as time spent in immobility (s) for the last 4 min of the test. C) Dark-light emergence test for βΑΓΓ2-ΚΟ mice and WT littermates treated chronically with LiCI. Behavior was scored as latency to first cross to the illuminated (light) compartment, time spent in the light compartment, activity in the illuminated (light) compartment and total distance traveled in both compartments for the whole duration of the 5 min test. Data are means± SEM. *p<0,05, **p<0,01 , ***p<0,005. One-way ANOVA with Bonferroni-corrected pairwise comparisons, n= 10 mice per group.
Fig. 5 The dopamine D2 receptor forms a protein complex with brain neuronal voltage-gated sodium channels A) Co-immunoprecipitation of NaV1 .6 with D2R in protein extracts prepared from the striatum of WT littermates but not from D2R-KO mice. L: lysate migrated on the same gel then immunoprecipitate, IP: Immunoprecipitate, IB: immunoblot of total lysate. B) Co-immunoprecipitation of different NaV oc-subunits (NaV 1 .1 , 1 .2 and 1 .6) with D2R in protein extract prepared from the striatum of WT C57BI6 mice. Arrowheads point to bands of different molecular weights in blots of immunoprecipitates stained with an anti-pan NaV. C) Co-immunoprecipitation of NaV1.6 with D2R in protein extracts prepared from HEK293 cell stably transfected with NaV1 .6 and D2L (D2L;NaV1 .6 double stable cell line). D) Co-immunoprecipitation of NaV1 .6 with D2R only in protein extracts prepared from HEK293-NaV1.6 cells transiently transfected with a mouse D2L expression vector. E) Co-immunoprecipitation of D2R with NaV1 .6 in protein extracts prepared from D2L;NaV1 .6 double stable cells. All co-immunoprecipitations were replicated a minimum of 5 times with identical results using separate batches of transfected cells or brain extracts. Note that the D2R showed on immunoblots is a high molecular weight variant (about 50-60 kD) that corresponds to the surface expressed glycosylated version of the receptor.
Fig. 6 Co-expression of D2L with NaV1.6 abolishes cAMP-mediated signaling without affecting NaV1.6-mediated currents. A) Voltage-dependence of activation of NaV1 .6 channels in NaV1 .6 cells and D2L;NaV1 .6 cells. The inset shows the voltage-clamp protocol. Currents were elicited by depolarizing steps between -100 and 90 mV in 10 mV increments for 50 ms. Cells were held at a holding potential of - 140 mV. The D2R caused no shift in the activation curve (P > 0.05), n=5. B) NaV1 .6 sodium currents in D2L;NaV1 .6 and NaV1 .6 HEK293 stable cell lines. Representative NaV1 .6 current trances in D2L;NaV1 .6 double stable cells following application of different concentrations of bromocriptine. Current were elicited by a pulse at -10 mV for 50 ms every 5 s from a holding potential of -140 mV. Bromocriptine does not have any effect on the current amplitude, n=6. C) Representative alpha-screen measurement of cAMP inhibition in response to D2L activation by different concentrations of the D2R agonist bromocriptine in D2L;NaV1 .6 cells or in NaV1 .6 HEK293 and HEK293 that were transfected transiently with a mouse D2L expression vector. D) Measurement of cAMP inhibition in response to D2S activation in HEK293 and NaV1 .6 HEK293 cells transiently transfected with a human D2S expression vector. E) Measurement of cAMP inhibition in response to different concentrations of D2R antagonist haloperidol and inverse agonist spiperone in D2L;NaV1 .6 cells. Data are means± SEM. EC50 for inhibition of cAMP by bromocriptine is 5.4 nM in D2L and 6.8 nM in D2S transfected HEK293 cells. No significant EC50 were measured in response to D2R ligands in cells expressing NaV1 .6. All alpha-screen measurements were replicated a minimum of three times in separate experiences. Fig. 7 Supplement to co-expression of D2L with NaV1.6 abolishes cAMP- mediated signaling without affecting NaV1.6-mediated currents. Alpha-screen dose-response measurement of cAMP induction in response to different concentrations of the adenylate cyclase activator forskolin in D2L;NaV1 .6 cells or in NaV1 .6 HEK293 and HEK293 that were transfected transiently with a mouse D2L expression vector. Data are means± SEM. EC50 for the activation of adenylate cyclases in the different cell lines are indicated. Fig. 8 Co-expression of D2L with NaV1.6 favors pArr2-mediated D2R signaling
A-D) Quantitative immuno-blot analysis of pAkt (Th308) and ρΘ8Κ3β (Ser9) levels in response to a 30 minute stimulation at 37Ό with 20 μΜ of the D2R agonist bromocriptine in (A) mock transfected HEK293, (B) NaV1 .6 HEK293, (C) HEK293 cells and (D) NaV1 .6 HEK293 cells transiently transfected with a D2L expression vector. Veh: vehicle, Bromo: bromocriptine. E, F) Quantitative immunoblot analysis of ρΘ8Κ3β (Ser9) dephosphorylation in response to bromocriptine (Bromo) in D2L; NaV1 .6 double stable cells following a 60 min preincubation at 37Ό with (E) the D2R antagonist haloperidol (0.1 μΜ) or (F) LiCI (2mM). G) Inhibition of βΑπ-2 expression in D2L; NaV1 .6 double stable cells transfected with an siRNA directed against human βΑΓΓ2. NT. : non-transfected cells. H) Effect of human βΑΓΓ2 siRNA on bromocriptine induced Θ8Κ3β activation/dephosphorylation in D2L; NaV1 .6 double stable cells. For all analysis respective total protein signal were used as internal reference for phospho-proteins. Actin was used as a reference for the measurement of βΑΓΓ2 levels in G. Data (means± SEM) were normalized to average protein levels in vehicle treated cells. *p<0.05, student double tailed, t-test. n= 5 per group. Detection and quantification of immunoblot signal were performed within a linear signal range using near infrared fluorescence and a LiCor Odyssey. Fig. 9 Lamotrigine and valproate disrupt the NaV;D2 receptor complex and associated signaling A-D) Quantitative immunoblot analysis of (A,B) pAkt (Th308) and (C,D) ρΘ8Κ3β (Ser9) levels in response to a 30 minute stimulation at 37Ό with 20 μΜ of the D2R agonists bromocriptine (Bromo) with or without preincubation with (A,C) lamotrigine (Lamo, 10 μΜ, 37 , 60 min) or (B,D) valproate (Val, 10 μΜ, 37 , 120 min) in D2L;NaV1 .6 double stable cells. E) Treatment with vehicle (Veh) lamotrigine (Lamo, 10 μΜ, 37 , 60 min) or valproate (Val, 10 μΜ, 37 , 120 min) prevents the co-immunoprecipitation of NaV1 .6 with D2L in D2L;NaV1 .6 double stable cells. F) Treatment with haloperidol (0.1 μΜ, 37 , 60 min) or LiCI (2 mM, 37Ό, 60 min) does not affect the co-immunoprecipit ation of NaV1 .6 with D2L in D2L;NaV1 .6 double stable cells. G) Chronic treatment with vehicle (Veh, water+tween, i.p.), lamotrigine (10 mg/kg i.p.) or valproate (10 mg per kg of chow) for 21 days prevents the co-immunoprecipitation of NaV1 .6 with D2R in protein extract prepared from the striatum of WT C57BI6 mice. All co-immunoprecipitations were replicated a minimum of 5 times with identical results using separate batches of transfected cells or brain extracts.
Fig. 10 Working model of D2R regulated signaling pathways showing G protein and βΑπ-2-dependent mechanisms. When expressed alone, D2R would tend to signal preferentially through a G protein-mediated mechanism resulting in an inhibition of cAMP production. Interaction of D2R with NaV within a protein complex would "bias" D2R signaling toward a βArr2-mediated mechanism resulting in the inactivation of Akt by PP2A and concomitant activation/dephosphorylation of GSK3. The mood stabilizer lithium has previously been shown (Beaulieu et al., 2008a) to destabilize the interaction of Akt with βΑΓΓ2. The anticonvulsant mood stabilizers lamotrigine and valproate would destabilize the NaV;D2R receptor complex, therefore exerting an "lithium-like" action on Akt/GSK3 signaling. In contrast, the non-biased D2R antagonist haloperidol can equally block D2R signaling along both G protein and βArr2-dependent pathways by interacting with both the D2R and the NaV; D2R receptor complex.
Fig. 11 Regulation of 5HT2 βΑιτ2 dependent signaling by valproate Quantitative immunoblot analysis of pErk2 levels in the frontal cortex of WT mice treated with either vehicle or valproate (400mg/kg) administered along with MDL100,907 (0.1 mg/kg, i.p.) or SB242084 (3 mg/kg, i.p.). Mice were treated with MDL100,907 at 30 min or with SB242084 at 90 min after receiving either vehicle or valproate. Phospho-protein levels were quantified at 120 min after valproic acid treatment. A-D) Quantitative immuno-blot analysis of pErk2 levels in the frontal cortex of (C, D) βΑπ-2-KO mice or (A, B) WT littermates treated with (A, C) MDL100,907 or (B, D) SB242084. E, F) Treatment with valproate (10 μΜ, 37 , 120 min) prevents the co- immunoprecipitation of NaV1 .6 with (E) 5HT2A or (F) 5HT2C in NaV1 .6 HEK293 transfected transiently with 5-HT receptor expression vectors. Co- immunoprecipitations were replicated a minimum of 5 times with identical results using separate batches of transfected cells. For quantitative immunoblots respective total protein signal were used as internal reference for phospho-proteins. Data (means± SEM) were normalized to average protein levels in vehicle treated animals from the same genotype. *p<0.05. Student double tailed, t-test. n= 5 mice per group. Detection and quantification of Immunoblot signal were performed within a linear signal range using near infrared fluorescence and a LiCor Odyssey.
Fig. 12 Disruption of the association between 5HT1 and NAV1.6 by valproate
Treatment with valproate (10 μΜ, 37 , 120 min) prevents the co- immunoprecipitation of NaV1 .6 with (A, B) 5HT1 A in NaV1 .6 HEK293 transfected transiently with 5-HT receptor expression vectors. Co-immunoprecipitations were replicated a minimum of 5 times with identical results using separate batches of transfected cells. The expression "transgenic cell" refers to genetically engineered cells. Methods for genetically engineering cells are known such as molecular cloning and gene targeting.
The expression "cell co-expressing" refers to a simultaneous expression of at least two genes of interest by the cell. Methods for introducing a gene of interest within a cell are known such as transfection such as chemical-based transfection (chemical phosphate, dendrimer, liposome, cationic polymer), electroporation, sono-poration, optical transfection, gene electrotransfer, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral methods, nucleofection or heat shock. As also known, a gene can be stably or transiently expressed depending on the method of gene transfection used. The cell comprises at least one cell surface ionic channel. The expression "at least one cell surface ionic channel" refers to a pore-forming protein integrated within the cell wall helping and controling the voltage gradient across the plasma membrane of the cell by allowing the flow of ions down their electrochemical gradient. Ionic channels are known such as voltage-gated, ligand-gated and other gating channels.
In one embodiment, the ionic channel is a sodium channel (NaV). The expression "sodium channel (NaV)" refers to an integral membrane protein that forms an ion channel conducting sodium through the cell's plasma membrane.
In one embodiment, the sodium channel is a voltage-gated sodium channel. The expression "voltage-gated sodium channel" refers to a sodium channel which is activated by an ion. Voltage-gated sodium channel normally comprises an alpha subunit that forms the ion conduction pore and one or two beta subunits that have several functions including modulation of channel gating. However, it is known that expression of the alpha -subunit alone is sufficient to produce a functional channel. Thus, in one embodiment the voltage-gated sodium channel comprises one alpha-subunit only. There are nine known alpha subunits having more than 50% identity in their amino acid sequence of the transmembrane segments and extracellular loop regions. The alpha- subunits are named NaV1.1 through NaV 1.9. In one embodiment, the cell comprises one of NaV 1.1 , 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8 or 1.9 alpha-subunit. In another embodiment, the cell comprises one of 1.1 , 1.2 or 1.6 alpha-subunit. The nucleic acid and the amino acid sequences of these alpha-subunits are known.
In another embodiment, the voltage-gated sodium channel comprises at least one beta- subunit. The term "beta-subunit" refers to transmembrane glycoprotein with an extracellular N-terminus and a cytoplasmic C-terminus regulating the channel gating. There are four disctinct beta subunits; SCN1 B, SCN2B, SCN3B and SCN4B. Beta 1 and 3 interact with the alpha-subunit non-covalently while beta 2 and 4 associate with alpha via disulfide bond. The nucleic acid and the amino acid sequences of these beta- subunits are known.
In another embodiment, the NaV channel is a ligand-gated voltage channel. The expression "Ngand gated voltage channel" refers to a sodium channel activated by binding of a ligand. Ligand-gated voltage channels as well as their nucleotide and amino acid sequences are known. For instance, the ligand-gated channel may be glutamate NMDA receptor.
In one embodiment, the ionic channel interacts with the GPCR. The term "interacts" refers to the ionic channel cooperating with the GPCR. In one embodiment, the ionic channel binds to the GPCR. The term "binds" refers to a physical contact between the GPCR and the ionic channel. The GPCR can bind the ionic channel through transmembrane domain, through intracellular domain and/or through extracellular domain. Methods for determining the binding of proteins are known such as co- immunoprecipitation, western blot, immunofluorescence, site-directed mutagenesis or FRET.
The expression "G protein coupled receptor" refers to a receptor having 7 transmembrane domains that senses molecule outside the cell and can activate intracellular signal transduction pathways. As known, GPCR can be grouped in 6 classes based in sequence homology; rhodopsin-like, secretin receptor family, metabotropic glutamate/pheromone, fungal mating pheromone receptor, cyclic AMP receptor and frizzled/smoothened. In one embodiment, the GPCR can be beta- adrenergic, alpha-adrenergic, angiotensin 1 , angiotensin 2, NK1 , Trace amine receptors, DREADDs (designer receptors exclusively activated by a designer drug), mu opioid receptor, delta opioid receptor, and all receptors listed in: Vassilatis, D.K., Hohmann, J.G., Zeng, H., Li, F., Ranchalis, J.E., Mortrud, M.T., Brown, A., Rodriguez, S.S., Weller, J.R., Wright, A.C., et al. (2003), The G protein-coupled receptor repertoires of human and mouse. Proc Natl Acad Sci U S A 100, 4903^1908.
In one embodiment, the GPCR is a serotonin receptor. The expression "serotonin receptor" refers to GPCR activated by serotonin or analogues thereof. As known, there are 6 classes of GPCR serotonin receptors; 5-HT1 , 5-HT2, 5-HT4, 5-HT5, 5-HT6 and 5- HT7. As also known, the serotonin receptors are divided in subclasses such as 5-HT1A, 5-HT1 B, 5-HT2A, 5-HT2B, 5-HT2C, 5-HT4, 5-HT5A, 5-HT5B, 5-HT6 and 5-HT7. In one embodiment, the serotonin receptor is 5-HT1A, 5-HT2A and/or 5-HT2C. The nucleic acid and the amino acid sequences of these receptors are known.
In another embodiment, the GPCR receptor is a dopamine receptor. The expression "dopamine receptor" refers to a GPCR activated by dopamine or analogues thereof. As known, there are two classes of dopamine receptors; D1 -like family and D2-like family. The D1 -like family comprises D1 and D5 receptors and the D2-like family comprises D2, D3 and D4 receptors.
In one embodiment, the GPCR is D2 dopamine receptor. As known, D2 receptor exists under a short form (D2S) and a long form (D2L). The nucleic acid and the amino acid sequences of these receptors are known.
In one embodiment, the transgenic cell expresses dopamine and serotonin receptors.
At least one GPCR signaling pathway is modulated in the cell by a GPCR signaling compound. The expression "GPCR signaling pathway" refers to an intracellular modification triggered by the GPCR. GPCR are known to modulate G-protein- dependent signaling pathway as well as G-protein independent signaling pathway. In one embodiment, the GPCR signaling pathway is cAMP (Cyclic Adenosine Monophosphate)/ PKA (Protein Kinase-A) pathway, Ca2+/PKC (Protein Kinase- C) pathway, Ca2+/NFAT (Nuclear Factor of Activated T-cells) pathway, PLC (Phospholipase- C) pathway, PTK (Protein Tyrosine Kinase) pathway, PKC/MEK (MAPK/ERK1 ) pathway, p43/p44MAPK (Mitogen Activated Protein Kinase) pathway, p38 MAP pathway, PI3K (Phosphoinositide-3 Kinase) pathway, NO-cGMP pathway, Rho pathway, NF-KappaB (Nuclear Factor-Kappa B) pathway and JAK (Janus Kinase )/ STAT (Signal Transducers and Activators of Transcription Factors) pathway and/or beta-arrestin pathway. In one embodiment, the beta-arrestin pathway comprises Akt/GSK3 pathway and/or Akt/beta-arrestin/PP2A pathway (Louis M. Luttrell and Diane Gesty-Palmer, Beyond Desensitization: Physiological Relevance of Arrestin-Dependent Signaling Pharmacol Rev June 2010 62:305-330; published ahead of print April 28, 2010, doi: 10.1 124/pr.109.002436 and Beaulieu JM et al. Frontiers in Molecular Neuroscience, 201 1 , vol. 4, article 34, p. 1 -13).
In one embodiment, the GPCR signaling pathway is the beta-arrestin pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway. The proteins involve in these signaling pathways are known in the art. For instance, beta-arrestin can be involved in the desensitisation of the GPCR and/or in the inhibition of Akt which can lead to an activation of GSK3 pathway. Further, for instance, GPCR coupled to Gas or Gai/o protein can either increase or inhibit the production of cAMP and consequently activate or inhibit PKA. In addition, GPCR can for instance activate PKC/MEK (MAPK/ERK1 ) pathway following PLC activation.
The term "modulated" refers to an alteration in the activity of the signaling pathway. The signaling pathway may be activated, enhanced, reduced or inhibited. Methods for measuring a modulation in a GPCR signaling pathway are known such as phosphorylation assay, calcium assay, cAMP assay, co-immunoprecipitation, and dephosphorylation assay. The expression "GPCR signaling compound" includes compounds such as small molecules, nucleic acids, antibodies or polypeptides capable of interacting with a biological target molecule, in particular with a protein, in such a way as to modify the biological activity thereof.
In one embodiment, the GPCR signaling compound is a GPCR ligand. The expression "GPCR ligand" refers to a substance that forms a complex with a GPCR to serve a biological purpose. The GPCR ligand can be for instance, dopamine, serotonin, endothelin, bradykinin, angiotensin, somatostatin, neuropeptide, opioids, leukotriens, vasopressin, neurotensin, calcitonin, secretin or functional analogues thereof. The expression "functional analogues thereof refers to compound having similar structure, differing in respect to certain component but having the same or a similar biological function.
In one embodiment, the cell is a HEK293 cell. The term ΉΕΚ293" refers to Human Embryonic Kidney 293 cells line transformed with adenovirus 5 DNA. HEK293 can be obtained from ATCC (ATCC number CRL-1573).
In one embodiment, the activity of Akt pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway is reduced following stimulation with a GPCR signaling compound.
A reduction in the Akt activity pathway can be measured by a phosphorylation assay as known. For instance, phosphorylation of Akt and GSK3 can be reduced by at least 40% following stimulation with a GPCR signaling compound such as a dopamine receptor agonist. Further, the cAMP/PKA pathway which is a GPCR canonical G protein- mediated mechanism inhibiting cAMP production can be reduced following stimulation with a GPCR signaling compound such as dopamine. Reduction of cAMP production can be measured by cAMP assay as known. For instance, the cAMP inhibition can be reduced by at least 50% relative to a control. The PKC/MEK pathway can also be reduced following stimulation with a GPCR signaling compound such as serotonin. Reduction of the PKC/MEK signaling pathway can be measured by a phosphorylation assay as known. Phosphorylation of Erk1 and/or Erk2 protein can be reduced. In one embodiment, the GPCR signaling can be biased away from the canonical G protein- mediated mechanism towards beta-arrestin signaling in a cell co-expressing at least one GPCR and at least one ionic channel.
In one embodiment, the GPCR signaling compound is an ionic channel ligand. The expression "ionic channel ligand" refers to a substance that forms a complex with an ionic channel to serve a biological purpose. The ionic channel ligand can be for instance lamotrigine, valproate or analogues thereof. When the GPCR signaling compound is a ionic channel ligand, the GPCR can be stimulated with a GPCR ligand in order to measure the effect of the ionic channel ligand on the GPCR signaling pathway.
In another aspect, a use of the cell as described herein for identifying a GPCR signaling compound which can modulate at least one GPCR signaling pathway is provided. Said cell can be used in a screening method.
In another aspect, a screening method for identifying a GPCR signaling compound capable of modulating at least one GPCR signaling pathway is provided. The screening method comprises the step of contacting a cell co-expressing at least one cell surface ionic channel and at least one GPCR as described above with the GPCR signaling compound.
The expression "contacting a transgenic cell" refers to allowing the GPCR signaling compound to be in close proximity with the cell. The GPCR signaling compound can be added to a tissue culture media nourishing the cell.
The method further comprises the step of determining the ability of the GPCR signaling compound to modulate at least one GPCR signaling pathway.
The expression "determining the ability of the GPCR signaling compound to modulate" refers to evaluate if the GPCR signaling compound can activate, enhance, reduce or inhibit at least one GPCR signaling pathway. Methods for evaluating activation, enhancement, reduction or inhibition of a GPCR signaling pathway are known such as phosphorylation assay, calcium assay, cAMP assay, co-immunoprecipitation, and dephosphorylation assay. As also known, determination of modulation of a GPCR signaling pathway is relative to a control. The term "control" refers to determining the modulation of the GPCR signaling pathway in the absence of the GPCR signaling compound. If the GPCR signaling compound can activate, enhance, reduce or inhibit at least one GPCR signaling pathway it indicates that it modulates the at least one GPCR signaling pathway.
In another embodiment, the beta-arrestin pathway is reduced or disrupted in the presence of the GPCR signaling compound following GPCR stimulation. Reduction or disruption of beta-arrestin pathway can be measured by evaluating phosphorylation of Akt and/or GSK3 relative to a control such as in absence of the GPCR signaling compound. A reduction of phosphorylation or a prevention of Akt and/or GSK3 dephosphorylation indicates that the beta-arrestin pathway is reduced or disrupted.
In another embodiment, the transgenic cells as described herein can be used for characterize and/or study a GPCR pathway. In one embodiment, the transgenic cells are contacted with a compound and the level of activity of the GPCR pathway is analysed compared to a control. Methods for evaluating the activity of a GPCR pathway are known such as anaylising the level of proteins phosphorylation, immunoprecipitation, western blot.
The identification of 7TM^Arr-mediated signaling (Luttrell et al., 1999; Luttrell et al. , 2001 ) has raised the hypothesis that targeting βΑΓΓ or G protein signaling mechanisms specifically downstream of a given receptor can provide an opportunity for the discovery of a new generation of drugs with greater efficacy and lesser side effects (Beaulieu and Gainetdinov, 201 1 ; Reiter et al. , 2012; Shenoy and Lefkowitz, 2005). This idea has paved the way for the development of functionally selective 7TM ligands, some of which may have promising clinical advantages over more traditional drugs (Gesty-Palmer et al. , 2009; Hostrup et al. , 2012; Wisler et al. , 2007). An important postulate behind the development of such ligand is that 7TM have an intrinsic capability to signal via G protein and βΑΓΓ simultaneously. The results presented here, indicate that in addition to this proven intrinsic property of some receptors (Luttrell et al., 1999; Raehal et al., 201 1 ; Reiter et al., 2012), the signaling of at least two 7TM, the D2L and the D2S, can be biased away from G protein toward βΑΓΓ following their interaction with NaV oc-subunits.
When expressed alone in HEK293 cells, the D2R signals trough its canonical G protein-mediated mechanism (Kebabian and Calne, 1979) to inhibit cAMP production (Figure 6) and does not regulate Akt/GSK3 signaling as it does in vivo (Figure 8C). In contrast, when expressed with NaV1 .6, both the D2L and D2S cease to inhibit cAMP production (Figure 6C, D) and instead inhibit Akt through a βΑΓΓ2 dependent mechanism (Figure 8), therefore replicating in vitro the βArr2-mediated signaling mechanism that was originally identified in vivo (Beaulieu et al., 2005; Beaulieu et al., 2004).
Immunoprecipitation experiments have shown that D2R and neuronal brain NaV oc- subunits can form receptor protein complexes both in a recombinant system and in the mouse brain (Figure 5). Furthermore, the D2R/NaV1 .6 receptor complex identified here appears to play a role in mediating some of the effects of two clinically effective drugs, valproate and lamotrigine. Indeed these drugs can prevent the formation of the D2R/NaV1 .6 receptor complex, therefore preventing its βΑΓΓ2- mediated signaling to Akt and GSK3 (Figure 1 , 9). This suggests that in vivo, D2R may exist in at least two different forms, one that is not associated to NaV and signals to Goci/o and another that is incorporated to D2R/NaV receptor complexes that signal through βΑΓΓ2 to inhibit Akt and activate GSK3 isoforms (Figure 10). Interestingly, recent data have shown that NaV.1 .6 is distributed unevenly in the neuronal dendritic compartment (Lorincz and Nusser, 2010) therefore supporting the idea that dendritic microdomains expressing D2R and NaV1 .6 differently may exist in vivo.
The present inventors have investigated the contribution of βArr2-mediated D2R signaling in the regulation of the Akt/GSK3 pathway and associated behaviors by valproate and lamotrigine. The results showed that lamotrigine and valproate can disrupt βArr2-mediated D2R signaling by preventing the formation of a receptor complex between D2R and voltage-gated sodium channels (NaV), a known direct molecular target of anticonvulsant mood stabilizers (Rogawski and Loscher, 2004b). Furthermore, co-expression of D2R with NaV results in a shift of D2R signaling from cAMP to βΑΓΓ2. Without being bound to any specific theory, the inventors believe that this suggests a mechanism through which a farm illy of cell surface proteins can modulate 7TM coupling to G protein or βΑΓΓ in vivo.
The interaction of D2R with NaV described here raises several interesting questions. For instance, our results indicate that these complexes may exist under at least six different variants involving either NaV1 .1 , 1 .2 or 1 .6. along with the D2L or the D2S (Figure 5B). However, several other types of higher order complexes involving the inclusion of other 7TM (Lee et al. , 2004) and/or signaling proteins (Sutton and Rushlow, 201 1 ) may also exist in vivo. Another pending question is the nature of the interaction between NaV and the D2R. Both of these proteins have multiple transmembrane domains, seven single alpha helix domains for the D2R (Beaulieu and Gainetdinov, 201 1 ) and four repeated transmembrane domains each composed of 6 alpha helixes— for a total of 24 alpha helixes— for NaV (Chahine et al. , 2008). Interestingly, valproate and lamotrigine are both binding to transmembrane domains within the different NaV oc-subunits (Liu et al. , 2003; Rogawski and Loscher, 2004a, b; Yang et al. , 2010). Without being bound to any specific theory, the inventors believe that it is thus possible that the interaction between NaV and D2R may involve transmembrane domains of both proteins. A similar mechanism of interaction has been proposed to underlie the formation of 7TM dimers but is not yet been fully understood (Hebert and Bouvier, 1998; Maurice et al., 201 1 ; Pin et al., 2007). Further detailed investigations and validation by crystalography (Cherezov et al., 2007) is required to fully understand the structural determinants of D2R/Nav interaction.
A potential clinical consequence of these findings comes from the effects of the anticonvulsant mood stabilizers valproate and lamotrigine on the integrity of the D2R/NaV1 .6 receptor complex (Figure 9) and from the central role of D2R and βΑΓΓ2 in the regulation of Akt/GSK3 and associated behaviors by these drugs (Figures 1 and 3). Valproate and lamotrigine are known to elicit several biochemical effects. In addition to their actions on NaV, Akt and GSK3 activity (Abelaira et al., 201 1 ; Beaulieu et al., 2009; De Sarno et al., 2002), valproate and lamotrigine also appear to modulate the production of prostaglandins, possibly as a downstream consequence of disrupted D2R signaling (Ramadan et al., 201 1 ). Valproic acid is also a weak histone deacethylase inhibitor (Phiel et al., 2001 ), but the contribution of this effect to its clinical action on mood disorders remains unclear. Future studies in human are needed to establish the potential clinical relevance of a disruption of the D2R/NaV1 .6 receptor complex by these drugs. That being said, our findings suggest a working model (Figurel O) that can be useful to understand the effects of mood stabilizers and antipsychotics that are prescribed for the treatment of bipolar disorder. Following this model, antipsychotics like haloperidol would affect G protein and βArr2-mediated mechanism equally by acting as direct antagonists of D2R (Creese et al., 1976; Meltzer, 1991 ). Previous observation have shown that lithium acts on D2R-mediated signaling by disrupting the formation of the Akt^Arr2/PP2A signaling complex downstream of D2R (Beaulieu et al., 2008a; O'Brien et al., 201 1 ; Pan et al., 201 1 ). Finally, by disrupting the D2R/NaV1 .6 receptor complex, valproate and lamotrigine would prevent the βArr2-mediated signaling to Akt and GSK3 that is- mediated by this complex, therefore providing a signaling network for the shared action of antipsychotics, lithium and anticonvulsant mood stabilizers on brain Akt and GSK3 activity. Furthermore, this model also suggests a close physical proximity between D2R/NaV receptor complexes targeted by valproate and lamotrigine and the Akt^Arr2/PP2A signaling complex that is targeted by lithium. This may be instrumental to the effects of lithium in vivo since NaV may serve as a gateway for lithium (Hille, 2001 ) and therefore facilitate the entry and accumulation of this ion into cells in the physical vicinity of Akt^Arr2/PP2A complexes in sufficient concentrations to disrupt them. In conclusion our results indicate that the formation of a receptor complex between D2R and NaV1 .6, and/or potentially other NaVs, is sufficient to alter D2R signaling from G protein-mediated regulation of cAMP synthesis to βArr2-mediated Akt inhibition. The effect of anticonvulsant mood stabilizers on this complex and of lithium on its downstream signaling suggest that this modality of D2R signaling can be important for the management of bipolar disorders and other mental illnesses for which these drugs are used. Finally the effect of NaV on D2R signaling suggests that signaling properties of other 7TM may also be affected by their integration in complexes along with NaV. This possibility might have important implications for several human diseases involving tissues and cell types that co-express 7TM along with different NaV and for which βArr2-mediated signaling may play a role in modulating physiology and pathology.
The present invention will be more readily understood by referring to the following examples. These examples are illustrative of the wide range of applicability of the present invention and are not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred methods and materials are described. The issued patents, published patent applications, and references that are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of inconsistencies, the present disclosure will prevail.
EXAMPLES
EXAMPLE 1 Anticonvulsant mood stabilizers regulate Akt/GSK3 signaling downstream of dopamine D2 receptors
D2R are known to signal through at least two parallel pathways (Figure 1A). One of these is-mediated by Gai/o proteins that inhibit the production of cAMP. This results in a reduction of protein kinase A (PKA) activity and, thus, reduced phosphorylation of PKA substrates like the Thr34 of the dopamine and cAMP-regulated phosphoprotein MW 32 kD (DARPP-32)(Bateup et al., 2008; Hemmings et al., 1984). The other pathway is-mediated by βΑΓΓ2 and results in a dephosphorylation/inactivation of Akt on Thr308 and in the activation of GSK3 isoforms following the dephosphorylation of their aminoterminal serine residues (Beaulieu and Gainetdinov, 201 1 ; Beaulieu et al., 2005; Beaulieu et al., 2004). First, we have used acute administration of the D2R antagonist haloperidol, known to affect Akt/GSK3 signaling (Emamian et al., 2004; Manago et al., 2012) to validate the use of βΑΓΓ2 and D2R-KO mice in the assessment of differential effects of drugs on these two pathways in vivo. Our data reveal that, by preventing the action of brain dopamine on D2R, haloperidol provoked increased phosphorylation of Thr34 DARPP-32 and Thr308 Akt as measured from striatal extracts of wild type (WT) mice (Figure 1 B,C). As it may be expected, these effects were completely absent in D2R- KO mice. In contrast, the effect of haloperidol on DARPP-32 was maintained in βΑΓΓ2-ΚΟ mice in which no effect on Akt phoshorylation were observed. Thus, by testing the effects of a drug in both D2R-KO and βΑΓΓ2-ΚΟ animals it is possible to establish not only specific D2R contribution but also to delineate which pathway— G protein or βΑΓΓ2 dependent— is involved in a given effect. The mood stabilizer drugs lithium, valproate and lamotrigine have all been reported to increase the phosphorylation of Akt and GSK3 isoforms when given chronically (Abelaira et al., 201 1 ; Beaulieu et al., 2008a; De Sarno et al., 2002). Furthermore, it has been shown (Beaulieu et al., 2008a; O'Brien et al., 201 1 ; Pan et al., 201 1 ) that in the case of lithium, this effect is-mediated by a disruption of βArr2-mediated signaling, presumably downstream of D2R. Here we show that chronic administration of lithium, lamotrigine or valproate to WT mice (C57BI6) indeed results in an increase in the phosphorylation of striatal Thr308 Akt but not of Thr34 DARPP-32 (Figure 1 D, E).
To establish whether these effects of valproate and lamotrigine on protein phosphorylation are dependent upon D2R^Arr2-mediated signaling, we repeated the same treatments in D2R-KO, βΑΓΓ2-ΚΟ and their respective WT littermates. Chronic treatment with either valproate or lamotrigine increased the phosphorylation of Thr308 Akt and Ser9 Θ8Κ3β in the striatum and frontal cortex of WT littermates from these two lines of mice (Figures 1 F, G and 2 E ,F). Furthermore, chronic inhibition of GSK3 as a result of these treatments also resulted in an increase in the levels of βθ3ίβηίη, a protein that is targeted for degradation following its phosphorylation by GSK3. In contrast, chronic treatments with lamotrigine or valproate had no effect on Akt (Thr308) and ΰ8Κ3β (Ser9) phosphorylation or βθ8ίβηίη levels in D2R-KO and βΑΓΓ2-ΚΟ mice (Figure 1 F, H, I), indicating that these drugs can affect the activity of the Akt/GSK3 pathway by acting on D2R^Arr2- mediated signaling. Interestingly, a similar dependency on D2R and βΑΓΓ2 expression was also observed in mice chronically treated with lithium (Figure 2 A-D) (Beaulieu et al., 2008a). EXAMPLE 2 Loss of GSK3 dependent behavioral responses to valproate and lamotrigine in Arr2-KO mice
Previous data have shown that βΑΓΓ2 is essential for the effects of lithium in behavioral tests with predictive validity for anti-manic and antidepressant effects (Beaulieu et al., 2008a). While valproate and lamotrigine appear to act on the same pathway (Figure 1 ), it remains possible that these two drugs may also affect behavior in such tests by acting through other mechanisms. This issue was addressed by testing βΑΓΓ2-ΚΟ mice and their WT littermates treated chronically with valproate or lamotrigine in three behavioral test that have been shown to be responsive to lithium and GSK3 inhibitors (Beaulieu et al., 2008a; Beaulieu et al., 2004; Beaulieu et al., 2008b; Harrison-Read, 2009; Kaidanovich-Beilin et al., 2004; O'Brien et al., 2004). Reduction of spontaneous exploratory locomotor activity in a novel environment is a test with predictive validity for the identification of antimanic drugs and has been used extensively since the early days of the development of mood stabilizers (Beaulieu et al., 2004; Cade, 1949; Ralph-Williams et al., 2003). Reduction of immobility time in the tail suspension test (TST) is a behavioral paradigm commonly used to evaluate "antidepressant-like" effects of drugs in rodents (Crowley et al., 2005; Crowley et al., 2004). The dark-light emergence test (DLET) is a lithium-responsive (Beaulieu et al., 2008a), behavioral assay that reveals the potential efficacy of antidepressants and anxiolytics in rodents. In this test, mice are placed in a darkened compartment and allowed free exploration of the darkened and adjoining bright compartments (Beaulieu et al., 2008b; Crawley, 2008; Weisstaub et al., 2006). Variation of several parameters such as a reduction of the latency to cross from the dark to the illuminated compartment as well as increased in time spent and locomotor activity in the illuminated compartment are used to assess drug efficacy. In addition, this test provides an overall measurement of locomotor activity in both compartments that can be used as a separate measure of novelty- induced locomotor activity under environmental conditions that are different from those used in previous tests.
Chronic treatments with valproate or lamotrigine in βΑΓΓ2-\Λ/Τ mice resulted in a reduction of exploratory locomotion (Figure 3A, B) immobility in the TST (Figure 3C, D) and latency to cross in the DLET (Figure 3E, F). Furthermore, both drugs reduced immobility and increased the time spent in the bright compartment in the DLET (Figure 3G-L). These behavioral effects are similar to those previously reported for lithium (Beaulieu et al. , 2008a) and in a cohort of lithium treated βΑΓΓ2-\Λ/Τ mice that was used as a positive control for these tests (Figure 4). In contrast, chronic treatment with lamotrigine or valproate failed to elicit these effects in βΑΓΓ2-ΚΟ mice (Figure 3). A similar absence of effects was also observed in the control lithium treated mouse cohort (Figure 4). It is important to note that a lack of responsiveness of βΑΓΓ2-ΚΟ mice to valproate and lamotrigine is not indicative of a generalized absence of responsiveness of these mice in these tests. Indeed, treatments with GSK3 inhibitors have been shown to elicit behavioral responses in these tests that are similar to those observed in WT animals treated with valproate or lamotrigine (Beaulieu et al. , 2008a; Beaulieu et al. , 2005).
EXAMPLE 3 Dopamine D2 receptors form a protein complex with voltage- gated sodium channels in vivo
Results obtained following treatment of D2R-KO and βΑΓΓ2-ΚΟ mice suggest that valproate and lamotrigine can trigger the dephosphorylation of Akt and GSK3 by interfering with βArr2-mediated D2R signaling. While these drugs have several potential molecular targets, they are not known to interact with the D2R (Freland and Beaulieu, 2012; Jope, 201 1 ; Valvezan and Klein, 2012). However, since valproate and lamotrigine are known ligands of the oc-subunits of voltage-gated sodium channel (NaV) (Rogawski and Loscher, 2004a). We used immunoprecipitation assays to test the possibility that D2R may participate to a protein complex with NaV oc-subunits (Figure 5).
Immunoprecipitation of D2R from striatum of D2R-WT mice led to a coimmunoprecipitation of the endogenous NaV oc-subunits (NaV1 .6), while no immunoprecipitation of D2R or NaV1 .6 was obtained when using striatal extracts from D2R-KO mice (Figure 5A). To further validate this result, D2R immunoprecipitates from the striatum of WT (C57BI6) mice were stained with an anti-pan-NaV that is not specific to a single NaV oc-subunits. Since at least three bands were observable in immunoprecipitates using this antibody (Figure 5B), additional immunoprecipitates were stained with commercial antibodies directed to the three NaV oc-subunits expressed in the adult brain (Chahine et al. , 2008). These experiments revealed that at least three different NaV oc-subunits, NaV 1 .1 , NaV 1 .2 and NaV 1 .6 can form a protein complex along with the D2R in the mouse striatum (Figure 5B).
To pursue the functional characterization of this D2R/NaV1 .6 receptor complex, an expression vector encoding the mouse D2L was stably transfected in HEK293 cells expressing NaV1 .6 (Zhao et al. , 201 1 ). As it may be expected from the in vivo study, immunoprecipitation of D2R from these D2L; NaV1 .6 cells yield to a coimmunoprecipitation of NaV1 .6 with the D2R (Figure 5C). Importantly, NaV1 .6 was also immunoprecipitated using D2R antibodies in NaV1 .6 stable cell lines that were transfected transiently with the D2L expression vector but not from cells that did not express the D2R (Figure 5D). In addition, immunoprecipitation of NaV1 .6 from the double stable cells led to a coimmunoprecipitation of the D2R (Figure 5E).
EXAMPLE 4 D2R activation does not affect NaV1.6 channel currents In addition to NaV, D2R have been shown to interact with at least two different types of neuronal ion channels (Beaulieu and Gainetdinov, 201 1 ). Interaction of D2R with the NR2B subunit of the glutamate NMDA receptor (Liu et al. , 2006) or with N-type calcium channels (Kisilevsky and Zamponi, 2008) have both been shown to inhibit channel current following D2R activation. We used patch clamp analysis on Nav1 .6 and D2L; NaV1 .6 cells to investigate the possible impact of D2R on NaV1 .6 currents. A G/V curves analysis in these two cell types (Figure 6A) showed that NaV1 .6 induced currents at different membrane potentials are not affected by its co- expression with the D2L. In a second series of experiments, we investigated the impact of D2R activation by its agonist bromocriptine on maximal NaV1 .6 currents in the cells. Interestingly, NaV 1 .6 maximal currents were not affected by the activation of D2R with two different doses of bromocriptine (Figure 6B). Therefore, in contrast to other ion channels that can participate to protein complexes with the D2R, NaV1 .6 functions would not be overtly affected by D2R activation.
EXAMPLE 5 Coexpression of NaV1.6 prevents D2R signaling via G protein cAMP mechanism
We used an AlphaScreen based cAMP competition assay to measure the effect of NaV1 .6 on D2R Goci/o-mediated signaling. Stimulation of the mouse D2L receptor transiently transfected in HEK293 cells led to an inhibition of cAMP production in response to different doses of bromocriptine with an efficacy that was comparable to published EC50 for this pair of receptor and ligand (Gardner and Strange, 1998). In contrast, dose-response curves made in NaV1 .6 cells transfected transiently with the mouse D2L or in D2L; NaV1 .6 double stable cells revealed a lack of cAMP responses to bromocriptine when the D2R was expressed along with NaV1 .6 (Figure 6C). To further validate this finding, bromocriptine dose-response curve studies were also conducted with equivalent results in cell transfected transiently with the human D2S with or without NaV1 .6 (Figure 6D). In addition, both the neutral D2R antagonist haloperidol and the inverse agonist spiperone (Roberts and Strange, 2005) failed to affect cAMP levels in D2L;NaV1.6 double stable cells, indicating that a lack of responsiveness to bromociptine in these cells is unlikely to be caused by a constitutive activation of D2R-G protein-mediated signaling in the presence of NaV1 .6 (Figure 6 E). To rule out the possibility that the loss of responsiveness of the cAMP pathway to D2R stimulation may results form a broader disruption cAMP synthesis in NaV1 .6 positive cells, we also examined the effects of different doses of the adenylate cyclase activator forskolin and found equivalent levels of cAMP production across the different types of transfected cells (Figure 7). Taken together these results suggest the existence of a functional cross-talk between D2R and NaV1 .6 that severely curtails the ability of D2R to signal via its canonical G protein/cAMP-mediated mechanism.
EXAMPLE 6 Coexpression of NaV1.6 allows D2R signaling via βΑιτ2
To assess the possible impact of NaV1 .6 on βArr2-mediated D2R signaling, HEK293 and HEK293 NaV1 .6 stable cell lines were transfected transiently with a vector expressing the human D2S. The effect of bromocriptine on Akt and GSK3 phosphorylation was measured by immunoblotting of phospho-Akt (Thr308) and phospho-GSh^ (Ser9). We found that bromocriptine had no effect on Akt or GSK3 phosphorylation on cells that did not express the D2R (Figure 8A, B). In contrast to what has been reported in vivo (Beaulieu et al., 2007), D2R stimulation also failed to affect Akt and GSK3 phosphorylation in HEK 293 cells that were transfected with the D2R alone (Figure 8C). However, expression of the D2S along with NaV1 .6 resulted in a significant reduction in the phosphorylation of Akt (Thr308) and GSh^ (Ser9) in response to stimulation with the D2R agonist (Figure 8D). To further establish that this effect of bromocriptine on Akt and GSK3 phosphorylation results from a stimulation of the D2R, D2L;NaV1 .6 double stable cells were then stimulated with bromocriptine with or without prior incubation with the D2R antagonist haloperidol. The stimulation of D2R by bromocriptine in these cells resulted in a dephosphorylation of Θ8Κ3β (Ser9) that is preventable by haloperidol (Figure 8E).
Lithium can antagonize D2R^Arr2-mediated signaling in vivo by interfering with the formation of the Akt^Arr2/PP2A signaling complex that mediates this cellular response (Beaulieu et al., 2008a; Beaulieu et al., 2005). As a first step to verify the involvement of βΑΓΓ2 in the regulation of GSK3 phosphorylation by the D2R/NaV1 .6 receptor complex, D2L;NaV1 .6 double stable cells were stimulated with bromocriptine in the presence and absence of lithium. Immunoblot analysis from these experiments revealed that the Θ8Κ3β (Ser9) dephosphorylation in these cells is antagonized by lithium (Figure 8F). We then use a siRNA-based approach to establish the contribution of βΑΓΓ2 more directly. Transfection of D2L;NaV1.6 double stable cells with an siRNA directed toward human βΑΓΓ2 reduced the expression of this protein by ~50% while a control siRNA with a scrambled sequence had no effect on expression (Figure 8G). Transfection of the βΑΓΓ2 siRNA, but not of the control siRNA, also prevented the effect of the D2R agonist on Θ8Κ3β (Ser9)(Figure 8H), indicating that the regulation of GSK3 phosphorylation by the D2R/NaV1 .6 receptor complex is dependent of βΑΓΓ2 in these cells as it is the case in the brain (Beaulieu et al., 2005).
EXAMPLE 7 Anticonvulsant mood stabilizers disrupt the NaV;D2 receptor complex in vivo
We exploited stable D2L;NaV1 .6 cells to investigate the effects of valproate and lamotrigine on D2R/NaV1 .6 receptor complex signaling. Quantification of phospho- Akt (Thr308) and phospho-GSh^ (Ser9) in these cells showed that lamotrigine and valproate (Figure 9A-D) do not act on the phosphorylation of these proteins in cultured cells under serum starvation. In contrast, pre-incubation with lamotrigine and valproate prevented the dephosphorylation of Akt and Θ8Κ3β following stimulation with the D2R agonist bromocriptine (Figure 9A-D), therefore indicating that lamotrigine and valproate antagonise βArr2-mediated signaling by the D2R/NaV1 .6 receptor complex.
Coimmunoprecipitation studies were then carried out to investigate whether lamotrigine and valproate can disrupt the integrity of the D2R/NaV1 .6 receptor complex. As shown in figure 9 (G), treatment of D2L;NaV1 .6 cells with the two anticonvulsant mood stabilizers prevented the coimmunoprecipitation of NaV1 .6 with the D2L in these cells. In contrast, treatment of these cells with lithium or haloperidol, two drugs that can prevent the signaling by the D2R/NaV1 .6 receptor complex (Figure 8) without binding to NaV1 .6, had no effect on the coimmunoprecipitation of NaV1 .6 with the D2L (Figure 9F).
Finally, since chronic treatment with lamotrigine or valproate can inhibit βΑΓΓ2- mediated D2R signaling in response to endogenous dopamine (Figure 1 ), the effects of these drugs on the D2R/NaV1 .6 receptor complex were examined in vivo. While the immunoprecipitation of D2R from the striatum of vehicle-treated WT mice led to a coimmunoprecipitation of endogenous NaV1 .6, we observed that this interaction was completely disrupted in mice treated chronically with valproate or lamotrigine (Figure 9).
Materials and Methods Experimental animals
C57BL/6J and D2R-KO mice were obtained from The Jackson Laboratory (Bar Harbor, ME). pArr2-KO mice have been described previously (Beaulieu et al., 2005; Bohn et al., 1999). Animals were genotyped by PCR amplification from ear punch biopsy genomic DNA and genotypes were reconfirmed after experimentation. Respective WT littermates were used as controls for KO mice. All mice were used at 3-4 months of age and housed 4-5/cage with ad libitum access to food and water in a humidity-controlled room at 23 on a 12 h light- dark cycle. All experimental procedures were approved by the Universite Laval Institutional Animal Care Committee according to guidelines from the Canadian Council on Animal Care.
Drugs and treatments
For acute treatments, haloperidol (Sigma-Aldrich, Oakville, Ontario, Canada) was solubilized in a minimal volume of dimethyl sulfoxide (DMSO; Sigma-Aldrich) and brought to volume with distilled water as described (Emamian et al., 2004). For chronic treatments, LiCI (Sigma-Aldrich) was added to the drinking water for a period of 15 days at a concentration of 0.12% (w/v), which produces brain lithium concentrations of ~ 0.8 mM in mice from the different genotypes without affecting water intake (Beaulieu et al., 2008a). Valproate was administered for a period of 21 days in chow at a concentration of 10 mg/kg of chow as described (Hao et al., 2004; Leng et al., 2008). Lamotrigine (Tocris Bioscience, Bristol, UK) was prepared as a suspension in a minimal amount of Tween-20 and brought to volume with distilled water. It was then administered once daily (10 mg/kg, i.p.) for a period of 21 days (Ahmad et al., 2004; Chang et al., 2009). All experiments were carried out 6 h after cessation of drug administration.
For treatments on cultured cells, lamotrigine, haloperidol, forskolin (Sigma-Aldrich), bromocriptine (Tocris Bioscience) and spiperone (Sigma-Aldrich) were prepared in a minimal volume of DMSO and brought to volume in cell culture media. Valproic acid and LiCI were prepared in phosphate buffered saline (PBS). Drugs were used at different concentrations and for different time periods as specified in figure legends.
Antibodies
The anti-phospho-GSK3p (Ser9), anti-p-catenin, anti^Arr2 and anti-DARPP32, were purchased from Cell Signaling Technology (Beverly, MA). Anti-Phospho DARPP32 (Th34) antibodies were obtained from Phosphosolutions (Aurora, CO). Anti-total- GSK3a/p clone 001 1 -A monoclonal antibodies and anti-phospho-Akt (Thr308) polyclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti- total-Akt monoclonal antibodies were obtained from Biosources (San Diego, CA). Anti-D2R(L/S) polyclonal and anti-actin clone c4 monoclonal antibodies were purchased from Millipore (Billerica, MA). Anti-PAN NaV polyclonal was from Alomone Lab (Jerusalem, Israel). Anti-NaV1 .6 monoclonal clone 4G7 was purchased from Sigma-Aldrich, anti-NaV1 .1 and anti-NaV1 .2 were purchased from UC Davis/NIH NeuroMab Facility (Davis, CA). Quantitative Immunoblots
Euthanasia and immunoblots analyses were performed as described (Beaulieu et al., 2004). Briefly, mice were killed by decapitation, after which the heads were immediately cooled by immersion in liquid nitrogen for 6 sec. The right hemistriatum and hemifrontal-cortex were rapidly dissected out (within 30 sec) on an ice-cold surface and frozen in liquid nitrogen before protein extraction. Tissue samples were homogenized in boiling 1 % (v/v) SDS solution and boiled for 5 min. Protein concentration was measured using a DC-protein assay (Bio-Rad, Hercules, CA).
For measurements involving cellular extracts, cells where frozen on liquid nitrogen and sonicated in boiling 1 % (v/v) SDS solution.
Protein extracts (25 or 50 g) were separated on 10% SDS/PAGE Tris-glycine gels (Life Technologies, Burlington, Ontario) and transferred to nitrocellulose membranes. Blots were immunostained overnight at 4 with prim ary antibodies. Immune complexes were revealed using appropriate IR dye labeled secondary antibodies from Licor Biotechnology (Lincoln, NE). Quantitative analyses of fluorescent IR dye signal were carried out using an Odyssey Imager (Licor Biotechnology). For quantification, actin was used as a loading control for the evaluation of total protein levels while respective total protein signals were used as loading controls for each phospho-protein signal. Results were further normalized to respective control conditions in order to allow for comparison between separate experiments. The gels shown in the figures correspond to representative experiments, where each lane corresponds to a separate animal. Separate gels are presented within separate frames and apparent signals may not be directly comparable between gels pictures.
D2R transfections in HEK293-Nav1.6 cells culture
HEK293-NaV1 .6 cells where described previously (Zhao et al. , 201 1 ) and were maintained as monolayer cultures at 37 in Dubelco 's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum heat-inactivated (FBS-HI), 2 mM L-glutamine, 400 μg/mL geneticin and penicillin/streptavidin. Stable (D2L; NaV1 .6) cell lines co-expressing NaV1 .6 and D2L were derived from HEK293- NaV1 .6 cells. The D2 receptor cDNA was inserted into and expression vector encoding an hygromycin resistance gene. The full length coding region of mouse D2 long (D2L) dopamine receptor was amplified by PCR from a D2LR-RLuc expression vector (Masri et al. , 2008) using the following primers: AAAAGCTAGCATGGATCCACTGAACCTGTCC (SEQ ID NO: 1 ) and AAAAGGTACCTCAGCAGTGCAGGATCTTCAT (SEQ ID NO:2) containing respectively a Nhe I and Kpn I restriction site. The 1 .3 Kb PCR amplicon was cloned into a pcDNA3+ vector in which the neomycin-resistant cassette has been replaced by a hygromycin-resistant one. The hygromycin-resistant gene was amplified by PCR using the following primers:
AAAACCTAGGATGAAAAAGCCTGAACTCACTCACC (SEQ ID NO:3) and AAAACCCGGGCTATTCCTTTGCCCTCGGACGAGTGCTG (SEQ ID NO:4). The PCR amplicon was cloned into Avr ll/Xma I sites and the resulting plasmid sequenced. Antibiotic-resistant clones were selected with 100 μg/ml hygromycin B, were isolated, amplified and tested for expression of D2L receptor using western blot. For experiments, 22 to 30,000 cells/cm2 were seeded and grown 48 h prior to starvation 5h in DMEM supplement with 0.1 % bovine serum albumin. For transient expression of D2R, 50 % confluent HEK293 or HEK293-NaV1 .6 cells were transfected using calcium phosphate precipitates with15 μg (for a p-100 plate) of DNA encoding the mouse D2L or the short isoform of the human D2 receptor (D2S) (Kim et al., 2001 ). siRNA silencing of |3Arr2
siRNA (sense: AAGGACCGCAAAGUGUUUGUG (SEQ ID NO:5); antisense: CACAAACACUUUGCGGUCCUU (SEQ ID NO:6); Santa Cruz) directed against human βΑΓΓ2 and commercially available control siRNA (Santa Cruz) were introduced into D2L;NaV1 .6 cells using Lipofectamine 2000™ (Life Technologies) according to manufacturer protocol. A total of 480 pmol of siRNA per well of a 6-well plate were used on 50% confluent cells. Following transfection, cells were cultured at 37 for 48 h in regular media prior to stimulation .
Measurement of cAMP
cAMP assays were performed using AiphaScreen™ cAMP assay kit from PerkinElmer (Boston, MA) based on the competition between endogenous cAMP and exogenous added biotinylated cAMP. Briefly, a mix of cells and anti-cAMP Acceptor beads was stimulated with agonists at room temperature in an OptiPlate- 384 (PerkinElmer). After a 30 m in incubation, a lysis/detection mix was added and plates were read after 1 hour incubation using an AiphaScreen plate reader. Number of cells per well and forskolin (Sigma-Aldrich) dose response curve experiments were carried out first to determine the optimal assay conditions. Subsequently, cAMP mesurements were assessed using 10 000 cells/well and a forskolin concentration of 10 μΜ corresponding to the EC8o- When using antagonists, preincubation of 30 minutes was performed before cells stimulation.
Co-immunoprecipitations from Cells and Brain Tissue For in vivo studies, a complete mouse striatum was rapidly dissected on an ice-cold surface and homogenized at 4 in 200 μΙ lysis buffer [10mM Tris-HCL (pH 7.4), 1 % (v/v) Triton X-100] containing okadaic acid (2 μΜ), Na-orthovanadate (0.5 μΜ) and a cocktail of protease inhibitors (Sigma-Aldrich). For interaction studies in cells, HEK- 293 cells were homogenized in lysis buffer. Cells or striatum homogenates were incubated for 30 min at 4 with rotation and centr ifuged for 30 min at 4 (15,000 rpm). Immunoprecipitations were conducted overnight in a volume of 150 μΙ at 4 in lysis buffer using 400 μg of supernatant proteins and either Anti-D2R(L/S) polyclonal (1/200) (Millipore, Billerica, MA) or Anti-Nav1 .6 monoclonal clone 4G7 (1/100) (Sigma-Aldrich). Immuno-labelled protein supernatant were incubated and rocked for 2 h with magnetic dynabeads protein A (Life Technologies) at 4 . Dynabeads, were separated from the supernatant with a magnetic wall, rinsed with lysis buffer and pellet were resuspended in pre-heated (95 ) Laemml i sample-buffer complemented with 5% β-mercaptoethanol. Purified proteins were boiled for 5 min. Protein extracts were analyzed by immunoblot. Immune complexes were detected using appropriate HRP peroxidase-conjugated secondary antibody (Jackson Immuno-Research, West Grove, PA) along with a chemoluminescent reagent (Super Signal West-Pico, Thermo Scientific). Luminescence was detected using Ultra Cruz autoradiography film blue (Santa Cruz Biotechnology, inc.). All experiments were replicated a minimum of 5 times with identical results using separate batches of transfected cells or brain extracts.
Whole cell patch-clamp recording
The whole cell configuration of the patch-clamp technique was used to record macroscopic Na+ currents from HEK293 D2L;NaV1 .6 and HEK293 NaV1.6 stable cell lines. The pipette solution was composed of 5 mM NaCI, 135 mM CsF, 10 mM EGTA, and 10 mM Cs-HEPES. The pH was adjusted to 7.4 using 1 N CsOH. The bath solution was composed of 150 mM NaCI, 2 mM KCI, 1 .5 mM CaCI2, 1 mM MgCI2, 10 mM glucose, and 10 mM HEPES. The pH was adjusted to 7.4 with 1 N NaOH.
For the G/V curves analysis, the recordings were taken exactly 5 min after the whole cell configuration was obtained to allow the current to stabilize and fully dialyze the cell with pipette solution. For the bromocriptine block, the needle of a constantly running gravity-driven perfusion system was positioned close to the recorded cell and drug was applied by switching to bath solution containing the indicated concentration. A series of test pulse at -10 mV for 50 ms every 5 s from a holding potential of -140 mV were recorded during the perfusion. Na+ currents were recorded at room temperature (22-23 ). Command pulses were generated, and currents were recorded using pCLAMP software (version 8.0) and an Axopatch 200 amplifier (Molecular Devices, Sunnyvale, CA). Patch electrodes were fashioned from borosilicate glass (Corning 8161 ) and coated with silicone elastomer (Sylgard, Dow- Corning, Midland, Ml) to minimize stray capacitance. Current recordings were taken using low-resistance electrodes (<1 ΜΩ), and the series resistance was compensated at values of >80% to minimize patch-clamp errors. Whole cell currents were filtered at 5 kHz, digitized at 10 kHz, and stored on a microcomputer equipped with an analog-to-digital converter (Digidata 1300, Molecular Devices).
For the construction of activation curves, Na+ conductance (GN3) was calculated from the peak current (/Na) using the following equation: GNA = INJ( V - ^Na), where V is the test potential and ENa is the reversal potential. Normalized GNA was plotted against the test potentials.
Measurement of locomotor activity
Locomotion was evaluated under illuminated conditions in an automated Omnitech Digiscan apparatus (AccuScan Instruments, Columbus, OH) after a 72 h period of habituation to the test room as described (Gainetdinov et al., 1999) motor activity was measured in terms of the total distance traveled as described (Beaulieu et al., 2004). For chronic treatment, mice were housed 4-5/cage in a humidity-controlled behavior tests room at 23Ό on a 12 h light-dark cy cle for the duration of chronic drug treatment and then tested for 30 min without further drug injections as described above.
Tail suspension test
Mice were tested for 6 min in a tail suspension apparatus (Med-Associates) as described (Beaulieu et al., 2008b; Crowley et al., 2004). Behavior was scored as time spent in immobility (sec) over the last 4 minutes of the test. The light-dark emergence test
The light-dark emergence test was performed for a period of 5 min with mice placed initially at the center of the dark chamber, as described (Beaulieu et al., 2008b; Weisstaub et al., 2006). Tests were conducted using an automated open field activity setup with light/dark insert (Med-Associates) with the light compartment illuminated at 600 lux. The total time spent in light compartments, the locomotor activity in the light compartment, the total distance traveled and the delay to cross from the dark to the light chamber for the first time, were used as parameters for analysis. Statistical analysis
The data are presented as means ± SEM. Data from western blot were analyzed by two-tailed t-test or ANOVA; behavioral data were evaluated by t-test, or repeated measures two way ANOVA or one way ANOVA followed by Bonferroni-corrected pair-wise comparisons using Prism 4.0c (GraphPad software inc, San Diego, CA) for Macintosh computers. A p<0.05 was considered significant. References
Abelaira, H.M., Reus, G.Z., Ribeiro, K.F., Zappellini, G., Ferreira, G.K., Gomes, L.M., Carvalho-Silva, M., Luciano, T.F., Marques, S.O., Streck, E.L, et al. (201 1 ). Effects of acute and chronic treatment elicited by lamotrigine on behavior, energy metabolism, neurotrophins and signaling cascades in rats. Neurochem Int 59, 1 163- 1 174.
Ahmad, S., Fowler, L.J., and Whitton, P.S. (2004). Effect of acute and chronic lamotrigine on basal and stimulated extracellular 5-hydroxytryptamine and dopamine in the hippocampus of the freely moving rat. Br J Pharmacol 142, 136-142. Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B.A. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1 . Embo J 15, 6541 -6551 .
Angers, S., Salahpour, A., and Bouvier, M. (2002). Dimerization: an emerging concept for G protein-coupled receptor ontogeny and function. Annu Rev Pharmacol Toxicol 42, 409-435.
Bateup, H.S., Svenningsson, P., Kuroiwa, M., Gong, S., Nishi, A., Heintz, N., and Greengard, P. (2008). Cell type-specific regulation of DARPP-32 phosphorylation by psychostimulant and antipsychotic drugs. Nat Neurosci 11, 932-939.
Beaulieu, J.M., and Gainetdinov, R.R. (201 1 ). The physiology, signaling, and pharmacology of dopamine receptors. Pharmacological reviews 63, 182-217.
Beaulieu, J.M., Gainetdinov, R.R., and Caron, M.G. (2009). Akt/GSK3 signaling in the action of psychotropic drugs. Annu Rev Pharmacol Toxicol 49, 327-347.
Beaulieu, J.M., Marion, S., Rodriguiz, R.M., Medvedev, I.O., Sotnikova, T.D., Ghisi, V., Wetsel, W.C., Lefkowitz, R.J., Gainetdinov, R.R., and Caron, M.G. (2008a). A beta-arrestin 2 signaling complex mediates lithium action on behavior. Cell 132, 125- 136.
Beaulieu, J.M., Sotnikova, T.D., Marion, S., Lefkowitz, R.J., Gainetdinov, R.R., and Caron, M.G. (2005). An Akt/beta-arrestin 2/PP2A signaling complex mediates dopaminergic neurotransmission and behavior. Cell 122, 261-273.
Beaulieu, J.M., Sotnikova, T.D., Yao, W.D., Kockeritz, L, Woodgett, J.R., Gainetdinov, R.R., and Caron, M.G. (2004). Lithium antagonizes dopamine- dependent behaviors mediated by an AKT/glycogen synthase kinase 3 signaling cascade. Proc Natl Acad Sci U S A 101, 5099-5104. Beaulieu, J.M., Tirotta, E., Sotnikova, T.D., Masri, B., Salahpour, A., Gainetdinov, R.R., Borrelli, E., and Caron, M.G. (2007). Regulation of Akt signaling by D2 and D3 dopamine receptors in vivo. J Neurosci 27, 881-885.
Beaulieu, J.M., Zhang, X., Rodriguiz, R.M., Sotnikova, T.D., Cools, M.J., Wetsel, W.C., Gainetdinov, R.R., and Caron, M.G. (2008b). Role of GSK3beta in behavioral abnormalities induced by serotonin deficiency. Proc Natl Acad Sci U S A 105, 1333- 1338.
Bockaert, J., Perroy, J., Becamel, C, Marin, P., and Fagni, L. (2010). GPCR interacting proteins (GIPs) in the nervous system: Roles in physiology and pathologies. Annu Rev Pharmacol Toxicol 50, 89-109. Bohn, L.M., Lefkowitz, R.J., Gainetdinov, R.R., Peppel, K., Caron, M.G., and Lin, F.T. (1999). Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science 286, 2495-2498.
Cade, J.F. (1949). Lithium salts in the treatment of psychotic excitement. Med J Aust 2, 349-352. Chahine, M., Chatelier, A., Babich, 0., and Krupp, J.J. (2008). Voltage-gated sodium channels in neurological disorders. CNS Neurol Disord Drug Targets 7, 144-158.
Chang, Y.C., Rapoport, S.I., and Rao, J.S. (2009). Chronic administration of mood stabilizers upregulates BDNF and bcl-2 expression levels in rat frontal cortex. Neurochem Res 34, 536-541 .
Cherezov, V., Rosenbaum, D.M., Hanson, M.A., Rasmussen, S.G., Thian, F.S., Kobilka, T.S., Choi, H.J., Kuhn, P., Weis, W.I., Kobilka, B.K., et al. (2007). High- resolution crystal structure of an engineered human beta2-adrenergic G protein- coupled receptor. Science 318, 1258-1265. Crawley, J.N. (2008). Behavioral phenotyping strategies for mutant mice. Neuron 57, 809-818.
Creese, I., Burt, D.R., and Snyder, S.H. (1976). Dopamine receptor binding predicts clinical and pharmacological potencies of antischizophrenic drugs. Science 192, 481 -483.
Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M., and Hemmings, B.A. (1995). Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-789.
Crowley, J.J., Blendy, J. A., and Lucki, I. (2005). Strain-dependent antidepressant- like effects of citalopram in the mouse tail suspension test. Psychopharmacology (Berl) 183, 257-264.
Crowley, J.J., Jones, M.D., O'Leary, O.F., and Lucki, I. (2004). Automated tests for measuring the effects of antidepressants in mice. Pharmacol Biochem Behav 78, 269-274. De Sarno, P., Li, X., and Jope, R.S. (2002). Regulation of Akt and glycogen synthase kinase-3 beta phosphorylation by sodium valproate and lithium. Neuropharmacology 43, 1158-1164.
Emamian, E.S., Hall, D., Birnbaum, M.J., Karayiorgou, M., and Gogos, J. A. (2004). Convergent evidence for impaired AKT1-GSK3beta signaling in schizophrenia. Nat Genet 36, 131-137.
Ferguson, S.S., Downey, W.E., 3rd, Colapietro, A.M., Barak, L.S., Menard, L, and Caron, M.G. (1996). Role of beta-arrestin in mediating agonist-promoted G protein- coupled receptor internalization. Science 271, 363-366. Freland, L, and Beaulieu, J.M. (2012). Inhibition of GSK3 by lithium, from single molecules to signaling networks. Front Mol Neurosci 5, 14.
Gainetdinov, R.R., Wetsel, W.C., Jones, S.R., Levin, E.D., Jaber, M., and Caron, M.G. (1999). Role of serotonin in the paradoxical calming effect of psychostimulants on hyperactivity. Science 283, 397-401.
Galandrin, S., Oligny-Longpre, G., and Bouvier, M. (2007). The evasive nature of drug efficacy: implications for drug discovery. Trends Pharmacol Sci 28, 423-430.
Gardner, B., and Strange, P.G. (1998). Agonist action at D2(long) dopamine receptors: ligand binding and functional assays. Br J Pharmacol 124, 978-984.
Gesty-Palmer, D., Flannery, P., Yuan, L., Corsino, L., Spurney, R., Lefkowitz, R.J., and Luttrell, L.M. (2009). A beta-arrestin-biased agonist of the parathyroid hormone receptor (PTH1R) promotes bone formation independent of G protein activation. Sci Transl Med 1, 1ra1.
Giros, B., Sokoloff, P., Martres, M.P., Riou, J.F., Emorine, L.J., and Schwartz, J.C. (1989). Alternative splicing directs the expression of two D2 dopamine receptor isoforms. Nature 342, 923-926. Gould, T.D., Einat, H., Bhat, R., and Manji, H.K. (2004). AR-A014418, a selective GSK-3 inhibitor, produces antidepressant-like effects in the forced swim test. Int J Neuropsychopharmacol, 1 -4.
Hao, Y., Creson, T., Zhang, L, Li, P., Du, F., Yuan, P., Gould, T.D., Manji, H.K., and Chen, G. (2004). Mood stabilizer valproate promotes ERK pathway-dependent cortical neuronal growth and neurogenesis. J Neurosci 24, 6590-6599.
Harrison-Read, P.E. (2009). Models of mania and antimanic drug actions: progressing the endophenotype approach. J Psychopharmacol 23, 334-337.
Hebert, T.E., and Bouvier, M. (1998). Structural and functional aspects of G proteinic) coupled receptor oligomerization. Biochem Cell Biol 76, 1 -1 1 .
Hebert, T.E., Loisel, T.P., Adam, L, Ethier, N., Onge, S.S., and Bouvier, M. (1998). Functional rescue of a constitutively desensitized beta2AR through receptor dimerization. Biochem J 330 ( Pt 1), 287-293.
Hemmings, H.C., Jr., Greengard, P., Tung, H.Y., and Cohen, P. (1984). DARPP-32, a dopamine-regulated neuronal phosphoprotein, is a potent inhibitor of protein phosphatase-! Nature 310, 503-505.
Hille, B. (2001 ). Ion channels of excitable membranes, 3rd edn (Sunderland, Mass., Sinauer).
Hostrup, A., Christensen, G.L., Bentzen, B.H., Liang, B., Aplin, M., Grunnet, M., 0 Hansen, J.L., and Jespersen, T. (2012). Functionally Selective AT(1 ) Receptor Activation Reduces Ischemia Reperfusion Injury. Cell Physiol Biochem 30, 642-652.
Jacinto, E., Facchinetti, V., Liu, D., Soto, N., Wei, S., Jung, S.Y., Huang, Q., Qin, J., and Su, B. (2006). SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 127, 125-137. Jope, R.S. (201 1 ). Glycogen synthase kinase-3 in the etiology and treatment of mood disorders. Frontiers in molecular neuroscience 4, 16.
Kaidanovich-Beilin, 0., Milman, A. , Weizman, A. , Pick, C.G. , and Eldar-Finkelman, H. (2004). Rapid antidepressive-like activity of specific glycogen synthase kinase-3 inhibitor and its effect on beta-catenin in mouse hippocampus. Biol Psychiatry 55, 781 -784.
Kaidanovich-Beilin, O. , and Woodgett, J. R. (201 1 ). GSK-3: Functional Insights from Cell Biology and Animal Models. Frontiers in molecular neuroscience 4, 40.
Kalinichev, M. , and Dawson, L.A. (201 1 ). Evidence for antimanic efficacy of glycogen synthase kinase-3 (GSK3) inhibitors in a strain-specific model of acute mania. Int J Neuropsychopharmacol, 1 -17.
Kebabian, J.W., and Calne, D. B. (1979). Multiple receptors for dopamine. Nature 277, 93-96.
Kenakin, T. , and Miller, L.J. (2010). Seven transmembrane receptors as shapeshifting proteins: the impact of allosteric modulation and functional selectivity on new drug discovery. Pharmacol Rev 62, 265-304.
Kim, K.M. , Valenzano, K.J. , Robinson, S. R. , Yao, W.D. , Barak, L.S. , and Caron, M.G. (2001 ). Differential regulation of the dopamine D2 and D3 receptors by G protein-coupled receptor kinases and beta-arrestins. J Biol Chem 276, 37409-37414. Kisilevsky, A. E. , and Zamponi, G.W. (2008). D2 dopamine receptors interact directly with N-type calcium channels and regulate channel surface expression levels. Channels (Austin) 2, 269-277.
Kovacs, J.J. , Hara, M. R. , Davenport, C. L. , Kim, J. , and Lefkowitz, R.J. (2009). Arrestin development: emerging roles for beta-arrestins in developmental signaling pathways. Dev Cell 17, 443-458. Lee, S.P., So, C.H., Rashid, A.J., Varghese, G., Cheng, R., Lanca, A.J., O'Dowd, B.F., and George, S.R. (2004). Dopamine D1 and D2 receptor Co-activation generates a novel phospholipase C-mediated calcium signal. J Biol Chem 279, 35671 -35678.
Leng, Y., Liang, M.H., Ren, M., Marinova, Z., Leeds, P., and Chuang, D.M. (2008). Synergistic neuroprotective effects of lithium and valproic acid or other histone deacetylase inhibitors in neurons: roles of glycogen synthase kinase-3 inhibition. J Neurosci 28, 2576-2588.
Liu, G., Yarov-Yarovoy, V., Nobbs, M., Clare, J.J., Scheuer, T., and Catterall, W.A. (2003). Differential interactions of lamotrigine and related drugs with transmembrane segment IVS6 of voltage-gated sodium channels. Neuropharmacology 44, 413-422.
Liu, X.Y., Chu, X.P., Mao, L.M., Wang, M., Lan, H.X., Li, M.H., Zhang, G.C., Parelkar, N.K., Fibuch, E.E., Haines, M., et al. (2006). Modulation of D2R-NR2B interactions in response to cocaine. Neuron 52, 897-909.
Lohse, M.J., Benovic, J.L., Codina, J., Caron, M.G., and Lefkowitz, R.J. (1990). beta- Arrestin: a protein that regulates beta-adrenergic receptor function. Science 248, 1547-1550.
Lorincz, A., and Nusser, Z. (2010). Molecular identity of dendritic voltage-gated sodium channels. Science 328, 906-909. Luttrell, L.M., Ferguson, S.S., Daaka, Y., Miller, W.E., Maudsley, S., Delia Rocca, G.J., Lin, F., Kawakatsu, H., Owada, K., Luttrell, D.K., et al. (1999). Beta-arrestin- dependent formation of beta2 adrenergic receptor-Src protein kinase complexes. Science 283, 655-661 .
Luttrell, L.M., and Gesty-Palmer, D. (2010). Beyond desensitization: physiological relevance of arrestin-dependent signaling. Pharmacol Rev 62, 305-330. Luttrell, L.M., Roudabush, F.L., Choy, E.W., Miller, W.E., Field, M.E., Pierce, K.L., and Lefkowitz, R.J. (2001). Activation and targeting of extracellular signal-regulated kinases by beta-arrestin scaffolds. Proc Natl Acad Sci U S A 98, 2449-2454.
Manago, F., Espinoza, S., Salahpour, A., Sotnikova, T.D., Caron, M.G., Premont, R.T., and Gainetdinov, R.R. (2012). The role of GRK6 in animal models of Parkinson's Disease and L-DOPA treatment. Sci Rep 2, 301.
Masri, B., Salahpour, A., Didriksen, M., Ghisi, V., Beaulieu, J.M., Gainetdinov, R.R., and Caron, M.G. (2008). Antagonism of dopamine D2 receptor/beta-arrestin 2 interaction is a common property of clinically effective antipsychotics. Proc Natl Acad Sci U S A 105, 13656-13661.
Maurice, P., Kamal, M., and Jockers, R. (2011). Asymmetry of GPCR oligomers supports their functional relevance. Trends Pharmacol Sci 32, 514-520.
Meltzer, H.Y. (1991). The mechanism of action of novel antipsychotic drugs. Schizophr Bull 17, 263-287.
Northup, J.K., Smigel, M.D., Sternweis, P.C., and Gilman, A.G. (1983). The subunits of the stimulatory regulatory component of adenylate cyclase. Resolution of the activated 45,000-dalton (alpha) subunit. J Biol Chem 258, 11369-11376.
O'Brien, W.T., Harper, A.D., Jove, F., Woodgett, J.R., Maretto, S., Piccolo, S., and Klein, P.S. (2004). Glycogen synthase kinase-3beta haploinsufficiency mimics the behavioral and molecular effects of lithium. J Neurosci 24, 6791-6798.
O'Brien, W.T., Huang, J., Buccafusca, R., Garskof, J., Valvezan, A.J., Berry, G.T., and Klein, P.S. (2011). Glycogen synthase kinase-3 is essential for beta-arrestin-2 complex formation and lithium-sensitive behaviors in mice. The Journal of clinical investigation 121, 3756-3762. Overington, J. P., Al-Lazikani, B., and Hopkins, A.L. (2006). How many drug targets are there? Nat Rev Drug Discov 5, 993-996.
Pan, J.Q., Lewis, M.C., Ketterman, J.K., Clore, E.L., Riley, M., Richards, K.R., Berry- Scott, E., Liu, X., Wagner, F.F., Holson, E.B., et al. (201 1 ). AKT kinase activity is required for lithium to modulate mood-related behaviors in mice. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 36, 1397-141 1 .
Phiel, C.J., Zhang, F., Huang, E.Y., Guenther, M.G., Lazar, M.A., and Klein, P.S. (2001 ). Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen. J Biol Chem 276, 36734-36741.
Pin, J. P., Neubig, R., Bouvier, M., Devi, L, Filizola, M., Javitch, J.A., Lohse, M.J., Milligan, G., Palczewski, K., Parmentier, M., et al. (2007). International Union of Basic and Clinical Pharmacology. LXVII. Recommendations for the recognition and nomenclature of G protein-coupled receptor heteromultimers. Pharmacol Rev 59, 5- 13.
Pozzi, L., Hakansson, K., Usiello, A., Borgkvist, A., Lindskog, M., Greengard, P., and Fisone, G. (2003). Opposite regulation by typical and atypical anti-psychotics of ERK1/2, CREB and Elk-1 phosphorylation in mouse dorsal striatum. J Neurochem 86, 451 -459. Premont, R.T., and Gainetdinov, R.R. (2007). Physiological roles of G protein- coupled receptor kinases and arrestins. Annu Rev Physiol 69, 51 1 -534.
Raehal, K.M., Schmid, C.L., Groer, C.E., and Bohn, L.M. (201 1 ). Functional selectivity at the mu-opioid receptor: implications for understanding opioid analgesia and tolerance. Pharmacol Rev 63, 1001 -1019. Rajagopal, S. , Rajagopal, K. , and Lefkowitz, R.J. (2010). Teaching old receptors new tricks: biasing seven-transmembrane receptors. Nat Rev Drug Discov 9, 373- 386.
Ralph-Williams, R.J. , Paulus, M. P. , Zhuang, X. , Hen, R. , and Geyer, M.A. (2003). Valproate attenuates hyperactive and perseverative behaviors in mutant mice with a dysregulated dopamine system. Biol Psychiatry 53, 352-359.
Ramadan, E. , Basselin, M. , Taha, A.Y. , Cheon, Y. , Chang, L , Chen, M. , and Rapoport, S. I. (201 1 ). Chronic valproate treatment blocks D2-like receptor-mediated brain signaling via arachidonic acid in rats. Neuropharmacology 61, 1256-1264. Reiter, E. , Ahn, S. , Shukla, A.K. , and Lefkowitz, R.J. (2012). Molecular mechanism of beta-arrestin-biased agonism at seven-transmembrane receptors. Annu Rev Pharmacol Toxicol 52, 179-197.
Roberts, D.J. , and Strange, P.G. (2005). Mechanisms of inverse agonist action at D2 dopamine receptors. Br J Pharmacol 145, 34-42.
Rogawski, M.A. , and Loscher, W. (2004a). The neurobiology of antiepileptic drugs. Nat Rev Neurosci 5, 553-564.
Rogawski, M.A. , and Loscher, W. (2004b). The neurobiology of antiepileptic drugs for the treatment of nonepileptic conditions. Nat Med 10, 685-692.
Roth, B. L. , Sheffler, D.J. , and Kroeze, W.K. (2004). Magic shotguns versus magic bullets: selectively non-selective drugs for mood disorders and schizophrenia. Nat Rev Drug Discov 3, 353-359.
Seeman, P. , Lee, T., Chau-Wong, M. , and Wong, K. (1976). Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717-719. Shenoy, S.K., and Lefkowitz, R.J. (2005). Seven-transmembrane receptor signaling through beta-arrestin. Sci STKE 2005, cm 10.
Snyder, S.H. (1976). The dopamine hypothesis of schizophrenia: focus on the dopamine receptor. Am J Psychiatry 133, 197-202.
Sutton, L.P., and Rushlow, W.J. (201 1 ). The dopamine D2 receptor regulates Akt and GSK-3 via Dvl-3. The international journal of neuropsychopharmacology / official scientific journal of the Collegium Internationale Neuropsychopharmacologicum, 1 - 15.
Usiello, A., Baik, J.H., Rouge-Pont, F., Picetti, R., Dierich, A., LeMeur, M., Piazza, P. V., and Borrelli, E. (2000). Distinct functions of the two isoforms of dopamine D2 receptors. Nature 408, 199-203.
Valvezan, A.J., and Klein, P.S. (2012). GSK-3 and Wnt Signaling in Neurogenesis and Bipolar Disorder. Front Mol Neurosci 5, 1 .
Vassilatis, D.K., Hohmann, J.G., Zeng, H., Li, F., Ranchalis, J.E., Mortrud, M.T., Brown, A., Rodriguez, S.S., Weller, J.R., Wright, A.C., et al. (2003). The G protein- coupled receptor repertoires of human and mouse. Proc Natl Acad Sci U S A 100, 4903-4908.
Weisstaub, N.V., Zhou, M., Lira, A., Lambe, E., Gonzalez-Maeso, J., Hornung, J. P., Sibille, E., Underwood, M., Itohara, S., Dauer, W.T., et al. (2006). Cortical 5-HT2A receptor signaling modulates anxiety-like behaviors in mice. Science 313, 536-540.
Wisler, J.W., DeWire, S.M., Whalen, E.J., Violin, J.D., Drake, M.T., Ahn, S., Shenoy, S.K., and Lefkowitz, R.J. (2007). A unique mechanism of beta-blocker action: carvedilol stimulates beta-arrestin signaling. Proceedings of the National Academy of Sciences of the United States of America 104, 16657-16662. Yang, Y.C., Huang, C.S., and Kuo, C.C. (2010). Lidocaine, carbamazepine, and imipramine have partially overlapping binding sites and additive inhibitory effect on neuronal Na+ channels. Anesthesiology 113, 160-174.
Zhao, J., O'Leary, M.E., and Chahine, M. (201 1 ). Regulation of Nav1 .6 and Nav1 .8 peripheral nerve Na+ channels by auxiliary beta-subunits. J Neurophysiol 106, 608- 619.

Claims

What is claimed is:
1. A transgenic cell co-expressing at least one cell surface ionic channel and at least one G protein coupled receptor (GPCR), wherein at least one GPCR signaling pathway is modulated by a GPCR signaling compound.
2. The transgenic cell of claim 1 , wherein the at least one cell surface ionic channel interacts with the at least one GPCR.
3. The transgenic cell of claim 2, wherein the at least one cell surface ionic channel binds to the at least one GPCR.
4. The transgenic cell of any one of claim 1 to 3, wherein the at least one cell surface ionic channel is a sodium channel (NaV).
5. The transgenic cell of claim 4, wherein the NaV channel is a voltage-gated sodium channel and/or a ligand-gated voltage channel.
6. The transgenic cell of claim 5, wherein the at least one NaV voltage-gated sodium channel comprises one of 1.1 , 1.2, 1 .3, 1.4, 1.5, 1.6, 1.7, 1.8 or 1.9 alpha-subunit.
7. The transgenic cell of claim 6, wherein the at least one NaV voltage-gated sodium channel comprises one of 1.1 , 1.2 or 1.6 alpha-subunit.
8. The transgenic cell of claim 7, wherein the at least one NaV voltage-gated sodium channel further comprises at least one beta-subunit.
9. The transgenic cell of claim 8, wherein the beta-subunit comprises SCN1 B, SCN2B, SCN3B or SCN4B.
10. The transgenic cell of any one of claims 1 to 9, wherein the at least one GPCR receptor is a dopamine receptor and/or a serotonin receptor.
1 1 . The transgenic cell of claim 10, wherein the dopamine receptor is D1 , D2, and/or D3 dopamine receptor.
12. The transgenic cell of claim 10 or 1 1 wherein the dopamine receptor is D2 dopamine receptor.
13. The transgenic cell of claim 12, wherein the D2 dopamine receptor is D2S and/or D2L receptor.
14. The transgenic cell of any one of claims 10 to 13, wherein the serotonin receptor is 5-HT1 , 5-HT2, 5-HT4, 5-HT5, 5-HT6 and/or 5-HT7.
15. The transgenic cell of claim 14, wherein the serotonin receptor is 5-HT1A, 5- HT2A and/or 5-HT2C.
16. The transgenic cell of any one of claims 1 to 15, wherein the transgenic cell is a HEK293 cell.
17. The transgenic cell of any one of claims 1 to 16, wherein the at least one GPCR signaling pathway is cAMP/PKA pathway, Ca2+/PKC pathway, Ca2+/NFAT pathway, PLC pathway, PTK pathway, PKC/MEK pathway, p43/p44MAPK pathway, p38 MAP pathway, PI3K pathway, NO-cGMP pathway, Rho pathway, NF-KappaB pathway, JAK/ STAT pathway and/or beta-arrestin pathway.
18. The transgenic cell of claim 17, wherein the at least one GPCR signaling pathway is the beta-arrestin pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway.
19. The transgenic cell of claim 18, wherein the beta-arrestin pathway comprises Akt/GSK3 pathway and/or Akt/beta-arrestin/PP2A pathway.
20. The transgenic cell of claim 19, wherein the activity of Akt, the cAMP/PKA pathway and/or the PKC/MEK pathway is reduced.
21. The transgenic cell of any one of claims 1 to 20, wherein the GPCR signaling compound is a GPCR ligand.
22. The transgenic cell of claim 21 , wherein the GPCR ligand is dopamine, serotonin, endothelin, bradykinin, angiotensin, somatostatin, neuropeptide, opioid, leukotrien, vasopressin, neurotensin, calcitonin, secretin or functional analogues thereof.
23. The transgenic cell of any one of claims 1 to 19, wherein the beta-arrestin pathway is reduced.
24. The transgenic cell of claim 23, wherein the GPCR signaling compound is an ionic channel ligand.
25. Use of the transgenic cell of any one of claims 1 to 24 for identifying a GPCR signaling compound modulating at least one G protein coupled receptor (GPCR) signaling pathway.
26. A screening method for identifying a G protein coupled receptor (GPCR) signaling compound modulating at least one GPCR signaling pathway, the method comprising the steps of: a) contacting a transgenic cell with the GPCR signaling compound wherein the transgenic cell co-expresses at least one cell surface ionic channel and at least one GPCR; and
b) determining the ability of the GPCR signaling compound to modulate the at least one GPCR signaling pathway; wherein determining modulation of the at least one GPCR signaling pathway relative to a control indicates that the GPCR signaling compound modulates the at least one GPCR signaling pathway.
27. The screening method of claim 26, wherein the at least one cell surface ionic channel interacts with the at least one GPCR.
28. The screening method of claim 27, wherein the at least one cell surface ionic channel binds to the at least one GPCR.
29. The screening method of any one of claim 26 to 28, wherein the at least one cell surface ionic channel is a sodium channel (NaV).
30. The screening method of claim 29, wherein the NaV channel is a voltage-gated sodium channel and/or a ligand-gated voltage channel.
31. The screening method of claim 30, wherein the at least one NaV voltage-gated sodium channel comprises one of 1.1 , 1.2, 1 .3, 1.4, 1.5, 1.6, 1.7, 1.8 or 1.9 alpha-subunit.
32. The screening method of claim 31 , wherein the at least one NaV voltage-gated sodium channel comprises one of 1.1 , 1.2 or 1.6 alpha-subunit.
33. The screening method of claim 32, wherein the at least one NaV voltage-gated sodium channel further comprises at least one beta-subunit.
34. The screening method of claim 33, wherein the beta-subunit comprises SCN1 B, SCN2B, SCN3B or SCN4B.
35. The screening method of any one of claims 26 to 34, wherein the at least one GPCR receptor is a dopamine receptor and/or a serotonin receptor.
36. The screening method of claim 35, wherein the dopamine receptor is D1 , D2, and/or D3 dopamine receptor.
37. The screening method of claim 35 or 36, wherein the dopamine receptor is D2 dopamine receptor.
38. The screening method of claim 37, wherein the D2 dopamine receptor is D2S and/or D2L receptor.
39. The screening method of any one of claims 35 to 38, wherein the serotonin receptor is 5-HT1 , 5-HT2, 5-HT4, 5-HT5, 5-HT6 and/or 5-HT7.
40. The screening method of claim 39, wherein the serotonin receptor is 5-HT1A, 5- HT2A and/or 5-HT2C.
41 . The screening method of any one of claims 26 to 40, wherein the transgenic cell is a HEK293 cell.
42. The screening method of any one of claims 26 to 41 , wherein the at least one GPCR signaling pathway is cAMP/PKA pathway, Ca2+/PKC pathway, Ca2+/NFAT pathway, PLC pathway, PTK pathway, PKC/MEK pathway, p43/p44MAPK pathway, p38 MAP pathway, PI3K pathway, NO-cGMP pathway, Rho pathway, NF-KappaB pathway, JAK/ STAT pathway and/or beta-arrestin pathway.
43. The screening method of claim 42, wherein the at least one GPCR signaling pathway is the beta-arrestin pathway, the cAMP/PKA pathway and/or the PKC/MEK pathway.
44. The screening method of claim 43, wherein the beta-arrestin pathway comprises Akt/GSK3 pathway and/or Akt/beta-arrestin/PP2A pathway.
45. The screening method of claim 44, wherein the activity of Akt, the cAMP/PKA pathway and/or the PKC/MEK pathway is reduced.
46. The screening method of any one of claims 26 to 45, wherein the GPCR signaling compound is a GPCR ligand.
47. The screening method of claim 46, wherein the GPCR ligand is dopamine, serotonin, endothelin, bradykinin, angiotensin, somatostatin, neuropeptide, opioid, leukotrien, vasopressin, neurotensin, calcitonin, secretin or functional analogues thereof.
48. The screening method of any one of claims 26 to 44, wherein the beta-arrestin pathway is reduced.
49. The screening method of claim 48, wherein the GPCR signaling compound is an ionic channel ligand.
PCT/CA2013/050783 2012-10-16 2013-10-16 Transgenic cells for identifying gpcr signaling compound modulating gpcr signaling pathway and screening method thereof Ceased WO2014059544A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261714464P 2012-10-16 2012-10-16
US61/714,464 2012-10-16

Publications (1)

Publication Number Publication Date
WO2014059544A1 true WO2014059544A1 (en) 2014-04-24

Family

ID=50487384

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2013/050783 Ceased WO2014059544A1 (en) 2012-10-16 2013-10-16 Transgenic cells for identifying gpcr signaling compound modulating gpcr signaling pathway and screening method thereof

Country Status (1)

Country Link
WO (1) WO2014059544A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266747A (en) * 2018-09-21 2019-01-25 中国医学科学院北京协和医院 GPR56 associated with type I neurofibroma with spinal deformity and its application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012080248A1 (en) * 2010-12-13 2012-06-21 Fondazione Centro San Raffaele Del Monte Tabor Method to generate dopaminergic neurons from mouse and human cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012080248A1 (en) * 2010-12-13 2012-06-21 Fondazione Centro San Raffaele Del Monte Tabor Method to generate dopaminergic neurons from mouse and human cells

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BEAULIEU ET AL.: "A beta-arrestin 2 signaling complex mediates lithium action on behavior.", CELL, vol. 132, no. 1, 11 January 2008 (2008-01-11), pages 125 - 136 *
BEAULIEU ET AL.: "The physiology, signaling, and pharmacology of dopamine receptors.", PHARMACOLOGICAL REVIEWS, vol. 63, no. 1, March 2011 (2011-03-01), pages 182 - 217 *
DING ET AL.: "Molecular and functional differences in voltage-activated sodium currents between GABA projection neurons and dopamine neurons in the substantia nigra.", JOURNAL OF NEUROPHYSIOLOGY. DECEMBER, vol. 106, no. 6, 2011, pages 3019 - 3034 *
KISILEVSKY ET AL.: "D2 dopamine receptors interact directly with N-type calcium channels and regulate channel surface expression levels.", CHANNELS, vol. 2, no. 4, July 2008 (2008-07-01), pages 269 - 277 *
MARIN ET AL.: "5-HT receptor-associated protein networks: New targets for drug discovery in psychiatric disorders?", CURRENT DRUG TARGETS, vol. 13, no. 1, January 2012 (2012-01-01), pages 28 - 52 *
ROBERTS ET AL.: "R.S. Effect of dopamine on intracellular sodium: A common pathway for pharmacological mechanism of action in bipolar illness.", WORLD JOURNAL OF BIOLOGICAL PSYCHIATRY, vol. 11, no. 2, 2010, pages 181 - 187 *
TUCKER ET AL.: "Pacemaker rate and depolarization block in nigral dopamine neurons: a somatic sodium channel balancing act", THE JOURNAL OF NEUROSCIENCE: THE OFFICIAL JOURNAL OF THE SOCIETY FOR NEUROSCIENCE, vol. 32, no. 42, 17 October 2012 (2012-10-17), pages 14519 - 14531 *
YUEN ET AL.: "Activation of 5-HT2A/C receptors counteracts 5-HT1A regulation of N-methyl-D-aspartate receptor channels in pyramidal neurons of prefrontal cortex.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, no. 25, 2008, pages 17194 - 17204 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266747A (en) * 2018-09-21 2019-01-25 中国医学科学院北京协和医院 GPR56 associated with type I neurofibroma with spinal deformity and its application
CN109266747B (en) * 2018-09-21 2021-07-27 中国医学科学院北京协和医院 GPR56 associated with neurofibromatosis type I combined with spinal deformity disease and its application

Similar Documents

Publication Publication Date Title
Jiang et al. Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway
Groer et al. Agonist-directed interactions with specific β-arrestins determine μ-opioid receptor trafficking, ubiquitination, and dephosphorylation
Espinoza et al. Functional interaction between trace amine-associated receptor 1 and dopamine D2 receptor
Yano et al. Gs-versus Golf-dependent functional selectivity mediated by the dopamine D1 receptor
Baldwin et al. Insights into the regulatory properties of human adenylyl cyclase type 9
Cho et al. Current perspectives on the selective regulation of dopamine D2 and D3 receptors
Raote et al. Functional selectivity in serotonin receptor 2A (5-HT2A) endocytosis, recycling, and phosphorylation
Zhang et al. Serine 363 is required for nociceptin/orphanin FQ opioid receptor (NOPR) desensitization, internalization, and arrestin signaling
Garcia-Olivares et al. Inhibition of dopamine transporter activity by G protein βγ subunits
Bohn et al. Serotonin receptor signaling and regulation via β-arrestins
Brackley et al. GRK2 constitutively governs peripheral delta opioid receptor activity
Chen et al. Neurabin scaffolding of adenosine receptor and RGS4 regulates anti-seizure effect of endogenous adenosine
Jiang et al. Muscarinic acetylcholine receptor M3 modulates odorant receptor activity via inhibition of β-arrestin-2 recruitment
Körber et al. Effects of distinct collybistin isoforms on the formation of GABAergic synapses in hippocampal neurons
Brands et al. A molecular mechanism to diversify Ca2+ signaling downstream of Gs protein-coupled receptors
Kanaide et al. Desensitization of GABAB receptor signaling by formation of protein complexes of GABAB2 subunit with GRK4 or GRK5
Carter et al. Characterization of isoprenaline-and salmeterol-stimulated interactions between β2-adrenoceptors and β-arrestin 2 using β-galactosidase complementation in C2C12 cells
Lengyel et al. Chemically modified derivatives of the activator compound cloxyquin exert inhibitory effect on TRESK (K2P18. 1) background potassium channel
Björk et al. Modulation of monoamine receptors by adaptor proteins and lipid rafts: role in some effects of centrally acting drugs and therapeutic agents
Romo et al. xRic‐8 is a GEF for Gsα and participates in maintaining meiotic arrest in Xenopus laevis oocytes
Xiao et al. “Barcode” and differential effects of GPCR phosphorylation by different GRKs
WO2014059544A1 (en) Transgenic cells for identifying gpcr signaling compound modulating gpcr signaling pathway and screening method thereof
Schmid et al. βArrestins: ligand-directed regulators of 5-HT2A receptor trafficking and signaling events
Farrag et al. G Protein‐Coupled Receptor Kinase 5 (GRK5) Modulates Nociceptin/Orphanin FQ Opioid (NOP) Receptor Desensitization in Rat Sympathetic Neurons
Donthamsetti et al. Distinct GRK2 Recruitment Mechanisms Differentially Shape GPCR Signaling Bias

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13847303

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13847303

Country of ref document: EP

Kind code of ref document: A1