WO2014059372A1 - Characterization of cancer using detection of activated leukocyte cell adhesion molecule (alcam) shedding - Google Patents
Characterization of cancer using detection of activated leukocyte cell adhesion molecule (alcam) shedding Download PDFInfo
- Publication number
- WO2014059372A1 WO2014059372A1 PCT/US2013/064696 US2013064696W WO2014059372A1 WO 2014059372 A1 WO2014059372 A1 WO 2014059372A1 US 2013064696 W US2013064696 W US 2013064696W WO 2014059372 A1 WO2014059372 A1 WO 2014059372A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alcam
- cancer
- shed
- tumor
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/57585—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds identifiable in body fluids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57525—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57557—Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
Definitions
- the presently-disclosed subject matter relates to characterization of cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding.
- ACAM activated leukocyte cell adhesion molecule
- Characterization includes monitoring a cancer, providing a diagnosis, providing a prognosis, providing a theranosis, and evaluation treatment efficacy and/or progression of a cancer in a subject by determining a presence or an amount of shed ALCAM in a biological sample from the subject.
- CRC colorectal cancer
- TNM tumor node metastasis
- BCa bladder cancer
- BCa is another example of a widespread cancer
- BCa is the fourth most common cancer in men in the United States with an estimated 55,600 new cases in 2012 and a five-year relative survival of 71%, 35% and 5% for local, regional and distant disease, respectively.
- 60-70% of patients with non-muscle invasive BCa will recur locally after transurethral resection and another 20-50% will progress to invasive disease, ultimately requiring complete surgical resection of the bladder (cystectomy).
- cystectomy complete surgical resection of the bladder
- approximately 50% of patients undergoing radical cystectomy will recur with metastases within two years.
- neoadjuvant chemotherapy is under-utilized due to an inability to accurately predict recurrence and monitor treatment response that would justify the risk of exposure of an aging patient population with multiple comorbidities to chemotherapy-associated toxicities.
- Biomarkers can assist in identifying those patients that require more aggressive intervention or patients at risk of relapse after initial treatment.
- Promising clinical tests including ONCOTYPE DXTM and COLOPRTNTTM evaluate possible disease progression by assessing gene expression. These tests are not yet widely applied possibly because their epigenetic evaluation reflects on gene expression which does not always reliably predict actual cellular behavior. Thus, existing prognostic tests do not report on cancer progression.
- the heterogeneous nature of genetic drivers, particularly in BCa limits their use as predicative biomarkers.
- the presently-disclosed subject matter includes a shed ALCAM label for use in the identification of shed ALCAM in a sample from a subject.
- the label can include an antibody, which itself can be an isolated antibody.
- the label can produce a signal which can be detected, such as an optical signal or the like.
- the optical signal can include fluorescence.
- the label comprises an antibody and a signal-producing moiety conjugated to the antibody. The antibody can selectively bind to shed ALCAM, whereas the signal-producing moiety can produce a signal that can be detected (e.g., fluoresce).
- the label can recognize the C-terminal of ALCAM, shed ALCAM, or a combination thereof. In other embodiments the label can recognize the N- terminal ALCAM, shed ALCAM, or a combination thereof. In some embodiments the label is detectable with the use of ELSIA.
- the presently-disclosed subject matter also includes a method for characterizing, monitoring, or characterizing and monitoring a cancer in a subject.
- the methods comprise providing a biological sample from the subject, determining a presence or an amount of shed ALCAM in the biological sample, and comparing the presence or the amount of the shed ALCAM in the biological sample to a reference, wherein the cancer is characterized and/or monitored based on a measurable difference in the presence or the amount of the shed ALCAM from the biological sample as compared to the reference.
- the step of characterizing can include providing a diagnosis, prognosis, theranosis, or combination thereof of the cancer.
- a method for evaluating the treatment efficacy, progression, or both of a cancer in a subject.
- the methods comprise providing a biological sample from the subject, determining a presence or an amount of shed ALCAM in the biological sample, and comparing the presence or the amount of the shed ALCAM to a reference, wherein the treatment efficacy and/or progression of the cancer is evaluated based on a measurable difference in the presence or the amount of the shed ALCAM as compared to the reference.
- a step of contacting the biological sample with an antibody that selectively binds shed ALCAM can be provided.
- some embodied antibodies can recognize the C-terminal ALCAM, shed ALCAM, or a combination thereof, or they can recognize the N-terminal ALCAM, shed ALCAM, or a combination thereof.
- the step of determining a presence or an amount of shed ALCAM in the biological sample therefore includes the use of an ELISA.
- the cancer can include, but is not limited to, a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, colorectal cancer, and combinations thereof.
- a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, colorectal cancer, and combinations thereof.
- the cancer is urogenital cancer.
- the cancer is bladder cancer.
- the cancer is renal cell cancer.
- the cancer is colorectal cancer.
- the present methods can include comparing the presence or the amount of shed ALCAM to a reference.
- the reference comprises a level of the shed ALCAM in one or more samples from one or more individuals without the cancer.
- the reference comprises a level of the shed ALCAM in a sample from the subject taken over a time course.
- the reference comprises a sample from the subject collected prior to initiation of treatment for the cancer and/or onset of the cancer and the biological sample is collected after initiation of the treatment or onset of the cancer.
- the reference comprises a standard sample, control data, or both. The reference can also include any value calculated from one or more different possible references.
- the present methods comprise providing a series of biological samples collected from the subject over a time course, and then determining a presence or an amount of shed ALCAM in each of the series of biological samples.
- the series of biological samples comprises a first biological sample collected prior to initiation of treatment for the cancer and/or onset of the cancer and a second biological sample collected after initiation of the treatment or onset of the cancer.
- the biological sample comprises tissue, urine, serum, blood, spinal fluid, or the like or combinations thereof.
- the step of providing the biological sample from the subject comprises extracting the sample.
- the step of providing the biological sample from the subject comprises isolating the shed ALCAM from the sample.
- the methods can be carried out in vitro or in vivo.
- a step of determining an amount of intact ALCAM and, optionally, in some embodiments the methods comprise calculating a ratio of intact ALCAM to shed ALCAM.
- a reagent is used.
- the presently-disclosed subject matter includes a kit that comprises a reagent that can carry out any of the presently-disclosed methods.
- the kit can further comprise an antibody that selectively binds shed ALCAM.
- the antibody recognizes the C-terminal of ALCAM, and in other embodiments the antibody recognizes the N-terminal of ALCAM.
- kits can further comprise a reference standard sample and/or control data.
- the standard sample, the control data, or both can be for a cancer, a non-cancer, or a combination thereof.
- the cancer can include, but is not limited to, a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, and colorectal cancer.
- FIG. 1 shows ALCAM expression in colorectal carcinoma and its correlation to patient outcome.
- Expression (mRNA) of ALCAM (C) and ADAM17 (D) in a cohort of 250 colorectal cancer patients was correlated to patient survival after dichotomizing the population across its mean expression into patients with "High ALCAM” and "Low ALCAM".
- FIG. 2 shows ALCAM expression in continuous cancer cell lines. Lysates from human cancer cell lines immunoblotted for ALCAM using an antibody specific for its extracellular domain.
- FIG. 3 shows that the lack of cytoplasmic ALCAM corresponds with poor patient outcome.
- a tissue microarray of 75 CRC and 12 normal colonic tissues was stained by traditional IHC for the extracellular domain of ALCAM.
- Membranous and cytoplasmic staining was stained and scored by an independent pathologist in a blinded manner.
- Figure 4 shows the specificity of anti-ALCAM ICD confirmed by analysis of ALCAM in ALCAM-/- mice.
- Figure 5 shows multi-species sequence alignment was carried our using the GeneiousTM bioinformatics software. Along the top of each alignment is the sequence identity plot comparing the sequence across species. Green peaks are 100% identity among species; yellow and red are lower identities. Immunogen sequence is located in the cytoplasmic tail consisting of a highly conserved 14 amino acid sequence.
- Figure 6 shows the screening and validation of an antibody specific to the cytoplasmic domain of ALCAM.
- Hybridoma clones 1G3A1, 1G3B3, and 1G3CF were further for specificity to ALCAM by comparing their reactivity to ALCAM with a commercial antibody (directed against the extracellular domain) using lysates from parental PC3 cells and PC3 cells with shRNA-mediated knockdown of ALCAM.
- PC3 whole cell lysates
- D) Specificity of purified 1G3A1 against the cytoplasmic tail of ALCAM was confirmed by immunoblotting intact ALCAM (whole cell lysate; Lys.) and shed ALCAM (conditioned medium; CM.) from PC3 cells.
- FIG. 7 shows the detection of ALCAM shedding in cancers of the stomach and colon.
- FIG. 8 shows the quantitative analysis of ALCAM shedding in CRC
- the ALCAM dual stain was used to detection the extracellular domain (green) and intracellular domain (red) of ALCAM in normal colonic mucosa (A) and colorectal cancer (B).
- ALCAM shedding was defined as the detection of ALCAM-ICD in the absence of co-localized ALCAM-ECD.
- the results of this analysis presents ALCAM shedding quantitatively as the fraction of total detectable ALCAM from which the extracellular domain is absent.
- FIG. 9 shows the image processing pipeline implemented using FIJI. Images obtained of normal (A) and tumor (B) tissues through scanning on the Ariol® platform were processed to obtain the fraction of ALCAM shed. The original images was separated into its individual color channels and threshold values were obtained for the red channel (ALCAM- ICD) and the green channel (ALCAM-ECD). A co-localization of these thresholded areas was used to distinguish intact ALCAM (both ALCAM-ICD and -ECD, yellow) from shed ALCAM (only ALCAM -ICD, teal). Quantitatively ALCAM shedding is defined as the fraction of detectable ALCAM from which the extracellular domain is absent.
- FIG. 10 shows ALCAM shedding in CRC correlates with poor survival.
- Scatter plots demonstrate the differences in ALCAM shedding between normal colonic mucosa and CRC tumors as a single population (A), stratified across histological stage (B), or separated according to survival (C).
- Kaplan-Meier survival curves of CRC patients with high versus low ALCAM shedding were generated and log-rank tests performed to evaluate the correlation of ALCAM shedding with overall survival of patients at all stages (D), overall survival of stage II patients (E) or disease-specific survival of stage II patients (F).
- Scatter plots show the mean and SEM with statistical evaluation by Mann- Whitney for selected groups (A and C) or Kruskal-Wallis with Dunn's multiple comparison restricted to normal (B).
- FIG 11 shows ALCAM mRNA, protein and shedding in colorectal cancer.
- Kaplan-Meier survival analysis contrasts CRC patients overall survival, stage II patient overall survival and disease-specific stage II CRC survival with high versus low ALCAM mRNA expression (A) protein expression (B) or ALCAM shedding (C). Survival is presented as Kaplan-Meier plots with the log-rank test used to evaluate significance.
- Figure 12 shows a schematic of a multi-level approach for analysis of ALCAM in bladder cancer.
- Figure 13 shows the correlation of ALCAM mRNA with tumor stage and overall survival in bladder cancer.
- ALCAM Log 2 mRNA levels are graphed according to tumor pathology stage. Mean and 95% confidence intervals displayed. K-W, Kruskal-Wallis test. J- T, Jonckheere-Terpstra test for trend.
- B Kaplan-Meier curves and Log-rank test for significance of ALCAM dichotomized high/low around the median Log 2 mRNA level (10.4). HR, Hazard Ratio. CI, Confidence Interval. All analyses were two-tailed with a 0.05 alpha level.
- Figure 14 shows the correlation of ALCAM protein expression with tumor stage and overall survival in bladder cancer.
- IHC top panel
- IF bottom panels
- ALCAM green
- Ki67 white
- Collagen red
- Nuclei blue
- Scale bars ⁇ (low magnification) and 50 ⁇ (high magnification).
- FIG. 15 shows the detection of shed ALCAM in fluids and its correlation with stage and overall survival in bladder cancer.
- A A schematic of ALCAM acting as a cell-cell adhesion molecule in normal epithelial cells, which, during tumor progression, cells can regulate motility and invasion through ADAM 17 -mediated ALCAM cleavage.
- B ALCAM levels (ng/ml) in serum of normal controls compared to patients with BCa. Mann- Whitney U, two-tailed, 0.05 alpha level.
- C ALCAM levels (ng/ml) in urine of normal controls compared to patients with inflammatory conditions, cancers other than BCa, and BCa. Mann- Whitney U, two-tailed, 0.05 alpha level.
- UC ulcerative colitis.
- Figure 16 shows the mass spectrometry analysis and discovery of ALCAM as a CD151 associated protein.
- A (left panel) General tetraspanin schematic with the small extracellular loop (SEL) and the large extracellular loop (LEL) highlighted, (right panel) Schematic representation of tetraspanin-partner interaction (I-II), TERM assembly (III-IV) and interaction with intracellular signaling molecules (V).
- B Detection of CD 151 and associated proteins by metabolic labeling (S35), cell-surface biotin labeling (biotin), or CD 151 -specific immunoblot after immunoprecipitation from a HEp3 cell lysate.
- Figure 18 shows that CD151 and ALCAM cooperate in the regulation of tumor cell migration.
- A Schematic representation of migration in response to clustering of CD 151 by antibody 1A5 (I) which results in enhanced adhesion (II) and subsequent inhibition of migration.
- B Transwell migration of HT 1080 cells in the presence or absence of 1A5 after transfection with control siRNA (white bars) or ALCAM siRNA (black bars).
- C C
- FIG. 19 shows that the CD151/ALCAM signaling mechanism involves PKC and the small GTPase Rapl .
- A Transwell migration of HEp3 cells in the absence (white bars) or presence of 1A5 Anti-CD151 (black bars) analyzed in the presence of different pathway inhibitors.
- B Wound healing migration of HEp3 cells expressing siRNAs specific for ALCAM, PKCa, and Rapl.
- C Rapl activation HEp3 cells serum starved overnight and treated with 1A5 in culture for the indicated time points.
- D Plating HEp3 cells on ALCAM- Fc activates Rap 1 in a time dependent manner but has not impact on the activation of state of the small GTPase Racl .
- E 1A5 treatment activates Rapl in a PKCa-dependent manner.
- FIG. 20 shows that Rapl activation can inhibit tumor cell motility in vitro and in vivo.
- HEp3 cells were transiently transfected with empty vector (Control) dominant negative Rapl (N17) or dominant active Rapl (V12).
- A Transgene expression was verified by immunoblotting for the HA -tagged protein.
- B In Vitro cell migration was performed with transiently transfected cells in a wound-healing assay.
- C and (D) HEp3 cells were injected into 12 day old chicks and the migratory phenotype of metastatic colonies was evaluated (see methods for details). The number of motile colonies was quantified (C) from images taken of the chorioallantoic membrane containing metastatic colonies (D).
- FIG. 21 shows that ALCAM is overexpressed metastatic prostate cancer and correlates with patient survival.
- A Heat map and corresponding relative expression of ADAM 17
- ALCAM ii) N-cadherin (iii), pi 20
- iv iv
- E-cadherin v
- Figure 22 shows A) Western blot analysis of ALCAM shedding in conditioned media of LNCaP and PC3 cells treated with or without lOng/ml of TGF using antibodies specifically recognizing the extracellular and intracellular domains, and B) ALCAM shedding in response to lOng/ml TGF after 48 hours as measured by Western blotting of ALCAM and CD151 (exosome marker) in PC3 tumor cell conditioned media.
- Total CM total conditioned media
- CM Supernatant conditioned media supernatant without exosome pellet
- Exosome pellet exosome pellet resuspended in phosphate buffered saline.
- Figure 23 shows that the expression and shedding of ALCAM is increased in response to TGF .
- A ELISA analysis of ALCAM shedding in concentrated conditioned media of PC3 cells treated with indicated exogenous cytokines. TGF , p ⁇ 0.001
- B ELISA analysis of ALCAM shedding in concentrated conditioned media of PC3 cells treated with indicated exogenous cytokines. TGF , p ⁇ 0.001
- FIG. 24 shows that ALCAM shedding correlates with tumor burden.
- A Schematic representation of in vivo strategy for S.Q. and orthotopic tumor models.
- B and C Circulating levels of soluble host and tumor-derived ALCAM detectable in mice bearing subcutaneous injected PC3 cells (B) or PC3 cells orthotopically implanted into the prostate
- Figure 25 shows a graph of ALCAM serum half-life in mice.
- Figure 26 shows that the immune response modulation does not effect serum ALCAM.
- LPS Lipopolysaccharide
- Figure 28 shows a plot of compound-32/ADAM17 inhibitor dosing in vivo.
- Figure 31 shows that tumor-derived ALCAM impacts tumor survival in the bone microenvironment of intratibial bone tumor model.
- Figure 32 shows a graph of tumor cell proliferation over time assessed by total cell counts over 72 hours.
- Figure 33 shows representative TRAcP stained photomicrographs of PC3 shControl and shALCAM injected animals at day 28.
- Figure 34 shows the analysis of intra-tumoral ALCAM protein expression and shedding on a retrospective cohort of patients with clear cell renal cell carcinoma undergoing nephrectomy.
- Overall survival was defined as time from date of nephrectomy to date of death or last follow-up.
- Recurrence was defined as time from date of nephrectomy to date of metastatic recurrence validated by imaging.
- the presently-disclosed subject matter includes methods of characterizing a cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding. Characterization includes monitoring a cancer, providing a diagnosis, providing a prognosis, providing a theranosis, and evaluation treatment efficacy and/or progression of a cancer in a subject by determining a presence or an amount of shed ALCAM in a biological sample from the subject.
- ALCAM activated leukocyte cell adhesion molecule
- ALCAM Activated Leukocyte Cell Adhesion Molecule
- ALCAM consists of five extracellular IgG-like domains, a transmembrane domain and a short cytoplasmic domain. ALCAM can be proteolytically processed by ADAM 17, thereby generating a soluble ALCAM component and a truncated membrane -bound ALCAM containing the
- ALCAM expression is not tissue-restricted and it is commonly found in most epithelia and related carcinomas. ALCAM contributes to tumor progression by controlling migration.
- the present inventors have found that the molecular activity of ALCAM appears to be regulated through shedding of its extracellular domain. Consequently, certain advanced disease tissues express ALCAM but exhibit an elevated level of ALCAM shedding.
- a method for characterizing and/or monitoring a cancer in a subject includes providing a biological sample from the subject; determining a presence or an amount of shed ALCAM in the biological sample; and comparing the presence or the amount of the shed ALCAM in the biological sample to a reference, wherein the cancer is characterized and/or monitored based on a measurable difference in the presence or the amount of the shed ALCAM from the biological sample as compared to the reference.
- the presently-disclosed subject matter includes a method for evaluating treatment efficacy and/or progression of a cancer in a subject, which involves providing a biological sample from the subject; determining a presence or an amount of shed ALCAM in the biological sample; and comparing the presence or the amount of the shed ALCAM to a reference, wherein the treatment efficacy and/or progression of the cancer is evaluated based on a measurable difference in the presence or the amount of the shed ALCAM as compared to the reference.
- the presently-disclosed subject matter includes antibodies and kits useful for characterizing, monitoring, evaluating treatment efficacy of, and/or evaluating progression of a cancer in a subject.
- the antibody is an isolated antibody or antigen- binding fragment thereof that specifically binds to at least one of C-terminus of shed
- the kit includes an antibody that selectively binds shed ALCAM. In some embodiments, the kit further includes a reference.
- the term “characterizing” and “characterize” are used herein to refer to providing a diagnosis, a prognosis, and/or a theranosis of a cancer.
- diagnosis and “diagnosis” as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition. The skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, such as for example a biomarker, the amount (including presence or absence) of which is indicative of the presence, severity, or absence of the condition.
- "making a diagnosis” or “diagnosing”, as used herein, is further inclusive of determining a risk of developing cancer or determining a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the measure of the shed ALCAM disclosed herein. Diagnostic testing that involves treatment, such as treatment monitoring or decision making can be referred to as "theranosis.” Further, in some embodiments of the presently disclosed subject matter, multiple determinations of the shed ALCAM over time can be made to facilitate diagnosis and/or prognosis.
- a temporal change in the biomarker can be used to predict a clinical outcome, monitor the progression of the cancer and/or efficacy of appropriate therapies directed against the cancer.
- shed ALCAM refers to shedding of the cell adhesion molecule ALCAM, that is to say, ALCAM that has been shed into a biological sample.
- shed ALCAM is distinct from ALCAM that might be expressed and detected by measuring gene products, such as mRNA or expressed protein, i.e., intact ALCAM. In some embodiments, it can be useful to further detect intact ALCAM, and to determine a ratio of intact ALCAM to shed ALCAM, which can be useful in characterizing the cancer.
- determining a presence or an amount of shed ALCAM is described herein, it is inclusive of “determining a ratio of intact ALCAM to shed ALCAM,” and unless otherwise apparent, reference to “shed ALCAM” is inclusive of “a ratio of intact ALCAM to shed ALCAM.”
- the presently disclosed subject matter further provides in some embodiments a method for determining whether to initiate or continue treatment of a cancer in a subject and/or a method for evaluating treatment efficacy and/or progression of a cancer in a subject.
- treatment or “treating” relate to any treatment of a condition of interest, including but not limited to prophylactic treatment and therapeutic treatment.
- correlated refers to comparing the presence or quantity of the shed ALCAM in a subject to its presence or quantity in subjects known to suffer from, or known to be at risk of, a given condition (e.g., a particular cancer); or in subjects known to be free of a given condition, i.e. "normal subjects” or "control subjects”.
- a level of shed ALCAM disclosed herein in a biological sample can be compared to a shed ALCAM level determined to be associated with a specific type of cancer.
- sample's biomarker level is said to have been correlated with a diagnosis; that is, the skilled artisan can use the biomarker level to determine whether the subject suffers from a specific type of cancer, and respond accordingly.
- the sample's biomarker level can be compared to a control level of the shed ALCAM known to be associated with a good outcome (e.g., the absence of cancer), such as an average level found in a population of normal subjects.
- cancer can refer to a precancerous or cancerous pathology.
- the cancer is selected from the group consisting of carcinoma, lymphoma, blastoma, sarcoma and leukemia.
- cancer is also inclusive of other known cancers, including, but not limited to, squamous cell cancer, lung cancer, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer, gastrointestinal cancer, urogenital cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma., breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, head and neck cancer, and lymphoma.
- squamous cell cancer including, but not limited to, squamous cell cancer, lung cancer, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer, gastrointestinal cancer, urogenital cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma., breast cancer, colon cancer,
- the reference can be a level of the shed ALCAM in a sample from the subject taken over a time course.
- the reference can be a sample from the subject collected prior to initiation of treatment for the cancer and/or onset of the cancer and the biological sample can be collected after initiation of the treatment or onset of the cancer.
- the reference can be a standard sample.
- the reference can include control data.
- the terms "reference” or "control level" are used herein to refer to any presence and/or amount of the shed ALCAM to which the presence and/or amount of shed ALCAM in the biological sample is being compared.
- shed ALCAM is correlated to a condition or disease by merely its presence or absence.
- a threshold level of shed ALCAM can be established (e.g., a particular amount of shed ALCAM ), and the level of the indicator in a subject sample can simply be compared to the threshold level.
- determining the prognosis refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject.
- the term “prognosis” does not refer to the ability to predict the course or outcome of a condition with 100% accuracy, or even that a given course or outcome is predictably more or less likely to occur based on the presence, absence or levels of a biomarker. Instead, the skilled artisan will understand that the term “prognosis” refers to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a given condition, when compared to those individuals not exhibiting the condition.
- the chance of a given outcome may be very low (e.g., ⁇ 1%), or even absent.
- the chance of a given outcome e.g., suffering from a cancer or poor prognosis in connection with a cancer
- the chance of a given outcome may be high.
- a prognosis is about a 5% chance of a given expected outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance.
- a biomarker level e.g., quantity of shed ALCAM in a sample
- a control level can signal that a subject is more likely to suffer from a cancer than subjects with a level less than or equal to the control level, as determined by a level of statistical significance.
- a change in marker concentration from baseline levels can be reflective of subject prognosis, and the degree of change in marker level can be related to the severity of adverse events.
- Statistical significance is often determined by comparing two or more populations, and determining a confidence interval and/or a p value.
- Exemplary confidence intervals of the present subject matter are 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while exemplary p values are 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, and 0.0001.
- the "amount" of a biomarker determined from a sample refers to a qualitative (e.g., present or not in the measured sample), quantitative (e.g., how much is present), or both measurement of the biomarker.
- the "control level” can be an amount (including the qualitative presence or absence) or range of amounts of the biomarker found in a comparable biological sample in subjects free of a cancer, or at least free of the cancer of interest being tested.
- biological sample refers to a sample derived from a subject.
- the sample can include body fluids (e.g., peripheral fluids), tissue samples, cells, or a combination thereof. Examples include, blood, serum, plasma, a tissue sample (including, but not limited to, a formalin-fixed tissue sample, a biopsy sample, or a sample obtained at the time of or from a resection), cerebrospinal fluid, urine, sweat, cells recovered from stool, and the like.
- telomere binding refers to a measure of the capacity of a probe, such as an antibody, to bind a target polynucleotide with specificity.
- the shed ALCAM can be detected using a staining assay, as describe herein. In some embodiments, the shed ALCAM can be detected using an ELISA, as described herein.
- a preferred subject is a vertebrate subject.
- a preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal.
- a preferred mammal is most preferably a human.
- the term "subject" includes both human and animal subjects.
- veterinary therapeutic uses are provided in accordance with the presently disclosed subject matter.
- the presently disclosed subject matter provides for the diagnosis of mammals such as humans, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos.
- animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses.
- livestock including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), and the like.
- the continuous cell lines for cancer of the breast (MDA-MB-231 and MCF-7), prostate (PC3 and Dul45) and colon (RKO, DLD, LOVO, LS174t, HCT1 16, HCA7, Sckol, Caco2, HT29, KM12c and KM12) were cultured in their appropriate basal media (DMEM or RPMI) with 10% FBS to confluence before lysis with 1% Triton-X 100 in PBS.
- ALCAM knockout mice c57bl/6 ALCAM-/-
- Mouse tissues were surgically resected, snap frozen and subsequently extracted with 1% Triton-X 100 lysis buffer.
- shR As for human ALCAM and a negative control were obtained from Sigma-Aldrich (St. Louis, MO) (Mission shRNA). Constructs were packaged for viral production and infection and tested for target knockdown. For viral packaging, constructs were co-transfected into 293T cells using Fugene HD (Roche Applied Science, Indianapolis, IN)). Media containing viruses were collected 48hr after transfection. PC3 cells were infected with the viruses in the presence of Polybrene ⁇ g/ml) for 24hr and then subjected to selection by 5 ⁇ g/ml puromycin. Two constructs with >90% knockdown efficiency as determined by immunoblotting and flow cytometry were used for further studies.
- VMC 55 includes 14 patients from the University of Alabama-Birmingham Medical Center (Birmingham, AL).
- Microarray data for the NCI cell lines was obtained through the NCBI Gene Expression Omnibus (GEO data set GDS1761).
- a tissue microarray containing 75 primary colorectal carcinomas and 12 normal age and sex-matched colorectal mucosa was constructed using 2mm cores in triplicate.
- the arrays were incubated with Alexa-546 Goat anti-rabbit (1 :500) and Alexa-647 Goat anti-mouse secondary antibody (1 :500, LifeTechnologies). The sections were counterstained with 2 ⁇ g/ml of Hoechst for 2mins, and mounted with Prolong® Gold Anti- fade.
- the analysis pipeline was designed as follows: a) The tumor area was selected using the free-hand selection tool, b) The color image was split into its red, green and blue component channels, c) Image thresholding was used to generate the detectable region of intracellular ALCAM staining (red channel) and extracellular ALCAM staining (green channel), d) Intact ALCAM was determined as the area of co-localized intracellular and extracellular ALCAM (red and green channel) while ALCAM shedding was determined as the area of intracellular ALCAM that lacks extracellular ALCAM (red but no green). The sum of these two represents total ALCAM expression.
- ROC Operating Characteristic
- the soluble extracellular domain can be detected in the serum of some cancer patients.
- ALCAM-specific ELISA of serum from CRC patients did not reveal a correlation between disease progression and increase in circulating ALCAM when comparing serum obtained from cancer free patients and serum obtained from CRC patients prior to, and after therapy (Figure IE).
- Figure IE Detailed comparison of cancer free patients and normal healthy individuals versus increasing stages of CRC patients revealed no significant correlation with circulating levels of ALCAM ( Figure IF).
- ALCAM shedding is clearly elevated in tumors, without being bound by theory or mechanism, ALCAM shedding can be an accurate prognostic marker for colorectal cancer.
- Multivariable analysis was restricted to stage II patients since they were the emphasis of the investigation and the cohort biased to this population.
- Age; OR, 1.079; 95% CI, 1.027-1.133; p 0.003).
- ALCAM shedding rather than its expression, indicates disease progression.
- the dual stain reveals both intra- and extracellular epitopes of ALCAM and clarifies its prognostic value in CRC.
- ALCAM shedding in tissues was defined as the detection of the intracellular epitope in the absence of the extracellular domain.
- Using this novel assay a correlation between elevated ALCAM shedding and poor patient outcome was demonstrated.
- ALCAM shedding correlates with poor outcome in early stage disease (Stage II, Figure 10).
- ALCAM is not merely a biomarker for disease progression but can also allow for outcome stratification among patients with early stage disease.
- ALCAM shedding within the tumor tissue appears to correspond with disease progression.
- the detection of ALCAM shedding within the tumor tissue itself can increase the specificity of ALCAM as a prognostic factor.
- a method was devised to stratify at-risk patients using ALCAM shedding as an indicator of disease progression and poor patient outcome, and not as a diagnostic tool. Indeed, the correlation between ALCAM shedding and poor patient outcome in early stage disease suggests that molecular progression can occur in a cancer that appears histologically more benign.
- the analysis of ALCAM shedding ( Figure 11C) demonstrates that ALCAM shedding rather than loss of expression corresponds with patient outcome.
- the current Example evaluates shed ALCAM as a prognostic biomarker in bladder cancer.
- ALCAM expression is restricted to the umbrella cells and several layers of the urothelium.
- mRNA mRNA
- tissue expression protein
- shedding blood and urine
- Figure 12 Since tumor cell motility is a central driver in tumor progression and metastasis, such molecular indicators that report on cell migration should act as surrogate markers of progression prior to overt clinical manifestation.
- This Example describes how Activated Leukocyte Cell Adhesion Molecule (ALCAM) promotes adhesion, while shedding of its extracellular domain is associated with migration.
- ALCAM Activated Leukocyte Cell Adhesion Molecule
- NCBI Gene Expression Omnibus (GEO, GSE31684) was used to analyze ALCAM mRNA expression (probes 201951_at and 201952_at) in BCa and included 93 patients, representing stages pTa to pT4, who underwent radical cystectomy at Memorial Sloan-Kettering Cancer Center (New York, NY) between 1993 and 2004. Median age of patients was 69.1 years, 73% were male, median follow-up was 32 months, and incidence of death was 70%.
- Non-cancer control urines were collected from patients with no history or current diagnosis of cancer undergoing non-urologic surgeries including cardiac bypass, gastric bypass, thyroidectomy, esophagomyotomy, knee replacement, and hernia repair
- Inflammation control urines were collected from patients with rectovaginal fistula, colorectal enteritis and ulceration, gallbladder polyploid cholesterolosis, endometriosis, atherosclerosis, ulcerative colitis, uterine fibroids, urethral stricture, and staghorn calculus
- Urine was collected from patients with cancers other than BCa (General Cancer), consisting of prostate, pancreatic, neuroendocrine, renal, and colorectal cancers.
- Serum and urine were analyzed by human-specific ALCAM ELISA according to the manufacturer's protocol (R&D Systems, Minneapolis, MN). All samples were analyzed in duplicate at dilutions (Urine: 4-8 fold; Serum: 50-80 fold) that matched the dynamic range of the assay (0.05-4.00 ng/ml).
- Immunohistochemistry (IHC) and immunofluorescence (IF) was performed on formalin-fixed paraffin-embedded cores (5 ⁇ ) on tissue microarrays. Sections were deparaffinized, hydrated, and peroxidase blocked (IHC only). Antigen retrieval was performed with citrate buffer (pH 6.0) for 15 minutes in a pressure cooker and sections were then blocked for 1 hour in 20% Aquablock (East Coast Biologies; North Berwick, ME) plus 0.05% Tween-20. IHC was performed with mouse anti-ALCAM (MOG/07; NovocastraTM Leica Biosystems, Buffalo Grove, IL) followed by goat anti-mouse HRP (Jackson
- Fluorescence intensity, thresholded area, and colocalization were quantified in each TMA core by an Image J-based batch macro specifically written by our laboratory to quickly and efficiently set an intensity threshold for positive signal, identify the tissue area, define the region of interest, determine the percent thresholded area for each target within the region of interest, and determine percent colocalization of selected targets.
- Collagen staining was used to distinguish between the epithelial, stromal and muscular compartments in order to define the region of interest.
- Hoechst was used to define the nuclear compartment and to colocalize with Ki67. Percent thresholded area of ALCAM and percent nuclear area of Ki67 were subsequently used for analysis.
- Kruskal-Wallis and Jonckheere-Terpstra test for trend analyses were used to assess the differences and overall trend between multiple independent groups followed by Mann- Whitney U post-tests if any significant differences were detected by Kruskal-Wallis.
- ALCAM gene expression does not correlate with progression and/or patient outcome in BCa.
- FIG. 3A, IHC In non-invasive carcinoma in situ, the expansion of the urothelium led to an increase in ALCAM positive cells with no increase in signal intensity (Figure 14A, IHC). However, concomitant with the appearance of an invasive phenotype, ALCAM expression diminished in the progression from pTl to pT4 ( Figure 14A, IHC). Since each patient had multiple cores representing several pathological stages and, thus, had non-independent samples, the correlation of the mean ALCAM intensity score with pathological core stage was analyzed with generalized estimating equations (GEE) ordinal logistic regression and
- IF immunofluorescence
- Figure 14, FL The degree of ALCAM staining was quantified as described in the methods. Collagen staining was used to visualize the tissue architecture.
- the final readout for ALCAM was a continuous variable defined as the area within the region of interest that was above background (% thresholded area; range 0-72.8%).
- Ki67 was assessed as a marker of cell proliferation and a known indicator of outcome in BCa. Ki67 was quantified by measuring the amount of nuclear area that was colocalized with Ki67 within the ROI (% nuclear area). Consistent with the importance of proliferation in tumor progression, Ki67 staining was elevated in tumor compared to adjacent normal tissue (Figure 14F).
- This Ki67 data demonstrates that the current BCa TMA cohort is representative of the general population and that the analysis was consistent with accepted clinical practice and published studies, which validates that ALCAM protein expression does not appear to independently predict overall survival in BCa.
- Serum and urine ALCAM levels were analyzed from patients in four distinct cohorts including: 1) patients undergoing surgery but with no cancer (Normal Controls), 2) patients with inflammatory diseases (Inflammation), 3) patients with non-bladder malignancies (General Cancer) and 4) patients with BCa (Bladder Cancer).
- Analysis of serum ALCAM revealed that it was significantly elevated (1.3 -fold) in patients with BCa compared to Normal Controls ( Figure 15B; median 74.88 vs. 57.75 ng/ml; PO.0001).
- the detection of ALCAM in urine was dramatically elevated (17.0-fold) in BCa patients compared to normal controls ( Figure 15C; median 2.18 vs. 0.13 ng/ml; P ⁇ 0.0001).
- Urinary ALCAM measurements were not significantly influenced by repeated freeze-thaw, collection method (foley-derived vs. clean catch urine), or repeated sampling (Spearman coefficient, 0.86; P ⁇ 0.0001).
- Urine ALCAM levels were normalized to urinary total protein (Thermo Scientific, BCA, 23227), creatinine (Enzo Life Sciences, 937-001), specific gravity (Siemens Medical Solutions Diagnostics, Multistix® 8 SG, 2164) and hemoglobin (Sigma- Aldrich, Drabkin's Reagent, D5941) in an attempt to control for dehydration, proteinuria, and hematuria.
- BCA analysis for total protein in urine was unreliable due to the presence of urea. Spearman correlations were performed to compare un-corrected, raw urine ALCAM levels with hemoglobin, specific gravity, and creatinine-corrected urine ALCAM levels.
- Urinary ALCAM is an independent predictor of overall survival in BCa
- Prediction measurements were substantially improved by including both serum and urine ALCAM in the model where the concordance index (C-Index) increased 4.4% from 74.2% with age, tumor stage and lymph node status alone to 78.6% with the inclusion of serum and urine ALCAM ( Figure 151 and Table 9).
- C-Index concordance index
- the addition of serum and urine ALCAM led to improvements in standard prediction measures such as area under the curve (AUC), true positive rate (TPR), false positive rate (FPR), and accuracy at 1-year intervals (Table 9).
- AUC area under the curve
- TPR true positive rate
- FPR false positive rate
- accuracy accuracy at 1-year intervals
- ALCAM can dynamically regulate cell motility through homotypic
- the shed ectodomain of ALCAM is a molecular marker of cell motility.
- This Example describes biochemical and genetic procedures conducted to identify a new partner of CD 15 l free , Activated Leukocyte Cell Adhesion Molecule
- HEp3 cells were perpetually maintained on the chick chorioallantoic membrane (CAM) to retain metastatic and migratory potential.
- Cell lines were maintained in media supplemented with pen/strep, sodium pyruvate, non-essential amino acids and 10% fetal bovine serum and cultured at 37°C in a 5% C02 incubator.
- Plasmids used included untagged wildtype CD151 (Clontech Laboratories, Mountain View, CA).
- CD151-GFP Osaka University, Osaka, Japan
- ALCAM-GFP Universality of Iowa, Des Moines, IA
- HA-Rapl Universalitair Medisch Centrum Utrecht, The Netherlands
- CD151 specific shRNA was obtained from Sigma Aldrich.
- ALCAM and GFP siRNA were purchased from Invitrogen (Grand Island, NY).
- Anti-CD151 (1A5) was generated as previously described), ALCAM/CD166 (L50, Abeam and R&D systems).
- the control antibody 29-7 was generated in the same fashion as 1A5.
- HEp3 and HT1080 cells were lysed in 1% Brij99 lysis buffer as described above. Lysates were incubated with control antibody 29-7 or anti-CD151 antibody 1A5 overnight at 4°C and immunoprecipitated with protein-G sepharose beads. The
- U133Plus 2.0 reference was selected. Gene ontology analysis was performed with default parameters. Enriched biological processes were highlighted in red and labeled with number of associated genes and adjusted p-value.
- HEp3 and HT1080 cells were seeded to confluence in 6-well plates with complete medium. After 24hrs the cells were switched to serum free/insulin free media for an additional 24hrs. At 48hrs after seeding the confluent monolayers were scratched with a pipet tip in order to create a uniform wound after which the cells were washed with PBS to remove any floating cells. Cultures were returned to full medium and the wound was documented at Ohrs and 16hrs post-scratch using a light microscope TMS-F (Nikon, Tokyo, Japan) equipped with a D90 SLR camera (Nikon).
- Wound closure (% surface area) was calculated using Tscratch image analysis software (Ashby et al, 2012; Geback et al, 2009).
- [00163] In Vitro Transwell Migration Tumor cells in a single cell suspension were plated into the top chamber of 8 ⁇ transwell (Costar) inserts in the presence of serum free/insulin free media. Cell culture media containing 10% fetal bovine serum was placed in the bottom chamber to serve as a chemoattractant. Migration assays were carried out for 12hrs in a 37°C cell culture incubator containing 5%CO. The top surface of the inserts was cleaned with a cotton swab soaked with PBS to remove the non-migrated cells. The transwell inserts were subsequently fixed in methanol and stained with 0.2% crystal violet. The number of migrated cells was counted in 3 independent fields under 20x magnification with a light microscope.
- Two-Dimensional Migration Tumor cell migration on soluble ALCAM-Fc was performed by adhering it to tissue culture plates with protein-G. Briefly, protein-G ⁇ g/ml) was adhered to the culture plastic followed by rat tail collagen type 1 (100 ⁇ g/ml). Unbound surface was blocked with BSA (0.5% in PBS) after which the surface was washed and incubated with ALCAM-Fc in 0.5% BSA. Control migration was performed on identical surfaces not inclubated with ALCAM-Fc.
- Tumor cells were seeded at low density and tracked by live cell imaging every 10 minutes over a 6hr period with a fully automated microscope (BX61, Olympus, Tokyo, Japan) equipped with a digital camera (Orca ER, Hammatsu Photonics, Hamamatsu, Japan). Data acquisition and analysis was performed using Volocity image acquisition software (Perkin Elmer, Waltham, MA).
- HEp3 HT1080 or CHO cells were lysed in either 1% (vol/vol) Triton X-100 lysis buffer or 1% (vol/vol) Brij-99 lysis buffer and incubated on ice for 30 minutes. The samples were then cleared by centrifugation at 14,000 rpm for 15 minutes and the cleared lysates were then transferred to fresh tubes. Protein concentrations were determined by BCA assay (Pierce). Equal amounts of protein were loaded in to SDS-Page gels and subsequently transferred to polyvinylidene fluoride membranes (PVDF, Millipore).
- PVDF polyvinylidene fluoride membranes
- the membranes were blocked for lhr in 5% non-fat dry milk in phosphate buffered saline with 0.05% Tween-20 (PBSt). The membranes were incubated overnight at 4°C with specific antibodies prepared in blocking buffer after which the membranes were washed 3 times with PBSt and incubated with the appropriate species- specific horse radish peroxidase-conjugated secondary antibodies for lhr at room
- HEp3 cells were labeled overnight in methionine/cysteine free DMEM containing 35S-label. Cells were washed throughly with PBS and lysed in 1% Brij 99 lysis buffer. The lysates were incubated with control antibody or monoclonal antibody 1A5 and immunoprecipitated as described above. The gels were dried and then exposed to film at - 80°C.
- Rapl activation was analyzed using the Rapl activation kit (Chemicon). All treatments were performed in the presence of serum free/insulin free media. Cells to be assayed were washed with ice cold PBS and lysed in RIPA like Rapl buffer (10% glycerol, 50mM Tris/HCl, 150mM aCl, 5mM phenylmethylsulfonyl fluoride, ImM sodium orthovanadate). The lysates were pushed through a 25 gauge syringe and cleared by centrifugation at max speed at 4 degrees for 10 min. Equal amounts of lysates were immunoprecipitated with RalGDS RBD conjugated agarose beads for 45 minutes at 4°C.
- HEp3 cells grown to confluency on collagen coated coverslips were incubated with 1A5 and then fixed in 4% formalin in PBS.
- the coverslips were blocked with 5% BSA in PBS for 30 minutes at room temperature and then stained with 1A5 and ALCAM primary antibodies overnight at 4°C.
- the coverslips were washed with PBS and then incubated with species specific fluorophore -conjugated secondary antibodies for lhr at room temperature.). After staining the cells were washed with PBS and then counterstained with DAPI.
- the coverslips were then mounted onto glass slides with Fluorosave mounting media
- tandem Mass Spectrometry was used to identify CD151 partners that co-IP with 1A5 ( Figure 16C). Specifically, the HNSCC cell line HEp3 was lysed with Brij -based lysis buffer to maximize possible protein-protein interactions.
- Immunoprecipitations were preformed with the CD151 free -binding antibody 1A5.
- Control samples included immunoprecipitations with an isotype-matched control IgG or protein-G only.
- the precipitated complexes were separated by SDS-PAGE, gel pieces were excised and subsequently analyzed by LC-MS-MS using a LCQ-Deca or LTQ-Orbitrap mass
- CD 151 -specific candidates were identified by eliminating targets precipitated with an isotype control and protein-G respectively. Candidates identified by two or more peptides in two or more independent analyses were selected as viable targets. A total of 228 proteins were identified of which 51 candidates distributed across five phenotypic subgroups were detected repeatedly ( Figure 16C, pie chart and Table 1 1).
- Anti-CD 151 antibody 1A5 clusters the tetraspanin and promotes its accumulation at areas of cell-cell contact. Based on validated interactions and the observed cell-cell accumulation, a short list of potential candidates was developed (Figure 16D). Nearest neighbor analysis was performed on each putative candidate using the Broad Institute Cancer Cell Line Encyclopedia (http://www.broadinstitute.org/ccle/home). ALCAM was identified as the nearest neighbor of a3, one of the primary partners of CD 151. To evaluate ALCAM's role as a regulator of migration we evaluated changes in gene expression initiated upon expression of a dominant-negative ALCAM lacking the ligand-binding domain.
- the IgG superfamily member ALCAM is a novel CD151 partner
- Clustering of CD 151 with 1A5 promotes the localization of the tetraspanin to the areas of cell-cell contact leading to the inhibition of tumor cell migration and metastasis.
- ALCAM and CD151 occupy the same areas of cell-cell contact and clustering of the tetraspanin causes ALCAM to co-localize extensively with CD151 ( Figure 17A). To determine if CD 151 and ALCAM were physically interacting, the proteins were
- CD 151 and ALCAM did indeed co-immunoprecipitate in their reciprocal precipitations. Since 1A5 drives CD151 clustering and promotes an interaction between CD151 and ALCAM, an independent validation of the interaction between CD 151 and ALCAM was performed using affinity purification of GFP-tagged proteins.
- ALCAM-GFP and CD 151 -GFP were co-transfected with untagged CD 151 or ALCAM respectively into CHO cells. GFP-tagged protein was precipitated from TX-100 lystates using a GFP-binding protein ( Figures 17D and 17E). ALCAM co-precipitated with CD 151 -GFP and CD151 co- precipitated with ALCAM-GFP.
- CD151 forms a complex with ALCAM and that ALCAM is a component of the CD 151 -TERM.
- This complex is stable under stringent detergent conditions (TX-100) suggesting that the stability of the CD151-ALCAM interaction is similar to those observed previously for CD151 -a3.
- ALCAM and CD151 cooperate in their ability to regulate migration
- CD151 and ALCAM are a components of the TERM complex.
- the ability of CD 151 and ALCAM to regulate migration was evaluated after RNAi- mediated depletion in HT1080 and HEp3 cells ( Figure 18).
- CD151 clustering induced by the antibody 1A5 inhibited HT1080 tumor cell migration ( Figure 18A).
- Figures 18B and 18C After RNAi-mediated depletion of ALCAM, tumor cells were no longer sensitive to the immobilization by CD151 ( Figures 18B and 18C).
- Engaging HT1080 cells in ALCAM- ALCAM interactions can be accomplished by seeding cells on ALCAM-Fc coated surfaces ( Figure 18D).
- CD151 and ALCAM control tumor cell migration through PKCa-dependent activation of RaplA
- a targeted pharmacological screen was performed in an attempt to identify molecular mechanisms that might contribute to the inhibition of motility mediated by CD 151 and ALCAM (Figure 19A).
- Tetraspanins regulate intracellular signaling events by interacting directly or indirectly with signaling molecules including protein kinase Ca (PKCa) and phosphatidylinositol 4 kinase type Ila (PI4kinase Type Ha). Rho and PI3 kinase have also been associated with CD 151 -mediated regulation of tumor cell motility.
- MEK, Erk, and Rapl were targeted as established mediators of cell motility.
- Transwell migration assays were performed in the presence or absence of each inhibitor together with or without the anti- CD151 antibody 1A5.
- RaplA was activated in response to CD 151 clustering as well as ALCAM-ALCAM ligation
- HEp3 cells were treated with 1A5 or seeded on ALCAM-FC for up to 48hrs. Active RaplA in the cells was evaluated by immunblotting of GTP -bound RaplA affinity purified from lysates with Ral-GDS beads. Both CD 151 clustering and ALCAM-ALCAM binding resulted in rapid and persistent activation of RaplA ( Figure 19C). Activation of the GTPase Rac was evaluated as a control to confirm the specificity of RaplA activation (Figure 19D).
- PKCa can associate with CD 151 and ALCAM and has also been demonstrated to mediate activation of Rap 1. Together with the observed contribution of PKCa to the regulation of migration ( Figure 19A and 19B), this suggests that PKCa may mediate activation of RaplA by CD 151 and ALCAM.
- GTPase activity assays were performed in HEp3 cells after PKCa was disrupted with Chelethyrine or PKCa-specific siRNA (Figure 19E).
- Rapl activation is sufficient to immobilize tumor cells in vitro and in vivo
- RaplA serves as a molecular switch capable of regulating cell motility by controlling adhesion.
- the inhibition of tumor cell motility in response to CD151 and its partner ALCAM involves the activation of RaplA. It appears that Rapl activation was sufficient to inhibit tumor cell motility, and to address this issue GFP-expressing HEp3 cells was transfected with dominant negative RaplA (Rap IN 17) or the dominant active RaplA (RaplV12). The expression of the constructs was verified by western blot analysis ( Figure 20A). Migration assays were subsequently performed in order to determine if Rap 1 A activity was sufficient to impact on tumor cell migration in vitro. Dominant negative RaplA
- HEp3-GFP cells transfected with dominant negative RaplA (RaplN17) or dominant active RaplA (RaplV12) were injected intravenously into D12 avian embryos and metastatic colony formation was analyzed at 4 days post injection. Colony size can reflect tumor cell growth while the local dispersion of metastatic tumor cells reflects on their motility. All of the transfected cells demonstrated efficient colony formation. However, HEp3 cells expressing dominant active RaplA
- CD151 and ALCAM as partners in the regulation of tumor cell migration
- ALCAM was identified a novel CD 151 partner that can associate with integrin-free CD151.
- ALCAM is expressed broadly in human tissues and cells with predominant expression in neuronal cells, immune cells, epithelial cells, and stem cells of hematopoietic and mesenchymal origin. It is functionally associated with many cell adhesion events including T-cell activation, endothelial adherence junction, neuronal guidance, and epithelial integrity. ALCAM' s expression alters during cancer progression. Since ALCAM- ALCAM interactions are responsible for mediating the activation of RaplA and inhibiting motility, it appears that ALCAM shedding offers a mechanism by which tumor cells can control RaplA-mediated adhesion and migration.
- PKCa binding to the C-terminal tail of CD 151 allows the tetraspanin to serve as a linker between PKCa and the integrins ⁇ 3 ⁇ 1 and ⁇ 6 ⁇ 4 thereby regulating integrin signaling. It appears that CD 151 performs the same function for ALCAM but that the ultimate target of this signaling is RaplA. PKCa has been previously identified as an inhibitor of cell migration during an in vitro screening assay of normal epithelial migration. Since PKCa has many substrates, these results suggest that divergent signaling mechanisms may be initiated depending on what partner CD 151 interacts with. The elevation of integrin- free CD151 in cancer is likely to divert signaling from integrins to other tetraspanin partners.
- Rapl The activity of Rapl is regulated by a number of regulators including
- GEF Guanidine Exchange Factors
- GAP GTPase activators
- effectors that mediate the activity of the GTPase.
- This Example demonstrates that in the absence of PKCa, neither 1A5 treatment nor ALCAM adhesion is able to activate Rapl, which suggests that the signaling mechanisms associated with immobility require PKCa to activate RaplA.
- PKCa can activate Rapl in platelets and subsequently promote adhesion through integrin activation.
- CD 151 was initially identified as a platelet cell surface antigen and its clustering can induce platelet activation suggesting that this mechanism may apply broadly outside the regulation of tumor cell motility.
- This Example describes procedures conducted to show that ectodomain shedding of ALCAM is induced by cytokines present in the tumor microenvironment and that its detection can be a marker of tumor progression.
- ALCAM expression and shedding by ADAM 17 is examined in response to cytokine stimulation through biochemical analyses while its contribution to skeletal metastasis is determined in a series of orthotopic, and experimental metastasis models.
- this Example characterizes how elevated ALCAM expression in aggressive prostate cancer together with its putative role in cell adhesion/migration make ALCAM a molecular participant in prostate cancer metastasis.
- Antibodies against ALCAM were obtained from R&D Systems (Clone 105902).
- the following tumor cell lines were obtained from American Type Culture Collection (Manassas, VA) and maintained according to the American Type Culture Collection's recommendations: DU145, LNCaP, PC3 (prostate metastasis).
- PC3-luciferase (PC3-luc) cells (Simon Hayward, Vanderbilt) were cultured in RPMI/10%FBS. [00206] SDS-PAGE and immunoblotting. Cells (2.5 x 10 5 ) were plated in 6-well dishes. After 24 h, cells were serum starved in Opti-MEM for 16 h and then treated in the presence or absence of indicated growth factors or inhibitors, for 48 h.
- TNE Lysis Buffer (20 mM Tris-Cl [pH 7.4], 0.5 mM EDTA, 1% Triton X-100, 150 mM aCl, protease inhibitor cocktail (sigma), 1 mM phenylmethylsulfonyl fluoride).
- Total protein in the lysates was quantified using BCA assay (BioRad).
- Conditioned media samples were concentrated with microcon centrifugal filters (Millipore) following manufacturers protocol, which were eluted directly in 5X sample buffer for Western blot analysis. Protein loading for conditioned-medium samples for Western blot analysis was adjusted according to the total protein in cell lysates.
- mR A samples were prepared from tumor cells lysed in TRI Reagent (Ambion) and purified using phenol extraction, followed by real-time polymerase chain reaction (RT-PCR).
- RT-PCR real-time polymerase chain reaction
- Two-dimensional gap closure assays were conducted using magnetically attachable stencils attached to culture plates. 250,000 cells were seeded in 6-well plates and allowed to recover overnight to form a confluent monolayer. Stencils were removed with tweezers, after which cells were rinsed with PBS to remove detached cells. Culture medium was re-added and closure of the gap was measured at 8 and 16 hours. Gap closure was quantified using TScratch (National Institutes of Health, Bethesda, MD, USA).
- Tumor-bearing tissue and bones were fixed in 10% formalin. Bone specimens were decalcified in 20% EDTA pH 7.4 for 3-4 days at room temperature. Decalcified bone and tissue were dehydrated and embedded in paraffin. Tumor burden was confirmed in 5 ⁇ serial sections stained with H&E. Osteoclast were visualized using a standard Tartrate Resistant Acid Phosphatase (TRAP) protocol. All immunohistochemistry and
- Immunofluorescence on tumor sections involved antigen retrieval using a standard pH 6.0 citrate buffer followed by blocking via incubation with 20% Aquablock (East Coast Bio, North Berwick, ME). Immunofluorescence data was obtained using primary antibodies for ALCAM (1 : 1000; Leica Biosystems; Clone, MOG/07), Ki67 (1 :500; Fisher, Clone SP6), Cleaved caspase-3 (1 :200; CellSignaling, D 175), and collagen I (1 : 1000; Sigma C2206) by incubation overnight at 4°C. Corresponding Alexa Fluor® secondary antibodies were used (1 : 1000; Invitrogen). Fluorescent imaging was completed on a Olympus BX61WI upright fluorescent microscope using Volocity Imaging Software.
- Blood was obtained via the saphenous vein; samples were collected in either the presence of EDTA as an anticoagulant or a serum separator tube and were centrifuged at 1 ,500 rpm, 4°C to remove cells. Plasma and serum samples were stored at -80°C until analyzed. Samples were analyzed for soluble mouse and human ALCAM using the R&D Systems DuoSet following manufacturer's instructions. Briefly, ELIS plates coated with capture antibody were incubated overnight with 100 iL of sera diluted 1 :50. Capture ALCAM was detected with biotinylated antibody and peroxidase-conj ugated avidin followed by colorimetric detection at 450 urn.
- PC3-luc cells were suspended in 30 ⁇ of neutralized type I collagen and allowed to polymerize for 16 hrs at 37°C before implantation into the prostate of 10 week old C.B-17/IcrHsd-Prkdc scid male mice (Harlan, Indianapolis, IN). Tumor growth was monitored weekly by bioluminescent detection of luciferase expressing cells.
- subconfluent PC3-luc cells were trypsinized, washed twice in PBS to remove serum, and then resuspended in HBSS at a concentration of 1 x 10 7 cells/mL.
- PC3-luciferase shControl or PC3- luciferase shALCAM (KD2 or KD3) tumor cells (l lO 5 ) in a 10 ⁇ volume of sterile phosphate buffered saline (PBS) were injected into the tibia of anesthetized 6-week-old nude male mice (Harlan Laboratories) Skeletal metastasis was performed. Briefly, 1 x 10 5 PC-3- luc cells were injected into the left heart ventricle of male nude mice (Harlan Laboratories). Skeletal metastases were monitored by bioluminescent detection of luciferase expressing cells and formation of bone lesion by X-ray.
- PBS sterile phosphate buffered saline
- trabecular bone volume For gross analysis of trabecular bone volume, formalin fixed tibiae were scanned at an isotropic voxel size of 12 ⁇ using a microCT40 (SCANCO Medical, Bruttisellen, Switzerland).
- the tissue volume (TV) was derived from generating a contour around the metaphyseal trabecular bone that excluded the cortices. The area of measurement began at least 0.2 mm below the growth plate and was extended by 0.12 mm.
- the bone volume (BV) included all bone tissue that had a material density greater than 438.7 mgHA/cm 3 .
- Radiographic images (Faxitron X-ray Corp, Lincolnshire, IL, USA) were obtained using an energy of 35 kV and an exposure time of 8 seconds.
- Osteolytic lesions were quantified bilaterally in the tibia, fibula, femora, humeri, and pelvis at the endpoint using x-ray images. Lesion area and lesion numbers were evaluated using image analysis software (Metamorph, Molecular Devices, Inc.). Data presented are the average of lesion area and lesion numbers per mouse in each group.
- mice C57BL/6(SJL)-Tg(SMAD binding element [SBE]/Tk-luc)7Twc/j mice, obtained from the laboratory of Harold Moses, MD (Vanderbiit University), were used at 16 weeks of age. These transgenic mice, referred to as SBE-Luc mice, express luciferase in response to activation of the Smad2/3 -dependent signaling pathway. Mice were administered 2mg/kg of LPS to induce an acute inflammatory response and bled via saphenous vein at 0, 6, 24 hours and 1 week post-administration.
- mice were anesthetized by intraperitoneal injection. The back the C57/B16 male and female mice were shaved and two circular excisional full-thickness wounds of 6- mm diameter generated using a standard biopsy punch. Mice were bled via saphenous vein at 0 hours (establish basal levels) , 24 hours, one week and two weeks after wound initiation.
- TGFfi induces ALCAM expression and shedding
- ALCAM is proteolytically shed from PC3 cells ( Figure 21). Absence of the cytoplasmic tail confirms that the ectodomain is shed ( Figure 21A). Moreover, ALCAM is absent from PC3 -derived exosomes ensuring that the ectodomain is shed and not released with cell-derived microparticles ( Figure 21B). Since prostate cancer disseminates predominantly to bone we selected cytokines thought to be involved in this process, including TGF . Of the 8 agents tested, TGF promoted ALCAM shedding relative to overall total protein increase (Figure 23A).
- TGFP-induced expression in PC3 cells could be abrogated with the small molecule inhibitor SB431542 (Figure 23D, ⁇ ; Sigma) while TGFP-induced ALCAM mRNA and protein expression could be restored in LNCaP cells when the cells were transfected with dominant-active TGFP receptor type I ( Figures 23E and 23F).
- tumor-derived ALCAM is the source of elevated circulating ALCAM
- species-specific antibodies were used to monitor circulating levels of both host (mouse) ALCAM and tumor (human) ALCAM longitudinally during orthotopic and subcutaneous growth of PC3 cells (Figure 24).
- the half-life of human ALCAM in the circulation of its mouse host was determined to confirm that tumor-derived ALCAM could act as a stable biomarker in vivo ( Figure 25).
- Circulating ALCAM exhibits a 17hr half-life which is sufficient for monitoring its release from an endogenous tumor burden.
- TGF i pre -treatment and treatment were compared at the time of scratch and exhibited similar results.
- the analysis revealed a loss TGF - induced migration in PC3-luc-ALCAM KD1 cells (Figure 29B) similar observations were made in ALCAMTM 2 and ALCAMTM 3 cells.
- the reduction in ALCAM expression led to a slight increase in migration, possibly due to a loss of ALCAM -ALCAM homotypic interaction on adjacent cells.
- FIG. 30D Detailed imaging of the osteolytic lesions by microCT (Figure 31 A) further confirmed decreased lesion area and increased bone volume in the bones containing ALCAM KD cells ( Figures 31B and 31C). Finally, the histological visualization of bone tumors generated by control and ALCAM KD cells resulted in reduced bone tumor size upon ALCAM knockdown ( Figure 31D). Tibias in the PC3-luc -vector, PC3-luc-ALCAM KD2 and PC3-luc-ALCAM KD3 were stained for the osteoclast marker, tartrate -resistant alkaline phosphatase ( Figure 32). Both the ALCAM KD tumors induced osteolytic lesions as evidenced by osteoclast presence adjacent to tumor lesions suggesting that the ability to induce bone-remodeling was not deficient in these cells.
- the term "about,” when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ⁇ 20%, in some embodiments ⁇ 10%, in some embodiments ⁇ 5%, in some embodiments ⁇ 1%, in some embodiments ⁇ 0.5%, and in some embodiments ⁇ 0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
- ranges can be expressed as from “about” one particular value, and/or to "about” another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
- Colorectal Carcinoma Diagnostic, Prognostic, and Molecular Features.
- Johnston PG Stage II colorectal cancer: to treat or not to treat. Oncologist.
- ALCAM/CD166 is up-regulated in low-grade prostate cancer and progressively lost in high-grade lesions. Prostate. 2002;54(l):34-43.
- Zijlstra A Proangiogenic role of neutrophil-like inflammatory heterophils during neovascularization induced by growth factors and human tumor cells. Blood.
- CellProfiler image analysis software for identifying and quantifying cell phenotypes. Genome Biol. 2006;7(10):R100.
- TACE/ADAM-17 A Component of the Epidermal Growth Factor Receptor Axis and a Promising Therapeutic Target in Colorectal Cancer. Clinical Cancer Research.
- Activated leukocyte cell adhesion molecule is a component of the endothelial junction involved in transendothelial monocyte migration.
- Tachezy M Effenberger K, Zander H, et al. ALCAM (CD 166) expression and serum levels are markers for poor survival of esophageal cancer patients. Int. J. Cancer 2012;131(2):396-405. Tachezy M, Zander H, Marx AH, et al. ALCAM (CD166) expression and serum levels in pancreatic cancer. PLoS ONE 2012;7(6):e39018.
- ACAM/CD166 is a marker for thyroid cancer aggressiveness and disease-free survival.
- Rapl is activated by erythropoietin or interleukin-3 and is involved in regulation of betal integrin-mediated hematopoietic cell adhesion. J Biol Chem 276, 10453-10462.
- Rapl controls cell adhesion and cell motility through the regulation of myosin II. J Cell Biol 176, 1021— 1033.
- Tetraspanin CD 151 regulates RhoA activation and the dynamic stability of carcinoma cell-cell contacts. J Cell Sci 122, 2263-2273.
- Kirsten-ras-revertant 1 potentiation of its tumor suppressor activity by specific point mutations. Proc Natl Acad Sci USA 87, 4284 ⁇ 1288.
- CD151 enhances cell motility and metastasis of cancer cells in the presence of focal adhesion kinase. Int J Cancer 97, 336-343.
- Rapl a key regulator in cell-cell junction formation. J Cell Sci 120, 17-22.
- Tetraspanin CD151 regulates alpha6betal integrin adhesion strengthening. Proc Natl Acad Sci USA 100, 7616-7621.
- Tetraspanin CD151 plays a key role in skin squamous cell carcinoma. Oncogene.
- Integrin-free tetraspanin CD 151 can inhibit tumor cell motility upon clustering and is a clinical indicator of prostate cancer progression. Cancer Res Submitted.
- Rapl can bypass the FAK-Src-Paxillin cascade to induce cell spreading and focal adhesion formation.
- Extracellular signal-regulated kinase (ERK)-dependent gene expression contributes to LI cell adhesion molecule-dependent motility and invasion. J Biol Chem 279, 28880-28888.
- Ras guanyl nucleotide releasing protein 2 affects cell viability and cell-matrix adhesion in ECV304 endothelial cells.
- PKC protein kinase C
- PKCalpha independently of Rho-like GTPases. J Cell Sci 117, 2841-2852.
- TGF-beta transforming growth factor beta
- TACE TNF-alpha Converting Enzyme
- EWI-2 is a major CD9 and CD81 partner and member of a novel Ig protein subfamily. J Biol Chem. 2001;276:40545-54.
- tetraspanin CD 151 determines alpha 3 and alpha 6 integrin-dependent cellular morphology. J Cell Biol. 2002; 158: 1299-309.
- CD 151 accelerates breast cancer by regulating alpha 6 integrin function, signaling, and molecular organization. Cancer Res. 2008;68:3204-13.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Food Science & Technology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The presently-disclosed subject matter includes labels for use in the identification of shed ALCAM in s sample from a subject. Further included are methods for characterizing, monitoring, evaluating treatment efficacy, or evaluating the progression of cancer in a subject that comprise providing a biological sample from the subject, determining the presence or amount of shed ALCAM in the biological sample, and then comparing the presence or the amount of the shed ALCAM to a reference. Differences between the presence or amount of shed ALCAM relative to the reference can be used to diagnose, prognosticate, treat, monitor, or otherwise characterize a cancer in a subject. Further provided are kits comprising a reagent and/or antibody for diagnosing, prognosticating, monitoring, or otherwise characterizing a cancer in a subject.
Description
CHARACTERIZATION OF CANCER USING DETECTION OF ACTIVATED LEUKOCYTE CELL ADHESION MOLECULE (ALCAM) SHEDDING
by
Andries Zijlstra, of 1015 Villa Place, Nashville, TN 37212, a citizen of USA;
Amanda G. Hansen, of 1804 Long Avenue, Nashville, TN 37206, a citizen of USA; and
Shanna Arnold, of Nashville, TN, a citizen of USA.
Assignee: Vanderbilt University
Attorney Docket No.: 11672N/121 19P
RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional Application Serial No. 61/712,556, filed October 11, 2012, the entire disclosure of which is incorporated herein by this reference.
GOVERNMENT INTEREST
[0001] This invention was made with government support under grant numbers
CA12071 1-01, CA143081-01, CA143081-03, CA040035, CA9060625, UL1TR000445, CA136228, CA009592, CA098131, CA136228, HL007751, and DK079341 awarded by the National Institutes of Health. The government has certain rights in the invention.
TECHNICAL FIELD
[0002] The presently-disclosed subject matter relates to characterization of cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding.
Characterization includes monitoring a cancer, providing a diagnosis, providing a prognosis, providing a theranosis, and evaluation treatment efficacy and/or progression of a cancer in a subject by determining a presence or an amount of shed ALCAM in a biological sample from the subject.
INTRODUCTION
[0003] Cancer treatment is currently hindered in large part because of poor diagnostic, prognostic, and monitoring systems and methods. For example, colorectal cancer (CRC) is the third most frequently diagnosed cancer, and second leading cause of cancer-related deaths in the United States. Current prognosis for CRC patients predominantly rely on pathologic
UICC/AJCC tumor node metastasis (TNM) staging classification. Although TNM staging successfully stratifies high-risk patients, there is significant variability in the rate of disease progression within each stage. Particular concern exists for early stage disease (Stage I and II) where patients can progress more rapidly than expected. It is well known that
approximately 30% of stage II CRC patients die of recurrent and metastatic disease.
Identification of patients at risk of recurrence/progression could inform clinicians on adjuvant chemotherapeutic treatment decisions.
[0004] Furthermore, bladder cancer (BCa) is another example of a widespread cancer, and BCa is the fourth most common cancer in men in the United States with an estimated 55,600 new cases in 2012 and a five-year relative survival of 71%, 35% and 5% for local, regional and distant disease, respectively. Within 5 years of initial diagnosis, 60-70% of patients with non-muscle invasive BCa will recur locally after transurethral resection and another 20-50% will progress to invasive disease, ultimately requiring complete surgical resection of the bladder (cystectomy). Moreover, approximately 50% of patients undergoing radical cystectomy will recur with metastases within two years. The risk of progression and recurrence necessitates frequent follow-up, invasive monitoring, and repeated clinical interventions which decreases quality of life and makes lifelong management of BCa more costly than any other cancer. Furthermore, despite proven survival benefit, neoadjuvant chemotherapy is under-utilized due to an inability to accurately predict recurrence and monitor treatment response that would justify the risk of exposure of an aging patient population with multiple comorbidities to chemotherapy-associated toxicities.
[0005] These observations highlight the need for prognostic indicators that identify patients likely to benefit from aggressive intervention. Biomarkers can assist in identifying those patients that require more aggressive intervention or patients at risk of relapse after initial treatment. Promising clinical tests including ONCOTYPE DX™ and COLOPRTNT™ evaluate possible disease progression by assessing gene expression. These tests are not yet widely applied possibly because their epigenetic evaluation reflects on gene expression which does not always reliably predict actual cellular behavior. Thus, existing prognostic tests do not report on cancer progression. Furthermore, the heterogeneous nature of genetic drivers, particularly in BCa, limits their use as predicative biomarkers.
[0006] Accordingly, clinical intervention would greatly benefit from further
understanding of the molecular mechanisms that drive metastasis as well as molecular indicators that identify patients at risk of disease progression. There remains a need in the art
for a methods and compositions for diagnosing, prognosticating, and monitoring the progression of certain cancers.
SUMMARY
[0007] The presently-disclosed subject matter meets some or all of the above-identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document.
[0008] This Summary describes several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
[0009] The presently-disclosed subject matter includes a shed ALCAM label for use in the identification of shed ALCAM in a sample from a subject. The label can include an antibody, which itself can be an isolated antibody. The label can produce a signal which can be detected, such as an optical signal or the like. In some embodiments the optical signal can include fluorescence. In this regard, in some embodiments the label comprises an antibody and a signal-producing moiety conjugated to the antibody. The antibody can selectively bind to shed ALCAM, whereas the signal-producing moiety can produce a signal that can be detected (e.g., fluoresce).
[0010] In some embodiments the label can recognize the C-terminal of ALCAM, shed ALCAM, or a combination thereof. In other embodiments the label can recognize the N- terminal ALCAM, shed ALCAM, or a combination thereof. In some embodiments the label is detectable with the use of ELSIA.
[0011] The presently-disclosed subject matter also includes a method for characterizing, monitoring, or characterizing and monitoring a cancer in a subject. In some embodiments the methods comprise providing a biological sample from the subject, determining a presence or an amount of shed ALCAM in the biological sample, and comparing the presence or the amount of the shed ALCAM in the biological sample to a reference, wherein the cancer is characterized and/or monitored based on a measurable difference in the presence or the
amount of the shed ALCAM from the biological sample as compared to the reference. In different implementations, the step of characterizing can include providing a diagnosis, prognosis, theranosis, or combination thereof of the cancer.
[0012] In yet other embodiments a method is provided for evaluating the treatment efficacy, progression, or both of a cancer in a subject. In some embodiments the methods comprise providing a biological sample from the subject, determining a presence or an amount of shed ALCAM in the biological sample, and comparing the presence or the amount of the shed ALCAM to a reference, wherein the treatment efficacy and/or progression of the cancer is evaluated based on a measurable difference in the presence or the amount of the shed ALCAM as compared to the reference.
[0013] In the present methods there can be provided a step of contacting the biological sample with an antibody that selectively binds shed ALCAM. In this regard, some embodied antibodies can recognize the C-terminal ALCAM, shed ALCAM, or a combination thereof, or they can recognize the N-terminal ALCAM, shed ALCAM, or a combination thereof. In some embodiments the step of determining a presence or an amount of shed ALCAM in the biological sample therefore includes the use of an ELISA.
[0014] In the present methods the cancer can include, but is not limited to, a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, colorectal cancer, and combinations thereof. Thus, in some embodiments the cancer is urogenital cancer. In some embodiments the cancer is bladder cancer. In some embodiments the cancer is renal cell cancer. In some embodiments the cancer is colorectal cancer.
[0015] As described above, the present methods can include comparing the presence or the amount of shed ALCAM to a reference. In some embodiments the reference comprises a level of the shed ALCAM in one or more samples from one or more individuals without the cancer. In some embodiments the reference comprises a level of the shed ALCAM in a sample from the subject taken over a time course. In some embodiments the reference comprises a sample from the subject collected prior to initiation of treatment for the cancer and/or onset of the cancer and the biological sample is collected after initiation of the treatment or onset of the cancer. In some embodiments the reference comprises a standard sample, control data, or both. The reference can also include any value calculated from one or more different possible references.
[0016] In further embodiments, the present methods comprise providing a series of biological samples collected from the subject over a time course, and then determining a
presence or an amount of shed ALCAM in each of the series of biological samples. In some embodiments wherein the series of biological samples comprises a first biological sample collected prior to initiation of treatment for the cancer and/or onset of the cancer and a second biological sample collected after initiation of the treatment or onset of the cancer.
[0017] In some embodiments the biological sample comprises tissue, urine, serum, blood, spinal fluid, or the like or combinations thereof. In some embodiments the step of providing the biological sample from the subject comprises extracting the sample. Furthermore, in some embodiments the step of providing the biological sample from the subject comprises isolating the shed ALCAM from the sample.
[0018] In some embodiments the methods can be carried out in vitro or in vivo. In certain embodiments of the present methods there is further provided a step of determining an amount of intact ALCAM, and, optionally, in some embodiments the methods comprise calculating a ratio of intact ALCAM to shed ALCAM. In yet other embodiments of the present methods there is provided a step of selecting a treatment or modifying a treatment for the cancer based on the amount of the shed ALCAM determined. In some embodied methods a reagent is used.
[0019] Additionally, the presently-disclosed subject matter includes a kit that comprises a reagent that can carry out any of the presently-disclosed methods. In some embodiments the kit can further comprise an antibody that selectively binds shed ALCAM. In certain embodiments the antibody recognizes the C-terminal of ALCAM, and in other embodiments the antibody recognizes the N-terminal of ALCAM.
[0020] Embodiments of kits can further comprise a reference standard sample and/or control data. The standard sample, the control data, or both can be for a cancer, a non-cancer, or a combination thereof. The cancer can include, but is not limited to, a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, and colorectal cancer.
[0021] Further features and advantages of the present presently-disclosed subject matter will become evident to those of ordinary skill in the art after a study of the present application.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 shows ALCAM expression in colorectal carcinoma and its correlation to patient outcome. A) Representative immunohistochemical staining for ALCAM in normal
and tumor colon sections using an antibody directed to the extracellular domain of ALCAM (HPAO 10926). B) Expression of ALCAM in CRC cell lines evaluated by immunoblotting (left) and microarray analysis (right, GDS1761). Expression (mRNA) of ALCAM (C) and ADAM17 (D) in a cohort of 250 colorectal cancer patients was correlated to patient survival after dichotomizing the population across its mean expression into patients with "High ALCAM" and "Low ALCAM". E) Using an ALCAM sandwich ELISA, circulating levels of shed ALCAM were evaluated in serum from cancer- free patients (n=48) and compared to serum from CRC patients at time of diagnosis (pre-op, n=42) and serum from patient at time of followup after treatment (post-op, n=19). F) CRC patients were stratified according to stage (I-IV) and compared to cancer-free patients (n=48) and healthy adults (n=6). Box plots show the mean, standard deviation and full range of the expression data. Survival is presented with Kaplan-Meier plots and log-rank test was used to evaluate significance.
[0023] Figure 2 shows ALCAM expression in continuous cancer cell lines. Lysates from human cancer cell lines immunoblotted for ALCAM using an antibody specific for its extracellular domain.
[0024] Figure 3 shows that the lack of cytoplasmic ALCAM corresponds with poor patient outcome. A tissue microarray of 75 CRC and 12 normal colonic tissues was stained by traditional IHC for the extracellular domain of ALCAM. Membranous and cytoplasmic staining was stained and scored by an independent pathologist in a blinded manner.
[0025] Figure 4 shows the specificity of anti-ALCAM ICD confirmed by analysis of ALCAM in ALCAM-/- mice. A) Schematic representation of ALCAM and its organization as a cell-cell adhesion molecule. Individual domains are presented as ovals (extracellular IgG-like domain) or rectangles (intracellular domain). B) The antibody 1G3A1 specific for the cytoplasmic tail of ALCAM was used to immunoblot 40μg of liver extracts from wild type and ALCAM-/- mice. C) ALCAM specificity of individual clones was evaluated by outcompeting antibody binding with the immunizing peptide in immunofluorescence staining of human lung tissue sections.
[0026] Figure 5 shows multi-species sequence alignment was carried our using the Geneious™ bioinformatics software. Along the top of each alignment is the sequence identity plot comparing the sequence across species. Green peaks are 100% identity among species; yellow and red are lower identities. Immunogen sequence is located in the cytoplasmic tail consisting of a highly conserved 14 amino acid sequence.
[0027] Figure 6 shows the screening and validation of an antibody specific to the cytoplasmic domain of ALCAM. A) B) Individual hybridoma clones reactive to the
immunizing peptide were screened by direct ELISA using whole cell lysate from a cell line expressing high levels of ALCAM (PC3). A 1.0 OD was used to select clones for further validation by immunoblotting cutoff. Three high-titre clones chosen for further validation were 1G3A1 (ii), 1G3B3 (iv), and 1G3CF (i). B) Hybridoma clones 1G3A1, 1G3B3, and 1G3CF were further for specificity to ALCAM by comparing their reactivity to ALCAM with a commercial antibody (directed against the extracellular domain) using lysates from parental PC3 cells and PC3 cells with shRNA-mediated knockdown of ALCAM. C) ALCAM specificity of individual clones was further evaluated by outcompeting antibody binding with the immunizing peptide in Immunoblots of whole cell lysates (PC3). D) Specificity of purified 1G3A1 against the cytoplasmic tail of ALCAM was confirmed by immunoblotting intact ALCAM (whole cell lysate; Lys.) and shed ALCAM (conditioned medium; CM.) from PC3 cells.
[0028] Figure 7 shows the detection of ALCAM shedding in cancers of the stomach and colon. The ALCAM dual stain composed of the antibody HPAO 10926 directed against the extracellular domain (green) and antibody 1G3A1 directed against the intracellular domain (red) was used to identify locations within the tissue that exhibited ALCAM shedding in cancers of the stomach (A) and colon (B), scale bar = 64μιη. Images of nuclear stain (blue) were merged with images of HPAO 10926 (green) and 1G3A1 (red) staining. Insets (C) present magnified regions i and ii from stomach and colon carcinoma. Areas of ALCAM shedding are identified by the presence of 1G3A1 staining (red) and an absence of
HPAO 10926 (green) staining. Arrow: intact ALCAM, Arrow Head: ALCAM shedding. Scale bar = 320μιη.
[0029] Figure 8 shows the quantitative analysis of ALCAM shedding in CRC The ALCAM dual stain was used to detection the extracellular domain (green) and intracellular domain (red) of ALCAM in normal colonic mucosa (A) and colorectal cancer (B). ALCAM shedding was defined as the detection of ALCAM-ICD in the absence of co-localized ALCAM-ECD. The results of this analysis presents ALCAM shedding quantitatively as the fraction of total detectable ALCAM from which the extracellular domain is absent.
[0030] Figure 9 shows the image processing pipeline implemented using FIJI. Images obtained of normal (A) and tumor (B) tissues through scanning on the Ariol® platform were processed to obtain the fraction of ALCAM shed. The original images was separated into its individual color channels and threshold values were obtained for the red channel (ALCAM- ICD) and the green channel (ALCAM-ECD). A co-localization of these thresholded areas was used to distinguish intact ALCAM (both ALCAM-ICD and -ECD, yellow) from shed
ALCAM (only ALCAM -ICD, teal). Quantitatively ALCAM shedding is defined as the fraction of detectable ALCAM from which the extracellular domain is absent.
[0031] Figure 10 shows ALCAM shedding in CRC correlates with poor survival. Scatter plots demonstrate the differences in ALCAM shedding between normal colonic mucosa and CRC tumors as a single population (A), stratified across histological stage (B), or separated according to survival (C). Kaplan-Meier survival curves of CRC patients with high versus low ALCAM shedding were generated and log-rank tests performed to evaluate the correlation of ALCAM shedding with overall survival of patients at all stages (D), overall survival of stage II patients (E) or disease-specific survival of stage II patients (F). Scatter plots show the mean and SEM with statistical evaluation by Mann- Whitney for selected groups (A and C) or Kruskal-Wallis with Dunn's multiple comparison restricted to normal (B).
[0032] Figure 11 shows ALCAM mRNA, protein and shedding in colorectal cancer. Kaplan-Meier survival analysis contrasts CRC patients overall survival, stage II patient overall survival and disease-specific stage II CRC survival with high versus low ALCAM mRNA expression (A) protein expression (B) or ALCAM shedding (C). Survival is presented as Kaplan-Meier plots with the log-rank test used to evaluate significance.
[0033] Figure 12 shows a schematic of a multi-level approach for analysis of ALCAM in bladder cancer.
[0034] Figure 13 shows the correlation of ALCAM mRNA with tumor stage and overall survival in bladder cancer. (A) ALCAM Log2 mRNA levels are graphed according to tumor pathology stage. Mean and 95% confidence intervals displayed. K-W, Kruskal-Wallis test. J- T, Jonckheere-Terpstra test for trend. (B) Kaplan-Meier curves and Log-rank test for significance of ALCAM dichotomized high/low around the median Log2 mRNA level (10.4). HR, Hazard Ratio. CI, Confidence Interval. All analyses were two-tailed with a 0.05 alpha level.
[0035] Figure 14 shows the correlation of ALCAM protein expression with tumor stage and overall survival in bladder cancer. (A) IHC (top panel) for ALCAM (brown) and IF (bottom panels) for ALCAM (green), Ki67 (white), Collagen (red), and Nuclei (blue) in normal bladder and BCa (CIS, pTl, pT2, pT3, pT4). Scale bars = ΙΟΟμιη (low magnification) and 50μιη (high magnification). (B, D, F) Correlation of core stage (n=481) with ALCAM IHC intensity score (B), ALCAM IF percent thresholded area (D), and Ki67 IF percent nuclear area (F) with GEE ordinal logistic regression (OR, odds ratio; with 95% CI) and Kendall's (K) rank correlation (τ). Mean and 95% CI graphed. (C, E, G) Kaplan-Meier curves
and Log-rank tests for overall survival (n=198) with ALCAM IHC expression dichotomized around an intensity score of 2 (C), ALCAM IF expression dichotomized around the mean percent thresholded area of 6.66% (E), and Ki67 IF dichotomized around the mean percent nuclear area of 1.58% (G). HR, Hazard Ratio. CI, Confidence Interval. All analyses were two-tailed with a 0.05 alpha level.
[0036] Figure 15 shows the detection of shed ALCAM in fluids and its correlation with stage and overall survival in bladder cancer. (A) A schematic of ALCAM acting as a cell-cell adhesion molecule in normal epithelial cells, which, during tumor progression, cells can regulate motility and invasion through ADAM 17 -mediated ALCAM cleavage. (B) ALCAM levels (ng/ml) in serum of normal controls compared to patients with BCa. Mann- Whitney U, two-tailed, 0.05 alpha level. (C) ALCAM levels (ng/ml) in urine of normal controls compared to patients with inflammatory conditions, cancers other than BCa, and BCa. Mann- Whitney U, two-tailed, 0.05 alpha level. UC, ulcerative colitis. SC, staghorn calculi. (D,E) Correlation of shed ALCAM in the serum (D) and urine (E) with pathological tumor stage in the shed ALCAM BCa cohort (n=120). K-W, Kruskal-Wallis test. J-T, Jonckheere-Terpstra test for trend. Graphs display mean and 95% CI. Kaplan-Meier curves and Log-rank tests for analysis of overall survival with (F) tumor stage, (G) urine ALCAM, and (H) serum ALCAM. (I) Graph of the time-dependent receiver operating characteristic (ROC) curves based on the probabilities attained by the multivariable Cox regression analysis for age, tumor stage, and N-stage alone (red) compared to the addition of serum and urine ALCAM (blue).
Concordance indices (C-Index) are shown.
[0037] Figure 16 shows the mass spectrometry analysis and discovery of ALCAM as a CD151 associated protein. (A) (left panel) General tetraspanin schematic with the small extracellular loop (SEL) and the large extracellular loop (LEL) highlighted, (right panel) Schematic representation of tetraspanin-partner interaction (I-II), TERM assembly (III-IV) and interaction with intracellular signaling molecules (V). (B) Detection of CD 151 and associated proteins by metabolic labeling (S35), cell-surface biotin labeling (biotin), or CD 151 -specific immunoblot after immunoprecipitation from a HEp3 cell lysate. (C-D) Mass Spec analysis (LC-MS-MS) of CD151-associated proteins after immunoprecipitation by antibody 1A5. (C) SDS-PAGE used for LC-MS-MS and pie-chart representing distribution of identified targets. D). Table of known CD 151 -associated proteins and putative partners that can potentially control migration. E). Gene Ontology analysis performed with WebGestalt on genes differentially expressed after the introduction of a dominant-negative ALCAM.
[0038] Figure 17 shows the physical association of CD 151 with ALCAM. (A)
Immunofluorescent staining of CD 151 and ALCAM in HEp3 cells treated with control IgG or 1A5. (B) Co-immunoprecipitation of ALCAM by anti-CD151 antibody 1A5. (C) Co- immunoprecipitation of CD 151 by anti -ALCAM antibody. (D-E) Co-precipitation of ALCAM and CD 151 after pull-down of GFP-tagged partner. (CD151 *= untagged CD151 that co-precipitates with CD151-GFP).
[0039] Figure 18 shows that CD151 and ALCAM cooperate in the regulation of tumor cell migration. (A) Schematic representation of migration in response to clustering of CD 151 by antibody 1A5 (I) which results in enhanced adhesion (II) and subsequent inhibition of migration. (B) Transwell migration of HT 1080 cells in the presence or absence of 1A5 after transfection with control siRNA (white bars) or ALCAM siRNA (black bars). (C)
Immunoblotting and immunofluorescent staining of cultured cells. (D) Schematic representation of migration in response to ALCAM -ALCAM interactions. (E) Analysis of cell migration on ALCAM-Fc by single-cell tracking. Migration velocity is determined after transfection with control shRNA (white bars) or CD 151 shRNA (black bars). (F)
Immunoblotting and immunofluorescent staining of cultured cells.
[0040] Figure 19 shows that the CD151/ALCAM signaling mechanism involves PKC and the small GTPase Rapl . (A) Transwell migration of HEp3 cells in the absence (white bars) or presence of 1A5 Anti-CD151 (black bars) analyzed in the presence of different pathway inhibitors. (B) Wound healing migration of HEp3 cells expressing siRNAs specific for ALCAM, PKCa, and Rapl. (C) Rapl activation HEp3 cells serum starved overnight and treated with 1A5 in culture for the indicated time points. (D) Plating HEp3 cells on ALCAM- Fc activates Rap 1 in a time dependent manner but has not impact on the activation of state of the small GTPase Racl . (E) 1A5 treatment activates Rapl in a PKCa-dependent manner.
[0041] Figure 20 shows that Rapl activation can inhibit tumor cell motility in vitro and in vivo. HEp3 cells were transiently transfected with empty vector (Control) dominant negative Rapl (N17) or dominant active Rapl (V12). (A) Transgene expression was verified by immunoblotting for the HA -tagged protein. (B) In Vitro cell migration was performed with transiently transfected cells in a wound-healing assay. (C) and (D) HEp3 cells were injected into 12 day old chicks and the migratory phenotype of metastatic colonies was evaluated (see methods for details). The number of motile colonies was quantified (C) from images taken of the chorioallantoic membrane containing metastatic colonies (D). Data is representative of three experiments with n>5 for each experiment.
[0042] Figure 21 shows that ALCAM is overexpressed metastatic prostate cancer and correlates with patient survival. (A) Heat map and corresponding relative expression of ADAM 17 (i) ALCAM (ii) N-cadherin (iii), pi 20 (iv) and E-cadherin (v) indicated by arrows.
(B) Representative images from immunohistochemical staining of ALCAM membranous and cytoplasmic expression in benign to metastatic prostate cancer. (C) Correlation of ALCAM expression to overall survival in a publicly available dataset (code) composed of 600 prostate cancer patients. Kaplan-Meier survival curves represent the upper and lower quartile ALCAM expression.
[0043] Figure 22 shows A) Western blot analysis of ALCAM shedding in conditioned media of LNCaP and PC3 cells treated with or without lOng/ml of TGF using antibodies specifically recognizing the extracellular and intracellular domains, and B) ALCAM shedding in response to lOng/ml TGF after 48 hours as measured by Western blotting of ALCAM and CD151 (exosome marker) in PC3 tumor cell conditioned media. "Total CM" = total conditioned media, "CM Supernatant" = conditioned media supernatant without exosome pellet, "Exosome pellet" = exosome pellet resuspended in phosphate buffered saline.
[0044] Figure 23 shows that the expression and shedding of ALCAM is increased in response to TGF . (A) ELISA analysis of ALCAM shedding in concentrated conditioned media of PC3 cells treated with indicated exogenous cytokines. TGF , p<0.001 (B)
Expression of ALCAM by RT-PCR fold change relative to GAPDH, glyceraldehyde 3- phosphate dehydrogenase in PC3 or LNCaP cells treated with or without lOng/ml of TGF for 48 hrs (C) Western blot analysis of shed ALCAM in the conditioned media and intact ALCAM in the cell lysate in LNCaP and PC3 cells. D) Western blot detection of ALCAM and Phospho-smad2 expression in PC3 cells treated with lOng/ml TGF for 48 hrs in the presence or absence of 10μΜ SB431542. (E) RT-PCR and F) Western blot analysis of ALCAM expression in LNCaP cells transfected with vector control or T204D, dominant active TGF type I receptor; *p<0.05, **p<0.01.
[0045] Figure 24 shows that ALCAM shedding correlates with tumor burden. (A) Schematic representation of in vivo strategy for S.Q. and orthotopic tumor models. B and C) Circulating levels of soluble host and tumor-derived ALCAM detectable in mice bearing subcutaneous injected PC3 cells (B) or PC3 cells orthotopically implanted into the prostate
(C) . Levels of ALCAM are shown as a function of time (top) or tumor burden at the time of experiment completion (bottom). Each point reflects mean of duplicate measurements ± SD.
[0046] Figure 25 shows a graph of ALCAM serum half-life in mice.
[0047] Figure 26 shows that the immune response modulation does not effect serum ALCAM. A) Tumor-derived (human) ALCAM serum levels in individual mice plotted longitudinally B) Serum levels of mouse ALCAM pre-and post-treatment with
Lipopolysaccharide (LPS). Data are mean ± SEM (n=5); *p<0.05 (One-way ANOVA; Mann- Whitney test). C) Serum levels of mouse ALCAM in pre-and post full thickness skin punch. Data are mean ± SEM (n=6); *p<0.05 (One-way ANOVA; Mann-Whitney test).
[0048] Figure 27 shows (A) a Western blot analysis of shed ALCAM in the conditioned media and ADAM 17 in the total cell lysate of PC3 transiently transfected with either scrambled siRNA or siRNA targeting ADAM 17, (B) a Western blot analysis of shed ALCAM in PC3 cells treated with an ADAM17-specific inhibitor (Compound-32, BMS), broad-spectrum MMP inhibitor (GM6001), or diluent control, and (C) a graph of serum levels of tumor-derived ALCAM in lOwk old SCID mice bearing PC3-luc tumors and treated with DMSO diluent or Compound-32 for three days, p=0.0005
[0049] Figure 28 shows a plot of compound-32/ADAM17 inhibitor dosing in vivo.
[0050] Figure 29 shows (A) Western blot analysis of lysates from parental PC3-luc and PC3-luc shRNA ALCAM (KD1) knockdown cells, (B) quantitative analysis of tumor cell migration in parental PC3 cells and PC3 cells with shRNA-mediated knockdown of ALCAM treated with or without lOng/ml TGF , C) whole animal luciferase imaging of mice bearing orthotopic PC3-luc parental tumors or PC3-luc ALCAM knockdown tumors 6-weeks post surgery, (D) primary tumor weights of orthotopic PC3-luc parental tumors (n=8) and PC3-luc ALCAM knockdown tumors (n=8), (E) representative whole-animal luciferase imaging and matching x-rays 8 weeks post-intracardiac injection of PC3-luc parental (shControl) or PC3- luc ALCAM knockdown (shALCAM, KD1), and (F) a plot of average number of bone lesions in mice from PC3-luc (1.42 ± 0.26; n=31) or PC3-luc shRNA ALCAM (KD1) knockdown cells (0.16 ± 0.07;n=25). **p<0.0001.
[0051] Figure 30 shows (A) a representative whole animal luciferase and x-ray imaging of mice post-intratibial injection of PC3-luc parental tumors (vector, n=8), and PC3-luc ALCAM knockdown tumor cells (KD2, n=8 & KD3, n=8), (B) Collagen I and ALCAM immunoflurescence of tumor cells within the tibias of mice bearing PC3-luc vector or PC3- luc KD2 or KD3 tumors, (C) bioluminescent curve of intratibial tumor development in mice bearing PC3-luc vector, PC3-luc KD2 and KD3 tumors. (Two-way ANOVA with Bonferroni post-test), and (D) tumor incidence and average lesion area in the tibias of mice bearing PC3- luc vector, PC3-luc KD2 and KD3 tumors. Data represent the mean ± SEM
(n=8/group); * *p<0.01 ; * * *p<0.0001
[0052] Figure 31 shows that tumor-derived ALCAM impacts tumor survival in the bone microenvironment of intratibial bone tumor model. A) Representative three dimensional reconstitutions of microCT images from mice injected with PC3-luc -vector, PC3-luc-KDl and PC3-luc-KD2 tumor cells. B) Boxplots of average BV/TV (bone volume/total volume) by group for the PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor bearing mice. Data represents quartiles with dots indicating outliers (1.5x upper or lower quartile; n=16 tibias/group) *p<0.05, **p<0.01. C) A boxplot representing the lesion area calculated from end-point x-ray images from the same experiment. D) Representative H&E stains of osteolytic bone lesions in the hind leg of mice. Outlines indicate the osteolytic tumor lesion within the bone. E) Representative immuno fluorescent staining of cleaved caspase-3 positive cells (red) in tibias of PC3-luc -vector, PC3-luc-KD2 and PC3-luc-KD3 tumor-bearing mice. F) Representative immunofluorescent staining of Ki67 proliferating cells (red) in tibias of PC3-luc -vector, PC3-luc-KD2 and PC3-luc-KD3 tumor-bearing mice. Data are mean ± SEM (n=8/group); *p<0.05, **p<0.01, ***p<0.005. G) A plot of apoptosis in the tumor-bone microenvironment as a function of total cell number assessed by staining for cleaved caspase- 3 in PC3-luc -vector, PC3-luc-KD2 and PC3-luc-KD3 tumor bearing tibias of mice 4 weeks post-injection. H) A plot of proliferation in the tumor-bone microenvironment as a function of total cell number assessed by staining for Ki67 in PC3-luc -vector, PC3-luc-KD2 and PC3- luc-KD3 tumor bearing tibias of mice 4 weeks post- injection.
[0053] Figure 32 shows a graph of tumor cell proliferation over time assessed by total cell counts over 72 hours.
[0054] Figure 33 shows representative TRAcP stained photomicrographs of PC3 shControl and shALCAM injected animals at day 28.
[0055] Figure 34 shows the analysis of intra-tumoral ALCAM protein expression and shedding on a retrospective cohort of patients with clear cell renal cell carcinoma undergoing nephrectomy. A) Immunohistochemical staining for ALCAM with antibodies against the extracellular and intracellular domain. B) A plot showing ALCAM staining intensity, on a scale from 0-3, based on the signal observed in greater than 10% of tumor cells. C) A plot showing "shed" ALCAM as total ALCAM minus intact ALCAM. Overall survival was defined as time from date of nephrectomy to date of death or last follow-up. Recurrence was defined as time from date of nephrectomy to date of metastatic recurrence validated by imaging.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0056] The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.
[0057] The presently-disclosed subject matter meets some or all of the above-identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document. To avoid excessive repetition, this Description does not list or suggest all possible combinations of such features.
[0058] The presently-disclosed subject matter includes methods of characterizing a cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding. Characterization includes monitoring a cancer, providing a diagnosis, providing a prognosis, providing a theranosis, and evaluation treatment efficacy and/or progression of a cancer in a subject by determining a presence or an amount of shed ALCAM in a biological sample from the subject.
[0059] ALCAM (Activated Leukocyte Cell Adhesion Molecule) is a cell-cell adhesion protein that has been identified in a broad array of biological processes including
inflammatory responses, neuronal outgrowth, and migration and metastasis. ALCAM consists of five extracellular IgG-like domains, a transmembrane domain and a short cytoplasmic domain. ALCAM can be proteolytically processed by ADAM 17, thereby generating a soluble ALCAM component and a truncated membrane -bound ALCAM containing the
transmembrane and cytoplasmic domain. At the clinical level, shed ALCAM is detectable in the serum or other biological samples of cancer patients. The present inventors have found that cell adhesion is disrupted when the ectodomain of ALCAM is shed from malignant tumor cells during invasive transformation by ADAM17-mediated cleavage. Consequently, ALCAM shedding is a molecular indicator of a cellular activity, and can present itself pathologically in invasive and/or disseminated diseases.
[0060] Unlike most candidate biomarkers, ALCAM expression is not tissue-restricted and it is commonly found in most epithelia and related carcinomas. ALCAM contributes to tumor
progression by controlling migration. The present inventors have found that the molecular activity of ALCAM appears to be regulated through shedding of its extracellular domain. Consequently, certain advanced disease tissues express ALCAM but exhibit an elevated level of ALCAM shedding.
[0061] In some embodiments, a method for characterizing and/or monitoring a cancer in a subject includes providing a biological sample from the subject; determining a presence or an amount of shed ALCAM in the biological sample; and comparing the presence or the amount of the shed ALCAM in the biological sample to a reference, wherein the cancer is characterized and/or monitored based on a measurable difference in the presence or the amount of the shed ALCAM from the biological sample as compared to the reference.
[0062] In some embodiments, the presently-disclosed subject matter includes a method for evaluating treatment efficacy and/or progression of a cancer in a subject, which involves providing a biological sample from the subject; determining a presence or an amount of shed ALCAM in the biological sample; and comparing the presence or the amount of the shed ALCAM to a reference, wherein the treatment efficacy and/or progression of the cancer is evaluated based on a measurable difference in the presence or the amount of the shed ALCAM as compared to the reference.
[0063] The presently-disclosed subject matter includes antibodies and kits useful for characterizing, monitoring, evaluating treatment efficacy of, and/or evaluating progression of a cancer in a subject. In some embodiments, the antibody is an isolated antibody or antigen- binding fragment thereof that specifically binds to at least one of C-terminus of shed
ALCAM and N-terminus of shed ALCAM. In some embodiments, the kit includes an antibody that selectively binds shed ALCAM. In some embodiments, the kit further includes a reference.
[0064] The term "characterizing" and "characterize" are used herein to refer to providing a diagnosis, a prognosis, and/or a theranosis of a cancer. The terms "diagnosing" and "diagnosis" as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition. The skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, such as for example a biomarker, the amount (including presence or absence) of which is indicative of the presence, severity, or absence of the condition.
[0065] Along with diagnosis, clinical cancer prognosis is also an area of great concern and interest. It is important to know the aggressiveness of the cancer cells and the likelihood of tumor recurrence in order to plan the most effective therapy. If a more accurate prognosis
can be made or even a potential risk for developing the cancer assessed, appropriate therapy, and in some instances less severe therapy for the patient can be chosen. Measurement of shed ALCAM can be useful in order to separate subjects with good prognosis and/or low risk of developing cancer who will need no therapy or limited therapy from those more likely to develop cancer or suffer a recurrence of cancer who might benefit from more intensive treatments.
[0066] As such, "making a diagnosis" or "diagnosing", as used herein, is further inclusive of determining a risk of developing cancer or determining a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the measure of the shed ALCAM disclosed herein. Diagnostic testing that involves treatment, such as treatment monitoring or decision making can be referred to as "theranosis." Further, in some embodiments of the presently disclosed subject matter, multiple determinations of the shed ALCAM over time can be made to facilitate diagnosis and/or prognosis. A temporal change in the biomarker can be used to predict a clinical outcome, monitor the progression of the cancer and/or efficacy of appropriate therapies directed against the cancer. In such an embodiment, for example, one might expect to see a decrease and/or an increase in the amount of shed ALCAM in a biological sample over time during the course of effective therapy.
[0067] As used here, the term "shed ALCAM" refers to shedding of the cell adhesion molecule ALCAM, that is to say, ALCAM that has been shed into a biological sample. As will be known to one of ordinary skill in the art, shed ALCAM is distinct from ALCAM that might be expressed and detected by measuring gene products, such as mRNA or expressed protein, i.e., intact ALCAM. In some embodiments, it can be useful to further detect intact ALCAM, and to determine a ratio of intact ALCAM to shed ALCAM, which can be useful in characterizing the cancer. As such, when "determining a presence or an amount of shed ALCAM" is described herein, it is inclusive of "determining a ratio of intact ALCAM to shed ALCAM," and unless otherwise apparent, reference to "shed ALCAM" is inclusive of "a ratio of intact ALCAM to shed ALCAM."
[0068] The presently disclosed subject matter further provides in some embodiments a method for determining whether to initiate or continue treatment of a cancer in a subject and/or a method for evaluating treatment efficacy and/or progression of a cancer in a subject. As used herein, the terms "treatment" or "treating" relate to any treatment of a condition of interest, including but not limited to prophylactic treatment and therapeutic treatment.
[0069] The terms "correlated" and "correlating," as used herein in reference to the use of detection of shed ALCAM as disclosed herein, refers to comparing the presence or quantity of the shed ALCAM in a subject to its presence or quantity in subjects known to suffer from, or known to be at risk of, a given condition (e.g., a particular cancer); or in subjects known to be free of a given condition, i.e. "normal subjects" or "control subjects". For example, a level of shed ALCAM disclosed herein in a biological sample can be compared to a shed ALCAM level determined to be associated with a specific type of cancer. The sample's biomarker level is said to have been correlated with a diagnosis; that is, the skilled artisan can use the biomarker level to determine whether the subject suffers from a specific type of cancer, and respond accordingly. Alternatively, the sample's biomarker level can be compared to a control level of the shed ALCAM known to be associated with a good outcome (e.g., the absence of cancer), such as an average level found in a population of normal subjects.
[0070] As used herein the term "cancer" can refer to a precancerous or cancerous pathology. In some embodiments the cancer is selected from the group consisting of carcinoma, lymphoma, blastoma, sarcoma and leukemia. The term cancer is also inclusive of other known cancers, including, but not limited to, squamous cell cancer, lung cancer, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer, gastrointestinal cancer, urogenital cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma., breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, head and neck cancer, and lymphoma.
[0071] In some embodiments, the reference can be a level of the shed ALCAM in a sample from the subject taken over a time course. In some embodiments, the reference can be a sample from the subject collected prior to initiation of treatment for the cancer and/or onset of the cancer and the biological sample can be collected after initiation of the treatment or onset of the cancer. In some embodiments, the reference can be a standard sample. In some embodiments, the reference can include control data. Thus, the terms "reference" or "control level" are used herein to refer to any presence and/or amount of the shed ALCAM to which the presence and/or amount of shed ALCAM in the biological sample is being compared.
[0001] In certain embodiments, shed ALCAM is correlated to a condition or disease by merely its presence or absence. In other embodiments, a threshold level of shed ALCAM can
be established (e.g., a particular amount of shed ALCAM ), and the level of the indicator in a subject sample can simply be compared to the threshold level.
[0002] The phrase "determining the prognosis" as used herein refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject. The term "prognosis" does not refer to the ability to predict the course or outcome of a condition with 100% accuracy, or even that a given course or outcome is predictably more or less likely to occur based on the presence, absence or levels of a biomarker. Instead, the skilled artisan will understand that the term "prognosis" refers to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a given condition, when compared to those individuals not exhibiting the condition. For example, in individuals not exhibiting the condition, the chance of a given outcome may be very low (e.g., <1%), or even absent. In contrast, in individuals exhibiting the condition (e.g., elevated levels of shed ALCAM), the chance of a given outcome (e.g., suffering from a cancer or poor prognosis in connection with a cancer) may be high. In certain embodiments, a prognosis is about a 5% chance of a given expected outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance.
[0003] The skilled artisan will understand that associating a prognostic indicator with a predisposition to an adverse outcome is a statistical analysis. For example, a biomarker level (e.g., quantity of shed ALCAM in a sample) of greater than a control level in some embodiments can signal that a subject is more likely to suffer from a cancer than subjects with a level less than or equal to the control level, as determined by a level of statistical significance. Additionally, a change in marker concentration from baseline levels can be reflective of subject prognosis, and the degree of change in marker level can be related to the severity of adverse events. Statistical significance is often determined by comparing two or more populations, and determining a confidence interval and/or a p value. See, e.g., Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York, 1983, incorporated herein by reference in its entirety. Exemplary confidence intervals of the present subject matter are 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while exemplary p values are 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, and 0.0001.
[0004] The "amount" of a biomarker determined from a sample refers to a qualitative (e.g., present or not in the measured sample), quantitative (e.g., how much is present), or both measurement of the biomarker. The "control level" can be an amount (including the
qualitative presence or absence) or range of amounts of the biomarker found in a comparable biological sample in subjects free of a cancer, or at least free of the cancer of interest being tested.
[0005] The term "biological sample" is used herein refers to a sample derived from a subject. The sample can include body fluids (e.g., peripheral fluids), tissue samples, cells, or a combination thereof. Examples include, blood, serum, plasma, a tissue sample (including, but not limited to, a formalin-fixed tissue sample, a biopsy sample, or a sample obtained at the time of or from a resection), cerebrospinal fluid, urine, sweat, cells recovered from stool, and the like.
[0006] The terms "specific binding" or "specifically binds" as used herein refers to a measure of the capacity of a probe, such as an antibody, to bind a target polynucleotide with specificity.
[0007] In some embodiments, the shed ALCAM can be detected using a staining assay, as describe herein. In some embodiments, the shed ALCAM can be detected using an ELISA, as described herein.
[0008] Further with respect to the methods of the presently disclosed subject matter, a preferred subject is a vertebrate subject. A preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal. A preferred mammal is most preferably a human. As used herein, the term "subject" includes both human and animal subjects. Thus, veterinary therapeutic uses are provided in accordance with the presently disclosed subject matter.
[0009] As such, the presently disclosed subject matter provides for the diagnosis of mammals such as humans, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses. Thus, also provided is the diagnosis and treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), and the like.
[0072] The presently-disclosed subject matter is further illustrated by the following specific but non-limiting examples. The following examples may include compilations of
data that are representative of data gathered at various times during the course of
development and experimentation related to the present invention.
EXAMPLES
[0073] Example 1
[0074] In this Example, procedures were conducted to determine whether ALCAM shedding in human primary colorectal cancers reflects a unique molecular progression of the tumor and consequently acts as a prognostic biomarker. For this purpose a novel dual stain was developed to detect both the extracellular and the intracellular domain of ALCAM within the same tissue. As described below, ALCAM shedding in the primary tumor correlates strongly with a poor clinical outcome, especially in stage II patients in which disease-specific survival was significantly worse when the tumor tissue exhibited high ALCAM shedding.
[0075] Materials and Methods
[0076] Cell lines and mice
[0077] The continuous cell lines for cancer of the breast (MDA-MB-231 and MCF-7), prostate (PC3 and Dul45) and colon (RKO, DLD, LOVO, LS174t, HCT1 16, HCA7, Sckol, Caco2, HT29, KM12c and KM12) were cultured in their appropriate basal media (DMEM or RPMI) with 10% FBS to confluence before lysis with 1% Triton-X 100 in PBS. ALCAM knockout mice (c57bl/6 ALCAM-/-) were purchased from Jackson Laboratories. Mouse tissues were surgically resected, snap frozen and subsequently extracted with 1% Triton-X 100 lysis buffer.
[0078] Western Blot Analysis
[0079] SDS-PAGE under non-reducing conditions and transfer of proteins to a PVDF membrane has been described previously (31). After blocking with 5% skimmed milk in PBS/0.05% Tween-20, blots were probed with primary antibodies for extracellular ALCAM (Clone 105902; R&D Systems) and selected hybridoma clones, followed by peroxidase- conjugated secondary antibody and ECL (Perkin-Elmer) detection.
[0080] Lentivirus-delivered RNA Interference
[0081] Four individual constructs containing shR As for human ALCAM and a negative control (scrambled sequence) were obtained from Sigma-Aldrich (St. Louis, MO) (Mission shRNA). Constructs were packaged for viral production and infection and tested for target knockdown. For viral packaging, constructs were co-transfected into 293T cells using Fugene HD (Roche Applied Science, Indianapolis, IN)). Media containing viruses were collected 48hr after transfection. PC3 cells were infected with the viruses in the presence of Polybrene ^g/ml) for 24hr and then subjected to selection by 5μg/ml puromycin. Two constructs with
>90% knockdown efficiency as determined by immunoblotting and flow cytometry were used for further studies.
[0082] Human material
[0083] Tissue specimens from 250 colorectal cancer patient enrolled at Vanderbilt Medical Center (VMC, Nashville, TN, n = 55) and Moffitt Cancer Center (MCC, Tampa, FL, n = 195) were used for gene-expression microarray analyses. All patients had a diagnosis of colorectal adenocarcinoma. Each cancer specimen was staged according to American Joint Commission on Cancer (AJCC) guidelines (stages I-IV), and 10 normal adjacent specimens were deemed to contain only normal colonic tissue by a certified gastro-intestinal pathologist. VMC 55 includes 14 patients from the University of Alabama-Birmingham Medical Center (Birmingham, AL). Microarray data for the NCI cell lines was obtained through the NCBI Gene Expression Omnibus (GEO data set GDS1761).
[0084] A tissue microarray containing 75 primary colorectal carcinomas and 12 normal age and sex-matched colorectal mucosa was constructed using 2mm cores in triplicate.
Specimens from 69 CRC patients and 12 normal colonic mucosa were suitable to be used in the dual staining analysis. Subsequent expansion of this dataset was accomplished by selection of 36 stage II patients under IRB #120063 providing analysis for a total of 105 CRC and 12 normal mucosa with triplicate representation of each patient. Collection of serum from control (n=6), non-cancer patients (n=48) and colorectal patients immediately before surgery (pre-op, n=71) or after treatment (followup, n=20) at was accomplished at VMC under IRB# 121365.
[0085] ALCAM Dual Immunofluorescence stain
[0086] Immunofluorescent staining for ALCAM in tissues was performed with hybridoma HP AO 10926 (Sigma Prestige Antibodies) directed against the extracellular domain and clone 1G3A1 directed against the intracellular domain. Sections cut from patient tissue and tissue microarrays were deparaffinized in xylene and rehydrated. Sections were blocked in 20% Aqua Block™ after pressure cooker antigen retrieval in citrate buffer (pH 6.0) . Samples were immunostained with mouse monoclonal intracellular ALCAM antibody, 1G3A1, ^g/ml) and rabbit monoclonal extracellular ALCAM antibody, HPA010926 (1 :250 dilution). The arrays were incubated with Alexa-546 Goat anti-rabbit (1 :500) and Alexa-647 Goat anti-mouse secondary antibody (1 :500, LifeTechnologies). The sections were counterstained with 2μg/ml of Hoechst for 2mins, and mounted with Prolong® Gold Anti- fade.
[0087] Image acquisition and quantitative analysis of ALCAM shedding
[0088] Tissue microarrays were imaged using the Ariol® SL-50 platform from Genetix (Sunnyvale, CA). Image analysis and quantitation were performed using the open-source software ImageJ (FIJI). The analysis pipeline was designed as follows: a) The tumor area was selected using the free-hand selection tool, b) The color image was split into its red, green and blue component channels, c) Image thresholding was used to generate the detectable region of intracellular ALCAM staining (red channel) and extracellular ALCAM staining (green channel), d) Intact ALCAM was determined as the area of co-localized intracellular and extracellular ALCAM (red and green channel) while ALCAM shedding was determined as the area of intracellular ALCAM that lacks extracellular ALCAM (red but no green). The sum of these two represents total ALCAM expression.
[0089] Statistical analysis
[0090] Descriptive statistics were applied to show patient's basic characteristics stratified by ALCAM shedding score. Wilcoxon rank sum test and Kruskal-Wallis test were applied to exam the mRNA expression difference between normal tissues and cancer tissues or the ALCAM shedding percentage among normal patients and cancer patients in all different stages. Kaplan-Meier curve was used to estimate the survival probability for each group, with corresponding p-value and hazard ratio calculated from log-rank test. Receiver
Operating Characteristic (ROC) curves were used to identify the optimal specificity and sensitivity for patient stratification. For survival analysis the patient population was dichotomized across a value of ALCAM shedding or intact ALCAM as defined by the ROC curves. For ALCAM shedding this was 0.75 and for intact ALCAM this was 0.15 For shedding the p-values of all statistical tests were two-sided and considered significant when p<0.05 where * denotes p< 0.05, ** denotes p< 0.01 and *** denotes p< 0.001. All statistics were completed using either R, SPSS or GraphPad Prism. Multivariable analysis analysis using logistic regression was performed on stage II patients (n=66; median follow-up, 70 months; median age of diagnosis, 67 years). The variables included were ALC AM shedding, age at time of diagnosis, race and gender with an incidence of 51.5% (34 events) for overall survival and 26.9% ( 18 events) for disease specific survival.
[0091] Results
[0092] Correlation of ALCAM and AD AMI 7 expression with survival of colorectal cancer patients
[0093] In normal colorectal tissue, immunohistochemical staining for the extracellular domain of ALCAM using HPA 10926 reveals the protein at areas of cell-cell contact within the epithelial cells of the colonic crypts and in hemopoietic cell populations of the stroma
(Figure 1 A(i and ii)). In contrast to normal colon, the concomitant staining of colorectal cancer tissue reveals a very heterogeneous staining. Within the same tumor, some regions exhibit elevated ALCAM (Figure lA(iii)) while others exhibit irregular staining (iv) or lack ALCAM staining all-together (v). Similar heterogeneity of ALCAM staining is observed in a publicly available tissue microarray (proteinatlas.org). ALCAM protein expression is detectable in 12/14 CRC cell lines (Figure IB and 2). Expression of the ALCAM mRNA in CRC cell lines among the NCI60 (Col) is intermediate between the low expressing leukemia (Leu) cell lines and the high expressing breast cancer (Br) cell lines (Figure IB).
[0094] To evaluate ALCAM mRNA expression in colorectal cancer, a single cohort consisting of 250 patients obtained through a multi-institutional collection(VUMC, UAMC and Moffitt Cancer Center) was analyzed. ALCAM mRNA is elevated in cancer patients (Fig. 1C, pO.001) and univariate analysis revealed that high ALCAM expression was in fact associated with significantly decreased survival (Figure 1C, p<0.0001). Similarly, expression of ADAM 17 (the sheddase of ALCAM) was also significantly elevated in colorectal cancer (Figure ID, p<0.0001)). The elevated expression in CRC together with its established ability to cleave ALCAM suggests that AD AMI 7 is available to cleave ALCAM and increase its shedding within the tumor microenvironment. The soluble extracellular domain can be detected in the serum of some cancer patients. However, ALCAM-specific ELISA of serum from CRC patients did not reveal a correlation between disease progression and increase in circulating ALCAM when comparing serum obtained from cancer free patients and serum obtained from CRC patients prior to, and after therapy (Figure IE). Detailed comparison of cancer free patients and normal healthy individuals versus increasing stages of CRC patients revealed no significant correlation with circulating levels of ALCAM (Figure IF).
[0095] The histological detection of membranous ALCAM had been found to correspond negatively with patient survival. Using an antibody to the extracellular domain of ALCAM, a histological evaluation of a 69-patient cohort was performed (Figure 3). While the presence or absence of membrane staining did not correspond with overall or disease specific survival, the loss of detectable cytoplasmic ALCAM corresponded with very poor prognosis.
However, only 8/69 patients (12%) were negative for cytoplasmic ALCAM while 39/69 (56%) lacked membranous ALCAM. This loss of ALCAM from the membrane (with concomitant retention of cytoplasmic staining) is likely to be due to shedding of the ectodomain from the cell surface.
[0096] Production and validation of an antibody specific for the cytoplasmic domain of ALCAM
. 4 Τ ^ 4 Λ ί 1 , , . , c , ,
[uuy /J since ALCAM shedding occurs on the surface of the tumor ceils, it is possible that shedding might be detectable within the tumor tissue itself. In order to achieve this, an ALCAM dual-stain based on independent detection of the intracellular and extracellular domains with domain-specific antibodies was developed (Figure 4A). Using these antibodies in histological staining of normal and tumor tissue sections should enable the detection of ALCAM shedding in situ (Table 1). To accomplish this, a unique antibody directed to the cytoplasmic tail of ALCAM was generated using a 14 AA sequence from the cytoplasmic tail (Figure 5) conjugated to KHL to immunize four A/J mice. Spleens from two seropositive mice were fused and 125 viable hybridomas selected from >8000 antigen-reactive clones were evaluated by comparing reactivity to native ALCAM and KLH using direct ELISA (Figure 6A). ALCAM-specific hybridomas were validated by immunoblotting using whole cell lysate to confirm binding to intact ALCAM protein (Figure 6A). Antibody specificity for ALCAM was verified by comparing reactivity with lysates from control and ALCAM knockdown cells (Figure 6B) and mouse tissue from wild type and ALCAM-/- mice (Figure 4B). Antigen specificity was confirmed by competitive blocking using the immunizing peptide during immunoblotting (0.1 or ^g/ml, Figure 6C) and histological staining (^g/ml, Figure 4C). As expected, peptide competition with the immunizing peptide resulted in a loss of Intracellular ALCAM. The stable hybridoma 1G3A1 was selected as the most promising antibody based on its reactivity in ELISA, immunoblot, immunofluorescence and standard immunohistochemistry. Specificity of 1G3A1 for the cytoplasmic tail of ALCAM was defined by its ability to detect intact ALCAM in cell lysates but not shed ALCAM in conditioned medium (Figure 6D). In contrast, the commercial antibody against the extracellular domain of ALCAM (R&D) detects intact as well as shed ALCAM which lacks the cytoplasmic domain.
Table 1. Depiction of ALCAM immunoreactivity for HPA 10926 which
reacts with the extracellular domain and 1G3A1 which is specific for the
[0098] Dual-staining for the intracellular and extracellular domains of ALCAM in normal and tumor tissue
[0099] Using the antibody 1G3A1 to specifically detect the cytoplasmic domain of ALCAM together with the commercial antibody HP AO 10926 specific for the extracellular domain, we developed a dual-staining procedure for ALCAM in human tissues (Figures 7 and 8). Three-color staining (Nuclei: blue, Extracellular Domain: green, Intracellular Domain: red) was performed on tissues along the digestive tract including stomach (Figure 7A) and colon (Figure 7B). In normal tissues, detection of the extracellular and cytoplasmic domains of ALCAM coincided, thereby suggesting that ALCAM is expressed and present in its intact form (Figure 7C, arrow). However, within tumor tissues the intracellular domain (Red) is often seen in the absence of the extracellular domain (Green) indicating that the extracellular domain of ALCAM was shed (Figure 7C, arrow head). In gastric cancer, entire glandular structures appear to lack staining for the extracellular domain while others are fully positive (Figure 7Ci). This all-or-none staining for the extracellular domain suggests that ALCAM-shedding is activated at a macroscopic level within the tissue architecture of the stomach. In colorectal carcinoma tissue ALCAM staining is more heterogeneous with small populations of cells within the same histological structure exhibiting different levels of staining for the ALCAM extracellular domain (Figure 7Cii). The irregular staining in CRC suggests that ALCAM shedding is occurring throughout the tumor but regulated at a cellular level.
[00100] Quantitative analysis of ALCAM shedding
[00101] To visualize ALCAM shedding, HPA010926 (Sigma) was used to detect the extracellular domain and 1G3A1 (Figure 6) to detect the intracellular domain. Shedding of ALCAM was defined for the selected tumor area as the presence of the intracellular domain of ALCAM and the absence of the extracellular domain of ALCAM (Figure 8).
Immunofluorescent staining for each domain was completed simultaneously on sections from paraffin-embedded colorectal cancer tissue which were digitally scanned and quantitatively assessed using ImageJ (Figure 9). Shedding was defined as the loss of the extracellular domain and retention of the cytoplasmic domain. Shedding data is presented graphically in Figures 8A and 8B. Quantitatively ALCAM shedding is the fraction of detectable ALCAM from which the extracellular domain is absent ([Total ALCAM-Intact ALCAM]/Total ALCAM). In normal colonic mucosa, detection of the extracellular and intracellular domains overlap extensively, demonstrating the predominant presence of intact ALCAM (yellow) and little ALCAM shedding (teal) (Figure 8A, last panel). Conversely, in tumor sections the
absent, indicating that ALCAM is shed (Figure 8A, last panel).
[00102] ALCAM shedding corresponds with reduced patient survival
[00103] Since ALCAM shedding is clearly elevated in tumors, without being bound by theory or mechanism, ALCAM shedding can be an accurate prognostic marker for colorectal cancer. To evaluate this, histological detection of ALCAM shedding was performed on specimens from 105 CRC patients and 12 healthy controls (see Table 2 for patient demographics). For each specimen, ALCAM shedding was quantified as described for Figure 8. For each patient, the mean value across three specimens was used to evaluate the correlation between ALCAM shedding and patient survival. ALCAM shedding is clearly elevated in tissue from CRC (Figure 10A). Shedding is already increased in some stage I CRC patients and is significantly increased for stage II, III and TV patients. Indeed ANOVA analysis confirms significant elevation across the increasing stages (mean fraction shed = 0.64, 0.73, and 0.89, for stage II, III, and TV,
Figure 10B). Moreover, ALCAM shedding was elevated in patients that died during the course of their disease. The presence of elevated ALCAM shedding in stage II patients may suggest that patients with elevated ALCAM shedding have a worse outcome.
Table 2. Comparison of High and Low ALCAM shedding colon cancer with
respect to Age, Sex, and Staging.
[00104] To evaluate the correlation between ALCAM shedding and patient outcome, survival analysis was performed by segregating CRC patients based on ALCAM expression
(Figure 10D) using a shed fraction of 0.75 to delineate "High" vs "Low" ALCAM shedding. When analyzing the full population of CRC patients, high ALCAM shedding correlated positively with worse overall survival (p=0.035, Figure 10D). To determine if ALCAM shedding can be prognostic for early stage disease, a univariate survival analysis was performed specifically to stage II patients. While ALCAM shedding does not correlate with overall survival in stage II patients (Figure 10E), it correlates strongly with disease-related death showing significant survival benefit in the Stage II patients with low ALCAM shedding (Figure 10F, p=0.01 HR=3.0).
[00105] Multivariable analysis was restricted to stage II patients since they were the emphasis of the investigation and the cohort biased to this population. Multivariable analysis with logistic regression of stage II patients found that ALCAM shedding and age at time of diagnosis were both independent predictors of overall survival after adjusting for gender and race (ALCAM shedding; adjusted odds ratio (OR), 9.972; 95% confidence interval (CI) 1.17- 84.9 ; p=0.035. Age; OR, 1.079; 95% CI, 1.027-1.133; p=0.003). An analysis of disease- specific survival found that only ALCAM shedding was an independent predictor of survival after adjusting for age at time of diagnosis, race and gender (ALCAM shedding OR, 29.02; 95% CI, 2.165-389.08; p=0.011). Bootstrapping was performed as an internal validation to confirm these results and found that ALCAM shedding continued to be an independent predictor of survival in stage II patients (overall survival p=0.002; disease-specific survival p=0.023).
[00106] Discussion
[00107] It appears that ALCAM shedding, rather than its expression, indicates disease progression. The dual stain reveals both intra- and extracellular epitopes of ALCAM and clarifies its prognostic value in CRC. ALCAM shedding in tissues was defined as the detection of the intracellular epitope in the absence of the extracellular domain. Using this novel assay, a correlation between elevated ALCAM shedding and poor patient outcome was demonstrated. Importantly, ALCAM shedding correlates with poor outcome in early stage disease (Stage II, Figure 10). Thus, ALCAM is not merely a biomarker for disease progression but can also allow for outcome stratification among patients with early stage disease.
[00108] ALCAM shedding within the tumor tissue appears to correspond with disease progression. The detection of ALCAM shedding within the tumor tissue itself can increase the specificity of ALCAM as a prognostic factor. In this Example a method was devised to stratify at-risk patients using ALCAM shedding as an indicator of disease progression and
poor patient outcome, and not as a diagnostic tool. Indeed, the correlation between ALCAM shedding and poor patient outcome in early stage disease suggests that molecular progression can occur in a cancer that appears histologically more benign.
[00109] A disparity becomes apparent when clinical outcome (survival) are correlated with ALCAM gene transcription (mRNA), protein expression (based on detection of intact ALCAM) and ALCAM shedding. Elevated ALCAM transcription is associated with poor outcome yet elevated levels of intact ALCAM protein (through detection of co-localized extracellular domain and intracellular domain) is associated with improved outcome (Figure 11A vs. 11B). This disparity could be rectified if it is considered that the extracellular domain of ALCAM is shed leaving the mistaken impression that ALCAM protein is lost during tumor progression. The analysis of ALCAM shedding (Figure 11C) demonstrates that ALCAM shedding rather than loss of expression corresponds with patient outcome.
[00110] The results suggest that detection of molecular behavior correlates more specifically with the disease than gene expression itself. Given that the disruption of ALCAM-ALCAM interactions promotes tumor cell motility and metastasis, ALCAM shedding may predict malignant progression at a molecular level. The clinical correlation between ALCAM shedding and patient outcome (Figure 10) suggests that detection of disease progression at a molecular level can predict long-term patient outcome. The presence of this correlation in early stage disease (stage II, Figure 10) emphasizes that this molecular progression is present prior to pathological and clinical progression. Detection of this molecular progression allows for stratification of patients according to their risk for poor long-term outcome.
[00111] Example 2
[00112] The current Example evaluates shed ALCAM as a prognostic biomarker in bladder cancer. In the bladder, ALCAM expression is restricted to the umbrella cells and several layers of the urothelium. Using retrospective cohort studies, the ability of ALCAM gene expression (mRNA), tissue expression (protein), and shedding (blood and urine) to predict overall survival in BCa were compared (Figure 12). Since tumor cell motility is a central driver in tumor progression and metastasis, such molecular indicators that report on cell migration should act as surrogate markers of progression prior to overt clinical manifestation. This Example describes how Activated Leukocyte Cell Adhesion Molecule (ALCAM) promotes adhesion, while shedding of its extracellular domain is associated with migration.
[00113] Materials and Methods
[00114] Specimen Collection
[00115] All fluids were stored at -80°C. Tissues were processed as standard diagnostic blocks and stored in the Vanderbilt University Medical Center (VUMC, Nashville, TN) tissue library.
[00116] ALCAM mRNA Cohort
[00117] NCBI Gene Expression Omnibus (GEO, GSE31684) was used to analyze ALCAM mRNA expression (probes 201951_at and 201952_at) in BCa and included 93 patients, representing stages pTa to pT4, who underwent radical cystectomy at Memorial Sloan-Kettering Cancer Center (New York, NY) between 1993 and 2004. Median age of patients was 69.1 years, 73% were male, median follow-up was 32 months, and incidence of death was 70%.
[00118] ALCAM Expression Bladder Cancer TMA Cohort
[00119] Analysis of intra-tumoral ALCAM protein expression was performed on a retrospective cohort of patients with high-grade bladder cancer undergoing radical cystectomy at VUMC from 2000-2010. Tissue microarrays were constructed with matched adjacent normal, superficial (pTa and pTis/Cis) and invasive cores, when available. IHC and IF for ALCAM was performed on 651 total cores and analysis of overall survival was performed for those patients with a designated "invasive" core (n=198). Correlation of ALCAM expression with core pathology stage was performed on all unique cores (n=481) as described in statistical methods.
[00120] Shed ALCAM Bladder Cancer Cohort
[00121] The analysis of shed ALCAM in serum and urine was performed on a retrospective cohort of patients with high-grade bladder cancer undergoing radical cystectomy, which included pathological stages from pTO to pT4 and excluded patients who had received chemotherapy prior to surgical resection (n=120).
[00122] Urine Control Cohorts
[00123] Age -matched, control clean-catch or catheter-derived urine specimens were collected at VUMC by the Cooperative Human Tissue Network. Three groups were collected: 1) Non-cancer control urines (Normal Controls) were collected from patients with no history or current diagnosis of cancer undergoing non-urologic surgeries including cardiac bypass, gastric bypass, thyroidectomy, esophagomyotomy, knee replacement, and hernia repair, 2) Inflammation control urines (Inflammation) were collected from patients with rectovaginal fistula, colorectal enteritis and ulceration, gallbladder polyploid cholesterolosis, endometriosis, atherosclerosis, ulcerative colitis, uterine fibroids, urethral stricture, and
staghorn calculus, 3) Urine was collected from patients with cancers other than BCa (General Cancer), consisting of prostate, pancreatic, neuroendocrine, renal, and colorectal cancers.
[00124] Non-Cancer Serum Control Cohort
[00125] Serum from age -matched, non-cancer patients was collected from discarded clinical tests in the Vanderbilt Clinical Chemistry laboratory.
[00126] ALCAM Enzyme-Linked Immunosorbent Assay (ELISA)
[00127] Serum and urine were analyzed by human-specific ALCAM ELISA according to the manufacturer's protocol (R&D Systems, Minneapolis, MN). All samples were analyzed in duplicate at dilutions (Urine: 4-8 fold; Serum: 50-80 fold) that matched the dynamic range of the assay (0.05-4.00 ng/ml).
[00128] Immunohistochemistry (IHC) and Immunofluorescence (IF)
[00129] Immunohistochemistry (IHC) and immunofluorescence (IF) was performed on formalin-fixed paraffin-embedded cores (5 μιη) on tissue microarrays. Sections were deparaffinized, hydrated, and peroxidase blocked (IHC only). Antigen retrieval was performed with citrate buffer (pH 6.0) for 15 minutes in a pressure cooker and sections were then blocked for 1 hour in 20% Aquablock (East Coast Biologies; North Berwick, ME) plus 0.05% Tween-20. IHC was performed with mouse anti-ALCAM (MOG/07; Novocastra™ Leica Biosystems, Buffalo Grove, IL) followed by goat anti-mouse HRP (Jackson
ImmunoResearch Laboratories Inc., West Grove, PA), counterstained with Hematoxylin, and mounted in Cytoseal™ XYL (Thermo Scientific, Richard-Allan Scientific, Waltham, MA). ALCAM IHC intensity was scored by a trained pathologist on a scale from 0-3 based on the signal observed in greater than 10% of tumor cells. IF was performed with mouse anti- ALCAM (MOG/07), rabbit anti-Ki67 (Clone SP6; Thermo Scientific, Rockford, IL), collagen binding CNA35, and Hoechst 33342. IF slides were mounted in ProLong Gold Antifade (Invitrogen, Carlsbad, CA). Fluorescence intensity, thresholded area, and colocalization were quantified in each TMA core by an Image J-based batch macro specifically written by our laboratory to quickly and efficiently set an intensity threshold for positive signal, identify the tissue area, define the region of interest, determine the percent thresholded area for each target within the region of interest, and determine percent colocalization of selected targets. Collagen staining was used to distinguish between the epithelial, stromal and muscular compartments in order to define the region of interest. Hoechst was used to define the nuclear compartment and to colocalize with Ki67. Percent thresholded area of ALCAM and percent nuclear area of Ki67 were subsequently used for analysis.
[00130] Statistical Analysis
[00131] Statistical analyses were performed at a two-tailed significance of 0.05.
Kruskal-Wallis and Jonckheere-Terpstra test for trend analyses were used to assess the differences and overall trend between multiple independent groups followed by Mann- Whitney U post-tests if any significant differences were detected by Kruskal-Wallis.
Generalized estimating equations (GEE) ordinal logistic regression and Kendall's rank correlation were used to assess correlations of non-independent samples. Kaplan-Meier curves and log-rank tests were utilized for univariable overall survival analysis. For multivariable analysis of censored survival, Cox proportional hazards regression was performed with all variables treated as continuous covariates. Time-dependent receiver operating characteristics (ROC) curves were used to assess the prognostic value of the Cox regression models. The area under the time-dependent ROC curves, as well as the concordance index was used to express the prognostic accuracy of the Cox regression models. In addition, the false positive rate and accuracy were determined at a fixed true positive rate of 75% at 12, 24, and 36 months of follow-up. Statistical analyses and graphing were performed with SPSS (IBM, Armonk, NY), GraphPad Prism (GraphPad Software, Inc., La Jolla, CA) and R V2.14.1 for Windows (http://www.R-proiect.org). Bootstrap validation was performed via SPSS with a two-tailed significance, 1000 iterations and a Mersenne twister of 2,000,000. In addition, the concordance indices from the multivariable Cox regression models were validated in R with bootstrap method .632+.
[00132] Results
[00133] ALCAM gene expression does not correlate with progression and/or patient outcome in BCa.
[00134] ALCAM mRNA does not correlate with disease progression in BCa. Gene expression analyses performed on the Oncomine™ resource website
(http://www.oncomine.org) of two independent bladder cancer cohorts comparing normal urothelium with superficial and invasive bladder cancer demonstrate that ALCAM expression is not significantly altered during BCa progression (Sanchez-Carbayo, n=157 and Lee, GSE13507, n=256).
[00135] To further determine if ALCAM mRNA expression correlated with outcome in BCa, a detailed statistical analysis of a publicly available microarray dataset was performed (GSE31684). ALCAM mRNA expression did not correlate with tumor stage (Figure 13 A; Kruskal-Wallis (K-W), P=0.722; Jonckheere-Terpstra test for trend (J-T), P=0.610), nor did it significantly stratify patient outcome of overall survival (Figure 13B; Log-rank, p=0.3252; Hazards Ratio (HR), 1.25; 95% Confidence Interval (CI), 0.75-2.07).
Furthermore, multivariable Cox regression analysis reveals that ALCAM gene expression is not an independent predictor of 3 -year overall survival after adjusting for available indicators including age, gender and tumor stage (Table 3; adjusted HR, 1.26; 95% CI, 0.943-1.682; p=0.1 18). Since ALCAM mRNA levels remain unaltered during tumor progression in three independent patient cohorts and fail to predict overall survival by univariable and multivariable analyses, it appears that ALCAM gene expression is not a viable biomarker for BCa prognosis.
Table 3. Assessment of ALCAM mRNA expression as a predictor in a
multivariable Cox regression analysis of 3 -year overall survival in bladder cancer.
[00136] Assessment of ALCAM mRNA expression as a predictor of 3 -year overall survival by multivariable Cox regression analysis of the NCBI Gene Expression Omnibus (GEO) [GSE31684] dataset. Hazard Ratio is the adjusted hazards ratio, CI = confidence interval, bootstrap significance is two-tailed with 1000 iterations and a Mersenne twister of 2,000,000.
[00137] ALCAM protein expression inversely correlates with BCa progression but fails to predict outcome
[00138] Post-translational proteolytic processing of ALCAM can create a disparity between gene expression and the availability of ALCAM protein. Indeed, ALCAM levels can fail to correlate with gene transcription. To determine if protein expression of ALCAM in BCa correlates with tumor stage and/or patient outcome, immunohistochemistry (IHC) on tissue microarrays (TMAs) constructed of high-grade BCa specimens collected during cystectomy were performed (Table 4). ALCAM IHC intensity was scored (0-3).
Table 4. Bladder cancer TMA ALCAM expression cohort descriptors and frequencies.
Description of the bladder cancer TMA patient cohort (patients=198, cores=481) used for prognostic assessment of ALCAM expression by immunohistochemistry and
immunofluorescence. Only patients with invasive cores (n=198) were utilized for overall survival analysis while all unique cores (n=481) were used in the correlation of ALCAM expression with core stage.
[00139] In normal bladder, ALCAM expression was confined to the urothelium
(Figure 3A, IHC). In non-invasive carcinoma in situ, the expansion of the urothelium led to an increase in ALCAM positive cells with no increase in signal intensity (Figure 14A, IHC). However, concomitant with the appearance of an invasive phenotype, ALCAM expression diminished in the progression from pTl to pT4 (Figure 14A, IHC). Since each patient had multiple cores representing several pathological stages and, thus, had non-independent samples, the correlation of the mean ALCAM intensity score with pathological core stage
was analyzed with generalized estimating equations (GEE) ordinal logistic regression and
Kendall's rank correlation (K) (n=481). Based on these analyses, the mean ALCAM intensity score was significantly and inversely correlated with core stage, demonstrating a loss of
ALCAM detection with advanced stage (Figure 14B; K, τ=-0.20; pO.0001; GEE Odds Ratio
(OR), 1.32; 95% CI, 1.17-1.50; pO.0001). Overall survival analysis was subsequently performed using only invasive core values to ensure samples were independent (n=198).
Kaplan-Meier curves show separation when the mean ALCAM intensity score was dichotomized around 2, but a significant difference was not detected (Figure 14C; Log-Rank, p=0.1386; HR, 0.74; 95% CI, 0.50-1.10). Furthermore, mean ALCAM intensity score was not a significant predictor of overall survival when adjusted for age, gender, tumor stage and lymph node status by multivariable cox regression analysis (Table 5; adjusted HR, 0.937;
95% CI, 0.780-1.125; p=0.483).
Table 5. Assessment of immunohistochemistry ALCAM expression as
predictor in multivariable Cox regression analysis of 3 -year overall survival in MA bladder cancer cohort.
Assessment of ALCAM expression, measured by IHC intensity scoring (0-3), as a predictor of 3-year overall survival by multivariable Cox regression analysis. Hazard Ratio is the adjusted hazards ratio, CI = confidence interval, bootstrap significance is two-tailed with 1000 iterations and a Mersenne twister of 2,000,000.
[00140] To verify that the inability of ALCAM expression to predict overall survival in BCa is not due to the narrow nature of an ordinal scoring method, immunofluorescence (IF) for ALCAM was used to generate a continuous measurement of ALCAM protein expression (Figure 14, FL). The degree of ALCAM staining was quantified as described in the methods. Collagen staining was used to visualize the tissue architecture. The final readout for ALCAM was a continuous variable defined as the area within the region of interest that was above background (% thresholded area; range 0-72.8%). Similar to the IHC results, IF staining of ALCAM was significantly and inversely correlated with core stage (Figure 14D; K, τ=-0.16; p=0.0038; GEE OR, 1.04; 95% CI, 1.03-1.05; pO.0001) but failed to correlate with overall survival when percent thresholded area was dichotomized around the mean of 6.66% (Figure
14E; Log-Rank, p=0.4125; HR, 1.18; 95% CI, 0.79-1.76). Most importantly, ALCAM IF was not a significant predictor of overall survival when adjusted for age, gender, tumor stage and lymph node status by multivariable Cox regression analysis (Table 6; top model; adjusted HR, 1.001 ; 95% CI, 0.987-1.016; p=0.843). These observations demonstrate that, in spite of a strong correlation between ALCAM protein detection and tumor stage, ALCAM expression fails to correlate with or predict patient outcome.
Table 6. Assessment of immunofluorescence ALCAM and Ki67 expression as predictor in multivariable Cox regression analysis of 3-year overall survival in TMA bladder cancer cohort.
Assessment of ALCAM expression, measured by IF percent thresholded area, and Ki67 percent nuclear area as predictors of 3-year overall survival by multivariable Cox regression analysis. Hazard Ratio is the adjusted hazards ratio, CI = confidence interval, bootstrap significance is two-tailed with 1000 iterations and a Mersenne twister of 2,000,000.
[00141] To confirm that the BCa TMA cohort was generalizable and that the model behaved according to published observations, Ki67 was assessed as a marker of cell proliferation and a known indicator of outcome in BCa. Ki67 was quantified by measuring the amount of nuclear area that was colocalized with Ki67 within the ROI (% nuclear area). Consistent with the importance of proliferation in tumor progression, Ki67 staining was elevated in tumor compared to adjacent normal tissue (Figure 14F). Furthermore, Ki67 was a significant independent predictor of overall survival when adjusted for age, gender, tumor stage and lymph node status (Table 6; bottom model; adjusted HR, 1.20; 95% CI, 1.077- 1.341 ; p=0.001) despite the fact that by univariable analysis it was unable to discern patient outcome when dichotomized above and below the mean (Figure 14G; Log-Rank, p=0.3573;
HR, 1.18; 95% CI, 0.83-1.69). This Ki67 data demonstrates that the current BCa TMA cohort is representative of the general population and that the analysis was consistent with accepted clinical practice and published studies, which validates that ALCAM protein expression does not appear to independently predict overall survival in BCa.
[00142] ALCAM shedding into urine is significantly and specifically elevated in BCa patients
[00143] Since ALCAM protein is reduced without a concomitant reduction in gene expression (Figure 13A vs. Figures 14C and 14D), without being bound by theory or mechanism, the loss of ALCAM in BCa tissue may be due to proteolytic shedding of the ectodomain, which can be cleaved by ADAM 17. Consequently, shed ALCAM should be detectable in tumor-adjacent fluids such as serum and urine (Figure 15A).
[00144] Serum and urine ALCAM levels were analyzed from patients in four distinct cohorts including: 1) patients undergoing surgery but with no cancer (Normal Controls), 2) patients with inflammatory diseases (Inflammation), 3) patients with non-bladder malignancies (General Cancer) and 4) patients with BCa (Bladder Cancer). Analysis of serum ALCAM revealed that it was significantly elevated (1.3 -fold) in patients with BCa compared to Normal Controls (Figure 15B; median 74.88 vs. 57.75 ng/ml; PO.0001). Moreover, the detection of ALCAM in urine was dramatically elevated (17.0-fold) in BCa patients compared to normal controls (Figure 15C; median 2.18 vs. 0.13 ng/ml; P<0.0001). Urinary ALCAM levels were also measured for patients with inflammatory diseases or other cancers to confirm that the significant elevation of urine ALCAM was specific to the presence of BCa. These non-BCa urines were found to be slightly elevated when compared to normal controls (median 0.73 and 0.86 vs. 0.13 ng/ml; P=0.0183 and PO.0001) but contained significantly less ALCAM than urine from BCa patients (P<0.0001)(Figure 15C).
[00145] Quality control assays were performed to ensure that a clinical test of ALCAM would be sufficiently robust and reproducible. Specifically, the stability of ALCAM in serum and urine specimens was assessed by measuring ALCAM levels by ELISA before and after two freeze -thaw cycles. Samples were thawed at 4-degrees Celsius for three days, re-froze, and then re -thawed on ice just prior to use. Pre- and post-freeze -thaw ALCAM levels were assessed by calculating fold-change. The influence of catheterization on urine ALCAM levels was assessed by analyzing urine ALCAM in patient-matched clean catch and foley specimens collected just prior to and during surgery, respectively. A paired t-test was performed to detect any differences in the matched samples. Reproducibility of the detection of urine ALCAM was assessed by repeating the ELISA on two separate aliquots over two runs
separated by more than six months. A Spearman correlation was performed to determine the similarity between each run. Urinary ALCAM measurements were not significantly influenced by repeated freeze-thaw, collection method (foley-derived vs. clean catch urine), or repeated sampling (Spearman coefficient, 0.86; P<0.0001). In addition, correction for dehydration, proteinuria, and hematuria in the urine by normalizing urinary ALCAM to specific gravity, creatinine, and hemoglobin did not significantly altered the ranking of patients within the cohort in regard to urinary ALCAM levels (Spearman correlation coefficients: hemoglobin, 0.9962; specific gravity, 0.9996; creatinine, 0.7939; all PO.0001). Consequently, the raw urine ALCAM levels were utilized in all subsequent analyses.
[00146] In this regard, Urine ALCAM levels were normalized to urinary total protein (Thermo Scientific, BCA, 23227), creatinine (Enzo Life Sciences, 937-001), specific gravity (Siemens Medical Solutions Diagnostics, Multistix® 8 SG, 2164) and hemoglobin (Sigma- Aldrich, Drabkin's Reagent, D5941) in an attempt to control for dehydration, proteinuria, and hematuria. BCA analysis for total protein in urine was unreliable due to the presence of urea. Spearman correlations were performed to compare un-corrected, raw urine ALCAM levels with hemoglobin, specific gravity, and creatinine-corrected urine ALCAM levels.
[00147] Urinary ALCAM is an independent predictor of overall survival in BCa
[00148] Since both serum and urine ALCAM were elevated in BCa, the next step was to determine if shed ALCAM correlated with tumor stage, and whether shed ALCAM could improve the prediction of patient outcome (overall survival) when combined with known clinical indicators and, thus, could serve as a novel and clinically meaningful prognostic biomarker.
[00149] A retrospective analysis of shed ALCAM in serum and urine was performed to determine if shed ALCAM correlated with disease progression and could function as an independent predictor of survival. Pre-operation serum and urine from patients with high grade BCa were analyzed by ALCAM ELISA (Table 7, n=120). Serum ALCAM levels did not correlate with pathological tumor stage (Figure 15D; Kruskal-Wallis (K-W), P=0.595; Jonckheere-Terpstra test for trend (J-T), P=0.943). Urine ALCAM levels were not significantly different between tumor stages but did show a significant positive trend (Figure 15E; K-W P=0.058; J-T, P=0.018), suggesting that ALCAM levels in the urine increase as tumors become more invasive. Next, overall survival was plotted for tumor stage, urine ALCAM and serum ALCAM (Figure 15F-H). As expected, advanced tumor stage (≥pT3, high stage) significantly correlated with decreased survival (Figure 15F; median overall survival (OS), 94 vs. 15 months; Log-Rank, pO.0001; HR, 3.46; 95% CI, 2.12-5.64).
Urinary ALCAM dichotomized around the median of 2.18 ng/ml also significantly stratified patients into high and low risk of death (Figure 15G; median OS, 62 vs. 23 months; Log- Rank, 0.0484; HR, 1.64; 95% CI, 1.003-2.69). However, serum ALCAM dichotomized around the median of 74.88 ng/ml did not correlate with overall survival (Figure 15H; Log- Rank, 0.9288; HR, 1.02; 95% CI, 0.63-1.65).
Table 7. Bladder cancer "shed" ALCAM cohort descriptors and frequencies.
Description of the bladder cancer patient cohort (n=120) used for prognostic assessment of shed ALCAM in serum and urine. A 3 specimens missing for analysis, B 9 specimens missing for analysis, CI = confidence interval, NMIBC = non-muscle invasive BCa, OCMIBC = organ-confined muscle invasive BCa, EVMIBC = extravesical muscle invasive BCa, LN+ = lymph-node positive muscle invasive BCa.
[00150] To determine if serum and/or urine ALCAM were independent predictors of overall survival, a multivariable Cox regression analyses was performed. This cohort, by nature, is 95.8% white and 90.0% male, leading to exclusion of race and gender from all multivariable analyses. After adjusting for age, tumor stage, and lymph node status, urine ALCAM, but not serum ALCAM, was a significant independent predictor of 3 -year overall survival (Table 8; adjusted HR, 1.10; 95% CI 1.043-1.164, P=0.001). Age and tumor stage were also independent predictors of 3 -year overall survival while lymph node status approached significance (Table 8; PO.0001, P=0.001, P=0.064). The ability of serum and urine ALCAM to improve the prediction of 3 -year overall survival when compared to age, tumor stage and lymph node status alone was assessed with a time-dependent receiver operating characteristics curve based on multivariable Cox regression analysis. Prediction measurements were substantially improved by including both serum and urine ALCAM in the model where the concordance index (C-Index) increased 4.4% from 74.2% with age, tumor stage and lymph node status alone to 78.6% with the inclusion of serum and urine ALCAM (Figure 151 and Table 9). The addition of serum and urine ALCAM led to improvements in standard prediction measures such as area under the curve (AUC), true positive rate (TPR), false positive rate (FPR), and accuracy at 1-year intervals (Table 9). Of note, at 12 months of follow-up, when the TPR is set at 75.0%, the FPR is reduced by 10.2% and the accuracy is increased by 5.7% (Table 9).
Table 8. Assessment of "shed" ALCAM as a predictor in a multivariable Cox gression analysis of 3 -year overall survival in bladder cancer.
Assessment of shed ALCAM, serum and urine, as a predictor of 3 -year overall survival by multivariable Cox regression analysis. Hazard Ratio is the adjusted hazards ratio, CI = confidence interval, bootstrap significance is two-tailed with 1000 iterations and a Mersenne twister of 2,000,000.
Table 9. Overall survival (3 -year) multivariable model prediction
performance with the addition of "shed" ALCAM.
AUC 78.2 79.9 1.7
95.0% CI 71.4-86.6 71.7-87.8
TPR (%) 74.8 75.2 0.4
FPR (%) 35.5 25.3 -10.2
Accuracy (%) 69.3 75 5.7
24 (Months)
AUC 76.6 81.1 4.5
95.0% CI 72.8-87.4 75.6-89.3
TPR (%) 75.3 75.8 0.5
FPR (%) 36.2 28.6 -7.6
Accuracy (%) 69.2 73.4 4.2
36 (Months)
AUC 80.1 82.1 2.0
95.0% CI 76.4-90.1 77.0-91.0
TPR (%) 75.4 74.8 -0.6
FPR (%) 28.9 26.5 -2.4
Accuracy (%) 73.1 74.1 1.0
Prediction parameters for biomarker assessment of 3 -year overall survival analysis based on multivariable cox regression; Bootstrap validation was performed according to the .632+ method [27]. C-Index = concordance index, AUC = area under the curve of a receiver operating characteristics curve; TPR = true positive rate; FPR = false positive rate
[00151] ALCAM can dynamically regulate cell motility through homotypic
intracellular adhesions, which can be disrupted by the protease ADAM 17. Therefore, the shed ectodomain of ALCAM is a molecular marker of cell motility. The ectodomain of
ALCAM appears to be lost from the BCa tissue during malignant progression (Figure 14), while urinary ALCAM levels rise and correlate with poor outcome (Figure 15). Further statistical interrogation demonstrates that urinary ALCAM is a significant independent predictor of overall survival after adjusting for age, tumor stage and lymph node status
(Table 8) and improves accuracy of prediction by 4.4% (Figure 15).
[00152] Example 3
[00153] This Example describes biochemical and genetic procedures conducted to identify a new partner of CD 15 lfree, Activated Leukocyte Cell Adhesion Molecule
(ALCAM). Functional studies demonstrated that CD151 and ALCAM control cell migration via PKCa-dependent activation of the small GTPase RaplA. This mechanism was confirmed with both biochemical and genetic evaluation while the ability of Rap 1 activation to control tumor cell motility was subsequently validated in vivo. It appears that integrin-free CD 151 can bind ALCAM and control tumor cell motility via PKCa-dependent activation of the small GTPase RaplA.
[00154] Materials and Methods
[00155] Cell Culture, Plasmids, Transfections, Inhibitors, and Antibodies
[00156] HEp3 cells were perpetually maintained on the chick chorioallantoic membrane (CAM) to retain metastatic and migratory potential. Cell lines were maintained in media supplemented with pen/strep, sodium pyruvate, non-essential amino acids and 10% fetal bovine serum and cultured at 37°C in a 5% C02 incubator. Plasmids used included untagged wildtype CD151 (Clontech Laboratories, Mountain View, CA). CD151-GFP (Osaka University, Osaka, Japan), ALCAM-GFP (University of Iowa, Des Moines, IA), and HA-Rapl (Universitair Medisch Centrum Utrecht, The Netherlands) were obtained.
Transfections of all cells were performed using Extreme Gene HD (Roche), excluding Cho cells which were transfected using polyethylenimine (PEI). Signaling pathways inhibitors included small molecule inhibitors of Rho kinase (Y 297632,), PBkinase (LY294002), PI4kinase, (Wortmanin), MEK (U0126), PKA (KT5720), PKC (Calphostin) and Rap (GGTI- 298) obtained from Calbiochem (EMD Millipore, Billerica, MA). Knockdown of gene expression was achieved with siRNAs to PKCa, and Rapl A and B and the control non- targeting siRNA purchased from Dharmacon (Fisher Scientific, Pittsburgh, PA). CD151 specific shRNA was obtained from Sigma Aldrich. ALCAM and GFP siRNA were purchased from Invitrogen (Grand Island, NY). Anti-CD151 (1A5) was generated as previously described), ALCAM/CD166 (L50, Abeam and R&D systems). The control antibody 29-7 was generated in the same fashion as 1A5.
[00157] Mass Spectrometry
[00158] HEp3 and HT1080 cells were lysed in 1% Brij99 lysis buffer as described above. Lysates were incubated with control antibody 29-7 or anti-CD151 antibody 1A5 overnight at 4°C and immunoprecipitated with protein-G sepharose beads. The
immunoprecipitated complexes were then resolved by SDS-PAGEG. Each lane was excised and prepared for mass spectrometry analysis by the Vanderbilt University Mass Spectrometry Core (Nashville, TN). Mass spectrometry analyses were performed with a LCQ-Deca or LTQ-Orbitrap mass spectrometer (Thermo Finnigan). Tandem mass spectra were extracted from raw files and used to search the database. Only proteins identified from two independent matrix preparations were considered as candidate components of the matrix.
[00159] Microarray and Gene Ontology analysis
[00160] Gene Ontology analysis was performed with microarray data obtained from BLM melanoma cell lines were stably transfected with ΔΝ-ALCAM, sALCAM, or empty plasmid control. Samples were hybridized to Affymetrix U133Plus 2.0 (Santa Clara, CA)
microarray chip. Intensities were normalized by log2 transformation. Fold change was determined as compared to endogenous expression of wt ALCAM in BLM cells (empty vector control). P-value was determined using 2-tailed Student's t-test with unequal variances. Fold change and p-value calculations were done in Microsoft Excel (Microsoft Corporation, Redmond, WA). Genes with a fold change of at least 2 and p-value of 0.001 or less were considered differentially expressed. 260 gene probes were differentially expressed. Probe IDs of differentially expressed genes were up loaded to a WebGestalt analyzer.
U133Plus 2.0 reference was selected. Gene ontology analysis was performed with default parameters. Enriched biological processes were highlighted in red and labeled with number of associated genes and adjusted p-value.
[00161] Cell Motility Assays
[00162] In Vitro Wound Healing Assay HEp3 and HT1080 cells were seeded to confluence in 6-well plates with complete medium. After 24hrs the cells were switched to serum free/insulin free media for an additional 24hrs. At 48hrs after seeding the confluent monolayers were scratched with a pipet tip in order to create a uniform wound after which the cells were washed with PBS to remove any floating cells. Cultures were returned to full medium and the wound was documented at Ohrs and 16hrs post-scratch using a light microscope TMS-F (Nikon, Tokyo, Japan) equipped with a D90 SLR camera (Nikon).
Wound closure (% surface area) was calculated using Tscratch image analysis software (Ashby et al, 2012; Geback et al, 2009).
[00163] In Vitro Transwell Migration: Tumor cells in a single cell suspension were plated into the top chamber of 8μιη transwell (Costar) inserts in the presence of serum free/insulin free media. Cell culture media containing 10% fetal bovine serum was placed in the bottom chamber to serve as a chemoattractant. Migration assays were carried out for 12hrs in a 37°C cell culture incubator containing 5%CO. The top surface of the inserts was cleaned with a cotton swab soaked with PBS to remove the non-migrated cells. The transwell inserts were subsequently fixed in methanol and stained with 0.2% crystal violet. The number of migrated cells was counted in 3 independent fields under 20x magnification with a light microscope.
[00164] Two-Dimensional Migration: Tumor cell migration on soluble ALCAM-Fc was performed by adhering it to tissue culture plates with protein-G. Briefly, protein-G ^g/ml) was adhered to the culture plastic followed by rat tail collagen type 1 (100μg/ml). Unbound surface was blocked with BSA (0.5% in PBS) after which the surface was washed and incubated with ALCAM-Fc in 0.5% BSA. Control migration was performed on identical
surfaces not inclubated with ALCAM-Fc. Tumor cells were seeded at low density and tracked by live cell imaging every 10 minutes over a 6hr period with a fully automated microscope (BX61, Olympus, Tokyo, Japan) equipped with a digital camera (Orca ER, Hammatsu Photonics, Hamamatsu, Japan). Data acquisition and analysis was performed using Volocity image acquisition software (Perkin Elmer, Waltham, MA).
[00165] In Vivo Cell Motility: Briefly, cells to be injected were washed 2 times with PBS and detached with 2mM EDTA. The cells were resuspended in PBS and injected intravenously into Day 12 chick embryos. Four days post-injection the disseminated colonies were photographed using a Lumar VI 2 stereomicroscope (Zeiss) equipped with a Retiga Exi camera and controlled with Volocity image acquisition software (PerkinElmer). Antibody treatments were introduced by intravenous injection one day after tumor cell injection. "Non- motile" colonies were defined as colonies comprised of 5 or more cells where individual cells remained in direct contact. Such non-motile colonies are compact while "motile" colonies contained a migratory cell populations dispersed in the CAM. Assays were performed with 5 animals/treatment and > 5 fields/animal analyzed for colony formation. Data is represented as the percentage of colonies within a single animal that demonstrated a motile phenotype.
[00166] Flow Cytometry
[00167] Cells to be used in flow cytometry experiments were trypsinized with 0.25% Trypsin-EDTA and resuspended in cold Milytenyl FACs buffer (2mM EDTA, 0.5%BSA, PBS). For the analysis of cell surface expression of specific antigens the cells were washed 2 times with FACs buffer and then stained with the specific primary antibodies for lhr on ice. Following incubation with the primary antibody the cells were washed 2 times with cold FACs buffer and then incubated with species-specific, fluorophore-conjugated secondary antibody for 30 minutes on ice. After washing two times the cells were suspended in cold FACs buffer and subjected to flow cytometry.
[00168] Immunoblot and Immunoprecipitation Analysis
[00169] Immunoblotting: For immunoblot analysis HEp3 , HT1080 or CHO cells were lysed in either 1% (vol/vol) Triton X-100 lysis buffer or 1% (vol/vol) Brij-99 lysis buffer and incubated on ice for 30 minutes. The samples were then cleared by centrifugation at 14,000 rpm for 15 minutes and the cleared lysates were then transferred to fresh tubes. Protein concentrations were determined by BCA assay (Pierce). Equal amounts of protein were loaded in to SDS-Page gels and subsequently transferred to polyvinylidene fluoride membranes (PVDF, Millipore). The membranes were blocked for lhr in 5% non-fat dry milk in phosphate buffered saline with 0.05% Tween-20 (PBSt). The membranes were incubated
overnight at 4°C with specific antibodies prepared in blocking buffer after which the membranes were washed 3 times with PBSt and incubated with the appropriate species- specific horse radish peroxidase-conjugated secondary antibodies for lhr at room
temperature. After washing, antibody binding was visualized by chemiluminescence.
[00170] Immunoprecipitation: lmg total cell lysate was incubated with 2μg of the immunoprecipitation antibody and the antibody lysate solution was incubated over-night at 4°C with end to end rotation. In order to capture the protein/antibody complexes the lysates were coupled to protein G sepharose beads (GE Healthcare) for 4hr at 4°C with end to end rotation. The lysates were cleared by centrifugation at 8000 rpm for 30 sees and the unbound material saved for further analysis. The beads were washed 3 times with either Triton X-100 or Brij-99 lysis buffer accordingly and the immune complexes were then eluted in ΙΟΟμΙ lamelli sample buffer and boiled for 5 minutes. The samples were then prepared for SDS- Page analysis. For GBP immunoprecipitations the lysates were incubated overnight with GBP conjugated beads with end to end rotation overnight at 4°C. After clearing the lysates were subjected to SDS-PAGE as described above.
[00171] Cell Surface Biotinylation: For cell surface labeling confluent HEp3 cells were treated with 1A5 or control antibody for lhr on ice and then washed with cold PBS. Cultures were subsequently biotinylated with sulfoccinimidyl-6-[biotin-amido] hexanoate using the EZ-Link Sulfo-NHS-Biotinylation Kit (Thermo Scientific) according to manufacturer's instructions. Cells were lysed in 1% Brij 99 followed by extraction of the insoluble in 1% Triton X-100. Immunoprecipitation was performed as described above. Biotinylated proteins were detected with peroxidase conjugated streptavidin.
[00172] Metabolic Labeling
[00173] HEp3 cells were labeled overnight in methionine/cysteine free DMEM containing 35S-label. Cells were washed throughly with PBS and lysed in 1% Brij 99 lysis buffer. The lysates were incubated with control antibody or monoclonal antibody 1A5 and immunoprecipitated as described above. The gels were dried and then exposed to film at - 80°C.
[00174] Rapl Activation Assays
[00175] Rapl activation was analyzed using the Rapl activation kit (Chemicon). All treatments were performed in the presence of serum free/insulin free media. Cells to be assayed were washed with ice cold PBS and lysed in RIPA like Rapl buffer (10% glycerol, 50mM Tris/HCl, 150mM aCl, 5mM phenylmethylsulfonyl fluoride, ImM sodium orthovanadate). The lysates were pushed through a 25 gauge syringe and cleared by
centrifugation at max speed at 4 degrees for 10 min. Equal amounts of lysates were immunoprecipitated with RalGDS RBD conjugated agarose beads for 45 minutes at 4°C. After washing the beads where resuspended with sample buffer and boiled for 5 minutes. The immunoprecipitates were separated by SDS-Page as mentioned above, transferred to PVDF membranes, probed with the anti-Rapl antibody and horse radish peroxidase-conjugated secondary antibody. After washing the membranes were developed by autoradiography.
[00176] Immunfluorescence
[00177] HEp3 cells grown to confluency on collagen coated coverslips were incubated with 1A5 and then fixed in 4% formalin in PBS. The coverslips were blocked with 5% BSA in PBS for 30 minutes at room temperature and then stained with 1A5 and ALCAM primary antibodies overnight at 4°C. The coverslips were washed with PBS and then incubated with species specific fluorophore -conjugated secondary antibodies for lhr at room temperature.). After staining the cells were washed with PBS and then counterstained with DAPI. The coverslips were then mounted onto glass slides with Fluorosave mounting media
(Calbiochem). Pictures were taken with a BX 61 fluorescent microscope (Olympus) and analyzed using Volocity Image Acquisition Software (Perkin Elmer).
[00178] Statistical Analysis
[00179] All statistical analysis was performed using Graph Pad Prism Analysis Software (La. Jolla California). For statistical analysis of migration experimental groups were compared to the control groups using non-parametric Mann-Whitney test.
[00180] Results
[00181] Identification of CD151 associated proteins
[00182] The ability of tetraspanins to organize higher-order structures in the membrane leads to complex interactions of variable affinity with a variety of transmembrane and membrane proximal proteins (Figure 16A). Immunoprecipitation of CD 151 with the motility-inhibiting antibody 1A5 from lysates extracted with mild detergents (Brij) or stringent detergent (TX-100) co-precipitates several proteins (Figure 16B) visible after metabolic labeling (S35), and cell-surface biotinylation (Biotin). In order to elucidate the components of the CD 151 -TERM complex responsible for regulating tumor cell motility and metastasis, tandem Mass Spectrometry (LC-MS-MS) was used to identify CD151 partners that co-IP with 1A5 (Figure 16C). Specifically, the HNSCC cell line HEp3 was lysed with Brij -based lysis buffer to maximize possible protein-protein interactions.
Immunoprecipitations were preformed with the CD151free-binding antibody 1A5. Control samples included immunoprecipitations with an isotype-matched control IgG or protein-G
only. The precipitated complexes were separated by SDS-PAGE, gel pieces were excised and subsequently analyzed by LC-MS-MS using a LCQ-Deca or LTQ-Orbitrap mass
spectrometer (ThermoFinnigan). CD 151 -specific candidates were identified by eliminating targets precipitated with an isotype control and protein-G respectively. Candidates identified by two or more peptides in two or more independent analyses were selected as viable targets. A total of 228 proteins were identified of which 51 candidates distributed across five phenotypic subgroups were detected repeatedly (Figure 16C, pie chart and Table 1 1).
[00183] Anti-CD 151 antibody 1A5 clusters the tetraspanin and promotes its accumulation at areas of cell-cell contact. Based on validated interactions and the observed cell-cell accumulation, a short list of potential candidates was developed (Figure 16D). Nearest neighbor analysis was performed on each putative candidate using the Broad Institute Cancer Cell Line Encyclopedia (http://www.broadinstitute.org/ccle/home). ALCAM was identified as the nearest neighbor of a3, one of the primary partners of CD 151. To evaluate ALCAM's role as a regulator of migration we evaluated changes in gene expression initiated upon expression of a dominant-negative ALCAM lacking the ligand-binding domain.
Differentially expressed genes were grouped by gene ontology (GO) association using WebGestalt (http://bioinfo.vanderbilt.edu/webgestalt/) and enriched biological processes were displayed. The primary processes identified were cell adhesion and migration. In addition to its association with cancer metastasis and migration, ALCAM has also been suggested to interact with PKCa, a key regulator of CD151 activity, supporting its potential as a bonafide partner in the regulation of tumor cell motility by CD 151. ALCAM has broad expression in epithelial tissues and their corresponding tumors. Continuous cell lines derived from these tumors continue to express ALCAM both at the level of gene transcription and protein translation.
[00184] The IgG superfamily member ALCAM is a novel CD151 partner
[00185] Clustering of CD 151 with 1A5 promotes the localization of the tetraspanin to the areas of cell-cell contact leading to the inhibition of tumor cell migration and metastasis. ALCAM and CD151 occupy the same areas of cell-cell contact and clustering of the tetraspanin causes ALCAM to co-localize extensively with CD151 (Figure 17A). To determine if CD 151 and ALCAM were physically interacting, the proteins were
immunoprecipitated from mild (Brij) and stringent (TX-100) detergent lysates obtained from the HNSCC HEp3 using the antibodies 1A5 and AZL50 respectively and the resulting precipitations were immunoblotted for its possible partner (Figure 17B and 17C,
respectively). CD 151 and ALCAM did indeed co-immunoprecipitate in their reciprocal
precipitations. Since 1A5 drives CD151 clustering and promotes an interaction between CD151 and ALCAM, an independent validation of the interaction between CD 151 and ALCAM was performed using affinity purification of GFP-tagged proteins. ALCAM-GFP and CD 151 -GFP were co-transfected with untagged CD 151 or ALCAM respectively into CHO cells. GFP-tagged protein was precipitated from TX-100 lystates using a GFP-binding protein (Figures 17D and 17E). ALCAM co-precipitated with CD 151 -GFP and CD151 co- precipitated with ALCAM-GFP.
[00186] These four independent precipitations demonstrate that CD151 forms a complex with ALCAM and that ALCAM is a component of the CD 151 -TERM. This complex is stable under stringent detergent conditions (TX-100) suggesting that the stability of the CD151-ALCAM interaction is similar to those observed previously for CD151 -a3.
[00187] ALCAM and CD151 cooperate in their ability to regulate migration
[00188] The physical association of CD 151 and ALCAM demonstrates that ALCAM is a component of the TERM complex. To determine the relevance of this interaction in cell motility, the ability of CD 151 and ALCAM to regulate migration was evaluated after RNAi- mediated depletion in HT1080 and HEp3 cells (Figure 18). CD151 clustering induced by the antibody 1A5 inhibited HT1080 tumor cell migration (Figure 18A). After RNAi-mediated depletion of ALCAM, tumor cells were no longer sensitive to the immobilization by CD151 (Figures 18B and 18C). Engaging HT1080 cells in ALCAM- ALCAM interactions can be accomplished by seeding cells on ALCAM-Fc coated surfaces (Figure 18D). Similar to anti- CD 151 treatment, engaging ALCAM-ALCAM interactions can inhibit tumor cell motility in a wound-healing assay. The inhibition of cell motility upon ALCAM-ALCAM binding was enhanced by lA5-induced clustering of CD151 (Figure 18E, white bars). Conversely, shRNA mediated knockdown of CD151 in HT1080 cells not only eliminated sensitivity to the anti-CD51 antibody 1A5 but also prevented the inhibition of motility by ALCAM- ALCAM ligation (Figure 18E, black bars). Similar observations were made for the HNSCC HEp3. These data demonstrate that CD151 and ALCAM cooperate to control tumor cell motility.
[00189] CD151 and ALCAM control tumor cell migration through PKCa-dependent activation of RaplA
[00190] A targeted pharmacological screen was performed in an attempt to identify molecular mechanisms that might contribute to the inhibition of motility mediated by CD 151 and ALCAM (Figure 19A). Tetraspanins regulate intracellular signaling events by interacting directly or indirectly with signaling molecules including protein kinase Ca
(PKCa) and phosphatidylinositol 4 kinase type Ila (PI4kinase Type Ha). Rho and PI3 kinase have also been associated with CD 151 -mediated regulation of tumor cell motility. MEK, Erk, and Rapl were targeted as established mediators of cell motility. Transwell migration assays were performed in the presence or absence of each inhibitor together with or without the anti- CD151 antibody 1A5. The MEK inhibitor (U0126) and PI3 kinase inhibitor (LY294002) inhibited migration independent of anti-CD 151 antibody treatment (1A5) while the PI3 kinase inhibitor (Wortmannin) did neither influence the migration of untreated cells nor did it prevent the inhibition of migration by 1A5. Conversely, the PKC inhibitor (Chelerythrin) and the RApl inhibitor (GGTI-298) allowed for migration of untreated cells but prevented 1A5 from inhibiting migration. RNAi-mediated ablation (siRNA) of PKCa and RaplA confirm that these proteins are required for CD 151 to inhibit motility (Figure 19B). RaplA is a GTPase that can promote adhesion upon activation.. To evaluate whether RaplA was activated in response to CD 151 clustering as well as ALCAM-ALCAM ligation, HEp3 cells were treated with 1A5 or seeded on ALCAM-FC for up to 48hrs. Active RaplA in the cells was evaluated by immunblotting of GTP -bound RaplA affinity purified from lysates with Ral-GDS beads. Both CD 151 clustering and ALCAM-ALCAM binding resulted in rapid and persistent activation of RaplA (Figure 19C). Activation of the GTPase Rac was evaluated as a control to confirm the specificity of RaplA activation (Figure 19D).
[00191] PKCa can associate with CD 151 and ALCAM and has also been demonstrated to mediate activation of Rap 1. Together with the observed contribution of PKCa to the regulation of migration (Figure 19A and 19B), this suggests that PKCa may mediate activation of RaplA by CD 151 and ALCAM. To determine if PKCa signaling is required for RaplA activation by CD151, GTPase activity assays were performed in HEp3 cells after PKCa was disrupted with Chelethyrine or PKCa-specific siRNA (Figure 19E). In control transfected or untreated cells 1A5 promotes activation of RaplA, however, when PKCa is knocked down by genetic manipulation or inhibited by pharmacological means, 1A5 was unable to promote RaplA activation. This demonstrates that downstream of CD 151 clustering, RaplA is activated in a PKCa-dependent manner.
[00192] Rapl activation is sufficient to immobilize tumor cells in vitro and in vivo
[00193] RaplA serves as a molecular switch capable of regulating cell motility by controlling adhesion. The inhibition of tumor cell motility in response to CD151 and its partner ALCAM involves the activation of RaplA. It appears that Rapl activation was sufficient to inhibit tumor cell motility, and to address this issue GFP-expressing HEp3 cells was transfected with dominant negative RaplA (Rap IN 17) or the dominant active RaplA
(RaplV12). The expression of the constructs was verified by western blot analysis (Figure 20A). Migration assays were subsequently performed in order to determine if Rap 1 A activity was sufficient to impact on tumor cell migration in vitro. Dominant negative RaplA
(RaplN17) had no significant impact while the dominant active RaplA (RaplV12) reduced migration. This observation extended to in vivo migration. HEp3-GFP cells transfected with dominant negative RaplA (RaplN17) or dominant active RaplA (RaplV12) were injected intravenously into D12 avian embryos and metastatic colony formation was analyzed at 4 days post injection. Colony size can reflect tumor cell growth while the local dispersion of metastatic tumor cells reflects on their motility. All of the transfected cells demonstrated efficient colony formation. However, HEp3 cells expressing dominant active RaplA
(RaplV12) formed compact colony indicative of reduced motility while mock and RaplN17 transfected cells exhibited a dispersed, motile colony appearance.
[00194] Discussion
[00195] CD151 and ALCAM as partners in the regulation of tumor cell migration
[00196] ALCAM was identified a novel CD 151 partner that can associate with integrin-free CD151. ALCAM is expressed broadly in human tissues and cells with predominant expression in neuronal cells, immune cells, epithelial cells, and stem cells of hematopoietic and mesenchymal origin. It is functionally associated with many cell adhesion events including T-cell activation, endothelial adherence junction, neuronal guidance, and epithelial integrity. ALCAM' s expression alters during cancer progression. Since ALCAM- ALCAM interactions are responsible for mediating the activation of RaplA and inhibiting motility, it appears that ALCAM shedding offers a mechanism by which tumor cells can control RaplA-mediated adhesion and migration.
[00197] Molecular integration of CD151, ALCAM, PKCa and RaplA
[00198] PKCa binding to the C-terminal tail of CD 151 allows the tetraspanin to serve as a linker between PKCa and the integrins α3 β 1 and α6β4 thereby regulating integrin signaling. It appears that CD 151 performs the same function for ALCAM but that the ultimate target of this signaling is RaplA. PKCa has been previously identified as an inhibitor of cell migration during an in vitro screening assay of normal epithelial migration. Since PKCa has many substrates, these results suggest that divergent signaling mechanisms may be initiated depending on what partner CD 151 interacts with. The elevation of integrin- free CD151 in cancer is likely to divert signaling from integrins to other tetraspanin partners.
[00199] Both CD 151 clustering and homotypic ALCAM-ALCAM interactions mediated promote tumor cell adhesion and control motility by activating the small GTPase
Ra l A. Since then many lines of evidence demonstrate that Rapl can influence cancer progression, including the identification of SIPAl, a Rapl GTPase activators (Rapl GAP) as the mediator of differential metastatic ability associated with Polyoma Middle T antigen initiated breast cancer, and metastatic virulence in breast cancer appears to be associate with specific Single Nucleotide Polymorphisms (SNPs) in SIPAl. Thus, active (GTP -bound Rapl) may limit metastatic dissemination. This Example demonstrates that the activation of Rapl A (generating the GTP -bound state of Rapl A) promotes adhesion and thereby limits dissemination.
[00200] The activity of Rapl is regulated by a number of regulators including
Guanidine Exchange Factors (GEF), GTPase activators (GAP) and effectors that mediate the activity of the GTPase. This Example demonstrates that in the absence of PKCa, neither 1A5 treatment nor ALCAM adhesion is able to activate Rapl, which suggests that the signaling mechanisms associated with immobility require PKCa to activate RaplA. PKCa can activate Rapl in platelets and subsequently promote adhesion through integrin activation. CD 151 was initially identified as a platelet cell surface antigen and its clustering can induce platelet activation suggesting that this mechanism may apply broadly outside the regulation of tumor cell motility.
[00201] Example 4
[00202] This Example describes procedures conducted to show that ectodomain shedding of ALCAM is induced by cytokines present in the tumor microenvironment and that its detection can be a marker of tumor progression. ALCAM expression and shedding by ADAM 17 is examined in response to cytokine stimulation through biochemical analyses while its contribution to skeletal metastasis is determined in a series of orthotopic, and experimental metastasis models. Specifically, this Example characterizes how elevated ALCAM expression in aggressive prostate cancer together with its putative role in cell adhesion/migration make ALCAM a molecular participant in prostate cancer metastasis.
[00203] Materials and Methods
[00204] Reagents, cell culture
[00205] Full-length purified recombinant porcine TGF was obtained from .
Antibodies against ALCAM were obtained from R&D Systems (Clone 105902). The following tumor cell lines were obtained from American Type Culture Collection (Manassas, VA) and maintained according to the American Type Culture Collection's recommendations: DU145, LNCaP, PC3 (prostate metastasis). PC3-luciferase (PC3-luc) cells (Simon Hayward, Vanderbilt) were cultured in RPMI/10%FBS.
[00206] SDS-PAGE and immunoblotting. Cells (2.5 x 105) were plated in 6-well dishes. After 24 h, cells were serum starved in Opti-MEM for 16 h and then treated in the presence or absence of indicated growth factors or inhibitors, for 48 h. After that, the cells were lysed in TNE Lysis Buffer (20 mM Tris-Cl [pH 7.4], 0.5 mM EDTA, 1% Triton X-100, 150 mM aCl, protease inhibitor cocktail (sigma), 1 mM phenylmethylsulfonyl fluoride). Total protein in the lysates was quantified using BCA assay (BioRad). Conditioned media samples were concentrated with microcon centrifugal filters (Millipore) following manufacturers protocol, which were eluted directly in 5X sample buffer for Western blot analysis. Protein loading for conditioned-medium samples for Western blot analysis was adjusted according to the total protein in cell lysates. Conditioned media and total protein was subjected to SDS-PAGE and electrophoretic transfer to polyvinylidene difluoride membranes (Immobilon P, Millipore, Inc., Bedford, MA). Immunodetection was done by conventional chemiluminescence
[00207] Quantitative PCR
[00208] The mR A samples were prepared from tumor cells lysed in TRI Reagent (Ambion) and purified using phenol extraction, followed by real-time polymerase chain reaction (RT-PCR). The following qPCR primers were used ALCAM,
TCAAGGTGTTCAAGCAACCA (forward) and CTGAAATGCAGTCACCCAAC (reverse); ADAM 17, ATGTTTCACGTTTGCAGTCTCCA (forward) and
CATGTATCTGTAGAAGCGATGATCTG (reverse); and glyceraldehyde-3 -phosphate dehydrogenase, ATCTTCTTTTGCGTCGCCAG (forward) and
TTCCCCATGGTGTCTGAGC (reverse).
[00209] ShRNA Knockdown
[00210] To establish cell lines in which ALCAM expression is stably knocked down cells were transduced with ALCAM-specifc Mission shRNA (Sigma) lentivirus. Following transduction, cells were selected in 10μg/ml of puromycin. Transduced cells were flow sorted for ALCAM expression and ALCAM knock-down cells were cultured and maintained on 5μg/ml of puromycin.
[00211] Migration Assay
[00212] Two-dimensional gap closure assays (formerly known as scratch assays) were conducted using magnetically attachable stencils attached to culture plates. 250,000 cells were seeded in 6-well plates and allowed to recover overnight to form a confluent monolayer. Stencils were removed with tweezers, after which cells were rinsed with PBS to remove detached cells. Culture medium was re-added and closure of the gap was measured at 8 and
16 hours. Gap closure was quantified using TScratch (National Institutes of Health, Bethesda, MD, USA).
[00213] Histological analysis of mouse tissue
[00214] Tumor-bearing tissue and bones were fixed in 10% formalin. Bone specimens were decalcified in 20% EDTA pH 7.4 for 3-4 days at room temperature. Decalcified bone and tissue were dehydrated and embedded in paraffin. Tumor burden was confirmed in 5μιη serial sections stained with H&E. Osteoclast were visualized using a standard Tartrate Resistant Acid Phosphatase (TRAP) protocol. All immunohistochemistry and
immunofluorescence on tumor sections involved antigen retrieval using a standard pH 6.0 citrate buffer followed by blocking via incubation with 20% Aquablock (East Coast Bio, North Berwick, ME). Immunofluorescence data was obtained using primary antibodies for ALCAM (1 : 1000; Leica Biosystems; Clone, MOG/07), Ki67 (1 :500; Fisher, Clone SP6), Cleaved caspase-3 (1 :200; CellSignaling, D 175), and collagen I (1 : 1000; Sigma C2206) by incubation overnight at 4°C. Corresponding Alexa Fluor® secondary antibodies were used (1 : 1000; Invitrogen). Fluorescent imaging was completed on a Olympus BX61WI upright fluorescent microscope using Volocity Imaging Software.
[00215] ELISA of mouse serum and plasma
[00216] Blood was obtained via the saphenous vein; samples were collected in either the presence of EDTA as an anticoagulant or a serum separator tube and were centrifuged at 1 ,500 rpm, 4°C to remove cells. Plasma and serum samples were stored at -80°C until analyzed. Samples were analyzed for soluble mouse and human ALCAM using the R&D Systems DuoSet following manufacturer's instructions. Briefly, ELIS plates coated with capture antibody were incubated overnight with 100 iL of sera diluted 1 :50. Capture ALCAM was detected with biotinylated antibody and peroxidase-conj ugated avidin followed by colorimetric detection at 450 urn.
[00217] Mouse models of prostate cancer and in vivo quantitation of tumor growth
[00218] Briefly, 5X104 PC3-luc cells were suspended in 30 μΐ of neutralized type I collagen and allowed to polymerize for 16 hrs at 37°C before implantation into the prostate of 10 week old C.B-17/IcrHsd-Prkdc scid male mice (Harlan, Indianapolis, IN). Tumor growth was monitored weekly by bioluminescent detection of luciferase expressing cells. For the xenograft model, subconfluent PC3-luc cells were trypsinized, washed twice in PBS to remove serum, and then resuspended in HBSS at a concentration of 1 x 107 cells/mL. One hundred μΐ containing 1 x 106 PC3 cells in a 50/50 mix of PBS and growth factor-reduced Matrigel (BD Biosciences, San Jose, CA) were injected subcutaneously into the right flank of
7-week-old nude male mice (Harlan Laboratories; athymic Foxnl nu/nu). Tumor growth was monitored weekly by caliper measurements, and tumor volume was calculated based on the following formula: (length x length x width) / 6. PC3-luciferase shControl (Vector) or PC3- luciferase shALCAM (KD2 or KD3) tumor cells (l lO5) in a 10 μΐ volume of sterile phosphate buffered saline (PBS) were injected into the tibia of anesthetized 6-week-old nude male mice (Harlan Laboratories) Skeletal metastasis was performed. Briefly, 1 x 105 PC-3- luc cells were injected into the left heart ventricle of male nude mice (Harlan Laboratories). Skeletal metastases were monitored by bioluminescent detection of luciferase expressing cells and formation of bone lesion by X-ray. Whole animal luminescent imaging was performed with the IVIS™ system (Caliper Life Sciences, Hopkinton, MA). Luciferin (150 mg/kg in sterile PBS, Biosynth International, Itasca, IL) was delivered via intra-peritoneal injection 10 minutes prior imaging. Living Image™ software (Caliper Life Sciences, Hopkinton, MA) was used to quantify the luminescence intensity. Blood was obtained via the saphenous vein and collected in either the presence of EDTA as an anticoagulant or a serum separator tube (Fisher Scientific). Plasma and serum samples were stored at -80°C until analyzed.
[00219] Micro computed tomography (μϋΤ) analysis
[00220] For gross analysis of trabecular bone volume, formalin fixed tibiae were scanned at an isotropic voxel size of 12 μιη using a microCT40 (SCANCO Medical, Bruttisellen, Switzerland). The tissue volume (TV) was derived from generating a contour around the metaphyseal trabecular bone that excluded the cortices. The area of measurement began at least 0.2 mm below the growth plate and was extended by 0.12 mm. The bone volume (BV) included all bone tissue that had a material density greater than 438.7 mgHA/cm3.
[00221] Radiographic Analysis
[00222] Beginning 1 week after tumor cell inoculation, tumor-bearing animals were subjected to radiographic imaging. Radiographic images (Faxitron X-ray Corp, Lincolnshire, IL, USA) were obtained using an energy of 35 kV and an exposure time of 8 seconds.
Osteolytic lesions were quantified bilaterally in the tibia, fibula, femora, humeri, and pelvis at the endpoint using x-ray images. Lesion area and lesion numbers were evaluated using image analysis software (Metamorph, Molecular Devices, Inc.). Data presented are the average of lesion area and lesion numbers per mouse in each group.
[00223] Statistical Analyses
[00224] Expression analysis was performed on datasets GDS1439 and GSE10645 available through the Gene Expression Omnibus (references (21)and (22) respectively). Expression data for selected genes from GDS1439 was clustered in software Cluster 3.0 and visualized with software TreeView. For survival analysis the patient population of GSE 10645 (n=596) was dichotomized across upper and lower quartile of ALCAM expression. Statistics were completed using either R, SPSS or GraphPad Prism. For all standard bar and box plots the results were reported as mean and SEM unless stated otherwise in the legend.
Comparisons were performed using unpaired two-sided Student's t test, nonparametric Mann- Whitney test, or one-way ANOVA. R2 and P values were reported from linear regression analysis of mouse data. .Ail statistical tests were considered significant when p<0.05 where * denotes p< 0.05, ** denotes p< 0.01 and *** denotes p< 0.001.
[00225] Mouse models of acute inflammation
[00226] C57BL/6(SJL)-Tg(SMAD binding element [SBE]/Tk-luc)7Twc/j mice, obtained from the laboratory of Harold Moses, MD (Vanderbiit University), were used at 16 weeks of age. These transgenic mice, referred to as SBE-Luc mice, express luciferase in response to activation of the Smad2/3 -dependent signaling pathway. Mice were administered 2mg/kg of LPS to induce an acute inflammatory response and bled via saphenous vein at 0, 6, 24 hours and 1 week post-administration.
[00227] Mouse models of wound-healing
[00228] Mice were anesthetized by intraperitoneal injection. The back the C57/B16 male and female mice were shaved and two circular excisional full-thickness wounds of 6- mm diameter generated using a standard biopsy punch. Mice were bled via saphenous vein at 0 hours (establish basal levels) , 24 hours, one week and two weeks after wound initiation.
[00229] In vivo ALCAM serum half-life
[00230] Serum was harvested from ALCAM wild-type, mixed background, mice and pooled. Combined serum collected from WT mice was injected retrorbitally in ALCAM KO mice (ΙΟΟμΙ/mouse). ALCAM KO mice were pre -bled via saphenous vein bleed, and then bled at 10 mins, 2 hours, 4 hours, 24 hours and 48 hours (n=2/time point; total n=10). WT pooled serum was used as ELISA control to quantitatively determine ALCAM serum half- life.
[00231] Results
[00232] ALCAM gene expression is elevated in advanced prostate cancer and correlates with poor patient outcome
[00233] Several publicly available microarray datasets were evaluated to determine the relationship between ALCAM mRNA levels, patient diagnosis and outcome (Figure 21). A comparison of benign, localized and metastatic disease revealed increased levels of ALCAM mRNA in metastatic prostate cancer (Figure 21 A). Elevated levels of ALCAM coincided with molecular evidence of a pro-migratory phenotype based on the decreased expression of E-cadherin and pl20 concurrent with elevated expression of N-cadherin (Figure 21B). These observations were supported by survival analysis for a cohort of 600 prostate cancer patients which revealed that high levels of ALCAM mRNA corresponded with poor patient outcome. (Figure 21C). Immunohistological staining of prostate cancer tissue microarrays available through the Human Protein Atlas revealed that ALCAM staining is evident in both normal, benign and malignant disease but is frequently absent from the tumor cell surface in advanced disease (proteinatlas.org, Figure 21D).
[00234] TGFfi induces ALCAM expression and shedding
[00235] ALCAM is proteolytically shed from PC3 cells (Figure 21). Absence of the cytoplasmic tail confirms that the ectodomain is shed (Figure 21A). Moreover, ALCAM is absent from PC3 -derived exosomes ensuring that the ectodomain is shed and not released with cell-derived microparticles (Figure 21B). Since prostate cancer disseminates predominantly to bone we selected cytokines thought to be involved in this process, including TGF . Of the 8 agents tested, TGF promoted ALCAM shedding relative to overall total protein increase (Figure 23A). To further explore the response to exogenous stimulation with TGF , ALCAM expression in PC3 cells was compared to ALCAM expression in LNCaP cells which are unable to respond to the cytokine because they lack TGFP receptor type I (Figures 23B and 23C). Quantitative RT-PCR analysis for ALCAM demonstrates that TGFP was also able to induce ALCAM gene transcription in PC3 but not LNCaP cells (Figure 23B). The cytokine also increased levels of ALCAM protein expression and ectodomain shedding (Figure 23C). Conversely, LNCaP did not respond to TGFP even though these cells express abundant ALCAM (Figure 23C). TGFP-induced expression in PC3 cells could be abrogated with the small molecule inhibitor SB431542 (Figure 23D, ΙΟμιη; Sigma) while TGFP-induced ALCAM mRNA and protein expression could be restored in LNCaP cells when the cells were transfected with dominant-active TGFP receptor type I (Figures 23E and 23F).
[00236] ALCAM shedding in vivo correlates with tumor progression
[00237] To determine if tumor-derived ALCAM is the source of elevated circulating ALCAM, species-specific antibodies were used to monitor circulating levels of both host
(mouse) ALCAM and tumor (human) ALCAM longitudinally during orthotopic and subcutaneous growth of PC3 cells (Figure 24). The half-life of human ALCAM in the circulation of its mouse host was determined to confirm that tumor-derived ALCAM could act as a stable biomarker in vivo (Figure 25). Circulating ALCAM exhibits a 17hr half-life which is sufficient for monitoring its release from an endogenous tumor burden.
[00238] Circulating levels of ALCAM were subsequently monitored on a weekly basis (Figure 24A) in SCID mice bearing subcutanous (Figures 24B, n=5) or orthotopic xenografts of PC3 (Figure 24C, n=8). Animals were bled on a pre-determined schedule via saphenous vein puncture. Circulating ALCAM levels were detected by ELISA and a comparison to pre-grafting baseline levels allowed for the detection of any increase in host (mouse) ALCAM and the appearance of tumor (human) ALCAM in response to an increasing tumor burden. Tumor-derived ALCAM levels showed significant weekly increases in the serum of tumor-bearing mice (Figures 24B, 24C, and 26; P < 0.0001). Regression analysis showed a direct linear relationship between circulating levels of tumor-derived ALCAM and tumor burden for subcutaneous xenografts (Figure 24B; tumor-derived R2 = 0.707, pO.0001, n = 4) and orthotopic xenografts (Figure 24C; tumor-derived R2 = 0.7066, pO.0001, n = 4). In contrast to tumor-derived ALCAM, changes in host-derived ALCAM did not correspond to tumor burden (Figure 24B; host-derived R2 = 0.03671, n = 4 animals; Figure 24C; host-derived R2 = 0.01358, n = 4 animals).
[00239] ALCAM shedding is mediated by AD AMI 7 in vitro and in vivo
[00240] Knockdown of ADAM 17 using small interfering RNA (siRNA) transfection resulted in a loss of TGF -induced ALCAM shedding (Figure 27A). Similar results were obtained using an ADAM17-specific inhibitor (Figure 27B, Compound-32, BMS). These studies were extended to orthotopic models to confirm that ADAM 17 was also the primary protease responsible for ALCAM shedding in vivo (Figure 27C). In vivo inhibitor dosing and efficacy was confirmed using serum TNF-alpha (Figure 28, n=6) which demonstrated that 50% inhibition of ADAM 17 could be achieved for the duration of the ALCAM serum half-life (Figure 25; 17hr) without signs of distress or toxicity. Mice were treated twice-daily for 3 days with 20mg/kg of the ADAM 17 inhibitor (Compound-32 or vehicle DMSO control). Pre-surgery, weekly, pre- and post-treatment saphenous vein bleeds were collected. Inhibition of ADAM 17 resulted in a significant decrease in serum levels of shed ALCAM approximating the 50% inhibition we achieved with our dosing studies (Figure 28). Taken together these data suggest that ALCAM cell surface shedding is mediated by ADAM 17 and promoted by TGF .
[00241] Knockdown of ALCAM in PC3 cells inhibits TGFfi-induced migration and in vivo dissemination to bone
[00242] To test whether ALCAM is functionally involved in tumor cell migration and metastasis, expression in PC3-Luc cells was knocked down using viral delivery of short hairpin RNA (shRNA). Three separate stable ALCAM knockdowns were produced (ALCAM KD 1, 2 and 3). Transduced cells were selected with puromycin and subsequently subjected to flow-sorting to isolate the highest knockdown population (Figure 29A). PC3-luc- ALCAM™1 cells and PC3-luc-ALCAM shControl cells were pretreated with K^g/ml TGF i for 16hrs in serum-free conditions, followed by initiation of MAtS assay (Figure 29B) or scratch assay (data not shown). TGF i pre -treatment and treatment were compared at the time of scratch and exhibited similar results. The analysis revealed a loss TGF - induced migration in PC3-luc-ALCAMKD1 cells (Figure 29B) similar observations were made in ALCAM™2 and ALCAM™3 cells. The reduction in ALCAM expression led to a slight increase in migration, possibly due to a loss of ALCAM -ALCAM homotypic interaction on adjacent cells.
[00243] Given the critical importance of cancer cell migration in malignant tumor expansion and metastasis, the contribution of ALCAM to primary tumor growth and bone metastasis was evaluated. Primary tumor growth was accomplished using an orthotopic model based on implantation of tumor cells into the anterior prostate of SCID mice (Figure 29C, n=8 for PC3-luc-Control and PC3-luc-ALCAMKD1). Skeletal metastasis was accomplished by intracardiac injection of tumor cells in nude mice (Fig. 5D, n=31 for PC3- luc-Control and n=25 for PC3-luc-ALCAMKD1). Bioluminescent imaging was used to monitor tumor burden for both models at weekly intervals. Reduced ALCAM expression did not limit tumor growth within the prostate (Figure 29C). Whole body and ex vivo bioluminescent imaging of the orthotopic model upon experiment completion confirmed that both the PC3-luc-Control and PC3-luc-ALCAMKD1 exhibited similar tumor burden based on luciferase activity (Figure 29C), and comparable tumor size based on weight (Figure 29D). Local invasion and mesenteric dissemination is common in this model and was not altered by reduced ALCAM expression.
[00244] In contrast to the orthotopic model, a reduction in ALCAM resulted in a significant decrease in skeletal metastasis (Figure 29E). Both incidence and metastatic burden were reduced. Approximately 75% of mice injected with PC3-luc-Control tumor cells developed bone metastasis while only 17% of the mice injected with PC3-luc-ALCAMKD1 cells developed bone lesion. In addition, mice that did develop skeletal metastases formed by
PC3-luc -ALCAM , the number of lesions per mouse was greatly reduced (0.2 events versus 1.4 events Figure 29F). The orthotopic and intracardiac experiments were repeated with PC3-luc-ALCAMKD3 and similar results obtained.
[00245] ALCAM expression contributes to tumor cell survival in the bone
microenvironment
[00246] To determine the biologic importance of tumor-derived ALCAM in prostate tumor growth in the bone, PC3-luc-Control (n=8), PC3-luc-ALCAMKD2 (n=8) and PC3-luc- ALCAM™3 (n=8) were injected into the tibia of nude mice. Following intratibial injection, luminescent and X-ray imaging was used to monitor tumor burden over time (Figure 30A). Quantitation of the bioluminescent signal showed a lower growth rate for the ALCAM KD cells (Figure 30B). At completion of the experiment 100% of control mice exhibited lesion compared to an 80% incidence in limbs bearing PC3-luc-ALCAMKD3 tumor cells (Figure 30C). ALCAM™ intratibial tumors continued to exhibit reduced ALCAM expression
(Figure 30D). Detailed imaging of the osteolytic lesions by microCT (Figure 31 A) further confirmed decreased lesion area and increased bone volume in the bones containing ALCAM KD cells (Figures 31B and 31C). Finally, the histological visualization of bone tumors generated by control and ALCAM KD cells resulted in reduced bone tumor size upon ALCAM knockdown (Figure 31D). Tibias in the PC3-luc -vector, PC3-luc-ALCAMKD2 and PC3-luc-ALCAMKD3 were stained for the osteoclast marker, tartrate -resistant alkaline phosphatase (Figure 32). Both the ALCAM KD tumors induced osteolytic lesions as evidenced by osteoclast presence adjacent to tumor lesions suggesting that the ability to induce bone-remodeling was not deficient in these cells.
[00247] Immunofluorescent staining was performed for cleaved caspase-3 (Figure 31E, apoptosis) and Ki67 (Figure 31F, proliferation) on intratibial bone tumors harvested at 28 days post injection Compared to the control tumors, the bone tumors created by both ALCAM KD cells exhibited elevated levels of cleaved caspase-3 suggesting that these cells are experiencing a reduced ability to survive (Figure 31G). In addition, bone tumors from PC3-luc-ALCAMKD3 had significantly lower Ki67 staining suggesting that ALCAM contributes to both proliferation and survival (Figure 31H).
[00248] Discussion
[00249] The data reveals that ALCAM plays a role in prostate cancer establishment in the bone microenvironment. ALCAM mRNA is elevated in malignant disease yet by immunohistochemistry it is frequently absent from the tumor cell surface in advanced disease (Figure 24D). In colorectal cancer, ectodomain shedding is responsible for the apparent loss
of ALCAM detection. This shedding is likely the cause for conflicting results reported for several malignancies. Indeed the protease responsible for shedding of ALCAM ectodomain (ADAM 17), is elevated in advanced prostate cancer (Figure 21B). This data implies that, while ALCAM gene transcription is elevated in prostate cancer, ectodomain shedding depletes the cell surface of intact protein in advanced disease. Regression analysis showed a direct linear relationship between circulating levels of (human) tumor-derived ALCAM and tumor burden in animals with subcutaneous xenografts (Figure 24B) and orthotopic xenografts (Figure 24C). In contrast, the host-derived ALCAM did not correspond to tumor burden (Figures 24B and 24C), demonstrating that elevations in circulating ALCAM are tumor-specific. Consistent with this observation, host-derived ALCAM does not increase, but rather decreases slightly, in immunocompetent mice challenged LPS (a model of acute inflammation)or full-thickness skin punch ( a model for wound-healing, Figures 24B and 24C, respectively). These data suggest that tumor-derived ALCAM is a marker specific of tumor burden and that host ALCAM is not significantly shed in response to the tumor burden.
[00250] Suppression of ALCAM expression using gene-specific shR As prevented TGF induced migration in vitro (Figure 29B) and inhibited metastasis as well as tumor growth in bone in vivo (Figures 29-31). These observations demonstrate that ALCAM is not only a marker of cancer progression but also a significant regulator of tumor cell migration and metastasis to bone. Within the metastatic cascade there are many sequential steps that can contribute to the overall success of any single metastatic lesion. Evaluation of the primary tumor within the prostate did not reveal any deficiency in growth or local invasion.
Conversely, experimental metastasis by intracardiac injection resulted in nearly 10-fold reduction of skeletal metastasis (Figure 29). This reduced metastatic incidence suggests that ALCAM is required for dissemination to the bone. Further examination tumor growth after intratibial injection (Figure 30) revealed a significant inhibition in tumor growth without affecting the tumor incidence. The reduced metastatic incidence from circulating tumor cells (intracardiac injection) together with the reduced growth of the metastatic burden in the bone (intratibial injection) without further impact on incidence indicates that ALCAM contributes to metastatic dissemination as well as growth in the metastatic sites.
[00251] Although the role of ALCAM in extravasation was not be tested directly, it is possible that the requirement for transendothelial migration extends to metastatic tumor cells. The reduced metastatic incidence after intracardiac injections indeed supports that hypothesis (Figure 29). The lesions that did arise from circulating PC3-luc -ALCAM™ cells were smaller than those generated from PC3-luc-Control cells suggesting an additional
contribution from ALCAM to metastatic growth. Indeed, metastatic lesions generated after intratibial injection did not significantly impact tumor incidence (Figure 30C) but did dramatically reduce expansion of the metastatic tumor burden (Figure 31F).
[00252] Intratibial tumors generated by PC3-luc -ALCAM™ did not re-express ALCAM (Figure 29D) allowing further investigation of any molecular disparities between metastatic lesions that expressed ALCAM and those that did not. The abundant presence of osteoclast activity by TRAP staining (Figure 32) in metastatic lesions of PC3-luc -ALCAM™ suggests that there is no deficiency in osteolysis. Nevertheless, these lesions remain significantly smaller than those created by PC3-luc-Control suggesting that there was not a lag in tumor growth but rather a persistent reduced ability to proliferate or, conversely, a decreased ability to survive. Although reduced proliferation in vitro was not observed
(Figure 33), in vivo metastatic lesions created by PC3-luc -ALCAM™ did exhibit reduced proliferation and increased apoptosis. Intriguingly, PC3-luc -ALCAM™2, which retains more ALCAM expression than PC3-luc-ALCAM™3 (Figure 30A), did not exhibit reduced proliferation suggesting that the threshold of ALCAM expression that influences cell survival is different from the threshold influencing cell proliferation.
[00253] Together these observations suggest a dual adhesive and signaling function of ALCAM whereby the intracellular signaling function of ALCAM functions to serve a protective role in apoptosis, and the extracellular adhesive function is required for extravasation and subsequent colonization at a secondary site.
[00254] While the terms used herein are believed to be well understood by one of ordinary skill in the art, definitions are set forth herein to facilitate explanation of the presently-disclosed subject matter.
[00255] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are now described.
[00256] Following long-standing patent law convention, the terms "a", "an", and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "an antibody" includes a plurality of such antibodies, and so forth.
[00257] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.
[00258] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
[00259] As used herein, ranges can be expressed as from "about" one particular value, and/or to "about" another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[00260] Throughout this document, various references are mentioned. All such references are incorporated herein by reference, including the references set forth in the following list:
REFERENCES
1. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 201 1. CA: A Cancer Journal for Clinicians. 201 1;61(4):212-236.
2. Compton CC. Colorectal Carcinoma: Diagnostic, Prognostic, and Molecular Features.
Mod Pathol. 2003; 16(4):376-388.
3. Quasar Collaborative Group, Gray R, Barnwell J, McConkey C, Hills RK, Williams NS, et al. Adjuvant chemotherapy versus observation in patients with colorectal cancer: a randomised study. Lancet. 2007;370(9604):2020-2029.
4. Figueredo A. Adjuvant Therapy for Stage II Colon Cancer: A Systematic Review From the Cancer Care Ontario Program in Evidence-Based Care's Gastrointestinal Cancer Disease Site Group. Journal of Clinical Oncology. 2004;22(16):3395-3407.
Midgley R, Kerr DJ. Adjuvant chemotherapy for stage II colorectal cancer: the time is right! Nat Clin Pract Oncol. 2005;2(7):364-369.
Johnston PG. Stage II colorectal cancer: to treat or not to treat. Oncologist.
2005; 10(5):332-334.
Eschrich S. Molecular Staging for Survival Prediction of Colorectal Cancer Patients. Journal of Clinical Oncology. 2005;23(15):3526-3535.
Smith JJ, Deane NG, Wu F, Merchant NB, Zhang B, Jiang A, et al. Experimentally Derived Metastasis Gene Expression Profile Predicts Recurrence and Death in Patients With Colon Cancer. Gastroenterology. 2010; 138(3):958-968.
Ogino S, Nosho K, Irahara N, Shima K, Baba Y, Kirkner GJ, et al. Prognostic
Significance and Molecular Associations of 18q Loss of Heterozygosity: A Cohort Study of Micros atellite Stable Colorectal Cancers. Journal of Clinical Oncology.
2009;27(27):4591-4598.
Lugli A, Iezzi G, Hostettler I, Muraro MG, Mele V, Tornillo L, et al. Prognostic impact of the expression of putative cancer stem cell markers CD133, CD166, CD44s, EpCAM, and ALDH1 in colorectal cancer. Br J Cancer. 2010; 103(3):382-390.
Gerger A, Zhang W, Yang D, Bohanes P, Ning Y, Winder T, et al. Common cancer stem cell gene variants predict colon cancer recurrence. Clin. Cancer Res. 2011 ; 17(21):6934- 6943.
Witzel I, Schroder C, Muller V, Zander H, Tachezy M, Ihnen M, et al. Detection of Activated Leukocyte Cell Adhesion Molecule in the Serum of Breast Cancer Patients and Implications for Prognosis. Oncology. 2012;82(6):305-312.
Micciche F, Da Riva L, Fabbi M, Pilotti S, Mondellini P, Ferrini S, et al. Activated leukocyte cell adhesion molecule expression and shedding in thyroid tumors. PLoS ONE. 2011 ;6(2):el7141.
Mezzanzanica D, Fabbi M, Bagnoli M, Staurengo S, Losa M, Balladore E, et al.
Subcellular Localization of Activated Leukocyte Cell Adhesion Molecule Is a Molecular Predictor of Survival in Ovarian Carcinoma Patients. Clinical Cancer Research.
2008; 14(6): 1726-1733.
Hansen A, Swart GW, Zijlstra A. ALCAM[Internet]. UCSD Nature Molecule Pages. 2011 ;Available from: http://www.signaling- gateway.org/molecule/query?afcsid=A004126&type=abstract
Weichert W, Kn5sel T, Bellach J, Dietel M, Kristiansen G. ALCAM/CD166 is overexpressed in colorectal carcinoma and correlates with shortened patient survival.
Journal of Clinical Pathology. 2004;57(11): 1 160-1164.
Horst D, Kriegl L, Engel J, Kirchner T, Jung A. Prognostic Significance of the Cancer Stem Cell Markers CD 133, CD44, and CD 166 in Colorectal Cancer. Cancer Invest. 2009;27(8):844-850.
Levin TG, Powell AE, Davies PS, Silk AD, Dismuke AD, Anderson EC, et al.
Characterization of the Intestinal Cancer Stem Cell Marker CD 166 in the Human and Mouse Gastrointestinal Tract. Gastroenterology. 2010; 139(6):2072-2082.e5.
Kristiansen G, Pilarsky C, Wissmann C, Stephan C, Weissbach L, Loy V, et al.
ALCAM/CD166 is up-regulated in low-grade prostate cancer and progressively lost in high-grade lesions. Prostate. 2002;54(l):34-43.
Kristiansen G, Pilarsky C, Wissmann C, Kaiser S, Bruemmendorf T, Roepcke S, et al. Expression profiling of microdissected matched prostate cancer samples reveals CD166/MEMD and CD24 as new prognostic markers for patient survival. J. Pathol. 2005;205(3):359-376.
SR, Dent C, Watkins G, King JA, Mokbel K, Jiang WG. Expression of the cell to cell adhesion molecule, ALCAM, in breast cancer patients and the potential link with skeletal metastasis. Oncol Rep. 2008; 19(2):555-561.
Ishigami S, Ueno S, Arigami T, Arima H, Uchikado Y, Kita Y, et al. Clinical implication of CD166 expression in gastric cancer. J Surg Oncol. 2011 ; 103(1):57— 61.
Tachezy M, Zander H, Marx AH, Gebauer F, Rawnaq T, Kaifi JT, et al. ALCAM
(CD 166) expression as novel prognostic biomarker for pancreatic neuroendocrine tumor patients. J. Surg. Res. 201 1; 170(2):226-232.
van Kempen LCLT, Meier F, Egeblad M, Kersten-Niessen MJF, Garbe C, Weidle UH, et al. Truncation of activated leukocyte cell adhesion molecule: a gateway to melanoma metastasis. J Invest Dermatol. 2004; 122(5): 1293-1301.
Swart GWM. Activated leukocyte cell adhesion molecule (CD 166/ALCAM):
developmental and mechanistic aspects of cell clustering and cell migration. European Journal of Cell Biology. 2002;81(6):313-321.
Bech-Serra JJ, Santiago-Josefat B, Esselens C, Saftig P, Baselga J, Arribas J, et al. Proteomic Identification of Desmoglein 2 and Activated Leukocyte Cell Adhesion Molecule as Substrates of ADAM 17 and ADAM 10 by Difference Gel Electrophoresis. Molecular and Cellular Biology. 2006;26(13):5086-5095.
Rosso O, Piazza T, Bongarzone I, Rossello A, Mezzanzanica D, Canevari S, et al. The ALCAM shedding by the metalloprotease ADAM17/TACE is involved in motility of
ovarian carcinoma cells. Mol. Cancer Res. 2007;5(12): 1246-1253.
Piao D, Jiang T, Liu G, Wang B, Xu J, Zhu A. Clinical implications of activated leukocyte cell adhesion molecule expression in breast cancer. Mol Biol Rep.
2012;39(l):661-668.
Zijlstra A. Proangiogenic role of neutrophil-like inflammatory heterophils during neovascularization induced by growth factors and human tumor cells. Blood.
2006; 107(l):317-327.
Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O, et al.
CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol. 2006;7(10):R100.
Lamprecht M, Sabatini D, Carpenter A. CellProfiler™: free, versatile software for automated biological image analysis. BioTechniques. 2007;42(l):71-75.
Uhlen M, Oksvold P, Fagerberg L, Lundberg E, Jonasson K, Forsberg M, et al. Towards a knowledge -based Human Protein Atlas. Nature Publishing Group. 2010;28(12): 1248— 1250.
Merchant NB, Voskresensky I, Rogers CM, LaFleur B, Dempsey PJ, Graves-Deal R, et al. TACE/ADAM-17: A Component of the Epidermal Growth Factor Receptor Axis and a Promising Therapeutic Target in Colorectal Cancer. Clinical Cancer Research.
2008; 14(4): 1 182-1191.
Zhang T-C, Zhu W-G, Huang M-D, Fan R-H, Chen X-F. Prognostic value of AD AMI 7 in human gastric cancer. Med Oncol. 201 1.
Smedbakken L, Jensen JK, Hallen J, Atar D, Januzzi JL, Halvorsen B, et al. Activated Leukocyte Cell Adhesion Molecule and Prognosis in Acute Ischemic Stroke. Stroke. 2011 ;42(9):2453-2458.
Hollmen M, Maatta JA, Bald L, Sliwkowski MX, Elenius K. Suppression of breast cancer cell growth by a monoclonal antibody targeting cleavable ErbB4 isoforms.
Oncogene. 2009;28(10): 1309-1319.
Kahlert C, Weber H, Mogler C, Bergmann F, Schirmacher P, Kenngott HG, et al.
Increased expression of ALCAM/CD166 in pancreatic cancer is an independent prognostic marker for poor survival and early tumour relapse. Br J Cancer.
2009; 101(3):457^164.
Ihnen M, Muller V, Wirtz RM, Schroder C, Krenkel S, Witzel I, et al. Predictive impact of activated leukocyte cell adhesion molecule (ALCAM/CD166) in breast cancer. Breast Cancer Res Treat. 2008; 1 12(3):419-427.
Minner S, Kraetzig F, Tachezy M, Kilic E, Graefen M, Wilczak W, et al. Low activated leukocyte cell adhesion molecule expression is associated with advanced tumor stage and early prostate-specific antigen relapse in prostate cancer. Hum. Pathol.
2011 ;42(12): 1946-1952.
Hong X, Michalski CW, Kong B, Zhang W, Raggi MC, Sauliunaite D, et al. ALCAM is associated with chemoresistance and tumor cell adhesion in pancreatic cancer. J Surg Oncol. 2010; 101(7):564-569.
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin 2012;62(1): 10-29. van Rhijn BW, Burger M, Lotan Y, et al. Recurrence and progression of disease in non-muscle- invasive bladder cancer: from epidemiology to treatment strategy. European urology
2009;56(3):430-42.
Yafi FA, Aprikian AG, Fradet Y, et al. Surveillance guidelines based on recurrence patterns after radical cystectomy for bladder cancer: the Canadian Bladder Cancer Network experience. BJU Int. 2012;110(9):1317-1323.
Botteman MF, Pashos CL, Redaelli A et al. The health economics of bladder cancer: a comprehensive review of the published literature. PharmacoEconomics 2003;21(18): 1315-30. Collaboration ABC AM-a. Neoadjuvant chemotherapy in invasive bladder cancer: update of a systematic review and meta-analysis of individual patient data advanced bladder cancer (ABC) meta-analysis collaboration. Eur. Urol. 2005;48(2):202-5- discussion 205-6.
Raghavan D, Burgess E, Gaston KE, et al. Neoadjuvant and adjuvant chemotherapy approaches for invasive bladder cancer. In. Semin. Oncol; 2012, 588-597.
Masedunskas A, King JA, Tan F, et al. Activated leukocyte cell adhesion molecule is a component of the endothelial junction involved in transendothelial monocyte migration. FEBS Lett
2006;580(11):2637 5.
Smith JR, Chipps TJ, Ilias H et al. Expression and regulation of activated leukocyte cell adhesion molecule in human retinal vascular endothelial cells. Exp. Eye Res. 2012;104:89-93.
Abidi SM, Saifullah MK, Zafiropulos MD, et al. CD166 expression, characterization, and localization in salivary epithelium: implications for function during sialoadenitis. Journal of clinical immunology 2006;26(1): 12-21.
Fraboulet S, Kawadia K, Pourquie O, et al. BEN DM-GRASP/SCl expression during mouse facial development: differential expression and regulation in molars and incisors. Gene expression patterns : GEP 2003;3(3):255-9.
Jannie KM, Stipp CS, Weiner JA. ALCAM regulates motility, invasiveness, and adherens junction formation in uveal melanoma cells. In. PLoS ONE; 2012, e39330.
Weidle UH, Eggle D, Klostermann S, et al. ALCAM/CD166: cancer-related issues. Cancer Genomics Proteomics 2010;7(5):231-43.
Eissa S, Kassim S, El-Anmady O. Detection of bladder tumours: role of cytology, morphology- based assays, biochemical and molecular markers. Curr. Opin. Obstet. Gynecol. 2003;15(5):395- 403.
Kim W-J, Bae S-C. Molecular biomarkers in urothelial bladder cancer. Cancer Sci.
2008;99(4):646-652.
Carbotti G, Orengo AM, Mezzanzanica D, et al. Activated leukocyte cell adhesion molecule soluble form: a potential biomarker of epithelial ovarian cancer is increased in type Π tumors. Int. J. Cancer 2012.
Uinen M, Kress K, Kersten JF, et al. Relevance of activated leukocyte cell adhesion molecule (ALCAM) in tumor tissue and sera of cervical cancer patients. BMC Cancer 2012; 12: 140.
Tachezy M, Effenberger K, Zander H, et al. ALCAM (CD 166) expression and serum levels are markers for poor survival of esophageal cancer patients. Int. J. Cancer 2012;131(2):396-405. Tachezy M, Zander H, Marx AH, et al. ALCAM (CD166) expression and serum levels in pancreatic cancer. PLoS ONE 2012;7(6):e39018.
M, Taylor JM, Feifer A et al. Combination of a novel gene expression signature with a clinical nomogram improves the prediction of survival in high-risk bladder cancer. Clin. Cancer Res. 2012;18(5):1323-1333.
RA, Krahn KN, Megens RT, et al. High resolution imaging of collagen organisation and synthesis using a versatile collagen specific probe. Journal of structural biology 2007; 159(3):392-9.
Krahn KN, Bouten CV, van Tuijl S, et al. Fluorescently labeled collagen binding proteins allow specific visualization of collagen in tissues and live cell culture. Analytical biochemistry
2006;350(2): 177-85.
R Development Core Team. R: A language and environment for statistical computing. In.
Vienna, Austria: R Foundation for Statistical Computing; 2008.
Efron B, Tibshirani R. Improvements on cross-validation: The .632+ bootstrap method. Journal of the American Statistical Association 1997;92(438):548-560.
Liang S, Huang C, Jia S, et al. Activated leukocyte cell adhesion molecule expression is up- regulated in the development of endometrioid carcinoma. Int. J. Gynecol. Cancer 2011;21(3):523- 528.
Verma A, Shukla NK, Deo SVS, et al. MEMD/ALCAM: a potential marker for tumor invasion and nodal metastasis in esophageal squamous cell carcinoma. Oncology 2005;68(4-6):462 70. Ihnen M, Wirtz RM, Kalogeras KT, et al. Combination of osteopontin and activated leukocyte cell
adhesion molecule as potent prognostic discriminators in HER2- and ER-negative breast cancer. British journal of cancer 2010; 103(7): 1048-56.
67. Ofori-Acquah SF, King J, Voelkel N, et at Heterogeneity of barrier function in the lung reflects diversity in endothelial cell junctions. Microvasc Res 2008;75(3):391 02.
68. Lee JS, Leem SH, Lee SY, et al. Expression signature of E2F1 and its associated genes predict superficial to invasive progression of bladder tumors. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2010;28(16):2660-7.
69. Sanchez-Carbayo M, Socci ND, Lozano J, et al. Defining molecular profiles of poor outcome in patients with invasive bladder cancer using oligonucleotide microarrays. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2006;24(5):778-89.
70. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, et al. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 2007;9(2): 166-80.
71. Chaker S, Kak I, Macmillan C, et al. Activated leukocyte cell adhesion molecule
(ALCAM/CD166) is a marker for thyroid cancer aggressiveness and disease-free survival.
Thyroid 2012.
72. Ishiguro F, Murakami H, Mizuno T, et al. Membranous expression of activated leukocyte cell adhesion molecule contributes to poor prognosis and malignant phenotypes of non-small-cell lung cancer. J. Surg. Res. 2013;179(l):24-32.
73. Tachezy M, Zander H, Gebauer F, et al. Activated leukocyte cell adhesion molecule (CD 166)— its prognostic power for colorectal cancer patients. J. Surg. Res. 2012;177(l):el5-20.
74. Rodriguez Alonso A, Pita Fernandez S, Gonzalez-Carrero J, et al. [Multivariate analysis of
recurrence and progression in stage Tl transitional-cell carcinoma of the bladder. Prognostic value of p53 and Ki67]. Actas urologicas espanolas 2003;27(2): 132-41.
75. Arai, A., Nosaka, Y., Kanda, E., Yamamoto, K., Miyasaka, N. and Miura, O. (2001).
Rapl is activated by erythropoietin or interleukin-3 and is involved in regulation of betal integrin-mediated hematopoietic cell adhesion. J Biol Chem 276, 10453-10462.
76. Aruffo, A., Bowen, M. A., Patel, D. D., Haynes, B. F., Starling, G. C, Gebe, J. A. and Bajorath, J. (1997). CD6-ligand interactions: a paradigm for SRCR domain function? Immunol Today 18, 498-504.
77. Ashby, W. J., Wikswo, J. P. and Zijlstra, A. (2012). Magnetically attachable stencils and the non-destructive analysis of the contribution made by the underlying matrix to cell migration. Biomaterials 33, 8189-8203.
78. Bailey, C. L., Kelly, P. and Casey, P. J. (2009). Activation of Rapl promotes prostate cancer metastasis. Cancer Res 69, 4962^1968.
79. Bessard, A., Fremin, C, Ezan, F., Coutant, A. and Baffet, G. (2007). MEK/ERK- dependent uPAR expression is required for motility via phosphorylation of P70S6K in human hepatocarcinoma cells. J Cell Physiol 212, 526-536.
80. Bivona, T. G., Wiener, H. FL, Ahearn, I. M., Silletti, J., Chiu, V. K. and Philips, M. R.
(2004). Rapl up-regulation and activation on plasma membrane regulates T cell adhesion. J Cell Biol 164, 461-470.
81. Boettner, B. and Van Aelst, L. (2009). Control of cell adhesion dynamics by Rapl
signaling. Curr Opin Cell Biol 21, 684-693.
82. Bos, J. L., de Rooij, J. and Reedquist, K. A. (2001). Rapl signalling: adhering to new models. Nat Rev Mol Cell Biol 2, 369-377.
83. Buhusi, M., Demyanenko, G. P., Jannie, K. M., Dalai, J., Darnell, E. P. B., Weiner, J. A. and Maness, P. F. (2009). ALCAM regulates mediolateral retinotopic mapping in the superior colliculus. J Neurosci 29, 15630-15641.
84. Cherfils, J. and Zeghouf, M. (2013). Regulation of small GTPases by GEFs, GAPs, and GDIs. Physiol. Rev. 93, 269-309.
85. Chometon, G., Zhang, Z.-G., Rubinstein, E., Boucheix, C, Mauch, C. and Aumailley, M. (2006). Dissociation of the complex between CD151 and laminin-binding integrins permits migration of epithelial cells. Exp Cell Res 312, 983-995.
86. Copeland, B. T., Bowman, M. J. and Ashman, L. K. (2012). Genetic Ablation of the Tetraspanin Cdl51 Reduces Spontaneous Metastatic Spread of Prostate Cancer in the TRAMP Model. Mol Cancer Res 11, 95-105.
87. Crawford, N. P. S., Ziogas, A., Peel, D. J., Hess, J., Anton-Culver, H. and Hunter, K. W.
(2006). Germline polymorphisms in SIPA1 are associated with metastasis and other indicators of poor prognosis in breast cancer. Breast Cancer Res 8, R16.
88. Dedhar, S., Saulnier, R., Nagle, R. and Overall, C. M. (1993). Specific alterations in the expression of alpha 3 beta 1 and alpha 6 beta 4 integrins in highly invasive and metastatic variants of human prostate carcinoma cells selected by in vitro invasion through reconstituted basement membrane. Clin Exp Metastasis 11, 391-400.
89. Deng, X., Li, Q., Hoff, J., Novak, M., Yang, H., Jin, H., Erfani, S. F., Sharma, C, Zhou, P., Rabinovitz, I., et al. (2012). Integrin-associated CD151 drives ErbB2-evoked mammary tumor onset and metastasis. Neoplasia 14, 678-689.
90. Geback, T., Schulz, M. M. P., Koumoutsakos, P. and Detmar, M. (2009). TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays.
91. Gilsanz, A., Sanchez-Martin, L., Gutierrez-Lopez, M. D., Ovalle, S., Machado-Pineda, Y., Reyes, R., Swart, G. W., Figdor, C. G., Lafuente, E. M. and Cabanas, C. (2013). ALCAM/CD166 adhesive function is regulated by the tetraspanin CD9. Cell Mol Life Sci 70, 475-493.
92. Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C, Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., et al. (1999). Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286, 531-537.
93. Han, J., Lim, C. J., Watanabe, N., Soriani, A., Ratnikov, B., Calderwood, D. A., Puzon- McLaughlin, W., Lafuente, E. M., Boussiotis, V. A., Shattil, S. J., et al. (2006).
Reconstructing and deconstructing agonist- induced activation of integrin alphallbbeta3. Curr Biol 16, 1796-1806.
94. Hansen, A. G., Freeman, T. J., Arnold, S. A., Starchenko, A., jones-paris, C. R., Gilger, M. A., Washington, M. K., Fan, K.-H., Shyr, Y., Beauchamp, R. D., et al. (2013).
Elevated ALCAM Shedding in Colorectal Cancer Correlates with Poor Patient Outcome. Cancer Res 73, 2955-2964.
95. Hemler, M. E. (2005). Tetraspanin functions and associated microdomains. Nat Rev Mol Cell Biol 6, 801-81 1.
96. Hemler, M. E. (2008). Targeting of tetraspanin proteins - potential benefits and
strategies. Nature reviews Drug discovery 7, 747-758.
97. Hunter, K. W. (2003). Allelic diversity in the host genetic background may be an
important determinant in tumor metastatic dissemination. Cancer Lett 200, 97-105.
98. Ikeyama, S., Koyama, M., Yamaoko, M., Sasada, R. and Miyake, M. (1993).
Suppression of cell motility and metastasis by transfection with human motility -related protein (MRP-1/CD9) DNA. J Exp Med 177, 1231-1237.
99. Jeon, T. J., Lee, D.-J., Merlot, S., Weeks, G. and Firtel, R. A. (2007). Rapl controls cell adhesion and cell motility through the regulation of myosin II. J Cell Biol 176, 1021— 1033.
100. Johnson, J. L., Winterwood, N., DeMali, K. A. and Stipp, C. S. (2009). Tetraspanin CD 151 regulates RhoA activation and the dynamic stability of carcinoma cell-cell contacts. J Cell Sci 122, 2263-2273.
101. King, J. A., Tan, F., Mbeunkui, F., Chambers, Z., Cantrell, S., Chen, H., Alvarez, D., Shevde, L. A. and Ofori-Acquah, S. F. (2010). Mechanisms of transcriptional regulation and prognostic significance of activated leukocyte cell adhesion molecule in cancer. Mol
Cancer 9, 266.
102. Kitayama, H., Matsuzaki, T., Ikawa, Y. and oda, M. (1990). Genetic analysis of the Kirsten-ras-revertant 1 gene: potentiation of its tumor suppressor activity by specific point mutations. Proc Natl Acad Sci USA 87, 4284^1288.
103. Kitayama, H., Sugimoto, Y., Matsuzaki, T., Ikawa, Y. and Noda, M. (1989). A ras- related gene with transformation suppressor activity. Cell 56, 77-84.
104. Kohno, M., Hasegawa, H., Miyake, M., Yamamoto, T. and Fujita, S. (2002). CD151 enhances cell motility and metastasis of cancer cells in the presence of focal adhesion kinase. Int J Cancer 97, 336-343.
105. Kooistra, M. R. FL, Dube, N. and Bos, J. L. (2007). Rapl : a key regulator in cell-cell junction formation. J Cell Sci 120, 17-22.
106. Lammerding, J., Kazarov, A. R., Huang, H., Lee, R. T. and Hemler, M. E. (2003).
Tetraspanin CD151 regulates alpha6betal integrin adhesion strengthening. Proc Natl Acad Sci USA 100, 7616-7621.
107. Li, Q., Yang, X. H., Xu, F., Sharma, C, Wang, H.-X., Knoblich, K., Rabinovitz, I., Granter, S. R. and Hemler, M. E. (2012). Tetraspanin CD151 plays a key role in skin squamous cell carcinoma. Oncogene.
108. Lifsted, T., Le Voyer, T., Williams, M., Muller, W., Klein-Szanto, A., Buetow, K. H. and Hunter, K. W. (1998). Identification of inbred mouse strains harboring genetic modifiers of mammary tumor age of onset and metastatic progression. Int J Cancer 77, 640-644.
109. Liu, J. J., Stockton, R. A., Gingras, A. R., Ablooglu, A. J., Han, J., Bobkov, A. A. and Ginsberg, M. H. (2011). A mechanism of Rapl -induced stabilization of endothelial cell- cell junctions. Mol Biol Cell 22, 2509-2519.
110. Nishiuchi, R., Sanzen, N., Nada, S., Sumida, Y., Wada, Y., Okada, M., Takagi, J., Hasegawa, H. and Sekiguchi, K. (2005). Potentiation of the ligand-binding activity of integrin alpha3betal via association with tetraspanin CD151. Proc Natl Acad Sci USA 102, 1939-1944.
111. Ossowski, L., Russo, H., Gartner, M. and Wilson, E. L. (1987). Growth of a human carcinoma (HEp3) in nude mice: rapid and efficient metastasis. J Cell Physiol 133, 288- 296.
112. Palmer, D. T. and Zijlstra, A. (201 1). CD151. UCSD-Nature Molecule Pages.
113. Palmer, T. D., Ashby, W. J., Lewis, J. D. and Zijlstra, A. (201 la). Targeting tumor cell motility to prevent metastasis. Adv Drug Deliv Rev 63, 568-581.
114. Palmer, T. D., Lewis, J. and Zijlstra, A. (2011b). Quantitative analysis of cancer metastasis using an avian embryo model. J Vis Exp.
115. Palmer, T. D., Martinez, C. FL, Vasquez, C, Hebron, K. E., jones-paris, C. R., Arnold, S.
A., Chan, S. M., Chalasani, V., gomez-lemus, J. A., Williams, A. K., et al. Integrin-free tetraspanin CD 151 can inhibit tumor cell motility upon clustering and is a clinical indicator of prostate cancer progression. Cancer Res Submitted.
116. Partin, A. W., Schoeniger, J. S., Mohler, J. L. and Coffey, D. S. (1989). Fourier analysis of cell motility: correlation of motility with metastatic potential. Proc Natl Acad Sci USA 86, 1254-1258.
117. Price, L. S., Hajdo-Milasinovic, A., Zhao, J., Zwartkruis, F. J. T., Collard, J. G. and Bos, J. L. (2004). Rapl regulates E-cadherin-mediated cell-cell adhesion. J Biol Chem 279, 35127-35132.
118. Radford, K. J., Thorne, R. F. and Hersey, P. (1997). Regulation of tumor cell motility and migration by CD63 in a human melanoma cell line. J Immunol 158, 3353-3358.
119. Reedquist, K. A., Ross, E., Koop, E. A., Wolthuis, R. M., Zwartkruis, F. J., van Kooyk, Y., Salmon, M., Buckley, C. D. and Bos, J. L. (2000). The small GTPase, Rapl, mediates CD31-induced integrin adhesion. J Cell Biol 148, 1 151-1158.
120. Ross, S. H., Spanjaard, E., Post, A., Vliem, M. J., Kristyanto, H., Bos, J. L. and de Rooij, J. (2012). Rapl can bypass the FAK-Src-Paxillin cascade to induce cell spreading and focal adhesion formation. PLoS ONE 7, e50072.
121. Rubinstein, E., Charrin, S. and Tomlinson, M. G. (2013). Organisation of the
Tetraspanin Web. 47-90.
122. Silletti, S., Yebra, M., Perez, B., Cirulli, V., McMahon, M. and Montgomery, A. M. P.
(2004). Extracellular signal-regulated kinase (ERK)-dependent gene expression contributes to LI cell adhesion molecule-dependent motility and invasion. J Biol Chem 279, 28880-28888.
123. Simpson, K. J., Selfors, L. M., Bui, J., Reynolds, A., Leake, D., Khvorova, A. and
Brugge, J. S. (2008). Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nat Cell Biol 10, 1027-1038.
124. Takeda, Y., Li, Q., Kazarov, A. R., Epardaud, M., Elpek, K., Turley, S. J. and Hemler, M. E. (2011). Diminished metastasis in tetraspanin CD 151 -knockout mice. Blood 1 18, 464-472.
125. Takino, J., Nagamine, K. and Hori, T. (2013). Ras guanyl nucleotide releasing protein 2 affects cell viability and cell-matrix adhesion in ECV304 endothelial cells. Cell Adh
Migr 7.
126. Testa, J. E., Brooks, P. C, Lin, J. M. and Quigley, J. P. (1999). Eukaryotic expression cloning with an antimetastatic monoclonal antibody identifies a tetraspanin (PETA- 3/CD151) as an effector of human tumor cell migration and metastasis. Cancer Res 59, 3812-3820.
127. van Kilsdonk, J. W. J., Takahashi, N., Weidle, U., Burtscher, H., Jarry, J., Daha, M. R., Swart, G. W. M. and van Kempen, L. C. L. T. (2012). Modulation of activated leukocyte cell adhesion molecule-mediated invasion triggers an innate immune gene response in melanoma. J Invest Dermatol 132, 1462-1470.
128. Varzavand, A., Drake, J. M., Svensson, R. U., Herndon, M. E., Zhou, B., Henry, M. D. and Stipp, C. S. (2013). Integrin α3β1 regulates tumor cell responses to stromal cells and can function to suppress prostate cancer metastatic colonization. Clin Exp Metastasis 30, 541-552.
129. Winterwood, N. E., Varzavand, A., Meland, M. N., Ashman, L. K. and Stipp, C. S.
(2006). A critical role for tetraspanin CD151 in alpha3betal and alpha6beta4 integrin- dependent tumor cell functions on laminin-5. Mol Biol Cell 17, 2707-2721.
130. Yang, Y.-M., Zhang, Z.-W., Liu, Q.-M., Sun, Y.-F., Yu, J.-R. and Xu, W.-X. (2013).
Overexpression of CD151 Predicts Prognosis in Patients with Resected Gastric Cancer. PLoS ONE 8, e58990.
131. Yauch, R. L. and Hemler, M. E. (2000). Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem J 351 Pt 3, 629- 637.
132. Yauch, R. L., Berditchevski, F., Harler, M. B., Reichner, J. and Hemler, M. E. (1998).
Highly stoichiometric, stable, and specific association of integrin alpha3betal with CD151 provides a major link to phosphatidylinositol 4-kinase, and may regulate cell migration. Mol Biol Cell 9, 2751-2765.
133. Yunta, M. and Lazo, P. A. (2003). Tetraspanin proteins as organisers of membrane microdomains and signalling complexes. 15, 559-564.
134. Zhang, B., Kirov, S. and Snoddy, J. (2005). WebGestalt: an integrated system for
exploring gene sets in various biological contexts. Nucleic Acids Res 33, W741-8.
135. Zhang, X. A., Bontrager, A. L. and Hemler, M. E. (2001). Transmembrane-4
superfamily proteins associate with activated protein kinase C (PKC) and link PKC to specific beta(l) integrins. J Biol Chem 276, 25005-25013.
136. Zijlstra, A. (2010). Tetraspanins in Cancer. Cell-Extracellular Matrix Interactions in
Cancer.
137. Zijlstra, A., Lewis, J., Degryse, B., Stuhlmann, H. and Quigley, J. P. (2008). The
inhibition of tumor cell intravasation and subsequent metastasis via regulation of in vivo tumor cell motility by the tetraspanin CD151. Cancer Cell 13, 221-234.
138. Zimmerman, A. W., Nelissen, J. M. D. T., van Emst-de Vries, S. E., Willems, P. H. G.
M., de Lange, F., Collard, J. G., van Leeuwen, F. N. and Figdor, C. G. (2004).
Cytoskeletal restraints regulate homotypic ALCAM-mediated adhesion through
PKCalpha independently of Rho-like GTPases. J Cell Sci 117, 2841-2852.
139. Z511er, M. (2010). Tetraspanins and Cancer Metastasis. The Tumor Microenvironment.
140. Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nat Rev Cancer. 2002;2:584-93.
141. Pound CR, Partin AW, Eisenberger MA, Chan DW, Pearson JD, Walsh PC. Natural history of progression after PSA elevation following radical prostatectomy. JAMA. 1999;281 : 1591-7.
142. Jin J-K, Dayyani F, Gallick GE. Steps in prostate cancer progression that lead to bone metastasis. Int J Cancer. 2011 ; 128:2545-61.
143. van Kempen LC, Nelissen JM, Degen WG, Torensma R, Weidle UH, Bloemers HP, et al. Molecular basis for the homophilic activated leukocyte cell adhesion molecule (ALCAM)-ALCAM interaction. J Biol Chem. 2001 ;276:25783-90.
144. Pokutta S, Weis WI. Structure and mechanism of cadherins and catenins in cell-cell contacts. Annu Rev Cell Dev Biol. 2007;23 :237-61.
145. King JA, Ofori-Acquah SF, Stevens T, Al-Mehdi A-B, Fodstad O, Jiang WG. Activated leukocyte cell adhesion molecule in breast cancer: prognostic indicator. Breast Cancer Res. 2004;6:R478-87.
146. Lunter PC, van Kilsdonk JWJ, van Beek H, Cornelissen IMHA, Bergers M, Willems PHGM, et al. Activated leukocyte cell adhesion molecule (ALCAM/CD 166/MEMD), a novel actor in invasive growth, controls matrix metalloproteinase activity. Cancer Res. 2005;65:8801-8.
147. Li H, Jiang M, Honorio S, Patrawala L, Jeter CR, Calhoun-Davis T, et al. Methodologies in assaying prostate cancer stem cells. Methods Mol Biol. 2009;568:85-138.
148. Park SI, Kim S-J, McCauley LK, Gallick GE. Pre -clinical mouse models of human prostate cancer and their utility in drug discovery. Curr Protoc Pharmacol. 2010;Chapter 14:Unitl4.15.
149. Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tomlins SA, et al. Integrative
genomic and proteomic analysis of prostate cancer reveals signatures of metastatic progression. Cancer Cell. 2005;8:393^K)6.
150. Nakagawa T, Kollmeyer TM, Morlan BW, Anderson SK, Bergstralh EJ, Davis BJ, et al.
A Tissue Biomarker Panel Predicting Systemic Progression after PSA Recurrence Post- Definitive Prostate Cancer Therapy. PLoS ONE. Public Library of Science;
2008;3:e2318.
151. Kim ΓΥ, Ahn HJ, Zelner DJ, Shaw JW, Sensibar JA, Kim JH, et al. Genetic change in transforming growth factor beta (TGF-beta) receptor type I gene correlates with insensitivity to TGF-beta 1 in human prostate cancer cells. Cancer Res. 1996;56:44-8.
152. Wang SE, Xiang B, Guix M, Olivares MG, Parker J, Chung CH, et al. Transforming growth factor beta engages TACE and ErbB3 to activate phosphatidylinositol-3 kinase/Akt in ErbB2-overexpressing breast cancer and desensitizes cells to trastuzumab. Mol Cell Biol. 2008;28:5605-20.
153. Soond SM, Everson B, Riches DWH, Murphy G. ERK-mediated phosphorylation of Thr735 in TNFalpha-converting enzyme and its potential role in TACE protein trafficking. J Cell Sci. 2005; 1 18:2371-80.
154. Ott GR, Asakawa N, Lu Z, Anand R, Liu R-Q, Covington MB, et al. Potent,
exceptionally selective, orally bioavailable inhibitors of TNF-alpha Converting Enzyme (TACE): novel 2-substituted-lH-benzo[d]imidazol-l-yl)methyl)benzamide ΡΓ substituents. Bioorganic & Medicinal Chemistry Letters. 2008; 18: 1577-82.
155. Wang Y, Xue H, Cutz J-C, Bayani J, Mawji NR, Chen WG, et al. An orthotopic
metastatic prostate cancer model in SCID mice via grafting of a transplantable human prostate tumor line. Lab Invest. 2005;85: 1392-404.
156. Ofori-Acquah SF, King JA. Activated leukocyte cell adhesion molecule: a new paradox in cancer. Translational research : the journal of laboratory and clinical medicine.
2008; 151 : 122-8.
157. Karan D, Lin FC, Bryan M, Ringel J, Moniaux N, Lin M-F, et al. Expression of ADAMs (a disintegrin and metalloproteases) and TIMP-3 (tissue inhibitor of metalloproteinase-3) in human prostatic adenocarcinomas. Int J Oncol. 2003;23: 1365-71.
158. Jezierska A, Matysiak W, Motyl T. ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 2006; 12:BR263-73.
159. Buijs JT, Que I, L5wik CWGM, Papapoulos SE, van der Pluijm G. Inhibition of bone resorption and growth of breast cancer in the bone microenvironment. Bone.
2009;44:380-6.
160. Zijlstra A. Tetraspanins in Cancer. Cell-Extracellular Matrix Interactions in Cancer. 2010.
161. Wang HX, Li Q, Sharma C, Knoblich K, Hemler ME. Tetraspanin protein contributions to cancer. Biochem Soc Trans. 2011 ;39:547-52.
162. Hong I-K, Jin Y-J, Byun H-J, Jeoung D-I, Kim Y-M, Lee H. Homophilic interactions of Tetraspanin CD 151 up-regulate motility and matrix metalloproteinase-9 expression of human melanoma cells through adhesion-dependent c-Jun activation signaling pathways. J Biol Chem. 2006;281 :24279-92.
163. Stipp CS, Kolesnikova TV, Hemler ME. EWI-2 is a major CD9 and CD81 partner and member of a novel Ig protein subfamily. J Biol Chem. 2001;276:40545-54.
164. Yanez-Mo M, Barreiro O, Gonzalo P, Batista A, Megias D, Genis L, et al. MT1-MMP collagenolytic activity is regulated through association with tetraspanin CD151 in primary endothelial cells. Blood. 2008; 1 12:3217-26.
165. Kazarov AR, Yang X, Stipp CS, Sehgal B, Hemler ME. An extracellular site on
tetraspanin CD 151 determines alpha 3 and alpha 6 integrin-dependent cellular morphology. J Cell Biol. 2002; 158: 1299-309.
166. Novitskaya V, Romanska H, Dawoud M, Jones JL, Berditchevski F. Tetraspanin CD151 regulates growth of mammary epithelial cells in three-dimensional extracellular matrix: implication for mammary ductal carcinoma in situ. Cancer Res. 2010;70:4698-708.
167. Yang XH, Flores LM, Li Q, Zhou P, Xu F, Krop IE, et al. Disruption of laminin- integrin-CD 151 -focal adhesion kinase axis sensitizes breast cancer cells to ErbB2 antagonists. Cancer Res. 2010;70:2256-63.
168. Lau L-M, Wee JL, Wright MD, Moseley GW, Hogarth PM, Ashman LK, et al. The tetraspanin superfamily member CD 151 regulates outside-in integrin alphallbbeta3 signaling and platelet function. Blood. 2004; 104:2368-75.
169. Sachs N, Kreft M, van den Bergh Weerman MA, Beynon AJ, Peters TA, Weening JJ, et al. Kidney failure in mice lacking the tetraspanin CD151. J Cell Biol. 2006; 175:33-9.
170. Berditchevski F, Gilbert E, Griffiths MR, Fitter S, Ashman L, Jenner SJ. Analysis of the CD151-alpha3betal integrin and CD 151 -tetraspanin interactions by mutagenesis. J Biol Chem. 2001 ;276:41165-74.
171. Zhang XA, Kazarov AR, Yang X, Bontrager AL, Stipp CS, Hemler ME. Function of the tetraspanin CD151-alpha6betal integrin complex during cellular morphogenesis. Mol Biol Cell. 2002; 13 : 1-11.
172. Yamada M, Tamura Y, Sanzen N, Sato-Nishiuchi R, Hasegawa H, Ashman LK, et al.
Probing the interaction of tetraspanin CD151 with integrin alpha 3 beta 1 using a panel of monoclonal antibodies with distinct reactivities toward the CD 151 -integrin alpha 3 beta 1 complex. Biochem J. 2008;415:417-27.
173. Haeuw JF, Goetsch L, Bailly C, Corvaia . Tetraspanin CD 151 as a target for antibody- based cancer immunotherapy. Biochem Soc Trans. 201 1;39:553-8.
174. Serru V, Le Naour F, Billard M, Azorsa DO, Lanza F, Boucheix C, et al. Selective tetraspan-integrin complexes (CD81/alpha4betal, CD151/alpha3betal,
CD151/alpha6betal) under conditions disrupting tetraspan interactions. Biochem J [Internet]. 1999;340 ( Pt 1): 103— 11.
175. Geary SM, Cambareri AC, Sincock PM, Fitter S, Ashman LK. Differential tissue
expression of epitopes of the tetraspanin CD 151 recognised by monoclonal antibodies. Tissue Antigens. 2001;58: 141-53.
176. Sterk LMT, Geuijen CAW, van den Berg JG, Claessen N, Weening JJ, Sonnenberg A.
Association of the tetraspanin CD151 with the laminin-binding integrins alpha3betal, alpha6betal, alpha6beta4 and alpha7betal in cells in culture and in vivo.
2002; 115: 1 161-73.
177. Ossowski L, Reich E. Changes in malignant phenotype of a human carcinoma
conditioned by growth environment. Cell. 1983;33:323-33.
178. Marjoram RJ, Voss B, Pan Y, Dickeson SK, Zutter MM, (null), et al. Suboptimal
activation of protease-activated receptors enhances alpha2betal integrin-mediated platelet adhesion to collagen. J. Biol. Chem. 2009;284:34640-7.
179. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discovery. 2012;2:401^1.
180. Chandran UR, Ma C, Dhir R, Bisceglia M, Lyons-Weiler M, Liang W, et al. Gene expression profiles of prostate cancer reveal involvement of multiple molecular pathways in the metastatic process. 2007;7:21.
181. Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, et al.
Integrative molecular concept modeling of prostate cancer progression. Nat Genet. 2007;39:41-51.
182. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010; 18: 11-22.
183. Dezso Z, Nikolsky Y, Sviridov E, Shi W, Serebriyskaya T, Dosymbekov D, et al. A comprehensive functional analysis of tissue specificity of human gene expression. BMC
Biol. 2008;6:49.
184. Fogerty FJ, Akiyama SK, Yamada KM, Mosher DF. Inhibition of binding of fibronectin to matrix assembly sites by anti-integrin (alpha 5 beta 1) antibodies. J Cell Biol.
1990; 11 1 :699-708.
185. Offermanns S. Activation of platelet function through G protein-coupled receptors. Circ Res. 2006;99: 1293-304.
186. Nishiuchi R, Murayama O, Fujiwara H, Gu J, Kawakami T, Aimoto S, et al.
Characterization of the ligand-binding specificities of integrin alpha3betal and alpha6betal using a panel of purified laminin isoforms containing distinct alpha chains. J Biochem. 2003; 134:497-504.
187. Yang XH, Richardson AL, Torres-Arzayus MI, Zhou P, Sharma C, Kazarov AR, et al.
CD 151 accelerates breast cancer by regulating alpha 6 integrin function, signaling, and molecular organization. Cancer Res. 2008;68:3204-13.
188. Liu L, He B, Liu WM, Zhou D, Cox JV, Zhang XA. Tetraspanin CD151 promotes cell migration by regulating integrin trafficking. J Biol Chem. 2007;282:31631-42.
189. Ke H, Wang P, Yu W, Liu X, Liu C, Yang F, et al. Derivation, characterization and gene modification of cynomolgus monkey mesenchymal stem cells. Differentiation.
2009;77:256-62.
190. Tsujino K, Takeda Y, Arai T, Shintani Y, Inagaki R, Saiga H, et al. Tetraspanin CD151 protects against pulmonary fibrosis by maintaining epithelial integrity. Am J Respir Crit Care Med. 2012; 186: 170-80.
191. Palecek SP, Loftus JC, Ginsberg MH, Lauffenburger DA, Horwitz AF. Integrin-ligand binding properties govern cell migration speed through cell-substratum adhesiveness. Nature. 1997;385:537^K).
192. Sachs N, Sonnenberg A. Cell-matrix adhesion of podocytes in physiology and disease.
Nat Rev Nephrol. Nature Publishing Group; 2013;9:200-10.
Claims
1. A shed ALCAM label for use in the identification of shed ALCAM in a sample from a subject.
2. The label of claim 1, wherein the label includes an antibody.
3. The label of claim 1 or 2, wherein the label can produce a signal which can be detected.
4. The label of claim 3, wherein the signal is an optical signal.
5. The label of claim 3, wherein the optical signal includes fluorescence.
6. The label of any preceding claim, wherein the label comprises an antibody and a signal-producing moiety conjugated to the antibody.
7. The label of any preceding claim, wherein the label recognizes the C-terminal ALCAM, shed ALCAM, or a combination thereof.
8. The label of claim 1 to 6, wherein the label recognizes the N-terminal ALCAM, shed ALCAM, or a combination thereof.
9. The label of any preceding claim, wherein the label is detectable with the use of ELISA.
10. A method for characterizing and/or monitoring a cancer in a subject, comprising:
(a) providing a biological sample from the subject;
(b) determining a presence or an amount of shed ALCAM in the biological sample; and
(c) comparing the presence or the amount of the shed ALCAM in the biological sample to a reference, wherein the cancer is characterized and/or monitored based on a
measurable difference in the presence or the amount of the shed ALCAM from the biological sample as compared to the reference.
1 1. The method of claim 10, wherein the characterizing comprises providing a diagnosis, prognosis and/or theranosis of the cancer.
12. A method for evaluating treatment efficacy and/or progression of a cancer in a subject, comprising:
(a) providing a biological sample from the subject;
(b) determining a presence or an amount of shed ALCAM in the biological sample; and
(c) comparing the presence or the amount of the shed ALCAM to a reference, wherein the treatment efficacy and/or progression of the cancer is evaluated based on a measurable difference in the presence or the amount of the shed ALCAM as compared to the reference.
13. The method of any one of claims 10 to 12, and further comprising determining an amount of intact ALCAM.
14. The method of claim 13, and further comprising calculating a ratio of intact ALCAM to shed ALCAM.
15. The method of any one of claims 10 to 14, wherein the cancer is a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, and colorectal cancer.
16. The method of claim 15, wherein the cancer is urogenital cancer
17. The method of claim 15, wherein the cancer is bladder cancer.
18. The method of claim 15, wherein the cancer is renal cell cancer.
19. The method of claim 15, wherein the cancer is colorectal cancer.
20. The method of any one of claims 10 to 19, wherein the reference comprises a level of the shed ALCAM in one or more samples from one or more individuals without the cancer.
21. The method of any one of claims 10 to 19, wherein the reference comprises a level of the shed ALCAM in a sample from the subject taken over a time course.
22. The method of any one of claims 30 to 19, wherein the reference comprises a sample from the subject collected prior to initiation of treatment for the cancer and/or onset of the cancer and the biological sample is collected after initiation of the treatment or onset of the cancer.
23. The method of any one of claims 10 to 19 wherein the reference comprises a standard sample.
24. The method of any one of claims 10 to 19, wherein the reference comprises control data.
25. The method of any one of claims 10 to 24, wherein the amount of the shed ALCAM is increased relative to the reference.
26. The method of any one of claims 10 to 25, further comprising: providing a series of biological samples collected from the subject over a time course; and determining a presence or an amount of shed ALCAM in each of the series of biological samples.
27. The method of claim 26, wherein the series of biological samples comprises a first biological sample collected prior to initiation of treatment for the cancer and/or onset of the cancer and a second biological sample collected after initiation of the treatment or onset of the cancer.
28. The method of any one of claims 10 to 27, wherein the biological sample comprises blood, serum, plasma, a tissue sample (including, but not limited to, a formalin-fixed tissue sample, a biopsy sample, or a sample obtained at the time of or from a resection), and cells recovered from stool.
29. The method of any one of claims 10 to 28, wherein the biological sample comprises tissue.
30. The method of any one of claims 10 to 29, wherein the biological sample comprises urine.
31. The method of any one of claims 10 to 30, wherein the biological sample comprises serum.
32. The method of any one of claims 10 to 31 , wherein providing the biological sample from the subject comprises extracting the sample.
33. The method of any one of claims 10 to 32, wherein providing the biological sample from the subject comprises isolating the shed ALCAM from the sample.
34. The method of any one of claims 10 to 33, further comprising contacting the biological sample with an antibody that selectively binds shed ALCAM.
35. The method of claim 34, wherein the antibody recognizes the C-terminal ALCAM, shed ALCAM, or a combination thereof.
36. The method of claim 34, wherein the antibody recognizes the N-terminal ALCAM, shed ALCAM, or a combination thereof.
37. The method of any one of claims 10 to 36, wherein determining a presence or an amount shed ALCAM in the biological sample includes use of an ELISA.
38. The method of any one of claims 10 to 37, wherein the method is performed in vitro.
39. The method of any one of claims 10 to 38, further comprising selecting a treatment or modifying a treatment for the cancer based on the amount of the shed ALCAM determined.
40. The method of any one of claims 10 to 39, wherein a reagent is used.
41. A kit comprising a reagent to carry out the method of any of claims 10 to 40.
42. The kit of claim 41 , comprising an antibody that selectively binds shed ALCAM.
43. The kit of claim 42, wherein the antibody recognizes the C-terminal ALCAM.
44. The kit of claim 42, wherein the antibody recognizes the N-terminal ALCAM.
45. The kit of any one of claims 41 to 44, further comprising a reference standard sample.
46. The kit of any one of claims 41 to 45, further comprising reference control data.
47. The kit of claim 45 or 46, wherein the standard sample or the control data is for a cancer.
48. The kit of claim 45 or 46, wherein the standard sample or the control data is for non- cancer.
49. The kit of claim 48, further comprising a standard sample or control data for a cancer.
50. The kit of any one of claims 41 to 49, wherein the cancer is a precancerous or cancerous pathology selected from the group consisting of urogenital cancer, bladder cancer, renal cell cancer, and colorectal cancer.
51. The kit of claim 50, wherein the cancer is urogenital cancer
52. The kit of claim 50, wherein the cancer is bladder cancer.
53. The kit of claim 50, wherein the cancer is renal cell cancer.
54. The kit of claim 50, wherein the cancer is colorectal cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/433,519 US10585102B2 (en) | 2012-10-11 | 2013-10-11 | Characterization of cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261712556P | 2012-10-11 | 2012-10-11 | |
| US61/712,556 | 2012-10-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014059372A1 true WO2014059372A1 (en) | 2014-04-17 |
Family
ID=50477956
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/064696 Ceased WO2014059372A1 (en) | 2012-10-11 | 2013-10-11 | Characterization of cancer using detection of activated leukocyte cell adhesion molecule (alcam) shedding |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10585102B2 (en) |
| WO (1) | WO2014059372A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733056A (en) * | 2020-06-18 | 2020-10-02 | 上海交通大学 | Microfluidic chip integrating circulating tumor cell isolation and single-cell immunoblotting |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES3015226T3 (en) | 2012-08-16 | 2025-04-30 | Veracyte Sd Inc | Prostate cancer prognosis using biomarkers |
| AU2015373423A1 (en) * | 2014-12-30 | 2017-05-18 | Ventana Medical Systems, Inc. | Systems and methods for co-expression analysis in immunoscore computation |
| US11414708B2 (en) | 2016-08-24 | 2022-08-16 | Decipher Biosciences, Inc. | Use of genomic signatures to predict responsiveness of patients with prostate cancer to post-operative radiation therapy |
| WO2018165600A1 (en) | 2017-03-09 | 2018-09-13 | Genomedx Biosciences, Inc. | Subtyping prostate cancer to predict response to hormone therapy |
| AU2018310987A1 (en) | 2017-08-04 | 2020-02-27 | Decipher Biosciences, Inc. | Use of immune cell-specific gene expression for prognosis of prostate cancer and prediction of responsiveness to radiation therapy |
| US20230115828A1 (en) * | 2020-04-03 | 2023-04-13 | Decipher Biosciences, Inc. | Genomic classifiers for prognosing and treating clinically aggressive luminal bladder cancer |
| WO2025255460A1 (en) * | 2024-06-06 | 2025-12-11 | Ampa Biosciences Inc. | Methods for early cancer detection using exosomal pcna biomarkers |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6022540A (en) * | 1997-09-04 | 2000-02-08 | Osiris Therapeutics, Inc. | Ligands that modulate differentiation of mesenchymal stem cells |
| WO2003093443A2 (en) * | 2002-05-03 | 2003-11-13 | Raven Biotechnologies, Inc. | Alcam and alcam modulators |
| US20110151580A1 (en) * | 2007-11-06 | 2011-06-23 | University Health Network | Method for the detection of breast cancer by determining alcam and/or bcam levels in a patient |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US105902A (en) * | 1870-08-02 | Improvement in grading and ditching plows |
-
2013
- 2013-10-11 US US14/433,519 patent/US10585102B2/en active Active
- 2013-10-11 WO PCT/US2013/064696 patent/WO2014059372A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6022540A (en) * | 1997-09-04 | 2000-02-08 | Osiris Therapeutics, Inc. | Ligands that modulate differentiation of mesenchymal stem cells |
| WO2003093443A2 (en) * | 2002-05-03 | 2003-11-13 | Raven Biotechnologies, Inc. | Alcam and alcam modulators |
| US20110151580A1 (en) * | 2007-11-06 | 2011-06-23 | University Health Network | Method for the detection of breast cancer by determining alcam and/or bcam levels in a patient |
Non-Patent Citations (2)
| Title |
|---|
| HANSEN ET AL.: "Elevated ALCAM shedding in colorectal cancer correlates with poor patient out come", CANCER RESERCH, vol. 73, no. 10, 28 March 2013 (2013-03-28), pages 2955 - 2964 * |
| MICCICHE ET AL.: "Activated leukocyte cell adhesion molecule expression and shedding in thyroid tumors, Article No.e17141", PLOS ONE, vol. 6, no. 2, 22 February 2011 (2011-02-22), pages 1 - 9 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733056A (en) * | 2020-06-18 | 2020-10-02 | 上海交通大学 | Microfluidic chip integrating circulating tumor cell isolation and single-cell immunoblotting |
| CN111733056B (en) * | 2020-06-18 | 2022-09-27 | 水熊健康科技(南通)有限公司 | Micro-fluidic chip integrating circulating tumor cell separation and single-cell immunoblotting |
Also Published As
| Publication number | Publication date |
|---|---|
| US10585102B2 (en) | 2020-03-10 |
| US20150253331A1 (en) | 2015-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10585102B2 (en) | Characterization of cancer using detection of activated leukocyte cell adhesion molecule (ALCAM) shedding | |
| US20250290153A1 (en) | Methods of diagnosing, determining the progression of, and treating a prostate cancer | |
| Ding et al. | Perturbed myoepithelial cell differentiation in BRCA mutation carriers and in ductal carcinoma in situ | |
| Zhang et al. | CPNE8 promotes gastric cancer metastasis by modulating focal adhesion pathway and tumor microenvironment | |
| ES2691213T3 (en) | Cancer treatment | |
| JP2013520958A (en) | Method of using AXL as a biomarker for epithelial-mesenchymal transition | |
| JP5893037B2 (en) | Means and methods for the diagnosis of cancer using antibodies that specifically bind to BRAFV600E | |
| AU2020343723B2 (en) | Methods for confirming detection and evaluating the progression of a prostate cancer and related therapies | |
| CN103238069B (en) | BARD1 isoforms and their application in lung and colorectal cancer | |
| EP2449383B1 (en) | Diagnostic method for predicting the risk of cancer recurrence based on histone macroh2a isoforms | |
| JP2014531020A (en) | Expression of BIN1 as a marker for cancer | |
| Zhou et al. | Concurrent alterations of RAGE, RECK, and MMP9 protein expression are relevant to Epstein-Barr virus infection, metastasis, and survival in nasopharyngeal carcinoma | |
| JP7065539B2 (en) | Prognosis biomarker for colorectal cancer | |
| JP7114112B2 (en) | Prognostic biomarkers for lung cancer | |
| WO2011129427A1 (en) | Diagnostic agent and therapeutic agent for cancer | |
| JP6695586B2 (en) | Diagnostic agent and kit for use in predicting recurrence risk of pancreatic cancer, and prediction method | |
| JP2023544387A (en) | GDF3 as a biomarker and biotarget in postischemic cardiac remodeling | |
| CN103852585B (en) | Rna plymerase ii the 5th subunit Function protein is preparing the application carried out in the reagent of prognosis of HCC or complementary TACE prognosis | |
| JP6833226B2 (en) | Prognosis biomarker for colorectal cancer | |
| HK40049121A (en) | Methods for detecting prostate cancer | |
| WO2025027126A1 (en) | New populations of fibroblasts and macrophages as prognosis markers for detection of fibroblasts associated diseases | |
| JP2015232441A (en) | Cancer detection method, diagnostic agent and diagnosis kit, and pharmaceutical composition for cancer treatment | |
| JP5954796B2 (en) | Cancer therapeutic agent and method for determining prognosis of cancer | |
| Liu et al. | C/EBPB-dependent Adaptation to Palmitic Acid Promotes Stemness in Hormone Receptor Negative Breast Cancer | |
| Silye et al. | Joint Annual Meeting SGPath–ÖGP/IAP Austria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13845866 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14433519 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13845866 Country of ref document: EP Kind code of ref document: A1 |










