WO2014059031A2 - Nad biosynthesis and precursors in the prevention and treatment of inflammation - Google Patents
Nad biosynthesis and precursors in the prevention and treatment of inflammation Download PDFInfo
- Publication number
- WO2014059031A2 WO2014059031A2 PCT/US2013/064150 US2013064150W WO2014059031A2 WO 2014059031 A2 WO2014059031 A2 WO 2014059031A2 US 2013064150 W US2013064150 W US 2013064150W WO 2014059031 A2 WO2014059031 A2 WO 2014059031A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hif
- mitochondrial
- sirtl
- mice
- nad
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
- A01K2217/203—Animal model comprising inducible/conditional expression system, e.g. hormones, tet
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0368—Animal model for inflammation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/02—Pentosyltransferases (2.4.2)
- C12Y204/02012—Nicotinamide phosphoribosyltransferase (2.4.2.12), i.e. visfatin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07001—Nicotinamide-nucleotide adenylyltransferase (2.7.7.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the invention relates to methods for treatment and prevention of diseases or disorders associated with mitochondrial dysfunction by administering inhibitors of HIFl-a and/or agents that increase levels of NAD+.
- the invention relates to methods for treatment and prevention of disorders associated with inflammation by administering agents that increase levels of NAD+.
- Aging is characterized by a progressive decline in cellular and tissue homeostasis leading to a variety of age-related diseases that limit lifespan. Although improvements in sanitation, diet and medicines over the past 100 years have produced dramatic
- Mitochondria are highly dynamic organelles that move throughout the cell and undergo structural transitions, changing the length, morphology, shape and size. Moreover, mitochondria are continuously eliminated and regenerated in a process known as mitochondrial biogenesis. Over the past 2 billion years, since eukaryotes subsumed the a- proteobacterial ancestor of mitochondria, most mitochondrial genes have been transferred to the nuclear genome, where regulation is better integrated. However, the mitochondrial genome still encodes rRNAs, tRNAs, and 13 subunits of the electron transport chain (ETC). Functional communication between the nuclear and mitochondrial genomes is therefore essential for mitochondrial biogenesis, efficient oxidative phosphorylation, and normal health. Failure to maintain the stoichiometry of ETC complexes is exemplified by mitochondrial disorders such as Leber's hereditary optic neuropathy (LHON),
- mitochondrial encephalomyopathy lactic acidosis and stroke like episode syndrome (MELAS), myoclonic epilepsy with ragged red fibers (MERRF), and Leigh Syndrome.
- MELAS lactic acidosis and stroke like episode syndrome
- MERRF myoclonic epilepsy with ragged red fibers
- mitochondrial homeostasis is believed to be an underlying cause of aging and the etiology of numerous age-related diseases (de Moura et al., 2010; Figueiredo et al., 2009; Sahin et al., 2011; Schulz et al., 2007; Wallace et al., 2010). Despite its importance, there is still a great deal of controversy as to why age induces the disruption of mitochondrial homeostasis and how this process might be slowed or reversed.
- compositions and methods for improving metabolism and mitochondrial function in aging tissues would be useful for the treatment of age related and mitochondrial diseases, as well as for increasing stress resistance, improving resistance to hypoxia and extending the lifespan of organisms and cells.
- NAD+ is an essential co-factor for several important enzymes (Canto and Auwerx, 2011).
- NAD+ is generated from nicotinamide in a salvage pathway wherein nicotinamide phosphoribosyltransferase (NAMPT) converts nicotinamide to nicotinamide mononucleotide (NMN) which is then converted to NAD+ by nicotinamide mononucleotide adenylyltransferase (NMNAT) (Canto and Auwerx, 2011).
- NAMPT nicotinamide phosphoribosyltransferase
- Hypoxia- Inducible Factor la interacts with the transcription factor c-Myc to inhibit c-Myc activity, causing genome asynchrony and the decline in mitochondrial function during aging.
- Reducing the ability of HIF-la to inhibit c- Myc activity, such as by disrupting the formation of the complex containing HIF- la and c- Myc, therefore conveys beneficial effects on metabolism, cellular fitness, survival (e.g., survival under hypoxic conditions) and mitochondrial function in aged tissues.
- agents that reduce inhibition of c-Myc activity by HIF- la and/or disrupt the formation of a complex between HIF-la and c-Myc are useful for the treatment of age-related and mitochondrial diseases, including Alzheimer's disease, diabetes mellitus, heart disease, obesity, osteoporosis, Parkinson's disease and stroke.
- Such agents are also therefore useful for extending the life span, increasing the stress resistance and improving resistance to hypoxia of a subject (e.g., a human, a non-human animal and/or a plant) or a cell.
- the instant invention relates to a method of treating or preventing an age-related disease and/or a mitochondrial disease by administration of an agent that reduces inhibition of c-Myc activity by HIF- la.
- the agent inhibits the formation of a complex between HIF- la and c-Myc.
- the agent induces a conformational change in HIF- la or c-Myc that abrogates their interaction and/or alters the ability of HIF- la to affect c-Myc activity, protein levels or cell
- the age-related disease is Alzheimer's disease, amniotropic lateral sclerosis, arthritis, atherosclerosis, cachexia, cancer, cardiac
- hypertrophy cardiac failure, cardiac hypertrophy, cardiovascular disease, cataracts, colitis, chronic obstructive pulmonary disease, dementia, diabetes mellitus, frailty, heart disease, hepatic steatosis, high blood cholesterol, high blood pressure, Huntington' s disease, hyperglycemia, hypertension, infertility, inflammatory bowel disease, insulin resistance disorder, lethargy, metabolic syndrome, muscular dystrophy, multiple sclerosis, neuropathy, , nephropathy, obesity, osteoporosis, Parkinson' s disease, psoriasis, retinal degeneration, sarcopenia, sleep disorders, sepsis and/or stroke.
- the mitochondrial disease is mitochondrial myopathy, diabetes mellitus and deafness (DAD), Leber's hereditary optic neuropathy (LHON), Leigh syndrome, neuropathy, ataxia, retinitis pigmentosa and petosis (NARP), myoclonic epilepsy with ragged red fibers (MERRF), myoneurogenic gastrointestinal encephalopathy (MNGIE), mitochondrial myopathy, encephalomyopathy, lactic acidosis, stroke-like symptoms (MELAS), Kearns-Sayre syndrome (KSS), chronic progressive external opthalmoplegia (CPEO) and/or mtDNA depletion.
- DAD diabetes mellitus and deafness
- LHON Leber's hereditary optic neuropathy
- NARP Leigh syndrome
- MNARP myoclonic epilepsy with ragged red fibers
- MNGIE myoneurogenic gastrointestinal encephalopathy
- MELAS stroke-like symptoms
- KSS Kearns-Sa
- the instant invention relates to a method of increasing the life span and/or increasing the stress resistance of a subject by administration of an agent that reduces inhibition of c-Myc activity by HIF- ⁇ .
- the agent inhibits the formation of a complex between HIF- ⁇ and c-Myc.
- the agent induces a conformational change in HIF- ⁇ or c-Myc that abrogates their interaction and/or alters the ability of HIF- ⁇ to affect c-Myc activity, protein levels or cell
- administration of the agent increases the resistance of cells in the organism against stress (e.g., heat shock, osmotic stress, DNA damaging agents and inadequate nitrogen levels).
- stress e.g., heat shock, osmotic stress, DNA damaging agents and inadequate nitrogen levels.
- the invention relates to extending the life span or increasing the stress resistance of a cell by contacting the cell with an agent that inhibits the formation of a complex between HIF- ⁇ and c-Myc.
- the present invention relates to a method of improving the survival of a cell, organ and/or tissue under hypoxic conditions.
- the method includes contacting the cell, organ and/or tissue with an agent that reduces inhibition of c-Myc activity by HIF- ⁇ .
- the agent inhibits the formation of a complex between HIF- ⁇ and c-Myc.
- the agent induces a conformational change in HIF- ⁇ or c-Myc that abrogates their interaction and/or alters the ability of HIF- ⁇ to affect c-Myc activity, protein levels or cell localization.
- the cell, organ and/or tissue has been exposed to a hypoxic
- the cell, organ and/or tissue is within a subject (e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease, reperfusion or stroke) who is administered the agent.
- a subject e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease, reperfusion or stroke
- a subject e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease, reperfusion or stroke
- the cell is being cultured in vitro.
- the cell is a neuron, a cardiac myocyte, a skeletal myocyte, an iPS cell, blood cell, germ cell or germ cell precursor.
- the present invention relates to a method of treating or preventing damage to a tissue or organ that has been exposed to hypoxia in a subject by administering an agent described herein to the subject.
- the subject is suffering from or has suffered from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease reperfusion or a stroke.
- the agent is an isolated antibody or antigen binding fragment thereof that specifically binds to a domain in HIF- ⁇ that contributes to complex formation with c-Myc.
- the antibody or antigen binding fragment thereof binds to an epitope of human HIF- la located within amino acids 167-329 of the HIF- la protein.
- the antibody or antigen binding fragment thereof can be monoclonal, polyclonal, chimeric, humanized and/or human.
- the antibody or antigen binding fragment thereof is a full length immunoglobulin molecule; an scFv; a Fab fragment; an Fab' fragment; an F(ab')2; an Fv; a NANOBODY®; or a disulfide linked Fv.
- the antibody or antigen binding fragment thereof binds to HIF- la with a dissociation constant of no greater than about 10 "6 M, 10 "7 M, 10 ⁇ 8 M or 10 "9 M.
- the antibody or antigen binding fragment thereof inhibits the formation of a complex between HIF- la and c-Myc.
- the agent is an isolated soluble polypeptide that includes at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive amino acids of the HIF- la domain that contributes to complex formation with c-Myc.
- the isolated soluble polypeptide includes at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive amino acids of one of SEQ ID NO: 11-20.
- the polypeptide comprises one of SEQ ID NO: 11-20.
- the polypeptide also includes an immunoglobulin constant domain (e.g., a human immunoglobulin constant domain).
- the polypeptide binds to c-Myc with a dissociation constant of no greater than about 10 "6 M, 10 "7 M, 10 ⁇ 8 M or 10 "9 M.
- the agent is a small molecule.
- the small molecule binds the HIF-l domain that contributes to complex formation with c- Myc.
- the small molecule binds to human HIF-la at a location within amino acids 167-329 of the HIF-la protein.
- the small molecule is attached to an antibody, protein or a peptide.
- the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance.
- the method comprises forming a test reaction mixture that includes a HIF-la polypeptide or fragment thereof, an c-Myc polypeptide or fragment thereof and a test agent.
- the method includes the step of incubating the test reaction mixture under conditions conducive for the formation of a complex between the HIF-la polypeptide or fragment thereof and the c-Myc polypeptide or fragment thereof.
- the test reaction includes a cell lysate.
- the method includes the step of determining the amount of the complex in the test reaction mixture.
- a test agent that reduces the amount of the complex in the test reaction mixture compared to the amount of the complex in a control reaction mixture is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance.
- the HIF-la polypeptide or fragment thereof comprises an amino acid sequence of one of SEQ ID NO: 11-20.
- the test agent is an antibody, a protein, a peptide or a small molecule.
- the test agent is a member of a library of test agents.
- control reaction mixture is substantially identical to the test reaction mixture except that the control reaction mixture does not comprise a test agent. In certain embodiments the control reaction mixture is substantially identical to the test reaction mixture except that the control reaction mixture comprises a placebo agent instead of a test agent.
- the test reaction mixture is formed by adding the test agent to a mixture comprising the HIF-la polypeptide or fragment thereof and the c-Myc polypeptide or fragment thereof. In certain embodiments the test reaction mixture is formed by adding the HIF-la polypeptide or fragment thereof to a mixture comprising the test agent and the c-Myc polypeptide or fragment thereof. In certain embodiments the test reaction mixture is formed by adding the c-Myc polypeptide or fragment thereof to a mixture comprising the test agent and the HIF- ⁇ polypeptide or fragment thereof.
- the HIF- ⁇ polypeptide or fragment thereof is anchored to a solid support in the test reaction mixture.
- the test reaction mixture is incubated under conditions conducive to the binding of the c-Myc polypeptide or fragment thereof to the anchored HIF- ⁇ polypeptide or fragment thereof.
- the method also includes the step of isolating c-Myc polypeptide or fragment thereof bound to the HIF- ⁇ polypeptide or fragment thereof from c-Myc polypeptide or fragment thereof not bound to the HIF- la polypeptide or fragment thereof.
- the amount of complex in the test reaction mixture is determined by detecting the amount of c-Myc polypeptide or fragment thereof bound to the HIF- la polypeptide or fragment thereof.
- the c-Myc polypeptide or fragment thereof is linked (e.g. bound either directly or indirectly) to a detectable moiety (e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.).
- a detectable moiety e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.
- the c-Myc polypeptide or fragment thereof is anchored to a solid support in the test reaction mixture.
- the test reaction mixture is incubated under conditions conducive to the binding of the HIF- la polypeptide or fragment thereof to the anchored c-Myc polypeptide or fragment thereof.
- the method also includes the step of isolating HIF- la polypeptide or fragment thereof bound to the c-Myc polypeptide or fragment thereof from HIF- la polypeptide or fragment thereof not bound to the c-Myc polypeptide or fragment thereof.
- the amount of complex in the test reaction mixture is determined by detecting the amount of HIF- la polypeptide or fragment thereof bound to the c-Myc polypeptide or fragment thereof.
- the HIF- la polypeptide or fragment thereof is linked (e.g. bound either directly or indirectly) to a detectable moiety (e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.).
- a detectable moiety e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.
- the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance that includes contacting a polypeptide comprising a sequence of one of SEQ ID NO: 11-20 with a test agent and determining whether the test agent binds to the epitope; wherein a test agent that binds to the epitope is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance.
- the test agent is an antibody, a protein, a peptide or a small molecule.
- the test agent is a member of a library of test agents.
- the test agent is a small molecule.
- the polypeptide is attached to a solid substrate.
- the method also includes the step of isolating test agent that is bound to the epitope from test agent that is not bound to the epitope.
- the test agent is linked to a detectable moiety.
- the test agent is attached to a solid substrate.
- the method also includes the step of isolating polypeptide that is bound to the test agent from polypeptide that is not bound to the test agent.
- the polypeptide is linked to a detectable moiety.
- the test agent is a member of a library of test agents.
- the test agent is a small molecule.
- the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance, wherein the method includes the steps of contacting a cell that expresses HIF- ⁇ and c-Myc with a test agent, and detecting the expression of a reporter gene that is transcriptionally regulated by c-Myc.
- the reporter gene is a gene that controls mitochondrial function, such as TFAM, NDl, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COXl, COX2, COX3, ATP6 or ATP8.
- a test agent that increases expression of the reporter gene in the cell as compared to a cell that has not been contacted with the test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance.
- the reporter gene is operably linked to the promoter of c-Myc target gene, such as the promoter of TFAM, NDl, ND2, ND3, ND4, ND4I, ND5, ND6,
- reporter gene is detected by detecting the presence and/or amount of reporter gene mRNA
- the cell is a mammalian cell (e.g., a C2C12 cell). In certain embodiments, the cell is in an organism. In some embodiments, the cell is a transgenic cell that recombinantly expresses the reporter gene.
- the reporter gene encodes a detectable moiety, such as a fluorescent protein (e.g., GFP, RFP, YFP, etc.), or an enzyme that catalyzes a reaction that produces a change in luminescence, opacity or color.
- a detectable moiety such as a fluorescent protein (e.g., GFP, RFP, YFP, etc.), or an enzyme that catalyzes a reaction that produces a change in luminescence, opacity or color.
- the test agent is a member of a library of test agents.
- the agent is a small molecule.
- aspects of the present disclosure relate to the surprising discovery that HIF- ⁇ is increased during aging and mitochondrial disorders and that NAD + precursors and NAD + biosynthetic genes (e.g., NMNAT-1 and NAMPT) counteract HIF- ⁇ activity.
- NAD + precursors and NAD + biosynthetic genes e.g., NMNAT-1 and NAMPT
- a method for treating or preventing a disease associated with deregulation of mitochondrial homeostasis in a subject in need thereof comprises administering to the subject an effective amount of a HIF- l inhibitor.
- the disease associated with deregulation of mitochondrial homeostasis is aging, an aging-related disease, a mitochondrial disease, metabolic disorder, cardiovascular disease, stroke, pulmonary hypertension, ischemia, cachexia, sarcopenia, a neurodegenerative disease, dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male infertility, diabetes, muscle wasting, or combinations thereof.
- the HIF- ⁇ inhibitor is a small molecule, siRNA, or antisense oligonucleotide.
- the small molecule is chrysin (5,7-dihydroxyflavone), methyl 3-(2-(4-(adamantan- l-yl)phenoxy)acetamido)-4-hydroxybenzoate, P3155, NSC 644221, S-2-amino-3-[4'-N,N,-bis(chloroethyl)amino]phenyl propionic acid N-oxide dihydrochloride, dimethyl-bisphenol A, vincristine, apigenin, 2-methoxyestradiol, chetomin, or echinomycin.
- the method further comprises administering to the subject an effective amount of an agent that increases the level of NAD + in the subject.
- the agent is an NAD + precursor, such as NMN or a salt thereof, or an NMN prodrug.
- the agent is administered at a dose of between 0.5 - 5 grams per day.
- the agent is an enzyme involved in NAD + biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD + biosynthesis, or an enzymatically active fragment thereof.
- the enzyme is NMNAT-1 or NAMPT.
- a method for treating or preventing a disease associated with deregulation of mitochondrial homeostasis in a subject in need thereof comprising administering to the subject an effective amount of an agent that increases the level of NAD + in the subject.
- the disease associated with deregulation of mitochondrial homeostasis is aging, an aging-related disease, a mitochondrial disease, metabolic disorder, cardiovascular disease, stroke, pulmonary hypertension, ischemia, cachexia, sarcopenia, a neurodegenerative disease, dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male infertility, or combinations thereof.
- the agent is an NAD + precursor, such as NMN or a salt thereof, or an NMN prodrug. In some aspects, the agent is administered at a dose of between 0.5 - 5 grams per day. In some embodiments, the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some aspects, the enzyme is NMNAT-1 or NAMPT.
- a screening method for identifying a HIF- ⁇ inhibitor comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the level of expression of one or more mitochondrial genes; (c) comparing the level of expression determined in (b) to a reference level of expression, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF- ⁇ inhibitor if a significantly decreased level of mitochondrial gene expression is determined in (b), as compared to the reference level in (c).
- the one or more mitochondrial genes is selected from cytochrome b, cytochrome oxidase, NADH dehydrogenase, and ATP synthase.
- aspects of the invention relate to methods for treating or preventing a disorder associated with inflammation in a subject in need thereof comprising administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject.
- the agent is an NAD+ precursor.
- the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof.
- the agent is administered at a dose of between 0.5 - 5 grams per day.
- the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
- the enzyme is NMNAT-1 or NAMPT.
- the subject is a human.
- the disorder associated with inflammation is selected from the group consisting of: septic shock, obesity-related inflammation, Parkinson's Disease, Crohn's Disease, Alzheimer's Disease (AD), cardiovascular disease (CVD), inflammatory bowel disease (IBD), chronic obstructive pulmonary disease, an allergic reaction, an autoimmune disease, blood inflammation, joint inflammation, arthritis, asthma, ulcerative colitis, hepatitis (e.g., viral chronic hepatitis), psoriasis, atopic dermatitis, pemphigus,
- glomerulonephritis atherosclerosis, sarcoidosis, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Wegner's syndrome, Goodpasture's syndrome, giant cell arteritis, polyarteritis nodosa, idiopathic pulmonary fibrosis, acute lung injury, post-influenza pneumonia, SARS, tuberculosis, malaria, sepsis, cerebral malaria, Chagas disease, schistosomiasis, bacteria and viral meningitis, cystic fibrosis, multiple sclerosis, encephalomyelitis, sickle cell anemia, pancreatitis, transplantation (e.g., host-mediated rejection of transplanted tissue such as hematopoietic stem cells or an organ, graft mediated host response, such as graft vs. host disease), systemic lupus erythematosis, autoimmune diabetes, thyroiditis, radiation pneumonitis
- the agent is an NAD+ precursor.
- the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof.
- the agent is administered at a dose of between 0.5 - 5 grams per day.
- the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
- the enzyme is NMNAT-1 or NAMPT.
- the subject is a human.
- FIG. 1 provides exemplary HIF- ⁇ amino acid sequences (SEQ ID NOs: 1-10).
- FIG. 2 provides exemplary amino acid sequences of the domain of the HIF-l protein that is required for complex formation with c-Myc (SEQ ID NOs: 11-20).
- FIG. 3 provides exemplary c-Myc amino acid sequences (SEQ ID NOs: 21-30).
- FIG. 4 shows loss of SIRTl causes a specific decrease in the expression of mitochondrially-encoded genes resulting in genome asynchrony and mitochondrial dysfunction.
- D-E is exemplary c-Myc amino acid sequences (SEQ ID NOs: 21-30).
- NDUFS8 NDUFAS, SDHb, SDHd, Uqcrcl, Uqcrc2, COX5b, Cox6al, ATP5al, ATPbl (D), ND1, ND2, ND3, ND4, ND41, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8 (E) mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice.
- FIG. 5 shows aging leads to genome asynchrony and impaired mitochondrial function.
- B ATP content from gastrocnemius of 6-
- E Mitochondrial DNA integrity in
- H-I NDl, CYTB, COXl, and ATP6
- NDUFS8 SDHb, Uqcrcl, COX5b, ATP5al
- K K
- FIG. 6 shows loss of SIRT1 disrupts mitochondrial homeostasis through PGC-la- independent regulation of mitochonrially-encoded ETC subunits driven by HIF-l stabilization.
- B TFAM mRNA analyzed by qPCR in gastrocnemius of WT and SIRT1 KO animals.
- D Representative immunoblot for SIRT1, TFAM and tubulin in C2C12 cells infected with nontargeting or SIRT1 shRNA with or without TFAM overexpression.
- E NDl, CYTB, COXl and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with nontargeting or SIRT1 shRNA with or without TFAM overexpression.
- FIG. 7 shows HIF- la, but not HIF-2a, controls oxidative phosphorylation by regulating mitochondrially-encoded ETC components in response to SIRTl.
- D ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in control, HIF- la DPA or HIF-2a
- (G) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with HIF- ⁇ or nontargeting shRNA treated with EX-527. Relative expression values were normalized to control cells (n 6, *p ⁇ 0.05 versus control, #p ⁇ 0.05 versus control EX-527).
- H Representative images of mitochondrial membrane potential in C2C12 cells infected with HIF- ⁇ or nontargeting shRNA treated with EX-527 and analyzed by fluorescence microscopy.
- (I) ATP content in C2C12 cells infected with HIF-la or nontargeting shRNA treated with EX-527 (n 4, *p ⁇ 0.05 versus control, #p ⁇ 0.05 versus control EX-527).
- FIG. 8 shows HIFl-a regulates genome synchrony by modulation of TFAM promoter through c-Myc in response to changes in SIRT1 activity.
- B Representative
- (D) TFAM promoter activity in C2C12 cells infected with c- Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRT1 or empty vector (n 4, *p ⁇ 0.05 versus empty vector, #p ⁇ 0.05 versus SIRT1 OE).
- (E) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with c-Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRT1 or empty vector. Relative expression values were normalized to control cells (n 6, *p ⁇ 0.05 versus empty vector, #p ⁇ 0.05 versus SIRT1 OE).
- (G) Mitochondrial DNA content analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative amount was normalized to control cells (n 5, *p ⁇ 0.05 versus empty vector, #p ⁇ 0.05 versus c-Myc OE).
- (H) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative expression values were normalized to control cells (n 6, *p ⁇ 0.05 versus empty vector,
- FIG. 9 shows Caloric restriction protects from age-related mitochondrial dysfunction in skeletal muscle by preventing HIF-la stabilization and loss of
- (D) Cytochrome c Oxidase Activity (Cox) activity in skeletal muscle of 6- and 22-month AL and 22-month old CR mice (n 4, *p ⁇ 0.05 versus 6-month-old animals #p ⁇ 0.05 versus 22-month-old AL mice).
- (E) Mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6- and 22-month AL and 22-month old CR mice. Relative amount was normalized to 6-month-old mice (n 5, *p ⁇ 0.05 versus 6-month-old animals #p ⁇ 0.05 versus 22-month-old AL mice).
- FIG. 10 shows increasing NAD+ rescues age-related mitochondrial dysfunction and genome asynchrony in skeletal muscle through a SIRTl-HIF-la pathway.
- (C) ATP content in skeletal muscle of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n 5, *p ⁇ 0.05 versus 3-month-old PBS animals, #p ⁇ 0.05 versus 24- month-old PBS animals).
- (D) Cytochrome c Oxidase (Cox) activity in skeletal muscle of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n 4, *p ⁇ 0.05 versus 3-month-old animals, #p ⁇ 0.05 versus 24-month-old PBS animals).
- (F) PGK-1, Glutl, PKD1, and VEGFa mRNA analyzed by qPCR in gastrocnemius of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to 3 month old PBS animals. (n 5, *p ⁇ 0.05 versus 3-month-old PBS animals, #p ⁇ 0.05 versus 24-month-old PBS animals).
- ETC mitochondrially-encoded electron transport chain
- FIG. 11 reveals that aging leads to a specific decline in mitochondrial-encoded genes and impairment in mitochondrial homeostasis through decline in nuclear NAD + levels.
- FIG. 11C depicts mitochondrial DNA integrity in gastrocnemius of 6-, 22-, and 30-month-old mice.
- FIG. 11D depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in
- FIG. HE depicts a representative immunoblot for COX2 and COX4 in gastrocnemius of 6-, 22-, and 30-month-old mice.
- FIG. 11H depicts expression of nuclear
- FIG. I ll depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in primary myoblasts WT cells infected with NMNAT3 or nontargeting shRNA.
- FIG. 12 reveals that loss of SIRT1 resembles the specific decrease in the expression of mitochondrial-encoded genes that occurs with aging and resulting in disruption mitochondrial metabolism and impaired muscle health.
- FIG. 12B depicts mitochondrial
- 12D depicts expression of nuclear (NDUFS8, NDUFAS, SDHb, SDHd, Uqcrcl, Uqcrc2, COX5b, Cox6al, ATP5al, ATPcl) versus mitochondrial- encoded genes (ND1, ND2, ND3, ND4, ND41, ND5, ND6, Cytb, COX1, COX2, COX3, ATP6 and ATP8) analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice.
- FIG. 12E depicts a representative immunoblot for COX2 and COX4 in gastrocnemius of WT and SIRTl KO mice.
- FIG. 12E depicts a representative immunoblot for COX2 and COX4 in gastrocnemius of WT and SIRTl KO mice.
- FIG. 12F depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with
- FIG. 12G depicts representative immunoblot for MyHCHIIa, MyHCIIb and Tubulin in gastrocnemius of WT and SIRTl KO mice.
- FIG. 12H depicts a representative immunoblot for Atrogin-1, MuRFl and Tubulin in gastrocnemius of WT and SIRTl KO mice.
- FIG. 121 depicts a representative immunoblot for p-AKT, Total AKT, p-IRS-1 and Total IRS-1 in soleus of WT and SIRTl KO mice under basal conditions and upon insulin stimulation. Values are expressed as mean + SEM (*p ⁇ 0.05 versus WT animals).
- FIG. 13 reveals that SIRTl regulates mitochondrial homeostasis through energy sensitive PGC- la-dependent and -independent mechanisms.
- FIG. 13A depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in WT and PGC-lo/ ⁇ knockout myotubes treated with adenovirus overexpressing SIRTl or empty vector. Relative expression values
- FIG. 13C depicts mitochondrial mass measured by staining of the cells with NAO in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours.
- FIG. 13C depicts mitochondrial mass measured by staining of the cells with NAO in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours.
- FIG. 13D depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours.
- FIG. 13D depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours.
- FIG. 13F depicts a representative immunoblot for p-ACC (Ser79) and ACC in SIRTl flox/flox Cre- ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 48h and infected with empty or AMPK-DN adenovirus for the same period of time.
- FIG. 13F depicts a representative immunoblot for p-ACC (Ser79) and ACC in SIRTl flox/flox Cre- ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 48h and infected with empty or AMPK-DN adenovirus for the same period of time.
- FIG. 13H depicts TFAM mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO animals.
- 13J depicts a representative immunoblot for SIRTl, TFAM ant Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time.
- 13L depicts ATP content in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time
- FIG. 13M depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in
- FIG. 14 reveals that loss of SIRTl induces a psedohypoxic state that disrupts mitochondrial-encoded genes and mitochondrial homeostasis.
- FIG. 14A depicts HK2,
- FIG. 14C depicts lactate levels measured in gastrocnemius of WT and SIRTl KO mice
- FIG. 14D depicts a representative immunoblot for HIF- ⁇ and Tubulin in gastrocnemius of WT and SIRTl KO mice and in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h.
- FIG. 14E depicts a representative immunoblot for HIF- ⁇ and Tubulin in gastrocnemius of WT and Eglnl KO mice.
- FIG. 141 depicts a representative
- FIG. 14K depicts expression of mitochondrial-encoded genes (NDl, Cytb, COXl and ATP6) analyzed by qPCR in control,
- FIG. 14L depicts a representative immunoblot for HIF- la and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with HIF- ⁇ or nontargeting shRNA and DMOG to promote HIF- ⁇ stabilization.
- FIG. 14L depicts a representative immunoblot for HIF- la and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with HIF- ⁇ or nontargeting shRNA and DMOG to promote HIF- ⁇ stabilization.
- FIG. 15 reveals that SIRTl regulates HIF- ⁇ stabilization in the skeletal muscle through regulation of VHL expression.
- FIG. 15A depicts a representative immunoblot for VHL and Tubulin in gastrocnemius of WT and SIRTl KO mice.
- FIG. 15B depicts a representative immunoblot for VHL and Tubulin is gastrocnemius of WT and SIRTl -Tg overexpressing mice.
- FIG. 15D depicts VHL mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl-Tg mice.
- FIG. 15G depicts a representative immunoblot for VHL, HIF- ⁇ and Tubulin in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA.
- FIG. 151 depicts a representative immunoblot for VHL, HIF- ⁇ and Tubulin in gastrocnemius of 6-, 22-, and 30-month-old mice.
- FIG. 15J depicts a representative immunoblot for VHL, HIF- ⁇ , TFAM and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
- FIG. 15K depicts a representative immunoblot for VHL and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA.
- FIG. 15L depicts a representative immunoblot for VHL and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA and treated with OHT for 24h after which SIRTl was added back by infection with an adenovirus.
- FIG. 15K depicts a representative immunoblot for VHL and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA.
- FIG. 16 reveals that HIF- ⁇ regulates mitochondrial homeostasis by modulation of TFAM promoter through c-Myc in response to changes in SIRTl activity.
- FIG. 16B depicts a representative immunoblot for c-Myc and tubulin in C2C12 cells infected with c-Myc or nontargeting shRNA.
- FIG. 161 and 16J depict chromatin immunoprecipitation (I) and respective quantification by qPCR (J) of c-Myc and HIF- ⁇ to the TFAM promoter in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours.
- FIG. 16K depicts chromatin immunoprecipitation (I) and respective quantification by qPCR (J) of c-Myc and HIF- ⁇ to the TFAM promoter in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours.
- FIG. 16K depicts chromatin
- FIG. 16L depicts TFAM promoter activity measured by luciferase assay in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours infected with HIF- ⁇ or nontargeting shRNA.
- FIG. 17 reveals that increasing NAD + levels rescues age-related mitochondrial and muscle dysfunction through a SIRTl-HIF-la pathway.
- FIG. 17D depicts a representative immunoblot for VHL, HIF- ⁇ and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN.
- FIG. 17H depicts expression of mitochondrial-enoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA treated with either the vehicle (PBS) or NMN. Relative expression
- FIG. 17J depicts a representative immunoblot for Atrogin-2, MuRFl and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN.
- FIG. 17K depicts a representative immunoblot for p-AKT, AKT, p-IRS-1, IRS-lin gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN.
- FIG. 17L depicts a schematic which reveals that the decline in nuclear NAD + during aging elicits a biphasic response mediated by SIRTl to regulate mitochondrial homeostasis.
- SIRTl regulates specifically mitochondrial-encoded genes trough regulation of the TFAM promoter by regulating HIF- ⁇ stabilization and c-Myc activity. Under conditions of low energy supply, like fasting or prolonged OXPHOS inhibition, SIRTl regulates mitochondrial biogenesis through deacetylation of PGC-la. Values are expressed as mean + SEM.
- FIG. 8 provides additional data related to the content of FIG. 11.
- FIG. 18A depicts a representative immunoblot for NMNAT1 and Tubulin in primary myoblasts WT cells infected with NMN ATI or nontargeting shRNA. Relative amount was normalized to control cells.
- FIG. 18B depicts a representative immunoblot for NMNAT2 and Tubulin in primary myoblasts WT cells infected with NMNAT2 or nontargeting shRNA. Relative amount was normalized to control cells.
- FIG. 18C depicts a representative immunoblot for NMNAT3 and Tubulin in primary myoblasts WT cells infected with NMNAT3 or nontargeting shRNA. Relative amount was normalized to control cells.
- FIG. 18A depicts a representative immunoblot for NMNAT1 and Tubulin in primary myoblasts WT cells infected with NMN ATI or nontargeting shRNA. Relative amount was normalized to control cells.
- FIG. 18B
- FIG. 18G depicts a representative immunoblot for SIRTl and tubulin in gastrocnemius of 6-, 22-, and
- mice 30-month-old mice. Values are expressed as mean + SEM.
- FIG. 19 provides additional data related to the content of FIG. 12.
- FIG. 19A depicts
- FIG. 19E depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in white adipose tissue of WT and SIRTl KO mice.
- FIG. 19G depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in heart of WT and SIRTl KO mice.
- FIG. 20 provides additional data related to the content of FIG. 13.
- FIG. 20D depicts a representative immunoblot for Flag and Tubulin in PGC- ⁇ / ⁇ knockout myo tubes infected with adenovirus expressing a flag-PGC-la WT, PGC-la T177A/S538A mutant or empty vector.
- FIG. 20E depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in gastrocnemius of WT and SIRT1 KO mice under fed and fasted conditions.
- FIG. 20F depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in gastrocnemius of 6- and 22-months-old mice.
- FIG. 20G depicts PGC-l , PGC- ⁇ , NRF-1, NRF-2m
- FIG. 20H depicts a representative immunoblot for TFAm and Tubulin in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector.
- FIG. 201 depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analyzed by qPCR in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector.
- FIG. 21 provides additional data related to the content of FIG. 14.
- FIG. 21B depicts hypoxia response element activity in primary myoblasts isolated from WT and SIRTl KO mice and treated with
- FIG. 21C depicts a representative immunoblot of HIF-l and Tubulin in PGC- ⁇ / ⁇ KO myo tubes treated with adenovirus overexpressing SIRTl or empty vector as well as treatment with DMSO or with HIF stabilizing compound DMOG.
- FIG. 21E depicts a representative immunoblot of HIF- ⁇ and Tubulin in primary WT myoblasts treated with 10 mM pyruvate, 10 mM lactate or vehicle for 24h.
- FIG. 21C depicts a representative immunoblot of HIF-l and Tubulin in PGC- ⁇ / ⁇ KO myo tubes treated with adenovirus overexpressing SIRTl or empty vector as well as treatment with DMSO or with HIF stabilizing compound DMOG.
- FIG. 21D depict
- 21F depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) in PGC- l / ⁇ KO myo tubes treated with 10 mM pyruvate, 10 mM lactate or vehicle for 24h in the presence or absence of DMOG. Relative expression values were normalized to control cells
- FIG. 21G depicts a representative immunoblot for SIRTl, HIF- ⁇ and Tubulin in gastrocnemius of WT and SIRTl-tg mice treated with vehicle (PBS) or DMOG.
- FIG. 21L depicts mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with ARNT or nontargeting shRNA.
- FIG. 22 provides additional data related to the content of FIG. 15.
- FIG. 22A depicts a representative immunoblot for COX2, SIRTl, HIFl-a, VHL, TFAM and Tubulin in parental or rhoO cells derived from SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision.
- FIG. 22C depicts a representative immunoblot for HA and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision and infected with HA-HIF-la, the Q and R mutants of the K709 and Q mutant of K674.
- FIG. 22D depicts a representative immunoblot for HIF-la-OH, HIF-la and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision in the presence and absence of the proteasome inhibitor, MG-132.
- FIG. 22E depicts a representative immunoblot for HIF-2a and Tubulin in gastrocnemius of WT and SIRTl KO mice and in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision or treated with DMOG to stabilize HIFa.
- FIG. 23 provides additional data related to the content of FIG. 16.
- FIG. 23A depicts a representative immunoblot for c-Myc and tubulin in C2C12 cells overexpressing c-Myc.
- FIG. 23C depicts NDl, Cytb, COXl and ATP6 mRNA analyzed by qPCR in C2C12 cells overexpressing c-Myc.
- FIG. 23E depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in primary WT myoblasts treated with vehicle (DMSO) or DMOG.
- FIG. 23G and 23H depict chromatin immunoprecipitation (G) and respective quantification by qPCR (H) of HIF- ⁇ to the LDHA gene in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours.
- FIG. 24 provides additional data related to the content of FIG. 17.
- FIG. 24F depicts a representative immunoblot for COX2, COX4, and tubulin in gastrocnemius of 22-month- old AL and CR mice.
- FIG. 24F depicts a representative immunoblot for COX
- FIG. 24G depicts a representative immunoblot for HIFl , and tubulin in gastrocnemius of 6- and 22-month AL and 22-month old CR mice.
- FIG. 2 6 reveals that NMN reduces inflammation in aortas from old mice.
- FIG. 27 reveals that NMN reduces inflammation in aortas from old mice.
- VEGF and IL-18 inflammatory markers
- FIG. 28 reveals that NMN reverses age-related increase in inflammatory markers in the skeletal muscle.
- NMN treatment IP injections of 500mg/kg/day for 7 consecutive days.
- FIG. 29 reveals that NMN destabilizes HIF- 1 alpha in the skeletal muscle of old animals.
- a representative immunoblot is provided for VHL, HIF-1 a and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN.
- NMN treatment IP injections of 500mg/kg/day for 7 consecutive days.
- FIG. 30 reveals that in vivo stabilization of HIF-1 alpha with DMOG induces inflammatory markers in the skeletal muscle.
- DMOG treatment IP injections of
- DMOG Dimethyloxallyl Glycine.
- FIG. 31 depicts a model for raising NAD+ to decrease inflammation.
- Raising NAD+ levels by supplying NAD+ precursors prevents and reverses inflammation. The link between inflammation in the brain and longevity indicates that NMN could delay aging.
- compositions and methods for the treatment of age-related diseases the treatment of mitochondrial diseases, the improvement of stress resistance, the improvement of resistance to hypoxia and the extension of life span. Also described herein are methods for the identification of agents useful in the foregoing methods.
- HIF- 1 a interacts with c-
- Agents that reduce HIF-1 a' s ability to inhibit c-Myc including, for example, agents that inhibit the formation of a complex between HIF- 1 a and c-Myc, convey beneficial effects on metabolism and mitochondrial function in aging tissues.
- agents can, for example, inhibit complex formation by targeting the domain of HIF- 1 a that is required for formation of a complex with c-Myc (e.g., amino acids 167-329 of the human HIF- la protein).
- Such agents may also, for example, prevent HIF- ⁇ from altering c-Myc activity, abundance and/or its localization within the cell.
- the instant invention relates to compositions and/or methods for the treatment of age-related diseases, the treatment of mitochondrial diseases, the improvement of the stress response, the improvement of hypoxia resistance and/or the improvement of life span by administering an agent that reduces HIF- la's inhibition of c- Myc.
- the agent reduces HIF- la's inhibition of c-Myc by acting to inhibit of the formation of a HIF-la/c-Myc complex.
- the agent induces a conformational change in HIF- ⁇ or c-Myc that abrogates their interaction and/or alters the ability of HIF- ⁇ to affect c-Myc activity, protein levels or cell localization.
- the agent is an antibody, an antigen binding fragment thereof, a small molecule and/or a polypeptide that binds to HIF- ⁇ or c-Myc.
- the agents described herein bind to the HIF- ⁇ domain required for c-Myc complex formation.
- administering means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
- agent is used herein to denote a chemical compound, a small molecule, a mixture of chemical compounds and/or a biological macromolecule (such as a nucleic acid, an antibody, an antibody fragment, a protein or a peptide). Agents may be identified as having a particular activity by screening assays described herein below. The activity of such agents may render them suitable as a "therapeutic agent” which is a biologically, physiologically, or pharmacologically active substance (or substances) that acts locally or systemically in a subject.
- amino acid is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids.
- exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.
- antibody may refer to both an intact antibody and an antigen binding fragment thereof.
- Intact antibodies are glycoproteins that include at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- Each heavy chain includes a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region.
- Each light chain includes a light chain variable region (abbreviated herein as V L ) and a light chain constant region.
- the V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- CDR complementarity determining regions
- Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system
- antibody includes, for example, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies and antigen-binding antibody fragments.
- isolated antibody refers to an antibody which is substantially free of other antibodies having different antigenic specificities. An isolated antibody may, however, have some cross-reactivity to other, related antigens.
- antigen binding fragment and "antigen-binding portion" of an antibody, as used herein, refers to one or more fragments of an antibody that retain the ability to bind to an antigen.
- binding fragments encompassed within the term “antigen-binding fragment” of an antibody include Fab, Fab', F(ab') 2 , Fv, scFv, disulfide linked Fv, Fd, diabodies, single-chain antibodies, NANOBODIES®, isolated CDRH3, and other antibody fragments that retain at least a portion of the variable region of an intact antibody. These antibody fragments can be obtained using conventional recombinant and/or enzymatic techniques and can be screened for antigen binding in the same manner as intact antibodies.
- c-Myc refers to the c-Myc transcription factor originally identified as an oncogene in Burkett's lymphoma patients. c-Myc is a highly conserved transcriptional regulator present in many organisms. Exemplary c-Myc amino acid sequences are provided in Figure 3.
- CDR complementarity determining region
- CDRL1, CDRL2 and CDRL3 three CDRs are present in a light chain variable region
- CDRH1, CDRH2 and CDRH3 three CDRs are present in a heavy chain variable region.
- CDRs contribute to the functional activity of an antibody molecule and are separated by amino acid sequences that comprise scaffolding or framework regions.
- the CDR3 sequences, and particularly CDRH3 are the most diverse and therefore have the strongest contribution to antibody specificity.
- CDRs There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Kabat et al., Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda, Md. (1987), incorporated by reference in its entirety); and (2) an approach based on crystallographic studies of antigen-antibody complexes (Chothia et al., Nature, 342:877 (1989), incorporated by reference in its entirety).
- cross-species sequence variability i.e., Kabat et al., Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda, Md. (1987), incorporated by reference in its entirety
- crystallographic studies of antigen-antibody complexes Chothia et al., Nature, 342:877 (1989), incorporated by reference in its entirety.
- Diabetes refers to high blood sugar or ketoacidosis, as well as chronic, general metabolic abnormalities arising from a prolonged high blood sugar status or a decrease in glucose tolerance. “Diabetes” encompasses both the type I and type II (Non-Insulin Dependent Diabetes Mellitus or NIDDM) forms of the disease.
- the risk factors for diabetes include the following factors: waistline of more than 40 inches for men or 35 inches for women, blood pressure of 130/85 mmHg or higher, triglycerides above 150 mg/dl, fasting blood glucose greater than 100 mg/dl or high-density lipoprotein of less than 40 mg/dl in men or 50 mg/dl in women.
- epitope means a protein determinant capable of specific binding to an antibody.
- Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains.
- Certain epitopes can be defined by a particular sequence of amino acids to which an antibody is capable of binding, such as, for example, the interaction domain sequences provided in Figure 2.
- HIF-la refers to the Hypoxia- Inducible Factor 1, alpha subunit protein. HIF- ⁇ is a highly conserved protein present in most, if not all, metazoa.
- HIF- ⁇ amino acid sequences are provided in Figure 1. Under certain conditions, HIF- ⁇ forms a complex with c-Myc. A specific interaction domain of the HIF- l protein is required for this complex formation. Exemplary interaction domain sequences are provided in Figure 2.
- humanized antibody refers to an antibody that has at least one CDR derived from a mammal other than a human, and a FR region and the constant region of a human antibody.
- a humanized antibody is useful as an effective component in a therapeutic agent according to the present invention since antigenicity of the humanized antibody in human body is lowered.
- insulin resistance disorder refers to any disease or condition that is caused by or contributed to by insulin resistance. Examples include:
- diabetes gestational diabetes, obesity, metabolic syndrome, insulin-resistance syndromes, syndrome X, insulin resistance, high blood pressure, hypertension, high blood cholesterol, dyslipidemia, hyperlipidemia, dyslipidemia, atherosclerotic disease including stroke, coronary artery disease or myocardial infarction, hyperglycemia, hyperinsulinemia and/or hyperproinsulinemia, impaired glucose tolerance, delayed insulin release, diabetic complications, including coronary heart disease, angina pectoris, congestive heart failure, stroke, cognitive functions in dementia, retinopathy, peripheral neuropathy, nephropathy, glomerulonephritis, glomerulosclerosis, nephrotic syndrome, hypertensive nephrosclerosis some types of cancer (such as endometrial, breast, prostate, and colon), complications of pregnancy, poor female reproductive health (such as menstrual irregularities, infertility, irregular ovulation, polycystic ovarian syndrome (PCOS)),lipodystrophy, cholesterol related disorders, such as gallstones
- isolated polypeptide refers to a polypeptide, in certain embodiments prepared from recombinant DNA or RNA, or of synthetic origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is isolated from the cell in which it normally occurs, (3) is isolated free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature.
- the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies that specifically bind to the same epitope, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- Obese individuals or individuals suffering from obesity are generally individuals having a body mass index (BMI) of at least 25 or greater. Obesity may or may not be associated with insulin resistance.
- BMI body mass index
- pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body
- Small molecule as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5 kD and most preferably less than about 4 kD. Small molecules can be nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic (carbon-containing) or inorganic molecules. Many pharmaceutical companies have extensive libraries of chemical and/or biological mixtures, often fungal, bacterial, or algal extracts, which can be screened with any of the assays described herein.
- Stress refers to any non-optimal condition for growth, development or
- a "stress condition” can be exposure to heatshock; osmotic stress; a DNA damaging agent; inadequate salt level; inadequate nitrogen levels; inadequate nutrient level; radiation or a toxic compound, e.g., a toxin or chemical warfare agent (such as dirty bombs and other weapons that may be used in bioterrorism).
- “Inadequate levels” refer to levels that result in non-optimal condition for growth, development or reproduction.
- telomere binding refers to the ability of an antibody to bind to a predetermined antigen or the ability of a polypeptide to bind to its predetermined binding partner.
- an antibody or polypeptide specifically binds to its predetermined antigen or binding partner with an affinity corresponding to a K D of about 10 " M or less, and binds to the predetermined antigen/binding partner with an affinity (as expressed by K D ) that is at least 10 fold less, at least 100 fold less or at least 1000 fold less than its affinity for binding to a non-specific and unrelated antigen/binding partner (e.g., BSA, casein).
- a non-specific and unrelated antigen/binding partner e.g., BSA, casein
- the term "subject” means a human or non-human animal selected for treatment or therapy.
- therapeutically-effective amount” and “effective amount” as used herein means the amount of an agent which is effective for producing the desired therapeutic effect in at least a sub-population of cells in a subject at a reasonable
- Treating" a disease in a subject or “treating” a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased or prevented from worsening.
- the present invention relates to antibodies and antigen binding fragments thereof that bind specifically to HIF- ⁇ and uses thereof.
- the antibodies bind to a domain of HIF- la required for complex formation with c-Myc.
- the HIF- la domain has an amino acid sequence selected from SEQ ID NOs 11-20. Accordingly, in certain embodiments the antibodies described herein are able to inhibit complex formation between HIF- la and c-Myc.
- Such antibodies can be polyclonal or monoclonal and can be, for example, murine, chimeric, humanized or fully human.
- Polyclonal antibodies can be prepared by immunizing a suitable subject (e.g. a mouse) with a polypeptide immunogen (e.g., a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20).
- a polypeptide immunogen e.g., a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20.
- the polypeptide antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide.
- ELISA enzyme linked immunosorbent assay
- the antibody directed against the antigen can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG fraction.
- antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies using standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256:495-497) (see also Brown et al. (1981) J.
- an immortal cell line typically a myeloma
- lymphocytes typically splenocytes
- the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds to the polypeptide antigen, preferably specifically.
- a monoclonal specific for HIF- ⁇ and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20 can be identified and isolated by screening a recombinant combinatorial immunoglobulin library ⁇ e.g., an antibody phage display library or an antibody yeast display library) with the appropriate polypeptide ⁇ e.g. a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20) to thereby isolate
- immunoglobulin library members that bind the polypeptide.
- recombinant antibodies specific for HIF- ⁇ and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20 can be made using standard recombinant DNA techniques.
- Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in US Pat No. 4,816,567; US Pat. No. 5,565,332; Better et al. (1988) Science 240: 1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol.
- Human monoclonal antibodies specific for HIF- ⁇ and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20 can be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system.
- transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system.
- “HuMAb mice” which contain a human immunoglobulin gene miniloci that encodes unrearranged human heavy ( ⁇ and ⁇ ) and ⁇ light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous ⁇ and ⁇ chain loci (Lonberg, N. et al. (1994) Nature 368(6474): 856 859).
- mice exhibit reduced expression of mouse IgM or ⁇ , and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high affinity human IgGK monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49 101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65 93, and Harding, F. and Lonberg, N. (1995) Ann. N. Y Acad. Sci 764:536 546).
- the preparation of HuMAb mice is described in Taylor, L. et al.
- the antibodies of the instant invention are able to bind to an epitope of HIF- ⁇ in a domain required for complex formation with c-Myc ⁇ e.g., a domain having an amino acid sequence selected from SEQ ID NOs 11-20) with a dissociation constant of no greater than 10 "6 , 10 "7 , 10 "8 or 10 "9 M.
- Standard assays to evaluate the binding ability of the antibodies are known in the art, including for example, ELISAs,
- the binding of the antibody to HIF- ⁇ substantially inhibits the ability of c- Myc to form a complex with HIF- ⁇ .
- an antibody substantially inhibits the ability of c-Myc to form a complex with HIF- ⁇ when an excess of antibody reduces the quantity of complex formed to by at least about 20%, 40%, 60% or 80%, 85% or 90% (as measured in an in vitro competitive binding assay). Soluble HIF- la Polypeptides
- the invention relates to isolated polypeptides comprising a HIF- ⁇ domain or fraction thereof required for c-Myc to form a complex with HIF- ⁇ (i.e., comprising a portion of an amino acid sequence selected from SEQ ID NO: 11-20).
- Such polypeptides can be useful, for example, for inhibiting the ability of c-Myc to form a complex with HIF- la and for identifying and/or generating antibodies that specifically bind to the c-Myc interaction domain of HIF- la.
- the polypeptide comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 consecutive amino acids of an amino acid sequence selected from SEQ ID NO: 11-20. In some embodiments the polypeptide of the invention comprises less than 100, 90, 80, 70, 60, 50, 40, 30, 25 or 20 consecutive amino acids of the natural HIF- la protein (e.g., a protein having an amino acid sequence selected from SEQ ID NO: 1- 10). In some embodiments, the polypeptide of the invention comprises an amino acid sequence selected from SEQ ID NO: 11-20.
- polypeptide of the instant invention is able to bind to c-
- the polypeptide binds to c-Myc with a dissociation constant of no greater than 10 "5 M, 10 "6 M, 10 "7 M, 10 "8 M or 10 "9 M.
- Standard assays to evaluate the binding ability of the polypeptides are known in the art, including for example, ELISAs, Western blots and RIAs and suitable assays are described in the Examples.
- the binding kinetics (e.g., binding affinity) of the polypeptides also can be assessed by standard assays known in the art, such as by Biacore analysis.
- the binding of the polypeptide to c-Myc substantially inhibits the ability of c-Myc to bind to HIF-la.
- a polypeptide substantially inhibits adhesion of c-Myc to HIF-la when an excess of polypeptide reduces the quantity of c-Myc bound to HIF-la by at least about 20%, 40%, 60% or 80%, 85% or 90% (as measured in an in vitro competitive binding assay).
- polypeptides of the present invention can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
- polypeptides of the present invention are produced by recombinant DNA techniques.
- polypeptides of the present invention can be chemically synthesized using standard peptide synthesis techniques.
- polypeptides of the present invention comprise an amino acid sequence substantially identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof. Accordingly, in another embodiment, the polypeptides of the present invention comprises an amino acid sequence at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof.
- the polypeptides of the present invention comprise an amino acid identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof except for 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) conservative sequence modifications.
- conservative sequence modifications is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody by standard techniques known in the art, such as site- directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid
- substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- amino acids with basic side chains
- the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
- the invention also provides chimeric or fusion proteins.
- a chimeric or fusion proteins As used herein, a
- chimeric protein or “fusion protein” comprises a polypeptide(s) of the present invention (e.g., those comprising a sequence selected from SEQ ID NO: 11-20, or a fragment thereof) linked to a distinct polypeptide to which it is not linked in nature.
- the distinct polypeptide can be fused to the N-terminus or C-terminus of the polypeptide either directly, through a peptide bond, or indirectly through a chemical linker.
- the peptide of the instant invention is linked to an immunoglobulin constant domain (e.g., an IgG constant domain, such as a human IgG constant domain).
- a chimeric or fusion polypeptide of the present invention can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with
- the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can
- polypeptides described herein can be produced in prokaryotic or eukaryotic host cells by expression of polynucleotides encoding a polypeptide(s) of the present invention. Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous polypeptides in recombinant hosts, chemical synthesis of polypeptides, and in vitro translation are well known in the art and are described further in Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring
- Certain embodiments of the present invention relate to methods of treating age- related and mitochondrial diseases, enhancing stress response, improving resistance to hypoxia and/or increasing life span. These methods include administering that reduces HIF-l ' a ability to inhibit c-Myc function. For example, in certain embodiments the agent inhibits complex formation between HIF- la and c-Myc. In some embodiments, the agents induce a conformational change in HIF-la or c-Myc that abrogates their interaction and/or alters the ability of HIF-la to affect c-Myc activity, protein levels or cell localization.
- any agent that reduces inhibition of c-Myc by HIF- la can be used to practice the methods of the invention.
- the agent inhibits complex formation between HIF- la and c-Myc.
- Such agents can be those described herein or those identified through routine screening assays (e.g. the screening assays described herein).
- assays used to identify agents useful in the methods of the present invention include a reaction between a polypeptide comprising a sequence selected from SEQ ID NO: 11-20 or a fragment thereof and one or more assay components.
- the other components may be either a test compound (e.g. the potential agent), or a
- test compounds and a c-Myc protein or fragment thereof.
- Agents identified via such assays may be useful, for example, for preventing or treating age-related and mitochondrial diseases, enhancing stress response and/or improving life span.
- Agents useful in the methods of the present invention may be obtained from any available source, including systematic libraries of natural and/or synthetic compounds. Agents may also be obtained by any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckermann et al. , 1994, J. Med. Chem. 37:2678-85); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
- the biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are applicable to peptide, non- peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12: 145).
- Biotechniques 13:412-421 or on beads (Lam, 1991, Nature 354:82-84), chips (Fodor, 1993, Nature 364:555-556), bacteria and/or spores, (Ladner, USP 5,223,409), plasmids (Cull et al, 1992, Proc Natl Acad Sci USA 89: 1865-1869) or on phage (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al, 1990, Proc. Natl. Acad. Sci. 87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301-310; Ladner, supra.).
- Agents useful in the methods of the present invention may be identified, for example, using assays for screening candidate or test compounds which inhibit complex formation between c-Myc and HIF-l .
- the basic principle of the assay systems used to identify compounds that inhibit complex formation between c-Myc and HIF- ⁇ involves preparing a reaction mixture containing a HIF- ⁇ protein or fragment thereof and a c-Myc protein or fragment thereof under conditions and for a time sufficient to allow the HIF- ⁇ protein or fragment thereof to form a complex with the c-Myc protein or fragment thereof.
- the reaction mixture is prepared in the presence and absence of the test compound.
- the test compound can be initially included in the reaction mixture, or can be added at a time subsequent to the addition of the HIF- ⁇ protein or fragment thereof and the c-Myc protein or fragment thereof. Control reaction mixtures are incubated without the test compound or with a placebo.
- any complexes between the HIF-la protein or fragment thereof and the c-Myc protein or fragment thereof is then detected.
- the formation of a complex in the control reaction but less or no such formation in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the HIF-la protein or fragment thereof and the c-Myc protein or fragment thereof.
- the assay for compounds that modulate the interaction of the HIF- ⁇ protein or fragment thereof and the c-Myc protein or fragment thereof may be conducted in a heterogeneous or homogeneous format.
- Heterogeneous assays involve anchoring either the HIF- la protein or fragment thereof or the c-Myc protein or fragment thereof onto a solid phase and detecting complexes anchored to the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the HIF- la protein or fragment thereof and the c-Myc protein or fragment thereof (e.g., by competition) can be identified by conducting the reaction in the presence of the test substance, i.e., by adding the test substance to the reaction mixture prior to or
- test compounds that disrupt preformed complexes e.g., compounds with higher binding constants that displace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed.
- test compounds that disrupt preformed complexes e.g., compounds with higher binding constants that displace one of the components from the complex.
- either the HIF- la protein or fragment thereof or the c-Myc protein or fragment thereof is anchored onto a solid surface or matrix, while the other corresponding non-anchored component may be labeled, either directly or indirectly.
- microtitre plates are often utilized for this approach.
- the anchored species can be immobilized by a number of methods, either non-covalent or covalent, that are typically well known to one who practices the art. Non-covalent attachment can often be
- an immobilized antibody specific for the assay component to be anchored can be used for this purpose.
- a fusion protein can be provided which adds a domain that allows one or both of the assay components to be anchored to a matrix.
- S-transferase/marker fusion proteins or glutathione-S-transferase/binding partner can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and either the non-adsorbed the HIF- la protein or fragment thereof or the c-
- Myc protein or fragment thereof and the mixture incubated under conditions conducive to complex formation (e.g., physiological conditions). Following incubation, the beads or microtiter plate wells are washed to remove any unbound assay components, the immobilized complex assessed either directly or indirectly, for example, as described above.
- a homogeneous assay may also be used to identify inhibitors of complex formation. This is typically a reaction, analogous to those mentioned above, which is conducted in a liquid phase in the presence or absence of the test compound. The formed complexes are then separated from unreacted components, and the amount of complex formed is determined. As mentioned for heterogeneous assay systems, the order of addition of reactants to the liquid phase can yield information about which test compounds modulate (inhibit or enhance) complex formation and which disrupt preformed complexes.
- reaction products may be separated from unreacted assay components by any of a number of standard techniques, including but not limited to: differential centrifugation, chromatography, electrophoresis and
- the relatively different charge properties of the complex as compared to the uncomplexed molecules may be exploited to differentially separate the complex from the remaining individual reactants, for example through the use of ion-exchange chromatography resins.
- ion-exchange chromatography resins Such resins and chromatographic techniques are well known to one skilled in the art (see, e.g., Heegaard, 1998, J Mol.
- Gel electrophoresis may also be employed to separate complexed molecules from unbound species (see, e.g., Ausubel et al (eds.), In: Current Protocols in Molecular
- Agents useful in the methods described herein may also be identified, for example, using methods wherein a cell ⁇ e.g., a cell that expresses c-Myc and HIF- ⁇ , such as a mammalian cell) is contacted with a test compound, and the expression level of a c-Myc target gene or a reporter gene under the transcriptional control of the promoter of a c-Myc target gene is determined (collectively referred to as c-Myc reporter genes).
- c-Myc target gene refers to a gene whose expression increases in the presence of c-Myc.
- c-Myc target genes are well known in the art and include, for example, TFAM, ND1, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8.
- the c-Myc reporter gene encodes a readily detectable protein ⁇ e.g., a fluorescent protein or a protein catalyzes a reaction that produces a change in color, luminescence and/or opacity).
- the level of expression of the reporter gene in the presence of the test compound is compared to the level of expression of mRNA or protein in the absence of the candidate compound. If the expression of the mRNA or protein increases in the presence of the test compound, the test compound an agent useful in the methods described herein.
- compositions in certain embodiments the instant invention relates to a composition, e.g., a pharmaceutical composition, containing at least one agent described herein together with a pharmaceutically acceptable carrier.
- the composition includes a combination of multiple (e.g., two or more) agents of the invention.
- compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g. , those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation.
- oral administration for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g. , those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue
- parenteral administration for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension
- Methods of preparing these formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients.
- the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
- compositions of this invention suitable for parenteral administration comprise one or more agents described herein in combination with one or more
- sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
- aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
- polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
- vegetable oils such as olive oil
- injectable organic esters such as ethyl oleate.
- Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
- the agents of the present invention which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically- acceptable dosage forms by conventional methods known to those of skill in the art.
- the agents described herein are administered to a subject (e.g., a subject in need thereof).
- the agents are used to enhance stress response, improve hypoxia resistance or increase the life span of a cell.
- the agent is contacted to the cell either in vitro or in vivo.
- the present invention provides therapeutic methods of treating an age-related disease.
- Age-related diseases include, but are not limited to, Alzheimer's disease, amniotropic lateral sclerosis, arthritis, atherosclerosis, cachexia, cancer, cardiac hypertrophy, cardiac failure, cardiac hypertrophy, cardiovascular disease, cataracts, colitis, chronic obstructive pulmonary disease, dementia, diabetes mellitus, frailty, heart disease, hepatic steatosis, high blood cholesterol, high blood pressure,
- Huntington's disease hyperglycemia, hypertension, infertility, inflammatory bowel disease, insulin resistance disorder, lethargy, metabolic syndrome, muscular dystrophy, multiple sclerosis, neuropathy, , nephropathy, obesity, osteoporosis, Parkinson's disease, psoriasis, retinal degeneration, sarcopenia, sleep disorders, sepsis and/or stroke.
- the present invention provides therapeutic methods of treating a mitochondrial disease.
- Mitochondrial diseases include, but are not limited to, mitochondrial myopathy, diabetes mellitus and deafness (DAD), Leber's hereditary optic neuropathy (LHON), Leigh syndrome, neuropathy, ataxia, retinitis pigmentosa and petosis (NARP), myoclonic epilepsy with ragged red fibers (MERRF), myoneurogenic
- MNGIE gastrointestinal encephalopathy
- MELAS stroke-like symptoms
- KSS Kearns-Sayre syndrome
- CPEO chromic progressive external opthalmoplegia
- the methods described herein are useful for increasing the life span of a cell or organism. All animals typically go through a period of growth and maturation followed by a period of progressive and irreversible physiological decline ending in death.
- the length of time from birth to death is known as the life span of an organism, and each organism has a characteristic average life span. Aging is a physical manifestation of the changes underlying the passage of time as measured by percent of average life span.
- characteristics of aging can be quite obvious.
- characteristics of older humans include skin wrinkling, graying of the hair, baldness, and cataracts, as well as hypermelanosis, osteoporosis, altered adiposity, cerebral cortical atrophy, lymphoid depletion, memory loss, thymic atrophy, increased incidence of diabetes type II, atherosclerosis, cancer, muscle loss, bone loss, and heart disease. Nehlin et al. (2000), Annals NY Acad Sci 980: 176-79.
- mammalian aging include weight loss, lordokyphosis (hunchback spine), absence of vigor, lymphoid atrophy, decreased bone density, dermal thickening and subcutaneous adipose tissue, decreased ability to tolerate stress (including heat or cold, wounding, anesthesia, and hematopoietic precursor cell ablation), liver pathology, atrophy of intestinal villi, skin ulceration, amyloid deposits, and joint diseases. Tyner et al. (2002), Nature 415:45-53.
- characteristics of aging in other eukaryotes include slow movement, flaccidity, yolk accumulation, intestinal autofluorescence
- aging process is also manifested at the cellular level, as well as in mitochondria.
- Cellular aging is manifested in reduced mitochondrial function, loss of doubling capacity, increased levels of apoptosis, changes in differentiated phenotype, and changes in metabolism, e.g., decreased fatty acid oxidation, respiration, and protein synthesis and turnover.
- biological age can be deduced from patterns of gene expression, resistance to stress (e.g., oxidative or genotoxic stress), rate of cellular proliferation, and the metabolic characteristics of cells (e.g., rates of protein synthesis and turnover, mitochondrial function, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels within the cell, levels of a Krebs cycle intermediate in the cell, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.).
- stress e.g., oxidative or genotoxic stress
- rate of cellular proliferation e.g., rate of cellular proliferation
- metabolic characteristics of cells e.g., rates of protein synthesis and turnover, mitochondrial function, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels within the cell, levels of a Krebs cycle intermediate in the cell, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.
- biological age is a measure of the age of a cell or organism based upon the molecular characteristics of the cell or organism. Biological age is distinct from “temporal age,” which refers to the age of a cell or organism as measured by days, months, and years.
- the rate of aging of an organism can be determined by a variety of methods, e.g., by one or more of: a) assessing the life span of the cell or the organism; (b) assessing the presence or abundance of a gene transcript or gene product in the cell or organism that has a biological age-dependent expression pattern; (c) evaluating resistance of the cell or organism to stress, e.g., genotoxic stress (e.g., etopocide, UV irradition, exposure to a mutagen, and so forth) or oxidative stress; (d) evaluating one or more metabolic stress, e.g., genotoxic stress (e.g., etopocide, UV irradition, exposure to a mutagen, and so forth) or oxidative stress; (d) evaluating one or more metabolic stress, e.g., genotoxic stress (e.g., etopocide, UV irradition, exposure to a mutagen, and so forth) or oxidative stress
- evaluating the rate of aging includes directly measuring the average life span of a group of animals (e.g., a group of genetically matched animals) and comparing the resulting average to the average life span of a control group of animals (e.g., a group of animals that did not receive the test compound but are genetically matched to the group of animals that did receive the test compound).
- the rate of aging of an organism can be determined by measuring an age-related parameter.
- age-related parameters include: appearance, e.g., visible signs of age; the expression of one or more genes or proteins (e.g., genes or proteins that have an age- related expression pattern); resistance to oxidative stress; metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.); and cellular proliferation (e.g., of retinal cells, bone cells, white blood cells, etc.).
- genes or proteins e.g., genes or proteins that have an age- related expression pattern
- resistance to oxidative stress e.g., metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.); and cellular proliferation (e.g., of retinal cells, bone cells, white blood cells, etc.).
- the methods described herein relate to increasing the life span of cells and/or protecting cells against at least certain stresses in vitro.
- cells in culture can be treated as described herein, such as to keep them proliferating longer.
- This is particularly useful for primary cell cultures (i.e., cells obtained from an organism, e.g., a human), which are known to have only a limited life span in culture. Treating such cells according to methods of the invention ( e.g., by contacting the cells with an agent that inhibits complex formation between HIF- ⁇ and c-Myc or the ability of
- HIF- ⁇ to inhibit c-Myc activity, levels or cell localization will result in increasing the amount of time that the cells are kept alive in culture.
- Embryonic stem (ES) cells and pluripotent cells, and cells differentiated therefrom can also be modified according to the methods of the invention such as to keep the cells or progeny thereof in culture for longer periods of time.
- Primary cultures of cells, ES cells, pluripotent cells and progeny thereof can be used, e.g., to identify compounds having particular biological effects on the cells or for testing the toxicity of compounds on the cells (i.e., cytotoxicity assays).
- cells that are intended to be preserved for long periods of time are treated as described herein.
- the cells can be cells in suspension, e.g., blood cells, stem cells, iPS cells, germ cells, germ cell precursors, or tissues or organs.
- blood collected from an individual for administering to an individual can be treated according to the invention, such as to preserve the blood cells or stem cells for longer periods of time.
- Other cells that one may treat for extending their lifespan and/or protect them against certain types of stresses include cells for consumption, e.g., cells from non- human mammals (such as meat), or plant cells (such as vegetables). Cells may also be treated prior to implantation or genetic or physical manipulation.
- cells obtained from a subject are treated according to the methods of the invention and then administered to the same or a different subject.
- cells or tissues obtained from a donor for use as a graft can be treated as described herein prior to administering to the recipient of the graft.
- bone marrow cells can be obtained from a subject, treated ex vivo to extend their life span and protect the cells against certain types of stresses and then administered to a recipient.
- the graft can be an organ, a tissue or loose cells.
- cells are treated in vivo to increase their life span and/or protect them against certain types of stresses.
- skin can be protected from aging, e.g., developing wrinkles, by treating skin, e.g., epithelial cells, as described herein.
- skin is contacted with a pharmaceutical or cosmetic composition comprising an agent described herein.
- the methods can also be applied to plants and plant cells. Accordingly, the invention also provides methods for extending the life span of plants and plant cells and for rendering the plant and plant cells more resistant to stress, e.g., excessive salt conditions. This can be achieved, e.g., by inhibiting complex formation of proteins in the plant cells that are essentially homologous to the proteins described herein in the animal systems (i.e., HIF- ⁇ and c-Myc) in order to increase the life span and/or the stress resistance of cells.
- stress e.g., excessive salt conditions.
- Agents that extend the life span of cells and protect them from stress can also be administered to subjects for treatment of diseases, e.g., chronic diseases, associated with cell death, such as to protect the cells from cell death, e.g., diseases associated with neural cell death or muscular cell death.
- diseases e.g., chronic diseases, associated with cell death, such as to protect the cells from cell death, e.g., diseases associated with neural cell death or muscular cell death.
- the methods may be used to prevent or alleviate neurodegeneration and peripheral neuropathies associated with chemotherapy, such as cancer chemotherapy (e.g., taxol or cisplatin treatment).
- Neurodegenerative diseases include Parkinson' s disease, Alzheimer' s disease, multiple sclerosis, amniotropic lateral sclerosis (ALS), retinal degeneration, macular degeneration, Huntington's disease and muscular dystrophy.
- the agents may be used as neuroprotective agents.
- the agent may be administered in the tissue or organ likely to encounter cell death.
- the methods described herein relate to improving the survival of a cell that has been exposed to hypoxia.
- the method includes contacting the cell with an that reduces inhibition of c-Myc activity by HIF-l .
- the cell has been exposed to a hypoxic environment.
- the cell is a neuron, a cardiac myocyte, a skeletal myocyte, an iPS cell, blood cell, germ cell or germ cell precursor.
- the cell is being cultured in vitro.
- the cell is a part of a tissue or organ of a subject who is administered the agent (e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis,
- the agent e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis,
- the present invention relates to a method of treating or preventing damage to a tissue or organ that has been exposed to hypoxia in a subject by administering an agent described herein to the subject.
- Tissues and organs are often exposed to hypoxic conditions during a stroke, a myocardial infarction or a peripheral vascular disease.
- the methods the subject that may be treated include patients suffering from a cardiac disease, e.g., ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease.
- Cardiovascular diseases that can be treated or prevented include cardiomyopathy or myocarditis; such as idiopathic
- cardiomyopathy metabolic cardiomyopathy
- alcoholic cardiomyopathy drug-induced cardiomyopathy
- ischemic cardiomyopathy hypertensive cardiomyopathy.
- atheromatous disorders of the major blood vessels such as the aorta, the coronary arteries, the carotid arteries, the cerebrovascular arteries, the renal arteries, the iliac arteries, the femoral arteries, and the popliteal arteries.
- Other vascular diseases that can be treated or prevented include those related to the retinal arterioles, the glomerular arterioles, the vasa nervorum, cardiac arterioles, and associated capillary beds of the eye, the kidney, the heart, and the central and peripheral nervous systems.
- the methods may also be used for increasing HDL levels in plasma of an individual.
- compositions of the present invention may be delivered by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.
- the pharmaceutical compositions are delivered generally ( e.g., via oral or parenteral administration).
- Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
- the selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
- a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
- the physician or veterinarian could prescribe and/or administer doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
- Mitochondria are highly dynamic organelles that are continuously eliminated and regenerated in a process known as mitochondrial biogenesis (Michel et al., 2012). Over the past 2 billion years, since eukaryotes subsumed the a-proteobacterial ancestor of mitochondria, most mitochondrial genes have been transferred to the nuclear genome, where regulation is better integrated. However, the mitochondrial genome still encodes rRNAs, tRNAs, and 13 subunits of the electron transport chain (ETC) (Falkenberg et al., 2007; Larsson, 2010). Functional communication between the nuclear and mitochondrial genomes is therefore essential for mitochondrial biogenesis and homeostasis, efficient oxidative phosphorylation, and normal health (Scarpulla, 2011b). The major known regulatory pathway of mitochondrial biogenesis involves the peroxisome
- NRF-1/-2 binds to and promotes transcription of nuclear genes encoding ETC components and the protein machinery needed to replicate, transcribe, and translate mitochondrial DNA (mtDNA).
- TFAM mitochondrial transcription factor A
- TFAM mitochondrial transcription factor A
- mCAT peroxisomal catalase to mitochondria
- SIRT1-7 Mammalian sirtuins (SIRT1-7) are a conserved family of NAD + -dependent lysine- modifying enzymes that modulate the physiological response to dietary changes and can protect against several age-related diseases (Haigis and Sinclair, 2010).
- the expression of SIRT1 an NAD + -dependent protein deacetylase, is elevated in a number of tissues following restriction of caloric intake (CR) by 30-40% (Cohen et al., 2004), one intervention generally accepted to extend lifespan.
- Overexpression or pharmacological activation of SIRT1 reproduces many of the health benefits of CR, including protection from metabolic decline (Banks et al., 2008; Baur et al., 2006; Bordone et al., 2007;
- SIRT1 regulates HIF- ⁇ transcriptional activity under hypoxic conditions (Lim et al., 2010) while SIRT3 regulates HIF- ⁇ protein stability (Bell et al., 2011; Finley et al., 2011).
- the Hif-1 gene regulates lifespan and may also mediate the effects of CR (Chen et al., 2009; Leiser and Kaeberlein, 2010), however, a role for HIF- ⁇ in mammalian aging has not been explored.
- the present disclosure provides evidence that a cause of the disruption in mitochondrial homeostasis during aging is a pseudohypoxic response that disrupts the coordination between the nuclear and mitochondrial genomes, eliciting a specific decline in mitochondrial-encoded genes.
- the cause was traced to a decline in nuclear NAD + and
- SIRT1 activity with age which triggers the accumulation of HIF- ⁇ that suppresses the ability of c-Myc to regulate TFAM, independently of the canonical PGC-l pathway.
- the result is an imbalance between nuclear- and mitochondrial-encoded ETC components and loss of oxidative phosphorylation (OXPHOS) capacity, leading to mitochondrial dysfunction and thus loss of cell health (which in turn results in e.g., aging, age-related diseases, and other diseases or disorders described herein).
- OXPHOS oxidative phosphorylation
- mitochondrial dysfunction or “deregulation of mitochondrial homeostasis” means that one or more mitochondrial component (e.g., ETC component) is depleted, for example by a decrease in mitochondrial gene expression or mitochondrial DNA content, resulting in compromised mitochondrial function (e.g., loss of or decreased oxidative phosphorylation (OXPHOS) capacity).
- ETC component e.g., ETC component
- OXPHOS oxidative phosphorylation
- diseases, disorders, or conditions associated with mitochondrial dysfunction include, but are not limited to, aging, aging-related diseases, mitochondrial diseases (e.g., Alper's disease, Barth syndrome, beta- oxidation defects, carnitine-acyl-carnitine deficiency, carnitine deficiency, creatine deficiency syndromes, coenzyme Q10 deficiency, complex I deficiency, complex II deficiency, complex III deficiency, complex IV deficiency/COX deficiency, complex V deficiency, chronic progressive external ophthalmoplegia syndrome, CPT I deficiency, CPT II deficiency, Kearns-Sayre syndrome, lactic acidosis, long-chain acyl-CoA dehydrongenase deficiency, Leigh disease, Heil disease, glutaric aciduria type II, mitochondrial cytopathy,
- mitochondrial diseases e.g., Alper's disease, Barth syndrome, beta-
- mitochondrial DNA depletion mitochondrial encephalopathy, mitochondrial myopathy, and Pearson syndrome
- metabolic diseases and disorders e.g., amino acid deficiency
- diseases resulting from mitochondrial and energy deficiency lethargy, heart disorders, cardiovascular disease, stroke, infarction, pulmonary hypertension, ischemia, cachexia, sarcopenia
- neurodegenerative diseases e.g., Alzherimer's disease, Parkinson's disease, Huntington's disease
- dementia lipodystrophy
- liver steatosis hepatitis
- cirrhosis cirrhosis
- methods and compositions provided herein are useful for promoting cell viability (in various species), vascular remodeling, wound healing and healing in general (e.g., treating wounds resulting from cuts, scrapes, surgery, bodily insults, trauma, burns, abrasions, sunburns, etc.).
- the methods and compositions are useful for promoting iron homeostasis and/or erythropoiesis.
- methods and compositions provided herein are useful to promote successful organ and tissue transplantation, or to promote recovery from organ and tissue transplantation.
- provided methods and compositions are useful for preserving cells and organs.
- methods and compositions provided herein have cosmetic applications, for example for treating conditions associated with mitochondrial dysfunction which relate to the skin or scalp/hair, such as skin aging (e.g., loss in volume and elasticity, discoloration, liver spots (lentigo senislis)), wrinkles, baldness, and loss of hair
- agents or compositions described herein are useful for products or methods relating to cosmetics, energy drinks, and/or animal industries.
- the methods include administering to the subject an effective amount of an agent that inhibits HIF-l .
- HIF-l inhibitors can inhibit activity of the protein including its binding to hypoxia-responsive elements, promote degradation of HIF- la, reduce HIF-l protein stability, or inhibit HIF-la protein synthesis.
- Small molecule HIF-la inhibitors include: chrysin (5,7-dihydroxyflavone); methyl 3-(2-(4-(adamantan-l- yl)phenoxy)acetamido)-4-hydroxybenzoate (LW6; see Biochem Pharmacol. 2010 Oct
- HIF-la inhibitors also can include siRNA molecules (see BMC Cancer 2010, 10:605; US 13/555,589) or antisense
- oligonucleotides e.g., EZN-2968 - see Mol Cancer Ther. 2008 Nov;7(l l):3598-608.
- the subject is typically a subject having, or suspected of having a disease, disorder, or condition associated with mitochondrial dysfunction (e.g., as described herein).
- the methods further comprise administering to the subject an effective amount of an agent that increases the levels of nicotinamide adenine dinucleotide (NAD+; which may also be referred to herein as NAD) in the subject.
- NAD + precursor such as nicotinic acid, nicotinamide, nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), or a salt thereof or prodrug thereof.
- NAD + precursor such as nicotinic acid, nicotinamide, nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), or a salt thereof or prodrug thereof.
- such an agent is administered at a dose of between 0.5 - 5 grams per day.
- NMN is orally administered in doses of between 250 mg - 5 grams per day.
- NAD + levels also can be increased by increasing the activity of enzymes
- NAD + biosynthesis nicotinate phosphoribosyl transferase 1 (NPT1), pyrazinamidase/nicotinamidase 1 (PNC1), nicotinic acid mononucleotide adenylyltransf erase 1 (NMA1), nicotinic acid mononucleotide adenylyltransferase 2 (NMA2), nicotinamide N-methyltransferase (NNMT), nicotinamide phosphoribosyl transferase (NAMPT or NAMPRT), nicotinate/nicotinamideamide
- NTT1 nicotinate phosphoribosyl transferase 1
- PNC1 pyrazinamidase/nicotinamidase 1
- NMA1 nicotinic acid mononucleotide adenylyltransf erase 1
- NMA2 nicotinic acid mononucleot
- NMNAT-1 mononucleotide adenylyl transferase 1
- NMNAT-2 nicotinamide mononucleotide adenylyl transferase 2
- the methods include administering to a subject an effective amount of an agent that increases the levels of NAD+, without administering an inhibitor of HIF-l .
- compositions of matter including NAD + precursors, such as NMN or a salt thereof or prodrug thereof. Further aspects of the invention relate to compositions of matter including an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD + biosynthesis, or an enzymatically active fragment thereof.
- compositions include conjugates of agents described herein, such as fish oil conjugates.
- prodrug means a derivative of a compound that can hydrolyze, oxidize, or otherwise react under biological conditions (in vitro or in vivo) to provide a compound described herein as useful in the methods of the invention. While prodrugs typically are designed to provide active compound upon reaction under biological conditions, prodrugs may have similar activity as a prodrug.
- Prodrugs of the compounds described herein can be prepared by modifying functional groups present in said component in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent component.
- prodrugs are described for instance in WO 99/33795, WO 99/33815, WO 99/33793 and WO 99/33792, each of which is incorporated herein by reference for these teachings.
- Prodrugs can be characterized by increased bio-availability and are readily metabolized into the active inhibitors in vivo.
- prodrugs include, but are not limited to, analogs or derivatives of the compounds described herein, further comprising biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates,
- prodrugs include derivatives of the compounds described herein that comprise -NO, -N0 2 , -ONO, or -ON0 2 moieties. Prodrugs are prepared using methods known to those of skill in the art, such as those described by BURGER'S
- biohydrolyzable amide As used herein, the terms “biohydrolyzable amide,” “biohydrolyzable ester,”
- biohydrolyzable carbamate means an amide, ester, carbamate, carbonate, ureide, or phosphate analogue, respectively, that either: 1) does not destroy the biological activity of the compound and confers upon that compound advantageous properties in vivo, such as uptake, duration of action, or onset of action; or 2) is itself biologically inactive but is converted in vivo to a biologically active compound.
- biohydrolyzable amides include, but are not limited to, lower alkyl amides, a-amino acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides.
- biohydrolyzable esters include, but are not limited to, lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl esters, and choline esters.
- biohydrolyzable carbamates include, but are not limited to, lower alkylamines, substituted ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and heteroaromatic amines, and polyether amines.
- Prodrugs can include fatty acids or lipids linked to the compounds described herein by the moieties described herein.
- exemplary fatty acids include the omega-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA).
- EPA omega-3 fatty acids eicosapentaenoic acid
- DHA docosahexaenoic acid
- salt or “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
- compositions of this invention include those derived from suitable inorganic and organic acids and bases. Examples of
- nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
- inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid
- organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
- salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate,
- Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N + (C 1 ⁇ alkyl) 4 salts.
- Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
- Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
- solvate includes any combination which may be formed by a compound of this invention with a suitable inorganic solvent (e.g. hydrates) or organic solvent, such as but not limited to alcohols, ketones, esters and the like.
- suitable inorganic solvent e.g. hydrates
- organic solvent such as but not limited to alcohols, ketones, esters and the like.
- the invention includes methods for delivering agents to a subject.
- the term "subject” refers to a human or non-human mammal.
- Non-human mammals include livestock animals, companion animals, laboratory animals, and non-human primates.
- Non-human subjects also specifically include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits.
- the subject is a patient.
- a "patient” refers to a subject who is under the care of a physician, dentist, or other health care worker, including someone who has consulted with, received advice from or received a prescription or other
- a patient is typically a subject having or at risk of having a disorder associated with mitochondrial dysfunction.
- compositions comprising one or more HIF- l inhibitors and/or one or more agents that increase the level of NAD + in a subject are provided.
- the HIF- ⁇ inhibitors and additional agents are collectively referred to as the "agents" or "active ingredient” s of the pharmaceutical compositions provided herein.
- the compositions comprising the agents can be mixed with a
- compositions are delivered or administered in effective amounts to treat an individual, such as a human having a disease or disorder resulting from a nonsense mutation, for example those described herein.
- a pharmaceutically acceptable carrier is compatible with the active ingredient(s) of the composition (and preferably, capable of stabilizing it).
- Such compositions are delivered or administered in effective amounts to treat an individual, such as a human having a disease or disorder resulting from a nonsense mutation, for example those described herein.
- To “treat” a disease means to reduce or eliminate a sign or symptom of the disease, to stabilize the disease, and/or to reduce or slow further progression of the disease.
- “treat”, “treatment” or “treating” is intended to include prophylaxis, amelioration, prevention or cure from the disease.
- Actual dosage levels of active ingredients in the pharmaceutical compositions of the invention can be varied to obtain an amount of the active HIF- ⁇ inhibitor(s) and/or other agent(s) that is effective to achieve the desired therapeutic response for a particular patient, combination, and mode of administration.
- the selected dosage level depends upon the activity of the particular HIF- ⁇ inhibitors and other agent(s), the route of administration, the severity of the condition being treated, the condition, and prior medical history of the patient being treated. However, it is within the skill of one in the art to start doses of the compositions described herein at levels lower than required to achieve the desired therapeutic effort and to gradually increase the dosage until the desired effect is achieved.
- a “therapeutically effective amount,” as used herein, refers to an amount of a compound and/or an additional therapeutic agent, or a composition thereof that results in improvement (complete or partial) of a disease or disorder caused by mitochondrial dysfunction (e.g., mitochondrial homeostasis deregulation).
- a therapeutically effective amount also refers to an amount that prevents or delays the onset of a disease or disorder caused by mitochondrial dysfunction (e.g., mitochondrial homeostasis deregulation).
- the therapeutically effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration, and like factors are within the knowledge and expertise of the health practitioner. For example, an effective amount can depend upon the duration the subject has had the disease.
- an effective amount of a composition described herein when administered to a subject results in e.g., increased muscle strength, increased motility, restoration of muscle function or phenotype, decreased fatigue, decreased difficulty with motor skills, decreased dementia, etc.
- the desired therapeutic or clinical effect resulting from administration of an effective amount of a composition described herein may be measured or monitored by methods known to those of ordinary skill in the art e.g., by routine physical examination.
- an effective amount can refer to each individual agent or to the combination as a whole, wherein the amounts of all agents administered are together effective, but wherein the component agent of the combination may not be present individually in an effective amount.
- compositions described herein can be administered to a subject by any suitable route.
- compositions can be administered orally, including sublingually, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically and transdermally (as by powders, ointments, or drops), bucally, or nasally.
- parenteral administration refers to modes of administration other than through the gastrointestinal tract, which include intravenous, intramuscular, intraperitoneal, intrasternal, intramammary, intraocular, retrobulbar, intrapulmonary, intrathecal, subcutaneous and intraarticular injection and infusion.
- Surgical implantation also is contemplated, including, for example, embedding a composition of the disclosure in the body such as, for example, in the brain, in the abdominal cavity, under the splenic capsule, brain, or in the cornea.
- compositions described herein can also be administered in the form of liposomes.
- liposomes generally are derived from
- Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any nontoxic, physiologically acceptable, and metabolizable lipid capable of forming liposomes can be used.
- the present compositions in liposome form can contain, in addition to an agent of the present disclosure, stabilizers, preservatives, excipients, and the like.
- the preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art. See, for example, Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N.Y. (1976), p. 33, et seq.
- Dosage forms for topical administration of the pharmaceutical compositions described herein include powders, sprays, ointments, and inhalants as described herein.
- the active agent(s) is mixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives, buffers, or propellants which may be required.
- Ophthalmic formulations eye ointments, powders, and solutions also are contemplated as being within the scope of this disclosure.
- compositions for parenteral injection comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
- suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water ethanol, polyols (such as, glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such, as olive oil), and injectable organic esters such as ethyl oleate.
- Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
- Compositions also can contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It also may be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
- compositions described herein e.g., those containing HIF- ⁇ inhibitors and/or agents that increase NAD + levels
- intramuscular injection This result can be accomplished by the use of a liquid suspension of crystalline or amorphous materials with poor water solubility.
- the rate of absorption of the active agent(s) then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form.
- delayed absorption of a parenterally administered active agent(s) is accomplished by dissolving or suspending the agent(s) in an oil vehicle.
- Injectable depot forms are made by forming microencapsule matrices of the agent(s) in biodegradable polymers such a polylactide-polyglycolide. Depending upon the ratio of agent(s) to polymer and the nature of the particular polymer employed, the rate of agent(s) release can be controlled. Examples of other biodegradable polymers include
- Depot injectable formulations also are prepared by entrapping the agent(s) in liposomes or microemulsions which are compatible with body tissue.
- the injectable formulations can be sterilized, for example, by filtration through a bacterial- or viral-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
- Oral solid dosage forms are described generally in
- Solid dosage forms for oral administration include capsules, tablets, pills, powders, troches or lozenges, cachets, pellets, and granules.
- liposomal or proteinoid encapsulation can be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Pat. No. 4,925,673).
- Liposomal encapsulation may include liposomes that are derivatized with various polymers (e.g., U.S.
- the formulation includes the agent(s) and inert ingredients which protect against degradation in the stomach and which permit release of the biologically active material in the intestine.
- agents that increase levels of NAD + for example NMN, can be orally administered in dosages from 250 mg to 5 grams per day.
- the agent(s) is mixed with, or chemically modified to include, a least one inert, pharmaceutically acceptable excipient or carrier.
- the excipient or carrier preferably permits (a) inhibition of proteolysis and/or nucleic acid degradation, and (b) uptake into the blood stream from the stomach or intestine.
- the excipient or carrier increases uptake of the agent(s), overall stability of the agent(s)and/or circulation time of the agent(s) in the body.
- Excipients and carriers include, for example, sodium citrate or dicalcium phosphate and/or (a) fillers or extenders such as starches, lactose, sucrose, glucose, cellulose, modified dextrans, mannitol, and silicic acid, as well as inorganic salts such as calcium triphosphate, magnesium carbonate and sodium chloride, and commercially available diluents such as FAST-FLO®, EMDEX®, STA-RX 1500®, EMCOMPRESS® and AVICEL®, (b) binders such as, for example,
- AMBERLITE® sodium carboxymethylcellulose, ultramylopectin, gelatin, orange peel, carboxymethyl cellulose, natural sponge, bentonite, insoluble cationic exchange resins, and powdered gums such as agar, karaya or tragacanth;
- solution retarding agents such a paraffm
- absorption accelerators such as quaternary ammonium compounds and fatty acids including oleic acid, linoleic acid, and linolenic acid
- g) wetting agents such as, for example, cetyl alcohol and glycerol monosterate, anionic detergent surfactants including sodium lauryl sulfate, dioctyl sodium sulfosuccinate, and dioctyl sodium sulfonate
- cationic detergents such as benzalkonium chloride or benzethonium chloride, nonionic detergents including lauromacrogol 400, polyoxyl 40 stearate, polyoxy
- compositions of a similar type also can be employed as fillers in soft and hard- filled gelatin capsules, using such excipients as lactose or milk sugar, as well as high molecular weight polyethylene glycols and the like.
- the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They optionally can contain opacifying agents and also can be of a composition that they release the active ingredients(s) only, or preferentially, in a part of the intestinal tract, optionally, in a delayed manner.
- exemplary materials include polymers having pH sensitive solubility, such as the materials available as EUDRAGIT® Examples of embedding compositions which can be used include polymeric substances and waxes.
- agent(s) also can be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
- Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active
- the liquid dosage forms can contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol ethyl carbonate ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol,
- inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol ethyl carbonate ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in
- tetrahydroflirfuryl alcohol polyethylene glycols, fatty acid esters of sorbitan, and mixtures thereof.
- the oral compositions also can include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, coloring, flavoring, and perfuming agents.
- adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, coloring, flavoring, and perfuming agents.
- Oral compositions can be formulated and further contain an edible product, such as a beverage. Oral composition can also be administered by oral gavage.
- Suspensions in addition to the active ingredient(s), can contain suspending agents such as, for example ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and mixtures thereof.
- suspending agents such as, for example ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and mixtures thereof.
- Also contemplated herein is pulmonary delivery of the HIF- ⁇ inhibitors and/or agents that increase NAD + levels.
- the agents are delivered to the lungs of a mammal while inhaling, thereby promoting the traversal of the lung epithelial lining to the blood stream.
- Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
- Some specific examples of commercially available devices suitable for the practice of the invention are the ULTRA VENT® nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, MO; the ACORN II® nebulizer, manufactured by Marquest Medical Products, Englewood, CO.; the VENTOL® metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, N.C.; and the SPINHALER® powder inhaler, manufactured by Fisons Corp., Bedford, MA.
- each formulation is specific to the type of device employed and can involve the use of an appropriate propellant material, in addition to diluents, adjuvants, and/or carriers useful in therapy.
- composition is prepared in particulate form, preferably with an average particle size of less than 10 ⁇ , and most preferably 0.5 to 5 ⁇ , for most effective delivery to the distal lung.
- Carriers include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol.
- Other ingredients for use in formulations may include lipids, such as DPPC, DOPE, DSPC and DOPC, natural or synthetic surfactants, polyethylene glycol (even apart from its use in derivatizing the inhibitor itself), dextrans, such as cyclodextran, bile salts, and other related enhancers, cellulose and cellulose derivatives, and amino acids.
- liposomes are contemplated.
- microcapsules or microspheres inclusion complexes, or other types of carriers.
- Formulations suitable for use with a nebulizer typically comprise an agent of the invention dissolved in water at a concentration of about 0.1 to 25 mg of biologically active protein per mL of solution.
- the formulation also can include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure).
- the nebulizer formulation also can contain a surfactant to reduce or prevent surface- induced aggregation of the inhibitor composition caused by atomization of the solution in forming the aerosol.
- Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the agent suspended in a propellant with the aid of a surfactant.
- the propellant can be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof.
- Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid also can be useful as a surfactant.
- Formulations for dispensing from a powder inhaler device comprise a finely divided dry powder containing the agent(s) and also can include a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol, in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
- a bulking agent such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol
- Nasal delivery of the agent(s) and compositions of the invention also are possible.
- Nasal delivery allows the passage of the agent(s) or composition to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
- Formulations for nasal delivery include those with dextran or cyclodextran. Delivery via transport across other mucous membranes also is contemplated.
- compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the agent(s) with suitable nonirritating excipients or carriers, such as cocoa butter, polyethylene glycol, or suppository wax, which are solid at room temperature, but liquid at body temperature, and therefore melt in the rectum or vaginal cavity and release the active agent.
- suitable nonirritating excipients or carriers such as cocoa butter, polyethylene glycol, or suppository wax, which are solid at room temperature, but liquid at body temperature, and therefore melt in the rectum or vaginal cavity and release the active agent.
- compositions of relatively high hydrophobicity are preferred.
- Agent(s) can be modified in a manner which increases hydrophobicity, or the agents can be encapsulated in hydrophobic carriers or solutions which result in increased hydrophobicity.
- kits comprising a pharmaceutical composition comprising a therapeutically effective amount of one or more HIF- ⁇ inhibitors and/or a therapeutically effective amount of one or more agents that increase NAD + levels and instructions for administration of the pharmaceutical composition.
- the kit can include a pharmaceutical preparation vial, a pharmaceutical preparation diluent vial, and the HIF- ⁇ inhibitors(s) and additional agent(s).
- the diluent vial contains a diluent such as physiological saline for diluting what could be a concentrated solution or lyophilized powder of the agent of the invention.
- the instructions include instructions for mixing a particular amount of the diluent with a particular amount of the concentrated pharmaceutical preparation, whereby a final formulation for injection or infusion is prepared.
- the instructions include instructions for use in a syringe or other administration device.
- the instructions include instructions for treating a patient with an effective amount of the HIF- ⁇ inhibitors(s) and optional additional agent(s).
- the containers containing the preparations can contain indicia such as conventional markings which change color when the preparation has been autoclaved or otherwise sterilized.
- methods for screening for inhibitors of HIF- ⁇ are provided.
- increased HIF- ⁇ activity or levels is causative of mitochondrial dysfunction.
- Such dysfunction can be measured according to standard methods, for example any of those described in the Examples section.
- a readout of mitochondrial dysfunction e.g., resulting from increased levels or activity of HIF- ⁇ is a decrease in mitochondrial gene expression.
- a screening method for identifying a HIF- ⁇ inhibitors comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the level of expression of one or more mitochondrial genes; (c) comparing the level of expression determined in (b) to a reference level of expression, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF- ⁇ inhibitor if a significantly decreased level of mitochondrial gene expression is determined in (b), as compared to the reference level in (c).
- the reference level is a predetermined level, for example the wild type level, or the level in a mutant cell.
- the one or more mitochondrial genes is selected from any of the 13 genes encoding protein in the mitochondrial genome, for example cytochrome b, cytochrome oxidase, NADH
- the eukaryotic cell is any of the cells described in the Examples section, including those genetically modified.
- the cell may comprise a knockout of SIRTl, which as described herein has an accumulation of HIFl-a, and thus mitochondrial dysfunction.
- the method would comprise contacting the cell with a candidate compound and identifying the compound as a HIF- ⁇ inhibitor if the candidate compound increases mitochondrial gene expression, or otherwise improves or restores mitochondrial function or homeostasis.
- the readout of mitochondrial dysfunction is a loss or depletion of mitochondrial DNA content.
- the method comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the amount of mitochondrial DNA in the cell; (c) comparing the amount determined in (b) to a reference amount, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF- ⁇ inhibitor if a significantly decreased amount of mitochondrial DNA is determined in (b), as compared to the reference level in (c).
- the reference level is a predetermined level, for example the wild type level, or the level in a mutant cell.
- the eukaryotic cell is any of the cells described in the Examples section, including those genetically modified.
- the cell may comprise a knockout of SIRTl, which as described herein has an accumulation of HIFl-a, and thus mitochondrial dysfunction (and depletion or loss of mitochondrial DNA).
- the method would comprise contacting the cell with a candidate compound and identifying the compound as a HIF- ⁇ inhibitor if the candidate compound increases the amount of mitochondrial DNA in the cell.
- the methods include administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject.
- agents include NAD+ precursors, such as NMN or a salt thereof or prodrug thereof.
- such an agent is administered at a dose of between 0.5 - 5 grams per day.
- agents include an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
- the subject is a human or non-human mammal.
- NAD+ nicotinamide adenine dinucleotide
- NAD+ precursors such as nicotinic acid, nicotinamide, nicotinamide mononucleotide (NMN) and nicotinamide riboside (NR).
- NAD+ levels also can be increased by increasing the activity of enzymes involved in NAD+ biosynthesis (de novo synthesis or salvage pathways). Enzymes involved in NAD+ biosynthesis such as nicotinate phosphoribosyl transferase 1 (NPT1),
- PNC1 pyrazinamidase/nicotinamidase 1
- adenylyltransferase 1 (NMA1), nicotinic acid mononucleotide adenylyltransferase 2 (NMA2), nicotinamide N-methyltransferase (NNMT), nicotinamide phosphoribosyl transferase (NAMPT or NAMPRT), nicotinate/nicotinamide mononucleotide adenylyl transferase 1 (NMNAT-1), and nicotinamide mononucleotide adenylyl transferase 2 (NMNAT-2); are described in US 7,977,049, which is incorporated by reference herein.
- prodrug means a derivative of a compound that can hydrolyze, oxidize, or otherwise react under biological conditions (in vitro or in vivo) to provide a compound described herein as useful in the methods of the invention. While prodrugs typically are designed to provide active compound upon reaction under biological conditions, prodrugs may have similar activity as a prodrug.
- prodrugs typically are designed to provide active compound upon reaction under biological conditions, prodrugs may have similar activity as a prodrug.
- Prodrugs of the compounds described herein can be prepared by modifying functional groups present in said component in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent component.
- prodrugs are described for instance in WO 99/33795, WO 99/33815, WO 99/33793 and WO 99/33792, each of which is incorporated herein by reference for these teachings.
- Prodrugs can be characterized by increased bio-availability and are readily metabolized into the active inhibitors in vivo.
- prodrugs include, but are not limited to, analogs or derivatives of the compounds described herein, further comprising biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates,
- prodrugs include derivatives of the compounds described herein that comprise NO, N02, ONO, or ON02 moieties. Prodrugs are prepared using methods known to those of skill in the art, such as those described by BURGER'S
- biohydrolyzable amide means an amide, ester, carbamate, carbonate, ureide, or phosphate analogue, respectively, that either: 1) does not destroy the biological activity of the compound and confers upon that compound advantageous properties in vivo, such as uptake, duration of action, or onset of action; or 2) is itself biologically inactive but is converted in vivo to a biologically active compound.
- biohydrolyzable amides include, but are not limited to, lower alkyl amides, a-amino acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides.
- biohydrolyzable esters include, but are not limited to, lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl esters, and choline esters.
- biohydrolyzable carbamates include, but are not limited to, lower alkylamines, substituted ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and heteroaromatic amines, and polyether amines.
- Prodrugs can include fatty acids or lipids linked to the compounds described herein by the moieties described herein.
- exemplary fatty acids include the omega-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA).
- EPA omega-3 fatty acids eicosapentaenoic acid
- DHA docosahexaenoic acid
- salt or “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
- compositions of this invention include those derived from suitable inorganic and organic acids and bases. Examples of
- nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
- inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid
- organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
- salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate,
- Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(Cl-4alkyl)4 salts.
- Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
- Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
- solvate includes any combination which may be formed by a compound of this invention with a suitable inorganic solvent (e.g. hydrates) or organic solvent, such as but not limited to alcohols, ketones, esters and the like.
- suitable inorganic solvent e.g. hydrates
- organic solvent such as but not limited to alcohols, ketones, esters and the like.
- compositions of matter including NAD+ precursors, such as NMN or a salt thereof or prodrug thereof. Further aspects of the invention relate to compositions of matter including an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
- compositions include conjugates of agents described herein, such as fish oil conjugates.
- disorders associated with inflammation include septic shock, obesity-related inflammation, Parkinson's Disease, Crohn's Disease, Alzheimer's Disease (AD), cardiovascular disease (CVD), inflammatory bowel disease (IBD), chronic obstructive pulmonary disease, blood inflammation, joint inflammation, arthritis, asthma, ulcerative colitis, hepatitis (e.g., viral chronic hepatitis), psoriasis, atopic dermatitis, pemphigus, glomerulonephritis, atherosclerosis, sarcoidosis, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Wegner's syndrome, Goodpasture's syndrome, giant cell arteritis, polyarteritis nodosa, idiopathic pulmonary fibrosis, acute lung injury, post-influenza pneumonia, SARS, tuberculosis, malaria, sep
- transplantation e.g., host-mediated rejection of transplanted tissue such as hematopoietic stem cells or an organ, graft mediated host response, such as graft vs. host disease
- systemic lupus erythematosis autoimmune diabetes, thyroiditis
- radiation pneumonitis eye irritation, reduced longevity, respiratory inflammation and pulmonary inflammation.
- Pulmonary inflammation can be caused by infection, such as from an influenza virus, rhinovirus, respiratory syncytial virus, parainfluenza, Staphylococcus aureus, Streptococcus pneumoniae, Francisella tularensis, Mycobacterium tuberculosis and Bacillus anthracis.
- the invention includes methods for delivering agents to a subject.
- the term "subject” refers to a human or non-human mammal.
- Non-human mammals include livestock animals, companion animals, laboratory animals, and non-human primates.
- Non-human subjects also specifically include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits.
- the subject is a patient.
- a "patient” refers to a subject who is under the care of a physician, dentist, or other health care worker, including someone who has consulted with, received advice from or received a prescription or other
- a patient is typically a subject having or at risk of having a disorder associated with inflammation.
- treat, treated, or treating when used with respect to an disorder such as a disorder associated with inflammation refers to a prophylactic treatment which increases the resistance of a subject to development of the disease or, in other words, decreases the likelihood that the subject will develop the disease as well as a treatment after the subject has developed the disease in order to fight the disease or prevent the disease from becoming worse.
- an effective amount of an agent of the invention refers to the amount necessary or sufficient to realize a desired biologic effect.
- an effective amount of an agent for treating a disorder associated with inflammation is that amount sufficient to prevent an increase in one or more symptoms of a disorder associated with inflammation in the subject or that amount necessary to decrease one or more symptoms of a disorder associated with inflammation in the subject that would otherwise occur in the absence of the agent.
- an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
- the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, or the severity of the disease or condition.
- One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the invention without necessitating undue experimentation.
- the agents of the invention may be delivered to the subject on an as needed or desired basis. For instance a subject may self-administer the agents as desired or a physician may administer the agents. Additionally a physician or other health care worker may select a delivery schedule. In other embodiments of the invention, the agents are administered on a routine schedule.
- routine schedule may involve administration of the composition on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between, every two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, etc.
- the composition may involve administration of the composition on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between, every two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, etc.
- the routine schedule may involve administration of the composition on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between, every two months, three months, four months,
- predetermined routine schedule may involve, for example, administration of the
- composition on a daily basis for the first week, followed by a monthly basis for several months, and then every three months after that. Any particular combination would be covered by the routine schedule as long as it is determined ahead of time that the appropriate schedule involves administration on a certain day.
- the agents may be administered alone or in any appropriate pharmaceutical carrier, such as a liquid, for example saline, or a powder, for administration in vivo. They can also be co-delivered with larger carrier particle or within administration devices.
- the agents may be formulated.
- the formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable
- concentrations of salt concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
- an effective amount of the agents can be administered to a subject by any mode.
- Administering a pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
- Routes of administration include but are not limited to oral, parenteral, intramuscular, intravenous, subcutaneous, mucosal, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, dermal, rectal, and by direct injection. It is well known to those skilled in the art that agents may be administered to patients using a full range of routes of administration.
- agents may be blended with direct compression or wet compression tableting excipients using standard formulation methods. The resulting granulated masses may then be compressed in molds or dies to form tablets and subsequently administered via the oral route of administration.
- particle granulates may be extruded, spheronized and administered orally as the contents of capsules and caplets.
- Tablets, capsules and caplets may be film coated to alter dissolution of the delivery system (enteric coating) or target delivery of the particle to different regions of the gastrointestinal tract.
- particles may be orally administered as suspensions in aqueous fluids or sugar solutions (syrups) or hydroalcoholic solutions (elixirs) or oils. The particles may also be administered directly by the oral route without any further processing.
- the agents of the invention may be systemically administered in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules or compressed into tablets.
- a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules or compressed into tablets.
- the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- Such compositions and preparations should contain at least 0.1% of an active compound, e.g., calcium.
- the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form.
- agents described herein such as NMN or a salt or prodrug thereof, are administered at a dosage of 250 mg - 5 grams per day, by an oral route.
- the tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added.
- a liquid carrier such as a vegetable oil or a polyethylene glycol.
- any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
- a coating impermeable to at least pH 5.0 can be helpful.
- examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
- a coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow.
- Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic, e.g., powder; for liquid forms, a soft gelatin shell may be used.
- the shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
- the agents of the invention may also be administered intravenously or
- Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes.
- the compositions of the invention are not encapsulated or formulated in liposomes.
- the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage.
- the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants.
- the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum
- the agents of the invention will generally be administered as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.
- a dermatologically acceptable carrier which may be a solid or a liquid.
- Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like.
- Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non- toxic surfactants.
- Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.
- compositions of the inventions may include a physiologically or
- pharmaceutically acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
- pharmaceutically- acceptable carrier means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
- carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- the components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired
- a pharmaceutical preparation is a composition suitable for administration to a subject. Such preparations are usually sterile and prepared according to GMP standards, particularly if they are to be used in human subjects.
- a pharmaceutical composition or preparation comprises the particles, and optionally agents of the invention and a pharmaceutically- acceptable carrier, wherein the agents are generally provided in effective amounts.
- Agents may also be suspended in non- viscous fluids and nebulized or atomized for administration of the dosage form to nasal membranes. Agents may also be delivered parenterally by either intravenous, subcutaneous, intramuscular, intrathecal, intravitreal or intradermal routes as sterile suspensions in isotonic fluids.
- agents may be nebulized and delivered as dry powders in metered-dose inhalers for purposes of inhalation delivery.
- the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of for use in an inhaler or insufflator may be formulated containing the microparticle and optionally a suitable base such as lactose or starch.
- suitable base such as lactose or starch.
- MDI metered dose inhalers
- DPI dry powder inhaler
- spacer/holding chambers in combination with MDI spacer/holding chambers in combination with MDI
- nebulizers nebulizers.
- Techniques for preparing aerosol delivery systems are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the agent in the nanoparticle or microparticle (see, for example, Sciarra and Cutie, "Aerosols," in Remington's Pharmaceutical Sciences, 18th edition, 1990, pp. 1694-1712; incorporated by reference).
- Ultravent nebulizer manufactured by Mallinckrodt, Inc., St. Louis, Missouri
- Acorn II nebulizer manufactured by Marquest Medical Products, Englewood, Colorado
- the Ventolin metered dose inhaler manufactured by Glaxo Inc., Research Triangle Park, North Carolina
- the Spinhaler powder inhaler manufactured by Fisons Corp., Bedford, Massachusetts.
- Agents when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- kits comprising a pharmaceutical composition comprising a therapeutically effective amount of one or more agents that increase NAD+ levels and instructions for administration of the pharmaceutical composition.
- the kit can include a pharmaceutical preparation vial, a pharmaceutical preparation diluent vial, and the agent(s).
- the diluent vial can contain a diluent such as physiological saline for diluting what could be a concentrated solution or lyophilized powder of the agent of the invention.
- the instructions include instructions for mixing a particular amount of the diluent with a particular amount of the concentrated pharmaceutical preparation, whereby a final formulation for injection or infusion is prepared.
- the instructions include instructions for use in a syringe or other administration device. In some embodiments, the instructions include instructions for treating a patient with an effective amount of an agent. It also will be understood that the containers containing the preparations, whether the container is a bottle, a vial with a septum, an ampoule with a septum, an infusion bag, and the like, can contain indicia such as conventional markings which change color when the preparation has been autoclaved or otherwise sterilized.
- mice Whole body adult-inducible SIRT1 knockout mice were treated with tamoxifen for 5 weeks and the efficiency of deletion in DNA from tail samples was determined by PCR. Animals were then maintained on regular diet for 4 months. For the fasting experiments, mice were fasted for 16 hrs prior to sacrifice. All animal care followed the guidelines and was approved by the Institutional Animal Care and Use Committees (IACUCs) at Harvard Medical School.
- IACUCs Institutional Animal Care and Use Committees
- mice of 3, 6, 22, 24, or 30 months of age were obtained from the National Institutes of Aging mouse aging colony. Mice were acclimated for at least one- week prior to sacrifice. 3, and 24-month-old mice were given interperitoneal (IP) injections of 500 mg NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee
- TFAM promoter, HRE and c-Myc activity were determined using a luciferase-based system. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference.
- NAD + from C2C12 cells and skeletal muscle was quantified with a commercially available kit (Bio Vision) according to the manufacturer's instructions and as described before (Gomes et ah, Biochim. Biophys. Acta. 1822: 185-195 (2012)).
- Bio Vision Bio Vision
- SIRTl knockout mice die in utero or exhibit developmental abnormalities.
- tissue-specific knockouts which are viable, one cannot rule out the possibility that artifacts have been introduced during the selection pressures of development.
- SIRTl KO adult- inducible whole body SIRTl knockout mouse strain
- SIRTl floxAE4/floxAE4 SIRTl floxAE4/floxAE4
- WT wildtype controls
- genome asynchrony was not a phenotype of the PGC- ⁇ / ⁇ KO myotubes under basal conditions, as both the mitochondrial and nuclear encoded components of the ETC were similarly affected by the knockout.
- SIRTl can regulate mitochondrial gene expression independently of the canonical PGC- la pathway and raised the possibility that genome asynchrony was due to an alternative mechanism.
- HIF-l protein levels of HIF-l were examined by Western blotting in skeletal muscle of SIRTl KO mice. As shown in Figure 6J, the levels of HIF-la were considerably higher in the KO tissue, demonstrating that loss of SIRTl leads to HIF-la accumulation.
- the SIRTl KO animals exhibited a gene expression pattern reminiscent of a shift towards non-oxidative metabolism, including upregulation of HIF-la target genes PGK-1, Glutl, PDK1 and VEGFa (Figure 6K). Consistently, primary myoblasts isolated from SIRTl KO animals showed increased activity of the hypoxia response element (HRE), despite being cultured in normoxic conditions (Figure 6L).
- HRE hypoxia response element
- C2C12 myoblasts were grown under hypoxic conditions (1% oxygen) or treated with dimethyloxaloylglycine (DMOG), a HIFa prolyl hydroxylase inhibitor that stabilizes HIF. Both treatments resulted in a specific decline in mtDNA content and the expression of mitochondrially-encoded ETC genes but not the nuclear- encoded components, paralleling the effect of a SIRTl deletion.
- DMOG dimethyloxaloylglycine
- HIF-la regulates c-Myc independently of its transcriptional activity (Koshiji et al, EMBO J. 23: 1949-1956 (2004); ; Koshiji et al, Mol. Cell. 17:793-803 (2005), each of which is hereby incorporated by reference in its entirety). It was tested whether c-Myc was the factor linking SIRTl and HIF-la to genome asynchrony. Myoblasts from the SIRTl KO mice were about half as active as wildtype cells in a c-Myc reporter assay (Figure 8A).
- Example 6 CR Delays Age-related Mitochondrial Dysfunction by Preventing HIF-la- induced Genome Asynchrony.
- Example 7 NMN Induces NAD + Levels in Skeletal Muscle and Reverses Age-Induced Genome Asynchrony and Mitochondrial Dysfunction
- NAD + nicotinamide mononucleotide
- NMN induced expression of mitochondrially-encoded ETC genes (ND1, CYTB, COX1, ATP6) but this effect was completely abolished by DMOG and DFO, indicating that, under these conditions, NMN improves mitochondrial function
- SIRT1 KO mouse allowed the testing of the involvement of SIRT1 in the effects of NMN in vivo.
- the ability of NMN treatment to induce mitochondrially- encoded genes and improve mitochondrial function was lost in animals lacking SIRT1
- Example 8 Aging Leads to a Specific Decline in Mitochondrial-encoded Genes Through Decreased Nuclear NAD + Levels
- SIRT1 KO and SIRT1 OE mice were generated as previously described (Minamishima et al., 2008; Price et al., 2012). Mice were acclimated for at least one-week prior to sacrifice.
- mice were given interperitoneal (IP) injections of 500 mg
- SIRTl-tg mice of 6 months of age were given interperitoneal (IP) injections of 300 mg DMOG/kg body weight per day or the equivalent volume of PBS for 5 consecutive days.
- IP interperitoneal
- mice Whole body adult-inducible Eglnl knockout mice (Minamishima et al, 2007) were treated with IP injection of tamoxifen for 3 days after which they were allowed to rest. The mice were given interperitoneal (IP) injections of 500 mg NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee.
- IP interperitoneal
- C2C12 cell line was cultured in low glucose Dulbecco's modified eagle medium (DMEM) (Invitrogen) supplemented with 10% FBS (Invitrogen) and a mix of antibiotic and antimycotic (Invitrogen).
- DMEM low glucose Dulbecco's modified eagle medium
- FBS Invitrogen
- FBS Invitrogen
- Ivitrogen antibiotic and antimycotic
- cells were treated the vehicle (0.001% DMSO) or 10 ⁇ EX-527 (Tocris) for 12h.
- C2C12 myoblasts were infected with an empty or SIRT1 adenovirus as described before (Gerhart-Hines et al., 2007) and the media was replaced with fresh DMEM for additional 48h, after that the cells were treated as described before.
- C2C12 myoblasts were exposed to 1% oxygen for 16h or treated with the vehicle (0.001% DMSO) or DMOG (Cayman) for the same period of time.
- WT and PGC- ⁇ / ⁇ KO primary myoblasts were plated and allowed to differentiate into myotubes by replacing the media with low glucose DMEM supplemented with 2% horse serum (Sigma- Aldrich) for 4 days. After the differentiation the cells were infected with empty vector or flag-SIRTl adenovirus as described before (Gerhart-Hines et al., 2007).
- Mitochondrial membrane potential was evaluated by fluorescence of the potential dependent TMRM probe. Briefly, cells were incubated with 100 nM TMRM for 15 minutes in the dark, after which the media was replaced and the fluorescence was measure by flow cytometry.
- ROS and mitochondrial mass were evaluated by flow cytometry using the fluorescent probes DHE and NAO respectively as described before (Bell et a, 2011; Gomes et al, 2012).
- Cytochrome c oxidase activity was polarographically determined based on the 02 consumption upon cytochrome c oxidation, as previously described (Brautigan et al., 1978). The reaction was carried out at 25°C in 1.3 mL of standard respiratory medium (as in mitochondrial respiration) supplemented with 2 ⁇ rotenone, 10 ⁇ oxidized cytochrome c, 0.3 mg TritonX-100. Following addition of the sample, the reaction was initiated by adding 5 mM ascorbate plus 0.25 mM tetramethylphenylene-diamine (TMPD).
- TMPD tetramethylphenylene-diamine
- ATP content was measured with a commercial kit according to the manufacturer's instructions (Roche).
- RNA from skeletal muscle tissue and C2C12 cells were extracted with RNeasy mini kit (Qiagen) according to the instructions and quantified using the NanoDrop 1000 spectrophotometer (Thermo Scientific).
- cDNA was synthesized with the iSCRIP cDNA synthesis kit (BioRad) using 600 ng of RNA.
- Quantitative RT-PCR reactions were performed using 1 ⁇ of primers and LightCycler® 480 SYBR Green Master (Roche) on an LightCycler® 480 detection system (Roche). Calculations were performed by a comparative method (2-ACT) using 18S as an internal control.
- 2-ACT comparative method
- mtDNA was amplified using primers specific for the mitochondrial cytochrome c oxidase subunit 2 (COX2) gene and normalized to genomic DNA by amplification of the ribosomal protein si 8 (rpsl8) nuclear gene. Primers were designed using the IDT software (IDT) and the primer sequences can be found in Table 1.
- Protein extracts from tissue or C2C12 cells were obtained by lysis in ice-cold lysis buffer (150 mM NaCl,10 mM Tris HCl (pH 7.4),1 mM EDTA,1 mM EGTA, 1 % Triton X- 100, 0.5% NP-40) supplemented with a cocktail of protease and phosphatase inhibitors
- Protein content was determined by the Bradford protein assay (Biorad), and 50 ⁇ g proteins were run on SDS-PAGE under reducing conditions. The separated proteins were then electrophoretically transferred to a polyvinylidene difluoride membrane (Perkin- Elmer). Proteins of interest were revealed with specific antibodies: anti-TFAM (Aviva biosciences), anti-COX2, anti-COX4 (Mito sciences), anti-SIRTl, anti-P-tubulin (Sigma- Aldrich), anti-HIFla (Cayman), anti-HA (Covance) and anti-c-Myc (Cell Signaling) overnight at 4°C. The immuno staining was detected using horseradish peroxidase- conjugated anti-rabbit or anti-mouse immunoglobulin for 1 h at room temperature. Bands were revealed using Amersham ECL detection system (GE Healthcare).
- Chromatin immunoprecipitation was performed using a commercial available kit
- TFAM promoter, VHL promoter, HRE and c-Myc activity were determined using a luciferase-based system. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference.
- TFAM promoter activity was evaluated using a TFAM promotes-luc plasmid.
- a fragment of the mouse Tfam promoter (1.4kb upstream of the coding sequence) was cloned into a pGL4.15 vector (Promega). Luciferase activity was measured using the Dual- Luciferase Reporter Assay System (Promega) with Renilla as the reference 48h after transfection.
- HIF-mediated transcriptional activity was measured using an HRE-lucif erase plasmid (Bell et al., 2011).
- VHL promoter activity was measured using a commercially available luciferase plasmid (Affymetrix).
- c-Myc-mediated transcriptional activity was measured using a luciferase plasmid containing CDK4 Myc binding sites (Addgene plasmid 16564) and a mutated version as a negative control (Addgene plasmid 16565).
- the plasmids were transfected using X-tremeGENE HP (Roche) in accordance with the manufacturer's protocol. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference 48h after transfection.
- SIRT1 knockdown cells were produced as described before (Gomes et al., 2012).
- ShMyc#l (TRCN0000042517; Open Biosystems) ShMyc#2 (TRCN0000054885; Open Biosystems), shHIFla (TRCN0000054450; Open Biosystems), shARNT#l and shANRT#2 (TRCN0000079930 and TRCN0000079931, respectively; Open Biosystems) and control shGFP lentivirus were produced by co-transfection of 293T cells with plasmids encoding psPAX2 (Addgene plasmid 12260), pMD2.G (Addgene plasmid 12259) using X- tremeGENE HP (Roche) in accordance with the manufacturer's protocol.
- HIFla DPA Additional plasmid 1764
- HIF2a DPA Additional plasmid 128
- HIF2a DPA HIF2a DPA
- plasmid 19006 retrovirus were produced by co-transfection of 293T cells with plasmids encoding gagpol (Addgene plasmid 14887) and vsvg (Addgene plasmid 8454) using X-tremeGENE HP (Roche) in accordance with the manufacturer's protocol. Media was changed 24 hours post-transfection and the virus harvested after 48 hours, was filtered and used to infect C2C12 cells in the presence of 5 ⁇ g/mL polybrene (Sigma- Aldrich) via spin infection (2500 rpm, 30 minutes). Selection of resistant colonies was initiated 24 hours later using 2 ⁇ g/mL puromycin (Invivogen). For silencing c-Myc in HIFl knockdown cells, non-target or RNAi targeting c-Myc (Dharmacon) was transfected using
- RNAiMAX Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. 24 hours after the first transfection, the transfection was repeated, to enhance the knockdown, and after 24h hours the media was replaced and the cells treated as described previously.
- mouse TFAM cDNA cloned into the pIRES2-EGFP (Clontech) backbone with the EGFP cassette replaced with a hygromycin resistance cassette was transfected using Fugene HD (Roche) in accordance with the manufacturer's instructions.
- NAD + from skeletal muscle was quantified with a commercially available kit (Bio Vision) according to the manufacturer's instructions and as described before (Gomes et al., 2012).
- NAMPT phosphoribosyltransferase
- NMNAT nicotinamide mononucleotide adenylyltransferase
- compartmentalized NAD + levels are responsible for the generation of the imbalance between nuclear- and mitochondrial-encoded genes the different NMNATs were targeted with shRNA in primary myoblasts.
- a decline in mitochondrial-encoded genes was observed when NMNATl was knocked down, but not NMNAT2 or NMNAT3 (FIG. 11G-I and FIG. 18A-C).
- the specific knockdown of NMNATl also resulted in decline in mtDNA content (FIG. 11J) as well as ATP levels (FIG. 1 IK) mirroring the effects observed in 22- old-mice.
- SIRTl is an NAD + -dependent deacetylase present in the nucleus and known to be tightly regulated by nuclear energetics (Canto and Auwerx, 2012; Yang and Sauve, 2006), and plays an essential role in maintenance of cellular homeostasis (Haigis and Sinclair, 2010). Both SIRTl mRNA and protein levels were not altered in 22-month-old mice (FIG. 18F and 18G), but since a specific decline in mitochondrial-encoded genes was observed which could be driven by modulation of nuclear NAD + levels, it was hypothesized that this effect could be mediated by alterations in SIRTl activity.
- SIRTl KO an adult-inducible whole body SIRTl knockout mouse strain was utilized (SIRTl KO; Price et al., 2012), circumventing the developmental abnormalities of germline SIRTl KO mice (Cheng et al., 2003; McBurney et al., 2003; Sequeira et al., 2008).
- SIRTl KO mice have a decline in cellular ATP levels (FIG. 12A) as well as a decline in mtDNA content (FIG. 12B), similar to what was observed in the skeletal muscle of 22-month-old mice (FIG. 11).
- FIG. 12A cellular ATP levels
- FIG. 12B mtDNA content
- FIG. 12C mitochondria in electron micrographs.
- SIRTl regulates PGC-la activity
- a master regulator of the mitochondrial biogenesis program a general decrease in the expression of ETC components in the SIRTl KO mice was expected.
- the mRNA levels of all 13 mitochondrial-encoded ETC genes, as well as the 2 rRNAs encoded by the mitochondrial genome were reduced in the SIRTl KO mice compared to wild-type controls (FIG. 12D and FIG. 19C) without a decrease in the expression of any of the nuclear-encoded components (FIG. 12D).
- protein levels of the mitochondrial-encoded COX2 subunit were significantly decreased but the nuclear-encoded COX4 was unaltered (FIG.
- SIRTl KO mice had a striking increase in the muscle atrophy markers, (Atrogin-1 and MuRFl) (FIG. 12H), (Gumucio and Mendias, 2013), as well as, increased expression of inflammatory markers (IL-6, IL-18 and Nlrp3) (FIG. 19H).
- a decline in insulin signaling pathway in the soleus of SIRTl KO animals under basal conditions was also observed, as shown by a pronounced decline in phosphorylation of AKT and IRS1.
- the soleus from SIRTl KO mice demonstrated decreased phosphorylation of both AKT and IRS1 in response to insulin as compared to WT mice (FIG. 121).
- SIRTl has been previously shown to regulate mitochondrial homeostasis under low energy conditions, by de-acetylating the transcriptional co-activator PGC- la to activate mitochondrial biogenesis (Gerhart-Hines et al., 2007; Rodgers et al., 2005). Consistent with this, it was observed that SIRTl KO animals failed to upregulate ETC genes in response to fasting (FIG. 20A). However, as shown in FIG. 12, under basal conditions a general effect of SIRTl in the mitochondrial biogenesis program and mitochondrial mass was not observed, but rather a specific decline in mitochondrial-encoded genes only, suggesting that SIRTl might regulate mitochondrial-encoded genes independently of PGC- la.
- PGC-l activity is complex and depends on many factors (Fernandez - Marcos and Auwerx, 2011).
- SIRT1 regulates PGC-la acetylation status in conditions of low energy when there is a need for increased mitochondrial metabolism, while under basal conditions PGC-la acetylation status is primarily regulated by GCN5 (Dominy et al., 2012; Fernandez-Marcos and Auwerx, 2011).
- Phosphorylation of PGC-la by AMPK- activated kinase (AMPK) can also play an important role in regulating its activity.
- AMPK AMPK- activated kinase
- AMPK activity was blocked with an AMPK dominant negative adenovirus (AMPK-DN), which efficiently inhibited phosphorylation of the AMPK target ACC, (FIG. 13F).
- AMPK-DN blocked the decrease in nuclear-encoded genes observed 48h after treatment with OHT, but not the decline in mitochondrial-encoded genes (FIG. 13G).
- PGC-la PGC-la/ ⁇ KO myo tubes were reconstituted with either a WT PGC-la or an AMPK insensitive version of PGC-la (PGC-la T177A/S538A) (FIG.20F).
- TFAM is necessary for mtDNA stability, replication, and transcription (Falkenberg et al., 2007), thus it was reasoned that if the specific decline in mitochondrial-encoded genes in cells lacking SIRTl is caused by a decrease in TFAM, restoring the expression levels of TFAM should correct this effect and restore mitochondrial homeostasis. Restoring TFAM levels in primary myoblasts previously treated with OHT for 24h to induce SIRT1KO (FIG. 13J), was sufficient to rescue mitochondrial-gene expression levels (FIG. 13K) and ATP levels (FIG. 13L).
- SIRTl KO mice have increased type II glycolytic fibers (FIG. 12G) and expectedly gene expression analysis demonstrated increased levels of genes involved in glycolysis, including hexokinase 2 (HK2), pyruvate kinase (PKM), phosphofructokinase (PFKM) and lactate dehydrogenase A (LDHA) (FIG. 14A and 14B). Accordingly, SIRT1 KO mice also presented increased lactate levels in the skeletal muscle (FIG. 14C), reminiscent of Warburg remodeling of metabolism in cancer cells.
- the metabolic remodeling characteristic of cancer cells is in part mediated by the stabilization of the transcription factor HIF- ⁇ (Majmundar et al., 2010).
- HIF- ⁇ The transcription factor HIF- ⁇
- the similarity between the gene expression of muscle from the SIRT1 KO mice and of cancer cells prompted testing as to whether the specific decline in mitochondrial-encoded genes and consequent disruption of OXPHOS functionality might be due to a pseudohypoxic response and HIF- ⁇ stabilization.
- FIG. 14D the levels of HIF- ⁇ were considerably higher in the KO tissue, demonstrating that loss of SIRT1 leads to HIF- ⁇ accumulation.
- the SIRT1 KO animals exhibited a gene expression pattern reminiscent of cancer cells, including upregulation of HIF- ⁇ target genes PGK-1, Glutl, PDK1 and VEGFa (FIG. 21 A).
- primary myoblasts also demonstrated increased HIF- ⁇ protein levels (FIG. 14D), as well as the activity of the hypoxia response element (HRE), despite being cultured in normoxic conditions (FIG.21B). Consistent with the idea that
- SIRT1 in PGC- ⁇ / ⁇ knockout myo tubes induced the expression of mitochondrial ETC genes (as shown above) but the induction was completely blocked by DMOG (FIG. 14H). Furthermore, increasing NAD + levels by supplementation with pyruvate in the PGC- ⁇ / ⁇ KO cells increased mitochondrial-encoded genes (FIG. 2 IF). Interestingly, the NAD + mediated increases in mitochondrial-encoded genes can be inhibited by stabilizing HIF-l with DMOG (FIG. 141 and FIG. 21F). SIRTl overexpression in vivo induces an increase in OXPHOS capacity in the skeletal muscle by increasing the mitochondrial biogenesis program (Price et al., 2012). Therefore, it was next determined whether HIF-la
- SIRTl-tg satu mice stabilization in the whole body SIRTl overexpressing mice (SIRTl-tg) (Price et al., 2012) would prevent this increase.
- SIRTl-tg mice were treated with vehicle or DMOG to increase HIF-la (FIG. 21G) and this abolished the increase in the expression of
- HIF-la or HIF-2a were introduced into C2C12 myoblasts (FIG. 141).
- HIF-la mutant caused a specific decline in the expression of mitochondrial-encoded genes similar to Eglnl KO and treatment with DMOG (FIG. 14J) and also prevented SIRTl overexpression from increasing the expression of mitochondrial- encoded ETC subunits and mtDNA (FIG. 14K and FIG. 21J).
- mitochondrial homeostasis are mediated by HIF-l both in vitro and in vivo.
- Example 12 HIF-la Stabilization Induced by Loss of SIRT1 is independent of retrograde signaling and HIF-la Deacetylation and Mediated by Regulation of VHL Levels
- SIRT1 has been implicated in the regulation of HIF-la transcriptional activity (Lim et al., 2010), but not protein stabilization.
- Mitochondrial homeostasis plays an important role in the regulation of HIF-la protein stability through generation of ROS from complex III (Bell et al., 2007; Chandel et al., 2000) therefore it was determined whether ROS and retrograde signaling were the cause of HIF-la stabilization in response to loss of SIRTl.
- Time course experiments demonstrate that ROS levels are only upregulated 24h after SIRTl deletion by OHT (FIG. 22B), while the impairment in mitochondrial homeostasis was observed at 12h (FIG. 13A and FIG. 20B-C) and HIF-la stabilization at 6h (FIG.
- SIRTl is a deacetylase it is possible that it may regulate HIF-la protein stability via K709 deacetylation.
- K709 was mutated to glutamine (acetylation mimetic) or arginine (non acetylated form), as well as, K674. The latter mutations serve as a positive control since this residue is deacetylated by SIRTl but does not affect HIF-la stability
- HIFa protein abundance is tightly regulated by an oxygen-dependent proteasomal degradation mechanism, involving the Von Hippel-Lindau protein (VHL) E3 ubiquitin ligase recognizing hydroxylated proline residues. (Kaelin, 2008).
- VHL Von Hippel-Lindau protein
- SIRTl deletion impacts HIF- ⁇ stability through proline hydroxylation an antibody specific for HIF- ⁇ proline hydroxylation was used.
- HIF- ⁇ protein was stabilized with MG132 no differences in hydroxylation were found between control cells and cells lacking SIRTl (FIG. 22D), indicating that SIRTl does not regulate HIF- ⁇ hydroxylation.
- VHL protein levels decline as earlier as 6h upon SIRTl deletion, coinciding with the accumulation of HIF- ⁇ .
- TFAM levels decrease 12h after SIRTl deletion (FIG. 15J), further strengthening the idea that loss of SIRTl causes a decrease in TFAM and a specific decline in mitochondrial- encoded genes due to HIF- ⁇ stabilization.
- VHL levels were correlated with HIF- ⁇ stabilization in several of the systems and animal models utilized, next it was determined whether decreasing VHL levels is necessary for SIRTl to induce HIF- ⁇ stabilization. VHL was knocked down in primary myoblasts with and without SIRTl (FIG. 15K).
- Example 13 c-Myc Links SIRT1 and HIF-l to the specific decline in mitochondrial- encoded gene expression
- c-Myc A major transcriptional mediator that has been shown to aid cancer cells to proliferate under hypoxic conditions is the oncogene c-Myc (Gordan et al., 2007). This is partially due to a crosstalk between HIF- ⁇ and c-Myc, which together fine-tune the adaptive responses to the hypoxic environment. Interestingly, some reports suggest that c- Myc controls mitochondrial biogenesis (Kim et al., 2008; Li et al., 2005) and that primary hepatocytes from c-Myc knockout mice have reduced mitochondrial mass (Li et al., 2005).
- FIG. 16B knockdown of c-Myc (FIG. 16B) completely blocked the ability of SIRTl to increase mtDNA, the expression of mitochondrial-encoded ETC genes (FIG. 16C and 16D).
- FIG. 23 A overexpression of c-Myc (FIG. 23 A) restored the level of mtDNA, mitochondrial ETC mRNA, and increased cellular ATP levels (FIG. 23B-D).
- c-Myc was previously shown to directly bind to the TFAM promoter in cancer cells
- HIF-la inhibits TFAM transcription by interfering with c-Myc, providing the first clear link between HIF-la and the regulation of mitochondrial-encoded ETC subunits.
- SIRTl can regulate mitochondrial homeostasis via a PGC-la/p-independent mechanism that involves Hif- ⁇ and c-Myc.
- Example 14 Caloric Restriction (CR) and NAD + Supplementation Protects Against Pseudohypoxic Induced Decline in Mitochondrial Homeostasis and Muscle Health During Aging
- NMN a compound recently shown to increase NAD + levels in a variety of tissues (Yoshino et al., 2011), to 6- and 22-month-old C57BL/6J mice for one week increased levels of cellular NAD + in both the young and old mice were by 2-fold.
- the boost in the treated 22-month-old mice resembled the untreated 6-month-olds (FIG. 17A).
- NMN treatment restored oxidative phosphorylation capacity as demonstrated by an increase in ATP levels and COX activity (FIG. 17B and FIG. 24H), as well as the expression of mitochondrial-encoded genes in old mice (FIG. 17C).
- NMN treatment also reversed the age-induced decline in VHL and consequent
- Muscle wasting and inflammation are markers of muscle aging and, as expected an increase in the muscle wasting markers Atrogin-1 and MuRFl (FIG. 17J) and in the expression of inflammation markers in the skeletal muscle of old mice were observed (FIG. 24J).
- NMN treatment completely reversed these markers (FIG. 17J and FIG. 24K), indicating that restoring NAD + levels can improve age-related muscle wasting and inflammation.
- NMN was also able to reverse age-induced insulin resistance in the skeletal muscle, as shown by its ability to restore insulin signaling in the soleus of old mice treated with NMN via the increasing the phosphorylation of two important
- Deregulation of mitochondrial homeostasis is one of the hallmarks of aging in diverse species such as yeast and humans.
- disruption of mitochondrial homeostasis is believed to be an underlying cause of aging and the etiology of numerous age-related diseases (Coskun et al., 2011; de Moura et al., 2010; Figueiredo et al., 2009; Finsterer, 2004; Sahin et al., 2011; Schulz et al., 2007; Wallace et al., 2010).
- age-related diseases Coskun et al., 2011; de Moura et al., 2010; Figueiredo et al., 2009; Finsterer, 2004; Sahin et al., 2011; Schulz et al., 2007; Wallace et al., 2010.
- age-related diseases Coskun et al., 2011; de Moura et al., 2010; Figueiredo et al., 2009;
- SIRTl can regulate mitochondrial function independently of the canonical PGC- ⁇ / ⁇ pathway.
- the data demonstrates that SIRTl regulates mitochondrial homeostasis through two distinct pathways that are activated in distinct energetic states, and suggests that SIRTl is involved in fine-tuning mitochondrial metabolism to maintain cellular homeostasis.
- SIRT1 regulates mitochondrial homeostasis through the PGC- ⁇ / ⁇ -independent regulation of specifically mitochondrial-encoded genes driven by HIF- l /c-Myc.
- SIRT1 deacetylates and activates PGC- ⁇ to induce fatty acid oxidation and promote mitochondrial biogenesis (Gerhart-Hines et al., 2007) (FIG. 17M).
- the ability of SIRT1 to induce one pathway versus the other is related to AMPK activity and its ability to phosphorylate PGC- ⁇ (Canto et al., 2009). Indeed, it was found that in conditions of energetic decline AMPK is active and signals PGC- ⁇ to be deacetylated by SIRT1 through phosphorylation, thus activating the mitochondrial biogenesis program. However, under normal energetic conditions the phosphorylation signal is not present as AMPK is not active, thus SIRTl's effects on mitochondria are mainly mediated by the PGC-l /p-independent pathway.
- SIRTl pharmacological means induced an imbalance between nuclear- and mitochondrial-encoded ETC genes, and prevented the ability of SIRTl to induce expression of mitochondrial- encoded genes.
- Different studies have previously linked SIRTl to the hypoxic regulation of HIF- ⁇ .
- SIRTl inhibition increases acetylation of HIF- la, thereby increasing its transcriptional activity (Lim et al., 2010), while another study, has reported that SIRTl inhibition reduces the accumulation and transcriptional activity of HIF- la protein in hypoxic conditions (Laemmle et al., 2012).
- VHL also targets to proteasomal degration HIF-2a in a similar manner to HIF- ⁇ .
- SIRT1 has also previously reported to regulate HIF- 2a (Dioum et al., 2009).
- the expression of HIF-2a (but not HIF-la) is regulated by PGC- l and plays an important role in fiber type switching of skeletal muscle (Rasbach et al., 2010).
- the metabolic and fiber type changes that were observed are seemingly distinct from this pathway because the ability of SIRT1 to increase expression of mitochondrial genes or mtDNA content does not require PGC- ⁇ , nor is it affected by stabilization of HIF-2a.
- HIF-l was previously associated with changes in mitochondrial biogenesis under conditions of obesity.
- High fat diet feeding induced the expression of HIFla as well as levels of mtDNA in liver (Carabelli et al., 2011).
- HIF-la was also reported to be stabilized in white adipose tissue in animal models of obesity, but upregulation of HIF-la was found to be correlated with a decline in mitochondrial related genes in this tissue (Krishnan et al., 2012).
- Mclk+/- mouse HIF-la was found to be upregulated (Wang et al., 2010).
- the results herein also demonstrated that different tissues have different responses, suggesting that the role of HIF-la in the regulation of mitochondrial homeostasis is tissue specific, possibly acting in accordance to the metabolic specificities of each tissue.
- SIRTl is known to directly regulate c-Myc transcriptional activity in cancer cells, either by deacetylation of c-Myc (Menssen et al., 2012) or by binding c-Myc and promoting its association with Max (Mao et al., 2011).
- c-Myc on the TFAM promoter driven by SIRTl requires HIF- ⁇ , but a direct effect of SIRTl on c-Myc under different condition cannot be excluded and as such additional studies will be required to elucidate how these feedback loops affect the regulation of mitochondrial-encoded genes.
- mitochondrial homeostasis at old age is protected in the long lived Mclkl+/- mouse, however mitochondrial homeostasis was found to be disturbed in young ages
- HIF- ⁇ stabilization may also induce a similar beneficial effect on metabolism and mitochondrial homeostasis in aged tissues.
- these findings provide evidence for a new pathway that drives the changes in carbon utilization and the disruption in mitochondrial homeostasis that characterize aging, a pathway that is rapidly reversible and potentially amenable to treatment of a variety of age-related diseases.
- hypoxia inducible factor 1 alpha and tumor growth by inhibiting mitochondrial ROS production.
- Biochimica et biophysica acta 1226, 73-82.
- SIRT1 transgenic mice show phenotypes resembling calorie restriction. Aging Cell 6, 759-767.
- AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 458, 1056-1060.
- HIF-1 modulates dietary restriction- mediated lifespan extension via IRE-1 in Caenorhabditis elegans.
- Civitarese A.E., Carling, S., Heilbronn, L.K., Hulver, M.H., Ukropcova, B., Deutsch,
- the deacetylase Sirt6 activates the acetyltransferase GCN5 and suppresses hepatic gluconeogenesis.
- SIRT1 suppresses beta- amyloid production by activating the alpha- secretase gene ADAM10.
- NRF-1 a trans-activator of nuclear-encoded
- CLK-1 controls respiration, behavior and aging in the nematode Caenorhabditis elegans. Embo J 18, 1783-1792.
- Mitochondrial electron transport is a key
- SIRT3 opposes reprogramming of cancer cell metabolism through HIF1 alpha destabilization. Cancer Cell 19, 416-428.
- HDAC4 protein regulates HIF1 alpha protein lysine acetylation and cancer cell response to hypoxia.
- Houtkooper R.H., Mouchiroud, L., Ryu, D., Moullan, N., Katsyuba, E., Knott, G.,
- HIF-1 alpha induces cell cycle arrest by functionally counteracting Myc. Embo J 23,
- HIF-1 alpha induces genetic instability by transcriptionally downregulating MutSalpha expression. Mol Cell 17, 793-803.
- Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1 alpha. Cell 127, 1109-1122.
- hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biol Chem 391, 1131-1137.
- SIRTl promotes N-Myc oncogenesis through a positive feedback loop involving the effects of MKP3 and ERK on N-
- the mammalian SIR2alpha protein has a role in embryogenesis and gametogenesis. Mol Cell Biol 23, 38-54.
- SIRT1 -inhibitor DBC1 and the SIRT1 deacetylase form a positive feedback loop.
- Mitochondrial signaling contributes to disuse muscle atrophy.
- SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell metabolism 15, 675-690.
- Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470, 359-365.
- Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell metabolism 6, 280-293.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Environmental Sciences (AREA)
- Neurosurgery (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Psychiatry (AREA)
- Rheumatology (AREA)
- Psychology (AREA)
- Pain & Pain Management (AREA)
- Hospice & Palliative Care (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Description
NAD BIOSYNTHESIS AND PRECURSORS IN THE PREVENTION AND TREATMENT OF INFLAMMATION
RELATED APPLICATIONS
This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional
Application Serial No. 61/711,552, entitled "Treatment of Age-Related and Mitochondrial Diseases by Inhibition of HIF-lcc Function," filed on October 9, 2012, U.S. Provisional Application Serial No. 61/832,414, entitled "NAD Biosynthesis and NAD Precursors for the Treatment of Disease," filed on June 7, 2013, and U.S. Provisional Application Serial No. 61/832,204, entitled "NAD Biosynthesis and Precursors in the Prevention and
Treatment of Inflammation," filed on June 7, 2013, the entire contents of each of which are herein incorporated by reference in their entireties.
GOVERNMENT INTEREST
This invention was made with Government support under National Institutes of
Health Grant AG028730. The Government has certain rights in this invention.
FIELD OF THE INVENTION
The invention relates to methods for treatment and prevention of diseases or disorders associated with mitochondrial dysfunction by administering inhibitors of HIFl-a and/or agents that increase levels of NAD+. The invention relates to methods for treatment and prevention of disorders associated with inflammation by administering agents that increase levels of NAD+.
BACKGROUND
Aging is characterized by a progressive decline in cellular and tissue homeostasis leading to a variety of age-related diseases that limit lifespan. Although improvements in sanitation, diet and medicines over the past 100 years have produced dramatic
improvements in human health, maximum human lifespan has not changed. The inability to impact the maximal lifespan is due, in large part, to a limited understanding of why aging occurs and what genes control these processes.
Mitochondria are highly dynamic organelles that move throughout the cell and undergo structural transitions, changing the length, morphology, shape and size. Moreover,
mitochondria are continuously eliminated and regenerated in a process known as mitochondrial biogenesis. Over the past 2 billion years, since eukaryotes subsumed the a- proteobacterial ancestor of mitochondria, most mitochondrial genes have been transferred to the nuclear genome, where regulation is better integrated. However, the mitochondrial genome still encodes rRNAs, tRNAs, and 13 subunits of the electron transport chain (ETC). Functional communication between the nuclear and mitochondrial genomes is therefore essential for mitochondrial biogenesis, efficient oxidative phosphorylation, and normal health. Failure to maintain the stoichiometry of ETC complexes is exemplified by mitochondrial disorders such as Leber's hereditary optic neuropathy (LHON),
mitochondrial encephalomyopathy, lactic acidosis and stroke like episode syndrome (MELAS), myoclonic epilepsy with ragged red fibers (MERRF), and Leigh Syndrome.
One of the most conserved and robust phenomena in biology, in organisms as diverse as yeast and humans, is a progressive decline in mitochondrial function with age leading to a loss of cellular homeostasis and organismal health. In mammals, there is a large body of evidence implicating mitochondrial decline in aging and age-related diseases, including type II diabetes, Parkinson's disease, Alzheimer's disease, sarcopenia, lethargy, frailty, hepatic steatosis and obesity. For example, mice with mutations that impair the proofreading capacity of the mitochondrial DNA polymerase gamma (Ροΐγ) exhibit a premature aging phenotype. Conversely, targeting peroxisomal catalase to mitochondria (mCAT) extends mouse lifespan. Recently, telomere erosion in mice was found to disrupt mitochondrial function but the underlying mechanism has not yet been established. Despite the apparent importance of mitochondrial decline in aging and disease, there is considerable debate about its underlying causes.
Deregulation of mitochondrial homeostasis is one of the hallmarks of aging and disease in diverse species such as yeast and humans. In mammals, disruption of
mitochondrial homeostasis is believed to be an underlying cause of aging and the etiology of numerous age-related diseases (de Moura et al., 2010; Figueiredo et al., 2009; Sahin et al., 2011; Schulz et al., 2007; Wallace et al., 2010). Despite its importance, there is still a great deal of controversy as to why age induces the disruption of mitochondrial homeostasis and how this process might be slowed or reversed.
In light of the foregoing, there is great need for novel compositions and methods for improving metabolism and mitochondrial function in aging tissues. Such compositions and methods would be useful for the treatment of age related and mitochondrial diseases, as
well as for increasing stress resistance, improving resistance to hypoxia and extending the lifespan of organisms and cells.
NAD+ is an essential co-factor for several important enzymes (Canto and Auwerx, 2011). In mammals, NAD+ is generated from nicotinamide in a salvage pathway wherein nicotinamide phosphoribosyltransferase (NAMPT) converts nicotinamide to nicotinamide mononucleotide (NMN) which is then converted to NAD+ by nicotinamide mononucleotide adenylyltransferase (NMNAT) (Canto and Auwerx, 2011).
SUMMARY
As described herein, Hypoxia- Inducible Factor la (HIF-l ) interacts with the transcription factor c-Myc to inhibit c-Myc activity, causing genome asynchrony and the decline in mitochondrial function during aging. Reducing the ability of HIF-la to inhibit c- Myc activity, such as by disrupting the formation of the complex containing HIF- la and c- Myc, therefore conveys beneficial effects on metabolism, cellular fitness, survival (e.g., survival under hypoxic conditions) and mitochondrial function in aged tissues. Thus, agents that reduce inhibition of c-Myc activity by HIF- la and/or disrupt the formation of a complex between HIF-la and c-Myc (e.g., anti-HIF-la antibodies, HIF- la decoy proteins, small molecules), are useful for the treatment of age-related and mitochondrial diseases, including Alzheimer's disease, diabetes mellitus, heart disease, obesity, osteoporosis, Parkinson's disease and stroke. Such agents are also therefore useful for extending the life span, increasing the stress resistance and improving resistance to hypoxia of a subject (e.g., a human, a non-human animal and/or a plant) or a cell.
In certain embodiments, the instant invention relates to a method of treating or preventing an age-related disease and/or a mitochondrial disease by administration of an agent that reduces inhibition of c-Myc activity by HIF- la. In some embodiments, the agent inhibits the formation of a complex between HIF- la and c-Myc. In some embodiments, the agent induces a conformational change in HIF- la or c-Myc that abrogates their interaction and/or alters the ability of HIF- la to affect c-Myc activity, protein levels or cell
localization. In certain embodiments the age-related disease is Alzheimer's disease, amniotropic lateral sclerosis, arthritis, atherosclerosis, cachexia, cancer, cardiac
hypertrophy, cardiac failure, cardiac hypertrophy, cardiovascular disease, cataracts, colitis, chronic obstructive pulmonary disease, dementia, diabetes mellitus, frailty, heart disease,
hepatic steatosis, high blood cholesterol, high blood pressure, Huntington' s disease, hyperglycemia, hypertension, infertility, inflammatory bowel disease, insulin resistance disorder, lethargy, metabolic syndrome, muscular dystrophy, multiple sclerosis, neuropathy, , nephropathy, obesity, osteoporosis, Parkinson' s disease, psoriasis, retinal degeneration, sarcopenia, sleep disorders, sepsis and/or stroke. In some embodiments the mitochondrial disease is mitochondrial myopathy, diabetes mellitus and deafness (DAD), Leber's hereditary optic neuropathy (LHON), Leigh syndrome, neuropathy, ataxia, retinitis pigmentosa and petosis (NARP), myoclonic epilepsy with ragged red fibers (MERRF), myoneurogenic gastrointestinal encephalopathy (MNGIE), mitochondrial myopathy, encephalomyopathy, lactic acidosis, stroke-like symptoms (MELAS), Kearns-Sayre syndrome (KSS), chronic progressive external opthalmoplegia (CPEO) and/or mtDNA depletion.
In certain embodiments, the instant invention relates to a method of increasing the life span and/or increasing the stress resistance of a subject by administration of an agent that reduces inhibition of c-Myc activity by HIF-Ι . In some embodiments the agent inhibits the formation of a complex between HIF- Ια and c-Myc. In some embodiments, the agent induces a conformational change in HIF- Ια or c-Myc that abrogates their interaction and/or alters the ability of HIF- Ια to affect c-Myc activity, protein levels or cell
localization. For example, in some embodiments, administration of the agent increases the resistance of cells in the organism against stress (e.g., heat shock, osmotic stress, DNA damaging agents and inadequate nitrogen levels). In certain embodiments, the invention relates to extending the life span or increasing the stress resistance of a cell by contacting the cell with an agent that inhibits the formation of a complex between HIF-Ια and c-Myc.
In some embodiments, the present invention relates to a method of improving the survival of a cell, organ and/or tissue under hypoxic conditions. In certain embodiments the method includes contacting the cell, organ and/or tissue with an agent that reduces inhibition of c-Myc activity by HIF- Ια. In some embodiments the agent inhibits the formation of a complex between HIF- Ια and c-Myc. In some embodiments, the agent induces a conformational change in HIF- Ια or c-Myc that abrogates their interaction and/or alters the ability of HIF-Ια to affect c-Myc activity, protein levels or cell localization. In some embodiments, the cell, organ and/or tissue has been exposed to a hypoxic
environment. In certain embodiments the cell, organ and/or tissue is within a subject (e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction,
congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease, reperfusion or stroke) who is administered the agent. In some
embodiments, the cell is being cultured in vitro. In some embodiments the cell is a neuron, a cardiac myocyte, a skeletal myocyte, an iPS cell, blood cell, germ cell or germ cell precursor.
In certain embodiments, the present invention relates to a method of treating or preventing damage to a tissue or organ that has been exposed to hypoxia in a subject by administering an agent described herein to the subject. In some embodiments the subject is suffering from or has suffered from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis, macrovascular disease, peripheral vascular disease reperfusion or a stroke.
In certain embodiments, the agent is an isolated antibody or antigen binding fragment thereof that specifically binds to a domain in HIF-Ι that contributes to complex formation with c-Myc. For example, in certain embodiments the antibody or antigen binding fragment thereof binds to an epitope of human HIF- la located within amino acids 167-329 of the HIF- la protein. In some embodiments the antibody or antigen binding fragment thereof can be monoclonal, polyclonal, chimeric, humanized and/or human. In certain embodiments, the antibody or antigen binding fragment thereof is a full length immunoglobulin molecule; an scFv; a Fab fragment; an Fab' fragment; an F(ab')2; an Fv; a NANOBODY®; or a disulfide linked Fv. In some embodiments the antibody or antigen binding fragment thereof binds to HIF- la with a dissociation constant of no greater than about 10"6 M, 10"7 M, 10~8 M or 10"9 M. In certain embodiments the antibody or antigen binding fragment thereof inhibits the formation of a complex between HIF- la and c-Myc.
In certain embodiments, the agent is an isolated soluble polypeptide that includes at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive amino acids of the HIF- la domain that contributes to complex formation with c-Myc. For example, in some embodiments the isolated soluble polypeptide includes at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive amino acids of one of SEQ ID NO: 11-20. In some embodiments, the polypeptide comprises one of SEQ ID NO: 11-20. In certain embodiments the polypeptide also includes an immunoglobulin constant domain (e.g., a human immunoglobulin constant domain). In some embodiments the polypeptide binds to c-Myc with a dissociation constant of no greater than about 10"6 M, 10"7 M, 10~8 M or 10"9 M.
In certain embodiments, the agent is a small molecule. In some embodiments the small molecule binds the HIF-l domain that contributes to complex formation with c- Myc. In some embodiments the small molecule binds to human HIF-la at a location within amino acids 167-329 of the HIF-la protein. In some embodiments, the small molecule is attached to an antibody, protein or a peptide.
In some embodiments, the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance. In certain embodiments, the method comprises forming a test reaction mixture that includes a HIF-la polypeptide or fragment thereof, an c-Myc polypeptide or fragment thereof and a test agent. In some embodiments the method includes the step of incubating the test reaction mixture under conditions conducive for the formation of a complex between the HIF-la polypeptide or fragment thereof and the c-Myc polypeptide or fragment thereof. In certain embodiments, the test reaction includes a cell lysate. In some embodiments, the method includes the step of determining the amount of the complex in the test reaction mixture. In some
embodiments, a test agent that reduces the amount of the complex in the test reaction mixture compared to the amount of the complex in a control reaction mixture is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance. In some embodiments, the HIF-la polypeptide or fragment thereof comprises an amino acid sequence of one of SEQ ID NO: 11-20. In some embodiments the test agent is an antibody, a protein, a peptide or a small molecule. In certain embodiments the test agent is a member of a library of test agents.
In some embodiments, the control reaction mixture is substantially identical to the test reaction mixture except that the control reaction mixture does not comprise a test agent. In certain embodiments the control reaction mixture is substantially identical to the test reaction mixture except that the control reaction mixture comprises a placebo agent instead of a test agent.
In some embodiments, the test reaction mixture is formed by adding the test agent to a mixture comprising the HIF-la polypeptide or fragment thereof and the c-Myc polypeptide or fragment thereof. In certain embodiments the test reaction mixture is formed by adding the HIF-la polypeptide or fragment thereof to a mixture comprising the
test agent and the c-Myc polypeptide or fragment thereof. In certain embodiments the test reaction mixture is formed by adding the c-Myc polypeptide or fragment thereof to a mixture comprising the test agent and the HIF- Ι polypeptide or fragment thereof.
In certain embodiments, the HIF-Ι polypeptide or fragment thereof is anchored to a solid support in the test reaction mixture. In some embodiments the test reaction mixture is incubated under conditions conducive to the binding of the c-Myc polypeptide or fragment thereof to the anchored HIF- Ι polypeptide or fragment thereof. In some embodiments, the method also includes the step of isolating c-Myc polypeptide or fragment thereof bound to the HIF-Ι polypeptide or fragment thereof from c-Myc polypeptide or fragment thereof not bound to the HIF- la polypeptide or fragment thereof. In certain embodiments, the amount of complex in the test reaction mixture is determined by detecting the amount of c-Myc polypeptide or fragment thereof bound to the HIF- la polypeptide or fragment thereof. In some embodiments the c-Myc polypeptide or fragment thereof is linked (e.g. bound either directly or indirectly) to a detectable moiety (e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.).
In some embodiments, the c-Myc polypeptide or fragment thereof is anchored to a solid support in the test reaction mixture. In some embodiments the test reaction mixture is incubated under conditions conducive to the binding of the HIF- la polypeptide or fragment thereof to the anchored c-Myc polypeptide or fragment thereof. In certain embodiments the method also includes the step of isolating HIF- la polypeptide or fragment thereof bound to the c-Myc polypeptide or fragment thereof from HIF- la polypeptide or fragment thereof not bound to the c-Myc polypeptide or fragment thereof. In some embodiments the amount of complex in the test reaction mixture is determined by detecting the amount of HIF- la polypeptide or fragment thereof bound to the c-Myc polypeptide or fragment thereof. In certain embodiments the HIF- la polypeptide or fragment thereof is linked (e.g. bound either directly or indirectly) to a detectable moiety (e.g., a fluorescent moiety, a luminescent moiety, a radioactive moiety, etc.).
In some embodiments, the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance that includes contacting a polypeptide comprising a sequence of one of SEQ ID NO: 11-20 with a test agent and determining whether the test agent binds to the epitope; wherein a test agent that binds to
the epitope is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance. In some embodiments the test agent is an antibody, a protein, a peptide or a small molecule. In certain embodiments the test agent is a member of a library of test agents. In some embodiments the test agent is a small molecule.
In some embodiments the polypeptide is attached to a solid substrate. In some embodiments, the method also includes the step of isolating test agent that is bound to the epitope from test agent that is not bound to the epitope. In some embodiments the test agent is linked to a detectable moiety.
In some embodiments the test agent is attached to a solid substrate. In certain embodiments the method also includes the step of isolating polypeptide that is bound to the test agent from polypeptide that is not bound to the test agent. In some embodiments the polypeptide is linked to a detectable moiety. In certain embodiments the test agent is a member of a library of test agents. In some embodiments the test agent is a small molecule.
In some embodiments, the instant invention relates to a method of determining whether a test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance, wherein the method includes the steps of contacting a cell that expresses HIF-Ι and c-Myc with a test agent, and detecting the expression of a reporter gene that is transcriptionally regulated by c-Myc. In some embodiments, the reporter gene is a gene that controls mitochondrial function, such as TFAM, NDl, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COXl, COX2, COX3, ATP6 or ATP8. In some embodiments, a test agent that increases expression of the reporter gene in the cell as compared to a cell that has not been contacted with the test agent is a candidate therapeutic agent for the treatment of an age-related disease, for the treatment of a mitochondrial disease, for increasing life span, for improving resistance to hypoxia and/or for increasing stress resistance.
In some embodiments, the reporter gene is operably linked to the promoter of c-Myc target gene, such as the promoter of TFAM, NDl, ND2, ND3, ND4, ND4I, ND5, ND6,
CYTB, COXl, COX2, COX3, ATP6 or ATP8. In some embodiments expression of the reporter gene is detected by detecting the presence and/or amount of reporter gene mRNA
(e.g., by RT PCR, northern blot, a nucleic acid probe hybridization assay and/or a gene
expression array). In certain embodiments expression of the reporter gene is detected by detecting the presence and/or amount of reporter gene encoded protein (e.g., by western blot, ELISA, an antibody hybridization assay, etc.). In some embodiments, the cell is a mammalian cell (e.g., a C2C12 cell). In certain embodiments, the cell is in an organism. In some embodiments, the cell is a transgenic cell that recombinantly expresses the reporter gene. In certain embodiments the reporter gene encodes a detectable moiety, such as a fluorescent protein (e.g., GFP, RFP, YFP, etc.), or an enzyme that catalyzes a reaction that produces a change in luminescence, opacity or color. In certain embodiments the test agent is a member of a library of test agents. In some embodiments the agent is a small molecule.
Aspects of the present disclosure relate to the surprising discovery that HIF-Ι is increased during aging and mitochondrial disorders and that NAD+ precursors and NAD+ biosynthetic genes (e.g., NMNAT-1 and NAMPT) counteract HIF-Ι activity.
Accordingly, provided herein are methods and compositions for the treatment of diseases or disorders associated with mitochondrial dysfunction.
Thus, in one embodiment, a method for treating or preventing a disease associated with deregulation of mitochondrial homeostasis in a subject in need thereof is provided. The method comprises administering to the subject an effective amount of a HIF- l inhibitor. In some aspects, the disease associated with deregulation of mitochondrial homeostasis is aging, an aging-related disease, a mitochondrial disease, metabolic disorder, cardiovascular disease, stroke, pulmonary hypertension, ischemia, cachexia, sarcopenia, a neurodegenerative disease, dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male infertility, diabetes, muscle wasting, or combinations thereof. In some aspects, the HIF- Ι inhibitor is a small molecule, siRNA, or antisense oligonucleotide. In some aspects, the small molecule is chrysin (5,7-dihydroxyflavone), methyl 3-(2-(4-(adamantan- l-yl)phenoxy)acetamido)-4-hydroxybenzoate, P3155, NSC 644221, S-2-amino-3-[4'-N,N,-bis(chloroethyl)amino]phenyl propionic acid N-oxide dihydrochloride, dimethyl-bisphenol A, vincristine, apigenin, 2-methoxyestradiol, chetomin, or echinomycin.
In some embodiments, the method further comprises administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject. In some aspects, the agent is an NAD+ precursor, such as NMN or a salt thereof, or an NMN prodrug. In some aspects, the agent is administered at a dose of between 0.5 - 5 grams per day. In some embodiments, the agent is an enzyme involved in NAD+ biosynthesis, or an
enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some aspects, the enzyme is NMNAT-1 or NAMPT.
In another embodiment, a method for treating or preventing a disease associated with deregulation of mitochondrial homeostasis in a subject in need thereof is provided, comprising administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject. In some aspects, the disease associated with deregulation of mitochondrial homeostasis is aging, an aging-related disease, a mitochondrial disease, metabolic disorder, cardiovascular disease, stroke, pulmonary hypertension, ischemia, cachexia, sarcopenia, a neurodegenerative disease, dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male infertility, or combinations thereof. In some aspects, the agent is an NAD+ precursor, such as NMN or a salt thereof, or an NMN prodrug. In some aspects, the agent is administered at a dose of between 0.5 - 5 grams per day. In some embodiments, the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some aspects, the enzyme is NMNAT-1 or NAMPT.
In another embodiment, a screening method for identifying a HIF-Ι inhibitor is provided. The method comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the level of expression of one or more mitochondrial genes; (c) comparing the level of expression determined in (b) to a reference level of expression, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF-Ι inhibitor if a significantly decreased level of mitochondrial gene expression is determined in (b), as compared to the reference level in (c). In some aspects, the one or more mitochondrial genes is selected from cytochrome b, cytochrome oxidase, NADH dehydrogenase, and ATP synthase.
Aspects of the invention relate to methods for treating or preventing a disorder associated with inflammation in a subject in need thereof comprising administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject. In some embodiments, the agent is an NAD+ precursor. In some embodiments, the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof. In some embodiments, the agent is administered at a dose of between 0.5 - 5 grams per day.
In some embodiments, the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some embodiments, the enzyme is NMNAT-1 or NAMPT. In some embodiments, the subject is a human. In some embodiments, the disorder associated with inflammation is selected from the group consisting of: septic shock, obesity-related inflammation, Parkinson's Disease, Crohn's Disease, Alzheimer's Disease (AD), cardiovascular disease (CVD), inflammatory bowel disease (IBD), chronic obstructive pulmonary disease, an allergic reaction, an autoimmune disease, blood inflammation, joint inflammation, arthritis, asthma, ulcerative colitis, hepatitis (e.g., viral chronic hepatitis), psoriasis, atopic dermatitis, pemphigus,
glomerulonephritis, atherosclerosis, sarcoidosis, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Wegner's syndrome, Goodpasture's syndrome, giant cell arteritis, polyarteritis nodosa, idiopathic pulmonary fibrosis, acute lung injury, post-influenza pneumonia, SARS, tuberculosis, malaria, sepsis, cerebral malaria, Chagas disease, schistosomiasis, bacteria and viral meningitis, cystic fibrosis, multiple sclerosis, encephalomyelitis, sickle cell anemia, pancreatitis, transplantation (e.g., host-mediated rejection of transplanted tissue such as hematopoietic stem cells or an organ, graft mediated host response, such as graft vs. host disease), systemic lupus erythematosis, autoimmune diabetes, thyroiditis, radiation pneumonitis, respiratory inflammation and pulmonary inflammation.
Further aspects of the invention relate to methods for modulating inflammation in a subject in need thereof comprising administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject. In some embodiments, the agent is an NAD+ precursor. In some embodiments, the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof. In some embodiments, the agent is administered at a dose of between 0.5 - 5 grams per day. In some embodiments, the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some embodiments, the enzyme is NMNAT-1 or NAMPT. In some embodiments, the subject is a human.
These and other aspects of the invention, as well as various embodiments thereof, will become more apparent in reference to the drawings and detailed description of the invention. Each of the limitations of the invention can encompass various embodiments of
the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing, in the drawings:
FIG. 1 provides exemplary HIF-Ια amino acid sequences (SEQ ID NOs: 1-10). FIG. 2 provides exemplary amino acid sequences of the domain of the HIF-l protein that is required for complex formation with c-Myc (SEQ ID NOs: 11-20).
FIG. 3 provides exemplary c-Myc amino acid sequences (SEQ ID NOs: 21-30). FIG. 4 shows loss of SIRTl causes a specific decrease in the expression of mitochondrially-encoded genes resulting in genome asynchrony and mitochondrial dysfunction. (A) Mitochondrial membrane potential of isolated mitochondria from skeletal muscle of WT and SIRTl KO mice (n=4). (B) ATP content from gastrocnemius of WT and SIRTl KO mice (n=4). (C) Electronic microscopy analysis of gastrocnemius from WT and SIRTl KO mice and the respective mitochondrial area quantification (n=4). (D-E)
NDUFS8, NDUFAS, SDHb, SDHd, Uqcrcl, Uqcrc2, COX5b, Cox6al, ATP5al, ATPbl (D), ND1, ND2, ND3, ND4, ND41, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8 (E) mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice.
Relative expression values were normalized to WT mice (n=4). (F) Representative immunoblot for COX2 and COX4 in gastrocnemius of WT and SIRTl KO mice. (G) Cytochrome c Oxidase (COX) activity in gastrocnemius of WT and SIRTl KO mice (n=5). (H) Succinate Dehydrogenase (SDH) activity in gastrocnemius of WT and SIRTl KO mice (n=5). (I) Mitochondrial DNA content analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice Relative amount was normalized to WT mice (n=4). Values are expressed as mean + SEM (*p<0.05 versus WT animals).
FIG. 5 shows aging leads to genome asynchrony and impaired mitochondrial function. (A) Mitochondrial membrane potential of isolated mitochondria from skeletal muscle of 6-, 22-, and 30-month-old mice (n=4). (B) ATP content from gastrocnemius of 6-
, 22-, and 30-month-old mice (n=5). (C) Cytochrome c Oxidase (COX) activity in
gastrocnemius of 6-, 22-, and 30-month-old mice (n=4). (D) Mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative amount was normalized to 6 month old mice (n=5). (E) Mitochondrial DNA integrity in
gastrocnemius of6-, 22-, and 30-month-old mice. Relative amount was normalized to 6 month old mice (n=5). (F) SIRT1 mRNA analyzed by qPCR in gastrocnemius of6-, 22-, and 30-month-old mice. Relative expression values were normalized to 6 month old mice (n=5). (G) NAD+ levels in gastrocnemius of 6-, 22-, and 30-month-old mice (n=5). (H-I) NDl, CYTB, COXl, and ATP6 (H), NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al (I) mRNA analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative expression values were normalized to 6-month-old mice (n=5). (J) Expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrially-encoded genes (NDl, CYTB, COXl, ATP6) analysed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative expression values were normalized to 6-month-old mice (N=5). (K)
Representative immunoblot for COX2 and COX4 in gastrocnemius of 6-, 22-, and 30- month-old mice. Values are expressed as mean + SEM (*p<0.05 versus 6-month-old animals).
FIG. 6 shows loss of SIRT1 disrupts mitochondrial homeostasis through PGC-la- independent regulation of mitochonrially-encoded ETC subunits driven by HIF-l stabilization. (A) NDl, CYTB, COXl and ATP6 mRNA analyzed by qPCR in WT and PGC-Ι /β knockout myo tubes treated with adenovirus overexpressing SIRT1 or empty vector. Relative expression values were normalized to WT control cells (n=4 experiments, *p<0.05 versus WT empty vector, #p<0.05 versus PGC-Ια/β KO empty vector). (B) TFAM mRNA analyzed by qPCR in gastrocnemius of WT and SIRT1 KO animals. Relative expression values were normalized to WT mice (n=4, *p<0.05 versus WT). (C) TFAM promoter activity measured by luciferase assay in primary myoblasts extracted from WT and SIRT1 KO mice. Relative luciferase values were normalized to WT (n=6, *p<0.05 versus control. (D) Representative immunoblot for SIRT1, TFAM and tubulin in C2C12 cells infected with nontargeting or SIRT1 shRNA with or without TFAM overexpression. (E) NDl, CYTB, COXl and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with nontargeting or SIRT1 shRNA with or without TFAM overexpression. Relative expression values were normalized to control cells (n=4, *p<0.05 versus shCtl, #p<0.05 versus shSIRTl). (F) Mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with nontargeting or SIRT1 shRNA with or without TFAM overexpression. Relative amount
was normalized to control cells (n=4, *p<0.05 versus shCtl, #p<0.05 versus shSIRTl). (G) ATP content in C2C12 cells infected with nontargeting or SIRTl shRNA with or without TFAM overexpression (n=4, *p<0.05 versus shCtl, #p<0.05 versus shSIRTl). (H) HK2, PKM, and PFKM mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5, *p<0.05 versus WT). (I) LDHA mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5, *p<0.05 versus WT). (J)
Representative immunoblot for HIFl and tubulin in gastrocnemius of WT and SIRTl KO mice. (K) PGK-1, Glutl, PKD1, and VEGFa mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=4, *p<0.05 versus WT). (L) Hypoxia response element activity in primary myoblasts isolated from WT and SIRTl KO mice and treated with or without DMOG. Relative luciferase activity was normalized to WT cells (n=6, *p<0.05 versus WT). (M) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in PGC-Ι /β KO myo tubes treated with adenovirus overexpressing SIRTl or empty vector as well as treatment with DMSO or with HIF stabilizing compounds DMOG and DFO. Relative expression values were normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus SIRTl OE). Values are expressed as mean + SEM.
FIG. 7 shows HIF- la, but not HIF-2a, controls oxidative phosphorylation by regulating mitochondrially-encoded ETC components in response to SIRTl. (A)
Representative immunoblot for HA-tag and tubulin in control C2C12 cells and cells overexpressing either HIF- la or HIF-2a with the proline residues mutated (HIF- la DPA; HIF-2a DPA). (B) Expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrially-encoded genes (ND1, CYTB, COX1, ATP6) analyzed by qPCR in control, HIF- la DPA or HIF-2a DPA C2C12 cells. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector). (C) Mitochondrial DNA content analyzed by qPCR in control, HIF- la DPA or HIF-2a DPA C2C12 cells treated with adenovirus overexpressing SIRTl or empty vector. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus SIRTl OE). (D) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in control, HIF- la DPA or HIF-2a
DPA C2C12 cells treated with adenovirus overexpressing SIRTl or empty vector. Relative expression values were normalized to control cells (n=4, *p<0.05 versus empty vector,
#p<0.05 versus SIRTl OE). (E) HIF- la mRNA analyzed by qPCR in C2C12 cells infected
with HIF-Ια or nontargeting shRNA. Relative expression values were normalized to control cells (n=4, *p<0.05 versus control). (F) Mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with HIF-Ια or nontargeting shRNA treated with EX-527. Relative amount was normalized to control cells (n=6, *p<0.05 versus control, #p<0.05 versus control EX-527). (G) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with HIF-Ια or nontargeting shRNA treated with EX-527. Relative expression values were normalized to control cells (n=6, *p<0.05 versus control, #p<0.05 versus control EX-527). (H) Representative images of mitochondrial membrane potential in C2C12 cells infected with HIF-Ια or nontargeting shRNA treated with EX-527 and analyzed by fluorescence microscopy. (I) ATP content in C2C12 cells infected with HIF-la or nontargeting shRNA treated with EX-527 (n=4, *p<0.05 versus control, #p<0.05 versus control EX-527).
FIG. 8 shows HIFl-a regulates genome synchrony by modulation of TFAM promoter through c-Myc in response to changes in SIRT1 activity. (A) c-Myc activity in primary myoblasts extracted from WT and SIRT1 KO animals. Relative lucif erase values were normalized to WT cells (n=3, *p<0.05 versus control). (B) Representative
immunoblot for c-Myc and tubulin in C2C12 cells infected with c-Myc or nontargeting shRNA. (C) Mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with c- Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRT1 or empty vector. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus SIRT1 OE). (D) TFAM promoter activity in C2C12 cells infected with c- Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRT1 or empty vector (n=4, *p<0.05 versus empty vector, #p<0.05 versus SIRT1 OE). (E) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with c-Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRT1 or empty vector. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector, #p<0.05 versus SIRT1 OE). (F) Representative immunoblot for c-Myc and tubulin in C2C12 cells overexpressing c-Myc. (G) Mitochondrial DNA content analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus c-Myc OE). (H) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector,
#p<0.05 versus c-Myc OE). (I) TFAM promoter activity in in C2C12 cells overexpressing
c-Myc. (n=6, *p<0.05 versus empty vector, #p<0.05 versus c-Myc OE). (J) ATP content in C2C12 cells overexpressing c-Myc. (n=6, *p<0.05 versus empty vector, #p<0.05 versus c- Myc OE). (K) TFAM promoter activity in control or HIF-Ι DPA C2C12 cells treated with adenovirus overexpressing SIRTl or empty vector (n=6, *p<0.05 versus empty vector #p<0.05 versus SIRTl OE). (L) TFAM promoter activity in C2C12 cells infected with HIF- la or nontargeting shRNA treated with EX-527 and c-Myc siRNA (n=6, *p<0.05 versus DMSO, #p<0.05 versus Ex-527, +*p<0.05 versus HIF-la KD). Values are expressed as mean + SEM.
FIG. 9 shows Caloric restriction protects from age-related mitochondrial dysfunction in skeletal muscle by preventing HIF-la stabilization and loss of
mitochondrial-encoded ETC genes. (A) NAD+ levels in gastrocnemius of 6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). (B) Mitochondrial membrane potential of isolated mitochondria from skeletal muscle of 6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). (C) ATP content in skeletal muscle of 6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus 6 month old animals #p<0.05 versus 22 month old AL mice). (D) Cytochrome c Oxidase Activity (Cox) activity in skeletal muscle of 6- and 22-month AL and 22-month old CR mice (n=4, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). (E) Mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6- and 22-month AL and 22-month old CR mice. Relative amount was normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). (F) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in gastrocnemius of 6- and 22- month AL and 22-month old CR mice. Relative expression values were normalized to 6- month-old mice (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). (G) Representative immunoblot for COX2, COX4, and tubulin in gastrocnemius of 22-month-old AL and CR mice. (H) Representative immunoblot for HIFla, and tubulin in gastrocnemius of 6- and 22-month AL and 22-month old CR mice. (I) PGK-1, Glutl, PKD1, and VEGFa mRNA analyzed by qPCR in gastrocnemius o6- and 22-month AL and 22-month old CR mice. Relative expression values were normalized to 6-month-old mice. (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). Values are expressed as mean + SEM.
FIG. 10 shows increasing NAD+ rescues age-related mitochondrial dysfunction and genome asynchrony in skeletal muscle through a SIRTl-HIF-la pathway. (A) NAD+ levels in gastrocnemius of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS animals). (B) Mitochondrial membrane potential of isolated mitochondria from skeletal muscle of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n=4, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24-months-old PBS animals). (C) ATP content in skeletal muscle of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24- month-old PBS animals). (D) Cytochrome c Oxidase (Cox) activity in skeletal muscle of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n=4, *p<0.05 versus 3-month-old animals, #p<0.05 versus 24-month-old PBS animals). (E) Representative immunoblot for HIFl , and tubulin in gastrocnemius of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN. (F) PGK-1, Glutl, PKD1, and VEGFa mRNA analyzed by qPCR in gastrocnemius of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to 3 month old PBS animals. (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS animals). (G) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in PGC-lo/β KO myotubes treated with PBS or NMN as well as treatment with DMSO or with DMOG or DFO. Relative expression values were normalized to PBS treated cells. (n=6, *p<0.05 versus PBS, #p<0.05 versus NMN). (H) ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice treated with either the vehicle (PBS) or NMN (n=4, *p<0.05 versus WT untreated animals). (I) Mitochondrial membrane potential of isolated mitochondria from skeletal muscle of WT and SIRTl KO mice treated with either the vehicle (PBS) or NMN (n=4, *p<0.05 versus WT PBS animals). (J) Model for age-related mitochondrial dysfunction caused by genome asynchrony. A decline in NAD+ with age leads to HIF- la- mediated inhibition of nuclear- mitochondrial
communication and a deficiency of mitochondrially-encoded electron transport chain (ETC) subunits. Values are expressed as mean + SEM.
FIG. 11 reveals that aging leads to a specific decline in mitochondrial-encoded genes and impairment in mitochondrial homeostasis through decline in nuclear NAD+ levels. FIG. 11 A depicts ATP content from gastrocnemius of 6-, 22-, and 30-month-old mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 11B depicts mitochondrial DNA
content analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative amount was normalized to 6-month-old mice (n=5). FIG. 11C depicts mitochondrial DNA integrity in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative amount was normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 11D depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in
gastrocnemius of 6-, 22-, and 30-month-old mice. Relative expression values were normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old animals). FIG. HE depicts a representative immunoblot for COX2 and COX4 in gastrocnemius of 6-, 22-, and 30-month-old mice. FIG. 1 IF depicts NAD+ levels in gastrocnemius of 6-, 22-, and 30- month-old mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 11G depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). FIG. 11H depicts expression of nuclear
(NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in primary myoblasts WT cells infected with NMNAT2 or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). FIG. I ll depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in primary myoblasts WT cells infected with NMNAT3 or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). FIG. 11 J depicts mitochondrial DNA content analyzed by qPCR in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). FIG. 1 IK depicts ATP content in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). Values are expressed as mean + SEM.
FIG. 12 reveals that loss of SIRT1 resembles the specific decrease in the expression of mitochondrial-encoded genes that occurs with aging and resulting in disruption mitochondrial metabolism and impaired muscle health. FIG. 12A depicts ATP content from gastrocnemius of WT and SIRT1 KO mice (n=5). FIG. 12B depicts mitochondrial
DNA content analyzed by qPCR in gastrocnemius of WT and SIRT1 KO mice Relative
amount was normalized to WT mice (n=5). FIG. 12C depicts electronic microscopy analysis of gastrocnemius from WT and SIRTl KO mice and the respective mitochondrial area quantification (n=4). FIG. 12D depicts expression of nuclear (NDUFS8, NDUFAS, SDHb, SDHd, Uqcrcl, Uqcrc2, COX5b, Cox6al, ATP5al, ATPcl) versus mitochondrial- encoded genes (ND1, ND2, ND3, ND4, ND41, ND5, ND6, Cytb, COX1, COX2, COX3, ATP6 and ATP8) analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice.
Relative expression values were normalized to WT mice (n=5). FIG. 12E depicts a representative immunoblot for COX2 and COX4 in gastrocnemius of WT and SIRTl KO mice. FIG. 12F depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with NMNATl or nontargeting shRNA. Relative amount was normalized to control cells (n=4, *p<0.05 versus control). FIG. 12G depicts representative immunoblot for MyHCHIIa, MyHCIIb and Tubulin in gastrocnemius of WT and SIRTl KO mice. FIG. 12H depicts a representative immunoblot for Atrogin-1, MuRFl and Tubulin in gastrocnemius of WT and SIRTl KO mice. FIG. 121 depicts a representative immunoblot for p-AKT, Total AKT, p-IRS-1 and Total IRS-1 in soleus of WT and SIRTl KO mice under basal conditions and upon insulin stimulation. Values are expressed as mean + SEM (*p<0.05 versus WT animals).
FIG. 13 reveals that SIRTl regulates mitochondrial homeostasis through energy sensitive PGC- la-dependent and -independent mechanisms. FIG. 13A depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in WT and PGC-lo/β knockout myotubes treated with adenovirus overexpressing SIRTl or empty vector. Relative expression values were normalized to WT control cells (n=4 experiments). FIG. 13B depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours. Relative expression values were normalized to control cells (n=4). FIG. 13C depicts mitochondrial mass measured by staining of the cells with NAO in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours. FIG. 13D depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48
hours. FIG. 13E depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in PGC-Ια/β knockout myotubes infected with adenovirus expressing a flag-PGC-l WT, PGC-la T177A/S538A mutant or empty and treated with vehicle (DMSO) or EX-527 for 48h. Relative expression values were normalized to control cells (n=4). FIG. 13F depicts a representative immunoblot for p-ACC (Ser79) and ACC in SIRTl flox/flox Cre- ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 48h and infected with empty or AMPK-DN adenovirus for the same period of time. FIG. 13G depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND 1 , Cytb, COX 1 , ATP6) analysed by qPCR in SIRT 1 flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 48h and infected with empty or AMPK-DN adenovirus for the same period of time. Relative expression values were normalized to control cells (n=4). FIG. 13H depicts TFAM mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO animals.
Relative expression values were normalized to WT mice (n=5, *p<0.05 versus WT). FIG. 131 depicts TFAM promoter activity measured by luciferase assay in primary myoblasts extracted from WT and SIRTl KO mice. Relative luciferase values were normalized to WT cells (n=6, *p<0.05 versus control). FIG. 13J depicts a representative immunoblot for SIRTl, TFAM ant Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time. FIG. 13K depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time. Relative expression values were normalized to control cells (n=4). FIG. 13L depicts ATP content in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time
(n=4). FIG. 13M depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in
SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
SIRTl excision for 24h after which the cells were added back TFAM by infection with a TFAM adenovirus, or for 48h hours and infected with empty or TFAM adenovirus for the same period of time.
FIG. 14 reveals that loss of SIRTl induces a psedohypoxic state that disrupts mitochondrial-encoded genes and mitochondrial homeostasis. FIG. 14A depicts HK2,
PKM, and PFKM mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5, *p<0.05 versus WT). FIG. 14B depicts LDHA mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5, *p<0.05 versus WT). FIG. 14C depicts lactate levels measured in gastrocnemius of WT and SIRTl KO mice
(n=5, *p<0.05 versus WT). FIG. 14D depicts a representative immunoblot for HIF-Ια and Tubulin in gastrocnemius of WT and SIRTl KO mice and in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24h. FIG. 14E depicts a representative immunoblot for HIF-Ι and Tubulin in gastrocnemius of WT and Eglnl KO mice. FIG. 14F depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analysed by qPCR in gastrocnemius of WT and Eglnl KO mice (n=5). FIG. 14G depicts mitochondrial DNA content analyzed by qPCR in gastrocnemius of WT and Eglnl KO mice. Relative amount was normalized to WT mice (n=5). FIG. 14H depicts expression of mitochondrial-encoded genes (ND 1 , Cytb, COX 1 and ATP6) analyzed by qPCR in PGC- l /β KO myo tubes treated with adenovirus overexpressing SIRTl or empty vector as well as treatment with DMSO or with HIF stabilizing compound DMOG. Relative expression values were normalized to control cells (n=4). FIG. 141 depicts a representative
immunoblot for HA-tag and tubulin in control C2C12 cells and cells overexpressing either HIF- 1 a or HIF-2a with the proline residues mutated (HIF- 1 a DPA; HIF-2a DPA). FIG. 14J depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in control, HIF- la DPA or HIF-2a DPA C2C12 cells. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector). FIG. 14K depicts expression of mitochondrial-encoded genes (NDl, Cytb, COXl and ATP6) analyzed by qPCR in control,
HIF- la DPA or HIF-2a DPA C2C12 cells treated with adenovirus overexpressing SIRTl or empty vector. Relative expression values were normalized to control cells (n=4). FIG. 14L depicts a representative immunoblot for HIF- la and Tubulin in SIRTl flox/flox Cre-ERT2
primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with HIF-Ια or nontargeting shRNA and DMOG to promote HIF-Ια stabilization. FIG. 14M depicts mitochondrial DNA content analyzed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with HIF-Ι or nontargeting shRNA. Relative amount was normalized to control cells (n=4). FIG. 14N depicts ATP content in gastrocnemius of in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision infected with HIF-Ι or nontargeting shRNA. Relative amount was normalized to control cells (n=5). Values are expressed as mean + SEM.
FIG. 15 reveals that SIRTl regulates HIF-Ι stabilization in the skeletal muscle through regulation of VHL expression. FIG. 15A depicts a representative immunoblot for VHL and Tubulin in gastrocnemius of WT and SIRTl KO mice. FIG. 15B depicts a representative immunoblot for VHL and Tubulin is gastrocnemius of WT and SIRTl -Tg overexpressing mice. FIG. 15C depicts VHL mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to control WT mice (n=5). FIG. 15D depicts VHL mRNA analyzed by qPCR in gastrocnemius of WT and SIRTl-Tg mice. Relative expression values were normalized to control WT mice (n=5). FIG. 15E depicts VHL promoter activity measured by luciferase assay in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision. Relative luciferase values were normalized to vehicle. Relative luciferase values were normalized to control cells (n=5, *p<0.05 versus control). FIG. 15F depicts VHL promoter activity measured by luciferase assay in primary myoblasts infected with adenovirus expressing SIRTl or empty vector. Relative luciferase values were normalized to empty vector (n=5, *p<0.05 versus control). FIG. 15G depicts a representative immunoblot for VHL, HIF-Ι and Tubulin in primary myoblasts WT cells infected with NMNAT1 or nontargeting shRNA. FIG. 15H depicts VHL mRNA analyzed by qPCR in primary WT myoblasts infected with NMNAT1 or nontargeting shRNA. Relative expression values were normalized to control cells (n=4). FIG. 151 depicts a representative immunoblot for VHL, HIF-Ια and Tubulin in gastrocnemius of 6-, 22-, and 30-month-old mice. FIG. 15J depicts a representative immunoblot for VHL, HIF-Ια, TFAM and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
SIRTl excision for 6, 12, 24 hours and in cells treated with OHT for 24h after which SIRTl was added back by infection with an adenovirus. FIG. 15K depicts a representative
immunoblot for VHL and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA. FIG. 15L depicts a representative immunoblot for VHL and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA and treated with OHT for 24h after which SIRTl was added back by infection with an adenovirus. FIG. 15M depicts TFAM promoter activity measured by lucif erase assay in SIRTl flox/flox Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA and treated with OHT for 24h after which SIRTl was added back by infection with an adenovirus. Relative luciferase values were normalized to control cells (n=4). FIG. 15N depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in primary WT myoblasts infected with VHL or nontargeting shRNA and treated with adenovirus expressing SIRTl or empty vector. Relative expression values were normalized to control cells (n=5). Values are expressed as mean + SEM.
FIG. 16 reveals that HIF-Ι regulates mitochondrial homeostasis by modulation of TFAM promoter through c-Myc in response to changes in SIRTl activity. FIG. 16A depicts c-Myc activity in SIRTl flox/flox Cre-ERT2 primary myoblasts and treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 hours. Relative luciferase values were normalized to control cells (n=4). FIG. 16B depicts a representative immunoblot for c-Myc and tubulin in C2C12 cells infected with c-Myc or nontargeting shRNA. FIG. 16C depicts mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with c-Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRTl or empty vector. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus SIRTl OE). FIG. 16D depicts ND1, Cytb, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with c-Myc or nontargeting shRNA and treated with adenovirus overexpressing SIRTl or empty vector. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector, #p<0.05 versus SIRTl OE). FIG. 16E depicts TFAM promoter activity measured by luciferase assay in primary WT myoblasts infected with c-Myc or nontargeting shRNA. Relative luciferase values were normalized to control cells (n=4). FIG. 16F depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in primary WT myoblasts infected with c-Myc or empty vector. Relative luciferase values were normalized to control cells (n=4). FIG. 16G depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in primary WT myoblasts infected with adenovirus expressing PGC-Ι or empty vector. Relative luciferase values
were normalized to control cells (n=4). FIG. 16H depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in primary WT myoblasts infected with adenovirus expressing SIRTl or empty vector. Relative luciferase values were normalized to control cells (n=4). FIG. 161 and 16J depict chromatin immunoprecipitation (I) and respective quantification by qPCR (J) of c-Myc and HIF-Ι to the TFAM promoter in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours. FIG. 16K depicts chromatin
immunoprecipitation of c-Myc to the TFAM promoter in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours infected with HIF-Ι or nontargeting shRNA. FIG. 16L depicts TFAM promoter activity measured by luciferase assay in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours infected with HIF-Ια or nontargeting shRNA. Relative luciferase values were normalized to control cells (n=4). Values are expressed as mean + SEM.
FIG. 17 reveals that increasing NAD+ levels rescues age-related mitochondrial and muscle dysfunction through a SIRTl-HIF-la pathway. FIG. 17A depicts NAD+ levels in gastrocnemius of 3- and 24-month-old mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS animals). FIG. 17B depicts ATP content in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN (n=6). FIG. 17C depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to 6-months old PBS mice (n=6). FIG. 17D depicts a representative immunoblot for VHL, HIF-Ια and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. FIG. 17E depicts lactate levels in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN (n=6). FIG. 17F depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in gastrocnemius of WT and Eglnl KO mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to WT PBS mice (n=5). Eglnl encodes the HIF-1 prolylhydroxylase that targets HIF-1 for degradation. FIG. 17G depicts ATP content in gastrocnemius of WT and Eglnl KO mice treated with either the vehicle (PBS) or NMN (n=5). FIG. 17H depicts expression of mitochondrial-enoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in primary
myoblasts WT cells infected with NMNAT1 or nontargeting shRNA treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to control cells (n=4). FIG. 171 depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to WT PBS mice (n=4). FIG. 17J depicts a representative immunoblot for Atrogin-2, MuRFl and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. FIG. 17K depicts a representative immunoblot for p-AKT, AKT, p-IRS-1, IRS-lin gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. FIG. 17L depicts a schematic which reveals that the decline in nuclear NAD+ during aging elicits a biphasic response mediated by SIRTl to regulate mitochondrial homeostasis. In normal energy supply condition SIRTl regulates specifically mitochondrial-encoded genes trough regulation of the TFAM promoter by regulating HIF-Ι stabilization and c-Myc activity. Under conditions of low energy supply, like fasting or prolonged OXPHOS inhibition, SIRTl regulates mitochondrial biogenesis through deacetylation of PGC-la. Values are expressed as mean + SEM.
FIG. 8 provides additional data related to the content of FIG. 11. FIG. 18A depicts a representative immunoblot for NMNAT1 and Tubulin in primary myoblasts WT cells infected with NMN ATI or nontargeting shRNA. Relative amount was normalized to control cells. FIG. 18B depicts a representative immunoblot for NMNAT2 and Tubulin in primary myoblasts WT cells infected with NMNAT2 or nontargeting shRNA. Relative amount was normalized to control cells. FIG. 18C depicts a representative immunoblot for NMNAT3 and Tubulin in primary myoblasts WT cells infected with NMNAT3 or nontargeting shRNA. Relative amount was normalized to control cells. FIG. 18D depicts ATP content in primary myoblasts WT cells infected with NMNAT2 or nontargeting shRNA (n=4). FIG. 18E depicts ATP content in primary myoblasts WT cells infected with NMNAT3 or nontargeting shRNA (n=4). FIG. 18F depicts SIRTl mRNA analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative expression values were normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 18G depicts a representative immunoblot for SIRTl and tubulin in gastrocnemius of 6-, 22-, and
30-month-old mice. Values are expressed as mean + SEM.
FIG. 19 provides additional data related to the content of FIG. 12. FIG. 19A depicts
Cytochrome c Oxidase (COX) activity in gastrocnemius of WT and SIRTl KO mice (n=5).
FIG. 19B depicts Succinate Dehydrogenase (SDH) activity in gastrocnemius of WT and SIRTl KO mice (n=5). FIG. 19C depicts mitochondrial ribosomal rRNA expression analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 19D depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in liver of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=4, *p<0.05 versus control). FIG. 19E depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in white adipose tissue of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 19F depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in brain of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 19G depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in heart of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 19H depicts expression of inflammatory markers (TNF-a, IL-6, IL-18 and Nlrp3) analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). Values are expressed as mean + SEM.
FIG. 20 provides additional data related to the content of FIG. 13. FIG. 20A depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial- encoded genes (NDl, Cytb, COXl, ATP6) analyzed by qPCR in gastrocnemius of WT and SIRTl KO mice under fed and fasted conditions. Relative expression values were normalized to WT Fed mice (n=5). FIG. 20B depicts mitochondrial DNA content analyzed by qPCR in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours. Relative amount was normalized to control cells (n=5). FIG. 20C depicts mitochondrial membrane potential analyzed by TMRM fluorescence in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 6, 12, 24 and 48 hours (n=5). FIG. 20D depicts a representative immunoblot for Flag and Tubulin in PGC-Ι /β knockout myo tubes infected with adenovirus expressing a flag-PGC-la WT, PGC-la T177A/S538A mutant or empty vector. FIG. 20E depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in
gastrocnemius of WT and SIRT1 KO mice under fed and fasted conditions. FIG. 20F depicts a representative immunoblot for p-AMPK (Thrl72) and AMPK in gastrocnemius of 6- and 22-months-old mice. FIG. 20G depicts PGC-l , PGC-Ιβ, NRF-1, NRF-2m
TFB1M, TFB2M, POLMRT and Twinkle expression in gastrocnemius of WT and SIRT1 KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 20H depicts a representative immunoblot for TFAm and Tubulin in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector. FIG. 201 depicts expression of nuclear (NDUFS8, SDHb, Uqcrcl, COX5b, ATP5al) versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analyzed by qPCR in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector. Relative expression values were normalized to control cells (n=4). FIG. 20J depicts mitochondrial DNA content analyzed by qPCR in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector. Relative amount was normalized to control cells (n=4). FIG. 20K depicts ATP content in primary WT myoblasts infected with adenovirus expressing TFAM or empty vector (n=4). Values are expressed as mean + SEM.
FIG. 21 provides additional data related to the content of FIG. 14. FIG. 21A depicts HIF-Ι target genes (PGK-1, Glutl, PDK1 and Vegfa) expression in gastrocnemius of WT and SIRTl KO mice. Relative expression values were normalized to WT mice (n=5). FIG. 21B depicts hypoxia response element activity in primary myoblasts isolated from WT and SIRTl KO mice and treated with or without DMOG. Relative luciferase activity was normalized to WT cells (n=6, *p<0.05 versus WT). FIG. 21C depicts a representative immunoblot of HIF-l and Tubulin in PGC-Ι /β KO myo tubes treated with adenovirus overexpressing SIRTl or empty vector as well as treatment with DMSO or with HIF stabilizing compound DMOG. FIG. 21D depicts NAD+/NADH ration measured in primary WT myoblasts treated with either 10 mM pyruvate, 10 mM lactate or vehicle for 24h (n=4). FIG. 21E depicts a representative immunoblot of HIF-Ια and Tubulin in primary WT myoblasts treated with 10 mM pyruvate, 10 mM lactate or vehicle for 24h. FIG. 21F depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) in PGC- l /β KO myo tubes treated with 10 mM pyruvate, 10 mM lactate or vehicle for 24h in the presence or absence of DMOG. Relative expression values were normalized to control cells
(n=4). FIG. 21G depicts a representative immunoblot for SIRTl, HIF-Ια and Tubulin in gastrocnemius of WT and SIRTl-tg mice treated with vehicle (PBS) or DMOG. FIG. 21H depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) in
gastrocnemius of WT and SIRTl-tg mice treated with vehicle (PBS) or DMOG. Relative expression values were normalized to WT PBS mice (n=5). FIG. 211 depicts ATP content in gastrocnemius of WT and SIRTl-tg mice treated with vehicle (PBS) or DMOG (n=5). FIG. 21J depicts mitochondrial DNA content analyzed by qPCR in control, HIF-Ια DPA or HIF-2a DPA C2C12 cells treated with adenovirus overexpressing SIRTl or empty vector. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus SIRTl OE). FIG. 21K depicts ARNT mRNA analyzed by qPCR in C2C12 cells infected with ARNT or nontargeting shRNA. Relative expression values were normalized to control cells (n=4, *p<0.05 versus control). FIG. 21L depicts mitochondrial DNA content analyzed by qPCR in C2C12 cells infected with ARNT or nontargeting shRNA. Relative amount was normalized to control cells (n=5, *p<0.05 versus control). FIG. 21M depicts ND1, Cytb, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected with ARNT or nontargeting shRNA. Relative levels were normalized to control cells (n=6, *p<0.05 versus control). FIG. 21N depicts ATP content in C2C12 cells infected with ARNT or nontargeting shRNA. Relative expression values were normalized to control cells (n=4, *p<0.05 versus control). Values are expressed as mean + SEM.
FIG. 22 provides additional data related to the content of FIG. 15. FIG. 22A depicts a representative immunoblot for COX2, SIRTl, HIFl-a, VHL, TFAM and Tubulin in parental or rhoO cells derived from SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision. FIG. 22B depicts ROS levels, measured by DHE fluorescence intensity, in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 6, 12, 24 and 48 hours to induce SIRTl excision. Relative expression values were normalized to control cells (n=4). FIG. 22C depicts a representative immunoblot for HA and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision and infected with HA-HIF-la, the Q and R mutants of the K709 and Q mutant of K674. FIG. 22D depicts a representative immunoblot for HIF-la-OH, HIF-la and Tubulin in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision in the presence and absence of the proteasome inhibitor, MG-132. FIG. 22E depicts a representative immunoblot for HIF-2a and Tubulin in gastrocnemius of WT and SIRTl KO mice and in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision or treated with DMOG to stabilize HIFa. FIG. 12F depicts HIF-2a
target genes (Epo, Cacnala, Angpt2 and Ptplzl) expression in gastrocnemius of WT and SIRT1 KO mice. Relative expression values were normalized to WT mice (n=5).
FIG. 23 provides additional data related to the content of FIG. 16. FIG. 23A depicts a representative immunoblot for c-Myc and tubulin in C2C12 cells overexpressing c-Myc. FIG. 23B depicts mitochondrial DNA content analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative amount was normalized to control cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus c-Myc OE). FIG. 23C depicts NDl, Cytb, COXl and ATP6 mRNA analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative expression values were normalized to control cells (n=6, *p<0.05 versus empty vector, #p<0.05 versus c-Myc OE). FIG. 23D depicts ATP content in C2C12 cells overexpressing c-Myc. (n=6, *p<0.05 versus empty vector, #p<0.05 versus c-Myc OE). FIG. 23E depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in primary WT myoblasts treated with vehicle (DMSO) or DMOG.
Relative luciferase values were normalized to control cells (n=4). FIG. 23F depicts TFAM promoter activity full length or c-Myc consensus sequence mutation measured by luciferase assay in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24h to induce SIRTl excision. Relative luciferase values were normalized to control cells (n=4). FIG. 23G and 23H depict chromatin immunoprecipitation (G) and respective quantification by qPCR (H) of HIF-Ι to the LDHA gene in SIRTl flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce SIRTl excision for 24 hours.
FIG. 24 provides additional data related to the content of FIG. 17. FIG. 24A depicts NAD+ levels in gastrocnemius of 6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG. 24B depicts ATP content in skeletal muscle of 6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus 6 month old animals #p<0.05 versus 22 month old AL mice). FIG. 24C depicts Cytochrome c Oxidase Activity (Cox) activity in skeletal muscle of 6- and 22- month AL and 22-month old CR mice (n=4, *p<0.05 versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG. 24D depicts mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6- and 22-month AL and 22-month old CR mice. Relative amount was normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old animals
#p<0.05 versus 22-month-old AL mice). FIG. 24E depicts NDl, Cytb, COXl and ATP6 mRNA analyzed by qPCR in gastrocnemius of6- and 22-month AL and 22-month old CR mice. Relative expression values were normalized to 6-month-old mice (n=5, *p<0.05
versus 6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG. 24F depicts a representative immunoblot for COX2, COX4, and tubulin in gastrocnemius of 22-month- old AL and CR mice. FIG. 24G depicts a representative immunoblot for HIFl , and tubulin in gastrocnemius of 6- and 22-month AL and 22-month old CR mice. FIG. 24H depicts Cytochrome c Oxidase Activity (Cox) activity in gastrocnemius of 3- and 24- month-old mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3- month-old PBS animals, #p<0.05 versus 24-month-old PBS animals). FIG. 241 depicts mitochondrial DNA content in in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. Relative amount was normalized to 6-months-old PBS mice (n=6). FIG. 24J depicts expression of inflammatory markers (TNF-a, IL-6 and IL-18) in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. Relative expression levels were normalized to 6-months-old PBS mice (n=6).
FIG. 25 reveals that NMN increases NAD+ levels in the skeletal muscle of old mice. NAD+ levels are depicted in gastrocnemius of 3- and 24-month-old C57BL6J mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS animals). Measurements were conducted using a colorimetric NAD+ assay. NMN treatment: IP injections of 500mg/kg/day for 7 consecutive days.
FIG. 2 6 reveals that NMN reduces inflammation in aortas from old mice.
Expression of inflammation related markers (IL-6, TNFa, Nlrp3, IL-lb, CD68 and IL-10, FIGs 2A-F, respsectively) were analyzed by qPCR in aortas of 6- and 22-months-old mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to 6-months-old PBS mice (n=6). NMN treatment: IP injections of 500mg/kg/day for 7 consecutive days.
FIG. 27 reveals that NMN reduces inflammation in aortas from old mice.
Expression of inflammatory markers (VEGF and IL-18, FIG. 3A and B, respectively) were analyzed by qPCR in aortas of 6- and 22-months-old mice treated with either the vehicle (PBS) or NMN. Relative expression values were normalized to 6-months-old PBS mice (n=6). NMN treatment: IP injections of 500mg/kg/day for 7 consecutive days.
FIG. 28 reveals that NMN reverses age-related increase in inflammatory markers in the skeletal muscle. Expression of inflammation related markers (TNFa, IL-6 and IL-18) was analyzed by qPCR in gastrocnemius of 6- and 22-months-old mice treated with either
the vehicle (PBS) or NMN. Relative expression values were normalized to 6-months-old PBS mice (n=6). NMN treatment: IP injections of 500mg/kg/day for 7 consecutive days.
FIG. 29 reveals that NMN destabilizes HIF- 1 alpha in the skeletal muscle of old animals. A representative immunoblot is provided for VHL, HIF-1 a and Tubulin in gastrocnemius of 6- and 22-month-old mice treated with either the vehicle (PBS) or NMN. NMN treatment: IP injections of 500mg/kg/day for 7 consecutive days.
FIG. 30 reveals that in vivo stabilization of HIF-1 alpha with DMOG induces inflammatory markers in the skeletal muscle. Expression of inflammation related markers (TNFalpha, IL-6, II- lb and IL- 18) was analyzed by qPCR in gastrocnemius of 6-month-old mice treated with either the vehicle (PBS) or DMOG. Relative expression values were normalized to 6-months-old PBS mice (n=5). DMOG treatment: IP injections of
300mg/kg/day for 5 consecutive days. DMOG: Dimethyloxallyl Glycine.
FIG. 31 depicts a model for raising NAD+ to decrease inflammation. A decline in NAD+ levels during aging, allergic reactions, or autoimmune disease, among others, leads to an increase in inflammation and destruction/dysfunction of tissues. This is mediated in part by HIF1 alpha. Raising NAD+ levels by supplying NAD+ precursors prevents and reverses inflammation. The link between inflammation in the brain and longevity indicates that NMN could delay aging.
DETAILED DESCRIPTION OF THE INVENTION
Disclosed herein are novel compositions and methods for the treatment of age- related diseases, the treatment of mitochondrial diseases, the improvement of stress resistance, the improvement of resistance to hypoxia and the extension of life span. Also described herein are methods for the identification of agents useful in the foregoing methods.
As disclosed herein, the instant inventors discovered that HIF- 1 a interacts with c-
Myc to inhibit c-Myc activity, which results in mitochondrial dysfunction during the aging process. Agents that reduce HIF-1 a' s ability to inhibit c-Myc, including, for example, agents that inhibit the formation of a complex between HIF- 1 a and c-Myc, convey beneficial effects on metabolism and mitochondrial function in aging tissues. Such agents can, for example, inhibit complex formation by targeting the domain of HIF- 1 a that is required for formation of a complex with c-Myc (e.g., amino acids 167-329 of the human
HIF- la protein). Such agents may also, for example, prevent HIF-Ια from altering c-Myc activity, abundance and/or its localization within the cell.
Thus, in certain embodiments, the instant invention relates to compositions and/or methods for the treatment of age-related diseases, the treatment of mitochondrial diseases, the improvement of the stress response, the improvement of hypoxia resistance and/or the improvement of life span by administering an agent that reduces HIF- la's inhibition of c- Myc. In some embodiments, the agent reduces HIF- la's inhibition of c-Myc by acting to inhibit of the formation of a HIF-la/c-Myc complex. In some embodiments, the agent induces a conformational change in HIF-Ια or c-Myc that abrogates their interaction and/or alters the ability of HIF-Ια to affect c-Myc activity, protein levels or cell localization. In some embodiments the agent is an antibody, an antigen binding fragment thereof, a small molecule and/or a polypeptide that binds to HIF-Ια or c-Myc. For example, in some embodiments the agents described herein bind to the HIF-Ια domain required for c-Myc complex formation. Definitions
For convenience, certain terms employed in the specification, examples, and appended claims are collected here.
As used herein, the term "administering" means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
The term "agent" is used herein to denote a chemical compound, a small molecule, a mixture of chemical compounds and/or a biological macromolecule (such as a nucleic acid, an antibody, an antibody fragment, a protein or a peptide). Agents may be identified as having a particular activity by screening assays described herein below. The activity of such agents may render them suitable as a "therapeutic agent" which is a biologically, physiologically, or pharmacologically active substance (or substances) that acts locally or systemically in a subject.
The term "amino acid' is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids. Exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino
acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.
As used herein, the term "antibody" may refer to both an intact antibody and an antigen binding fragment thereof. Intact antibodies are glycoproteins that include at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain includes a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain includes a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system
(e.g., effector cells) and the first component (Clq) of the classical complement system. The term "antibody" includes, for example, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies and antigen-binding antibody fragments. An "isolated antibody," as used herein, refers to an antibody which is substantially free of other antibodies having different antigenic specificities. An isolated antibody may, however, have some cross-reactivity to other, related antigens.
The terms "antigen binding fragment" and "antigen-binding portion" of an antibody, as used herein, refers to one or more fragments of an antibody that retain the ability to bind to an antigen. Examples of binding fragments encompassed within the term "antigen-binding fragment" of an antibody include Fab, Fab', F(ab')2, Fv, scFv, disulfide linked Fv, Fd, diabodies, single-chain antibodies, NANOBODIES®, isolated CDRH3, and other antibody fragments that retain at least a portion of the variable region of an intact antibody. These antibody fragments can be obtained using conventional recombinant and/or enzymatic techniques and can be screened for antigen binding in the same manner as intact antibodies.
As used herein, the term "c-Myc" refers to the c-Myc transcription factor originally identified as an oncogene in Burkett's lymphoma patients. c-Myc is a highly conserved
transcriptional regulator present in many organisms. Exemplary c-Myc amino acid sequences are provided in Figure 3.
The terms "CDR", and its plural "CDRs", refer to a complementarity determining region (CDR) of an antibody or antibody fragment, which determine the binding character of an antibody or antibody fragment. In most instances, three CDRs are present in a light chain variable region (CDRL1, CDRL2 and CDRL3) and three CDRs are present in a heavy chain variable region (CDRH1, CDRH2 and CDRH3). CDRs contribute to the functional activity of an antibody molecule and are separated by amino acid sequences that comprise scaffolding or framework regions. Among the various CDRs, the CDR3 sequences, and particularly CDRH3, are the most diverse and therefore have the strongest contribution to antibody specificity. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Kabat et al., Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda, Md. (1987), incorporated by reference in its entirety); and (2) an approach based on crystallographic studies of antigen-antibody complexes (Chothia et al., Nature, 342:877 (1989), incorporated by reference in its entirety).
"Diabetes" refers to high blood sugar or ketoacidosis, as well as chronic, general metabolic abnormalities arising from a prolonged high blood sugar status or a decrease in glucose tolerance. "Diabetes" encompasses both the type I and type II (Non-Insulin Dependent Diabetes Mellitus or NIDDM) forms of the disease. The risk factors for diabetes include the following factors: waistline of more than 40 inches for men or 35 inches for women, blood pressure of 130/85 mmHg or higher, triglycerides above 150 mg/dl, fasting blood glucose greater than 100 mg/dl or high-density lipoprotein of less than 40 mg/dl in men or 50 mg/dl in women.
The term "epitope" means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains. Certain epitopes can be defined by a particular sequence of amino acids to which an antibody is capable of binding, such as, for example, the interaction domain sequences provided in Figure 2.
As used herein, the term "HIF-la" refers to the Hypoxia- Inducible Factor 1, alpha subunit protein. HIF-Ι is a highly conserved protein present in most, if not all, metazoa.
Exemplary HIF-Ι amino acid sequences are provided in Figure 1. Under certain conditions, HIF-Ια forms a complex with c-Myc. A specific interaction domain of the HIF-
l protein is required for this complex formation. Exemplary interaction domain sequences are provided in Figure 2.
As used herein, the term "humanized antibody" refers to an antibody that has at least one CDR derived from a mammal other than a human, and a FR region and the constant region of a human antibody. A humanized antibody is useful as an effective component in a therapeutic agent according to the present invention since antigenicity of the humanized antibody in human body is lowered.
An "insulin resistance disorder " as discussed herein, refers to any disease or condition that is caused by or contributed to by insulin resistance. Examples include:
diabetes, gestational diabetes, obesity, metabolic syndrome, insulin-resistance syndromes, syndrome X, insulin resistance, high blood pressure, hypertension, high blood cholesterol, dyslipidemia, hyperlipidemia, dyslipidemia, atherosclerotic disease including stroke, coronary artery disease or myocardial infarction, hyperglycemia, hyperinsulinemia and/or hyperproinsulinemia, impaired glucose tolerance, delayed insulin release, diabetic complications, including coronary heart disease, angina pectoris, congestive heart failure, stroke, cognitive functions in dementia, retinopathy, peripheral neuropathy, nephropathy, glomerulonephritis, glomerulosclerosis, nephrotic syndrome, hypertensive nephrosclerosis some types of cancer (such as endometrial, breast, prostate, and colon), complications of pregnancy, poor female reproductive health (such as menstrual irregularities, infertility, irregular ovulation, polycystic ovarian syndrome (PCOS)),lipodystrophy, cholesterol related disorders, such as gallstones, cholescystitis and cholelithiasis, gout, obstructive sleep apnea and respiratory problems, osteoarthritis, and prevention and treatment of bone loss, e.g. osteoporosis.
The term "isolated polypeptide" refers to a polypeptide, in certain embodiments prepared from recombinant DNA or RNA, or of synthetic origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is isolated from the cell in which it normally occurs, (3) is isolated free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature.
As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies that specifically bind to the same epitope, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. The modifier
"monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
"Obese" individuals or individuals suffering from obesity are generally individuals having a body mass index (BMI) of at least 25 or greater. Obesity may or may not be associated with insulin resistance.
The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body
"Small molecule" as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5 kD and most preferably less than about 4 kD. Small molecules can be nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic (carbon-containing) or inorganic molecules. Many pharmaceutical companies have extensive libraries of chemical and/or biological mixtures, often fungal, bacterial, or algal extracts, which can be screened with any of the assays described herein.
"Stress" refers to any non-optimal condition for growth, development or
reproduction. A "stress condition" can be exposure to heatshock; osmotic stress; a DNA damaging agent; inadequate salt level; inadequate nitrogen levels; inadequate nutrient level; radiation or a toxic compound, e.g., a toxin or chemical warfare agent (such as dirty bombs and other weapons that may be used in bioterrorism). "Inadequate levels" refer to levels that result in non-optimal condition for growth, development or reproduction.
As used herein, "specific binding" refers to the ability of an antibody to bind to a predetermined antigen or the ability of a polypeptide to bind to its predetermined binding partner. Typically, an antibody or polypeptide specifically binds to its predetermined antigen or binding partner with an affinity corresponding to a KD of about 10" M or less, and binds to the predetermined antigen/binding partner with an affinity (as expressed by KD) that is at least 10 fold less, at least 100 fold less or at least 1000 fold less than its affinity for binding to a non-specific and unrelated antigen/binding partner (e.g., BSA, casein).
As used herein, the term "subject" means a human or non-human animal selected for treatment or therapy.
The phrases " therapeutically-effective amount" and "effective amount" as used herein means the amount of an agent which is effective for producing the desired therapeutic effect in at least a sub-population of cells in a subject at a reasonable
benefit/risk ratio applicable to any medical treatment.
"Treating" a disease in a subject or "treating" a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased or prevented from worsening.
Anti-HIF-l Antibodies
In certain embodiments, the present invention relates to antibodies and antigen binding fragments thereof that bind specifically to HIF-Ι and uses thereof. In some embodiments, the antibodies bind to a domain of HIF- la required for complex formation with c-Myc. In some embodiments, the HIF- la domain has an amino acid sequence selected from SEQ ID NOs 11-20. Accordingly, in certain embodiments the antibodies described herein are able to inhibit complex formation between HIF- la and c-Myc. Such antibodies can be polyclonal or monoclonal and can be, for example, murine, chimeric, humanized or fully human.
Polyclonal antibodies can be prepared by immunizing a suitable subject (e.g. a mouse) with a polypeptide immunogen (e.g., a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20). The polypeptide antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If desired, the antibody directed against the antigen can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG fraction.
At an appropriate time after immunization, e.g., when the antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies using standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256:495-497) (see also Brown et al. (1981) J.
Immunol. 127:539-46; Brown et al. (1980) J. Biol. Chem. 255:4980-83; Yeh et al. (1976) Proc. Natl. Acad. Sci. 76:2927-31; and Yeh et al. (1982) Int. J. Cancer 29:269-75), the more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol. Today 4:72), the EBV-hybridoma technique (Cole et al. (1985) Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The technology for producing monoclonal antibody hybridomas is well known (see generally Kenneth, R. H. in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, New York (1980); Lerner, E. A. (1981) Yale J. Biol. Med. 54:387-402; Gefter, M. L. et al. (1977) Somatic Cell Genet. 3:231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds to the polypeptide antigen, preferably specifically.
As an alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal specific for HIF-Ι and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20 can be identified and isolated by screening a recombinant combinatorial immunoglobulin library {e.g., an antibody phage display library or an antibody yeast display library) with the appropriate polypeptide {e.g. a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20) to thereby isolate
immunoglobulin library members that bind the polypeptide.
Additionally, recombinant antibodies specific for HIF-Ι and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20, such as chimeric or humanized monoclonal antibodies, can be made using standard recombinant DNA techniques. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in US Pat No. 4,816,567; US Pat. No. 5,565,332; Better et al. (1988) Science 240: 1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol.
139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. 84:214-218; Nishimura et al.
(1987) Cancer Res. 47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl. Cancer Inst. 80: 1553-1559); Morrison, S. L. (1985) Science 229: 1202- 1207; Oi et al. (1986) Biotechniques 4:214; Winter U.S. Patent 5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al. (1988) /. Immunol. 141:4053-4060.
Human monoclonal antibodies specific for HIF-Ι and/or a polypeptide having an amino acid sequence selected from SEQ ID NOs 11-20 can be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system. For example, "HuMAb mice" which contain a human immunoglobulin
gene miniloci that encodes unrearranged human heavy (μ and γ) and κ light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous μ and κ chain loci (Lonberg, N. et al. (1994) Nature 368(6474): 856 859). Accordingly, the mice exhibit reduced expression of mouse IgM or κ, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high affinity human IgGK monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49 101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65 93, and Harding, F. and Lonberg, N. (1995) Ann. N. Y Acad. Sci 764:536 546). The preparation of HuMAb mice is described in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287 6295; Chen, J. et al. (1993) International Immunology 5: 647 656; Tuaillon et al. (1993) Proc. Natl. Acad. Sci USA 90:3720 3724; Choi et al. (1993) Nature Genetics 4: 117 123; Chen, J. et al. (1993) EMBO J. 12: 821 830; Tuaillon et al. (1994) J. Immunol. 152:2912 2920; Lonberg et al, (1994) Nature 368(6474): 856 859; Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49 101; Taylor, L. et al. (1994) International Immunology 6: 579 591; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65 93; Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536 546; Fishwild, D. et al. (1996) Nature Biotechnology 14: 845 851. See further, U.S. Pat. Nos. 5,545,806;
5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; 5,770,429; and 5,545,807.
In certain embodiments, the antibodies of the instant invention are able to bind to an epitope of HIF-Ι in a domain required for complex formation with c-Myc {e.g., a domain having an amino acid sequence selected from SEQ ID NOs 11-20) with a dissociation constant of no greater than 10"6, 10"7, 10"8 or 10"9 M. Standard assays to evaluate the binding ability of the antibodies are known in the art, including for example, ELISAs,
Western blots and RIAs. The binding kinetics {e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis. In some embodiments, the binding of the antibody to HIF-Ι substantially inhibits the ability of c- Myc to form a complex with HIF-Ι . As used herein, an antibody substantially inhibits the ability of c-Myc to form a complex with HIF-Ι when an excess of antibody reduces the quantity of complex formed to by at least about 20%, 40%, 60% or 80%, 85% or 90% (as measured in an in vitro competitive binding assay).
Soluble HIF- la Polypeptides
In certain embodiments, the invention relates to isolated polypeptides comprising a HIF-Ι domain or fraction thereof required for c-Myc to form a complex with HIF- Ια (i.e., comprising a portion of an amino acid sequence selected from SEQ ID NO: 11-20). Such polypeptides can be useful, for example, for inhibiting the ability of c-Myc to form a complex with HIF- la and for identifying and/or generating antibodies that specifically bind to the c-Myc interaction domain of HIF- la. In some embodiments, the polypeptide comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 consecutive amino acids of an amino acid sequence selected from SEQ ID NO: 11-20. In some embodiments the polypeptide of the invention comprises less than 100, 90, 80, 70, 60, 50, 40, 30, 25 or 20 consecutive amino acids of the natural HIF- la protein (e.g., a protein having an amino acid sequence selected from SEQ ID NO: 1- 10). In some embodiments, the polypeptide of the invention comprises an amino acid sequence selected from SEQ ID NO: 11-20.
In some embodiments, the polypeptide of the instant invention is able to bind to c-
Myc. In some embodiments, the polypeptide binds to c-Myc with a dissociation constant of no greater than 10"5 M, 10"6 M, 10"7 M, 10"8 M or 10"9 M. Standard assays to evaluate the binding ability of the polypeptides are known in the art, including for example, ELISAs, Western blots and RIAs and suitable assays are described in the Examples. The binding kinetics (e.g., binding affinity) of the polypeptides also can be assessed by standard assays known in the art, such as by Biacore analysis. In some embodiments, the binding of the polypeptide to c-Myc substantially inhibits the ability of c-Myc to bind to HIF-la. As used herein, a polypeptide substantially inhibits adhesion of c-Myc to HIF-la when an excess of polypeptide reduces the quantity of c-Myc bound to HIF-la by at least about 20%, 40%, 60% or 80%, 85% or 90% (as measured in an in vitro competitive binding assay).
In some embodiments, the polypeptides of the present invention can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, polypeptides of the present invention are produced by recombinant DNA techniques. Alternatively, polypeptides of the present invention can be chemically synthesized using standard peptide synthesis techniques.
In some embodiments, polypeptides of the present invention comprise an amino acid sequence substantially identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof. Accordingly, in another embodiment, the polypeptides of the present
invention comprises an amino acid sequence at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof.
In certain embodiments, the polypeptides of the present invention comprise an amino acid identical to a sequence selected from SEQ ID NO: 11-20, or a fragment thereof except for 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) conservative sequence modifications. As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody by standard techniques known in the art, such as site- directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid
substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues of the polypeptides described herein can be replaced with other amino acid residues from the same side chain family and the altered antibody can be tested for retained function using the functional assays described herein.
To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences,
taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The invention also provides chimeric or fusion proteins. As used herein, a
"chimeric protein" or "fusion protein" comprises a polypeptide(s) of the present invention (e.g., those comprising a sequence selected from SEQ ID NO: 11-20, or a fragment thereof) linked to a distinct polypeptide to which it is not linked in nature. For example, the distinct polypeptide can be fused to the N-terminus or C-terminus of the polypeptide either directly, through a peptide bond, or indirectly through a chemical linker. In some embodiments, the peptide of the instant invention is linked to an immunoglobulin constant domain (e.g., an IgG constant domain, such as a human IgG constant domain).
A chimeric or fusion polypeptide of the present invention can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with
conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can
subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety.
The polypeptides described herein can be produced in prokaryotic or eukaryotic host cells by expression of polynucleotides encoding a polypeptide(s) of the present invention. Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous polypeptides in recombinant hosts, chemical synthesis of polypeptides, and in vitro translation are well known in the art and are described further in Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring
Harbor, N. Y.; Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to
Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif.; Merrifield,
J. (1969) J. Am. Chem. Soc. 91 :501 ; Chaiken I. M. (1981) CRC Crit. Rev. Biochem.
11 :255; Kaiser et al. (1989) Science 243: 187; Merrifield, B. (1986) Science 232:342; Kent, S. B. H. (1988) Annu. Rev. Biochem. 57:957; and Offord, R. E. (1980) Semisynthetic Proteins, Wiley Publishing, which are incorporated herein by reference.
Other Inhibitors of HIF- l / c-Myc Complex Formation
Certain embodiments of the present invention relate to methods of treating age- related and mitochondrial diseases, enhancing stress response, improving resistance to hypoxia and/or increasing life span. These methods include administering that reduces HIF-l ' a ability to inhibit c-Myc function. For example, in certain embodiments the agent inhibits complex formation between HIF- la and c-Myc. In some embodiments, the agents induce a conformational change in HIF-la or c-Myc that abrogates their interaction and/or alters the ability of HIF-la to affect c-Myc activity, protein levels or cell localization.
In some embodiments, any agent that reduces inhibition of c-Myc by HIF- la can be used to practice the methods of the invention. In some embodiments, the agent inhibits complex formation between HIF- la and c-Myc. Such agents can be those described herein or those identified through routine screening assays (e.g. the screening assays described herein).
In some embodiments, assays used to identify agents useful in the methods of the present invention include a reaction between a polypeptide comprising a sequence selected from SEQ ID NO: 11-20 or a fragment thereof and one or more assay components. The other components may be either a test compound (e.g. the potential agent), or a
combination of test compounds and a c-Myc protein or fragment thereof. Agents identified via such assays, may be useful, for example, for preventing or treating age-related and mitochondrial diseases, enhancing stress response and/or improving life span.
Agents useful in the methods of the present invention may be obtained from any available source, including systematic libraries of natural and/or synthetic compounds. Agents may also be obtained by any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckermann et al. , 1994, J. Med. Chem. 37:2678-85); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are
limited to peptide libraries, while the other four approaches are applicable to peptide, non- peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12: 145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med. Chem. 37: 1233.
Libraries of agents may be presented in solution (e.g., Houghten, 1992,
Biotechniques 13:412-421), or on beads (Lam, 1991, Nature 354:82-84), chips (Fodor, 1993, Nature 364:555-556), bacteria and/or spores, (Ladner, USP 5,223,409), plasmids (Cull et al, 1992, Proc Natl Acad Sci USA 89: 1865-1869) or on phage (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al, 1990, Proc. Natl. Acad. Sci. 87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301-310; Ladner, supra.).
Agents useful in the methods of the present invention may be identified, for example, using assays for screening candidate or test compounds which inhibit complex formation between c-Myc and HIF-l .
The basic principle of the assay systems used to identify compounds that inhibit complex formation between c-Myc and HIF-Ι involves preparing a reaction mixture containing a HIF-Ι protein or fragment thereof and a c-Myc protein or fragment thereof under conditions and for a time sufficient to allow the HIF-Ια protein or fragment thereof to form a complex with the c-Myc protein or fragment thereof. In order to test an agent for modulatory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound can be initially included in the reaction mixture, or can be added at a time subsequent to the addition of the HIF-Ια protein or fragment thereof and the c-Myc protein or fragment thereof. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of any complexes between the HIF-la protein or fragment thereof and the c-Myc protein or fragment thereof is then detected. The formation of a complex in the control reaction, but less or no such formation in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the HIF-la protein or fragment thereof and the c-Myc protein or fragment thereof.
The assay for compounds that modulate the interaction of the HIF-Ι protein or fragment thereof and the c-Myc protein or fragment thereof may be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the HIF- la protein or fragment thereof or the c-Myc protein or fragment thereof onto a solid phase and detecting complexes anchored to the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the HIF- la protein or fragment thereof and the c-Myc protein or fragment thereof (e.g., by competition) can be identified by conducting the reaction in the presence of the test substance, i.e., by adding the test substance to the reaction mixture prior to or
simultaneously with the HIF- la protein or fragment thereof and the c-Myc protein or fragment thereof. Alternatively, test compounds that disrupt preformed complexes, e.g., compounds with higher binding constants that displace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are briefly described below.
In a heterogeneous assay system, either the HIF- la protein or fragment thereof or the c-Myc protein or fragment thereof is anchored onto a solid surface or matrix, while the other corresponding non-anchored component may be labeled, either directly or indirectly. In practice, microtitre plates are often utilized for this approach. The anchored species can be immobilized by a number of methods, either non-covalent or covalent, that are typically well known to one who practices the art. Non-covalent attachment can often be
accomplished simply by coating the solid surface with a solution of the HIF- la protein or fragment thereof or the c-Myc protein or fragment thereof and drying. Alternatively, an immobilized antibody specific for the assay component to be anchored can be used for this purpose.
In related assays, a fusion protein can be provided which adds a domain that allows one or both of the assay components to be anchored to a matrix. For example, glutathione -
S-transferase/marker fusion proteins or glutathione-S-transferase/binding partner can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and either the non-adsorbed the HIF- la protein or fragment thereof or the c-
Myc protein or fragment thereof, and the mixture incubated under conditions conducive to
complex formation (e.g., physiological conditions). Following incubation, the beads or microtiter plate wells are washed to remove any unbound assay components, the immobilized complex assessed either directly or indirectly, for example, as described above.
A homogeneous assay may also be used to identify inhibitors of complex formation. This is typically a reaction, analogous to those mentioned above, which is conducted in a liquid phase in the presence or absence of the test compound. The formed complexes are then separated from unreacted components, and the amount of complex formed is determined. As mentioned for heterogeneous assay systems, the order of addition of reactants to the liquid phase can yield information about which test compounds modulate (inhibit or enhance) complex formation and which disrupt preformed complexes.
In such a homogeneous assay, the reaction products may be separated from unreacted assay components by any of a number of standard techniques, including but not limited to: differential centrifugation, chromatography, electrophoresis and
immunoprecipitation. In differential centrifugation, complexes of molecules may be separated from uncomplexed molecules through a series of centrifugal steps, due to the different sedimentation equilibria of complexes based on their different sizes and densities (see, for example, Rivas, G., and Minton, A.P., Trends Biochem Sci 1993 Aug;18(8):284- 7). Standard chromatographic techniques may also be utilized to separate complexed molecules from uncomplexed ones. For example, gel filtration chromatography separates molecules based on size, and through the utilization of an appropriate gel filtration resin in a column format, for example, the relatively larger complex may be separated from the relatively smaller uncomplexed components. Similarly, the relatively different charge properties of the complex as compared to the uncomplexed molecules may be exploited to differentially separate the complex from the remaining individual reactants, for example through the use of ion-exchange chromatography resins. Such resins and chromatographic techniques are well known to one skilled in the art (see, e.g., Heegaard, 1998, J Mol.
Recognit. 11: 141-148; Hage and Tweed, 1997, J. Chromatogr. B. Biomed. Sci. Appl., 699:499-525). Gel electrophoresis may also be employed to separate complexed molecules from unbound species (see, e.g., Ausubel et al (eds.), In: Current Protocols in Molecular
Biology, J. Wiley & Sons, New York. 1999). In this technique, protein or nucleic acid complexes are separated based on size or charge, for example. In order to maintain the binding interaction during the electrophoretic process, nondenaturing gels in the absence of
reducing agent are typically preferred, but conditions appropriate to the particular interactants will be well known to one skilled in the art. Immunoprecipitation is another common technique utilized for the isolation of a protein-protein complex from solution (see, e.g., Ausubel et al (eds.), In: Current Protocols in Molecular Biology, J. Wiley & Sons, New York. 1999). In this technique, all proteins binding to an antibody specific to one of the binding molecules are precipitated from solution by conjugating the antibody to a polymer bead that may be readily collected by centrifugation. The bound assay
components are released from the beads (through a specific proteolysis event or other technique well known in the art which will not disturb the protein-protein interaction in the complex), and a second immunoprecipitation step is performed, this time utilizing antibodies specific for the correspondingly different interacting assay component. In this manner, only formed complexes should remain attached to the beads. Variations in complex formation in both the presence and the absence of a test compound can be compared, thus offering information about the ability of the compound to modulate interactions between the HIF-Ι protein or fragment thereof and the c-Myc protein or fragment thereof.
Agents useful in the methods described herein may also be identified, for example, using methods wherein a cell {e.g., a cell that expresses c-Myc and HIF-Ι , such as a mammalian cell) is contacted with a test compound, and the expression level of a c-Myc target gene or a reporter gene under the transcriptional control of the promoter of a c-Myc target gene is determined (collectively referred to as c-Myc reporter genes). As used herein, the term "c-Myc target gene" refers to a gene whose expression increases in the presence of c-Myc. Examples of c-Myc target genes are well known in the art and include, for example, TFAM, ND1, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8. In some embodiments, the c-Myc reporter gene encodes a readily detectable protein {e.g., a fluorescent protein or a protein catalyzes a reaction that produces a change in color, luminescence and/or opacity). In some embodiments, the level of expression of the reporter gene in the presence of the test compound is compared to the level of expression of mRNA or protein in the absence of the candidate compound. If the expression of the mRNA or protein increases in the presence of the test compound, the test compound an agent useful in the methods described herein.
Pharmaceutical Compositions
In certain embodiments the instant invention relates to a composition, e.g., a pharmaceutical composition, containing at least one agent described herein together with a pharmaceutically acceptable carrier. In one embodiment, the composition includes a combination of multiple (e.g., two or more) agents of the invention.
As described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g. , those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation.
Methods of preparing these formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more agents described herein in combination with one or more
pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
Regardless of the route of administration selected, the agents of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical
compositions of the present invention, are formulated into pharmaceutically- acceptable dosage forms by conventional methods known to those of skill in the art.
Therapeutic Methods
Disclosed herein are novel methods of treating age-related and mitochondrial diseases, enhancing stress response, improving resistance to hypoxia and/or increasing life span. In certain embodiments the agents described herein are administered to a subject (e.g., a subject in need thereof). In some embodiments, the agents are used to enhance stress response, improve hypoxia resistance or increase the life span of a cell. In such embodiments, the agent is contacted to the cell either in vitro or in vivo.
In some embodiments, the present invention provides therapeutic methods of treating an age-related disease. Age-related diseases include, but are not limited to, Alzheimer's disease, amniotropic lateral sclerosis, arthritis, atherosclerosis, cachexia, cancer, cardiac hypertrophy, cardiac failure, cardiac hypertrophy, cardiovascular disease, cataracts, colitis, chronic obstructive pulmonary disease, dementia, diabetes mellitus, frailty, heart disease, hepatic steatosis, high blood cholesterol, high blood pressure,
Huntington's disease, hyperglycemia, hypertension, infertility, inflammatory bowel disease, insulin resistance disorder, lethargy, metabolic syndrome, muscular dystrophy, multiple sclerosis, neuropathy, , nephropathy, obesity, osteoporosis, Parkinson's disease, psoriasis, retinal degeneration, sarcopenia, sleep disorders, sepsis and/or stroke.
In some embodiments, the present invention provides therapeutic methods of treating a mitochondrial disease. Mitochondrial diseases include, but are not limited to, mitochondrial myopathy, diabetes mellitus and deafness (DAD), Leber's hereditary optic neuropathy (LHON), Leigh syndrome, neuropathy, ataxia, retinitis pigmentosa and petosis (NARP), myoclonic epilepsy with ragged red fibers (MERRF), myoneurogenic
gastrointestinal encephalopathy (MNGIE), mitochondrial myopathy, encephalomyopathy, lactic acidosis, stroke-like symptoms (MELAS), Kearns-Sayre syndrome (KSS), chromic progressive external opthalmoplegia (CPEO) and/or mtDNA depletion.
In certain embodiments, the methods described herein are useful for increasing the life span of a cell or organism. All animals typically go through a period of growth and maturation followed by a period of progressive and irreversible physiological decline ending in death. The length of time from birth to death is known as the life span of an organism, and each organism has a characteristic average life span. Aging is a physical
manifestation of the changes underlying the passage of time as measured by percent of average life span.
In some cases, characteristics of aging can be quite obvious. For example, characteristics of older humans include skin wrinkling, graying of the hair, baldness, and cataracts, as well as hypermelanosis, osteoporosis, altered adiposity, cerebral cortical atrophy, lymphoid depletion, memory loss, thymic atrophy, increased incidence of diabetes type II, atherosclerosis, cancer, muscle loss, bone loss, and heart disease. Nehlin et al. (2000), Annals NY Acad Sci 980: 176-79. Other aspects of mammalian aging include weight loss, lordokyphosis (hunchback spine), absence of vigor, lymphoid atrophy, decreased bone density, dermal thickening and subcutaneous adipose tissue, decreased ability to tolerate stress (including heat or cold, wounding, anesthesia, and hematopoietic precursor cell ablation), liver pathology, atrophy of intestinal villi, skin ulceration, amyloid deposits, and joint diseases. Tyner et al. (2002), Nature 415:45-53.
Careful observation reveals characteristics of aging in other eukaryotes, including invertebrates. For example, characteristics of aging in the model organism C. elegans include slow movement, flaccidity, yolk accumulation, intestinal autofluorescence
(lipofuscin), loss of ability to eat food or dispel waste, necrotic cavities in tissues, and germ cell appearance.
Those skilled in the art will recognize that the aging process is also manifested at the cellular level, as well as in mitochondria. Cellular aging is manifested in reduced mitochondrial function, loss of doubling capacity, increased levels of apoptosis, changes in differentiated phenotype, and changes in metabolism, e.g., decreased fatty acid oxidation, respiration, and protein synthesis and turnover.
Given the programmed nature of cellular and organismal aging, it is possible to evaluate the "biological age" of a cell or organism by means of phenotypic characteristics that are correlated with aging. For example, biological age can be deduced from patterns of gene expression, resistance to stress (e.g., oxidative or genotoxic stress), rate of cellular proliferation, and the metabolic characteristics of cells (e.g., rates of protein synthesis and turnover, mitochondrial function, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels within the cell, levels of a Krebs cycle intermediate in the cell, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.). As used herein, "biological age" is a measure of the age of a cell or organism based upon the molecular characteristics of the
cell or organism. Biological age is distinct from "temporal age," which refers to the age of a cell or organism as measured by days, months, and years.
The rate of aging of an organism, e.g., an invertebrate (e.g., a worm or a fly) or a vertebrate (e.g., a rodent, e.g., a mouse) can be determined by a variety of methods, e.g., by one or more of: a) assessing the life span of the cell or the organism; (b) assessing the presence or abundance of a gene transcript or gene product in the cell or organism that has a biological age-dependent expression pattern; (c) evaluating resistance of the cell or organism to stress, e.g., genotoxic stress (e.g., etopocide, UV irradition, exposure to a mutagen, and so forth) or oxidative stress; (d) evaluating one or more metabolic
parameters of the cell or organism; (e) evaluating the proliferative capacity of the cell or a set of cells present in the organism; and (f) evaluating physical appearance or behavior of the cell or organism. In one example, evaluating the rate of aging includes directly measuring the average life span of a group of animals (e.g., a group of genetically matched animals) and comparing the resulting average to the average life span of a control group of animals (e.g., a group of animals that did not receive the test compound but are genetically matched to the group of animals that did receive the test compound). Alternatively, the rate of aging of an organism can be determined by measuring an age-related parameter.
Examples of age-related parameters include: appearance, e.g., visible signs of age; the expression of one or more genes or proteins (e.g., genes or proteins that have an age- related expression pattern); resistance to oxidative stress; metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.); and cellular proliferation (e.g., of retinal cells, bone cells, white blood cells, etc.).
In certain embodiments, the methods described herein relate to increasing the life span of cells and/or protecting cells against at least certain stresses in vitro. For example, cells in culture can be treated as described herein, such as to keep them proliferating longer. This is particularly useful for primary cell cultures (i.e., cells obtained from an organism, e.g., a human), which are known to have only a limited life span in culture. Treating such cells according to methods of the invention ( e.g., by contacting the cells with an agent that inhibits complex formation between HIF- Ι and c-Myc or the ability of
HIF-Ι to inhibit c-Myc activity, levels or cell localization) will result in increasing the amount of time that the cells are kept alive in culture. Embryonic stem (ES) cells and pluripotent cells, and cells differentiated therefrom, can also be modified according to the
methods of the invention such as to keep the cells or progeny thereof in culture for longer periods of time. Primary cultures of cells, ES cells, pluripotent cells and progeny thereof can be used, e.g., to identify compounds having particular biological effects on the cells or for testing the toxicity of compounds on the cells (i.e., cytotoxicity assays).
In other embodiments, cells that are intended to be preserved for long periods of time are treated as described herein. The cells can be cells in suspension, e.g., blood cells, stem cells, iPS cells, germ cells, germ cell precursors, or tissues or organs. For example, blood collected from an individual for administering to an individual can be treated according to the invention, such as to preserve the blood cells or stem cells for longer periods of time. Other cells that one may treat for extending their lifespan and/or protect them against certain types of stresses include cells for consumption, e.g., cells from non- human mammals (such as meat), or plant cells (such as vegetables). Cells may also be treated prior to implantation or genetic or physical manipulation.
In another embodiment, cells obtained from a subject, e.g., a human or other mammal, are treated according to the methods of the invention and then administered to the same or a different subject. Accordingly, cells or tissues obtained from a donor for use as a graft can be treated as described herein prior to administering to the recipient of the graft. For example, bone marrow cells can be obtained from a subject, treated ex vivo to extend their life span and protect the cells against certain types of stresses and then administered to a recipient. The graft can be an organ, a tissue or loose cells.
In yet other embodiments, cells are treated in vivo to increase their life span and/or protect them against certain types of stresses. For example, skin can be protected from aging, e.g., developing wrinkles, by treating skin, e.g., epithelial cells, as described herein. In an exemplary embodiment, skin is contacted with a pharmaceutical or cosmetic composition comprising an agent described herein.
In addition to applying the methods of the invention in humans and non-human animals, the methods can also be applied to plants and plant cells. Accordingly, the invention also provides methods for extending the life span of plants and plant cells and for rendering the plant and plant cells more resistant to stress, e.g., excessive salt conditions. This can be achieved, e.g., by inhibiting complex formation of proteins in the plant cells that are essentially homologous to the proteins described herein in the animal systems (i.e., HIF-Ια and c-Myc) in order to increase the life span and/or the stress resistance of cells.
Agents, such as those described herein, that extend the life span of cells and protect them from stress can also be administered to subjects for treatment of diseases, e.g., chronic diseases, associated with cell death, such as to protect the cells from cell death, e.g., diseases associated with neural cell death or muscular cell death. In particular, the methods may be used to prevent or alleviate neurodegeneration and peripheral neuropathies associated with chemotherapy, such as cancer chemotherapy (e.g., taxol or cisplatin treatment). Neurodegenerative diseases include Parkinson' s disease, Alzheimer' s disease, multiple sclerosis, amniotropic lateral sclerosis (ALS), retinal degeneration, macular degeneration, Huntington's disease and muscular dystrophy. Thus, the agents may be used as neuroprotective agents. The agent may be administered in the tissue or organ likely to encounter cell death.
In certain embodiments, the methods described herein relate to improving the survival of a cell that has been exposed to hypoxia. In some embodiments, the method includes contacting the cell with an that reduces inhibition of c-Myc activity by HIF-l . In some embodiments, the cell has been exposed to a hypoxic environment. In certain embodiments the cell is a neuron, a cardiac myocyte, a skeletal myocyte, an iPS cell, blood cell, germ cell or germ cell precursor. In some embodiments, the cell is being cultured in vitro. In certain embodiments the cell is a part of a tissue or organ of a subject who is administered the agent (e.g., a subject suffering from ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease, cardiomyopathy, myocarditis,
macrovascular disease, peripheral vascular disease or stroke).
In certain embodiments, the present invention relates to a method of treating or preventing damage to a tissue or organ that has been exposed to hypoxia in a subject by administering an agent described herein to the subject. Tissues and organs are often exposed to hypoxic conditions during a stroke, a myocardial infarction or a peripheral vascular disease. Thus, in some embodiments the methods the subject that may be treated include patients suffering from a cardiac disease, e.g., ischemia, cardiovascular diseases, myocardial infarction, congestive heart disease. Cardiovascular diseases that can be treated or prevented include cardiomyopathy or myocarditis; such as idiopathic
cardiomyopathy, metabolic cardiomyopathy, alcoholic cardiomyopathy, drug-induced cardiomyopathy, ischemic cardiomyopathy, and hypertensive cardiomyopathy. Also treatable or preventable using methods described herein are atheromatous disorders of the major blood vessels (macrovascular disease) such as the aorta, the coronary arteries, the
carotid arteries, the cerebrovascular arteries, the renal arteries, the iliac arteries, the femoral arteries, and the popliteal arteries. Other vascular diseases that can be treated or prevented include those related to the retinal arterioles, the glomerular arterioles, the vasa nervorum, cardiac arterioles, and associated capillary beds of the eye, the kidney, the heart, and the central and peripheral nervous systems. The methods may also be used for increasing HDL levels in plasma of an individual.
The pharmaceutical compositions of the present invention may be delivered by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually. In certain embodiments the pharmaceutical compositions are delivered generally ( e.g., via oral or parenteral administration).
Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
The selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could prescribe and/or administer doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
Conserved amongst organisms as diverse as yeast and humans is a progressive decline in mitochondrial function with age, leading to a loss of cellular homeostasis and organismal health (Figueiredo et al., 2008; Figueiredo et al., 2009; Hartmann et al., 2011 ;
Lanza and Nair, 2010). Mitochondria are highly dynamic organelles that are continuously
eliminated and regenerated in a process known as mitochondrial biogenesis (Michel et al., 2012). Over the past 2 billion years, since eukaryotes subsumed the a-proteobacterial ancestor of mitochondria, most mitochondrial genes have been transferred to the nuclear genome, where regulation is better integrated. However, the mitochondrial genome still encodes rRNAs, tRNAs, and 13 subunits of the electron transport chain (ETC) (Falkenberg et al., 2007; Larsson, 2010). Functional communication between the nuclear and mitochondrial genomes is therefore essential for mitochondrial biogenesis and homeostasis, efficient oxidative phosphorylation, and normal health (Scarpulla, 2011b). The major known regulatory pathway of mitochondrial biogenesis involves the peroxisome
proliferator- activated receptor-γ coactivators alpha and beta (PGC-la and PGCl-Ιβ), which induce Nuclear Respiratory Factors 1 and 2 (NRF-1 and -2) (Evans and Scarpulla, 1990). NRF-1/-2 binds to and promotes transcription of nuclear genes encoding ETC components and the protein machinery needed to replicate, transcribe, and translate mitochondrial DNA (mtDNA). One of the key proteins that enable this coordination between the nucleus and mitochondria is TFAM (mitochondrial transcription factor A), a nuclear-encoded protein that promotes transcription of mitochondrial-encoded genes and the replication of mtDNA (Parisi and Clayton, 1991 ; Scarpulla, 2011a).
In mammals, there is a large body of evidence implicating mitochondrial decline in aging, age-related diseases, and many other diseases, disorders, or conditions. For example, mice with mutations that impair the proofreading capacity of the mitochondrial DNA polymerase gamma (Ροΐγ) exhibit a premature aging phenotype (Trifunovic et al., 2005; Trifunovic et al., 2004; Vermulst et al., 2008). Conversely, targeting peroxisomal catalase to mitochondria (mCAT) extends mouse lifespan (Schriner et al., 2005). Recently, telomere erosion in mice was found to disrupt mitochondrial function but the underlying mechanism has not yet been established (Sahin et al., 2011). Despite the apparent importance of mitochondrial decline in aging and disease, there is considerable debate about its underlying causes (Dutta et al., 2012; Moslehi et al., 2012; Peterson et al., 2012). The original idea of Harman (Harman, 1972), that reactive oxygen species (ROS) from mitochondria are a primary cause of disruption of mitochondrial homeostasis, has been challenged (Andziak and Buffenstein, 2006; Andziak et al., 2006; Howes, 2006) (Lapointe and Hekimi, 2010), leaving the primary causes of mitochondrial disturbances during the aging process unresolved.
Mammalian sirtuins (SIRT1-7) are a conserved family of NAD+-dependent lysine- modifying enzymes that modulate the physiological response to dietary changes and can protect against several age-related diseases (Haigis and Sinclair, 2010). The expression of SIRT1, an NAD+-dependent protein deacetylase, is elevated in a number of tissues following restriction of caloric intake (CR) by 30-40% (Cohen et al., 2004), one intervention generally accepted to extend lifespan. Overexpression or pharmacological activation of SIRT1 reproduces many of the health benefits of CR, including protection from metabolic decline (Banks et al., 2008; Baur et al., 2006; Bordone et al., 2007;
Lagouge et al., 2006; Minor et al., 2011; Pfluger et al., 2008), cardiovascular disease (Zhang et al., 2008), cancer (Herranz et al., 2010; Oberdoerffer et al., 2008) and neurodegeneration (de Oliveira et al., 2010; Donmez et al., 2010; Qin et al., 2006). Studies have linked the health benefits of CR to increased mitochondrial biogenesis (Cerqueira et al., 2011; Choi et al., 2011; Civitarese et al., 2007; Lopez-Lluch et al., 2006) and delayed mitochondrial decline (Niemann et al., 2010) mediated by the deacetylation and activation of PGC-Ια by SIRT1 (Baur et al., 2006; Gerhart-Hines et al., 2007; Lagouge et al., 2006; Minor et al., 2011; Rodgers et al., 2005).
While oxidative metabolism is critical for the health of metazoans, in the case of cancer the opposite is true. Cancer cells typically undergo a shift away from oxidative phosphorylation towards anaerobic glycolysis, allowing them to generate substrates for biomass, even in the presence of oxygen. This metabolic reprogramming, known as the Warburg effect (Warburg, 1956), is driven by several different pathways including the mTOR pathway, the oncogene c-Myc, and hypoxia- inducible factor 1 (HIF-Ια), to induce a survival response in low oxygen conditions (Cadenas et al., 2010). Interestingly, both SIRT1 and SIRT3 regulate HIF-Ια. SIRT1 regulates HIF-Ια transcriptional activity under hypoxic conditions (Lim et al., 2010) while SIRT3 regulates HIF-Ια protein stability (Bell et al., 2011; Finley et al., 2011). In C. elegans, the Hif-1 gene regulates lifespan and may also mediate the effects of CR (Chen et al., 2009; Leiser and Kaeberlein, 2010), however, a role for HIF-Ια in mammalian aging has not been explored.
The present disclosure provides evidence that a cause of the disruption in mitochondrial homeostasis during aging is a pseudohypoxic response that disrupts the coordination between the nuclear and mitochondrial genomes, eliciting a specific decline in mitochondrial-encoded genes. The cause was traced to a decline in nuclear NAD+ and
SIRT1 activity with age, which triggers the accumulation of HIF-Ια that suppresses the
ability of c-Myc to regulate TFAM, independently of the canonical PGC-l pathway. The result is an imbalance between nuclear- and mitochondrial-encoded ETC components and loss of oxidative phosphorylation (OXPHOS) capacity, leading to mitochondrial dysfunction and thus loss of cell health (which in turn results in e.g., aging, age-related diseases, and other diseases or disorders described herein).
Accordingly, provided herein are methods and compositions for treating or preventing diseases or disorders associated with mitochondrial dysfunction (e.g., resulting from the deregulation of mitochondrial homeostasis). In some embodiments,
"mitochondrial dysfunction" or "deregulation of mitochondrial homeostasis" means that one or more mitochondrial component (e.g., ETC component) is depleted, for example by a decrease in mitochondrial gene expression or mitochondrial DNA content, resulting in compromised mitochondrial function (e.g., loss of or decreased oxidative phosphorylation (OXPHOS) capacity). Examples of diseases, disorders, or conditions associated with mitochondrial dysfunction include, but are not limited to, aging, aging-related diseases, mitochondrial diseases (e.g., Alper's disease, Barth syndrome, beta- oxidation defects, carnitine-acyl-carnitine deficiency, carnitine deficiency, creatine deficiency syndromes, coenzyme Q10 deficiency, complex I deficiency, complex II deficiency, complex III deficiency, complex IV deficiency/COX deficiency, complex V deficiency, chronic progressive external ophthalmoplegia syndrome, CPT I deficiency, CPT II deficiency, Kearns-Sayre syndrome, lactic acidosis, long-chain acyl-CoA dehydrongenase deficiency, Leigh disease, Luft disease, glutaric aciduria type II, mitochondrial cytopathy,
mitochondrial DNA depletion, mitochondrial encephalopathy, mitochondrial myopathy, and Pearson syndrome), metabolic diseases and disorders (e.g., amino acid deficiency), diseases resulting from mitochondrial and energy deficiency, lethargy, heart disorders, cardiovascular disease, stroke, infarction, pulmonary hypertension, ischemia, cachexia, sarcopenia, neurodegenerative diseases (e.g., Alzherimer's disease, Parkinson's disease, Huntington's disease), dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male infertility, obesity, diabetes (e.g., diabetes type I), muscle disorders, and muscle wasting. In some aspects, methods and compositions provided herein are useful for promoting cell viability (in various species), vascular remodeling, wound healing and healing in general (e.g., treating wounds resulting from cuts, scrapes, surgery, bodily insults, trauma, burns, abrasions, sunburns, etc.). In some aspects, the methods and compositions are useful for promoting iron homeostasis and/or erythropoiesis. In some
aspects, methods and compositions provided herein are useful to promote successful organ and tissue transplantation, or to promote recovery from organ and tissue transplantation. In some aspects, provided methods and compositions are useful for preserving cells and organs. In some aspects, methods and compositions provided herein have cosmetic applications, for example for treating conditions associated with mitochondrial dysfunction which relate to the skin or scalp/hair, such as skin aging (e.g., loss in volume and elasticity, discoloration, liver spots (lentigo senislis)), wrinkles, baldness, and loss of hair
pigmentation. In some embodiments, agents or compositions described herein are useful for products or methods relating to cosmetics, energy drinks, and/or animal industries.
In some embodiments, the methods include administering to the subject an effective amount of an agent that inhibits HIF-l . HIF-l inhibitors can inhibit activity of the protein including its binding to hypoxia-responsive elements, promote degradation of HIF- la, reduce HIF-l protein stability, or inhibit HIF-la protein synthesis. Small molecule HIF-la inhibitors include: chrysin (5,7-dihydroxyflavone); methyl 3-(2-(4-(adamantan-l- yl)phenoxy)acetamido)-4-hydroxybenzoate (LW6; see Biochem Pharmacol. 2010 Oct
1;80(7):982-9); P3155 (see BMC Cancer 2011, 11:338); NSC 644221 (see Clin Cancer Res. 2007 Feb l;13(3): 1010-8); S-2-amino-3-[4'-N,N,-bis(chloroethyl)amino]phenyl propionic acid N-oxide dihydrochloride (PX-478, see Mol Cancer Ther. 2008 Jan;7(l):90-100);
dimethyl-bisphenol A; vincristine; apigenin (see Mol Carcinog. 2008 Sep;47(9):686-700); 2-methoxyestradiol; chetomin; and echinomycin. HIF-la inhibitors also can include siRNA molecules (see BMC Cancer 2010, 10:605; US 13/555,589) or antisense
oligonucleotides (e.g., EZN-2968 - see Mol Cancer Ther. 2008 Nov;7(l l):3598-608). The subject is typically a subject having, or suspected of having a disease, disorder, or condition associated with mitochondrial dysfunction (e.g., as described herein).
In some embodiments, the methods further comprise administering to the subject an effective amount of an agent that increases the levels of nicotinamide adenine dinucleotide (NAD+; which may also be referred to herein as NAD) in the subject. Examples of such agents include NAD+ precursor, such as nicotinic acid, nicotinamide, nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), or a salt thereof or prodrug thereof. In some embodiments, such an agent is administered at a dose of between 0.5 - 5 grams per day. In some embodiments, NMN is orally administered in doses of between 250 mg - 5 grams per day. NAD+ levels also can be increased by increasing the activity of enzymes
(or enzymatically active fragments thereof) involved in NAD+ biosynthesis (de novo
synthesis or salvage pathways). Enzymes involved in NAD+ biosynthesis such as nicotinate phosphoribosyl transferase 1 (NPT1), pyrazinamidase/nicotinamidase 1 (PNC1), nicotinic acid mononucleotide adenylyltransf erase 1 (NMA1), nicotinic acid mononucleotide adenylyltransferase 2 (NMA2), nicotinamide N-methyltransferase (NNMT), nicotinamide phosphoribosyl transferase (NAMPT or NAMPRT), nicotinate/nicotinamide
mononucleotide adenylyl transferase 1 (NMNAT-1), and nicotinamide mononucleotide adenylyl transferase 2 (NMNAT-2); are described in US 7,977,049, which is incorporated by reference herein. The HIF-Ι inhibitor and agent that increases the levels of NAD+ can be administered simultaneously (e.g., as a single formulation) or sequentially (e.g., as separate formulations).
In some embodiments, the methods include administering to a subject an effective amount of an agent that increases the levels of NAD+, without administering an inhibitor of HIF-l .
Aspects of the invention thus relate to compositions of matter including NAD+ precursors, such as NMN or a salt thereof or prodrug thereof. Further aspects of the invention relate to compositions of matter including an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some embodiments, compositions include conjugates of agents described herein, such as fish oil conjugates.
As used herein, the term "prodrug" means a derivative of a compound that can hydrolyze, oxidize, or otherwise react under biological conditions (in vitro or in vivo) to provide a compound described herein as useful in the methods of the invention. While prodrugs typically are designed to provide active compound upon reaction under biological conditions, prodrugs may have similar activity as a prodrug.
The references by Goodman and Gilman (The Pharmacological Basis of
Therapeutics, 8th Ed, McGraw-Hill, Int. Ed. 1992, "Biotransformation of Drugs", p 13-15); T. Higuchi and V. Stella (Pro-drugs as Novel Delivery Systems, Vol. 14 of the A.C.S. Symposium Series); and Bioreversible Carriers in Drug Design (E.B. Roche, ed., American Pharmaceutical Association and Pergamon Press, 1987) describing pro-drugs generally are hereby incorporated by reference. Prodrugs of the compounds described herein can be prepared by modifying functional groups present in said component in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent
component. Typical examples of prodrugs are described for instance in WO 99/33795, WO 99/33815, WO 99/33793 and WO 99/33792, each of which is incorporated herein by reference for these teachings. Prodrugs can be characterized by increased bio-availability and are readily metabolized into the active inhibitors in vivo.
Examples of prodrugs include, but are not limited to, analogs or derivatives of the compounds described herein, further comprising biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates,
biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogues. Other examples of prodrugs include derivatives of the compounds described herein that comprise -NO, -N02, -ONO, or -ON02 moieties. Prodrugs are prepared using methods known to those of skill in the art, such as those described by BURGER'S
MEDICINAL CHEMISTRY AND DRUG DISCOVERY (1995) 172-178, 949-982
(Manfred E. Wolff ed., 5th ed), the entire teachings of which are incorporated herein by reference.
As used herein, the terms "biohydrolyzable amide," "biohydrolyzable ester,"
"biohydrolyzable carbamate," "biohydrolyzable carbonate," "biohydrolyzable ureide" and "biohydrolyzable phosphate analogue" mean an amide, ester, carbamate, carbonate, ureide, or phosphate analogue, respectively, that either: 1) does not destroy the biological activity of the compound and confers upon that compound advantageous properties in vivo, such as uptake, duration of action, or onset of action; or 2) is itself biologically inactive but is converted in vivo to a biologically active compound. Examples of biohydrolyzable amides include, but are not limited to, lower alkyl amides, a-amino acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides. Examples of biohydrolyzable esters include, but are not limited to, lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl esters, and choline esters. Examples of biohydrolyzable carbamates include, but are not limited to, lower alkylamines, substituted ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and heteroaromatic amines, and polyether amines.
Prodrugs can include fatty acids or lipids linked to the compounds described herein by the moieties described herein. Exemplary fatty acids include the omega-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Such prodrugs and the preparation thereof will be clear to the skilled person; reference is for instance made to the prodrug types and preparations described in US 5,994,392, US 4,933,324 and US
5,284,876.
As used herein, the term "salt" or "pharmaceutically acceptable salt" refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66: 1-19. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of
pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1^alkyl)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
As used herein, the term "solvate" includes any combination which may be formed by a compound of this invention with a suitable inorganic solvent (e.g. hydrates) or organic solvent, such as but not limited to alcohols, ketones, esters and the like. Such salts, hydrates, solvates, etc. and the preparation thereof will be clear to the skilled person;
reference is for instance made to the salts, hydrates, solvates, etc. described in US
6,372,778, US 6,369,086, US 6,369,087 and US 6,372,733.
Thus, the invention includes methods for delivering agents to a subject. As used herein, the term "subject" refers to a human or non-human mammal. Non-human mammals include livestock animals, companion animals, laboratory animals, and non-human primates. Non-human subjects also specifically include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits. In some embodiments the subject is a patient. As used herein, a "patient" refers to a subject who is under the care of a physician, dentist, or other health care worker, including someone who has consulted with, received advice from or received a prescription or other
recommendation from a physician or other health care worker. A patient is typically a subject having or at risk of having a disorder associated with mitochondrial dysfunction.
Pharmaceutical compositions
In some embodiments, pharmaceutical compositions comprising one or more HIF- l inhibitors and/or one or more agents that increase the level of NAD+ in a subject are provided. In some aspects, the HIF-Ι inhibitors and additional agents are collectively referred to as the "agents" or "active ingredient" s of the pharmaceutical compositions provided herein. The compositions comprising the agents can be mixed with a
pharmaceutically acceptable carrier, either taken alone or in combination with the one or more additional therapeutic agents described above, to form pharmaceutical compositions. A pharmaceutically acceptable carrier is compatible with the active ingredient(s) of the composition (and preferably, capable of stabilizing it). Such compositions are delivered or administered in effective amounts to treat an individual, such as a human having a disease or disorder resulting from a nonsense mutation, for example those described herein. To "treat" a disease, means to reduce or eliminate a sign or symptom of the disease, to stabilize the disease, and/or to reduce or slow further progression of the disease. In some embodiments, "treat", "treatment" or "treating" is intended to include prophylaxis, amelioration, prevention or cure from the disease.
Actual dosage levels of active ingredients in the pharmaceutical compositions of the invention can be varied to obtain an amount of the active HIF-Ι inhibitor(s) and/or other agent(s) that is effective to achieve the desired therapeutic response for a particular patient, combination, and mode of administration. The selected dosage level depends upon the activity of the particular HIF-Ια inhibitors and other agent(s), the route of administration, the severity of the condition being treated, the condition, and prior medical history of the
patient being treated. However, it is within the skill of one in the art to start doses of the compositions described herein at levels lower than required to achieve the desired therapeutic effort and to gradually increase the dosage until the desired effect is achieved. A "therapeutically effective amount," as used herein, refers to an amount of a compound and/or an additional therapeutic agent, or a composition thereof that results in improvement (complete or partial) of a disease or disorder caused by mitochondrial dysfunction (e.g., mitochondrial homeostasis deregulation). A therapeutically effective amount also refers to an amount that prevents or delays the onset of a disease or disorder caused by
mitochondrial dysfunction. The therapeutically effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration, and like factors are within the knowledge and expertise of the health practitioner. For example, an effective amount can depend upon the duration the subject has had the disease. In some aspects, an effective amount of a composition described herein when administered to a subject results in e.g., increased muscle strength, increased motility, restoration of muscle function or phenotype, decreased fatigue, decreased difficulty with motor skills, decreased dementia, etc. In some aspects, the desired therapeutic or clinical effect resulting from administration of an effective amount of a composition described herein, may be measured or monitored by methods known to those of ordinary skill in the art e.g., by routine physical examination.
In the combination therapies, an effective amount can refer to each individual agent or to the combination as a whole, wherein the amounts of all agents administered are together effective, but wherein the component agent of the combination may not be present individually in an effective amount.
The pharmaceutical compositions described herein (e.g., those containing HIF-l inhibitors and/or agents that increase NAD+ levels), can be administered to a subject by any suitable route. For example, compositions can be administered orally, including sublingually, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically and transdermally (as by powders, ointments, or drops), bucally, or nasally. The term "parenteral" administration as used herein refers to modes of administration other than through the gastrointestinal tract, which include intravenous, intramuscular, intraperitoneal, intrasternal, intramammary, intraocular, retrobulbar, intrapulmonary, intrathecal, subcutaneous and intraarticular injection and infusion. Surgical implantation also is
contemplated, including, for example, embedding a composition of the disclosure in the body such as, for example, in the brain, in the abdominal cavity, under the splenic capsule, brain, or in the cornea.
The pharmaceutical compositions described herein can also be administered in the form of liposomes. As is known in the art, liposomes generally are derived from
phospholipids or other lipid substances. Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any nontoxic, physiologically acceptable, and metabolizable lipid capable of forming liposomes can be used. The present compositions in liposome form can contain, in addition to an agent of the present disclosure, stabilizers, preservatives, excipients, and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art. See, for example, Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N.Y. (1976), p. 33, et seq.
Dosage forms for topical administration of the pharmaceutical compositions described herein include powders, sprays, ointments, and inhalants as described herein. The active agent(s) is mixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives, buffers, or propellants which may be required.
Ophthalmic formulations, eye ointments, powders, and solutions also are contemplated as being within the scope of this disclosure.
Pharmaceutical compositions (e.g., those containing HIF-Ι inhibitors and/or agents that increase NAD+ levels) for parenteral injection comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water ethanol, polyols (such as, glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such, as olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
Compositions also can contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It also may be desirable to include
isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of the pharmaceutical compositions described herein (e.g., those containing HIF-Ι inhibitors and/or agents that increase NAD+ levels), it is desirable to slow the absorption of the drug from subcutaneous or
intramuscular injection. This result can be accomplished by the use of a liquid suspension of crystalline or amorphous materials with poor water solubility. The rate of absorption of the active agent(s) then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered active agent(s) is accomplished by dissolving or suspending the agent(s) in an oil vehicle.
Injectable depot forms are made by forming microencapsule matrices of the agent(s) in biodegradable polymers such a polylactide-polyglycolide. Depending upon the ratio of agent(s) to polymer and the nature of the particular polymer employed, the rate of agent(s) release can be controlled. Examples of other biodegradable polymers include
poly(orthoesters) and poly(anhydrides). Depot injectable formulations also are prepared by entrapping the agent(s) in liposomes or microemulsions which are compatible with body tissue.
The injectable formulations can be sterilized, for example, by filtration through a bacterial- or viral-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
Also described here are methods for oral administration of the pharmaceutical compositions described herein. Oral solid dosage forms are described generally in
Remington's Pharmaceutical Sciences, 18th Ed., 1990 (Mack Publishing Co. Easton Pa. 18042) at Chapter 89. Solid dosage forms for oral administration include capsules, tablets, pills, powders, troches or lozenges, cachets, pellets, and granules. Also, liposomal or proteinoid encapsulation can be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Pat. No. 4,925,673). Liposomal encapsulation may include liposomes that are derivatized with various polymers (e.g., U.S.
Pat. No. 5,013,556). In general, the formulation includes the agent(s) and inert ingredients which protect against degradation in the stomach and which permit release of the
biologically active material in the intestine. In some embodiments, agents that increase levels of NAD+, for example NMN, can be orally administered in dosages from 250 mg to 5 grams per day.
In such solid dosage forms, the agent(s) is mixed with, or chemically modified to include, a least one inert, pharmaceutically acceptable excipient or carrier. The excipient or carrier preferably permits (a) inhibition of proteolysis and/or nucleic acid degradation, and (b) uptake into the blood stream from the stomach or intestine. In a most preferred embodiment, the excipient or carrier increases uptake of the agent(s), overall stability of the agent(s)and/or circulation time of the agent(s) in the body. Excipients and carriers include, for example, sodium citrate or dicalcium phosphate and/or (a) fillers or extenders such as starches, lactose, sucrose, glucose, cellulose, modified dextrans, mannitol, and silicic acid, as well as inorganic salts such as calcium triphosphate, magnesium carbonate and sodium chloride, and commercially available diluents such as FAST-FLO®, EMDEX®, STA-RX 1500®, EMCOMPRESS® and AVICEL®, (b) binders such as, for example,
methylcellulose ethylcellulose, hydroxypropyhnethyl cellulose, carboxymethylcellulose, gums (e.g., alginates, acacia), gelatin, polyvinylpyrrolidone, and sucrose, (c) humectants, such as glycerol, (d) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium carbonate, starch including the commercial disintegrant based on starch, EXPLOTAB®, sodium starch glycolate,
AMBERLITE®, sodium carboxymethylcellulose, ultramylopectin, gelatin, orange peel, carboxymethyl cellulose, natural sponge, bentonite, insoluble cationic exchange resins, and powdered gums such as agar, karaya or tragacanth; (e) solution retarding agents such a paraffm, (f) absorption accelerators, such as quaternary ammonium compounds and fatty acids including oleic acid, linoleic acid, and linolenic acid (g) wetting agents, such as, for example, cetyl alcohol and glycerol monosterate, anionic detergent surfactants including sodium lauryl sulfate, dioctyl sodium sulfosuccinate, and dioctyl sodium sulfonate, cationic detergents, such as benzalkonium chloride or benzethonium chloride, nonionic detergents including lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65, and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose; (h) absorbents, such as kaolin and bentonite clay, (i) lubricants, such as talc, calcium sterate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils, waxes, CARBOWAX® 4000, CARBOWAX® 6000, magnesium lauryl
sulfate, and mixtures thereof; (j) glidants that improve the flow properties of the drug during formulation and aid rearrangement during compression that include starch, talc, pyrogenic silica, and hydrated silicoaluminate. In the case of capsules, tablets, and pills, the dosage form also can comprise buffering agents.
Solid compositions of a similar type also can be employed as fillers in soft and hard- filled gelatin capsules, using such excipients as lactose or milk sugar, as well as high molecular weight polyethylene glycols and the like.
The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They optionally can contain opacifying agents and also can be of a composition that they release the active ingredients(s) only, or preferentially, in a part of the intestinal tract, optionally, in a delayed manner. Exemplary materials include polymers having pH sensitive solubility, such as the materials available as EUDRAGIT® Examples of embedding compositions which can be used include polymeric substances and waxes.
The agent(s) also can be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active
ingredient(s), the liquid dosage forms can contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol ethyl carbonate ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol,
tetrahydroflirfuryl alcohol, polyethylene glycols, fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions also can include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, coloring, flavoring, and perfuming agents. Oral compositions can be formulated and further contain an edible product, such as a beverage. Oral composition can also be administered by oral gavage.
Suspensions, in addition to the active ingredient(s), can contain suspending agents such as, for example ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan
esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and mixtures thereof.
Also contemplated herein is pulmonary delivery of the HIF-Ι inhibitors and/or agents that increase NAD+ levels. The agents are delivered to the lungs of a mammal while inhaling, thereby promoting the traversal of the lung epithelial lining to the blood stream. See, Adjei et al., Pharmaceutical Research 7:565-569 (1990); Adjei et al., International Journal of Pharmaceutics 63: 135-144 (1990) (leuprolide acetate); Braquet et al., Journal of Cardiovascular Pharmacology 13 (suppl.5): s.143-146 (1989)(endothelin-l); Hubbard et al., Annals of Internal Medicine 3:206-212 (1989)(al-antitrypsin); Smith et al., J. Clin. Invest. 84: 1145-1146 (1989) (a 1 -proteinase); Oswein et al., "Aerosolization of Proteins,"
Proceedings of Symposium on Respiratory Drug Delivery II, Keystone, Colorado, March, 1990 (recombinant human growth hormone); Debs et al., The Journal of Immunology 140:3482-3488 (1988) (interferon-γ and tumor necrosis factor a) and Platz et al., U.S. Pat. No. 5,284,656 (granulocyte colony stimulating factor).
Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
Some specific examples of commercially available devices suitable for the practice of the invention are the ULTRA VENT® nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, MO; the ACORN II® nebulizer, manufactured by Marquest Medical Products, Englewood, CO.; the VENTOL® metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, N.C.; and the SPINHALER® powder inhaler, manufactured by Fisons Corp., Bedford, MA.
All such devices require the use of formulations suitable for the dispensing of the agent(s) described herein. Typically, each formulation is specific to the type of device employed and can involve the use of an appropriate propellant material, in addition to diluents, adjuvants, and/or carriers useful in therapy.
The composition is prepared in particulate form, preferably with an average particle size of less than 10 μιη, and most preferably 0.5 to 5 μιη, for most effective delivery to the distal lung.
Carriers include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations may include lipids, such as DPPC,
DOPE, DSPC and DOPC, natural or synthetic surfactants, polyethylene glycol (even apart from its use in derivatizing the inhibitor itself), dextrans, such as cyclodextran, bile salts, and other related enhancers, cellulose and cellulose derivatives, and amino acids.
Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
Formulations suitable for use with a nebulizer, either jet or ultrasonic, typically comprise an agent of the invention dissolved in water at a concentration of about 0.1 to 25 mg of biologically active protein per mL of solution. The formulation also can include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure). The nebulizer formulation also can contain a surfactant to reduce or prevent surface- induced aggregation of the inhibitor composition caused by atomization of the solution in forming the aerosol.
Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the agent suspended in a propellant with the aid of a surfactant. The propellant can be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid also can be useful as a surfactant.
Formulations for dispensing from a powder inhaler device comprise a finely divided dry powder containing the agent(s) and also can include a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol, in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
Nasal delivery of the agent(s) and compositions of the invention also are
contemplated. Nasal delivery allows the passage of the agent(s) or composition to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung. Formulations for nasal delivery include those with dextran or cyclodextran. Delivery via transport across other mucous membranes also is contemplated.
Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the agent(s) with suitable nonirritating excipients or carriers, such as cocoa butter, polyethylene glycol, or suppository wax, which are solid at room
temperature, but liquid at body temperature, and therefore melt in the rectum or vaginal cavity and release the active agent.
In order to facilitate delivery of agent(s) across cell and/or nuclear membranes, compositions of relatively high hydrophobicity are preferred. Agent(s) can be modified in a manner which increases hydrophobicity, or the agents can be encapsulated in hydrophobic carriers or solutions which result in increased hydrophobicity.
In one aspect, the invention provides kits comprising a pharmaceutical composition comprising a therapeutically effective amount of one or more HIF-Ι inhibitors and/or a therapeutically effective amount of one or more agents that increase NAD+ levels and instructions for administration of the pharmaceutical composition. In some aspects of the invention, the kit can include a pharmaceutical preparation vial, a pharmaceutical preparation diluent vial, and the HIF-Ια inhibitors(s) and additional agent(s). The diluent vial contains a diluent such as physiological saline for diluting what could be a concentrated solution or lyophilized powder of the agent of the invention. In some embodiments, the instructions include instructions for mixing a particular amount of the diluent with a particular amount of the concentrated pharmaceutical preparation, whereby a final formulation for injection or infusion is prepared. In some embodiments, the instructions include instructions for use in a syringe or other administration device. In some
embodiments, the instructions include instructions for treating a patient with an effective amount of the HIF-Ια inhibitors(s) and optional additional agent(s). It also will be understood that the containers containing the preparations, whether the container is a bottle, a vial with a septum, an ampoule with a septum, an infusion bag, and the like, can contain indicia such as conventional markings which change color when the preparation has been autoclaved or otherwise sterilized.
In another embodiment, methods for screening for inhibitors of HIF-Ια are provided. As described herein, increased HIF-Ια activity or levels is causative of mitochondrial dysfunction. Such dysfunction can be measured according to standard methods, for example any of those described in the Examples section. In one example, a readout of mitochondrial dysfunction (e.g., resulting from increased levels or activity of HIF-Ια) is a decrease in mitochondrial gene expression. Thus, in some aspects a screening method for identifying a HIF-Ια inhibitors comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the level of expression of one or more mitochondrial genes; (c) comparing the level of expression determined in (b) to a reference level of
expression, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF-Ι inhibitor if a significantly decreased level of mitochondrial gene expression is determined in (b), as compared to the reference level in (c). In some aspects, the reference level is a predetermined level, for example the wild type level, or the level in a mutant cell. In some aspects, the one or more mitochondrial genes is selected from any of the 13 genes encoding protein in the mitochondrial genome, for example cytochrome b, cytochrome oxidase, NADH
dehydrogenase, or ATP synthase. In some aspects, the eukaryotic cell is any of the cells described in the Examples section, including those genetically modified. For example, the cell may comprise a knockout of SIRTl, which as described herein has an accumulation of HIFl-a, and thus mitochondrial dysfunction. Thus, in this example, the method would comprise contacting the cell with a candidate compound and identifying the compound as a HIF-Ι inhibitor if the candidate compound increases mitochondrial gene expression, or otherwise improves or restores mitochondrial function or homeostasis.
In some embodiments, the readout of mitochondrial dysfunction (e.g., resulting from increased levels or activity of HIF-Ι ) is a loss or depletion of mitochondrial DNA content. Thus, in some aspects, the method comprises (a) contacting a eukaryotic cell with a candidate compound; (b) determining the amount of mitochondrial DNA in the cell; (c) comparing the amount determined in (b) to a reference amount, wherein the reference level is determined in the absence of the candidate compound; and (d) identifying the compound as a HIF-Ι inhibitor if a significantly decreased amount of mitochondrial DNA is determined in (b), as compared to the reference level in (c). In some aspects, the reference level is a predetermined level, for example the wild type level, or the level in a mutant cell. In some aspects, the eukaryotic cell is any of the cells described in the Examples section, including those genetically modified. For example, the cell may comprise a knockout of SIRTl, which as described herein has an accumulation of HIFl-a, and thus mitochondrial dysfunction (and depletion or loss of mitochondrial DNA). Thus, in this example, the method would comprise contacting the cell with a candidate compound and identifying the compound as a HIF-Ι inhibitor if the candidate compound increases the amount of mitochondrial DNA in the cell.
This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of
being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of "including," "comprising," or "having," "containing," "involving," and variations thereof herein, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
Provided herein are methods for treating or preventing disorders associated with inflammation in a subject in need thereof. The methods include administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject. Examples of such agents include NAD+ precursors, such as NMN or a salt thereof or prodrug thereof. In some embodiments, such an agent is administered at a dose of between 0.5 - 5 grams per day. Other examples of agents include an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some embodiments the subject is a human or non-human mammal.
Agents that increase levels of nicotinamide adenine dinucleotide (NAD+; which may also be referred to herein as NAD) include NAD+ precursors, such as nicotinic acid, nicotinamide, nicotinamide mononucleotide (NMN) and nicotinamide riboside (NR).
NAD+ levels also can be increased by increasing the activity of enzymes involved in NAD+ biosynthesis (de novo synthesis or salvage pathways). Enzymes involved in NAD+ biosynthesis such as nicotinate phosphoribosyl transferase 1 (NPT1),
pyrazinamidase/nicotinamidase 1 (PNC1), nicotinic acid mononucleotide
adenylyltransferase 1 (NMA1), nicotinic acid mononucleotide adenylyltransferase 2 (NMA2), nicotinamide N-methyltransferase (NNMT), nicotinamide phosphoribosyl transferase (NAMPT or NAMPRT), nicotinate/nicotinamide mononucleotide adenylyl transferase 1 (NMNAT-1), and nicotinamide mononucleotide adenylyl transferase 2 (NMNAT-2); are described in US 7,977,049, which is incorporated by reference herein.
As used herein, the term "prodrug" means a derivative of a compound that can hydrolyze, oxidize, or otherwise react under biological conditions (in vitro or in vivo) to provide a compound described herein as useful in the methods of the invention. While prodrugs typically are designed to provide active compound upon reaction under biological conditions, prodrugs may have similar activity as a prodrug.
The references by Goodman and Gilman (The Pharmacological Basis of
Therapeutics, 8th Ed, McGraw-Hill, Int. Ed. 1992, "Biotransformation of Drugs", p 13-15); T. Higuchi and V. Stella (Pro-drugs as Novel Delivery Systems, Vol. 14 of the A.C.S. Symposium Series); and Bioreversible Carriers in Drug Design (E.B. Roche, ed., American Pharmaceutical Association and Pergamon Press, 1987) describing pro-drugs generally are hereby incorporated by reference. Prodrugs of the compounds described herein can be prepared by modifying functional groups present in said component in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent component. Typical examples of prodrugs are described for instance in WO 99/33795, WO 99/33815, WO 99/33793 and WO 99/33792, each of which is incorporated herein by reference for these teachings. Prodrugs can be characterized by increased bio-availability and are readily metabolized into the active inhibitors in vivo.
Examples of prodrugs include, but are not limited to, analogs or derivatives of the compounds described herein, further comprising biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates,
biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogues. Other examples of prodrugs include derivatives of the compounds described herein that comprise NO, N02, ONO, or ON02 moieties. Prodrugs are prepared using methods known to those of skill in the art, such as those described by BURGER'S
MEDICINAL CHEMISTRY AND DRUG DISCOVERY (1995) 172-178, 949-982
(Manfred E. Wolff ed., 5th ed), the entire teachings of which are incorporated herein by reference.
As used herein, the terms "biohydrolyzable amide," "biohydrolyzable ester," "biohydrolyzable carbamate," "biohydrolyzable carbonate," "biohydrolyzable ureide" and "biohydrolyzable phosphate analogue" mean an amide, ester, carbamate, carbonate, ureide, or phosphate analogue, respectively, that either: 1) does not destroy the biological activity of the compound and confers upon that compound advantageous properties in vivo, such as uptake, duration of action, or onset of action; or 2) is itself biologically inactive but is converted in vivo to a biologically active compound. Examples of biohydrolyzable amides include, but are not limited to, lower alkyl amides, a-amino acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides. Examples of biohydrolyzable esters include, but are not limited to, lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl esters, and choline esters. Examples of biohydrolyzable carbamates include, but are not limited to,
lower alkylamines, substituted ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and heteroaromatic amines, and polyether amines.
Prodrugs can include fatty acids or lipids linked to the compounds described herein by the moieties described herein. Exemplary fatty acids include the omega-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Such prodrugs and the preparation thereof will be clear to the skilled person; reference is for instance made to the prodrug types and preparations described in US 5,994,392, US 4,933,324 and US
5,284,876.
As used herein, the term "salt" or "pharmaceutically acceptable salt" refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66: 1-19. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of
pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(Cl-4alkyl)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium,
and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
As used herein, the term "solvate" includes any combination which may be formed by a compound of this invention with a suitable inorganic solvent (e.g. hydrates) or organic solvent, such as but not limited to alcohols, ketones, esters and the like. Such salts, hydrates, solvates, etc. and the preparation thereof will be clear to the skilled person;
reference is for instance made to the salts, hydrates, solvates, etc. described in US
6,372,778, US 6,369,086, US 6,369,087 and US 6,372,733.
Aspects of the invention relate to compositions of matter including NAD+ precursors, such as NMN or a salt thereof or prodrug thereof. Further aspects of the invention relate to compositions of matter including an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof. In some embodiments, compositions include conjugates of agents described herein, such as fish oil conjugates.
Aspects of the invention relate to treatment and/or prevention of disorders associated with inflammation. Non-limiting examples of disorders associated with inflammation include septic shock, obesity-related inflammation, Parkinson's Disease, Crohn's Disease, Alzheimer's Disease (AD), cardiovascular disease (CVD), inflammatory bowel disease (IBD), chronic obstructive pulmonary disease, blood inflammation, joint inflammation, arthritis, asthma, ulcerative colitis, hepatitis (e.g., viral chronic hepatitis), psoriasis, atopic dermatitis, pemphigus, glomerulonephritis, atherosclerosis, sarcoidosis, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Wegner's syndrome, Goodpasture's syndrome, giant cell arteritis, polyarteritis nodosa, idiopathic pulmonary fibrosis, acute lung injury, post-influenza pneumonia, SARS, tuberculosis, malaria, sepsis, cerebral malaria, Chagas disease, schistosomiasis, bacteria and viral meningitis, cystic fibrosis, multiple sclerosis, encephalomyelitis, sickle cell anemia, pancreatitis,
transplantation (e.g., host-mediated rejection of transplanted tissue such as hematopoietic stem cells or an organ, graft mediated host response, such as graft vs. host disease), systemic lupus erythematosis, autoimmune diabetes, thyroiditis, and radiation pneumonitis, eye irritation, reduced longevity, respiratory inflammation and pulmonary inflammation. Pulmonary inflammation can be caused by infection, such as from an influenza virus,
rhinovirus, respiratory syncytial virus, parainfluenza, Staphylococcus aureus, Streptococcus pneumoniae, Francisella tularensis, Mycobacterium tuberculosis and Bacillus anthracis.
Thus, the invention includes methods for delivering agents to a subject. As used herein, the term "subject" refers to a human or non-human mammal. Non-human mammals include livestock animals, companion animals, laboratory animals, and non-human primates. Non-human subjects also specifically include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits. In some embodiments the subject is a patient. As used herein, a "patient" refers to a subject who is under the care of a physician, dentist, or other health care worker, including someone who has consulted with, received advice from or received a prescription or other
recommendation from a physician or other health care worker. A patient is typically a subject having or at risk of having a disorder associated with inflammation.
As used herein, the term treat, treated, or treating when used with respect to an disorder such as a disorder associated with inflammation refers to a prophylactic treatment which increases the resistance of a subject to development of the disease or, in other words, decreases the likelihood that the subject will develop the disease as well as a treatment after the subject has developed the disease in order to fight the disease or prevent the disease from becoming worse.
The term "effective amount" of an agent of the invention refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an agent for treating a disorder associated with inflammation is that amount sufficient to prevent an increase in one or more symptoms of a disorder associated with inflammation in the subject or that amount necessary to decrease one or more symptoms of a disorder associated with inflammation in the subject that would otherwise occur in the absence of the agent. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative
bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, or the severity of the disease or condition. One of
ordinary skill in the art can empirically determine the effective amount of a particular composition of the invention without necessitating undue experimentation.
The agents of the invention may be delivered to the subject on an as needed or desired basis. For instance a subject may self-administer the agents as desired or a physician may administer the agents. Additionally a physician or other health care worker may select a delivery schedule. In other embodiments of the invention, the agents are administered on a routine schedule. A "routine schedule" as used herein, refers to a predetermined designated period of time. The routine schedule may encompass periods of time which are identical or which differ in length, as long as the schedule is predetermined. For instance, the routine schedule may involve administration of the composition on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between, every two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, etc. Alternatively, the
predetermined routine schedule may involve, for example, administration of the
composition on a daily basis for the first week, followed by a monthly basis for several months, and then every three months after that. Any particular combination would be covered by the routine schedule as long as it is determined ahead of time that the appropriate schedule involves administration on a certain day.
The agents may be administered alone or in any appropriate pharmaceutical carrier, such as a liquid, for example saline, or a powder, for administration in vivo. They can also be co-delivered with larger carrier particle or within administration devices. The agents may be formulated. The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable
concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, an effective amount of the agents can be administered to a subject by any mode. Administering a pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Routes of administration include but are not limited to oral, parenteral, intramuscular, intravenous, subcutaneous, mucosal, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, dermal, rectal, and by direct injection.
It is well known to those skilled in the art that agents may be administered to patients using a full range of routes of administration. As an example, agents may be blended with direct compression or wet compression tableting excipients using standard formulation methods. The resulting granulated masses may then be compressed in molds or dies to form tablets and subsequently administered via the oral route of administration.
Alternately particle granulates may be extruded, spheronized and administered orally as the contents of capsules and caplets. Tablets, capsules and caplets may be film coated to alter dissolution of the delivery system (enteric coating) or target delivery of the particle to different regions of the gastrointestinal tract. Additionally, particles may be orally administered as suspensions in aqueous fluids or sugar solutions (syrups) or hydroalcoholic solutions (elixirs) or oils. The particles may also be administered directly by the oral route without any further processing.
The agents of the invention may be systemically administered in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules or compressed into tablets. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of an active compound, e.g., calcium. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained. In some embodiments, agents described herein, such as NMN or a salt or prodrug thereof, are administered at a dosage of 250 mg - 5 grams per day, by an oral route.
The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or
capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
To ensure full gastric resistance a coating impermeable to at least pH 5.0 can be helpful. Examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
A coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow. Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic, e.g., powder; for liquid forms, a soft gelatin shell may be used. The shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
The agents of the invention may also be administered intravenously or
intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In some embodiments the compositions of the invention are not encapsulated or formulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for
example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum
monostearate and gelatin.
For topical administration, the agents of the invention will generally be administered as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid. Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non- toxic surfactants. Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.
The compositions of the inventions may include a physiologically or
pharmaceutically acceptable carrier, excipient, or stabilizer mixed with the particles. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term
"pharmaceutically- acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired
pharmaceutical efficiency. A pharmaceutical preparation is a composition suitable for administration to a subject. Such preparations are usually sterile and prepared according to GMP standards, particularly if they are to be used in human subjects. In general, a pharmaceutical composition or preparation comprises the particles, and optionally agents of
the invention and a pharmaceutically- acceptable carrier, wherein the agents are generally provided in effective amounts.
Agents may also be suspended in non- viscous fluids and nebulized or atomized for administration of the dosage form to nasal membranes. Agents may also be delivered parenterally by either intravenous, subcutaneous, intramuscular, intrathecal, intravitreal or intradermal routes as sterile suspensions in isotonic fluids.
Finally, agents may be nebulized and delivered as dry powders in metered-dose inhalers for purposes of inhalation delivery. For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of for use in an inhaler or insufflator may be formulated containing the microparticle and optionally a suitable base such as lactose or starch. Those of skill in the art can readily determine the various parameters and conditions for producing aerosols without resort to undue experimentation. Several types of metered dose inhalers are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDI), breath- actuated MDI, dry powder inhaler (DPI), spacer/holding chambers in combination with MDI, and nebulizers. Techniques for preparing aerosol delivery systems are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the agent in the nanoparticle or microparticle (see, for example, Sciarra and Cutie, "Aerosols," in Remington's Pharmaceutical Sciences, 18th edition, 1990, pp. 1694-1712; incorporated by reference).
Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Missouri; the Acorn II nebulizer, manufactured by Marquest Medical Products, Englewood, Colorado; the Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, North Carolina; and the Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford, Massachusetts.
Agents, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Further aspects of the invention relate to kits comprising a pharmaceutical composition comprising a therapeutically effective amount of one or more agents that increase NAD+ levels and instructions for administration of the pharmaceutical composition. In some aspects of the invention, the kit can include a pharmaceutical preparation vial, a pharmaceutical preparation diluent vial, and the agent(s). The diluent vial can contain a diluent such as physiological saline for diluting what could be a concentrated solution or lyophilized powder of the agent of the invention. In some embodiments, the instructions include instructions for mixing a particular amount of the diluent with a particular amount of the concentrated pharmaceutical preparation, whereby a final formulation for injection or infusion is prepared. In some embodiments, the instructions include instructions for use in a syringe or other administration device. In some embodiments, the instructions include instructions for treating a patient with an effective amount of an agent. It also will be understood that the containers containing the preparations, whether the container is a bottle, a vial with a septum, an ampoule with a septum, an infusion bag, and the like, can contain indicia such as conventional markings which change color when the preparation has been autoclaved or otherwise sterilized.
The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and copending patent applications) cited throughout this application are hereby expressly incorporated herein by reference.
EXAMPLES
The present invention will be more specifically illustrated by the following
Examples. However, it should be understood that the present invention is not limited by these examples in any manner.
Experimental Procedures
Generation of a whole body adult-inducible SIRT1 knockout mouse
Whole body adult-inducible SIRT1 knockout mice were treated with tamoxifen for 5 weeks and the efficiency of deletion in DNA from tail samples was determined by PCR. Animals were then maintained on regular diet for 4 months. For the fasting experiments, mice were fasted for 16 hrs prior to sacrifice. All animal care followed the guidelines and was approved by the Institutional Animal Care and Use Committees (IACUCs) at Harvard Medical School.
Aging cohorts
C57BL/6J mice of 3, 6, 22, 24, or 30 months of age were obtained from the National Institutes of Aging mouse aging colony. Mice were acclimated for at least one- week prior to sacrifice. 3, and 24-month-old mice were given interperitoneal (IP) injections of 500 mg NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee
C2C12 Cell Cultures treatments, adenoviral infections and SIRT1 gene silencing
Methods for cell culture treatments, adenoviral infections, and gene silencing in C2C12 cells can be found in the supplemental information.
Mitochondrial Function
Skeletal muscle mitochondria were isolated as described previously (Frezza et ah,
Nat. Protoc. 2:287-295 (2007)). Mitochondrial membrane potential, cytochrome c activity and succinate dehydrogenase were determined as described (Brautigan et ah, Methods Enzymol. 53: 128-164 (1978); Rolo et al., Biochim. Biophys. Acta. 1637: 127-132 (s003); ; Singer, T. P., Methods Biochem. Anal. 22: 123-175 (1974)). ATP content was measured with a commercial kit according to the manufacturer's instructions (Roche).
TFAM Promoter, HRE and c-Myc activity
TFAM promoter, HRE and c-Myc activity were determined using a luciferase-based system. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference.
NAD+ measurement
NAD+ from C2C12 cells and skeletal muscle was quantified with a commercially available kit (Bio Vision) according to the manufacturer's instructions and as described before (Gomes et ah, Biochim. Biophys. Acta. 1822: 185-195 (2012)).
Statistical Analysis
Data were analyzed by a two-tailed Student's t-test. All data are reported as mean + SEM. Statistical analysis was performed using Excel software.
Example 1: Knockout of SIRTl in Adult Mice Causes an Imbalance Between Nuclear and Mitochondrially-Encoded ETC subunits
The biological importance of SIRTl has limited the type and interpretation of experiments that are possible in complex organisms. One of the main obstacles to studying the role of this enzyme in mammals is the fact that inbred SIRTl knockout mice die in utero or exhibit developmental abnormalities. In the case of tissue-specific knockouts, which are viable, one cannot rule out the possibility that artifacts have been introduced during the selection pressures of development. To circumvent this obstacle, an adult- inducible whole body SIRTl knockout mouse strain (SIRTl KO) was developed that allows the testing of the effect of deleting SIRTl in adult animals.
At 6-8 weeks of age, male SIRTl KO mice (C57BL/6J Cre-ERT2 x
SIRTlfloxAE4/floxAE4) and "wildtype" (WT) controls (Cre-ERT2 or Snmflox^floxAE4) wefe placed on a tamoxifen diet for 5 weeks, resulting in deletion of SIRTl from major tissues in the SIRTl KO mice but not in controls. In contrast to the germline knockout mice, deletion of SIRTl in the adult did not affect mortality and the SIRTl KO mice appeared outwardly normal. Upon closer examination of the muscle, however, a metabolic defect was apparent. Mitochondria isolated from gastrocnemius muscle of SIRTl KO animals had significantly lower mitochondrial membrane potential (Figure 4A) and cellular ATP levels (Figure 4B).
There was no difference in mitochondrial mass between SIRTl KO and wildtype animals, as indicated by comparing the cross-sectional area and number of mitochondria in electron micrographs (Figure 4C). Quantitative PCR was performed to determine the mRNA levels of ETC subunits encoded by either the nuclear and mitochondrial genome.
The mRNA levels of all 13 mitochondrially-encoded ETC genes were reduced in the SIRTl KO mice compared to wildtype controls, but there was no decrease in the expression of any of the nuclear-encoded components tested (Figure 4D and E). Consistent with this, protein levels of the mitochondrially-encoded COX2 (cytochrome c oxidase subunit II) subunit were significantly decreased but the nuclear-encoded COX4 (Cytochrome c oxidase subunit IV) was unaltered (Figure 4F). The specific loss of mitochondrial subunits predicts that Complex II of the ETC, which is comprised of only nuclear-encoded subunits, should be
less affected by the SIRTl deletion than other ETC complexes. The activity of Complex II (SDH) in the KO mouse was not significantly different from the wildtype, whereas the activity of Complex IV (COX) was significantly decreased (Figures 4G and H). In addition, mtDNA content was also reduced in the SIRTl KO muscle relative to wildtype (Figure 41) despite no difference in mitochondrial mass (see Figure 4C). To simplify discussion, the discord between nuclear and mitochondrial ETC components is referred to herein as "genome asynchrony."
Example 2: Age-Related Mitochondrial Dysfunction Resembles Genome Asynchrony in SIRTl KO Mice
It was tested whether genome asynchrony caused by the loss of SIRTl was relevant to normal aging. A progressive, age-dependent decline in mitochondrial function with age was observed in our C57BL/6J mice. By 22 months of age, mitochondrial membrane potential, ATP content and COX activity were all decreased, a trend that was extended even further by 30 months of age (Figure 5A-C), while there was an equal decrease in mtDNA content at both ages (Figure 5D). The integrity of mitochondrial DNA in skeletal muscle of 6, 22 and 30 month old mice was quantified using a long-range PCR-mediated detection method. mtDNA integrity at 30 months of age was considerably lower than at 6 months. mtDNA integrity was not significantly reduced in the 22-month- olds. (Figure 5E). These data, indicate that an alternative mechanism may be primarily responsible for the mitochondrial dysfunction observed in 22-month-old animals.
Whether the mitochondrial dysfunction in 22-month-old mice was related to the phenomenon observed in SIRTl KO mice was tested. This possibility was supported by the fact that NAD+ levels and SIRTl activity decline with aging in a variety of tissues. While SIRTl expression was not altered under these experimental conditions, NAD+ levels were reduced in skeletal muscle of elderly mice (Figures 5F and 5G), indicating that SIRTl activity may be impaired. A comparison between the skeletal muscle of 22-month- and 6- month-old mice showed that ETC genes encoded by the mitochondrial genome (ND1, CYTB, COX1, ATP6) were all significantly lower at 22 months, whereas ETC components encoded by the nuclear genome (NDUFS8, SDHb, Uqcrcl, COX5, ATP5a) were not (Figures 5H and I). By 30 months, however, both the nuclear and the mitochondrial ETC subunit mRNAs were lower relative to the 6-month-olds, with the exception of SDHb, which did not decline during aging (Figure 51 and J). Mirroring the SIRTl KO mice, levels
of the mitochondrially-encoded COX2 protein were decreased at 22 months but COX4, a nuclear-encoded protein, was only slightly lower. By 30 months however, both proteins were equally reduced relative to the young mice (Figure 5K).
Example 3: SIRTl Regulates Mitochondrial Homeostasis Through PGC -la-Dependent and Independent Mechanisms
The adaptation of metabolic tissues to fasting involves upregulation of SIRTl and the targeted deacetylation of the transcriptional co-activator PGC- la. Consistent with this, both the young SIRTl KO and 22-month-old wildtype animals failed to upregulate ETC genes in response to fasting. Hence, it was possible that the phenotypes observed in the SIRTl KO mice and the aged mice were a defect in the SIRTl -PGC- la pathway of mitochondrial biogenesis. To test this, the expression of nuclear- and mitochondrially- encoded ETC genes in primary myotubes from PGC-Ια/β KO mice and the effect of SIRTl in this context was examined. The ability of SIRTl to induce nuclear-encoded ETC genes was absent in the PGC-Ια/β KO myotubes. However, overexpression of SIRTl induced the mitochondrial ETC genes even in the absence of PGC- la and PGC-Ιβ (Figure 6A).
Moreover, genome asynchrony was not a phenotype of the PGC-Ια/β KO myotubes under basal conditions, as both the mitochondrial and nuclear encoded components of the ETC were similarly affected by the knockout. Together, these observations revealed that SIRTl can regulate mitochondrial gene expression independently of the canonical PGC- la pathway and raised the possibility that genome asynchrony was due to an alternative mechanism.
To provide additional clues about the molecular basis of genome asynchrony, the gene expression patterns of skeletal muscle of SIRTl KO mice was analyzed. Out of the mitochondrial biogenesis genes that were analyzed, only TFAM was decreased (Figure 6B). Consistent with the in vivo findings, TFAM promoter activity was 50% lower in primary myoblasts isolated from SIRTl KO mice than from wildtype littermates (Figure 6C). If genome asynchrony in cells lacking SIRTl is caused by a decrease in TFAM, restoring the expression levels of TFAM should correct genome asynchrony, along with mtDNA content and ATP levels. The restoration of TFAM levels in SIRTl knockdown cells (Figure 3D) was sufficient to correct genome asynchrony, mtDNA content, and ATP levels (Figure 6E- G). This provided strong evidence that TFAM is a limiting factor that is depleted in SIRTl KO mice causing genome asynchrony and decreased mitochondrial function.
Example 4: SIRTl Regulates Mitochondrial Homeostasis Through HIF-la
How SIRTl regulates TFAM independently of PGC-Ια/β was next examined.
Expression analysis of gastrocnemius tissue showed that genes involved in glycolysis are more expressed in the SIRTl KO animals, including hexokinase 2 (HK2), pyruvate kinase (PKM), phosphofructokinase (PFKM) and lactate dehydrogenase A (LDHA) (Figure 6H and I), reminiscent of Warburg remodeling of metabolism in cancer cells.
To test whether genome asynchrony and the resulting mitochondrial dysfunction in the muscle might be due to ectopic HIF-l stabilization and the induction of a
pseudohypoxic response, protein levels of HIF-l were examined by Western blotting in skeletal muscle of SIRTl KO mice. As shown in Figure 6J, the levels of HIF-la were considerably higher in the KO tissue, demonstrating that loss of SIRTl leads to HIF-la accumulation. The SIRTl KO animals exhibited a gene expression pattern reminiscent of a shift towards non-oxidative metabolism, including upregulation of HIF-la target genes PGK-1, Glutl, PDK1 and VEGFa (Figure 6K). Consistently, primary myoblasts isolated from SIRTl KO animals showed increased activity of the hypoxia response element (HRE), despite being cultured in normoxic conditions (Figure 6L).
To test if the normal hypoxic response reproduces the effect of a SIRTl deletion by causing genome asynchrony, C2C12 myoblasts were grown under hypoxic conditions (1% oxygen) or treated with dimethyloxaloylglycine (DMOG), a HIFa prolyl hydroxylase inhibitor that stabilizes HIF. Both treatments resulted in a specific decline in mtDNA content and the expression of mitochondrially-encoded ETC genes but not the nuclear- encoded components, paralleling the effect of a SIRTl deletion.
Next whether the ability of SIRTl to regulate mitochondrial function independently of PGC-Ια/β is mediated by HIF-la was tested. Overexpression of SIRTl in PGC-Ια/β knockout myocytes induced the expression of mitochondrial ETC genes (as shown above) but the induction was completely blocked by the HIF- la- stabilizing compounds DMOG and desferoxamine (DFO) (Figure 6M). Furthermore, cells expressing a mutant allele of HIF-la that is constitutively stabilized due to the replacement of the two hydroxylated prolines with alanines (DPA) (Figure 7A), caused genome asynchrony similar to hypoxia and treatment with DMOG (Figure 7B). The stabilized HIF-la also prevented SIRTl from increasing the expression of mitochondrially-encoded ETC subunits or mtDNA content
(Figure 7C and 7D). Importantly, cells expressing a mutant allele of the related factor HIF-
2a (stabilized by mutation of prolines 405 and 531 to alanine) did not induce genome
asynchrony and had no effect on the ability of SIRTl to promote the expression of mitochondrial ETC genes or mtDNA content. (Figure 7A-D), indicating that this effect of SIRTl is specific to HIF-la.
Having shown that HIF-la stabilization was sufficient to induce genome
asynchrony, it was next tested whether it was necessary. Genome asynchrony was induced using the specific SIRTl inhibitor EX-527 and HIF-la was knocked down using an shRNA against HIF-la (Figure 7E). Knockdown of HIF-la in C2C12 cells treated with the SIRTl inhibitor EX-527 prevented genome asynchrony and decline in mitochondrial function, as evidenced by the maintenance of mtDNA content (Figure 7F), mitochondrial ETC gene expression (Figure 7G), mitochondrial membrane potential (Figure 7G) and ATP levels
(Figure 71). Impairment of the transcriptional activity of the HIF complex by knockdown of ARNT did not impair the effects of SIRTl inhibition with EX-527, indicating that the effect of HIF-la on mitochondrial homeostasis in response to SIRTl is not mediated through changes in the HIF-la/ARNT transcription complex but rather HIF- la's ability to regulate the activity of other transcriptional mediators.
Example 5: c-Myc Links SIRTl and HIF-la to Genome Asynchrony
Under certain circumstances, HIF-la regulates c-Myc independently of its transcriptional activity (Koshiji et al, EMBO J. 23: 1949-1956 (2004); ; Koshiji et al, Mol. Cell. 17:793-803 (2005), each of which is hereby incorporated by reference in its entirety). It was tested whether c-Myc was the factor linking SIRTl and HIF-la to genome asynchrony. Myoblasts from the SIRTl KO mice were about half as active as wildtype cells in a c-Myc reporter assay (Figure 8A). Additionally, knockdown of c-Myc (Figure 8B) completely blocked the ability of SIRTl to increase mtDNA content, the expression of mitochondrially-encoded ETC genes, and TFAM promoter activity in C2C12 myoblasts (Figure 8C-E). Conversely, in C2C12 myoblasts treated with EX-527, overexpression of c- Myc (Figure 8F) restored the level of mtDNA content, mitochondrial ETC mRNA, TFAM promoter activity, and increased cellular ATP levels (Figure 8G-J). A stabilized form of HIF-la (DPA) inhibited c-Myc reporter activity in C2C12 myoblasts and prevented the increase in TFAM promoter caused by SIRTl overexpression (Figure 8K). Furthermore, the ability of HIF-la knockdown to prevent the loss of TFAM promoter activity was completely prevented by c-Myc knockdown (Figure 8L). Together these data show that HIF-la inhibits TFAM by interfering with c-Myc, providing a link between HIF-la and the
regulation of mitochondrially-encoded ETC subunits The data also demonstrate that SIRTl can regulate mitochondrial function via a PGC-la/p-independent mechanism that involves Hif-ΐα and c-Myc.
Example 6: CR Delays Age-related Mitochondrial Dysfunction by Preventing HIF-la- induced Genome Asynchrony.
In male C57BL/6 mice, instituting a 30-40% reduction in caloric intake from 6 weeks to 22 months of age prevents an age-associated decline in NAD+ levels (Figure 9A) mitochondrial membrane potential (Figure 9B), ATP levels (Figure 9C) and COX activity
(Figure 9D). CR also prevented the decrease in mtDNA content (Figure 9E) and
mitochondrially-encoded ETC components (Figure 9F) while maintaining levels of COX subunits 2 and 4 (Figure 9G).
If the SIRTl KO mouse is a mimic of normal mitochondrial decline, then muscle from old mice should also contain higher levels of HIF-Ι and CR should counteract this.
As shown in Figure 9H, HIF-Ι levels in the muscle of 22-month-old mice were considerably higher than young controls, and CR prevented this increase (Figure 9H). CR also suppressed the increased expression of key target genes downstream of HIF-Ια that promote the shift towards non-oxidative metabolism, paralleling the effects of SIRTl KO
(Figure 91).
Example 7: NMN Induces NAD+ Levels in Skeletal Muscle and Reverses Age-Induced Genome Asynchrony and Mitochondrial Dysfunction
To test whether a decline in NAD+ availability, invokes a pseudohypoxic response in muscle that inhibits mitochondrial function, we treated 3- and 24-month-old C57BL/6J mice for one week by intraperitoneal injection of nicotinamide mononucleotide (NMN) (500 mg/kg body weight), a compound that increases NAD+ levels in a variety of tissues. After the treatment, levels of cellular NAD+ in both the young and old mice were approximately 2-fold higher, such that the treated 24-month-old mice resembled the untreated 3-month-olds (Figure 10A). In the treated old mice a restoration of mitochondrial membrane potential to the levels of the young mice (Figure 10B), concomitant with increases in ATP levels and COX activity (Figure IOC and D) were observed. Moreover, NMN treatment reversed the age-induced increase in HIF-Ια in muscle and suppressed the expression of HIF-Ια target genes (Figure 10E and 10F).
As a functional test of whether NMN reverses genome asynchrony by depleting cells of HIF-Ι , primary PGC-Ι /β KO myo tubes were incubated with NMN in the presence and absence of the HIF stabilizing compounds DMOG and DFO. As shown in Figure 10K, NMN induced expression of mitochondrially-encoded ETC genes (ND1, CYTB, COX1, ATP6) but this effect was completely abolished by DMOG and DFO, indicating that, under these conditions, NMN improves mitochondrial function
independently of PGC-Ι /β by depleting HIF- la (Figure 10G).
The inducible SIRT1 KO mouse allowed the testing of the involvement of SIRT1 in the effects of NMN in vivo. The ability of NMN treatment to induce mitochondrially- encoded genes and improve mitochondrial function was lost in animals lacking SIRT1
(Figure 10H and 101). Taken together, this result demonstrates that restoring NAD+ levels in old animals is sufficient to restore mitochondrial function and that the mechanism involves the SIRTl-mediated suppression of a pseudohypoxic response that disrupts nuclear-mitochondrial communication.
Example 8: Aging Leads to a Specific Decline in Mitochondrial-encoded Genes Through Decreased Nuclear NAD+ Levels
Materials and Methods
Aging cohorts, SIRT1 KO, EGLNl KO and SIRT1 OE mice and NMN ATI electroporation
C57BL/6J mice of 6, 22, or 30 months of age were obtained from the National
Institutes of Aging mouse aging colony. Additionally 22 months old caloric restricted mice were also obtained from the National Institutes of Aging mouse aging colony. EGLNl KO,
SIRT1 KO and SIRT1 OE mice were generated as previously described (Minamishima et al., 2008; Price et al., 2012). Mice were acclimated for at least one-week prior to sacrifice.
3, 6, 22 and 24-month-old mice were given interperitoneal (IP) injections of 500 mg
NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at
5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection.
Whole body SIRT1 overexpressor (SIRTl-tg) mice of 6 months of age were given interperitoneal (IP) injections of 300 mg DMOG/kg body weight per day or the equivalent volume of PBS for 5 consecutive days.
Whole body adult-inducible Eglnl knockout mice (Minamishima et al, 2007) were treated with IP injection of tamoxifen for 3 days after which they were allowed to rest. The
mice were given interperitoneal (IP) injections of 500 mg NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee.
All animal care followed the guidelines and was approved by the Institutional
Animal Care and Use Committees (IACUCs) at Harvard Medical School.
Adenovirus generation and Mutagenesis
C2C12 cell line (ATCC) was cultured in low glucose Dulbecco's modified eagle medium (DMEM) (Invitrogen) supplemented with 10% FBS (Invitrogen) and a mix of antibiotic and antimycotic (Invitrogen). To inhibit SIRT1, cells were treated the vehicle (0.001% DMSO) or 10 μΜ EX-527 (Tocris) for 12h. C2C12 myoblasts were infected with an empty or SIRT1 adenovirus as described before (Gerhart-Hines et al., 2007) and the media was replaced with fresh DMEM for additional 48h, after that the cells were treated as described before. To test the effects of hypoxia and HIFa stabilization in genome asyncrony, C2C12 myoblasts were exposed to 1% oxygen for 16h or treated with the vehicle (0.001% DMSO) or DMOG (Cayman) for the same period of time.
Generation of primary myoblasts, rhoO cells, cell culture treatments, adenoviral infections and gene silencing
Primary myoblasts cells were isolated from WT, SIRT1 KO (Price et al., 2012) and PGC-Ια/β KO (Zechner et al., 2010) mice as previously described (Price et al., 2012). WT and PGC-Ι /β KO primary myoblasts were plated and allowed to differentiate into myotubes by replacing the media with low glucose DMEM supplemented with 2% horse serum (Sigma- Aldrich) for 4 days. After the differentiation the cells were infected with empty vector or flag-SIRTl adenovirus as described before (Gerhart-Hines et al., 2007). Media was replaced with fresh DMEM supplemented with 2% horse serum (Sigma- Aldrich) for an additional 48hr and, after that the cells were harvested for the different assays as described. To investigate the role of HIF-Ι in genome asynchrony, PGC-Ι /β KO primary myotubes were treated for 12 hours with ImM DMOG (Sigma) or 10 μΜ DFO (Sigma), 24h after infection with empty vector of flag-SIRTl adenovirus or after 12h treatment with 500 mM NMN (Sigma).
Mitochondrial Function
Mitochondrial membrane potential was evaluated by fluorescence of the potential dependent TMRM probe. Briefly, cells were incubated with 100 nM TMRM for 15 minutes in the dark, after which the media was replaced and the fluorescence was measure by flow cytometry.
ROS and mitochondrial mass were evaluated by flow cytometry using the fluorescent probes DHE and NAO respectively as described before (Bell et a, 2011; Gomes et al, 2012).
Cytochrome c oxidase activity was polarographically determined based on the 02 consumption upon cytochrome c oxidation, as previously described (Brautigan et al., 1978). The reaction was carried out at 25°C in 1.3 mL of standard respiratory medium (as in mitochondrial respiration) supplemented with 2 μΜ rotenone, 10 μΜ oxidized cytochrome c, 0.3 mg TritonX-100. Following addition of the sample, the reaction was initiated by adding 5 mM ascorbate plus 0.25 mM tetramethylphenylene-diamine (TMPD).
Succinate dehydrogenase activity was polarographically determined based on the
02 consumption using phenazine metasulphate (PMS) as an artificial electron acceptor, as previously described (Singer, 1974). The reaction was carried out at 25°C in 1.3 mL of standard respiratory medium (as in mitochondrial respiration) supplemented with 5 mM succinate, 2 μΜ rotenone, 0.1 μg antimycin A, 1 mM KCN and 0.3 mg Triton X- 100. After the addition of the sample, the reaction was initiated with 1 mM PMS.
ATP content was measured with a commercial kit according to the manufacturer's instructions (Roche).
Electron Microscopy
Skeletal muscle from mice were fixed in 2.5% glutaraldehyde and 2.5%
paraformaldehyde in cacodylate buffer (Electron Microscopy Sciences) then were removed, put directly into fixative, then were embedded and photographed with an electron microscope (Tecnai G2 Spirit BioTWTN) and mitochondrial area quantified with Image J software.
Gene expression and mtDNA analysis
RNA from skeletal muscle tissue and C2C12 cells were extracted with RNeasy mini kit (Qiagen) according to the instructions and quantified using the NanoDrop 1000
spectrophotometer (Thermo Scientific). cDNA was synthesized with the iSCRIP cDNA synthesis kit (BioRad) using 600 ng of RNA. Quantitative RT-PCR reactions were performed using 1 μΜ of primers and LightCycler® 480 SYBR Green Master (Roche) on an LightCycler® 480 detection system (Roche). Calculations were performed by a comparative method (2-ACT) using 18S as an internal control. For mtDNA analysis, total DNA was extracted with DNeasy blood and tissue kit (Qiagen). mtDNA was amplified using primers specific for the mitochondrial cytochrome c oxidase subunit 2 (COX2) gene and normalized to genomic DNA by amplification of the ribosomal protein si 8 (rpsl8) nuclear gene. Primers were designed using the IDT software (IDT) and the primer sequences can be found in Table 1.
Total DNA was extracted with DNeasy blood and tissue kit (Qiagen). Integrity of mtDNA was assessed using the long range PCR mediated detection method as described previously (Santos et al., 2006), using the following primer sequences:
Fwd:GCCAGCCTGACCCATAGCCATAATAT (SEQ ID NO: 31)
Rev: GAGAGATTTTATGGGTGTAATGCGG (SEQ ID NO: 32)
Chromatin Immunoprecipitation and Immunoblots
Protein extracts from tissue or C2C12 cells were obtained by lysis in ice-cold lysis buffer (150 mM NaCl,10 mM Tris HCl (pH 7.4),1 mM EDTA,1 mM EGTA, 1 % Triton X- 100, 0.5% NP-40) supplemented with a cocktail of protease and phosphatase inhibitors
(Roche). Protein content was determined by the Bradford protein assay (Biorad), and 50 μg proteins were run on SDS-PAGE under reducing conditions. The separated proteins were then electrophoretically transferred to a polyvinylidene difluoride membrane (Perkin- Elmer). Proteins of interest were revealed with specific antibodies: anti-TFAM (Aviva biosciences), anti-COX2, anti-COX4 (Mito sciences), anti-SIRTl, anti-P-tubulin (Sigma- Aldrich), anti-HIFla (Cayman), anti-HA (Covance) and anti-c-Myc (Cell Signaling) overnight at 4°C. The immuno staining was detected using horseradish peroxidase- conjugated anti-rabbit or anti-mouse immunoglobulin for 1 h at room temperature. Bands were revealed using Amersham ECL detection system (GE Healthcare).
Chromatin immunoprecipitation was performed using a commercial available kit
(Millipore) according to the manufacturer's instructions and using anti-HIFla (Cayman) and anti-c-Myc (Cell Signaling) antibodies.
TFAM Promoter, VHL promoter, HRE and c-Myc activity
TFAM promoter, VHL promoter, HRE and c-Myc activity were determined using a luciferase-based system. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference.
TFAM promoter activity was evaluated using a TFAM promotes-luc plasmid. A fragment of the mouse Tfam promoter (1.4kb upstream of the coding sequence) was cloned into a pGL4.15 vector (Promega). Luciferase activity was measured using the Dual- Luciferase Reporter Assay System (Promega) with Renilla as the reference 48h after transfection.
HIF-mediated transcriptional activity was measured using an HRE-lucif erase plasmid (Bell et al., 2011). VHL promoter activity was measured using a commercially available luciferase plasmid (Affymetrix). c-Myc-mediated transcriptional activity was measured using a luciferase plasmid containing CDK4 Myc binding sites (Addgene plasmid 16564) and a mutated version as a negative control (Addgene plasmid 16565). The plasmids were transfected using X-tremeGENE HP (Roche) in accordance with the manufacturer's protocol. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with Renilla as the reference 48h after transfection.
SIRT1, c-Myc, HFla and ARNT gene silencing in C2C12 cells
SIRT1 knockdown cells were produced as described before (Gomes et al., 2012).
ShMyc#l (TRCN0000042517; Open Biosystems) ShMyc#2 (TRCN0000054885; Open Biosystems), shHIFla (TRCN0000054450; Open Biosystems), shARNT#l and shANRT#2 (TRCN0000079930 and TRCN0000079931, respectively; Open Biosystems) and control shGFP lentivirus were produced by co-transfection of 293T cells with plasmids encoding psPAX2 (Addgene plasmid 12260), pMD2.G (Addgene plasmid 12259) using X- tremeGENE HP (Roche) in accordance with the manufacturer's protocol. Media was changed 24 hours post-transfection and the virus harvested after 48 hours, was filtered and used to infect C2C12 cells in the presence of 5 μg/mL polybrene (Sigma- Aldrich) via spin infection (2500 rpm, 30 minutes). Selection of resistant colonies was initiated 24 hours later using 2 μg/mL puromycin (Invivogen). c-Myc over expression and HIFla and HIF2a DP A in C2C12 cells
pMXsc-Myc (Addgene plasmid 13375) and empty as well as pBabe empty
(Addgene plasmid 1764), HIFla DPA (Addgene plasmid 19005), and HIF2a DPA
(Addgene plasmid 19006) retrovirus were produced by co-transfection of 293T cells with plasmids encoding gagpol (Addgene plasmid 14887) and vsvg (Addgene plasmid 8454) using X-tremeGENE HP (Roche) in accordance with the manufacturer's protocol. Media was changed 24 hours post-transfection and the virus harvested after 48 hours, was filtered and used to infect C2C12 cells in the presence of 5 μg/mL polybrene (Sigma- Aldrich) via spin infection (2500 rpm, 30 minutes). Selection of resistant colonies was initiated 24 hours later using 2 μg/mL puromycin (Invivogen). For silencing c-Myc in HIFl knockdown cells, non-target or RNAi targeting c-Myc (Dharmacon) was transfected using
Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. 24 hours after the first transfection, the transfection was repeated, to enhance the knockdown, and after 24h hours the media was replaced and the cells treated as described previously.
TF AM over -expression in C2C12 cells lacking SIRT1
To increase expression of TFAM in C2C12 cells lacking SIRT1, mouse TFAM cDNA cloned into the pIRES2-EGFP (Clontech) backbone with the EGFP cassette replaced with a hygromycin resistance cassette, was transfected using Fugene HD (Roche) in accordance with the manufacturer's instructions. Media was changed 24h post-transfection and the selection of resistant colonies was initiated 48h post-transfection using 100 μg/mL hygromycin as well as 2 μg/mL puromycin to maintain SIRT1 silenced. After selection the cells were maintained and treated as described before with the addition of hygromycin and puromycin to the media.
NAD+ measurement
NAD+ from skeletal muscle was quantified with a commercially available kit (Bio Vision) according to the manufacturer's instructions and as described before (Gomes et al., 2012).
Statistical Analysis
Data were analyzed by a two-tailed Student's t-test. All data are reported as mean + SEM. Statistical analysis was performed using Excel software.
Table 1. Mouse primers used for PCR analysis (SEQ ID NOs: 33-114)
Gene Primer Sequence Ta(sC)
Forward CACCAAACCCACAGAAAACAG
PGC-1 a 60
Reverse GGGTCAGAGGAAGAG AT A A AG TTG
Forward AATGTCCGCAGTGATGTCC
NRF-1 60
Reverse GCCTGAGTTTGTGTTTGCTG
Forward TGAAGTTCGCATTTTGATGGC
NRF-2 60
Reverse CTTTG GTCCTGG C ATCTCTAC
Forward CACCCAGATGCAAAACTTTCAG
TFAM 60
Reverse CTG CTCTTT AT ACTTG CTC AC AG
Forward ATAGAGCCCAAGATCAAGCAG
TFB1 M 60
Reverse TGTAACAGCCTTCCAGTGC
Forward ACCAAAACCCATCCCGTC
TFB2M 60
Reverse TCTGTAAG GG CTCC AAATGTG
Forward GTTCATAGGGTCAGAGGTCAAG
NDUFS8 60
Reverse TCCATTAAGATGTCCTGTGCG
Forward ACCCCTTCTCTGTCTACCG
SDHb 60
Reverse AATGCTCGCTTCTCCTTGTAG
Forward ATCAAGGCACTGTCCAAGG
Uqcrd 60
Reverse TCATTTTCCTGCATCTCCCG
Forward ACCCTAATCTAGTCCCGTCC
COX5b 60
Reverse CAGCCAAAACCAGATGACAG
Forward CATTGGTGATGGTATTGCGC
ATP5a1 60
Reverse TCCCAAACACGACAACTCC
Forward GGACCGAGTTCTGTATGTCTTG
NDUFAB1 60
Reverse AAACCCAAATTCGTCTTCCATG
Forward CTTG AATCCCTG CTCTGTG G
SDHd 60
Reverse AAAGCTGAGAGTGCCAAGAG
Forward TTCCAGTGCAGATGTCCAAG
Uqcrc2 60
Reverse CTGTTGAAGGACGGTAGAAGG
Forward GTTCGTTGCCTACCCTCAC
COX6a1 60
Reverse TCTCTTTACTCATCTTCATAGCCG
Forward CCGTGAGGGCAATGATTTATAC
ATP5b1 60
Reverse GTCAAACCAGTCAGAGCTACC
Forward TGCACCTACCCTATCACTCA
ND1 60
Reverse GG CTC ATCCTG ATC AT AG AATG G
Forward CCCACCCCATATTAAACCCG
Ctyb 60
Reverse GAGGTATGAAGGAAAGGTATAAGGG
Forward CCCAGATATAGCATTCCCACG
COX1 60
Reverse ACTGTTC ATCCTGTTCCTG C
Forward TCCC AATCGTTGTAG CC ATC
ATP6 60
Reverse TGTTGGAAAGAATGGAGTCGG
Forward ATACTAGCAATTACTTCTATTTTCATAGGG
ND2 60
Reverse GAGGGATGGGTTGTAAGGAAG
Forward AAGCAAATCCATATGAATGCGG
ND3 60
Reverse GCTCATGGTAGTGGAAGTAGAAG
Forward C ATC ACTCCTATTCTG CCTAG C
ND4 60
Reverse CC AACTCC ATAAG CTCC ATACC
Forward CC AACTCC ATAAG CTCC ATACC
ND4I 60
Reverse GATTTTGGACGTAATCTGTTCCG
Forward ACGAAAATGACCCAGACCTC
ND5 60
Reverse GAGATGACAAATCCTGCAAAGATG
Forward TGTTGGAGTTATGTTGGAAGGAG
ND6 60
Reverse CAAAGATCACCCAGCTACTACC
Forward AGTTGATAACCGAGTCGTTCTG
COX2 60
Reverse CTGTTGCTTGATTTAGTCGGC
Forward CGTGAAGGAACCTACCAAGG
COX3 60
Reverse CGCTCAGAAGAATCCTGCAA
Forward GCCACAACTAGATACATCAACATG
ATP8 60
Reverse TGGTTGTTAGTGATTTTGGTGAAG
Forward GAACATCAAGTCAGCAACGTG
H IF1 a 60
Reverse TTTGACGGATGAGGAATGGG
Forward CGAGAATGGCTGTGGATGAG
ARNT 60
Reverse GGATGGTGTTGGACAGTGTAG
Forward GCTCCCCAGAACAAGATTACAG
LDHA 60
Reverse TCGCCCTTGAGTTTGTCTTC
Forward TCAAAGAGAACAAGGGCGAG
HK2 60
Reverse AGGAAGCGGACATCACAATC
Forward TGCAGCCCAAGGATCTCTCT
Glutl 60
Reverse CGGCTTGCCCGAGATCT
Forward CCATTCTCTACCGTCCTGTTG
PKM 60
Reverse TCC ATGTAAG CGTTGTCC AG
Forward GGCAGCTTGAGTTAAACGAAC
VEGFa 60
Reverse TGGTGACATGGTTAATCGGTC
Forward GACTGTGAAGATGAGTGACCG
PDK1 60
Reverse CAATCCGTAACCAAACCCAG
Forward AACCTCCGCTTTCATGTAGAG
PGK-1 60
Reverse GACATCTCCTAGTTTGGACAGTG
Forward GATGGCTTTGAGGGTCTGG
PFKM 60
Reverse CTTGGTTATGTTGGCACTGATC
Forward TGTGTTAGGGGACTGGTGGACA mtDNA (RSP1 8) 60
Reverse CATCACCCACTTACCCCCAAAA mtDNA Forward ATAACCGAGTCGTTCTGCCAAT
60
(C0X2) Reverse TTTC AG AG C ATTG G CC AT AG AA
Aging is associated with a decline in mitochondrial homeostasis (Figueiredo et al., 2008; Figueiredo et al., 2009; Hartmann et al., 2011; Lanza and Nair, 2010; Osiewacz, 2011) and consistent with previous reports (Peterson et al., 2012), a progressive, age- dependent decline in OXPHOS efficiency with age in the C57BL/6J mice was observed. By 22 months of age, ATP content was decreased, a trend that was extended even further by 30 months of age (Figure 11 A), while there was an equal decrease in mtDNA content at both ages (FIG. 1 IB). The integrity of mitochondrial DNA in skeletal muscle of 6, 22 and 30 month old mice was quantified using a long-range PCR-mediated detection method (Santos et al., 2006). As expected, mtDNA integrity at 30 months of age was considerably lower than at 6 months, consistent with the mtDNA damage hypothesis of aging.
Surprisingly, mtDNA integrity was not significantly reduced in the 22-month-old mice. (FIG. 11C). This data, together with previous reports (Andziak and Buffenstein, 2006; Andziak et al., 2006; Howes, 2006; Lapointe et al., 2009), suggests that there is a mechanism that is independent of oxidative damage to mtDNA which may be responsible for the decline in OXPHOS observed in 22-month-old animals.
It has been previously shown that there is a correlation with age and a decline in the activity of the OXPHOS complexes, except for complex II, (Boffoli et al., 1994; Bowling et al., 1993; Kwong and Sohal, 2000) which is the only complex of the ETC chain that is composed of only nuclear-encoded subunits (Falkenberg et al., 2007). As a decline in mtDNA content was observed, it was reasoned that the impairment in OXHPOS observed in 22-month-old mice could be due to a specific decline in mitochondrial-encoded ETC complex subunits. A comparison between the skeletal muscle of 22-month- and 6-month- old mice showed that ETC genes encoded by the mitochondrial genome (ND1, Cytb, COX1, ATP6) were all significantly lower at 22 months, whereas those encoded by the nuclear genome (NDUFS8, SDHb, Uqcrcl, COX5, ATP5a) remained unchanged (FIG. 1 ID). By 30 months, however, both the nuclear and the mitochondrial-encoded ETC subunit mRNAs were lower relative to the 6-month-old mice (FIG. 1 ID). Mirroring the effects at the mRNA level, protein levels of the mitochondrial-encoded COX2 gene (cytochrome c oxidase subunit II) was decreased at 22 months but COX4 (Cytochrome c oxidase subunit IV), a nuclear-encoded protein was only slightly lower. By 30 months however, both proteins were equally reduced relative to the young mice (FIG. 1 IE).
NAD+ levels decline with aging in a variety of tissues (Braidy et al., 2011; Massudi et al., 2012), and since NAD+ is an essential co-factor for several important enzymes (Canto and Auwerx, 2011) it was next determined whether the specific decline in mitochondrial- encoded genes observed in 22-month-old mice was related with NAD+ levels. Consistent with other reports (Braidy et al., 2011; Massudi et al., 2012) observed a decline in NAD+ levels was observed in the skeletal muscle of elderly mice (FIG. 1 IF). In mammals NAD+ is generated from nicotinamide in a salvage pathway where nicotinamide
phosphoribosyltransferase (NAMPT) converts nicotinamide to nicotinamide
mononucleotide (NMN) which is then converted to NAD+ by nicotinamide mononucleotide adenylyltransferase (NMNAT) (Canto and Auwerx, 2011). Interestingly, there are three NMNAT isoforms in mammals, each with a specific subcellular localization: NMNAT1 in the nucleus; NMNAT2 in the Golgi apparatus and cytosol; and NMNAT3 in the
mitochondria (Jayaram et al., 2011). The different localizations of the NMNATs allows for the differential regulation of NAD+ levels in different cellular compartments (Falk et al., 2012; Zhang et al., 2009; Zhang et al., 2012). To determine whether changes in
compartmentalized NAD+ levels are responsible for the generation of the imbalance
between nuclear- and mitochondrial-encoded genes the different NMNATs were targeted with shRNA in primary myoblasts. A decline in mitochondrial-encoded genes was observed when NMNATl was knocked down, but not NMNAT2 or NMNAT3 (FIG. 11G-I and FIG. 18A-C). The specific knockdown of NMNATl also resulted in decline in mtDNA content (FIG. 11J) as well as ATP levels (FIG. 1 IK) mirroring the effects observed in 22- old-mice. Together, these data indicate that age- associated impairment in mitochondrial homeostasis is caused, at least in part, by a specific decline in mitochondrial-encoded subunits of the ETC that is driven by decreased nuclear NAD+ levels.
Example 9: Knockout of SIRTl in Adult Mice Causes a Specific Decline in Mitochondrial- encoded Genes Similar to Aging
SIRTl is an NAD+-dependent deacetylase present in the nucleus and known to be tightly regulated by nuclear energetics (Canto and Auwerx, 2012; Yang and Sauve, 2006), and plays an essential role in maintenance of cellular homeostasis (Haigis and Sinclair, 2010). Both SIRTl mRNA and protein levels were not altered in 22-month-old mice (FIG. 18F and 18G), but since a specific decline in mitochondrial-encoded genes was observed which could be driven by modulation of nuclear NAD+ levels, it was hypothesized that this effect could be mediated by alterations in SIRTl activity. To test this an adult-inducible whole body SIRTl knockout mouse strain was utilized (SIRTl KO; Price et al., 2012), circumventing the developmental abnormalities of germline SIRTl KO mice (Cheng et al., 2003; McBurney et al., 2003; Sequeira et al., 2008). Interestingly, SIRTl KO mice have a decline in cellular ATP levels (FIG. 12A) as well as a decline in mtDNA content (FIG. 12B), similar to what was observed in the skeletal muscle of 22-month-old mice (FIG. 11). Surprisingly, there was no difference in mitochondrial mass between SIRTl KO and wild- type animals, as indicated by comparing the cross-sectional area and number of
mitochondria in electron micrographs (FIG. 12C). Given that SIRTl regulates PGC-la activity, a master regulator of the mitochondrial biogenesis program, a general decrease in the expression of ETC components in the SIRTl KO mice was expected. However, the mRNA levels of all 13 mitochondrial-encoded ETC genes, as well as the 2 rRNAs encoded by the mitochondrial genome, were reduced in the SIRTl KO mice compared to wild-type controls (FIG. 12D and FIG. 19C) without a decrease in the expression of any of the
nuclear-encoded components (FIG. 12D). Consistent with this, protein levels of the mitochondrial-encoded COX2 subunit were significantly decreased but the nuclear-encoded COX4 was unaltered (FIG. 12E). The specific loss of mitochondrial subunits without a change in nuclear encoded subunits suggests that Complex II of the ETC, should be less affected by SIRTl deletion than other ETC complexes. Indeed, the activity of Complex II (SDH) in the KO mouse was not significantly different from the wild-type, whereas the activity of Complex IV (COX) was significantly decreased (FIG. 19A and 19B). This defect is not restricted to skeletal muscle as a specific decline in mitochondrial-encoded genes was also observed in the heart of SIRTl KO mice (FIG. 19G). However, this effect of SIRTl does not seem to be systematic, as there was not this difference in WAT and brain, but rather a general decline in both nuclear- and mitochondrial-encoded genes in these tissues (FIG. 19D-F). Overexpression of the nuclear specific NMNAT1 induces mitochondrial-encoded genes in a SIRTl -dependent manner, as shown by the inability of NMNAT1 to induce the expression of mitochondrial-encoded genes in primary myoblasts lacking SIRTl. These data suggest that the regulation of mitochondrial homeostasis via nuclear energetics seen in aging may occur through SIRTl (FIG. 12F).
Maintenance of mitochondrial function plays a critical role in maintenance of cellular homeostasis and muscle health (Johnson et al., 2013; Powers et al., 2012). As SIRTl KO animals present with altered mitochondrial homeostasis it was next determined whether muscle physiology was also altered. In line with the impairment in OXPHOS capacity, a reduction in markers of slow twitch oxidative muscle fiber marker MyHCIIa was also observed, as was a concomitant increase in fast twitch glycolytic fibers as evidenced by increase in MyHCIIb content in the gastrocnemius of the SIRTl KO mice (FIG. 12G). In addition, the SIRTl KO mice had a striking increase in the muscle atrophy markers, (Atrogin-1 and MuRFl) (FIG. 12H), (Gumucio and Mendias, 2013), as well as, increased expression of inflammatory markers (IL-6, IL-18 and Nlrp3) (FIG. 19H). A decline in insulin signaling pathway in the soleus of SIRTl KO animals under basal conditions was also observed, as shown by a pronounced decline in phosphorylation of AKT and IRS1. Similarly to what was observed under basal conditions, the soleus from SIRTl KO mice demonstrated decreased phosphorylation of both AKT and IRS1 in response to insulin as compared to WT mice (FIG. 121).
Together, these data demonstrate that loss of SIRTl mirrors the specific decline in mitochondrial-encoded genes, disruption of mitochondrial homeostasis and negatively impacts muscle health similar to what occurs with age.
Example 10: SIRTl Regulates Mitochondrial Homeostasis Through PGC- la-Dependent and Independent Mechanisms
SIRTl has been previously shown to regulate mitochondrial homeostasis under low energy conditions, by de-acetylating the transcriptional co-activator PGC- la to activate mitochondrial biogenesis (Gerhart-Hines et al., 2007; Rodgers et al., 2005). Consistent with this, it was observed that SIRTl KO animals failed to upregulate ETC genes in response to fasting (FIG. 20A). However, as shown in FIG. 12, under basal conditions a general effect of SIRTl in the mitochondrial biogenesis program and mitochondrial mass was not observed, but rather a specific decline in mitochondrial-encoded genes only, suggesting that SIRTl might regulate mitochondrial-encoded genes independently of PGC- la. To test this, the expression of nuclear- and mitochondrial-encoded ETC genes in primary myotubes from PGC-Ια/β KO mice and the effect of SIRTl in this context was examined. As expected, the ability of SIRTl to induce nuclear-encoded ETC genes was absent in the PGC-Ια/β KO myotubes (FIG. 13A). However, overexpression of SIRTl induced the mitochondrial ETC genes even in the absence of PGC- la and PGC-Ιβ (FIG. 13A), demonstrating, for the first time, that SIRTl can regulate mitochondrial gene expression independently of the canonical PGC- la pathway.
Using myotubes isolated from the inducible SIRTl KO mice (Hubbard et al., 2013), time course experiments to determine when mitochondrial homeostasis is disrupted were performed. The results demonstrated that a specific decline in mitochondrial-encoded genes (FIG. 13B), mtDNA content (FIG. 20B) and a decrease in mitochondrial membrane potential occurs as early as 12h after excision of SIRTl by the addition of 2- Hydroxytamoxifen (OHT) (FIG. 20C). These defects occurred without having any effect on either nuclear-encoded genes (FIG. 13B) or mitochondrial mass (FIG. 13C), resembling the effects observed in the skeletal muscle of SIRTl KO mice under basal conditions (FIG. 12). Interestingly, 48hr after excision there was a decline in both nuclear- and
mitochondrial-encoded genes, mitochondrial mass and a more pronounced decrease in
mitochondrial membrane potential (FIG. 13B-C and FIG. 20B-C). This data suggests that loss of SIRT1 results in a biphasic disruption of mitochondrial homeostasis, possibly via two distinct mechanisms.
Regulation of PGC-l activity is complex and depends on many factors (Fernandez - Marcos and Auwerx, 2011). SIRT1 regulates PGC-la acetylation status in conditions of low energy when there is a need for increased mitochondrial metabolism, while under basal conditions PGC-la acetylation status is primarily regulated by GCN5 (Dominy et al., 2012; Fernandez-Marcos and Auwerx, 2011). Phosphorylation of PGC-la by AMPK- activated kinase (AMPK) can also play an important role in regulating its activity. AMPK
phosphorylation of PGC-la on T177 and S538 (Jager et al., 2007) is required for SIRT1- mediated deacetylation and activation of PGC-la (Canto et al., 2009). This raises the interesting possibility that the biphasic disruption in mitochondrial homeostasis upon SIRT1 deletion is mediated by AMPK activity. Consistent with this idea AMPK activity (measured by T172 phosphorylation) was not altered up to 24h of OHT treatment (FIG. 13D). However, at 48h of treatment with OHT, the time point where SIRT1 effects on mitochondrial biogenesis were observed (FIG. 13B and 13C), AMPK phosphorylation was markedly increased (FIG. 13D). Similarly, AMPK activity was unchanged in the skeletal muscle of SIRT1KO mice under fed conditions and in 22-month-old mice, but markedly increased by fasting (FIG. 20D and 20E). These experiments suggest that AMPK activity might be what causes the biphasic response between one pathway versus the other in response to SIRTl loss
To further explore this idea, AMPK activity was blocked with an AMPK dominant negative adenovirus (AMPK-DN), which efficiently inhibited phosphorylation of the AMPK target ACC, (FIG. 13F). AMPK-DN blocked the decrease in nuclear-encoded genes observed 48h after treatment with OHT, but not the decline in mitochondrial-encoded genes (FIG. 13G). In order to determine if this AMPK affect is through PGC-la PGC-la/β KO myo tubes were reconstituted with either a WT PGC-la or an AMPK insensitive version of PGC-la (PGC-la T177A/S538A) (FIG.20F). Reconstitution with either WT or the mutant version of PGC-la increased both nuclear- and mitochondrial-encoded genes (FIG. 13E). Inhibition of SIRTl function for 48h with the specific inhibitor EX-527 decreased both nuclear- and mitochondrial-encoded genes in the presence of WT PGC-la while only the mitochondrial-encoded genes decreased in the presence of the PGC-la
mutant (FIG. 13E). Together, these results demonstrate that AMPK determines whether SIRTl utilizes a PGC- la-dependent or independent mechanism to impact mitochondrial homeostasis
To provide additional clues about the molecular basis of this novel PGC-l - independent regulation of mitochondrial-encoded genes by SIRTl, gene expression patterns were analyzed from skeletal muscle of SIRTl KO mice. The only gene that changed which is involved in the mtDNA transcription was TFAM (FIG. 13H and FIG. 20G). Consistent with the in vivo findings, TFAM promoter activity was 50% lower in primary myoblasts isolated from SIRTl KO mice than from wild-type littermates (FIG. 131). TFAM is necessary for mtDNA stability, replication, and transcription (Falkenberg et al., 2007), thus it was reasoned that if the specific decline in mitochondrial-encoded genes in cells lacking SIRTl is caused by a decrease in TFAM, restoring the expression levels of TFAM should correct this effect and restore mitochondrial homeostasis. Restoring TFAM levels in primary myoblasts previously treated with OHT for 24h to induce SIRT1KO (FIG. 13J), was sufficient to rescue mitochondrial-gene expression levels (FIG. 13K) and ATP levels (FIG. 13L). In addition, the decline in mitochondrial biogenesis caused by prolonged loss of SIRTl (48h of treatment with OHT) was completely absent in cells where TFAM levels where maintained for that period of time (FIG. 13K and 13L) and accordingly, AMPK activity was also not induced (FIG. 13M). Interestingly, a 2-3 fold overexpression of TFAM in primary myoblasts (FIG. 20H), not only lead to the predictable increase in the expression of mitochondrial-encoded genes and mtDNA content (FIG. 201 and 20 J) but also to a similar increase in nuclear-encoded genes (FIG. 201) and as a result a global increase in OXPHOS activity and ATP production (FIG. 20K). Together, these results show that TFAM is the limiting factor that is depleted in SIRTl KO mice causing a specific decline in mitochondrially-encoded genes and, as a consequence, impairing mitochondrial
homeostasis.
Example 11: SIRTl Regulates Mitochondrial Homeostasis through HIF-l
Next, experiments were performed to better understand how SIRTl regulates TFAM independently of PGC-Ι /β. The skeletal muscle in SIRTl KO animals have increased type II glycolytic fibers (FIG. 12G) and expectedly gene expression analysis
demonstrated increased levels of genes involved in glycolysis, including hexokinase 2 (HK2), pyruvate kinase (PKM), phosphofructokinase (PFKM) and lactate dehydrogenase A (LDHA) (FIG. 14A and 14B). Accordingly, SIRT1 KO mice also presented increased lactate levels in the skeletal muscle (FIG. 14C), reminiscent of Warburg remodeling of metabolism in cancer cells.
The metabolic remodeling characteristic of cancer cells is in part mediated by the stabilization of the transcription factor HIF-Ια (Majmundar et al., 2010). The similarity between the gene expression of muscle from the SIRT1 KO mice and of cancer cells prompted testing as to whether the specific decline in mitochondrial-encoded genes and consequent disruption of OXPHOS functionality might be due to a pseudohypoxic response and HIF-Ια stabilization. As shown in FIG. 14D, the levels of HIF-Ια were considerably higher in the KO tissue, demonstrating that loss of SIRT1 leads to HIF-Ια accumulation. Moreover, the SIRT1 KO animals exhibited a gene expression pattern reminiscent of cancer cells, including upregulation of HIF-Ι target genes PGK-1, Glutl, PDK1 and VEGFa (FIG. 21 A). Moreover, primary myoblasts also demonstrated increased HIF-Ια protein levels (FIG. 14D), as well as the activity of the hypoxia response element (HRE), despite being cultured in normoxic conditions (FIG.21B). Consistent with the idea that
manipulation of cellular energetics by decreasing NAD+/NADH ratio with lactate treatment also induces HIF-Ια protein stabilization in primary myoblasts (FIG. 21D and 21E). To test if stabilization of HIF-Ι is sufficient to induce the observed decline in mitochondrial-encoded ETC genes similar to the effect of SIRT1 deletion in the skeletal muscle, Eglnl KO (PHD2) inducible- whole body KO mouse were used (Minamishima et al., 2008). As expected, upon induction of Eglnl deletion HIF-Ια was stabilized in the skeletal muscle (FIG. 14E). Strikingly, Eglnl deletion and consequent HIF-Ια stabilization resulted in a specific decline in mtDNA content and decreased expression of mitochondrial- encoded ETC genes but not the nuclear-encoded components, paralleling the effect of SIRT1 deletion in the skeletal muscle (FIG. 14F and 14G). Moreover, treatment of PGC- l /β knockout myo tubes with dimethyloxaloylglycine (DMOG), a HIFa prolyl hydroxylase inhibitor that stabilizes HIF-Ια protein (FIG. 21C), induced a decline in the expression of mitochondrial-encoded genes compared to vehicle control (FIG. 14H). Overexpression of
SIRT1 in PGC-Ι /β knockout myo tubes induced the expression of mitochondrial ETC genes (as shown above) but the induction was completely blocked by DMOG (FIG. 14H).
Furthermore, increasing NAD+ levels by supplementation with pyruvate in the PGC-Ι /β KO cells increased mitochondrial-encoded genes (FIG. 2 IF). Interestingly, the NAD+ mediated increases in mitochondrial-encoded genes can be inhibited by stabilizing HIF-l with DMOG (FIG. 141 and FIG. 21F). SIRTl overexpression in vivo induces an increase in OXPHOS capacity in the skeletal muscle by increasing the mitochondrial biogenesis program (Price et al., 2012). Therefore, it was next determined whether HIF-la
stabilization in the whole body SIRTl overexpressing mice (SIRTl-tg) (Price et al., 2012) would prevent this increase. SIRTl-tg mice were treated with vehicle or DMOG to increase HIF-la (FIG. 21G) and this abolished the increase in the expression of
mitochondrial-encoded genes, as well as, the increase in ATP levels observed in SIRTl-tg mice (FIG. 21H and 211).
To dissect which one of the HIFa proteins was responsible for this increase, constitutively stabilized HIF-la or HIF-2a (DPA) were introduced into C2C12 myoblasts (FIG. 141). Expression of the HIF-la mutant caused a specific decline in the expression of mitochondrial-encoded genes similar to Eglnl KO and treatment with DMOG (FIG. 14J) and also prevented SIRTl overexpression from increasing the expression of mitochondrial- encoded ETC subunits and mtDNA (FIG. 14K and FIG. 21J). Importantly, cells expressing a mutant allele of the related factor HIF-2a did not alter the gene expression pattern of both nuclear and mitochondrial-encoded ETC genes and had no effect on the ability of SIRTl to promote the expression of mitochondrial ETC genes or mtDNA (FIG. 14L-Kand FIG. 21J), indicating that this effect of SIRTl is specific to HIF-la.
Since HIF-la stabilization was sufficient to induce a specific decline in
mitochondrial-encoded genes, it was next determined whether it was also necessary.
Knockdown of HIF-la in primary myoblasts lacking SIRTl (FIG. 14L) prevented the disruption of mitochondrial homeostasis, as evidenced by the maintenance of mtDNA content (FIG. 140) and ATP levels (FIG. 14P). In addition, impairment of the
transcriptional activity of the HIF complex by knockdown of ARNT did not impair the effects of SIRTl inhibition with EX-527 (FIG. 21K-N), indicating that the effect of HIF-la on mitochondrial homeostasis in response to SIRTl is not mediated through changes in the HIF- la/ ARNT transcription complex, but rather HIF- la's ability to regulate the activity of other transcriptional mediators. These data combined demonstrate that the effects of SIRTl
in the specific regulation of mitochondrial-encoded genes and maintenance of
mitochondrial homeostasis are mediated by HIF-l both in vitro and in vivo.
Example 12: HIF-la Stabilization Induced by Loss of SIRT1 is independent of retrograde signaling and HIF-la Deacetylation and Mediated by Regulation of VHL Levels
SIRT1 has been implicated in the regulation of HIF-la transcriptional activity (Lim et al., 2010), but not protein stabilization. Mitochondrial homeostasis plays an important role in the regulation of HIF-la protein stability through generation of ROS from complex III (Bell et al., 2007; Chandel et al., 2000) therefore it was determined whether ROS and retrograde signaling were the cause of HIF-la stabilization in response to loss of SIRTl. Time course experiments demonstrate that ROS levels are only upregulated 24h after SIRTl deletion by OHT (FIG. 22B), while the impairment in mitochondrial homeostasis was observed at 12h (FIG. 13A and FIG. 20B-C) and HIF-la stabilization at 6h (FIG. 15J). This data indicates that increased ROS upon SIRTl deletion are not the cause of HIF-la stabilization but rather a consequence of impaired mitochondrial homeostasis. Further supporting this idea, primary myoblasts depleted of mitochondrial DNA (rhoO), which are unable to produce ROS and signal to the nucleus (Chandel and Schumacker, 1999), showed the same effects upon loss of SIRTl as their parental control cells, indicating that the effects observed are also not due to retrograde signaling (FIG. 22A). HIF-la stability was also previously reported to be regulated by acetylation, particularly acetylation of the lysine 709 (Geng et al., 2011). Since SIRTl is a deacetylase it is possible that it may regulate HIF-la protein stability via K709 deacetylation. To explore this possibility we K709 was mutated to glutamine (acetylation mimetic) or arginine (non acetylated form), as well as, K674. The latter mutations serve as a positive control since this residue is deacetylated by SIRTl but does not affect HIF-la stability
(Lim et al., 2010). Under control conditions, stabilization of HIF-la in any of the mutants was not detected. Moreover, SIRTl deletion did not affect the mutants (FIG. 22C), suggesting that SIRTl does not regulate HIF-la protein stability acetylation.
HIFa protein abundance is tightly regulated by an oxygen-dependent proteasomal degradation mechanism, involving the Von Hippel-Lindau protein (VHL) E3 ubiquitin ligase recognizing hydroxylated proline residues. (Kaelin, 2008). To determine whether
SIRTl deletion impacts HIF-Ι stability through proline hydroxylation an antibody specific for HIF-Ι proline hydroxylation was used. When HIF-Ια protein was stabilized with MG132 no differences in hydroxylation were found between control cells and cells lacking SIRTl (FIG. 22D), indicating that SIRTl does not regulate HIF-Ια hydroxylation.
Interestingly, both VHL protein and mRNA levels were reduced by 50% in the skeletal muscle of SIRTl KO mice (FIG. 15A and 15C). Conversely, in the skeletal muscle of SIRTl-tg mice VHL protein and mRNA levels were increased (FIG. 15B and 15D), demonstrating that SIRTl regulates VHL abundance in the skeletal muscle. Consistent with HIF-Ια stabilization being caused by decreased VHL in the absence of SIRTl, HIF-2a was also stabilized in both skeletal muscle and primary myoblasts upon SIRTl deletion
(FIG. 22E). However HIF-2a target genes were not upregulated (FIG. 22F), suggesting that under these conditions HIF-2a is not transcriptionally active. Interestingly, an effect on VHL promoter activity upon SIRTl deletion was not observed, suggesting that the differences in VHL mRNA are independent of transcription (FIG. 15E and 15F). Consistent with the data demonstrating that decreased NAD+ during aging drives a pseudohypoxic response by inducing HIF-Ια stabilization, knockdown of NMNAT1 in primary myoblasts lead to a decline in VHL mRNA and protein levels (FIG. 15G and 15H) and consequent HIF-Ια stabilization. VHL is also decreased in the skeletal muscle of 22- month-old mice but not 6 month-old mice. To determine causality, time course
experiments were performed. As shown in FIG. 15 J, VHL protein levels decline as earlier as 6h upon SIRTl deletion, coinciding with the accumulation of HIF-Ια. In addition, TFAM levels decrease 12h after SIRTl deletion (FIG. 15J), further strengthening the idea that loss of SIRTl causes a decrease in TFAM and a specific decline in mitochondrial- encoded genes due to HIF-Ια stabilization. As VHL levels were correlated with HIF-Ια stabilization in several of the systems and animal models utilized, next it was determined whether decreasing VHL levels is necessary for SIRTl to induce HIF-Ια stabilization. VHL was knocked down in primary myoblasts with and without SIRTl (FIG. 15K). SIRTl rescue in the SIRT1KO cells no longer reversed HIF-Ια accumulation as in cells with VHL (FIG. 15L). Accordingly, knockdown of VHL significantly reduces the ability of SIRTl to induce TFAM promoter activity and consequently the expression of mitochondrial-encoded genes (FIG. 15M and
N). Together, these results show that SIRT1 regulates VHL to impact HIF-Ια protein stability.
Example 13: c-Myc Links SIRT1 and HIF-l to the specific decline in mitochondrial- encoded gene expression
A major transcriptional mediator that has been shown to aid cancer cells to proliferate under hypoxic conditions is the oncogene c-Myc (Gordan et al., 2007). This is partially due to a crosstalk between HIF-Ια and c-Myc, which together fine-tune the adaptive responses to the hypoxic environment. Interestingly, some reports suggest that c- Myc controls mitochondrial biogenesis (Kim et al., 2008; Li et al., 2005) and that primary hepatocytes from c-Myc knockout mice have reduced mitochondrial mass (Li et al., 2005). Despite these reports suggesting the role of c-Myc in the regulation of mitochondrial biogenesis, the relevance of c-Myc aging or in the development of aging-related diseases, other than cancer, remains unknown. Based on the fact that HIF-Ια regulates c-Myc independently of its transcriptional activity (Koshiji et al., 2004; Koshiji et al., 2005), it was postulated that c-Myc might be the factor linking SIRT1 and HIF-Ια to the specific regulation of mitochondrial-encoded ETC genes. Consistent with this, loss of SIRTl in primary myoblasts lead to a 50% decrease in c-Myc reporter activity, as early as 6h after the deletion was induced (FIG. 16A).
Additionally, knockdown of c-Myc (FIG. 16B) completely blocked the ability of SIRTl to increase mtDNA, the expression of mitochondrial-encoded ETC genes (FIG. 16C and 16D). Conversely, in C2C12 myoblasts treated with EX-527, overexpression of c-Myc (FIG. 23 A) restored the level of mtDNA, mitochondrial ETC mRNA, and increased cellular ATP levels (FIG. 23B-D). c-Myc was previously shown to directly bind to the TFAM promoter in cancer cells
(Li et al., 2005) and consistent with this report, it was observed that knockdown of c-Myc in primary myoblasts leads to decreased TFAM promoter activity (FIG. 16E). Mutation of the c-Myc consensus sequence, CACGTG, present in the TFAM promoter decreased the promoter activity by about half of the full length promoter (FIG. 16F). Importantly, mutation of c-Myc binding site blocks the effect of c-Myc in the TFAM promoter and does not disrupt the activity of the TFAM promoter in response to PGC-Ια overexpression (FIG.
16F and 16G). Next it was tested whether c-Myc binding site was required for SIRTl's ability to induce TFAM promoter activity. Overexpression of SIRT1 in primary myoblasts lead to an increase in the full length TFAM promoter activity, however disruption of c-Myc binding site was sufficient to completely prevent the ability of SIRT1 to induce TFAM promoter activity (FIG. 16H). Furthermore, chromatin immunoprecipitation experiments showed that c-Myc binds to the TFAM promoter in primary myoblasts and that this binding is markedly reduced upon loss of SIRT1 induced by OHT (FIG. 161 and 1J). Interestingly, stabilization of HIF-l with DMOG in primary myoblasts reduces the full length TFAM promoter activity (FIG. 23E) and does not have an additive effect in the absence of the c- Myc binding site (FIG. 23E and 23F). Chromatin immunoprecipitation experiments demonstrate that HIF-la does not bind to the TFAM promoter (FIG. 161 and 16J), however it can bind to its known target LDHA upon SIRT1 loss (FIG. 23G and 23H). These data suggests that HIF-la regulates c-Myc binding to the TFAM promoter, to mediate SIRTl regulation of mitochondrial homeostasis independently of PGC-Ια. To test if indeed SIRTl's effects on the activity of the TFAM promoter require HIF-la/c-Myc, we used primary myoblasts where HIF-la was knockdown (FIG. 140). Similarly to what was observed before (as described above), c-Myc binds to the TFAM promoter and its binding is dramatically decreased upon SIRTl deletion with OHT, which also correlated with a decrease in promoter activity (FIG. 16K and 16L). However, in cells lacking HIF-la loss of SIRTl does not lead to a reduction in c-Myc binding to the TFAM promoter and consequently no alteration in the TFAM promoter activity was observed (FIG. 16K and 16L).
Together these data demonstrate that HIF-la inhibits TFAM transcription by interfering with c-Myc, providing the first clear link between HIF-la and the regulation of mitochondrial-encoded ETC subunits. The data also demonstrate, for the first time, that SIRTl can regulate mitochondrial homeostasis via a PGC-la/p-independent mechanism that involves Hif-ΐα and c-Myc.
Example 14: Caloric Restriction (CR) and NAD+ Supplementation Protects Against Pseudohypoxic Induced Decline in Mitochondrial Homeostasis and Muscle Health During Aging
There are conflicting reports about the relationship between CR and mitochondrial homeostasis (Boily et al., 2008; Civitarese et al., 2007; Cohen et al., 2004; Hancock et al.,
2011; Kaeberlein et al., 2005; Lopez-Lluch et al., 2006). In male C57BL/6 mice, it was found that instituting a 30-40% reduction in caloric intake from 6 weeks to 22 months of age prevents an age-associated decline in NAD+ levels, ATP levels and COX activity (FIG. 24A-C). CR also prevented the decrease in mtDNA and mitochondrial-encoded ETC components (FIG. 23D-F). CR was also able to prevent the decline in VHL protein levels and consequent increase in HIF- la protein levels in the muscle of 22-month-old mice (FIG. 24G), suggesting that aging induces a pseudohypoxic state that can be reversed by an intervention that activates SIRT1.
It was shown above that decreased levels of NAD+ associated with age invokes a SIRT1 dependent pseudohypoxic response that disrupts mitochondrial homeostasis.
Therefore, artificially boosting NAD+ levels in old mice should restore mitochondrial homeostasis by reducing HIF- la levels and restoring the expression of mitochondrial- encoded ETC components. Administration of NMN, a compound recently shown to increase NAD+ levels in a variety of tissues (Yoshino et al., 2011), to 6- and 22-month-old C57BL/6J mice for one week increased levels of cellular NAD+ in both the young and old mice were by 2-fold. The boost in the treated 22-month-old mice resembled the untreated 6-month-olds (FIG. 17A). NMN treatment restored oxidative phosphorylation capacity as demonstrated by an increase in ATP levels and COX activity (FIG. 17B and FIG. 24H), as well as the expression of mitochondrial-encoded genes in old mice (FIG. 17C). Moreover, NMN treatment also reversed the age-induced decline in VHL and consequent
accumulation of HIF- la (FIG. 17D), as well as suppressed the increase in lactate levels in the skeletal muscle (FIG. 17E). Interestingly, in Eglnl KO mice treated with NMN did not restore mitochondrial-encoded genes and ATP levels in the skeletal muscle when compared to WT controls, indicating that HIF- la protein stabilization inhibits the effects of NMN (FIG. 17F and 17G). Coming full circle, if the effects that were observed with NMN are due to increase in NAD+ specific to the nucleus and reestablishment of proper nuclear energetics as our initial experiments suggested (FIG. 11), then impairment of NAD+ production from NMN specifically in the nucleus should prevent NMN effects on mitochondria. In primary myoblasts, knockdown of NMNAT1 completely abolishes the ability of NMN to induce the expression of mitochondrial-encoded genes (FIG. 17H), demonstrating that indeed these effects are mediated by changes in nuclear energetics. In line with this, treatment of the inducible SIRTl KO mouse with NMN showed that the
ability of NMN to increase mitochondrial-encoded genes in the skeletal muscle is lost in animals lacking SIRTl (FIG. 171), demonstrating that SIRTl is the mediator between changes in nuclear energetics and consequent alterations in mitochondrial homeostasis.
As a functional test of whether the effects of NMN in mitochondrial homeostasis were also relevant for global muscle health, several markers were evaluated. Muscle wasting and inflammation are markers of muscle aging and, as expected an increase in the muscle wasting markers Atrogin-1 and MuRFl (FIG. 17J) and in the expression of inflammation markers in the skeletal muscle of old mice were observed (FIG. 24J).
Strikingly, NMN treatment completely reversed these markers (FIG. 17J and FIG. 24K), indicating that restoring NAD+ levels can improve age-related muscle wasting and inflammation. In addition, NMN was also able to reverse age-induced insulin resistance in the skeletal muscle, as shown by its ability to restore insulin signaling in the soleus of old mice treated with NMN via the increasing the phosphorylation of two important
downstream targets of the insulin receptor, AKT and IRS-1 (FIG. 17L). Taken together, these results provides convincing evidence that restoring NAD+ levels in old animals is sufficient to restore mitochondrial homeostasis in the skeletal muscle through restoration of nuclear energetics and consequent SIRTl -mediated suppression of a pseudohypoxic, as well as to improve global muscle health.
DISCUSSION
Deregulation of mitochondrial homeostasis is one of the hallmarks of aging in diverse species such as yeast and humans. In mammals, disruption of mitochondrial homeostasis is believed to be an underlying cause of aging and the etiology of numerous age-related diseases (Coskun et al., 2011; de Moura et al., 2010; Figueiredo et al., 2009; Finsterer, 2004; Sahin et al., 2011; Schulz et al., 2007; Wallace et al., 2010). Despite its importance, there is still a great deal of controversy as to why age induces the disruption of mitochondrial homeostasis and how this process might be slowed or reversed.
One of the more surprising findings in described herein was that SIRTl can regulate mitochondrial function independently of the canonical PGC-Ι /β pathway. The data demonstrates that SIRTl regulates mitochondrial homeostasis through two distinct pathways that are activated in distinct energetic states, and suggests that SIRTl is involved
in fine-tuning mitochondrial metabolism to maintain cellular homeostasis. Under normal cellular energetic conditions, SIRT1 regulates mitochondrial homeostasis through the PGC- Ι /β-independent regulation of specifically mitochondrial-encoded genes driven by HIF- l /c-Myc. However, under conditions of low energy, such as fasting and prolonged ETC decline, SIRT1 deacetylates and activates PGC-Ι to induce fatty acid oxidation and promote mitochondrial biogenesis (Gerhart-Hines et al., 2007) (FIG. 17M).
Mechanistically, the ability of SIRT1 to induce one pathway versus the other is related to AMPK activity and its ability to phosphorylate PGC-Ι (Canto et al., 2009). Indeed, it was found that in conditions of energetic decline AMPK is active and signals PGC-Ι to be deacetylated by SIRT1 through phosphorylation, thus activating the mitochondrial biogenesis program. However, under normal energetic conditions the phosphorylation signal is not present as AMPK is not active, thus SIRTl's effects on mitochondria are mainly mediated by the PGC-l /p-independent pathway.
The ability of SIRT1 to regulate mitochondrial homeostasis independently of PGC- 1 /β in SIRTl KO and elderly mice was traced to an accumulation of HIF-Ι in the skeletal muscle. This seems to occur in aerobic conditions, and it was demonstrated that this accumulation impairs OXPHOS and mitochondrial homeostasis in vitro and in vivo. Both CR and NMN reduced the level of HIF-Ια in muscle, coincident with improvements in mitochondrial homeostasis. Conversely, stabilization of HIF-Ια by genetic or
pharmacological means induced an imbalance between nuclear- and mitochondrial-encoded ETC genes, and prevented the ability of SIRTl to induce expression of mitochondrial- encoded genes. Different studies have previously linked SIRTl to the hypoxic regulation of HIF-Ια. One study demonstrated that inhibition of SIRTl increases acetylation of HIF- la, thereby increasing its transcriptional activity (Lim et al., 2010), while another study, has reported that SIRTl inhibition reduces the accumulation and transcriptional activity of HIF- la protein in hypoxic conditions (Laemmle et al., 2012). Importantly, it was shown herein that deletion of SIRTl in vivo leads to an increase in HIF-la protein levels in skeletal muscle under normal oxygen conditions, indicating that under normal physiological conditions SIRTl acts as a negative regulator of HIF-la protein stability. Interestingly it was demonstrated that the regulation of HIF-la protein levels goes awry during aging. This occurs through the ability of SIRTl to regulate mRNA of the E3 ubiquitin ligase VHL that is responsible for tagging HIF-la for degradation. The data provided herein indicates that
SIRT1 does not alter VHL promoter activity, thus suggesting that this change likely due to regulation of mRNA stability. However, further studies will be necessary to determine how SIRT1 regulates VHL mRNA levels in the skeletal muscle. Moreover, VHL also targets to proteasomal degration HIF-2a in a similar manner to HIF-Ι . Interestingly, in addition to regulating HIF-Ια (Lim et al., 2010), SIRT1 has also previously reported to regulate HIF- 2a (Dioum et al., 2009). The expression of HIF-2a (but not HIF-la) is regulated by PGC- l and plays an important role in fiber type switching of skeletal muscle (Rasbach et al., 2010). The metabolic and fiber type changes that were observed are seemingly distinct from this pathway because the ability of SIRT1 to increase expression of mitochondrial genes or mtDNA content does not require PGC-Ι , nor is it affected by stabilization of HIF-2a.
HIF-l was previously associated with changes in mitochondrial biogenesis under conditions of obesity. High fat diet feeding induced the expression of HIFla as well as levels of mtDNA in liver (Carabelli et al., 2011). HIF-la was also reported to be stabilized in white adipose tissue in animal models of obesity, but upregulation of HIF-la was found to be correlated with a decline in mitochondrial related genes in this tissue (Krishnan et al., 2012). Moreover, in the liver and macrophages of the long lived Mclk+/- mouse HIF-la was found to be upregulated (Wang et al., 2010). The results herein also demonstrated that different tissues have different responses, suggesting that the role of HIF-la in the regulation of mitochondrial homeostasis is tissue specific, possibly acting in accordance to the metabolic specificities of each tissue.
This metabolic state in the muscle of the SIRT1 KO and 22-month-old mice is referred to herein as pseudohypoxia, in part because the pattern of gene expression is similar to the effects of hypoxia and both involve HIF-la and c-Myc. The other compelling reason is that the increase in HIF-la and the shift towards non-oxidative pathways of the myoblasts occurs and persists even in the presence of normal levels of oxygen, similar to what has been described previously as a pseudohypoxic state (Sanders, 2012; Williamson et al., 1993). As far as the inventors are aware, this is the first report to suggest that pseudohypoxia-induced metabolic reprogramming is triggered in post-mitotic cells during aging and is responsible for the age-related disruption in mitochondrial homeostasis and raises the possibility that this mechanism might also be relevant to the metabolic reprogramming characteristic of cancer cells.
The finding that aging leads to a pseudohypoxic response driven by decline in nuclear energetics is particularly interesting since numerous studies have examined the role of HIF-Ι in the regulation of life span in C. elegans. Although these studies clearly point to HIF-Ι as a player in the aging process, its role is still a matter of debate with different lifespan outcomes being reported (Leiser and Kaeberlein, 2010). The data herein indicate that one possible explanation for the disparity is that moderate Hif-1 overexpression induces mitochondrial dysfunction, which, under certain conditions, has been shown to promote lifespan in the worm (Dillin et al., 2002; Felkai et al., 1999; Feng et al., 2001; Gallo et al., 2011). In this study a series of genetic and pharmacological experiments are presented that point to HIF-1 a -mediated inhibition of c-Myc as a cause of the specific decline in mitochondrial-encoded genes in the skeletal muscle. Together these findings clearly show that in addition to SIRTl 's ability to regulate PGC-Ι , it also regulates mitochondrial homeostasis by preventing the HIF-1 a- mediated inhibition of c-Myc and TFAM
expression, thereby providing the first link between HIF-1 a/c-Myc and the disruption of mitochondrial homeostasis in the skeletal muscle during aging. Recent reports have shown that c-Myc and SIRTl regulate each other via feedback loops, whether these are positive or negative loops is still a question of debate as different groups have reached different conclusions (Mao et al., 2011; Marshall et al., 2011; Menssen et al., 2012; Yuan et al., 2009). SIRTl is known to directly regulate c-Myc transcriptional activity in cancer cells, either by deacetylation of c-Myc (Menssen et al., 2012) or by binding c-Myc and promoting its association with Max (Mao et al., 2011). However, under these conditions the effect of c-Myc on the TFAM promoter driven by SIRTl requires HIF-Ια, but a direct effect of SIRTl on c-Myc under different condition cannot be excluded and as such additional studies will be required to elucidate how these feedback loops affect the regulation of mitochondrial-encoded genes.
These observations beg the question: why does aging produce a pseudohypoxic response that causes a selective loss of mitochondrial-encoded genes? On one hand, the fact that two different genomes encode different subunits of critical multi-protein complexes certainly demands tight coordination between the two genomes (Wallace et al.,
2010), as such one can speculate that increased survival at advanced ages is simply beyond the force of natural selection, so that aged organisms simply succumb to entropy. On the
other hand, a more nuanced explanation is based on the concept of antagonistic pleiotropy, the idea that adaptations that help young individuals survive can be deleterious later in life (Williams and Day, 2003). In this scenario, the SIRT 1 -HIF- 1 a-Myc-TFAM pathway evolved to ensure optimal mitochondrial function in response to nuclear energetics and oxygen content. In later life, however, the chronic activation of a pseudohypoxic response and the resulting disruption of normal metabolism, may result in accelerating age-related diseases. In line with this concept, disturbance in mitochondrial homeostasis during development in C.elegans extends lifespan (Dillin et al., 2002; Durieux et al., 2011).
Moreover, mitochondrial homeostasis at old age is protected in the long lived Mclkl+/- mouse, however mitochondrial homeostasis was found to be disturbed in young ages
(Wang et al., 2009) and more recently, it was shown that a mitonuclear protein imbalance can act as a conserved longevity pathway by inducing mtUPR (Houtkooper et al., 2013). While it cannot be excluded that when acutely induced this pseudohypoxia pathway might elicit mtUPR and thus be beneficial, it can be concluded that chronic induction of this pathway does not illicit mtUPR in both SIRT1 KO and in 22-months-old mice.
Together, the work described herein lead the following model, declining NAD+ specifically in the nucleus elicits a pseudohypoxic state driven by loss of SIRT1 activity, which induces an imbalance between nuclear- and mitochondrial-encoded genes and consequently disrupts the stoichiometric OXPHOS complexes, thus suggesting that a decline in nuclear energetics is, at least in part one, of the causes of age-related disruption of mitochondrial homeostasis and one of the means by which CR confers its beneficial health effects. Moreover, the current dogma is that aging is irreversible, but the data herein show that one week of treatment with a compound that boosts NAD+ levels was sufficient to restore the mitochondrial function, as well as global muscle health of 22-month-old mice to levels similar to 6-month-olds. This study also suggests that compounds that prevent
HIF-Ι stabilization, or promote its degradation may also induce a similar beneficial effect on metabolism and mitochondrial homeostasis in aged tissues. In summary, these findings provide evidence for a new pathway that drives the changes in carbon utilization and the disruption in mitochondrial homeostasis that characterize aging, a pathway that is rapidly reversible and potentially amenable to treatment of a variety of age-related diseases.
REFERENCES
Andziak, B., and Buffenstein, R. (2006). Disparate patterns of age-related changes in lipid peroxidation in long-lived naked mole-rats and shorter-lived mice. Aging cell 5, 525-532.
Andziak, B., O'Connor, T.P., Qi, W., DeWaal, E.M., Pierce, A., Chaudhuri, A.R., Van
Remmen, H., and Buffenstein, R. (2006). High oxidative damage levels in the longest-living rodent, the naked mole-rat. Aging Cell 5, 463-471.
Banks, A.S., Kon, N., Knight, C, Matsumoto, M., Gutierrez-Juarez, R., Rossetti, L., Gu,
W., and Accili, D. (2008). SirTl gain of function increases energy efficiency and prevents diabetes in mice. Cell metabolism 8, 333-341.
Baur, J. A., Pearson, K.J., Price, N.L., Jamieson, H.A., Lerin, C, Kalra, A., Prabhu, V.V.,
Allard, J.S., Lopez-Lluch, G., Lewis, K., et al. (2006). Resveratrol improves health and survival of mice on a high-calorie diet. Nature 444, 337-342.
Bell, E.L., Emerling, B.M., Ricoult, S.J., and Guarente, L. (2011). SirT3 suppresses
hypoxia inducible factor 1 alpha and tumor growth by inhibiting mitochondrial ROS production. Oncogene 30, 2986-2996.
Bell, E.L., Klimova, T.A., Eisenbart, J., Moraes, C.T., Murphy, M.P., Budinger, G.R., and Chandel, N.S. (2007). The Qo site of the mitochondrial complex III is required for the transduction of hypoxic signaling via reactive oxygen species production. The Journal of cell biology 177, 1029-1036.
Boffoli, D., Scacco, S.C., Vergari, R., Solarino, G., Santacroce, G., and Papa, S. (1994).
Decline with age of the respiratory chain activity in human skeletal muscle. Biochimica et biophysica acta 1226, 73-82.
Boily, G., Seifert, E.L., Bevilacqua, L., He, X.H., Sabourin, G., Estey, C, Moffat, C,
Crawford, S., Saliba, S., Jardine, K., et al. (2008). SirTl regulates energy metabolism and response to caloric restriction in mice. PLoS One 3, el759.
Bordone, L., Cohen, D., Robinson, A., Motta, M.C., van Veen, E., Czopik, A., Steele, A.D., Crowe, H., Marmor, S., Luo, J., et al. (2007). SIRT1 transgenic mice show phenotypes resembling calorie restriction. Aging Cell 6, 759-767.
Bowling, A.C., Mutisya, E.M., Walker, L.C., Price, D.L., Cork, L.C., and Beal, M.F.
(1993). Age-dependent impairment of mitochondrial function in primate brain.
Journal of neurochemistry 60, 1964-1967.
Braidy, N., Guillemin, G.J., Mansour, H., Chan-Ling, T., Poljak, A., and Grant, R. (2011).
Age related changes in NAD+ metabolism oxidative stress and Sirtl activity in wistar rats. PLoS One 6, el9194.
Cadenas, S., Aragones, J., and Landazuri, M.O. (2010). Mitochondrial reprogramming
through cardiac oxygen sensors in ischaemic heart disease. Cardiovasc Res 88, 219- 228.
Canto, C, and Auwerx, J. (2011). NAD+ as a signaling molecule modulating metabolism.
Cold Spring Harbor symposia on quantitative biology 76, 291-298.
Canto, C, and Auwerx, J. (2012). Targeting sirtuin 1 to improve metabolism: all you need is NAD(+)? Pharmacological reviews 64, 166-187.
Canto, C, Gerhart-Hines, Z., Feige, J.N., Lagouge, M., Noriega, L., Milne, J.C., Elliott,
P.J., Puigserver, P., and Auwerx, J. (2009). AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 458, 1056-1060.
Carabelli, J., Burgueno, A.L., Rosselli, M.S., Gianotti, T.F., Lago, N.R., Pirola, C.J., and
Sookoian, S. (2011). High fat diet-induced liver steatosis promotes an increase in liver mitochondrial biogenesis in response to hypoxia. Journal of cellular and molecular medicine 15, 1329-1338.
Cerqueira, F.M., da Cunha, F.M., Caldeira da Silva, C.C., Chausse, B., Romano, R.L.,
Garcia, C.C., Colepicolo, P., Medeiros, M.H., and Kowaltowski, A.J. (2011). Long- term intermittent feeding, but not caloric restriction, leads to redox imbalance, insulin receptor nitration, and glucose intolerance. Free Radic Biol Med 51, 1454- 1460.
Chandel, N.S., McClintock, D.S., Feliciano, C.E., Wood, T.M., Melendez, J.A., Rodriguez, A.M., and Schumacker, P.T. (2000). Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia- inducible factor- 1 alpha during hypoxia: a mechanism of 02 sensing. The Journal of biological chemistry 275, 25130-25138. Chandel, N.S., and Schumacker, P.T. (1999). Cells depleted of mitochondrial DNA (rhoO) yield insight into physiological mechanisms. FEBS letters 454, 173-176.
Chen, D., Thomas, E.L., and Kapahi, P. (2009). HIF-1 modulates dietary restriction- mediated lifespan extension via IRE-1 in Caenorhabditis elegans. PLoS Genet 5, el000486.
Cheng, H.L., Mostoslavsky, R., Saito, S., Manis, J.P., Gu, Y., Patel, P., Bronson, R.,
Appella, E., Alt, F.W., and Chua, K.F. (2003). Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRTl)-deficient mice. Proceedings of the National Academy of Sciences of the United States of America 100, 10794-10799. Choi, J.S., Choi, K.M., and Lee, C.K. (2011). Caloric restriction improves efficiency and capacity of the mitochondrial electron transport chain in Saccharomyces cerevisiae. Biochemical and biophysical research communications 409, 308-314.
Civitarese, A.E., Carling, S., Heilbronn, L.K., Hulver, M.H., Ukropcova, B., Deutsch,
W.A., Smith, S.R., and Ravussin, E. (2007). Calorie restriction increases muscle mitochondrial biogenesis in healthy humans. PLoS medicine 4, e76.
Cohen, H.Y., Miller, C, Bitterman, K.J., Wall, N.R., Hekking, B., Kessler, B., Howitz, K.T., Gorospe, M., de Cabo, R., and Sinclair, D.A. (2004). Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 305, 390-392.
Coskun, P., Wyrembak, J., Schriner, S., Chen, H.W., Marciniack, C, Laferla, F., and
Wallace, D.C. (2011). A mitochondrial etiology of Alzheimer and Parkinson disease. Biochimica et biophysica acta.
de Moura, M.B., dos Santos, L.S., and Van Houten, B. (2010). Mitochondrial dysfunction in neurodegenerative diseases and cancer. Environmental and molecular mutagenesis 51, 391-405.
de Oliveira, R.M., Pais, T.F., and Outeiro, T.F. (2010). Sirtuins: common targets in aging and in neurodegeneration. Curr Drug Targets 11, 1270-1280.
Dillin, A., Hsu, A.L., Arantes-Oliveira, N., Lehrer-Graiwer, J., Hsin, H., Fraser, A.G.,
Kamath, R.S., Ahringer, J., and Kenyon, C. (2002). Rates of behavior and aging specified by mitochondrial function during development. Science 298, 2398-2401.
Dioum, E.M., Chen, R., Alexander, M.S., Zhang, Q., Hogg, R.T., Gerard, R.D., and Garcia, J.A. (2009). Regulation of hypoxia-inducible factor 2alpha signaling by the stress- responsive deacetylase sirtuin 1. Science 324, 1289-1293.
Dominy, J.E., Jr., Lee, Y., Jedrychowski, M.P., Chim, H., Jurczak, M.J., Camporez, J.P.,
Ruan, H.B., Feldman, J., Pierce, K., Mostoslavsky, R., et al. (2012). The deacetylase Sirt6 activates the acetyltransferase GCN5 and suppresses hepatic gluconeogenesis. Molecular cell 48, 900-913.
Donmez, G., Wang, D., Cohen, D.E., and Guarente, L. (2010). SIRT1 suppresses beta- amyloid production by activating the alpha- secretase gene ADAM10. Cell 142, 320- 332.
Durieux, J., Wolff, S., and Dillin, A. (2011). The cell-non-autonomous nature of electron
transport chain-mediated longevity. Cell 144, 79-91.
Dutta, D., Calvani, R., Bernabei, R., Leeuwenburgh, C, and Marzetti, E. (2012).
Contribution of impaired mitochondrial autophagy to cardiac aging: mechanisms and therapeutic opportunities. Circ Res 110, 1125-1138.
Evans, M.J., and Scarpulla, R.C. (1990). NRF-1: a trans-activator of nuclear-encoded
respiratory genes in animal cells. Genes & development 4, 1023-1034.
Falk, M.J., Zhang, Q., Nakamaru-Ogiso, E., Kannabiran, C, Fonseca-Kelly, Z., Chakarova,
C, Audo, I., Mackay, D.S., Zeitz, C, Borman, A.D., et al. (2012). NMNAT1 mutations cause Leber congenital amaurosis. Nature genetics 44, 1040-1045.
Falkenberg, M., Larsson, N.G., and Gustafsson, CM. (2007). DNA replication and
transcription in mammalian mitochondria. Annual review of biochemistry 76, 679-
699.
Felkai, S., Ewbank, J. J., Lemieux, J., Labbe, J.C., Brown, G.G., and Hekimi, S. (1999).
CLK-1 controls respiration, behavior and aging in the nematode Caenorhabditis elegans. Embo J 18, 1783-1792.
Feng, J., Bussiere, F., and Hekimi, S. (2001). Mitochondrial electron transport is a key
determinant of life span in Caenorhabditis elegans. Dev Cell 1, 633-644.
Fernandez-Marcos, P. J., and Auwerx, J. (2011). Regulation of PGC-lalpha, a nodal
regulator of mitochondrial biogenesis. The American journal of clinical nutrition 93, 884S-890.
Figueiredo, P.A., Mota, M.P., Appell, H.J., and Duarte, J.A. (2008). The role of
mitochondria in aging of skeletal muscle. Biogerontology 9, 67-84.
Figueiredo, P.A., Powers, S.K., Ferreira, R.M., Appell, H.J., and Duarte, J.A. (2009). Aging impairs skeletal muscle mitochondrial bioenergetic function. The journals of gerontology Series A, Biological sciences and medical sciences 64, 21-33.
Finley, L.W., Carracedo, A., Lee, J., Souza, A., Egia, A., Zhang, J., Teruya-Feldstein, J.,
Moreira, P.I., Cardoso, S.M., Clish, C.B., et al. (2011). SIRT3 opposes reprogramming of cancer cell metabolism through HIF1 alpha destabilization. Cancer Cell 19, 416-428.
Finsterer, J. (2004). Mitochondriopathies. European journal of neurology : the official
journal of the European Federation of Neurological Societies 11, 163-186.
Gallo, M., Park, D., and Riddle, D.L. (2011). Increased longevity of some C. elegans
mitochondrial mutants explained by activation of an alternative energy-producing pathway. Mech Ageing Dev 132, 515-518.
Geng, H., Harvey, C.T., Pittsenbarger, J., Liu, Q., Beer, T.M., Xue, C, and Qian, D.Z.
(2011). HDAC4 protein regulates HIF1 alpha protein lysine acetylation and cancer cell response to hypoxia. The Journal of biological chemistry 286, 38095-38102. Gerhart-Hines, Z., Rodgers, J.T., Bare, O., Lerin, C, Kim, S.H., Mostoslavsky, R., Alt,
F.W., Wu, Z., and Puigserver, P. (2007). Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRTl/PGC-1 alpha. The EMBO journal
26, 1913-1923.
Gomes, A. P., Duarte, F.V., Nunes, P., Hubbard, B.P., Teodoro, J.S., Varela, A.T., Jones,
J.G., Sinclair, D.A., Palmeira, CM., and Rolo, A.P. (2012). Berberine protects against high fat diet-induced dysfunction in muscle mitochondria by inducing SIRT1 -dependent mitochondrial biogenesis. Biochim Biophys Acta 1822, 185-195.
Gordan, J.D., Thompson, C.B., and Simon, M.C (2007). HIF and c-Myc: sibling rivals for control of cancer cell metabolism and proliferation. Cancer Cell 12, 108-113.
Gumucio, J.P., and Mendias, C.L. (2013). Atrogin-1, MuRF-1, and sarcopenia. Endocrine 43, 12-21.
Haigis, M.C., and Sinclair, D.A. (2010). Mammalian sirtuins: biological insights and disease relevance. Annual review of pathology 5, 253-295.
Hancock, C.R., Han, D.H., Higashida, K., Kim, S.H., and Holloszy, J.O. (2011). Does
calorie restriction induce mitochondrial biogenesis? A reevaluation. FASEB journal: official publication of the Federation of American Societies for Experimental
Biology 25, 785-791.
Harman, D. (1972). The biologic clock: the mitochondria? J Am Geriatr Soc 20, 145-147. Hartmann, N., Reichwald, K., Wittig, I., Drose, S., Schmeisser, S., Luck, C, Hahn, C, Graf, M., Gausmann, U., Terzibasi, E., et al. (2011). Mitochondrial DNA copy number and function decrease with age in the short-lived fish Nothobranchius furzeri. Aging cell
10, 824-831.
Herranz, D., Munoz-Martin, M., Canamero, M., Mulero, F., Martinez-Pastor, B.,
Fernandez-Capetillo, O., and Serrano, M. (2010). Sirtl improves healthy ageing and protects from metabolic syndrome-associated cancer. Nat Commun 1, 3.
Houtkooper, R.H., Mouchiroud, L., Ryu, D., Moullan, N., Katsyuba, E., Knott, G.,
Williams, R.W., and Auwerx, J. (2013). Mitonuclear protein imbalance as a conserved longevity mechanism. Nature 497, 451-457.
Howes, R.M. (2006). The free radical fantasy: a panoply of paradoxes. Ann N Y Acad Sci 1067, 22-26.
Hubbard, B.P., Gomes, A.P., Dai, H., Li, J., Case, A.W., Considine, T., Riera, T.V., Lee,
J.E., E, S.Y., Lamming, D.W., et al. (2013). Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 339, 1216-1219.
Jager, S., Handschin, C, St-Pierre, J., and Spiegelman, B.M. (2007). AMP- activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1 alpha. Proceedings of the National Academy of Sciences of the United States of America
104, 12017-12022.
Jayaram, H.N., Kusumanchi, P., and Yalowitz, J.A. (2011). NMNAT expression and its relation to NAD metabolism. Current medicinal chemistry 18, 1962-1972.
Johnson, M.L., Robinson, M.M., and Nair, K.S. (2013). Skeletal muscle aging and the
mitochondrion. Trends in endocrinology and metabolism: TEM 24, 247-256.
Kaeberlein, M., Hu, D., Kerr, E., Tsuchiya, M., Westman, E., Dang, N., Fields, S., and
Kennedy, B. (2005). Increased life span due to calorie restriction in respiratory- deficient yeast. PLoS Genet 1.
Kaelin, W.G., Jr. (2008). The von Hippel-Lindau tumour suppressor protein: 02 sensing and cancer. Nature reviews Cancer 8, 865-873.
Kim, J., Lee, J.H., and Iyer, V.R. (2008). Global identification of Myc target genes reveals its direct role in mitochondrial biogenesis and its E-box usage in vivo. PloS one 3, el798.
Koshiji, M., Kageyama, Y., Pete, E.A., Horikawa, I., Barrett, J.C., and Huang, L.E. (2004).
HIF-1 alpha induces cell cycle arrest by functionally counteracting Myc. Embo J 23,
1949-1956.
Koshiji, M., To, K.K., Hammer, S., Kumamoto, K., Harris, A.L., Modrich, P., and Huang, L.E. (2005). HIF-1 alpha induces genetic instability by transcriptionally downregulating MutSalpha expression. Mol Cell 17, 793-803.
Krishnan, J., Danzer, C, Simka, T., Ukropec, J., Walter, K.M., Kumpf, S., Mirtschink, P., Ukropcova, B., Gasperikova, D., Pedrazzini, T., et al. (2012). Dietary obesity- associated Hifl alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes & development 26, 259-270.
Kwong, L.K., and Sohal, R.S. (2000). Age-related changes in activities of mitochondrial electron transport complexes in various tissues of the mouse. Archives of biochemistry and biophysics 373, 16-22.
Laemmle, A., Lechleiter, A., Roh, V., Schwarz, C, Portmann, S., Furer, C, Keogh, A., Tschan, M.P., Candinas, D., Vorburger, S.A., et al. (2012). Inhibition of SIRT1 impairs the accumulation and transcriptional activity of HIF-1 alpha protein under hypoxic conditions. PLoS One 7, e33433.
Lagouge, M., Argmann, C, Gerhart-Hines, Z., Meziane, H., Lerin, C, Daussin, F.,
Messadeq, N., Milne, J., Lambert, P., Elliott, P., et al. (2006). Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1 alpha. Cell 127, 1109-1122.
Lanza, I.R., and Nair, K.S. (2010). Mitochondrial function as a determinant of life span.
Pflugers Archiv : European journal of physiology 459, 277-289.
Lapointe, J., and Hekimi, S. (2010). When a theory of aging ages badly. Cell Mol Life Sci 67, 1-8.
Lapointe, J., Stepanyan, Z., Bigras, E., and Hekimi, S. (2009). Reversal of the
mitochondrial phenotype and slow development of oxidative biomarkers of aging in long-lived Mclkl+/- mice. The Journal of biological chemistry 284, 20364-20374. Larsson, N.G. (2010). Somatic mitochondrial DNA mutations in mammalian aging. Annual review of biochemistry 79, 683-706.
Leiser, S.F., and Kaeberlein, M. (2010). The hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biol Chem 391, 1131-1137.
Li, F., Wang, Y., Zeller, K.I., Potter, J.J., Wonsey, D.R., O'Donnell, K.A., Kim, J.W.,
Yustein, J.T., Lee, L.A., and Dang, C.V. (2005). Myc stimulates nuclearly encoded mitochondrial genes and mitochondrial biogenesis. Mol Cell Biol 25, 6225-6234.
Lim, J.H., Lee, Y.M., Chun, Y.S., Chen, J., Kim, J.E., and Park, J.W. (2010). Sirtuin 1 modulates cellular responses to hypoxia by deacetylating hypoxia- inducible factor lalpha. Molecular cell 38, 864-878.
Lopez-Lluch, G., Hunt, N., Jones, B., Zhu, M., Jamieson, H., Hilmer, S., Cascajo, M.V., Allard, J., Ingram, D.K., Navas, P., et al. (2006). Calorie restriction induces mitochondrial biogenesis and bioenergetic efficiency. Proc Natl Acad Sci U S A
103, 1768-1773.
Majmundar, A.J., Wong, W.J., and Simon, M.C. (2010). Hypoxia-inducible factors and the response to hypoxic stress. Molecular cell 40, 294-309.
Mao, B., Zhao, G., Lv, X., Chen, H.Z., Xue, Z., Yang, B., Liu, D.P., and Liang, C.C.
(2011). Sirtl deacetylates c-Myc and promotes c-Myc/Max association. Int J
Biochem Cell Biol 43, 1573-1581.
Marshall, G.M., Liu, P.Y., Gherardi, S., Scarlett, C.J., Bedalov, A., Xu, N., Iraci, N., Valli,
E., Ling, D., Thomas, W., et al. (2011). SIRTl promotes N-Myc oncogenesis through a positive feedback loop involving the effects of MKP3 and ERK on N-
Myc protein stability. PLoS Genet 7, el 002135.
Massudi, H., Grant, R., Braidy, N., Guest, J., Farnsworth, B., and Guillemin, G.J. (2012).
Age-Associated Changes In Oxidative Stress and NAD(+) Metabolism In Human
Tissue. PLoS One 7, e42357.
McBurney, M.W., Yang, X., Jardine, K., Hixon, M., Boekelheide, K., Webb, J.R.,
Lansdorp, P.M., and Lemieux, M. (2003). The mammalian SIR2alpha protein has a role in embryogenesis and gametogenesis. Mol Cell Biol 23, 38-54.
Menssen, A., Hydbring, P., Kapelle, K., Vervoorts, J., Diebold, J., Luscher, B., Larsson,
L.G., and Hermeking, H. (2012). The c-MYC oncoprotein, the NAMPT enzyme, the
SIRT1 -inhibitor DBC1, and the SIRT1 deacetylase form a positive feedback loop.
Proc Natl Acad Sci U S A 109, E187-196.
Michel, S., Wanet, A., De Pauw, A., Rommelaere, G., Arnould, T., and Renard, P. (2012).
Crosstalk between mitochondrial (dys)function and mitochondrial abundance.
Journal of cellular physiology 227, 2297-2310.
Minamishima, Y.A., Moslehi, J., Bardeesy, N., Cullen, D., Bronson, R.T., and Kaelin,
W.G., Jr. (2008). Somatic inactivation of the PHD2 prolyl hydroxylase causes polycythemia and congestive heart failure. Blood 111, 3236-3244.
Minor, R.K., Baur, J.A., Gomes, A.P., Ward, T.M., Csiszar, A., Mercken, E.M.,
Abdelmohsen, K., Shin, Y.K., Canto, C, Scheibye-Knudsen, M., et al. (2011).
SRT1720 improves survival and healthspan of obese mice. Scientific reports 1, 70. Moslehi, J., DePinho, R.A., and Sahin, E. (2012). Telomeres and mitochondria in the aging heart. Circ Res 110, 1226-1237.
Niemann, B., Chen, Y., Issa, H., Silber, R.E., and Rohrbach, S. (2010). Caloric restriction delays cardiac ageing in rats: role of mitochondria. Cardiovascular research 88, 267-
276.
Oberdoerffer, P., Michan, S., McVay, M., Mostoslavsky, R., Vann, J., Park, S.K.,
Hartlerode, A., Stegmuller, J., Hafner, A., Loerch, P., et al. (2008). SIRT1 redistribution on chromatin promotes genomic stability but alters gene expression during aging. Cell 135, 907-918.
Osiewacz, H.D. (2011). Mitochondrial quality control in aging and lifespan control of the fungal aging model Podospora anserina. Biochem Soc Trans 39, 1488-1492.
Parisi, M.A., and Clayton, D.A. (1991). Similarity of human mitochondrial transcription factor 1 to high mobility group proteins. Science 252, 965-969.
Peterson, CM., Johannsen, D.L., and Ravussin, E. (2012). Skeletal muscle mitochondria and aging: a review. J Aging Res 2012, 194821.
Pfluger, P.T., Herranz, D., Velasco-Miguel, S., Serrano, M., and Tschop, M.H. (2008).
Sirtl protects against high-fat diet-induced metabolic damage. Proc Natl Acad Sci U S A 105, 9793-9798.
Powers, S.K., Wiggs, M.P., Duarte, J.A., Zergeroglu, A.M., and Demirel, H.A. (2012).
Mitochondrial signaling contributes to disuse muscle atrophy. American journal of physiology Endocrinology and metabolism 303, E31-39.
Price, N.L., Gomes, A.P., Ling, A.J., Duarte, F.V., Martin-Montalvo, A., North, B.J.,
Agarwal, B., Ye, L., Ramadori, G., Teodoro, J.S., et al. (2012). SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell metabolism 15, 675-690.
Qin, W., Yang, T., Ho, L., Zhao, Z., Wang, J., Chen, L., Zhao, W., Thiyagarajan, M.,
MacGrogan, D., Rodgers, J.T., et al. (2006). Neuronal SIRT1 activation as a novel mechanism underlying the prevention of Alzheimer disease amyloid neuropathology by calorie restriction. J Biol Chem 281, 21745-21754.
Rasbach, K.A., Gupta, R.K., Ruas, J.L., Wu, J., Naseri, E., Estall, J.L., and Spiegelman,
B.M. (2010). PGC-1 alpha regulates a HIF2alpha-dependent switch in skeletal muscle fiber types. Proc Natl Acad Sci U S A 107, 21866-21871.
Rodgers, J.T., Lerin, C, Haas, W., Gygi, S.P., Spiegelman, B.M., and Puigserver, P.
(2005). Nutrient control of glucose homeostasis through a complex of PGC-1 alpha and SIRTl. Nature 434, 113-118.
Sahin, E., Colla, S., Liesa, M., Moslehi, J., Muller, F.L., Guo, M., Cooper, M., Kotton, D.,
Fabian, A. J., Walkey, C, et al. (2011). Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470, 359-365.
Sanders, E. (2012). Pseudohypoxia, Mitochondrial Mutations, the Warburg Effect and
Cancer. Biomedical Research 23, 109-131.
Santos, J.H., Meyer, J.N., Mandavilli, B.S., and Van Houten, B. (2006). Quantitative PCR- based measurement of nuclear and mitochondrial DNA damage and repair in mammalian cells. Methods Mol Biol 314, 183-199.
Scarpulla, R.C. (2011a). Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochim Biophys Acta 1813, 1269-1278.
Scarpulla, R.C. (201 lb). Nucleus-encoded regulators of mitochondrial function: Integration of respiratory chain expression, nutrient sensing and metabolic stress. Biochimica et biophysica acta.
Schriner, S.E., Linford, N.J., Martin, G.M., Treuting, P., Ogburn, C.E., Emond, M., Coskun, P.E., Ladiges, W., Wolf, N., Van Remmen, H., et al. (2005). Extension of murine life span by overexpression of catalase targeted to mitochondria. Science 308, 1909-
1911.
Schulz, T.J., Zarse, K., Voigt, A., Urban, N., Birringer, M., and Ristow, M. (2007). Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell metabolism 6, 280-293.
Sequeira, J., Boily, G., Bazinet, S., Saliba, S., He, X., Jardine, K., Kennedy, C, Staines, W., Rousseaux, C, Mueller, R., et al. (2008). sirtl-null mice develop an autoimmune- like condition. Experimental cell research 314, 3069-3074.
Trifunovic, A., Hansson, A., Wredenberg, A., Rovio, A.T., Dufour, E., Khvorostov, I.,
Spelbrink, J.N., Wibom, R., Jacobs, H.T., and Larsson, N.G. (2005). Somatic mtDNA mutations cause aging phenotypes without affecting reactive oxygen species production. Proceedings of the National Academy of Sciences of the United States of America 102, 17993-17998.
Trifunovic, A., Wredenberg, A., Falkenberg, M., Spelbrink, J.N., Rovio, A.T., Bruder, C.E., Bohlooly, Y.M., Gidlof, S., Oldfors, A., Wibom, R., et al. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429, 417-423.
Vermulst, M., Wanagat, J., Kujoth, G.C., Bielas, J.H., Rabinovitch, P.S., Prolla, T.A., and Loeb, L.A. (2008). DNA deletions and clonal mutations drive premature aging in mitochondrial mutator mice. Nature genetics 40, 392-394.
Wallace, D.C., Fan, W., and Procaccio, V. (2010). Mitochondrial energetics and
therapeutics. Annual review of pathology 5, 297-348.
Wang, D., Malo, D., and Hekimi, S. (2010). Elevated mitochondrial reactive oxygen
species generation affects the immune response via hypoxia- inducible factor- 1 alpha in long-lived Mclkl+/- mouse mutants. J Immunol 184, 582-590.
Wang, Y., Branicky, R., Stepanyan, Z., Carroll, M., Guimond, M.P., Hihi, A., Hayes, S., McBride, K., and Hekimi, S. (2009). The anti-neurodegeneration drug clioquinol inhibits the aging-associated protein CLK-1. The Journal of biological chemistry 284, 314-323.
Warburg, O. (1956). On the origin of cancer cells. Science 123, 309-314.
Williams, P.D., and Day, T. (2003). Antagonistic pleiotropy, mortality source interactions, and the evolutionary theory of senescence. Evolution 57, 1478-1488.
Williamson, J.R., Chang, K., Frangos, M., Hasan, K.S., Ido, Y., Kawamura, T., Nyengaard, J.R., van den Enden, M., Kilo, C, and Tilton, R.G. (1993). Hyperglycemic pseudohypoxia and diabetic complications. Diabetes 42, 801-813.
Yang, T., and Sauve, A. A. (2006). NAD metabolism and sirtuins: metabolic regulation of
protein deacetylation in stress and toxicity. The AAPS journal 8, E632-643.
Yoshino, J., Mills, K.F., Yoon, M.J., and Imai, S. (2011). Nicotinamide mononucleotide, a key NAD(+) intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell metabolism 14, 528-536.
Yuan, J., Minter-Dykhouse, K., and Lou, Z. (2009). A c-Myc-SIRTl feedback loop
regulates cell growth and transformation. J Cell Biol 185, 203-211.
Zhang, Q.J., Wang, Z., Chen, H.Z., Zhou, S., Zheng, W., Liu, G., Wei, Y.S., Cai, H., Liu,
D.P., and Liang, C.C. (2008). Endothelium- specific overexpression of class III deacetylase SIRT1 decreases atherosclerosis in apolipoprotein E-deficient mice. Cardiovasc Res 80, 191-199.
Zhang, T., Berrocal, J.G., Frizzell, K.M., Gamble, M.J., DuMond, M.E., Krishnakumar, R., Yang, T., Sauve, A. A., and Kraus, W.L. (2009). Enzymes in the NAD+ salvage pathway regulate SIRT1 activity at target gene promoters. The Journal of biological chemistry 284, 20408-20417.
Zhang, T., Berrocal, J.G., Yao, J., DuMond, M.E., Krishnakumar, R., Ruhl, D.D., Ryu,
K.W., Gamble, M.J., and Kraus, W.L. (2012). Regulation of poly(ADP-ribose) polymerase- 1 -dependent gene expression through promoter-directed recruitment of a nuclear NAD+ synthase. The Journal of biological chemistry 287, 12405-12416. Bell, E.L., Emerling, B.M., Ricoult, S.J.H., and Guarente, L. (2011). SirT3 suppresses
hypoxia inducible factor la and tumor growth by inhibiting mitochondrial ROS production. Oncogene. 30, 2986-2996.
Brautigan, D.L., Ferguson-Miller, S., and Margoliash, E. (1978). Mitochondrial cytochrome c: preparation and activity of native and chemically modified cytochromes c.
Methods in enzymology 53, 128-164.
Emaus, R.K., Grunwald, R. and Lemasters, J.J. (1986). Rhodamine 123 as a probe of
transmembrane potential in isolated rat-liver mitochondria: spectral and metabolic properties. Biochim. Biophys. Acta. 850, 436-448.
Gerhart-Hines, Z., Rodgers, J.T., Bare, O., Lerin, C, Kim, S.H., Mostoslavsky, R., Alt,
F.W., Wu, Z., and Puigserver, P. (2007). Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRTl/PGC-lalpha. EMBO J. 26, 1913-
1923.
Gomes, A. P., Duarte, F.V., Nunes, P., Hubbard, B.P., Teodor, J.S., Varela, A.T., Jones,
J.G., Sinclair, D.A., Palmeira, CM., and Rolo, A.P. (2012). Berberine protects against high fat diet-induced dysfunction in muscle mitochondria by inducing SIRT1 -dependent mitochondrial biogenesis. Biochim. Biophys. Acta. 1822, 185-
195.
Rolo, A.P., Palmeira, CM., and Wallace, K.B. (2003). Mitochondrially mediated
synergistic cell killing by bile acids. Biochimica et biophysica acta 1637, 127-132. Price, N.L., Gomes, A.P., Ling, A.J.Y., Duarte, F.V., Matin-Montalvo, A., North, B.J., Agarwal, B., Ye, L., Ramadori, G., Teodoro, J.S., Hubbard, B.P., Varela A.T.,
David, J.G., Varamini, B., Hafner, A., Moaddel, R., Rolo, A.P., Coppari, R., Palmeira, CM., de Cabo, R., Baur, J.A., and Sinclair, D.A. (2012). SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab. 15, 675-690.
Santos, J.H., Meyer, J.N., Mandavilli, B.S. and Van Houten, B. (2006). Quantitative PCR- based measurement of nuclear and mitochondrial DNA damage and repair in mammalian cells. Methods Mol. Biol. 314, 183-199.
Singer, T.P. (1974). Determination of the activity of succinate, NADH, choline, and alpha- glycerophosphate dehydrogenases. Methods of biochemical analysis 22, 123-175.
Zechner, C, Lai, L., Zechner, J.F., Gen, T., Yan. Z., Rumsey, J.W., Collia, D., Chen, Z., Wozniak, D.F., Leone, T.C. and Kelly, D.P. (2010). Total skeletal muscle PGC-1
deficiency uncouples mitochondrial derangements from fiber type determination and insulin sensitivity. Cell Metab. 12, 633-642.
Example 15: Reduced Inflammation through Increased NAD+ Levels
Methods
Aging cohorts C57BL/6J mice of 3, 6, 22, or 24 months of age were obtained from the National
Institutes of Aging mouse aging colony. Mice were acclimated for at least one- week prior to sacrifice. 3, 6, 22 and 24-month-old mice were given interperitoneal (IP) injections of 500 mg NMN/kg body weight per day or the equivalent volume of PBS for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4 hr after last injection. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee
In vivo DMOG treatment
C57BL/6J mice of 6 months of age were given interperitoneal (IP) injections of 300 mg DMOG/kg body weight per day or the equivalent volume of PBS for 5 consecutive days. All animal studies followed the guidelines of and were approved by the Harvard Institutional Animal Care and Use Committee
Gene expression
RNA from skeletal muscle and aorta were extracted with RNeasy mini kit (Qiagen) according to the instructions and quantified using the NanoDrop 1000 spectrophotometer (Thermo Scientific). cDNA was synthesized with the iSCRIP cDNA synthesis kit (BioRad) using 600 ng of RNA. Quantitative RT-PCR reactions were performed using 1 μΜ of primers and LightCycler® 480 SYBR Green Master (Roche) on an LightCycler® 480 detection system (Roche). Calculations were performed by a comparative method (2-ACT) using 18S as an internal control. Primers were designed using the IDT software (IDT).
Immunoblot
Protein extracts from tissue were obtained by lysis in ice-cold lysis buffer (150 mM NaCl,10 mM Tris HC1 (pH 7.4), 1 mM EDTA, 1 mM EGTA, 1 % Triton X-100, 0.5% NP- 40) supplemented with a cocktail of protease and phosphatase inhibitors (Roche). Protein content was determined by the Bradford protein assay (Biorad), and 50 μg proteins were run on SDS-PAGE under reducing conditions. The separated proteins were then
electrophoretically transferred to a polyvinylidene difluoride membrane (Perkin-Elmer). Proteins of interest were revealed with specific antibodies: anti-P-tubulin (Sigma- Aldrich), anti-HIFl (Cayman) overnight at 4°C. The immuno staining was detected using
horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin for 1 h at room temperature. Bands were revealed using Amersham ECL detection system (GE Healthcare).
NAD+ measurement
NAD+ from C2C12 cells and skeletal muscle was quantified with a commercially available kit (Bio Vision) according to the manufacturer's instructions and as described before (Gomes et al., 2012).
Results
FIG. 25 reveals that NMN increases NAD+ levels in the skeletal muscle of old mice. FIG. 26 reveals that NMN reduces inflammation in aortas from old mice.
Expression if inflammation-related markers (IL-6, TNFa, Nlrp3, IL-lb, CD68 and IL-10, FIGs 26A-F, respectively) were analyzed in aortas of 6- and 22-months-old mice treated with either the vehicle (PBS) or NMN. FIG. 27 also demonstrates that NMN reduces inflammation in aortas from old mice. Expression of inflammatory markers (VEGF and IL- 18, FIG. 27A and B, respectively) were analyzed in aortas of 6- and 22-months-old mice treated with either the vehicle (PBS) or NMN.
FIG. 28 reveals that NMN reverses age-related increase in inflammatory markers in the skeletal muscle. Expression of inflammation related markers (TNFa, IL-6 and IL-18) was analyzed in gastrocnemius of 6- and 22-months-old mice treated with either the vehicle (PBS) or NMN. FIG. 29 reveals that NMN destabilizes HIF-1 alpha in the skeletal muscle of
old animals. FIG. 30 reveals that in vivo stabilization of HIF-lalpha with DMOG induces inflammatory markers in the skeletal muscle. Expression of inflammation related markers (TNFalpha, IL-6, II- lb and IL-18) was analyzed in gastrocnemius of 6-month-old mice treated with either the vehicle (PBS) or DMOG. FIG. 31 depicts a model for raising NAD+ to decrease inflammation.
References
Gomes, A. P., Duarte, F.V., Nunes, P., Hubbard, B.P., Teodoro, J.S., Varela, A.T., Jones, J.G., Sinclair, D.A., Palmeira, CM., and Rolo, A. P. (2012). Berberine protects against high fat diet-induced dysfunction in muscle mitochondria by inducing SIRT1 -dependent mitochondrial biogenesis. Biochim Biophys Acta 1822, 185-195.
EQUIVALENTS AND SCOPE
Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
In the claims articles such as "a," "an," and "the" may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to
include one or more limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc. , certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not been specifically set forth in haec verba herein. It is also noted that the term "comprising" is intended to be open and permits the inclusion of additional elements or steps.
Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.
Incorporation by Reference
All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent
application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
All references cited herein, including patents, published patent applications, and publications, are incorporated by reference in their entirety. EQUIVALENTS
Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated that various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. All references, including patent documents, disclosed herein are incorporated by reference in their entirety, particularly for the disclosure referenced herein.
What is claimed is:
Claims
1. A method for treating or preventing a disorder associated with inflammation in a subject in need thereof comprising
administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject.
2. The method of claim 1, wherein the agent is an NAD+ precursor.
3. The method of claim 1 or 2, wherein the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof.
4. The method of any one of claims 1-3, wherein the agent is administered at a dose of between 0.5 - 5 grams per day.
5. The method of claim 1, wherein the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically actice fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
6. The method of claim 5, wherein the enzyme is NMNAT- 1 or NAMPT.
7. The method of any one of claims 1-6, wherein the subject is a human.
8. The method of any one of claims 1-7, wherein the disorder associated with inflammation is selected from the group consisting of: septic shock, obesity-related inflammation, Parkinson's Disease, Crohn's Disease, Alzheimer's Disease (AD), cardiovascular disease (CVD), inflammatory bowel disease (IBD), chronic obstructive pulmonary disease, an allergic reaction, an autoimmune disease, blood inflammation, joint inflammation, arthritis, asthma, ulcerative colitis, hepatitis (e.g., viral chronic hepatitis), psoriasis, atopic dermatitis, pemphigus, glomerulonephritis, atherosclerosis, sarcoidosis, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Wegner's syndrome,
Goodpasture's syndrome, giant cell arteritis, polyarteritis nodosa, idiopathic pulmonary fibrosis, acute lung injury, post-influenza pneumonia, SARS, tuberculosis, malaria, sepsis,
cerebral malaria, Chagas disease, schistosomiasis, bacteria and viral meningitis, cystic fibrosis, multiple sclerosis, encephalomyelitis, sickle cell anemia, pancreatitis,
transplantation (e.g., host-mediated rejection of transplanted tissue such as hematopoietic stem cells or an organ, graft mediated host response, such as graft vs. host disease), systemic lupus erythematosis, autoimmune diabetes, thyroiditis, and radiation pneumonitis, respiratory inflammation and pulmonary inflammation.
9. A method for modulating inflammation in a subject in need thereof comprising
administering to the subject an effective amount of an agent that increases the level of NAD+ in the subject.
10. The method of claim 9, wherein the agent is an NAD+ precursor.
11. The method of claim 9 or 10, wherein the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof.
12. The method of any one of claims 9-11, wherein the agent is administered at a dose of between 0.5 - 5 grams per day.
13. The method of claim 9, wherein the agent is an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof, or a nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or an enzymatically active fragment thereof.
14. The method of claim 13, wherein the enzyme is NMNAT- 1 or NAMPT.
15. The method of any one of claims 9-14, wherein the subject is a human.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/434,614 US20150265642A1 (en) | 2012-10-09 | 2013-10-09 | Nad biosynthesis and precursors in the prevention and treatment of inflammation |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261711552P | 2012-10-09 | 2012-10-09 | |
| US61/711,552 | 2012-10-09 | ||
| US201361832204P | 2013-06-07 | 2013-06-07 | |
| US201361832414P | 2013-06-07 | 2013-06-07 | |
| US61/832,414 | 2013-06-07 | ||
| US61/832,204 | 2013-06-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014059031A2 true WO2014059031A2 (en) | 2014-04-17 |
Family
ID=50478055
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/064150 Ceased WO2014059031A2 (en) | 2012-10-09 | 2013-10-09 | Nad biosynthesis and precursors in the prevention and treatment of inflammation |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20150265642A1 (en) |
| WO (1) | WO2014059031A2 (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018102426A1 (en) * | 2016-11-29 | 2018-06-07 | University Of Iowa Research Foundation | Use of nad precursors for improving maternal health and/or offspring health |
| CN109999052A (en) * | 2018-02-12 | 2019-07-12 | 四川大学 | The purposes of β-nicotinamide mononucleotide or its precursor in preparation treatment or alleviation respiratory disorder or the drug or health care product of disease |
| CN110237088A (en) * | 2019-06-06 | 2019-09-17 | 泓博元生命科技(深圳)有限公司 | A kind of application of nicotinamide mononucleotide and/or nicotinamide mononucleotide salt |
| CN112245447A (en) * | 2020-10-30 | 2021-01-22 | 深圳市旷逸生物科技有限公司 | Application of compound with NMN and/or NADH structure and pharmaceutically acceptable salt thereof in preparation of mycobacterium tuberculosis inhibitor |
| WO2021073249A1 (en) * | 2019-10-17 | 2021-04-22 | 苏州大学 | USE OF β-NMN IN PREPARATION OF DRUG FOR TREATING AND PREVENTING SEPSIS-INDUCED ORGAN DAMAGE |
| WO2021074284A1 (en) * | 2019-10-18 | 2021-04-22 | Nuvamid Sa | Use of nicotinamide mononucleotide (nmn) for the prevention and/or treatment of rheumatoid arthritis, and corresponding compositions |
| WO2021105461A1 (en) * | 2019-11-28 | 2021-06-03 | Nuvamid Sa | Use of compounds for the prevention and/or treatment of ankylosing spondylitis, and corresponding compositions |
| US11071747B2 (en) | 2016-11-29 | 2021-07-27 | University Of Iowa Research Foundation | Use of NAD precursors for breast enhancement |
| WO2021187396A1 (en) * | 2020-03-16 | 2021-09-23 | めぐみ 田中 | Coenzyme q production promoter and coenzyme q production promoting method |
| WO2023012182A1 (en) * | 2021-08-02 | 2023-02-09 | Nuvamid Sa | Nicotinamide mononucleotide derivatives for use in the treatment of sapho syndrome |
| EP4139322A1 (en) * | 2020-04-24 | 2023-03-01 | Nuvamid SA | Nicotinamide mononucleotide and nicotinamide riboside derivatives and use thereof in the treatment of viral infections and respiratory complications, in particular caused by influenzavirus or coronavirus |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8017634B2 (en) | 2003-12-29 | 2011-09-13 | President And Fellows Of Harvard College | Compositions for treating obesity and insulin resistance disorders |
| WO2014059034A2 (en) | 2012-10-09 | 2014-04-17 | President And Fellows Of Harvard College | Nad biosynthesis and precursors for the treatment and prevention of cancer and proliferation |
| SG11201803915UA (en) | 2015-11-10 | 2018-06-28 | Childrens Research Institute Childrens National Medical Center | Echinomycin formulation, method of making and method of use thereof |
| WO2018108991A2 (en) * | 2016-12-13 | 2018-06-21 | Ecole Polytechnique Federale De Lausanne | Methods of treating amyloid-beta peptide diseases |
| US20210015764A1 (en) * | 2018-03-28 | 2021-01-21 | Peloton Therapeutics Inc. | Methods of reducing inflammation of the digestive system with inhibitors of hif-2- alpha |
| MX2022000774A (en) | 2019-07-19 | 2022-05-03 | Biosynth Ag | METHOD FOR PREPARING NICOTINAMIDE RIBOFURANOSIDE SALTS, NICOTINAMIDE RIBOFURANOSIDE SALTS AS SUCH, AND USES THEREOF. |
| FR3108502B1 (en) * | 2020-03-27 | 2022-09-23 | Nuvamid Sa | NICOTINAMIDE MONONUCLEOTIDE DERIVATIVES IN THE TREATMENT AND PREVENTION OF BACTERIAL INFECTIONS |
| EP4130250A4 (en) * | 2020-03-30 | 2024-05-15 | Oriental Yeast Co., Ltd. | STEM CELL CHROMOSOME STABILIZER |
| US20210332033A1 (en) * | 2020-04-24 | 2021-10-28 | Nuvamid Sa | Nicotinamide mononucleotide derivatives and use thereof in the treatment of viral infections |
| US20210353656A1 (en) * | 2020-05-12 | 2021-11-18 | Nuvamid Sa | Combination of nicotinamide mononucleotide derivatives and histamine h2 receptor antagonists for viral infections |
| CA3206030A1 (en) | 2020-12-18 | 2022-06-23 | Nuvamid Sa | Nicotinamide mononucleotide derivatives and use thereof in the treatment and prevention of a red blood cell disorder |
| CN112587665B (en) * | 2021-03-08 | 2021-06-18 | 苏州大学 | Application of AR inhibitor and/or HIF-1α inhibitor in the preparation of medicine |
| CN115227821A (en) * | 2021-04-23 | 2022-10-25 | 四川大学 | Use of SIRT1 agonist in the preparation of a medicament for preventing and/or treating autoimmune diseases of the digestive system |
| EP4333807A1 (en) * | 2021-05-04 | 2024-03-13 | Sovida Solutions Ltd. | Nicotinamide adenine dinucleotide (nad) compositions, methods of manufacturing thereof, and methods of use thereof |
| KR102747714B1 (en) * | 2021-12-22 | 2024-12-31 | 아주대학교산학협력단 | Composition for treating or preventing colitis by NAMPT metabolic regulation |
| WO2023119230A1 (en) | 2021-12-22 | 2023-06-29 | L'oreal | Coagulation pathway and nicotinamide-adenine dinucleotide pathway modulating compositions and methods of their use |
| CN116236499B (en) * | 2022-12-13 | 2024-03-22 | 泓博元生命科技(深圳)有限公司 | Composition for preventing and treating inflammatory factor storm |
| WO2025259632A1 (en) * | 2024-06-12 | 2025-12-18 | Sirtsei Pharmaceuticals, Inc. | Compositions and methods for treating retinal diseases or conditions |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7977049B2 (en) * | 2002-08-09 | 2011-07-12 | President And Fellows Of Harvard College | Methods and compositions for extending the life span and increasing the stress resistance of cells and organisms |
| CN1964627B (en) * | 2004-06-04 | 2011-10-19 | 华盛顿大学 | Methods and compositions for treating neuropathy |
-
2013
- 2013-10-09 WO PCT/US2013/064150 patent/WO2014059031A2/en not_active Ceased
- 2013-10-09 US US14/434,614 patent/US20150265642A1/en not_active Abandoned
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11071747B2 (en) | 2016-11-29 | 2021-07-27 | University Of Iowa Research Foundation | Use of NAD precursors for breast enhancement |
| US11633421B2 (en) | 2016-11-29 | 2023-04-25 | University Of Iowa Research Foundation | Use of NAD precursors for improving maternal health and/or offspring health |
| WO2018102426A1 (en) * | 2016-11-29 | 2018-06-07 | University Of Iowa Research Foundation | Use of nad precursors for improving maternal health and/or offspring health |
| CN109999052A (en) * | 2018-02-12 | 2019-07-12 | 四川大学 | The purposes of β-nicotinamide mononucleotide or its precursor in preparation treatment or alleviation respiratory disorder or the drug or health care product of disease |
| WO2019154220A1 (en) * | 2018-02-12 | 2019-08-15 | 四川大学 | Use of β-nicotinamide mononucleotide or precursor thereof in preparation of medicament or health care product for treating or alleviating respiratory disorder or disease |
| CN109999052B (en) * | 2018-02-12 | 2022-08-26 | 四川大学 | Use of beta-nicotinamide mononucleotide or a precursor thereof for the manufacture of a medicament for the treatment or alleviation of a respiratory disorder or disease |
| CN110237088A (en) * | 2019-06-06 | 2019-09-17 | 泓博元生命科技(深圳)有限公司 | A kind of application of nicotinamide mononucleotide and/or nicotinamide mononucleotide salt |
| WO2020244507A1 (en) * | 2019-06-06 | 2020-12-10 | 泓博元生命科技(深圳)有限公司 | Use of nicotinamide mononucleotide and/or nicotinamide mononucleotide salt |
| WO2021073249A1 (en) * | 2019-10-17 | 2021-04-22 | 苏州大学 | USE OF β-NMN IN PREPARATION OF DRUG FOR TREATING AND PREVENTING SEPSIS-INDUCED ORGAN DAMAGE |
| FR3102058A1 (en) * | 2019-10-18 | 2021-04-23 | Nuvamid Sa | Use of NMN for the prevention and / or treatment of rheumatoid arthritis and corresponding compositions |
| WO2021074284A1 (en) * | 2019-10-18 | 2021-04-22 | Nuvamid Sa | Use of nicotinamide mononucleotide (nmn) for the prevention and/or treatment of rheumatoid arthritis, and corresponding compositions |
| FR3103702A1 (en) * | 2019-11-28 | 2021-06-04 | Nuvamid Sa | Use of NMN for the prevention and / or treatment of ankylosing spondylitis and corresponding compositions |
| WO2021105461A1 (en) * | 2019-11-28 | 2021-06-03 | Nuvamid Sa | Use of compounds for the prevention and/or treatment of ankylosing spondylitis, and corresponding compositions |
| WO2021187396A1 (en) * | 2020-03-16 | 2021-09-23 | めぐみ 田中 | Coenzyme q production promoter and coenzyme q production promoting method |
| JPWO2021187396A1 (en) * | 2020-03-16 | 2021-09-23 | ||
| EP4139322A1 (en) * | 2020-04-24 | 2023-03-01 | Nuvamid SA | Nicotinamide mononucleotide and nicotinamide riboside derivatives and use thereof in the treatment of viral infections and respiratory complications, in particular caused by influenzavirus or coronavirus |
| CN112245447A (en) * | 2020-10-30 | 2021-01-22 | 深圳市旷逸生物科技有限公司 | Application of compound with NMN and/or NADH structure and pharmaceutically acceptable salt thereof in preparation of mycobacterium tuberculosis inhibitor |
| WO2023012182A1 (en) * | 2021-08-02 | 2023-02-09 | Nuvamid Sa | Nicotinamide mononucleotide derivatives for use in the treatment of sapho syndrome |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150265642A1 (en) | 2015-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9877981B2 (en) | NAD biosynthesis and precursors for the treatment and prevention of cancer and proliferation | |
| US20150265642A1 (en) | Nad biosynthesis and precursors in the prevention and treatment of inflammation | |
| US20200291100A1 (en) | Treatment of age-related and mitochondrial diseases by inhibition of hif-1 alpha function | |
| EP3371207B1 (en) | Nucleic acids, peptides and methods | |
| Coyne et al. | mPOS is a novel mitochondrial trigger of cell death–implications for neurodegeneration | |
| US12447142B2 (en) | Compositions and methods for preventing and treating radiation-induced bystander effects caused by radiation or radiotherapy | |
| US20220313628A1 (en) | Methods for selecting phosphatase selective and non-selective phosphatase inhibitors | |
| Delaunay et al. | The ER-bound RING finger protein 5 (RNF5/RMA1) causes degenerative myopathy in transgenic mice and is deregulated in inclusion body myositis | |
| Iwawaki et al. | The role of the unfolded protein response in diabetes mellitus | |
| US20160193231A1 (en) | Rett syndrome and treatments therefore | |
| JP7825361B2 (en) | Compositions and methods for the treatment of hereditary cystatin c amyloid angiopathy (HCCAA) and other neurodegenerative disorders involving abnormal amyloid deposition | |
| US11136383B2 (en) | Methods and compositions for modulaton of transforming growth factor beta-regulated functions | |
| HK1207573A1 (en) | Compositions and methods for treating otitis media and other conditions with inhibitors of cyld | |
| US8436039B2 (en) | Inhibitors of the ATB(0,+) transporter and uses thereof | |
| Class et al. | Patent application title: NAD BIOSYNTHESIS AND PRECURSORS FOR THE TREATMENT AND PREVENTION OF CANCER AND PROLIFERATION Inventors: David A. Sinclair (Chestnut Hill, MA, US) David A. Sinclair (Chestnut Hill, MA, US) Ana P. Gomes (Boston, MA, US) | |
| KR101734529B1 (en) | Method of screening compound for treating sepsis and pharmaceutical composition for treating sepsis | |
| US20240075050A1 (en) | Methods and Compositions for Treating Leucine Rich Repeat Kinase 2 (LRRK2)-Associated Disorder or Condition | |
| KR20190122163A (en) | Use of TAZ to control blood sugar by controlling PDX1 activity | |
| Jin | Molecular Characterization of Niemann-Pick Disease Type C-associated Mutants and Therapeutics Testing | |
| Sayas | Tau-based therapies for Alzheimer's disease: Promising | |
| US11331388B1 (en) | PTP4A1 as a therapeutic target for fibrotic diseases and disorders including systemic sclerosis | |
| Tang et al. | Emi2-mediated inhibition of E2-substrate ubiquitin transfer by the APC/C through a D-Box-independent mechanism | |
| EP3794030A1 (en) | Inhibition of follistatin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13844989 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14434614 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13844989 Country of ref document: EP Kind code of ref document: A2 |