WO2014044697A1 - Method for producing an alginate coated titanium dioxide scaffold - Google Patents
Method for producing an alginate coated titanium dioxide scaffold Download PDFInfo
- Publication number
- WO2014044697A1 WO2014044697A1 PCT/EP2013/069343 EP2013069343W WO2014044697A1 WO 2014044697 A1 WO2014044697 A1 WO 2014044697A1 EP 2013069343 W EP2013069343 W EP 2013069343W WO 2014044697 A1 WO2014044697 A1 WO 2014044697A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alginate
- scaffolds
- titanium dioxide
- scaffold
- coated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/28—Materials for coating prostheses
- A61L27/34—Macromolecular materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/54—Biologically active materials, e.g. therapeutic substances
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/02—Inorganic materials
- A61L27/025—Other specific inorganic materials not covered by A61L27/04 - A61L27/12
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/02—Inorganic materials
- A61L27/04—Metals or alloys
- A61L27/06—Titanium or titanium alloys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/02—Inorganic materials
- A61L27/10—Ceramics or glasses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
- A61L27/3834—Cells able to produce different cell types, e.g. hematopoietic stem cells, mesenchymal stem cells, marrow stromal cells, embryonic stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/56—Porous materials, e.g. foams or sponges
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/20—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices containing or releasing organic materials
- A61L2300/216—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices containing or releasing organic materials with other specific functional groups, e.g. aldehydes, ketones, phenols, quaternary phosphonium groups
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/20—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices containing or releasing organic materials
- A61L2300/25—Peptides having up to 20 amino acids in a defined sequence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
- A61L2300/412—Tissue-regenerating or healing or proliferative agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
- A61L2300/422—Anti-atherosclerotic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2400/00—Materials characterised by their function or physical properties
- A61L2400/18—Modification of implant surfaces in order to improve biocompatibility, cell growth, fixation of biomolecules, e.g. plasma treatment
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2420/00—Materials or methods for coatings medical devices
- A61L2420/02—Methods for coating medical devices
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/02—Materials or treatment for tissue regeneration for reconstruction of bones; weight-bearing implants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/12—Materials or treatment for tissue regeneration for dental implants or prostheses
Definitions
- the present document is directed to medical implants and methods for improving their biocompatibility and function in the body.
- the present document discloses a method for producing a titanium dioxide scaffold comprising an alginate coating, which alginate coating optionally may comprise a biologically active substance.
- Conditions such as trauma, tumours, cancer, periodontitis and osteoporosis may lead to bone loss, reduced bone growth and volume. For these and other reasons it is of great importance to find methods to improve bone growth and to regain bone anatomy.
- Natural bone tissue formation from osteogenic cells with the aid of a three-dimensional scaffold offers an alternative to autografts and allografts to repair and regenerate lost bone.
- a well-constructed scaffold provides a suitable surface for cells to attach and adhere with a porous and well interconnected network guiding the development of new bone, supporting migration, proliferation and differentiation of bone-forming cells and vascularization of the ingrowth tissue.
- Titanium dioxide (Ti0 2 ) is a biocompatible material, which has also been reported to have bioactive properties and a certain degree of bacteriostatic effect. Therefore, ceramic Ti0 2 has been studied as a material for bone tissue engineering purposes. High porous and well-interconnected Ti0 2 scaffolds with high mechanical strength achieving values of 90% of porosity and of 1.63-2,67 Pa of compressive strength have been recently developed (Tiainen et ai. 2010) and their biocompatibility and osteoinductive properties have been demonstrated in vitro and in vivo.
- Alginate is one example of a polymer chosen to form hydrogels for tissue engineering, having been used in a variety of medical applications including cell and/or growth factor encapsulation and drug stability and delivery.
- Alginate is a hydrophilic and linear polysaccharide copolymer of ⁇ -D-mannuronic acid (M) and a-L-glucuronic acid (G) monomers.
- Alginate gel is formed when divalent cations such as Ca 2+ , Ba 2+ or Sr 2+ cooperatively interact with blocks of G monomers creating ionic bridges between different polymer chains. Due to favorable properties for a biomateria!, such as nontoxicity, biodegradability, and ease of processing into desired shape under normal physiological conditions, alginate has been studied extensively in tissue engineering, including the regeneration of skin, cartilage, bone, liver and cardiac tissue.
- One object of the present document is to provide a titanium dioxide scaffold suitable as a a supporting structure, such as a medical implant, which is biocompatible and/or which has improved integration properties.
- step b) providing the titanium dioxide scaffold obtained in step b) with a divalent cation salt solution, wherein said divalent cation is selected from the group consisting of Ca 2+ , Mg 2+ , Ba 2+ or Sr ⁇ and then optionally rinsing the titanium dioxide scaffold; and
- steps b) and c) optionally are repeated at least once.
- step b) is performed before step c
- the centrifugation in step b) and/or the low densities of alginate and/or divalent cation solutions in steps b) and c), respectively allows the formation of a thin layer of alginate solution on the titanium dioxide scaffold that is present not just on the outer surface of the scaffold but also on the walls of the pores inside the scaffold.
- the divalent cation salt solution is added in step c)
- a gelation of the alginate is effected, thereby forming an alginate gel layer.
- an alginate coating consisting of two or more alginate gel layers may be built up.
- the present method allows the formation of a thin coating of alginate, built up by one or more layers of alginate gel, the titanium scaffold pores are not blocked by the alginate coating but are readily accessible for cells and tissue to grow into the scaffold structure.
- Another effect when the present method is used for preparing an alginate coating on a titanium dioxide scaffold is that, as the alginate coating forms on the inside of at least part of the pores, there will be a very large surface-to-volume ratio as compared to if the alginate coating would only form on the other surface of the scaffold. This will affect the release profile of any substance, such as a bioiogically active substance, included in the alginate coating. Also, even if the alginate coating would flake off from the outer surface of the titanium dioxide scaffold, the alginate coating would still be present on the surface of the pores inside the scaffold.
- the present document is also directed to a titanium dioxide scaffold obtainable by the above method for producing a titanium dioxide scaffold comprising an alginate coating.
- a medical implant comprising a titanium dioxide scaffold provided with an alginate coating produced by the method disclosed herein.
- the alginate coated titanium dioxide scaffold for use as a medical implant.
- the present document is also directed to the alginate coated titanium dioxide scaffold or a medical implant comprising it for the regeneration, repair, substitution and/or restoration of tissue, such as bone and/or for use for the regeneration, repair, substitution and/or restoration of tissue, such as bone.
- the use of the alginate coated titanium dioxide scaffold or a medicai implant comprising it for the preparation of a medical implant for the regeneration, repair, substitution and/or restoration of tissue and/or bone.
- a method for the regeneration, repair, substitution and/or restoration of tissue comprising the implantation into a subject in need thereof of the alginate coated titanium dioxide scaffold or a medical implant comprising it.
- Scaffold in the present context relates to an open porous structure. Scaffold may in the present context be abbreviated "SC”.
- titanium dioxide scaffold is meant a scaffold comprising predominantly titanium dioxide as the building material for the scaffold
- titanium dioxide is the main substance responsible for forming the scaffold structure.
- the titanium dioxide scaffold therefore has more than 50 wt% titanium dioxide, such as about 51 wt%, 60 wt%, 70 wt%, 80 wt%, 90 wt%, 95 wt%, 96 wt%, 97 wt%, 98 wt%, 99 wt% or 100 wt% titanium dioxide, such as about 51-100 wt%, 60-100 wt%, 60-90 wt%, 70-100 wt%, 70-90 wt%, 80-90 wt%, or 80-95 wt% titanium dioxide.
- the titanium dioxide is the main substance responsible for forming the scaffold structure.
- the titanium dioxide scaffold therefore has more than 50 wt% titanium dioxide, such as about 51 wt%, 60 wt%, 70 wt%, 80 wt%, 90 wt%, 95 wt%, 96 wt%, 97 wt
- 15 dioxide scaffold may thus comprise or consist of titanium dioxide as the building material for the scaffold.
- pore diameter is in the context of the present document intended the hydraulic diameter of a pore without its surrounding walls.
- the hydraulic diameter is well known to the person skilled in the art and is defined as 4 «area of a pore divided by the 20 circumferential length of the pore.
- Frractal dimension strut is a statistical quantity that gives an indication of how completely a fractal appears to fill space, as one zooms down to finer and finer scales. There are many specific definitions of fractal dimension and none of them should be treated as the universal one. A value of 1 pertains to a straight line. The higher the number the more
- Fractal dimension is in the present document calculated using the Kolmogorov or "box counting” method (Liebovitch L.S. ei a/. 1989). It is calculated in both 2d and 3d in Skyscan CTAn, Kontich , Belgium. The surface or volume is divided into an array of equal squares or cubes, and the number of squares containing part of the object surface is counted. This is repeated over a range of box sizes such as 3-
- Total porosity is in the present context defined as all compartments within a body which is not a material, e.g. the space not occupied by any material. Total porosity involves both closed and open pores.
- inner strut volume is meant the voiume of the inner lumen of the strut.
- sintering By “sintering”, “sinter” and the like is meant a method for making objects from powder, by heating the material ⁇ below its melting point) until its particles adhere to each other. Sintering is traditionally used for manufacturing ceramic objects, and has also found uses in such fields as powder metallurgy.
- a “medical prosthetic device, "medical implant”, “implant” and the like in the present context relates to a device intended to be implanted into the body of a vertebrate animal, such as a mammal, e.g. a human mammal. Implants in the present context may be used to replace anatomy and/or restore any function of the body. Examples of such devices include, but are not limited to, dental implants and orthopaedic implants.
- orthopedic implants includes within its scope any device intended to be implanted into the body of a vertebrate animal, in particular a mammal such as a human, for preservation and restoration of the function of the musculoskeletal system, particularly joints and bones, including the alleviation of pain in these structures
- dental implant includes within its scope any device intended to be implanted into the oral cavity of a vertebrate animal, in particular a mammal such as a human, in tooth restoration procedures.
- a dental implant is composed of one or several implant parts.
- a dental implant usually comprises a dental fixture coupled to secondary implant parts, such as an abutment and/or a dental restoration such as a crown, bridge or denture.
- any device, such as a dental fixture, intended for implantation may alone be referred to as an implant even if other parts are to be connected thereto.
- Orthopedic and dental implants may also be denoted as orthopedic and dental prosthetic devices as is clear from the above.
- subject relate to any vertebrate animal, such as a bird, reptile, mammal, primate and human.
- ceramics are in the present context meant objects of inorganic powder material treated with heat to form a solidified structure.
- biologically active substance is meant a substance which may influence a biological process, i.e. it has a biological activity.
- a biologically active substance may be a small molecule, such as an inorganic ion or a Wegger molecule, such as a protein, and even a complex structure, such as a cell. Examples of biologically active substances suitable for use in the context of the present document are disclosed below.
- a biologically active substance may in the present context also be denoted a "biomolecule”.
- soft tissue is in the context of the present document intended tissues that connect, support, or surround other structures and organs of the body, not being bone. Soft tissue includes iigaments, tendons, fascia, skin, fibrous tissues, fat, synovial membranes, epithe!ium, muscles, nerves and biood vessels.
- hard tissue is in the context of the present document intended mineralized tissues, such as bone and teeth, and cartilage.
- Mineralized tissues are biological tissues that incorporate minerals into soft matrices.
- FIG. 1 Microstructure of 2% of alginate (A and B) and 2% of alginate containing synthetic peptide (C and D) gelled by 300 mM of CaCI 2 . Observation by SEM at *25 (A and C) and ⁇ 100 of magnification (S and D).
- This gel is not present on a titanium dioxide scaffold and not prepared by the method for producing a titanium dioxide scaffold comprising an alginate coating disclosed herein. Therefore, this gel adopts a porous structure.
- Figure 2 Release profile of peptide 2 labeled with FITC after 21 days of incubation at 37 °C. Bar graph show the amount of peptide released after each time point. Line graph represents cumulative amount of peptide released up to 21 days. Values represent mean +SEM.
- Figure 3 A. Top: number of adherent cells when seeding different amounts of cells (30 10 3 , 60 10 3 , 100 x 10 3 and 200 ⁇ 10 3 ceils Weil) after 1 and 5 days of culture. Values represent the mean ⁇ SEM. Bottom: representative picture of osteoblast ceils adhered on 2% alginate hydrogels when seeding 100 ⁇ 10 3 cells/well obtained by SEM at ⁇ 200 of magnification. B. Osteoblast attachment on 2% alginate coating.
- Cell nuclei are presented in white (DAP! staining) (Left column) and actin filaments are presented in white (phalloidin-FITC) (right column).
- the bar scale represents 150 pm.
- FIG. 5A-D Expression of cell adhesion related genes after culture of MC3T3-E1 cells onto 2% of alginate gels without peptide (-, control group), containing synthetic peptides or EMD (50 pg/m! for 14 and 21 days.
- Data represent relative mRNA levels of target genes normalized with reference genes, expressed as a percentage of control alginate gel at 14 days of culture, which was set to 100%. Values represent the mean ⁇ SEM. Differences between groups were assessed by Student Mest; (*) p ⁇ 0.05 versus control alginate gel (-), (#) p ⁇ 0.05 versus EMD.
- FIG. 6A-F Expression of osteoblast differentiation related genes after culture of MC3T3-E1 cells onto 2% of alginate gels without peptide (-, control group), containing synthetic peptides or EMD (50 pg/ml) for 14 and 21 days.
- Data represent relative mRNA levels of target genes normalized with reference genes, expressed as a percentage of control alginate gel at 14 days of culture, which was set to 100%. Values represent the mean ⁇ SEM. Differences between groups were assessed by Student f-test; (*) p ⁇ 0.05 versus control alginate gel (-), (#) p ⁇ 0.05 versus EMD.
- Figure 7 Release profile of peptide 2 (SEQ ID NO 1 ) from P2-alginate-coated scaffolds after 21 days of incubation at 37°C. Bar graph show the amount of peptide released after each time point. Line graph represents cumulative amount of peptide released up to 21 days. Values represent mean ⁇ SD.
- Figure 8 LDH activity measured from culture media collected after 48 h of culture. Values represent the mean ⁇ SEM. Mann-Whitney test (p ⁇ 0.05): (a) versus regular scaffold (SC) and (b) versus control alginate scaffold (-).
- Figure 9 SEM visualization of 2% alginate-coated Ti0 2 scaffolds (control alginate scaffold) at 10kV and 40Pa.
- Figures A and B show the microstructure of Ti0 2 scaffolds right after the coating process with one layer of 2% alginate gel at 50x (A) and 300x (B) of magnification.
- Figures C and D show cells cultured on control alginate scaffolds after 7 days of culture at 50x (C) and 300x (D) of magnification.
- FIG. 10 SEM visualization of MC3T3-E1 cells growing on regular scaffolds (A and B), control alginate scaffolds (C and D) and P2-alginate-coated scaffolds (E and F) after 7 (A, C and E) and 21 (B, D and F) days of culture. Scaffolds were observed by SEM at 10kV, 40Pa and x50 of magnification.
- Figure 11 Number of cells growing on the scaffolds after 7 days of culture. DNA content was analyzed by Hoechst fluorescence staining and correlated to a linear standard curve. Values represent the mean ⁇ SEM. Values represent the mean ⁇ SEM. Mann-Whitney test: (a) p ⁇ 0.05 versus regular scaffold (SC) and (b) versus control alginate scaffold ⁇ -).
- FIG 12 A-D Relative mRNA expression levels of ltgb1(A), Itgb3 (B), Fn1(C) and Itgad (D) in MC3T3-E1 cells cultured on Ti0 2 scaffolds for 7 ( ⁇ ) and 21 days ⁇ ).
- Regular scaffolds (SC) were used as reference group.
- Data represent fold changes of target genes normalized with reference genes (Gapdh and 18S), expressed as a percentage of cells cultured on regular scaffolds (SC) at day 7, which were set to 100%. Values represent the mean ⁇ SEM. Student t-test: (a) p ⁇ 0.05 versus regular scaffold (SC) and (b) versus control alginate scaffold (-).
- FIG 13A-H Relative mRNA expression levels of A) osterix (Osx), B) bone morphogenetic protein 2 (Bmp2), C) collagen-l (Coll-I), D) interleukin 6 (11-6), E) osteopontin (Opn), F) bone sialoprotein (Bsp), G) alkaline phosphatase (Alp) and H) osteocalcin (Oc) in MC3T3-E1 cells cultured on Ti0 2 scaffolds for 7 ( ⁇ ) and 21 days ( ⁇ ).
- Regular scaffolds were used as reference group. Data represent fold changes of target genes normalized with reference genes (Gapdh and 18S), expressed as a percentage of cells cultured on regular scaffolds (SC) at day 7, which were set to 100%.
- Figure 14 Scanning electron microscope characterization of alginate-coated Ti0 2 scaffolds. Scanning electron microscope visualization of alginate layer (arrows) coating the strut surface of Ti0 2 scaffolds at 250x (A) and 1500x (B, C) of magnification.
- FIG. Periodic acid-Schiff visualization of alginate-coated and uncoated Ti0 2 scaffolds. Periodic acid-Schiff staining of alginate-coated (A, B) and uncoated (C, D) Ti0 2 scaffolds. The alginate (red) is distributed throughout the scaffold as seen in the view from the top (A) and in the middle (B).
- FIG. 16 Simvastatin release. Release profile of SIM from alginate-coated Ti0 2 scaffolds containing 2.4 mM and 0.6 mM SIM after 19-day incubation at 37 ° C. Bar graph shows the amount of SIM released after each time point. Line graph represents cumulative amount of SIM released up to 19 days. Values represent the mean ⁇ SD.
- Figure 17A-C Lactate dehydrogenase activity assay. LDH activity in culture medium from scaffolds with 10 nM and 10 ⁇ SIM is shown compared to scaffolds without SIM for donor 1 (A), donor 2 (B) and donor 3 (C) measured every other day up til 14 days. Neither of the SIM concentrations caused a significant increase in LDH activity compared to the effect of alginate-coated scaffolds without SIM. Values represent the mean ⁇ SD.
- FIG. 18A-C Alkaline phosphatase activity assay.
- ALP activity (y axis) in culture medium from scaffolds with 10 nM and 10 ⁇ SIM is shown in percentage of control, scaffolds without SIM, for donor 1 (A), donor 2 (B) and donor 3 (C) at 2, 8, 14 and 21 days.
- ALP activity did not significantiy change in the culture medium at any of the time points measured either for scaffolds with 10 nM or 10 ⁇ SIM when compared to scaffolds without SIM. Values represent the mean ⁇ SD.
- FIG. 19A-C Immunoassay: Quantification of secreted proteins. Secretion of TNFRSF11 B, VEGFA and BGLAP to cell culture medium from scaffolds with 10 nM and 10 ⁇ SIM is shown in percentage of control, scaffolds without SIM, at 2, 8, 14 and 21 days. Values represent the mean ⁇ SD.
- FIG. 20 Real-time RT-PCR analysis. Relative mRNA expression levels for BGLAP are shown in cells cultured on scaffolds with 10 nM and 10 ⁇ SIM compared to scaffolds without SIM and normalized to reference gene GAPDH at 7, 14 and 21 days. Values represent the mean ⁇ SD.
- Figure 21A-C Confocal laser scanning microscopy visualization of type I collagen deposition in alginate-coated Ti0 2 scaffolds with or without simvastatin. Fluorescence immunocytochemical analysis of type ! collagen in primary human osteoblasts cultured on alginate-coated ⁇ 02 scaffolds. Type I collagen is detected in the majority of the cells cultured on scaffolds with 10 nM SIM (A), 10 ⁇ SIM (B) and without SIM (C). Extracellular collagen fibrils are only seen in scaffold without SIM (C). Type I collagen , DNA, Ti0 2 scaffold surface.
- FIG 22 Periodic acid-Schiff/Pan-cadherin visualization of alginate-coated and uncoated scaffold. Periodic acid-Schiff staining of alginate-coated (B) and uncoated (A) scaffold. The alginate (red) is distributed throughout the scaffold as seen in the view from the cross section (B). Periodic acid-Schiff/Pan-cadherin double staining of cell-seeded alginate-coated (D) and uncoated (C) scaffold at 2 day. Alginate layer containing cells is covering the scaffold (D).
- Figure 23 Acridine-orange/ethidium bromide visualization of cell-seeded alginate-coated scaffold. Acridine-orange/ethidium bromide staining of human adipose-derived
- mesenchymal stem cells seeded on alginate-coated scaffold at 2 day. Majority of the cells have survived the alginate coating procedure. Live cells stain green, dead cells stain red.
- Figure 24A-D Lactate dehydrogenase activity and total protein content assays.
- Lactate dehydrogenase activity and total protein content in culture medium from cell-seeded alginate-coated scaffolds with (EMD alginate) or without emdogain (Alginate) is shown in percentage of control, cell-seeded uncoated scaffolds, for human adipose-derived mesenchymal stem cells (hAD-MSC) (A, C), and primary human osteoblasts (hOST) (B, D) measured at every other day up to 14 days. Values represent the mean + SD.
- hAD-MSC human adipose-derived mesenchymal stem cells
- hOST primary human osteoblasts
- FIG. 25 Confocal laser scanning microscopy visualization of RUNX2 and SOX9. Fluorescence immunocytochemical analysis of RUNX2 and SOX9 in human adipose- derived mesenchymal stem cells cultured on alginate-coated scaffold with emdogain (A) and uncoated scaffold (B). RUNX2 is detected in the majority of the cells cultured on scaffolds with emdogain (A). However RUNX2 and SOX9 are detected equally in the cells cultured on uncoated scaffold (B). RUNX2 (green), SOX9 (red), T1O2 scaffold surface (white).
- Figure 26 Cross section of Ti0 2 scaffold coated with an alginate layer produced by the method of the present document showing an open porous structure. The diameter of the section is 3 mm.
- the present document is in one aspect directed to a method for producing a titanium dioxide scaffold comprising an alginate coating.
- the present document is therefore directed to a method for producing a titanium dioxide scaffold comprising an alginate coating, which method comprises the steps of:
- step b) providing the titanium dioxide scaffold obtained in step b) with a divalent cation salt solution, wherein said divalent cation is selected from the group consisting of Ca 2* , Mg 2+ , Ba 2+ or Sr 2+ , and then optionally rinsing the titanium dioxide scaffold; and
- steps b) and c) optionally are repeated at Ieast once.
- the method may also consist of the above steps a)-d), wherein steps b) and c) optionally are repeated at Ieast once.
- steps b) and c) are repeated, an alginate coating comprising two or more alginate gel layers is built up.
- the alginate coating may therefore comprise or consist of one or more alginate gel layers.
- the alginate and/or the divalent cation salt solution(s) may further comprise one or more biologically active substances as disclosed elsewhere in this document.
- the titanium dioxide scaffold may optionally be centrifuged after the divalent cation salt solution has been provided to the scaffold but preferably before the optional rinsing.
- the above method may also be denoted a method for coating at Ieast part of a titanium dioxide scaffold with an alginate coating.
- the alginate coating may also be denoted a coating of alginate. It is to be understood that in the alginate coating, the alginate adopts a ge!-like state when wet. However, it is to be also to be understood that a certain amount of moisture is required for the alginate coating to adopt this gel-like state. Therefore, when an alginate coated titanium dioxide scaffold is dried, stored in a dry place and the like, the alginate coating will rather be in the form of a thin, dehydrated, film layer (aka a "xerogel").
- the alginate coated titanium dioxide scaffold is subjected to a moister environment, such as when implanted in a body or when immersed in an aqueous solution, the alginate coating will adopt a gel-like appearance again.
- a moister environment such as when implanted in a body or when immersed in an aqueous solution
- the alginate coating will adopt a gel-like appearance again.
- this is to be understood to encompass both moist and dry forms of the alginate coating.
- the titanium dioxide scaffold produced by the present method may be denoted a" titanium dioxide scaffold comprising an alginate coating", an "alginate coated titanium dioxide scaffold” or the like.
- the titanium dioxide scaffold has an outer surface which will be at least partially covered by the alginate coating.
- the who!e of the outer surface of the titanium dioxide scaffold may be covered by the alginate coating.
- the alginate solution and the divalent cation solution will also be allowed to penetrate the pores of the scaffold and the alginate coating consequently also form on the surface of at least part of the pores inside the scaffold.
- the alginate coating will form, will of course depend on factors such as scaffold porosity (a larger porosity will ease the penetration of alginate and allow the coating to form deeper inside the scaffold), concentration of alginate and/or divalent cation solution, the centrifugation speed etc.
- the present method allows at least part of the surface (the walls) of at least the outer pores of the titanium dioxide scaffold to be coated with an alginate coating.
- the alginate coating is present throughout the scaffold structure (i.e. line the walls of the majority or all of the pores of the scaffold), when an alginate coated titanium dioxide scaffold is analysed by scanning electron microscopy (SEM).
- the alginate coating therefore does not only form on the outer surface of the titanium dioxide scaffold, but also in a varying degree on the surface of the pores inside the scaffold.
- the majority of the pore surfaces onto which the alginate coating is provided will be coated with the alginate coating.
- the whole of or only part of the titanium dioxide scaffold may be provided with the alginate and/or divalent cation solutions, such as 10-100 %, 20-98 %, 30-98 %, 40- 98 % , 50-98 %, 60-98 %, 70-98 %, 80-98 % or 90-98 % of the inner and outer surfaces of the scaffold. It is to be understood that even when all of the inner and outer scaffold surfaces (i.e. both the outer surface and the walls of the inner pores) are to be provided with an alginate coating , minor parts of the surfaces may remain uncoated as not each and every part of the walls of the pores may be reached by the alginate and divalent cation solutions during the preparation of the alginate layer.
- the use of centrifugation both enables the formation of a thin alginate coating and forces the alginate and divalent cation solutions into the inner parts of the scaffolds, thereby enabling the formation of the alginate coating also on the inner parts of the pores.
- the part of the scaffold on which such alginate coating formation is desired must be subjected to both the alginate and the divalent cation solutions as no gelation of the alginate will otherwise occur.
- the present method it is possible to form a thin alginate coating on the titanium dioxide scaffold as the centrifugation in step b) allows a very thin layer of alginate solution to be deposited on the outer surface and a!so inside the pores of the titanium dioxide scaffo!d.
- the thin alginate coating may be the result of the low density of the alginate and divalent cation solutions used, which allow their penetration into the pores of the scaffold.
- the present method allows each alginate gel layer of the alginate coating to typically have a wet thickness of at least 1 pm, such as about 3 pm, on the surfaces it coats.
- an alginate coating consisting of two or more alginate layers may be built up.
- the present method may therefore be used to control the thickness of the alginate coating by repeating steps b) and c), such as for 2-100, 2-10, 2-6, 2-4, 3 or 4 times, until an alginate coating of the desired thickness is obtained.
- the alginate coating may therefore comprise one or more alginate gel layers.
- the alginate coating typically has a thickness of about 1 - 20 pm, such as 1-10 ⁇ or 3-8 ⁇ .
- the alginate coating consists of 1 -10 alginate gel layers, such as 2-6, 2-4, 3 or 4 layers.
- the size of the biomolecule may affect the choice of the number of layers.
- a smaller biomolecule i.e. having a lower Mw, such as doxycycline
- the release rate from the alginate coating is more dependent on degradation of the alginate gel, and the biomolecule does not diffuse out of the alginate coating as fast as a smaller biomolecule. Therefore, less alginate gel layers in the alginate coating may be used for a larger biomolecule.
- the number of alginate gel layers in the alginate coating may therefore be adjusted to achieve the desirable release rate.
- the thin thickness of the alginate coating is advantageous as such a thin alginate coating will not substantially block the pore openings of the titanium dioxide scaffold, even if the pore diameter of course is somewhat reduced due to the alginate coating. Rather, the alginate coating lines the walls of the titanium dioxide scaffold pores. Some initial blocking of the scaffold pores may occur even when a thin alginate coating is prepared, but in a biological environment, a certain degradation of the blocking alginate coating was seen in those pores that remained blocked right after the coating process (see Example 2). The substantial lack of pore blocking is advantageous as cell growth into the titanium dioxide scaffold thereby may be improved as the pores, despite the alginate coating, are readily accessible for penetration by cells and tissue.
- the present method allows an alginate coating having a more even thickness to form.
- the alginate coating formed by the method of the present document is substantially non-porous, c.f. an alginate gel prepared by simply mixing alginate and a divalent cation salt solution which has some porosity (see e.g. the gel prepared in Example 1 and depictured in Fig. 1 ).
- the reason for the substantial lack of porosity of the alginate coating when prepared on a titanium dioxide scaffold by the method disclosed herein, is probably the thin coating of alginate solution formed on the titanium dioxide scaffold after centrifugation in step b).
- Another advantage with the present method is that, as the alginate coating forms on the inside of at least part of the pores in a thin layer, there will be a very large surface-to- volume ratio as compared to if the alginate coating would only form on the outer surface of the scaffold. This will affect the release profile of any substance, such as a biologically active substance (see elsewhere herein), included in the alginate coating. Also, even if the alginate coating would flake off from the outer surface of the titanium dioxide scaffold, the alginate coating would still be present on the surface of the pores inside the scaffold. Also, the present method allows the formation of an alginate coating comprising one or more alginate gel layers by repeating steps b) and c). If preferred, this also allows the formation of different alginate gel layers with different biologically active substance and/or types of alginate or divalent cation in the different layers.
- step c) before step b).
- a thin coating of alginate is not formed. Rather, the alginate coating fills up the majority of the pores inside the titanium dioxide scaffold. This may be particularly advantageous when cells, such as stem cells, are to be incorporated into the titanium dioxide scaffold, as this allows a large number of cells to be deposited inside the scaffold pores.
- step c) is performed before step b) it may be superfluous to repeat steps c) and b) as most of the pores of the titanium dioxide scaffold will be filled up with alginate coating already after performing steps c) and b) once.
- the present document is therefore also directed to a titanium dioxide scaffold comprising an alginate layer produced by performing step c) before step b).
- the alginate solution is an aqueous solution comprising alginate. It may be prepared by dissolving alginate in distilled water or a suitable buffer, such as phosphate buffered saline, by stirring until the alginate is dissolved, preferably at room temperature, e.g. for 1 hour to overnight (e.g. 1 -24 hours).
- a suitable buffer such as phosphate buffered saline
- the alginate may e.g. be chosen from the group consisting of sodium alginate, potassium alginate, calcium alginate, and strontium alginate. A mixture of two or more kinds of alginates may be used.
- the alginate is typically a high molecular weight alginate having a molecular weight (M w ) of about 10 000-600 000 g/mol, such as about 10 000-100 000 g/mol, 100 000-300 000 g/mol, 250 000-600 000 g/mol, 50 000-150 000 g/mol, 50 000- 200 000 g/mol, or 50 000-100 000 g/mol.
- M w molecular weight
- the alginate may also have a high molecular weight of about 1000-200 000 g/mol.
- the concentration of alginate in the alginate solution is typically about 1 -3% w/v, such as 1 .5-2.5% w/v or about 2% w/v, such as at least 1 % and at the most 3,5%, such as at the most 3%.
- the alginate may comprise a minimum of about 60% of guluronic (guluronate) monomers.
- Biomolecules i.e. biologically active substances, disclosed elsewhere herein may be added to the alginate solution.
- the concentration of the biologically active substance when added to the alginate solution, of course depends on the specific biologically active substance and/or its intended function in the body. Typically, it's concentration in the alginate solution is in the range of micrograms, although it may range from 1 ng-1 mg/ml, such as 500 ng/ml-500 ⁇ ⁇ , 1 -500 ng/ml, 1 -100 ⁇ / ⁇ , 1 -80 ⁇ , 20-70 ⁇ /m ⁇ , 40-60 ⁇ 9 ⁇ or 50 ⁇ g/m1.
- the scaffold may be immersed into an alginate solution. This may take place under agitation, e.g. via an orbital shaker at about 100 rpm/min. The agitation helps in spreading the alginate solution in the porous network of the scaffold, Typically, the titanium dioxide scaffold is immersed for a time period of about 10 min to 2 hours, such as 1 -2 hour, e.g. 1 hour. The immersion typically takes place at room temperature. After immersion into an alginate solution, excess solution is removed typically by careful centrifugation of the titanium dioxide scaffold, such as at about 200-300 x g, for a short time period, such as 0.5-2 min, e.g. 1 min.
- the titanium dioxide scaffold is provided with a divalent cation salt solution.
- the divalent cation salt solution (also denoted “divalent cation solution” herein) is an aqueous solution comprising at least one salt of a divalent cation, such as Ca 2+ , Mg 2+ , Ba 2+ or Sr 2+ .
- suitable divalent cation salts include, but are not iimited to, CaCI 2, SrC ⁇ , SrC0 3 , SrP0 4 , CaC0 3 , CaP ⁇ 3 ⁇ 4, MgCi 2 , MgC0 3 , and MgP0 4 .
- the concentration of the divalent cation salt in this solution is typically about 1 5-500 mM, such as about 15-150, 20-500 mM, 20-100 mM, 20-400 mM, 200-400 mM, 250-350 mM, 30-80 mM, 40-60 mM, 45-55 mM or about 50 mM.
- the concentration is about 20-100 mM.
- the divalent cation salt is CaCI 2 .
- the titanium dioxide scaffold may be immersed in the divalent cation solution for a period of time of e.g. 10 min to 2 hours, such as 1-2 hour, e.g. 1 hour.
- the scaffold is optionally rinsed, e.g. in distilled water to remove excess divalent cation solution. Excess divalent cation salt solution may alternatively or in addition be removed by careful centrifugation of the titanium dioxide scaffold, such as at about 200-300 x g, for a short time period, such as 0.5-2 min, e.g.
- the optional rinsing preferably takes place after the centrifugation.
- biologically active substances may be added to the divalent cation solution (e.g. in the same concentrations as when added to the alginate solution), although these are preferably added to the alginate solution, when biologically active substances are to be included in the alginate coating.
- Step d) may be optional and may be performed for a time period of about 0.5 hours to several days. It may e.g. be performed overnight, e.g. for 0.5-24 hours, 5-10 hours or just 1 hour. Typically this step is performed at room temperature.
- the method for producing an alginate coated titanium dioxide scaffold disclosed herein provides a titanium dioxide scaffold provided with an alginate coating, optionally also comprising a biologically active substance(s).
- This document is therefore also directed to a titanium dioxide scaffold comprising an alginate coating, optionally comprising a biologically active substance(s), obtainable or obtained by the method disclosed herein.
- a titanium dioxide scaffold may e.g. be denoted an alginate coated titanium dioxide scaffold or a titanium dioxide scaffold comprising an alginate coating.
- the titanium dioxide scaffold comprising an alginate coating is typically used as a medical implant, either aione or comprised as a part of an implant.
- the titanium dioxide scaffold structure used allows tailor-making of implant structures, specifically adapted to the implantation site and intended function of the implant. This document is therefore also directed to a titanium dioxide scaffold comprising an alginate coating for use as a medical implant.
- the alginate coated titanium dioxide scaffold comprises a porous structure which has a good biocompatibi!ity and which may stimulate the growth of cells and attachment of the scaffold or the implant comprising the scaffold.
- the porous structure allows ingrowth of cells into the scaffold, which thereby allows for the regeneration of tissue.
- the large surface area also facilitates the growth of cells into the structure and thereby the attachment of the scaffold and regeneration of tissue.
- the titanium dioxide scaffold in itself is made of a material which has a good biocompatibility, adverse reactions to the scaffold when implanted into a subject are reduced.
- Alginate gels have been used for different applications in tissue engineering such as space filling agents, as delivery vehicles for bioactive molecules, and as three dimensional structures that organize cells and present stimuli to direct the formation of a desired tissue and the alginate coating disclosed in the present document may advantageously be used for any such purpose.
- the titanium dioxide scaffolds of the 10 present document may also advantageously be used for cell seeding, before or after being coated with an alginate layer by a method disclosed herein.
- the titanium dioxide scaffold comprising an alginate coating may be implanted into a subject wherein cells will grow into the scaffold structure. It is also possible to seed and grow cells on the alginate coated titanium dioxide scaffold prior to implantation.
- interconnected macroporous structure of the titanium dioxide scaffold is especially suitable for tissue engineering, and notably bone tissue engineering, an interesting alternative to currently available bone repair therapies.
- bone marrow- derived cell seeding of the titanium dioxide scaffold is performed using conventional methods, which are well known to those of skill in the art (see e.g. Maniatopoulos et al.
- Cells are seeded onto the alginate coated titanium dioxide scaffold and cultured under suitable growth conditions. The cultures are fed with media appropriate to establish the growth thereof. It is also possible to seed the titanium dioxide scaffold with cells, such as stem cells, such as mesenchymal stem cells, prior to providing the alginate coating to the scaffold (see Example 4 for an exemplary method to perform such cell seeding and
- Cells of various types can be grown throughout the alginate coated titanium dioxide scaffold. More precisely, cell types include hematopoietic or mesenchymal stem cells, and also include ceils yielding cardiovascular, muscular, or any connective tissue. Ceils may be of human or other animal origin. However, the alginate coated titanium dioxide scaffold 30 is particularly suited for the growth of osteogenic cells, especially cells that elaborate bone matrix. For tissue engineering, the cells may be of any origin. The cells are advantageously of human origin.
- a method of growing cells in an alginate coated titanium dioxide scaffold allows seeded osteogenic cells, for example, to penetrate the titanium dioxide scaffold to elaborate bone matrix, during the in vitro stage, with pervasive distribution in the structure of the titanium dioxide scaffold. Osteogenic cell penetration and, as a result, bone matrix elaboration can be enhanced by mechanical, ultrasonic, electric field or electronic means.
- the alginate coated titanium dioxide scaffold is useful whenever one is in need of a structure to act as a framework for growth of cells, such as for regeneration of a tissue.
- the presence of the alginate layer of the titanium dioxide scaffold allows the delivery of biologically active substance which may improve the scaffolds integration, biocompatibility etc.
- the alginate coated titanium dioxide scaffold is particularly useful for the regeneration of bone and cartilage structures. Examples of situations where the regeneration of such structures may be necessary include trauma, surgical removal of bone or teeth or in connection to cancer therapy.
- Examples of structures in a subject which wholly or partially may be replaced include, but are not limited to, cranio-facia! bones, including arcus zygomaticus, bones of the inner ear (in particular the malleus, stapes and incus, maxillar and mandibular dentoalveo!ar ridge, walls and floor of eye sockets, walls and floor of sinuses, skull bones and defects in skull bones, socket of hip joint ⁇ Fossa acetabuli), e.g.
- the alginate coated titanium dioxide scaffold is useful for the filling of all types of bone defects resulting from (the removal of) tumors, cancer, infections, trauma, surgery, congenital malformations, hereditary conditions, metabolic diseases (e.g. osteoporosis and diabetes).
- the alginate coated titanium dioxide scaffold prepared by the disclosed method or a medical implant comprising such a scaffold may be used for the regeneration, repair, substitution and/or restoration of tissue, such as bone.
- This document is therefore also directed to the alginate coated titanium dioxide scaffold or a medical implant comprising it for use for the regeneration, repair, substitution and/or restoration of tissue, such as bone.
- the alginate coated titanium dioxide scaffold obtainable or obtained by the method of the present document may also be used for the preparation of a medical implant for the regeneration, repair, substitution and/or restoration of tissue.
- the alginate coated titanium dioxide scaffold may also be used for the preparation of a medical implant for the regeneration, repair, substitution and/or restoration of tissue, such as bone.
- the alginate coated titanium dioxide scaffold obtainable or obtained by the method of the present document or a medical imp!ant comprising it may also be used in a method for the regeneration, repair, substitution and/or restoration of tissue, such as bone, comprising the implantation into a subject in need thereof of the scaffo!d or medical implant comprising such an alginate coated titanium dioxide scaffold.
- Biomolecules Biologically active substances (biomolecules)
- the alginate solution and/or the divalent cation solution may comprise one or more different kinds of biologically active substance(s).
- the biologically active substance(s) may therefore be incorporated into the alginate coating.
- the alginate coating may therefore act as a carrier for a biologically active substance and biologically active substances consequently delivered by the alginate coated titanium dioxide scaffold via the alginate coating.
- the alginate coating may comprise one kind of biologically active substance or a mixture of two or more biologically active substances.
- the different layers may comprise different biologicaily active substances.
- the biologically active substance may be any substance having a biological activity in the body, such as a synthetic or natural bioactive molecule, a natural or synthetic drug, and/or a living cell.
- biologically active ions may also be incorporated, such as calcium, chromium, fluoride, gold, iodine, potassium, magnesium, manganese, selenium, sulphur, stannum, sodium, zinc, strontium, nitrate, nitrite, phosphate, chloride, sulphate, carbonate, carboxyl or oxide.
- the biologicaily active substance may also be a cell.
- living ce!ls for incorporation in the alginate coating include, but are not limited to, mesenchymai stem cells, bone cells, pluripotent cells, bone precursors cells, vascular ceils, precursors vascular cells, and/or stromal cells.
- biologically active substances also include, but are not limited to, natural or recombinant bto-adhesives; natural or recombinant cell attachment factors; natural, recombinant or synthetic biopo!ymers; natural or recombinant b!ood proteins; natural or recombinant enzymes; natural or recombinant extracellular matrix proteins; natural or synthetic extracellular matrix biomolecules; natural or recombinant signal molecules, growth factors and hormones; natural, recombinant and synthetic peptides, synthetic peptide hormones; natural, recombinant or synthetic deoxyribonucleic acids; natural, recombinant or synthetic ribonucleotide acids; natural or recombinant receptors; enzyme inhibitors; drugs; biologically active anions and cations; vitamins, such as vitamin D; adenosine monophosphate (AMP), adenosine diphosphate (ADP) or adenosine triphosphate (ATP); marker biomo
- Peptides and proteins suitable for incorporation into the alginate coating include peptides and proteins known to affect cell growth and/or osseotntegration of implants.
- a number of natural peptides have been shown to induce mineral precipitation and may therefore suitably be incorporated in the alginate coating. Examples include collagen 1 and 2, ameiogenin, ameloblastic bone sialoprotein, enamelin, and ansocalcin. Deposition and growth of apatites into endoskeletai mineralized tissues is a process guided by polyproline-rich proteins.
- Poiyproline repeats are a common characteristic of hard tissue extracellular matrix proteins, playing a role on compaction of protein matrix, conformational variability, the apatite crystal length and bond to protein domains frequently involved in signaling events.
- enamel matrix derivative EMD
- EMD is an extract of porcine fetal tooth material used to biomimetically stimulate the soft and hard growth.
- EMD has also been proven to have a diversity of other biological activities, such as inhibition of inflammation and infection.
- a commercial product comprising EMD is Straumann®Emdogatn (Straumann AG, Peter Merian-Weg 12, CH 4052 Basel, Switzerland).
- EMD contains a large amount of ameiogenin, which is a protein which suitably may be incorporated into the alginate matrix, as mentioned above.
- peptides suitable for incorporation in the alginate coating include peptides based on the consensus peptides disclosed in WO 2008/078167, which induce biomineraltzation.
- Peptides P2 (SEQ ID NO 1 ), P5 (SEQ ID NO 2) and P6 (SEQ ID NO 3), used in the experimental section, are examples of peptides based on the consensus sequences of WO 2008/078167 which may suitably be incorporated in the alginate coating.
- Other examples of such a sequence are P1 (SEQ ID NO 4: PLV PSY PLV PSY PLV PSY PYP PLPP), P3 (SEQ ID NO 5: PLV PSQ PLV PSQ PLV PSQ PQP PLPP) and P4 (SEQ ID NO 6: PLV PCC PLV PCC PLV PCC PCP PLPP).
- the biologically active substance may typically be a substance which promotes the integration of the titanium dioxide scaffold in a subject.
- the diffusion rate of biologically active substances optionally incorporated in the alginate coating is affected by the molecular weight and size of the biologically active substances (defined by Stokes radii) compared to the pores of the alginate coating and depends on the chemical nature of the biologically active substance (interactions molecule-alginate, polarization, i.e. hydrophi!ic substances may diffuse very quickly while hydrophobic substances diffuse slowly through the alginate gel).
- a burst release profile of the biologically active substance during the first day or days after implantation of the alginate coated titanium dioxide scaffold in a subject may be found for a smaller biologically active substance, such as the peptides used in the experimental section of this document.
- a smaller biologically active substance such as the peptides used in the experimental section of this document.
- the titanium dioxide scaffold of the present document is a reticulated scaffold which may function as a structural support which allows tissue formation by creating a three dimensional space for cellular attachment and ingrowth.
- the titanium dioxide of the scaffold provides a scaffold which is biocompatible and which can be processed into different shapes to provide mechanical support and a framework for cellular growth.
- the titanium dioxide scaffold provides a suitable structure to be used in tissue engineering, such as for regeneration of bone.
- the titanium dioxide scaffold suitable for use in the context of the present document is a scaffold basically formed of titanium dioxide, i.e. titanium dioxide is the main structural component of the titanium dioxide scaffold.
- the titanium dioxide scaffold should adopt an open porous structure.
- the titanium dioxide scaffold typically is macroporous scaffold comprising macropores and interconnections. Macropores of the titanium dioxide scaffold have a pore diameter in the range between approximately 10-3000 pin, such as 20-2000 ⁇ , about 30-1500 ⁇ or about 30-700 pm. it is important that the titanium dioxide scaffold allows for the ingrowth of larger structures such as blood vessels and trabecular bone, i.e. also comprises pores with a diameter of about 100 pm or more. It is important that at least some of the pores are interconnected and/or partially interconnected.
- the pore diameter may affect the rate and extent of growth of cells into the titanium dioxide scaffold and therefore the constitution of the resulting tissue.
- the macroporous system typically occupies at least 50% volume of the titanium dioxide scaffold.
- the volume of the macro- and micropores in the titanium dioxide scaffolds may vary depending on the function of the titanium dioxide scaffold. If the aim with a treatment is to replace much bone structure and the titanium dioxide scaffold can be kept unloaded during the healing time, the titanium dioxide scaffold may be made with a macroporous system occupying up to 90% of the totai scaffold volume.
- the titanium dioxide scaffold typically has a total porosity of about 40-99%, such as 70- 90%.
- the fractal dimension strut of the titanium dioxide scaffold is typically about 2.0-3.0, such as about 2.2-2.3.
- the strut thickness affects the strength of the titanium dioxide scaffolds, the thicker the struts in the titanium dioxide scaffold are, the stronger the titanium dioxide scaffold is.
- the titanium dioxide scaffold typically has an inner strut volume of about 0.001-3.0 ⁇ 3 , such as about 0.8-1.2 ⁇ 3 .
- a lower volume and a higher fractal number give a stronger scaffold.
- the surface of the titanium dioxide scaffold has a structure on the microlevel and the nanoievei. This micro and nano structure may be modified due to the manufacturing conditions.
- the pore diameters on the microlevel are typically in the range of 1-10 pm.
- the pore diameters on the nanoievei typically are less than 1 pm.
- a titanium dioxide scaffold structure in the present context typically has a combined micro and macro pore diameter of approximately 10 - 3000 pm, such as 20-2000 pm, 30-1500 pm or 30-700 pm.
- the pore diameter may also be above 40 pm, with interconnective pore of at least 20 pm.
- the size and the shape of the titanium dioxide scaffold are decided depending on its intended use.
- the titanium dioxide scaffold size and shape may be adjusted either at the stage of production or by later modification of a ready scaffold.
- the titanium dioxide scaffolds may therefore easily be tailored for their specific use in a specific subject. Typically the size, shape etc. of the titanium dioxide scaffold is adjusted before being coated with an alginate coating.
- the titanium dioxide scaffold may be produced by a method of dipping a polymer sponge structure in a titanium dioxide slurry (see e.g. the methods disclosed in WO08078164), allowing the slurry to solidify on the sponge and performing one or more sintering steps to remove the sponge and creating a strong scaffold structure.
- the titanium dioxide scaffold may therefore for example be a titanium dioxide scaffold disclosed in WO08078164.
- Such a method may include the steps of:
- step b) providing the slurry of step a) to a combustible porous structure, such as a porous polymer structure, such as a sponge structure
- step d) may be performed by
- Enamel matrix derivative was kindly supplied by Straumann GmbH (Basel, Switzerland). EMD was dissolved to 10 mg/ml in 0.1 % acetic acid in phosphate-buffered saline (PBS) (PAA Laboratories GmbH, Pasching, Austria). Three synthetic peptides (Table 1 ) were designed as described in detail in previous studies (Rubert M et al., 201 1 )
- Peptides were purchased from Eurogentec (Seraing, Belgium). The synthetic peptides were dissolved to 5 or 10 mg/m! (in the case of peptide 2 FITC-labeled) in 0.1 % acetic acid in PBS. Aiiquots to avoid repeated freeze-thaw cycles were prepared and stored at -20°C until use.
- Sodium alginate (Pronova UP LVG ®)— a low viscosity alginate where minimum 60% of monomers are guluronate— was purchased from NovaMatrix (FMC BioPolymer AS, Norway). The sodium alginate was used without further purification. Two percent (w/v) sodium alginate was prepared in PBS and stirred at 180 rpm at room temperature overnight to get a homogenous alginate hydrogel. The alginate solution was mixed with synthetic peptides or EMD at final concentration of 50 jug/ml.
- alginate containing synthetic peptides/EMD was then distributed into 24-well culture plate and sprayed with 300 mM CaCI 2 by means of an aerograph paint atomizer (Precisso ®, Madrid, Spain). After 1-2 h of incubation at room temperature, alginate hydrogel was completely gelled.
- Relative fluorescence units were correlated with the amount of peptide released using a linear standard curve for each time point.
- the mouse osteoblastic cell line MC3T3-E1 (DSMZ, Braunschweig , Germany) was maintained as previously described (Tiainen H ef a/. , 201 1 ). Before seeding, 24-well culture plates containing crosslinked alginate hydrogels were washed with 750 ⁇ of culture media to remove the excess of CaCI 2 . After evaluation of the efficiency of cell adhesion on 2% alginate gel using different cell densities, for the final experiments, cells were seeded at a density of 100 000 cells/Well. Media was refreshed twice a week. Culture media was collected 24 h after seeding to study cell viability.
- Adhesion of cells onto the alginate hydrogel after one and five days post-seeding was evaluated in order to determine the best seeding density for the experiments. Densities from 30 ⁇ 10 4 to 200 * 10 4 ceils/Well were tested. Cells that were adhered onto the alginate hydroge! were lysed by a freeze-thaw method in deionized distilled water. Cell lysates were used for determination of DNA quantity using Hoechst 33 258 fluorescence assay. Samples were mixed with 20 ⁇ glm ⁇ of Hoechst 33 258 fluorescence stain (Sigma, St.
- the LDH activity determined in the culture media after 24 h was taken as an indicator of membrane leakage or cell lysis.
- the activity of the cytosolic enzyme was estimated as previously described (Rupert M et a/. , 201 1 ).
- Table 2 Sequence of osteoblast markers related genes.
- Itgb1 S 5' AGCAGGCGTGGTTGCTGGAA -3 ' (SEQ ID NO 13)
- RNA-to-cDNA kit (Applied Biosystems, Foster City, CA), according to the protocol of the supplier. Aliquots of each cDNA were frozen (-20 °C) until the PCR reactions were carried out.
- Real-time PCR was performed in the Lightcycler 480® (Roche Diagnostics, Mannheim, Germany) using SYBR green detection. Real-time PCR was done for two reference genes (18SrRNA and glyceraidehyde-3-phosphate dehydrogenase (GAPDH)) and ten target genes (integrin a!pha 8 (Itga8), integrin betal (Itgb l), integrin beta 3 (Itgb3), fibronectin 1 (F i1 ), bone morphogenetic protein 2 (Bmp2), collagen type I (Co//-/), bone siaioprotein ⁇ Bsp), alkaline phosphatase ⁇ Alp), osteocalcin (Oc) and osteopontin ⁇ Opn)).
- GPDH glyceraidehyde-3-phosphate dehydrogenase
- the primer sequences are detailed in Table 2. Reaction conditions and relative quantification have been done as previously described (Tiainen H ef a/. , 201 1 ).
- Figure 1 shows the microstructure of a cross section from a lyophilized 2% alginate hydrogel ( Figures 1 A) and S)) and 2% alginate hydroge! containing synthetic peptide ( Figures 1 C) and D)).
- Figures 1 A and S 2% alginate hydrogel
- Figures 1 C 2% alginate hydroge! containing synthetic peptide
- Peptide release profile from 2% alginate hydrogeis is depicted in Figure 2.
- Bmp2 relative mRNA levels increased significantly after 14 days of treatment with P6, while decreased after 21 days of treatment with P2 compared to EMD. Though EMD treatment induced a significant decrease on Bmp2 mRNA levels after 14 days of cell culture compared to control, an increase on Bmp2 mRNA levels was found after 21 days, 15 although differences did not reach statistical significance (Figure QA)).
- Opn mRNA levels increased significantly with any of the synthetic peptides and EMD compared to control.
- EMD treatment markedly increased mRNA expression levels of Opn compared to P2 and P6 treatment ( Figure 6F)).
- Polyproline-rich synthetic peptides have previously been shown to induce bone formation 30 and mineralization in vitro and to decrease bone resorption in vivo.
- the aim of this study was to develop a suitable formulation with a hydrogel for local treatment with these synthetic peptides to promote bone formation and mineralization, either alone or as a biodegradable coating for skeletal implants.
- cells were exposed to alginate gel containing different synthetic peptides and cultured for a long-term period in order to evaluate the effect of those peptides on the biological response of osteoblasts.
- the optimal formulation of the hydrogel has to allow the formation of a compact structure for a controlled, local and specific bioactive molecule delivery. Such features are governed by the physical property (e.g. mechanics, degradation, gel formation), the mass transport property (e.g. diffusion) and the biological interaction requirements (e.g. cell adhesion and signaling) of each specific application.
- alginate gel Protanal LF200M, FMC polymers, Oslo, Norway
- 2% alginate hydrogel was ionically cross-linked with 300 mM of CaCI 2 and selected as the material of choice.
- alginate gel for cell adhesion and proliferation was also examined since alginate has been described as an inert substrate with insufficient protein interaction for cell attachment, and it has been suggested that mammalian ceils cannot interact with unmodified alginate hydrogels.
- alginate hydrogel cova! ently couple to the polymer an entire ECM protein or a peptide sequence capable of binding to cellular receptors. Indeed, some studies have reported that modification of alginate with an RGD-containing peptide promoted cell adhesion and spreading, whereas minimal cell adhesion was observed on unmodified alginate hydrogels.
- the alginate hydrogel showed to be non-toxic for the MC3T3-E1 cells, displaying some kind of protective effect on cell viability compared to cells cultured on tissue culture plastic. Moreover, it was validated that the synthetic peptides administered as a hydrogel formulation are non-cytotoxic, in agreement with the results obtained in previous studies after short- and long-time cell treatment.
- Stable osteoblastic cell adhesion is largely mediated by integrins, heterodimeric receptors composed of or and ⁇ subunits that dimerize in specific combinations and interact with extracellular matrix proteins. It has been shown that osteoblasts express different integrin receptors depending on the materia! where they are grown. In addition to their role in cell adhesion, integrins regulate cytoskeleton organization and mediate signal transduction, and therefore regulate the expression of genes controlling proliferation, differentiation and matrix remodeling.
- the synthetic peptides may affect integrin expression and cell adhesion on the alginate hydrogels.
- the mRNA expression levels of Itga8, Itgb l, Itgb3 and the extracelluiar matrix protein Fn 1 were studied.
- the expression of Itgb l, Itgb3 and Fn 1 was significantly decreased after 14 days of treatment with synthetic peptides, especially for P2 and P6.
- the ⁇ integrin subunit is found in the bone receptors for collagen, fibronectin and laminin mediating adhesion of osteoblasts to ECM whereas av 33-integrin would mediate the adhesion to Opn and vitronectin.
- the mode of action of the synthetic peptides might involve interaction with a receptor capable of influencing intracellular signaling cascades, and that the exposition of their C termini containing conserved proline-rich region (PPLPP) may be of importance in the signaling activity of the synthetic peptides.
- the synthetic peptides show signature of compact, well-packed structures lacking secondary structure elements, as expected due to the rich content of prolines and expose their PPLPP stretch in a way suitable for interactions. While peptide 2 and peptide 6 present two distinct loops, peptide 5 has different topology of loops that makes possible a contact between C and N terminus. Therefore, the fact these structural differences in the accessibility of the C terminus and structural rigidity of this short consensus sequences (PPXPP) between different peptides could affect in the interaction with a receptor may explain the differential expression of adhesion genes.
- osteocalcin the most specific and the latest of expressed osteoblast markers with a role in mineralization, was significantly induced after 14 and 21 days of treatment with the formulated synthetic peptides compared to untreated and EMD alginate gel, i.e. in agreement with the results obtained when administered in the culture media. Accordingly, Opn, a sialoprotein produced at various stages of differentiation with higher levels expressed after mineralization has been initiated, was significantly up- regulated after 21 days of treatment with both EMD and synthetic peptides compared to control.
- the synthetic peptides improve the alginate hydrogel properties for cell attachment and that the cells cultured on the hydrogel formulated with synthetic peptides were at a more mature stage of the differentiation process over the cells cultured on control hydrogel and hydrogel formulated with EMD.
- the mode of action of the synthetic peptides might involve interaction with a receptor capable of influencing intracellular signaling cascades at the initial states of cell differentiation to finally stimulate osteoblast-differentiation and that the accessibility and structural rigidity of this short consensus sequence (PPXPP) may be of importance in the signaling activity of the synthetic peptides.
- PPXPP this short consensus sequence
- alginate hydrogel is a suitable formulation for the local delivery of synthetic polyproline-rich peptides, inducing integrin alpha 8, osteopontin and osteocalcin expression in C3T3-E1 cells.
- These peptide- modified alginate hydrogels may represent a new generation of injectable carriers with biologically active substance for bone tissue engineering applications and are promising for use as biodegradable coatings for skeletal implants, such as titanium dioxide scaffolds.
- Synthetic proline-rich peptide 2 (P2) (2HN- PLVPSQPLVPSQPLVPSQPQPPLPP-COOH) (SEQ ID NO 1 ) was purchased from Eurogentec (Seraing, Belgium). One vial containing 7.2 mg of the selected synthetic peptide was delivered in a freeze-dried pellet form and dissolved to 10 mg/ml in 0.1 % acetic acid in phosphate-buffered saline (PBS) (PAA Laboratories GmbH, Pasching, Austria).
- PBS phosphate-buffered saline
- the sodium alginate was used without further purification. Quantity (2%, w/v) of sodium alginate was dissolved in distilled water by stirring for 3 h at room temperature to get a homogenous alginate solution. A fixed concentration (50 pg/ml) of P2 was added to the solution and stirred for 1 h.
- Ti0 2 scaffoids were produced by polymer sponge replication as previously described by (Tiainen H ef a/., 2010), with a size of 9 mm of diameter and 8 mm high. Then, Ti0 2 scaffolds were coated with one layer of 2% alginate gel with or without P2. Briefly, Ti0 2 scaffolds were submerged into 2% alginate solution with or without P2 under agitation at 100 rpm on an orbital shaker (!KA Vibrax VXR basic, Staufen, Germany) for 1 h at room temperature. Scaffolds were then centrifuged at 252xg for 1 min. Samples were immersed into 50 mM CaCI 2 for h to allow gelation.
- Scaffolds were then rinsed with dH 2 0 to remove the excess of CaCI 2 . Finally, samples were let to dry overnight at room temperature. Scaffolds coated with one layer of 2% alginate gel (control alginate scaffold), were used as control group, whereas uncoated Ti0 2 scaffolds (without alginate, SC) were also used as control group.
- Ti0 2 scaffolds coated with 2% alginate containing peptide 2 (P2 ⁇ aiginate ⁇ coated scaffold) were placed into 48-weil plates (Nunc GmBh & Co. Kg, Langenselbold, Germany) containing 1 mi distilled water (pH 7.4).
- the samples were agitated on an orbital shaker at 200 rpm (IKA® Schiittler MTS 2, Germany) for 6 h at 37°C and in humidity conditions (using a distilled water container). Then, samples were maintained at 37 °C in a humidified atmosphere for up to 21 days.
- distilled water was collected and fresh distilled water was added into each well.
- Sample absorbances were analyzed by UV-Vis spectrophotometer (PerkinElmer® Lambda 25 UV/Vis Systems, USA) at a wavelength of 206 nm to determine the amount of peptide released.
- Ti0 2 scaffolds coated with one layer of 2% alginate gel were used as control to subtract absorbance values obtained from degradation products from alginate. Relative absorbance units were correlated with the amount of peptide released using a linear standard curve for each time point and the cumulative P2 released was then calculated. The experiment was performed in triplicate.
- SC Ti0 2 scaffolds uncoated and coated with 2% alginate with or without peptide (P2 and control (-)) were placed into 48-well plates (Nunc GmbH & CO. KG, Langenselbold, Germany) in sterile conditions.
- Cells were seeded at a density of 200,000 cells/scaffold and maintained in a-MEM (PAA Laboratories, Pasching, Austria) supplemented with 10% FBS (PAA Laboratories, Pasching, Austria) and 100 U penicillin/ml and 100 pg streptomycin/ml antibiotics (PAA Laboratories, Pasching, Austria).
- an agitated seeding method was used (Takahashi Y ef a/., 2003). Briefly, after adding 1 ml of eel! suspension to the scaffolds, plates were agitated on an orbital shaker (Unitron, Infers HT, Basel, Switzerland) for 6 h at 180 rpm at 37°C and in humidity conditions. Then, cells were maintained at 37 °C in a humidified atmosphere of 5% C0 2 for up to 21 days. Culture media (1 ml) was refreshed every other day.
- Morphology of alginate-coated Ti0 2 scaffolds was observed using a scanning electron microscope (SEM, Hitachi S-3400N, Hitachi High-Technologies Europe GmbH, Krefeld, Germany). SEM was further used to visualize the cell adhesion into the Ti0 2 scaffold structure after 7 and 21 days of culture. Briefly, ceils were washed twice with PBS and fixed with glutaraldehyde 4% in PBS for 2 h. Then the fixative solution was removed and the cells were washed with distilled water twice. At 30 minute intervals, the cells were dehydrated by the addition of 50%, 70%, 90% and 100% ethanol solutions. Ethanol was removed and the cells were left at room temperature to evaporate the remaining ethanol. Scaffolds were observed at 10kV and 40Pa using back scattered and secondary electrons detector. Images presented are from a representative area.
- Results were presented relative to the LDH activity in the medium of cells cultured in uncoated scaffolds, which were set to 100%.
- Cells growing on the 3D scaffolds were lysed by a freeze-thaw method in deionised destillecl water. Cell lysates were used for determination of DNA quantity using Hoechst 33258 fluorescence assay. Samples were mixed with 20 pg/rn! of Hoechst 33258 fluorescence stain (Sigma, St. Quentin Fallavier, France) in TNE buffer, and the intensity of fluorescence was measured at excitation and emission wavelengths of 356/465nm using a multifunction microplate reader (Cary Eclipse fluorescence spectrophotometer, Agilent Technologies, Santa Clara, United States). Relative fluorescence units were correlated with the ceil number using a linear standard curve.
- Real-time PCR was performed in the Lightcycier 480® (Roche Diagnostics, Mannheim, Germany) using SYBR green detection. Real-time PCR was done for two reference genes (18SrRNA and glyceraldehyde-3-phosphate dehydrogenase (Gapdh)) and 12 target genes (integrin alpha8 ⁇ ItgaS), integrin betal ⁇ Itgb l), integrin beta3 (Itgb3), fibronectin 1 (Fn1 ), osterix (Osx), bone morphogenetic protein 2 (Bmp2), collagen-i (Co//-/), interleukin- 6 ⁇ 11-6), bone sialoprotein (Bsp), alkaline phosphatase (Alp), osteocalcin (Oc) and osteopontin ⁇ Opn ⁇ .
- the primer sequences are detailed in table 3.
- Gapdh S 5'-ACCCAGAAGACTGTGGATGG-3' (SEQ ID NO 9)
- Each reaction contained 7 ⁇ Lightcycler-FastStart DNA MasterPLUS SYBR Green I (containing Fast Start Taq polymerase, reaction buffer, dNTPs mix, SYBRGreen I dye and MgCI2), 0.5 ⁇ of each, the sense and the antisense specific primers and 3 ⁇ 1 of the cDNA dilution in a final volume of 10 pi.
- SYBR Green I containing Fast Start Taq polymerase, reaction buffer, dNTPs mix, SYBRGreen I dye and MgCI2
- the amplification program consisted of a preincubation step for denaturation of the template cDNA (10 min 95 D C), followed by 45 cycles consisting of a denaturation step (10 s 95 °C), an annealing step (8-10 s 60 °C, except for Osx that was 5 s 68°C and Alp that was 8s 65 °C) and an extension step (10 s 72 °C).
- Relative quantification after PCR was calculated by dividing the concentration of the target gene in each sample by the mean of the concentration of the two reference genes in the same sample using the Advanced relative quantification method provided by the LightCycler 480 analysis software version 1.5 (Roche Diagnostics, Mannheim, Germany). 2. 10. Statistics
- Peptide release profile from P2-alginate-coated scaffolds is depicted in Figure 7.
- a burst release of the peptide during the first 2 days of incubation was observed (42.8% of the cumulative amount of P2 released after 21 days).
- the amount of peptide released decreased to a 9.4% (of the cumulative amount released up to 21 days) followed by a slower but sustained peptide release over time up to 21 days of incubation.
- the cumulative release suggests that, after 21 days of incubation, there were still P2 entrapped into the 2% alginate gel.
- Alginate-coated T1O2 scaffolds were observed by SEM. As shown in Figures 9A and 9B, some pores of the Ti0 2 scaffolds were blocked after the coating process with alginate, though, after ceil seeding and 7 days of incubation in standard ceil culture conditions (37°C and in a humidified atmosphere), almost all pores were unblocked ( Figure 9C and 9D). Thus, certain degradation of the blocking alginate gel was seen in those pores that remained blocked right after the coating process.
- Figure 13 shows relative mRNA levels for several osteoblast differentiation marker genes.
- osterix mRNA levels were increased in cells growing on alginate- coated scaffolds (either with or without P2) compared to uncoated scaffolds.
- Bmp-2 and II- 6 mRNA levels were significantly increased in cells cultured on P2-alginate-coated scaffolds compared to both uncoated scaffolds and aiginate-coated scaffolds after 21 days of cell culture.
- Co//-/ mRNA levels a marker related with cell proliferation, were significantly increased in cells cultured on P2 ⁇ alginate-coated scaffolds compared to aiginate-coated scaffolds after 7 days of cell culture.
- Ti0 2 scaffolds have been reported to have strength up to 2.6 MPa in compressive strength (Tiainen H et al. 2010) and showed excellent mechanical resistance in a pig in vivo study.
- the structure of the scaffold must provide an optimal microenvironment for osteogenesis.
- the scaffold porosity, pore network interconnectivity, the surface-area-to-volume ratio and the physico-chemical properties of the surface determines ceil migration and differentiation, bone ingrowth, vascularization, and mass transfer between the cells and the environment.
- the use of highly porous Ti0 2 scaffolds using an agitated eel! seeding method has proved to achieve a good attachment and distribution of mouse preosteoblastic cells.
- Ti0 2 scaffolds coated with one layer of 2% alginate displayed a microstructure suitable for their use as scaffold for three-dimensional cell growth.
- Ti0 2 scaffolds provided an appropriate surface for osteoblasts to adhere, migrate and proliferate. Although the amount of cells into alginate-coated Ti0 2 scaffolds was Sower than in uncoated Ti0 2 scaffolds, scaffolds coated with alginate supported cell progression and differentiation. These results are in accordance with previous studies reporting that the alginate is an inert substrate for cell attachment and that synthetic peptides rich in proline sequences increase properties for cell attachment of the alginate hydrogei. Thus, although not significantly, Ti0 2 scaffolds coated with 2% alginate containing synthetic peptide 2 showed a trend to improve cell attachment (+32 % ⁇ after 7 days compared to alginate-coated Ti0 2 scaffolds. It has been reported that biomaterial composition regulates cell attachment and cytoskeleta!
- Itgb l mRNA levels were decreased in cells growing on alginate-coated Ti0 2 scaffolds compared to those growing on uncoated scaffolds. Further, Itgb3 and Fn1 mRNA levels (which are highly expressed at early stages of osteogenesis and reduced through the cellular maturation process) were significantly increased in cells growing into alginate-coated ⁇ 2 scaffolds compared to the uncoated scaffoids after 21 days of culture.
- alginate-coated Ti0 2 scaffolds can act as a matrix for delivery of biologically active substances, such as a synthetic peptide rich in proline sequences inducing osteoblast cell differentiation.
- biologically active substances such as a synthetic peptide rich in proline sequences inducing osteoblast cell differentiation.
- the combination of the physical and osteoconductive properties of Ti0 2 scaffolds with osteogenic effects of a biologically active substance, such as a synthetic proline-rich peptides, on bone formation and mineralization may represent a new strategy for bone tissue regeneration in load-bearing applications.
- Example 3 Preparation of an alginate coated titanium dioxide scaffold for local delivery of simvastatin
- Ti0 2 Highly porous titanium dioxide (Ti0 2 ) scaffolds were submerged into simvastatin (SIM) (i.e. a biologically active substance) containing alginate solution.
- SIM simvastatin
- Expression of osteoblast markers (collagen type I alpha 1 , alkaline phosphatase, osteoprotegerin, osteocalcin and vascular endothelial growth factor A) was quantified using real-time RT-PCR.
- vascular endothelial growth factor A and osteocalcin was analysed by multiplex immunoassay (Luminex). The relative expression and secretion of osteocalcin was significantly increased by cells cultured on scaffolds with 10 ⁇ SIM when compared to scaffolds without SIM after 21 days. In addition, secretion of vascular endothelial growth factor A was significantly enhanced from cells cultured on scaffolds with both 10 nM and 10 ⁇ SIM when compared to scaffolds without SIM at day 21 . In conclusion, the results indicate that SIM- coated Ti0 2 scaffolds can support a sustained release SIM and induce osteoblast differentiation.
- the combination of the physical properties of Ti0 2 scaffolds with the osteogenic effect of SIM may represent a new strategy for bone regeneration in defects where immediate load is wanted or unavailable.
- This example is therefore an exemplary embodiment demonstrating that the alginate coated titanium dioxide scaffolds of the present document can be used to deliver a biologically active substance, such as for providing a positive effect on osteoblast cell growth.
- Porous Ti0 2 scaffolds with a size of 9 mm in diameter and 8 mm in height, were produced by polymer sponge replication as previously described (Tiainen H et al. 2010). In short, polymer foams were impregnated with Ti0 2 slurry, dried and subsequently sintered at 1500 ° C for 40 hours. A second layer of Ti0 2 slurry was added to the scaffolds and re-sintered at the same temperature as previously mentioned. Total surface area of the scaffolds, determined by micro-computed tomography (1172 micro-CT imaging system, Skyscan, Kontich, Belgium), was 20.295 cm 2 . Produced scaffolds were sterilized by autoclaving at 121 ° C for 20 minutes.
- SIM Karls Biochemicals & Industries, Andhra Pradesh, India
- 2% (w/v) Pronova UP LVG sodium alginate FMC BioPolymer, Sandvika, Norway
- Alginate solution with or without SiM was sterilized before use with a 0.22 pm pore size syringe filter (TPP Techno Plastic Products AG, Trasadingen, Switzerland).
- the Ti0 2 scaffolds were submerged into alginate solution with or without SIM under agitation at 100 rpm on an orbital shaker for 1 hour at room temperature followed by cent ifugation at 300xg for 1 minute to remove the excess alginate solution. Subsequently, scaffolds were immersed into 50 mM CaCl 2 with or without SIM under agitation at 100 rpm on an orbital shaker for 1 hour. Alginate-coated scaffolds were finally rinsed with milliQ water to remove the excess CaCI 2 and air-dried overnight. Scaffolds coated with 2% alginate hydroge! without SIM, were used as a control group.
- Alginate-coated scaffolds and SIM (2.4 mM, 0.6 mM) containing alginate-coated scaffolds were kept at 37°C in 1 ml milliQ water in a humidified atmosphere for up to 19 days to determine the release profile of SIM.
- the milliQ water was replaced, and the amount of SIM released was quantified using UV-Vis spectrophotometer (PerkinElmer Lambda 25 UV/Vis System, PerkinElmer, Waltham, MA, USA).
- the sample absorbance at a wavelength of 238 nm was analyzed and the relative absorbance units were correlated with the amount of SIM released for each time point using a linear standard curve. Absorbance values from scaffolds coated with alginate without SIM were used as control to subtract background values obtained from alginate degradation products. The experiment was performed in triplicate.
- the cytotoxicity of the SIM containing scaffolds was estimated based on the activity of the cytostoiic enzyme lactate dehydrogenase (LDH) in the culture medium.
- LDH activity was determined in medium collected every other day up til 14 days, according to the manufacturer's cytotoxicity detection kit instructions (Roche Diagnostics, Mannheim, Germany). 50 ⁇ ! of sample was incubated with the kit reaction mixture for 30 minutes in the dark at room temperature. The absorbance of the samples was measured at 492 nm in a plate reader (Biochrom Asys Expert 96 Microplate Reader, Biochrom, Holliston, MA, USA).
- ALP to hydrolyze P-nitrophenyl phosphate (pNPP) substrates (Sigma- Aldrich, St. Louis, MO, USA) into the yellow end-product, p-nitrophenol, was used to quantify the ALP activity in the culture medium after 2, 8, 14 and 21 days of culture. 25 ⁇ of medium was taken from each sample and incubated with 100 ⁇ pNPP solution in a 96- well plate for 30 minutes in the dark at room temperature, subsequently 50 ⁇ ! of 3M !MaOH was added to each well to stop the reaction.
- pNPP P-nitrophenyl phosphate
- the absorbance was measured at 405 nm in a plate reader (Biochrom Asys Expert 96 Microplate Reader, Biochrom, Holliston, MA, USA) and the ALP activity was quantified using a standard curve based on calf intestinal alkaline phosphatase (Promega, Madison, Wl, USA).
- TNFRSF1 1 B The amount of osteoprotegerin (TNFRSF1 1 B), osteocalcin (BGLAP) and vascular endothelial growth factor A (VEGFA) in the culture medium was measured using the human bone panel and human cytokine/chemokine kits (MiSlipore, Btirerica, MA, USA) after 2, 8, 14 and 21 days of culture. All analyses were performed according to the manufacturer ' s protocols.
- cDNA was synthesized with RevertAid First Strand cDNA Synthesis Kit (Fermentas, St. Leon- Rot, Germany) using oligo dT primers.
- Real-time PCR was performed in the CFX 384 ⁇ . ⁇ Real-Time System (Bio-Rad, Hercules, California, USA) using SsoAdvancedn SYBR® Green Supermix. Three-step amplification (40 cycles: 5 seconds 95 °C, 60 seconds 60 * C, 30 seconds 72 ° C) was implemented. No amplification control and no template control were used.
- giyceraldehyde-3-phosphate dehydrogenase GAA
- collagen type I alpha 1 COL1A1
- alkaline phosphatase ALPL
- osteoprotegerin TNFRSF1 1 B
- osteocalcin BGLAP
- VEGFA vascular endothelial growth factor A
- scaffolds were cut in half by use of a scalpel and fixed in 4% paraformaldehyde (PFA)/4.6% D-Mannitol for 15 minutes and subsequently stored in 1 % PFA/4.6% D-Mannitol until further processing.
- PFA paraformaldehyde
- Celi- seeded whole mount stained scaffolds were counterstained using DAPi, placed on a coverslip and covered with Dako fluorescent mounting medium (Dako, Glostrup, Denmark). Confocal laser scanning microscopy was performed on a FluoView 1000 confocal laser scanning microscope (CLSM) (Olympus, Center Valley, PA, USA). The scaffold surfaces were visualized using the CLSM in reflection mode, images were analyzed using ImageJ (N!H, Bethesda, MD, USA).
- CLSM FluoView 1000 confocal laser scanning microscope
- the cytotoxic effect of SIM from aiginate-coated scaffolds was tested for a wide range of concentrations (2.4 mM, 0.6 mM, 24 ⁇ , 10 ⁇ , 1 ⁇ , 0.1 ⁇ , and 10 nM).
- SIM was found to be highly cytotoxic for osteoblasts at higher concentrations (above 10 ⁇ ), when cells were seeded on the scaffolds (data not shown).
- a 14-day cytotoxicity study was performed for lower concentrations of SIM (10 ⁇ and 10 nM) to investigate the effect on osteoblast viability when exposed to SIM for a sustained time period.
- a higher LDH activity was generally detected in the medium from scaffolds with 10 ⁇ SIM compared to scaffolds with 10 nM SIM throughout the 14-day period.
- alginate-coated Ti0 2 scaffolds can act as a matrix for SIM delivery inducing osteoblast cell differentiation.
- Scaffolds coated with alginate containing 10 pm Si had low cytotoxicity and significantly increased the secretion of VEGFA and BGLAP from osteoblasts cultured on the scaffolds.
- the combination of the local osteogenic effect of SIM and the physical properties of the Ti0 2 scaffolds may represent a new strategy for bone tissue regeneration in load-bearing bone.
- Example 4 Preparation of an alginate coated titanium dioxide scaffold for local delivery of Emdogain ⁇ E D) and for support of human adipose-derived mesenchymal stem cells
- Porous Ti0 2 scaffolds with a size of 9 mm in diameter and 4 mm in height, were produced by polymer sponge replication as previously described (Tiainen et al 2010). In short, polymer foams were impregnated with Ti0 2 slurry, dried and subsequently sintered at 1500 ° C for 40 hours. Produced scaffolds were sterilized by autoclaving at 121 ° C for 20 minutes. 1.2. Isolation, characterization and cell culture of human adipose-derived mesenchymal stem cells
- hAD-MSC were isolated from subcutanous fat tissues. To confirm their mesenchymal character, the cells were characterized with respect to their expression of surface antigens and the ability to selectively differentiate into osteogenic, chondrogenic and adipogenic lineages in response to environmental stimuli. The following marker proteins were assessed:
- the osteogenic differentiation phenotype of the cells was assessed by runt- related transcription factor 2 (RUNX2), collagen type I alpha 1 (COL 1A 1), alkaline phosphatase (ALPL) activity/mRNA expression, and histological evaluation with alizarin red staining. Chondrogenic differentiation was analyzed by evaluating SRY (sex determining region Y)-box 9 (SOX9), collagen type I I alpha 1 (COL2A 1) and aggrecan (ACAN) mRNA expression. Adipogenic differentiation was determined by peroxisome proliferator-activated receptor gamma (PPARG) mRNA expression, and histological visualization with oil red staining.
- RUNX2 runt- related transcription factor 2
- COX9 serum phosphatase
- Adipogenic differentiation was determined by peroxisome proliferator-activated receptor gamma (PPARG) mRNA expression, and histological visualization with oil red staining.
- hOSTs (Cambrex Bio Science, Waikersvpository, MD, USA) from three male donors, one from tibia and two from femur, respectively, were cultured in osteoblast culture medium supplemented with 10% foetal bovine serum, 0.1 % gentamicin sulfate and amphotericin-B antibiotics and 0.1 % ascorbic acid (Lonza Waikersvpository, MD, USA) in 75 cm 2 culture flasks at 37 ° C in a humidified atmosphere of 5% C0 2 .
- the hOSTs from tibia had reached passage 9 and the hOSTs from the two femur donors had reached passage 6 and 8, respectively.
- Scaffolds pre-soaked with culture medium were placed in 24-well culture plates, and the cell suspension was added drop-wise on the top of the scaffolds at a density of 2 x 10 5 ce!ls/scaffo!d in 1 ml of culture medium.
- an agitated seeding method was used (Takahashi ef al 2003), After seeding, the plates were agitated on an orbita! shaker at 200 rpm for 6 hours at 37 ° C in humidity conditions.
- Cell-seeded scaffoids were transferred to new culture plates in 1 ml culture medium and maintained at 37 ° C in a humidified atmosphere of 5% C0 2.
- the uncoated scaffolds in the control group were immediately transferred to new culture plates in 1 ml culture medium and maintained at 37 ° C in a humidified atmosphere of 5% C0 2 up to 21 days,
- the scaffolds in the alginate group without EMD were coated with alginate hydrogei by soaking for 10 minutes in a freshly made solution consisting of 300 ⁇ 2% (w/v) Pronova UP LVG sodium alginate (FMC BioPolymer, Sandvika, Norway), 600 ⁇ 2% (w/v) Pronova UP LVG calcium alginate (FMC BioPolymer, Sandvika, Norway), 600 ⁇ 0.003% (w/v) citric acid/4.6% D-Mannitol and 300 ⁇ 4.6% D-Mannitol followed by centrifugation at 300xg for 1 minute to remove the excess alginate solution.
- the alginate-coated scaffolds were stabilized in a 50 mM CaCI 2 solution and transferred to new culture plates in 1 ml culture medium and maintained at 37 " C in a humidified atmosphere of 5% C0 2 up to 21 days .
- the scaffolds in the alginate group with EMD were treated in the same way as scaffolds in the alginate group without EMD, except that 600 ⁇ 0.003% (w/v) citric acid/4.6% D-Mannitol contained an additional 150 pg/ml of EMD (Lot number: EMD 9121 , Institut Straumann, Basel, Switzerland), resulting in final EMD concentration of 50 pg/ml for the entire alginate solution.
- the alginate coating was visualized by Periodic acid-Schiff (PAS) staining.
- PAS Periodic acid-Schiff
- 0 scaffolds were washed with miliiQ water and oxidized in 1 % periodic acid solution (Sigma-Aldrich, St. Louis, MO, USA) for 5 minutes.
- the scaffolds were rinsed with miliiQ water and placed into Schiff reagent (Sigma-Aldrich, St. Louis, MO, USA) for 15 minutes.
- the scaffolds were soaked in lukewarm tap water for 5 minutes and subsequently photographed. Further, the adherence of hAD-MSC in the alginate coating5 was assessed by PAS/Pan-Cadherin double staining after 2 days of culture.
- PAS stained scaffolds were incubated with monoclonal mouse anti-0 human Pan cadherin antibody (I-8H5, MP Biomedicals, Santa Ana, CA, USA) diluted to 4 pg/ml in 1.25% bovine serum albumin (BSA) in phosphate buffered saline (PBS) with 0.2% Triton X for 1 hour at room temperature, followed by incubation for 30 minutes at room temperature in Cy3 ⁇ conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA, USA) diluted in 2.5% BSA/0.05% Tween-20/PBS at a concentration of 25 pg/ml.
- BSA bovine serum albumin
- PBS phosphate buffered saline
- Triton X Triton X
- the cytotoxicity of the cell-seeded scaffolds was estimated based on the activity of the cytosolic enzyme lactate dehydrogenase (LDH) in the culture medium.
- LDH activityS was determined in medium collected every other day until 14 days of culture, according to the manufacturer's cytotoxicity detection kit instructions (Roche Diagnostics, Mannheim, Germany). 50 pi of sample was incubated with 50 ⁇ ! of the kit reaction mixture for 30 minutes in the dark at room temperature. The absorbance of the samples was measured at 492 nm in a plate reader (Biochrom Asys Expert 96 Microplate Reader, Biochrom, Holliston, MA, USA).
- hAD-MSC viability was visualized by acridine orange/ethidium bromide staining at 2 day of culture. Scaffolds were cut in half by a scalpel and fixed in 4% paraformaldehyde (PFA)/4.6% D-Mannitol for 15 minutes and subsequently stored in 1 % PFA/4.6% D-Mannitol until further processing. Confocal laser scanning microscopy was performed on a FiuoView 1000 CLSM (Olympus, Center Valley, PA, USA). The scaffold surfaces were visualized using the CLSM in reflection mode. Images were analyzed by ImageJ (N!H, Bethesda, MD, USA).
- the total protein content of the cell-seeded scaffolds was determined in the culture medium after 2, 8, 14 and 21 days of culture with a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer's instructions. 25 ⁇ of sample was incubated with 200 ⁇ ! of the kit working reagent for 30 minutes in the dark at 37 ° C. The absorbance of the samples was measured at 562 nm in a plate reader (Biochrom Asys Expert 96 Microplate Reader, Biochrom, Hoiliston, MA, USA) and total protein amount was calculated by a standard curve based on BSA (Thermo Scientific Pierce Biotechnology, Rockford, IL, USA ).
- BCA bicinchoninic acid
- ALP to hydro!yze P-nitrophenyl phosphate (pNPP) substrates (Sigma- Aldrich, St. Louis, MO, USA) into the yellow end-product, p-nitrophenol, was used to quantify the ALP activity in the culture medium after 2, 4, 6, 10, 16 and 20 days of culture for hAD-MSCs and 4, 8, 12, 16 and 21 days of culture for hOSTs. 25 ⁇ of sample was incubated with 100 ⁇ pNPP for 30 minutes in the dark at room temperature, and subsequently 50 pi of 3M NaOH was added to stop the reaction.
- pNPP P-nitrophenyl phosphate
- Real-time PCR was performed in the Applied Biosystems 7300 Real-Time System (Life Technologies, Paisley, UK) with TaqMan® Universal Master Mix.
- the amplification program consisted of a preincubation step for template cDNA denaturation (10 min, 95°C), followed by 40 cycles comprising of a denaturation step (15 s, 95 ° C) and an annealing step (60 s, 60 °C).
- Multianalyte profiling of protein levels in the culture medium was performed on the Luminex 100/200 system (Luminex, Austin, TX, USA) employing xMAP technology. Acquired fluorescence data was analyzed by the xPONENT 3.1 software (Luminex, Austin, TX, USA). The amount of osteoprotegerin (TNFRSF1 B), secreted phosphoprotein 1 (SPP1 ) and osteocalcin (BGLAP) in the culture medium was measured by the human bone panel kit (Millipore, Billerica, MA, USA) after 2, 8, 14 and 21 days of culture. All analyses were performed according to the manufacturer ' s protocols.
- scaffolds were cut in half by a scalpel and fixed in 4% paraformaldehyde (PFA)/4.6% D-Mannitol for 1 5 minutes and subsequently stored in 1 % PFA/4.6% D-Mannitol until further processing.
- PFA paraformaldehyde
- PAS staining of the alginate-coated scaffolds revealed an even distribution of alginate hydrogel, coating the entire surface of the T1O2 scaffold struts (Fig. 23A).
- hAD-MSC adherence to alginate-coated T1O2 scaffolds was demonstrated by PAS/Pan-cadherin double staining (Fig. 22D). Moreover, the majority of the seeded hAD- MSCs were viable according to the acridine-orange/ethidium bromide staining at 2 day of culture (Fig. 23).
- Cellular surface antigen expression patterns CD14( ⁇ ), CD19(-), CD34(+), CD45(-), CD44(+), CD73(+), CD90(+), CD105(+), HLA-DR(-) and IgG(-) suggested the absence of hematopoietic or endothelial origin cells. Osteo- and adipogenic differentiation was demonstrated by histological visualization with alizarin red and oil red, respectively. In addition, the cells differentiated selectively into bone-, cartilage- and adipose-depositing cells in a culture. Because of their antigen surface expression pattern, histological evaluation and their potential to differentiate along the osteogenic, chondrogenic and adipogenic lineages the cells were referred to as hAD-MSCs. 2.3. Cytocompatibility/Lactate dehydrogenase activity
- Culturing hAD-MSCs on alginate-coated scaffolds with or without EMD did not significantly change the ALP activity in the culture medium at any of the time points measured either for scaffolds with or without EMD when compared to uncoated scaffolds, except for donor 1 the ALP activity in the medium was significantly increased from cells cultured on alginate-coated scaffolds with EMD when compared to alginate-coated scaffolds without EMD and uncoated scaffolds at day 20, and for donor 3 the ALP activity in the medium was significantly decreased from cells cultured on scaffolds with EMD when compared to alginate-coated scaffolds without EMD and uncoated scaffolds at day 10.
- Culturing hOSTs on alginate-coated scaffolds with or without EMD did not significantly change the ALP activity in the culture medium at any of the time points measured either for scaffolds with or without EMD when compared to uncoated scaffolds, except for donor 1 the ALP activity in the medium was significantly decreased from cells cultured on alginate-coated scaffolds without EMD when compared to uncoated scaffolds at day 4, for donor 2 the ALP activity in the medium was significantly decreased from cells cultured on alginate-coated scaffolds without EMD when compared to uncoated scaffolds at day 12, and for donor 3 the ALP activity in the medium was significantly decreased from ceils cultured on alginate-coated scaffolds with and without EMD when compared to uncoated scaffolds at 4 and 16 days. Some variation was seen in the ALP activity profiles, indicating donor dependent differences in the cellular response to alginate-coated scaffolds with or without EMD.
- first and second donor ' s TNFRSF1 1 B in the culture medium were more expressed from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at all-time points
- the content of third donor ' s TNFRSF1 1 B in the culture medium was more expressed from cells cultured on scaffolds without EMD when compared to scaffolds with EMD at 2 and 8 days.
- no substantial differences were observed in the third donor ' s TNFRSF1 1 B content of the culture medium at 14 and 21 days either from scaffolds with or without EMD.
- the content of first donor ' s SPP1 in the culture medium was more increased from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at all-time points.
- the content of second donor ' s SPP1 in the culture medium was more increased from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at 2, 8 and 14 days. No substantial differences were observed in the third donor ' s SPP1 content of the culture medium at 2 and 8 days either from scaffolds with or without EMD.
- the content of first donor ' s BGLAP in the culture medium was more increased from cel!s cultured on scaffolds without EMD when compared to scaffolds with EMD at 2 day.
- the content of first donor ' s BGLAP in the culture medium was more increased from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at 8 day.
- the content of second donor ' s BGLAP in the culture medium was more increased from cells cultured on scaffolds without EMD when compared to scaffolds with EMD at 2 and 21 days. However, the content of second donor ' s BGLAP in the culture medium was more increased from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at 14 day.
- the content of third donor ' s BGLAP in the culture medium was more increased from cells cultured on scaffolds with EMD when compared to scaffolds without EMD at 8, 14 and 21 days. However, the content of third donor ' s BGLAP in the culture medium was more increased from cells cultured on scaffolds without EMD when compared to scaffolds with EMD at 2 day. 5.
- hAD-MSCs and hOSTs have the ability to survive the coating procedure for EMC derivative delivery. Moreover, hOSTs could differentiate into osteogenic lineage within alginate-coated scaffolds with EMD, which is important before evaluating the efficacy in vivo.
- Example 5 Fabrication of Ti0 2 scaffolds coated with radiopaque alginate layer proving open porous structure
- Ti0 2 scaffolds were produced by polymer sponge replication as previously described by (Tiainen H et at., 2010), with a size of 9 mm of diameter and 8 mm high. Then, Ti0 2 scaffolds were coated with one layer of 2% alginate gel with a radiopaque contrast liquid (Omnipaque (iohexol), GE Healtcare). Briefly, Ti0 2 scaffolds were submerged into 2% alginate solution with or without P2 (SEQ ID NO 1 ) under agitation at 100 rpm on an orbital shaker (IKA Vibrax VXR basic, Staufen, Germany) for 1 h at room temperature. Scaffolds were then centrifuged at 252xg for 1 min. Samples were immersed into 50 mM CaCI 2 for 1 h to allow gelation. Scaffolds were then rinsed with dH 2 0 to remove the excess of CaCI 2 . Finally, samples were let to dry overnight at room
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Dermatology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Transplantation (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Inorganic Chemistry (AREA)
- Molecular Biology (AREA)
- Dispersion Chemistry (AREA)
- Cell Biology (AREA)
- Ceramic Engineering (AREA)
- Developmental Biology & Embryology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Botany (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hematology (AREA)
- Materials For Medical Uses (AREA)
- Prostheses (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2015531604A JP2015535695A (en) | 2012-09-18 | 2013-09-18 | Method for producing alginate coated titanium dioxide skeleton |
| CA2880992A CA2880992A1 (en) | 2012-09-18 | 2013-09-18 | Method for producing an alginate coated titanium dioxide scaffold |
| US14/427,854 US20150209474A1 (en) | 2012-09-18 | 2013-09-18 | Method for producing an alginate coated titanium dioxide scaffold |
| KR1020157006520A KR20150058203A (en) | 2012-09-18 | 2013-09-18 | Method for producing an alginate coated titanium dioxide scaffold |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| SE1251042A SE537635C2 (en) | 2012-09-18 | 2012-09-18 | Method of producing an alginate coated titanium dioxide scaffold, this titanium dioxide scaffold and medical implant containing scaffold |
| SE1251042-6 | 2012-09-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014044697A1 true WO2014044697A1 (en) | 2014-03-27 |
Family
ID=49209373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/069343 Ceased WO2014044697A1 (en) | 2012-09-18 | 2013-09-18 | Method for producing an alginate coated titanium dioxide scaffold |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20150209474A1 (en) |
| JP (1) | JP2015535695A (en) |
| KR (1) | KR20150058203A (en) |
| CA (1) | CA2880992A1 (en) |
| SE (1) | SE537635C2 (en) |
| WO (1) | WO2014044697A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170055960A (en) * | 2014-08-01 | 2017-05-22 | 메사추세츠 인스티튜트 오브 테크놀로지 | Modified alginates for anti-fibrotic materials and applications |
| US10709818B2 (en) | 2015-11-01 | 2020-07-14 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US11318231B2 (en) | 2017-11-06 | 2022-05-03 | Massachusetts Institute Of Technology | Anti-inflammatory coatings to improve biocompatibility of neurological implants |
| US12186453B2 (en) | 2015-11-01 | 2025-01-07 | Massachusetts Institute Of Technology | Materials with improved biocompatibility |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SE537633C2 (en) * | 2012-09-18 | 2015-08-25 | Corticalis As | Hydrogel coated titanium dioxide scaffold and method of making this scaffold |
| CN106377290B (en) | 2016-08-19 | 2018-06-22 | 北京派尔特医疗科技股份有限公司 | A kind of medicine-carried titanium nail and load medicine titanium nail and preparation method thereof |
| EP4487863A1 (en) * | 2023-07-07 | 2025-01-08 | NuPep AS | Consensus peptides in hya for use in treating degenerated joints |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008078164A2 (en) | 2006-12-21 | 2008-07-03 | Numat As | Metal oxide scaffolds |
| WO2008078167A2 (en) | 2006-12-21 | 2008-07-03 | Numat As | Consensus peptide |
-
2012
- 2012-09-18 SE SE1251042A patent/SE537635C2/en not_active IP Right Cessation
-
2013
- 2013-09-18 US US14/427,854 patent/US20150209474A1/en not_active Abandoned
- 2013-09-18 JP JP2015531604A patent/JP2015535695A/en active Pending
- 2013-09-18 WO PCT/EP2013/069343 patent/WO2014044697A1/en not_active Ceased
- 2013-09-18 KR KR1020157006520A patent/KR20150058203A/en not_active Withdrawn
- 2013-09-18 CA CA2880992A patent/CA2880992A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008078164A2 (en) | 2006-12-21 | 2008-07-03 | Numat As | Metal oxide scaffolds |
| WO2008078167A2 (en) | 2006-12-21 | 2008-07-03 | Numat As | Consensus peptide |
Non-Patent Citations (15)
| Title |
|---|
| EROL M M ET AL: "Copper-releasing, boron-containing bioactive glass-based scaffolds coated with alginate for bone tissue engineering", ACTA BIOMATERIALIA, vol. 8, no. 2, 10 October 2011 (2011-10-10), ELSEVIER, AMSTERDAM, NL, pages 792 - 801, XP028123841, ISSN: 1742-7061, [retrieved on 20111017], DOI: 10.1016/J.ACTBIO.2011.10.013 * |
| HANNA TIAINEN ET AL: "Bone formation in TiObone scaffolds in extraction sockets of minipigs", ACTA BIOMATERIALIA, vol. 8, no. 6, 23 February 2012 (2012-02-23), ELSEVIER, AMSTERDAM, NL, pages 2384 - 2391, XP028480461, ISSN: 1742-7061, [retrieved on 20120303], DOI: 10.1016/J.ACTBIO.2012.02.020 * |
| HANNA TIAINEN ET AL: "Ultra-porous titanium oxide scaffold with high compressive strength", JOURNAL OF MATERIALS SCIENCE: MATERIALS IN MEDICINE, vol. 21, no. 10, 14 August 2010 (2010-08-14), KLUWER ACADEMIC PUBLISHERS, BO, pages 2783 - 2792, XP019856602, ISSN: 1573-4838, DOI: 10.1007/S10856-010-4142-1 * |
| LARRY S. LIEBOVITCH; TIBOR TOTH: "A fast algorithm to determine fractal dimensions by box counting", PHYSICS LETTERS A, vol. 141, 20 November 1989 (1989-11-20), pages 386 - 390 |
| M RUBERT ET AL: "Effect of alginate hydrogel containing polyproline-rich peptides on osteoblast differentiation", BIOMEDICAL MATERIALS, vol. 7, no. 5, 055003, 11 July 2012 (2012-07-11), pages 1 - 11, XP055087796, ISSN: 1748-6041, DOI: 10.1088/1748-6041/7/5/055003 * |
| M. RUPERT: "Effect of TiO 2 scaffolds coated with alginate hydrogel containing a proline-rich peptide on osteoblast growth and differentiation in vitro", JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A, vol. 101a, no. 6, June 2013 (2013-06-01), pages 1768 - 1777, XP002716225, ISSN: 1549-3296, DOI: 10.1002/jbm.a.34458 * |
| MANIATOPOULOS C; SODEK J; MELCHER AH: "Bone formation in vitro by stromal cells obtained from bone marrow of young adult rats", CELL AND TISSUE RESEARCH, vol. 254, 1988, pages 317 - 30 |
| MONJO M; RAMIS J M; RONOLD H J; TAXT-LAMOLLE S F; ELLINGSEN J E; LYNGSTADAAS S P: "Correlation between molecular signals and bone bonding to titanium implants", CLIN. ORAL IMPLANTS RES., 2012 |
| PFAFFL MW: "A new mathematical model for relative quantification in real-time RT-PCR", NUCLEIC ACIDS RES, vol. 29, 2001 |
| RANI V V D ET AL: "Fabrication of alginate/nanoTiO2 needle composite scaffolds for tissue engineering applications", CARBOHYDRATE POLYMERS, vol. 83, no. 2, 10 January 2011 (2011-01-10), APPLIED SCIENCE PUBLISHERS, LTD. BARKING, GB, pages 858 - 864, XP027488175, ISSN: 0144-8617, [retrieved on 20100928], DOI: 10.1016/J.CARBPOL.2010.08.065 * |
| RUBERT M; RAMIS J M; VONDRASEK J; GAY'A A; LYNGSTADAAS SP; MONJO M: "Synthetic peptides analogue to enamel proteins promote osteogenic differentiation of MC3T3-E1 and mesenchymal stem cells", J. BIOMATER. TISSUE ENG., vol. 1, 2011, pages 198 - 209 |
| TAKAHASHI Y; TABATA Y: "Homogeneous seeding of mesenchymal stem cells into nonwoven fabric for tissue engineering", TISSUE ENG, vol. 9, 2003, pages 931 - 8 |
| TIAINEN H; LYNGSTADAAS SP; ELLINGSEN JE; HAUGEN HJ: "Ultra-porous titanium oxide scaffold with high compressive strength", J MATER SCI MATER MED, vol. 21, 2010, pages 2783 - 92 |
| TIAINEN H; MONJO M; KNYCHALA J; NILSEN 0; LYNGSTADAAS S P; ELLINGSEN J E; HAUGEN H J: "The effect of fluoride surface modification of ceramic Ti02 on the surface properties and biological response of osteoblastic cells", VITRO BIOMED. MATER., vol. 6, 2011, pages 045006 |
| ZHANG ET AL: "An ionically crosslinked hydrogel containing vancomycin coating on a porous scaffold for drug delivery and cell culture", INTERNATIONAL JOURNAL OF PHARMACEUTICS, vol. 353, no. 1-2, 21 November 2007 (2007-11-21), ELSEVIER BV, NL, pages 74 - 87, XP022513707, ISSN: 0378-5173, DOI: 10.1016/J.IJPHARM.2007.11.023 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11266606B2 (en) | 2014-08-01 | 2022-03-08 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US10426735B2 (en) | 2014-08-01 | 2019-10-01 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| EP3174906B1 (en) * | 2014-08-01 | 2025-03-19 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| AU2019200810B2 (en) * | 2014-08-01 | 2020-07-30 | Children's Medical Center Corporation | Modified alginates for anti-fibrotic materials and applications |
| KR102719485B1 (en) | 2014-08-01 | 2024-10-21 | 메사추세츠 인스티튜트 오브 테크놀로지 | Modified alginates for anti-fibrotic materials and applications |
| US10898443B2 (en) | 2014-08-01 | 2021-01-26 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| KR20170055960A (en) * | 2014-08-01 | 2017-05-22 | 메사추세츠 인스티튜트 오브 테크놀로지 | Modified alginates for anti-fibrotic materials and applications |
| US11090413B2 (en) | 2015-11-01 | 2021-08-17 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US12097307B2 (en) | 2015-11-01 | 2024-09-24 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US10729818B2 (en) | 2015-11-01 | 2020-08-04 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US12186453B2 (en) | 2015-11-01 | 2025-01-07 | Massachusetts Institute Of Technology | Materials with improved biocompatibility |
| US10709818B2 (en) | 2015-11-01 | 2020-07-14 | Massachusetts Institute Of Technology | Modified alginates for anti-fibrotic materials and applications |
| US11318231B2 (en) | 2017-11-06 | 2022-05-03 | Massachusetts Institute Of Technology | Anti-inflammatory coatings to improve biocompatibility of neurological implants |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150209474A1 (en) | 2015-07-30 |
| JP2015535695A (en) | 2015-12-17 |
| KR20150058203A (en) | 2015-05-28 |
| CA2880992A1 (en) | 2014-03-27 |
| SE537635C2 (en) | 2015-08-25 |
| SE1251042A1 (en) | 2014-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2897656B1 (en) | Hydrogel coated scaffold | |
| Zheng et al. | Hypoxia-mimicking 3D bioglass-nanoclay scaffolds promote endogenous bone regeneration | |
| Barba et al. | Osteoinduction by foamed and 3D-printed calcium phosphate scaffolds: effect of nanostructure and pore architecture | |
| Fahimipour et al. | 3D printed TCP-based scaffold incorporating VEGF-loaded PLGA microspheres for craniofacial tissue engineering | |
| Jahan et al. | Composite biopolymers for bone regeneration enhancement in bony defects | |
| US20150209474A1 (en) | Method for producing an alginate coated titanium dioxide scaffold | |
| Kim et al. | Fabrication of a BMP-2-immobilized porous microsphere modified by heparin for bone tissue engineering | |
| Geng et al. | The synergistic effect of strontium-substituted hydroxyapatite and microRNA-21 on improving bone remodeling and osseointegration | |
| Wei et al. | In vitro osteogenic induction of bone marrow mesenchymal stem cells with a decellularized matrix derived from human adipose stem cells and in vivo implantation for bone regeneration | |
| Filipowska et al. | Incorporation of sol–gel bioactive glass into PLGA improves mechanical properties and bioactivity of composite scaffolds and results in their osteoinductive properties | |
| Yao et al. | Calcium phosphate nanocluster-loaded injectable hydrogel for bone regeneration | |
| Liu et al. | Magnesium ammonium phosphate composite cell-laden hydrogel promotes osteogenesis and angiogenesis in vitro | |
| Lin et al. | Osteoblast differentiation and phenotype expressions on chitosan-coated Ti-6Al-4V | |
| Stępniewski et al. | Chitosan and its composites: Properties for use in bone substitution | |
| Liu et al. | Polyelectrolyte multilayer composite coating on 316 L stainless steel for controlled release of dual growth factors accelerating restoration of bone defects | |
| Li et al. | Accelerating bone healing by decorating BMP-2 on porous composite scaffolds | |
| Wu et al. | Self-Healing micro arc oxidation and dicalcium phosphate dihydrate double-passivated coating on magnesium membrane for enhanced bone integration repair | |
| Luss et al. | Gel based on hydroxyethyl starch with immobilized Amikacin for coating of bone matrices in experimental osteomyelitis treatment | |
| Amemiya et al. | Tissue response of surface-modified three-dimensional titanium fiber structure | |
| Wang et al. | Coating polyelectrolyte multilayers loaded with quercetin on titanium surfaces by layer-by-layer assembly technique to improve surface osteogenesis under osteoporotic condition | |
| Yun et al. | Local delivery of recombinant human bone morphogenic protein-2 (rhBMP-2) from rhBMP-2/heparin complex fixed to a chitosan scaffold enhances osteoblast behavior | |
| Sezer et al. | In vivo performance of poly (ε-caprolactone) constructs loaded with gentamicin releasing composite microspheres for use in bone regeneration | |
| Jyoti et al. | Initial in vitro biocompatibility of a bone cement composite containing a poly-ε-caprolactone microspheres | |
| Wang et al. | β-tcp/collagen composite scaffolds facilitate bone remodeling in vertebral plate fusion | |
| Zhang et al. | In-situ biomimetic mineralisation of dual cross-linked silk fibroin/carboxymethyl chitosan scaffolds for bone regeneration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13763074 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE2 | Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2880992 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015531604 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14427854 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 20157006520 Country of ref document: KR Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013763074 Country of ref document: EP |

