WO2014043700A1 - Melanocortin receptor mutant mouse and uses thereof - Google Patents
Melanocortin receptor mutant mouse and uses thereof Download PDFInfo
- Publication number
- WO2014043700A1 WO2014043700A1 PCT/US2013/060163 US2013060163W WO2014043700A1 WO 2014043700 A1 WO2014043700 A1 WO 2014043700A1 US 2013060163 W US2013060163 W US 2013060163W WO 2014043700 A1 WO2014043700 A1 WO 2014043700A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- transgenic mouse
- mutation
- melanoma
- mc1r
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
- A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
- A01K2217/203—Animal model comprising inducible/conditional expression system, e.g. hormones, tet
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
- A01K2217/206—Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0331—Animal model for proliferative diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
Definitions
- the technology disclosed relate to the field of melanoma and knock-out transgenic mice.
- the transgenic mice are used for screening for therapeutic candidates for treatment of melanoma.
- Melanoma is a malignant tumor of melanocytes, and can originate in any part of the body that contains melanocytes. There are 160,000 new cases diagnosed each year, and about 48,000 melanoma related deaths reported each year. Melanoma is the most incurable cancer once the cancerous cells have metastasized to distant part of the body. Therefore, metastatic melanomas have to be aggressively treated with current and newer therapies.
- MAPK pathway is an important signaling cascade driving cell proliferation, differentiation, and survival and could have an important role in the pathogenesis of melanoma.
- redhead humans are at higher risk for melanoma.
- the redhead phenotype includes red hair, fair skin and poor tanning ability. This phenotype is due to mutations in a gene called melanocortin 1 receptor (MCIR).
- MCIR melanocortin 1 receptor
- Embodiments herein are based on the discovery that transgenic mice having genomic mutations in a melanocortin 1 receptor (MCIR) gene and a BRAF gene have high incidences of invasive melanomas.
- MCIR melanocortin 1 receptor
- the mutation in MCIR gene produces a premature termination of the MCIR transcript and a truncated MCIR protein.
- This MCIR mutation known to produce the redhead phenotype which includes red hair, high pheomelanin versus eumelanin production, fair skin and poor tanning ability.
- the gene mutation in the BRAF gene is a V600E substitution that is common in many highly invasive melanomas. It is also known that humans with the redhead phenotype are prone to melanoma.
- transgenic mice transgenic mice are useful animal systems and tools for screening therapeutic candidates for the treatment of melanoma.
- the transgenic animal systems are useful where the melanomas involve MC1R and BRAF mutations.
- transgenic animal systems, reagents and tools for screening and identifying potential therapeutic candidates for the treatment of melanoma This is particularly useful for highly invasive and metastatic melanomas.
- tumor cells, melanoma cells and tissues from the transgenic mice that have MC1R and BRAF mutations For examples, tumor cells, melanoma cells and tissues from the transgenic mice that have MC1R and BRAF mutations.
- a transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B-RAF gene.
- the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein.
- tissue of the transgenic mouse described for example, tumor cells, melanoma cells, and melanocytes.
- cultured cells isolated from the transgenic mouse described wherein the genomes of these cells comprise a mutation of a MC1R gene and a BRAF gene.
- a method of screening and identifying a test candidate for the treatment of melanoma comprises providing a transgenic mouse described herein, and administering a test candidate to the mouse. In one embodiment, the method further comprises monitoring for a development of melanoma in the mouse.
- a method of screening and identifying test candidates for the treatment of melanoma comprises providing a transgenic mouse transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring the development of melanoma in the mouse.
- the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein,
- the method further comprises monitoring for a development of melanoma in the mouse. In one embodiment of any method described, the method further comprises monitoring the latency period before the development of melanomas. In one embodiment of any method described, the method further comprises monitoring the survival rate of the tested transgenic mouse compared to control transgenic mouse that have not received the test candidate. In one embodiment of any method described, the method further comprises monitoring the number of melanomas developing over a period of time.
- the MC1R gene mutation is a homozygous mutation.
- the BRAF gene mutation is a
- the MCIR gene mutation results in premature termination of the MCIR transcript
- the MCIR gene mutation results in a nonfunctional MCIR or an inactivation form of a MCIR.
- the MCIR gene mutation results in the non-expression of the MCIR protein, full-length or truncated or otherwise.
- the MCIR gene mutation is selected from the group consisting of D294H, R151C, and R160W, ie., amino acid substitutions in the MCIR coding nucleotide at the identified location in the polypeptide.
- the B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
- tissue of the transgenic mouse tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
- tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described the B-RAF gene mutation is conditionally expressed in melanocytes.
- the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
- FIG. C57BL/6 pigmentation variants with epidermal melanocytes (K14-SCF).
- Figure lb Genotype of animals used for experimental studies.
- FIG. 2g Melanin containing tumor cells can also be found in the superficial aspect of redhead-BRaf v600E melanomas, near the epidermis (arrows).
- FIG. 1 Further magnification of two redhead melanomas also illustrates pigmented tumor cells (arrows).
- Figure 2i Forskolin induces significant epidermal pigmentation (arrowheads) and mild tumor cell pigmentation (arrows) in redhead K14-SCF mice.
- Figure 2j Tumor cells stain positive for the SI 00 melanoma marker.
- FIG. 1k Skin-draining lymph nodes carry clusters of gpl00+ cells (lighter shade in the non-color micrograph).
- Figure 3d 2 ⁇ PLX4720 upregulates expression of melanocytic markers. mRNA expression normalized to 18s rRNA and 0 h timepoint. Error bars denote s.e.m.
- FIG 4a Albino- cir e e mice were generated and melanoma incidence after BRaf v600E activation was compared to redhead-only and albino-only mice (from Figure 1).
- p alb/red-albino 0.308, Palb/red- red ⁇ 0.0001, p albino . rcd ⁇ 0.0001.
- ROS such as free hydroxyl radicals can react with purine nucleosides in DNA to produce 8,5'-cyclopurine lesions, i.e., cdA and cdG (cdA shown here).
- Figures 5a-5f The BRaf v600E -Pten Nu11 melanomas on a C57BL/6 background are histologically similar to the BRaf v600E -pigmentation variant melanomas.
- Figures 5a, 5c, and 5e On the C57BL/6 background, some BRaf v600E -Pten Nu11 melanomas are heavily pigmented superficially but typically become less pigmented at greater tumor depths.
- Figures 5b, 5d, and 5f Other BRaf v600E -PtenNull melanomas, however, are generally amelanotic. These tumors were seen to exhibit the same spindle cell-like morphology as the BRaf- pigmentation variant melanomas.
- mice which also carry the Dct-LacZ transgene.
- Figures 7a-7c Melanomas arising in albino- cir e e mice are similar to the other pigmentation variant melanomas.
- Figure 7a The tumors on the albino- cir e e animals were grossly amelanotic.
- FIG. 7b The tumors on the albino- cir e e animals were histologically similar to the other BRaf v600E tumors.
- Figure 7c The tumors on the albino- cir e e animals stained positively for the S100 neural crest marker.
- Figures 8a-8b UV irradiation but not high intensity visible light exposure promotes oxidative lipid damage in redhead mouse skin.
- the term "mutation" with respect to a gene refers to a change of the nucleotide sequence of the gene of an organism.
- the "mutations" referred to herein can take the form of one or more nucleotides deletions, one or more nucleotides additions, or one or more nucleotides substitutions.
- the "mutations” referred to herein have the effects of one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a polypeptide.
- mutations referred to herein have the effects of non-expression of a polypeptide from the affected gene.
- a MC1R mutation refers to a change of the coding nucleotide sequence of the MC1R gene such that there is one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a MC1R polypeptide.
- a MC1R mutation refers to a change of the nucleotide sequence of the MC1R gene such that no MC1R protein is transcribed and translated.
- a B-RAF mutation refers to a change of the nucleotide sequence of the B-RAF gene such that there is one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a BRAF polypeptide.
- the term "gene” with references to mutations means the nucleic acid sequence which is transcribed (DNA) and translated (mRNA) into a polypeptide in vitro or in vivo when operably linked to appropriate regulatory sequences.
- the gene may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5'UTR) or "leader” sequences and 3' UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons).
- amino acid is intended to include naturally occurring amino acids (alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine).
- Amino acids can be referred to herein by either their commonly known three letter symbols or by the one -letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
- amino acid substitutions for a particular amino acid residue at a particular position in a polypeptide is indicated by a first single upper case alphabet followed by a number which is then followed by a second single upper case alphabet.
- first single upper case alphabet is the original amino acid normally found at position 500 of the polypeptide
- second single upper case alphabet is the substitution amino acid for the original amino acid.
- lysine at position 500 of the polypeptide is substituted by leucine.
- administration refers to contact of an exogenous pharmaceutical, therapeutic, or composition to the transgenic mouse.
- the administration can be oral administration, topical administration, transdermal administration or systemic administration.
- M1R protein refers to a full length MC1R polypeptide.
- Examples of a MC1R protein includes all mammalian MC1R proteins, for example, human MC1R protein (Genbank Protein Accession Nos: NP_002377.4, GenelD: 4157), and mouse MC1R protein (Genbank Protein Accession Nos: NP_032585.2).
- M1R gene refers to a nucleotide sequence encoding a
- MC1R protein examples include nucleotide sequences encoding all mammalian MC1R proteins, for example, the human MClRgene (Genbank Accession Nos: NM_002386.3), and the mouse MC1R gene (Genbank Accession No.: NM_008559).
- BRAF protein refers to a full length BRAF polypeptide.
- the full-length BRAF protein can be the wild-type form or one that has amino acid substitutions.
- Examples of a BRAF protein includes all mammalian BRAF proteins, for example, human BRAF protein (Genbank Protein Accession Nos: AAA35609.2, NM_004333.4; GenelD: 673), and mouse BRAF protein
- BRAF gene refers to a nucleotide sequence encoding a full- length wild-type BRAF protein.
- Examples of a BRAF gene includes nucleotide sequences encoding the human BRAF gene (Genbank Accession Nos: M95712, M95720, X54072, NM_004333.4), and the mouse BRAF gene (Genbank Accession No.: NM_139294.5).
- the term "deficient in the MC1R gene" or “MC1R- deficient” means that no functional MC1R 1 protein is produced due to the disruption of the MC1R 1 gene or non-expression of the MC1R protein.
- “deficient in the MClRgene” or “MClR-deficient” means a truncated MC1R protein that is incapable of binding its ligand, melanocyte - stimulating hormone (MSH) and/or does not any transduce signal upon ligand or other agonist binding. The signal is the induction of cAMP levels in the cell.
- MC1R protein refers to a MC1R protein that responds to stimulation by melanocyte stimulating hormone (MSH) exposure by stimulating the synthesis of cAMP inside cells.
- MSH melanocyte stimulating hormone
- cAMP can be directly measured using various assays, or can be indirectly measured through its downstream effects in cells, such as induction of phosphorylation of CREB protein.
- activating form of a MC1R protein refers to a form of a
- MC1R protein that is that is incapable of binding its ligand, melanocyte-stimulating hormone (MSH) and/or does not any transduce signal upon ligand or other agonist binding.
- MSH melanocyte-stimulating hormone
- tissue includes any tissues, for example but not limited to, tumors, melanomas, melanocytes, spleen, bone marrow, lymph nodes, endocrine tissues such as pancreatic islets, pituitary glands and exocrine tissues such as exocrine pancreas, gastric glands, small intestinal glands, Brunner's glands, salivary glands, mammary glands, etc., and their acini.
- transgene refers to a nucleic acid sequence which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
- a transgene can be operably linked to one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
- Exemplary transgenes of the present disclosure encode, for instance, a neomycine resistance gene fused with a mouse MC1R cDNA coding nucleotides 1-150 and a Cre recombinase enzyme.
- Other exemplary transgenes are directed to disrupting a MC1R gene by homologous recombination with genomic sequences of a MC1R gene.
- test candidate refers to any substance that, when administered to the disclosed transgenic mice, can prevent, inhibit or stop the development of melanomas in the disclosed transgenic mice compared to in the absence of the administered test candidate. In some embodiment, the test candidate reduces the number and/or rate of melanomas formation compared to in the absence of the administered therapeutic candidate.
- test candidates include, but are not limited to, small organic molecules, large organic molecules, amino acids, peptides, polypeptides, nucleotides, nucleic acids (including DNA, cDNA, RNA, antisense RNA and any double- or single-stranded forms of nucleic acids), polynucleotides, carbohydrates, lipids, lipoproteins, glycoproteins, inorganic ions (including, for example, Gd3+, lead and lanthinum).
- “therapeutic candidates” include currently known drugs for non-melanomas.
- therapeutic candidates include currently known B-RAF inhibitors, MAPK inhibitors, NRAS inhibitors and/or c-KIT inhibitors.
- B-Raf inhibitors include, but are in no way limited to, vemurafenib, GDC-0879, PLX-4720, Sorafenib Tosylate, dabrafenib, and LGX818.
- inhibitor when used in reference to the MAPK pathway, B-
- Raf, NRAS and/or c-KIT refers to an agent that inhibits the normal cellular activities of the proteins that are involved, that constitute, or that are participants in the MAPK pathway, or the normal cellular activities of B-Raf , NRAS and/or c-KIT.
- Embodiments of the present disclosure herein are based on the discovery that transgenic mice having genomic mutations in a melanocortin 1 receptor (MC1R) gene and a BRAF gene have high incidences of invasive melanomas.
- the mutation in MC1R gene produces a premature termination of the MC1R transcript and a truncated MC1R protein.
- This MC1R mutation known to be responsible for the redhead phenotype, a phenotype which includes red hair, high pheomelanin versus eumelanin production, fair skin and poor tanning ability.
- the gene mutation in the BRAF gene is a V600E substitution that is common in many highly invasive melanomas.
- transgenic mice are useful animal systems and tools for screening therapeutic candidates for the treatment of melanoma.
- the transgenic animal systems are useful where the melanomas involve MC1R and BRAF mutations.
- redhead phenotype People with pale skin, red hair, freckles, and an inability to tan, the "redhead" phenotype, are at highest risk of developing melanoma, compared to all other pigmentation types 1 .
- M1R melanocortin 1 receptor
- MC1R encodes a cAMP MClRulating G-protein coupled receptor that controls pigment production.
- Minimal receptor activity, as in redhead polymorphisms produces red/yellow sulfur-containing pheomelanin pigment, while increasing MC1R activity MClRulates production of black/brown non-sulfuric eumelanin.
- Pheomelanin has weak UV shielding capacity relative to eumelanin and has been shown to amplify UVA-induced reactive oxygen species (ROS) 3"5 .
- ROS reactive oxygen species
- mice carrying an inactivating mutation in the Mclr gene (who exhibit a phenotype analogous to redheaded humans), a conditional, melanocyte-targeted allele of the most commonly mutated melanoma oncogene, BRafV600E.
- the inventors observed a high incidence of invasive melanomas without providing additional oncogenic or tumor suppressor gene aberrations or UV exposure.
- the inventors introduced an albino allele, which ablates all pigment production on the redhead-Mclr e/e background. Selective absence of pheomelanin synthesis was protective against melanoma.
- a transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene.
- the MCIR gene mutation is a homozygous mutation.
- the BRAF gene mutation is a homozygous or a heterologous mutation.
- the transgenic mouse has a homozygous mutation of the MCIR gene and a homozygous mutation of the B-RAF gene.
- the transgenic mouse has a knock-out mutation in the MCIR gene.
- the transgenic mouse has a point mutation in the MCIR gene that results in the premature transcription termination of the MCIR gene.
- the resultant MCIR protein is a truncated protein. Consequently, the transgenic mouse expresses an inactivating form of the MCIR protein.
- the transgenic mouse is deficient in the MCIR gene or is MClR-deficient. This is because the truncated MCIR protein is no capable of carrying out in normal function in the absence of its missing amino acid sequence.
- the transgenic mouse exhibits a mutant form of the BRAF protein and expresses no MCIR protein.
- the transgenic mouse exhibits a mutant form of the BRAF protein and an inactivating form of the MCIR protein.
- the transgenic mouse produces an inactivating form of a MCIR protein.
- the MCIR protein is nonfunctional, the resulting mouse contains melanocytes that synthesis red pigment (pheomelanin) but not black pigment (eumelanin). Consequently these MC1R deficient mice are a model of the redhair-fairskin phenotype of humans, since human
- redheaded/fairskinned people also typically contain deficient variant forms of the MC1R protein.
- Melanocortin receptors are members of the rhodopsin family of 7-transmembrane G protein-coupled receptors. There are five known members of the melanocortin receptor system, MC1R, MC2R, MC3R, MC4R, and MC5R; each with differing specificities for melanocortins.
- the MCl-R is found on many cell types in the skin, including melanocytes, keratinocytes, fibroblasts, endothelial cells, and antigen-presenting cells; however, melanocytes clearly have the highest density of MCl-R.
- MC1R is associated with pigmentation genetics. See J. V. Schaffer, and J. L.
- the human MCl-R gene is an intronless gene that encodes the receptor protein for melanocyte-stimulating hormone (MSH).
- MSH melanocyte-stimulating hormone
- the encoded protein a seven pass transmembrane G protein coupled receptor, controls melanogenesis.
- Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis.
- This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation.
- the receptor is primarily located on the surface of melanocytes, which are specialized cells that produce a pigment called melanin.
- Melanin is the substance that gives skin, hair, and eyes their color. Melanin is also found in the light-sensitive tissue at the back of the eye (the retina), where it plays a role in normal vision.
- Melanocytes make two forms of melanin, eumelanin and pheomelanin. The relative amounts of these two pigments help determine the color of a person's hair and skin. People who produce mostly eumelanin tend to have brown or black hair and dark skin that tans easily. Eumelanin also protects skin from damage caused by ultraviolet (UV) radiation in sunlight. People who produce mostly pheomelanin tend to have red or blond hair, freckles, and light-colored skin that tans poorly. Because pheomelanin does not protect skin from UV radiation, people with more pheomelanin have an increased risk of skin damage caused by sun exposure.
- UV radiation ultraviolet
- the melanocortin 1 receptor controls which type of melanin is produced by melanocytes.
- MCIR Common variations (polymorphisms) in the MCIR gene are associated with normal differences in skin and hair color. Certain genetic variations are most common in people with red hair, fair skin, freckles, and an increased sensitivity to sun exposure. These MCIR polymorphisms reduce the ability of the melanocortin 1 receptor to stimulate eumelanin production, causing melanocytes to make mostly pheomelanin. Although MCIR is a key gene in normal human pigmentation, researchers believe that the effects of other genes also contribute to a person's hair and skin coloring.
- Loss-of-function mutation of the human MCIR gene is described in Abdel-Malek ZA., et al. J Cell Sci. 2001 Mar;l 14(Pt 5): 1019-24, and in J. V. Schaffer and J. L. Bolognia,Arch Dermatol. 2001 ; 137(11): 1477-1485. The references are incorporated by reference in their entirety.
- BRAF belongs to a family of serine -threonine protein kinases that includes ARAF
- RAF kinases are central mediators in the MAP kinase signaling cascade and exert their effect predominantly through phosphorylation and activation of MEK. This occurs following the dimerization (hetero- or homo-) of the RAF molecules. As part of the MAP kinase pathway, RAF is involved in many cellular processes, including cell proliferation, differentiation, and transcriptional regulation.
- Mutant BRAF has been implicated in the pathogenesis of several cancers, including melanoma, non-small cell lung cancer, colorectal cancer, papillary thyroid cancer, and ovarian cancer. Mutations in BRAF are the most common genetic alterations in melanoma, found in -50% of tumor. The most frequent BRAF mutation is the substitution of valine at position 600 by glutamic acid (BRAF V600E) that results in the constitutive activation of its serine/threonine kinase activity and sustained activation of MAP kinase signal transduction pathway.
- BRAF V600E glutamic acid
- BRAF directly phosphorylates the dual- specificity kinases MEK1 and MEK2, which in turn phosphorylate and activate the mitogen-activated protein kinases, ERK1 and ERK2.
- BRAF has been shown by overexpression and knockdown experiments to be a critical mediator of melanomagenesis. In mice, activation of BRAF in combination with deletion of the tumor suppressor genes PTEN or INK4A leads to melanoma with complete.
- a knockout preferably the target gene expression is undetectable or insignificant.
- a knock-out of a MC1R gene means that the function of the respective MC1R protein has been
- a chromosomal deletion of all or part of the genomic gene may be induced, including deletions of the non-coding regions, particularly the promoter region, 3' regulatory sequences, enhancers, or deletions of gene that activate expression of MC1R genes.
- a functional knock-out may also be achieved by the introduction of an anti-sense construct that blocks expression of the native genes (for example, see Li and Cohen (1996) Cell 85:319-329).
- "Knock-outs” also include conditional knock-outs, for example where alteration of the target gene occurs upon exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e.g. Cre in the Cre-lox system), or other method for directing the target gene alteration postnatally.
- a tissue of the transgenic mouse described is isolated from the transgenic mouse and cultured in vitro to produce cell lines therefrom. For example, tumor cells, melanoma cells, and melanocytes.
- a tissue from the transgenic mouse carry a mutation of a MC1R gene and a mutation of a B-RAF gene as described.
- a tissue from the transgenic mouse described expresses no MC1R protein.
- a tissue from the transgenic mouse described expresses an inactivating form MC1R protein.
- a tissue from the transgenic mouse described produce more pheomelanin compared to a wild-type mouse expressing a full length MC1R protein.
- cultured cells isolated from the transgenic mouse described wherein the genomes of these cells comprise a mutation of a MC1R gene and a BRAF gene as described.
- the isolated cultured cells described express no MC1R protein.
- the isolated cultured cells described express an inactivating form MC1R protein.
- the isolated cultured cells described produce more pheomelanin compared to a wild-type mouse expressing a full length MC1R protein.
- Such tissues and isolated cultured cells from the transgenic mouse that carry a mutation of a MCIR gene and a mutation of a B-RAF gene are useful research and screening tools and reagents for drug screening and for studying the role of the affected proteins in cancer/melanoma development.
- a method of screening and identifying a test candidate for the treatment of melanoma comprising providing a transgenic mouse described, administering a test candidate to the mouse, and monitoring for a development of melanoma.
- a method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mouse, the transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring the development of melanoma in the mouse.
- the transgenic mouse provided has a homozygous mutation of the MCIR gene and a homozygous mutation of the B-RAF gene.
- the transgenic mouse provided has a homozygous mutation of the MCIR gene and a heterozygous mutation of the B-RAF gene.
- the transgenic mouse provided has a knock-out mutation in the MCIR gene. In one embodiment, the transgenic mouse provided exhibits a mutant form of the BRAF protein and expresses no MCIR protein. In one embodiment, the transgenic mouse provided exhibits a mutant form of the BRAF protein and an inactivating form of the MCIR protein. In one embodiment, the transgenic mouse provided produces an inactivating form of a MCIR protein.
- known drugs and small chemical compounds are administered to the described transgenic mouse over a period of time.
- B- RAF inhibitors, MAPK inhibitors, NRAS inhibitors and/or c-KIT inhibitors are potential therapeutic candidates to be screened.
- B-Raf inhibitors include, but are in no way limited to, vemurafenib, GDC-0879, PLX-4720, Sorafenib Tosylate, dabrafenib, and LGX818; other inhibitors can include but are not limited to mitochondrial inhibitors such as NV-128, ME-344, TTFA, rotenone, 2,4- Dinitrophenol (DNP), or oligomycin A; OXPHOS inhibitors such as oligomycin, malonate, oxaloacetate, barbiturates, rotenone, antimycin-A and arsenate; and MEK kinase inhibitors such as MEK162, trametinib, and selumetinib.
- mitochondrial inhibitors such as NV-128, ME-344, TTFA, rotenone, 2,4- Dinitrophenol (DNP), or oligomycin A
- OXPHOS inhibitors such as oligomycin, malonate, oxal
- known antioxidant agents are tested using the screening method described.
- the known antioxidant agents are administered to the described transgenic mice over a period of time, and the mice are monitored for the described parameters.
- known small molecules and compound libraries are screened for test candidates that are capable of blocking the pheomelanin-specific pathway and or excessive ROS production in the transgenic mice. Such candidates may protect against melanoma formation in redheads.
- the dosage of a test candidate to be tested by in vivo in the transgenic mice described can range from O.OOlmg/kg body weight to 5 g/kg body weight.
- the dosage range is from 0.001 mg/kg body weight to lg/kg body weight, from 0.001 mg/kg body weight to 0.5 g/kg body weight, from 0.001 mg/kg body weight to 0.1 g/kg body weight, from 0.001 mg/kg body weight to 50 mg/kg body weight, from 0.001 mg/kg body weight to 25 mg/kg body weight, from 0.001 mg/kg body weight to 10 mg/kg body weight, from 0.001 mg/kg body weight to 5 mg/kg body weight, from 0.001 mg/kg body weight to 1 mg/kg body weight, from 0.001 mg/kg body weight to 0.1 mg/kg body weight, from 0.001 mg/kg body weight to 0.005 mg/kg body weight.
- the dosage range is from 0.1 g/kg body weight to 5 g/kg body weight, from 0.5 g/kg body weight to 5 g/kg body weight, from 1 g/kg body weight to 5 g/kg body weight, from 1.5g/kg body weight to 5 g/kg body weight, from 2 g/kg body weight to 5 g/kg body weight, from 2.5 g/kg body weight to 5 g/kg body weight, from 3 g/kg body weight to 5 g/kg body weight, from 3.5 g/kg body weight to 5 g/kg body weight, from 4 g/kg body weight to 5 g/kg body weight, from 4.5 g/kg body weight to 5 g/kg body weight, from 4.8 g/kg body weight to 5 g/kg body weight.
- the dose range is from 5 g/kg body weight to 30 g/kg body weight.
- the dose range will be titrated to maintain serum levels between 5 g/mL and
- the test candidate to be screened is administered once or twice daily, or once every other day for about one, two or three months, or till there are observable melanomas.
- the test candidate to be screened is administered orally by ingestion.
- the therapeutic candidate to be screened is admix into the mouse chow such that the mouse ingest the test candidate ad libitum.
- the BRAF inhibitor PLX4720 is incorporated into the mouse chow at 2% by weight. Control mouse chow does not have the added PLX4720. Control mouse chow is fed to control transgenic mice.
- the transgenic mice are then monitored for the time of first observable melanomas which would give a measurement of the rate of invasive melanomas development. In other word, the latency period before manifestation of melanomas.
- the transgenic mice are also then monitored for the number of invasive melanomas occurring during a fixed period of time, e.g., 6 months, 1 year.
- the transgenic mice are also then monitored for survival time and/or rate over time, e.g., 1 year, 2 years. These transgenic mice are compared to control transgenic mice that have been administered a placebo or control mouse chow.
- the transgenic mice receiving the test candidate are the test transgenic mice.
- the transgenic mice receiving the placebo or control mouse chow are the control transgenic mice.
- the conditions in which the test transgenic mice and the control transgenic mice are housed and fed etc. are identical or similar except the test transgenic mice are administered the test candidate.
- the test transgenic mice and the control transgenic mice are also of the same age.
- the test transgenic mice and the control transgenic mice have the same exposure to UV radiation.
- the UV radiation is the usual UV radiation from visible light.
- the UV radiation is lOJ/com 2 UVA/0.65J/cm 2 UVB).
- transgenic mice are monitored for anywhere up to 6 months for the development of invasive melanoma.
- the monitoring period can be 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 35 days, 40 days, 45 days, 50 days, 55 days, 60 days, 65 days, 70 days, 75 days, 80 days, 85 days, 90 days, 95 days, 100 days, 120 days, 150 days, 180 days, 220 days, 260 days, 300 days, 330 days 370 days and 400 days, including all the whole integer number of days from 14 days and 400 days after the start of
- the teste candidate tested is determined to be a likely potential therapeutic candidate for further testing when the test candidate reduces the number of invasive melanomas developed in the test transgenic mice by at least two fold compared to the control transgenic mice, increases the survival period of the test transgenic mice by at least two fold compared to the control transgenic mice, and/or reduces the rate of invasive melanomas development in the test transgenic mice by at least two fold compared to the control transgenic mice.
- likely potential therapeutic candidates for further testing give longer latency and/or a lower rate of melanomas formation in the test transgenic mice compared to the control transgenic mice.
- the longer latency and/or a lower rate of melanomas formation are by at least two fold compared to the control transgenic mice.
- tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described the MC1R gene mutation results in premature termination of the MC1R transcript.
- tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described the MC1R gene mutation is selected from the group consisting of D294H, R151C, and R160W.
- the B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
- tissue of the transgenic mouse tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
- the B-RAF gene mutation is a substitution of the respective amino acid residue of the encoded B-Raf polypeptide at the following locations: L597S, L597Q, L597R, V600M, V600K, V600R, V600E, V600G, V600D, V600E, and K601E.
- the B-RAF gene mutation is conditionally expressed in melanocytes.
- the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
- [A] A transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene.
- [K] A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mouse of any one of paragraphs [A]-[H], administering a test candidate to the mouse, and monitoring for a development of melanoma.
- [L] A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mice transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring for a development of melanoma.
- [M] The method of paragraph [L] , wherein the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein,
- C57BL/6 genetic background (this corresponds to a >98.4% C57BL/6 congenic animal, (See internet tutorial at website of jaxmice, jax organization).
- the black (wild type), redhead (Mclr de ) and albino (Tyr c/c ) animals were purchased from Jackson Laboratories.
- K14-SCF animals were acquired from T. Kunisada. Genotyping of each litter, including the Tyr-Cre(ER BRaf A , and PTEI ⁇ ⁇ 0X alleles was performed as previously published 10 ' 11 .
- Tissues of interest were photographed, excised, weighed, rinsed in phosphate -buffered saline (PBS), fixed in 10% neutral-buffered formalin, rinsed in PBS, and stored in 70% ethanol.
- PBS phosphate -buffered saline
- Formalin-fixed tissues were paraffin embedded (FFPE) and sectioned (3-5 ⁇ ) using standard procedures. Morphological analysis was performed using multiple independent samples per site/organ (5 to 9 samples per genotype) as well as >6 animals. Two pathologists (JKL, MPH) independently examined the histopathology of the tumor samples. Digitization and image capture was performed using an Olympus DP70 digital camera (Olympus, Tokyo, Japan) connected to an Olympus BX51 light microscope or a Scanscope whole-slide scanning system (Aperio, Vista, CA).
- Sections were blocked in 1% BSA, 0.1% Triton X-100 PBS, incubated with 1 :200 dilutions of rabbit anti-SlOO (Dako), 1 : 100 dilutions of goat anti-DCT (Santa Cruz), 1 :200 dilutions of mouse-anti HMB45 (Santa Cruz) and 1:200 dilutions of mouse-anti gplOO (Abeam) antibodies, followed by visualization with appropriate secondary antibodies conjugated to Alexa594 or Alexa488 (1 :500). Appropriate controls for specificity of staining were included and images were captured using an upright fluorescence microscope (Eclipse 90i, Nikon).
- Tumor cells were digested overnight in 10 mg/ml collagenase and 1 mg/ml hyaluronidase. Initially tumor cells were grown in RPMI media with HEPES and 20% serum.
- the nucleic acids in the supernatant were precipitated with cold ethanol, dissolved in water and incubated in the presence of 0.03% RNase A (w/v) and 0.25 U/ ⁇ of RNase Tl at 37 ° C overnight, and subsequently extracted with an equal volume of chloroform isoamyl alcohol (24: 1, v/v) twice.
- the DNA was then precipitated from the aqueous layer by cold ethanol, centrifuged at 8,000 rpm at 4 ° C for 15 min, washed twice with 70% cold ethanol and dried under vacuum.
- the DNA pellet was dissolved in deionized water and quantified by using ultraviolet absorption spectrophotometry.
- Nuclease PI (16 U), phosphodiesterase 2 (0.025 U), 20 nmol of EHNA and a 30- ⁇ solution containing 300 mM sodium acetate (pH 5.6) and 10 mM zinc chloride were added to 200 ⁇ g of DNA.
- EHNA served as an inhibitor for deamination of 2' -deoxy adenosine to 2'- deoxyinosine (dl) induced by adenine deaminase.
- the above digestion was continued at 37 ° C for 48 h. To the digestion mixture were then added alkaline phosphatase (10 U), phosphodiesterase 1 (0.0125 U) and 60 ⁇ of 0.5 M Tris-HCl buffer (pH 8.9).
- the digestion was continued at 37 ° C for 2 h and subsequently neutralized by addition of formic acid.
- the enzymes in the digestion mixture were subsequently removed by chloroform extraction twice.
- the resulting aqueous layer was subjected to off-line high-performance liquid chromatography (HPLC) separation for the enrichment of the lesions under study, following our previously described procedures 26 .
- HPLC high-performance liquid chromatography
- LC-MS/MS/MS Analysis [0156] The LC-MS/MS/MS experiments were conducted using an LTQ linear ion trap mass spectrometer using our recently described conditions 26 . Briefly, the amounts of cdA and cdG lesions in each nucleoside sample were calculated based on the ratios of peak areas found in the selected-ion chromatograms for the analyte (e.g., the 23.5 min peak in the top panel of Fig. 4d for 5-cdA) and the corresponding stable isotope-labeled standard (e.g., the 23.4 min peak in the bottom panel of Fig.
- analyte e.g., the 23.5 min peak in the top panel of Fig. 4d for 5-cdA
- stable isotope-labeled standard e.g., the 23.4 min peak in the bottom panel of Fig.
- the known amount of uniformly 15N-labeled standard added to the nucleoside mixture e.g. 40 fmol for 5-cdA
- the calibration curves were constructed from the same LC-MS/MS/MS analyses of a series of mixtures with known compositions of the unlabeled cdA, cdG and constant amounts of the corresponding uniformly 15 N-labeled standards, as described previously 26 .
- the lesion formation frequencies as shown in Fig. 4e were then calculated by dividing the amounts of cdA and cdG in the sample with the total amount of nucleosides present.
- mice 6-week old mice were euthanized and fur was removed using animal shears with a 0.25 mm head. Twelve sections of skin, each with an area of 1 cm2, were removed from each mouse and placed in 35mm dishes on ice after adherence to WHATMAN filter paper suspended in PBS. For each UV and visible light study, 6 sections of skin from each mouse were placed in the dark on ice as controls. For UV studies, 6 sections of skin from each mouse were irradiated on ice with 10 J/cm 2 UVA and 0.65J/cm 2 UVB at an irradiance of 6.67 mW/cm 2 using a Sylvania 350 Blacklight (Osram Sylvania).
- pigmentation type was used for a total of 6 skin samples for each condition. Following treatment, skin sections were flash frozen and homogenized in PBS containing the antioxidant butylated hydroxy toluene (BHT) to prevent further lipid peroxidation, using a QIAGEN TISSUELYSER II. Homogenized samples were centrifuged and supernatants were collected. Protein content of each sample was determined by Coomassie Plus Protein Assay, and samples were diluted with PBS+BHT for normalization of sample concentration (THERMO SCIENTIFIC). Lipid peroxidation of each irradiated set of sample was determined using an OxiSelect TBARS Assay Kit and normalized to its unirradiated control (CELL BIOLABS).
- BHT antioxidant butylated hydroxy toluene
- mice with the wild type C57BL/6 pigmentation phenotype (“black”
- mice with premature termination of the Mclr transcript Mclr e/e , redhead 8 .
- mice with an inactivating mutation at the Tyrosinase locus were used 9 . Since tyrosinase is the initial and rate -limiting enzyme in melanin synthesis, albino melanocytes do not produce any pigment, but are normal in number and viability 10 .
- the inventors generated two variants of each pigmentation phenotype.
- One variant
- normal mouse contains melanocytes in the dermis.
- a second matched variant (“humanized mouse”) contains transgenic Stem Cell Factor expressed under the keratin 14 promoter ("K14-SCF”), which mimics SCF expression in human epidermal keratinocytes and results in epidermal melanocyte localization 11 .
- K14-SCF transgenic Stem Cell Factor expressed under the keratin 14 promoter
- the inventors initially produced 6 groups of BRaf v600E inducible mice representing 3 pigmentation variants ("black,” “redhead,” and “albino") with or without epidermal melanocytes (+/- transgenic K14-SCF, Fig. lb).
- Melanocyte-selective expression of BRaf v600E was achieved by topical tamoxifen activation of estrogen-receptor fused Cre recombinase (Tyr-Cre(ER) T2 ) in 6-10 week old mice carrying the BRaf A allele. The animals were then followed without environmental genotoxic stressors (such as UV).
- Black and albino BRafCA mice developed similarly low rates of melanoma after a long latency (regardless of K14-SCF status). In contrast, redhead BRaf mice developed melanomas at an accelerated rate with >50 having tumors after one year, regardless of K14- SCF status (Fig. lc and Id).
- HGF hepatocyte growth factor
- the tumors were histologically similar with spindle cell features which were not easily distinguishable from tumors on C57BL/6 BRaf :A -Pten floxflox animals generated in parallel (Fig. 2 vs. Fig. 5).
- Fig. 2g and at higher magnification, 2h melanin
- Fig. 2i an adenylate cyclase agonist known to MClRulate skin pigmentation 19
- the limited extent of pigmentation is likely related to forskolin' s poor tissue penetration, but nonetheless demonstrates the ability of the melanoma cells to become hyper-pigmented in vivo upon stimulation of cAMP signaling.
- BRaf v600E To determine if the redhead-derived melanomas were dependent on the presumed oncogenic driver BRaf v600E , the inventors tested their response to small molecule inhibitors of BRAF or MEK. Treatment with the oncogenic BRAF inhibitor, PLX4720, or the MEK inhibitor, U0126, prevented melanoma cell proliferation in vitro, and PLX4720 blocked tumor cell growth in vivo, consistent with a dependency of these tumors on the BRaf v600E oncoprotein (Fig. 3b and 3c). BRaf inhibition also elevated the expression of melanocytic genes as previously reported in human melanomas (Fig. 3d) 20 .
- UV radiation amplifies ROS production and the subsequent incidence of oxidative DNA damage in the skin of pigmented mice 18 .
- UV radiated cells with high pheomelanin levels have been found to carry particularly high levels of oxidative damage 4 ' 5 .
- Pheomelanin or its synthetic intermediates might also elevate ROS independently of UV exposure.
- the sulfur-containing aromatic rings in pheomelanin (which are absent in eumelanin) may propagate the ROS produced as a normal by-product of metabolism and pigment synthesis 23 .
- darkly pigmented individuals carry both pheomelanin and eumelanin, it has been hypothesized that their lower melanoma risk may result from eumelanin intermediates and polymers absorbing ROS and functioning as in vivo antioxidants.
- a predominantly pheomelanotic cell would lack these antioxidants and be prone to higher levels of oxidative damage 24 ' 25 .
- UV radiation at a UVA/UVB ratio similar to that found in sunlight (10J/cm 2 UVA and 0.65J/cm 2 UVB) was found to exacerbate oxidative damage selectively in redhead mouse skin as measured by levels of lipid peroxidation 4 ' 5 (Fig. 8a).
- a recent paper has suggested that visible light is also able to induce ROS in skin 31 .
- Preliminary studies examining the effect of a similar high intensity dose of visible light (180J/cm 2 ) as used in this paper, did not significantly alter lipid peroxidation levels in any pigmentation context (p 0.4506).
- UV shielding may protect against only one of several carcinogenic mechanisms—with the intrinsic pheomelanin pathway representing another contributor to
- UV shielding remains extremely important for skin cancer prevention, its role in specifically protecting against melanoma may be only partial. Additional preventative strategies may be essential to optimally diminish melanoma risk in the most susceptible individuals.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Environmental Sciences (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Endocrinology (AREA)
- General Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Oncology (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Physiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Diabetes (AREA)
- Public Health (AREA)
- Food Science & Technology (AREA)
Description
MELANOCORTIN RECEPTOR MUTANT MOUSE AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims benefit under 35 U.S.C. § 119(e) of the U.S. provisional application No. 61/701,767 filed September 17, 2012, the contents of which incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The technology disclosed relate to the field of melanoma and knock-out transgenic mice.
The transgenic mice are used for screening for therapeutic candidates for treatment of melanoma.
BACKGROUND OF THE INVENTION
[0003] Melanoma is a malignant tumor of melanocytes, and can originate in any part of the body that contains melanocytes. There are 160,000 new cases diagnosed each year, and about 48,000 melanoma related deaths reported each year. Melanoma is the most incurable cancer once the cancerous cells have metastasized to distant part of the body. Therefore, metastatic melanomas have to be aggressively treated with current and newer therapies.
[0004] A good number of mutations have been found in melanoma. For examples, mutations in
BRAF and NRAS genes have found in melanomas, and these mutations have been known to activate downstream MEK-ERK oncogenic signal transduction pathway, or MAPK pathway. The MAPK pathway is an important signaling cascade driving cell proliferation, differentiation, and survival and could have an important role in the pathogenesis of melanoma.
[0005] In addition, it is known that redhead humans are at higher risk for melanoma. The redhead phenotype includes red hair, fair skin and poor tanning ability. This phenotype is due to mutations in a gene called melanocortin 1 receptor (MCIR).
[0006] An improved understanding of the role of these genetic mutations in melanoma development could result in advancements in treatments of melanoma and cancers, and the development of targeted therapy directed towards highly susceptible humans such as redheads. Currently, there is still a need for tools that aid in such discoveries and development.
SUMMARY OF THE INVENTION
[0007] Embodiments herein are based on the discovery that transgenic mice having genomic mutations in a melanocortin 1 receptor (MCIR) gene and a BRAF gene have high incidences of invasive melanomas. In humans, the mutation in MCIR gene produces a premature termination of the MCIR transcript and a truncated MCIR protein. This MCIR mutation known to produce the redhead phenotype which includes red hair, high pheomelanin versus eumelanin production, fair skin and poor tanning ability. The gene mutation in the BRAF gene is a V600E substitution that is common in many highly invasive melanomas. It is also known that humans with the redhead phenotype are prone to melanoma.
Therefore, such transgenic mice transgenic mice are useful animal systems and tools for screening
therapeutic candidates for the treatment of melanoma. In particular, the transgenic animal systems are useful where the melanomas involve MC1R and BRAF mutations.
[0008] It is the objective of this disclosure to provide transgenic animal systems, reagents and tools for screening and identifying potential therapeutic candidates for the treatment of melanoma. This is particularly useful for highly invasive and metastatic melanomas. For examples, tumor cells, melanoma cells and tissues from the transgenic mice that have MC1R and BRAF mutations.
[0009] It is also the objective of this disclosure to provide a method of screening and identifying test candidates for the treatment of melanoma using transgenic animal systems, reagents and tools.
[0010] Accordingly, in one embodiment, provided herein is a transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B-RAF gene.
[0011] In one embodiment, the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein.
[0012] In one embodiment, provided herein is a tissue of the transgenic mouse described. For example, tumor cells, melanoma cells, and melanocytes.
[0013] In one embodiment, provided herein is cultured cells isolated from the transgenic mouse described, wherein the genomes of these cells comprise a mutation of a MC1R gene and a BRAF gene.
[0014] In another embodiment, provided herein is a method of screening and identifying a test candidate for the treatment of melanoma comprises providing a transgenic mouse described herein, and administering a test candidate to the mouse. In one embodiment, the method further comprises monitoring for a development of melanoma in the mouse.
[0015] In another embodiment, provided herein is a method of screening and identifying test candidates for the treatment of melanoma, the method comprises providing a transgenic mouse transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring the development of melanoma in the mouse. In one embodiment, the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein,
[0016] In one embodiment of any method described, the method further comprises monitoring for a development of melanoma in the mouse. In one embodiment of any method described, the method further comprises monitoring the latency period before the development of melanomas. In one embodiment of any method described, the method further comprises monitoring the survival rate of the tested transgenic mouse compared to control transgenic mouse that have not received the test candidate. In one embodiment of any method described, the method further comprises monitoring the number of melanomas developing over a period of time.
[0017] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MC1R gene mutation is a homozygous mutation.
[0018] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the BRAF gene mutation is a
homozygous or a heterozygous mutation.
[0019] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation results in premature termination of the MCIR transcript
[0020] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation results in a nonfunctional MCIR or an inactivation form of a MCIR.
[0021] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation results in the non-expression of the MCIR protein, full-length or truncated or otherwise.
[0022] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation is selected from the group consisting of D294H, R151C, and R160W, ie., amino acid substitutions in the MCIR coding nucleotide at the identified location in the polypeptide.
[0023] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
[0024] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
[0025] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation is conditionally expressed in melanocytes.
[0026] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figures la- Id. Without UV radiation, BRaf ^ red mice have an increased rate of melanoma development relative to black and albino BRaf ^ animals.
[0028] Figure la. C57BL/6 pigmentation variants with epidermal melanocytes (K14-SCF).
From left to right: black (wild- type), redhead (Mclre/e), and albino (Tyrdc).
[0029] Figure lb. Genotype of animals used for experimental studies.
[0030] Figure lc. Percent survival of pigmentation variants not carrying the K14-SCF transgene, i.e. no epidermal melanocytes. (nblack=28, nredhead=40, nalbino=48)
Palbino-red 0.003.
[0031] Figure ld.Percent survival of pigmentation variants carrying the K14-SCF transgene, i.e. epidermal melanocytes (nblack=49, nredhead=77, nalbino=41)
Pbiack-red=0.009, paibmo- red<0.0001.
[0032] Figures 2a-2k. Melanomas on all three pigmentation variants are morphologically similar and exhibit common histologic features
[0033] Melanomas on (Figure 2a) black, (Figure 2b) albino, and (Figure 2c) redhead mice are grossly amelanotic. Histologically, (Figure 2d) black, (Figure 2e) albino, and (Figure 2f) redhead melanomas are also mostly amelanotic though superficial tumor cells in black-BRafv600E tumors carry melanin.
[0034] Figure 2g. Melanin containing tumor cells can also be found in the superficial aspect of redhead-BRafv600E melanomas, near the epidermis (arrows).
[0035] Figure 2h. Further magnification of two redhead melanomas also illustrates pigmented tumor cells (arrows).
[0036] Figure 2i. Forskolin induces significant epidermal pigmentation (arrowheads) and mild tumor cell pigmentation (arrows) in redhead K14-SCF mice.
[0037] Figure 2j. Tumor cells stain positive for the SI 00 melanoma marker.
[0038] Figure 2k. Skin-draining lymph nodes carry clusters of gpl00+ cells (lighter shade in the non-color micrograph).
[0039] Figures 3a-3d. Tumor cells from a redhead-BRaf ^ animal behave like classic
BRAFV600E melanomas after cAMP upregulation or BRAF inhibition.
[0040] Figure 3a. 20 μΜ forskolin upregulates expression of melanocytic markers (n=4).
[0041] Figure 3b. 72 hours of MAPK inhibition by PLX4720 or U0126 decreases melanoma cell proliferation
μΜ) (n=3).
[0042] Figure 3c. 4 weeks of mouse chow containing 2% PLX4720 by weight, blocks melanoma growth in vivo (n=3).
[0043] Figure 3d. 2 μΜ PLX4720 upregulates expression of melanocytic markers. mRNA expression normalized to 18s rRNA and 0 h timepoint. Error bars denote s.e.m.
[0044] Figures 4a-4f. The UV independent propensity of redhead BRaf ^ mice to develop melanoma is dependent on pigment production.
[0045] Figure 4a. Albino- cire e mice were generated and melanoma incidence after BRafv600E activation was compared to redhead-only and albino-only mice (from Figure 1).
[0046] Figure 4b. The albino allele was found to protect Mclre/e mice from their propensity to develop a high rate of melanoma (nredhead=40, nalbino=48, nalbino.redhead=90) p alb/red-albino =0.308, Palb/red- red<0.0001, palbino.rcd<0.0001.
[0047] Figure 4c. ROS such as free hydroxyl radicals can react with purine nucleosides in DNA to produce 8,5'-cyclopurine lesions, i.e., cdA and cdG (cdA shown here).
[0048] Figure 4d. Selected-ion chromatograms (SICs) for monitoring the m/z 250→164→136
[upper panel, for unlabeled S-cdA] and m/z 255→169→141 [lower panel, for uniformly 15N-labeled S- cdA] transitions of the S-cdA -containing fraction from off-line HPLC enrichment for the digestion mixture of nuclear DNA isolated from the skin of an albino- tJre e mouse. Shown in the insets are the positive-ion MS3 spectra for the unlabeled and labeled S-cdA.
[0049] Figure 4e. Both 5'R and 5'S diastereomers of cdA and cdG are significantly higher in redhead- cire eskin compared to albino- cire e skin. (n=3) *=p<0.05; **=p<0.01; ***=p<0.001.
[0050] Figure 4f. Lipid peroxide levels are significantly higher in redhead- cire e skin compared to albino- cire e skin (n=3). p<0.0001.
[0051] Figures 5a-5f. The BRafv600E-PtenNu11 melanomas on a C57BL/6 background are histologically similar to the BRafv600E-pigmentation variant melanomas.
[0052] Figures 5a, 5c, and 5e. On the C57BL/6 background, some BRafv600E-PtenNu11 melanomas are heavily pigmented superficially but typically become less pigmented at greater tumor depths.
[0053] Figures 5b, 5d, and 5f. Other BRafv600E-PtenNull melanomas, however, are generally amelanotic. These tumors were seen to exhibit the same spindle cell-like morphology as the BRaf- pigmentation variant melanomas.
[0054] Figures 6a-6b. Redhead- cire e and albino- cire e K14-SCF mice do not differ significantly in epidermal melanocyte number
[0055] Figure 6a. β-galactosidase staining of frozen sections from redhead-Mclre/e (Mclrde
;7 r+ +; K14-SCF) and albino- cire e (Mclre,e ;Tyr 'c; K14-SCF) mice which also carry the Dct-LacZ transgene.
[0056] Figure 6b. Quantification of Dct+ epidermal melanocytes (n=20).
[0057] Figures 7a-7c. Melanomas arising in albino- cire e mice are similar to the other pigmentation variant melanomas.
[0058] Figure 7a. The tumors on the albino- cire e animals were grossly amelanotic.
[0059] Figure 7b. The tumors on the albino- cire e animals were histologically similar to the other BRafv600E tumors.
[0060] Figure 7c. The tumors on the albino- cire e animals stained positively for the S100 neural crest marker.
[0061] Figures 8a-8b. UV irradiation but not high intensity visible light exposure promotes oxidative lipid damage in redhead mouse skin.
[0062] Figure 8a. UV irradiation (lOJ/cm2 UVA-0.65J/cm2 UVB) significantly increases lipid peroxidation levels in redhead mouse skin but not in black or albino mouse skin (n=12) *=p<0.05.
[0063] Figure 8b. High-dose visible light exposure (180J/cm2) did not significantly increase lipid peroxide levels in any pigmentation phenotype (n=6).
DETAILED DESCRIPTION OF THE INVENTION
[0064] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes IX, published by Jones & Bartlett Publishing, 2007 (ISBN-13: 9780763740634); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0065] Unless otherwise stated, the present invention was performed using standard procedures known to one skilled in the art, for example, in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual (2 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier Science
Publishing, Inc., New York, USA (1986); Current Protocols in Molecular Biology (CPMB) (Fred M. Ausubel, et al. ed., John Wiley and Sons, Inc.), Current Protocols in Immunology (CPI) (John E. Coligan, et. al., ed. John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998), Methods in Molecular biology, Vol.180, Transgenesis Techniques by Alan R. Clark editor, second edition, 2002, Humana Press, and Methods in Meolcular Biology, Vo. 203, 2003, Transgenic Mouse, editored by Marten H. Hofker and Jan van Deursen, which are all herein incorporated by reference in their entireties.
[0066] It should be understood that this technology is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0067] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified
in all instances by the term "about." The term "about" when used in connection with percentages will mean ±1%.
[0068] All patents and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0069] Definitions
[0070] As used herein, the term "mutation" with respect to a gene refers to a change of the nucleotide sequence of the gene of an organism. In some embodiments, the "mutations" referred to herein can take the form of one or more nucleotides deletions, one or more nucleotides additions, or one or more nucleotides substitutions. In some embodiments, the "mutations" referred to herein have the effects of one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a polypeptide. In one embodiment, mutations referred to herein have the effects of non-expression of a polypeptide from the affected gene.
[0071] In one embodiment, as used herein, the term "a MC1R mutation" refers to a change of the coding nucleotide sequence of the MC1R gene such that there is one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a MC1R polypeptide. In another embodiment, "a MC1R mutation" refers to a change of the nucleotide sequence of the MC1R gene such that no MC1R protein is transcribed and translated.
[0072] As used herein, the term "a B-RAF mutation" refers to a change of the nucleotide sequence of the B-RAF gene such that there is one or more amino acids deletions, one or more amino acids additions, or one or more amino acids substitutions when the mutated gene is transcribed and translated into a BRAF polypeptide.
[0073] As used herein, the term "gene" with references to mutations means the nucleic acid sequence which is transcribed (DNA) and translated (mRNA) into a polypeptide in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5'UTR) or "leader" sequences and 3' UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).
[0074] As used herein, the term "amino acid" is intended to include naturally occurring amino acids (alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine,
isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine). Amino acids can be referred to herein by either their commonly known three letter symbols or by the one -letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
[0075] As used herein, the abbreviations of amino acid substitutions for a particular amino acid residue at a particular position in a polypeptide is indicated by a first single upper case alphabet followed by a number which is then followed by a second single upper case alphabet. For example, K500L. In this example, the first single upper case alphabet is the original amino acid normally found at position 500 of the polypeptide, and the second single upper case alphabet is the substitution amino acid for the original amino acid. In this example, lysine at position 500 of the polypeptide is substituted by leucine.
[0076] As used herein, "administration" and "administering," as it applies to a transgenic mouse, refers to contact of an exogenous pharmaceutical, therapeutic, or composition to the transgenic mouse. In some embodiment, the administration can be oral administration, topical administration, transdermal administration or systemic administration.
[0077] As used herein, the term "MC1R protein" refers to a full length MC1R polypeptide.
Examples of a MC1R protein includes all mammalian MC1R proteins, for example, human MC1R protein (Genbank Protein Accession Nos: NP_002377.4, GenelD: 4157), and mouse MC1R protein (Genbank Protein Accession Nos: NP_032585.2).
[0078] As used herein, the term "MC1R gene" refers to a nucleotide sequence encoding a
MC1R protein. Examples of a MC1R gene includes nucleotide sequences encoding all mammalian MC1R proteins, for example, the human MClRgene (Genbank Accession Nos: NM_002386.3), and the mouse MC1R gene (Genbank Accession No.: NM_008559).
[0079] As used herein, the term "BRAF protein" refers to a full length BRAF polypeptide. The full-length BRAF protein can be the wild-type form or one that has amino acid substitutions. Examples of a BRAF protein includes all mammalian BRAF proteins, for example, human BRAF protein (Genbank Protein Accession Nos: AAA35609.2, NM_004333.4; GenelD: 673), and mouse BRAF protein
(Genbank Protein Accession Nos: NP_647455.3; GenelD: 109880, ).
[0080] As used herein, the term "BRAF gene" refers to a nucleotide sequence encoding a full- length wild-type BRAF protein. Examples of a BRAF gene includes nucleotide sequences encoding the human BRAF gene (Genbank Accession Nos: M95712, M95720, X54072, NM_004333.4), and the mouse BRAF gene (Genbank Accession No.: NM_139294.5).
[0081] In one embodiment, as used herein, the term "deficient in the MC1R gene" or "MC1R- deficient" means that no functional MC1R 1 protein is produced due to the disruption of the MC1R 1 gene or non-expression of the MC1R protein. In another embodiment, "deficient in the MClRgene" or "MClR-deficient" means a truncated MC1R protein that is incapable of binding its ligand, melanocyte - stimulating hormone (MSH) and/or does not any transduce signal upon ligand or other agonist binding. The signal is the induction of cAMP levels in the cell. This can be measured by either directly
quantifying cAMP levels or the downstream consequences of cAMP increases, such as the phosphorylation of CREB protein. These measurements can be made by any method known in the art, e.g., as described in J. Lyons et al, 2013, Proc. Nat. Acad. Sci. NY, vol. 110:13845-13850; in C. Herraiz, et al., 2011, Mol. Endocrinology, vol. 25: 138-156; and in A. G. Smith, 2008, J. Biol. Chem. Vol. 283: 12564-12570. These references are hereby incorporated by reference in their entirety.
[0082] As used herein, the term "functional MC1R protein" refers to a MC1R protein that responds to stimulation by melanocyte stimulating hormone (MSH) exposure by stimulating the synthesis of cAMP inside cells. cAMP can be directly measured using various assays, or can be indirectly measured through its downstream effects in cells, such as induction of phosphorylation of CREB protein.
[0083] As used herein, the term "inactivating form of a MC1R protein" refers to a form of a
MC1R protein that is that is incapable of binding its ligand, melanocyte-stimulating hormone (MSH) and/or does not any transduce signal upon ligand or other agonist binding.
[0084] As to the mice of the present disclosure, the term "tissue" includes any tissues, for example but not limited to, tumors, melanomas, melanocytes, spleen, bone marrow, lymph nodes, endocrine tissues such as pancreatic islets, pituitary glands and exocrine tissues such as exocrine pancreas, gastric glands, small intestinal glands, Brunner's glands, salivary glands, mammary glands, etc., and their acini.
[0085] When a cell or animal has two identical or substantially similar alleles of a gene, it is said to be "homozygous." In contrast, when the cell or animal has two substantially different alleles it is said to be "heterozygous" for that gene.
[0086] As used herein, the term "transgene" refers to a nucleic acid sequence which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can be operably linked to one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid. Exemplary transgenes of the present disclosure encode, for instance, a neomycine resistance gene fused with a mouse MC1R cDNA coding nucleotides 1-150 and a Cre recombinase enzyme. Other exemplary transgenes are directed to disrupting a MC1R gene by homologous recombination with genomic sequences of a MC1R gene.
[0087] As used herein, "test candidate" refers to any substance that, when administered to the disclosed transgenic mice, can prevent, inhibit or stop the development of melanomas in the disclosed transgenic mice compared to in the absence of the administered test candidate. In some embodiment, the test candidate reduces the number and/or rate of melanomas formation compared to in the absence of the administered therapeutic candidate. Examples of test candidates include, but are not limited to, small
organic molecules, large organic molecules, amino acids, peptides, polypeptides, nucleotides, nucleic acids (including DNA, cDNA, RNA, antisense RNA and any double- or single-stranded forms of nucleic acids), polynucleotides, carbohydrates, lipids, lipoproteins, glycoproteins, inorganic ions (including, for example, Gd3+, lead and lanthinum). In some embodiments, "therapeutic candidates" include currently known drugs for non-melanomas. In some embodiments, "therapeutic candidates" include currently known B-RAF inhibitors, MAPK inhibitors, NRAS inhibitors and/or c-KIT inhibitors. Some examples of B-Raf inhibitors include, but are in no way limited to, vemurafenib, GDC-0879, PLX-4720, Sorafenib Tosylate, dabrafenib, and LGX818.
[0088] As used herein, the term "inhibitor" when used in reference to the MAPK pathway, B-
Raf, NRAS and/or c-KIT, refers to an agent that inhibits the normal cellular activities of the proteins that are involved, that constitute, or that are participants in the MAPK pathway, or the normal cellular activities of B-Raf , NRAS and/or c-KIT.
[0089] As used herein, the term "comprising" or "comprises" is used in reference to methods and compositions, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not. The use of "comprising" indicates inclusion rather than limitation.
[0090] The term "consisting of refers to methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0091] Embodiments of the present disclosure herein are based on the discovery that transgenic mice having genomic mutations in a melanocortin 1 receptor (MC1R) gene and a BRAF gene have high incidences of invasive melanomas. The mutation in MC1R gene produces a premature termination of the MC1R transcript and a truncated MC1R protein. This MC1R mutation known to be responsible for the redhead phenotype, a phenotype which includes red hair, high pheomelanin versus eumelanin production, fair skin and poor tanning ability. The gene mutation in the BRAF gene is a V600E substitution that is common in many highly invasive melanomas. It is also known that humans with the redhead phenotype are prone to melanoma. Therefore, such transgenic mice are useful animal systems and tools for screening therapeutic candidates for the treatment of melanoma. In particular, the transgenic animal systems are useful where the melanomas involve MC1R and BRAF mutations.
[0092] People with pale skin, red hair, freckles, and an inability to tan, the "redhead" phenotype, are at highest risk of developing melanoma, compared to all other pigmentation types1. Genetically, the redhead phenotype is frequently the product of inactivating polymorphisms in the melanocortin 1 receptor (MC1R) gene. MC1R encodes a cAMP MClRulating G-protein coupled receptor that controls pigment production. Minimal receptor activity, as in redhead polymorphisms, produces red/yellow sulfur-containing pheomelanin pigment, while increasing MC1R activity MClRulates production of black/brown non-sulfuric eumelanin. Pheomelanin has weak UV shielding capacity relative to eumelanin and has been shown to amplify UVA-induced reactive oxygen species (ROS) 3"5. Several observations,
however, complicate the assumption that melanoma risk is completely UV dependent. For example, unlike non-melanoma skin cancers, melanoma is not restricted to sun-exposed skin and UV signature mutations are infrequently oncogenic drivers6. While linkage of melanoma risk to UV exposure is beyond doubt, UV -independent events are also likely to play a significant role1'7. Disclosed herein, the inventors introduced into mice carrying an inactivating mutation in the Mclr gene (who exhibit a phenotype analogous to redheaded humans), a conditional, melanocyte-targeted allele of the most commonly mutated melanoma oncogene, BRafV600E. The inventors observed a high incidence of invasive melanomas without providing additional oncogenic or tumor suppressor gene aberrations or UV exposure. To investigate the mechanism of UV -independent carcinogenesis, the inventors introduced an albino allele, which ablates all pigment production on the redhead-Mclr e/e background. Selective absence of pheomelanin synthesis was protective against melanoma. In addition, normal redhead- Mclre/e mouse skin was found to have significantly greater oxidative DNA and lipid damage than albino-Mclre/e mouse skin. These data indicate that the pheomelanin pigment pathway produces UV- independent carcinogenic contributions to melanomagenesis by a mechanism of oxidative damage, which carries significant implications regarding melanoma prevention strategies.
[0093] Accordingly, in one embodiment, provided herein is a transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene.
[0094] In one embodiment, the MCIR gene mutation is a homozygous mutation.
[0095] In one embodiment, the BRAF gene mutation is a homozygous or a heterologous mutation.
[0096] In one embodiment, the transgenic mouse has a homozygous mutation of the MCIR gene and a homozygous mutation of the B-RAF gene.
[0097] In one embodiment, the transgenic mouse has a knock-out mutation in the MCIR gene.
Consequently, there is no expression of the MCIR protein, either full-length or truncation.
[0098] In another embodiment, the transgenic mouse has a point mutation in the MCIR gene that results in the premature transcription termination of the MCIR gene. In one embodiment, the resultant MCIR protein is a truncated protein. Consequently, the transgenic mouse expresses an inactivating form of the MCIR protein. In this embodiment, the transgenic mouse is deficient in the MCIR gene or is MClR-deficient. This is because the truncated MCIR protein is no capable of carrying out in normal function in the absence of its missing amino acid sequence.
[0099] In one embodiment, the transgenic mouse exhibits a mutant form of the BRAF protein and expresses no MCIR protein.
[0100] In one embodiment, the transgenic mouse exhibits a mutant form of the BRAF protein and an inactivating form of the MCIR protein.
[0101] In one embodiment, the transgenic mouse produces an inactivating form of a MCIR protein. When the MCIR protein is nonfunctional, the resulting mouse contains melanocytes that
synthesis red pigment (pheomelanin) but not black pigment (eumelanin). Consequently these MC1R deficient mice are a model of the redhair-fairskin phenotype of humans, since human
redheaded/fairskinned people also typically contain deficient variant forms of the MC1R protein.
[0102] Melanocortin receptors are members of the rhodopsin family of 7-transmembrane G protein-coupled receptors. There are five known members of the melanocortin receptor system, MC1R, MC2R, MC3R, MC4R, and MC5R; each with differing specificities for melanocortins.
[0103] The human MCl-R gene was first cloned in 1992, and has been mapped to chromosome
16q24.3.24 The MCl-R is found on many cell types in the skin, including melanocytes, keratinocytes, fibroblasts, endothelial cells, and antigen-presenting cells; however, melanocytes clearly have the highest density of MCl-R. MC1R is associated with pigmentation genetics. See J. V. Schaffer, and J. L.
Bolognia, (2001) Arch Dermatol. 137(11): 1477-1485.
[0104] The human MCl-R gene is an intronless gene that encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation.
[0105] The receptor is primarily located on the surface of melanocytes, which are specialized cells that produce a pigment called melanin. Melanin is the substance that gives skin, hair, and eyes their color. Melanin is also found in the light-sensitive tissue at the back of the eye (the retina), where it plays a role in normal vision.
[0106] Melanocytes make two forms of melanin, eumelanin and pheomelanin. The relative amounts of these two pigments help determine the color of a person's hair and skin. People who produce mostly eumelanin tend to have brown or black hair and dark skin that tans easily. Eumelanin also protects skin from damage caused by ultraviolet (UV) radiation in sunlight. People who produce mostly pheomelanin tend to have red or blond hair, freckles, and light-colored skin that tans poorly. Because pheomelanin does not protect skin from UV radiation, people with more pheomelanin have an increased risk of skin damage caused by sun exposure.
[0107] The melanocortin 1 receptor controls which type of melanin is produced by melanocytes.
When the receptor is activated, it triggers a series of chemical reactions inside melanocytes that stimulate these cells to make eumelanin. If the receptor is not activated or is blocked, melanocytes make pheomelanin instead of eumelanin.
[0108] Common variations (polymorphisms) in the MCIR gene are associated with normal differences in skin and hair color. Certain genetic variations are most common in people with red hair, fair skin, freckles, and an increased sensitivity to sun exposure. These MCIR polymorphisms reduce the ability of the melanocortin 1 receptor to stimulate eumelanin production, causing melanocytes to make mostly pheomelanin. Although MCIR is a key gene in normal human pigmentation, researchers believe that the effects of other genes also contribute to a person's hair and skin coloring.
[0109] Loss-of-function mutation of the human MCIR gene is described in Abdel-Malek ZA., et al. J Cell Sci. 2001 Mar;l 14(Pt 5): 1019-24, and in J. V. Schaffer and J. L. Bolognia,Arch Dermatol. 2001 ; 137(11): 1477-1485. The references are incorporated by reference in their entirety.
[0110] BRAF belongs to a family of serine -threonine protein kinases that includes ARAF,
BRAF, and CRAF (RAFl). RAF kinases are central mediators in the MAP kinase signaling cascade and exert their effect predominantly through phosphorylation and activation of MEK. This occurs following the dimerization (hetero- or homo-) of the RAF molecules. As part of the MAP kinase pathway, RAF is involved in many cellular processes, including cell proliferation, differentiation, and transcriptional regulation.
[0111] Mutant BRAF has been implicated in the pathogenesis of several cancers, including melanoma, non-small cell lung cancer, colorectal cancer, papillary thyroid cancer, and ovarian cancer. Mutations in BRAF are the most common genetic alterations in melanoma, found in -50% of tumor. The most frequent BRAF mutation is the substitution of valine at position 600 by glutamic acid (BRAF V600E) that results in the constitutive activation of its serine/threonine kinase activity and sustained activation of MAP kinase signal transduction pathway. BRAF directly phosphorylates the dual- specificity kinases MEK1 and MEK2, which in turn phosphorylate and activate the mitogen-activated protein kinases, ERK1 and ERK2. BRAF has been shown by overexpression and knockdown experiments to be a critical mediator of melanomagenesis. In mice, activation of BRAF in combination with deletion of the tumor suppressor genes PTEN or INK4A leads to melanoma with complete.
Conversely, treatment of BRAF mutant melanomas in vitro with chemical inhibitors of BRAF or MEK1/2 promotes cell cycle arrest and apoptosis. Moreover, the BRAF inhibitor vemurafenib
(PLX4032) leads to tumor regression and improved overall survival in patients whose melanomas have the BRAF(V600E) mutation, leading to its approval as a treatment for patients with metastatic melanoma. Despite the promise and dramatic initial effects of BRAF inhibitors in the clinic, patients eventually relapse within several months, suggesting that combination therapies may be needed to overcome intrinsic or acquired resistance.
[0112] Detailed descriptions on the productions of knockout mouse, mouse with genomic homologous or heterologous mutations and protocols of preparation and gene targeting of ES cells, electroporation, clonal selection and more are available in the following books: Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994) Manipulating the Mouse Embryo: A Laboratory Manual, Cold
Spring Harbor Laboratory; Porter et al., Eur. J. Biochem., vol. 218, pp. 273-281 (1993); Bradley, A. (1991) "Modifying the mammalian genome by gene targeting" Current Opinion in Biotechnology 2: 823- 829; Capecchi, M., "The New Mouse Genetics: Altering the Genome by Gene Targeting," Trends in Genetics, vol. 5, No. 3, 70-76 (1989); US Patents Nos.: 6100445, 6060642, 6365796, 6747187, and 7166764, and they are hereby explicitly incorporated by reference.
[0113] In a knockout, preferably the target gene expression is undetectable or insignificant. A knock-out of a MC1R gene means that the function of the respective MC1R protein has been
substantially decreased so that expression is not detectable or only present at insignificant levels. This may be achieved by a variety of mechanisms, including introduction of a disruption of the coding sequence, e.g. insertion of one or more stop codons, insertion of a DNA fragment, etc., deletion of coding sequence, substitution of stop codons for coding sequence, etc. In some cases the exogenous transgene sequences are ultimately deleted from the genome, leaving a net change to the native sequence. Different approaches may be used to achieve the "knock-out". A chromosomal deletion of all or part of the genomic gene may be induced, including deletions of the non-coding regions, particularly the promoter region, 3' regulatory sequences, enhancers, or deletions of gene that activate expression of MC1R genes. A functional knock-out may also be achieved by the introduction of an anti-sense construct that blocks expression of the native genes (for example, see Li and Cohen (1996) Cell 85:319-329). "Knock-outs" also include conditional knock-outs, for example where alteration of the target gene occurs upon exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e.g. Cre in the Cre-lox system), or other method for directing the target gene alteration postnatally.
[0114] In one embodiment, provided herein is a tissue of the transgenic mouse described. In one embodiment, the tissue is isolated from the transgenic mouse and cultured in vitro to produce cell lines therefrom. For example, tumor cells, melanoma cells, and melanocytes. In one embodiment, a tissue from the transgenic mouse carry a mutation of a MC1R gene and a mutation of a B-RAF gene as described. In one embodiment, a tissue from the transgenic mouse described expresses no MC1R protein. In one embodiment, a tissue from the transgenic mouse described expresses an inactivating form MC1R protein. In one embodiment, a tissue from the transgenic mouse described produce more pheomelanin compared to a wild-type mouse expressing a full length MC1R protein.
[0115] In one embodiment, provided herein are cultured cells isolated from the transgenic mouse described wherein the genomes of these cells comprise a mutation of a MC1R gene and a BRAF gene as described. In one embodiment, the isolated cultured cells described express no MC1R protein. In one embodiment, the isolated cultured cells described express an inactivating form MC1R protein. In one embodiment, the isolated cultured cells described produce more pheomelanin compared to a wild-type mouse expressing a full length MC1R protein.
[0116] Such tissues and isolated cultured cells from the transgenic mouse that carry a mutation of a MCIR gene and a mutation of a B-RAF gene are useful research and screening tools and reagents for drug screening and for studying the role of the affected proteins in cancer/melanoma development.
[0117] Accordingly, in another embodiment, provided herein is a method of screening and identifying a test candidate for the treatment of melanoma comprising providing a transgenic mouse described, administering a test candidate to the mouse, and monitoring for a development of melanoma.
[0118] In another embodiment, provided herein is a method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mouse, the transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring the development of melanoma in the mouse. In one embodiment, the transgenic mouse provided has a homozygous mutation of the MCIR gene and a homozygous mutation of the B-RAF gene. In one embodiment, the transgenic mouse provided has a homozygous mutation of the MCIR gene and a heterozygous mutation of the B-RAF gene. In one embodiment, the transgenic mouse provided has a knock-out mutation in the MCIR gene. In one embodiment, the transgenic mouse provided exhibits a mutant form of the BRAF protein and expresses no MCIR protein. In one embodiment, the transgenic mouse provided exhibits a mutant form of the BRAF protein and an inactivating form of the MCIR protein. In one embodiment, the transgenic mouse provided produces an inactivating form of a MCIR protein.
[0119] In some embodiments of the method, known drugs and small chemical compounds are administered to the described transgenic mouse over a period of time. For example, currently known B- RAF inhibitors, MAPK inhibitors, NRAS inhibitors and/or c-KIT inhibitors are potential therapeutic candidates to be screened. Some examples of B-Raf inhibitors include, but are in no way limited to, vemurafenib, GDC-0879, PLX-4720, Sorafenib Tosylate, dabrafenib, and LGX818; other inhibitors can include but are not limited to mitochondrial inhibitors such as NV-128, ME-344, TTFA, rotenone, 2,4- Dinitrophenol (DNP), or oligomycin A; OXPHOS inhibitors such as oligomycin, malonate, oxaloacetate, barbiturates, rotenone, antimycin-A and arsenate; and MEK kinase inhibitors such as MEK162, trametinib, and selumetinib.
[0120] In some embodiments of the method, known antioxidant agents are tested using the screening method described. The known antioxidant agents are administered to the described transgenic mice over a period of time, and the mice are monitored for the described parameters.
[0121] In some embodiments of the method, known small molecules and compound libraries are screened for test candidates that are capable of blocking the pheomelanin-specific pathway and or excessive ROS production in the transgenic mice. Such candidates may protect against melanoma formation in redheads.
[0122] Typically, the dosage of a test candidate to be tested by in vivo in the transgenic mice described can range from O.OOlmg/kg body weight to 5 g/kg body weight. In some embodiments, the
dosage range is from 0.001 mg/kg body weight to lg/kg body weight, from 0.001 mg/kg body weight to 0.5 g/kg body weight, from 0.001 mg/kg body weight to 0.1 g/kg body weight, from 0.001 mg/kg body weight to 50 mg/kg body weight, from 0.001 mg/kg body weight to 25 mg/kg body weight, from 0.001 mg/kg body weight to 10 mg/kg body weight, from 0.001 mg/kg body weight to 5 mg/kg body weight, from 0.001 mg/kg body weight to 1 mg/kg body weight, from 0.001 mg/kg body weight to 0.1 mg/kg body weight, from 0.001 mg/kg body weight to 0.005 mg/kg body weight. Alternatively, in some embodiments of the method, the dosage range is from 0.1 g/kg body weight to 5 g/kg body weight, from 0.5 g/kg body weight to 5 g/kg body weight, from 1 g/kg body weight to 5 g/kg body weight, from 1.5g/kg body weight to 5 g/kg body weight, from 2 g/kg body weight to 5 g/kg body weight, from 2.5 g/kg body weight to 5 g/kg body weight, from 3 g/kg body weight to 5 g/kg body weight, from 3.5 g/kg body weight to 5 g/kg body weight, from 4 g/kg body weight to 5 g/kg body weight, from 4.5 g/kg body weight to 5 g/kg body weight, from 4.8 g/kg body weight to 5 g/kg body weight. In one embodiment, the dose range is from 5 g/kg body weight to 30 g/kg body weight. Alternatively, the dose range will be titrated to maintain serum levels between 5 g/mL and 30 g/mL.
[0123] In some embodiments of the method, the test candidate to be screened is administered once or twice daily, or once every other day for about one, two or three months, or till there are observable melanomas.
[0124] In some embodiments of the method, the test candidate to be screened is administered orally by ingestion. In some embodiments of the method, the therapeutic candidate to be screened is admix into the mouse chow such that the mouse ingest the test candidate ad libitum. For example, the BRAF inhibitor PLX4720 is incorporated into the mouse chow at 2% by weight. Control mouse chow does not have the added PLX4720. Control mouse chow is fed to control transgenic mice.
[0125] The transgenic mice are then monitored for the time of first observable melanomas which would give a measurement of the rate of invasive melanomas development. In other word, the latency period before manifestation of melanomas. The transgenic mice are also then monitored for the number of invasive melanomas occurring during a fixed period of time, e.g., 6 months, 1 year. The transgenic mice are also then monitored for survival time and/or rate over time, e.g., 1 year, 2 years. These transgenic mice are compared to control transgenic mice that have been administered a placebo or control mouse chow.
[0126] The transgenic mice receiving the test candidate are the test transgenic mice. The transgenic mice receiving the placebo or control mouse chow are the control transgenic mice. Ideally, the conditions in which the test transgenic mice and the control transgenic mice are housed and fed etc. are identical or similar except the test transgenic mice are administered the test candidate. In one embodiment, the test transgenic mice and the control transgenic mice are also of the same age. In one embodiment, the test transgenic mice and the control transgenic mice have the same exposure to UV
radiation. In one embodiment, the UV radiation is the usual UV radiation from visible light. In one embodiment, the UV radiation is lOJ/com2 UVA/0.65J/cm2 UVB).
[0127] In other embodiments of the method, transgenic mice are monitored for anywhere up to 6 months for the development of invasive melanoma. In some embodiments of any of the method described, the monitoring period can be 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 35 days, 40 days, 45 days, 50 days, 55 days, 60 days, 65 days, 70 days, 75 days, 80 days, 85 days, 90 days, 95 days, 100 days, 120 days, 150 days, 180 days, 220 days, 260 days, 300 days, 330 days 370 days and 400 days, including all the whole integer number of days from 14 days and 400 days after the start of
administration of the therapeutic candidate to the transgenic mice.
[0128] In some embodiments of the method, the teste candidate tested is determined to be a likely potential therapeutic candidate for further testing when the test candidate reduces the number of invasive melanomas developed in the test transgenic mice by at least two fold compared to the control transgenic mice, increases the survival period of the test transgenic mice by at least two fold compared to the control transgenic mice, and/or reduces the rate of invasive melanomas development in the test transgenic mice by at least two fold compared to the control transgenic mice. In some embodiments of the method, likely potential therapeutic candidates for further testing give longer latency and/or a lower rate of melanomas formation in the test transgenic mice compared to the control transgenic mice. In some embodiments, the longer latency and/or a lower rate of melanomas formation are by at least two fold compared to the control transgenic mice.
[0129] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MC1R gene mutation results in premature termination of the MC1R transcript.
[0130] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MC1R gene mutation is selected from the group consisting of D294H, R151C, and R160W.
[0131] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
[0132] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
[0133] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation is a substitution of the respective amino acid residue of the encoded B-Raf polypeptide at the following locations: L597S, L597Q, L597R, V600M, V600K, V600R, V600E, V600G, V600D, V600E, and K601E.
[0134] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the B-RAF gene mutation is conditionally expressed in melanocytes.
[0135] In any one embodiment of the transgenic mouse, tissue of the transgenic mouse, cultured cells isolated from the transgenic mouse or methods described, the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
[0136] In some embodiments, the present disclosure can be defined in any of the following alphabetized paragraphs:
[A] A transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene.
[B] The transgenic mouse of paragraph [A] , wherein the transgenic mouse exhibits a mutant form of the BRAF protein and an inactivating form of the MCIR protein.
[C] The transgenic mouse of paragraph [A] or [B], wherein the MCIR gene mutation results in a premature termination of the MCIR transcript.
[D] The transgenic mouse of paragraph [A] or [B], wherein the MCIR gene mutation is selected from the group consisting of D294H, R151C, and R160W.
[E] The transgenic mouse of any one of paragraphs [A]-[D], wherein the at least one B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
[F] The transgenic mouse of any one of paragraphs [A]-[E], wherein the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
[G] The transgenic mouse of any one of paragraphs [A]-[F], wherein the B-RAF gene mutation is conditionally expressed in melanocytes.
[H] The transgenic mouse of any one of paragraphs [A]-[G], wherein the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
[I] A tissue of the transgenic mouse of any one of paragraphs [A]-[H].
[J] Cultured cells isolated from the transgenic mouse of any one of paragraphs [A]-[H], wherein the genomes of said cells comprise a mutation of a MCIR gene and a BRAF gene. [K] A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mouse of any one of paragraphs [A]-[H], administering a test candidate to the mouse, and monitoring for a development of melanoma.
[L] A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mice transgenic mouse whose genome comprises a mutation of a MCIR gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring for a development of melanoma.
[M] The method of paragraph [L] , wherein the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MC1R protein,
[N] The method of paragraph [L] or [M], wherein the MC1R gene mutation results in premature termination of the MC1R transcript.
[O] The method of paragraph [L] or [M], wherein the MC1R gene mutation is selected from the group consisting of D294H, R151C, and R160W.
[P] The method of any one of paragraphs [L]-[0], wherein the at least one B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
[Q] The method of any one of paragraphs [L]-[P], wherein the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
[R] The method of any one of paragraphs [L]-[Q], wherein the B-RAF gene mutation is conditionally expressed in melanocytes.
[S] The method of any one of paragraphs [L]-[R], wherein the MC1R gene mutation results in premature termination of the MC1R transcript and wherein the B-RAF gene mutation is V600E.
[0137] This invention is further illustrated by the following example which should not be construed as limiting. The contents of all references cited throughout this application, as well as the figures and table are incorporated herein by reference.
[0138] Those skilled in the art will recognize, or be able to ascertain using not more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
EXAMPLE
[0139] Materials and Methods
[0140] Mice.
[0141] All animals used for breeding were backcrossed a minimum of 6 generations onto the
C57BL/6 genetic background (this corresponds to a >98.4% C57BL/6 congenic animal, (See internet tutorial at website of jaxmice, jax organization). The black (wild type), redhead (Mclrde) and albino (Tyrc/c) animals were purchased from Jackson Laboratories. K14-SCF animals were acquired from T. Kunisada. Genotyping of each litter, including the Tyr-Cre(ER BRafA, and PTEI^→0X alleles was performed as previously published10'11.
[0142] At 6-10 weeks of age the dorsal fur was trimmed using animal shears with a 0.25 mm head and the mice were treated topically with 20 mg/ml tamoxifen for 5 consecutive days. For tumor darkening, a 20% solution of Coleus forskohlii root extract (80 μΜ forskolin) was topically applied daily as previously described17. For in vivo PLX4720 studies, animals were given ad libitum mouse chow containing 2% PLX4720 by weight or control chow acquired from Plexxikon Inc. All studies and
procedures involving animal subjects were approved by the Institutional Animal Care and Use
Committees of Massachusetts General Hospital and Dana-Farber Harvard Cancer Center and were conducted strictly in accordance with the approved animal handling protocol.
[0143] Dissection and histology.
[0144] Tissues of interest were photographed, excised, weighed, rinsed in phosphate -buffered saline (PBS), fixed in 10% neutral-buffered formalin, rinsed in PBS, and stored in 70% ethanol.
Formalin-fixed tissues were paraffin embedded (FFPE) and sectioned (3-5 μιη) using standard procedures. Morphological analysis was performed using multiple independent samples per site/organ (5 to 9 samples per genotype) as well as >6 animals. Two pathologists (JKL, MPH) independently examined the histopathology of the tumor samples. Digitization and image capture was performed using an Olympus DP70 digital camera (Olympus, Tokyo, Japan) connected to an Olympus BX51 light microscope or a Scanscope whole-slide scanning system (Aperio, Vista, CA).
[0145] Immunohistochemistry.
[0146] For immunohistochemistry, sections were deparaffinized with xylene and hydrated with a graded series of alcohol. Sections were boiled in 50 mM TRIS-buffer (pH9) or citrate for antigen retrieval and rinsed in PBS. Sections were blocked in 1% BSA, 0.1% Triton X-100 PBS, incubated with 1 :200 dilutions of rabbit anti-SlOO (Dako), 1 : 100 dilutions of goat anti-DCT (Santa Cruz), 1 :200 dilutions of mouse-anti HMB45 (Santa Cruz) and 1:200 dilutions of mouse-anti gplOO (Abeam) antibodies, followed by visualization with appropriate secondary antibodies conjugated to Alexa594 or Alexa488 (1 :500). Appropriate controls for specificity of staining were included and images were captured using an upright fluorescence microscope (Eclipse 90i, Nikon). To identify epidermal melanocytes, skin from reporter mice carrying the various pigmentation alleles and the K14-SCF transgene as well as a DCT-LacZ reporter allele was cryosectioned and stained with XGal and nuclear fast red counterstaining.
[0147] Primary Cell Culture.
[0148] Tumor cells were digested overnight in 10 mg/ml collagenase and 1 mg/ml hyaluronidase. Initially tumor cells were grown in RPMI media with HEPES and 20% serum.
Subsequently tumor cells were grown in DMEM media with 10% serum. Proliferation after 72 hours of PLX4720 (CHEMIETEK) and U0126 (CELL SIGNALING) was determined by the CELLTITER-GLO Luminescent Cell Viability Assay (PROMEGA).
[0149] Quantitative RT-PCR.
[0150] RNA was harvested from primary cultured tumor cells treated for varying times with forskolin or PLX4720 using the RNeasy Plus mini kit (QIAGEN). mRNA expression of melanocytic markers was determined using intron-spanning mouse- specific primers with Kapa SYBR FAST qPCR master mix (KAPA BIOSYSTEMS). Expression was normalized to 18s rRNA and 0 hour time-points. Primer sequences used:
Mitf fwd GCCTGAAACCTTGCTATGCTGGAA, (SEQ ID NO: 1)
Mitf rev- AAGGTACTGCTTTACCTGGTGCCT, (SEQ ID NO:2 )
Dct fwd- AGGTACCATCTGTTGTGGCTGGAA, (SEQ ID NO:3 )
Dct rev- AGTTCCGACTAATCAGCGTTGGGT, (SEQ ID NO: 4)
Tyrpl fwd-TGGGGATGTGGATTTCTCTC, (SEQ ID NO:5)
Tyrpl rev- AGGGAGAAAGAAGGCTCCTG, (SEQ ID NO: 6)
18s fwd- AGGTTCTGGCCAACGGTCTAG, (SEQ ID NO: 7)
18s rev- CCCTCTATGGGC AATTTT, (SEQ ID NO: 9).
[0151] Cyclopurine quantification
[0152] Extraction of nuclear DNA from mouse skin tissues. Nuclear DNA was isolated from mouse skin using a high-salt method. Tissues were ground under liquid nitrogen into fine powder using a mortar and pestle. A nuclei lysis buffer containing 20 mM Tris (pH 8.3), 20 mM EDTA, 400 mM NaCl, 1% SDS (w/v) and 0.05% proteinase K (w/v) was added to the tissue and incubated in a water bath at 55°C overnight. Half volume of saturated NaCl solution was added to the digestion mixture, incubated at 55 °C for 15 min then centrifuged at -10,000 rpm for 30 min. The supernatant was collected and centrifuged again. The nucleic acids in the supernatant were precipitated with cold ethanol, dissolved in water and incubated in the presence of 0.03% RNase A (w/v) and 0.25 U/μΕ of RNase Tl at 37°C overnight, and subsequently extracted with an equal volume of chloroform isoamyl alcohol (24: 1, v/v) twice. The DNA was then precipitated from the aqueous layer by cold ethanol, centrifuged at 8,000 rpm at 4°C for 15 min, washed twice with 70% cold ethanol and dried under vacuum. The DNA pellet was dissolved in deionized water and quantified by using ultraviolet absorption spectrophotometry.
[0153] Enzymatic digestion of nuclear DNA.
[0154] Nuclease PI (16 U), phosphodiesterase 2 (0.025 U), 20 nmol of EHNA and a 30-μΕ solution containing 300 mM sodium acetate (pH 5.6) and 10 mM zinc chloride were added to 200 μg of DNA. In this context, EHNA served as an inhibitor for deamination of 2' -deoxy adenosine to 2'- deoxyinosine (dl) induced by adenine deaminase. The above digestion was continued at 37°C for 48 h. To the digestion mixture were then added alkaline phosphatase (10 U), phosphodiesterase 1 (0.0125 U) and 60 μΕ of 0.5 M Tris-HCl buffer (pH 8.9). The digestion was continued at 37°C for 2 h and subsequently neutralized by addition of formic acid. To the mixture were then added uniformly 15N- labeled standard lesions, which included 400 fmol of R-cdG, 150 fmol of 5-cdG, 80 fmol of R-cdA and 40 fmol of 5-cdA. The enzymes in the digestion mixture were subsequently removed by chloroform extraction twice. The resulting aqueous layer was subjected to off-line high-performance liquid chromatography (HPLC) separation for the enrichment of the lesions under study, following our previously described procedures26.
[0155] LC-MS/MS/MS Analysis.
[0156] The LC-MS/MS/MS experiments were conducted using an LTQ linear ion trap mass spectrometer using our recently described conditions26. Briefly, the amounts of cdA and cdG lesions in each nucleoside sample were calculated based on the ratios of peak areas found in the selected-ion chromatograms for the analyte (e.g., the 23.5 min peak in the top panel of Fig. 4d for 5-cdA) and the corresponding stable isotope-labeled standard (e.g., the 23.4 min peak in the bottom panel of Fig. 4d for the 15N-labeled 5-cdA), the known amount of uniformly 15N-labeled standard added to the nucleoside mixture (e.g., 40 fmol for 5-cdA), and calibration curves. The calibration curves were constructed from the same LC-MS/MS/MS analyses of a series of mixtures with known compositions of the unlabeled cdA, cdG and constant amounts of the corresponding uniformly 15N-labeled standards, as described previously26. The lesion formation frequencies as shown in Fig. 4e were then calculated by dividing the amounts of cdA and cdG in the sample with the total amount of nucleosides present.
[0157] Skin irradiation and lipid peroxide measurement.
[0158] 6-week old mice were euthanized and fur was removed using animal shears with a 0.25 mm head. Twelve sections of skin, each with an area of 1 cm2, were removed from each mouse and placed in 35mm dishes on ice after adherence to WHATMAN filter paper suspended in PBS. For each UV and visible light study, 6 sections of skin from each mouse were placed in the dark on ice as controls. For UV studies, 6 sections of skin from each mouse were irradiated on ice with 10 J/cm2 UVA and 0.65J/cm2 UVB at an irradiance of 6.67 mW/cm2 using a Sylvania 350 Blacklight (Osram Sylvania). This UV distribution is comparable to natural sunlight (96.65% UVA & 3.35% UVB). Two mice of each pigmentation type were used for a total of n=12 skin samples for each condition. For visible light studies, 6 sections of skin from each mouse were irradiated on ice with 180 J/cm2 visible light from a Dolan- Jenner A3200 Fiber-Lite Illuminator at an irradiance of 200 mW/cm2. The illuminator bulb was fit with a Thorlabs FEL0400 Edgepass UV filter with a transmission of <0.001% for wavelengths <400 nm, such that no irradiation output was detectable in the UV range below 400 nm. One mouse of each
pigmentation type was used for a total of 6 skin samples for each condition. Following treatment, skin sections were flash frozen and homogenized in PBS containing the antioxidant butylated hydroxy toluene (BHT) to prevent further lipid peroxidation, using a QIAGEN TISSUELYSER II. Homogenized samples were centrifuged and supernatants were collected. Protein content of each sample was determined by Coomassie Plus Protein Assay, and samples were diluted with PBS+BHT for normalization of sample concentration (THERMO SCIENTIFIC). Lipid peroxidation of each irradiated set of sample was determined using an OxiSelect TBARS Assay Kit and normalized to its unirradiated control (CELL BIOLABS).
[0159] Results
[0160] To study the role of pigmentation in BRafv600E melanoma development, the inventors utilized a series of genetically matched mice on the C57BL/6 background with various pigmentation phenotypes (Fig. la). To mimic dark-skinned individuals with a high eumelanin-to-pheomelanin ratio,
we used mice with the wild type C57BL/6 pigmentation phenotype ("black"). To mimic individuals with the redhead phenotype who carry a high pheomelanin-to-eumelanin ratio, we used mice with premature termination of the Mclr transcript (Mclre/e, redhead)8. To mimic individuals with albinism who have no melanin, mice with an inactivating mutation at the Tyrosinase locus (Tyrc/c, "albino") were used9. Since tyrosinase is the initial and rate -limiting enzyme in melanin synthesis, albino melanocytes do not produce any pigment, but are normal in number and viability10.
[0161] The inventors generated two variants of each pigmentation phenotype. One variant
("normal mouse") contains melanocytes in the dermis. A second matched variant ("humanized mouse") contains transgenic Stem Cell Factor expressed under the keratin 14 promoter ("K14-SCF"), which mimics SCF expression in human epidermal keratinocytes and results in epidermal melanocyte localization11.
[0162] To create a genetic context primed for the induction of melanoma we also introduced into each of the 6 variant mouse produced, a previously published system for inducible, melanocyte - specific expression of oncogenic BRaf™12. In humans, mice and zebrafish, expression of BRafV600E in melanocytes primarily causes benign nevi, rather than melanoma12"15. In this context, malignant melanoma progression is thought to be constrained by oncogene -induced senescence15. Consistent with this, expression of BRAFV600E in conjunction with silencing of PTEN, TP53 or CDKN2A leads to development of malignant melanoma12"14. Spontaneous progression of BRafv600E-expressing melanocytes to malignant melanoma has been reported, however, following a long latency period in C57BL/6 mice, though this phenomenon was not seen on an outbred model12'16'17.
[0163] The inventors initially produced 6 groups of BRafv600E inducible
mice representing 3 pigmentation variants ("black," "redhead," and "albino") with or without epidermal melanocytes (+/- transgenic K14-SCF, Fig. lb). Melanocyte-selective expression of BRafv600E was achieved by topical tamoxifen activation of estrogen-receptor fused Cre recombinase (Tyr-Cre(ER)T2) in 6-10 week old mice carrying the BRafA allele. The animals were then followed without environmental genotoxic stressors (such as UV). Black and albino BRafCA mice developed similarly low rates of melanoma after a long latency (regardless of K14-SCF status). In contrast, redhead BRaf mice developed melanomas at an accelerated rate with >50 having tumors after one year, regardless of K14- SCF status (Fig. lc and Id). The observation that mice of multiple pigmentation phenotypes can develop melanoma in the context of activation of a single oncogene is consistent with a recently published paper investigating the effect of UV radiation on a mouse model over-expressing hepatocyte growth factor (HGF). Unlike the HGF model, the present study did not find a significant difference in melanoma rates between black and albino animals, but this discrepancy may be due to the fact that the BRAF models were not exposed to UV radiation18.
[0164] In all three pigmentation contexts the tumors were grossly amelanotic and largely on the dorsal trunk of the mice (within the tamoxifen-treated areas). Occasionally, a tumor would develop on the
ventral trunk, tail or paw, which may reflect a predictable spread of tamoxifen secondary to grooming. (Fig. 2a, 2b and 2c). The tumors, which were primarily dermal, were mostly amelanotic in the redhead background, whereas melanomas in black mice exhibited some superficial pigmentation adjacent to the epidermis. Regardless of pigmentation background, the tumors were histologically similar with spindle cell features which were not easily distinguishable from tumors on C57BL/6 BRaf:A-Ptenfloxflox animals generated in parallel (Fig. 2 vs. Fig. 5). Upon closer examination, occasional redhead-BRafv600E tumor cells were found to contain melanin (Fig. 2g and at higher magnification, 2h). It was further possible to increase pigmentation in the most superficial melanoma cells with topical application of forskolin, an adenylate cyclase agonist known to MClRulate skin pigmentation19 (Fig. 2i). The limited extent of pigmentation is likely related to forskolin' s poor tissue penetration, but nonetheless demonstrates the ability of the melanoma cells to become hyper-pigmented in vivo upon stimulation of cAMP signaling.
[0165] Tumors on all three pigmentation backgrounds stained positively for S100, a standard immunohistochemical melanoma marker (Fig. 2j). In addition, RT-PCR revealed that the tumors consistently express the melanocytic pigment genes M-Mitf, Dct, Tyrpl, and Tyr (Fig 3a, d and data not shown) although immunohistochemical staining for Dct and Mitf were weak or negative, likely because of low-level expression (data not shown). In addition, occasional Hmb45+ cells could be found by immunofluorescence (data not shown). The tumors on all three pigmentation backgrounds were aggressive and locally invasive to fat and skeletal muscle with active mitoses. While no gross visceral organ metastases were observed, small clusters of cells expressing gplOO, the premelanosome-associated glycoprotein (Pmel/Gpl00/Hmb45), could be found in skin draining lymph nodes (Fig. 2k).
[0166] Utilizing a primary cell line derived from one of the redhead (BRaf^^- cir^) melanomas, the inventors observed that forskolin upregulated the expression of the melanocyte-specific isoform of Mitf (M-Mitf), and produced a dramatic increase in expression of the Dct and Tyrpl pigment genes, consistent with the ability of the cells to respond to melanocytic differentiation signals (Fig. 3a).
[0167] To determine if the redhead-derived melanomas were dependent on the presumed oncogenic driver BRafv600E, the inventors tested their response to small molecule inhibitors of BRAF or MEK. Treatment with the oncogenic BRAF inhibitor, PLX4720, or the MEK inhibitor, U0126, prevented melanoma cell proliferation in vitro, and PLX4720 blocked tumor cell growth in vivo, consistent with a dependency of these tumors on the BRafv600E oncoprotein (Fig. 3b and 3c). BRaf inhibition also elevated the expression of melanocytic genes as previously reported in human melanomas (Fig. 3d)20.
[0168] Since inactivating mutations in Mclr alter cAMP levels in the cell, redhead mice undoubtedly have numerous intracellular pathway differences relative to wildtype MclrE/E (black) animals. For example, prior studies have demonstrated diminished DNA repair capacity, downstream of MC1R variants21'22. The inventors therefore wished to study whether the pheomelanin pigment pathway itself plays an intrinsic mechanistic role, or whether it is merely a marker of melanoma risk. To investigate this question we introduced the albino tyrosinase (Tyrc/c) allele into the redhead Mclre/e
genetic background to test melanoma incidence in albino-Mclr e animals, which retain low Mclr activity and also lack all pigment production (Fig. 4a). A melanocyte-targeted LacZ transgene was used to confirm that the albino allele does not alter melanocyte number in these mice (Fig. 6a and 6b)10. As shown in Figure 4b, the albino allele profoundly protected redhead mice from melanoma. The rare albino-Mc lre/e melanomas occurred after long latency and exhibited the same amelanotic, S100+, histologic features as the other pigmentation variant BRaf ^ mice (Fig. 7a, 7b and 7c). This observation indicates that the pheomelanin synthesis pathway is necessary for the high rate of UV-independent melanoma in the redhead context.
[0169] Prior studies have demonstrated that UV radiation amplifies ROS production and the subsequent incidence of oxidative DNA damage in the skin of pigmented mice18. UV radiated cells with high pheomelanin levels have been found to carry particularly high levels of oxidative damage4'5.
Pheomelanin or its synthetic intermediates might also elevate ROS independently of UV exposure. For example, the sulfur-containing aromatic rings in pheomelanin (which are absent in eumelanin) may propagate the ROS produced as a normal by-product of metabolism and pigment synthesis23. Since darkly pigmented individuals carry both pheomelanin and eumelanin, it has been hypothesized that their lower melanoma risk may result from eumelanin intermediates and polymers absorbing ROS and functioning as in vivo antioxidants. A predominantly pheomelanotic cell would lack these antioxidants and be prone to higher levels of oxidative damage24'25.
[0170] To determine if ROS-mediated oxidative DNA damage is affected by the pheomelanin synthesis pathway, levels of 8,5 '-cyclo-2'-deoxy adenosine (cdA) and 8,5'-cyclo-2'-deoxyguanosine (cdG) were measured in DNA isolated from skin of redhead- cire/e and albino-Mc lre/e mice, using a previously reported LC -tandem mass spectrometric method26 (Fig. 4c). These two cyclopurines are typically produced by ROS and are quite stable27'28. Additionally, because their formation is inhibited under aerobic conditions, these lesions are unlikely to be artificially induced during DNA isolation and sample preparation, making them excellent markers for oxidative stress 28. Significantly, replication studies in E. coli have shown that S-cdA and S-cdG can lead to A to T and G to A mutations at frequencies of 11% and 20%, respectively29. Comparing cyclopurine levels in the skin from various pigmentation variant mice, it was found that the levels of both diastereomers of cdA and cdG are significantly higher in redhead- cire/e as compared to albino- cire/e skin (Fig. 4d-4e). This observation indicates that activation of the pheomelanin synthesis pathway results in increased oxidative DNA damage. Correlative evidence for increased cellular oxidative stress was also found in the observation that redhead- cire/e mouse skin also carries higher levels of lipid peroxides, a product of ROS -mediate lipid damage (Fig 4f).
[0171] The findings reported here indicate that in the context of oncogenic BRAF activation, individuals carrying redhead MC1R polymorphisms have an increased risk of melanoma, due to both poor protection from environmental carcinogens like UV radiation, and also via intrinsic carcinogenic
features of pheomelanin synthesis; potentially via pheomelanin itself, an intermediate of pigment synthesis or a by-product of the pathway.
[0172] In humans, there are multiple MC1R polymorphisms with varied perturbation of receptor function that produce a redhead phenotype, however, a unifying feature of these various polymorphisms is a high pheomelanin to eumelanin ratio, which is also produced by the Mclre/e allele in mouse. Since black mice carry both pheomelanin and eumelanin and yet are relatively protected against melanoma development, pheomelanin within the context of abundant eumelanin is likely to be significantly less toxic, perhaps via quenching of ROS by eumelanin. Studies by Ito et al have found that the reaction kinetics of pigment synthesis initially generates only pheomelanin, until the sulfhydryl donors within melanosomes are depleted. Subsequently if the pathway is adequately activated, eumelanin is produced. The implication of this work may be that eumelanin surrounds pheomelanin in the melanosome thereby dampening its potential toxic effects30. It will be of interest to determine whether topical forskolin, which induces eumelanin synthesis in redhead mouse may alter the melanoma risk in this model19. Of particular interest will be future studies investigating the role of UV in the context of our BRAF(V600E) pigmentation variants. Recent data from Noonan et al intriguingly demonstrated that UV irradiated black animals over-expressing HGF are at higher risk of melanoma than their albino counterparts18. While the present study revealed a small difference between black and albino BRAF(V600E) driven melanomas in the presence of K14-SCF (Fig Id), the effect did not reach statistical significance (p=0.1455). It seems likely that the effects of pigmentation and UV radiation are likely to synergize and exacerbate melanoma risk.
[0173] The photometer used for our lab's routine calibration (International Light 1400) was unable to detect any measurable UV radiation in our mouse cages during ambient light exposure. Thus if UV radiation were contributing to the carcinogenic effects seen, the redhead phenotype would have exhibited a sensitivity profoundly more severe than previously suspected for UV exposure. However, strong epidemiological work, including the typical localization of MClRe/e melanoma to intermittently sun-exposed skin, links UV radiation to melanoma, and the current data do not diminish the importance of sun exposure as a key contributing factor to melanoma risk1. In humans, it is likely the UV- independent effects are acting in concert with UV-mediated cellular toxicity. In agreement with published studies, UV radiation at a UVA/UVB ratio similar to that found in sunlight (10J/cm2 UVA and 0.65J/cm2 UVB) was found to exacerbate oxidative damage selectively in redhead mouse skin as measured by levels of lipid peroxidation4'5 (Fig. 8a). Studies are underway to investigate whether UV radiation is able to alter the redhead-BRaiV 600E tumor phenotype. A recent paper has suggested that visible light is also able to induce ROS in skin31. Preliminary studies examining the effect of a similar high intensity dose of visible light (180J/cm2) as used in this paper, did not significantly alter lipid peroxidation levels in any pigmentation context (p=0.4506). Perhaps, however, there is a trend towards an increased level of lipid peroxidation in the redhead skin (Fig. 8b).
[0174] Further evidence suggesting a UV-independent redhead melanoma risk is the observation that while darker-skinned individuals have a significantly lower risk of melanoma than lighter-skinned individuals, the sun protective factor (SPF, a measurement of sunburn protection) of darker skin has been eMClRated at only in the range of SPF 2.0-4.032. In addition, sunscreen (typically SPF 20-40) has exhibited weak efficacy in protecting against melanoma, unlike its protection against cutaneous squamous cell carcinoma33'34. There are numerous potential explanations for the sunscreen-melanoma data, including insufficient follow-up, inadequate UVA shielding, and insufficient topical applications. However it is also possible that UV shielding may protect against only one of several carcinogenic mechanisms— with the intrinsic pheomelanin pathway representing another contributor to
melanomagenesis via UV-independent means. While UV shielding remains extremely important for skin cancer prevention, its role in specifically protecting against melanoma may be only partial. Additional preventative strategies may be essential to optimally diminish melanoma risk in the most susceptible individuals.
[0175] The references cited herein and throughout the specification are incorporated herein by reference.
References
1. Rhodes, A. R., Weinstock, M. A., Fitzpatrick, T. B., Mihm, M. C. J. & Sober, A. J. Risk factors for cutaneous melanoma. A practical method of recognizing predisposed individuals. JAMA 258, 3146- 3154 (1987).
2. Valverde, P., Healy, E., Jackson, I., Rees, J. L. & Thody, A. J. Variants of the melanocyte- MClRulating hormone receptor gene are associated with red hair and fair skin in humans. Nat. Genet. 11, 328-330 (1995).
3. Rouzaud, F., Kadekaro, A. L., Abdel-Malek, Z. A. & Hearing, V. J. MC1R and the response of melanocytes to ultraviolet radiation. Mutation research 571, 133-152 (2005).
4. Wenczl, E. et al. (Pheo)melanin photosensitizes UVA-induced DNA damage in cultured human melanocytes. J Invest Dermatol 111, 678-682 (1998).
5. Hill, H. Z. & Hill, G. J. UVA, pheomelanin and the carcinogenesis of melanoma. Pigment Cell Res 13 Suppl 8, 140-144 (2000).
6. Curtin, J. A. et al. Distinct sets of genetic alterations in melanoma. N Engl J Med 353, 2135- 2147 (2005).
7. Elwood, J. M. & Jopson, J. Melanoma and sun exposure: an overview of published studies. International Journal of Cancer 73, 198-203 (1997).
8. Robbins, L. S. et al. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72, 827-834 (1993).
9. Halaban, R. et al. Tyrosinases of murine melanocytes with mutations at the albino locus. Proc Natl Acad Sci U S A 85, 7241-7245 (1988).
10. Vanover, J. C. et al. Stem cell factor rescues tyrosinase expression and pigmentation in discreet anatomic locations in albino mice. Pigment cell & melanoma research 22, 827-838 (2009).
11. Kunisada, T. et al. Murine cutaneous mastocytosis and epidermal melanocytosis induced by keratinocyte expression of transgenic stem cell factor. J Exp Med 187, 1565-1573 (1998).
12. Dankort, D. et al. Braf(V600E) cooperates with Pten loss to induce metastatic melanoma. Nat. Genet. 41, 544-552 (2009).
13. Patton, E. E. et al. BRAF mutations are sufficient to promote nevi formation and cooperate with p53 in the genesis of melanoma. Curr Biol 15, 249-254 (2005).
14. Goel, V. K. et al. Melanocytic nevus-like hyperplasia and melanoma in transgenic BRAFV600E mice. Oncogene 28, 2289-2298 (2009).
15. Michaloglou, C. et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-724 (2005).
16. Dhomen, N. et al. Oncogenic Braf induces melanocyte senescence and melanoma in mice.
Cancer Cell 15, 294-303 (2009).
17. Rae, J. et al. (V600E)Braf: :Tyr-CreERT2: :K14-Kitl Mice Do Not Develop Superficial
Spreading-Like Melanoma: Keratinocyte Kit Ligand Is Insufficient to "Translocate" (V600E)Braf -Driven Melanoma to the Epidermis. Journal of Investigative Dermatology 132, 488-491
18. Noonan, F. P. et al. Melanoma induction by ultraviolet A but not ultraviolet B radiation requires melanin pigment. Nat Commun 3, 884 (2012).
19. D'Orazio, J. A. et al. Topical drug rescue strategy and skin protection based on the role of Mclr in UV-induced tanning. Nature 443, 340-344 (2006).
20. Boni, A. et al. Selective BRAFV600E inhibition enhances T-cell recognition of melanoma without affecting lymphocyte function. Cancer Research 70, 5213-5219
21. Kadekaro, A. L. et al. Melanocortin 1 receptor genotype: an important determinant of the damage response of melanocytes to ultraviolet radiation. The FASEB Journal 24, 3850-3860
22. Landi, M. T. et al. MC1R, ASIP, and DNA repair in sporadic and familial melanoma in a Mediterranean population. JNCI Journal of the National Cancer Institute 97, 998-1007 (2005).
23. Samokhvalov, A. Heterogeneous photocatalytic reactions of sulfur aromatic compounds.
Chemphyschem 12, 2870-2885
24. Nofsinger, J. B., Liu, Y. & Simon, J. D. Aggregation of eumelanin mitigates photogeneration of reactive oxygen species. Free Radical Biology and Medicine 32, 720-730 (2002).
25. Kovacs, D. et al. The Eumelanin Intermediate 5,6-Dihydroxyindole-2-Carboxylic Acid Is a Messenger in the Cross-Talk among Epidermal Cells. Journal of Investigative Dermatology
doi: 10.1038/jid.2011.457
26. Wang, J. et al. Quantification of Oxidative DNA Lesions in Tissues of Long-Evans Cinnamon Rats by Capillary High-Performance Liquid Chromatography-Tandem Mass Spectrometry Coupled with Stable Isotope-Dilution Method. Analytical Chemistry 83, 2201-2209 (2011).
27. Wang, Y. Bulky DNA lesions induced by reactive oxygen species. Chemical research in toxicology 21, 276-281 (2008).
28. Jaruga, P. & Dizdaroglu, M. 8,5'-Cyclopurine-2'-deoxynucleosides in DNA: Mechanisms of formation, measurement, repair and biological effects. DNA Repair 7, 1413-1425 (2008).
29. Yuan, B., Wang, J., Cao, H., Sun, R. & Wang, Y. High-throughput analysis of the mutagenic and cytotoxic properties of DNA lesions by next-generation sequencing. Nucleic Acids Research 39, 5945- 5954 (2011).
30. Ito, S. & Wakamatsu, K. Chemistry of mixed melanogenesis— pivotal roles of dopaquinone. Photochem. Photobiol. 84, 582-592 (2008).
31. Liebel, F., Kaur, S., Ruvolo, E., Kollias, N. & Southall, M. D. Irradiation of skin with visible light induces reactive oxygen species and matrix-degrading enzymes. Journal of Investigative
Dermatology 132, 1901-1907 (2012).
32. Neugut, A. I., Kizelnik-Freilich, S. & Ackerman, C. Black-white differences in risk for cutaneous, ocular, and visceral melanomas. Am J Public Health 84, 1828-1829 (1994).
33. Green, A. C, Williams, G. M., Logan, V. & Strutton, G. M. Reduced melanoma after regular sunscreen use: randomized trial follow-up. Journal of Clinical Oncology 29, 257-263
34. Huncharek, M. & Kupelnick, B. Use of topical sunscreens and the risk of malignant melanoma: a meta-analysis of 9067 patients from 11 case-control studies. Am J Public Health 92, 1173-1177 (2002).
Claims
1. A transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B- RAF gene.
2. The transgenic mouse of claim 1 , wherein the transgenic mouse exhibits a mutant form of the BRAF protein and an inactivating form of the MC1R protein.
3. The transgenic mouse of claim 1 or 2, wherein the MC1R gene mutation results in a premature termination of the MC1R transcript.
4. The transgenic mouse of claim 1 or 2, wherein the MC1R gene mutation is selected from the group consisting of D294H, R151C, and R160W.
5. The transgenic mouse of any one of claims 1-4, wherein the at least one B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
6. The transgenic mouse of any one of claims 1-5, wherein the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
7. The transgenic mouse of any one of claims 1-6, wherein the B-RAF gene mutation is
conditionally expressed in melanocytes.
8. The transgenic mouse of any one of claims 1-7, wherein the MC1R gene mutation results in premature termination of the MC1R transcript and wherein the B-RAF gene mutation is V600E.
9. A tissue of the transgenic mouse of any one of claims 1-8.
10. Cultured cells isolated from the transgenic mouse of any one of claims 1-8, wherein the genomes of said cells comprise a mutation of a MC1R gene and a BRAF gene.
11. A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mouse of any one of claims 1-8, administering a test candidate to the mouse, and monitoring for a development of melanoma.
12. A method of screening and identifying test candidates for the treatment of melanoma comprising providing a transgenic mice transgenic mouse whose genome comprises a mutation of a MC1R gene and a mutation of a B-RAF gene, administering a test candidate to the mouse, and monitoring for a development of melanoma.
13. The method of claim 12, wherein the transgenic mouse exhibits a mutant form of a BRAF protein and an inactivating for a MCIR protein,
14. The method of claim 12 or 13, wherein the MCIR gene mutation results in premature
termination of the MCIR transcript.
15. The method of claim 12 or 13, wherein the MCIR gene mutation is selected from the group consisting of D294H, R151C, and R160W.
16. The method of any one of claims 12-15, wherein the at least one B-RAF gene mutation is a substitution of valine at the 600 amino acid residue of the encoded B-Raf polypeptide.
17. The method of any one of claims 12-16, wherein the B-RAF gene mutation selected from the group consisting of V600E, V600D, V600K and V600R.
18. The method of any one of claims 12-17, wherein the B-RAF gene mutation is conditionally expressed in melanocytes.
19. The method of any one of claims 12-18, wherein the MCIR gene mutation results in premature termination of the MCIR transcript and wherein the B-RAF gene mutation is V600E.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/428,520 US20150245596A1 (en) | 2012-09-17 | 2013-09-17 | Melanocortin receptor mutant mouse and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261701767P | 2012-09-17 | 2012-09-17 | |
| US61/701,767 | 2012-09-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014043700A1 true WO2014043700A1 (en) | 2014-03-20 |
Family
ID=50278766
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/060163 Ceased WO2014043700A1 (en) | 2012-09-17 | 2013-09-17 | Melanocortin receptor mutant mouse and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20150245596A1 (en) |
| WO (1) | WO2014043700A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2572569C1 (en) * | 2014-11-27 | 2016-01-20 | Федеральное государственное бюджетное научное учреждение "Российский онкологический научный центр имени Н.Н. Блохина" (ФГБНУ "РОНЦ им. Н.Н. Блохина") | METHOD OF PRODUCTION OF SUBDERMAL XENOGRAFTS OF CELL LINE OF PEOPLE SKIN MELANOMA mel Cher WITH MUTATION V600E BRAF FOR PRECLINICAL STUDY OF ANTINEOPLASTIC TARGETED AGENTS |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114276999A (en) * | 2022-03-03 | 2022-04-05 | 中日友好医院(中日友好临床医学研究所) | Melanoma cell strain and preparation method thereof |
-
2013
- 2013-09-17 WO PCT/US2013/060163 patent/WO2014043700A1/en not_active Ceased
- 2013-09-17 US US14/428,520 patent/US20150245596A1/en not_active Abandoned
Non-Patent Citations (3)
| Title |
|---|
| DANKORT DAVID ET AL.: "BraV600E cooperates with Pten loss to induce metastatic melanoma.", NATURE GENETICS, vol. 41, no. 5, 2009, pages 544 - 552 * |
| FARGNOLI MARIA CONCETIA ET AL.: "MCIR Variants Increase Risk of Melanomas Harboring BRAF Mutations", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 128, 2008, pages 2485 - 2490 * |
| HACKER ELKE ET AL.: "Germline MCIR Variants and BRAF Mutant Melanoma", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 128, 2008, pages 2354 - 2356 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2572569C1 (en) * | 2014-11-27 | 2016-01-20 | Федеральное государственное бюджетное научное учреждение "Российский онкологический научный центр имени Н.Н. Блохина" (ФГБНУ "РОНЦ им. Н.Н. Блохина") | METHOD OF PRODUCTION OF SUBDERMAL XENOGRAFTS OF CELL LINE OF PEOPLE SKIN MELANOMA mel Cher WITH MUTATION V600E BRAF FOR PRECLINICAL STUDY OF ANTINEOPLASTIC TARGETED AGENTS |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150245596A1 (en) | 2015-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mitra et al. | An ultraviolet-radiation-independent pathway to melanoma carcinogenesis in the red hair/fair skin background | |
| Bang et al. | Protease-activated receptor 2 induces ROS-mediated inflammation through Akt-mediated NF-κB and FoxO6 modulation during skin photoaging | |
| Nguyen et al. | MITF and UV responses in skin: From pigmentation to addiction | |
| Favaro et al. | DRP1-mediated mitochondrial shape controls calcium homeostasis and muscle mass | |
| Slominski et al. | Functional activity of serotoninergic and melatoninergic systems expressed in the skin | |
| Mecklenburg et al. | Learning from nudity: lessons from the nude phenotype | |
| Nasti et al. | MC 1R, Eumelanin and Pheomelanin: Their role in determining the susceptibility to skin cancer | |
| Abdel-Malek et al. | Melanocortins and the melanocortin 1 receptor, moving translationally towards melanoma prevention | |
| Zhao et al. | Sestrin2 protein positively regulates AKT enzyme signaling and survival in human squamous cell carcinoma and melanoma cells | |
| US9290489B2 (en) | Activation of TRPV4 ion channel by physical stimuli and critical role for TRPV4 in organ-specific inflammation and itch | |
| Koikov et al. | Development of hMC1R selective small agonists for sunless tanning and prevention of genotoxicity of UV in melanocytes | |
| Yoo et al. | CRTC3, a sensor and key regulator for melanogenesis, as a tunable therapeutic target for pigmentary disorders | |
| Fuerst et al. | DNp73-induced degradation of tyrosinase links depigmentation with EMT-driven melanoma progression | |
| WO2016028325A1 (en) | Trpa1 and trpv4 inhibitors and methods of using the same for organ-specific inflammation and itch | |
| Pandolfi et al. | Hedgehog-Gli signaling in basal cell carcinoma and other skin cancers: prospects for therapy | |
| Carpenter et al. | Thioredoxin reductase 1 modulates pigmentation and photobiology of murine melanocytes in vivo | |
| Liu et al. | Proopiomelanocortin gene delivery induces apoptosis in melanoma through NADPH oxidase 4-mediated ROS generation | |
| US20150245596A1 (en) | Melanocortin receptor mutant mouse and uses thereof | |
| Benjamin et al. | Models and mechanisms in malignant melanoma | |
| US11229628B2 (en) | TRPA1 and TRPV4 inhibitors and methods of using the same for organ-specific inflammation and itch | |
| Byun et al. | Daily variation of D2 dopamine receptor transcription in the brain of the Japanese eel Anguilla japonica and its regulation with dopamine and melatonin | |
| Galeotti et al. | Protective role of MnSOD and redox regulation of neuronal cell survival | |
| US20080070836A1 (en) | Emt-Inducing Agents | |
| US20240307283A1 (en) | Compositions and methods for decreasing pigmentation | |
| Schaffer et al. | The Biology of the Melanocyte |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13838012 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14428520 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13838012 Country of ref document: EP Kind code of ref document: A1 |