WO2014037574A1 - Methods for reprogramming a somatic cell - Google Patents
Methods for reprogramming a somatic cell Download PDFInfo
- Publication number
- WO2014037574A1 WO2014037574A1 PCT/EP2013/068678 EP2013068678W WO2014037574A1 WO 2014037574 A1 WO2014037574 A1 WO 2014037574A1 EP 2013068678 W EP2013068678 W EP 2013068678W WO 2014037574 A1 WO2014037574 A1 WO 2014037574A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- hsa
- seq
- cell
- reprogramming
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/602—Sox-2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/603—Oct-3/4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/604—Klf-4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/606—Transcription factors c-Myc
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/65—MicroRNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the invention relates to methods for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA.
- the invention also relates to methods for reprogramming a somatic cell comprising the step of exposing the cell to a miRNA and one, two or more reprogramming factors.
- iPSCs induced pluripotent stem cells
- miPSCs Mouse induced pluripotent stem cells colonies were initially selected based on the neomycin resistance provided by the reactivation of the Fbx15 promoter (Takahashi and Yamanaka). Although these miPSCs contributed to all three germ layers after injection into blastocysts, no live chimeric mice were obtained, probably due to the incomplete reprogramming of the miPSCs (Takahashi and Yamanaka).
- Somatic cells from these mice can be reprogrammed by the addition of doxycycline only, and are easily traceable by the re-expression of a green fluorescent protein (GFP) gene driven by the NANOG or OCT4 gene promoters, yielding reprogramming efficiencies 15 to 50-fold greater than those observed in traditional protocols (Wernig et al., 2008, Nat. Biotechnol. 26: 916-24).
- GFP green fluorescent protein
- Mouse embryonic fibroblasts (MEFs) isolated from these transgenic mice could generate "secondary" GFP-positive miPSC only when the missing factor was re-introduced.
- MEFs Mouse embryonic fibroblasts isolated from these transgenic mice
- Id Mouse induced pluripotent stem cells (miPSCs) colonies were initially selected based on the neomycin resistance provided by the reactivation of the Fbx15 promoter (Takahashi and Yamanaka).
- These systems have greatly facilitated the characterization of the reprogramming process and have provided an invaluable tool for genetic or chemical screenings for functional substitutes of reprogramming factors with traceable fluorescent markers.
- similar reporter systems in human cells have not been generated due to the challenge in modifying genetically human pluripotent cells.
- the inventors previously developed a human reporter system based on the expression of a GFP gene driven by the endogenous OCT4 promoter to follow early events of cell reprogramming (Ruiz et al., 201 1 , Curr. Biol. 21 (1 ): 45-52).
- the inventors also reported a differentiated knock-in OCT4 GFP human H1 embryonic stem cell line (Zwaka and Thomson, 2003, Nat. Biotechnol. 21 (3): 319-21 ) into a fibroblast-like population of cells (dFib-OCT4 GFP ) (Ruiz et al.).
- the inventors verified that the population of dFib-OCT4 GFP cells displayed the expected morphology and expressed fibroblast markers at a similar level to what is observed in human fibroblasts (Ruiz et al.). Moreover, it was determined that these cells no longer expressed GFP, due to silencing by methylation of the OCT4 promoter, or several pluripotent markers detected in the H1 -OCT4 GFP cell line.
- miRNAs are 22 nucleotide non-coding RNAs that regulate the expression of downstream targets by mRNA destabilization and translational inhibition (Bartel, 2009, Cell 136(2): 215-33). Most mRNA-miRNA targeting occurs through incomplete nucleotide complementation between a short sequence located in the 5' region of the miRNA (the "seed sequence") and its mRNA target. A single miRNA can target hundreds of different mRNAs and multiple pathways that make them powerful regulators of cell function.
- miRNAs have emerged recently in the art as critical factors in regulating cell fate, as well as in the maintenance and acquisition of pluripotency during cell reprogramming (Mallanna et al., 2010, Dev. Biol. 344(1 ): 16-25).
- mouse embryonic stem cell-specific miRNAs such as members of the miR-290 cluster (mmu-miR-291 , mmu-miR-294 or mmu-miR295), the miR-106b ⁇ 25 cluster (mmu-miR93 and mmu-miR106b) or depletion of fibroblast-specific miRNAs such as mmu-miR-21 or mmu-miR-29a, promoted the formation of miPSCs in the absence of cMYC (Judson et al., 2009, Nat. Biotechnol. 27(5): 459-61 ; Li et al., 201 1 , EMBO J.
- the invention provides a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA.
- the invention also provides a method for reprogramming a somatic cell comprising the step of exposing the cell to a miRNA and one, two or more reprogramming factors.
- the invention further provides a method for reprogramming or enhancing reprogramming in a somatic cell comprising the step of exposing the cell to hsa-miR-519a and the reprogramming factors OCT4, SOX2, and KLF4.
- the present invention relates to an in vitro method for enhancing reprogramming in a somatic cell wherein said method comprises the step of exposing the cell to a miRNA.
- said miRNA comprises a seed sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 27 and SEQ ID NO: 29-33.
- said miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- SEQ ID NO: 3 hsa
- said cell of the present method is exposed to the miRNA by contacting the cell with the miRNA.
- said cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA.
- said viral vector is a retrovirus or a lentivirus.
- said method further comprises exposing the cell to a second miRNA.
- said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- said cell is exposed to the second miRNA by contacting the cell with the second miRNA.
- said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA.
- said viral vector is a retrovirus or a lentivirus.
- the present invention relates to an in vitro method for reprogramming a somatic cell wherein said method comprises the steps of exposing the cell to (i) a miRNA and (ii) one, two or more reprogramming factors.
- said miRNA comprises a seed sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 27 and SEQ ID NO: 29-33.
- said miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- SEQ ID NO: 3 hsa
- said cell of the present method is exposed to the miRNA by contacting the cell with the miRNA.
- said cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA.
- said viral vector is a retrovirus or a lentivirus.
- At least one of the reprogramming factors of the present method is selected from the group consisting of OCT4, SOX2, KLF4, and cMYC.
- the one, two or more reprogramming factors of the present method are selected from the group consisting of OCT4, SOX2, KLF4, and cMYC.
- said cell of the present method is exposed to the reprogramming factor(s) by contacting the cell with the reprogramming factor(s).
- said cell of the present method is exposed to the reprogramming factor(s) by infecting the cell with a viral vector encoding the reprogramming factor(s).
- said viral vector is a retrovirus or a lentivirus.
- said method further comprises exposing the cell to a second miRNA.
- said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- said cell is exposed to the second miRNA by contacting the cell with the second miRNA.
- said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA.
- said viral vector is a retrovirus or a lentivirus.
- the present invention relates to an in vitro method for reprogramming or enhancing reprogramming in a somatic cell wherein said method comprises the steps of exposing the cell to (i) a miRNA comprising a seed sequence of SEQ ID NO: 28 and (ii) the reprogramming factors OCT4, SOX2, and KLF4.
- said miRNA is hsa-miR-519a (SEQ ID NO: 3).
- said cell of the present method is exposed to hsa-miR-519a (SEQ ID NO: 3) by contacting the cell with hsa-miR-519a.
- said cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by infecting the cell with a viral vector encoding hsa-miR- 519a (SEQ ID NO: 3).
- said viral vector is a retrovirus or a lentivirus.
- said cell of the present method is exposed to the reprogramming factor(s) by contacting the cell with the reprogramming factor(s).
- said cell of the present method is exposed to the reprogramming factor(s) by infecting the cell with a viral vector encoding the reprogramming factor(s).
- said viral vector is a retrovirus or a lentivirus.
- said method further comprises exposing the cell to a second miRNA.
- said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- said cell is exposed to the second miRNA by contacting the cell with the second miRNA.
- said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA.
- said viral vector is a retrovirus or a lentivirus.
- said method further comprises exposing the cell to an additional reprogramming factor, wherein the additional reprogramming factor is a reprogramming factor other than OCT4, SOX2, or KLF4.
- said cell is exposed to the additional reprogramming factor by contacting the cell with the additional reprogramming factor.
- said cell is exposed to the additional reprogramming factor by infecting the cell with a viral vector encoding the additional reprogramming factor.
- said viral vector is a retrovirus or lentivirus. Additional features and advantages are described herein, and will be apparent from the following Detailed Description, Drawings and the claims.
- Figure 1 shows the generation of hiPSC lines with doxycycline-inducible expression of different subsets of reprogramming factors.
- Figure 1A shows a schematic representation of the rationale followed to obtain dFib-OCT4 GFP -ind fibroblast-like cells expressing different subsets of reprogramming factors. The right side shows different combinations of retroviruses and lentiviruses used to express the reprogramming factors.
- Figure 1 B shows the results of real time PCR analysis performed for the pluripotent markers OCT4, SOX2, NANOG, the reprogramming factors KLF4 and cMYC, the fibroblast marker COL1A1 and for GFP. Data are shown as relative averages ⁇ SD of two biological replicates analyzed in triplicate.
- Figure 2 shows generation of dFib-OCT4 GFP -ind lines with doxycycline-inducible expression of different subsets of reprogramming factors.
- Figure 2A shows the results of real time PCR analysis performed for the pluripotent markers OCT4, SOX2, NANOG, the reprogramming factors KLF4 and cMYC, the fibroblast marker COL1A1 and for GFP. Data are shown as relative averages ⁇ SD of two biological replicates analyzed in triplicate.
- Figure 2B shows the results of real time PCR analyses performed on dFib-OCT4 GFP - indSKC, dFib-OCT4 GFP -ind-OKC and dFib-OCT4 GFP -ind-OSK cells infected with retroviruses encoding OCT4, SOX2 and cMYC respectively, and either untreated or treated with 100 ng/ml of doxycycline for 24 hours to detect the transcripts corresponding to the four reprogramming factors. No expression from the factors was delivered by retrovirus to generate originally the primary hiPSC lines. Data are shown as relative averages ⁇ SD of two biological replicates analyzed in triplicate.
- Figure 2C shows cell cultures of the indicated dFib-OCT4 GFP -ind cells which were infected with retroviruses encoding the missing reprogramming factor and treated with different doses of doxycycline for 18 days (upper wells). Uninfected cells either untreated or treated with doxycycline were used as negative controls of the experiment (lower wells). hiPSC colonies were detected by alkaline phosphatase staining.
- Figure 3 shows miR-519a enhancement of reprogramming efficiency through TGFpRII downregulation.
- Figure 3F shows a schematic representation of the putative target sites of miR-519a for the TGFpRII mRNA.
- Figure 3G shows real time PCR analysis used to detect the transcripts of TGFpRII in BJ fibroblasts that were either uninfected or infected with the indicated lentiviruses. Data are shown as relative averages ⁇ SD of two biological replicates analyzed in triplicate.
- Figure 4 shows identification of miRNAs strongly expressed in pluripotent cells or downregulated in somatic cell types. Samples plotted along the first and second principal components. Pluripotent cells notably group together.
- the disclosure describes a human drug-inducible reporter system utilizing, by way of example, dFib-OCT4 GFP -ind cells.
- This system presents a reliable, genetically homogenous and simple system that can be used for high-throughput screening of functional substitutes for reprogramming factors or modifiers of the reprogramming efficiency in manner.
- the reprogramming of these cells can easily be tracked by the reactivation of the endogenous OCT4 promoter through the appearance of GFP and by the only addition of doxycycline without the need of additional viral infections.
- the disclosure also describes an example of this system for use in screening of pluripotent-enriched miRNAs, which uncovered new players of the reprogramming process.
- This screening of a pluripotent-enriched miRNA library identified unreported inducers of the reprogramming efficiency.
- the data presented herein describe the existence of human pluripotent-specific miRNAs with the ability to increase the reprogramming efficiency.
- hsa-miR-519a (SEQ ID NO: 3) emerged as a potent inducer of pluripotency likely through the downregulation of TGFpRII.
- NANOG is human NANOG protein, which is a 305 amino acid protein with a conserved homeodomain motif that is localized to the nuclear component of cells. The NANOG homeodomain region facilitates DNA binding.
- TRA-1-60 means a keratan sulfate antigen found on the surface of stem cells.
- cell includes progeny thereof. It is also understood that all progeny may not be precisely identical, such as in DNA content, due to deliberate or inadvertent mutation. Variant progeny that have the same function or biological property of interest, as screened for in the original cell, are included.
- the cell is a somatic cell or a pluripotent cell. In certain embodiments, the cell is a human somatic cell.
- reprogramming means the process of changing or inducing a cell from a more differentiated state into a less differentiated state. Changing or inducing a differentiated somatic cell to de-differentiate into a pluripotent cell or induced pluripotent cell (iPSC), is accomplished through the process of reprogramming, as non-limiting examples.
- iPSC induced pluripotent cell
- the cell is a somatic cell that is to be changed into a pluripotent stem cell.
- a "somatic cell” is any biological cell other than a gamete, germ cell, gametocyte or undifferentiated stem cell and refers to differentiated body cells.
- Induced pluripotent stem cells iPS cells or iPSCs are a type of pluripotent stem cell artificially derived from a non-pluripotent cell, typically an adult somatic cell, by the induction of expression of certain embryonic genes or "reprogramming factors" as used herein.
- Induced pluripotent stem cells are similar to natural pluripotent stem cells, such as embryonic stem (ES) cells, in many aspects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.
- ES embryonic stem
- “Differentiation” refers to process through which a stem cell loses its capacity for self-renewal and becomes a mature and definitive cell-type i.e., a differentiated cell, thereby acquiring the features of a specialized cell.
- exposing encompasses any means by which a miRNA or reprogramming factor becomes associated with a cell or with cell function.
- the cell is exposed to a miRNA or reprogramming factor by "contacting" the cell with the miRNA or reprogramming factor. Contacting can be achieved, for example, by adding a reprogramming factor to the cell media.
- the cell is exposed to a miRNA or reprogramming factor by "infection.”
- cell infection is accomplished via infection by retrovirus or lentivirus.
- miRNA(s) refers to 20-24 nucleotide RNAs that are 22 nucleotide non- coding RNAs that regulate eukaryotic gene expression post-transcriptionally by the degradation or translational inhibition of their target messenger RNAs (mRNAs) (Bartel, 2009, Cell 136(2): 215-33).
- miRNAs are initially transcribed as primary microRNAs (pri- miRNAs) followed by a two step processing into precursor miRNAs (pre-miRNAs) then mature microRNAs and incorporation into the RNA-induced silencing complex (RISC).
- RISC RNA-induced silencing complex
- Mature microRNAs downregulate their target-mRNAs by sequence-specific base-pairing with their 3'-untranslated regions (3'-UTRs) and act as key regulatory molecules in various cellular processes like proliferation, differentiation, apoptosis and metabolism.
- Most mRNA-miRNA targeting occurs through incomplete nucleotide complementation between a short sequence located in the 5' region of the miRNA (the "seed sequence") and the 3' UTR of its mRNA target.
- the seed sequence of has- miR-519a is AAGUGCA (SEQ ID NO: 28).
- a single miRNA can target hundreds of different mRNAs and multiple pathways that make them powerful regulators of cell function.
- the double-stranded precursor miRNA is noted “pre-mir-” or “mir-” and the single-stranded mature miRNA is noted “miR- ", all followed by a number naming said miRNA.
- has-miR-429 (SEQ ID NO: 9) is a human (Homo sapiens) miRNA and oar-miR-429 is a sheep (Ovis aries) miRNA. miRNAs with nearly identical sequences except for one or two identical nucleotides are annotated with an additional lower case letter. For example, hsa-miR-517c (SEQ ID NO: 6) differs from has-miR-517a (SEQ ID NO: 7) by only one nucleotide. Pre-miRNAs that lead to 100% identical mature miRNAs but that are located at different places in the genome are indicated with an additional dash-number suffix.
- has-mir-519a-1 and has-mir-519a-2 are distinct pre- miRNAs that generate the same mature miRNA: has-miR-519a (SEQ ID NO: 3).
- has-miR-519a SEQ ID NO: 3
- two mature miRNAs originate from opposite arms of the same pre-miRNA, they are denoted with a -3p or -5p suffix as for example for has-miR-512-3p (SEQ ID NO: 8).
- the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR-302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19),
- the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR- 519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520
- the miRNA is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512- 3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- the miRNA is hsa-miR-429 (SEQ ID NO: 9) or hsa-miR-519a (SEQ ID NO: 3).
- a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to hsa-miR-519a (SEQ ID NO: 3).
- a method for reprogramming a somatic cell comprising the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) one, two or more reprogramming factors.
- the cell is exposed to the miRNA by contacting the cell with the miRNA or by expressing it after the delivery inside cell of a vector encoding said miRNA.
- miRNAs may be replaced with primary miRNAs transcripts or precursors miRNA (pre-miRNAs) leading to them upon maturation, or chemically synthetized molecules equivalent to these molecular species; as an illustrative example, miRNAs of the present invention may be replaced by miRNA mimics such as miScript miRNA Mimics (Qiagen) which are chemically synthetized, double-stranded RNAs which mimic mature endogenous miRNAs after transfection into cells.
- miRNAs may be replaced with primary miRNAs transcripts or precursors miRNA (pre-miRNAs) leading to them upon maturation, or chemically synthetized molecules equivalent to these molecular species; as an illustrative example, miRNAs of the present invention may be replaced by miRNA mimics such as miScript miRNA Mimics (Qiagen) which are chemically
- miRNAs of the present invention may originate from numerous organisms; as a non-limiting example, miRNAs of the present invention may originate from mammals. As another non-limiting example, miRNAs may originate from human, i.e. being a human miRNA. miRNAs, as used herein in the methods of the present invention, also encompass miRNAs which share the same seed sequence than selected miRNAs.
- a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA, wherein said miRNA shares the same seed sequences than miRNAs selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO:
- a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA, wherein said miRNA comprises a seed sequence selected from the group of SEQ ID NO: 27-33.
- a method for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA which shares the same seed sequence than hsa-miR-519a (SEQ ID NO: 3) and (ii) one, two or more reprogramming factors.
- a method for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) one, two or more reprogramming factors. It is intended than the methods of the present invention can notably be carried out in vitro.
- miRNAs according to the present invention for enhancing the reprogrammation of a somatic cell.
- miRNAs according to the present invention for reprogramming a somatic cell by contacting said cell with at least said miRNAs are also encompassed in the present invention, use of miRNAs according to the present invention for enhancing the reprogrammation of a somatic cell.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- a “vector” in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acids.
- vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
- the cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA.
- Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adenoassociated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double- stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox).
- orthomyxovirus e.g., influenza virus
- rhabdovirus e.g., rabies and vesicular stomatitis virus
- paramyxovirus
- the viral vector is a retrovirus or lentivirus.
- retrovirus means an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host's genome by an integrase enzyme. The virus thereafter replicates as part of the host cell's DNA.
- Retroviruses are enveloped viruses that belong to the viral family Retroviridae.
- lentivirus means a genus of viruses of the Retroviridae family, characterized by a long incubation period. Lentiviruses can deliver a significant amount of viral RNA into the DNA of the host cell.
- a lentivirus is HIV, SIV, BIV, Equine Infectious Anemia Virus, Maedi- visna Virus or Caprine Encephalitis Arthritis Virus as illustrating examples.
- Lentiviral vectors derived from such lentivirus can be integrative or non-integrative.
- the method herein further comprises exposing the cell to a second miRNA.
- the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR-302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-363 (SEQ ID NO: 14), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-200c (SEQ ID NO: 13), hsa-miRNA
- the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa- miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR- 520h
- the second miRNA is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512- 3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- the cell is exposed to the second miRNA by contacting the cell as explained above with the second miRNA or infecting the cell with a viral vector encoding the second miRNA.
- the viral vector is a retrovirus or lentivirus.
- the method for enhancing reprogramming in a somatic cell herein comprises the step of exposing the cell to more than one miRNA, i.e., exposing the cell to successive miRNAs or to a combination of two, three, four or five miRNAs selected from the groups mentioned above.
- reprogramming factors include proteins, small molecules, and miRNAs capable of inducing reprogramming, or nucleic acid encoding for such proteins or miRNAs.
- examples of reprogramming factors include but are not limited to OCT4, SOX2, KLF4, and cMYC. Additional reprogramming factors may be C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 (as reviewed in Stadtfeld and Hochedlinger, 2010, Genes Dev.
- WO2010/068955 such as 6-bromoindirubin-3'- oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)- 1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino- 3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2, as non-limiting examples.
- BIO 6-bromoindirubin-3'- oxime
- INO lndirubin-5-nitro-3'-oxime
- Valproic acid 2-(3-(6-Methylpyridin-2-yl)- 1 H-pyrasol-4-yl)-1 ,5
- Oct-4 is a transcription factor that is initially active as a maternal factor in the oocyte but remains active in embryos throughout the pre-implantation period.
- Oct-4 expression is associated with an undifferentiated phenotype and tumors.
- Gene knockdown of Oct-4 promotes differentiation, thereby demonstrating a role for these factors in human embryonic stem cell self-renewal.
- Oct-4 can form a heterodimer with Sox2, allowing these two proteins to bind DNA together.
- SRY (sex determining region Y)-box 2, also known as "SOX2,” is a transcription factor that is essential for maintaining self-renewal, or pluripotency, of undifferentiated embryonic stem cells.
- Sox2 is a member of the Sox family of transcription factors, which have been shown to play key roles in many stages of mammalian development. This protein family shares highly conserved DNA binding domains known as HMG (High-mobility group) box domains containing approximately 80 amino acids. Sox2 has a critical role in maintenance of embryonic and neural stem cells (Avilion et al., 2003, Genes and Development 17: 126-140).
- Krueppel-like factor 4 is a protein that in humans is encoded by the KLF4 gene. In embryonic stem cells (ESCs), KLF4 has been demonstrated to be a good indicator of stem-like capacity.
- cMyc is a regulator gene that codes for a transcription factor that is known to be involved with certain cancers.
- the cell is exposed to the reprogramming factors by contacting the cell with the reprogramming factors. In a specific embodiment, the cell is exposed to the reprogramming factors following transformation by one or several vectors expressing said reprogramming factors. In a specific embodiment, the cell is exposed to the reprogramming factors by infecting the cell with one or more viral vectors encoding the reprogramming factors. In one embodiment, at least one of the viral vectors is a retrovirus or lentivirus.
- a method for reprogramming a somatic cell comprising the step of exposing the cell to at least (i) a miRNA and (ii) one, two or more reprogramming factors said one, two or more reprogramming factors being selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 and/or from the group of small molecules selected from the group consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1
- a method for reprogramming somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein said two reprogramming factors are selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 .
- a method for reprogramming somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein said two reprogramming factors are selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
- BIO 6-bromoindirubin-3'-oxime
- INO lndirubin-5-nitro-3'-oxime
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein one of said reprogramming factors is selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 and the other one is selected from the group of small molecules consisting of 6- bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphth, 2-(3-(6
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) more than two reprogramming factors, i.e., three, four, five or six reprogramming factors.
- said three, four, five or six reprogramming factors can be selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utf1 , SV40LT and Glis1 and/or can be selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2
- the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2 and KLF4 reprogramming factors.
- the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) OCT4, SOX2 and KLF4 reprogramming factors.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) OCT4, SOX2 and KLF4 reprogramming factors.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6J-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), I nd i ru bi n-5-n itro-3'- oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
- BIO 6-bromoindirubin-3'-
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6- bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4, 5,6,7- tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
- a miRNA wherein said miRNA comprises
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, cMYC and KLF4 reprogramming factors.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, cMYC and KLF4 reprogramming factors.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, cMYC, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro- 3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5- naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl) ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, cMYC, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6J-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) a miRNA and (ii) at least one reprogramming factor or a combination of reprogramming factors as listed in Table 2 of Stadtfeld and Hochedlinger and / or in Tables 1 of respectively Nakhaei-Rad et al, 2012 and Mochiduki and Okita, 2012, all incorporated here by reference.
- the method for reprogramming somatic cell comprises the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) at least one reprogramming factor or a combination of reprogramming factors as listed in Table 2 of Stadtfeld and Hochedlinger and / or in Tables 1 of respectively Nakhaei-Rad et al, 2012 and Mochiduki and Okita, 2012.
- the method as described herein further comprises exposing the cell to a second miRNA.
- the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR- 302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-363 (SEQ ID NO: 14), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-200c (SEQ ID NO: 13), hsa-mRNA
- the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa- miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa- miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520h (SEQ ID NO:
- the second miR is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa- miR-520c-3p (SEQ ID NO: 26), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
- the cell is exposed to the second miRNA by contacting the cell with the second miRNA or by infecting the cell with a viral vector encoding the second miRNA.
- a method for reprogramming or enhancing reprogramming in a somatic cell comprising the step of exposing the cell to (i) hsa-miR-519a and (ii) the reprogramming factors OCT4, SOX2, and KLF4.
- the cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by contacting the cell with hsa-miR-519a (SEQ ID NO: 3).
- the cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by infecting the cell with a viral vector encoding hsa-miR-519a (SEQ ID NO: 3).
- the viral vector is a retrovirus or lentivirus.
- the cell is exposed to the reprogramming factors by contacting the cell with the reprogramming factors. In certain embodiments, the cell is exposed to the reprogramming factors by infecting the cell with one or more viral vectors encoding the reprogramming factors. In other embodiments, at least one of the viral vectors is a retrovirus or lentivirus.
- the cell is a cell line derived from human cells.
- cell lines may be 293T cells or BJ fibroblasts.
- the method as disclosed herein comprises exposing the cell to an additional reprogramming factor, wherein the additional reprogramming factor is a reprogramming factor other than OCT4, SOX2, or KLF4.
- the cell is exposed to the additional reprogramming factor by contacting the cell with the additional reprogramming factor.
- the cell is exposed to the additional reprogramming factor by infecting the cell with a viral vector encoding the additional reprogramming factor, in one embodiment the viral vector is a retrovirus or lentivirus.
- Another object of the present invention is a composition which comprises, as active principle, a miRNA according to the present invention.
- This composition comprises an effective dose of said miRNA and at least one suitable excipient appropriate with the use of said composition.
- kits to implement the methods of the present invention comprising at least one miRNA according to the present invention and instructions to use it in order to reprogram or enhance the reprogrammation of a somatic cell.
- H1 (WA01 ), H7 (WA07), H9 (WA09) and H1 -OCT4 GFP embryonic stem cell lines were obtained from WiCell Research Institute and maintained on mouse embryonic fibroblasts (MEFs) or Matrigel (BD Biosciences) using mTeSRI medium (Stem Cell Technologies). hESC colonies were split using a solution of dispase (2 mg/ml) or collagenase (1 mg/ml) and scraping the colonies with a glass pipette. Derived hiPSCs were cultured similarly as described above for hESCs.
- 293T cells and dFib-OCT4 GFP fibroblast-like cells and BJ human fibroblasts were cultured in DMEM (Invitrogen) supplemented with 10% FBS and 0.1 mM non-essential amino acids.
- DMEM Invitrogen
- Commercial primary cells obtained from ATCC, Lonza and Promocell were cultured according to the recommendations of the supplier.
- a mix of retroviruses plus lentiviruses was used to infect the fibroblast-like cells by spinfection at 1850 rpm for 1 hour at room temperature in the presence of polybrene ⁇ g/ml).
- the ratio of viruses used was 0.5:0.05:0.05:0.05:0.15 (pMX-OCT4:pLVFUtetO-SOX2:pLVFUtetO-KLF4:pLVFUtetO- cMYC:FUdeltaGW-rtTA).
- the remaining hiPSC lines were obtained by using different combinations of retroviruses and lentiviruses. After two serial infections, cells were plated onto fresh MEFs with DMEM (Invitrogen), 10% FBS and 0.1 mM nonessential amino acids supplemented with 100ng/ml (unless otherwise specified) of doxycycline.
- DMEM Invitrogen
- FBS FBS
- 0.1 mM nonessential amino acids supplemented with 100ng/ml (unless otherwise specified) of doxycycline.
- hESC medium DMEM/F12 (Invitrogen) supplemented with 20% Knockout Serum Replacement (KOSR, Invitrogen), 1 mM L-glutamine, 0.1 mM non-essential amino acids, 55 ⁇ ⁇ -mercaptoethanol, 10 ng/ml bFGF (Joint Protein Central) and 100ng/ml doxycycline.
- KOSR Knockout Serum Replacement
- bFGF Joint Protein Central
- doxycycline 100ng/ml doxycycline.
- the corresponding dFib-OCT4 GFP fibroblast-like cells were serially infected twice with retroviruses encoding the missing reprogramming factor or with miRNA-encoding lentiviruses.
- cells were incubated with DMEM (Invitrogen), 10% FBS and 0.1 mM non-essential amino acids supplemented with 100ng/ml (unless other specified) of doxycycline and two days later plated onto fresh MEFs or Matrigel. The following day, cells were switched to hESC medium supplemented with doxycycline until colonies appeared in the well.
- hiPSC colonies were stained for either alkaline phosphatase (AP) or NANOG expression, or used to establish independent cell lines.
- hiPSC43A2, hiPSC43B2, hiPSC43D6 and hiPSC57A5, hiPSC57A7, hiPSC57B7 lines were generated from human fibroblasts CRL- 2429 and CRL-2522 using the commercial polycistronic lentivirus STEMCCA encoding the four reprogramming factors (Millipore, SCR510).
- F1 hiPSC4F line was generated from F1 fibroblasts using the polycistronic lentivirus STEMCCA.
- CBhiPSC2F3, CBhiPSC3F12 and CBhiPSC4F3 lines were generated from human cord blood samples by retroviral infection. These hiPSC lines were maintained on MEFs or human feeder fibroblasts using KO DMEM medium (Life Technologies) in the presence of KOSR (Life Technologies) supplemented with 0.1 mM non-essential amino acids, 0.1 mM mercaptoethanol, 1x glutamax and 10 ng/ml bFGF (Life Technologies).
- pMX-OCT4, pMX-SOX2, pMX-KLF4, pMX-cMyc, FUdeltaGW-rtTA, pLVFUtetO-OCT4, pLVFUtetO-SOX2, pLVFUtetO-KLF4 and pLVFUtetO-cMYC were obtained from Addgene (plasmids 17217, 17218, 17219, 17220, 19780, 19778, 19779, 19777 and 19775 respectively).
- the lentiviral vectors encoding specific miRNAs (pMIRNAI ) were purchased to SBY, System Biosciences.
- Moloney-based retroviruses were generated as described.
- Third generation lentiviral vectors pLV-FU-tetO and pMIRNA
- packaging plasmids pMDL, REV and VSVg, kindly provided by Dr. Oded Singer, Laboratory of Genetics Lab, The SALK Institute, La Jolla, CA
- Supernatants were collected and passed through a 0.45 ⁇ filter to remove cellular debris.
- Antibodies against NANOG (Abeam, Ab21624), TRA-1 -60 (Chemicon, MAB4360), AFP (DAKO, A0008), FOXA2 (R&D, AF2400), TUJ1 (Covance, MMS-435-P), Alpha-smooth muscle actin (ASMA) (Sigma, A5228), Alpha-sarcomeric actin (ASA) (Sigma, A2172) and GFAP (Dako, AB1980) diluted in 1 % PBS-BSA were used for overnight incubation at 4°C.
- the reverse transcription (RT) step was performed with 2 ⁇ g of total RNA using the RT Supermix M-MuLV kit (BioPioneer). 0.25 ⁇ of the final reaction was used to quantify gene expression by real time PCR using the SYBR-Green PCR Master mix (Applied Biosystems) in the ViiA 7 Real Time PCR System (Applied Biosystems). Values of gene expression were normalized using GAPDH expression and data is shown as fold change relative to the value of the sample control. All reactions were done in triplicate.
- RNA total RNA (including small RNA) from the samples indicated in the table below was extracted from 3- 10 6 cells by using RNeasy® Mini Kit (Qiagen) according to manufacturer's protocols. RNA was quantified on a NanoDrop 8000 spectrophotometer (Thermo Scientific). For microarray analysis, RNA quality was determined on a Bio analysesr 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used. Table 1 : Samples profiled on miRNA arrays.
- CDMPRO Melanocytes Promocell
- TLDA human TaqMan Low Density miRNA Arrays
- TLDAs were run on a 7900HT Thermocycler (Applied Biosystems) using Sequence Detection Systems (SDS) software version 2.3. Data analysis was performed using SDS RQ manager v1.2 (Applied Biosystems) which utilizes the delta-delta CT method.
- the threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence exceeds the fixed threshold of 0.1. For each sample, the median of the CT values from detected signals was used to normalize the RNA input. A total of 26 miRNAs were identified as uniquely or strongly expressed in pluripotent cells compared to somatic cells (see Table 2 for list of miRNAs).
- EBs embryoid bodies
- FBS Antlanta Biologicals
- EBs were plated onto gelatin-coated tissue culture plates and maintained in EB media for two additional days followed by their maintenance in DMEM, 10% FBS and 1 % NEAA, until cells showed fibroblast morphology.
- Derived fibroblasts-like cells were serially passaged by using Tryple (Invitrogen) and tested for loss of pluripotent marker as well as GFP expression, and gain of expression of fibroblast markers. 10.
- BJ fibroblasts were infected only once by spinfection with a mix of retroviruses encoding OCT4, SOX2 and cMYC (day 0).
- days 0 and 5 after initial infection cells were transfected with miRNA-mimics (obtained from Qiagen) at 30 nM final concentration using Lipofectamine (Invitrogen) following manufacturer's recommendations.
- miRNA-mimics obtained from Qiagen
- Lipofectamine Invitrogen
- cells were transferred onto fresh MEFs with DMEM (Invitrogen), 10% FBS and 0.1 mM nonessential aminoacids. The following day, cells were switched to hESC medium (see above in section 2) until hiPSC colonies developed.
- the 177 major miRNAs which presented a significant (p ⁇ 0.05) difference between those two groups were then used in the principal components analysis.
- the first principal component separated the hiPSC lines from the differentiated cells and was, therefore, interpreted as the pluripotency component (see Figure 4).
- the loading coefficients of principal component 1 ranked the miRNAs as predictors of pluripotency.
- the expression levels of the miRNAs in each sample-group were binned into four categories: +++ (high); ++ (medium); + (low); - (no expression).
- 26 miRNAs were selected.
- the chromosome-19 cluster of miRNA genes is referred to as C19MC.
- TargetSca miRNA families are as described in http://www.targetscan.org, whereas hairpin families (mir-#) are as described in http://www.mirbase.org/ftp.shtml (miRBase file: hairpin.fa). Gene expression levels are reported as mean ⁇ SD. The number of biological replicates, independent experiments and technical replicates are given in the Brief Description of the Drawings section.
- Example 1 Human inducible system for reprogramming of cells
- dFib-OCT4 GFP cells can then be differentiated towards fibroblasts-like cells which retain the ability to re-express the three lentiviral- delivered reprogramming factors after the addition of doxycycline while the remaining retroviral-delivered factor will not be expressed.
- OCT4 pMX-OCT4
- lentiviruses expressing SOX2, KLF4 and cMYC pLVFUtetO-SOX2, KLF4 and cMYC
- hiPSCs-OCT4 GFP -indSKC were generated that could be further differentiated towards fibroblast-like cells (dFib-OCT4 GFP -indSKC) ( Figures 1A).
- dFib-OCT4 GFP -indSKC cells express SOX2, KLF4 and cMYC after the addition of doxycycline but not OCT4. Under the proper culture conditions these cells do not reprogram unless exogenous OCT4 or a functional OCT4 substitute is supplied to the cells and detection of GFP can be used to identify fully reprogrammed cells.
- This cellular system represents a useful tool for screen functional substitutes of the reprogramming factors or new players in the reprogramming process.
- dFib-OCT4 GFP cells were infected with different combinations of retroviruses and drug- inducible lentiviruses. This led to the successful generation of primary hiPSC-OCT4 GFP colonies ( Figures 1A).
- Four hiPSC-OCT4 GFP -SKC, four hiPSC-OCT4 GFP -OKC, and nine hiPSC-OCT4 GFP -OSK lines were isolated and expanded in the absence of doxycycline.
- the hiPSC-OCT4 GFP -SKC-2 and 4 were selected for further analysis.
- These reprogrammed cells were first verified for regained expression of GFP, expression of endogenous pluripotent markers, and downregulation of fibroblast markers ( Figure 1 B). The pluripotency of these hiPSC lines was confirmed as they differentiated in vitro and contributed in vivo to the three embryonic germ layers.
- the hiPSC-OCT4 GFP lines were then differentiated using an embryoid body protocol to obtain morphologically fibroblast-like cells (dFib-OCT4 GFP -ind). It was next determined that the different dFib-OCT4 GFP -ind fibroblast-like cells regained the expression of fibroblasts markers, downregulated the expression of pluripotent markers and lost the expression of GFP ( Figure 2A). It was also observed that treatment of dFib-OCT4 GFP -ind cells with doxycycline induced the expression of the lentiviral-delivered reprogramming factors, but not the expression of the factor initially supplied by retroviral infection (Figure 2A).
- dFib-OCT4 GFP -ind cells were validated for having the ability to reprogram back into pluripotency by the addition of doxycycline and supplying of a missing reprogramming factor.
- dFib-OCT4 GFP -indSKC, dFib-OCT4 GFP - indOKC, and dFib-OCT4 GFP -indOSK cells were infected with retroviruses encoding OCT4, SOX2, and cMYC, respectively, and incubated with or without doxycycline in the culture media. They were then compared to untreated cells to evaluate their reprogramming abilities.
- miRNAs belonging to clusters were identified, such as hsa-miR-302, hsa-miR- 372, and hsa-miR-373 (human orthologous to mouse mmu-miR-290), hsa-miR-200, or hsa-miR-520, which have been described as having a role in stem cell maintenance or participate in cell reprogramming in mouse cells (Judson et a/.; Yang et a/.; Subramanyam et a/., 201 1 , Nat. Biotechnol. 29(5): 443-48; Wang et al., 2008, Nat. Genet. 40(12): 1478- 83). Other identified miRNAs had never been associated with pluripotence. Whether the expression of these miRNAs influence the reprogramming efficiency in the absence of cMYC in human fibroblasts was then investigated.
- dFib-OCT4 GFP -indOSK-1 1 cells were infected with lentiviruses encoding each of the 26 miRNAs selected for analysis (see Table 2 below), adding doxycycline to the media and followed the formation of hiPSC colonies.
- hsa-miR-363 MIMAT0000707 AAUUGCACGGUAUCCAUCUGUA 14 Homo sapiens miR-363
- hsa-miR-373 MIMAT0000726 GAAGUGCUUCGAUUUUGGGGUGU 16 Homo sapiens miR-373
- hsa-miR-372 MIMAT0000724 AAAGUGCUGCGACAUUUGAGCGU 17 Homo sapiens miR-372
- hsa-miR-367 MIMAT0000719 AAUUGCACUUUAGCAAUGGUGA 19 Homo sapiens miR-367
- hsa-miR-519a SEQ ID NO: 3
- hsa-miR-429 SEQ ID NO: 9
- members of the hsa-miR-290 cluster are directly regulated by the binding of cMYC to their promoters.
- Expression of hsa-miR-291 , -294, and -295 do not have a positive further effect in the formation of hiPSC colonies when cMYC is included in the reprogramming experiments (Figure 3C) (Judson et a/.).
- hsa-miR-519a SEQ ID NO: 3
- TGFpRII was focused on because it has been already demonstrated to be a target of several miRNAs implicated in enhancing the reprogramming efficiency (Li et a/.; Subramanyam et a/.).
- the 3' UTR region of the TGFpRII mRNA contains two well conserved recognition sequences for hsa-miR-519a (SEQ ID NO: 3) and its expression downregulates the level of TGFpRII mRNA in fibroblasts ( Figures 3F and 3G).
- iPS cells produce viable mice through tetraploid complementation. Nature 461: 86-90.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Developmental Biology & Embryology (AREA)
- Transplantation (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
METHODS FOR REPROGRAMMING A SOMATIC CELL
FIELD OF THE INVENTION
The invention relates to methods for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA. The invention also relates to methods for reprogramming a somatic cell comprising the step of exposing the cell to a miRNA and one, two or more reprogramming factors.
BACKGROUND OF THE INVENTION
Reprogramming of somatic cells into induced pluripotent stem cells (iPSCs) can be achieved by the expression of the transcription factors OCT4, SOX2, KLF4, and cMYC (Takahashi and Yamanaka, 2006, Cell 126(4): 663-76). Reprogramming strategies based on doxycycline-inducible lentivirus, which facilitate temporal control in the expression of the reprogramming factors, have been recently developed in the art. These reprogramming systems, based on doxycycline-inducible lentivirus expressing the reprogramming factors, represented a step toward further understanding the mechanisms governing cell reprogramming (Brambrink et al., 2008, Cell Stem Cell 2(2): 151-59; Stadtfeld et al., 2008, Cell Stem Cell 2(3): 230-40; Stadtfeld et al., 2010, Nat. Methods 7(1 ): 53-55; Wernig et al., 2008, Nat. Biotechnol. 26(8): 916-24; Markoulaki et al., 2009, Nat. Biotechnol. 27(2): 169-71 ; Hockemeyer et al., 2008, Cell Stem Cell 3(3): 346-53; Maherali et al., 2008, Cell Stem Cell 3(3): 340-45). These reprogramming systems have been used as powerful tools for screening in mouse cells.
Mouse induced pluripotent stem cells (miPSCs) colonies were initially selected based on the neomycin resistance provided by the reactivation of the Fbx15 promoter (Takahashi and Yamanaka). Although these miPSCs contributed to all three germ layers after injection into blastocysts, no live chimeric mice were obtained, probably due to the incomplete reprogramming of the miPSCs (Takahashi and Yamanaka). Later reports showed that selection based on the promoter reactivation of alternative stem cell markers, such as OCT4 or NANOG, rendered miPSCs capable of generating germline-competent live chimeric mice (Maherali et al., 2007, Cell Stem Cell 1 (1 ): 55-70; Okita et al., 2007, Nature 448(7151 ): 313-17; Wernig et al., 2007, Nature 448(7151 ): 318-24) and even all- miPSC mice (Zhao et al., 2009, Nature 461 (7260): 86-90; Boland et al., 2009, Nature 461 (7260): 91-94; Kang et al., 2009, Cell Stem Cell 5(2): 135-38) demonstrating the full pluripotency of these cells. These reports highlighted the importance of using selective
stem cell markers to identify fully reprogrammed iPSC colonies. The system based on doxycycline-inducible lentivirus expressing the reprogramming factors was used to generate chimeric mice with doxycycline-inducible miPSCs or engineered mouse embryonic stem cells (mESCs) with a reprogramming cassette that facilitated the generation of "secondary" miPSCs from a wide variety of somatic tissues (Stadtfeld et al.; Wernig et a/.). Somatic cells from these mice can be reprogrammed by the addition of doxycycline only, and are easily traceable by the re-expression of a green fluorescent protein (GFP) gene driven by the NANOG or OCT4 gene promoters, yielding reprogramming efficiencies 15 to 50-fold greater than those observed in traditional protocols (Wernig et al., 2008, Nat. Biotechnol. 26: 916-24). Generation of transgenic mice with defined doxycycline-inducible subsets of the four reprogramming factors has also recently been reported (Markoulaki et al.). Mouse embryonic fibroblasts (MEFs) isolated from these transgenic mice could generate "secondary" GFP-positive miPSC only when the missing factor was re-introduced. Id. Mouse induced pluripotent stem cells (miPSCs) colonies were initially selected based on the neomycin resistance provided by the reactivation of the Fbx15 promoter (Takahashi and Yamanaka). These systems have greatly facilitated the characterization of the reprogramming process and have provided an invaluable tool for genetic or chemical screenings for functional substitutes of reprogramming factors with traceable fluorescent markers. However, similar reporter systems in human cells have not been generated due to the challenge in modifying genetically human pluripotent cells.
The inventors previously developed a human reporter system based on the expression of a GFP gene driven by the endogenous OCT4 promoter to follow early events of cell reprogramming (Ruiz et al., 201 1 , Curr. Biol. 21 (1 ): 45-52). The inventors also reported a differentiated knock-in OCT4GFP human H1 embryonic stem cell line (Zwaka and Thomson, 2003, Nat. Biotechnol. 21 (3): 319-21 ) into a fibroblast-like population of cells (dFib-OCT4GFP) (Ruiz et al.). The inventors verified that the population of dFib-OCT4GFP cells displayed the expected morphology and expressed fibroblast markers at a similar level to what is observed in human fibroblasts (Ruiz et al.). Moreover, it was determined that these cells no longer expressed GFP, due to silencing by methylation of the OCT4 promoter, or several pluripotent markers detected in the H1 -OCT4GFP cell line. After reprogramming these derived fibroblasts by transduction with a combination of retroviruses encoding for OCT4, sex determining region Y-box 2 (SOX2), Krueppel-like factor 4 (KLF4), and/or cMYC (OSKC), the inventors observed the reactivation of the endogenous OCT4 locus which correlated with the appearance of GFP. Id. However, the inventors were not able to reprogram dFib-OCT4GFP cells by transduction of only OCT4 or
OCT4/SOX2. Generation of drug-inducible reprogramming systems in human cells with higher efficiencies compared to retroviral-based protocols have recently been described in the art (Hockemeyer et al.; Maherali et al., 2008). Although these cellular systems can be used to dissect the underlying molecular and epigenetic events occurring during the reprogramming of human cells, the technical challenges in engineering pluripotent human cells that allow for the identification of bona-fide hiPSC colonies based on the reactivation of endogenous stem cell promoters have precluded their use for screening purposes. Therefore, the inventors generated a drug inducible reprogramming system using the human dFib-Oct4GFP cells. They obtained different cells with an inducible expression of different subsets of reprogramming factors.
The description provides new insights into microRNA regulation of cell reprogramming. This was accomplished through analysis of the effect on the reprogramming efficiency of pluripotent-enriched miRNAs. miRNAs are 22 nucleotide non-coding RNAs that regulate the expression of downstream targets by mRNA destabilization and translational inhibition (Bartel, 2009, Cell 136(2): 215-33). Most mRNA-miRNA targeting occurs through incomplete nucleotide complementation between a short sequence located in the 5' region of the miRNA (the "seed sequence") and its mRNA target. A single miRNA can target hundreds of different mRNAs and multiple pathways that make them powerful regulators of cell function. miRNAs have emerged recently in the art as critical factors in regulating cell fate, as well as in the maintenance and acquisition of pluripotency during cell reprogramming (Mallanna et al., 2010, Dev. Biol. 344(1 ): 16-25). Introduction of mouse embryonic stem cell-specific miRNAs, such as members of the miR-290 cluster (mmu-miR-291 , mmu-miR-294 or mmu-miR295), the miR-106b~25 cluster (mmu-miR93 and mmu-miR106b) or depletion of fibroblast-specific miRNAs such as mmu-miR-21 or mmu-miR-29a, promoted the formation of miPSCs in the absence of cMYC (Judson et al., 2009, Nat. Biotechnol. 27(5): 459-61 ; Li et al., 201 1 , EMBO J. 30(5): 823-34; Yang et al., 201 1 , RNA 17(8): 1451 -60). It has also been suggested that the expression of specific subsets of different miRNAs could be sufficient to reprogram somatic cells (Anokye- Danso et al., 201 1 , Cell Stem Cell 8(4): 376-88; Miyoshi et al., 201 1 , Cell Stem Cell 8(6): 633-38). Although extensive analysis for the role of miRNAs in self-renewal and pluripotency or during the generation of iPSCs from mouse cells has been reported, little is known about their role in a human context. Thus, it would be desirable to identify miRNAs able to induce or enhance reprogramming of human somatic cells. SUMMARY OF THE INVENTION
The invention provides a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA.
The invention also provides a method for reprogramming a somatic cell comprising the step of exposing the cell to a miRNA and one, two or more reprogramming factors.
The invention further provides a method for reprogramming or enhancing reprogramming in a somatic cell comprising the step of exposing the cell to hsa-miR-519a and the reprogramming factors OCT4, SOX2, and KLF4.
In a first aspect, the present invention relates to an in vitro method for enhancing reprogramming in a somatic cell wherein said method comprises the step of exposing the cell to a miRNA.
In a first embodiment, said miRNA comprises a seed sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 27 and SEQ ID NO: 29-33. In another embodiment, said miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In a preferred embodiment, said miRNA is hsa-miR-519a (SEQ ID NO: 3) or hsa-miR-429 (SEQ ID NO: 9).
In another embodiment of this first aspect of the invention, said cell of the present method is exposed to the miRNA by contacting the cell with the miRNA. In another embodiment, said cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA. In another embodiment, said viral vector is a retrovirus or a lentivirus.
In another embodiment, said method further comprises exposing the cell to a second miRNA. In another embodiment, said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In another embodiment of the present method, said cell is exposed to the second miRNA by contacting the cell with the second miRNA. In another embodiment, said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA. In another embodiment, said viral vector is a retrovirus or a lentivirus.
In a second aspect, the present invention relates to an in vitro method for reprogramming a somatic cell wherein said method comprises the steps of exposing the cell to (i) a miRNA and (ii) one, two or more reprogramming factors.
In a first embodiment, said miRNA comprises a seed sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 27 and SEQ ID NO: 29-33. In another embodiment, said miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In a preferred embodiment, said miRNA is hsa-miR-519a (SEQ ID NO: 3) or hsa-miR-429 (SEQ ID NO: 9).
In another embodiment of this aspect of the present invention said cell of the present method is exposed to the miRNA by contacting the cell with the miRNA. In another embodiment, said cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA. In another embodiment, said viral vector is a retrovirus or a lentivirus.
In another embodiment of the present invention, at least one of the reprogramming factors of the present method is selected from the group consisting of OCT4, SOX2, KLF4, and cMYC. In another embodiment, the one, two or more reprogramming factors of the present method are selected from the group consisting of OCT4, SOX2, KLF4, and cMYC. In another embodiment of this aspect of the present invention, said cell of the present method is exposed to the reprogramming factor(s) by contacting the cell with the reprogramming factor(s). In another embodiment, said cell of the present method is exposed to the reprogramming factor(s) by infecting the cell with a viral vector encoding the reprogramming factor(s). In another embodiment, said viral vector is a retrovirus or a lentivirus.
In another embodiment of this aspect of the invention, said method further comprises exposing the cell to a second miRNA. In another embodiment, said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In another embodiment of the present method, said cell is exposed to the second miRNA by contacting the cell with the second miRNA. In another embodiment, said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA. In another embodiment, said viral vector is a retrovirus or a lentivirus.
In a particular aspect, the present invention relates to an in vitro method for reprogramming or enhancing reprogramming in a somatic cell wherein said method comprises the steps of exposing the cell to (i) a miRNA comprising a seed sequence of SEQ ID NO: 28 and (ii) the reprogramming factors OCT4, SOX2, and KLF4.
In a first embodiment, said miRNA is hsa-miR-519a (SEQ ID NO: 3). In another embodiment, said cell of the present method is exposed to hsa-miR-519a (SEQ ID NO: 3) by contacting the cell with hsa-miR-519a. In another embodiment said cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by infecting the cell with a viral vector encoding hsa-miR- 519a (SEQ ID NO: 3). In another embodiment, said viral vector is a retrovirus or a lentivirus.
In another embodiment of this aspect of the present invention, said cell of the present method is exposed to the reprogramming factor(s) by contacting the cell with the reprogramming factor(s). In another embodiment, said cell of the present method is exposed to the reprogramming factor(s) by infecting the cell with a viral vector encoding the reprogramming factor(s). In another embodiment, said viral vector is a retrovirus or a lentivirus.
In another embodiment of this aspect of the invention, said method further comprises exposing the cell to a second miRNA. In another embodiment, said second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In another embodiment of the present method, said cell is exposed to the second miRNA by contacting the cell with the second miRNA. In another embodiment, said cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA. In another embodiment, said viral vector is a retrovirus or a lentivirus. In another embodiment of this aspect of the present invention, said method further comprises exposing the cell to an additional reprogramming factor, wherein the additional reprogramming factor is a reprogramming factor other than OCT4, SOX2, or KLF4. In another embodiment, said cell is exposed to the additional reprogramming factor by contacting the cell with the additional reprogramming factor. In another embodiment, said cell is exposed to the additional reprogramming factor by infecting the cell with a viral vector encoding the additional reprogramming factor. In another embodiment, said viral vector is a retrovirus or lentivirus.
Additional features and advantages are described herein, and will be apparent from the following Detailed Description, Drawings and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the generation of hiPSC lines with doxycycline-inducible expression of different subsets of reprogramming factors. Figure 1A shows a schematic representation of the rationale followed to obtain dFib-OCT4GFP-ind fibroblast-like cells expressing different subsets of reprogramming factors. The right side shows different combinations of retroviruses and lentiviruses used to express the reprogramming factors. Figure 1 B shows the results of real time PCR analysis performed for the pluripotent markers OCT4, SOX2, NANOG, the reprogramming factors KLF4 and cMYC, the fibroblast marker COL1A1 and for GFP. Data are shown as relative averages ± SD of two biological replicates analyzed in triplicate.
Figure 2 shows generation of dFib-OCT4GFP-ind lines with doxycycline-inducible expression of different subsets of reprogramming factors. Figure 2A shows the results of real time PCR analysis performed for the pluripotent markers OCT4, SOX2, NANOG, the reprogramming factors KLF4 and cMYC, the fibroblast marker COL1A1 and for GFP. Data are shown as relative averages ± SD of two biological replicates analyzed in triplicate.
Figure 2B shows the results of real time PCR analyses performed on dFib-OCT4GFP- indSKC, dFib-OCT4GFP-ind-OKC and dFib-OCT4GFP-ind-OSK cells infected with retroviruses encoding OCT4, SOX2 and cMYC respectively, and either untreated or treated with 100 ng/ml of doxycycline for 24 hours to detect the transcripts corresponding to the four reprogramming factors. No expression from the factors was delivered by retrovirus to generate originally the primary hiPSC lines. Data are shown as relative averages ± SD of two biological replicates analyzed in triplicate. Figure 2C shows cell cultures of the indicated dFib-OCT4GFP-ind cells which were infected with retroviruses encoding the missing reprogramming factor and treated with different doses of doxycycline for 18 days (upper wells). Uninfected cells either untreated or treated with doxycycline were used as negative controls of the experiment (lower wells). hiPSC colonies were detected by alkaline phosphatase staining.
Figure 3 shows miR-519a enhancement of reprogramming efficiency through TGFpRII downregulation. Figure 3A shows pictures of cell cultures of dFib-OCT4GFP-indOSK-1 1 infected with lentiviruses encoding the indicated miRNAs and treated with doxycycline. Relative reprogramming efficiency normalized to the efficiency observed in pmiR-000-
infected (a plasmid expressing a scrambled miRNA, taken as a control) cells is shown with the fold changes indicated in a second graph. Uninfected cells were used as a negative control for all experiments. n=number of independent experiments. All error bars depict the SD. A representative example of the colonies formed is shown (upper panel) (*=p<0.05; **=p<0.01 ). Figures 3B and 3C show a similar experiment as described for Figure 3A but BJ fibroblasts (CRL-2522, ATCC), infected with retroviruses encoding the three factors (B, OSK) or the four factors (C, OSKC) plus lentiviruses encoding the indicated miRNAs, were used instead (*=p<0.05; **=p<0.01 ). Figure 3D and 3E show cultures of BJ fibroblasts (D) or dFib-OCT4GFP-ind cells (E) infected with retroviruses encoding the three factors (OSK) and transfected at day 0 and 5 with 30nM of the indicated miRNA mimics. Relative reprogramming efficiency normalized to the efficiency observed in mimic-control cells, is shown with the fold changes indicated. n=number of independent experiments. All error bars depict the SD (*=p<0.05; **=p<0.01 ). Figure 3F shows a schematic representation of the putative target sites of miR-519a for the TGFpRII mRNA. Figure 3G shows real time PCR analysis used to detect the transcripts of TGFpRII in BJ fibroblasts that were either uninfected or infected with the indicated lentiviruses. Data are shown as relative averages ± SD of two biological replicates analyzed in triplicate.
Figure 4 shows identification of miRNAs strongly expressed in pluripotent cells or downregulated in somatic cell types. Samples plotted along the first and second principal components. Pluripotent cells notably group together.
DETAILED DESCRIPTION
The disclosure describes a human drug-inducible reporter system utilizing, by way of example, dFib-OCT4GFP-ind cells. This system presents a reliable, genetically homogenous and simple system that can be used for high-throughput screening of functional substitutes for reprogramming factors or modifiers of the reprogramming efficiency in manner. The reprogramming of these cells can easily be tracked by the reactivation of the endogenous OCT4 promoter through the appearance of GFP and by the only addition of doxycycline without the need of additional viral infections.
The disclosure also describes an example of this system for use in screening of pluripotent-enriched miRNAs, which uncovered new players of the reprogramming process. This screening of a pluripotent-enriched miRNA library identified unreported inducers of the reprogramming efficiency.
The data presented herein describe the existence of human pluripotent-specific miRNAs with the ability to increase the reprogramming efficiency. Of those, hsa-miR-519a (SEQ ID NO: 3) emerged as a potent inducer of pluripotency likely through the downregulation of TGFpRII.
The section headings are used herein for organizational purposes only, and are not to be construed as in any way limiting the subject matter described. The invention as disclosed herein is not limited to the particular methodology, protocols, cell lines, vectors, or reagents described herein because they may vary without departing from the spirit and scope of the invention.
Conventional and standard techniques may be used for recombinant DNA molecule, protein, and antibody production, as well as for tissue culture and cell transformation. Enzymatic reactions and purification techniques are typically performed according to the manufacturer's specifications or as commonly accomplished in the art using conventional procedures known in the art, or as described herein. Unless specific definitions are provided, the nomenclature utilized in connection with, and the laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
Further, the terminology used herein is for the purpose of exemplifying particular embodiments only and is not intended to limit the scope of the invention as disclosed herein. Any method and material similar or equivalent to those described herein can be used in the practice of the invention as disclosed herein and only exemplary methods, devices, and materials are described herein.
All patents and publications mentioned herein are incorporated by reference in their entirety for the purpose of describing and disclosing the proteins, enzymes, vectors, host cells, and methodologies reported therein that might be used with and in the invention as disclosed herein. However, nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
As used herein, "NANOG" is human NANOG protein, which is a 305 amino acid protein with a conserved homeodomain motif that is localized to the nuclear component of cells. The NANOG homeodomain region facilitates DNA binding.
As used herein, the term "TRA-1-60" means a keratan sulfate antigen found on the surface of stem cells.
The terms "cell," "cell line," and "cell culture" include progeny thereof. It is also understood that all progeny may not be precisely identical, such as in DNA content, due
to deliberate or inadvertent mutation. Variant progeny that have the same function or biological property of interest, as screened for in the original cell, are included. In certain embodiments, the cell is a somatic cell or a pluripotent cell. In certain embodiments, the cell is a human somatic cell.
Provided herein is a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA. As used herein, "reprogramming" means the process of changing or inducing a cell from a more differentiated state into a less differentiated state. Changing or inducing a differentiated somatic cell to de-differentiate into a pluripotent cell or induced pluripotent cell (iPSC), is accomplished through the process of reprogramming, as non-limiting examples. "Enhancing reprogramming" as used herein, means improving the ability of a cell to change its type.
In a certain embodiment, the cell is a somatic cell that is to be changed into a pluripotent stem cell. As used herein, a "somatic cell" is any biological cell other than a gamete, germ cell, gametocyte or undifferentiated stem cell and refers to differentiated body cells. Induced pluripotent stem cells (iPS cells or iPSCs) are a type of pluripotent stem cell artificially derived from a non-pluripotent cell, typically an adult somatic cell, by the induction of expression of certain embryonic genes or "reprogramming factors" as used herein. Induced pluripotent stem cells are similar to natural pluripotent stem cells, such as embryonic stem (ES) cells, in many aspects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.
"Differentiation" as used herein, refers to process through which a stem cell loses its capacity for self-renewal and becomes a mature and definitive cell-type i.e., a differentiated cell, thereby acquiring the features of a specialized cell.
As used herein, "exposing" encompasses any means by which a miRNA or reprogramming factor becomes associated with a cell or with cell function. In certain embodiments, the cell is exposed to a miRNA or reprogramming factor by "contacting" the cell with the miRNA or reprogramming factor. Contacting can be achieved, for example, by adding a reprogramming factor to the cell media. In another embodiment, the cell is exposed to a miRNA or reprogramming factor by "infection." In specific embodiments, cell infection is accomplished via infection by retrovirus or lentivirus. Are also encompassed in the notion of "contacting" or "exposing" a cell to miRNAs or reprogramming factors in the present invention, numerous transfection methods evident for the skilled in the art which actively favors the contact between a cell and miRNAs and/or reprogramming factors by their intracellular delivery.
As used herein "miRNA(s)" refers to 20-24 nucleotide RNAs that are 22 nucleotide non- coding RNAs that regulate eukaryotic gene expression post-transcriptionally by the degradation or translational inhibition of their target messenger RNAs (mRNAs) (Bartel, 2009, Cell 136(2): 215-33). miRNAs are initially transcribed as primary microRNAs (pri- miRNAs) followed by a two step processing into precursor miRNAs (pre-miRNAs) then mature microRNAs and incorporation into the RNA-induced silencing complex (RISC). Mature microRNAs downregulate their target-mRNAs by sequence-specific base-pairing with their 3'-untranslated regions (3'-UTRs) and act as key regulatory molecules in various cellular processes like proliferation, differentiation, apoptosis and metabolism. Most mRNA-miRNA targeting occurs through incomplete nucleotide complementation between a short sequence located in the 5' region of the miRNA (the "seed sequence") and the 3' UTR of its mRNA target. As an illustrative example, the seed sequence of has- miR-519a (SEQ ID NO: 3) is AAGUGCA (SEQ ID NO: 28). A single miRNA can target hundreds of different mRNAs and multiple pathways that make them powerful regulators of cell function. Under a standard nomenclature system, the double-stranded precursor miRNA is noted "pre-mir-" or "mir-" and the single-stranded mature miRNA is noted "miR- ", all followed by a number naming said miRNA. Species of origin is designated with a three-letter prefix, e.g., has-miR-429 (SEQ ID NO: 9) is a human (Homo sapiens) miRNA and oar-miR-429 is a sheep (Ovis aries) miRNA. miRNAs with nearly identical sequences except for one or two identical nucleotides are annotated with an additional lower case letter. For example, hsa-miR-517c (SEQ ID NO: 6) differs from has-miR-517a (SEQ ID NO: 7) by only one nucleotide. Pre-miRNAs that lead to 100% identical mature miRNAs but that are located at different places in the genome are indicated with an additional dash-number suffix. For example, has-mir-519a-1 and has-mir-519a-2 are distinct pre- miRNAs that generate the same mature miRNA: has-miR-519a (SEQ ID NO: 3). When two mature miRNAs originate from opposite arms of the same pre-miRNA, they are denoted with a -3p or -5p suffix as for example for has-miR-512-3p (SEQ ID NO: 8).
Also provided herein is a method for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) one, two or more reprogramming factors. As for the method provided herein for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA, in certain embodiments, the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR-302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-363 (SEQ ID NO: 14), hsa-miR-371 -3p (SEQ ID NO: 18), hsa- miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO:
9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa- miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ). In other embodiments, the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR- 519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ). In a specific embodiment, the miRNA is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512- 3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In another specific embodiment, the miRNA is hsa-miR-429 (SEQ ID NO: 9) or hsa-miR-519a (SEQ ID NO: 3). In another specific embodiment, provided herein is a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to hsa-miR-519a (SEQ ID NO: 3). In another specific embodiment, provided herein is a method for reprogramming a somatic cell comprising the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) one, two or more reprogramming factors. In other embodiments, the cell is exposed to the miRNA by contacting the cell with the miRNA or by expressing it after the delivery inside cell of a vector encoding said miRNA. As immediately apparent to the skilled in the art, throughout the present invention, miRNAs may be replaced with primary miRNAs transcripts or precursors miRNA (pre-miRNAs) leading to them upon maturation, or chemically synthetized molecules equivalent to these molecular species; as an illustrative example, miRNAs of the present invention may be replaced by miRNA mimics such as miScript miRNA Mimics (Qiagen) which are chemically synthetized, double-stranded RNAs which mimic mature endogenous miRNAs after transfection into cells. miRNAs of the present invention may originate from numerous organisms; as a non-limiting example, miRNAs of the present invention may originate from mammals. As another non-limiting example, miRNAs may originate from human, i.e. being a human miRNA. miRNAs, as used herein in the methods of the present invention, also encompass miRNAs which share the same seed sequence than selected miRNAs. As a first non-limiting example, is
provided herein a method for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA, wherein said miRNA shares the same seed sequences than miRNAs selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In other words, a method is provided herein for enhancing reprogramming in a somatic cell comprising the step of exposing the cell to a miRNA, wherein said miRNA comprises a seed sequence selected from the group of SEQ ID NO: 27-33. As a second non-limiting example, a method is provided herein for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA which shares the same seed sequence than hsa-miR-519a (SEQ ID NO: 3) and (ii) one, two or more reprogramming factors. In other words, a method is provided herein for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) one, two or more reprogramming factors. It is intended than the methods of the present invention can notably be carried out in vitro.
Are encompassed in the scope of the present invention, miRNAs according to the present invention for enhancing the reprogrammation of a somatic cell. Are also encompassed in the scope of the present invention, miRNAs according to the present invention for reprogramming a somatic cell by contacting said cell with at least said miRNAs. Are also encompassed in the present invention, use of miRNAs according to the present invention for enhancing the reprogrammation of a somatic cell.
The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A "vector" in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acids. In specific embodiments, vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available. In another embodiment, the cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA.
Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adenoassociated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-
stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). In one embodiment, the viral vector is a retrovirus or lentivirus. As used herein, the term "retrovirus" means an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host's genome by an integrase enzyme. The virus thereafter replicates as part of the host cell's DNA. Retroviruses are enveloped viruses that belong to the viral family Retroviridae. As used herein, the term "lentivirus" means a genus of viruses of the Retroviridae family, characterized by a long incubation period. Lentiviruses can deliver a significant amount of viral RNA into the DNA of the host cell. In certain embodiments a lentivirus is HIV, SIV, BIV, Equine Infectious Anemia Virus, Maedi- visna Virus or Caprine Encephalitis Arthritis Virus as illustrating examples. Lentiviral vectors derived from such lentivirus can be integrative or non-integrative.
In another embodiment, the method herein further comprises exposing the cell to a second miRNA. In certain embodiments, the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR-302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR- 520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-363 (SEQ ID NO: 14), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa- miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ).. In other embodiments, the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa- miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR- 520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ). In a specific embodiment, the second miRNA is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-
3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In another specific embodiment, the cell is exposed to the second miRNA by contacting the cell as explained above with the second miRNA or infecting the cell with a viral vector encoding the second miRNA. In a specific embodiment, the viral vector is a retrovirus or lentivirus. In another embodiment, the method for enhancing reprogramming in a somatic cell herein comprises the step of exposing the cell to more than one miRNA, i.e., exposing the cell to successive miRNAs or to a combination of two, three, four or five miRNAs selected from the groups mentioned above.
As used herein, "reprogramming factors" include proteins, small molecules, and miRNAs capable of inducing reprogramming, or nucleic acid encoding for such proteins or miRNAs. Examples of reprogramming factors include but are not limited to OCT4, SOX2, KLF4, and cMYC. Additional reprogramming factors may be C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 (as reviewed in Stadtfeld and Hochedlinger, 2010, Genes Dev. 24(20): 2239-63, Nakhaei-Rad et al, 2012 Biochem. Cell. Biol 90: 1 15-123 and in Mochiduki and Okita, 2012 Biotechnol. J. 7: 789-797) or small molecules e.g. those described in International Publication No. WO2010/068955 such as 6-bromoindirubin-3'- oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)- 1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino- 3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2, as non-limiting examples.
As used herein, "Oct-4" is a transcription factor that is initially active as a maternal factor in the oocyte but remains active in embryos throughout the pre-implantation period. Oct-4 expression is associated with an undifferentiated phenotype and tumors. Gene knockdown of Oct-4 promotes differentiation, thereby demonstrating a role for these factors in human embryonic stem cell self-renewal. Oct-4 can form a heterodimer with Sox2, allowing these two proteins to bind DNA together. It has been shown that reactivation of the OCT4 promoter is a very reliable marker to identify fully reprogrammed mouse cells for screening purposes (Shi et al., 2008, Cell Stem Cell 3(5): 568-74; lchida et al., 2009, Cell Stem Cell 5(5): 491-503).
As used herein SRY (sex determining region Y)-box 2, also known as "SOX2," is a transcription factor that is essential for maintaining self-renewal, or pluripotency, of undifferentiated embryonic stem cells. Sox2 is a member of the Sox family of transcription factors, which have been shown to play key roles in many stages of mammalian development. This protein family shares highly conserved DNA binding domains known as HMG (High-mobility group) box domains containing approximately 80
amino acids. Sox2 has a critical role in maintenance of embryonic and neural stem cells (Avilion et al., 2003, Genes and Development 17: 126-140).
As used herein, Krueppel-like factor 4 or "KLF4" is a protein that in humans is encoded by the KLF4 gene. In embryonic stem cells (ESCs), KLF4 has been demonstrated to be a good indicator of stem-like capacity. As used herein, "cMyc" is a regulator gene that codes for a transcription factor that is known to be involved with certain cancers.
In a certain embodiment, the cell is exposed to the reprogramming factors by contacting the cell with the reprogramming factors. In a specific embodiment, the cell is exposed to the reprogramming factors following transformation by one or several vectors expressing said reprogramming factors. In a specific embodiment, the cell is exposed to the reprogramming factors by infecting the cell with one or more viral vectors encoding the reprogramming factors. In one embodiment, at least one of the viral vectors is a retrovirus or lentivirus.
Provided herein is a method for reprogramming a somatic cell comprising the step of exposing the cell to at least (i) a miRNA and (ii) one, two or more reprogramming factors said one, two or more reprogramming factors being selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 and/or from the group of small molecules selected from the group consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4, 5,6,7- tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
In a specific embodiment, provided herein is a method for reprogramming somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein said two reprogramming factors are selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 .
In another specific embodiment, provided herein is a method for reprogramming somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein said two reprogramming factors are selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) two reprogramming factors wherein one of said reprogramming factors is selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utfl , SV40LT and Glis1 and the other one is selected from the group of small molecules consisting of 6- bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4, 5,6,7- tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
In another embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) more than two reprogramming factors, i.e., three, four, five or six reprogramming factors. In this embodiment, said three, four, five or six reprogramming factors can be selected from the group of proteins consisting of OCT4, SOX2, KLF4, cMYC, C/EBPot, Lin28, Orphan nuclear receptors Esrrb and Nr5a2, Sox1 , Sox3, Klf2, Klf5, N-Myc, L-Myc, Tert, Sall4, Tbx3 Wnt3a, Utf1 , SV40LT and Glis1 and/or can be selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2. It is well understood in this case that all combinations of reprogramming factors selected from both proteins and small molecules categories of reprogramming factors are encompassed in the scope of the method provided herein.
In a specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2 and KLF4 reprogramming factors. In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) OCT4, SOX2 and KLF4 reprogramming factors. In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) OCT4, SOX2 and KLF4 reprogramming factors. In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime
(INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4- Methylphenyl)-2-(4,5,6J-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), I nd i ru bi n-5-n itro-3'- oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2. In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA wherein said miRNA comprises a seed sequence of SEQ ID NO: 28 and (ii) OCT4, SOX2, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6- bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6- Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1 -(4-Methylphenyl)-2-(4, 5,6,7- tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, cMYC and KLF4 reprogramming factors.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, cMYC and KLF4 reprogramming factors.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) OCT4, SOX2, cMYC, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro- 3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5- naphthyridine, 1 -(4-Methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl) ethanone HBr, Pifithrin-alpha, Prostaglandin J2 and Prostaglandin E2. In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a and (ii) OCT4, SOX2, cMYC, KLF4 reprogramming factors and a fourth reprogramming factor selected from the group of small molecules consisting of 6-bromoindirubin-3'-oxime (BIO), lndirubin-5-nitro-3'-oxime (INO), Valproic acid, 2-(3-(6-Methylpyridin-2-yl)-1 H-pyrasol-4-yl)-1 ,5-naphthyridine, 1-(4-
Methylphenyl)-2-(4,5,6J-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone HBr, Pifithrin- alpha, Prostaglandin J2 and Prostaglandin E2.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) a miRNA and (ii) at least one reprogramming factor or a combination of reprogramming factors as listed in Table 2 of Stadtfeld and Hochedlinger and / or in Tables 1 of respectively Nakhaei-Rad et al, 2012 and Mochiduki and Okita, 2012, all incorporated here by reference.
In another specific embodiment, the method for reprogramming somatic cell provided herein comprises the step of exposing the cell to (i) hsa-miR-519a (SEQ ID NO: 3) and (ii) at least one reprogramming factor or a combination of reprogramming factors as listed in Table 2 of Stadtfeld and Hochedlinger and / or in Tables 1 of respectively Nakhaei-Rad et al, 2012 and Mochiduki and Okita, 2012.
In one embodiment, the method as described herein further comprises exposing the cell to a second miRNA. In certain embodiments, the miRNA is selected from the group consisting of hsa-miR-302a (SEQ ID NO: 23), hsa-miR-302b (SEQ ID NO: 22), hsa-miR- 302d (SEQ ID NO: 20), hsa-miR-302c (SEQ ID NO: 21 ), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-363 (SEQ ID NO: 14), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa- miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa-miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR- 520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ). In other embodiments, the miRNA is selected from the group consisting of hsa-miR-363 (SEQ ID NO: 14), hsa- miR-200c (SEQ ID NO: 13), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-141 (SEQ ID NO: 15), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-519b-3p (SEQ ID NO: 2), hsa-miR-512-3p (SEQ ID NO: 8), hsa-miR-517a (SEQ ID NO: 7), hsa- miR-517c (SEQ ID NO: 6), hsa-miR-518b (SEQ ID NO: 5), hsa-miR-518e (SEQ ID NO: 4), hsa-miR-520h (SEQ ID NO: 24), hsa-miR-520g (SEQ ID NO: 25), hsa-miR-519d (SEQ ID NO: 1 ), hsa-miR-20b (SEQ ID NO: 10) and hsa-miR-205 (SEQ ID NO: 1 1 ). In a specific embodiment, the second miR is selected from the group consisting of hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-519a (SEQ ID NO: 3), hsa-miR-200b (SEQ ID NO: 12), hsa- miR-520c-3p (SEQ ID NO: 26), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10). In a specific embodiment, the cell is
exposed to the second miRNA by contacting the cell with the second miRNA or by infecting the cell with a viral vector encoding the second miRNA. In one embodiment the viral vector is a retrovirus or lentivirus.
Provided herein is a method for reprogramming or enhancing reprogramming in a somatic cell comprising the step of exposing the cell to (i) hsa-miR-519a and (ii) the reprogramming factors OCT4, SOX2, and KLF4. In an embodiment, the cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by contacting the cell with hsa-miR-519a (SEQ ID NO: 3). In another specific embodiment the cell is exposed to hsa-miR-519a (SEQ ID NO: 3) by infecting the cell with a viral vector encoding hsa-miR-519a (SEQ ID NO: 3). In another embodiment the viral vector is a retrovirus or lentivirus.
In one embodiment, the cell is exposed to the reprogramming factors by contacting the cell with the reprogramming factors. In certain embodiments, the cell is exposed to the reprogramming factors by infecting the cell with one or more viral vectors encoding the reprogramming factors. In other embodiments, at least one of the viral vectors is a retrovirus or lentivirus.
Provided herein is a method for reprogramming or enhancing reprogramming in a somatic cell comprising the step as described throughout the present specification wherein the somatic cell is a human cell. In certain embodiments, the cell is a cell line derived from human cells. As non-limiting examples, cell lines may be 293T cells or BJ fibroblasts. In one embodiment the method as disclosed herein comprises exposing the cell to an additional reprogramming factor, wherein the additional reprogramming factor is a reprogramming factor other than OCT4, SOX2, or KLF4. In a specific embodiment, the cell is exposed to the additional reprogramming factor by contacting the cell with the additional reprogramming factor. In a certain embodiment the cell is exposed to the additional reprogramming factor by infecting the cell with a viral vector encoding the additional reprogramming factor, in one embodiment the viral vector is a retrovirus or lentivirus.
Another object of the present invention is a composition which comprises, as active principle, a miRNA according to the present invention. This composition comprises an effective dose of said miRNA and at least one suitable excipient appropriate with the use of said composition.
Are also encompassed in the scope of the present invention, kits to implement the methods of the present invention, comprising at least one miRNA according to the present invention and instructions to use it in order to reprogram or enhance the reprogrammation of a somatic cell.
Materials and Methods
1. hES cell culture and differentiation
H1 (WA01 ), H7 (WA07), H9 (WA09) and H1 -OCT4GFP embryonic stem cell lines were obtained from WiCell Research Institute and maintained on mouse embryonic fibroblasts (MEFs) or Matrigel (BD Biosciences) using mTeSRI medium (Stem Cell Technologies). hESC colonies were split using a solution of dispase (2 mg/ml) or collagenase (1 mg/ml) and scraping the colonies with a glass pipette. Derived hiPSCs were cultured similarly as described above for hESCs. 293T cells and dFib-OCT4GFP fibroblast-like cells and BJ human fibroblasts (ATCC, CRL-2522) were cultured in DMEM (Invitrogen) supplemented with 10% FBS and 0.1 mM non-essential amino acids. Commercial primary cells obtained from ATCC, Lonza and Promocell (see table 1 below) were cultured according to the recommendations of the supplier.
2. Human hiPSC generation
For the generation of human primary hiPSCs derived from dFib-OCT4GFP cells, a mix of retroviruses plus lentiviruses was used to infect the fibroblast-like cells by spinfection at 1850 rpm for 1 hour at room temperature in the presence of polybrene ^g/ml). As an example, for the generation of hiPSC-OCT4GFP-indSKC, the ratio of viruses used was 0.5:0.05:0.05:0.05:0.15 (pMX-OCT4:pLVFUtetO-SOX2:pLVFUtetO-KLF4:pLVFUtetO- cMYC:FUdeltaGW-rtTA). Similarly, the remaining hiPSC lines were obtained by using different combinations of retroviruses and lentiviruses. After two serial infections, cells were plated onto fresh MEFs with DMEM (Invitrogen), 10% FBS and 0.1 mM nonessential amino acids supplemented with 100ng/ml (unless otherwise specified) of doxycycline. The following day, cells were switched to hESC medium:DMEM/F12 (Invitrogen) supplemented with 20% Knockout Serum Replacement (KOSR, Invitrogen), 1 mM L-glutamine, 0.1 mM non-essential amino acids, 55 μΜ β-mercaptoethanol, 10 ng/ml bFGF (Joint Protein Central) and 100ng/ml doxycycline. For the derivation of the hiPSC lines, GFP-positive colonies were manually picked and maintained on fresh MEF feeder layers for five passages before growth in Matrigel/mTesRI conditions. For the generation of secondary hiPSC lines, the corresponding dFib-OCT4GFP fibroblast-like cells were serially infected twice with retroviruses encoding the missing reprogramming factor or with miRNA-encoding lentiviruses. Immediately after the second infection, cells were incubated with DMEM (Invitrogen), 10% FBS and 0.1 mM non-essential amino acids supplemented with 100ng/ml (unless other specified) of doxycycline and two days later plated onto fresh MEFs or Matrigel. The following day, cells were switched to hESC medium supplemented with doxycycline until colonies appeared in the well. In all cases,
hiPSC colonies were stained for either alkaline phosphatase (AP) or NANOG expression, or used to establish independent cell lines. hiPSC43A2, hiPSC43B2, hiPSC43D6 and hiPSC57A5, hiPSC57A7, hiPSC57B7 lines were generated from human fibroblasts CRL- 2429 and CRL-2522 using the commercial polycistronic lentivirus STEMCCA encoding the four reprogramming factors (Millipore, SCR510). F1 hiPSC4F line was generated from F1 fibroblasts using the polycistronic lentivirus STEMCCA. CBhiPSC2F3, CBhiPSC3F12 and CBhiPSC4F3 lines were generated from human cord blood samples by retroviral infection. These hiPSC lines were maintained on MEFs or human feeder fibroblasts using KO DMEM medium (Life Technologies) in the presence of KOSR (Life Technologies) supplemented with 0.1 mM non-essential amino acids, 0.1 mM mercaptoethanol, 1x glutamax and 10 ng/ml bFGF (Life Technologies).
3. Evaluation of reprogramming efficiency
To calculate the efficiency of reprogramming, the same number of dFib-OCT4GFP fibroblast-like cells was plated on MEFs after the infection. The relative percentage of AP or NANOG+ colonies is shown as fold change relative to the value of the number of colonies generated with dFib-OCT4GFP fibroblast-like cells infected with pmiR-000 lentiviruses (which encoded for a control miRNA). At least two independent experiments were performed by triplicate for verification.
4. Plamids
pMX-OCT4, pMX-SOX2, pMX-KLF4, pMX-cMyc, FUdeltaGW-rtTA, pLVFUtetO-OCT4, pLVFUtetO-SOX2, pLVFUtetO-KLF4 and pLVFUtetO-cMYC were obtained from Addgene (plasmids 17217, 17218, 17219, 17220, 19780, 19778, 19779, 19777 and 19775 respectively). The lentiviral vectors encoding specific miRNAs (pMIRNAI ) were purchased to SBY, System Biosciences.
5. Retroviral and lentiviral production
Moloney-based retroviruses were generated as described. Third generation lentiviral vectors (pLV-FU-tetO and pMIRNA) were co-transfected with packaging plasmids (pMDL, REV and VSVg, kindly provided by Dr. Oded Singer, Laboratory of Genetics Lab, The SALK Institute, La Jolla, CA) in 293T cells using Lipofectamine (Invitrogen). Supernatants were collected and passed through a 0.45 μΜ filter to remove cellular debris.
6. Immunostainings
Imnunodetection of pluripotent markers in hiPSCs or of differentiation-associated markers in embryoid bodies or teratomas was performed as described in Ruiz et al., 201 1. Cells were fixed with 4% paraformaldehyde in PBS for 15 minutes, washed in PBS and incubated with 0.5% Triton-X100 in PBS for 10 minutes and blocked with 5 % normal donkey serum in 1 % PBS-BSA for 1 hour at RT. Antibodies against NANOG (Abeam, Ab21624), TRA-1 -60 (Chemicon, MAB4360), AFP (DAKO, A0008), FOXA2 (R&D, AF2400), TUJ1 (Covance, MMS-435-P), Alpha-smooth muscle actin (ASMA) (Sigma, A5228), Alpha-sarcomeric actin (ASA) (Sigma, A2172) and GFAP (Dako, AB1980) diluted in 1 % PBS-BSA were used for overnight incubation at 4°C. After extensive washes with PBS, cells were incubated with secondary biotin-conjugated anti-rabbit antibody, AlexaFluor 488 or 568 (Invitrogen) anti-mouse, rabbit or goat antibodies where correspond for an additional 2 hours at room temperature. For the immunodetection of NANOG, cells were afterwards incubated with streptavidin-HRP (Vector) and a DAB substrate kit for peroxidase (Vector, SK-4100) was used to develop the staining. DAPI was used to visualize nuclei at a concentration of 10μg ml in PBS.
7. RNA isolation and real time-PCR analysis
Total RNA was obtained using Trizol Reagent (Invitrogen) according the manufacturer's recommendations. The reverse transcription (RT) step was performed with 2μg of total RNA using the RT Supermix M-MuLV kit (BioPioneer). 0.25 μΙ of the final reaction was used to quantify gene expression by real time PCR using the SYBR-Green PCR Master mix (Applied Biosystems) in the ViiA 7 Real Time PCR System (Applied Biosystems). Values of gene expression were normalized using GAPDH expression and data is shown as fold change relative to the value of the sample control. All reactions were done in triplicate. Lists of the primers used for real time-PCR experiments are available in Panopoulos et al., 201 1 , PLoS One 6(5): e19743, and in Maherali et al., 2008, Cell Stem Cell 3: 340-45, each incorporated herein by reference. For the miRNA arrays, total RNA (including small RNA) from the samples indicated in the table below was extracted from 3- 106 cells by using RNeasy® Mini Kit (Qiagen) according to manufacturer's protocols. RNA was quantified on a NanoDrop 8000 spectrophotometer (Thermo Scientific). For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used.
Table 1 : Samples profiled on miRNA arrays.
Sample name Cell type Origin
CRL-2429 Neonatal fibroblasts ATCC
CRL-2522 BJ foreskin fibroblasts ATCC
CC-251 1 Adult fibroblasts Lonza
CC-2509 Neonatal fibroblasts Lonza
CDMPRO Melanocytes Promocell
WA01 ESC H1 cell line Wicell
WA07 ESC H7 cell line Wicell
WA09 ESC H9 cell line Wicell hiPSC43A2 CRL-2429 fibroblasts reprogrammed with
lentivirus STEMCCA
hiPSC43B2 CRL-2429 fibroblasts reprogrammed with
lentivirus STEMCCA
hiPSC43ID6 CRL-2429 fibroblasts reprogrammed with
lentivirus STEMCCA
hiPSC57A5 CRL-2522 fibroblasts reprogrammed with
lentivirus STEMCCA
hiPSC57A7 CRL-2522 fibroblasts reprogrammed with
lentivirus STEMCCA
hiPSC57B7 CRL-2522 fibroblasts reprogrammed with
lentivirus STEMCCA
F1 hiPSC4F F1 fibroblasts reprogrammed with lentivirus
STEMCCA
CBhiPSC4F3 umbilical cord blood cells reprogrammed with
retroviruses encoding OCT4, SOX2, KLF4
and cMYC
CBhiPSC3F12 umbilical cord blood cells reprogrammed with
retroviruses encoding OCT4, SOX2 and KLF4
CBhiPSC2F3 umbilical cord blood cells reprogrammed with
retroviruses encoding OCT4 and SOX2
8. miRNA quantitation and data normalization
Megaplex profiling using human TaqMan Low Density miRNA Arrays (TLDA) (Applied Biosystems) was used to evaluate the expression of 667 miRNAs as described by the manufacturer. 600 ng of total RNA were used in two Megaplex reverse transcription (RT) reactions containing each one, a pool of Megaplex RT primers designed to detect and quantify up to 380 miRNAs and controls in a single reaction. No prior miRNA pre- amplification step was needed. Each reverse transcribed product was mixed with 2X TaqMan Universal PCR Master Mix, without AmpErase UNG (Applied Biosystems) and loaded onto a TLDA v2.0 containing 380 TaqMa miRNAs assays. TLDAs were run on a 7900HT Thermocycler (Applied Biosystems) using Sequence Detection Systems (SDS) software version 2.3. Data analysis was performed using SDS RQ manager v1.2 (Applied Biosystems) which utilizes the delta-delta CT method. The threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence exceeds the fixed threshold of 0.1. For each sample, the median of the CT values from detected signals was used to normalize the RNA input. A total of 26 miRNAs were identified as uniquely or strongly expressed in pluripotent cells compared to somatic cells (see Table 2 for list of miRNAs).
9. Derivation and validation of dFib-OCT4GFP cells
For differentiation of pluripotent cells into fibroblast-like cells by forming embryoid bodies (EBs), pluripotent cell colonies growing on Matrigel were loosely detached by dispase treatment, resuspended in DMEM/F12 supplemented with 10% FBS (Atlanta Biologicals), 0.5 mM L-glutamine, 0.1 mM non-essential amino acids and 55 μΜ β-mercaptoethanol and maintained on low attachment plates with daily media changes. After four days in suspension, EBs were plated onto gelatin-coated tissue culture plates and maintained in EB media for two additional days followed by their maintenance in DMEM, 10% FBS and 1 % NEAA, until cells showed fibroblast morphology. Derived fibroblasts-like cells were serially passaged by using Tryple (Invitrogen) and tested for loss of pluripotent marker as well as GFP expression, and gain of expression of fibroblast markers. 10. AP-staining
For AP staining, cells were fixed in a solution of 4% paraformaldehide in PBS for 20 minutes. After extensive washes in PBS, cells were incubated in NTMT solution (10 mM NaCI, 100 mM Tris-HCI (pH 9), 50 mM MgCI2 and 0.1 % Tween-20) for 5 minutes and then in NTMT solution supplemented with NBT (Nitro-Blue Tetrazolium Chloride) and
BCIP (5-Bromo-4-Chloro-3'-lndolyphosphate p-Toluidine Salt) in the dark until the staining was developed.
11. Reprogramming with miRNA-mimics
For the evaluation of the reprogramming efficiency after transfection with miRNA-mimics, BJ fibroblasts were infected only once by spinfection with a mix of retroviruses encoding OCT4, SOX2 and cMYC (day 0). At days 0 and 5 after initial infection, cells were transfected with miRNA-mimics (obtained from Qiagen) at 30 nM final concentration using Lipofectamine (Invitrogen) following manufacturer's recommendations. At day 6, cells were transferred onto fresh MEFs with DMEM (Invitrogen), 10% FBS and 0.1 mM nonessential aminoacids. The following day, cells were switched to hESC medium (see above in section 2) until hiPSC colonies developed.
12. Statistical analyses
To obtain the list of miRNAs enriched in pluripotent cells, the results of three statistical procedures we accounted for. Pearson correlation (GeneSpring version 1 1 .5.1 software, Agilent) was employed to identify and rank miRNAs with expression profiles similar to that of hsa-miR-302a, which miRNA is reportedly associated with pluripotency. Then, hypothesis-free hierarchical clustering (Ward method) and a principal components analysis (SPSS Statistics® version 19 software, IBM) were used . Briefly, the samples were first classified into two main clusters: pluripotent samples and somatic cells. A two- tailed Student's-T test was used for evaluating the significance of the difference in expression levels of each miRNA between the two groups. The 177 major miRNAs which presented a significant (p<0.05) difference between those two groups were then used in the principal components analysis. The first principal component separated the hiPSC lines from the differentiated cells and was, therefore, interpreted as the pluripotency component (see Figure 4). The loading coefficients of principal component 1 ranked the miRNAs as predictors of pluripotency. Lastly, the expression levels of the miRNAs in each sample-group were binned into four categories: +++ (high); ++ (medium); + (low); - (no expression). On the basis of the ranks of each miRNA resulting from the above statistical tests and its binned expression levels, 26 miRNAs were selected. The chromosome-19 cluster of miRNA genes is referred to as C19MC. TargetSca miRNA families are as described in http://www.targetscan.org, whereas hairpin families (mir-#) are as described in http://www.mirbase.org/ftp.shtml (miRBase file: hairpin.fa). Gene expression levels are
reported as mean ± SD. The number of biological replicates, independent experiments and technical replicates are given in the Brief Description of the Drawings section.
EXAMPLES
The invention now will be exemplified for the benefit of the artisan by the following non- limiting examples that depict some of the embodiments by and in which the invention can be practiced. Example 1 : Human inducible system for reprogramming of cells
Cell reprogramming was facilitated by the fact that retroviral expression of exogenous factors is epigenetically silenced after the reactivation of the pluripotent endogenous network, whereas the expression of the reprogramming factors delivered by lentiviruses can be still modulated by doxycycline independently of the somatic or pluripotent cell state. Takahashi and Yamanaka, 2006, Cell 26: 663-76. Therefore, infecting dFib- OCT4GFP cells with a combination of retrovirus expressing one factor and a mix of inducible lentiviruses expressing the remaining three factors allowed for generation of primary hiPSCs (hiPSC-OCT4GFP) (see Figure 1A). These cells can then be differentiated towards fibroblasts-like cells which retain the ability to re-express the three lentiviral- delivered reprogramming factors after the addition of doxycycline while the remaining retroviral-delivered factor will not be expressed. By infecting dFib-OCT4GFP cells with retroviruses expressing OCT4 (pMX-OCT4) and lentiviruses expressing SOX2, KLF4 and cMYC (pLVFUtetO-SOX2, KLF4 and cMYC) hiPSCs-OCT4GFP-indSKC were generated that could be further differentiated towards fibroblast-like cells (dFib-OCT4GFP-indSKC) (Figures 1A). dFib-OCT4GFP-indSKC cells express SOX2, KLF4 and cMYC after the addition of doxycycline but not OCT4. Under the proper culture conditions these cells do not reprogram unless exogenous OCT4 or a functional OCT4 substitute is supplied to the cells and detection of GFP can be used to identify fully reprogrammed cells. This cellular system represents a useful tool for screen functional substitutes of the reprogramming factors or new players in the reprogramming process.
dFib-OCT4GFP cells were infected with different combinations of retroviruses and drug- inducible lentiviruses. This led to the successful generation of primary hiPSC-OCT4GFP colonies (Figures 1A). Four hiPSC-OCT4GFP-SKC, four hiPSC-OCT4GFP-OKC, and nine hiPSC-OCT4GFP-OSK lines were isolated and expanded in the absence of doxycycline. Based on the expression of the reprogramming factors after the addition of doxycycline in
these hiPSC-OCT4GFP lines, the hiPSC-OCT4GFP-SKC-2 and 4, hiPSC-OCT4GFP-OKC-2 and hiPSC-OCT4GFP-OSK-10 and 1 1 lines were selected for further analysis. These reprogrammed cells were first verified for regained expression of GFP, expression of endogenous pluripotent markers, and downregulation of fibroblast markers (Figure 1 B). The pluripotency of these hiPSC lines was confirmed as they differentiated in vitro and contributed in vivo to the three embryonic germ layers.
The hiPSC-OCT4GFP lines were then differentiated using an embryoid body protocol to obtain morphologically fibroblast-like cells (dFib-OCT4GFP-ind). It was next determined that the different dFib-OCT4GFP-ind fibroblast-like cells regained the expression of fibroblasts markers, downregulated the expression of pluripotent markers and lost the expression of GFP (Figure 2A). It was also observed that treatment of dFib-OCT4GFP-ind cells with doxycycline induced the expression of the lentiviral-delivered reprogramming factors, but not the expression of the factor initially supplied by retroviral infection (Figure 2A).
Example 2: Functional validation of the human reprogramming system
Populations of dFib-OCT4GFP-ind cells were validated for having the ability to reprogram back into pluripotency by the addition of doxycycline and supplying of a missing reprogramming factor. To accomplish this, dFib-OCT4GFP-indSKC, dFib-OCT4GFP- indOKC, and dFib-OCT4GFP-indOSK cells were infected with retroviruses encoding OCT4, SOX2, and cMYC, respectively, and incubated with or without doxycycline in the culture media. They were then compared to untreated cells to evaluate their reprogramming abilities. First determined was the optimal concentration of doxycycline to reprogram the dFib-OCT4GFP-ind cells (it has been reported that the level of expression of reprogramming factors can influence the efficiency of the reprogramming process) (Figure 2A). It was observed that in the case of dFib-OCT4GFP-indSKC and dFib-OCT4GFP- indOKC cells, reprogrammed colonies were only obtained when doxycycline and the missing factor were supplied to the cells. However, dFib-OCT4GFP-indOSK could reprogram, although with much lower reprogramming efficiency, by the addition of doxycycline only. The appearance of reprogrammed colonies from dFib-OCT4GFP-ind cells correlated with the expression of GFP. Moreover, GFP-positive hiPSCs also expressed pluripotent markers such as NANOG or TRA-1 -60. These hiPSC colonies could be isolated and expanded as independent hiPSC cell lines which showed GFP expression, regained the expression of endogenous pluripotent markers and downregulated fibroblast markers (Figure 2A). These data demonstrate that an easy and reliable system which provides a GFP readout can be used to screen substitutes for the
functions of reprogramming factors or find new players in the reprogramming process in a high-throughput manner through addition of doxycycline only, and without any further viral manipulation. Example 3: miRNA expression increases the reprogramming efficiency
A miRNA population of 18 samples comprising different subsets of pluripotent and somatic cells was profiled (see Table 1 ). Statistical analysis based on similarity with the hsa-miR-302a expression profile and principal component analysis combined with expression level comparisons led to the identification of 26 miRNAs specifically expressed in pluripotent cells or strongly downregulated in somatic cells (Figure 8A; Tables 2 and 3). Various miRNAs belonging to clusters were identified, such as hsa-miR-302, hsa-miR- 372, and hsa-miR-373 (human orthologous to mouse mmu-miR-290), hsa-miR-200, or hsa-miR-520, which have been described as having a role in stem cell maintenance or participate in cell reprogramming in mouse cells (Judson et a/.; Yang et a/.; Subramanyam et a/., 201 1 , Nat. Biotechnol. 29(5): 443-48; Wang et al., 2008, Nat. Genet. 40(12): 1478- 83). Other identified miRNAs had never been associated with pluripotence. Whether the expression of these miRNAs influence the reprogramming efficiency in the absence of cMYC in human fibroblasts was then investigated.
dFib-OCT4GFP-indOSK-1 1 cells were infected with lentiviruses encoding each of the 26 miRNAs selected for analysis (see Table 2 below), adding doxycycline to the media and followed the formation of hiPSC colonies.
Table 2: selected miRNAs
Sequence Name Sequence SEQ ID NO hsa-miR-519d CAAAGUGCCUCCCUUUAGAGU 1 MIMAT0002853 Homo
sapiens miR-519d
hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU 2 MIMAT0002837
Homo sapiens miR-519b-3p
hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU 3 MIMAT0002869 Homo
sapiens miR-519a
hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG 4 MIMAT0002861 Homo
sapiens miR-518e
hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU 5 MIMAT0002844 Homo
sapiens miR-518b
hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU 6 MIMAT0002866 Homo
sapiens miR-517c
hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU 7 MIMAT0002852 Homo
sapiens miR-517a
hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC 8 MIMAT0002823 Homo
sapiens miR-512-3p
hsa-miR-429 MIMAT0001536 UAAUACUGUCUGGUAAAACCGU 9 Homo sapiens miR-429
hsa-miR-20b MIMAT0001413 CAAAGUGCUCAUAGUGCAGGUAG 10 Homo sapiens miR-20b
hsa-miR-205 MIMAT0000266 UCCUUCAUUCCACCGGAGUCUG 1 1 Homo sapiens miR-205
hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA 12 MIMAT0000318 Homo
sapiens miR-200b
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA 13 MIMAT0000617 Homo
sapiens miR-200c
hsa-miR-363 MIMAT0000707 AAUUGCACGGUAUCCAUCUGUA 14 Homo sapiens miR-363
hsa-miR-141 MIMAT0000432 UAACACUGUCUGGUAAAGAUGG 15 Homo sapiens miR-141
hsa-miR-373 MIMAT0000726 GAAGUGCUUCGAUUUUGGGGUGU 16 Homo sapiens miR-373
hsa-miR-372 MIMAT0000724 AAAGUGCUGCGACAUUUGAGCGU 17 Homo sapiens miR-372
hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU 18 MIMAT0000723 Homo
sapiens miR-371 -3p
hsa-miR-367 MIMAT0000719 AAUUGCACUUUAGCAAUGGUGA 19 Homo sapiens miR-367
hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU 20 MIMAT0000718 Homo
sapiens miR-302d
hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG 21 MIMAT0000717 Homo
sapiens miR-302c
hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG 22 MIMAT0000715 Homo
sapiens miR-302b
hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA 23 MIMAT0000684 Homo
sapiens miR-302a
hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU 24 MIMAT0002867 Homo
sapiens miR-520h
hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU 25 MIMAT0002858 Homo
sapiens miR-520g
hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU 26 MIMAT0002846 Homo
sapiens miR-520c-3p
Table 3 : selected miRNA and data for their selection
It was observed that, although the expression of hsa-miR-200b (SEQ ID NO: 12), -520c- 3p (SEQ ID NO: 26), -371-3p (SEQ ID NO: 18), -512-3p (SEQ ID NO: 8), or -20b (SEQ ID NO: 10) promoted the formation of hiPSC colonies to some extent, the expression of hsa- miR-367 (SEQ ID NO: 19), -372 (SEQ ID NO: 17), -373 (SEQ ID NO: 16), -429 (SEQ ID NO: 9), and -519a (SEQ ID NO: 3) greatly improved the reprogramming efficiency in the absence of cMYC (Figure 3A). To validate these effects, a similar reprogramming experiment was performed using BJ fibroblasts (Figure 3B). Similar results were observed and it was determined that expression of stem cell-specific miRNAs with a shared seed sequence, as reported for mouse cells, have a profound impact in reprogramming efficiency (Wang et a/.). Due to its great effect in reprogramming efficiency, hsa-miR-519a (SEQ ID NO: 3) was investigated further. Whether the effect of hsa-miR-519a (SEQ ID NO: 3) was dependent on the expression of cMYC was first analyzed, as it has been shown that expression of some miRNAs, such as hsa-miR-429 (SEQ ID NO: 9) or members of the hsa-miR-290 cluster, are directly regulated by the binding of cMYC to their promoters. Expression of hsa-miR-291 , -294, and -295 do not have a positive further effect in the formation of hiPSC colonies when cMYC is included in the reprogramming experiments (Figure 3C) (Judson et a/.). However, it was observed that the effect of hsa-miR-519a (SEQ ID NO: 3) seemed to be independent of cMYC because the reprogramming efficiency remained increased in experiments where cMYC was also expressed (Figure 3C). Furthermore, reprogramming efficiency was also increased after transfection of hsa-miR-519a (SEQ ID NO: 3) mimics in BJ fibroblasts or dFib-OCT4GFP cells (Figures 3D and 3E).
To get insights into the mechanisms by which hsa-miR-519a (SEQ ID NO: 3) positively affects cell reprogramming, cellular targets of this miRNA were investigated based on bioinformatic predictions from DIANA-MICROT, MICRORNA.org, MIRDB, RNA22-HSA, TARGETMINER and TARGETSCAN-VERT according to links found in miRNA database. Among all the predicted targets, TGFpRII was focused on because it has been already demonstrated to be a target of several miRNAs implicated in enhancing the reprogramming efficiency (Li et a/.; Subramanyam et a/.). The 3' UTR region of the TGFpRII mRNA contains two well conserved recognition sequences for hsa-miR-519a (SEQ ID NO: 3) and its expression downregulates the level of TGFpRII mRNA in fibroblasts (Figures 3F and 3G).
[0001] It should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims.
Bibliographic references:
1. Takahashi, K. and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 26: 663-76.
2. Brambrink, T., Foreman, R., Welstead, G.G., Lengner, C.J., Wernig, M., Suh, H. and Jaenisch, R. (2008). Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Cell Stem Cell 2: 151 -9.
3. Stadtfeld, M., Maherali, N., Breault, D.T. and Hochedlinger, K. (2008). Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell Stem Cell 2: 230-40.
4. Stadtfeld, M., Maherali, N., Borkent, M. and Hochedlinger, K. (2010). A reprogrammable mouse strain from gene-targeted embryonic stem cells. Nat Methods 7: 53-5.
5. Wernig, M., Lengner, C.J., Hanna, J., Lodato, M.A., Steine, E., Foreman, R., Staerk, J., Markoulaki, S. and Jaenisch, R. (2008). A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types. Nat Biotechnol 26: 916-24.
6. Markoulaki, S., Hanna, J., Beard, C, Carey, B.W., Cheng, A.W., Lengner, C.J., Dausman, J.A., Fu, D., Gao, Q., Wu, S., Cassady, J. P. and Jaenisch, R. (2009). Transgenic mice with defined combinations of drug-inducible reprogramming factors. Nat Biotechnol 27: 169-71.
7. Hockemeyer, D., Soldner, F., Cook, E.G., Gao, Q., Mitalipova, M. and Jaenisch, R. (2008). A drug-inducible system for direct reprogramming of human somatic cells to pluripotency. Cell Stem Cell 3: 346-53.
8. Maherali, N., Ahfeldt, T., Rigamonti, A., Utikal, J., Cowan, C. and Hochedlinger, K. (2008). A high-efficiency system for the generation and study of human induced pluripotent stem cells. Cell Stem Cell 3: 340-5.
9. Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., Plath, K. and Hochedlinger, K. (2007). Directly
reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1: 55-70.
10. Okita, K., Ichisaka, T. and Yamanaka, S. (2007). Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-7.
1 1. Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E. and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448: 318-24.
12. Zhao, X.Y., Li, W., Lv, Z., Liu, L, Tong, M., Hai, T., Hao, J., Guo, C.L., Ma, Q.W., Wang, L., Zeng, F. and Zhou, Q. (2009). iPS cells produce viable mice through tetraploid complementation. Nature 461: 86-90.
13. Boland, M.J., Hazen, J.L., Nazor, K.L., Rodriguez, A.R., Gifford, W., Martin, G., Kupriyanov, S. and Baldwin, K.K. (2009) Adult mice generated from induced pluripotent stem cells. Nature 461: 91 -4.
14. Kang, L., Wang, J., Zhang, Y., Kou, Z. and Gao, S. (2009) iPS cells can support full- term development of tetraploid blastocyst-complemented embryos. Cell Stem Cell 5: 135-
8.
15. Ruiz, S., Panopoulos, A.D., Herrerias, A., Bissig, K.D., Lutz, M., Berggren, W.T., Verma, I.M. and Izpisua Belmonte JC. (201 1 ). A high proliferation rate is required for cell reprogramming and maintenance of human embryonic stem cell identity. Curr Biol. 21: 45-52.
16. Zwaka, T.P. and Thomson, J.A. (2003) Homologous recombination in human embryonic stem cells. Nat Biotechnol 21, 319-321.
17. Shi, Y., Desponts, C, Do, J.T., Hahm, H.S., Scholer, H.R. and Ding, S. (2008) Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3: 568-74.
18. Ichida, J.K., Blanchard, J., Lam, K., Son, E.Y., Chung, J.E., Egli, D., Loh, K.M., Carter, A.C., Di Giorgio, F.P., Koszka, K., Huangfu, D., Akutsu, H., Liu, D.R., Rubin, L.L. and
Eggan, K. (2009) A small-molecule inhibitor of tgf-Beta signaling replaces sox2 in reprogramming by inducing nanog. Cell Stem Cell 5: 491 -503.
19. Bartel, D.P. (2009)_MicroRNAs: target recognition and regulatory functions. Cell 136: 215-33.
20. Mallanna, S.K. and Rizzino, A. (2010) Emerging roles of microRNAs in the control of embryonic stem cells and the generation of induced pluripotent stem cells. Dev Biol 344: 16-25.
21. Judson, R.L., Babiarz, J.E., Venere, M. and Blelloch R. (2009) Embryonic stem cell- specific microRNAs promote induced pluripotency. Nat Biotechnol 27: 459-61.
22. Li, Z., Yang, C.S., Nakashima, K. and Rana, T.M. (201 1 ) Small RNA-mediated regulation of iPS cell generation. EMBO J 30: 823-34.
23. Yang, C.S., Li, Z. and Rana, T.M. (201 1 ) microRNAs modulate iPS cell generation. RNA 17: 1451 -60.
24. Anokye-Danso, F., Trivedi, CM., Juhr, D., Gupta, M., Cui, Z., Tian, Y., Zhang, Y., Yang, W., Gruber, P.J., Epstein, J.A. and Morrisey, E.E. (201 1 ) Highly efficient miRNA- mediated reprogramming of mouse and human somatic cells to pluripotency. Cell Stem Cell 8: 376-88.
25. Miyoshi, N., Ishii, H., Nagano, H., Haraguchi, N., Dewi, D.L., Kano, Y., Nishikawa, S., Tanemura, M., Mimori, K., Tanaka, F., Saito, T., Nishimura, J., Takemasa, I., Mizushima, T., Ikeda, M., Yamamoto, H., Sekimoto, M., Doki, Y. and Mori, M. (201 1 ) Reprogramming of mouse and human cells to pluripotency using mature microRNAs. Cell Stem Cell 8: 633-8.
26. Subramanyam, D., Lamouille, S., Judson, R.L., Liu, J.Y., Bucay, N., Derynck, R. and Blelloch, R. (201 1 ) Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol 29: 443-8.
27. Wang, Y., Baskerville, S., Shenoy, A., Babiarz, J.E., Baehner, L. and Blelloch, R. (2008) Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Nat Genet 40: 1478-83.
28. Avilion A. A., Nicolis S. K., Pevny L. H., Perez L, Vivian N. and Lovell-Badge R. (2003) Mulitpotent cell lineages in early mouse development depend on SOX2 function.
Genes and Development 17: 126-140.
29. Panopoulos A. D., Ruiz S., Yi F., Herrenas A., Batchelder E. M. and Izpisua Belmonte J. C. (201 1 ) Rapid and highly efficient generation of induced pluripotent stem cells from human umbilical vein endothelial cells. PLoS One 6(5): e19743.
30. Nakhaei-Rad S., Bahrami A. R., Mirahmadi M. And Matin M. M. (2012) New windows to enhance direct reprogramming of somatic cells towards induced pluripotent stem cells. Biochem. Cell. Biol 90: 1 15-123.
31. Mochiduki Y. and Okita K. (2012) Methods for iPS cell generation for basic research and clinical applications. Biotechnol. J. 7: 789-797
Claims
1. An in vitro method for reprogramming a somatic cell comprising the step of exposing the cell to (i) a miRNA and (ii) one, two or more reprogramming factors.
2. The method of claim 1 wherein the miRNA comprises a seed sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 27 and SEQ ID NO: 29-33.
3. The method of claim 2, wherein the miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367 (SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa-miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371 -3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
4. The method of claim 3, wherein the miRNA is hsa-miR-519a (SEQ ID NO: 3) or hsa-miR-429 (SEQ ID NO: 9).
5. The method of claims 1 -4, wherein the cell is exposed to the miRNA by contacting the cell with the miRNA.
6. The method of claims 1 -5, wherein the cell is exposed to the miRNA by infecting the cell with a viral vector encoding the miRNA.
7. The method of claim 6, wherein the viral vector is a retrovirus or lentivirus.
8. The method of claims 1 -7, wherein at least one of the reprogramming factors is selected from the group consisting of OCT4, SOX2, KLF4, and cMYC.
9. The method of claims 1 -8, wherein the cell is exposed to the reprogramming factor by contacting the cell with the reprogramming factor.
10. The method of claims 1 -9, wherein the cell is exposed to the reprogramming factor by infecting the cell with a viral vector encoding the reprogramming factor.
1 1. The method of claim 10, wherein the viral vector is a retrovirus or lentivirus.
12. The method of claims 1-1 1 , wherein the one, two or more reprogramming factors are selected from the group consisting of OCT4, SOX2, KLF4, and cMYC.
13. The method of claim 12, wherein the cell is exposed to the reprogramming factors by contacting the cell with the reprogramming factors.
14. The method of claims 12-13, wherein the cell is exposed to the reprogramming factors by infecting the cell with one or more viral vectors encoding the reprogramming factors.
15. The method of claim 14, wherein at least one of the viral vectors is a retrovirus or lentivirus.
16. The method of claims 1-15, further comprising exposing the cell to a second miRNA.
17. The method of claim 16, wherein the second miRNA is selected from the group consisting of hsa-miR-519a (SEQ ID NO: 3), hsa-miR-429 (SEQ ID NO: 9), hsa-miR-367
(SEQ ID NO: 19), hsa-miR-372 (SEQ ID NO: 17), hsa-miR-373 (SEQ ID NO: 16), hsa- miR-200b (SEQ ID NO: 12), hsa-miR-520c-3p (SEQ ID NO: 26), hsa-miR-371-3p (SEQ ID NO: 18), hsa-miR-512-3p (SEQ ID NO: 8), and hsa-miR-20b (SEQ ID NO: 10).
18. The method of claims 16-17, wherein the cell is exposed to the second miRNA by contacting the cell with the second miRNA.
19. The method of claims 16-18, wherein the cell is exposed to the second miRNA by infecting the cell with a viral vector encoding the second miRNA.
20. The method of claim 19, wherein the viral vector is a retrovirus or lentivirus.
21. An in vitro method for reprogramming or enhancing reprogramming in a somatic cell comprising the step of exposing the cell to (i) a miRNA comprising a seed sequence of SEQ ID NO: 28 and (ii) the reprogramming factors OCT4, SOX2, and KLF4.
22. The method of claim 21 wherein the miRNA is hsa-miR-519a (SEQ ID NO: 3).
23. In vitro use of a miRNA for enhancing reprogramming in a somatic cell.
24. Use according to claim 23, wherein said miRNA is a miRNA as defined in anyone of claims 1 to 4.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261698850P | 2012-09-10 | 2012-09-10 | |
| EP12306088 | 2012-09-10 | ||
| EP12306088.1 | 2012-09-10 | ||
| US61/698,850 | 2012-09-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014037574A1 true WO2014037574A1 (en) | 2014-03-13 |
Family
ID=46924379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/068678 Ceased WO2014037574A1 (en) | 2012-09-10 | 2013-09-10 | Methods for reprogramming a somatic cell |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014037574A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018064460A1 (en) | 2016-09-30 | 2018-04-05 | Mayo Foundation For Medical Education And Research | Viral vectors for nuclear reprogramming |
| CN112430596A (en) * | 2019-08-26 | 2021-03-02 | 中国科学院上海营养与健康研究所 | Application of small RNA molecules and analogs thereof in anti-aging |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080293143A1 (en) * | 2003-05-15 | 2008-11-27 | Shi-Lung Lin | Generation of human embryonc stem-like cells using intronic RNA |
| US20100075421A1 (en) * | 2007-12-10 | 2010-03-25 | Kyoto University | Efficient method for nuclear reprogramming |
| EP2202309A1 (en) * | 2008-12-08 | 2010-06-30 | Kyoto University | Efficient method for nuclear reprogramming |
| WO2011023413A1 (en) * | 2009-08-31 | 2011-03-03 | Alcedo Biotech Gmbh | Microrna-based methods and compositions for reprogramming cells |
| WO2011037270A1 (en) * | 2009-09-24 | 2011-03-31 | Kyoto University | Method of efficiently establishing induced pluripotent stem cells |
| WO2012151309A1 (en) * | 2011-05-02 | 2012-11-08 | Sanford-Burnham Medical Research Institute | Methods for regulating induced pluripotent stem cell generation and compositions thereof |
-
2013
- 2013-09-10 WO PCT/EP2013/068678 patent/WO2014037574A1/en not_active Ceased
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080293143A1 (en) * | 2003-05-15 | 2008-11-27 | Shi-Lung Lin | Generation of human embryonc stem-like cells using intronic RNA |
| US20100075421A1 (en) * | 2007-12-10 | 2010-03-25 | Kyoto University | Efficient method for nuclear reprogramming |
| EP2202309A1 (en) * | 2008-12-08 | 2010-06-30 | Kyoto University | Efficient method for nuclear reprogramming |
| WO2011023413A1 (en) * | 2009-08-31 | 2011-03-03 | Alcedo Biotech Gmbh | Microrna-based methods and compositions for reprogramming cells |
| WO2011037270A1 (en) * | 2009-09-24 | 2011-03-31 | Kyoto University | Method of efficiently establishing induced pluripotent stem cells |
| WO2012151309A1 (en) * | 2011-05-02 | 2012-11-08 | Sanford-Burnham Medical Research Institute | Methods for regulating induced pluripotent stem cell generation and compositions thereof |
Non-Patent Citations (4)
| Title |
|---|
| CHEN JIE ET AL: "Synergetic cooperation of microRNAs with transcription factors in iPS cell generation.", PLOS ONE 2012, vol. 7, no. 7, E40849, 13 July 2012 (2012-07-13), pages 1 - 13, XP002702926, ISSN: 1932-6203 * |
| CHEN JING ET AL: "Overexpression of miR-429 induces mesenchymal-to-epithelial transition (MET) in metastatic ovarian cancer cells.", GYNECOLOGIC ONCOLOGY, vol. 121, no. 1, April 2011 (2011-04-01), pages 200 - 205, XP002702927, ISSN: 1095-6859 * |
| LAURENT LOUISE C ET AL: "Comprehensive microRNA profiling reveals a unique human embryonic stem cell signature dominated by a single seed sequence", STEM CELLS, vol. 26, no. 6, 1 June 2008 (2008-06-01), ALPHAMED PRESS, INC, UNITED STATES, pages 1506 - 1516, XP002577532, ISSN: 1549-4918, [retrieved on 20080410], DOI: 10.1634/STEMCELLS.2007-1081 * |
| WELSTEAD G G ET AL: "The reprogramming language of pluripotency", CURRENT OPINION IN GENETICS & DEVELOPMENT, vol. 18, no. 2, 1 April 2008 (2008-04-01), CURRENT BIOLOGY LTD, pages 123 - 129, XP022698490, ISSN: 0959-437X, [retrieved on 20080320], DOI: 10.1016/J.GDE.2008.01.013 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018064460A1 (en) | 2016-09-30 | 2018-04-05 | Mayo Foundation For Medical Education And Research | Viral vectors for nuclear reprogramming |
| EP4056189A1 (en) * | 2016-09-30 | 2022-09-14 | Mayo Foundation for Medical Education and Research | Viral vectors for nuclear reprogramming |
| US12529073B2 (en) | 2016-09-30 | 2026-01-20 | Mayo Foundation For Medical Education And Research | Viral vectors for nuclear reprogramming |
| CN112430596A (en) * | 2019-08-26 | 2021-03-02 | 中国科学院上海营养与健康研究所 | Application of small RNA molecules and analogs thereof in anti-aging |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2462225B1 (en) | Method of efficiently establishing induced pluripotent stem cells | |
| US9353352B2 (en) | Embryonic stem cell specific microRNAs promote induced pluripotency | |
| US8530238B2 (en) | Method of efficiently establishing induced pluripotent stem cells | |
| EP2853592B1 (en) | Highly efficient method for establishing artificial pluripotent stem cell | |
| US11898169B2 (en) | Synergistic genome-nonintegrating reprogramming by microRNAs and transcription factors | |
| US9447408B2 (en) | Method of efficiently establishing induced pluripotent stem cells | |
| AU2013274197A1 (en) | Methods of preparing pluripotent stem cells | |
| Nguyen et al. | miR-524-5p of the primate-specific C19MC miRNA cluster targets TP53IPN1-and EMT-associated genes to regulate cellular reprogramming | |
| EP2635678A1 (en) | Method of efficiently establishing induced pluripotent stem cells | |
| WO2014065435A1 (en) | Method of efficiently establishing induced pluripotent stem cells | |
| Augustyniak et al. | Reprogramming of somatic cells: possible methods to derive safe, clinical-grade human induced pluripotent stem cells | |
| WO2011027908A1 (en) | Method of selecting safe pluripotent stem cells | |
| Romeo et al. | Embryonic stem cells and inducible pluripotent stem cells: two faces of the same coin? | |
| WO2014037574A1 (en) | Methods for reprogramming a somatic cell | |
| WO2012151309A1 (en) | Methods for regulating induced pluripotent stem cell generation and compositions thereof | |
| WO2016178968A1 (en) | Method of enhancing somatic cell reprogramming with the acetyllysine reader brd3r | |
| NHI | EXPRESSION AND BIOLOGICAL ROLE OF THE CHROMOSOME | |
| Voutila | RNA-Mediated Transcriptional Activation Of Endogenous Pluripotency Gene Expression | |
| Orlanski et al. | 12 MicroRNAs in embryonic stem cells | |
| Jung et al. | Pluripotency and Early Cell Fate Decisions are Orchestrated by microRNAs | |
| HK1208492B (en) | Highly efficient method for establishing artificial pluripotent stem cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13762441 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13762441 Country of ref document: EP Kind code of ref document: A1 |
