WO2014026284A1 - Internal structured self assembling liposomes - Google Patents

Internal structured self assembling liposomes Download PDF

Info

Publication number
WO2014026284A1
WO2014026284A1 PCT/CA2013/050622 CA2013050622W WO2014026284A1 WO 2014026284 A1 WO2014026284 A1 WO 2014026284A1 CA 2013050622 W CA2013050622 W CA 2013050622W WO 2014026284 A1 WO2014026284 A1 WO 2014026284A1
Authority
WO
WIPO (PCT)
Prior art keywords
issal
liposome
molecule
affinity enhancing
ssdna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2013/050622
Other languages
French (fr)
Inventor
Aaron FROESE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to EP13829520.9A priority Critical patent/EP2884965B1/en
Priority to CA2881605A priority patent/CA2881605A1/en
Priority to US14/420,983 priority patent/US9775804B2/en
Publication of WO2014026284A1 publication Critical patent/WO2014026284A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1274—Non-vesicle bilayer structures, e.g. liquid crystals, tubules, cubic phases or cochleates; Sponge phases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1277—Preparation processes; Proliposomes

Definitions

  • the present invention relates to internal structured self- assembled liposomes (ISSAL), their process for manufacture and uses or applications.
  • ISSAL internal structured self- assembled liposomes
  • nucleic acid analogue approach still suffers from issues involving delivery into cells.
  • foreign protein drugs are delivered into the body, they are usually targeted by the humoral immune system (4).
  • patients with haemophilia A and B receiving injections of blood coagulation factors frequently develop neutralizing antibody responses which in many cases render the treatments useless with time (5) .
  • haemophilia A and B receiving injections of blood coagulation factors frequently develop neutralizing antibody responses which in many cases render the treatments useless with time (5) .
  • the lack of a practical delivery method for large molecules renders this data largely unusable.
  • years of work have been put into designing methods to solve the issue of large molecule delivery. These methods mostly include the use of modified recombinant viruses and non- viral liposomes (6).
  • viruses have shown promise under some medical circumstances there are ongoing issues of toxicity, target specificity or cell tropism, and ethical concerns associated with their use (7). Virus particles also become targets for the humoral immune system, greatly limiting their use to a narrow time window before neutralizing antibodies arise (8). If treatments are unsuccessful in this time window, further virus injections are quickly eliminated by the immune system . Non-viral methods based on liposomes have been seen as the safer alternative to viral delivery of large molecules. Efforts involving liposomes have been classically hampered by low efficiency of delivery, issues with vehicle loading efficiency, and practical issues involving preservation of structure during storage (3, 9).
  • Liposomes are normally single phospholipid bilayer bubbles which separate the drug inside from the hostile environment outside.
  • the liposome contents are then free to act in the local environment.
  • targeting the nucleus in non-mitotic cells is impeded by the dual-bilayered nuclear membrane barrier and the nuclear pore complex.
  • Another additive to the liposome is the use of membrane fusion proteins. These proteins have been employed to allow liposomal membranes to fuse with the cell's plasma membrane. This method unloads the contents of the cell into the cytoplasm without breaking down endosomal barriers, avoiding considerable cytotoxicity (13, 14). In effect, the liposome can be loaded with any sized nucleic acid for delivery into the cytoplasm . However, nucleic acids delivered by membrane fusion proteins into the cytoplasm are still subject to the "thread in needle" efficiency of the nuclear pore complex.
  • Nanotechnology often employs information encoding DNA to design structures with preset parameters (16). Structures often are designed by linking ssDNA to effector molecule(s) and then assembled by the complementary base pairing innate to dsDNA. These techniques coupled with lithographic chip and microfluidics gives the user the capability to create devices that can perform a wide array of tasks from sensing DNA sequences, to the step wise assembly of small machines (17).
  • the use of nanotechnology in the synthesis of drugs is still in its infancy.
  • only a few labs have considered the use of DNA in the synthesis of drug delivery vehicles. These interests surround designing DNA to form three dimensional structures which are then placed in the body (18). However, most of these techniques do not account for the body's innate ability to clear foreign DNA from the blood stream . Liposomes, which are used to hide DNA cargo from destructive blood enzymes, have not been designed with a self assembling platform.
  • Figure 1 shows electron micrograph images of prepared negative control and Internal Structured Self Assembling Liposome (ISSAL) liposomes.
  • the specification relates to an internal structured self assembled liposome (ISSAL), containing :
  • a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule couples to the first affinity enhancing molecule.
  • the specification relates to a method of forming an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity enhancing complex having a phospholipid coupled to second affinity enhancing
  • the method including the step of mixing the nuclear core molecule or complex with the phospholipid-affinity affinity enhancing complex.
  • the specification relates to use of an internal structured self assembled liposome, in the treatment of a disease, the internal structured self assembled liposome containing a nuclear core complex having a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
  • the specification relates to a method of delivering an active pharmaceutical ingredient to a patient in need thereof, containing the step of providing the active pharmaceutical ingredient in an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
  • the specification relates to method of treatment of a disease, including the step of providing to a patient in need therof, a active pharmaceutical ingredient in an internal structured self assembled liposome including a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
  • the specification relates to a pharmaceutical composition containing an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule; and a pharmaceutically acceptable excipient.
  • the specification relates to a kit, containing :
  • an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is capable coupled to the first affinity enhancing molecule; and
  • the assembly of the liposome internal structure begins with the production of a "nucleus" molecule/complex for the core. This is the point upon which the rest of the liposome is assembled in stages.
  • the nuclear core molecule or complex is linked (in one example embodiment and without limitation, covalently linked) to first affinity enhancing molecules which provide the assembly point for the first surrounding lipid bilayer.
  • An example of this nuclear core complex could be to covalently link micelle forming phospholipids to the 5' phosphate groups of ssDNA.
  • the nuclear core structure can be roughly spherical and capable of binding multiple ssDNA groups via a 5' phosphate.
  • Another example of a nuclear core molecule could be a group of oligonucleotides which when combined in solution make a three dimensional pattern with free ssDNA ends.
  • the following is an example of the assembly of the first lipid bilayer in the liposome.
  • Phospholipids which have been covalently linked at the hydrophiiic end to a second affinity enhancing molecule, are used to bind to the core complex.
  • An example of this could be to link the terminal NH 2 group of phosphatidylethanolamine (PE) to the 5' phosphate group of ssDNA to create a phospholipid-ssDNA adduct (pl-ssDNA).
  • PE phosphatidylethanolamine
  • pl-ssDNA phospholipid-sDNA adduct
  • the first bilayer is formed upon mixing phospholipids and pl-ssDNA with the ssDNA-nuclear core complex. This assembly of the first bilayer is helped by the specific association of dsDNA affinity complementary binding.
  • the pl-ssDNA on the outer surface of the first liposome bilayer provides the structural basis for assembling further bilayers.
  • liposomes bilayers are constructed in stages. With each sequential stage, different soluble drugs or varying membrane functionality can be applied. The entire structure, when assembled, could be comparable to a "3D wheel" where the dsDNA functions as structural "spokes".
  • Another example could be to use affinity proteins, polypeptides, or nucleic acid analogues in place of ssDNA at all points in the above assembly.
  • the nuclear core is linked to the first bilayer via protein-protein specific interaction.
  • protein subunits could face outward on the liposomal surface for assembly of the next lipid bilayer.
  • the nuclear core molecular or complex need not be a micelle; rather a generally spherical molecule can be used with outward functional points.
  • Another example of a nuclear core complex could be a small compact protein with modified surface residues linked to affinity based molecules, such as ssDNA.
  • the overall liposome structure could still resemble a layered 3D wheel in which
  • molecules of DNA or polypeptide function as spokes to keep and align lipid bilayers around a central core.
  • the overall use of these internal structured self-assembling liposomes could be to place any soluble molecule into any sub-cellular location in the body.
  • Sub-cellular targeting can be accomplished by adding specific membrane affinity (ie. surface antibodies) and membrane fusion properties to each liposome bilayer stepwise during assembly.
  • membrane affinity ie. surface antibodies
  • membrane fusion properties ie. surface antibodies
  • the outer bilayer binds and enters the surface of a targeted cell in the body and the subsequent bilayers underneath are targeted to other membrane layers within the cell (ie. nuclear envelope, mitochondria, golgi complex, etc).
  • Insoluble drugs can also be mixed in the hydrophobic region of phospholipid bilayers during their assembly.
  • Soluble proteins which are linked to ISSAL ssDNA can be incorporated into the complex via base pair affinity.
  • Single span membrane proteins such as various membrane fusion proteins which are stabilized in solution via solubilising domains can also be linked to ssDNA (19).
  • These single span membrane proteins could then be added to the existing scaffold of pl-ssDNA. The net effect could be that the membrane proteins are ordered in the correct ecto/endo domain orientation in the bilayer.
  • unique affinity targeting and membrane fusion can be applied to separate layers. Since the DNA scaffold keeps the bilayers from interacting, any membrane fusion events would have to begin at the liposomal outer surface instead of between interior bilayers.
  • the first bilayer could breach the plasma membrane of a cell and the subsequent bilayers could be targeted to breach the nuclear envelope layers.
  • Layers in the liposome internal structure are severed via specific endonuclease or protease activity. This is done by dividing one regime into two separate but equivalent parts. Each of the two formulations contains the enzymes to break the structural components of the other formulation. This avoids the breakdown of the internal structure components of the liposome prior to the correct delivery to each subsequently targeted membrane compartment.
  • the excess DNA on the surface is cut via recombinant nuclease activity and the liposomes purified.
  • a complex multi-layered self assembling liposome could be loaded with any soluble or insoluble molecule(s) and its contents released in any sub-cellular address within the body. This can help to address the issues of liposome delivery efficiency with the use of surface antibodies and membrane fusion proteins.
  • the internal structural supports also greatly decrease the movement of membranes during drug loading and storage. This design can also allow for the ability to unload even
  • chromosome sized molecules into targets like the nucleus or mitochondria.
  • Iron superparamagnetic nanoparticle resins can be used for the large scale, batch format separation of large molecules such as long chain ssDNA. The following method was adapted from Bumb et al . 2008 (20). These nanoparticles are an example of known design that could aide in the extraction of ISSAL components and is not required for ISSAL assembly or function. Briefly, iron nanoparticles are created by reacting Fe 2+ and Fe 3+ ions with concentrated ammonia. The particles are washed with magnetic separation and then washed with 2M HN0 3 to convert the surface charge from negative to positive. The particles are then washed with magnetic separation to remove most of the concentrated acid. After stabilizing the pH at 2.5 with NaOH and HN0 3 , the particles are surface stabilized by saturation with citrate ions. The particles are then washed and pH stabilized at 6.0. The particles are then silica coated by reacting with a mixture of
  • TEOS tetraethylorthosilicate
  • EDC l-ethyl-3-(3-dimethylaminopropyl) carbodiimide
  • Scheme 1 discloses how longer ISSAL ssDNA is made and purified.
  • Scheme 1 Synthesis of long single stranded DNA for ISSAL structural assembly. Double stranded DNA is grown in E. coli via high copy number plasmids. These plasmids are then cut with restriction endonucleases. The double stranded DNA is then separated with iterative high temperature annealing to complementary ssDNA bound magnetic resin.
  • the complementary ssDNA can be synthesized using standard synthetic techniques.
  • the synthetic ssDNA is crossl inked to surface amine groups of silica coated iron nanoparticles with EDC in water.
  • the solution is washed with water via magnetic separation.
  • Longer ssDNA can now be purified by strategically controlling the temperature of annealing and magnetic separation. This is made possible because the iron nanoparticles are not sensitive to heat ranges between 4°C and 200°C (20).
  • Long chain DNA to be used in the synthesis of self assembling liposomes is grown within high copy number plasmids. These plasmids are harvested inexpensively from bacteria such as E. coli. These high copy number plasmids contain the desired sequence in multiple repeats for added efficiency.
  • the double stranded plasmid DNA is purified from bacteria using the common alkaline lysis technique. Following a basic DNA purification with a silica substrate, the DNA is cut with restriction enzymes designed to remove the plasmid back bone and separate individual desired sequences. This digested mixture is then applied to the iron nanoparticle ssDNA conjugates for separation. Separation is achieved by high temperature annealing followed by magnetic separation.
  • the separation efficiency of short chain DNA conjugated nanoparticles can be low at first. However, after multiple separations a small fraction of purified complementary DNA can emerge. This small amount of purified long chain ssDNA is then used to create a new and superior batch of iron nanoparticle ssDNA conjugates. This process is repeated until the separated ssDNA is completely free of
  • This process also applies to any other complementary ssDNA to be separated.
  • the method can allow avoidance of harsh chemical treatment of the original dsDNA to separate ssDNA strands based on GC/AT ratio differences.
  • This technique is also not biased to any base pair configuration, can be inexpensive and scalable to large batch size.
  • the iron nanoparticle ssDNA conjugates can also be reused many times.
  • Long chain ssDNA is purified with the above method and placed in solution with EDC and N-hydroxysuccinimide (N HS) .
  • PE is added to the ssDNA mixture.
  • the components are purified to remove unwanted products.
  • the PE, ssDNA, and pl-ssDNA are separated using a large column format containing covalently bound complementary ssDNA. Initially the ssDNA and pl-ssDNA are bound to the column . Then the PE is washed away using an increasingly organic phased buffer. The ssDNA and pl-ssDNA are then eluted at high temperature and put through a second column with a hydrophobic medium .
  • the ssDNA will not bind to the hydrophobic column and is eluted .
  • the pl-ssDNA is then eluted by increasing the organic eluant phase.
  • the pl-ssDNA is then dried by solvent evaporation and stored in the dark under nitrogen . Note that any trace contaminants of PE or ssDNA should not be problematic for the assembly of ISSALs.
  • Micelles are a mixture of spherical amphipathic molecules in water without a bilayer. Some amphipathic molecules form micelles more readily than others.
  • monoacyl phospholipids such as lysophosphatidylethanolamine (LPE) .
  • LPE can be made by reacting purified PE with a soluble phospholipase A2. This produces a LPE with the second carbon of the glycerol chain deacylated.
  • LPE which is positively charged, is purified to remove free fatty acids. This is done by binding to a cation exchanging hydrophobic mixed mode resin . Free fatty acids will not bind and are carried away in the wash .
  • the resulting mixture is of LPE and unreacted contaminant PE. These PE contaminants can be ignored if they are in low enough concentrations as they can have little impact on the formation of micelle structures. The molar ratio of this contaminant should not react higher than 20 LPE to 1 PE. LPE can be dried and stored in the dark under nitrogen . [0044] The ISSAL ssDNA is mixed with LPE and allowed to react in the presence of EDC and N HS soluble crosslinking reagents. The resulting mixture of LPE, ssDNA, LPE-ssDNA adducts, EDC and NHS can be separated and purified as described above with pl-ssDNA. Purified ssDNA-LPE should be stored dry in the dark under nitrogen.
  • the assembly of ISSAL in solution is a step wise process under on and off column conditions. Columns conditions involving iron nanoparticle ssDNA conjugates are used to simplify purification of ISSAL during synthesis and to minimize the occurrence of contaminants. Scheme 2 illustrates how the ISSAL assembly proceeds.
  • the first layer there is a mixture of two different pl-ssDNA molecules.
  • Self-assembly begins by mixing ssDNA-LPE adducts and regular LPE in water with agitation at 4°C. This forms the micelle nuclei
  • mice are the lowest energy state for this molecule and the longer the solution is shaken, the higher the entropy of the system will be when the agitation stops.
  • the micelles in solution are then mixed with pl-ssDNA, phosphatidylcholine, PE, cholesterol, etc. in the correct mixture ratio. This forms the first lipid bilayer surrounding the nuclei.
  • bilayers are formed as above by varying the pl-ssDNA and phospholipid/cholesterol mixtures stepwise.
  • the outer layer can be predominantly of the pl-ssDNA that was last used in excess.
  • Contaminants or spontaneous incorporation of a complementary binding pl-ssDNA into the assembly is a rare occurrence which should not affect the function of the overall ISSAL structure.
  • Intermediate structures formed without the internal structure of the ISSAL can be less stable under cold agitation conditions and should form the lowest entropic variation over time.
  • the rigidity of the nucleus and the shear stress stability of the ISSAL complex can determine how much agitation can be used before the ISSAL structures gain enough free energy to break apart. Higher shear stress stability is also inversely proportional to membrane fusion reactivity, once membrane fusion proteins have been added to the outer layer.
  • a functionality to be added using proteins is membrane fusion and targeting affinity.
  • Membrane proteins can represent a challenge for standardized incorporation into complex bilayered structures.
  • membrane spanning proteins can be adapted and engineered to incorporate correctly. For example, single transmembrane domain proteins are more likely to be solubilized then multiple
  • transmembrane domain containing proteins This is because of the random and unfavourable movement of the various multiple transmembrane domains in solution are more likely to cause irreversible aggregation and precipitation.
  • Many soluble proteins, for example albumin have considerable hydrophobic regions masked by highly hydrophilic regions. The use of solubility
  • the proteins can be engineered to be readily amenable to ISSAL affinity molecules.
  • a SNAP25/synaptobrevin/syntaxin snare tag complex is a viable option for simplistic attachment of ssDNA to ISSAL engineered soluble membrane proteins (21).
  • the snare complex described by Ferrari et al. 2010 is an example of how molecules can be linked together in a facile way.
  • the snare complex has not been used to link liposome associated structures together.
  • the use of a snare complex in this design is an example of molecular ligation that can be replicated with other
  • Scheme 3 shows how the SNAP25 complex functions.
  • Scheme 4 discloses how the SNAP25/synaptobrevin/syntaxin complex functions as a tag for soluble membrane proteins and how these complexes are added to the ISSAL scaffold. This is done by chemically ligating the ssDNA to the syntaxin peptide. EDC readily reacts with both - NH 2 groups and -C0 2 - groups. Therefore simplistic addition of EDC directly to syntaxin peptide can cause many unwanted addition reactions in the center of the peptide with acidic side chains. Because of this, the reaction can be modified so that the ssDNA reacts first and that any unreacted EDC is removed afterward. This is done by first adhering soluble ssDNA to a complementary ssDNA iron nanoparticle resin.
  • the EDC is added in the presence of NHS.
  • the syntaxin peptide is then mixed with the ssDNA-N-hydroxysuccinimide intermediates and allowed to react.
  • the product is predominantly N-terminal and -NH 2 side chain additions via a phosphoramidate linkage to the 5' phosphate group on the ssDNA.
  • the nanoparticle beads bound to ssDNA- syntaxin adducts are then washed to remove excess unreacted syntaxin peptide.
  • the syntaxin-ssDNA adducts need not be uniform to interact correctly with the rest of a snare complex. Therefore only simplistic purification is required. This purification can be done by making use of a histidine-6x tag applied to the end of the syntaxin peptide or by making use of a synaptobrevin/SNAP25 linked resin. Histidine-6x tags, which are normally bound to NTA-based resins, are the least expensive and fully reusable choice. The soluble membrane protein with a synaptobrevin tag is then mixed with soluble SNAP25 and ssDNA-syntaxin to form a highly stable complex. This tags the soluble membrane protein with ISSAL compatible ssDNA scaffolding.
  • the soluble membrane proteins are then mixed with ISSAL scaffolds via DNA base pair affinity.
  • the ssDNA interaction from the endo domain of the membrane protein can ensure that the correct outward protein orientation occurs.
  • the solution can also be filled with soluble drugs for incorporation into the structure. This allows the soluble molecules to be incorporated into specific layers of the ISSAL to be delivered to different sub-cellular addresses.
  • Insoluble drugs can be mixed into the pl-ssDNA mixture for incorporation.
  • the ISSAL scaffolds are filled in with a pl-ssDNA/lipid mixture to form the next bilayer. Since membrane proteins can contain a highly hydrophobic region at their transmembrane domain, this portion of the protein can be more likely to be incorporated into the bilayer structure. The lowest energy state is the one in which membrane proteins are comfortably seated inside a lipid bilayer in order to meet the hydrophobicity of the transmembrane domain . Agitation in a cold system should maximize the entropy of the system.
  • Solubility tags on the outside of the ISSAL structure can be removed for the sake of the adaptive immune system. This is done by adhering the ISSALs via external pl-ssDNA to compatible complementary ssDNA iron nanoparticles resin and placing the mixture in a solution of site specific proteases engineered to remove the tags. Since the ISSALs in solution are "on column” they can be modified with any other system and then purified by using either heat or nucleases to release the ISSALs from the column. The external nucleic acids can also be removed from ISSAL structures due to their likely interaction with blood factors. Again, a microfluidics "lab on a chip” assembly could also be used in place of iron nanoparticles described above.
  • ISSAL surface modifications [0057] The external structure of a liposome is critical to its function in the body. Once in the blood stream, liposomes are scrutinized for surface charge, foreign antigens, and pathogen associated molecular patterns. Many research groups have altered the surface chemistry of liposomes to make them even less visible to the immune system. For example: hyaluronic acid and polyethylene glycol have been used to modify foreign antigen recognition in viral and liposome vectors (22). These methods could also be applied to this invention using the "on column” method mentioned above. However, the functionality of membrane fusion proteins and targeting affinity should be preserved after any surface modifications or the ISSAL can become inert. It is conceivable that small sugar based polymers could be added to the surface of ISSALs. These sugar polymers, could function to hydrate the surface of the ISSAL.
  • An ordered self assembling internal structure in a liposome allows the advantage of adaptivity of size which is pre-programmed by varying the length of the ISSAL supports. As is disclosed herein, varying the length of the ssDNA allows for larger or smaller liposome formulations. This size flexibility cannot be replicated using any other known design for liposome size adjustment. Normally liposomes are extruded through a filter and then frozen at a specific size, that size can be highly variable upon freeze-dry hydrodynamic reconstitution which curtails overall function mostly due the formation of multi-lamellar structures. Another example of this designs' superiority is in the ability to add membrane functionality in a step- wise manner to each liposome layer. This allows for membrane fusion events and affinity events to work in a concerted manner to break sub-cellular addresses. No other known liposome or virus design is capable of
  • a rigid outer encapsulating layer may allow for cell surface affinity by linking the encapsulating layer surface with antibodies, however there is no place for a membrane fusion protein to function due the restriction of the outer layer.
  • the ISSAL design can allow for both
  • the ISSAL's can be used in, for example and without limitation, the field of drug delivery, vaccination, imaging contrast agents, and nanotechnology, in which liposomes of ordered, self-assembling structure are employed to deliver soluble or insoluble molecules to any sub-cellular address.
  • the self-assembling nature of this design also allows for a higher order assembly of larger structures based on a spherical starting point.
  • a 6-ended star DNA pattern was designed from 6 separate 33 base pair oligonucleotides with sequence symmetry minimization. Each oligonucleotide binds to its two neighbours with 9 base pairs each and has a terminal stretch of 15 base pairs of non-binding single stranded DNA. This 15 base pair stretch is identical between all oligonucleotides in the DNA pattern in order to act as acceptor ends for free pl-ssDNA.
  • oligonucleotides (Table 1), when placed in solution with a magnesium ion concentration of at least 5 mM form a three dimensional star shape with free single stranded 3' DNA ends. This star pattern is analogous to the "ISSAL core" described in center of Scheme 2. Three dimensional patterns were formed by mixing each oligonucleotide to a final concentration of 12uM with lOmM Mg2+ in IX Tris/Boric acid/EDTA buffer with nuclease-free water. The DNA pattern oligonucleotides were heated to 95°C for 10 minutes then decreasing sequentially from 65°C to 45°C to 35°C to 25°C for 20 minutes each. Pattern oligonucleotides were stored at -20°C when not in use. Table 1. DNA Sequences of an ISSAL Assembly
  • a phospholipid-ssDNA adduct molecule was synthesized by first joining an azide containing group to the head group of egg PE with N- hydroxysuccinimide (NHS) chemistry.
  • NHS N- hydroxysuccinimide
  • methanol water layers to separate.
  • the upper methanol water layer was removed carefully and the lower chloroform layer placed in a pre-weighed glass vial. The vial was then placed in a vacuum oven overnight to
  • a complementary pairing oligonucleotide (Table 1) was synthesized with a 5'-Octadiynyl containing group (IDT Inc). PE-azide (0.0031g, in 250ul_ chloroform) was mixed with the 5'-Octadiynyl- oligonucleotide (1 umol, 750ul_ nuclease free water) for a molar equivalence of 4 PE-azide to 1 equivalent oligo.
  • Liposomes were prepared by first creating a solution of pl- ssDNA in nuclease free water. 6-Ended DNA patterns in the appropriate buffer (x mol equivalence) were mixed with pl-ssDNA solution (20 to 400x mol equivalence) and phosphatidylcholine (dissolved in ethanol, 50 to 500x mol equivalence). Liposomes were prepared by heating the mixture to between 45 and 70°C with medium intensity ultrasonication for 10-30 minutes.
  • Table 2 shows an example of a mixing strategy for assembly of ISSAL liposomes.
  • Figure 1 shows electron micrograph images of prepared negative control and ISSAL liposomes (Table 2).
  • Figure 1 shows electron microscopy images of liposomes negative stained with uranyl acetate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Dispersion Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

INTERNAL STRUCTURED SELF ASSEMBLING
LIPOSOMES
CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of and priority to US
Provisional Patent Application Serial No. 61/682,897 filed August 14, 2012 under the title INTERNAL STRUCTURED SELF ASSEMBLING LIPOSOMES. The content of the above patent application is hereby expressly incorporated by reference into the detailed description hereof.
FIELD
[0002] The present invention relates to internal structured self- assembled liposomes (ISSAL), their process for manufacture and uses or applications.
BACKGROUND
[0003] Drug delivery using liposomes over conventional delivery methods
[0004] Drug delivery methods have become a hot topic of focus due to the difficulty of targeting medical interventions with small or large molecules alone. As small molecule drugs are designed and tested, an incredible number of possible candidates are removed from consideration due to issues involving poor pharmacodynamics or kinetics (1). A similar issue exists in larger molecular drugs based on DNA, RNA and proteins. Studies involving the direct injection of plasmid DNA and smaller strands of RNA have shown that nucleases in blood serum destroy these drugs in a highly efficient manner (2). As such, nucleic acids cannot be delivered into the body without substantial help. Nucleic acid analogues have been used to overcome blood instability issues by being resistant to nucleases (3). However, the nucleic acid analogue approach still suffers from issues involving delivery into cells. When foreign protein drugs are delivered into the body, they are usually targeted by the humoral immune system (4). For example, patients with haemophilia A and B receiving injections of blood coagulation factors frequently develop neutralizing antibody responses which in many cases render the treatments useless with time (5) . Although incredible genetic discoveries in various medical fields have been made over the last decade and a half, the lack of a practical delivery method for large molecules renders this data largely unusable. As a result, years of work have been put into designing methods to solve the issue of large molecule delivery. These methods mostly include the use of modified recombinant viruses and non- viral liposomes (6). Although viruses have shown promise under some medical circumstances there are ongoing issues of toxicity, target specificity or cell tropism, and ethical concerns associated with their use (7). Virus particles also become targets for the humoral immune system, greatly limiting their use to a narrow time window before neutralizing antibodies arise (8). If treatments are unsuccessful in this time window, further virus injections are quickly eliminated by the immune system . Non-viral methods based on liposomes have been seen as the safer alternative to viral delivery of large molecules. Efforts involving liposomes have been classically hampered by low efficiency of delivery, issues with vehicle loading efficiency, and practical issues involving preservation of structure during storage (3, 9).
[0005] Liposome design challenges with delivery efficiency, drug loading, and structure preservation
[0006] Liposomes are normally single phospholipid bilayer bubbles which separate the drug inside from the hostile environment outside.
Incredible arrays of methods have been used to modify the outside of liposomes in order to make them more targetable, more delivery efficiency, and more structurally stable. Efforts to target the liposome via linked antibodies/peptides to the surface of the desired cell type for endosome uptake are known (10). When the targeted cell envelopes the liposome, the newly formed endosome continues through a natural process which degrades the contents for use as food sources. During this process, the contents of the liposome are freed into the cytoplasm usually via the destruction of the endosome membrane. The release of late-endosomal or lysosomal contents into the cytoplasm is a source of cytotoxic effects of non-viral vectors (11). Now in the cytoplasm, the liposome contents are then free to act in the local environment. However, targeting the nucleus in non-mitotic cells is impeded by the dual-bilayered nuclear membrane barrier and the nuclear pore complex. Some have attempted to address this issue by introducing transcription factor binding sites into the therapeutic DNA drug (12).
Transcription factors bind to target sites on the DNA drug and help to shuttle it to the nucleus during signal transduction. These efforts have increased the rate of uptake into the nucleus; however the efficiencies of liposome therapy still remain much lower than robust viral methods. The movement of nucleic acids into the nucleus from the cytoplasm is dependent on the length of the strand due to the need for this molecule to fit though the narrow nuclear pore complex.
[0007] Another additive to the liposome is the use of membrane fusion proteins. These proteins have been employed to allow liposomal membranes to fuse with the cell's plasma membrane. This method unloads the contents of the cell into the cytoplasm without breaking down endosomal barriers, avoiding considerable cytotoxicity (13, 14). In effect, the liposome can be loaded with any sized nucleic acid for delivery into the cytoplasm . However, nucleic acids delivered by membrane fusion proteins into the cytoplasm are still subject to the "thread in needle" efficiency of the nuclear pore complex.
[0008] The efficiency of drug loading and structure retention can also be of concern in the practical implementation of liposomal drug delivery. In simplest terms, a tiny bubble can be formed easily, but keeping it intact during drug loading and long term storage has provided challenges (9).
When a normal liposome mixture is extruded to produce the desired single membrane unilamellar format, the subsequent drug loading and storage can become a problem . Freeze dried liposomes do not retain their original shape and size upon addition of soluble drug. Since their shape and size are relevant to the desired delivery function, liposomes should be shape- stabilized prior to storage (9). In order to address this issue, some have used complexing agents to harden the liposome membrane/structure. This allows liposomes to be formed with one membrane, to be fixed in that structure through a complexing agent, freeze-dried, and then loaded by hydrodynamic force (drug in water) (15). This allows a liposomal drug to be assembled and stored as a freeze dried mixture and loaded efficiently prior to use. Although, the efficiency of the liposome assembly process is enhanced, surface hardening and complexing chemistry is incompatible with the use of membrane fusion protein methods. This is because the modified liposome surface has no fluidity or opening within which a membrane fusion protein could function. This lack of fluidity limits externally hardened liposomes to a delivery efficiency which is dependent on endosomal escape.
[0009] Self-assembling structures based on DNA complementary binding
[0010] In the past decade, researchers have begun to explore the assembly of complex structures at the nanometer scale. Nanotechnology often employs information encoding DNA to design structures with preset parameters (16). Structures often are designed by linking ssDNA to effector molecule(s) and then assembled by the complementary base pairing innate to dsDNA. These techniques coupled with lithographic chip and microfluidics gives the user the capability to create devices that can perform a wide array of tasks from sensing DNA sequences, to the step wise assembly of small machines (17). The use of nanotechnology in the synthesis of drugs is still in its infancy. To date, only a few labs have considered the use of DNA in the synthesis of drug delivery vehicles. These interests surround designing DNA to form three dimensional structures which are then placed in the body (18). However, most of these techniques do not account for the body's innate ability to clear foreign DNA from the blood stream . Liposomes, which are used to hide DNA cargo from destructive blood enzymes, have not been designed with a self assembling platform.
[0011] There is a need in the art for a liposome and method of preparing a liposome with an internal structure that is amenable to the addition of surface proteins with a fluid membrane, and while still being stable during a freeze thaw cycle. In addition, there is a need in the art for an internal structure in a liposome that could aid its overall structural stability by keeping membrane layers from mixing and moving during both the freeze-drying and storage. Further, there is a need in the art for a liposome having an internal structure that could also aid in the synthesis of the overall vehicle with multiple bilayers and by allowing effector proteins to bind to the scaffold itself, and the product of which could be capable of taking any sized molecule and placing in any sub-cellular address in the body.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Reference will now be made, by way of example, to the accompanying drawings which show example embodiments of the present application, and in which :
[0013] Figure 1 shows electron micrograph images of prepared negative control and Internal Structured Self Assembling Liposome (ISSAL) liposomes. SUMMARY OF INVENTION
[0014] In one aspect, the specification relates to an internal structured self assembled liposome (ISSAL), containing :
[0015] - a nuclear core molecule or complex including a first affinity enhancing molecule; and
[0016] - a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule couples to the first affinity enhancing molecule.
[0017] In another aspect, the specification relates to a method of forming an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity enhancing complex having a phospholipid coupled to second affinity enhancing
molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule, the method including the step of mixing the nuclear core molecule or complex with the phospholipid-affinity affinity enhancing complex.
[0018] In a further aspect, the specification relates to use of an internal structured self assembled liposome, in the treatment of a disease, the internal structured self assembled liposome containing a nuclear core complex having a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
[0019] In still another aspect, the specification relates to a method of delivering an active pharmaceutical ingredient to a patient in need thereof, containing the step of providing the active pharmaceutical ingredient in an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
[0020] In another further aspect, the specification relates to method of treatment of a disease, including the step of providing to a patient in need therof, a active pharmaceutical ingredient in an internal structured self assembled liposome including a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule.
[0021] In another still further aspect, the specification relates to a pharmaceutical composition containing an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid-affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is coupled to the first affinity enhancing molecule; and a pharmaceutically acceptable excipient. [0022] In still another further aspect, the specification relates to a kit, containing :
[0023] an internal structured self assembled liposome containing a nuclear core molecule or complex including a first affinity enhancing molecule; and a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer containing a phospholipid- affinity affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule is capable coupled to the first affinity enhancing molecule; and
[0024] instructions for use.
DESCRIPTION OF EXAMPLE EMBODIMENTS
[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, only embodiments of the materials and methods are described herein.
[0026] The examples of molecules used in the assembly of this structure are examples of molecules which can form the internal structure overall and should not be considered as exclusive embodiments of this invention or in any way limiting the scope of invention. Many other molecules can be combined covalently to form similar structures to those examples listed and are equally viable examples of this ordered self- assembling internal structure liposome.
[0027] The assembly of the liposome internal structure begins with the production of a "nucleus" molecule/complex for the core. This is the point upon which the rest of the liposome is assembled in stages. The nuclear core molecule or complex is linked (in one example embodiment and without limitation, covalently linked) to first affinity enhancing molecules which provide the assembly point for the first surrounding lipid bilayer. An example of this nuclear core complex could be to covalently link micelle forming phospholipids to the 5' phosphate groups of ssDNA. In this example, the nuclear core structure can be roughly spherical and capable of binding multiple ssDNA groups via a 5' phosphate. Another example of a nuclear core molecule could be a group of oligonucleotides which when combined in solution make a three dimensional pattern with free ssDNA ends.
[0028] The following is an example of the assembly of the first lipid bilayer in the liposome. Phospholipids, which have been covalently linked at the hydrophiiic end to a second affinity enhancing molecule, are used to bind to the core complex. An example of this could be to link the terminal NH2 group of phosphatidylethanolamine (PE) to the 5' phosphate group of ssDNA to create a phospholipid-ssDNA adduct (pl-ssDNA). The first bilayer is formed upon mixing phospholipids and pl-ssDNA with the ssDNA-nuclear core complex. This assembly of the first bilayer is helped by the specific association of dsDNA affinity complementary binding. In this example, the pl-ssDNA on the outer surface of the first liposome bilayer provides the structural basis for assembling further bilayers. As such, liposomes bilayers are constructed in stages. With each sequential stage, different soluble drugs or varying membrane functionality can be applied. The entire structure, when assembled, could be comparable to a "3D wheel" where the dsDNA functions as structural "spokes".
[0029] For the implementation of this design, another example could be to use affinity proteins, polypeptides, or nucleic acid analogues in place of ssDNA at all points in the above assembly. In this way, the nuclear core is linked to the first bilayer via protein-protein specific interaction. At this point, protein subunits could face outward on the liposomal surface for assembly of the next lipid bilayer. In the same way, the nuclear core molecular or complex need not be a micelle; rather a generally spherical molecule can be used with outward functional points. Another example of a nuclear core complex could be a small compact protein with modified surface residues linked to affinity based molecules, such as ssDNA. The overall liposome structure could still resemble a layered 3D wheel in which
molecules of DNA or polypeptide function as spokes to keep and align lipid bilayers around a central core.
[0030] The overall use of these internal structured self-assembling liposomes could be to place any soluble molecule into any sub-cellular location in the body. Sub-cellular targeting can be accomplished by adding specific membrane affinity (ie. surface antibodies) and membrane fusion properties to each liposome bilayer stepwise during assembly. As such, the outer bilayer binds and enters the surface of a targeted cell in the body and the subsequent bilayers underneath are targeted to other membrane layers within the cell (ie. nuclear envelope, mitochondria, golgi complex, etc).
Insoluble drugs can also be mixed in the hydrophobic region of phospholipid bilayers during their assembly.
[0031] Soluble proteins which are linked to ISSAL ssDNA can be incorporated into the complex via base pair affinity. Single span membrane proteins such as various membrane fusion proteins which are stabilized in solution via solubilising domains can also be linked to ssDNA (19). These single span membrane proteins could then be added to the existing scaffold of pl-ssDNA. The net effect could be that the membrane proteins are ordered in the correct ecto/endo domain orientation in the bilayer. As the bilayers are assembled stepwise, unique affinity targeting and membrane fusion can be applied to separate layers. Since the DNA scaffold keeps the bilayers from interacting, any membrane fusion events would have to begin at the liposomal outer surface instead of between interior bilayers. In such a way, the first bilayer could breach the plasma membrane of a cell and the subsequent bilayers could be targeted to breach the nuclear envelope layers. [0032] Layers in the liposome internal structure are severed via specific endonuclease or protease activity. This is done by dividing one regime into two separate but equivalent parts. Each of the two formulations contains the enzymes to break the structural components of the other formulation. This avoids the breakdown of the internal structure components of the liposome prior to the correct delivery to each subsequently targeted membrane compartment. When the final bilayer is assembled, the excess DNA on the surface is cut via recombinant nuclease activity and the liposomes purified.
[0033] In summary, a complex multi-layered self assembling liposome could be loaded with any soluble or insoluble molecule(s) and its contents released in any sub-cellular address within the body. This can help to address the issues of liposome delivery efficiency with the use of surface antibodies and membrane fusion proteins. The internal structural supports also greatly decrease the movement of membranes during drug loading and storage. This design can also allow for the ability to unload even
chromosome sized molecules into targets like the nucleus or mitochondria.
[0034] Production and Purification of Long Chain ssDNA
[0035] Currently, it can be challenging to synthesize long chain ssDNA with high quality and quantity in an inexpensive manner. The following method was adapted to provide one route, although routes may be also possible, for synthesizing sufficient inexpensive long chain ssDNA for use in ISSAL constructs.
[0036] Iron superparamagnetic nanoparticle resins can be used for the large scale, batch format separation of large molecules such as long chain ssDNA. The following method was adapted from Bumb et al . 2008 (20). These nanoparticles are an example of known design that could aide in the extraction of ISSAL components and is not required for ISSAL assembly or function. Briefly, iron nanoparticles are created by reacting Fe2+ and Fe3+ ions with concentrated ammonia. The particles are washed with magnetic separation and then washed with 2M HN03 to convert the surface charge from negative to positive. The particles are then washed with magnetic separation to remove most of the concentrated acid. After stabilizing the pH at 2.5 with NaOH and HN03, the particles are surface stabilized by saturation with citrate ions. The particles are then washed and pH stabilized at 6.0. The particles are then silica coated by reacting with a mixture of
tetraethylorthosilicate (TEOS) and (3-amino-propyl) triethoxysilane in ethanol, using triethylamine as a catalyst. The amino groups on the surface of the particle are then ready to be linked to ssDNA with a water soluble cross linker such as l-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC).
[0037] To separate long chain ssDNA, a complementary base sequence can be added to the surface of the nanopartides. Scheme 1 discloses how longer ISSAL ssDNA is made and purified.
Iron magnetic nanopartides
coated in silica with 3- Iron nanopartides coated
Figure imgf000013_0001
Scheme 1. Synthesis of long single stranded DNA for ISSAL structural assembly. Double stranded DNA is grown in E. coli via high copy number plasmids. These plasmids are then cut with restriction endonucleases. The double stranded DNA is then separated with iterative high temperature annealing to complementary ssDNA bound magnetic resin.
[0038] In order to create the first batch of separating nanopartides, the complementary ssDNA can be synthesized using standard synthetic techniques. The synthetic ssDNA is crossl inked to surface amine groups of silica coated iron nanoparticles with EDC in water. When the reaction is complete, the solution is washed with water via magnetic separation. Longer ssDNA can now be purified by strategically controlling the temperature of annealing and magnetic separation. This is made possible because the iron nanoparticles are not sensitive to heat ranges between 4°C and 200°C (20).
[0039] Long chain DNA to be used in the synthesis of self assembling liposomes is grown within high copy number plasmids. These plasmids are harvested inexpensively from bacteria such as E. coli. These high copy number plasmids contain the desired sequence in multiple repeats for added efficiency. The double stranded plasmid DNA is purified from bacteria using the common alkaline lysis technique. Following a basic DNA purification with a silica substrate, the DNA is cut with restriction enzymes designed to remove the plasmid back bone and separate individual desired sequences. This digested mixture is then applied to the iron nanoparticle ssDNA conjugates for separation. Separation is achieved by high temperature annealing followed by magnetic separation. The separation efficiency of short chain DNA conjugated nanoparticles can be low at first. However, after multiple separations a small fraction of purified complementary DNA can emerge. This small amount of purified long chain ssDNA is then used to create a new and superior batch of iron nanoparticle ssDNA conjugates. This process is repeated until the separated ssDNA is completely free of
contaminants. This process also applies to any other complementary ssDNA to be separated. The method can allow avoidance of harsh chemical treatment of the original dsDNA to separate ssDNA strands based on GC/AT ratio differences. This technique is also not biased to any base pair configuration, can be inexpensive and scalable to large batch size. The iron nanoparticle ssDNA conjugates can also be reused many times.
Alternatively, a purified preparation of ssDNA could be bound to a solid column matrix. This could allow for high temperature liquid chromatography of the desired ssDNA instead of magnetic separation. [0040] Synthesis of DI-SSD NA subunits
[0041] Long chain ssDNA is purified with the above method and placed in solution with EDC and N-hydroxysuccinimide (N HS) . Next, PE is added to the ssDNA mixture. After the reaction is complete, the components are purified to remove unwanted products. The PE, ssDNA, and pl-ssDNA are separated using a large column format containing covalently bound complementary ssDNA. Initially the ssDNA and pl-ssDNA are bound to the column . Then the PE is washed away using an increasingly organic phased buffer. The ssDNA and pl-ssDNA are then eluted at high temperature and put through a second column with a hydrophobic medium . The ssDNA will not bind to the hydrophobic column and is eluted . The pl-ssDNA is then eluted by increasing the organic eluant phase. The pl-ssDNA is then dried by solvent evaporation and stored in the dark under nitrogen . Note that any trace contaminants of PE or ssDNA should not be problematic for the assembly of ISSALs.
[0042] Synthesis of micelle-ssDNA nuclei subunits
[0043] Micelles are a mixture of spherical amphipathic molecules in water without a bilayer. Some amphipathic molecules form micelles more readily than others. On example of this is monoacyl phospholipids such as lysophosphatidylethanolamine (LPE) . LPE can be made by reacting purified PE with a soluble phospholipase A2. This produces a LPE with the second carbon of the glycerol chain deacylated. LPE, which is positively charged, is purified to remove free fatty acids. This is done by binding to a cation exchanging hydrophobic mixed mode resin . Free fatty acids will not bind and are carried away in the wash . The resulting mixture is of LPE and unreacted contaminant PE. These PE contaminants can be ignored if they are in low enough concentrations as they can have little impact on the formation of micelle structures. The molar ratio of this contaminant should not react higher than 20 LPE to 1 PE. LPE can be dried and stored in the dark under nitrogen . [0044] The ISSAL ssDNA is mixed with LPE and allowed to react in the presence of EDC and N HS soluble crosslinking reagents. The resulting mixture of LPE, ssDNA, LPE-ssDNA adducts, EDC and NHS can be separated and purified as described above with pl-ssDNA. Purified ssDNA-LPE should be stored dry in the dark under nitrogen.
[0045] Assembly of ISSAL subunits
[0046] The assembly of ISSAL in solution is a step wise process under on and off column conditions. Columns conditions involving iron nanoparticle ssDNA conjugates are used to simplify purification of ISSAL during synthesis and to minimize the occurrence of contaminants. Scheme 2 illustrates how the ISSAL assembly proceeds.
Figure imgf000017_0001
Figure imgf000017_0002
Scheme 2. Synthesis of phospholipid-single stranded DIMA adducts (pl- ssDNA), the production of ISSAL "nuclei" structures, and the stepwise assembly of internal structured self assembling liposomes.
[0047] In the first layer, there is a mixture of two different pl-ssDNA molecules. Self-assembly begins by mixing ssDNA-LPE adducts and regular LPE in water with agitation at 4°C. This forms the micelle nuclei
spontaneously in solution. Micelles are the lowest energy state for this molecule and the longer the solution is shaken, the higher the entropy of the system will be when the agitation stops. The micelles in solution are then mixed with pl-ssDNA, phosphatidylcholine, PE, cholesterol, etc. in the correct mixture ratio. This forms the first lipid bilayer surrounding the nuclei.
Mixtures are shaken at 4°C to ensure the highest entropy for the system . Most will be specific for the complementary layers in the ISSAL structure, but a small proportion (30 : 1 molar ratio) will be specific for the iron nanoparticle ssDNA resin. Once the ISSAL intermediates are bound to the column they can be treated with any reagents compatible with the pH, temperature, ionic and solvent requirements of DNA complementary base pair binding. To avoid incorporation of iron nanoparticles in the ISSALs during assembly, the double-stranded DNA can be cut or removed by denaturation. A microfluidics "lab on a chip" assembly could also be used in place of iron nanoparticles described above.
[0048] Further bilayers are formed as above by varying the pl-ssDNA and phospholipid/cholesterol mixtures stepwise. When properly assembled, the outer layer can be predominantly of the pl-ssDNA that was last used in excess. Contaminants or spontaneous incorporation of a complementary binding pl-ssDNA into the assembly is a rare occurrence which should not affect the function of the overall ISSAL structure. Intermediate structures formed without the internal structure of the ISSAL can be less stable under cold agitation conditions and should form the lowest entropic variation over time. The rigidity of the nucleus and the shear stress stability of the ISSAL complex can determine how much agitation can be used before the ISSAL structures gain enough free energy to break apart. Higher shear stress stability is also inversely proportional to membrane fusion reactivity, once membrane fusion proteins have been added to the outer layer.
[0049] Engineering ISSAL membrane proteins
[0050] A functionality to be added using proteins is membrane fusion and targeting affinity. Membrane proteins can represent a challenge for standardized incorporation into complex bilayered structures. In order to overcome these difficulties, membrane spanning proteins can be adapted and engineered to incorporate correctly. For example, single transmembrane domain proteins are more likely to be solubilized then multiple
transmembrane domain containing proteins. This is because of the random and unfavourable movement of the various multiple transmembrane domains in solution are more likely to cause irreversible aggregation and precipitation. Many soluble proteins, for example albumin, have considerable hydrophobic regions masked by highly hydrophilic regions. The use of solubility
enhancing ecto and endo domains in protein engineering allows for similar amphipathic formations which enhance the solubility of a single pass transmembrane protein.
[0051] In order to efficiently incorporate membrane proteins into ISSAL scaffolds, the proteins can be engineered to be readily amenable to ISSAL affinity molecules. For example, a SNAP25/synaptobrevin/syntaxin snare tag complex is a viable option for simplistic attachment of ssDNA to ISSAL engineered soluble membrane proteins (21). The snare complex described by Ferrari et al. 2010 is an example of how molecules can be linked together in a facile way. The snare complex has not been used to link liposome associated structures together. The use of a snare complex in this design is an example of molecular ligation that can be replicated with other
approaches and should not be considered a mechanism that is limited to ISSAL design. Scheme 3 shows how the SNAP25 complex functions.
Although SNAP25 tags do not involve covalent linkage, the association of the complex is extremely stable.
x
al
Figure imgf000020_0001
domains)
Scheme 3. Diagrammatic illustration of the formation of
syntaxin/SNAP25/synaptobrevin SNARE complexes.
[0052] Scheme 4 discloses how the SNAP25/synaptobrevin/syntaxin complex functions as a tag for soluble membrane proteins and how these complexes are added to the ISSAL scaffold. This is done by chemically ligating the ssDNA to the syntaxin peptide. EDC readily reacts with both - NH2 groups and -C02- groups. Therefore simplistic addition of EDC directly to syntaxin peptide can cause many unwanted addition reactions in the center of the peptide with acidic side chains. Because of this, the reaction can be modified so that the ssDNA reacts first and that any unreacted EDC is removed afterward. This is done by first adhering soluble ssDNA to a complementary ssDNA iron nanoparticle resin. Then the EDC is added in the presence of NHS. This forms a stable reactive intermediate which allows for the unreacted EDC to be washed out in the presence of excess NHS. The syntaxin peptide is then mixed with the ssDNA-N-hydroxysuccinimide intermediates and allowed to react. The product is predominantly N-terminal and -NH2 side chain additions via a phosphoramidate linkage to the 5' phosphate group on the ssDNA. The nanoparticle beads bound to ssDNA- syntaxin adducts are then washed to remove excess unreacted syntaxin peptide.
Figure imgf000021_0001
Scheme 4. The tagging of soluble membrane proteins with SNARE complexes and incorporation into ISSAL assembly. Stepwise synthesis of ISSAL allows for layers to be targeted to pass different membrane barriers.
[0053] The syntaxin-ssDNA adducts need not be uniform to interact correctly with the rest of a snare complex. Therefore only simplistic purification is required. This purification can be done by making use of a histidine-6x tag applied to the end of the syntaxin peptide or by making use of a synaptobrevin/SNAP25 linked resin. Histidine-6x tags, which are normally bound to NTA-based resins, are the least expensive and fully reusable choice. The soluble membrane protein with a synaptobrevin tag is then mixed with soluble SNAP25 and ssDNA-syntaxin to form a highly stable complex. This tags the soluble membrane protein with ISSAL compatible ssDNA scaffolding. The soluble membrane proteins are then mixed with ISSAL scaffolds via DNA base pair affinity. The ssDNA interaction from the endo domain of the membrane protein can ensure that the correct outward protein orientation occurs. While the soluble membrane proteins are added, the solution can also be filled with soluble drugs for incorporation into the structure. This allows the soluble molecules to be incorporated into specific layers of the ISSAL to be delivered to different sub-cellular addresses.
Insoluble drugs can be mixed into the pl-ssDNA mixture for incorporation.
[0054] Once proteins are incorporated, the ISSAL scaffolds are filled in with a pl-ssDNA/lipid mixture to form the next bilayer. Since membrane proteins can contain a highly hydrophobic region at their transmembrane domain, this portion of the protein can be more likely to be incorporated into the bilayer structure. The lowest energy state is the one in which membrane proteins are comfortably seated inside a lipid bilayer in order to meet the hydrophobicity of the transmembrane domain . Agitation in a cold system should maximize the entropy of the system.
[0055] Solubility tags on the outside of the ISSAL structure can be removed for the sake of the adaptive immune system. This is done by adhering the ISSALs via external pl-ssDNA to compatible complementary ssDNA iron nanoparticles resin and placing the mixture in a solution of site specific proteases engineered to remove the tags. Since the ISSALs in solution are "on column" they can be modified with any other system and then purified by using either heat or nucleases to release the ISSALs from the column. The external nucleic acids can also be removed from ISSAL structures due to their likely interaction with blood factors. Again, a microfluidics "lab on a chip" assembly could also be used in place of iron nanoparticles described above.
[0056] ISSAL surface modifications [0057] The external structure of a liposome is critical to its function in the body. Once in the blood stream, liposomes are scrutinized for surface charge, foreign antigens, and pathogen associated molecular patterns. Many research groups have altered the surface chemistry of liposomes to make them even less visible to the immune system. For example: hyaluronic acid and polyethylene glycol have been used to modify foreign antigen recognition in viral and liposome vectors (22). These methods could also be applied to this invention using the "on column" method mentioned above. However, the functionality of membrane fusion proteins and targeting affinity should be preserved after any surface modifications or the ISSAL can become inert. It is conceivable that small sugar based polymers could be added to the surface of ISSALs. These sugar polymers, could function to hydrate the surface of the ISSAL.
[0058] Advantages of the ISSAL design over other liposomes
[0059] An ordered self assembling internal structure in a liposome allows the advantage of adaptivity of size which is pre-programmed by varying the length of the ISSAL supports. As is disclosed herein, varying the length of the ssDNA allows for larger or smaller liposome formulations. This size flexibility cannot be replicated using any other known design for liposome size adjustment. Normally liposomes are extruded through a filter and then frozen at a specific size, that size can be highly variable upon freeze-dry hydrodynamic reconstitution which curtails overall function mostly due the formation of multi-lamellar structures. Another example of this designs' superiority is in the ability to add membrane functionality in a step- wise manner to each liposome layer. This allows for membrane fusion events and affinity events to work in a concerted manner to break sub-cellular addresses. No other known liposome or virus design is capable of
overcoming the issue of sub-cell addressing. Finally, the assembly of multiple layers of in the ISSAL allows for resistance to shape changes of the liposome during freeze-dry hydrodynamic reconstitution. Some liposome designs are capable of being highly resistant to hydrodynamic reconstitution, but at the expense of further functionality afforded by a fluid outer
membrane. For example, a rigid outer encapsulating layer may allow for cell surface affinity by linking the encapsulating layer surface with antibodies, however there is no place for a membrane fusion protein to function due the restriction of the outer layer. The ISSAL design can allow for both
hydrodynamic reconstitution as well as the addition of membrane fusion proteins along with any other desired membrane surface functionality.
[0060] The ISSAL's can be used in, for example and without limitation, the field of drug delivery, vaccination, imaging contrast agents, and nanotechnology, in which liposomes of ordered, self-assembling structure are employed to deliver soluble or insoluble molecules to any sub-cellular address. The self-assembling nature of this design also allows for a higher order assembly of larger structures based on a spherical starting point.
[0061] EXAMPLES
[0062] A 6-ended star DNA pattern was designed from 6 separate 33 base pair oligonucleotides with sequence symmetry minimization. Each oligonucleotide binds to its two neighbours with 9 base pairs each and has a terminal stretch of 15 base pairs of non-binding single stranded DNA. This 15 base pair stretch is identical between all oligonucleotides in the DNA pattern in order to act as acceptor ends for free pl-ssDNA. These
oligonucleotides (Table 1), when placed in solution with a magnesium ion concentration of at least 5 mM form a three dimensional star shape with free single stranded 3' DNA ends. This star pattern is analogous to the "ISSAL core" described in center of Scheme 2. Three dimensional patterns were formed by mixing each oligonucleotide to a final concentration of 12uM with lOmM Mg2+ in IX Tris/Boric acid/EDTA buffer with nuclease-free water. The DNA pattern oligonucleotides were heated to 95°C for 10 minutes then decreasing sequentially from 65°C to 45°C to 35°C to 25°C for 20 minutes each. Pattern oligonucleotides were stored at -20°C when not in use. Table 1. DNA Sequences of an ISSAL Assembly
Name DNA Sequence 5' to 3'
6 ended star pattern oligo 1 CGTACGACGACCTCAACGCCACACCACTCCACC
6 ended star pattern oligo 2 CGTTGAGGTAGTGCAACGCCACACCACTCCACC
6 ended star pattern oligo 3 CGTTGCACTGGCACATCGCCACACCACTCCACC
6 ended star pattern oligo 4 CGATGTGCCGTGCGAACGCCACACCACTCCACC
6 ended star pattern oligo 5 CGTTCGCACCGACAGTCGCCACACCACTCCACC
6 ended star pattern oligo 6 CGACTGTCGCGTCGTACGCCACACCACTCCACC
5'-Octadiynyl-complementary 5'Octadiynyl-dU-AGGTGGAGTGGTGTGG oligo
[0063] A phospholipid-ssDNA adduct molecule was synthesized by first joining an azide containing group to the head group of egg PE with N- hydroxysuccinimide (NHS) chemistry. The egg PE (O. lg, Avanti Polar Lipids Inc.) was mixed with a slight molar excess of azido succinimidyl acetic acid NHS (0.03g, Nanocs Inc.) in chloroform : methanol (lOmL, v/v = 4: 1) with triethylamine (0.15 %v). The reaction was stirred overnight at room temperature under nitrogen. Deionized water (5ml_) was added to the reaction mixture and allowed to stir for 30 minutes to hydrolyze excess NHS reagent. The solvents were then evaporated with a rotary evaporator. The crude product was then resuspended in chloroform : methanol (lOmL, v/v = 1 : 1) and placed into a 15ml_ polypropylene tube. Water (1.25ml_) was added to the mixture for a final solution ratio of chloroform : methanol : water
(11.25ml_, v/v/v =2 : 2 : 1). The mixture was shaken briefly and spun in a centrifuge at 3200xg for 8 minutes causing the chloroform and
methanol : water layers to separate. The upper methanol : water layer was removed carefully and the lower chloroform layer placed in a pre-weighed glass vial. The vial was then placed in a vacuum oven overnight to
evaporate the chloroform . The product weighed 0.1222g for a percent yield of 110%. This product phosphatidylethanolamine-N-azidoacetamide (PE- azide) was analyzed by mass spectrometry to have an average molecular weight of 799.53g/mol which corresponded to the addition of the azide group to the egg PE mixture. The purity was assessed by thin layer
chromatography to be approximately 80% product and 20% PE. [0064] A complementary pairing oligonucleotide (Table 1) was synthesized with a 5'-Octadiynyl containing group (IDT Inc). PE-azide (0.0031g, in 250ul_ chloroform) was mixed with the 5'-Octadiynyl- oligonucleotide (1 umol, 750ul_ nuclease free water) for a molar equivalence of 4 PE-azide to 1 equivalent oligo. Separately, a mixture of copper(II) sulfate (1.24xl0-5g, 0.05 molar equivalent) and ascorbic acid (4.4x xl0-5g, 0.25 molar equivalent) in water. The copper/ascorbic acid mixture (lOuL) was then added to the PE-azide/oligonucleotide mixture and the reaction was stirred vigorously overnight at room temperature. The product was then aliquoted into separate polypropylene tubes and placed in the vacuum oven overnight. The combined yield of the reaction was 0.0081g or a percent yield of 95% as an example of a pI-ssDNA.
[0065] Liposomes were prepared by first creating a solution of pl- ssDNA in nuclease free water. 6-Ended DNA patterns in the appropriate buffer (x mol equivalence) were mixed with pl-ssDNA solution (20 to 400x mol equivalence) and phosphatidylcholine (dissolved in ethanol, 50 to 500x mol equivalence). Liposomes were prepared by heating the mixture to between 45 and 70°C with medium intensity ultrasonication for 10-30 minutes. Table 2 shows an example of a mixing strategy for assembly of ISSAL liposomes. Figure 1 shows electron micrograph images of prepared negative control and ISSAL liposomes (Table 2). Figure 1 shows electron microscopy images of liposomes negative stained with uranyl acetate.
Control samples with non-complimentary ISSAL "core" DNA patterns do not form organized structures at lOnm (A and B). Properly formed ISSAL liposomes assemble at the expected size range (C and D). Aggregation seen in C and D is likely due to excess DNA pattern oligos crosslinking individual liposomes into grape-like clusters. Images were taken at 200000X
magnification using JEOL 1200 TEMSCAN microscope.
Table 2. Solution and mixing parameters for liposomes imaged by electron microscopy
Name of Component and Mixing Stock Final Volume
Figure imgf000027_0001
[0066] Other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. All patents, patent applications, and other references noted herein for whatever reason are specifically incorporated by reference. The specification and examples should be considered exemplary only with the true scope and spirit of the invention indicated by the following claims.
[0067] Certain adaptations and modifications of the described embodiments can be made. Therefore, the above discussed embodiments are considered to be illustrative and not restrictive.
[0068] 1. Varma, M .V., Khandavilli, S., Ashokraj, Y., Jain, A.,
Dhanikula, A., Sood, A., Thomas, N .S., Pillai, O., Sharma, P., Gandhi, R. et al . 2004. Biopharmaceutic classification system : a scientific framework for pharmacokinetic optimization in drug research. Curr. Drug Metab. 5: 375- 388.
[0069] 2. Shaw, J. P., Kent, K., Bird, J., Fishback, J., and Froehler, B. 1991. Modified deoxyoligonucleotides stable to exonuclease degradation in serum. Nucleic Acids Res. 19 :747-750.
[0070] 3. Xu, L, and Anchordoquy, T. 2011. Drug delivery trends in clinical trials and translational medicine : challenges and opportunities in the delivery of nucleic acid-based therapeutics. J. Pharm. Sci. 100: 38-52.
[0071] 4. Kringelum, J.V., Nielsen, M ., Padkjaer, S. B., and Lund, 0. 2012. Structural analysis of B-cell epitopes in antibody: protein complexes. Mol. Immunol. 53 : 24-34.
[0072] 5. Kasper, C.K. 1991. Complications of hemophilia A
treatment: factor VIII inhibitors. Ann N Y Acad Sci. 614: 97-105.
[0073] 6. Tani, J., Faustine, and Sufian, J.T. 2011. Updates on current advances in gene therapy. West Indian Med. J. 60 : 188-194.
[0074] 7. Grieger, J.C., and Samulski, R.J. 2012. Adeno-associated virus vectorology, manufacturing, and clinical applications. Methods Enzymol. 507: 229-254.
[0075] 8. Jacobs, F., and Wang, L. 2011. Adeno-associated viral vectors for correction of inborn errors of metabolism : progressing towards clinical application. Curr. Pharm. Des. 17: 2500-2515.
[0076] 9. Peer, D., and Margalit, R. 2000. Physicochemical evaluation of a stability-driven approach to drug entrapment in regular and in surface- modified liposomes. Arch. Biochem. Biophys. 383 : 185-190.
[0077] 10. Peer, D., Karp, J. M ., Hong, S., Farokhzad, O.C., Margalit, R., and Langer, R. 2007. Nanocarriers as an emerging platform for cancer therapy. Nat. Nanotechnol 2: 751-760. [0078] 11. Guo, X., and Huang, L. 2012. Recent advances in nonviral vectors for gene delivery. Acc. Chem. Res. 45: 971-979.
[0079] 12. Cabrini, G., Bezzerri, V., Mancini, I ., Nicolis, E., Dechecchi, M .C., Tamanini, A., Lampronti, I ., Piccagli, L, Bianchi, N ., Borgatti, M . et al. 2010. Targeting transcription factor activity as a strategy to inhibit proinflammatory genes involved in cystic fibrosis: decoy oligonucleotides and low-molecular weight compounds. Curr. Med. Chem. 17:4392-4404.
[0080] 13. Top, D., de Antueno, R., Salsman, J., Corcoran, J., Mader, J., Hoskin, D., Touhami, A., Jericho, M .H ., and Duncan, R. 2005. Liposome reconstitution of a minimal protein-mediated membrane fusion machine. EMBO J. 24: 2980-2988.
[0081] 14. Barry, C, Key, T., Haddad, R., and Duncan, R. 2010.
Features of a spatially constrained cystine loop in the plO FAST protein ectodomain define a new class of viral fusion peptides. J. Biol. Chem.
285: 16424-16433.
[0082] 15. Peer, D., Florentin, A., and Margalit, R. 2003. Hyaluronan is a key component in cryoprotection and formulation of targeted unilamellar liposomes. Biochim. Biophys. Acta 1612: 76-82.
[0083] 16. Rothemund, P.W. 2006. Folding DNA to create nanoscale shapes and patterns. Nature 440 : 297-302.
[0084] 17. Dutse, S.W., and Yusof, N .A. 2011. Microfluidics-based lab- on-chip systems in DNA-based biosensing : an overview. Sensors (Basel) 11 : 5754-5768.
[0085] 18. Walsh, A.S., Yin, H ., Erben, CM ., Wood, M .J., and
Turberfield, A.J. 2011. DNA cage delivery to mammalian cells. ACS Nano 5: 5427-5432.
[0086] 19. Sun, P., Tropea, J.E., and Waugh, D.S. 2011. Enhancing the solubility of recombinant proteins in Escherichia coli by using hexahistidine- tagged maltose-binding protein as a fusion partner. Methods Mol. Biol.
705: 259-274.
[0087] 20. Bumb, A., Brechbiel, M .W., Choyke, P. L., Fugger, L, Eggeman, A., Prabhakaran, D., Hutchinson, J., and Dobson, P.J. 2008. Synthesis and characterization of ultra-small superparamagnetic iron oxide nanoparticles thinly coated with silica. Nanotechnology 19: 335601.
[0088] 21. Ferrari, E., Darios, F., Zhang, F., Niranjan, D., Bailes, J., Soloviev, M ., and Davletov, B. 2010. Binary polypeptide system for permanent and oriented protein immobilization. J. Nanobiotechnology 8: 9.
[0089] 22. Biswas, S., Dodwadkar, N .S., Sawant, R. R., and Torchilin, V. P. 2011. Development of the novel PEG-PE-based polymer for the reversible attachment of specific ligands to liposomes: synthesis and in vitro characterization. Bioconjug. Chem. 22: 2005-2013.

Claims

WHAT IS CLAIMED IS :
1. An internal structured self assembled liposome (ISSAL), comprising :
- a nuclear core molecule or complex comprising a first affinity enhancing molecule; and
- a liposome encompassing the nuclear core molecule or complex, the liposome containing a lipid bilayer comprising a phospholipid-affinity enhancing complex having a phospholipid coupled to second affinity enhancing molecule, wherein the second affinity enhancing molecule extends from an internal surface of the liposome and is coupled to the first affinity enhancing molecule.
2. The ISSAL of claim 1, the nuclear core molecule or complex comprises a micelle forming phospholipid coupled to the first affinity enhancing molecule.
3. The ISSAL of claim 1, the nuclear core molecule or complex comprises a protein coupled to the first affinity enhancing molecule.
4. The ISSAL of claim 1, the nuclear core molecule or complex comprises a group of oligonucleotide forming a three dimensional pattern and having free unpaired oligonucleotide sequences.
5. The ISSAL of claim 2 or 3, wherein the first affinity enhancing
molecule is an oligoncucleotide or protein.
6. The ISSAL of claim 5, wherein the first affinity enhancing molecule is a deoxyribonucleic acid (DNA) oligonucleotide.
7. The ISSAL of claim 6, wherein the DNA is a single stranded DNA
(ssDNA).
8. The ISSAL of claim 7, wherein the ssDNA is coupled via the 5'- phosphate of the ssDNA.
9. The ISSAL of any one of claims 1 to 8, wherein the phospholipid is phosphatidylethanolamine (PE).
10. The ISSAL of any one of claims 1 to 9, wherein the second affinity enhancing molecule is a complementary oligoncucleotide or protein, capable of coupling to the first affinity enhancing molecule.
11. The ISSAL of claim 10, wherein the second affinity enhancing molecule is a complementary single stranded deoxyribonucleic acid (ssDNA) oligonucleotide.
12. The ISSAL of any one of claims 1 to 11, further comprising the second affinity enhancing molecule extending from an external surface of the liposome.
13. The ISSAL of claim 12, further comprising a second liposome
encompassing the liposome that encompasses the nuclear core molecule or complex, the second liposome containing a second liposome lipid bilayer comprising a second liposome phospholipid- affinity enhancing complex having a second liposome phospholipid coupled to a third affinity enhancing molecule, wherein the third affinity enhancing molecule extends from an internal surface of the second liposome and is coupled to the second affinity enhancing molecule extending from the external surface of the first liposome.
14. The ISSAL of any one of claims 1 to 13, further comprising an active pharmaceutical ingredient (API).
15. The ISSAL of claim 14, wherein the API is at least partly insoluble in an aqueous environment.
16. The ISSAL of claim 14 or 15, wherein the API is present in the lipid bilayer.
17. The ISSAL of any one of claims 1 to 15, further comprising a
membrane affinity or membrane fusion molecules.
18. The ISSAL of claim 17, wherein the membrane affinity or membrane fusion molecules comprises a surface antibody or a membrane fusion protein.
19. A method of forming the ISSAL as defined in any one of claims 1 to 18, comprising the step of mixing the nuclear core molecule or complex with the phospholipid-affinity affinity enhancing complex under conditions to effect formation of the lipsome.
20. Use of the ISSAL as defined in any one of claims 1 to 18, in the
treatment of a disease.
21. A method of delivering an active pharmaceutical ingredient to a patient in need thereof, comprising providing the active pharmaceutical ingredient in the ISSAL as defined in any one of claims 1 to 18.
22. A method of treatment of a disease, comprising providing to a patient in need therof, a active pharmaceutical ingredient in the ISSAL as defined in any one of claims 1 to 18.
23. A pharmaceutical composition comprising the ISSAL as defined in any one of claims 1 to 18, and a pharmaceutically acceptable excipient.
24. A kit, comprising :
the ISSAL as defined in any one of claims 1 to 18,; and
instructions for use.
PCT/CA2013/050622 2012-08-14 2013-08-14 Internal structured self assembling liposomes Ceased WO2014026284A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP13829520.9A EP2884965B1 (en) 2012-08-14 2013-08-14 Internal structured self assembling liposomes
CA2881605A CA2881605A1 (en) 2012-08-14 2013-08-14 Internal structured self assembling liposomes
US14/420,983 US9775804B2 (en) 2012-08-14 2013-08-14 Internal structured self assembling liposomes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261682897P 2012-08-14 2012-08-14
US61/682,897 2012-08-14

Publications (1)

Publication Number Publication Date
WO2014026284A1 true WO2014026284A1 (en) 2014-02-20

Family

ID=50101157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2013/050622 Ceased WO2014026284A1 (en) 2012-08-14 2013-08-14 Internal structured self assembling liposomes

Country Status (4)

Country Link
US (1) US9775804B2 (en)
EP (1) EP2884965B1 (en)
CA (1) CA2881605A1 (en)
WO (1) WO2014026284A1 (en)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
WO2014152211A1 (en) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10207010B2 (en) 2015-12-10 2019-02-19 Modernatx, Inc. Compositions and methods for delivery of agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US11744801B2 (en) 2017-08-31 2023-09-05 Modernatx, Inc. Methods of making lipid nanoparticles
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation
US12077501B2 (en) 2017-06-14 2024-09-03 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US12090235B2 (en) 2018-09-20 2024-09-17 Modernatx, Inc. Preparation of lipid nanoparticles and methods of administration thereof
US12151029B2 (en) 2018-09-19 2024-11-26 Modernatx, Inc. PEG lipids and uses thereof
US12263248B2 (en) 2018-09-19 2025-04-01 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12383508B2 (en) 2018-09-19 2025-08-12 Modernatx, Inc. High-purity peg lipids and uses thereof
US12595226B2 (en) 2019-09-19 2026-04-07 Modernatx, Inc. Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117756945A (en) * 2023-11-14 2024-03-26 维康平生(北京)生物科技有限公司 Fusion proteins and their uses

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992021329A1 (en) * 1991-06-04 1992-12-10 A Et S Biovecteurs Biodegradable particulate vector and method of synthesis
WO2001049265A1 (en) * 1999-12-30 2001-07-12 Dana-Farber Cancer Institute, Inc. Proteoliposomes containing an integral membrane protein having one or more transmembrane domains
CA2567741A1 (en) * 2004-05-25 2006-03-30 Chimeracore, Inc. Self-assembling nanoparticle drug delivery system
CA2793604A1 (en) * 2010-03-19 2011-09-22 Massachusetts Institute Of Technology Lipid vesicle compositions and methods of use

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6147204A (en) * 1990-06-11 2000-11-14 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992021329A1 (en) * 1991-06-04 1992-12-10 A Et S Biovecteurs Biodegradable particulate vector and method of synthesis
WO2001049265A1 (en) * 1999-12-30 2001-07-12 Dana-Farber Cancer Institute, Inc. Proteoliposomes containing an integral membrane protein having one or more transmembrane domains
CA2567741A1 (en) * 2004-05-25 2006-03-30 Chimeracore, Inc. Self-assembling nanoparticle drug delivery system
CA2793604A1 (en) * 2010-03-19 2011-09-22 Massachusetts Institute Of Technology Lipid vesicle compositions and methods of use

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
BARRY, C.; KEY, T.; HADDAD, R.; DUNCAN, R.: "Features of a spatially constrained cystine loop in the p10 FAST protein ectodomain define a new class of viral fusion peptides", J. BIOL. CHEM., vol. 285, 2010, pages 16424 - 16433
BISWAS, S.; DODWADKAR, N.S.; SAWANT, R.R.; TORCHILIN, V.P.: "Development of the novel PEG-PE-based polymer for the reversible attachment of specific ligands to liposomes: synthesis and in vitro characterization", BIOCONJUG. CHEM., vol. 22, 2011, pages 2005 - 2013
BUCK ET AL.: "Engineering lipobeads: Properties of the hydrogel core and the lipid bilayer shell", BIOMACROMOLECULES, vol. 5, 2004, pages 2230 - 2237, XP055248567 *
BUMB, A.; BRECHBIEL, M.W.; CHOYKE, P.L.; FUGGER, L.; EGGEMAN, A.; PRABHAKARAN, D.; HUTCHINSON, J.; DOBSON, P.J.: "Synthesis and characterization of ultra-small superparamagnetic iron oxide nanoparticles thinly coated with silica", NANOTECHNOLOGY, vol. 19, 2008, pages 335601, XP020144474, DOI: doi:10.1088/0957-4484/19/33/335601
CABRINI, G.; BEZZERRI, V.; MANCINI, I.; NICOLIS, E.; DECHECCHI, M.C.; TAMANINI, A.; LAMPRONTI, I.; PICCAGLI, L.; BIANCHI, N.; BORG: "Targeting transcription factor activity as a strategy to inhibit pro-inflammatory genes involved in cystic fibrosis: decoy oligonucleotides and low-molecular weight compounds", CURR. MED. CHEM., vol. 17, 2010, pages 4392 - 4404
DAYANI ET AL.: "Liposomes with double-stranded DNA anchoring the bilayer to a hydrogel core", BIOMACROMOLECULES, vol. 14, 2013, pages 3380 - 3385, XP055248578 *
DAYANI Y.; MALMSTADT N.: "Liposomes with Double-Stranded DNA Anchoring the Bilayer to a Hydrogel Core", BIOMAC, vol. 14, 2013, pages 3370 - 85
DUTSE, S.W.; YUSOF, N.A.: "Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview", SENSORS (BASEL), vol. 11, 2011, pages 5754 - 5768
FERRARI, E.; DARIOS, F.; ZHANG, F.; NIRANJAN, D.; BAILES, J.; SOLOVIEV, M.; DAVLETOV, B.: "Binary polypeptide system for permanent and oriented protein immobilization", J. NANOBIOTECHNOLOGY, vol. 8, no. 9, 2010
GRIEGER, J.C.; SAMULSKI, R.J.: "Adeno-associated virus vectorology, manufacturing, and clinical applications", METHODS ENZYMOL., vol. 507, 2012, pages 229 - 254
GUO, X.; HUANG, L.: "Recent advances in nonviral vectors for gene delivery", ACC. CHEM. RES., vol. 45, 2012, pages 971 - 979
GUTMAYER ET AL.: "Synthesis of a polymer skeleton at the inner leaflet of liposomal membranes: Polymerization of membrane-adsorbed pH-sensitive monomers", BIOMACROMOLECULES, vol. 7, 2006, pages 1422 - 1428, XP055248570 *
JACOBS, F.; WANG, L.: "Adeno-associated viral vectors for correction of inborn errors of metabolism: progressing towards clinical application", CURR. PHARM. DES., vol. 17, 2011, pages 2500 - 2515, XP055017907, DOI: doi:10.2174/138161211797247569
KASPER, C.K.: "Complications of hemophilia A treatment:factor VIII inhibitors", ANN N Y ACAD SCI., vol. 614, 1991, pages 97 - 105
KHOSRAVI-DARANI K.; MOZAFARI M. R.: "Nanoliposome Potentials in Nanotherapy: A Concise Overview", INT. J. NANOSCI. NANOTECHNOL., vol. 6, no. 1, 2010, pages 3 - 13, XP055256293
KRINGELUM, J.V.; NIELSEN, M.; PADKJAER, S.B.; LUND, O.: "Structural analysis of B-cell epitopes in antibody:protein complexes", MOL. IMMUNOL., vol. 53, 2012, pages 24 - 34
MACKINNON N. ET AL.: "Triggered Instability of Liposomes Bound to Hydrophobically Modified Core-Shell PMIPAM Hydrogel Beads", LANGMUIR, vol. 26, no. 2, 2010, pages 1081 - 89, XP055256386, DOI: doi:10.1021/la902423v
NG ET AL.: "Properties of a self-assembled phospholipid membrane supported on lipobeads", BIOPHYSICAL JOURNAL, vol. 87, pages 323 - 331, XP055248565 *
PEER, D.; FLORENTIN, A.; MARGALIT, R.: "Hyaluronan is a key component in cryoprotection and formulation of targeted unilamellar liposomes", BIOCHIM. BIOPHYS. ACTA, vol. 1612, 2003, pages 76 - 82, XP004422676, DOI: doi:10.1016/S0005-2736(03)00106-8
PEER, D.; KARP, J.M.; HONG, S.; FAROKHZAD, O.C.; MARGALIT, R.; LANGER, R.: "Nanocarriers as an emerging platform for cancer therapy", NAT. NANOTECHNOL, vol. 2, 2007, pages 751 - 760, XP002531251, DOI: doi:10.1038/nnano.2007.387
PEER, D.; MARGALIT, R.: "Physicochemical evaluation of a stability-driven approach to drug entrapment in regular and in surface-modified liposomes", ARCH. BIOCHEM. BIOPHYS, vol. 383, 2000, pages 185 - 190
ROTHEMUND, P.W.: "Folding DNA to create nanoscale shapes and patterns", NATURE, vol. 440, 2006, pages 297 - 302
See also references of EP2884965A4
SHAW, J.P.; KENT, K.; BIRD, J.; FISHBACK, J.; FROEHLER, B.: "Modified deoxyoligonucleotides stable to exonuclease degradation in serum", NUCLEIC ACIDS RES., vol. 19, 1991, pages 747 - 750
STAUCH ET AL.: "Mimicking a cytoskeleton by coupling Poly(N-isopropylacrylamide) to the inner leaflet of liposomal membranes: Effects of photopolymerization on vesicle shape and polymer architecture", BIOMACROMOLECULES, vol. 3, 2002, pages 324 - 332, XP002673756 *
SUN, P.; TROPEA, J.E.; WAUGH, D.S.: "Enhancing the solubility of recombinant proteins in Escherichia coli by using hexahistidine-tagged maltose-binding protein as a fusion partner", METHODS MOL. BIOL., vol. 705, 2011, pages 259 - 274
TANI, J.; FAUSTINE; SUFIAN, J.T.: "Updates on current advances in gene therapy", WEST INDIAN MED. J., vol. 60, 2011, pages 188 - 194
TOP, D.; ANTUENO, R.; SALSMAN, J.; CORCORAN, J.; MADER, J.; HOSKIN, D.; TOUHAMI, A.; JERICHO, M.H.; DUNCAN, R.: "Liposome reconstitution of a minimal protein-mediated membrane fusion machine", EMBO J., vol. 24, 2005, pages 2980 - 2988
VARMA, M.V.; KHANDAVILLI, S.; ASHOKRAJ, Y.; JAIN, A.; DHANIKULA, A.; SOOD, A.; THOMAS, N.S; PILLAI, O.; SHARMA, P.; GANDHI, R. ET: "Biopharmaceutic classification system: a scientific framework for pharmacokinetic optimization in drug research", CURR. DRUG METAB., vol. 5, 2004, pages 375 - 388
WALSH, A.S.; YIN, H.; ERBEN, C.M.; WOOD, M.J.; TURBERFIELD, A.J.: "DNA cage delivery to mammalian cells", ACS NANO, vol. 5, 2011, pages 5427 - 5432
XU, L.; ANCHORDOQUY, T.: "Drug delivery trends in clinical trials and translational medicine: challenges and opportunities in the delivery of nucleic acid-based therapeutics", J. PHARM. SCI., vol. 100, 2011, pages 38 - 52, XP055044014, DOI: doi:10.1002/jps.22243

Cited By (85)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9271996B2 (en) 2011-12-16 2016-03-01 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9061059B2 (en) 2012-04-02 2015-06-23 Moderna Therapeutics, Inc. Modified polynucleotides for treating protein deficiency
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US10501512B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides
US9089604B2 (en) 2012-04-02 2015-07-28 Moderna Therapeutics, Inc. Modified polynucleotides for treating galactosylceramidase protein deficiency
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9050297B2 (en) 2012-04-02 2015-06-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
WO2014152211A1 (en) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10442756B2 (en) 2015-09-17 2019-10-15 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11220476B2 (en) 2015-09-17 2022-01-11 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12151995B2 (en) 2015-09-17 2024-11-26 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10392341B2 (en) 2015-09-17 2019-08-27 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12404232B2 (en) 2015-09-17 2025-09-02 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10485885B2 (en) 2015-12-10 2019-11-26 Modernatx, Inc. Compositions and methods for delivery of agents
US10556018B2 (en) 2015-12-10 2020-02-11 Modernatx, Inc. Compositions and methods for delivery of agents
US10207010B2 (en) 2015-12-10 2019-02-19 Modernatx, Inc. Compositions and methods for delivery of agents
US12491260B2 (en) 2015-12-10 2025-12-09 Modernatx, Inc. Compositions and methods for delivery of agents
US11285222B2 (en) 2015-12-10 2022-03-29 Modernatx, Inc. Compositions and methods for delivery of agents
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US12396961B2 (en) 2015-12-22 2025-08-26 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10799463B2 (en) 2015-12-22 2020-10-13 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US12144895B2 (en) 2016-11-08 2024-11-19 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US12552738B2 (en) 2017-03-15 2026-02-17 Modernatx, Inc. Crystal forms of amino lipids
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12324859B2 (en) 2017-03-15 2025-06-10 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation
US12077501B2 (en) 2017-06-14 2024-09-03 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
US12357575B2 (en) 2017-08-31 2025-07-15 Modernatx, Inc. Methods of making lipid nanoparticles
US11744801B2 (en) 2017-08-31 2023-09-05 Modernatx, Inc. Methods of making lipid nanoparticles
US12263248B2 (en) 2018-09-19 2025-04-01 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US12151029B2 (en) 2018-09-19 2024-11-26 Modernatx, Inc. PEG lipids and uses thereof
US12383508B2 (en) 2018-09-19 2025-08-12 Modernatx, Inc. High-purity peg lipids and uses thereof
US12090235B2 (en) 2018-09-20 2024-09-17 Modernatx, Inc. Preparation of lipid nanoparticles and methods of administration thereof
US12312293B2 (en) 2019-09-19 2025-05-27 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11597698B2 (en) 2019-09-19 2023-03-07 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US12595226B2 (en) 2019-09-19 2026-04-07 Modernatx, Inc. Carbonate containing lipid compounds and compositions for intracellular delivery of therapeutic agents
US11622972B2 (en) 2021-02-19 2023-04-11 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US12508278B2 (en) 2021-02-19 2025-12-30 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same

Also Published As

Publication number Publication date
CA2881605A1 (en) 2014-02-20
EP2884965B1 (en) 2018-08-08
US9775804B2 (en) 2017-10-03
EP2884965A4 (en) 2016-04-20
US20150231074A1 (en) 2015-08-20
EP2884965A1 (en) 2015-06-24

Similar Documents

Publication Publication Date Title
US9775804B2 (en) Internal structured self assembling liposomes
Mendes et al. Nanodelivery of nucleic acids
Chen et al. Amphiphilic dendrimer vectors for RNA delivery: State-of-the-art and future perspective
Qin et al. Rational design of nanocarriers for intracellular protein delivery
CN102824647B (en) Bone-targeted delivery system based on small nucleic acid drug osteogenesis therapy and preparation method thereof
US20170232115A1 (en) Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof
Du et al. Synthetic nanocarriers for intracellular protein delivery
van der Meel et al. Next-generation materials for nucleic acid delivery
Su et al. Cationic dynamic covalent polymers for gene transfection
Zhou et al. Design, synthesis, and applications of DNA–macrocyclic host conjugates
Zheng et al. Engineering heterogeneity of precision nanoparticles for biomedical delivery and therapy
Biswas et al. Engineered histidine-enriched facial Lipopeptides for enhanced intracellular delivery of functional siRNA to triple negative breast Cancer cells
Chen et al. Framework nucleic acid nanomaterials for central nervous system therapies: design for barrier penetration, targeted delivery, cellular uptake, and endosomal escape
Mazur et al. Membrane fusion models for bioapplications
Li et al. A novel cationic liposome formulation for efficient gene delivery via a pulmonary route
Garcia-Guerra et al. A modular RNA delivery system comprising spherical nucleic acids built on endosome-escaping polymeric nanoparticles
WO2021170034A1 (en) Amino lipid compound, preparation method therefor, and application thereof
US11739162B2 (en) Side chain modified peptoids useful as structure-stabilizing coatings for biomaterials
CN113968968B (en) Aminolipid compounds, preparation methods and applications thereof
Choe et al. Self-assembled polypeptide and polypeptide hybrid vesicles: from synthesis to application
Fu et al. Self-assembled nucleic acid nanostructures for cancer theranostic medicines
KR20140072273A (en) Gene delivery carrier based on PCR and method for preparing the same
Lee et al. Bionanotechnology in pharmaceuticals
Li et al. Microbial Compartments and Their Biomedical Applications
Tian DNA-programmed chemical synthesis in nano-sized lipid compartments

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13829520

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2881605

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14420983

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013829520

Country of ref document: EP