WO2014022774A1 - Treatment induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins - Google Patents

Treatment induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins Download PDF

Info

Publication number
WO2014022774A1
WO2014022774A1 PCT/US2013/053425 US2013053425W WO2014022774A1 WO 2014022774 A1 WO2014022774 A1 WO 2014022774A1 US 2013053425 W US2013053425 W US 2013053425W WO 2014022774 A1 WO2014022774 A1 WO 2014022774A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
protein
wnt16b
psc27
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/053425
Other languages
French (fr)
Inventor
Peter Nelson
Yu Sun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fred Hutchinson Cancer Center
Original Assignee
Fred Hutchinson Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fred Hutchinson Cancer Center filed Critical Fred Hutchinson Cancer Center
Priority to US14/418,789 priority Critical patent/US9759725B2/en
Publication of WO2014022774A1 publication Critical patent/WO2014022774A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/57585Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds identifiable in body fluids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/5759Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds localised on the membrane of tumour or cancer cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/44Multiple drug resistance
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/60Complex ways of combining multiple protein biomarkers for diagnosis

Definitions

  • sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification.
  • the name of the text file containing the sequence listing is 42895_SEQ_Final_2013-07-22.txt.
  • the text file is 8 KB; was created on July 22, 2013; and is being submitted via EFS-Web with the filing of the specification.
  • the present disclosure provides methods for enhancing the effectiveness of a cancer therapeutic by inhibiting the activity of a gene that encodes an extracellular protein, wherein after genotoxic treatment the gene is expressed at a level at least 3.5 fold above the level of expression without the genotoxic treatment.
  • the extracellular proteins are collectively termed herein DNA damage secretory program (DDSP) polypeptides or proteins.
  • DDSP DNA damage secretory program
  • the invention provides a method for determining a prognosis of cancer in a patient administered a genotoxic agent by observing expression changes in the production of extracellular proteins in the tumor microenvironment. By observing up regulation or down regulation of specified extracellular proteins, both the effectiveness of the genotoxic agent and a prognosis of cancer can be determined.
  • a major impediment to more effective cancer treatment is the ability of tumors to acquire resistance to cytotoxic and cytostatic therapeutics, a development that contributes to treatment failures exceeding 90% in patients with metastatic carcinomas (Longley and Johnston, J. Pathol. 205:272-292, 2005).
  • Efforts focused on circumventing cellular survival mechanisms after chemotherapy have defined systems that modulate the import, export or metabolism of drugs by tumor cells (Wang et al. , Proc. Natl. Acad. Sci. USA 101 :3089-3094, 2004; Schmitt et al, Nat. Med. 6: 1029-1035, 2000; Helmrich et al, Ocogene 24:4174-4182, 2005; Redmond et al, Front.
  • cancer therapies also affect benign cells and can disrupt the normal function and physiology of tissues and organs.
  • cancer therapies do not rely on single overwhelming treatment doses: both radiation and chemotherapy are administered at intervals to allow the recovery of vital normal cell types.
  • gaps between treatment cycles also allow tumor cells to recover, activate and exploit survival mechanisms and resist subsequent therapeutic insults.
  • treatment-associated DNA damage responses in benign cells comprising the tumor microenvironment promote therapy resistance and subsequent tumor progression.
  • Evidence of treatment-induced alterations in tumor stroma includes the expression of a diverse spectrum of secreted cytokines and growth factors.
  • the present disclosure shows that WNT16B is activated in fibroblasts through NF- ⁇ and promotes an epithelial to mesenchymal transition (EMT) in neoplastic prostate epithelium through paracrine signaling. Further, WNT16B, acting in a cell non-autonomous manner, promotes the survival of cancer cells after cytotoxic therapy.
  • EMT epithelial to mesenchymal transition
  • SFRP2 secreted fizzled-related protein 2
  • SPINK1 serine peptidase inhibitor
  • GDNF glial cell derived neurotrophic factor
  • the present disclosure provides methods for determining the effectiveness of a cancer therapy, as well as methods for increasing the effectiveness of that therapy and determining the prognosis of a patient receiving that therapy.
  • the disclosure provides a method for enhancing the effectiveness of a cancer therapeutic by administering an agent that inhibits the activity of a gene encoding an extracellular polypeptide protein that is increased subsequent to treatment of a patient with a cancer therapeutic.
  • the cancer therapeutic is a genotoxic agent.
  • the extracellular polypeptide or protein can be at least one of matrix metallopeptidase 1 (interstitial collagenase) (MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMPl 2), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2) (MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG),
  • the at least one extracellular protein is selected from Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and glial cell derived neurotrophic factor (GDNF).
  • WNT16B Wingless-type MMTV integration site family member 16B
  • SFRP2 secreted fizzled-related protein 2
  • SPINK1 serine peptidase inhibitor
  • GDNF glial cell derived neurotrophic factor
  • the present disclosure provides a method for determining the effectiveness of a cancer therapeutic in a patient comprising: i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample; wherein a decreased or unchanged level of the at least one extracellular protein is indicative of effectiveness of the cancer therapeutic and wherein an increased level of the at least one extracellular protein is indicative of a decreased effectiveness of the cancer therapeutic.
  • the cancer therapeutic is a genotoxic agent.
  • the at least one extracellular protein is matrix metallopeptidase 1 (interstitial collagenase) (MMP1), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANG
  • the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and/or glial cell derived neurotrophic factor (GDNF).
  • WNT16B secreted fizzled-related protein 2
  • SFRP2 secreted fizzled-related protein 2
  • SPINK1 serine peptidase inhibitor
  • GDNF glial cell derived neurotrophic factor
  • the present disclosure provides a method for determining a prognosis in a cancer patient treated with a cancer therapeutic; comprising: i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample; wherein a decreased or unchanged level of expression of the at least one extracellular protein is determinant of a more favorable or better prognosis, a longer survival period, and wherein an increase in the expression of the at least one extracellular protein is determinant of a less favorable prognosis and/or shorter period of survival.
  • the cancer therapeutic is a genotoxic agent.
  • the at least one extracellular protein can be matrix metallopeptidase 1 (interstitial collagenase) (MMP1), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1) (SPINK1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N- acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand
  • MMP1 inter
  • the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and/or glial cell derived neurotrophic factor (GDNF) .
  • SFRP2 secreted fizzled-related protein 2
  • SPINK1 serine peptidase inhibitor
  • GDNF glial cell derived neurotrophic factor
  • Figures 1A through 1J demonstrate that genotoxic damage to primary prostate fibroblasts induces expression of a spectrum of secreted proteins that includes WNT16B.
  • Figure 1A Schematic of the prostate cancer treatment regimen comprising a pretreatment prostate biopsy and four cycles of neoadjuvant DOC and MIT chemotherapy followed by radical prostatectomy.
  • Figure IB DNA damage foci in human prostate tissues collected before and after chemotherapy. Tissue sections were probed with antibodies recognizing ⁇ - ⁇ 2 ⁇ (lighter signals), and nuclei were counterstained with Hoechst 33342. Gl, gland lumen; e, epithelium; s, stroma. Scale bars, 50 ⁇ .
  • Figure 1C Figure 1C.
  • the heatmap depicts the relative mR A levels after exposure to H2O2,
  • Figure 1H Immunohistochemical analysis of WNT16B expression in prostate fibroblasts before (Pre) and after exposure to MIT or RAD. Brown chromogen indicates WNT16B expression. Scale bars, 50 ⁇ .
  • Figure II Expression of Wnt family members in prostate fibroblasts after exposure to DNA-damaging agents. Transcript quantification was determined by microarray hybridization. Columns represent independent replicate experiments. WNT16B is listed in bold for emphasis.
  • Figure 1 J WNT16B expression by qRT-PCR in PSC27 fibroblasts and prostate cancer cell lines after the indicated genotoxic exposure relative to pretreatment transcript amounts. Data are mean ⁇ s.d.
  • FIGS 2A through 2E demonstrate an analysis of DNA damage responses (DDR) in prostate fibroblasts following DNA damaging cancer therapy.
  • Figure 2A Quantitation of DNA damage foci before (Pre) and after DNA damaging treatments. DDR foci identified by immunofluorescence staining for ⁇ - ⁇ 2 ⁇ (see Figure 2B) were recorded according to a 4-category scale. Data were averaged from readings of 3 independent fields, each with a total count of 100 nuclei. * represent significant differences P ⁇ 0.01 compared to untreated (Pre).
  • Figure 2B Analysis of DNA damage foci formation in prostate fibroblasts upon exposure to various DNA damaging agents.
  • PSC27 prostate fibroblasts were treated with H 2 02, bleomycin (BLEO) or gamma- irradiation (RAD). Immunofluorescence staining for ⁇ - ⁇ 2 ⁇ (bright foci), with nuclei counterstained by Hoechst 33342 (light gray). Scale bar, 15 ⁇ .
  • Figure 2C Analysis of gene expression changes in prostate fibroblasts by microarray hybridization. The heatmaps depict the relative mRNA levels after exposure to hydrogen peroxide (H2O2),
  • FIG. 2D WNT16B transcript levels in specific cell populations microdissected from prostate tissues before and after exposure to cytotoxic chemotherapy. Measurements are by qRT-PCR. Log2 fold changes are shown relative to the lowest measurement of untreated benign prostate epithelium. Each data-point represents an individual patient sample.
  • Figure 2E Transcript levels of WNT family members in microdissected human prostate stroma acquired before and after exposure to chemotherapy as quantitated by microarray hybridization. Columns represent individual patients. Values for each gene are mean-centered across all samples.
  • Figures 3A through 3F demonstrate that cytotoxic chemotherapy induces
  • Figures 4 A through 4D show that DNA damage induces WNT16B expression in a spectrum of human fibroblasts and murine organs.
  • Figures 4A and 4B Human prostate fibroblasts (HSP27), and newly derived breast (HBF1203) and ovarian (OVF28901) primary fibroblast lines express stromal but not epithelial markers.
  • Figure 4A Concurrent immunofluorescence staining using vimentin (dark grey) and cytokeratin 8 (light grey) antibodies with PC3 cells serving as a positive control for epithelial cells. Scale bar, 15 ⁇ .
  • Figure 4B Western immunoblot of stromal and epithelial cell lines confirming expression of mesenchymal and epithelial proteins, respectively.
  • Figure 4C Human prostate fibroblasts (HSP27), and newly derived breast (HBF1203) and ovarian (OVF28901) primary fibroblast lines express stromal but not epithelial markers.
  • Figure 4A Concurrent immunofluorescence sta
  • WNT16B expression is induced by DNA damage in most, but not all human fibroblast isolates: HBF1203 (breast), OVF28901 (ovary), HS5 (bone marrow) and HS27A (bone marrow).
  • CM conditioned media
  • IC intracellular lysates.
  • Figure 4D Systemic chemotherapy induces WNT16B expression in diverse murine organs. Each tissue type was collected after three mitoxantrone treatments administered over eight weeks.
  • Figures 5A through 5F demonstrate that epithelial cell phenotypes are altered by fibroblast-derived paracrineacting WNT16B.
  • Figure 5 A Immunofluorescence confirmation of WNT16B in PSC27 cells engineered to alter WNT16B: (1) PSC27 vector control (PSC27C); (2) PSC27 cells expressing WNT16B (PSC27WNT16B); (3) PSC27WNT16B with non-specific shRNA; (4, 5) PSC27WNT16B cells with WNT16B- specific shRNAs. Scale bar, 25 ⁇ .
  • RAD genotoxic stress induced by irradiation
  • MIT mitoxantrone
  • Figure 5E Fibroblast derived WNT16B promotes the growth of prostate carcinoma in vivo.
  • Subrenal capsule grafts comprised of BPH1 prostate epithelial cells alone, in combination with PSC27C control fibroblasts, or in combination with PSC27WNT16B fibroblasts are shown. Dashed lines denote the size of the tumor outgrowth from the kidney capsule.
  • Figure 5F Histology of subrenal capsule grafts comprised of BPH1 or PC3 prostate cells in combination with control fibroblasts (PSC27C), or fibroblasts expressing WNT16B (PSC27WNT16B). Dashed lines demarcate the tumor (T) from the kidney parenchyma (K).
  • SV40 and CD44 IHC mark BPH1 and PC3 prostate epithelial cells respectively in the kidney grafts. Black arrows indicate epithelial cells invading into the kidney parenchyma. Scale bar, 150 ⁇ .
  • Figures 6A through 6G demonstrate that WNT16B is a major effector of the full DDSP and promotes the growth and invasion of prostate carcinoma.
  • Figure 6A Conditioned medium from WNT16B-expressing prostate fibroblasts (PSC27 WNT16B ) promotes the proliferation of neoplastic prostate epithelial cells.
  • shRNA c control shRNA;
  • shR A WNT16B #l and shRN AWNT 16B #2 WNT16B-specific shRNAs.
  • Figure 6B Scratch assay showing the enhanced motility of PC3 cells exposed to conditioned medium from prostate fibroblasts expressing a control vector (PSC27 C ) or fibroblasts expressing WNT16B (PSC27 WNT16B ).
  • F j gure 6 and Figure 6D are mean ⁇ s.e.m. of triplicates, with P values calculated by ANOVA followed by t test.
  • Figure 6E Schematic of the xenograft cell recombination experiment to assess the ability of fibroblasts expressing WNT16B to influence prostate tumorigenesis in vivo.
  • PFC prostate fibroblast cells
  • PC prostate cancer cells.
  • Figure 6F Prostate fibroblasts engineered to express WNT16B promote the growth of prostate carcinoma in vivo.
  • Subrenal capsule grafts comprised of PC3 prostate epithelial cells alone, PC3 cells in combination with PSC27 C control fibroblasts or PC3 cells in combination with PSC27 WNT16B fibroblasts are shown.
  • the green dashed lines denote the size of the tumor outgrowth from the kidney capsule.
  • Figure 6G Irradiated prostate fibroblasts (PSC27-RAD) promote the growth of prostate carcinoma cells in vivo, and this effect is significantly attenuated by the suppression of fibroblast WNT16B using WNT16B-specific shR As (PSC27-RAD+shRNA WNT16B ) (P ⁇ 0.05). Shown are tumor volumes 8 weeks after renal capsule implantation of PC3 and PSC27 cell grafts.
  • horizontal lines denote the mean of each group of eight tumors, and P values were determined by ANOVA followed by t test.
  • Figures 7 A through 71 demonstrate that genotoxic stress upregulates WNT16B through NF-KB and signals through the canonical Wnt-P-catenin pathway to promote tumor cell proliferation and the acquisition of mesenchymal characteristics.
  • Figure 7A Assay of canonical Wnt pathway signaling through activation of a TCF/LEF luciferase reporter construct (TOPflash) or a control reporter (FOPflash).
  • TOPflash TCF/LEF luciferase reporter construct
  • FOPflash control reporter
  • Epithelial cells were exposed to conditioned medium (CM) from PSC27 prostate fibroblasts expressing WNT16B (PSC27 WNT16B ) or control vector (PSC27 C ). Data are mean ⁇ s.e.m. of triplicates, and P values were determined by ANOVA followed by t test.
  • FIG. 7B qPvT-PCR assessment of the expression of ⁇ -catenin target genes in prostate cancer cell lines (BPH1, Ml 2 and PC3) before and 72 h after exposure to PSC27 WNT16B -conditioned medium. Data represent the mean ⁇ s.e.m. fold change after as compared to before exposure for three replicates.
  • Figure 7D Quantification of transcripts in neoplastic prostate epithelial cells encoding proteins associated with a phenotype of EMT. Measurements are from epithelial cells exposed to control media (DMEM), media conditioned by PSC27 fibroblasts (PSC27 C ) or PSC27 fibroblasts expressing WNT16B (PSC27 WNT16B ).
  • DMEM control media
  • PSC27 C media conditioned by PSC27 fibroblasts
  • PSC27 WNT16B PSC27 WNT16B
  • Figure 7F Analysis of EMT-associated protein expression by Western Blot. Ml 2 or PC3 cells were exposed to control media, media conditioned by PSC27 fibroblasts (PSC27 C ), PSC27 fibroblasts expressing WNT16B (PSC27 WNT16B ) or PSC27 fibroblasts expressing WNT16B and shRNA targeting WNT16B (psC27 shRNA"WNT16B ).
  • Figure 7G Chromatin immunoprecipitation assays identified NF- ⁇ binding sites within the proximal promoter of the WNT16 gene.
  • FIG. 7H Analysis of WNT16B transcript expression by qRT-PCR in PSC27 prostate fibroblasts with (PSC27 lKBa ) or without (PSC27 C ) inhibition of NF- ⁇ signaling before and after DNA-damaging exposures.
  • Figure 71 Analysis of WNT16B transcript expression by qRT-PCR in PSC27 prostate fibroblasts with (PSC27 lKBa ) or without (PSC27 C ) inhibition of NF- ⁇ signaling before and after DNA-damaging exposures.
  • Figures 8 A through 8D demonstrate that paracrine WNT16B induces a mesenchymal phenotype in vivo.
  • Figure 8 A Immunohistochemical assessment of WNT16B and ⁇ -catenin expression in human prostate cancers with and without exposure to chemotherapy. Arrows in ⁇ -catenin panels show minimal staining in cancer glands that is localized to the cytoplasm or plasma membrane in untreated tissues with intense nuclear localization in carcinoma cells following chemotherapy treatment.
  • Figure 8B The ⁇ -catenin pathway inhibitor XAV939 suppresses the invasion of prostate cancer cells in response to fibroblast WNT16B and attenuates the response to the full DNA damage secretory program. Cell numbers were determined after 24 h of treatment.
  • Figures 8C and 8D The ⁇ -catenin pathway inhibitor XAV939 suppresses the invasion of prostate cancer cells in response to fibroblast WNT16B and attenuates the response to the full DNA damage secretory program. Cell numbers were determined after 24 h of treatment.
  • Figures 9 A through 9E demonstrate that WNT16B expression is regulated by NFkB.
  • Figure 9 A Analysis of NFKB regulatory regions in the WNT16B promoter by site-directed mutagenesis.
  • Black boxes wild type sequence;
  • White boxes mutated NFKB binding sites.
  • WNT16B and NFkB promoter reporter assays with genotoxic stress Figure 9B and TNF-a Figure 9C. Multiple NFkB binding sites maximize WNT16B promoter activity in prostate fibroblasts following irradiation or exposure to TNF-a. Constructs shown in Figure 9A were used in assays of PSC27 fibroblasts. NATl l-Luc2CP is a NFKB promoter positive control construct.
  • Figure 9D Analysis of NFKB activity following genotoxic stress with mitoxantrone or irradiation.
  • Figure 9E ⁇ expression in PSC27 fibroblasts suppresses DNA damage-induced NFKB activation.
  • Figures 10A through 10E demonstrates that paracrine-acting WNT16B promotes the resistance of prostate carcinoma to cytotoxic chemotherapy.
  • Figure 10A Viability of prostate cancer cells 3 d after treatment with a half-maximal inhibitory concentration (IC 50 ) of MIT and medium conditioned by fibroblasts with (PSC27 WNT16B ) or without (PSC27 C ) WNT16B.
  • Figure 10B Bright field microscopic view of PC3 cells cultured with control or PSC27 WNT16B -conditioned medium photographed 24 h after exposure to vehicle or the IC50 of MIT. Arrowheads denote apoptotic cell bodies. Scale bars, 50 ⁇ .
  • Figure I OC Acute tumor cell responses to chemotherapy in vitro. Quantification of apoptosis by assays reflecting combined caspase 3 and 7 activity measured 24 h after the exposure of PC3 cells to vehicle or the IC50 of MIT. Data in a and c are mean ⁇ s.e.m. of triplicate experiments, and P values were determined by ANOVA followed by t test. RLU, relative luciferase unit.
  • Figure 10D In vivo responses of PC3 tumors to MIT chemotherapy.
  • grafts were comprised of PC3 cells alone or PC3 cells combined with either PSC27 prostate fibroblasts expressing a control vector (PC3+PSC27 C ) or PSC27 prostate fibroblasts expressing WNT16B (PC3+PSC27 WNT16B ).
  • MIT was administered every 2 weeks for three cycles, and grafts were harvested and tumor volumes determined 1 week after the final MIT treatment. Each data point represents an individual xenograft. Horizontal lines are group means of ten tumors, with P values determined by ANOVA followed by t test.
  • Figure 10E Acute tumor cell responses to chemotherapy in vivo.
  • C-caspase 3 cleaved caspase 3
  • ⁇ - ⁇ 2 ⁇ immunofluorescence ⁇ - ⁇ 2 ⁇ immunofluorescence in PC3 and fibroblast xenografts measured 24 h after in vivo treatment with vehicle (C) or MIT.
  • Values represent a minimum of 100 cells counted from each of 3-5 tumors per group. Data are mean ⁇ s.e.m., and P values were determined by ANOVA followed by t test.
  • Figure 11A through 11C demonstrate the modulation of chemotherapy resistance by paracrine WNT16B.
  • Figure 11 A Viability of prostate cancer cells across a range of mitoxantrone concentrations with (PSC27WNT16B) or without (PSC27C) WNT16B in fibroblast conditioned medium. Non-linear regression curves were calculated and plotted using GraphPad Prism.
  • Figure 11B Acute viability assays of epithelial cells following 12 h of exposure to IC50 concentrations of mitoxantrone and conditioned medium from
  • Figure 11C Tumor volumes of subrenal capsule grafts comprised of MDA-MB-231 breast carcinoma cells in combination breast fibroblasts (HBF1203) expressing a control vector (HBF1203C) or WNT16B (HBF1023WNT16B) with or without treatment with three cycles of mitoxantrone (MIT). Tumor grafts were harvested one week after the 3rd cycle of treatment. Depicted are typical grafts from each treatment group with tumor masses outlined by green dashed line. Each datapoint represents the volume of a tumor resected from an individual mouse.
  • Figures 12A through 12G Chemotherapy resistance promoted by damaged fibroblasts is attenuated by blocking WNT16B, ⁇ -catenin or NF- ⁇ signaling.
  • Figure 12 A Viability of prostate cancer cells across a range of MIT concentrations with (PSC27-RAD+shRNAWNT16B) or without (PSC27-RAD+shRNAC) the suppression of WNT16B in irradiated-fibroblast-conditioned medium or with the addition of the ⁇ -catenin pathway inhibitor XAV939. Data are mean ⁇ s.e.m. of triplicates.
  • Figure 12B The composition of the suppression of WNT16B in irradiated-fibroblast-conditioned medium or with the addition of the ⁇ -catenin pathway inhibitor XAV939. Data are mean ⁇ s.e.m. of triplicates.
  • Figure 12B See
  • FIG. 12C Viability of prostate cancer cells 3 days after treatment with two times the IC50 of MIT in the context of conditioned medium from irradiated prostate fibroblasts (PSC27-RAD) expressing shRNAs targeting and suppressing WNT16B (shRNAWNT 166 ), a vector control (shRNA c ) or combined with the ⁇ -catenin pathway inhibitor XAV939.
  • Figure 12C Viability of prostate cancer cells 3 days after treatment with the IC50 of MIT in the context of conditioned medium from prostate fibroblasts pretreated with radiation (PSC27-RAD) or MIT (PSC27-MIT) and with (PSC27 lKBa ) or without (PSC27 C ) the suppression of NF- ⁇ signaling.
  • Figure 12D Acute tumor cell responses to chemotherapy in vitro. Quantification of apoptosis by caspase 3 and 7 activity measured 24 hours after the exposure of PC3 cells to vehicle or the IC50 of MIT. Data for Figure
  • FIGS. 12B, Figure 12C and Figure 12D are mean ⁇ s.e.m. of triplicates, and P values were determined by ANOVA followed by t test.
  • Figures 12E and 12F In vivo effects of MIT chemotherapy in the context of suppressing the induction of the expression of fibroblast WNT16B.
  • Tumors comprised PC3 cells in combination with irradiated (PSC27-RAD) fibroblasts, Figure 12E, or unirradiated (PSC27 C ), Figure 12F, prostate fibroblasts expressing shRNAs targeting WNT16B (shRNAWNT 1 *®) or a vector control (shRNA c ).
  • MIT was administered every 2 weeks for three cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each data point represents an individual xenograft.
  • Tumor volumes of PSC27 c +shRNA c grafts in Figure 12F averaged 20 mm 3
  • tumor volumes of PSC27 c +shRNA WNT16B grafts averaged 12 mm 3 (P ⁇ 0.001).
  • the bracket boundaries in f are the group means for PSC27 c +shRNA c grafts compared to PSC27 c +shRNA WNT16B grafts showing a 40% difference in size.
  • Figure 12G The bracket boundaries in f are the group means for PSC27 c +shRNA c grafts compared to PSC27 c +shRNA WNT16B grafts showing a 40% difference in size.
  • Model for cell non-autonomous therapy-resistance effects originating in the tumor microenvironment in response to genotoxic cancer therapeutics The initial round of therapy engages an apoptotic or senescence response in subsets of tumor cells and activates a DNA damage response (DDR) in DDR-competent benign cells (+DDR) comprising the tumor microenvironment.
  • the DDR includes a spectrum of autocrine- and paracrine-acting proteins that are capable of reinforcing a senescent phenotype in benign cells and promoting tumor repopulation through progrowth signaling pathways in neoplastic cells.
  • Paracrine-acting secretory components such as WNT16B also promote resistance to subsequent cycles of cytotoxic therapy.
  • FIG. 13A through 13D demonstrate prostate, breast and ovarian carcinoma therapy resistance promoted by damaged fibroblasts is attenuated by blocking WNT16B or ⁇ -catenin signaling.
  • Figure 13 A Viability assays of prostate carcinoma cells exposed to prostate fibroblast conditioned medium and mitoxantrone chemotherapy.
  • Epithelial cells were treated with IC50 concentrations of mitoxantrone in conditioned medium from irradiated PSC27 (PSC27C-RAD) prostate fibroblasts expressing a control shR A or WNT16B-specific shR As and irradiated, or with the addition of the ⁇ -catenin pathway inhibitor XAV939. Epithelial viability was determined by trypan blue counting of cells 72 hours after chemotherapy. Bars represent means of 3 replicate experiments. Figure 13B. Viability assays of breast and ovarian carcinoma cells exposed to fibroblast conditioned medium and mitoxantrone chemotherapy.
  • Epithelial cells were treated with IC50 concentrations of mitoxantrone in conditioned medium from irradiated breast or ovarian fibroblasts expressing a control shRNA or WNT16B-specific shRNAs and irradiated, or with the addition of the ⁇ -catenin pathway inhibitor XAV939. Epithelial viability was determined by trypan blue counting of cells 72 hours after chemotherapy. Bars represent means of three replicate experiments. Figure 13C. In vivo effects of WNT16B on breast tumor responses to mitoxantrone chemotherapy. Tumors comprised MDAMB-231 cells in combination with irradiated breast (HBF 1203 -RAD) fibroblasts expressing short hairpin RNAs targeting WNT16B or a vector control.
  • Tumors comprised MDAMB-231 cells in combination with irradiated breast (HBF 1203 -RAD) fibroblasts expressing short hairpin RNAs targeting WNT16B or a vector control.
  • Mitoxantrone was administered every 2 weeks for 3 cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each datapoint represents an individual xenograft.
  • Figure 13D In vivo effects of mitoxantrone chemotherapy in the context of suppressing the induction of fibroblast WNT16B.
  • Tumors comprised PC3 cells in combination with untreated prostate fibroblasts expressing a control vector (PSC27C+shRNAC) or shRNAs targeting WNT16B (PSC27C+shRNAWNT16B).
  • Mitoxantrone was administered every 2 weeks for 3 cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each data point represents an individual xenograft.
  • Figure 14 Activation of the Wnt-P-catenin pathway by conditioned media from PSC27 cells, either after ionizing radiation, upon over-expression or knock-down of target genes. Data are mean ⁇ s.e.m. of triplicates, and P values were determined by ANOVA followed by t test.
  • Figure 15. Immunoblots of SFRP2 expression in PSC27 stable cell lines and shRNA silencing efficacy.
  • PSC27 vector control (PSC27 C ); PSC27 cells expressing SFRP2 (PSC27 SFRP2 ); PSC27 SFRP2 cells infected with non-specific shRNA; PSC27 SFRP2 cells infected with SFRP2-specific shRNAs (#1 and #2, respectively).
  • Figure 16 Generation of quiescent cells in culture and cell morphology upon genotoxic treatment. Photographs of cells in proliferation, cells arrested by mitogen withdrawal for 4 days or contact inhibition for about 7 to 10 days. PSC27 cells in either case were exposed to a 10 Gy ionizing radiation, maintained in stromal media for 7 days. Bright field pictures were taken at a magnification of 10X. Photos are representative of three independent experiments.
  • FIG. 1 Experimental model system: proliferating and quiescent cells. Proliferating cells and quiescent cells were incubated with bromodeoxyuridine (BrdU) for 6 hours. Cell nuclei were labeled with an anti-BrdU antibody and propidium iodide, and analyzed by FACS. DNA content was plotted along the x-axis, and BrdU intensity was plotted along the y axis. Percentage of cells that incorporated BrdU into their nuclei during the incubation is indicated in each case. Data are representative of three independent experiments.
  • bromodeoxyuridine BrdU
  • Figure 18 Genotoxic influence on expression of senescence and proliferation- related genes in pre-senescent or quiescent PSC27 cells.
  • MIT Mitoxantrone
  • FIG 19. Senescence associate ⁇ -Gal staining of prostate fibroblasts and senescence of quiescent cells.
  • PSC27 cells were either untreated or treated by lOGy radiation, processed for typical senescence associated ⁇ -Gal staining. For each case, cells were stained for 12 hours under culture conditions, and the photos are representative of three independent experiments.
  • Figure 21 Microarray patterns of gene expression in growing cells and cells arrested upon contact inhibition under the culture conditions.
  • Figures 22A through 22C Induced GDNF expression in PSC27 cells upon DNA damage.
  • Figure 22A demonstrates gene expression microarray data of GDNF in human prostate stromal cells treated with hydrogen peroxide (H 2 0 2 ), bleomycin (bleo) and irradiation (Rad) on a log scale.
  • Figure 22B shows qPCR data showing up-regulation of GDNF after irradiation between 6 and 16 days post treatment.
  • Figure 22C shows qPCR data showing up-regulation of GDNF after mitoxantrone treatment between days 17 and 15.
  • Figures 23A and 23B show that prostate cancer cell lines respond to GDNF stimulation and activate Src and Erk pathways.
  • Figure 23A CaP cell expressiong GDNF receptors Ret and/or GFRAl (top row) show increased proliferation upon GDNF stimulation in vitro with a maximum stimulation around 10 ng/ml GDNF in the culture medium (p ⁇ 0.001) whereas Ret and GFRAl negative cell (bottom ros) do not show any differences in proliferation after 3 or 5 days.
  • Figure 23B GDNF responsive cells show activation of the Src and the Erk pathways upon GDNF stimulation.
  • Figures 24A through 24C show human primary prostate stromal cells PSC27 over-expressing GDNF.
  • PSC27 cell transduced with GDNF-V5 expression construct Figure 23A shows GDNF-V5 expression and secretion to the conditioned medium analyzed by Western Blot.
  • Figure 24B ELISA measurement of GDNF secreted into the culture medium after 72 hours.
  • Figure 24C GDNF expression in transduced PSC27 cell lysates measured by ELISA with normalized input of 62.5 ⁇ / ⁇ 1 total protein starting concentration.
  • GDNF induces mitotic signaling in human stromal cells PSC27.
  • Human primary prostate fibroblast cell stimulated with human recombinant GDNF or conditioned medium from GDNF over-expressing cells show activation of the Ras/Raf/Erk and the SFK pathways, similar to the response in epithelial cancer cells.
  • FIG. 26 GDNF induction upon DNA damage is mTOR dependent. Up- regulation of GDNF upon DNA damage is reduce when mTOR activity is blocked by rapalogs. Gene expression data from microarray comparing GDNF mRNA levels post irradiation (IR), after rapalog treatment and after irradiation and rapalog treatment, (lines: mean with SEM).
  • the present disclosure provides methods for the identification of proteins secreted into a tumor microenvironment in response to a genotoxic stress. Certain of these proteins have been found to attenuate the effects of cytotoxic therapy in vivo, promoting tumor cell survival and disease progression, herein collectively the polypeptides or proteins are termed DNA damage secretory program (DDSP) proteins.
  • the methods include assessing for treatment-induced damage response in benign cells comprising the tumor microenvironment.
  • the methods compare the changes in expression of the DDSP polypeptide or protein before and after tumor therapy, such as chemotherapy or radiation therapy, in benign cells, such as, for example, fibroblasts, smooth muscle cells, and the like.
  • the level of one or more of the DDSP polypeptides or proteins can be used to determine the effectiveness of the administered genotoxic agent or the prognosis for the cancer.
  • DDSP proteins DNA damage secretory program proteins
  • transcriptional state the transcriptional activity of the cell
  • translational state the amount of protein translated from the resulting mRNA molecules
  • the transcriptional state of DDSP proteins can be conveniently determined by measuring transcript abundance by any of several existing gene expression technologies that are well-known in the art.
  • the translational state includes the identities and abundance of the constituent polypeptide species in the sample generated by the ribosomal machinery using the mR A template described above.
  • the translational state i.e., level of constituent DDSP proteins, can also be conveniently determined by various technologies that are well-known in the art.
  • primary tissues can be collected from patients before and after a genotoxic treatment.
  • the treatment can be, for example, chemotherapy, radiation therapy, or a combination thereof.
  • R A transcripts from the samples can be collected by any method well known in the art.
  • a comparison of the RNA transcripts from the patient samples collected before and after treatment can then be carried out by any standard method, such as, for example, whole-genome microarray analysis.
  • One specific embodiment of this particular method is set forth in the examples herein.
  • the DDSP proteins from prostate tissue can include, for example, and not by limitation, matrix metallopeptidase 1 (interstitial collagenase) (MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMPl 2), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2) (MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4),
  • MMPl matrix metallopeptidase 1
  • WNT16B Wingless-type MMTV integration site family member 16B
  • SFRP2 secreted fizzled-related protein 2
  • MMPl 2 matrix metall
  • a PCR method such as a quantitative RT PCR (qRT PCR or qPCR), can be used to compare specifically identified DDSP protein mRNA levels between treated and untreated samples, and thus determine the difference in a DDSP protein gene expression level.
  • the level of WNT16B was determined.
  • qPCR is performed with a transcript-specific antisense probe.
  • a PCR is prepared with a quencher and fluorescent reporter probe complexed to the 5' end of the oligonucleotide.
  • Taq DNA polymerase When Taq DNA polymerase is activated, it cleaves off the fluorescent reporters of the probe bound to the template by virtue of its 5' to 3' exonuclease activity. In the absence of the quenchers, the reporters now fluoresce providing a quantifiable signal to ascertain template abundance at every round of amplification.
  • An alternative technique is to use an intercalating dye such as the commercially available QuantiTectTM SYBR® Green PCR (Qiagen, Valencia, CA). RT-PCR is performed using SYBR® green as a fluorescent label which is incorporated into the PCR product during the PCR stage and produces a fluorescence proportional to the amount of PCR product.
  • nuclease protection assays can be used to detect and quantitate an identified DDSP protein mRNA level.
  • an antisense probe (labeled with, e.g., radiolabeled or nonisotopic label) hybridizes in solution to an RNA sample. Following hybridization, single-stranded, unhybridized probe and RNA are degraded by nucleases. An acrylamide gel is used to separate the remaining protected fragments.
  • solution hybridization is more efficient than membrane-based hybridization, and it can accommodate up to 100 ⁇ g of sample RNA, compared with the 20-30 ⁇ g maximum of blot hybridizations.
  • the ribonuclease protection assay which is the most common type of nuclease protection assay, requires the use of RNA probes. Oligonucleotides and other single-stranded DNA probes can only be used in assays containing SI nuclease.
  • the single-stranded, antisense probe must typically be completely homologous to the target RNA to prevent cleavage of the probe-target hybrid by the nuclease. For instance, the antisense probe can correspond to any section of the WNT16B mRNA sequence.
  • RNA samples are obtained and separated by size via electrophoresis.
  • the RNA is transferred to a membrane, crosslinked and hybridized with a labeled probe that hybridizes specifically to the target mRNA under defined hybridization conditions.
  • the probe can be labeled by any of the many different methods known to those skilled in this art. The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, and others.
  • RNA need not be extracted from the sample.
  • fluorescent in situ hybridization can be used to determine the presence, relative quantity, and spatial distribution of target mRNA in a cell.
  • Single Molecule RNA FISH Biosearch Technologies, Novato, CA
  • Single Molecule RNA FISH uses multiple short, singly-labeled oligonucleotide probes complementary to distinct portions of the target sequence. When each probe binds to the single stranded mRNA template, it causes cooperative unwinding of the mRNA, promoting the binding of the additional probes. The net result is the binding of a large multitude of fluorescent labels to a single molecule of mRNA template, providing sufficient fluorescence to reliably locate each target mRNA in a wide-field fluorescent microscopy image.
  • the gene expression level can be determined by assessing the translational state of an identified DDSP gene.
  • standard techniques can be used for determining the amount of the DDSP polypeptide or protein present in a sample. For example, immunoassays such as Western blot involve immunoprecipitation of protein from a sample according to methods well-known in the art. This is followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of the protein sample. After separation of the proteins, immunocytochemistry and the like can be used to determine the amount of the protein or proteins of interest present in a sample.
  • a typical agent for detecting a protein of interest is a detectable antibody, or fragment thereof, capable of binding to the protein of interest.
  • antibodies, or fragments thereof can be employed to detect levels of in identified DDSP polypeptide, including splice variant isoforms, in a sample by techniques such as with an enzyme-linked immunosorbent assay (ELISA). Briefly, an antibody or fragment thereof that specifically binds to a portion of the DDSP polypeptide or protein is immobilized on a solid substrate. The sample is contacted to the solid substrate and any DDSP polypeptides or proteins present in the sample are permitted to bind to the immobilized (capture) antibody. A second antibody that also binds to the DDSP polypeptide or protein is also contacted with the biological sample and/or solid substrate and permitted to bind to the OPN polypeptide.
  • ELISA enzyme-linked immunosorbent assay
  • the second antibody usually comprises a detectable label or signal.
  • the label can be detected directly, or it may be a component of a signal-generating system, which are well-known in the art.
  • the level of the DDSP polypeptide or protein is determined by assaying the detectable signal after the solid substrate has been rinsed of unbound sample and antibody.
  • antibodies, or fragments thereof can be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of a protein of interest.
  • In situ detection can be accomplished by obtaining a histological specimen ⁇ e.g., a biopsy specimen or immobilized cell culture) and applying thereto a labeled antibody that is directed to the target protein.
  • the antibody (or fragment) is preferably applied onto a biological sample, such as liver cells from a section or biopsy.
  • a biological sample such as liver cells from a section or biopsy.
  • Antibodies can be generated utilizing standard techniques well known to those of skill in the art. Such antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or an antibody fragment ⁇ e.g., Fab or F(ab')2), that specifically binds to a portion of the DDSP polypeptide or protein can be used. A wide variety of known signaling mechanisms are available for the described immunoassays. To illustrate, an enzyme bound to the antibody will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means.
  • an appropriate substrate preferably a chromogenic substrate
  • the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection can also be accomplished by radioactively labeling the antibodies or antibody fragments, and detecting the protein of interest through the use of a radioimmunoassay. It is also possible to label the antibody with a fluorescent compound which fluoresces upon stimulation by light of a proper wavelength. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde fluorescamine, and the like.
  • An agent as used in the present disclosure is a molecule that inhibits the expression of the identified DDSP gene or inhibits the activity of the polypeptide or protein expressed by the identified DDSP gene.
  • the identified agent can be, for example, an antibody that specifically binds to and inactivates the DDSP polypeptide or protein, a polynucleotide that inhibits the expression of the identified DDSP gene, or any protein or small molecule that blocks the activity of the identified DDSP polypeptide or protein or a pathway modulated by the identified DDSP polypeptide or protein that promotes genotoxic therapy resistance.
  • the agent that inhibits the activity of the identified DDSP is an antisense nucleic acid capable of inhibiting transcription of the DDSP gene or translation of the corresponding messenger R A.
  • the antisense nucleic acid can comprise all or part of the sequence of the DDSP gene, or of a sequence that is complementary thereto.
  • the antisense sequence can be a DNA, an RNA (e.g., siRNA), a ribozyme, and the like. It may be single-stranded or double stranded. It can also be a RNA encoded by an antisense gene.
  • an antisense nucleic acid comprising part of the sequence of the gene or messenger RNA under consideration
  • a part comprising at least 10 consecutive bases from the sequence, more preferably at least 15, in order to ensure specific hybridization.
  • an antisense oligonucleotide typically comprises less than 100 bases, for example in the order of 10 to 50 bases.
  • This oligonucleotide can be modified to improve its stability, its nuclease resistance, its cell penetration, and the like. Perfect complementarity between the sequence of the antisense molecule and that of the target gene or messenger RNA is not required, but is generally preferred.
  • the inhibitor compound is a polypeptide. It can be, for example, a peptide comprising a region of the DDSP polypeptide or protein, and capable of antagonizing its activity.
  • a peptide advantageously comprises from 5 to 50 consecutive amino acids of the primary sequence of the identified DDSP polypeptide or protein, typically from 7 to 40.
  • the polypeptide can also be an antibody that specifically binds the identified DDSP polypeptide or protein, or a fragment or derivative of such an antibody, for example a Fab fragment, a CDR region, or, more preferably, a single chain antibody (e.g., a scFv).
  • Single chain antibodies are particularly advantageous insofar as they can act in a specific and intracellular fashion to modulate the activity of a target protein.
  • Such antibodies, fragments, or derivatives can be produced by conventional techniques comprising immunizing an animal and recovering the serum (polyclonal) or spleen cells (in order to produce a hybridoma by fusion with appropriate cell lines).
  • the antigen, the identified DDSP polypeptide or protein, or a portion thereof is combined with an adjuvant (e.g., Freund's adjuvant) and administered to an animal, typically by subcutaneous injection. Repeated injections can be performed. Blood samples are collected and the immunoglobulin or serum is separated.
  • adjuvant e.g., Freund's adjuvant
  • Conventional methods for producing monoclonal antibodies comprise immunizing of an animal with an antigen, followed by recovery of spleen cells, which are then fused with immortalized cells, such as myeloma cells. The resulting hybridomas produce monoclonal antibodies and can be selected by limiting dilution in order to isolate individual clones.
  • Fab or F(ab')2 fragments can be produced by protease digestion, according to conventional techniques.
  • the inhibitor is a chemical compound, of natural or synthetic origin, particularly an organic or inorganic molecule, capable of modulating the expression or the activity of the identified DDSP polypeptide or protein.
  • a therapeutically effective amount is understood as the amount of an agent inhibiting the expression and/or activity of an identified DDPS polypeptide or protein of interest that is necessary to achieve the desired effect which, in this specific case, is the increase in the effectiveness of a genotoxic therapy.
  • the therapeutically effective amount of the inhibitory agent according to the present disclosure to be administered will depend, among other factors, on the individual to be treated, on the severity of the disease said individual suffers, on the chosen dosage form, and the like. For this reason, the doses mentioned in the present disclosure must be considered only as a guideline for the person skilled in the art, and the latter must adjust the doses according to the previously mentioned variables. Nevertheless, an inhibitory agent according to the present disclosure can be administered one or more times a day, for example, 1 , 2, 3 or 4 times a day, in a typical total daily amount comprised between 0.1 and 1000 mg/kg body mass/day, preferably 10 mg/kg body mass/day.
  • treatment means the administration of an inhibitory agent according to the disclosure to effectively decrease the expression of activity of the DDPS polypeptide or protein of interest such that it no longer promotes resistance to a genotoxic therapy.
  • the subject can be a human or non-human animal, a vertebrate, and is typically an animal, including but not limited to, cows, pigs, horses, chickens, cats, dogs, and the like. More typically, the subject is a mammal, and in a particular embodiment, human.
  • Various delivery systems are well known to the skilled artisan and can be used to administer the inhibitory agent, such as, for example, by infusion, injection (e.g., intradermal, intramuscular or intraperitoneal), oral delivery, nasal delivery, intrapulmonary delivery, rectal delivery, transdermal delivery, interstitial delivery or subcutaneous delivery.
  • injection e.g., intradermal, intramuscular or intraperitoneal
  • oral delivery e.g., nasal delivery, intrapulmonary delivery, rectal delivery, transdermal delivery, interstitial delivery or subcutaneous delivery.
  • the inhibitory agent can be desirable to administer the inhibitory agent locally to the area in need of treatment, e.g., the tumor bed, into the tumor, and the like; this administration can be achieved by, for example, and not by way of limitation, local infusion, topical application, by injection (e.g., intra-testicular or intra- prostatic), by means of a catheter, or by means of an implant, the implant being for example, a porous, non-porous, gelatinous or polymeric material, including membranes such as silastic membranes or fibers.
  • administration can be by direct injection at the target site, for example, into a tumor.
  • Pharmaceutical compositions containing the inhibitory agent can be formulated according to the desired delivery system.
  • compositions typically comprise a therapeutically effective amount of the inhibitory agent and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in vertebrates, typically animals, and more typically in humans.
  • carrier refers to a diluent, adjuvant, excipient, stabilizer, preservative, viscogen, or vehicle with which the inhibitory agent is formulated for administration.
  • Pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like.
  • Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, ethanol, and the like.
  • the composition if desired, can also contain minor amounts of a wetting or emulsifying agent, or a pH buffering agent.
  • Suitable preservatives include, for example, sodium benzoate, quaternary ammonium salts, sodium azide, methyl paraben, propyl paraben, sorbic acid, ascorbylpalmitate, butylated hydroxyanisole, butylated hydroxytoluene, chlorobutanol, dehydroacetic acid, ethylenediamine, potassium benzoate, potassium metabisulfite, potassium sorbate, sodium bisulfite, sulfur dioxide, organic mercurial salts, phenol and ascorbic acid.
  • Suitable viscogens include, for example, carboxymethylcellulose, sorbitol, dextrose, and polyethylene glycols.
  • suitable pharmaceutical carriers are described in, for example, Remington's Pharmaceutical Sciences (Gennaro (ed.), Mack Publishing Co., Easton, Pennsylvania (1990)).
  • the selected inhibitory agent can also be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, and the like, and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2- ethylamino ethanol, histidine, procaine, and the like.
  • the selected inhibitory agent can be formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • a pharmaceutical composition adapted for intravenous administration to human beings.
  • water is a typical carrier.
  • Saline, aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition can also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
  • Orally deliverable compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like.
  • Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
  • the inhibitory agent can also be formulated for other methods of delivery using well known formulations. These can included, but are not limited to, intranasal, rectal, intrathecal, controlled release systems, and the like. Controlled release systems can include, pumps, gels, skin patches, and the like.
  • the present example provides methods and determines those DDSP proteins increased by at least 3.5-fold in response to a genotoxic agent. Further, the example provides confirmation of the effectiveness of inhibiting the activity of one of those DDSP proteins, Wntl6B, in increasing the effectiveness of a cancer therapeutic agent.
  • Simon Hayward was derived from nonmalignant prostatic tissue with benign hyperplasia, immortalized by SV40-LT antigen, and cultured as previously described (Hayward et al, In vitro Cell Dev. Biol. Anim. 31 : 14-24, 1995).
  • the neoplastic metastatic M12 human prostate epithelial cell line was provided by Dr. Joy Ware and maintained as previously described (Bae, et al., Prostate 34:275-282, 1998).
  • BPH1 and M12 cells were transfected with a plasmid pIRES2-GFP, with cells passaged and subsequently flow-sorted in a FACSVantage.
  • Cancer lines from other human cancer types including lung (A549), colon (HCT116), breast (MDA-MB-231, T47D), cervix (HeLa) and ovary (SKOV3, OVCAR3) were obtained from ATCC and cultured according to supplied instructions.
  • DMEM or RPMI fetal calf serum
  • RPMI fetal calf serum
  • the culture was placed in a humidified 37 °C, 5 % C0 2 incubator, with fibroblast outgrowth checked every 3 to 4 days under an inverted phase-contrast microscope, and growth medium was changed after each assessment.
  • the coverslips were removed and the dish (or well) was washed twice with 4 °C PBS. Trypsin/EDTA (0.25%) was used to detach cells and fibroblasts were collected by centrifugation for 10 min at 150 x g, 4 °C in a 15-ml polypropylene centrifuge tube.
  • Plasmids and lentiviral infection Plasmids and lentiviral infection. Lentiviral agents were produced by transfecting 293FT packaging cells, with virus-containing culture medium harvested and filtered through 0.45- ⁇ syringe filters 48 to 96 hours post-transfection. PSC27 fibroblasts were infected by exposure to virus-containing medium for 12 to 16 hours, maintained in PSC complete medium, followed by selection in puromycin. For gene-specific silencing with small hairpin RNA (shRNA), the sequences targeting WNT16B gene were cloned in a lentiviral vector pGIPZ (Thermo Scientific). Transfection of 293FT cells and subsequent infection of PSC27 cells were carried out as above, with the interference of target gene expression confirmed by immunofluorescence and immunoblot analysis.
  • shRNA small hairpin RNA
  • PSC27-RAD After treatment, the cells were rinsed 3 times with PBS and left to recover for 3 days in PSC medium.
  • DDR foci were recorded with a 4-category counting strategy, namely 4 classes: 0 foci, 1 to 3 foci, 4 to 10 foci, and >10 foci. Data from each cell line/treatment were averaged from a pool of 3 independent fields counting 100 nuclei per pool.
  • BPH1-GFP cells were mixed with various proportions of PSC27 cells expressing vector control (PSC27 C ) or WNT16B (PSC27 WNT16B ). The cultures were incubated for 3 days after which cells were detached with trypsin and the total cell number was determined by direct counting with hemacytometer. The PSC27/BPH1-GFP proportion was determined on a FACScan using GFP fluorescence as a marker for BPH1-GFP cells. M12-GFP cells were mixed with PSC27 cells and analyzed as above.
  • Chemoresistance assays were performed using epithelial cells cultured with either DMEM and low serum (0.5 % FCS) (abbreviated as "DMEM”), or conditioned medium (CM) generated from PSC27, GHF1023 or OVF28901 cells expressing vector controls, WNT16B, or siR As.
  • DMEM low serum
  • CM conditioned medium
  • Cells received Mitoxantrone treatment for 12 hours, 1 or 3 days at concentrations near individual cell line's IC50. Cell viability was then assayed, and the percentage of viable cells was calculated by comparing each experiment to vehicle- treated cells. Each assay was repeated a minimum of 3 times with results reported as mean ⁇ s.e.m.
  • CM Conditioned Medium
  • TCA trichloroacetic acid
  • RNA from experimental samples was isolated using the RNeasy® maxi kit (Qiagen Inc, Valencia, CA), incorporating on- column DNase treatment using the RNase-Free DNase Set (Qiagen Inc, Valencia, CA).
  • pooled equal amounts were of total RNA isolated from LNCaP, DU145, PC3, and CWR22 cell lines (ATCC) growing at log phase in dye-free RPMI-1640 medium supplemented with 10%> FBS (Invitrogen, Carlsbad, CA) were used.
  • Reference RNA was purified using TRIzol® (Invitrogen, Carlsbad, CA) following the manufacturer's protocol.
  • RNA was then further purified by RNeasy® maxi kit incorporating on-column DNAse treatment using the RNase-Free DNase Set. Experimental total RNA samples were amplified one round while the reference RNA was amplified two rounds using the Ambion MessageAmpTM aRNA Kit (Ambion Inc, Austin, TX), incorporating amino-allyl UTP into amplified antisense RNA. Sample quality and quantity were assessed by agarose gel electrophoresis and absorbance at A260 and A280 using the Nanodrop® 1000 spectrophotometer (Thermo Fisher Scientific Wilmington, DE.)
  • SAM Significance Analysis of Microarray
  • Microarray data are deposited in the Gene Expression Omnibus database with accession code GSE26143.
  • RNA isolation and quantitative RT-PCR Cell cultures and human tissue samples were individually homogenized in Trizol (Invitrogen, Carlsbad CA) and total RNA was isolated using the RNeasy® Kit (Qiagen Inc, Valencia, CA). RNA was quantitated in a Gene-Spec III spectrophotometer (Hitachi, Tokyo), and amplified using the MessageAmpTM RNA amplification kit (Ambion). cDNA was generated by a reverse transcription reaction, and quantitative PCR (qRT-PCR) analyses were performed in triplicate using an Applied Biosystems 7700 sequence detector with approximately 5 ng of cDNA, 1 ⁇ of designated primer pairs and SYBR Green PCR master mix (Applied Biosystems, Foster City, CA).
  • Frozen sections (7 ⁇ ) were cut from OCT blocks, stained with Mayer's hematoxylin, dehydrated in 100% ethanol and xylene, and used for laser-capture microdissection (LCM) using an Arcturus PixCell® He microscope (Arcturus, Mountain View, CA).
  • Stroma, cancerous epithelium, benign epithelium, and stroma from untreated biopsy and post-treated prostatectomy specimens were captured separately and the histology of acquired cells was verified by review of hematoxylin and eosin-stained sections from each sample and review of the LCM images.
  • Samples of breast carcinoma and ovarian carcinoma were collected under IRB- approved protocols. Ovarian and breast cancer specimens were selected based on either no treatment prior to surgical resection or genotoxic chemotherapy (e.g., cisplatin) prior to surgical resection.
  • genotoxic chemotherapy e.g., cisplatin
  • Tissue microarrays were constructed using prostates from 2 sets of patients with prostate adenocarcinoma - 50 patients (median age 63 years old; range 62 to 74 y.o.) who received neoadjuvant chemotherapy (Mitoxantrone and docetaxel) prior to radical prostatectomy and 30 patients (median age 61 years old (y.o.); range 45 to 77 y.o.) who had no history of neoadjuvant chemotherapy prior to radical prostatectomy. Details of the neoadjuvant chemotherapy trial have been published. Duplicate cores from each set of radical prostatectomies were used in the TMAs.
  • Carcinoma was confirmed in sections adjacent to those used for WNT16B immunostaining by immunostaining for a basal cell marker.
  • An antibody to basal cell proteins high molecular weight keratins 1, 5, 10 and 14 (a mouse monoclonal antibody raised human stratum corneum; product number MS-1447-R7 clone 34betaE12, Thermo Fisher Scientific) was used in an indirect immunoperoxidase procedure.
  • WNT16B a mouse monoclonal antibody raised against human WNT16B recombinant protein; product number 552595 clone F4- 1582, BD Pharmingen
  • anti-P-catenin Clone 14/Beta-Catenin, BD Transduction
  • Sections were then incubated sequentially in solutions of 5 % albumin in PBS, 10 % hydrogen peroxide in water, primary antibody, secondary anti-mouse IgG (biotinylated anti-mouse IgG (BA-2000, Vector Labs, Burlingame, California) at 1 :500 in PBS, and avidin-biotin-peroxidase solution (Vectastain ABC Elite kit at 1 : 100 in PBS, Vector Labs, Burlingame, CA) with interval washes in phosphate buffered saline. Reaction product was detected by incubating sections in a solution of the 0.05 % diaminobenzidine and 0.3 % hydrogen peroxide for 7 minutes. Sections were briefly counterstained with hematoxylin.
  • Biochemical recurrence-free survival analysis Prostate cancer patients treated with neoadjuvant chemotherapy were partitioned into 3 groups based on stromal WNT16B expression determined by IHC: those with WNT16B average score higher than and equal to 0 but less than 1; those with WNT16B average score higher than and equal to 1 but less than 2; and those with WNT16B average score higher than and equal to 2 but less than 3.
  • Clinical outcome data were collected following surgical prostatectomy, specifically measures of serum prostate specific antigen (PSA) as a metric of disease recurrence. Biochemical relapse was defined as a confirmed serum PSA concentration > 0.4 ng/ml.
  • Kaplan-Meier survival curves were plotted with the program GraphPad® Prism, with p-value calculated and output designated as percent biochemical relapse-free survival.
  • 49 had cores present on the TMA and 6 patients had frozen specimens embedded in optimal cutting temperature (OCT).
  • OCT optimal cutting temperature
  • the positive control for WNT16B expression was PSC27-RAD cells and the negative control was IgG isotype antibody.
  • the retroviral construct encoding a mutant form of ⁇ , pBabe- Puro-lKBa-Mut (super repressor) that harbors two IKK phosphorylation sites genetically modified as S32A and S34A (Boehm et al, Cell 129: 1065-1079, 2007), was used for retroviral production with the PHOENIXTM packaging cell line.
  • Infections of PSC27 fibroblasts were performed serially using drug selection (2 ⁇ g/ml of puromycin) to isolate cell populations. The established cell strain was subsequently subjected to ionizing radiation or MIT. Conditioned medium was collected as described above and used to treat epithelial cells, and gene expression was assessed by qRT-PCR or Western blot.
  • CM from fibroblasts or regular epithelial media containing 10 % fetal calf serum (FCS) were added to the bottom chambers.
  • Migrating or invading cells in the bottom chambers were stained and plate absorbance was recorded at 485/520 nm emission.
  • Each assay was performed in triplicate and measured at 24 hour time points over 3 days and presented as the average absorbance of migrating cells and invading cells, with human HeLA cervical cancer cell line (ATCC) used as a reference positive control.
  • ATCC HeLA cervical cancer cell line
  • DMEM low serum
  • CM CM generated from PSC27, HBF1023 or OVF28901 in various states (e.g., WNT16B overexpression, WNT16B knockdown, irradiated).
  • DMEM low serum
  • CM CM generated from PSC27, HBF1023 or OVF28901 in various states (e.g., WNT16B overexpression, WNT16B knockdown, irradiated).
  • MIT Mitoxantrone
  • apoptosis assays 0.2 x 10 6 PC3 cells were dispensed into 6-well culture plates and co-cultured with media conditioned from PSC27 sublines. Twelve hours later, Mitoxantrone was added to the media at the IC50 concentration of the PC3 line, with distilled water applied in parallel as control.
  • lysates were prepared 24 hours post treatment from each group, and apoptosis quantitated using a Caspase-Glo 3/7 assay (Promega) that luminescently measures caspase-3 and -7 activities against a tetrapeptide sequence DEVD that is cleaved to release aminoluciferin, upon apoptosis in cultures.
  • Caspase-Glo 3/7 assay Promega
  • TOPFLASH reporter assay and ⁇ -catenin inhibition Epithelial cells were transfected with the standardized pair of Super 16 x TOPFLASH and Super 16 x FOPFLASH (Addgene), each with a Renilla control luciferase plasmid applied for signal normalization. Empty vector pDNA3.1 was used as control plasmid to adjust for equal DNA concentrations per transfection. A construct encoding the full-length sequence of ⁇ -catenin was used as positive control of the canonical Wnt signaling pathway. Luciferase assays were performed using a Dual-Luciferase Reporter Assay kit, and fold induction for each cell line was calculated as normalized relative light units of TOPFLASH divided by those of FOPFLASH.
  • a small molecule compound XAV939 (Miltenyi Biotec) (Huang et ah, Nature 461 :614-620, 2009) (0.25 to about 0.50 ⁇ ) was applied to cultures of epithelial cells treated with conditioned medium from various fibroblast manipulations and with MIT chemotherapy.
  • WNT16B promoter analyses A 4000 base pair (bp) region immediately upstream of the human WNT16B gene (Genbank accession NM 016087.2) was analyzed for core NF- ⁇ binding sites using the Consite computerized DNA-binding motif search program.
  • Primer set #1 (-502 to -201) forward 5'- CAGGAAAGGTCATGACACACC-3 * (SEQ ID NO: 1), reverse 5 * - AGAGCAGCCTGGGGATCT-3 * (SEQ ID NO: 2); primer set #2 (-947 to -618) forward 5 '-TCTC AGGGACTGC AGGAAAT-3 ' (SEQ ID NO: 3), reverse 5 * - CCCACCAACATCTGGGTTAC-3 * (SEQ ID NO: 4); primer set #3 (-1356 to -1024) forward 5 * -CTCCAGGGAGTACCCTGCTA-3 * (SEQ ID NO: 5), reverse 5 * - TGTGCTCTGATCTTTTTCTCC A-3 ' (SEQ ID NO: 6), and two additional primer sets were employed to amplify regions within the promoters of the human IL-6 (Naugler and Karin, Curr.
  • ChIP assays were then performed on PSC27 cells of early passage (p8) and those that had undergone ⁇ -irradiation at a 10-Gy dose, with detailed procedures carried out as per previously published methods (Nelson et ah, Methods Mol. Biol. 567:45-57, 2009).
  • a sample of formalin-fixed sheared chromatin (DNA fragments at about 500 bp in average) from these cells was used as 'input DNA' for control amplifications. Fixed chromatin was immunoprecipitated using monoclonal mouse anti-p65 antibody and DNAs were extracted from the immunoprecipitates and amplified using the primer sets described above. Control immunoprecipitations was carried out without antibody as control, which yielded no reaction products for any of the primer sets.
  • the immediate 5' upstream sequences containing putative NF- ⁇ binding elements of the WNT16B gene were amplified from genomic DNA extracted from PSC27 cells by a DNeasy Blood and Tissue kit (QIAGEN). PCR products were cloned into pCR2.1-TOPO vector (Invitrogen) and each insert was sequenced for confirmation. PCR fragments were then double-digested and subcloned into a reporter luciferase vector pGL4.22 vector. Constructs containing one or multiple mutant NF- ⁇ binding sites were generated from the reporter vector series by site-directed mutagenesis.
  • NAT11- Luc2CP-IRES-nEGFP control construct that contains large copy numbers of NF-KB binding sequences and an optimized IL-2 minimal promoter as part of NFKB-activated transgene (NAT) system was kindly provided by Dr. Hatakeyama (Hokkaido University). All constructs were confirmed by DNA sequencing in both directions. Reporter vectors were co-transfected with pRL-TK vector for transfection efficiency controls and internal normalization for gene expression measurements. Cells were either treated with 20 ng/ml TNF-a for 90 min, exposed to 10 Gy ⁇ -irradiation or 1 ⁇ Mitoxantrone for 1 day.
  • Luciferase activity was measured using the Luciferase Assay System and normalized luciferase activities were calculated as light units normalized to renilla luciferase activity present in each specimen.
  • fibroblasts PSC27 strain
  • epithelial cells PC3, BPH1 or MDA-MB-231
  • each recombinant comprised of 250,000 cells of each line.
  • the cell/collagen mixture was overlaid with growth medium and incubated at 37°C for 1 hour before implantation.
  • Xenografting was performed under isoflurane anesthesia. A pocket beneath the back skin was formed using surgical scissors, with an oblique incision ( ⁇ 1 cm) made on the capsule surface parallel and adjacent to the long axis of each kidney. Cells were injected under the capsule with a blunt 25 -gauge needle and a glass Hamilton syringe via a transrenal injection, forming a starting tumor with a volume of 1 to 2 mm 3 . The kidney was returned to the retroperitoneal space and the skin was closed with surgical staples. The growth of xenografts was assessed at weekly intervals using ultrasound instruments. Animals were sacrificed at 2-8 weeks post transplantation, based on the tumor burden and pathological progression of tested animals.
  • mice received subrenal capsule xenografts by implantation according to the procedure described above. After surgery, mice were given standard laboratory diets and water ad libitum for 2 weeks, to allow tumor uptake and growth initiation. Starting from the 3rd week (when tumor sizes reached from about 4 to about 8 mm in diameter), mice received Mitoxantrone at a dose of 0.2 mg/kg by i.p. injection, or vehicle control, on day 1 of week 3, week 5, and week 7 (Alderton et al, Cancer Res. 52: 194-201, 1992). Between 8 and 12 mice were randomly assigned to each study arm. A total regimen of 3 2-week cycles was administered.
  • mice After the final treatment cycle the mice were sacrificed, kidneys were removed for tumor measurement and histological analysis. The cumulative Mitoxantrone dose received per mouse was 0.6 mg/kg. Each experimental arm comprised 5-8 mice per treatment cohort.
  • mice At the completion of the 8-week treatment regimen, mice were euthanized and various tissues were rapidly resected and snap frozen or fixed in formalin. Following protein isolations, Western immunoblot analysis was performed for Wntl6b expression, as described above.
  • mice harboring xenografts of PC3 cells combined with PSC27 fibroblasts were treated with Mitoxantrone 0.2 mg/kg by i.p. injection, or vehicle control.
  • Xenografts were collected 24 hour after treatment and tissues were processed for IHC. Apoptosis was assessed by staining with anti- caspase 3 antibody (cleaved, BioCare Medical). On adjacent sections, immunostaining with anti-yH2AX (Upstate) was performed to quantitate cells with DNA-damage.
  • PSC27 cells primary prostate fibroblasts
  • MIT bleomycin
  • H2O2 hydrogen peroxide
  • RAD gamma radiation
  • DDSP DNA damage secretory program
  • peptide growth factors with known roles or the potential to influence the growth of prostate cancer were upregulated including epidermal growth factor receptor (EGFR) ligands epiregulin (EREG), induced 15 fold, and amphiregulin (AREG), induced 10 fold.
  • EGFR epidermal growth factor receptor
  • EREG ligands epiregulin
  • AREG amphiregulin
  • the serine protease inhibitor SPINK1 recently shown to promote EGFR signaling in prostate cancinoma, was induced 20 fold ( Figure ID).
  • the RET oncogene ligand GDNF was induced 6 fold ( Figure IE).
  • WNT16B increased between eightfold and 64-fold as a result of these treatments (P ⁇ 0.005) ( Figures 1C and IF).
  • Wnt family members participate in well-described mesenchymal and epithelial signaling events that span developmental biology, stem cell functions and neoplasia (Clevers, Cell 127:469-480. 2006). Though little information links Wnt signaling to DNA damage responses, a previous study reported WNT16B overexpression in the context of stress- and oncogene-induced senescence (Binet et al, Cancer Res. 69:9183- 9191, 2009). DNA damage increased WNT16B protein expression was confirmed and elevated amounts of extracellular WNT16B were found in conditioned medium from prostate fibroblasts after chemotherapy or radiation ( Figures 1G and 1H).
  • WNT16B protein expression was confirmed by immunohistochemistry. Compared to untreated prostate tissue, WNT16B protein was substantially and significantly increased after chemotherapy in the periglandular stroma, which included fibroblasts and smooth muscle cells (P ⁇ 0.01) ( Figures 3B and 3C). In contrast, very limited WNT16B expression was observed in benign or neoplastic epithelium, and mRNAs encoding other Wnt family proteins were not substantially altered in prostate stroma ( Figures 2D and 2E).
  • WNT16B promotes cancer cell proliferation and invasion
  • PSC27 WNT16B -conditioned medium significantly enhanced prostate cancer cell growth (P ⁇ 0.01) ( Figure 6A) and increased cellular migration and invasion of PC3 cells (P ⁇ 0.05) compared to conditioned medium from PSC27 vector controls (PSC27 C ) (Fig. 6B and Figures 5C and 5D), confirming that WNT16B can promote phenotypic changes in tumor cells through paracrine mechanisms.
  • the DDSP comprises a diverse spectrum of secreted proteins with the potential to alter the phenotypes of neighboring cells (Figure 1C).
  • conditioned medium from PSC27-RAD + shR AWNT 166 fibroblasts reduced these responses to the full DDSP by between 15% and 35%, depending on the cell line (P ⁇ 0.05) ( Figures 6C and 6D).
  • non-tumorigenic BPHl or tumorigenic PC3 cells were combined with psC27 WNT16B (BPH1+PSC27 WNT16B and PC3+PSC27 WNT16B , respectively) or control PSC27 (BPH1+PSC27 C and PC3+PSC27 C , respectively) fibroblasts and implanted the recombinants under the renal capsule of recipient mice (Figure 6E).
  • BPH1+PSC27 WNT16B grafts were larger than BPH1+PSC27 C grafts (approximately 200 mm 3 compared to approximately 10 mm 3 , respectively; P ⁇ 0.001) ( Figure 5E).
  • grafts of PC3 cells alone formed tumors, and the tumors from PC3+PSC27C cells were of comparable size.
  • PC3+PSC27 WNT16B recombinants generated very large poorly differentiated and invasive tumors with an average size of 500 mm 3 , which were substantially larger than any of the control tumors (P ⁇ 0.001) ( Figure 6F and Figure 5F).
  • WNT16B signals through ⁇ -catenin and induces an EMT
  • WNT16B can promote tumor growth through paracrine signaling, determination of the mechanism(s) by which it does so was sought.
  • PSC27 ⁇ NT16B -conditioned medium activated canonical Wnt signaling in BPH1, PC3 and Ml 2 prostate cancer cells, as measured by assays of ⁇ -catenin-mediated transcription through T cell factor/lymphoid enhancer binding factor (TCF/LEF) binding sites (Figure 7A).
  • TCF/LEF T cell factor/lymphoid enhancer binding factor
  • Wnt signaling is known to promote the acquisition of mesenchymal cell characteristics that can influence the migratory and invasive behavior of epithelial cells through an EMT (Thiery et al, Cell 139:871-890, 2009; Yook et al, Nat. Cell Biol 8: 1398-1406, 2006; Vincan and Barker, Clin. Exp. Metastasis 25:657-663, 2008).
  • Loss of CDH1 also known as E-cadherin
  • the prototypic epithelial adhesion molecule in adherens junctions, and gain of CDH2 (also known as N-cadherin) expression are among the main hallmarks of an EMT (Wu and Bonavida, Crit. Rev. Immunol.
  • NF- ⁇ is also pivotal in mediating the stress-associated induction of inflammatory networks, including the upregulation and secretion of interkeukin-6 (IL-6) and IL-8 (Acosta et al., Cell 133: 1006- 1018, 2008; Kuilman et al, Cell 133: 1019-1031, 2008). It was therefore sought to determine whether DNA-damage-induced WNT16B expression is mediated by NF-KB.
  • NF-KB binding motifs were identified in the WNT16B promoter region and their function was confirmed using WNT16B promoter constructs.
  • both RAD and tumor necrosis factor a TNF-a
  • TNF-a tumor necrosis factor a
  • PSC27 prostate fibroblasts were generated with stable expression of a mutant nuclear factor of K light polypeptide gene enhancer in B cells inhibitor, ⁇ ( ⁇ ) (PSC27 IkB(X ), which prevents ⁇ kinase (IKK)-dependent degradation of ⁇ and attenuates NF-KB signaling.
  • the conditioned medium from PSC27-RAD cells representing the full fibroblast DDSP, significantly increased the viability of PC3 cancer cells exposed to MIT concentrations ranging between 0.1 to 1 ⁇ in vitro (P ⁇ 0.01) ( Figure 12).
  • PSC27-RAD+shRNA WNT16B or PSC27 lKBa RAD fibroblasts engineered to suppress WNT16B expression or NF-KB activation, respectively, substantially augmented the effects of MIT, further increasing apoptosis and reducing tumor cell viability by 30 to 40 %.
  • the mTOR Inhibitor Rapamycin Suppresses the DDSP and Enhances Tumor Responses to Genotoxic Chemotherapy
  • mTOR is a serine/threonine protein kinase that governs highly-conserved nutrient- and growth factor-sensing pathways, and is a component of two distinct complexes: mTORCl and mTORC2.
  • DNA damage induced by UV irradiation can induce the mTOR target p70S6 kinase concomitant with the up-regulation of DDSP members MMP1 and MMP3. While a systematic analysis of mTOR's role in DDSP is lacking, the data suggest that mTOR inhibitors (e.g., RADOOl and Rapamycin) may regulate DDSP effection proteins.
  • mTOR inhibitors e.g., RADOOl and Rapamycin
  • DNA damage responses and senescence programs can clearly operate in a cell autonomous 'intrinsic' manner to arrest cell growth and inhibit tumor progression, as has been observed in premalignant nevi (Michaloglou et al, Nature 436:720-724, 2005).
  • IGFBP7 insulin-like growth factor binding protein 7
  • CXCR2 chemokine receptor 2
  • IL-6 and IL-8 participate in a positive feedback loop to fortify the senescence growth arrest induced by oncogenic stress and also promote immune responses that clear senescent cells and enhance tumor regression
  • the damage response program comprises proteases and mitogenic growth factors, such as MMPs, hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF) and epidermal growth factor receptor (EGFR) ligands that have clear roles in promoting tumor growth, inhibiting cellular differentiation, enhancing angiogenesis and influencing treatment resistance (Bavik et al, Cancer Res. 66:794-802, 2006; Coppe et al, PLoS Biol. 6:2853-2868, 2008; Coppe et al, J. Biol. Chem. 281 :29568-29574, 2006).
  • MMPs hepatocyte growth factor
  • VEGF vascular endothelial growth factor
  • EGFR epidermal growth factor receptor
  • the composition of the microenvironment damage response indicates the potential to promote resistance to pathway-targeted agents such as EGFR inhibitors, as these drugs must contend with damage-enhanced local concentrations of competing ligands such as SPINK1 and amphiregulin; and fourth, specific microenvironment DDSP proteins that promote therapy resistance such as WNT16B are attractive targets for augmenting responses to more general genotoxic therapeutics.
  • pathway-targeted agents such as EGFR inhibitors
  • SPINK1 and amphiregulin competing ligands
  • specific microenvironment DDSP proteins that promote therapy resistance such as WNT16B are attractive targets for augmenting responses to more general genotoxic therapeutics.
  • the complexity of the damage response program also supports strategies that are focused on inhibiting upstream master regulators, such as NF- ⁇ (Chien et al., Genes Dev. 25:2125-2136, 2011), that may be more efficient and effective adjuncts to cytotoxic therapies, provided their side effects are tolerable.
  • SFRP2 is expressed by fibroblasts following genotoxic treatment and that the expression of SFRP2 can be modulated to effect cancer therapy.
  • H2O2 hydrogen peroxide
  • BLEO bleomycin
  • MIT mitoxantrone
  • PSC27 cells were treated with 0.6 mM hydrogen peroxide, 10 ⁇ g/mL bleomycin, or 1 ⁇ mitoxantrone in PSC medium as previously described above.
  • SFRP2 4',6-diamidino-2- phenylindole
  • WNT16B a Wnt family member that participates in paracrine actions from stromal areas to the prostate epithelial populations and alters multiple epithelial phenotypes
  • WNT16B a Wnt family member that participates in paracrine actions from stromal areas to the prostate epithelial populations and alters multiple epithelial phenotypes
  • chemotherapy-induced SFRP2 expression changes in human prostate cancer associated stroma was measured by qRT-PCR after micro-dissection. Each data point represented the measurements from an individual patient and the results were determined as PCR cycle number relative to the reference gene, ribosomal protein L13 (RPL13), which served as the base control.
  • RPL13 ribosomal protein L13
  • SFRP2 The expression level of SFRP2 was measured in both pre- and post-treatment patients, and found its transcripts increased significantly (p ⁇ 0.05). It is therefore interesting to interrogate whether many of the DDSP factors share a similar expression pattern, or only a small handful of them exhibit this feature.
  • SFRP2 has been found to be over-expressed in the vasculature of 85 % human breast tumors (Courtwright et al, Cancer Res. 69: 4621-4628, 2009), it was determined whether its expression has a similar or special pattern in human prostate populations, including the well characterized cell lines.
  • RNAs were prepared, with cDNA synthesized by reverse transcription. Values on the Y axis are based on the Log2 of fold change of SFRP2 transcript expression, as post-treatment signal against pre-treatment signal. Data are the average of three independent experiments. Treatment to PSC27 and several typical prostate epithelial cell lines with radiation demonstrated that this Frizzled-related protein was more susceptible to be induced in prostate fibroblasts, while epithelial cells only had a minor response, even when the cells received the same dose of radiation.
  • SFRP2 belongs to a large family of SFRPs that are implicated in the Wnt signaling cascade and are involved in cancer progression. Some studies suggest that SFRP2 inhibits the Wnt-P-catenin pathway thus acts as a tumor suppressor (Kawano and Kypta, J. Cell Sci. 116: 2627-2634, 2003; Suzuki et al, Br. J. Cancer 98: 1147-1156, 2008).
  • SFRP2 can induce tumor growth and it is produced by certain tumor types including glioma (Roth et al, Oncogene 19: 4210-420, 2000) and stimulates angiogenesis via a calcineurin/NFAT signaling pathway (Courtwright et al, Cancer Res. 69:4621-4628, 2009; Siamakpour-Reihani et al, PloS One 6:e20412, 2011).
  • the first choice was to silence SFRP2 expression through the application of shRNA.
  • the primary prostate stromal line PSC27 and several established prostate epithelial lines were exposed to 5Gy ionizing radiation.
  • RNAs were prepared, with cDNA synthesized by reverse transcription. Data were calculated as the average of three independent experiments. From these data it was found that the activated ⁇ -catenin pathway by stromal conditioned media collected post-DNA damage which was mainly mediated by WNT16B, became significantly attenuated. When the conditioned media from PSC27 cells made to over-express SFRP2, the ⁇ -catenin signals remained unchanged, indicating SFRP2 itself does not activate this pathway. However, when SFRP2 and WNT16B were co-expressed, the conditioned media caused significantly higher activation of the ⁇ -catenin axis.
  • the present example demonstrates that quiescent cells retain their proliferative potential and "DNA damage secretory program” (DDSP) development capacity one the cells are allowed or induced to exit from their G Q phase.
  • DDSP DNA damage secretory program
  • TME tumor microenvironment
  • DDSP DNA damage secretory program
  • DDSP proteins are well-known to promote tumor progression. These include proteases (MMPs), growth factors (SPINKl, amphiregulin, epiregulin), pro-angiogenic factors (ANGPTL4, ANGPT1), and pro-inflammatory cytokines (IL- ⁇ , IL6, IL8) (Coppe et al. PLoS Biol. 6:e301 : 2853-2868 2008; Bavik et al., supra, 2006; Kuilman et al., Cell 133: 1019-1031, 2008; Krtolica et al., Proc. Natl. Acad. Sci. USA 98: 12072- 12077, 2001; Parrinello et al., J. Cell Sci. 118:485-496, 2005; and Examples above).
  • MMPs proteases
  • SPINKl growth factors
  • ANGPTL4, ANGPT1 pro-angiogenic factors
  • IL- ⁇ , IL6, IL8 pro-inflammatory cytokines
  • Quiescent cells sustain DNA damage and a unique gene expression program is induced upon DNA damage in quiescent cells. Cells that have withdrawn from the cell cycle do not proliferate. Such cells, which are in the G Q phase of the cell cycle, are also termed post-mitotic cells, non-cycling cells, or resting cells.
  • Example 1 describes a stroma-specific, DNA damage secretory phenotype (DDSP) that is unique, robust and universal in human fibroblasts, and such phenotype exert profound influences to the tumor microenvironment, including but not limited to increased epithelial growth, migration, invasion and resistance to anticancer treatments.
  • DDSP DNA damage secretory phenotype
  • Many cells in the human body are in a reversible state of quiescence, where they have exited the cell cycle but retain the capacity to re-enter it and divide again under in vivo conditions.
  • Quiescent fibroblasts remain highly metabolically active even though they are not dividing, and they degrade and re-synthesize protein and fatty acid, and secrete large amounts of protein into the extracellular environment (Lemons et al., PLoS Biol 8:el000514, 2010).
  • the goal of this example was to determine whether there is a novel set of genes whose expression is specifically associated with DNA damage response in the quiescent fibroblasts, as is similar to or distinct from what we have found for proliferating human prostate fibroblasts.
  • DNA microarrays were used to compare patterns of gene expression in growing cells and cells arrested upon contact inhibition under the culture conditions (Figure 21).
  • DDSP-associated genes had similar expression pattern change in quiescent cells as compared with those occurring in proliferating cells. However, their expression fold change was mostly less than that in proliferating fibroblasts, in particular IL-8, IL-1B and IL-7 ( Figure 18).
  • atypical alteration was observed for some genes implicated in cell proliferation or cell cycle arrest, including pl6, p21, p53, Cyclin A, Cyclin D2, PCNA and MCM3.
  • Some soluble factors including AREG, EREG, GAL, MMP3 and WNT16B exhibited similar tendency with cytokines, although GM-CSF, Groa and MCP2 were differentially regulated, potentially by some other mechanisms.
  • IL-2 expression did not change substantially, suggesting the DNA damage-induced gene expression change does not cover the entire spectrum of cytokines or secreted factors, instead, only a handful of the total extracellular proteins.
  • quiescent cells are reversibly growth-arrested, and can be induced to resume proliferation under certain conditions including exposure to growth factors, cytokine, hormones, or chemical agents, thus distinct from terminally differentiated cells that are definitively withdrawn from the cell cycle.
  • the quiescent cells were released from Go after they were subject to DNA damage, by allowing them to reestablish in vessels of larger growth area or subcultured into multiple vessels.
  • majority of them were able to reach a full expression fold change when normalized to their basic status, quiescence, as compared with proliferating stromal cells exposed to DNA damaging agents.
  • quiescent cells retain their proliferative potential and DDSP development capacity once allowed to exit from their G Q phase.
  • Quiescent cells can be senescent and reserve intact DNA damage response Although quiescent cells are not proliferating, do they respond by entering senescence when exposed to DNA damaging agent? To address this, the phenotype of PSC27 cells was examined after treatment with ionizing radiation by applying senescence-associated ⁇ -Gal (SA-B-Gal) staining, an indicator of cellular senescence, and found quiescent cells demonstrated significantly enhanced staining about 7 to 10 days after DNA damage (Figure 19). Not only the percentage of positively stained quiescent cells before treatment as a basal control is close to that of proliferating cells, but the ratio of SA-B-Gal stained cells resembles that of the PSC27 fibroblasts upon radiation.
  • SA-B-Gal senescence-associated ⁇ -Gal
  • the DDSP component glial cell line-derived neurotrophic factor (GDNF)
  • GDNF glial cell line-derived neurotrophic factor
  • cancer stem cells are known to respond to specific molecular cues from their cellular niche. It is likely that the microenvironment-derived DDSP components, including GDNF, exert potent pro-survival and therapy-resistance phenotypes in prostate cancer stem cells and these effects will be determined using in vitro and in vivo assays.
  • Wntl6B was identified as the first active component in the DDSP with therapy-resistance activity.
  • Wntl6B only accounted for about 1 ⁇ 2 of the DDSP induced effects.
  • additional components secreted by the tumor microenvironment upon DNA-damage are being examined, which act in an additive or synergistic manner to Wntl6B and/or GDNF.
  • Preliminary data from Example 1 demonstrated that GDNF exerted proliferation-inducing effects on both epithelial cancer cells as well as on the damaged tumor stroma itself.
  • Glial cell line-derived neurotrophic factor was identified as one of the secreted factors of the DDSP in human prostate tumor microenvironment upon DNA damage (See Example 1 above). It was also identified as activated in reactive prostate cancer associated tumor stroma in a cohort of grade 3 cancers in an independent study (Dakhova et al, Clin. Cancer Res. 15:3979-3989, 2009). GDNF was originally identified in glioma cell supernatant as a trophic factor for dopaminergic neurons.
  • GDNF GDNF family receptor alpha 1
  • RET trans-membrane receptor kinase RET
  • SFK Src family kinases
  • GDNF binds to GFRA1 which can activate SFK signaling if GFRA1 is in its GPI anchored form and bound to the cell membrane.
  • the GDNF/GFRA1 complex in both its soluble form and when GPI anchored binds to the RET receptor additionally activating the MEK/Erk pathway via RET trans-activation at its intracellular domain.
  • GDNF expression was increased in these experiments by at least 6-fold in all of the three DNA damaging conditions (Figure 22A).
  • PSC27 cells primary human prostate fibroblasts
  • Figure 22B and 22C a treatment group with Mitoxantrone, a drug originally used in the neo-adjuvant study known to induce DNA damage by disrupting DNA synthesis and repair.
  • GDNF induction was consistently found upon DNA damage and GDNF expression levels gradually increase over time post treatment reaching an induction > 3 -fold after approximately 4 days and increasing afterwards.
  • Both components of the GDNF receptor complex, RET and GFRA1 are expressed in CaP in both epithelial and stromal cells as determined by IHC staining. Expression of GDNF itself was only found in tumor stromal cells but not in the epithelial cancer cells in all samples analyzed, further supporting the concept that damage to components of the tumor microenvironment exerts paracrine-effects toward surviving tumor cells. An analysis of gene and protein expression showed that > 95% of CaP express the RET receptor and > 80 % express GFRAl, indicating that the majority of CaP are, via at least one pathway, GDNF sensitive.
  • the patient samples are being used from a neo-adjuvant study to confirm the up-regulation of GDNF in the CaP stroma by IHC and qPCR using RNA from micro-dissected tumor stroma after DNA damaging therapy.
  • GDNF has on tumor growth, we have used two experimental approaches have been used. 1) the effect of purified GDNF on cell proliferation of epithelial cells was analyzed and 2) GDNF over-expressing and secreting human prostate fibroblasts were generated which can also be used in co-culture and in vivo experiments.
  • the GDNF over-expressing cell lines can be used to determine the role of this growth factor in prostate cancer progression and therapy resistance: i) co-cultures with epithelial cells can be used to determine the growth changing effect these cells have on prostate cancer. Based on these results, ii) epithelial CaP cells can be implanted in a mix with the PSC27/iGDNF-V5 cells either subcutaneously or into the renal capsule of immune-compromised mice to analyze in vivo growth differences. These tumors can be further used to analyze the effect GDNF has on the tumor micro-architecture, gene expression and vascularization, iii) the conditioned medium of these cells can be used to analyze the effect GDNF has on epithelial cell proliferation and in particular treatment resistance.
  • MYC expression is unaffected upon rapalog treatment in the above data set. Therefore, the mechanism(s) by which mTOR inhibition suppresses GDNF transcription will be evaluated. Further analysis of whether pre-treatment of stromal cells and stromal- epithelial cell mixtures with rapalogs blocks the induction of the DDSP or DDSP components and thereby would limit the growth stimulating effects of, among others, GDNF and Wntl6B can also be examined.
  • Wntl6B expression is induced by NF-kB signaling upon DNA damage (See Example 1 above).
  • NF-kB inhibitor When human prostate stromal cells are treated with a NF-kB inhibitor, this blocks the induction of Wntl6B, however, GDNF gene expression is not affected.
  • GDNF and Wntl6B are but two out of > 30 components of the DNA damage response program with the potential to influence tumor phenotypes.
  • the above studies indicate that specifically co-targeting GDNF- and Wnt-mediated signaling in the context of conventional cytotoxic modalities has the potential to diminish therapy resistance.
  • GDNF induces stem cell renewal and proliferation and anti-cancer treatment resistance in other cancer types, indicating a potential role for GDNF in the tumor repopulation of CRPC (Plaza- Menacho et al, Oncogene, 29:4648-4657, 2010; Hansford and Marshall, Neurosci. Lett. 389:77-82, 2005; Kubota Et al. , Proc. Natl. Acad. Sci. USA, 101 :16489-16494, 2004).
  • the composition of the microenvironment damage response indicates a potential to promote resistance to pathway-targeted agents such as EGFR inhibitors as these drugs must contend with damage-enhanced local concentrations of competing ligands.
  • pathway-targeted agents such as EGFR inhibitors as these drugs must contend with damage-enhanced local concentrations of competing ligands.
  • specific effector proteins such as GDNF or Wntl6B represent attractive microenvironment targets that may avoid side-effects of more general therapeutics.
  • the complexity of the damage response program also supports strategies focused on upstream master regulators, such as NFKB (Chien et al., Genes Dev., 25:2125-2136, 2011.) and mTOR, that can be more efficient and effective adjuncts to cytotoxic therapies, provided side-effects are tolerable.
  • Example 1 The study performed on Wntl6B in Example 1 has served as a model for the analysis of GDNF and additional DDSP components.
  • the analysis of GDNF (and other factors) can be analyzed.
  • GDNF expression and secretion in patient samples can be examined after treatment to confirm GDNF activation in an expanded cohort.
  • additional human primary fibroblasts can be tested for the up-regulation of GDNF after DNA damage, also expanding to stromal cells from other cancer types like breast cancer.
  • the effect GDNF has on the IC50 concentrations of standard chemotherapeutics and irradiation in both epithelial and stromal cells can be analyzed to determine a potential pro-resistance effect.
  • the PSC27/iGDNF-V5 cells can be used to analyze the effects of GDNF through in vitro co-culture experiments, which form the basis for the subsequent in vivo analysis (as described below).
  • the effect GDNF has on global gene expression in stromal and epithelial cells can be examined to identify factors of the DDSP controlled by GDNF or functionally related to the observed phenotypes (MMPs, MDR genes, and the like).
  • MMPs, MDR genes, and the like The expression data shown above after rapalog treatment can be used to expand the analysis of how GDNF is regulated, primarily focusing on mTOR and FGF signaling.
  • the analysis can also be expanded to other cancer types, primarily to breast cancer.
  • Lin-;Trop2+;CD49f+ (LTC+) cell population has been shown to have PCSC characteristics in CaP.
  • These cells can be analyzed in respect of prosta-sphere (indicative of stem cell differentiation) or cancer-sphere formation, matrigel 3D sphere formation capacity and trans-well invasion potential when inoculated with GDNF or using GDNF as chemo-attractant.
  • PSC27 prostate fibroblasts can be transduced with shRNA targeting GDNF, RET and GFRA1 using a lenti-viral strategy. This will provide a more in depth analysis in co-culture experiments as well as in co-culture in vivo models.
  • Co-cultures of CaP cells and stable target knock-down or over expression stromal cells can be implanted into the renal capsule of immunocompromised SCID mice.
  • Xenograft growth can be monitored at least bi-weekly for up to 12 weeks.
  • tumors can be analyzed for mitotic figures, vascularization, weight, volume, and marker expression. Histological analysis and re- culturing can be done depending on the initial findings.
  • DDSP components can be analyzed for Wntl6B additive or synergistic effects. Based on our current data, Wntl6B contributes approximately 1 ⁇ 2 of the growth promoting effect of the DDSP.
  • the effect of GDNF can be quantified as a fraction of the full DDSP.
  • GDNF might also act in an additive or synergistic effect together with Wntl6B.
  • the initial screen performed above identified SFRP2 as substantially induced by DNA damage.
  • SFRP2 has traditionally been thought to function as a Wnt- signaling antagonist, but the studies above indicate that SFRP2 promotes Wntl6B effects toward frizzled receptor signaling.
  • siRNA knock-down screen can be performed for active DDSP components on "benign" fibroblasts, PSC27shRNA-Wntl6B and PCS27shRNA-GDNF cells enabling the detection of elements which induce a significant change in this setting even if they are not detectable when knocked down alone.
  • PSC27shRNA-Wntl6B and PCS27shRNA-GDNF cells can be transfected with siRNA targeting individual DDSP components leading to the simultaneous loss or down regulation of two DDSP components. Once achieved, these cells can then be used to generate conditioned medium after DDSP induction or for co-culture experiments. Since the effects of Wntl6B have been scrutinized before, the readout will be relatively simple as it will be de facto a single factor problem. All experimental approaches as outlined above are also applicable to this study.
  • DDSP component candidate expression in human tumor samples.
  • a candidate component will be analyzed for expression by IHC in samples of prostate tumors after neoadjuvant therapy with DNA damaging agents with confirmed DDSP induction.
  • the effect of the full DDSP on PCSC and the potential to induce stem like characteristics in non-stem like cancer cells can be determined.
  • Stem cells closely interact with their surrounding niche and reciprocal signal exchange is a key component of SC regulation. Thereby, the niche is both necessary and required to maintain the characteristics of non-transformed SC in various tissues and organs.
  • Several components of the DDSP, including GDNF, likely modulate adult SC function, and the DDSP can likely also influence the differential survival of PCSC following genotoxic therapy.
  • the expression levels of stem cell markers and PCSC markers can be determined in benign and neoplastic prostate epithelial cells with and without exposure to the stromal cell factors and separately, epithelial cell DDSP program from conditioned medium. Initial markers will include Nestin, Sox2, CD133, Trop2, CD49f, ALDH1A1, Bmi-1, integrin ⁇ 2 ⁇ 11 ⁇ , c-Met and Lin.
  • LTC + cells show distinct features including the potential of clonal expansion, unlimited replication, sphere formation including 3D matrigel cultures or in vivo tumorigenicity.
  • the PCSC enhancing effects the DDSP could have on both LTC + and LTC " cells of various CaP cell lines and ex vivo cells can be examined. These examinations can involve determining if the microenvironment DDSP will enhance the establishment of tumors from individual or small numbers of LTC + versus LTC " tumor cells and assessing whether the DDSP can modulate tumor growth and survival following cytotoxic therapeutics.
  • DDSP drugable DDSP activated pathways to block or reduce tumor promoting effects in vitro and in vivo: ultimately impact the survival of patients with advanced prostate cancer.
  • Co-targeting components of the DDSP in the tumor microenvironment or blocking the DDSP-inducing pathways will enhance the response rates of conventional genotoxic treatments.
  • suitable inhibitors can be found to assess the efficiency of anti-DDSP or anti-DDSP component combination strategies ⁇ e.g., anti-Wnt/p-catenin signaling, RET inhibitors and/or rapalogs to block GDNF induction).
  • GDNF represents an attractive DDSP target as pharmacological inhibitors of the RET tyrosine kinase have been developed and one, vandetanib, was recently approved for clinical use (REF).
  • the primary readout will be the reduction of proliferation rates, susceptibility to therapy (apoptosis), loss of LTC + cell population, and loss of tumorigenic potential.
  • An anti- DDSP combination therapy can be examined in vivo and subsequently in combination with chemo-therapy and radiotherapy.
  • the renal capsule in vivo model of CaP can be used to assess the in vivo applicability of regimens which have shown promising results in vitro.
  • the corollary will involve the examination of antagonism of upstream 'master regulators' of the DDSP, rather than specific individual effector proteins that can be targeted.
  • mTOR regulates major components of the full DDSP, and not only GDNF, and that mTOR inhibitors such as rapamycin or RADOOl effectively suppress key DDSP proteins including Wntl6B.
  • RADOOl can be combined, to suppress the microenvironment DDSP with or prior to genotoxic therapy (e.g., mitoxantrone) to assess for enhanced tumor regression.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present disclosure provides methods for determining the effectiveness of a cancer therapy, as well as methods for increasing the effectiveness of that therapy and determining a prognosis for a patient receiving that therapy.

Description

TREATMENT-INDUCED DAMAGE TO THE TUMOR MICRO-ENVIRONMENT PROMOTES CANCER THERAPY RESISTANCE THROUGH EXTRACELLULAR
PROTEINS RELATED APPLICATIONS
The present application claims the benefit of United States provisional application serial number 61/678972, filed August 2, 2012, the content of which is incorporated herein in its entirety.
STATEMENT REGARDING SEQUENCE LISTING
The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the sequence listing is 42895_SEQ_Final_2013-07-22.txt. The text file is 8 KB; was created on July 22, 2013; and is being submitted via EFS-Web with the filing of the specification.
FIELD OF THE INVENTION
The present disclosure provides methods for enhancing the effectiveness of a cancer therapeutic by inhibiting the activity of a gene that encodes an extracellular protein, wherein after genotoxic treatment the gene is expressed at a level at least 3.5 fold above the level of expression without the genotoxic treatment. The extracellular proteins are collectively termed herein DNA damage secretory program (DDSP) polypeptides or proteins. In another embodiment the invention provides a method for determining a prognosis of cancer in a patient administered a genotoxic agent by observing expression changes in the production of extracellular proteins in the tumor microenvironment. By observing up regulation or down regulation of specified extracellular proteins, both the effectiveness of the genotoxic agent and a prognosis of cancer can be determined.
STATEMENT OF GOVERNMENT LICENSE RIGHTS
This invention was made with Government support under U54 CA126540 awarded by National Cancer Institute, National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND
A major impediment to more effective cancer treatment is the ability of tumors to acquire resistance to cytotoxic and cytostatic therapeutics, a development that contributes to treatment failures exceeding 90% in patients with metastatic carcinomas (Longley and Johnston, J. Pathol. 205:272-292, 2005). Efforts focused on circumventing cellular survival mechanisms after chemotherapy have defined systems that modulate the import, export or metabolism of drugs by tumor cells (Wang et al. , Proc. Natl. Acad. Sci. USA 101 :3089-3094, 2004; Schmitt et al, Nat. Med. 6: 1029-1035, 2000; Helmrich et al, Ocogene 24:4174-4182, 2005; Redmond et al, Front. Biosci. 13:5138-5154, 2008; Wilson et al, Ann. Oncol. 17(Suppl.l0):x315-x324. 2006). Enhanced damage repair and modifications to apoptotic and senescence programs also contribute to de novo or acquired tolerance to anti-neoplastic treatments (Schmitt et al, Nat. Med. 6: 1029-1035, 2000; Lee and Schmitt, Curr. Opin. Genet. Dev. 13:90-96, 2003; Sakai et al, Nature 451 : 1116-1120, 2008). In addition, the finding that ex vivo assays of sensitivity to chemotherapy do not accurately predict responses in vivo indicate that tumor micro environments also contribute substantially to cellular viability after toxic insults (Kobayashi et al, Proc. Natl. Acad. Sci. USA 90:3294-3298, 1993; Waldman et al, Nat. Med. 3: 1034-1036, 1997; Samson et al, J. Clin. Oncol. 22:3618-3630, 2004). For example, cell adhesion to matrix molecules can affect life and death decisions in tumor cells responding to damage (Croix et al, J. Natl. Cancer Inst. 88: 1285-1296, 1996; Kerbel, Cancer Metastasis Rev. 20: 1-2, 2001; Wang et al, J. Natl. Cancer Inst. 94: 1494- 1503, 2002). Further, the spatial organization of tumors relative to the vasculature establishes gradients of drug concentration, oxygenation, acidity and states of cell proliferation, each of which may substantially influence cell survival and the subsequent tumor repopulation kinetics (Kim and Tannnock, Nat. Rev. Cancer 5:516-525, 2005; Tredan et a/., J. Natl. Cancer Inst. 99: 1441-1454, 2007).
Most cytotoxic agents selectively target cancers by exploiting differential tumor cell characteristics, such as high proliferation rates, hypoxia and genome instability, resulting in a favorable therapeutic index. However, cancer therapies also affect benign cells and can disrupt the normal function and physiology of tissues and organs. To avoid host lethality, most anticancer regimens do not rely on single overwhelming treatment doses: both radiation and chemotherapy are administered at intervals to allow the recovery of vital normal cell types. However, gaps between treatment cycles also allow tumor cells to recover, activate and exploit survival mechanisms and resist subsequent therapeutic insults.
Here it is demonstrated that treatment-associated DNA damage responses in benign cells comprising the tumor microenvironment promote therapy resistance and subsequent tumor progression. Evidence of treatment-induced alterations in tumor stroma is provided that include the expression of a diverse spectrum of secreted cytokines and growth factors. Among these, the present disclosure shows that WNT16B is activated in fibroblasts through NF-κΒ and promotes an epithelial to mesenchymal transition (EMT) in neoplastic prostate epithelium through paracrine signaling. Further, WNT16B, acting in a cell non-autonomous manner, promotes the survival of cancer cells after cytotoxic therapy. In additional embodiments it is demonstrated that secreted fizzled- related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and glial cell derived neurotrophic factor (GDNF) are activated in the tumor microenvironment and are targets for intervention for improving cancer therapeutics. As such, the inventors provide herein methods targeting constituents of the tumor microenvironment in conjunction with conventional cancer therapeutics to enhance treatment responses.
SUMMARY
The present disclosure provides methods for determining the effectiveness of a cancer therapy, as well as methods for increasing the effectiveness of that therapy and determining the prognosis of a patient receiving that therapy. In one embodiment, the disclosure provides a method for enhancing the effectiveness of a cancer therapeutic by administering an agent that inhibits the activity of a gene encoding an extracellular polypeptide protein that is increased subsequent to treatment of a patient with a cancer therapeutic. In certain embodiment the cancer therapeutic is a genotoxic agent. Further, the extracellular polypeptide or protein can be at least one of matrix metallopeptidase 1 (interstitial collagenase) (MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMPl 2), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2) (MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFPl), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINI1), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A). In a particular embodiment the at least one extracellular protein is selected from Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and glial cell derived neurotrophic factor (GDNF).
In another embodiment, the present disclosure provides a method for determining the effectiveness of a cancer therapeutic in a patient comprising: i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample; wherein a decreased or unchanged level of the at least one extracellular protein is indicative of effectiveness of the cancer therapeutic and wherein an increased level of the at least one extracellular protein is indicative of a decreased effectiveness of the cancer therapeutic. In a particular embodiment provided herein the cancer therapeutic is a genotoxic agent. Further, the at least one extracellular protein is matrix metallopeptidase 1 (interstitial collagenase) (MMP1), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFPl), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINI1), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A). In a particular embodiment the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and/or glial cell derived neurotrophic factor (GDNF).
In yet another embodiment the present disclosure provides a method for determining a prognosis in a cancer patient treated with a cancer therapeutic; comprising: i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample; wherein a decreased or unchanged level of expression of the at least one extracellular protein is determinant of a more favorable or better prognosis, a longer survival period, and wherein an increase in the expression of the at least one extracellular protein is determinant of a less favorable prognosis and/or shorter period of survival. In certain embodiments disclosed herein the cancer therapeutic is a genotoxic agent. Further, the at least one extracellular protein can be matrix metallopeptidase 1 (interstitial collagenase) (MMP1), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1) (SPINK1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N- acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFP1), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINIl), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A). In a particular embodiment the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and/or glial cell derived neurotrophic factor (GDNF) .
DESCRIPTION OF THE DRAWINGS
The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, wherein:
Figures 1A through 1J demonstrate that genotoxic damage to primary prostate fibroblasts induces expression of a spectrum of secreted proteins that includes WNT16B. Figure 1A. Schematic of the prostate cancer treatment regimen comprising a pretreatment prostate biopsy and four cycles of neoadjuvant DOC and MIT chemotherapy followed by radical prostatectomy. Figure IB. DNA damage foci in human prostate tissues collected before and after chemotherapy. Tissue sections were probed with antibodies recognizing γ-Η2ΑΧ (lighter signals), and nuclei were counterstained with Hoechst 33342. Gl, gland lumen; e, epithelium; s, stroma. Scale bars, 50 μιη. Figure 1C.
Analysis of gene expression changes in prostate fibroblasts by transcript microarray quantification. The heatmap depicts the relative mR A levels after exposure to H2O2,
BLEO or RAD compared to vehicle-treated cells. Columns are replicate experiments. WNT16B is highlighted in bold for emphasis. Figure ID shows a robust induction of GDNF in prostate fibroblasts following DNA damage. Figure IE shows a robust induction of SPINK1 in prostate fibroblasts following DNA damage. Figure IF. Measurements of WNT16B expression by qRT-PCR in prostate fibroblasts. Shown are the log2 transcript measurements before (Pre) or after exposure to the indicated factors relative to vehicle -treated control cells. Data are mean ± s.d. of triplicates. The P value was calculated by analysis of variance (ANOVA) followed by t test. Figure 1G. WNT16B protein expression in prostate PSC27 fibroblast extracellular conditioned medium (CM) or in cell lysates (IC) after genotoxic exposures, β-actin is a loading control. Figure 1H. Immunohistochemical analysis of WNT16B expression in prostate fibroblasts before (Pre) and after exposure to MIT or RAD. Brown chromogen indicates WNT16B expression. Scale bars, 50 μιη. Figure II. Expression of Wnt family members in prostate fibroblasts after exposure to DNA-damaging agents. Transcript quantification was determined by microarray hybridization. Columns represent independent replicate experiments. WNT16B is listed in bold for emphasis. Figure 1 J. WNT16B expression by qRT-PCR in PSC27 fibroblasts and prostate cancer cell lines after the indicated genotoxic exposure relative to pretreatment transcript amounts. Data are mean ± s.d.
Figures 2A through 2E demonstrate an analysis of DNA damage responses (DDR) in prostate fibroblasts following DNA damaging cancer therapy. Figure 2A. Quantitation of DNA damage foci before (Pre) and after DNA damaging treatments. DDR foci identified by immunofluorescence staining for γ-Η2ΑΧ (see Figure 2B) were recorded according to a 4-category scale. Data were averaged from readings of 3 independent fields, each with a total count of 100 nuclei. * represent significant differences P < 0.01 compared to untreated (Pre). Figure 2B. Analysis of DNA damage foci formation in prostate fibroblasts upon exposure to various DNA damaging agents. PSC27 prostate fibroblasts were treated with H202, bleomycin (BLEO) or gamma- irradiation (RAD). Immunofluorescence staining for γ-Η2ΑΧ (bright foci), with nuclei counterstained by Hoechst 33342 (light gray). Scale bar, 15 μιη. Figure 2C. Analysis of gene expression changes in prostate fibroblasts by microarray hybridization. The heatmaps depict the relative mRNA levels after exposure to hydrogen peroxide (H2O2),
Bleomycin (BLEO) or ionizing radiation (RAD) compared to vehicle treated cells. Figure 2D. WNT16B transcript levels in specific cell populations microdissected from prostate tissues before and after exposure to cytotoxic chemotherapy. Measurements are by qRT-PCR. Log2 fold changes are shown relative to the lowest measurement of untreated benign prostate epithelium. Each data-point represents an individual patient sample. Figure 2E. Transcript levels of WNT family members in microdissected human prostate stroma acquired before and after exposure to chemotherapy as quantitated by microarray hybridization. Columns represent individual patients. Values for each gene are mean-centered across all samples.
Figures 3A through 3F demonstrate that cytotoxic chemotherapy induces
WNT16B expression in the tumor microenvironment. Figure 3 A.
Chemotherapy-induced gene expression changes in human prostate-cancer-associated stroma measured by qRT-PCR of microdissected cells. The amounts of transcript before treatment (x axis) are plotted against the amounts of transcript after chemotherapy (y axis) from the same individual. Each data point represents the measurements from an individual patient. The results are shown as PCR cycle number relative to ribosomal protein LI 3 (RPL13), which served as the reference control. The P values were calculated by Student's t test. Figure 3B. IHC assessment of prostate stromal WNT16B expression in prostatectomy tissue samples from men with prostate cancer who were either untreated (n = 30) or treated with chemotherapy (n = 50). Patients were assigned to four categories based on their stromal WNT16B staining: 0, no expression; 1 , faint or equivocal expression; 2, moderate expression; 3, intense reactivity. P < 0.0001 by ANOVA. Figure 3C. Representative example of intense WNT16B expression in prostate stroma after in vivo exposure to MIT and DOC. The black arrows denote areas of the stroma with fibroblasts and smooth muscle. Note the minimal WNT16B reactivity in the epithelium (gray arrows). Scale bars, 50 μιη. Figure 3D. Kaplan-Meier plot of biochemical (prostate-specific antigen) relapse-free survival based on the expression of WNT16B in prostate stroma after exposure to MIT and DOC chemotherapy (P = 0.04 by log-rank test comparing WNT16B < 1 with WNT16B > 2 survival distributions). DFI, disease-free interval from surgery. Figures 3E and 3F. WNT16B staining of breast (Figure 3E) and ovarian (Figure 3F) carcinoma from patients receiving neoadjuvant chemotherapy or no treatment before surgical resection. Staining is recorded on a 4-point scale: 0, no expression; 1, faint or equivocal expression; 2, moderate expression; 3, intense reactivity. Scale bars, 50 μιη. The P values were calculated by ANOVA.
Figures 4 A through 4D show that DNA damage induces WNT16B expression in a spectrum of human fibroblasts and murine organs. Figures 4A and 4B. Human prostate fibroblasts (HSP27), and newly derived breast (HBF1203) and ovarian (OVF28901) primary fibroblast lines express stromal but not epithelial markers. Figure 4A. Concurrent immunofluorescence staining using vimentin (dark grey) and cytokeratin 8 (light grey) antibodies with PC3 cells serving as a positive control for epithelial cells. Scale bar, 15 μιη. Figure 4B. Western immunoblot of stromal and epithelial cell lines confirming expression of mesenchymal and epithelial proteins, respectively. Figure 4C. WNT16B expression is induced by DNA damage in most, but not all human fibroblast isolates: HBF1203 (breast), OVF28901 (ovary), HS5 (bone marrow) and HS27A (bone marrow). CM, conditioned media; IC, intracellular lysates. Figure 4D. Systemic chemotherapy induces WNT16B expression in diverse murine organs. Each tissue type was collected after three mitoxantrone treatments administered over eight weeks.
Figures 5A through 5F demonstrate that epithelial cell phenotypes are altered by fibroblast-derived paracrineacting WNT16B. Figure 5 A. Immunofluorescence confirmation of WNT16B in PSC27 cells engineered to alter WNT16B: (1) PSC27 vector control (PSC27C); (2) PSC27 cells expressing WNT16B (PSC27WNT16B); (3) PSC27WNT16B with non-specific shRNA; (4, 5) PSC27WNT16B cells with WNT16B- specific shRNAs. Scale bar, 25 μιη. Below: conditioned medium from PSC27C (1); PSC27WNT16B (2); PSC27WNT16B with control shRNA (3); and (4, 5) PSC27WNT16B with WNT16B-specific shRNAs. Figure 5B. WNT16B shRNAs suppress the induction of WNT16B following genotoxic stress induced by irradiation (RAD) or mitoxantrone (MIT). Conditioned medium from PSC27WNT16B cells promotes the migration Figure 5C and invasion Figure 5D of tumor cells (n=3 replicates). Figure 5E. Fibroblast derived WNT16B promotes the growth of prostate carcinoma in vivo. Subrenal capsule grafts comprised of BPH1 prostate epithelial cells alone, in combination with PSC27C control fibroblasts, or in combination with PSC27WNT16B fibroblasts are shown. Dashed lines denote the size of the tumor outgrowth from the kidney capsule. Figure 5F. Histology of subrenal capsule grafts comprised of BPH1 or PC3 prostate cells in combination with control fibroblasts (PSC27C), or fibroblasts expressing WNT16B (PSC27WNT16B). Dashed lines demarcate the tumor (T) from the kidney parenchyma (K). SV40 and CD44 IHC mark BPH1 and PC3 prostate epithelial cells respectively in the kidney grafts. Black arrows indicate epithelial cells invading into the kidney parenchyma. Scale bar, 150 μιη.
Figures 6A through 6G demonstrate that WNT16B is a major effector of the full DDSP and promotes the growth and invasion of prostate carcinoma. Figure 6A. Conditioned medium from WNT16B-expressing prostate fibroblasts (PSC27WNT16B) promotes the proliferation of neoplastic prostate epithelial cells. shRNAc, control shRNA; shR AWNT16B#l and shRN AWNT 16B#2 , WNT16B-specific shRNAs. Figure 6B. Scratch assay showing the enhanced motility of PC3 cells exposed to conditioned medium from prostate fibroblasts expressing a control vector (PSC27C) or fibroblasts expressing WNT16B (PSC27WNT16B). Scale bars, 100 μπι. Figure 6C. The full fibroblast DDSP induced by radiation (PSC27-RAD) promotes the proliferation of tumorigenic prostate epithelial cells. The proliferative effect is significantly attenuated by the suppression of damage-induced expression of WNT16B (PSC27-RAD+shRNAWNT16B) Fjgure 6D The full paracrine-acting fibroblast DDSP induced by radiation (PSC27-RAD) promotes the invasion of neoplastic epithelial cells. Invasion is significantly attenuated by the suppression of damage-induced expression of WNT16B (PSC27-RAD+shRNAWNT16B) Data m Fjgure 6A? Fjgure 6 and Figure 6D are mean ± s.e.m. of triplicates, with P values calculated by ANOVA followed by t test. Figure 6E. Schematic of the xenograft cell recombination experiment to assess the ability of fibroblasts expressing WNT16B to influence prostate tumorigenesis in vivo. PFC, prostate fibroblast cells; PC, prostate cancer cells. Figure 6F. Prostate fibroblasts engineered to express WNT16B promote the growth of prostate carcinoma in vivo. Subrenal capsule grafts comprised of PC3 prostate epithelial cells alone, PC3 cells in combination with PSC27C control fibroblasts or PC3 cells in combination with PSC27WNT16B fibroblasts are shown. The green dashed lines denote the size of the tumor outgrowth from the kidney capsule. Figure 6G. Irradiated prostate fibroblasts (PSC27-RAD) promote the growth of prostate carcinoma cells in vivo, and this effect is significantly attenuated by the suppression of fibroblast WNT16B using WNT16B-specific shR As (PSC27-RAD+shRNAWNT16B) (P < 0.05). Shown are tumor volumes 8 weeks after renal capsule implantation of PC3 and PSC27 cell grafts. In Figure 6F and Figure 6G, horizontal lines denote the mean of each group of eight tumors, and P values were determined by ANOVA followed by t test.
Figures 7 A through 71 demonstrate that genotoxic stress upregulates WNT16B through NF-KB and signals through the canonical Wnt-P-catenin pathway to promote tumor cell proliferation and the acquisition of mesenchymal characteristics. Figure 7A. Assay of canonical Wnt pathway signaling through activation of a TCF/LEF luciferase reporter construct (TOPflash) or a control reporter (FOPflash). Epithelial cells were exposed to conditioned medium (CM) from PSC27 prostate fibroblasts expressing WNT16B (PSC27WNT16B) or control vector (PSC27C). Data are mean ± s.e.m. of triplicates, and P values were determined by ANOVA followed by t test. Figure 7B. qPvT-PCR assessment of the expression of β-catenin target genes in prostate cancer cell lines (BPH1, Ml 2 and PC3) before and 72 h after exposure to PSC27WNT16B-conditioned medium. Data represent the mean ± s.e.m. fold change after as compared to before exposure for three replicates. Figure 7C. Expression of β-catenin target genes in human prostate cancers in vivo after neoadjuvant treatment with MIT and DOC. Log2 transcript amounts in carcinoma cells after and before chemotherapy are shown in relation to low or high WNT16B expression in the prostate stroma. Each data point represents an individual patient; n = 8 patients. Horizontal bars are group means. * < 0.05, **P < 0.01 by ANOVA followed by t test. Figure 7D. The β-catenin pathway inhibitor XAV939 suppresses the proliferation of prostate cancer cells in response to psC27WNT16B CM and attenuates the response to the full DDSP in PSC27-RAD- conditioned medium. Cell numbers were determined 72 hours after treatment. Figure 7E. Quantification of transcripts in neoplastic prostate epithelial cells encoding proteins associated with a phenotype of EMT. Measurements are from epithelial cells exposed to control media (DMEM), media conditioned by PSC27 fibroblasts (PSC27C) or PSC27 fibroblasts expressing WNT16B (PSC27WNT16B). E-cad, E-cadherin; N-cad, N-cadherin. Figure 7F. Analysis of EMT-associated protein expression by Western Blot. Ml 2 or PC3 cells were exposed to control media, media conditioned by PSC27 fibroblasts (PSC27C), PSC27 fibroblasts expressing WNT16B (PSC27WNT16B) or PSC27 fibroblasts expressing WNT16B and shRNA targeting WNT16B (psC27shRNA"WNT16B). Figure 7G. Chromatin immunoprecipitation assays identified NF-κΒ binding sites within the proximal promoter of the WNT16 gene. PCR reaction products from Mock (no DNA loading), NF-κΒ immunoprecipitation, input control DNA and no antibody (Ab) control before treatment (Pre) and after irradiation (Rad). pi, p2 and p3 indicate primer pairs corresponding to putative NF-κΒ binding regions in WNT16, IL-6 and IL-8, respectively (see Example for the primer sequences). Figure 7H. Analysis of WNT16B transcript expression by qRT-PCR in PSC27 prostate fibroblasts with (PSC27lKBa) or without (PSC27C) inhibition of NF-κΒ signaling before and after DNA-damaging exposures. Figure 71. Inhibition of NF-κΒ signaling in fibroblasts responding to DNA damage attenuates the effect of the DDSP on tumor cell proliferation. Cell numbers were determined 72 h after RAD exposure to conditioned medium from fibroblasts with (PSC27lKBa) or without (PSC27C) inhibition of NF-κΒ signaling. Data in Figure 7D, Figure 7E, Figure 7H and Figure 71 are mean ± s.e.m. of triplicates, and P values were determined by ANOVA followed by t test.
Figures 8 A through 8D demonstrate that paracrine WNT16B induces a mesenchymal phenotype in vivo. Figure 8 A. Immunohistochemical assessment of WNT16B and β-catenin expression in human prostate cancers with and without exposure to chemotherapy. Arrows in β-catenin panels show minimal staining in cancer glands that is localized to the cytoplasm or plasma membrane in untreated tissues with intense nuclear localization in carcinoma cells following chemotherapy treatment. Figure 8B. The β-catenin pathway inhibitor XAV939 suppresses the invasion of prostate cancer cells in response to fibroblast WNT16B and attenuates the response to the full DNA damage secretory program. Cell numbers were determined after 24 h of treatment. Figures 8C and 8D. Western immunoblot analysis of proteins associated with an epithelial to mesenchymal transition. BPHl and PC3 prostate (Figure 8C), MDA MD-231 breast (Figure 8(d)) and SKOV3 ovarian (Figure 8D) epithelial cells were treated with conditioned medium from prostate (PSC), breast (HBF) or ovarian (OVF) fibroblasts expressing a vector control (PSC27C), WNT16B (PSC27WNT16B), WNT16B with WNT16B-specific shRNAs, or WNT16B fibroblast conditioned medium with the β- catenin pathway inhibitor XAV939.
Figures 9 A through 9E demonstrate that WNT16B expression is regulated by NFkB. Figure 9 A. Analysis of NFKB regulatory regions in the WNT16B promoter by site-directed mutagenesis. (Left) WNT16B promoter constructs for each of the 10 putative NFKB binding sites in the WNT16B promoter, denoted by -181 through -3838 bp upstream of the transcriptions start site. Black boxes = wild type sequence; White boxes = mutated NFKB binding sites. (Right) Corresponding WNT16B promoter activity with and without γ-irradiation in HEK293 cells. Data are mean ± s.d., of normalized luciferase signals (n=3). WNT16B and NFkB promoter reporter assays with genotoxic stress Figure 9B and TNF-a Figure 9C. Multiple NFkB binding sites maximize WNT16B promoter activity in prostate fibroblasts following irradiation or exposure to TNF-a. Constructs shown in Figure 9A were used in assays of PSC27 fibroblasts. NATl l-Luc2CP is a NFKB promoter positive control construct. Figure 9D. Analysis of NFKB activity following genotoxic stress with mitoxantrone or irradiation. Figure 9E. ΙκΒα expression in PSC27 fibroblasts suppresses DNA damage-induced NFKB activation. Analysis of nuclear translocation of NFKB protein in prostate fibroblasts following irradiation with and without expression of mutant ΙκΒα (PSC27IKB(X). Pre = prior to irradiation; RAD = 72 h post-irradiation, β-actin and Histone HI represent resident cytoplasmic and nuclear protein controls, respectively.
Figures 10A through 10E demonstrates that paracrine-acting WNT16B promotes the resistance of prostate carcinoma to cytotoxic chemotherapy. Figure 10A. Viability of prostate cancer cells 3 d after treatment with a half-maximal inhibitory concentration (IC50 ) of MIT and medium conditioned by fibroblasts with (PSC27WNT16B) or without (PSC27C) WNT16B. Figure 10B. Bright field microscopic view of PC3 cells cultured with control or PSC27WNT16B-conditioned medium photographed 24 h after exposure to vehicle or the IC50 of MIT. Arrowheads denote apoptotic cell bodies. Scale bars, 50 μιη.
Figure I OC. Acute tumor cell responses to chemotherapy in vitro. Quantification of apoptosis by assays reflecting combined caspase 3 and 7 activity measured 24 h after the exposure of PC3 cells to vehicle or the IC50 of MIT. Data in a and c are mean ± s.e.m. of triplicate experiments, and P values were determined by ANOVA followed by t test. RLU, relative luciferase unit. Figure 10D. In vivo responses of PC3 tumors to MIT chemotherapy. Grafts were comprised of PC3 cells alone or PC3 cells combined with either PSC27 prostate fibroblasts expressing a control vector (PC3+PSC27C) or PSC27 prostate fibroblasts expressing WNT16B (PC3+PSC27WNT16B). MIT was administered every 2 weeks for three cycles, and grafts were harvested and tumor volumes determined 1 week after the final MIT treatment. Each data point represents an individual xenograft. Horizontal lines are group means of ten tumors, with P values determined by ANOVA followed by t test. Figure 10E. Acute tumor cell responses to chemotherapy in vivo. Quantification of apoptosis by cleaved caspase 3 (C-caspase 3) IHC and of DNA damage by γ-Η2ΑΧ immunofluorescence in PC3 and fibroblast xenografts measured 24 h after in vivo treatment with vehicle (C) or MIT. Values represent a minimum of 100 cells counted from each of 3-5 tumors per group. Data are mean ± s.e.m., and P values were determined by ANOVA followed by t test.
Figure 11A through 11C demonstrate the modulation of chemotherapy resistance by paracrine WNT16B. Figure 11 A. Viability of prostate cancer cells across a range of mitoxantrone concentrations with (PSC27WNT16B) or without (PSC27C) WNT16B in fibroblast conditioned medium. Non-linear regression curves were calculated and plotted using GraphPad Prism. Figure 11B. Acute viability assays of epithelial cells following 12 h of exposure to IC50 concentrations of mitoxantrone and conditioned medium from
PSC27 fibroblasts expressing a control vector (PSC27C) or WNT16B (PSC27WNT16B). Figure 11C. Tumor volumes of subrenal capsule grafts comprised of MDA-MB-231 breast carcinoma cells in combination breast fibroblasts (HBF1203) expressing a control vector (HBF1203C) or WNT16B (HBF1023WNT16B) with or without treatment with three cycles of mitoxantrone (MIT). Tumor grafts were harvested one week after the 3rd cycle of treatment. Depicted are typical grafts from each treatment group with tumor masses outlined by green dashed line. Each datapoint represents the volume of a tumor resected from an individual mouse.
Figures 12A through 12G. Chemotherapy resistance promoted by damaged fibroblasts is attenuated by blocking WNT16B, β-catenin or NF-κΒ signaling. Figure 12 A. Viability of prostate cancer cells across a range of MIT concentrations with (PSC27-RAD+shRNAWNT16B) or without (PSC27-RAD+shRNAC) the suppression of WNT16B in irradiated-fibroblast-conditioned medium or with the addition of the β-catenin pathway inhibitor XAV939. Data are mean ± s.e.m. of triplicates. Figure 12B. Viability of prostate cancer cells 3 days after treatment with two times the IC50 of MIT in the context of conditioned medium from irradiated prostate fibroblasts (PSC27-RAD) expressing shRNAs targeting and suppressing WNT16B (shRNAWNT166), a vector control (shRNAc) or combined with the β-catenin pathway inhibitor XAV939. Figure 12C. Viability of prostate cancer cells 3 days after treatment with the IC50 of MIT in the context of conditioned medium from prostate fibroblasts pretreated with radiation (PSC27-RAD) or MIT (PSC27-MIT) and with (PSC27lKBa) or without (PSC27C) the suppression of NF-κΒ signaling. Figure 12D. Acute tumor cell responses to chemotherapy in vitro. Quantification of apoptosis by caspase 3 and 7 activity measured 24 hours after the exposure of PC3 cells to vehicle or the IC50 of MIT. Data for Figure
12B, Figure 12C and Figure 12D are mean ± s.e.m. of triplicates, and P values were determined by ANOVA followed by t test. Figures 12E and 12F. In vivo effects of MIT chemotherapy in the context of suppressing the induction of the expression of fibroblast WNT16B. Tumors comprised PC3 cells in combination with irradiated (PSC27-RAD) fibroblasts, Figure 12E, or unirradiated (PSC27C), Figure 12F, prostate fibroblasts expressing shRNAs targeting WNT16B (shRNAWNT1*®) or a vector control (shRNAc). MIT was administered every 2 weeks for three cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each data point represents an individual xenograft. Tumor volumes of PSC27c+shRNAc grafts in Figure 12F averaged 20 mm3, and tumor volumes of PSC27c+shRNAWNT16B grafts averaged 12 mm3 (P < 0.001). Horizontal lines are group means, with n = 8. P values were determined by ANOVA followed by t test. The bracket boundaries in f are the group means for PSC27c+shRNAc grafts compared to PSC27c+shRNAWNT16B grafts showing a 40% difference in size. Figure 12G. Model for cell non-autonomous therapy-resistance effects originating in the tumor microenvironment in response to genotoxic cancer therapeutics. The initial round of therapy engages an apoptotic or senescence response in subsets of tumor cells and activates a DNA damage response (DDR) in DDR-competent benign cells (+DDR) comprising the tumor microenvironment. The DDR includes a spectrum of autocrine- and paracrine-acting proteins that are capable of reinforcing a senescent phenotype in benign cells and promoting tumor repopulation through progrowth signaling pathways in neoplastic cells. Paracrine-acting secretory components such as WNT16B also promote resistance to subsequent cycles of cytotoxic therapy. CEC, cancer epithelial cell; BEC, benign epithelial cell; FC, fibroblast cell.; -DDR, DDR-incompetent benign cells. Figure 13A through 13D demonstrate prostate, breast and ovarian carcinoma therapy resistance promoted by damaged fibroblasts is attenuated by blocking WNT16B or β-catenin signaling. Figure 13 A. Viability assays of prostate carcinoma cells exposed to prostate fibroblast conditioned medium and mitoxantrone chemotherapy. Epithelial cells were treated with IC50 concentrations of mitoxantrone in conditioned medium from irradiated PSC27 (PSC27C-RAD) prostate fibroblasts expressing a control shR A or WNT16B-specific shR As and irradiated, or with the addition of the β-catenin pathway inhibitor XAV939. Epithelial viability was determined by trypan blue counting of cells 72 hours after chemotherapy. Bars represent means of 3 replicate experiments. Figure 13B. Viability assays of breast and ovarian carcinoma cells exposed to fibroblast conditioned medium and mitoxantrone chemotherapy. Epithelial cells were treated with IC50 concentrations of mitoxantrone in conditioned medium from irradiated breast or ovarian fibroblasts expressing a control shRNA or WNT16B-specific shRNAs and irradiated, or with the addition of the β-catenin pathway inhibitor XAV939. Epithelial viability was determined by trypan blue counting of cells 72 hours after chemotherapy. Bars represent means of three replicate experiments. Figure 13C. In vivo effects of WNT16B on breast tumor responses to mitoxantrone chemotherapy. Tumors comprised MDAMB-231 cells in combination with irradiated breast (HBF 1203 -RAD) fibroblasts expressing short hairpin RNAs targeting WNT16B or a vector control. Mitoxantrone was administered every 2 weeks for 3 cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each datapoint represents an individual xenograft. Figure 13D. In vivo effects of mitoxantrone chemotherapy in the context of suppressing the induction of fibroblast WNT16B. Tumors comprised PC3 cells in combination with untreated prostate fibroblasts expressing a control vector (PSC27C+shRNAC) or shRNAs targeting WNT16B (PSC27C+shRNAWNT16B). Mitoxantrone was administered every 2 weeks for 3 cycles, and grafts were harvested and tumor volumes determined 1 week after the final treatment. Each data point represents an individual xenograft.
Figure 14. Activation of the Wnt-P-catenin pathway by conditioned media from PSC27 cells, either after ionizing radiation, upon over-expression or knock-down of target genes. Data are mean ± s.e.m. of triplicates, and P values were determined by ANOVA followed by t test. Figure 15. Immunoblots of SFRP2 expression in PSC27 stable cell lines and shRNA silencing efficacy. Samples were loaded to the gel, from left to right: PSC27 vector control ((PSC27C); PSC27 cells expressing SFRP2 (PSC27SFRP2); PSC27SFRP2 cells infected with non-specific shRNA; PSC27SFRP2 cells infected with SFRP2-specific shRNAs (#1 and #2, respectively).
Figure 16. Generation of quiescent cells in culture and cell morphology upon genotoxic treatment. Photographs of cells in proliferation, cells arrested by mitogen withdrawal for 4 days or contact inhibition for about 7 to 10 days. PSC27 cells in either case were exposed to a 10 Gy ionizing radiation, maintained in stromal media for 7 days. Bright field pictures were taken at a magnification of 10X. Photos are representative of three independent experiments.
Figure 17. Experimental model system: proliferating and quiescent cells. Proliferating cells and quiescent cells were incubated with bromodeoxyuridine (BrdU) for 6 hours. Cell nuclei were labeled with an anti-BrdU antibody and propidium iodide, and analyzed by FACS. DNA content was plotted along the x-axis, and BrdU intensity was plotted along the y axis. Percentage of cells that incorporated BrdU into their nuclei during the incubation is indicated in each case. Data are representative of three independent experiments.
Figure 18. Genotoxic influence on expression of senescence and proliferation- related genes in pre-senescent or quiescent PSC27 cells. Designation: N, untreated or pre-senescent cells; Q, quiescent cells; Q+R, quiescent cells exposed to ionizing radiation; Q+R+P, quiescent cells exposed to ionizing radiation, allowed to stay for 7-10 days, and released into larger vessels or sub-cultured into multiple flasks to allow resumed proliferation; R, proliferative PSC27 cells treated by ionizing radiation; Q+M, quiescent cells subject to Mitoxantrone (MIT) treatment in culture; Q+M+P, quiescent cells exposed to Mitoxantrone treatment, allowed to stay for 7 to 10 days, and released into larger vessels or subcultured into multiple flasks to allow resumed proliferation; M, proliferative PSC27 cells treated by Mitoxantrone in culture.
Figure 19. Senescence associate β-Gal staining of prostate fibroblasts and senescence of quiescent cells. PSC27 cells were either untreated or treated by lOGy radiation, processed for typical senescence associated β-Gal staining. For each case, cells were stained for 12 hours under culture conditions, and the photos are representative of three independent experiments. Figure 20. Characterization of DNA damage response by immunofluorescence staining on DNA double strand lesions. PSC27 fibroblasts on coverslips were rinsed, subjected to fixation in 4% paraformaldehyde and permeabilization with 0.1% Triton- XI 00 prior to immunostaining. Primary mouse monoclonal anti-phospho-Histone H2A.X (Serl39) (clone JBW301) and secondary antibody conjugated with Alexa Fluor® 488 (or 594) were sequentially applied. Nuclei were counterstained with DAPI and coverslips were mounted onto glass slides. Upon visual examination of the DNA damage extent with immunofluorescence microscopy, DDR foci were recorded with a 4-category counting strategy, namely 4 classes: 0 foci, 1 to about 3 foci, 4 to about 10 foci, and > 10 foci as above in Example 1. Data from each cell line/treatment were averaged from a pool of 3 independent fields counting 100 nuclei per pool. P values are calculated by student's t test.
Figure 21. Microarray patterns of gene expression in growing cells and cells arrested upon contact inhibition under the culture conditions.
Figures 22A through 22C. Induced GDNF expression in PSC27 cells upon DNA damage. Figure 22A demonstrates gene expression microarray data of GDNF in human prostate stromal cells treated with hydrogen peroxide (H202), bleomycin (bleo) and irradiation (Rad) on a log scale. Figure 22B shows qPCR data showing up-regulation of GDNF after irradiation between 6 and 16 days post treatment. Figure 22C shows qPCR data showing up-regulation of GDNF after mitoxantrone treatment between days 17 and 15.
Figures 23A and 23B show that prostate cancer cell lines respond to GDNF stimulation and activate Src and Erk pathways. Figure 23A. CaP cell expressiong GDNF receptors Ret and/or GFRAl (top row) show increased proliferation upon GDNF stimulation in vitro with a maximum stimulation around 10 ng/ml GDNF in the culture medium (p < 0.001) whereas Ret and GFRAl negative cell (bottom ros) do not show any differences in proliferation after 3 or 5 days. Figure 23B. GDNF responsive cells show activation of the Src and the Erk pathways upon GDNF stimulation.
Figures 24A through 24C show human primary prostate stromal cells PSC27 over-expressing GDNF. PSC27 cell transduced with GDNF-V5 expression construct. Figure 23A shows GDNF-V5 expression and secretion to the conditioned medium analyzed by Western Blot. Figure 24B. ELISA measurement of GDNF secreted into the culture medium after 72 hours. Figure 24C. GDNF expression in transduced PSC27 cell lysates measured by ELISA with normalized input of 62.5 μ§/ι 1 total protein starting concentration.
Figure 25. GDNF induces mitotic signaling in human stromal cells PSC27. Human primary prostate fibroblast cell stimulated with human recombinant GDNF or conditioned medium from GDNF over-expressing cells show activation of the Ras/Raf/Erk and the SFK pathways, similar to the response in epithelial cancer cells.
Figure 26. GDNF induction upon DNA damage is mTOR dependent. Up- regulation of GDNF upon DNA damage is reduce when mTOR activity is blocked by rapalogs. Gene expression data from microarray comparing GDNF mRNA levels post irradiation (IR), after rapalog treatment and after irradiation and rapalog treatment, (lines: mean with SEM).
DETAILED DESCRIPTION
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs.
The present disclosure provides methods for the identification of proteins secreted into a tumor microenvironment in response to a genotoxic stress. Certain of these proteins have been found to attenuate the effects of cytotoxic therapy in vivo, promoting tumor cell survival and disease progression, herein collectively the polypeptides or proteins are termed DNA damage secretory program (DDSP) proteins. The methods include assessing for treatment-induced damage response in benign cells comprising the tumor microenvironment. The methods compare the changes in expression of the DDSP polypeptide or protein before and after tumor therapy, such as chemotherapy or radiation therapy, in benign cells, such as, for example, fibroblasts, smooth muscle cells, and the like. In an another embodiment the level of one or more of the DDSP polypeptides or proteins can be used to determine the effectiveness of the administered genotoxic agent or the prognosis for the cancer.
Expression of DNA damage secretory program proteins (DDSP proteins) can be reflected in the transcriptional activity of the cell (i.e., transcriptional state), in addition to the amount of protein translated from the resulting mRNA molecules (i.e., translational state). Therefore, the level of DDSP proteins in the subject can be determined at the nucleic acid or protein levels. The transcriptional state of DDSP proteins can be conveniently determined by measuring transcript abundance by any of several existing gene expression technologies that are well-known in the art. The translational state includes the identities and abundance of the constituent polypeptide species in the sample generated by the ribosomal machinery using the mR A template described above. The translational state, i.e., level of constituent DDSP proteins, can also be conveniently determined by various technologies that are well-known in the art.
In a particular method, primary tissues can be collected from patients before and after a genotoxic treatment. The treatment can be, for example, chemotherapy, radiation therapy, or a combination thereof. R A transcripts from the samples can be collected by any method well known in the art. A comparison of the RNA transcripts from the patient samples collected before and after treatment can then be carried out by any standard method, such as, for example, whole-genome microarray analysis. One specific embodiment of this particular method is set forth in the examples herein.
Of particular interest in the present disclosure are proteins and factors with clear paracrine effects on tumor cells, and specifically genes with at least 3.5-fold elevated expression in the primary tissues after the genotoxic treatment that encode extracellular proteins (DNA damage secretory program proteins). The DDSP proteins from prostate tissue can include, for example, and not by limitation, matrix metallopeptidase 1 (interstitial collagenase) (MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMPl 2), serine peptidase inhibitor (Kazal type 1) (SPINK 1), matrix metallopeptidase 10 (stromelysin 2) (MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT), cheokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecustokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFPl), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINI1), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), interleukin 23, alpha subunit pl9 (IL23A), and the like. See Figure 1. A similar spectrum of secreted proteins can be identified for other tissues. Some of the proteins identified can be either the same or different from those identified above.
In one embodiment, a PCR method such as a quantitative RT PCR (qRT PCR or qPCR), can be used to compare specifically identified DDSP protein mRNA levels between treated and untreated samples, and thus determine the difference in a DDSP protein gene expression level. As one example herein, the level of WNT16B was determined. In one illustrative technique, for which there are commercially available kits such as Taqman® (Perkin Elmer, Foster City, CA), qPCR is performed with a transcript-specific antisense probe. A PCR is prepared with a quencher and fluorescent reporter probe complexed to the 5' end of the oligonucleotide. When Taq DNA polymerase is activated, it cleaves off the fluorescent reporters of the probe bound to the template by virtue of its 5' to 3' exonuclease activity. In the absence of the quenchers, the reporters now fluoresce providing a quantifiable signal to ascertain template abundance at every round of amplification. An alternative technique is to use an intercalating dye such as the commercially available QuantiTect™ SYBR® Green PCR (Qiagen, Valencia, CA). RT-PCR is performed using SYBR® green as a fluorescent label which is incorporated into the PCR product during the PCR stage and produces a fluorescence proportional to the amount of PCR product.
In another embodiment, nuclease protection assays (including both ribonuclease protection assays and SI nuclease assays) can be used to detect and quantitate an identified DDSP protein mRNA level. In nuclease protection assays, an antisense probe (labeled with, e.g., radiolabeled or nonisotopic label) hybridizes in solution to an RNA sample. Following hybridization, single-stranded, unhybridized probe and RNA are degraded by nucleases. An acrylamide gel is used to separate the remaining protected fragments. Typically, solution hybridization is more efficient than membrane-based hybridization, and it can accommodate up to 100 μg of sample RNA, compared with the 20-30 μg maximum of blot hybridizations. The ribonuclease protection assay, which is the most common type of nuclease protection assay, requires the use of RNA probes. Oligonucleotides and other single-stranded DNA probes can only be used in assays containing SI nuclease. The single-stranded, antisense probe must typically be completely homologous to the target RNA to prevent cleavage of the probe-target hybrid by the nuclease. For instance, the antisense probe can correspond to any section of the WNT16B mRNA sequence.
In another embodiment, standard Northern blot assays are used to detect and ascertain the relative amounts of RNA, such as mRNA, in a sample according to conventional Northern hybridization techniques known in the art. Briefly, RNA samples are obtained and separated by size via electrophoresis. The RNA is transferred to a membrane, crosslinked and hybridized with a labeled probe that hybridizes specifically to the target mRNA under defined hybridization conditions. The probe can be labeled by any of the many different methods known to those skilled in this art. The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, and others.
In additional embodiments, RNA need not be extracted from the sample. For example, fluorescent in situ hybridization can be used to determine the presence, relative quantity, and spatial distribution of target mRNA in a cell. In an illustrative example, Single Molecule RNA FISH (Biosearch Technologies, Novato, CA) uses multiple short, singly-labeled oligonucleotide probes complementary to distinct portions of the target sequence. When each probe binds to the single stranded mRNA template, it causes cooperative unwinding of the mRNA, promoting the binding of the additional probes. The net result is the binding of a large multitude of fluorescent labels to a single molecule of mRNA template, providing sufficient fluorescence to reliably locate each target mRNA in a wide-field fluorescent microscopy image.
In additional embodiments, the gene expression level can be determined by assessing the translational state of an identified DDSP gene. In these embodiments, standard techniques can be used for determining the amount of the DDSP polypeptide or protein present in a sample. For example, immunoassays such as Western blot involve immunoprecipitation of protein from a sample according to methods well-known in the art. This is followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of the protein sample. After separation of the proteins, immunocytochemistry and the like can be used to determine the amount of the protein or proteins of interest present in a sample. A typical agent for detecting a protein of interest is a detectable antibody, or fragment thereof, capable of binding to the protein of interest.
In another embodiment, antibodies, or fragments thereof, can be employed to detect levels of in identified DDSP polypeptide, including splice variant isoforms, in a sample by techniques such as with an enzyme-linked immunosorbent assay (ELISA). Briefly, an antibody or fragment thereof that specifically binds to a portion of the DDSP polypeptide or protein is immobilized on a solid substrate. The sample is contacted to the solid substrate and any DDSP polypeptides or proteins present in the sample are permitted to bind to the immobilized (capture) antibody. A second antibody that also binds to the DDSP polypeptide or protein is also contacted with the biological sample and/or solid substrate and permitted to bind to the OPN polypeptide. The second antibody usually comprises a detectable label or signal. The label can be detected directly, or it may be a component of a signal-generating system, which are well-known in the art. The level of the DDSP polypeptide or protein is determined by assaying the detectable signal after the solid substrate has been rinsed of unbound sample and antibody.
Additionally, antibodies, or fragments thereof, can be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of a protein of interest. In situ detection can be accomplished by obtaining a histological specimen {e.g., a biopsy specimen or immobilized cell culture) and applying thereto a labeled antibody that is directed to the target protein. The antibody (or fragment) is preferably applied onto a biological sample, such as liver cells from a section or biopsy. Through the use of such a procedure, it is possible to determine not only the presence of the protein of interest, but also its distribution, and/or its presence in lymphocytes within the sample. A wide variety of well-known histological methods (such as staining procedures) can be utilized in order to achieve such in situ detection.
Antibodies can be generated utilizing standard techniques well known to those of skill in the art. Such antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or an antibody fragment {e.g., Fab or F(ab')2), that specifically binds to a portion of the DDSP polypeptide or protein can be used. A wide variety of known signaling mechanisms are available for the described immunoassays. To illustrate, an enzyme bound to the antibody will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means. The detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection can also be accomplished by radioactively labeling the antibodies or antibody fragments, and detecting the protein of interest through the use of a radioimmunoassay. It is also possible to label the antibody with a fluorescent compound which fluoresces upon stimulation by light of a proper wavelength. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde fluorescamine, and the like.
Once the DDSP gene has been identified and the polypeptide or protein expressed by the gene recognized. An agent as used in the present disclosure is a molecule that inhibits the expression of the identified DDSP gene or inhibits the activity of the polypeptide or protein expressed by the identified DDSP gene. The identified agent can be, for example, an antibody that specifically binds to and inactivates the DDSP polypeptide or protein, a polynucleotide that inhibits the expression of the identified DDSP gene, or any protein or small molecule that blocks the activity of the identified DDSP polypeptide or protein or a pathway modulated by the identified DDSP polypeptide or protein that promotes genotoxic therapy resistance.
In one aspect the agent that inhibits the activity of the identified DDSP is an antisense nucleic acid capable of inhibiting transcription of the DDSP gene or translation of the corresponding messenger R A. The antisense nucleic acid can comprise all or part of the sequence of the DDSP gene, or of a sequence that is complementary thereto. The antisense sequence can be a DNA, an RNA (e.g., siRNA), a ribozyme, and the like. It may be single-stranded or double stranded. It can also be a RNA encoded by an antisense gene. When an antisense nucleic acid comprising part of the sequence of the gene or messenger RNA under consideration is being used, it is preferred to use a part comprising at least 10 consecutive bases from the sequence, more preferably at least 15, in order to ensure specific hybridization. In the case of an antisense oligonucleotide, it typically comprises less than 100 bases, for example in the order of 10 to 50 bases. This oligonucleotide can be modified to improve its stability, its nuclease resistance, its cell penetration, and the like. Perfect complementarity between the sequence of the antisense molecule and that of the target gene or messenger RNA is not required, but is generally preferred.
According to another embodiment, the inhibitor compound is a polypeptide. It can be, for example, a peptide comprising a region of the DDSP polypeptide or protein, and capable of antagonizing its activity. A peptide advantageously comprises from 5 to 50 consecutive amino acids of the primary sequence of the identified DDSP polypeptide or protein, typically from 7 to 40. The polypeptide can also be an antibody that specifically binds the identified DDSP polypeptide or protein, or a fragment or derivative of such an antibody, for example a Fab fragment, a CDR region, or, more preferably, a single chain antibody (e.g., a scFv). Single chain antibodies are particularly advantageous insofar as they can act in a specific and intracellular fashion to modulate the activity of a target protein. Such antibodies, fragments, or derivatives can be produced by conventional techniques comprising immunizing an animal and recovering the serum (polyclonal) or spleen cells (in order to produce a hybridoma by fusion with appropriate cell lines).
Methods for producing polyclonal antibodies in various species are described in the prior art. Typically, the antigen, the identified DDSP polypeptide or protein, or a portion thereof, is combined with an adjuvant (e.g., Freund's adjuvant) and administered to an animal, typically by subcutaneous injection. Repeated injections can be performed. Blood samples are collected and the immunoglobulin or serum is separated. Conventional methods for producing monoclonal antibodies comprise immunizing of an animal with an antigen, followed by recovery of spleen cells, which are then fused with immortalized cells, such as myeloma cells. The resulting hybridomas produce monoclonal antibodies and can be selected by limiting dilution in order to isolate individual clones. Fab or F(ab')2 fragments can be produced by protease digestion, according to conventional techniques.
According to another embodiment, the inhibitor is a chemical compound, of natural or synthetic origin, particularly an organic or inorganic molecule, capable of modulating the expression or the activity of the identified DDSP polypeptide or protein.
In another embodiment of the present disclosure provides for the administration to a subject of a therapeutically effective amount of an agent that inhibits the activity of the identified DDSP polypeptide or protein as an adjuvant to a cancer therapy. The agent of the present disclosure can be administered as a pharmaceutical composition comprising a therapeutically effective amount of the inhibitory agent together with a pharmaceutically acceptable carrier. In the context of the present disclosure, a "therapeutically effective amount" is understood as the amount of an agent inhibiting the expression and/or activity of an identified DDPS polypeptide or protein of interest that is necessary to achieve the desired effect which, in this specific case, is the increase in the effectiveness of a genotoxic therapy. Generally, the therapeutically effective amount of the inhibitory agent according to the present disclosure to be administered will depend, among other factors, on the individual to be treated, on the severity of the disease said individual suffers, on the chosen dosage form, and the like. For this reason, the doses mentioned in the present disclosure must be considered only as a guideline for the person skilled in the art, and the latter must adjust the doses according to the previously mentioned variables. Nevertheless, an inhibitory agent according to the present disclosure can be administered one or more times a day, for example, 1 , 2, 3 or 4 times a day, in a typical total daily amount comprised between 0.1 and 1000 mg/kg body mass/day, preferably 10 mg/kg body mass/day. In the context of the present disclosure, the term "treatment" or "treating" means the administration of an inhibitory agent according to the disclosure to effectively decrease the expression of activity of the DDPS polypeptide or protein of interest such that it no longer promotes resistance to a genotoxic therapy.
The subject can be a human or non-human animal, a vertebrate, and is typically an animal, including but not limited to, cows, pigs, horses, chickens, cats, dogs, and the like. More typically, the subject is a mammal, and in a particular embodiment, human.
Various delivery systems are well known to the skilled artisan and can be used to administer the inhibitory agent, such as, for example, by infusion, injection (e.g., intradermal, intramuscular or intraperitoneal), oral delivery, nasal delivery, intrapulmonary delivery, rectal delivery, transdermal delivery, interstitial delivery or subcutaneous delivery. In a specific embodiment, it can be desirable to administer the inhibitory agent locally to the area in need of treatment, e.g., the tumor bed, into the tumor, and the like; this administration can be achieved by, for example, and not by way of limitation, local infusion, topical application, by injection (e.g., intra-testicular or intra- prostatic), by means of a catheter, or by means of an implant, the implant being for example, a porous, non-porous, gelatinous or polymeric material, including membranes such as silastic membranes or fibers. In one embodiment, administration can be by direct injection at the target site, for example, into a tumor. Pharmaceutical compositions containing the inhibitory agent can be formulated according to the desired delivery system. Such pharmaceutical compositions typically comprise a therapeutically effective amount of the inhibitory agent and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in vertebrates, typically animals, and more typically in humans. The term "carrier" refers to a diluent, adjuvant, excipient, stabilizer, preservative, viscogen, or vehicle with which the inhibitory agent is formulated for administration. Pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, ethanol, and the like. The composition, if desired, can also contain minor amounts of a wetting or emulsifying agent, or a pH buffering agent.
Suitable preservatives include, for example, sodium benzoate, quaternary ammonium salts, sodium azide, methyl paraben, propyl paraben, sorbic acid, ascorbylpalmitate, butylated hydroxyanisole, butylated hydroxytoluene, chlorobutanol, dehydroacetic acid, ethylenediamine, potassium benzoate, potassium metabisulfite, potassium sorbate, sodium bisulfite, sulfur dioxide, organic mercurial salts, phenol and ascorbic acid. Suitable viscogens include, for example, carboxymethylcellulose, sorbitol, dextrose, and polyethylene glycols. Other examples of suitable pharmaceutical carriers are described in, for example, Remington's Pharmaceutical Sciences (Gennaro (ed.), Mack Publishing Co., Easton, Pennsylvania (1990)).
The selected inhibitory agent can also be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, and the like, and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2- ethylamino ethanol, histidine, procaine, and the like.
In one embodiment, the selected inhibitory agent can be formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. For intravenous delivery, water is a typical carrier. Saline, aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition can also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
Orally deliverable compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
The inhibitory agent can also be formulated for other methods of delivery using well known formulations. These can included, but are not limited to, intranasal, rectal, intrathecal, controlled release systems, and the like. Controlled release systems can include, pumps, gels, skin patches, and the like.
The following examples are merely illustrative and should not be construed to limit the invention.
EXAMPLES
Example 1
The present example provides methods and determines those DDSP proteins increased by at least 3.5-fold in response to a genotoxic agent. Further, the example provides confirmation of the effectiveness of inhibiting the activity of one of those DDSP proteins, Wntl6B, in increasing the effectiveness of a cancer therapeutic agent.
EXPERIMENTAL PROCEDURES
Cell lines and cultures. Cells of a primary normal human prostate fibroblast strain, PCS27, were cultured in prostate stromal cell (PSC) complete medium as described previously (Bavik et al. Cancer Res. 66:794-802, 2006). Human prostate epithelial cell lines DU145, PC3 and LNCaP were from American Type Culture Collection (ATCC, Manassas, VA) and routinely subcultured under RPMI 1640 with 5% fetal bovine serum (FBS) conditions as recommended by the vendor. The prostatic epithelial line BPH1 was kindly provided by Dr. Simon Hayward and was derived from nonmalignant prostatic tissue with benign hyperplasia, immortalized by SV40-LT antigen, and cultured as previously described (Hayward et al, In vitro Cell Dev. Biol. Anim. 31 : 14-24, 1995). The neoplastic metastatic M12 human prostate epithelial cell line was provided by Dr. Joy Ware and maintained as previously described (Bae, et al., Prostate 34:275-282, 1998). BPH1 and M12 cells were transfected with a plasmid pIRES2-GFP, with cells passaged and subsequently flow-sorted in a FACSVantage. Cancer lines from other human cancer types including lung (A549), colon (HCT116), breast (MDA-MB-231, T47D), cervix (HeLa) and ovary (SKOV3, OVCAR3) were obtained from ATCC and cultured according to supplied instructions.
Establishment of primary fibroblast lines. Fresh human breast and ovarian tissues were acquired through Institutional Review Board-approved collection protocols from discarded surgical specimens. Tissue samples were washed in sterile PBS and gently agitated in RPMI/10 % Fetal Bovine Serum media, with 1000 U/ml collagenase type IA. Samples were placed on the lid of a 100-mm tissue culture dish and dissected into small (2 to 3 mm) squares, and 5 to 10 tissue pieces were placed in the center of a 35-mm tissue culture dish or 6-well plate. A sterile 22-mm glass covers lip was placed gently over the tissue specimens, forming a sandwich. A few drops of 4°C complete growth medium
(DMEM or RPMI) was added under the covers lip. The culture was placed in a humidified 37 °C, 5 % C02 incubator, with fibroblast outgrowth checked every 3 to 4 days under an inverted phase-contrast microscope, and growth medium was changed after each assessment. Upon confluent growth, the coverslips were removed and the dish (or well) was washed twice with 4 °C PBS. Trypsin/EDTA (0.25%) was used to detach cells and fibroblasts were collected by centrifugation for 10 min at 150 x g, 4 °C in a 15-ml polypropylene centrifuge tube. About 3 to 10 x 104 viable cells were placed in 5 ml of fresh complete growth medium in a T25 flask. Cells attached to the new flask within 2 to 3 hour and began to exhibit the characteristic spindle shape within 24 hour. Medium was changed every 3 to 4 days until the culture was confluent, and fibroblasts were passaged two additional times following the procedure described above. To confirm the fibroblast phenotype and assess culture purity, immunofluorescence staining was used and Western blot analysis with antibodies against vimentin (abeam), smooth muscle a-actin (abeam), E-cadherin (Genetex), CD44 (R&D systems) and cytokeratin 8 (Santa Cruz). The breast fibroblast line was designated HBF1023 and the ovarian fibroblast line was designated OVF28901.
Plasmids and lentiviral infection. Lentiviral agents were produced by transfecting 293FT packaging cells, with virus-containing culture medium harvested and filtered through 0.45-μιη syringe filters 48 to 96 hours post-transfection. PSC27 fibroblasts were infected by exposure to virus-containing medium for 12 to 16 hours, maintained in PSC complete medium, followed by selection in puromycin. For gene-specific silencing with small hairpin RNA (shRNA), the sequences targeting WNT16B gene were cloned in a lentiviral vector pGIPZ (Thermo Scientific). Transfection of 293FT cells and subsequent infection of PSC27 cells were carried out as above, with the interference of target gene expression confirmed by immunofluorescence and immunoblot analysis.
Cell treatments with DNA damaging agents. PSC27 cells were grown until 80
% confluent (PSC27-Pre) and treated with 0.6 mM hydrogen peroxide (PSC27-H202),
100 μg/mL bleomycin (PSC27-BLEO) (Bavik et al, Cancer Res. 66:794-802, 2006), 1 μΜ Mitoxantrone (PSC27-MIT) or ionizing-radiated by a 137Cs source at 743 rad/min
(PSC27-RAD). After treatment, the cells were rinsed 3 times with PBS and left to recover for 3 days in PSC medium.
Immunofluorescence analysis and assessments of DNA-damage foci. Cells growing on covers lips were rinsed, subjected to fixation in 4 % paraformaldehyde and permeabilization with 0.1 % Triton-X100 prior to immunostaining. Primary mouse monoclonal anti-phospho-Histone H2A.X (Serl39) (clone JBW301) and secondary antibody Alexa Fluor® 488 (or 594)-conjugated F(ab')2 goat anti-mouse IgG were sequentially applied. Nuclei were counterstained with 2 μg/ml of 4',6-diamidino-2- phenylindole (DAPI) and coverslips were mounted onto glass slides. Upon visual examination of the DNA damage extent with immunofluorescence microscopy, DDR foci were recorded with a 4-category counting strategy, namely 4 classes: 0 foci, 1 to 3 foci, 4 to 10 foci, and >10 foci. Data from each cell line/treatment were averaged from a pool of 3 independent fields counting 100 nuclei per pool.
Epithelial and fibroblast co-cultures. For direct in vitro co-culture, BPH1-GFP cells were mixed with various proportions of PSC27 cells expressing vector control (PSC27C) or WNT16B (PSC27WNT16B). The cultures were incubated for 3 days after which cells were detached with trypsin and the total cell number was determined by direct counting with hemacytometer. The PSC27/BPH1-GFP proportion was determined on a FACScan using GFP fluorescence as a marker for BPH1-GFP cells. M12-GFP cells were mixed with PSC27 cells and analyzed as above. For indirect co-culture, or culture of prostate epithelial cells with treated (e.g., irradiated), or WNT16-overexpressing fibroblast-conditioned medium, confluent cultures of PSC27 cells were rinsed thrice in PBS and incubated for 3 days in DMEM + 0.5 % FCS. The supernatant was harvested, filtered, concentrated and either stored frozen at - 80°C or applied immediately. BPH1- GFP, PC3 and other cell lines were seeded in conditioned medium or fresh DMEM + 0.5 % FBS, and grown for specific time periods and the total number of cells was determined by direct counting.
Characterization of cell phenotypes. Assays of cell proliferation were performed with the Cell-Titer96® AQU60US One Solution Cell Proliferation Assay (MTS) with signals captured using a 96-well plate reader. Serum-starved cells for trans-well migration and invasion assays were added to the top chambers of Cultrex® 24-well Cell Migration Assay plates (8 μιη size) coated with or without basement membrane extract (BM) prepared as 0.5 X of stock solution. After 12 or 24 hours, migrating or invading cells in the bottom chambers were stained and plate absorbance was recorded. In the two-dimensional in vitro "wound healing" assay, cells were seeded before cell monolayers were incised. Photographs were taken at specific time points with the relative distance traveled by cells at the acellular front measured by microscopy.
Chemoresistance assays were performed using epithelial cells cultured with either DMEM and low serum (0.5 % FCS) (abbreviated as "DMEM"), or conditioned medium (CM) generated from PSC27, GHF1023 or OVF28901 cells expressing vector controls, WNT16B, or siR As. Cells received Mitoxantrone treatment for 12 hours, 1 or 3 days at concentrations near individual cell line's IC50. Cell viability was then assayed, and the percentage of viable cells was calculated by comparing each experiment to vehicle- treated cells. Each assay was repeated a minimum of 3 times with results reported as mean ± s.e.m.
Western Blot analysis. Conditioned Medium (CM) or cell lysates from PSC27 cells exposed to DNA damaging treatments (radiation, Bleomycin, hydrogen peroxide, Mitoxantrone) or vehicle controls were concentrated before SDS-PAGE by trichloroacetic acid (TCA) precipitation as described (Bavik et al., Cancer Res. 66:794- 802, 2006). After drying, the CM samples were dissolved, reduced, and separated on a NuPAGE® 4-12% gel. Primary antibodies were applied to the semi-dry-transferred blots before horseradish peroxidase (HRP)-linked secondary antibodies (Thermo Scientific, Rockford, IL) were used.
Human transcript microarray analysis. Total RNA from experimental samples was isolated using the RNeasy® maxi kit (Qiagen Inc, Valencia, CA), incorporating on- column DNase treatment using the RNase-Free DNase Set (Qiagen Inc, Valencia, CA). To provide a reference standard RNA for use on two-color microarrays, pooled equal amounts were of total RNA isolated from LNCaP, DU145, PC3, and CWR22 cell lines (ATCC) growing at log phase in dye-free RPMI-1640 medium supplemented with 10%> FBS (Invitrogen, Carlsbad, CA) were used. Reference RNA was purified using TRIzol® (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Reference RNA was then further purified by RNeasy® maxi kit incorporating on-column DNAse treatment using the RNase-Free DNase Set. Experimental total RNA samples were amplified one round while the reference RNA was amplified two rounds using the Ambion MessageAmp™ aRNA Kit (Ambion Inc, Austin, TX), incorporating amino-allyl UTP into amplified antisense RNA. Sample quality and quantity were assessed by agarose gel electrophoresis and absorbance at A260 and A280 using the Nanodrop® 1000 spectrophotometer (Thermo Fisher Scientific Wilmington, DE.)
Amplified amino-allyl aRNA (825 ng) from each experimental sample was labeled with Cy3 fluorescent dye (reference amino-allyl aRNA was labeled with Cy5) and hybridized to Agilent 44K whole human genome expression oligonucleotide microarray slides (Agilent Technologies, Inc., Santa Clara, CA) following the manufacturer's suggested protocols. Fluorescence array images were collected for Cy3 and Cy5 using the Agilent DNA microarray scanner G2565BA (Agilent Technologies, Inc., Santa Clara, CA), and Agilent Feature Extraction software was used to grid, extract, and normalize data. Spots of poor quality or average intensity levels < 300 were removed from further analysis. The Significance Analysis of Microarray (SAM) method (Tusher et al, Proc. Natl. Acad. Sci. USA 98:5116-5121, 2001) was used to analyze expression differences between groups. Unpaired, two-sample t tests were calculated for all probes passing filters and controlled for multiple testing by estimation of q- values using the false discovery rate (FDR) method. These results were reduced to unique genes by eliminating all but the highest scoring probe for each gene.
Accession codes. Microarray data are deposited in the Gene Expression Omnibus database with accession code GSE26143.
RNA isolation and quantitative RT-PCR. Cell cultures and human tissue samples were individually homogenized in Trizol (Invitrogen, Carlsbad CA) and total RNA was isolated using the RNeasy® Kit (Qiagen Inc, Valencia, CA). RNA was quantitated in a Gene-Spec III spectrophotometer (Hitachi, Tokyo), and amplified using the MessageAmp™ RNA amplification kit (Ambion). cDNA was generated by a reverse transcription reaction, and quantitative PCR (qRT-PCR) analyses were performed in triplicate using an Applied Biosystems 7700 sequence detector with approximately 5 ng of cDNA, 1 μΜ of designated primer pairs and SYBR Green PCR master mix (Applied Biosystems, Foster City, CA). The mean cycle threshold (Ct) for each gene was normalized to levels of RPL13A in the same sample (delta Ct). Unpaired two sample t- tests were used to determine differences in mean delta Ct's between treatment groups. The fold change was calculated by the delta-delta CT method (fold = 2DDCt). P values < 0.05 were considered significant.
Analyses of human clinical biospecimens. Patients with high-risk localized prostate cancer were enrolled and treated on a phase I— II clinical neoadjuvant chemotherapy trial at the Oregon Health & Science University, Portland VA Medical Center, Kaiser Permanente Northwest Region, Legacy Health System, and University of Washington (Beer et ah, Clin. Cancer Res. 10: 1306-1311, 2004). Patients provided signed informed consent approving the use of their tissues for research purposes. From each patient, prostate biopsies were obtained prior to chemotherapy. At the time of radical prostatectomy following chemotherapy, cancer-containing tissue samples were obtained and snap-frozen in liquid nitrogen. Frozen sections (7 μιη) were cut from OCT blocks, stained with Mayer's hematoxylin, dehydrated in 100% ethanol and xylene, and used for laser-capture microdissection (LCM) using an Arcturus PixCell® He microscope (Arcturus, Mountain View, CA). Stroma, cancerous epithelium, benign epithelium, and stroma from untreated biopsy and post-treated prostatectomy specimens were captured separately and the histology of acquired cells was verified by review of hematoxylin and eosin-stained sections from each sample and review of the LCM images. Samples of breast carcinoma and ovarian carcinoma were collected under IRB- approved protocols. Ovarian and breast cancer specimens were selected based on either no treatment prior to surgical resection or genotoxic chemotherapy (e.g., cisplatin) prior to surgical resection.
Tissue microarrays: Tissue microarrays (TMA's) were constructed using prostates from 2 sets of patients with prostate adenocarcinoma - 50 patients (median age 63 years old; range 62 to 74 y.o.) who received neoadjuvant chemotherapy (Mitoxantrone and docetaxel) prior to radical prostatectomy and 30 patients (median age 61 years old (y.o.); range 45 to 77 y.o.) who had no history of neoadjuvant chemotherapy prior to radical prostatectomy. Details of the neoadjuvant chemotherapy trial have been published. Duplicate cores from each set of radical prostatectomies were used in the TMAs. Carcinoma was confirmed in sections adjacent to those used for WNT16B immunostaining by immunostaining for a basal cell marker. An antibody to basal cell proteins high molecular weight keratins 1, 5, 10 and 14 (a mouse monoclonal antibody raised human stratum corneum; product number MS-1447-R7 clone 34betaE12, Thermo Fisher Scientific) was used in an indirect immunoperoxidase procedure.
Immunohistochemistry: Antibodies to WNT16B (a mouse monoclonal antibody raised against human WNT16B recombinant protein; product number 552595 clone F4- 1582, BD Pharmingen) and anti-P-catenin (Clone 14/Beta-Catenin, BD Transduction), were used at dilutions of 1 : 16,000 or 1 : 1000, respectively. These titers were selected to minimize nonspecific staining and specificity was confirmed by omission of the primary antibody. Immunolocalization was done using an indirect three-step avidin-biotin- peroxidase method. In brief, de-paraffinized sections were re-hydrated in phosphate- buffered saline. Sections were then incubated sequentially in solutions of 5 % albumin in PBS, 10 % hydrogen peroxide in water, primary antibody, secondary anti-mouse IgG (biotinylated anti-mouse IgG (BA-2000, Vector Labs, Burlingame, California) at 1 :500 in PBS, and avidin-biotin-peroxidase solution (Vectastain ABC Elite kit at 1 : 100 in PBS, Vector Labs, Burlingame, CA) with interval washes in phosphate buffered saline. Reaction product was detected by incubating sections in a solution of the 0.05 % diaminobenzidine and 0.3 % hydrogen peroxide for 7 minutes. Sections were briefly counterstained with hematoxylin.
Interpretation of immunohistochemical stains: The level of expression of WNT16B by prostate fibromuscular stromal cells in each core of each TMA was recorded on a 4-point scale as 3 "intensely", 2 "moderately", 1 "faintly/equivocally" or 0, for which there was no expression by any stromal cells. Statistical analysis testing the probability that there was unlikely to be a difference in expression level by the 2 types of patients (those who received neoadjuvant chemotherapy and those who did not receive neoadjuvant chemotherapy) was performed using 2-sample unpaired t-tests or logistic regression as previously described (Lucas et al., J. Pathol. 215: 118-125, 2008). Analyses of WNT16B staining in breast and ovarian carcinoma samples followed these procedures.
Biochemical recurrence-free survival analysis: Prostate cancer patients treated with neoadjuvant chemotherapy were partitioned into 3 groups based on stromal WNT16B expression determined by IHC: those with WNT16B average score higher than and equal to 0 but less than 1; those with WNT16B average score higher than and equal to 1 but less than 2; and those with WNT16B average score higher than and equal to 2 but less than 3. Clinical outcome data were collected following surgical prostatectomy, specifically measures of serum prostate specific antigen (PSA) as a metric of disease recurrence. Biochemical relapse was defined as a confirmed serum PSA concentration > 0.4 ng/ml. Kaplan-Meier survival curves were plotted with the program GraphPad® Prism, with p-value calculated and output designated as percent biochemical relapse-free survival. Of the 55 patients enrolled in the Phase I/II clinical study, 49 had cores present on the TMA and 6 patients had frozen specimens embedded in optimal cutting temperature (OCT). The positive control for WNT16B expression was PSC27-RAD cells and the negative control was IgG isotype antibody.
NFKB studies. To assess the WNT16B responses due to inhibition of NFKB nuclear translocation, the retroviral construct encoding a mutant form of ΙκΒα, pBabe- Puro-lKBa-Mut (super repressor) that harbors two IKK phosphorylation sites genetically modified as S32A and S34A (Boehm et al, Cell 129: 1065-1079, 2007), was used for retroviral production with the PHOENIX™ packaging cell line. Infections of PSC27 fibroblasts were performed serially using drug selection (2 μg/ml of puromycin) to isolate cell populations. The established cell strain was subsequently subjected to ionizing radiation or MIT. Conditioned medium was collected as described above and used to treat epithelial cells, and gene expression was assessed by qRT-PCR or Western blot.
Analyses of cell proliferation, migration, invasion and chemotherapy resistance. All assays were performed at least three times and reported as mean values. Assays of cell proliferation were performed with the CellTiter96® AQueous One Solution Cell Proliferation Assay (MTS) with signals captured using a 96-well plate reader or by direct counting using a hemacytometer. For trans-well migration and invasion assays, serum-starved cells in serum-free medium were added to the top chambers of Cultrex 24- well Cell Migration Assay plates (8 μιη size) coated with or without basement membrane extract (BM) prepared as 0.5 X of stock solution. CM from fibroblasts or regular epithelial media containing 10 % fetal calf serum (FCS) were added to the bottom chambers. Migrating or invading cells in the bottom chambers were stained and plate absorbance was recorded at 485/520 nm emission. Each assay was performed in triplicate and measured at 24 hour time points over 3 days and presented as the average absorbance of migrating cells and invading cells, with human HeLA cervical cancer cell line (ATCC) used as a reference positive control.
For the two-dimensional in vitro "wound healing" assay, cells were seeded, allowed to establish growth and high-density areas were incised. Detached cells were removed and fresh medium was added. Photographs were taken at 0, 12 and 24 hours, and the relative distance traveled by the cells at the acellular front was measured by microscopy.
For chemoresistance assays, various neoplastic epithelial cells were cultured with either DMEM of low serum (0.5 % FBS) only (abbreviated as "DMEM" ), or CM generated from PSC27, HBF1023 or OVF28901 in various states (e.g., WNT16B overexpression, WNT16B knockdown, irradiated). Cells received Mitoxantrone (MIT) treatment for 1 or 3 days at a range of concentrations bracketing individual cell line's IC50 levels. Cell viability was assayed by MTS or direct counting with trypan blue, and the percentage of viable cells was calculated by normalizing absorbance of each experiment to untreated cells. To assess the influence of WNT16B across a range of MIT concentrations, a series of drug concentrations were applied bracketing the IC50 dose, with percent survival plotted against MIT dose at a 3 -day time point. Non-linear regression curves were plotted using GraphPad Prism.
For apoptosis assays, 0.2 x 106 PC3 cells were dispensed into 6-well culture plates and co-cultured with media conditioned from PSC27 sublines. Twelve hours later, Mitoxantrone was added to the media at the IC50 concentration of the PC3 line, with distilled water applied in parallel as control. To measure cell apoptosis, lysates were prepared 24 hours post treatment from each group, and apoptosis quantitated using a Caspase-Glo 3/7 assay (Promega) that luminescently measures caspase-3 and -7 activities against a tetrapeptide sequence DEVD that is cleaved to release aminoluciferin, upon apoptosis in cultures. For the morphological analysis, bright field pictures were taken for PC3 cells with inverted phase-contrast microscopy.
TOPFLASH reporter assay and β-catenin inhibition. Epithelial cells were transfected with the standardized pair of Super 16xTOPFLASH and Super 16xFOPFLASH (Addgene), each with a Renilla control luciferase plasmid applied for signal normalization. Empty vector pDNA3.1 was used as control plasmid to adjust for equal DNA concentrations per transfection. A construct encoding the full-length sequence of β-catenin was used as positive control of the canonical Wnt signaling pathway. Luciferase assays were performed using a Dual-Luciferase Reporter Assay kit, and fold induction for each cell line was calculated as normalized relative light units of TOPFLASH divided by those of FOPFLASH. To inhibit the β-catenin pathway, a small molecule compound XAV939 (Miltenyi Biotec) (Huang et ah, Nature 461 :614-620, 2009) (0.25 to about 0.50 μΜ) was applied to cultures of epithelial cells treated with conditioned medium from various fibroblast manipulations and with MIT chemotherapy.
WNT16B promoter analyses. A 4000 base pair (bp) region immediately upstream of the human WNT16B gene (Genbank accession NM 016087.2) was analyzed for core NF-κΒ binding sites using the Consite computerized DNA-binding motif search program. Three PCR primer sets were designed to amplify small regions within the proximal promoter sequence (primer set #1 (-502 to -201) forward 5'- CAGGAAAGGTCATGACACACC-3* (SEQ ID NO: 1), reverse 5*- AGAGCAGCCTGGGGATCT-3* (SEQ ID NO: 2); primer set #2 (-947 to -618) forward 5 '-TCTC AGGGACTGC AGGAAAT-3 ' (SEQ ID NO: 3), reverse 5*- CCCACCAACATCTGGGTTAC-3* (SEQ ID NO: 4); primer set #3 (-1356 to -1024) forward 5*-CTCCAGGGAGTACCCTGCTA-3* (SEQ ID NO: 5), reverse 5*- TGTGCTCTGATCTTTTTCTCC A-3 ' (SEQ ID NO: 6), and two additional primer sets were employed to amplify regions within the promoters of the human IL-6 (Naugler and Karin, Curr. Opin. Genet. Dev. 18:19-26, 2008) (forward 5*- AAATGCCCAACAGAGGTCA-3* (SEQ ID NO: 7), reverse 5*- CACGGCTCTAGGCTCTGAAT-3* (SEQ ID NO: 8)) and IL-8 (Martone et al, Proc. Natl. Acad. Sci. USA 100: 12247-12252, 2003) (forward 5*- AC AGTTGAAAACT AT AGGAGCTAC ATT-3 ' (SEQ ID NO: 9), reverse 5*- TCGCTTCTGGGC AAGT AC A-3 ' (SEQ ID NO: 10)) genes, respectively, which encompass known NF-κΒ binding sites. ChIP assays were then performed on PSC27 cells of early passage (p8) and those that had undergone γ-irradiation at a 10-Gy dose, with detailed procedures carried out as per previously published methods (Nelson et ah, Methods Mol. Biol. 567:45-57, 2009). A sample of formalin-fixed sheared chromatin (DNA fragments at about 500 bp in average) from these cells was used as 'input DNA' for control amplifications. Fixed chromatin was immunoprecipitated using monoclonal mouse anti-p65 antibody and DNAs were extracted from the immunoprecipitates and amplified using the primer sets described above. Control immunoprecipitations was carried out without antibody as control, which yielded no reaction products for any of the primer sets.
The immediate 5' upstream sequences containing putative NF-κΒ binding elements of the WNT16B gene were amplified from genomic DNA extracted from PSC27 cells by a DNeasy Blood and Tissue kit (QIAGEN). PCR products were cloned into pCR2.1-TOPO vector (Invitrogen) and each insert was sequenced for confirmation. PCR fragments were then double-digested and subcloned into a reporter luciferase vector pGL4.22 vector. Constructs containing one or multiple mutant NF-κΒ binding sites were generated from the reporter vector series by site-directed mutagenesis. The NAT11- Luc2CP-IRES-nEGFP control construct that contains large copy numbers of NF-KB binding sequences and an optimized IL-2 minimal promoter as part of NFKB-activated transgene (NAT) system was kindly provided by Dr. Hatakeyama (Hokkaido University). All constructs were confirmed by DNA sequencing in both directions. Reporter vectors were co-transfected with pRL-TK vector for transfection efficiency controls and internal normalization for gene expression measurements. Cells were either treated with 20 ng/ml TNF-a for 90 min, exposed to 10 Gy γ-irradiation or 1 μΜ Mitoxantrone for 1 day. PSC27 line over-expressing ΙκΒα mutant/NF-κΒ super repressor was tested in parallel under above conditions for luciferase signals. Luciferase activity was measured using the Luciferase Assay System and normalized luciferase activities were calculated as light units normalized to renilla luciferase activity present in each specimen.
Animal and xenograft studies. All animal studies were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Fred Hutchinson Cancer Research Center, and were carried out in accordance with the NIH Guide for laboratory animals. Mouse care/welfare and veterinary oversight were provided by the center animal care. ICR SCID mice (Taconic, Inc.) at an age of approximately 6 weeks (25 g body weight) were used. Rat tail collagen (high concentration, type I) was prepared before the ice-cold collagen solution was neutralized and adjusted to the proper osmolarity by adding a mixture of NaOH and xlO PBS. To prepare tissue recombinants, fibroblasts (PSC27 strain) and epithelial cells (PC3, BPH1 or MDA-MB-231) were mixed at a ratio of 1 : 1, with each recombinant comprised of 250,000 cells of each line. After polymerization, the cell/collagen mixture was overlaid with growth medium and incubated at 37°C for 1 hour before implantation.
Xenografting was performed under isoflurane anesthesia. A pocket beneath the back skin was formed using surgical scissors, with an oblique incision (< 1 cm) made on the capsule surface parallel and adjacent to the long axis of each kidney. Cells were injected under the capsule with a blunt 25 -gauge needle and a glass Hamilton syringe via a transrenal injection, forming a starting tumor with a volume of 1 to 2 mm3. The kidney was returned to the retroperitoneal space and the skin was closed with surgical staples. The growth of xenografts was assessed at weekly intervals using ultrasound instruments. Animals were sacrificed at 2-8 weeks post transplantation, based on the tumor burden and pathological progression of tested animals. Upon dissection, tumor volume (V) was measured and calculated according to the tumor length (1) and width (w) by the following formula: V = (π/6) x ((l+w)/2)3 (Anand et al, Nat. Genet 31 :301-305, 2002). Tumors were snap-frozen or processed conventionally for formalin fixation. Resulting sections were used for hematoxylin/eosin staining, and immunostaining for selected gene expression markers.
For chemoresistance studies, ICR SCID mice received subrenal capsule xenografts by implantation according to the procedure described above. After surgery, mice were given standard laboratory diets and water ad libitum for 2 weeks, to allow tumor uptake and growth initiation. Starting from the 3rd week (when tumor sizes reached from about 4 to about 8 mm in diameter), mice received Mitoxantrone at a dose of 0.2 mg/kg by i.p. injection, or vehicle control, on day 1 of week 3, week 5, and week 7 (Alderton et al, Cancer Res. 52: 194-201, 1992). Between 8 and 12 mice were randomly assigned to each study arm. A total regimen of 3 2-week cycles was administered. After the final treatment cycle the mice were sacrificed, kidneys were removed for tumor measurement and histological analysis. The cumulative Mitoxantrone dose received per mouse was 0.6 mg/kg. Each experimental arm comprised 5-8 mice per treatment cohort. To determine the systemic effects of MIT treatment on Wntl6b expression, parallel experiments involved administering MIT or vehicle as per the treatment schema above, to cohorts of mice (n = 6) without xenografts. At the completion of the 8-week treatment regimen, mice were euthanized and various tissues were rapidly resected and snap frozen or fixed in formalin. Following protein isolations, Western immunoblot analysis was performed for Wntl6b expression, as described above.
For assessments of the acute effects of chemotherapy, mice harboring xenografts of PC3 cells combined with PSC27 fibroblasts were treated with Mitoxantrone 0.2 mg/kg by i.p. injection, or vehicle control. Xenografts were collected 24 hour after treatment and tissues were processed for IHC. Apoptosis was assessed by staining with anti- caspase 3 antibody (cleaved, BioCare Medical). On adjacent sections, immunostaining with anti-yH2AX (Upstate) was performed to quantitate cells with DNA-damage.
Statistical Analysis. Analyses of microarray experiments are described above. In vitro studies of cell proliferation, viability, or invasion were performed a minimum of 3 times and data reported as ± s.e.m. Statistical analyses was performed on raw data for each group by one-way analysis of variance or a two-tailed Student's t-test. A p<0.05 was considered significant.
Table 1. PCR Primers
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
According to the HUGO Gene Nomenclature Committee.
RESULTS
Therapy induces damage responses in tumor microenvironments
To assess for treatment-induced damage responses in benign cells comprising the tumor microenvironment, tissues collected before and after chemotherapy exposure were examined in men with prostate cancer enrolled in a neoadjuvant clinical trial combining the genotoxic drug mitoxantrone (MIT) and the microtubule poison docetaxel (DOC) (Fig. 1A) (Garzotto et ah, Urol. Oncol. 24:254-259, 2006; Beer et ah, Clin. Cancer Res. 10: 1306-1311, 2004). After chemotherapy, evidence of DNA damage in fibroblasts and smooth muscle cells comprising the prostate stroma was found, as determined by the phosphorylation of histone H2AX on Serl39 (γ-Η2ΑΧ) (Figure IB). To ascertain the molecular consequences of DNA damage in benign cells, primary prostate fibroblasts (PSC27 cells) were treated with MIT, bleomycin (BLEO), hydrogen peroxide (H2O2) or gamma radiation (RAD), each of which substantially increased the number of γ-Η2ΑΧ foci (Figures 2 A and 2B). Whole-genome microarrays were used to quantify transcripts in PSC27 cells and determined that the levels of 727 and 329 mRNAs were commonly increased and decreased, respectively (false discovery rate of 0.1 %), as a result of these genotoxic exposures (Figure 2C). To focus the present studies on those factors with the clear potential for paracrine effects on tumor cells, genes with at least 3.5 -fold elevated expression after genotoxic treatments that encode extracellular proteins were evaluated, here collectively termed the DNA damage secretory program (DDSP) (Figure 1C). Consistent with previous studies, transcripts encoding matrix metalloproteinases, such as MMP1, and chemokines, such as CXCL3, were substantially elevated in damaged cells. (Bavik et al, Cancer Res. 66:794-802, 2006; Coppe et al, PLos Biol. 6:2853-2868, 2008) Of particular interest, peptide growth factors with known roles or the potential to influence the growth of prostate cancer were upregulated including epidermal growth factor receptor (EGFR) ligands epiregulin (EREG), induced 15 fold, and amphiregulin (AREG), induced 10 fold. Surprisingly, the serine protease inhibitor SPINK1, recently shown to promote EGFR signaling in prostate cancinoma, was induced 20 fold (Figure ID). The RET oncogene ligand GDNF was induced 6 fold (Figure IE). Also, it was notable that the expression of WNT16B increased between eightfold and 64-fold as a result of these treatments (P < 0.005) (Figures 1C and IF).
Wnt family members participate in well-described mesenchymal and epithelial signaling events that span developmental biology, stem cell functions and neoplasia (Clevers, Cell 127:469-480. 2006). Though little information links Wnt signaling to DNA damage responses, a previous study reported WNT16B overexpression in the context of stress- and oncogene-induced senescence (Binet et al, Cancer Res. 69:9183- 9191, 2009). DNA damage increased WNT16B protein expression was confirmed and elevated amounts of extracellular WNT16B were found in conditioned medium from prostate fibroblasts after chemotherapy or radiation (Figures 1G and 1H). Transcripts encoding other Wnt family members were not substantially altered in the prostate fibroblasts studied here (Figure II). In contrast to the WNT16B responses in fibroblasts, little induction of WNT16B expression was observed in epithelial cells (Figure. 1 J.
Next confirmation that expression of WNT16B is induced by genotoxic therapy in vivo was sought. Laser-capture microdissection was used to separately isolate stroma and epithelium and determined by quantitative RT-PCR (qRT-PCR) that the number of WNT16B transcripts increased by approximately sixfold in prostate stroma after chemotherapy (P < 0.01) (Figure 3A and Figure 2D). The expression of other genes known to respond to DNA damage, including CDKN2A (also known as pi 6), CDKN1A (also known as p21) and IL8, also increased in response to chemotherapy in prostate stroma (Fig. 3A) (Coppe et al, PLos Biol. 6:2853-2868, 2008; Acosta et al, Cell 133: 1006-1018, 2008). Next, induction of WNT16B protein expression was confirmed by immunohistochemistry. Compared to untreated prostate tissue, WNT16B protein was substantially and significantly increased after chemotherapy in the periglandular stroma, which included fibroblasts and smooth muscle cells (P < 0.01) (Figures 3B and 3C). In contrast, very limited WNT16B expression was observed in benign or neoplastic epithelium, and mRNAs encoding other Wnt family proteins were not substantially altered in prostate stroma (Figures 2D and 2E).
These findings were confirmed in breast and ovarian carcinomas, two other malignancies commonly treated with cytotoxic chemotherapy. Genotoxic treatments induced the expression of WNT16B protein in primary human fibroblasts isolated directly from breast and ovarian tissues and in the prostates, breasts and ovaries of mice treated with MIT (Figures 4A through 4D). WNT16B protein expression was significantly elevated in the stroma of human breast and ovarian cancers treated with neoadjuvant chemotherapy compared with tumors from patients that did not receive treatment (P < 0.001) (Figure 3). Notably, in each of the tumor types evaluated, a range of absent to robust WNT16B expression was evident. Because responses to chemotherapy also varied, whether WNT16B expression was associated with clinical outcome was evaluated. In patients with prostate cancer treated with neoadjuvant chemotherapy, higher WNT16B immunoreactivity in prostate stroma after treatment was associated with a significantly greater likelihood of cancer recurrence (P = 0.04) (Figure 3D). Next, the mechanism(s) by which WNT16B could contribute to treatment failure was sought.
WNT16B promotes cancer cell proliferation and invasion
Members of the Wnt family influence cellular phenotypes through β-catenin- dependent and -independent pathways (Clevers, Cell 127:469-480, 2006). A prostate fibroblast cell strain with stable expression of WNT16B (PSC27WNT16B) and fibroblast strains that expressed a short hairpin (sh) RNAs specific to WNT16B (shRNAWNT^B) were generated, which blocked the induction of WNT16B expression by RAD and MIT (Figures 5A and 5B). PSC27WNT16B-conditioned medium significantly enhanced prostate cancer cell growth (P < 0.01) (Figure 6A) and increased cellular migration and invasion of PC3 cells (P < 0.05) compared to conditioned medium from PSC27 vector controls (PSC27C) (Fig. 6B and Figures 5C and 5D), confirming that WNT16B can promote phenotypic changes in tumor cells through paracrine mechanisms.
The DDSP comprises a diverse spectrum of secreted proteins with the potential to alter the phenotypes of neighboring cells (Figure 1C). Next sought was to determine to what extent WNT16B is responsible for such effects in the context of the amalgam of factors induced by DNA damage. Conditioned medium from irradiated PSC27 fibroblasts (PSC27-RAD), representing the full DDSP, increased the proliferation (between 1.5-fold and twofold, P < 0.05) and invasiveness (between threefold and fourfold, P < 0.05) of neoplastic epithelial cells compared to conditioned medium from untreated PSC27 fibroblasts (Figures 6C and 6D). Compared to irradiated PSC27 cells expressing control shRNAs, conditioned medium from PSC27-RAD + shR AWNT166 fibroblasts reduced these responses to the full DDSP by between 15% and 35%, depending on the cell line (P < 0.05) (Figures 6C and 6D).
To investigate the in vivo consequences of WNT16B expression in the tumor microenvironment, non-tumorigenic BPHl or tumorigenic PC3 cells were combined with psC27WNT16B (BPH1+PSC27WNT16B and PC3+PSC27WNT16B, respectively) or control PSC27 (BPH1+PSC27C and PC3+PSC27C, respectively) fibroblasts and implanted the recombinants under the renal capsule of recipient mice (Figure 6E). At 8 weeks after implantation, BPH1+PSC27WNT16B grafts were larger than BPH1+PSC27C grafts (approximately 200 mm3 compared to approximately 10 mm3, respectively; P < 0.001) (Figure 5E). As expected, grafts of PC3 cells alone formed tumors, and the tumors from PC3+PSC27C cells were of comparable size. In contrast, PC3+PSC27WNT16B recombinants generated very large poorly differentiated and invasive tumors with an average size of 500 mm3, which were substantially larger than any of the control tumors (P < 0.001) (Figure 6F and Figure 5F).
In vivo, PC3 cells combined with PSC27-RAD cells expressing the full fibroblast DDSP resulted in substantially larger tumors than PC3 cells combined with untreated PSC27 control fibroblasts (P < 0.001) (Figure 6G). Reducing the fibroblast contribution of WNT16B attenuated the PSC27-RAD effects: grafts of PC3+PSC27-RAD averaged 380 mm3, whereas PC3 cells combined with PSC27-RAD+shRNAWNT16B averaged 280 mm3, an approximately 25% reduction in tumor size when fibroblast WNT16B was suppressed (P < 0.02) (Figure 6G). Taken together, these findings show that paracrine WNT16B activity can promote tumor growth in vivo and accounts for a substantial component of the full DDSP effect on neoplastic epithelium.
WNT16B signals through β-catenin and induces an EMT
Having established that WNT16B can promote tumor growth through paracrine signaling, determination of the mechanism(s) by which it does so was sought. PSC27^NT16B-conditioned medium activated canonical Wnt signaling in BPH1, PC3 and Ml 2 prostate cancer cells, as measured by assays of β-catenin-mediated transcription through T cell factor/lymphoid enhancer binding factor (TCF/LEF) binding sites (Figure 7A). Known β-catenin target genes, including AXIN2 and MYC, were upregulated (approximately fivefold and over tenfold, respectively) after exposure to WNT16B-enriched conditioned medium (Figure 7B). In human prostate cancers treated with chemotherapy, β-catenin localized in the nucleus of tumor cells (Figure 8A). It was also found that β-catenin target genes were expressed more highly in tumors with elevated stromal WNT16B expression relative to those with low WNT16B expression (P < 0.05) (Figure 7C). To confirm that β-catenin signaling contributed to the epithelial phenotypes resulting from exposure to PSC27-RAD-conditioned medium, prostate cancer cells were treated with the tankyrase inhibitor XAV939, which stabilizes axin and inhibits β-catenin-mediated transcription (Huang et al., Nature 461 :614-620, 2009). XAV939 completely suppressed the proliferative and invasive responses induced by WNT16B and markedly attenuated the effects of the PSC27-RAD DDSP (Figure 7D and Figure 8B).
Wnt signaling is known to promote the acquisition of mesenchymal cell characteristics that can influence the migratory and invasive behavior of epithelial cells through an EMT (Thiery et al, Cell 139:871-890, 2009; Yook et al, Nat. Cell Biol 8: 1398-1406, 2006; Vincan and Barker, Clin. Exp. Metastasis 25:657-663, 2008). Loss of CDH1 (also known as E-cadherin), the prototypic epithelial adhesion molecule in adherens junctions, and gain of CDH2 (also known as N-cadherin) expression are among the main hallmarks of an EMT (Wu and Bonavida, Crit. Rev. Immunol. 29:241-254, 2009; Peinado et al, Nat. Rev. Cancer 7:415-428, 2007). After exposure of PC3 cells to PSC27WNT16B-conditioned medium, the number of E-cadherin transcripts decreased 64%, whereas the number of N-cadherin transcripts increased fourfold (P < 0.05). Similar alterations occurred in M12 and BPH1 cells (Figures 7E and 7F). Inhibiting β-catenin pathway signaling with XAV939 in epithelial cells blocked the WNT16B-induced EMT-associated gene expression (Figure 8C). Exposure to PSC27WNT16B-conditioned medium also promoted mesenchymal characteristics in MDA-MD-231 breast cancer and SKOV3 ovarian cancer cells (Figure 8D).
Genotoxic stress induces WNT16B expression through NF-KB
A key pathway linking DNA damage with apoptosis, senescence and DNA repair mechanisms involves activating the NF-κΒ complex (Bernard et al, Cancer Res. 64:472- 481, 2004; Berchtold et al, Mol. Cell. Biol. 27:497-509, 2007). NF-κΒ is also pivotal in mediating the stress-associated induction of inflammatory networks, including the upregulation and secretion of interkeukin-6 (IL-6) and IL-8 (Acosta et al., Cell 133: 1006- 1018, 2008; Kuilman et al, Cell 133: 1019-1031, 2008). It was therefore sought to determine whether DNA-damage-induced WNT16B expression is mediated by NF-KB. NF-KB binding motifs were identified in the WNT16B promoter region and their function was confirmed using WNT16B promoter constructs. Compared to untreated cells, both RAD and tumor necrosis factor a (TNF-a), which are known NF-κΒ activators, induced WNT16B reporter activity (P < 0.01) (Figure 7G and Figures 9A through 9E). Next, PSC27 prostate fibroblasts were generated with stable expression of a mutant nuclear factor of K light polypeptide gene enhancer in B cells inhibitor, α (ΙκΒα) (PSC27IkB(X), which prevents ΙκΒ kinase (IKK)-dependent degradation of ΙκΒα and attenuates NF-KB signaling. After irradiation of PSC27 cells, NF-κΒ translocated to the nucleus and induced NF-κΒ reporter activity > 100-fold (Figures 9D and 9E). In comparison, the amount of nuclear NF-κΒ in PSC27lKBa-RAD cells was markedly lower. The PSC27IkB(X cells with impaired NF-κΒ activation had a significant attenuation of induction of WNT16B expression after treatment with H202, BLEO or RAD (P < 0.05) (Figure 7H).
It was next determined whether suppressing fibroblast NF-κΒ signaling in response to DNA damage would attenuate the pro-proliferative effects of the PSC27-RAD DDSP. Whereas PSC27-RAD-conditioned medium promoted prostate epithelial cell proliferation, conditioned medium from PSC27IkB(X-RAD cells failed to do so (Fig. 71). These experiments identify WNT16B as a new member of the cellular genomic program that is regulated by NF-κΒ signaling in response to DNA damage.
Paracrine WNT16B attenuates the effect of cytotoxic therapy
The preceding data suggested that in addition to tumor-promoting effects, paracrine-acting WNT16B may influence the responses of tumors to genotoxic cancer therapeutics. To evaluate this possibility, MIT, a type 2 topoisomerase inhibitor that produces DNA strand breaks, leading to growth arrest, senescence or apoptosis, which is in clinical use for the treatment of advanced prostate cancer was studied. Prostate cancer cells exposed to PSC27^^T16B-conditioned medium compared to control medium consistently showed significant attenuation of chemotherapy-induced cytotoxicity across a range of MIT concentrations after 3 d (P < 0.05) (Figure 10A and Figure 11 A). Short-term cell viability assays confirmed that, compared to controls, PSC27WNT16B-conditioned medium improved cancer cell survival after acute 12 hour exposures to MIT (P < 0.01) (Figure 11B). Apoptotic responses measured after 24 hour of MIT exposure were substantially attenuated by PSC27WNT16B-conditioned medium (P < 0.01), an effect that was blocked by treatment with XAV939 (Figures 10B and IOC). To determine whether these observations were of relevance to tumor therapy in vivo, mice with tumor grafts comprised of BPH-1 or PC3 cells plus PSC27WNT16B or PSC27C fibroblasts were treated with three cycles of MIT given every other week. MIT treatment significantly reduced the tumor volumes (P < 0.001). However, grafts of tumor cells with PSC27WNT16B fibroblasts attenuated the tumor inhibitory effects of MIT compared to tumor cells grafted with control PSC27 fibroblasts: PC3+PSC27C and PC3+PSC27WNT16B tumors averaged 13 mm3 and 78 mm3, respectively (P < 0.001) (Figure 10D). Experiments using MDA-MB-231 breast cancer cells plus breast fibroblasts produced similar results (Figure 11C). To evaluate the influence of WNT16B on the acute effects of chemotherapy, cohorts of PC3+PSC27C and PC3+PSC27WNT16B xenografts were examined 24 hours after MIT treatment to quantify DNA damage using γ-Η2ΑΧ immunofluorescence and apoptosis using cleaved caspase 3 immunohistochemistry (IHC). Compared to PC3+PSC27C grafts, there was no difference in the number of DNA damage foci in PC3+PSC27WNT16B tumors, but significantly fewer apoptotic cells were present (34% compared to 14%, respectively; P < 0.05) (Figure 10E).
The conditioned medium from PSC27-RAD cells, representing the full fibroblast DDSP, significantly increased the viability of PC3 cancer cells exposed to MIT concentrations ranging between 0.1 to 1 μΜ in vitro (P < 0.01) (Figure 12). In comparison to PSC27-RAD-conditioned medium, PSC27-RAD+shRNAWNT16B or PSC27lKBaRAD fibroblasts, engineered to suppress WNT16B expression or NF-KB activation, respectively, substantially augmented the effects of MIT, further increasing apoptosis and reducing tumor cell viability by 30 to 40 %. Blocking β-catenin signaling in carcinoma cells with XAV939 also attenuated the effects of PSC27-RAD-conditioned medium on promoting tumor cell survival (Figures 12B through 12D and Figures 13A and 13B). This effect of WNT16B was also evident in vivo. PC3+PSC27-RAD tumor grafts averaged 300 mm3 in size compared to 25 mm3 for grafts of PC3 cells alone (P < 0.001). MIT chemotherapy suppressed the growth of the PC3+PSC27-RAD grafts, 55 mm3 in size (Figure 12E). However, after MIT treatment, grafts of PC3 tumor cells with PSC27-RAD + shR AWNT^B fibroblasts, with attenuated WNT16B induction, were on average about 33 % smaller than PC3+PSC27-RAD tumors ( O.001) (Figure 12E). Experiments with MDA-MD-231 cells and breast fibroblasts produced similar results (Figure 13C). To more accurately mimic the clinical situation of cancer therapy, grafted tumor cells with unirradiated PSC27 fibroblasts (PSC27C) were grafted and the same treatment schema of three MIT cycles was followed. Tumors from mice treated with MIT were substantially smaller than tumors from untreated mice (P < 0.001). Attenuating the induction of WNT16B further enhanced the effects of chemotherapy: after MIT treatment, grafts of PC3 cells and PSC27C + shRNAWNT166 were on average 40% smaller than grafts of PC3 cells combined with PSC27C cells without shRNAWOT166 ψ < o.OOl) (Figure 12F and Figure 13D).
The mTOR Inhibitor Rapamycin Suppresses the DDSP and Enhances Tumor Responses to Genotoxic Chemotherapy
The above data, and recent reports in the literature, provide strong evidence that signals initiated by genotoxic stress are propagated via NFKB, p38MAPK, mTOR, and potentially influenced by poly-ADP ribose polymerase (PARP). Inhibiting a key master regulator has the potential to simultaneously suppress major components of the DDSP, which is complex and likely exhibits substantial redundancy. Recent reports implicate the involvement of MDM2 in linking DNA damage to metabolic/energy regulation, and potentially the DDSP. DDR signals, independent of ATM/ATR, transiently activates mTOR-S6Kl, which phosphorylates MDM2, allowing retention in the cytoplasm, leading to loss of p53 ubiquitination and p53 stabilization. mTOR is a serine/threonine protein kinase that governs highly-conserved nutrient- and growth factor-sensing pathways, and is a component of two distinct complexes: mTORCl and mTORC2. DNA damage induced by UV irradiation can induce the mTOR target p70S6 kinase concomitant with the up-regulation of DDSP members MMP1 and MMP3. While a systematic analysis of mTOR's role in DDSP is lacking, the data suggest that mTOR inhibitors (e.g., RADOOl and Rapamycin) may regulate DDSP effection proteins.
The effects of inhibiting mTOR signaling in the context of genotoxic stress was evaluated. PSC27 fibroblasts were treated with Rapamycin (RAP A) prior to ionizing radiation. RAP A treatment markedly attenuated the induction of most of the DDSP factors analyzed, including SPINK1 and WNT16B. RAPA treatment also substantially reduced the MIT-resistance effects of the fibroblast DDSP toward prostate cancer cells. in vivo, systemic RAPA significantly enhanced the tumor inhibitory effects of MIT toward subcutaneous grafts of PC#/PSC27 cells. The RAPA was administered at concentrations that produced no individual anti-tumor effects, but used with MIT produced substantial responses (approximately 60 % reduction in tumor volumes; p < 0.001).
Optimizing radiotherapy and chemotherapy for the treatment of malignant neoplasms has relied on the iterative development and testing of models involving tumor growth dynamics, mutation rates and cell-kill kinetics. However, the most theoretically effective tumoricidal strategies must usually be tempered because of detrimental effects to the host. This reality has led to the development of regimens in which therapies are administered at intervals or cycles to avoid irreparable damage to vital host functions. However, the recovery and repopulation of tumor cells between treatment cycles is a major cause of treatment failure (Kim and Tannock, Nat. Rev. Cancer 5:516-525, 2005; Tredan et al., J. Natl. Cancer Inst. 99: 1441-1454, 2007). Interestingly, rates of tumor cell repopulation have been shown to accelerate in the intervals between successive courses of treatment, and solid tumors commonly show initial responses followed by rapid regrowth and subsequent resistance to further chemotherapy. Our results indicate that damage responses in benign cells comprising the tumor microenvironment may directly contribute to enhanced tumor growth kinetics (Fig. 12G).
The autocrine- and paracrine-acting influences of genotoxic stress responses can exert complex and potentially conflicting cell nonautonomous effects (Kuilman and Peeper, Nat. Rev. Cancer 9:81-94, 2009; Fumagalli and d'Adda di Fagagna, Nat. Cell Biol. 11 :921-923, 2009). Overall, the above findings are in agreement with studies of DNA damage in which the execution of a signaling program culminating in a senescence phenotype is accompanied by elevated concentrations of specific extracellular proteins termed a 'senescence messaging secretome' or a 'senescence-associated secretory phenotype' (Kuilman and Peeper, Nat. Rev. Cancer 9:81-94, 2009; Fumagalli and d'Adda di Fagagna, Nat. Cell Biol. 11 :921-923, 2009). DNA damage responses and senescence programs can clearly operate in a cell autonomous 'intrinsic' manner to arrest cell growth and inhibit tumor progression, as has been observed in premalignant nevi (Michaloglou et al, Nature 436:720-724, 2005). Secreted factors such as insulin-like growth factor binding protein 7 (IGFBP7) and the chemokine (C-X-C motif) receptor 2 (CXCR2) ligands IL-6 and IL-8 participate in a positive feedback loop to fortify the senescence growth arrest induced by oncogenic stress and also promote immune responses that clear senescent cells and enhance tumor regression (Acosta et al, Cell 133: 1006-1018, 2008; Kuilman et al, Cell 133:1019-1031, 2008; Xue et al, Nature 445:656-660, 2007; Wajapeyee et al, Cell 132:363-374, 2008). However, in addition to proinflammatory cytokines, the damage response program comprises proteases and mitogenic growth factors, such as MMPs, hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF) and epidermal growth factor receptor (EGFR) ligands that have clear roles in promoting tumor growth, inhibiting cellular differentiation, enhancing angiogenesis and influencing treatment resistance (Bavik et al, Cancer Res. 66:794-802, 2006; Coppe et al, PLoS Biol. 6:2853-2868, 2008; Coppe et al, J. Biol. Chem. 281 :29568-29574, 2006). This concept is supported by reports of tissue-specific chemoresistant survival niches involving hematopoietic neoplasms, such as lymphomas (Gilbert and Hemann, Cell 143:355-366, 2010). The situation also has parallels with studies of radiation and chemotherapy paradoxically promoting tumor dissemination (Biswas et al, J. Clin. Invest. 117: 1305-1313, 2007).
Collectively, the above support several conclusions: first, the outcomes of genotoxic exposures to any specific benign or neoplastic cell depend on the integration of innate damage response capabilities and the context that is dictated by the composition of the tumor micro environment; second, although intrinsic drug resistance is clearly operative in some cancers, acquired resistance can also occur without alterations in intrinsic cellular chemosensitivity (Davis and Tannock, Lancet Oncol. 1 :86-93, 2000), and the above results provide strong support for previous studies that implicate constituents of the tumor microenvironment as important contributors to this resistance (Meads et al, Clin. Cancer Res. 14:2519-2526, 2008; Shree et al, Genes Dev. 25:2465- 2479, 2011; DeNardo et al, Cancer Discov. 1 :54-67, 2011); third, the composition of the microenvironment damage response indicates the potential to promote resistance to pathway-targeted agents such as EGFR inhibitors, as these drugs must contend with damage-enhanced local concentrations of competing ligands such as SPINK1 and amphiregulin; and fourth, specific microenvironment DDSP proteins that promote therapy resistance such as WNT16B are attractive targets for augmenting responses to more general genotoxic therapeutics. However, the complexity of the damage response program also supports strategies that are focused on inhibiting upstream master regulators, such as NF-κΒ (Chien et al., Genes Dev. 25:2125-2136, 2011), that may be more efficient and effective adjuncts to cytotoxic therapies, provided their side effects are tolerable.
Example 2
In this example, it is demonstrated that SFRP2 is expressed by fibroblasts following genotoxic treatment and that the expression of SFRP2 can be modulated to effect cancer therapy.
It has been established that anticancer treatments cause DNA damage, which leads to tumor regression through the activation of apoptosis and senescence programs. To assess the damage responses of human benign stromal cells comprising the tumor microenvironment, a primary prostate stromal cell line, PSC27 (Bavik et al., Cancer Res. 66:794-802, 2006) was examined. PSC27 cells were exposed to a lOGy ionizing radiation, cell lysates were collected for R A preparation. Expression of both SFRP2 and WNT16B were analyzed by RT-PCR reactions. PSC27 stable line over-expressing SFRP2 or WNT16B was examined in parallel as positive control. Data was averaged from three independent experiments. Following this ionizing radiation, the expression of SFRP2 was found to be dramatically up-regulated in the PSC27 line, as evidenced by SRFP2 over-expression in these cells upon genotoxic treatment.
Since radiation caused such a remarkable influence to SFRP2 expression, the consequences of several other treatments was next examined, including the use of hydrogen peroxide (H2O2), DNA damaging agents including bleomycin (BLEO) and mitoxantrone (MIT). The latter are chemicals frequently used in clinical therapies of human cancer patients.
In particular, PSC27 cells were treated with 0.6 mM hydrogen peroxide, 10 μg/mL bleomycin, or 1 μΜ mitoxantrone in PSC medium as previously described above.
After treatment, the cells were rinsed thrice with PBS and left to recover 3 days in PSC medium. Following recovery, cells were designated PSC27-H202, PSC27-BLEO, PSC27-MIT or PSC27-RAD, while normally proliferating PSC27 cells as PSC27-Pre. After treatment, cells were maintained in medium for 7 to 10 days before cell lysis for R A or protein analysis. (A), quantitative RT-PCR of SFRP2 expression at transcription level, amplified signals normalized to the interior reference gene RPL13A; (B), Immunoblot analysis of SFRP2 with samples collected as either conditioned media about 7 to 10 days after in vitro treatments, or as the whole cell lysates collected in the same time period. Not surprisingly, a consistent pattern of SFRP2 was observed, indicating that the over-expression was not specific to ionizing radiation, but comprehensive to multiple DNA damaging treatments.
To determine the intracellular localization of SFRP2, immunofluorescence staining with an anti-SFRP2 antibody was applied. Subsequent to treatments under in vitro conditions, PSC27 cells were rinsed, subjected to fixation in 4% paraformaldehyde and permeabilization with 0.1% Triton-XlOO prior to immunostaining. A rabbit polyclonal anti-SFRP2 (Santa Cruz, clone no. H-140) and secondary antibody Alexa Fluor® 488 (or 594)-conjugated F(ab')2 goat anti-rabbit IgG (Invitrogen) were sequentially applied. Nuclei were counterstained with 2 μg/ml of 4',6-diamidino-2- phenylindole (DAPI) and coverslips were mounted onto glass slides. Interestingly, the majority of SFRP2 signals were found in the cytoplasm, while the untreated cells had barely detectable expression. Although the appearance of SFRP2 was visible only after 7 to 10 days upon treatment, this paralleled with most of other secreted factors, including WNT16B, MMP3, GM-CSF, Groa and IL-8.
In one of the previous study above, the expression of another factor, WNT16B, a Wnt family member that participates in paracrine actions from stromal areas to the prostate epithelial populations and alters multiple epithelial phenotypes, was found to be markedly enhanced upon chemotherapy and have the potential to propagate cellular DNA damage signals to other residents of the tissue microenvironment. In this work, chemotherapy-induced SFRP2 expression changes in human prostate cancer associated stroma was measured by qRT-PCR after micro-dissection. Each data point represented the measurements from an individual patient and the results were determined as PCR cycle number relative to the reference gene, ribosomal protein L13 (RPL13), which served as the base control. The P values were calculated by Student's t test. The expression level of SFRP2 was measured in both pre- and post-treatment patients, and found its transcripts increased significantly (p<0.05). It is therefore interesting to interrogate whether many of the DDSP factors share a similar expression pattern, or only a small handful of them exhibit this feature.
Since SFRP2 has been found to be over-expressed in the vasculature of 85 % human breast tumors (Courtwright et al, Cancer Res. 69: 4621-4628, 2009), it was determined whether its expression has a similar or special pattern in human prostate populations, including the well characterized cell lines. The primary prostate stromal line
PSC27 and several established prostate epithelial lines were exposed to 5Gy ionizing radiation. Total RNAs were prepared, with cDNA synthesized by reverse transcription. Values on the Y axis are based on the Log2 of fold change of SFRP2 transcript expression, as post-treatment signal against pre-treatment signal. Data are the average of three independent experiments. Treatment to PSC27 and several typical prostate epithelial cell lines with radiation demonstrated that this Frizzled-related protein was more susceptible to be induced in prostate fibroblasts, while epithelial cells only had a minor response, even when the cells received the same dose of radiation.
SFRP2 belongs to a large family of SFRPs that are implicated in the Wnt signaling cascade and are involved in cancer progression. Some studies suggest that SFRP2 inhibits the Wnt-P-catenin pathway thus acts as a tumor suppressor (Kawano and Kypta, J. Cell Sci. 116: 2627-2634, 2003; Suzuki et al, Br. J. Cancer 98: 1147-1156, 2008). In contrast, recent reports suggest that SFRP2 can induce tumor growth and it is produced by certain tumor types including glioma (Roth et al, Oncogene 19: 4210-420, 2000) and stimulates angiogenesis via a calcineurin/NFAT signaling pathway (Courtwright et al, Cancer Res. 69:4621-4628, 2009; Siamakpour-Reihani et al, PloS One 6:e20412, 2011). In the present disclosure, the first choice was to silence SFRP2 expression through the application of shRNA. In particular, the primary prostate stromal line PSC27 and several established prostate epithelial lines were exposed to 5Gy ionizing radiation. Total RNAs were prepared, with cDNA synthesized by reverse transcription. Data were calculated as the average of three independent experiments. From these data it was found that the activated β-catenin pathway by stromal conditioned media collected post-DNA damage which was mainly mediated by WNT16B, became significantly attenuated. When the conditioned media from PSC27 cells made to over-express SFRP2, the β-catenin signals remained unchanged, indicating SFRP2 itself does not activate this pathway. However, when SFRP2 and WNT16B were co-expressed, the conditioned media caused significantly higher activation of the β-catenin axis. In another study an assay of canonical Wnt pathway signaling through activation of a TCF/LEF luciferase reporter construct (TOPflash) or a control reporter (FOPflash) was conducted. In particular, epithelial cells were exposed to conditioned medium (CM) from PSC27 prostate fibroblasts over-expressing or silencing SFRP2, or WNT16B against their corresponding vector controls. These data were examined as the mean ± s.e.m. of triplicates, and P values were determined by ANOVA followed by t test. (Figure 14).
Similarly, immunoblot was used for confirmation of SFRP2 expression in PSC27 stable cell line and shRNA silencing efficacy. In this study, samples were loaded to the gel, from left to right: PSC27 vector control (PSC27C); PSC27 cells expressing SFRP2 (PSC27SFRP2); PSC27SFRP2 cells infected with non-specific shRNA; PSC27SFRP2 cells infected with SFRP2-specific shRNAs (#1 and #2, respectively). See Figure 15.
EXAMPLE 3
The present example demonstrates that quiescent cells retain their proliferative potential and "DNA damage secretory program" (DDSP) development capacity one the cells are allowed or induced to exit from their GQ phase.
Components of the tumor microenvironment (TME) are now well-established to strongly influence the development and progression of malignancies. A robust secretory phenotype that occurs during the process of cellular senescence primarily results from damage to DNA, and such a phenotype is regulated by a mechanism termed "DNA damage secretory program (DDSP)" (See above). The DDSP is remarkable in several respects. First, the program is complex, with several hundred proteins induced to varying levels. Second, the program is robust, many transcripts, and their attendant proteins, are induced more than 10-fold. Third, there is both consistency and variability in the program depending on the cell type, e.g., fibroblast or epithelium. Fourth, a number of the DDSP proteins are well-known to promote tumor progression. These include proteases (MMPs), growth factors (SPINKl, amphiregulin, epiregulin), pro-angiogenic factors (ANGPTL4, ANGPT1), and pro-inflammatory cytokines (IL-Ιβ, IL6, IL8) (Coppe et al. PLoS Biol. 6:e301 : 2853-2868 2008; Bavik et al., supra, 2006; Kuilman et al., Cell 133: 1019-1031, 2008; Krtolica et al., Proc. Natl. Acad. Sci. USA 98: 12072- 12077, 2001; Parrinello et al., J. Cell Sci. 118:485-496, 2005; and Examples above).
It is clear that current clinical therapeutics do not exclusively engage tumor cells, but rather also damage benign host 'bystander' cells, which are competent to activate damage responses including the DDSP. With preclinical animal models, it has been demonstrated above that following initial treatment, a robust DDSP derived from the TME, acts in a paracrine fashion to promote the survival and proliferation of adjacent neoplastic cells. In support of this concept, tumor growth kinetics has been shown to accelerate during the treatment intervals (Kim and Tannock, Nat. Rev. Cancer 5:516-525,
2005) . This rapid tumor repopulation is viewed as major cause of treatment failure in some malignancies, and therapies designed to suppress repopulation by using cytostatic agents in a metronomic fashion have improved clinical outcomes.
On the other hand, many cells in human exist in the state of quiescence, which is characterized by reversible exit from the cell cycle. Quiescent cells used to be described to have reduced size, nucleotide synthesis, and metabolic activity. However, recent studies reported that primary human fibroblasts continue to exhibit high metabolic rates when induced into quiescence via contact inhibition (Coller et ah, PLoS Biol. 4:e83,
2006) . By monitoring isotope labeling through metabolic pathways and quantitatively identifying fluxes from the data, some laboratories have shown that contact-inhibited fibroblasts utilize glucose in all branches of central carbon metabolism at rates similar to those of proliferating cells, with greater overflow flux from the pentose phosphate pathway back to glycolysis (Lemons et ah, PLoS Biol. 8:el000514, 2010). The high metabolic activity of the fibroblasts was partially directed to breakdown and re-synthesis of protein and lipid, and partially to excretion of extracellular matrix proteins. Thus, reduced metabolic activity per se is actually not a hallmark of the quiescent state. Quiescent fibroblasts, relieved of the biosynthetic requirements associated with generating progeny, maintain their metabolic activity to preservation of self-integrity and alternative functions beneficial to the organism as a whole.
Quiescent cells sustain DNA damage and a unique gene expression program is induced upon DNA damage in quiescent cells. Cells that have withdrawn from the cell cycle do not proliferate. Such cells, which are in the GQ phase of the cell cycle, are also termed post-mitotic cells, non-cycling cells, or resting cells.
RESULTS
Quescent cells sustain DNA damage and Unique gene expression program upon DNA damage in quiescent cells
Cell that have withdrawn from the cell cycle do not proliferate. Such cells, which are in the G0 phase of the cell cycle, are also termed post-mitotic cells, non-cycling cells, or resting cells. In this Example, human primary prostate fibroblast line, PSC27, was induced to quiescence by exposure to mitogen deprivation, or growth to maximal confluency ("contact inhibition") (Figure 16, left panel). Each of these arrest protocols caused greater than a 90 % decrease in the fraction of cells undergoing DNA synthesis, as indicated by flow cytometry of collected cells (Figure 17). Not surprisingly, about 7 to 10 days after proliferating fibroblasts were exposed to ionizing radiation, cells exhibited typical senescence morphology, including enlarged, flattened shape, expanding nuclei and nucleoli, with multiple granular vacuoles present in the cytoplasm. In contrast, when quiescent cells generated by mitogen withdrawal were treated the same way, they exhibited elongated spindle shape, while those induced quiescent by contact inhibition remained in compact and compressed state, not in line with damaged cells that were proliferation (Figure 16, right panel).
Example 1 describes a stroma-specific, DNA damage secretory phenotype (DDSP) that is unique, robust and universal in human fibroblasts, and such phenotype exert profound influences to the tumor microenvironment, including but not limited to increased epithelial growth, migration, invasion and resistance to anticancer treatments. Many cells in the human body are in a reversible state of quiescence, where they have exited the cell cycle but retain the capacity to re-enter it and divide again under in vivo conditions. Quiescent fibroblasts remain highly metabolically active even though they are not dividing, and they degrade and re-synthesize protein and fatty acid, and secrete large amounts of protein into the extracellular environment (Lemons et al., PLoS Biol 8:el000514, 2010). The goal of this example was to determine whether there is a novel set of genes whose expression is specifically associated with DNA damage response in the quiescent fibroblasts, as is similar to or distinct from what we have found for proliferating human prostate fibroblasts. DNA microarrays were used to compare patterns of gene expression in growing cells and cells arrested upon contact inhibition under the culture conditions (Figure 21).
Interestingly, many of DDSP-associated genes had similar expression pattern change in quiescent cells as compared with those occurring in proliferating cells. However, their expression fold change was mostly less than that in proliferating fibroblasts, in particular IL-8, IL-1B and IL-7 (Figure 18). In addition, atypical alteration was observed for some genes implicated in cell proliferation or cell cycle arrest, including pl6, p21, p53, Cyclin A, Cyclin D2, PCNA and MCM3. Some soluble factors, including AREG, EREG, GAL, MMP3 and WNT16B exhibited similar tendency with cytokines, although GM-CSF, Groa and MCP2 were differentially regulated, potentially by some other mechanisms. As a negative control, IL-2 expression did not change substantially, suggesting the DNA damage-induced gene expression change does not cover the entire spectrum of cytokines or secreted factors, instead, only a handful of the total extracellular proteins.
It is established that quiescent cells are reversibly growth-arrested, and can be induced to resume proliferation under certain conditions including exposure to growth factors, cytokine, hormones, or chemical agents, thus distinct from terminally differentiated cells that are definitively withdrawn from the cell cycle. To examine whether such cells are able to follow the complete expression fold change as proved by stromal cells damaged in the proliferative phase, the quiescent cells were released from Go after they were subject to DNA damage, by allowing them to reestablish in vessels of larger growth area or subcultured into multiple vessels. Interestingly, majority of them were able to reach a full expression fold change when normalized to their basic status, quiescence, as compared with proliferating stromal cells exposed to DNA damaging agents. Clearly, this demonstrates that quiescent cells retain their proliferative potential and DDSP development capacity once allowed to exit from their GQ phase.
Quiescent cells can be senescent and reserve intact DNA damage response Although quiescent cells are not proliferating, do they respond by entering senescence when exposed to DNA damaging agent? To address this, the phenotype of PSC27 cells was examined after treatment with ionizing radiation by applying senescence-associated β-Gal (SA-B-Gal) staining, an indicator of cellular senescence, and found quiescent cells demonstrated significantly enhanced staining about 7 to 10 days after DNA damage (Figure 19). Not only the percentage of positively stained quiescent cells before treatment as a basal control is close to that of proliferating cells, but the ratio of SA-B-Gal stained cells resembles that of the PSC27 fibroblasts upon radiation.
Following this, the extent of quiescent cells in activation of a typical DNA damage response (DDR) was examined by applying immunofluorescence staining with γ- H2AX antibody on cells maintained under culture conditions. Quiescent cells induced by either mitogen withdrawal or contact inhibition have similar formation of DNA damage foci, suggesting quiescence itself does not cause lesions to DNA strands; more importantly, once cells were exposed to radiation, quiescence cells exhibited robust DDR activation, and there was no significant difference between proliferating and quiescent fibroblasts (Figure 20).
Example 4
In this example, the DDSP component, glial cell line-derived neurotrophic factor (GDNF), is examined for its growth promoting, pro-invasive, and resistance-inducing potential. Importantly, cancer stem cells are known to respond to specific molecular cues from their cellular niche. It is likely that the microenvironment-derived DDSP components, including GDNF, exert potent pro-survival and therapy-resistance phenotypes in prostate cancer stem cells and these effects will be determined using in vitro and in vivo assays. In proof-of-principle studies, Wntl6B was identified as the first active component in the DDSP with therapy-resistance activity. However, Wntl6B only accounted for about ½ of the DDSP induced effects. Thus, additional components secreted by the tumor microenvironment upon DNA-damage are being examined, which act in an additive or synergistic manner to Wntl6B and/or GDNF. Preliminary data from Example 1 demonstrated that GDNF exerted proliferation-inducing effects on both epithelial cancer cells as well as on the damaged tumor stroma itself.
Glial cell line-derived neurotrophic factor (GDNF) was identified as one of the secreted factors of the DDSP in human prostate tumor microenvironment upon DNA damage (See Example 1 above). It was also identified as activated in reactive prostate cancer associated tumor stroma in a cohort of grade 3 cancers in an independent study (Dakhova et al, Clin. Cancer Res. 15:3979-3989, 2009). GDNF was originally identified in glioma cell supernatant as a trophic factor for dopaminergic neurons. It signals via the GDNF family receptor alpha 1 (GFRA1) and the trans-membrane receptor kinase RET, activating pro-survival and pro-proliferative signaling cascades via activation of Src family kinases (SFK) and the Ras/Raf/Erk pathway. GDNF binds to GFRA1 which can activate SFK signaling if GFRA1 is in its GPI anchored form and bound to the cell membrane. The GDNF/GFRA1 complex in both its soluble form and when GPI anchored binds to the RET receptor additionally activating the MEK/Erk pathway via RET trans-activation at its intracellular domain. Adult human stem cells are tightly regulated by their cellular niche which dictates self-renewal, proliferation and precursor differentiation. Adult spermatogonial stem cells (SSCs) up-regulate the expression of the transcription factor encoding genes bcl6b, etv5 and Ihxl upon GDNF stimulation, which regulate stem cell self-renewal and proliferation (Oatley and Brinster, Annu. Rev. Cell Dev. Biol. 24:263-286, 2008) indicating additional roles of GDNF in stem cell regulation. If GDNF is involved in PCSC regulation remains elusive.
The mechanism(s) that promote GDNF expression upon DNA damage in prostate cancer remains ill defined. However, several studies indicate that active FGF signaling via either PI3K/Akt or MEK/Erk and subsequent activation of the transcription factor CREB lead to the induction of GDNF expression in cancer cells (Tanabe et al. , Brain Res 1463:21-29, 2010; Tsuchioka et al, Brain Res. 1384: 1-8, 2011; Obara et al, Cell Signal, 23:666-672, 2011]. FGF expression and secretion is enhanced upon DNA damage in a variety of tissues including fibroblasts and adult stem cells (Haimovitz-Friedman et al, Cancer Res. 51 :2552-8, 1991; Harfouche et al, Stem Cells 28: 1639-48, 2010; Wondergem et al, Atherosclerosis 11 '5:59-67, 2004), suggesting a DNA damage induced, FGF/CPvEB mediated GDNF inducing control mechanism. However, this mechanism awaits experimental verification in CaP.
GDNF expression was increased in these experiments by at least 6-fold in all of the three DNA damaging conditions (Figure 22A). We confirmed the induction of GDNF expression was confirmed by qPCR in independent experiments in primary human prostate fibroblasts (PSC27 cells) and also included a treatment group with Mitoxantrone, a drug originally used in the neo-adjuvant study known to induce DNA damage by disrupting DNA synthesis and repair (Figure 22B and 22C). GDNF induction was consistently found upon DNA damage and GDNF expression levels gradually increase over time post treatment reaching an induction > 3 -fold after approximately 4 days and increasing afterwards.
Both components of the GDNF receptor complex, RET and GFRA1, are expressed in CaP in both epithelial and stromal cells as determined by IHC staining. Expression of GDNF itself was only found in tumor stromal cells but not in the epithelial cancer cells in all samples analyzed, further supporting the concept that damage to components of the tumor microenvironment exerts paracrine-effects toward surviving tumor cells. An analysis of gene and protein expression showed that > 95% of CaP express the RET receptor and > 80 % express GFRAl, indicating that the majority of CaP are, via at least one pathway, GDNF sensitive. The patient samples are being used from a neo-adjuvant study to confirm the up-regulation of GDNF in the CaP stroma by IHC and qPCR using RNA from micro-dissected tumor stroma after DNA damaging therapy. To study the effect GDNF has on tumor growth, we have used two experimental approaches have been used. 1) the effect of purified GDNF on cell proliferation of epithelial cells was analyzed and 2) GDNF over-expressing and secreting human prostate fibroblasts were generated which can also be used in co-culture and in vivo experiments. Stimulation of epithelial CaP cells with increasing concentrations of GDNF induced cell proliferation in cell lines expressing GFRAl alone or GFRAl in combination with RET whereas double negative epithelial cell lines did not show any increase in proliferation (Figure 23 A). GDNF can act in the absence of RET via GFRAl activating SFK pathways or through the activation of the RET/GFRAl complex activating the Ras/Raf/Erk pathway. In our experiments we determined that both pathways were activated in GDNF sensitive cell lines (Figure 23B). These data shows that the DNA damage in tumor stroma can cause increased proliferation and survival in prostate cancer cells via the secretion of GDNF. The number of epithelial cell lines are being expanded and analyzed after GDNF stimulation. GDNF-activated SFK and Erk pathways can lead to reduced sensitivity to pro-apoptotic treatments or decrease drug sensitivity.
Stimulation of epithelial CaP cells with GDNF leads to the activation of the SFK and the Ras/Raf/Erk pathways (Figure 25). To determine if the same pathways are involved in the pro-proliferative effect on the PSC27 stromal cells, PSC27 cells were stimulated with hrGDNF or conditioned medium from PSC27/iGDNF-V5 cells. The results show, that the same pathways activated in epithelial cells are also stimulated by both purified GDNF and CM in stromal cells (Figure 24). Additional more downstream effector proteins potentially involved in these effects are also being examined.
The GDNF over-expressing cell lines can be used to determine the role of this growth factor in prostate cancer progression and therapy resistance: i) co-cultures with epithelial cells can be used to determine the growth changing effect these cells have on prostate cancer. Based on these results, ii) epithelial CaP cells can be implanted in a mix with the PSC27/iGDNF-V5 cells either subcutaneously or into the renal capsule of immune-compromised mice to analyze in vivo growth differences. These tumors can be further used to analyze the effect GDNF has on the tumor micro-architecture, gene expression and vascularization, iii) the conditioned medium of these cells can be used to analyze the effect GDNF has on epithelial cell proliferation and in particular treatment resistance. DNA damage activates multiple DNA repair, cell cycle arrest and signaling cascades. In the case of Wntl6B it was shown that the activation of the NF-kB pathway led to the induction and secretion of Wntl6B. (See Example 1 above). For GDNF, FGF signaling has been suggested to induce expression upon DNA damage. If primary prostate stromal cells are treated with a mTOR-inhibiting Rapamycin analog (rapalog), the induction of GDNF is greatly reduced or, in some cases, even completely blocked (Figure 26). mTOR function is known to control translation initiation and this effect can be highly mRNA species specific, however, it also affects gene expression at the transcription level. Rapalog treatment does not block transcription in these cells in toto. For example, MYC expression is unaffected upon rapalog treatment in the above data set. Therefore, the mechanism(s) by which mTOR inhibition suppresses GDNF transcription will be evaluated. Further analysis of whether pre-treatment of stromal cells and stromal- epithelial cell mixtures with rapalogs blocks the induction of the DDSP or DDSP components and thereby would limit the growth stimulating effects of, among others, GDNF and Wntl6B can also be examined.
Wntl6B expression is induced by NF-kB signaling upon DNA damage (See Example 1 above). When human prostate stromal cells are treated with a NF-kB inhibitor, this blocks the induction of Wntl6B, however, GDNF gene expression is not affected. This indicates that there are at least two different, additive mechanisms controlling the expression of DDSP components after DNA damage. The two regulatory mechanisms via NFkB and mTOR control the DDSP can be examined.
GDNF and Wntl6B are but two out of > 30 components of the DNA damage response program with the potential to influence tumor phenotypes. The above studies indicate that specifically co-targeting GDNF- and Wnt-mediated signaling in the context of conventional cytotoxic modalities has the potential to diminish therapy resistance.
Optimizing radiotherapy and chemotherapy for the treatment of malignant neoplasms has relied on the iterative development and testing of models involving tumor growth dynamics, mutation rates, and cell-kill kinetics. Unfortunately, the most theoretically-effective tumoricidal strategies must be tempered by detrimental effects toward the host. This reality has led to regimens in which therapies are administered at intervals or cycles to avoid irreparable damage to vital functions. However, the recovery and repopulation of tumor cells between treatment cycles is a major cause of treatment failure (Kim and Tannock, Nat. Rev. Cancer 5:516-525, 2005; Tredan et ah, J. Natl. Cancer Inst. 99: 1441-1454, 2007). Interestingly, rates of repopulation have been shown to accelerate in the intervals between successive courses of treatment, and it is common for solid tumors to show initial responses followed by re-growth and subsequent resistance to further chemotherapy. Previous results indicate that damage responses in benign cells comprising the tumor microenvironment may directly contribute to enhanced tumor growth kinetics. As outlined above, tumor repopulation probably occurs via activation and selection of resistant cells or PCSC. The accelerated re-growth after treatment cycles can indicate refined selection for cells not responding to treatment or for cells more responsive to DDSP components (or a combination of both). GDNF induces stem cell renewal and proliferation and anti-cancer treatment resistance in other cancer types, indicating a potential role for GDNF in the tumor repopulation of CRPC (Plaza- Menacho et al, Oncogene, 29:4648-4657, 2010; Hansford and Marshall, Neurosci. Lett. 389:77-82, 2005; Kubota Et al. , Proc. Natl. Acad. Sci. USA, 101 :16489-16494, 2004).
These findings support several conclusions: first, the outcomes of genotoxic exposures to any specific benign or neoplastic cell depend on the integration of innate damage response capabilities and the context of the TME; second, although intrinsic drug resistance is clearly operative in some cancers, acquired resistance can also occur without alterations in intrinsic cellular chemosensitivity (Davis and Tannock, Lancet Oncol. 1 :86- 93, 2000), and the results on GDNF and Wntl6B provide strong support for previous studies that implicate the tumor microenvironment as an important contributor (Meads, et al, Clin. Cancer Res. 14:2519-2526, 2008); third, the composition of the microenvironment damage response indicates a potential to promote resistance to pathway-targeted agents such as EGFR inhibitors as these drugs must contend with damage-enhanced local concentrations of competing ligands. Finally, specific effector proteins such as GDNF or Wntl6B represent attractive microenvironment targets that may avoid side-effects of more general therapeutics. However, the complexity of the damage response program also supports strategies focused on upstream master regulators, such as NFKB (Chien et al., Genes Dev., 25:2125-2136, 2011.) and mTOR, that can be more efficient and effective adjuncts to cytotoxic therapies, provided side-effects are tolerable. The exact interplay between GDNF, Wntl6B and the remaining DDSP components can be defined by these methods. The effect of GDNF and other individual key DDSP components on prostate cancer cell proliferation, migration and treatment resistance in vitro and in vivo can be determined.
The study performed on Wntl6B in Example 1 has served as a model for the analysis of GDNF and additional DDSP components. Using the above findings as a staring point, the analysis of GDNF (and other factors)can be analyzed. For example, GDNF expression and secretion in patient samples can be examined after treatment to confirm GDNF activation in an expanded cohort. In parallel, additional human primary fibroblasts can be tested for the up-regulation of GDNF after DNA damage, also expanding to stromal cells from other cancer types like breast cancer. The effect GDNF has on the IC50 concentrations of standard chemotherapeutics and irradiation in both epithelial and stromal cells can be analyzed to determine a potential pro-resistance effect. The PSC27/iGDNF-V5 cells can be used to analyze the effects of GDNF through in vitro co-culture experiments, which form the basis for the subsequent in vivo analysis (as described below). The effect GDNF has on global gene expression in stromal and epithelial cells can be examined to identify factors of the DDSP controlled by GDNF or functionally related to the observed phenotypes (MMPs, MDR genes, and the like). The expression data shown above after rapalog treatment can be used to expand the analysis of how GDNF is regulated, primarily focusing on mTOR and FGF signaling. The analysis can also be expanded to other cancer types, primarily to breast cancer. A particular emphasis will be given to the analysis of the effects of GDNF and other DDSP components on PCSC. The Lin-;Trop2+;CD49f+ (LTC+) cell population has been shown to have PCSC characteristics in CaP. These cells can be analyzed in respect of prosta-sphere (indicative of stem cell differentiation) or cancer-sphere formation, matrigel 3D sphere formation capacity and trans-well invasion potential when inoculated with GDNF or using GDNF as chemo-attractant. PSC27 prostate fibroblasts can be transduced with shRNA targeting GDNF, RET and GFRA1 using a lenti-viral strategy. This will provide a more in depth analysis in co-culture experiments as well as in co-culture in vivo models. Co-cultures of CaP cells and stable target knock-down or over expression stromal cells (shRNA or pLX304-GDNF-V5) can be implanted into the renal capsule of immunocompromised SCID mice. Xenograft growth can be monitored at least bi-weekly for up to 12 weeks. At termination, tumors can be analyzed for mitotic figures, vascularization, weight, volume, and marker expression. Histological analysis and re- culturing can be done depending on the initial findings.
DDSP components can be analyzed for Wntl6B additive or synergistic effects. Based on our current data, Wntl6B contributes approximately ½ of the growth promoting effect of the DDSP. The effect of GDNF can be quantified as a fraction of the full DDSP. GDNF might also act in an additive or synergistic effect together with Wntl6B. For example, the initial screen performed above identified SFRP2 as substantially induced by DNA damage. SFRP2 has traditionally been thought to function as a Wnt- signaling antagonist, but the studies above indicate that SFRP2 promotes Wntl6B effects toward frizzled receptor signaling. Therefore, siRNA knock-down screen can be performed for active DDSP components on "benign" fibroblasts, PSC27shRNA-Wntl6B and PCS27shRNA-GDNF cells enabling the detection of elements which induce a significant change in this setting even if they are not detectable when knocked down alone. PSC27shRNA-Wntl6B and PCS27shRNA-GDNF cells can be transfected with siRNA targeting individual DDSP components leading to the simultaneous loss or down regulation of two DDSP components. Once achieved, these cells can then be used to generate conditioned medium after DDSP induction or for co-culture experiments. Since the effects of Wntl6B have been scrutinized before, the readout will be relatively simple as it will be de facto a single factor problem. All experimental approaches as outlined above are also applicable to this study.
Since these screens can be performed mostly using in vitro systems, it will be important to confirm DDSP component candidate expression in human tumor samples. A candidate component will be analyzed for expression by IHC in samples of prostate tumors after neoadjuvant therapy with DNA damaging agents with confirmed DDSP induction.
The effect of the full DDSP on PCSC and the potential to induce stem like characteristics in non-stem like cancer cells can be determined. Stem cells closely interact with their surrounding niche and reciprocal signal exchange is a key component of SC regulation. Thereby, the niche is both necessary and required to maintain the characteristics of non-transformed SC in various tissues and organs. Several components of the DDSP, including GDNF, likely modulate adult SC function, and the DDSP can likely also influence the differential survival of PCSC following genotoxic therapy. The expression levels of stem cell markers and PCSC markers can be determined in benign and neoplastic prostate epithelial cells with and without exposure to the stromal cell factors and separately, epithelial cell DDSP program from conditioned medium. Initial markers will include Nestin, Sox2, CD133, Trop2, CD49f, ALDH1A1, Bmi-1, integrin α2β11ιί, c-Met and Lin.
Approaches have been developed for isolating, propagating and characterizing prostate cancer stem cells based on lineage markers (L), Trop2 expression (T) and CD49f (C) expression. These LTC+ cells show distinct features including the potential of clonal expansion, unlimited replication, sphere formation including 3D matrigel cultures or in vivo tumorigenicity. To date, it is not clear how the tumor microenvironment, and more specifically, the altered microenvironment following genotoxic damage, influences this cell population. The PCSC enhancing effects the DDSP could have on both LTC+ and LTC" cells of various CaP cell lines and ex vivo cells can be examined. These examinations can involve determining if the microenvironment DDSP will enhance the establishment of tumors from individual or small numbers of LTC+ versus LTC" tumor cells and assessing whether the DDSP can modulate tumor growth and survival following cytotoxic therapeutics.
Identification and exploration of "drugable" DDSP activated pathways to block or reduce tumor promoting effects in vitro and in vivo: ultimately impact the survival of patients with advanced prostate cancer. Co-targeting components of the DDSP in the tumor microenvironment or blocking the DDSP-inducing pathways will enhance the response rates of conventional genotoxic treatments. Based on the targets identified in vitro and in vivo (see above), suitable inhibitors can be found to assess the efficiency of anti-DDSP or anti-DDSP component combination strategies {e.g., anti-Wnt/p-catenin signaling, RET inhibitors and/or rapalogs to block GDNF induction). GDNF represents an attractive DDSP target as pharmacological inhibitors of the RET tyrosine kinase have been developed and one, vandetanib, was recently approved for clinical use (REF). Studies can be conducted that involve co-administration of a vandetanib (and other RET TKI inhibitors) in conjunction with the genotoxic chemotherapeutic Mitoxantrone. The primary readout will be the reduction of proliferation rates, susceptibility to therapy (apoptosis), loss of LTC+ cell population, and loss of tumorigenic potential. An anti- DDSP combination therapy can be examined in vivo and subsequently in combination with chemo-therapy and radiotherapy. The renal capsule in vivo model of CaP can be used to assess the in vivo applicability of regimens which have shown promising results in vitro. The corollary will involve the examination of antagonism of upstream 'master regulators' of the DDSP, rather than specific individual effector proteins that can be targeted. For example, evidence is provided above that mTOR regulates major components of the full DDSP, and not only GDNF, and that mTOR inhibitors such as rapamycin or RADOOl effectively suppress key DDSP proteins including Wntl6B. As such, RADOOl can be combined, to suppress the microenvironment DDSP with or prior to genotoxic therapy (e.g., mitoxantrone) to assess for enhanced tumor regression.
While the preferred embodiment of the invention has been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.

Claims

CLAIMS The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:
1. A method for enhancing the effectiveness of a cancer therapeutic by administering an agent that inhibits the activity of a gene encoding an extracellular protein that is increased subsequent to treatment of a patient with a genotoxic agent.
2. The method according to claim 1, wherein the cancer therapeutic is a genotoxic agent.
3. The method according to claim 1 and claim 2, wherein the polypeptide or protein encoded by the gene encoding the extracellular protein is matrix metallopeptidase 1 (interstitial collagenase) (MMP1), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1) (SPINK1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N- acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFP1), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINI1), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A).
4. The method according to claim 3, wherein the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1) (SPINK1), and/or glial cell derived neurotrophic factor (GDNF).
5. A method for determining the effectiveness of a cancer therapeutic in a patient comprising:
i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and
iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample;
wherein a decreased or unchanged level of the at least one extracellular protein is indicative of effectiveness of the cancer therapeutic and wherein an increased level of the at least one extracellular protein is indicative of a decreased effectiveness of the cancer therapeutic.
6. The method according to claim 5, wherein the cancer therapeutic is a genotoxic agent.
7. The method according to claim 5 and claim 6, wherein the extracellular protein is matrix metallopeptidase 1 (interstitial collagenase)(MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1)(SPINK1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N- acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFP1), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINI1), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A).
8. The method according to claim 7, wherein the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1)(SPINK1), and/or glial cell derived neurotrophic factor (GDNF).
9. A method for determining a prognosis in a cancer patient treated with a cancer therapeutic; comprising
i) obtaining a sample of a tumor microenvironment from the patient; ii) measuring the level of expression of at least one extracellular protein in the sample; and
iii) assessing whether the level of the at least one extracellular protein is increased as compared with a control sample;
wherein a decreased or unchanged level of expression of the at least one extracellular protein is determinant of a more favorable prognosis and wherein an increase in the expression of the at least one extracellular protein is determinant of a less favorable prognosis.
10. The method according to claim 9, wherein the cancer therapeutic is a genotoxic agent.
11. The method according to claim 9 and claim 10, wherein the extracellular protein is matrix metallopeptidase 1 (interstitial collagenase)(MMPl), Wingless-type MMTV integration site family member 16B (WNT16B), secreted fizzled-related protein 2 (SFRP2), matrix metallopeptidase 12 (MMP12), serine peptidase inhibitor (Kazal type 1)(SPINK1), matrix metallopeptidase 10 (stromelysin 2)(MMP10), ectonucleotide pyrophosphatase/phosphodiesterase 5 (ENPP5), epiregulin (EREG), bone morphogenic protein 6 (BMP6), angiopoietin-like 4 (ANGPTL4), chondroitin sulfate N- acetylgalactosaminyltransferase (CSGALNACT), chemokine (C-C motif) ligand 26 (CCL26), ampiregulin (AREG), angioplastin 1 (ANGPT1), cholecystokinin (CCK), thrombomodulin (THBD), chemokine (C-X-C motif) ligand 14 (CXCL14), novoblastoma overexpressed protein (NOV), galanin prepropeptide (GAL), natriuretic peptide C (NPPC), family with sequence similarity 150, member B (FAM150B), cystatin SN (CST1), glial cell derived neurotrophic factor (GDNF), mucin- like 1 (MUCL1), neuronal pentaraxin II (NPTX2), transmembrane protein 155 (TMEM155), endothelin 1 (EDN1), pregnancy specific beta- 1 -glycoprotein 9 (PSG9), ADAM metallopeptidease with thrombospondin type 1 motif, 3 (ADAMTS3), CD24, pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP), chemokine (C-X-C motif) ligand 3 (CXCL3), matrix metallopeptidase 3 (stromelysin 1, progelatinase (MMP3), cystatin SA (CST2), pregnancy specific beta- 1 -glycoprotein 8 (PSG8), procollagen C-endopeptidase enhancer 2 (PCOLCE2), pregnancy specific beta- 1 -glycoprotein 7 (PSG7), tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), chromosome 17 open reading frame 67 (C17orfl7), calcitonin-related polypeptide alpha (CALCA), fibroblast growth factor 18 (FGF18), bone morphogenic protein 2 (BMP2), matrilin 3 (MATN3), transferring pseudogene 1 (TFP1), serpin peptidase inhibitor, clade 1, member 1 (neuroserpin) (SERPINIl), tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), or interleukin 23, alpha subunit pl9 (IL23A).
12. The method according to claim 11, wherein the at least one extracellular protein is WNT16B, secreted fizzled-related protein 2 (SFRP2), serine peptidase inhibitor (Kazal type 1)(SPINK1), and/or glial cell derived neurotrophic factor (GDNF).
PCT/US2013/053425 2012-08-02 2013-08-02 Treatment induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins Ceased WO2014022774A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/418,789 US9759725B2 (en) 2012-08-02 2013-08-02 Treatment-induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261678972P 2012-08-02 2012-08-02
US61/678,972 2012-08-02

Publications (1)

Publication Number Publication Date
WO2014022774A1 true WO2014022774A1 (en) 2014-02-06

Family

ID=50028566

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/053425 Ceased WO2014022774A1 (en) 2012-08-02 2013-08-02 Treatment induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins

Country Status (2)

Country Link
US (1) US9759725B2 (en)
WO (1) WO2014022774A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115991769A (en) * 2015-03-27 2023-04-21 中国科学院上海营养与健康研究所 Application of the antibody specifically targeting WNT16B in the preparation of antitumor drugs

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119818670A (en) * 2018-09-27 2025-04-15 Musc研究发展基金会 Pharmaceutical composition for treating cancer
LT6784B (en) * 2019-04-09 2020-12-10 Vilniaus Universitetas Automated tumour-stroma interface zone detection for anti-tumour response assessment by immunogradient indicators

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090075299A1 (en) * 2007-09-14 2009-03-19 Meso Scale Technologies, Llc Diagnostic Methods
US20090285832A1 (en) * 2008-05-15 2009-11-19 Bin Tean Teh Methods for treating sunitinib-resistant carcinoma and related biomarkers
US20110064739A1 (en) * 2008-03-28 2011-03-17 Borlak Juergen Medicament, compositions, and substances for treating and identifying adenocarcinoma of the lung
US20110152106A1 (en) * 2008-04-21 2011-06-23 Korea Research Institute Of Bioscience And Biotechnology Cst1, dcc1, ifitm1 or melk as markers for diagnosing stomach cancer

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2007104925A (en) * 2004-07-09 2008-08-20 Те Риджентс Оф Те Юниверсити Оф Калифорния (Us) CANCER TREATMENT METHODS USING AGENTS THAT INHIBIT Wnt16 SIGNAL WAY

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090075299A1 (en) * 2007-09-14 2009-03-19 Meso Scale Technologies, Llc Diagnostic Methods
US20110064739A1 (en) * 2008-03-28 2011-03-17 Borlak Juergen Medicament, compositions, and substances for treating and identifying adenocarcinoma of the lung
US20110152106A1 (en) * 2008-04-21 2011-06-23 Korea Research Institute Of Bioscience And Biotechnology Cst1, dcc1, ifitm1 or melk as markers for diagnosing stomach cancer
US20090285832A1 (en) * 2008-05-15 2009-11-19 Bin Tean Teh Methods for treating sunitinib-resistant carcinoma and related biomarkers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SUN ET AL.: "Treatment-induced damage to the tumor microenvironment promotes prostate cancer therapy resistance through WNT16B", NATURE MEDICINE, vol. 18, no. 9, 5 August 2012 (2012-08-05), pages 1359 - 1368 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115991769A (en) * 2015-03-27 2023-04-21 中国科学院上海营养与健康研究所 Application of the antibody specifically targeting WNT16B in the preparation of antitumor drugs

Also Published As

Publication number Publication date
US20150309037A1 (en) 2015-10-29
US9759725B2 (en) 2017-09-12

Similar Documents

Publication Publication Date Title
Song et al. Targeting FOXA1-mediated repression of TGF-β signaling suppresses castration-resistant prostate cancer progression
Lim et al. Crosstalk between GBM cells and mesenchymal stemlike cells promotes the invasiveness of GBM through the C5a/p38/ZEB1 axis
Kenny et al. Mesothelial cells promote early ovarian cancer metastasis through fibronectin secretion
Zhao et al. Blockade of CXCL12/CXCR4 signaling inhibits intrahepatic cholangiocarcinoma progression and metastasis via inactivation of canonical Wnt pathway
Li et al. Maternal embryonic leucine zipper kinase serves as a poor prognosis marker and therapeutic target in gastric cancer
US11397182B2 (en) Methods for prognosing and preventing metastatic liver disease
US11344601B2 (en) Tumor microenvironment-related target TAK1 and application thereof in inhibition of tumor
Liu et al. BMI1 promotes cholangiocarcinoma progression and correlates with antitumor immunity in an exosome-dependent manner
Chen et al. Distinct roles of PIK3CA in the enrichment and maintenance of cancer stem cells in head and neck squamous cell carcinoma
Yang et al. Therapeutic potential of cancer stem cells
Wang et al. Upregulation of ALDH1B1 promotes tumor progression in osteosarcoma
FR3022142A1 (en) INHIBITION OF CCL7 CHEMOKINE OR CCR3 RECEPTOR FOR THE TREATMENT AND DIAGNOSIS OF PROSTATE CANCER
US9759725B2 (en) Treatment-induced damage to the tumor micro-environment promotes cancer therapy resistance through extracellular proteins
US9745578B2 (en) Targeting microRNA miR-409-3P to treat prostate cancer
CN113876953B (en) Novel cell aging intervention target and targeted application thereof in chemotherapy and cancer resistance
EP2699696B1 (en) Molecular subtyping, prognosis and treatment of prostate cancer
KR102150239B1 (en) Anticarcinogenic composition comprising an inhibitor of DRG2 as an active ingredient
CN111040032A (en) Application of bidirectional regulator in preparation of preparation for diagnosing or regulating cell senescence and tumors
WO2016094697A2 (en) Targeting breast cancer therapy based on stromal subtypes and cd146 composition
US20220403395A1 (en) Composition for inhibiting growth of cancer stem cells, containing wdr34 inhibitor, and use thereof
CN111110849B (en) Application of serine protease inhibitor Kazal 1 in preparation of cell aging and tumor diagnosis or regulation preparation
CN119061140B (en) Targeting CYP3A5 for glioma treatment
JP5119546B2 (en) Diagnosis of malignant transformation of gastrointestinal stromal tumor originating in the stomach
Bukhari Evaluating Synthetic Lethal Interactions in DNA Damage Signaling for Breast Cancer Therapy
CN115991769A (en) Application of the antibody specifically targeting WNT16B in the preparation of antitumor drugs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13824816

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14418789

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13824816

Country of ref document: EP

Kind code of ref document: A1