WO2014015227A1 - Engineering cell surfaces for orthogonal selectability - Google Patents

Engineering cell surfaces for orthogonal selectability Download PDF

Info

Publication number
WO2014015227A1
WO2014015227A1 PCT/US2013/051232 US2013051232W WO2014015227A1 WO 2014015227 A1 WO2014015227 A1 WO 2014015227A1 US 2013051232 W US2013051232 W US 2013051232W WO 2014015227 A1 WO2014015227 A1 WO 2014015227A1
Authority
WO
WIPO (PCT)
Prior art keywords
chbd
cell
polypeptide
cells
egfp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/051232
Other languages
French (fr)
Inventor
Yingjie PENG
Richard Lerner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of WO2014015227A1 publication Critical patent/WO2014015227A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • markers have become a standard, procedure in molecular biology.
  • the most frequently used markers are fluorescent proteins and epitope tags.
  • Fluorescent markers such as green fluorescent protein (GFP) allows confirmation that the protein to which it is appended is expressed and enables study of the sub-cellular localization of the protein by fluorescent microscopy as well as isolation of the ceils expressing the protein by fluorescent cell sorting.
  • GFP green fluorescent protein
  • an antigen for which one has a cognate antibody or a peptide that has affinity for a ligand such as rsickei is appended to a protein. It is used to study the localization of a given protein in cells and allows identification of the molecule after analytical procedures and isolation by affinity chromatography.
  • the invention provides methods for engineering a surface selection marker on eukaryotic cells.
  • the methods entail expressing on the surface of the ceils a polypeptide comprising a chitin-binding domain (ChBD) or cellulase-bmding domain (CBD),
  • the polypeptide selection marker is expressed from a vector introduced into the cell
  • the expressed polypeptide additionally contains a eukaryotic transmembrane domain fused to the ChBD or CBD.
  • the expressed surface polypeptide can contain platelet-derived growth factor recepto (PDGFR).
  • the expressed polypeptide can further harbor an. enhanced green fluorescent protein (EGFP).
  • EGFP enhanced green fluorescent protein
  • the methods employ a ChBD that is obtained from Bacillus circular® WL-12 chitinase Al or ChBD from Vibrio harveyi chitinase A.
  • Some methods of the invention are directed to conferring selectability to mammalian cells.
  • the invention provides engineered or recombinant eukaryotic cells (e.g., mammalian ceils) which have been modified to provide a surface marker for caveiuiar selection.
  • the surface marker is a heterologous polypeptide comprising a chitin-binding domain (ChBD) or cellulase -binding domain (CBD),
  • the heterologous polypeptide is expressed from a vector introduced into the cell, in some embodiments, the heterologous polypeptide further comprises a eukaryotic transmembrane domain that is fused to the ChBD or CBD,
  • the ChBD or CBD can be fused to platelet-derived growth factor receptor (PDGFR).
  • PDGFR platelet-derived growth factor receptor
  • the polypeptide can additionally comprise an enhanced green fluorescent protein (EGFP) that is fused to the ChBD.
  • EGFP enhanced green fluorescent protein
  • the heterologous surface selection marker comprises a ChBD that is obtained from Bacillus circular® WL-12 chitinase or ChBD frorn Vibrio harveyi chitinase A.
  • the invention provides isolated or recombinant polypeptides that contain a chitin-binding domain (ChBD) fused to a transmembrane domain of a eukaryotic cell.
  • the polypeptide can have a ChBD obtained from Bacillus circulars WL-12 chitinase or Vibrio harveyi chitinase A.
  • the transmembrane domain is from platelet-derived growth factor receptor (PDGFR).
  • polynucleotides encoding the isolated or recombinant polypeptides are also provided in the invention, in other aspects, the invention provides expression vectors comprising the polynucleotides, host ceils harboring the vectors, as well as transgenic non-human animals which have integrated such vectors.
  • FIGS 1A-1C are schematic diagrams of ChBD-EGFP construct (A), BH1 vector (B), and BH2, Epstein Barr virus based vector (C).
  • the construct used the Ig leader which is the murine Ig kappa-chain V-J2-C signal peptide and included a gene encoding the
  • Hemagglutinin A (HA) epitope before the N-terminus of the ChBD is from Bacillus circular® WL-12 PDGFR TMD is the platelet-derived growth factor receptor transmembrane domain; EGFP is the enhanced green fluorescent protein.
  • a gene encoding the Myc epitope is located between the ChBD and the transmembrane domain.
  • FIGS. 2A-2B show cell surface expression of ChBD- EGFP in BHl transfecied HEK 293T cells allows attachment of cells to chitin-coated beads.
  • B after selection, non ChBD-EGFP expressing ceils did not bind to chitin-coated beads (left), while ChBD-EGFP expressing cells could specifically bind to the chitin-coated beads (right).
  • Figure 3 shows ceil membrane purification facilitated by ChBD.
  • Cell membrane fragments from ChBD-EGFP transfected HEK 293 ⁇ ceils (293T-CG) were studied.
  • Antibodies against two cell membrane marker proteins, al sodium/potassium ATPase and pan Cadherin were used to mark membrane fractions attached to chiti beads (B), the total cellular homogenate (H), and flow-through fraction (FT).
  • B chiti beads
  • H total cellular homogenate
  • FT flow-through fraction
  • Ceil membrane fragments from mock-transfected HEK 293T cells (293T) were studied.
  • Antibody against ⁇ Ac-tin was used to monitor the efficiency of the membrane purification.
  • Figure 4 shows expression of EGFP in mock (left), pBudCE4T -EGFP (middle), and BHl (right)-transfected HEK 293T cells.
  • the invention relates to methods and compositions which enable efficient and robust selection of modified ceils from a population of ceils.
  • Methods of the invention can find wide uses not only for selection of cells but also for isolating cells in vitro and in vivo in any situation where one wishes to trace the fate and ultimately recover a mino population of cells.
  • the present invention was employed for specific recovery of transformed cells and isolation of plasma membrane fragments. With the methods, certain cells can be easily and simply isolated from a population where they may be a minor component.
  • methods of the Invention find various important applications, e.g., in enriching for trans formants, especially when the transformation frequency is low.
  • the methods can facilitate combinatorial antibody selections of phage that bind to cell surfaces where, as for transformants, the target cell can be a minor component of an otherwise large population. Also, such a method would allow for rapid affinity based isolation of plasma membranes for biochemical studies.
  • Methods of the invention typically entail engineered expression on the surface of eukaryotic cells of a heterologous ligand binding domain obtained from some unusual enzymes such as chitin-btnding domain (ChBD), thereby conferring orthogonal seleciabiliiy to the target cells.
  • a heterologous ligand binding domain obtained from some unusual enzymes such as chitin-btnding domain (ChBD), thereby conferring orthogonal seleciabiliiy to the target cells.
  • the heterologous ligand binding domain is expressed as a fusion protein with a transmembrane domain on the cell surface.
  • a cellular selection system for affinity selection of ceils and plasma membranes was generated via expression of the chitin- binding domain (ChBD) as a fusion with a transmembrane domain on the surface of eukaryotic cells. Similar selection systems can be based on engineered expression on the cell surface of other ligand binding domains, e.g., or ceilulase binding domain (CBD). Conservatively modified variants of various known ChBDs or CBDs, as well as variant polypeptides with substantially identical sequences, can also be used in the practice of the present invention.
  • ChBD chitin- binding domain
  • CBD ceilulase binding domain
  • Transmembrane domain usually denotes a single transmembrane alpha helix of a transmembrane protein. It is called a "domain” because an alpha-helix in a membrane can fold independently from the rest of the protein, similar to domains of water-soluble proteins. More broadly, a transmembrane domain is any three-dimensional protein structure which is thermodynamically stable in a membrane. This may be a single alpha helix, a stable complex of several transmembrane alpha helices, a transmembrane beta barrel, a beta-helix of gramicidin A, or any other structure.
  • PDGFR platelet-derived growth factor receptor
  • amino acid of a peptide refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoscrirte.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl suifonium.
  • Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Cellulase refers to a suite of enzymes produced chiefly by fungi, bacteria, and protozoans that catalyze celiulolysss (i.e. the iiydrolysis of cellulose). Howe ver, there are also celiulases produced by a fe other types of organisms, such as some termites and the microbial intestinal symbionts of other termites. Several different kinds of celiulases are known, which differ structurally and mechanistically. Cellulases hydrolyze the 1 ,4 ⁇ beta-D ⁇ giycosidic linkages in cellulose, lichenin and cereal beta-D-glucans.
  • Chitinases are hydrolytic enzymes that break down giycosidic bonds in chitin.
  • chitin is a component of the cell walls of fungi and exoske!etai elements of some animals (including worms and arthropods)
  • chitinases are generally found in organisms that either need to reshape their own chitin or dissolve and digest the chitin of fungi or animals
  • Chitinivorous organisms include many bacteria (e.g., Aeromonads, Bacillus, Vibrio), which may be pathogenic or detritivorous. They attack living arthropods, zooplankton or fungi or they may degrade the remains of these organisms.
  • Fungi such as Coecidioid.es imi tts, also possess degradative chitinases related to their role as detritivores and also to their potential as arthropod pathogens. Chitinases are also present in plants (e.g., barley seed chitsnase).
  • 002 J As used herein the term "comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are essentia! to the invention, yet open to the inclusion of unspecified elements, whether essential or not.
  • the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
  • compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • “conservatively modified variants” refer to a variant which has conservative amino acid substitutions, amino acid residues replaced with other amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g..
  • glycine asparaginic, glutamine, serine, threonine, tyrosine, cysteine
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • recombinant host cell refers to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject celt but to the progeny of such a ceil. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell” as used herein,
  • the terra "isolated” means a reference molecule (e.g., a polypeptide or a polynucleotide) is removed from its natural surroundings. However, some of the components found with it may continue to be with an “isolated” molecule. Thus, an "isolated" molecule.
  • polypeptide is not as it appears in nature but may be substantially less than 100% pure protein
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences thai are the same. Two sequences aire “substantially identical” if two sequences have a specified
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region thai is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • nucleic acid sequences or polypeptides are substaniiaily identical
  • the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
  • operably linked refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
  • a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting.
  • some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • a "transgenic animal” refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the celt, directly or indirectly by introduction into a precursor of the ceil, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • the term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but. rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extracbromosomally replicating DNA.
  • vector' is intended to refer to a polynucleotide molecule capable of transporting another polynucleotide to which it has been linked.
  • plasmid refers to a circular double stranded DMA loop into which additional DMA segments may be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host ceil into which they are introduced (e.g., bacteria! vectors having a bacterial origin of replication and eplsomal mammalian vectors).
  • Other vectors e.g., non- episomal mammalian vectors
  • vectors are capable of directing the expression of genes to which they are operativeiy linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, “expression vectors”).
  • Vectors for expressing the fusion polypeptide can be generated in accordance with the techniques described herein and methods routinely practiced in the art, e.g., as described in Sarabrook. et a!.. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., (3 rd ed., 2000): and Brent et ai., Current Protocols in . Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003).
  • vectors expressing the ChBD linked to EGFP on the cell surface were constructed ( Figure 1A).
  • One vector (BHl ) was constructed based on the pBudCE4.1 vector (Invitrogen).
  • the ChBD-EGFP cassette was inserted into the cloning site under the control of the CMV promoter.
  • the second cloning site under the control of the EF ⁇ l a promoter can be used to express another gene of interest ( Figure IB)
  • the other vector (BH2) was constructed based on the pCEP4 vector (Invitrogen).
  • the CMV-ChBD-EGFP and EF-la promoter cassettes from BHl were inserted before the OriP of pCEP4 ( Figure 1C).
  • the methods of the invention are also useful for purification of plasma membranes for biochemical studies.
  • HBK 293T cells that expressed the ChBD on their cell surface were sonicated and the membrane fragments were collected on chitin beads.
  • Gel electrophoresis and western blotting studies showed that this procedure afforded highly purified membrane preparations (Figure 3).
  • the methods of the invention allow selection of eukaryotic cells by engineered expression on the cell of a specific ligand binding domain for selectability, importantly, the binding functionality that is used does not have a counterpart in animal cells thereby endowing the modified cell surface with a property that is orthogonal to animal cells.
  • the methods of the present invention are advantageous over other selection methods currently known in the art, e.g., using antibodies targeting cell surface proteins or the avidin-biotm. system. While antibodies might be an alternative, they generally do not have the affinity of the ChBD and are much more expensive to use.
  • the avidin-biotin system is also inferior because avidin is a tet amer and biotin is an essential vitamin such that the ligand is already present in all cells.
  • polynucleotides DNA or RNA
  • Expression vectors and engineered host cells harbormg the vectors for expressing polynucleotides encoding the polypeptides are also provided in the invention.
  • the polynucleotide encoding the fusion polypeptide is typically operably linked to a promoter in the expression vectors.
  • the expression construct can further encode a signal peptide for translocation of the expressed polypeptide across cell membrane.
  • the expression vectors of the invention are not subject to any particular limitation, and may be, for example, bacteriophages, plasmids, cosmids or phagemids.
  • Plasmid vectors include those based on plasmids from, e.g., E. coli (e.g., pB .322, pBR325, pUCl 18 and pUCl 19), plasmids from Bacillus subti!is (e.g., pUBl ! O and pTP5), and plasmids from yeasts (e.g., YBp l 3, YEp24 and YCp50).
  • E. coli e.g., pB .322, pBR325, pUCl 18 and pUCl 19
  • Bacillus subti!is e.g., pUBl ! O and pTP5
  • yeasts e.g., YBp l 3, YEp24 and YCp50.
  • the expression vectors can also include animal viruses such as retroviruses, vaccinia viruses and insect viruses (e.g., bacu!oviruses).
  • the host ceils to which the vectors are introduced can be any of a variety of expression host cells well known in the art, e.g., bacteria (e.g., E. coli), yeast cell, or animal cells such as CHO, COS or 293 cells, in some preferred ⁇ embodiments, the host cells are recombinant animal cells (e.g., mammalian ceils) which have integrated a polynucleotide encoding the ChBD- or CBD-containing polypeptide and express the polypeptide on the cell surface,
  • Methods of the invention find wide uses not only for selection of cells but also for isolating cells in vitro and in vivo in any situation where one wishes to trace the fate and ultimately recover a minor population of cells.
  • the invention further provides transgenic non-human animals such as mouse strains where the ChBD (or CBD) is either constitutive! ⁇ '- expressed in all cells or inducible in certain cell lineages. This should allow long-term studies on cell fates, where the likely immunogenicity of the ChBD would otherwise be a problem in ceil transfer experiments.
  • cells thai constitutive!' express the ChBD can be followed in other mouse strains where expression of the ChBD is repressed by, for example, tetracycline inactivation of a sensitive tetracyciine-depertdent tra»sactivator.
  • HE 293T cells Human embryonic kidney HE 293T cells were purchased from ATCC, and maintained in DMEM (GIBCO) supplemented with 10% fetal calf serum
  • CMV-CBD-5 ACGCGTCGACATGGAGACAGACACACTCCTGCTATG ⁇ SEQ ID NO: l)
  • CMV-CBD-F CMV-CBD-F:
  • the EGFP fragment was amplified from the pEGFP (Clontech) using the following primers: EF-GFP-5:
  • the ChBD-EGFP fusion was inserted into Sal I and BamB I sites of pBudCE4.1 (Invitrogen). Then the Noil site in EGFP was deleted using QuikChange Lightning Muiti Site-Directed Mutagenesis Kit (Agilent) with the primer
  • Ceil binding BH 1 or pBudC.E4.
  • i -EGFP transfected HEK 29ST cells were mixed with 10-fold non-transfected HEK 293T cells and then incubated with magnetic chitin-coated beads (New England B . iolabs) at room temperature for 1 hr. Then the beads were separated with a magnet and washed 5 times with PBS at room temperature. An aliquot of beads was transferred to slides and observed by fluorescent microscopy.
  • Cell membrane purification BHl or mock transfected HEK 293T cells were harvested, washed 3 times with cold PBS, and then sonicated in 600 ⁇ ! PBS on ice. The homogenate was incubated with magnetic chitin-coated beads blocked with BSA. The beads were separated with magnet and the unbound fraction (flow-through) was collected. The beads were washed 8 times with PBS at room temperature, and resuspended in 600 ⁇ ! PBS, The homogenate, flow-through and bead fractions were treated with SDS-PAGE loading buffer, then loaded 10 ⁇ for western blotting.
  • Antibodies against ctl sodium/potassium ATPase (ab ' 7671 , Abeam) and pan Cadherin (ab22744, Abeam) were used together with secondary HRP-conjugated goat-anti-mouse IgG ( 1030-05, Southern Biotech).
  • HRP- conjugated antibody against ⁇ Actin was purchased from Ceil Signaling,
  • One vector (BHl) was constructed based on the pBudCE4.1 vector (Invitrogen).
  • ChBD-EGFP cassette was inserted into the cloning site under the control of the Cytomegalovirus (CMV) promoter.
  • CMV Cytomegalovirus
  • EF- l a promoter can he used to express another gene of interest.
  • the other vector (BH2) was constructed based on the pCEP4 vector (Invitrogen).
  • the CMV-ChBD-EGFP and EF- l a promoter cassettes from Bill were inserted before the OriP of pCEP4,
  • the construct is anchored to the ceil membrane using the PDGF gene product thai is a protein that spans the plasma membrane. This membrane-spanning domain sits between the ChBD protein that is expressed on the outer surface of the cell and the EGFP protein that is present on the cytoplasmic side of the membrane. Since the EGFP protein is fluorescent it allows for the rapid determination of the efficiency of a given transformation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Description

Engineering Cell Surfaces for Ortliogoiia! Selectabiiit
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001 1 The subject patent application claims the benefit of priority to U.S. Provisional Patent Application Number 61/673,399 (filed July 39, 2012). The full disclosure of the priority application is incorporated herein by reference in its entirety and for all. purposes,
BACKGROUND OF THE INVENTION
[0002] The selective addition of markers to expressed proteins has become a standard, procedure in molecular biology. The most frequently used markers are fluorescent proteins and epitope tags. Fluorescent markers such as green fluorescent protein (GFP) allows confirmation that the protein to which it is appended is expressed and enables study of the sub-cellular localization of the protein by fluorescent microscopy as well as isolation of the ceils expressing the protein by fluorescent cell sorting. Similarly, in protein tagging, an antigen for which one has a cognate antibody or a peptide that has affinity for a ligand such as rsickei is appended to a protein. It is used to study the localization of a given protein in cells and allows identification of the molecule after analytical procedures and isolation by affinity chromatography. Thus, at the level of individual proteins the artisans have a choice of methods to study the expression patterns of the marked protein and even isolate the cells expressing it. by cell sorting. However, there is a need in the art for more robust and cost- effective genetic methods for marking the surface of the cells. The present invention addresses this and other needs by providing novel methods and. compositions useful for cellular selections.
SUMMARY Of THE INVENTION
[0003] In one aspect, the invention provides methods for engineering a surface selection marker on eukaryotic cells. The methods entail expressing on the surface of the ceils a polypeptide comprising a chitin-binding domain (ChBD) or cellulase-bmding domain (CBD), Typically, the polypeptide selection marker is expressed from a vector introduced into the cell In some embodiments, the expressed polypeptide additionally contains a eukaryotic transmembrane domain fused to the ChBD or CBD. For example, the expressed surface polypeptide can contain platelet-derived growth factor recepto (PDGFR). in various embodiments, the expressed polypeptide can further harbor an. enhanced green fluorescent protein (EGFP). In some embodiments, the methods employ a ChBD that is obtained from Bacillus circular® WL-12 chitinase Al or ChBD from Vibrio harveyi chitinase A. Some methods of the invention are directed to conferring selectability to mammalian cells.
|Θ 04| In a related aspect, the invention provides engineered or recombinant eukaryotic cells (e.g., mammalian ceils) which have been modified to provide a surface marker for ceiiuiar selection. Typically, the surface marker is a heterologous polypeptide comprising a chitin-binding domain (ChBD) or cellulase -binding domain (CBD), In some preferred embodiments, the heterologous polypeptide is expressed from a vector introduced into the cell, in some embodiments, the heterologous polypeptide further comprises a eukaryotic transmembrane domain that is fused to the ChBD or CBD, For example, the ChBD or CBD can be fused to platelet-derived growth factor receptor (PDGFR). In some embodiments, the polypeptide can additionally comprise an enhanced green fluorescent protein (EGFP) that is fused to the ChBD. In some engineered cells of the invention, the heterologous surface selection marker comprises a ChBD that is obtained from Bacillus circular® WL-12 chitinase or ChBD frorn Vibrio harveyi chitinase A.
[0095] In another related aspect, the invention provides isolated or recombinant polypeptides that contain a chitin-binding domain (ChBD) fused to a transmembrane domain of a eukaryotic cell. For example, the polypeptide can have a ChBD obtained from Bacillus circulars WL-12 chitinase or Vibrio harveyi chitinase A. In some embodiments, the transmembrane domain is from platelet-derived growth factor receptor (PDGFR).
Polynucleotides encoding the isolated or recombinant polypeptides are also provided in the invention, in other aspects, the invention provides expression vectors comprising the polynucleotides, host ceils harboring the vectors, as well as transgenic non-human animals which have integrated such vectors.
[ΘΘ06] A further understanding of the nature and advantages of the present i nvention may be realized by reference to the remaining portions of the specification and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
|0007] Figures 1A-1C are schematic diagrams of ChBD-EGFP construct (A), BH1 vector (B), and BH2, Epstein Barr virus based vector (C). The construct used the Ig leader which is the murine Ig kappa-chain V-J2-C signal peptide and included a gene encoding the
Hemagglutinin A (HA) epitope before the N-terminus of the ChBD. The ChBD is from Bacillus circular® WL-12 PDGFR TMD is the platelet-derived growth factor receptor transmembrane domain; EGFP is the enhanced green fluorescent protein. A gene encoding the Myc epitope is located between the ChBD and the transmembrane domain.
[0008 Figures 2A-2B show cell surface expression of ChBD- EGFP in BHl transfecied HEK 293T cells allows attachment of cells to chitin-coated beads. A: confocal images show thai no ChBD-EGFP is expressed in mock-transfected HEK 293T cells (left upper), while ChBD is uniformly expressed in BHl transfected HEK 293T cells (right upper). The ChBD co-localizes with wheat germ agglutinin that marks the external surface of the plasma membrane (left bottom and right bottom). B: after selection, non ChBD-EGFP expressing ceils did not bind to chitin-coated beads (left), while ChBD-EGFP expressing cells could specifically bind to the chitin-coated beads (right).
[0009] Figure 3 shows ceil membrane purification facilitated by ChBD. Cell membrane fragments from ChBD-EGFP transfected HEK 293Ϊ ceils (293T-CG) were studied.
Antibodies against two cell membrane marker proteins, al sodium/potassium ATPase and pan Cadherin were used to mark membrane fractions attached to chiti beads (B), the total cellular homogenate (H), and flow-through fraction (FT). As a control, ceil membrane fragments from mock-transfected HEK 293T cells (293T) were studied. Antibody against β Ac-tin was used to monitor the efficiency of the membrane purification.
(0010} Figure 4 shows expression of EGFP in mock (left), pBudCE4T -EGFP (middle), and BHl (right)-transfected HEK 293T cells.
DETAILED DESCRIPTION OF THE INVENTION
(0011 J The invention relates to methods and compositions which enable efficient and robust selection of modified ceils from a population of ceils. Methods of the invention can find wide uses not only for selection of cells but also for isolating cells in vitro and in vivo in any situation where one wishes to trace the fate and ultimately recover a mino population of cells. As exem lification, the present invention was employed for specific recovery of transformed cells and isolation of plasma membrane fragments. With the methods, certain cells can be easily and simply isolated from a population where they may be a minor component. Amongst other uses, methods of the Invention find various important applications, e.g., in enriching for trans formants, especially when the transformation frequency is low. The methods can facilitate combinatorial antibody selections of phage that bind to cell surfaces where, as for transformants, the target cell can be a minor component of an otherwise large population. Also, such a method would allow for rapid affinity based isolation of plasma membranes for biochemical studies.
[0012] Methods of the invention typically entail engineered expression on the surface of eukaryotic cells of a heterologous ligand binding domain obtained from some unusual enzymes such as chitin-btnding domain (ChBD), thereby conferring orthogonal seleciabiliiy to the target cells. In some embodiments, the heterologous ligand binding domain is expressed as a fusion protein with a transmembrane domain on the cell surface. As
exemplification, a cellular selection system for affinity selection of ceils and plasma membranes was generated via expression of the chitin- binding domain (ChBD) as a fusion with a transmembrane domain on the surface of eukaryotic cells. Similar selection systems can be based on engineered expression on the cell surface of other ligand binding domains, e.g., or ceilulase binding domain (CBD). Conservatively modified variants of various known ChBDs or CBDs, as well as variant polypeptides with substantially identical sequences, can also be used in the practice of the present invention.
[0013} The enzymes chttinase and ceilulase hydrolyze chitin and cellulose respectively, which are the two most abundant insoluble polymers on earth. These enzymes are unusual because, in addition to the canonical enzyme format where the active site has affinity for the substrate, they each have an appended, small domain that binds to their insoluble substrates. In the case of the ehitin-binding domain, this small appendage has nearly covalent binding energy for the substrate, which is a readily abundant and cheap insoluble polymer of N -acetyl glucosamine. By expressing ChBD or CBD on the eukaryotic ceil surface, the cells would have affinity for insoluble polymers that are not present in animal cells.
[00.14] Transmembrane domain usually denotes a single transmembrane alpha helix of a transmembrane protein. It is called a "domain" because an alpha-helix in a membrane can fold independently from the rest of the protein, similar to domains of water-soluble proteins. More broadly, a transmembrane domain is any three-dimensional protein structure which is thermodynamically stable in a membrane. This may be a single alpha helix, a stable complex of several transmembrane alpha helices, a transmembrane beta barrel, a beta-helix of gramicidin A, or any other structure. Depending on the target eukaryotic cells to be modified for conferring selectability, various eukaryotic transmembrane domain polypeptides can be used in the practice of the present invention. As exemplified herein, the transmembrane domain of platelet-derived growth factor receptor (PDGFR) is suitable for the invention. [0015] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood fay those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Academic Press Dictionary of Science and
Technology, Morris (Ed.), Academic Press (I31 ed,, 1992); Oxford Dictionary of
Biochemistry and Molecuiar Biology, Smith et al. (Eds,), Oxford University Press (revised ed., 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.). John Wiley & Sons (3rd ed., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1st ed., 1999); Dictionary of Pharmaceutical Medicine, Nahier (Ed.), Springer-Verlag Telos (1994);
Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications -Pvt. Ltd. (2002); and A Dictionary/ of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4* ed., 2000). In addition, the following definitions are provided to assist, the reader in the practice of the invention.
[0016] The singular terras "a," "an," and 'The" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise.
(0017] As used herein, the term "amino acid" of a peptide refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoscrirte. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl suifonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
[0018] Cellulase refers to a suite of enzymes produced chiefly by fungi, bacteria, and protozoans that catalyze celiulolysss (i.e. the iiydrolysis of cellulose). Howe ver, there are also celiulases produced by a fe other types of organisms, such as some termites and the microbial intestinal symbionts of other termites. Several different kinds of celiulases are known, which differ structurally and mechanistically. Cellulases hydrolyze the 1 ,4~beta-D~ giycosidic linkages in cellulose, lichenin and cereal beta-D-glucans.
[0019] Chitinases are hydrolytic enzymes that break down giycosidic bonds in chitin. As chitin is a component of the cell walls of fungi and exoske!etai elements of some animals (including worms and arthropods), chitinases are generally found in organisms that either need to reshape their own chitin or dissolve and digest the chitin of fungi or animals, Chitinivorous organisms include many bacteria (e.g., Aeromonads, Bacillus, Vibrio), which may be pathogenic or detritivorous. They attack living arthropods, zooplankton or fungi or they may degrade the remains of these organisms. Fungi, such as Coecidioid.es imi tts, also possess degradative chitinases related to their role as detritivores and also to their potential as arthropod pathogens. Chitinases are also present in plants (e.g., barley seed chitsnase). 002 J As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essentia! to the invention, yet open to the inclusion of unspecified elements, whether essential or not.
[0021] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0022] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0023] The term "conservatively modified variant" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic ac id that encodes a polypeptide is implicit in each described sequence.
[0024] For polypeptide sequences, "conservatively modified variants" refer to a variant which has conservative amino acid substitutions, amino acid residues replaced with other amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g.. glycine, asparaginic, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and. aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0025] The term ''engineered ceil" or "recombinant host cell" (or simply "host cell") refers to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject celt but to the progeny of such a ceil. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein,
{0026} The terra "isolated" means a reference molecule (e.g., a polypeptide or a polynucleotide) is removed from its natural surroundings. However, some of the components found with it may continue to be with an "isolated" molecule. Thus, an "isolated
polypeptide" is not as it appears in nature but may be substantially less than 100% pure protein,
[0027] The terms 'identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences thai are the same. Two sequences aire "substantially identical" if two sequences have a specified
percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region thai is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
[0028] Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl, Math, 2:482c, 1970; by the homology alignment algorithm of Needteman and Wunsch, Mol. Biol. 48:443, 1970; by the search for similarity method of Pearson and Lipman, Proc. Nat'!. Acad. Sci. USA 85 :2444, 1 88: by computerized implementations of these algorithms (GAP, BESTFIT, FAST A, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI); or by manual alignment and visual inspection (see, e.g.. Brent et al.s Current Protocols in Molecular Biology, John Wiley & Sons, inc. (ringbou ed., 2003)). Two examples of algorithms that are. suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al,, Nuc. Acids Res. 25:3389-3402, 1977; and Altschul. et aL J. Mol. Biol. 215:403-41 0, 1990, respectively. (0029) Other than percentage of sequence identity noted above, another indication that two nucleic acid sequences or polypeptides are substaniiaily identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
[0930] The term "operably linked" refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system. Generally, promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting. However, some transcriptional regulatory sequences, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
[603.1] A "transgenic animal" refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art. The nucleic acid is introduced into the celt, directly or indirectly by introduction into a precursor of the ceil, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but. rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extracbromosomally replicating DNA.
[0032] The term "vector'' is intended to refer to a polynucleotide molecule capable of transporting another polynucleotide to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DMA loop into which additional DMA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host ceil into which they are introduced (e.g., bacteria! vectors having a bacterial origin of replication and eplsomal mammalian vectors). Other vectors (e.g., non- episomal mammalian vectors) can be integrated into the genome of a host ceil upon introduction into the host cell, and thereby are replicated along with the host genome.
Moreover, certain vectors are capable of directing the expression of genes to which they are operativeiy linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors").
(0033] Expressing a ChBD- or CBD-contaming fusion polypeptide on cell surface as selection marker can be carried out in accordance with the exemplification provided herein and other methods well known in the art. Chitin-binding domains and celluiase-binding domains from various sources are known and well characterized in the art. See, e.g.,
Watanabe et al., J. Bacterid 176:4465-72, 1994; Hashimoto et al„ J. Bacterid. 182; 3045- 3054, 2000; Svitil et al., Microbiol. 144; 1299 -1308; 1998; Tjoelker et al, J. Biol. Chem. 275:514-520, 2000; Akagi et al, I. Biochem. 139: 483-493, 2006; Linder et ah, Proc Natl Acad. Sci. USA 93 : 12251 -5, 1996: and Tomme et al., in "Enzymatic Degradation of Insoluble Carbohydrates", Chapter 10, pp 142-163 (ACS Symposium Series, Vol. 618; May 1 96). Vectors for expressing the fusion polypeptide can be generated in accordance with the techniques described herein and methods routinely practiced in the art, e.g., as described in Sarabrook. et a!.. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., (3rd ed., 2000): and Brent et ai., Current Protocols in . Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003).
[0034] Unless otherwise stated, other procedures or steps required for practicing the present invention can be based on standard procedures as described, e.g., in Methods in Emymology, Volume 289: Solid-Phase Peptide Synthesis, J. N. Abelson, M. I. Simon, G. 8. Fields (Editors), Academic Press; 1 st edition (1997) (ISBN-! 3: 978-0121821906); U.S. Pat. Nos, 4,965,343, and 5,849,954; Sambrook et al., supra; Brent et ai., supra; White et a!., PCR Protocols, Academic Press, Inc. (1990); Freshney, Culture of Animal Cells, Wiley-Liss (2005); Murray et a!.. Gene Transfer and Expression Protocols, The Huraana Press inc. (1991); Davis et a!., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1986); or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol, 152, S. L. Berger and A. R. Kimmerl Eds., Academic Press Inc., San Diego, USA (1987); Current Protocols in Protein Science (CPPS) (John E. Coligan, et al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan 5. Bonifacino et. al. ed., John Wiley and Sons, inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Ceil Biology, Vol. 57, Jennie P. Niather and David Barnes editors. Academic Press, 1 st edition, 1998).
[0035] As exemplification, vectors expressing the ChBD linked to EGFP on the cell surface were constructed (Figure 1A). One vector (BHl ) was constructed based on the pBudCE4.1 vector (Invitrogen). The ChBD-EGFP cassette was inserted into the cloning site under the control of the CMV promoter. The second cloning site under the control of the EF~ l a promoter can be used to express another gene of interest (Figure IB), The other vector (BH2) was constructed based on the pCEP4 vector (Invitrogen). The CMV-ChBD-EGFP and EF-la promoter cassettes from BHl were inserted before the OriP of pCEP4 (Figure 1C).
[0036] To determine whether the transformation with the plasmid encoding the ChBD was efficient and was expressed on the cell surface in a functional form, the transformed cells were tested for their ability to both express GFP and bind to chitin beads. EGFP alone and EGFP linked to the ChBD were efficiently expressed in HEK 293T ceils (Figure 4). The ChBD expression was confined to the cell surface (Figure 2A). Ceils expressing the ChBD- EGFP encoded constructs bound efficiently to the chitin beads whereas cells that only expressed EGFP did not (Figure 28).
[0037] in addition to selection of intact cell s that express the ChBD, the methods of the invention are also useful for purification of plasma membranes for biochemical studies. As exemplification, HBK 293T cells that expressed the ChBD on their cell surface were sonicated and the membrane fragments were collected on chitin beads. Gel electrophoresis and western blotting studies showed that this procedure afforded highly purified membrane preparations (Figure 3).
[0038] The methods of the invention allow selection of eukaryotic cells by engineered expression on the cell of a specific ligand binding domain for selectability, importantly, the binding functionality that is used does not have a counterpart in animal cells thereby endowing the modified cell surface with a property that is orthogonal to animal cells. The methods of the present invention are advantageous over other selection methods currently known in the art, e.g., using antibodies targeting cell surface proteins or the avidin-biotm. system. While antibodies might be an alternative, they generally do not have the affinity of the ChBD and are much more expensive to use. The avidin-biotin system is also inferior because avidin is a tet amer and biotin is an essential vitamin such that the ligand is already present in all cells. Thus, even if the avidin tetramer could he expressed in functional form on the cell surface, it would already be saturated with ligand. Indeed, the avidin-biotin system has been tried and failed in eukaryotic cells. Finally, fluorescent activated cel.! sorting, while useful in some selection settings, is a method that requires expensive instrumentation as opposed to the "Bench Top" procedure described herein.
[0039] in addition to the methods described herein for conferring to. cells surface markers for orthogonal selectability, isolated or recombinantly expressed ChBD- or CBD-containing fusion polypeptides are also encompassed by the present invention. The invention
additionally provides isolated or substantially purified polynucleotides (DNA or RNA) which encode the fusion polypeptides described herein. Expression vectors and engineered host cells harbormg the vectors for expressing polynucleotides encoding the polypeptides are also provided in the invention. The polynucleotide encoding the fusion polypeptide is typically operably linked to a promoter in the expression vectors. As exemplified herein, the expression construct can further encode a signal peptide for translocation of the expressed polypeptide across cell membrane. The expression vectors of the invention are not subject to any particular limitation, and may be, for example, bacteriophages, plasmids, cosmids or phagemids. Examples of recombinant bacteriophage or phagemid vectors include that based on a filamentous phage such as M l 3, Plasmid vectors include those based on plasmids from, e.g., E. coli (e.g., pB .322, pBR325, pUCl 18 and pUCl 19), plasmids from Bacillus subti!is (e.g., pUBl ! O and pTP5), and plasmids from yeasts (e.g., YBp l 3, YEp24 and YCp50). The expression vectors can also include animal viruses such as retroviruses, vaccinia viruses and insect viruses (e.g., bacu!oviruses). Similarly, the host ceils to which the vectors are introduced can be any of a variety of expression host cells well known in the art, e.g., bacteria (e.g., E. coli), yeast cell, or animal cells such as CHO, COS or 293 cells, in some preferred ■embodiments, the host cells are recombinant animal cells (e.g., mammalian ceils) which have integrated a polynucleotide encoding the ChBD- or CBD-containing polypeptide and express the polypeptide on the cell surface,
[0040] Methods of the invention find wide uses not only for selection of cells but also for isolating cells in vitro and in vivo in any situation where one wishes to trace the fate and ultimately recover a minor population of cells. Toward this end, the invention further provides transgenic non-human animals such as mouse strains where the ChBD (or CBD) is either constitutive!}'- expressed in all cells or inducible in certain cell lineages. This should allow long-term studies on cell fates, where the likely immunogenicity of the ChBD would otherwise be a problem in ceil transfer experiments. Thus, cells thai constitutive!)' express the ChBD can be followed in other mouse strains where expression of the ChBD is repressed by, for example, tetracycline inactivation of a sensitive tetracyciine-depertdent tra»sactivator.
EXAMPLES
{0041] The following examples are provided to further illustrate the invention but not to limit its scope.
Example 1 Materials and methods
421 Some specific techniques and protocols for practicing methods of the invention are exemplified below.
[0043] Cell culture: Human embryonic kidney HE 293T cells were purchased from ATCC, and maintained in DMEM (GIBCO) supplemented with 10% fetal calf serum
(GiBCO) and non-essential amino acids (GIBCO) at 37°C in a humidified C02 incubator. HEK 293T cells were transfected with X-tremeGENE 9 DNA transfection reagent (Roche). ΘΘ44] Plasmid construction; ChBD-EGFP was cloned using overlapping PGR. First, the fragment extending from IgK leader to the PDGFR TMD was obtained using the following primers:
CMV-CBD-5: ACGCGTCGACATGGAGACAGACACACTCCTGCTATG {SEQ ID NO: l)
CMV-CBD-A:
ATGGAGACAGACACACTCCTGCTATGGGTACTGCl'GCTCTGGGTTCCAGGTI'CCA CTGGTGACTATCCATATGATGTTCCAGATTATGCTG (SEQ ID NO:2) CMV-CBD-B;
GCTGTGITGACCTGCCAAGCGGATACACCAGGATTTGTCGTGGCCGGCTGGGCCA
AGGCTCCAGCATAATCTGGAACATCATATGGATAGTC (SEQ ID NO:3) CMV-CBD-C:
GCTTGGCAGGTCAACACAGCTTATACTGCGGGACAATTGGTCACATATAACGGC AAGACGTATAAATG'FI GCAGCCTCACACATCATTGGCAG (SEQ ID NG:4) C V-CBD-D:
GAGATGAGCTTCTGTTCGAGGCCTCGGGGGCCTTGAAGCTGCCACAAGGCAGGA ACGTTGGATGGTTCCCATCCTGCCAATGATGTGTGAGGCTG (SEQ ID NO:5) C V-CBD-E:
GGCCTCGAACAGAAGCTCATCTCAGAAGAGGATCTGAATGCTGTGGGCCAGGAC ACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTI'AAGG (SEQ ID NO:6) CMV-CBD-F:
CATGATGAGGATGATAAGGGAGATGATGGTGAGCACCACCAGGGCCAGGATGGC TGAGATCACCACCACCTTAAAGGGCAAGGAGTGTGGC (SEQ ID NO:7)
■CMV-CBD-3 :
CGCGGATCCCTAACGTGGCTrCTTCTGCCAAAGCATGATGAGGATGATAAGGGA GATGATG (SEQ ID NO: 8)
The EGFP fragment was amplified from the pEGFP (Clontech) using the following primers: EF-GFP-5:
CCGTTTCGAACCAGACGTCTGGGCCGCCACCATGGTGAGCAAGGGCGAGGAG
(SEQ ID NO;9)
EF-GFP-3:
CC GTTTCG A ACTC C AGC ATGCTGGTCTTGTAC AGCTC GTC C ATGCCG AG (S EQ ID NO: 10}
To generate vector pBudCFA E-EGFP, this fragment was inserted into BstB 1 sites of pBudCE4, l . Thereafter, ChBD and the EGFP genes were fused using the following primers: CG-5 :
ACGCGTCGACATGGAGACAGACACACTCCTGCTATGGGTAC (SEQ ID NO: 1 1) CG-CP-F:
ATGGAGACAGACACACTCCTGCTATGGGTAC (SEQ ID NO: 12)
CG-CP-R:
GCTCCTCGCCCTTGCTCACCATGCTGCCTCCTGCAGCGGCCGCTCCGGAACGTGG
CTTCTTCTGCC A A AG C ATG (SEQ ID NO: 13)
CG-EGFP-F:
ATGGTGAGCAAGGGCGAGGAGC (SEQ ID NO: 14)
CG-EGFP-R;
CTTGTACAGCTCGTCCATGCCGAGAG (SEQ ID NO: 15)
CG-3:
CGCGGATCCCTACTTGTACAGCTCGTCCATGCCGAGAG (SEQ ID NO: 16)
To generate vector BFf l , the ChBD-EGFP fusion was inserted into Sal I and BamB I sites of pBudCE4.1 (Invitrogen). Then the Noil site in EGFP was deleted using QuikChange Lightning Muiti Site-Directed Mutagenesis Kit (Agilent) with the primer
CGTTCCGGAGCAGCCGCTGCAGG (SEQ ID NO: 17). To generate vector BH2, ChBD- EGFP and the CMV promoter were amplified from BHl and inserted into BsrG I and BamR I sites of pC.EP4 (Invitrogen). Then the EF-l cassette was amplified from BH l and inserted into the Xba I and Pci I sites,
[§045] immunofluorescence using confocal microscopy: BHl and mock transfected HEK 293T cells growing on collagen-coated coverslips wer fixed in 10% formaldehyde before staining. The eel! membranes were stained with 5 μ^ιηΐ Alexa Fluor 555 conjugated wheat germ agglutinin (invitrogen). The nuclei were stained with 5 (ug/ml Hoechst 34580
(Invitrogen). Confocal fluorescent images were obtained using a Bio-Rad (Zeiss) Radiance 2100 Rainbow laser scanning confocal microscope attached to a Nikon ΤΕ2000-Ό
microscope with infinity corrected optics with a 60x objective. After sequential excitation, blue, green and red fluoresoenl images of the same ceil were collected. Images were analyzed with Image.) software. The term co-localization refers to the coincidence of green and red fluorescence, as measured by the confocal microscope,
[0046] Ceil binding: BH 1 or pBudC.E4. i -EGFP transfected HEK 29ST cells were mixed with 10-fold non-transfected HEK 293T cells and then incubated with magnetic chitin-coated beads (New England B.iolabs) at room temperature for 1 hr. Then the beads were separated with a magnet and washed 5 times with PBS at room temperature. An aliquot of beads was transferred to slides and observed by fluorescent microscopy.
[0047] Cell membrane purification: BHl or mock transfected HEK 293T cells were harvested, washed 3 times with cold PBS, and then sonicated in 600 μ! PBS on ice. The homogenate was incubated with magnetic chitin-coated beads blocked with BSA. The beads were separated with magnet and the unbound fraction (flow-through) was collected. The beads were washed 8 times with PBS at room temperature, and resuspended in 600 μ! PBS, The homogenate, flow-through and bead fractions were treated with SDS-PAGE loading buffer, then loaded 10 μΐ for western blotting. Antibodies against ctl sodium/potassium ATPase (ab'7671 , Abeam) and pan Cadherin (ab22744, Abeam) were used together with secondary HRP-conjugated goat-anti-mouse IgG ( 1030-05, Southern Biotech). HRP- conjugated antibody against β Actin was purchased from Ceil Signaling,
Example 2 Cell surface expression of ChBD for affinity selection
(0048} One vector (BHl) was constructed based on the pBudCE4.1 vector (Invitrogen).
The ChBD-EGFP cassette was inserted into the cloning site under the control of the Cytomegalovirus (CMV) promoter. The second cloning site that is under the control of the
EF- l a promoter can he used to express another gene of interest. The other vector (BH2) was constructed based on the pCEP4 vector (Invitrogen). The CMV-ChBD-EGFP and EF- l a promoter cassettes from Bill were inserted before the OriP of pCEP4, The construct is anchored to the ceil membrane using the PDGF gene product thai is a protein that spans the plasma membrane. This membrane-spanning domain sits between the ChBD protein that is expressed on the outer surface of the cell and the EGFP protein that is present on the cytoplasmic side of the membrane. Since the EGFP protein is fluorescent it allows for the rapid determination of the efficiency of a given transformation.
[0049] To determine whether the transformation with the p!asmid encoding the ChBD was efficient and was expressed on the ceil surface in a functional form, the transformed ceils were tested for their ability to both express G.FP and bind to chitin beads, EGFP alone and EGFP linked to the ChBD were efficiently expressed. The ChBD expression was confined to the cell surface. When the ceils expressing the ChBD domain on their cell surface were mixed with chitin beads for thirty minutes, the cells bound to the beads whereas ceils that onl expressed EGFP did not. In this experiment, the surface of the chitin beads appears to be saturated with cells that express the ChBD. The absolute number of cells binding to the beads is a function of the ratio of beads to cells. In the pictured experiment, excess ceils were used solely for ease of visualization. After washing, cells expressing the CoBD-EGFP encoded constructs retained their affinity for the chitin beads. To determine the enrichment power of the method, different ratios of transformed to non-transformed cells were studied to determine the ab lity to recover rare cells. Transformed cells could be recovered when they represented only 0.5% of the population. Usually, after transformations a higher percentage of transformed cells are present. Thus, the method should be general and in many cases avoid the, often long, post-transformation enrichment procedures such as antibiotic selections.
[0050] it was essentia l to determine i f the cells remained viable after they bound to the chitin beads. To show this, ceils were bound to the chitin beads and then the complex was thoroughly washed and placed back into culture. The cells that bound initially were easily visible. After 4 days in culture new growth of cells was evident. Thus, the cells thai bound to the beads were capable of replication that qualitatively appeared unimpeded. After the beads were saturated with cells, the newly replicated cells were no longer attached to the beads. Thus, a culture could be establ ished from the viable progeny of cells that were originally attached to the beads. [0051 j In addition to selection of intact ceils that express the ChBD, the method should be usefiii for purification of piasma membranes for biochemical studies. To test this possibility, HEK. 293T ceils that expressed the ChBD on their ceil suriace were sonicated and the membrane fragments were collected on chitin beads. Gel electrophoresis and western blotting studies showed that this procedure afforded highly purified membrane preparations. Beta-actin was used as a control to show that there is no contamination in membranes that were isolated based on their affinity for chitin coated beads. Actin is present in large amounts in the cefi cytoplasm and if the purification were not stringent this protein would show up as a contaminant in the purified membranes.
¾s ^ ΐ
[0052] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
[0053 j All publications, databases, GenBank sequences, patents, and patent applications cited in this specification are herein incorporated by reference as if each was specifically and individually indicated to be incorporated by reference.

Claims

WHAT IS CLAIMED IS:
1. A method for engineering a surface selection marker on a eukaryotic ceii, comprising expressing on the surface of the cell a polypeptide comprising a chitin-binding domain (ChBD) or cellulase-bind g domain (CBD),
2. The method of claim 1 , wherein the polypeptide is expressed from a vector introduced into the cell.
3. The method of claim 1. wherein the polypeptide further comprises a eukaryotic transmembrane domain that is fused to the ChBD or CBD.
4. The method of claim 3, wherein the transmembrane domain is from platelet-derived growth factor receptor (PDG FR).
5. The method of claim k wherein the polypeptide further comprises an enhanced green fluorescent protein (EGFP) thai is fused to the ChBD.
6. The method of claim 1 , wherein the ChBD is ChBD from Bacillus circular® WL-T2 chitinase or ChBD from Vibrio harveyi chitinase A.
7. The method of claim 1 , wherein the ceil is a mammalian cell.
8. An engineered or recombinant eukaryotic cell comprising on its surface a heterologous polypeptide comprising a chitin-binding domain (ChBD) or ce!iulase-binding domain (CBD).
9. The cell of claim 8, wherein the polypeptide is expressed from a vector introduced into the ceil.
10. The cell of claim 8, wherein the polypeptide further comprises a eukaryotic transmembrane domain that is fused to the ChBD or CBD.
11. The cell of claim 1.0, wherein the transmembrane domain is from platelet- derived growth factor receptor (PDGFR).
12. The cell of claim 8, wherein the polypeptide further comprises an enhanced green fluorescent protein (EGFP) thai is fused to the ChBD.
13. The cell of claim 8, wherein the ChBD is ChBD from Bacillus circulans WL-12 chitinase or ChBD from Vibrio harveyi chitinase A.
14. The cell of claim 8, wherein the cell is a mammalian cell.
15. An isolated or recombinant polypeptide comprising a chitin-binding domain (ChBD) fused to 3 transmembrane domain of a eukaryotic cell.
16. The polypeptide of claim i 5, wherein the ChBD is ChBD from Bacillus circulans WL-12 chitinase or ChBD from Vibrio harveyi chitinase A.
17. The polypeptide of claim 15, wherein the transmembrane domain is from platelet-derived growth factor receptor (PDGF ).
18. A polynucleotide encoding the polypeptide of claim 15.
19. A vector comprising the polynucleotide of claim 18,
PCT/US2013/051232 2012-07-19 2013-07-19 Engineering cell surfaces for orthogonal selectability Ceased WO2014015227A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261673399P 2012-07-19 2012-07-19
US61/673,399 2012-07-19

Publications (1)

Publication Number Publication Date
WO2014015227A1 true WO2014015227A1 (en) 2014-01-23

Family

ID=49949266

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/051232 Ceased WO2014015227A1 (en) 2012-07-19 2013-07-19 Engineering cell surfaces for orthogonal selectability

Country Status (1)

Country Link
WO (1) WO2014015227A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3441471A1 (en) * 2017-08-08 2019-02-13 CEVEC Pharmaceuticals GmbH Use of constitutively active variants of growth factor receptors as selection makers for the generation of stable producer cell lines
US10793839B2 (en) 2015-01-07 2020-10-06 Cevec Pharmaceuticals Gmbh O-glycan sialylated recombinant glycoproteins
US11193156B2 (en) 2017-03-29 2021-12-07 Cevec Pharmaceutical GmbH Recombinant glycoproteins with reduced antennary fucosylation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991003554A1 (en) * 1989-09-01 1991-03-21 Genentech, Inc. Cells transfected with nucleic acid encoding gtp

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991003554A1 (en) * 1989-09-01 1991-03-21 Genentech, Inc. Cells transfected with nucleic acid encoding gtp

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
GOTOH, HIDEO ET AL.: "Cell-surface streptavidin fusion protein for rapid selection of transfected mammalian cells", GENE, vol. 389, no. 2, 3 November 2006 (2006-11-03), pages 146 - 153 *
HAN, HUAMIN ET AL.: "An efficient vector system to modify cells genetically", PLOS ONE, vol. 6, no. 11, 11 November 2011 (2011-11-11), pages 1 - 10 *
PENG, YINGJIE ET AL.: "Engineering cell surfaces for orthogonal selectability", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 52, no. 1, 13 December 2012 (2012-12-13), pages 336 - 340 *
WANG, AIJUN A. ET AL.: "Whole-cell immobilization using cell surface-exposed cellulose-binding domain", BIOTECHNOLOGY PROGRESS, vol. 17, no. 3, 7 April 2001 (2001-04-07), pages 407 - 411 *
WANG, JEN-YOU ET AL.: "Immobilization of cells with surface-displayed chitin-binding domain", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 72, no. 1, January 2006 (2006-01-01), pages 927 - 931 *
WANG, XIULI ET AL.: "A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells", BLOOD, vol. 118, no. 5, 7 June 2011 (2011-06-07), pages 1255 - 1263 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10793839B2 (en) 2015-01-07 2020-10-06 Cevec Pharmaceuticals Gmbh O-glycan sialylated recombinant glycoproteins
US11193156B2 (en) 2017-03-29 2021-12-07 Cevec Pharmaceutical GmbH Recombinant glycoproteins with reduced antennary fucosylation
EP3441471A1 (en) * 2017-08-08 2019-02-13 CEVEC Pharmaceuticals GmbH Use of constitutively active variants of growth factor receptors as selection makers for the generation of stable producer cell lines
WO2019030069A3 (en) * 2017-08-08 2019-03-21 Cevec Pharmaceuticals Gmbh Use of constitutively active variants of growth factor receptors as selection makers for the generation of stable producer cell lines
US12060561B2 (en) 2017-08-08 2024-08-13 Cevec Pharmaceuticals Gmbh Use of constitutively active variants of growth factor receptors as selection markers for the generation of stable producer cell lines

Similar Documents

Publication Publication Date Title
US12275952B2 (en) Using programmable DNA binding proteins to enhance targeted genome modification
US12065642B2 (en) Using nucleosome interacting protein domains to enhance targeted genome modification
Earley et al. Gateway‐compatible vectors for plant functional genomics and proteomics
US20190032053A1 (en) Synthetic guide rna for crispr/cas activator systems
CN119570864A (en) Methods and compositions for improving homologous recombination
US11965184B2 (en) CRISPR/Cas fusion proteins and systems
US20240175037A1 (en) Homologous recombination via transcriptional activation
EP3956460B1 (en) Stable targeted integration
US20240141310A1 (en) Methods for producing cas3 proteins
US20240093206A1 (en) System of stable gene expression in cell lines and methods of making and using the same
CN116970087A (en) Protein RNA complex for directional combination and delivery of plant leaf surfaces
CN107904252A (en) Plasmid vector and its construction method, application
Tzfira et al. Mammalian cells
HK40093157A (en) Using programmable dna binding proteins to enhance targeted genome modification
HK40027119A (en) Methods for improved homologous recombination and compositions thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13819424

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13819424

Country of ref document: EP

Kind code of ref document: A1