WO2013174760A1 - Optimized aav-vectors for high transduction rates in dendritic cells - Google Patents

Abstract

The present invention is concerned with a polynucleotide encoding an adeno-associated virus (AAV) capsid polypeptide comprising the amino acid sequence NYSRGVD or the amino acid sequence NEARVRE. The present invention further relates to an AAV capsid polypeptide encoded by said polynucleotide and the use therof as a medicament, in preventing and /or treating infectious disease, and in preventing and /or treating cancer. The invention also relates to a method of presenting at least one antigen on the surface of an antigen presenting cell (APC) and to a method for identifying a peptide mediating binding of a virus to a target cell, as well as kits and devices comprising the compounds of the invention.

Description

Optimized AAV- Vectors for high transduction rates in dendritic cells

The present invention is concerned with a polynucleotide encoding an adeno-associated virus (AAV) capsid polypeptide comprising the amino acid sequence NYSRGVD or the amino acid sequence NEARVRE. The present invention further relates to an AAV capsid polypeptide encoded by said polynucleotide and the use therof as a medicament, in preventing and /or treating infectious disease, and in preventing and /or treating cancer. The invention also relates to a method of presenting at least one antigen on the surface of an antigen presenting cell (APC) comprising contacting said APC with the AAV capsid polypeptide of the present invention transporting at least one antigen, allowing the APC to present said at least one antigen, thereby presenting at least one antigen on an APC, as well as kits and devices comprising the compounds of the invention.

Antigen presenting cells (APCs), especially dendritic cells, are of wide interest in the fields of vacciniation and in cancer therapy, because they are known to be central players in establishing a robust immune response to foreign (e.g. infectious agents) and endogenous (e.g. cancer markers) antigens. However, it has been found that these cells are difficult to maintain and to manipulate. Especially, methods for introducing foreign DNA into APCs known in the state of the art are insufficient, typically leading to transduction of 10% or less of the cell population. Improved methods for mainpulating APCs are thus urgently needed. The technical problems related to above are solved by the embodiments characterized in the claims and herein below.

Adeno-Associated Virus (AAV) vectors have been known to enable transfer and long-term expression of therapeutic genes in variuos ceils and tissues. The different serotypes of AAV have been shown to have different tropisms within the body, with AAV9 e.g. having the highest tropism for the heart. Thus, transduction efficiencies obtainable with AAV vectors comprising unmodified capsids are quite variable. However, for many cell types they are far too low to be of therapeutic use. AAV vectors would be a tool of interest for targeting dendritic cells because of several advantages like non-pathogenicity and lack of viral genes (see also review: otin RM, Hum Gene Ther. 1994 Jul;5(7):793-801). However, dendritic cells are poorly transduced by AAV vectors as shown e.g. in Jooss et al (J Virol. 1998 May; 72(5): 4212-4223). Accordingly, the present invention relates to a polynucleotide encoding an adeno- associated virus (AAV) capsid polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO:2. The term "Adeno-Associated Virus" or "AAV" as used in accordance with the present invention relates to the group of viruses containing a short (approx. 4.7 kB) single-stranded DNA and depending in their lytic replication on the presence of gene products of a helper virus, like Adenovirus or Herpes simplex virus. AAVs are members of the Parvoviridae family of viruses. Also encompassed in accordance with the present invention are vectors derived from AAV, i.e. gene transfer vehicles using the capsid polypeptide of AAV to mediate the transfer of recombinant polynucleic acids into target cells. Preferably, the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV10, AAVU, AAV12, or AAV13. More preferably, the AAV is AAV7, AAV8, AAV9, or AAVrhlO. The term "capsid polypeptide" as meant herein relates to a polypeptide, also referred to as coat protein or VP protein, with the biological activity of self-assembly to produce the proteinaceous shell of an AAV particle. It is to be understood that not all AAV capsid polypeptide molecules in a given cell assemble into AAV capsids. Preferably, at least 25%, at least 50%, at least 75%, at least 85%, at least 90%, at least 95% of all AAV capsid polypeptide molecules assemble into AAV capsids. Suitable assays for measuring this biological activity are described e.g. in Smith- Arica and Bartlett (2001), Curr Cardiol Rep 3(1): 43-49. Preferably, the capsid polypeptide is the capsid polypeptide of AAV1 (Genbank Acc. No: AAD27757.1, GI:4689097), AAV2 (Genbank Acc. No: AAC03780.1, GP.2906023), AAV3 (Genbank Acc. No: AAC55049.1, GI: 1408469), AAV4 (Genbank Acc. No: AAC58045.1, GL2337940), AAV5 (Genbank Acc. No: AAD13756.1, GI-4249658), AAV10 (Genbank Acc. No: AAT46337.1, GL48728343), AAVU (Genbank Acc. No: AAT46339.1, GI:48728346), AAV12 (Genbank Acc. No: ΑΒΠ 6639.1, GI: 112379656), or AAV13 (Genbank Acc. No: ABZ10812.1, GI: 167047087). More preferably, the capsid polypeptide is the capsid polypeptide of AAV7 (Genbank Acc. No: AAN03855.1, GL22652861), AAV 8 (Genbank Acc. No: AAN03857.1, GI:22652864), AAV9 (Genbank Acc. No: AAS99264.1, GI:46487805), or AAVrhlO (Genbank Acc. No: AAO88201.1, GL29650526). Most preferably, the capsid polypeptide is a capsid polypeptide comprising or having the amino acid sequence of SEQ ID NO:34 (AAVl) SEQ ID NO:27 (AAV2), SEQ ID NO:3 (AAV7), SEQ ID NO:4 (AAV8), SEQ ID NO:5 (AAV9), or SEQ ID NO:6 (AAVrhl 0). The capsid polypeptides of the present invention, preferably, are AAV capsid polypeptides comprising the amino acid sequence NYSRGVD (SEQ ID NO:l) and / or NEARVRE (SEQ ID NO:2) and, preferably, having the biological activity of mediating entry of said capsid polypeptide, and, preferably, AAV particles comprising said capsid polypeptide, into antigen presenting cells (APCs), preferably dendritic cells. More preferably, the capsid polypeptide of the present invention has the biological activity of leading to the infection of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of cells with AAV copmprising said capsid polypeptide, at a MOI of 50000, 25000, 10000, 5000, or 1000, wherein the cells are selected from RAW 264.7 cells, JAWS cells, primary BMDC cells (bone-marrow-derived dendritic cells). Methods of testing the biological activity are detailed herein below. Preferably, said insertion is at a site exposed to the exterior of the AAV capsid in a manner that does not interfere with the activity of said polypeptide in capsid assembly and in a manner that allows said peptide to interact with a receptor on a cell. Preferably, the said amino acid sequence is inserted at a position corresponding to the region of the primary receptor binding site of the AAV2 capsid polypeptide. More preferably, the first amino acid of said sequence is inserted at a position between amino acids 550 and 630 of the capsid polypeptide. Even more preferably, the first amino acid of said sequence is inserted at a position between amino acids 585 and 595 of the capsid polypeptide. Most preferably, the first amino acid of said sequence is inserted at position 591 of the AAV7 capsid polypeptide, at position 592 of the AAV8 capsid polypeptide, at position 590 of the AAV9 capsid polypeptide, or at position 592 of the AAVrhlO capsid polypeptide. In preferred embodiments, the capsid polypeptides comprising the amino acid sequence of SEQ ID NO:l or the amino acid sequence of SEQ ID NO:2 comprise or have the sequence of any one of SEQ ID NOs:7 to 14, 28, 29, and 32.

Moreover, also encompassed are variants of the aforementioned human AAV capsid polypeptides. Such variants have at least the same essential biological activity as the specific AAV capsid polypeptides. A preferred assay is described herein above and in the accompanying Examples. Moreover, it is to be understood that a variant as referred to in accordance with the present invention shall have an amino acid sequence which differs due to at least one amino acid substitution, deletion and/or addition wherein the amino acid sequence of the variant is still, preferably, at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical with the amino sequence of the specific AAV capsid polypeptides. The degree of identity between two amino acid sequences can be determined by algorithms well known in the art. Preferably, the degree of identity is to be determined by comparing two optimally aligned sequences over a comparison window, where the fragment of amino acid sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment. A preferred comparison window envisaged in accordance with the present invention is the entire length of one of the sequences to be compared, preferably the entire length of the aforementioned specific sequences or at least a contiguous stretch of at least 50% of the nucleotides of said sequence. The percentage is calculated by determining the number of positions at which the identical amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970), by the search for similarity method of Pearson and Lipman (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by visual inspection. Given that two sequences have been identified for comparison, GAP and BESTFIT are preferably employed to determine their optimal alignment and, thus, the degree of identity. Preferably, the default values of 5.00 for gap weight and 0.30 for gap weight length are used. Variants referred to above may be allelic variants or any other species specific homologs, paralogs, or orthologs. Moreover, the variants referred to herein include fragments of the specific AAV capsid polypeptides or the aforementioned types of variants as long as these fragments have the essential biological activity as referred to above. Such fragments may be, e.g., degradation products or splice variants of the AAV capsid polypeptides. Further included are variants which differ due to posttranslational modifications such as phosphorylation, glycosylation, ubiquitinylation, sumoylation or myristylation.

Preferably, the AAV capsid polypeptide comprises further amino acids which may serve e.g. as immunogens, as a tag for purification or detection or as a linker. In a preferred embodiment of the AAV capsid polypeptide of the present invention, said AAV capsid polypeptide further comprises an immunogenic peptide. The term "immunogenic peptide" refers to a stretch of amino acids which is added to or introduced into the AAV capsid polypeptide of the invention. Preferably, the immunogenic peptide shall be added C- or N- terminally to the AAV capsid polypeptide of the present invention. The said immunogenic peptide shall comprise at least one stretch of amino acids which is suspected to contribute to an improved immunity against a non-AAV antigen, preferably when presented on an antigen presenting cell. In another preferred embodiment of the AAV capsid polypeptide of the present invention, said AAV capsid polypeptide further comprises a detectable tag. The term "detectable tag" refers to a stretch of amino acids which are added to or introduced into the AAV capsid polypeptide of the invention. Preferably, the tag shall be added C- or N- terminally to the AAV capsid polypeptide of the present invention. The said stretch of amino acids shall allow for detection of the AAV capsid polypeptide by an antibody which specifically recognizes the tag or it shall allow for forming a functional conformation, such as a chelator or it shall allow for visualization by fluorescent tags. Preferred tags are the Myc-tag, FLAG-tag, 6-His-tag, HA-tag, GST-tag or GFP-tag. These tags are all well known in the art.

The term AAV capsid polypeptide also includes chemically modified polypeptides, e.g., containing modified amino acids or being biotinylated or coupled to fluorophores, such as fluorescin, or Cy 3, being conformationally restricted, e.g. by disulfide bridging or by stapling (Walensky 2004, Science 305(5689): 1466-1470). Such modifications may improve the biological properties of the AAV capsid polypeptides, e.g., binding or stability, or may be used as detection labels.

The term "polynucleotide", as used herein, relates to a polynucleotide comprising a nucleic acid sequence which encodes a polypeptide having the biological activity as described above. Preferably, the polynucleotide is a polynucleotide comprising or having the nucleic acid sequence of any one of SEQ ID NOs: 15-22, 30, 31 , and 33. It is to be understood that a polypeptide having an amino acid sequence as detailed above may also be encoded due to the degenerated genetic code by more than one species of polynucleotide. Moreover, the term "polynucleotide" as used in accordance with the present invention further encompasses variants of the aforementioned specific polynucleotides. Said variants may represent orthologs, paralogs or other homologs of the polynucleotide of the present invention. The polynucleotide variants, preferably, comprise a nucleic acid sequence characterized in that the sequence can be derived from the aforementioned specific nucleic acid sequences by at least one nucleotide substitution, addition and/or deletion whereby the variant nucleic acid sequence shall still encode a polypeptide having the activity as specified above. Variants also encompass polynucleotides comprising a nucleic acid sequence which is capable of hybridizing to the aforementioned specific nucleic acid sequences, preferably, under stringent hybridization conditions. These stringent conditions are known to the skilled worker and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1-6.3.6. A preferred example for stringent hybridization conditions are hybridization conditions in 6 x sodium chloride/sodium citrate (= SSC) at approximately 45°C, followed by one or more wash steps in 0.2 x SSC, 0.1% SDS at 50 to 65°C. The skilled worker knows that these hybridization conditions differ depending on the type of nucleic acid and, for example when organic solvents are present, with regard to the temperature and concentration of the buffer. For example, under "standard hybridization conditions" the temperature differs depending on the type of nucleic acid between 42°C and 58°C in aqueous buffer with a concentration of 0.1 to 5 x SSC pH 7.2). If organic solvent is present in the abovementioned buffer, for example 50% formamide, the temperature under standard conditions is approximately 42°C. The hybridization conditions for DNA:DNA hybrids are preferably for example 0.1 x SSC and 20°C to 45°C, preferably between 30°C and 45°C. The hybridization conditions for DNA:RNA hybrids are preferably, for example, 0.1 x SSC and 30°C to 55°C, preferably between 45°C and 55°C, The abovementioned hybridization temperatures are determined for example for a nucleic acid with approximately 100 bp (= base pairs) in length and a G + C content of 50% in the absence of formamide. The skilled worker knows how to determine the hybridization conditions required by referring to textbooks such as the textbook mentioned above.

Alternatively, polynucleotide variants are obtainable by PCR-based techniques such as mixed oligonucleotide primer- based amplification of DNA, i.e. using degenerated primers against conserved domains of the polypeptides of the present invention. Conserved domains of the polypeptides of the present invention may be identified by a sequence comparison of the nucleic acid sequence of the polynucleotide or of the amino acid sequence of the polypeptides as specified above. Suitable PCR conditions are well known in the art. As a template, DNA or cDNA from AAVs may be used. Further, variants include polynucleotides comprising nucleic acid sequences which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequences detailed above. The percent identity values are, preferably, calculated as set forth above. A polynucleotide comprising a fragment of any of the aforementioned nucleic acid sequences is also encompassed as a polynucleotide of the present invention. The fragment shall encode a polypeptide which still has the biological activity as specified above. Accordingly, the polypeptide may comprise or consist of the domains of the polypeptide of the present invention conferring the said biological activity. A fragment as meant herein, preferably, comprises at least 50, at least 100, at least 250 or at least 500 consecutive nucleotides of any one of the aforementioned nucleic acid sequences or encodes an amino acid sequence comprising at least 20, at least 30, at least 50, at least 80, at least 100 or at least 150 consecutive amino acids of any one of the aforementioned amino acid sequences.

The polynucleotide of the present invention shall be provided, preferably, either as an isolated polynucleotide (i.e. isolated from its natural context) or in genetically modified form. The polynucleotide, preferably, is DNA including cDNA or R A. The term encompasses single as well as double stranded polynucleotides. Moreover, comprised are also chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificially modified ones such as biotinylated polynucleotides.

The polynucleotides of the present invention either essentially consist of the aforementioned nucleic acid sequences or comprise the aforementioned nucleic acid sequences. Thus, they may contain further nucleic acid sequences as well. Specifically, the present invention also relates to a vector comprising the polynucleotide of the present invention

The term "vector", preferably, encompasses phage, plasmid, viral or retroviral vectors as well as artificial chromosomes, such as bacterial or yeast artificial chromosomes. More preferably, the term relates to a vector derived from an AAV. Moreover, the term also relates to targeting constructs which allow for random or site- directed integration of the targeting construct into genomic DNA. Such targeting constructs, preferably, comprise DNA of sufficient length for either homologous or heterologous recombination. The vector encompassing the polynucleotides of the present invention, preferably, further comprises selectable markers for propagation and/or selection in a host The vector may be incorporated into a host cell by various techniques well known in the art. For example, a plasmid vector can be introduced in a precipitate such as a calcium phosphate precipitate or rubidium chloride precipitate, or in a complex with a charged lipid or in carbon-based clusters, such as fullerens. Alternatively, a plasmid vector may be introduced by heat shock or electroporation techniques. Should the vector be a virus, it may be packaged in vitro using an appropriate packaging cell line prior to application to host cells. Viral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host/cells. More preferably, in the vector of the invention the polynucleotide is operatively linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells or isolated fractions thereof. Expression of said polynucleotide comprises transcription of the polynucleotide, preferably into a translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known in the art. They, preferably, comprise regulatory sequences ensuring initiation of transcription and, optionally, poly- A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers. Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., the lac, trp or tac promoter in E. coli, and examples for regulatory- elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the CMV-, SV40-, SV-promoter (Rous sarcoma virus), CMV-enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells. Moreover, inducible expression control sequences may be used in an expression vector encompassed by the present invention. Such inducible vectors may, preferably, comprise tet or lac operator sequences or sequences inducible by heat shock or other environmental factors. Suitable expression control sequences are well known in the art. Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as the SV40-poly-A site or the tk-poly-A site, downstream of the polynucleotide. In this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pBluescript (Stratagene), pCDM8, pRc/CMV, pcDNAl, pcDNA3 (InVitrogene) or pSPORTl (GIBCO BRL). Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno- associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector of the invention into targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994).

The present invention also relates to an AAV capsid polypeptide encoded by a polynucleotide of the present invention as detailed herein above.

Advantageously, it has been found that the embodiments of the present invention, i.e. the polynucleotides, the AAV capsid polypeptides, and the vectors provided by the present invention allow for infection of cells, especially antigen presenting cells like, e.g., dendritic cells, which are otherwise essentially refractory to infection with AAV. This makes said cells amenable to infection with AAV at an appreciable rate and, thus, makes e.g. gene therapy of said cells or presentation of antigens on the surface of said cells possible. It has been described earlier that infection of dendritic cells with recombinant AAV can be used to present antigens to the immune system and to induce an immune response against said antigen (see, e.g. US 2004/0072351, EP 1 206 563).

The definitions made above apply mutatis mutandis to the following:

Thus, in a preferred embodiment, the AAV capsid polypeptide of the invention is for use as a medicament. More preferably, said AAV capsid polypeptide is for use for gene transduction into cells, for in vivo and / or ex vivo gene therapy, for genetic immunization, for introduction of at least one marker into a cell, or for targeting of immune cells, tumor cells, or stem cells. The term, "gene transduction" relates to introducing a gene into a cell, e.g. a gene for activating said cell, or for inducing cell death in a malignant cell. Gene transduction preferably does not relate to gene transduction into germline cells, meaning that gene transduction preferably relates to somatic gene transduction. The term "gene therapy" is understood by the skilled person and relates to the introduction of a functional copy of a gene into a cell devoid of or otherwise in need of a functional copy of said gene. It is to be understood that the term, preferably, does not relate to germline gene therapy, i.e. gene therapy involving genetic modification of germline cells, meaning mat gene therapy preferably relates to somatic gene therapy. Genetic immunization relates to transduction of a gene encoding an antigen into a cell, where said gene is expressed, leading to presentation of said antigen encoded by said gene on the surface of said cell. The terms "introduction of a marker" into a cell and "targeting of immune cells" are understood by the skilled person.

In another preferred embodiment, the AAV capsid polypeptide of the present invention is for use for preventing and / or treating infectious disease.

The term "infectious disease", as used herein, relates to a disease resulting from the presence and activity of a pathogenic microbial agent. Preferably, said microbial agent is a fungus, a bacterium, or a virus. More preferably, the microbial agent is selected from the list consisting of human immunodeficiency virus, papillomavirus, Epstein-Barr virus, Yersina spec, Escherichia spec, Pneumococcus spec, or Meningococcus spec. Preferably, the infectious diesease is a disease caused by a microbial agent classified as group I, group Ila, or group lib carcinogen by the WHO International Agency on the Research on Cancer (IARC).

The term "preventing" refers to retaining health with respect to the diseases or disorders referred to herein for a certain period of time in a subject. It will be understood that the said period of time is dependent on the amount of the compound which has been administered and individual factors of the subject discussed elsewhere in this specification. It is to be understood that prevention may not be effective in all subjects treated with the compound according to the present invention. However, the tern requires that a statistically significant portion of subjects of a cohort or population are effectively prevented from suffering from a disease or disorder referred to herein or its accompanying symptoms. Preferably, a cohort or population of subjects is envisaged in this context which normally, i.e. without preventive measures according to the present invention, would develop a disease or disorder as referred to herein. Whether a portion is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools discussed herein below.

The term "treating" refers to ameliorating the diseases or disorders referred to herein or the symptoms accompanied therewith to a significant extent. Said treating as used herein also includes an entire restoration of the health with respect to the diseases or disorders referred to herein. It is to be understood that treating as used in accordance with the present invention may not be effective in all subjects to be treated. However, the term shall require that a statistically sigmficant portion of subjects suffering from a disease or disorder referred to herein can be successfully treated. Whether a portion is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p-value determination, Student's t-test, Mann- Whitney test etc.. Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99 %. The p-values are, preferably, 0.1, 0.05, 0.01, 0.005, or 0.0001. Preferably, the treatment shall be effective for at least 60%, at least 70%, at least 80%, or at least 90% of the subjects of a given cohort or population.

In another preferred embodiment, the AAV capsid polypeptide of the present invention is for used the prevention and / or treatment of cancer.

The term "cancer" in the context of this invention refers to a disease of an animal, including man, characterized by uncontrolled growth by a group of body cells ("cancer cells"). This uncontrolled growth may be accompanied by intrusion into and destruction of surrounding tissue and possibly spread of cancer cells to other locations in the body. Preferably, the cancer is selected from the list consisting of acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, aids-related lymphoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid, basal cell carcinoma, bile duct cancer, bladder cancer, brain stem glioma, breast cancer, burkitt lymphoma, carcinoid tumor, cerebellar astrocytoma, cervical cancer, cervix carcinoma, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, gallbladder cancer, gastric cancer, gastrointestinal stromal tumor, gestational trophoblastic tumor, glioblastoma, hairy cell leukemia, head and neck cancer, hepatocellular cancer, hodgkrn lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, kaposi sarcoma, laryngeal cancer, leukemia, meduUoblastoma, medulloepithelioma, melanoma, merkel cell carcinoma, mesothelioma, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma, myeloma, mycosis fungoides, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sezary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, and wilms tumor. More preferably, cancer is a cancer related to infection with a microbial agent classified as group I, group Ila, or group lib carcinogen by the WHO International Agency on the Research on Cancer (IARC).

The present invention also relates to the polynucleotide, the vector, or the AAV capsid polypeptide of the present invention comprised in a host cell. As used in this specification, "host cell" preferably relates to a cell maintained in vitro in a suitable cultivation medium and capable of producing AAV capsid polypeptides. Preferably, said host cell is a bacterial cell, a yeast cell, or an insect cell, and most preferably said host cell is a mammalian cell.

In a further embodiment, the present invention also relates to the polynucleotide or the AAV capsid polypeptide of the invention, wherein said polynucleotide or said AAV capsid polypeptide is comprised in an adeno associated viral particle. The terms "adeno associated viral particle" or "AAV particle" as used herein relate to protein aggregates comprising the capsid proteins of AAV. An AAV genome or recombinant AAV DNA may be present, but it may also be absent from the AAV particle, meaning that the term AAV particle also encompasses AA virus-like particles (AA-VLPs).

In another embodiment, the present invention relates to a method of presenting at least one antigen on the surface of an antigen presenting cell (APC) comprising: a) contacting said APC with the AAV capsid polypeptide of the invention transporting at least one antigen, b) allowing the APC to present said at least one antigen, thereby presenting at least one antigen on an APC.

The method of the present invention, preferably, is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate, e.g., to producing the AAV capsid polypeptide for step a), or incubating the APC under suitable conditions in step b).

The terms "antigen presenting cell" or "APC" relate to a cell of the immune system of a higher eukaryote, preferably a mammal, more preferably a human, with the ability to capture an antigen and to enable recognition of said antigen by T-cells. Preferably, the APC takes up the antigen, preferably a protein, proteolytically degrades the antigen and presents resulting peptides, preferably in the context of major histocompatibility complex (MHC) class II molecules. Preferably, the APC is a macrophage or a B-cell. More preferably, the APC is a dendritic cell. The term "presenting an antigen", preferably on the surface of an APC, is understood by the skilled person and relates to a process in a cell comprising binding of an antigenic determinant, e.g. an antigenic peptide, to an MHC molecule and transferring said MHC- antigen complex to the surface of the cell. Antigens may be antigens produced inside the cell and presented on MHC class I molecules, or, more preferably, antigens are exogenous to the cell and are presented on MHC class II molecules, preferably by APCs. It is to be understood that a cell can be induced, e.g. by genetic manipulation, to produce and secrete a specific antigen. In case said cell is an APC and reuptakes said antigen, the antigen will be presented in the context of MHC class I as well as MHC class II molecules. The term "transporting", as used herein, relates to a process wherein at least one antigen is associated in such a way with an AAV capsid polypeptide that the uptake of said AAV capsid polypeptide leads to the concurrent uptake of said antigen. The transport, preferably, is by a covalent or non-covalent binding between the AAV capsid polypeptide and the antigen, e.g. in that the antigen is a protein expressed as a fusion protein with the AAV capsid polypeptide, or by chemically forming a covalent bond between the antigen and the AAV capsid polypeptide, e.g. a disulfide bond. It is, however, also envisaged by the present invention that the transport is indirect, meaning that, preferably, the antigen is encoded by an expressible gene comprised in an AAV particle which comprises the AAV capsid polypeptide, e.g. as an expressible gene encoded on an AAV genome.

The term "contacting" as used in the context of the methods of the present invention is understood by the skilled person. Preferably, the term relates to bringing an AAV capsid polypeptide of the invention transporting at least one antigen in physical contact with an APC and thereby, e.g. allowing the AAV capsid polypeptide and the APC to interact.

The term "allowing the APC to present an antigen" relates to incubating the APC under conditions and for a period of time suitable for the processes required for antigen presentations to occur. It will be appreciated by the skilled person that the exact condidtions and the timing will depend, e.g., on the type of cell used, on the type of antigen and on the way the transporting of the antigen employed. Further, the present invention relates to a kit comprising the polynucleotide and / or the AAV capsid polypeptide of the invention and an instruction manual for carrying out the method of the present invention.

The term "kit" as used herein refers to a collection of the aforementioned means, provided separately or within a single container. The container, also preferably, comprises instructions for carrying out the method of the present invention. The components of the kit are provided, preferably, in a "ready-to-use" manner, e.g., concentrations are adjusted accordingly, etc. The present invention also relates to a device comprising the polynucleotide and / or the AAV capsid polypeptide of the present invention.

The term "device" as used herein relates to a system of means comprising at least the means referred to in the claims and a means of applying said means. Means of applying the compounds of the present invention, including the polynucleotides and the AAV capsid polypeptides, are well known to the skilled person and include, e.g. syringes, infusion sets, inhalers, and the like. Preferably, the means are comprised by a single device. Also preferably, the device is adapted for conducting the method of the present invention and comprises a system of means comprising at least the means operatively linked to each other as to allow the APC and the AAV capsid polypeptide to be contacted. Preferred means for contacting cells and compounds are well known in the art. How to link the means in an operating manner will depend on the type of means included into the device. Preferably, the means are comprised by a single device in such a case. Preferably, the device further comprises means for allowing the APC to present the antigen and / or for removing excess AAV capsid polypeptide, e.g. an incubation medium, a means for incubation, or a wash buffer. More preferably, the device comprises all the means in one device. However, it is also contemplated that the means of the current mvention may appear as separate devices in such an embodiment and are, preferably, packaged together as a kit. The person skilled in the art will realize how to link the means without further ado. Preferred devices are those which can be applied without the particular knowledge of a specialized technician.

The present invention also relates to the use of the polynucleotides and / or the AAV capsid polypeptides for the manufacture of a medicament for preventing and / or treating infectious disease. The present invention further relates to the use of the polynucleotides and / or the AAV capsid polypeptides for for the manufacture of a medicament for preventing and / or treating cancer.

Further, the present invention relates to a method of preventing and / or treating infectious disease comprising applying a polynucleotide and / or an AAV capsid polypeptide of the present invention to a subject afflicted with infectious disease, thereby preventing and / or treating infectious disease.

As used herein, the term "subject" relates to an animal, preferably a mammal, more preferably a mouse, rat, pig, sheep, goat, cattle, most preferably a human. Preferably, the subject ist afflicted with infectious disease. If a subject is afflicted with infectious disease can be determined by methods well known in the art.

Also, the present mvention relates to a method of preventing and / or treating cancer comprising applying a polynucleotide and / or an AAV capsid polypeptide of the present invention to a subject afflicted with cancer, thereby preventing and / or treating cancer.

As used herein, the term "subject" relates to an animal, preferably a mammal, more preferably a mouse, rat, pig, sheep, goat, cattle, most preferably a human. Preferably, the subject ist afflicted with infectious disease or cancer. If a subject is afflicted with infectious disease or cancer can be determined by methods well known in the art.

The present invention also relates to a method for identifying a peptide mediating binding of a virus to a target cell comprising: a) providing a library of peptides presented on the surface of said virus b) providing a receptor expressed on the surface of said target cell bound to a solid surface, c) contacting said library to said receptor, d) amplifying virus particles bound to the receptor in step c) by growth on a cell line expressing said receptor of the target cell, thereby identifying peptides mediating binding of a virus to a target cell.

The method of the present invention, preferably, is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate, e.g., to cloning of random DNA fragments into a gene coding for a viral surface polypeptide to provide the peptide library for step a), or steps for sequencing the component of a viral outer shell comprising said peptide. Preferably, it is also envisaged by the method for identifying a peptide that the said steps of the method are repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, preferably, in order to increase specificity. The term "identifying", as used herein, relates to enriching said peptide to an extent that information on its amino acid sequence can be obtained. Said information on the amino acid of said peptide may be obtained e.g. by mass spectrometry or by amino acid sequencing. More preferably the information on the amino acid of said peptide is obtained by sequencing the gene coding for the component of a viral outer shell comprising said peptide. The term "virus", as used in relation to the method for identifying a peptide, relates to any virus. Preferably, the virus is an adenovirus, a retrovirus, a parvovirus, more preferably the virus is an AAV.

The term "target cell" relates to a cell, preferably an isolated cell, more preferably a cultured cell. Preferably, the target cell is a cell from a higher eukaryote, more preferably a mammal, most preferably a human. Preferably, the target cell expresses a receptor molecule on its surface. Preferably, said receptor molecule is a polypeptide. Also preferably, the said receptor molecule is specific for a tissue, more preferably, the receptor molecule is specific for a cell type, most preferably, the receptor molecule is specific for the target cell. As used herein, the term "peptide mediating binding" relates to a stretch of amino acids which, when inserted into a component of a viral outer shell in a manner that the peptide is exposed to the surrounding medium, mediates a significantly stronger binding of said virus to said receptor or to said target cell as compared to said virus not comprising said peptide.

The term "peptide presented on the surface of a virus" is understood by the skilled person. It relates to a peptide inserted into a component of a viral outer shell in a manner that the peptide is exposed to the surrounding medium and, thus, can interact e.g. with a cell surface component, i.e. a receptor. Components of viral outer shells suitable for presenting peptides are well known in the art, as are suitable insertion sites for the peptides within the respective components of viral outer shells.

Preferably, the method of identifying a peptide comprises further steps. Preferably, non- bound or unspecifically bound peptides are removed by appropriate washing steps. More preferably, the virus is preabsorbed on a related cell line not expressing said receptor molecule. A most preferred embodiment of the method of identifying a peptide is detailed herein below in the Examples.

All references cited in this specification are herewith incorporated by reference with respect to their entire disclosure content and the disclosure content specifically mentioned in this specification.

Figure Legends

Fig. 1 : Schematic representation of the in vivo screening protocol. Ad = Adenovirus5

Fig. 2: Schematic representation of the receptor screening protocol. Fig. 3 : Transduction rates of depicted AAV vectors in Hela and RAW 264.7 cells. AAV serotypes 1-12 have been used either in the wt context or with described peptides. 96-well plates with 10.000 cells/well have been infected with crude lysates of vector productions. 48h after infection, reporter gene expression (YFP) has been determined by FACS measurement. For the purpose of this figure, AAV 10 relates to AAVrhlO.

Fig. 4: Transduction rates of depicted AAV vectors in JAWS cells and BMDC cells. AAV serotypes 1-12 have been used either in the wt context or with described peptides. 96-well plates with 10.000 cells/well have been infected with crude lysates of vector productions. 48h after infection, reporter gene expression (YFP) has been determined by FACS measurement. For the purpose of this figure, AAV 10 relates to AAVrhlO. Fig. 5: Transduction rates of depicted AAV vectors in depicted cell types. 96-well plates with 10.000 cells/well have been used for infection with purified viruses at MOI 10.000. 48h after infection, reporter gene expression (YFP) has been determined by FACS measurement. For the purpose of this figure, AAV 10 relates to AAVrhlO. Fig. 6: In vivo biodistribution of selected AAV8 vectors after injection into mice determined by quantification of viral genomes in different organs by quantitative real-time PCR: Number of vg per ng of total DNA of different organs. Mice were injected 7 days before with the vector set of AAV 8. Dark grey bars represent the wt vectors, grey bars the vectors displaying NYSRGVD and the light grey bars vectors displaying NEARVRE. Vg ng total DNA ratios were calculated as mean values from 3 injected animals per group. Results indicate that peptide insertions caused different viral tropism in AAV serotype 8: Insertion of both heptapep tides into AAV8 led to detargeting from the liver to the spleen (*: p- value < 0.05; ***: p-value < 0.01, 2-way ANOVA/ Bonferroni post test) Fig. 7: Transgene-specific and AAV8 capsid- specific titer induced after genetic immunization against HPV16L1 : AAV8-specific titers were determined by an ELISA using the respective AAV8 capsid as antigen. Four sera per group were titrated in 1:3 serial dilution steps. The titer was calculated to be the last dilution step showing an OD value higher than the cut-off, which was the mean of a titrated negative serum plus 3 times the standard deviation. Shown are mean values of LI -specific (transgene-specific) (dark grey bars) and capsid- specific (light grey bars) serum titers 14 weeks after immunization.

Examples

The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

Example 1 : In vivo screening for APC binding

A mouse has been injected with 2E1 1 viral genomes of the randomized AAV2 display peptide library described in Muller et al (Nat Biotechnol. 2003 Sep;21 (9): 1040-6.). After 3 days, the spleen was taken out and episomal DNA was extracted from spleen cells via HI T extraction.

The episomal DNA served as template for amplification by PCR (Primer fwd.: 5^ΑΑ^ΑΑΤ ^ΟΤ000^3 (SEQ ID NO:23); Primer rev.: 5 GAGGCTCTGAATACACGCCATTAG3^, (SEQ ID NO:24). A new AAV library according to the protocol of Muller et al (2003, ibd) was generated out of that PCR- product.

The newly generated library was again injected to a mouse and the same procedure was carried out to increase specificity of selected vectors. In summary, three selection rounds were carried out.

After the last round a PCR was carried out from episomal DNA around the region of insertion with the above mentioned primers. The PCR product was cloned into a TOPO vector to analyze the sequences which were selected. The peptide„NYSRGVD" was sequenced in approximately 50% of 48 clones sequenced in total.

Example 2: Receptor screening

The aim of this method was to target the receptor„DC-SIGN", which is specific for dendritic cells. For that, a fusion protein of the ectodomain of DC-SIGN and Protein A (SEQ ID NO:26, gene coding therefore SEQ ID NO:25) has been generated. The fusion protein was immobilized on a well of an ELISA-plate after coating with IgG-antibodies. Via the strong interaction of IgG and Protein A the fusionprotein was immobilized. 5E10 viral genomes from the library described in Miiller et al (Nat Biotechnol. 2003 Sep;21(9): 1040-6.) were preincubated on a well of an ELISA plate which was coated with 500 ng mouse IgG (Sigma Aldrich) to exclude AAV vectors binding to the plastic of the ELISA plate. For selection, the fusionprotein was immobilized on an ELISA plate by coating one well with 500 ng Mouse IgG o/n at 4°C and incubating with 100 μΐ of cell supernatant containing the secreted fusionprotein described above. This complex was incubated with the preincubated AAV display library for 1 hour.

After incubation, unspecific clones were washed away from the ELISA well with TST- buffer containing decreasing amounts of Tween 20 (0,5%, 0,3%, 0,05%). Specifically bound vectors were eluted from the fusionprotein-complex by incubating the plate for 10 minutes at 60° in 100 μΐ PBS.

Unspecific vectors have been excluded for a second time by incubating the eluate with an ELISA well coated with 500 ng IgG antibodies. Further steps were carried out with the supernatant of that step.

To increase specificity of the selected vectors they were amplified in a 293T cell line stably expressing the DC-SIGN receptor. By superinfection with wt Adenovirus 5, AAV vectors specific for DC-SIGN were amplified. Before that step, vectors mediating less specific binding have been excluded by incubating the eluted viruses with wildtype 293T cells to exclude vectors which enter the cells via other receptors than DC-SIGN.

With the amplified vectors the next selection round was carried out. In summary 5 selection rounds on the immobilized DC-SIGN receptor were carried out.

Sequences of selected heptapeptides have been analyzed by sequencing after amplifying a fragment around the heptapeptide insertion site by PCR (Primer fwd.: 5^,ACAACCAATCCCGTGGCTAC3^, (SEQ ID NO:23); Primer rev.: 5"CGAGGCTCTGAATACACGCCATTAG3 SEQ IDNO:24) and cloning into a TOPO vector.

During the selection some motifs were discovered several times over different rounds. The described peptide motive„NEARVRE" was one of the most frequent motifs and was selected for further examination.

Example 3: Subcloning of the peptides into various AAV types For sub cloning selected peptides into the respective AAV context, the respective oligonucleotides in forward and reverse orientation containing a Bgll restriction site have been annealed by using each 4 μg in lOmMTris pH 8,5 and 150 mM NaCl and incubating 5 minutes at 95°C, 20 minutes at 72°C and 20 minutes at 37°C. The fragments were ligated into the Sfil digested serotype respective backbone plasmids. As an example, the VP1 genes of AAV7, 8, 9, and rhlO comprised in said plasmids are the sequences of SEQ ID NOs: 15-22. Example 4: Infection measurements

The following cells were used: RAW 264.7 (ATCC number TIB-71), a mouse monocyte/macrophage cell line; JAWSII (designated JAWS in this specification; ATCC number CRL- 11904), a mouse dendritic cell line; and mouse bone-marrow derived dendritic cells (BMDC), prepared according to the method of Lutz et al. (1999, J Immunol Methods. 223(1 ):77-92). For measuring the transduction rates of selected AAV vectors, the vectors have been produced by triple transfection as described in Xao et al (Journal of Virology 72: 2224-2232). As packaging plasmid a pdsYFP plasmid has been used for production of self-complementary AAV particles (scAAV: described in Wang et al, Gene Therapy (2003) 10, 2105-2111).

Viral particles have been purified by a Iodixanol step gradient as described in Zolotukhin et al (Gene Ther. 1999 Jun;6(6):973-85). Number of viral genomes has been determined by quantitative Real-time PCR by using a CMV-promoter specific primer. Cells of interest have been infected with a MOI of 10.000 vg per cell. 48h after infection reporter gene expression (YFP) has been measured by FACS analysis.

Example 5: Infection of human monocytes Human dendritic cells are isolated from fresh human blood as described in de Vries et al (2002, J. Immunother. 25: 429-438). Macrophages are obtained from human blood according to Vijayan (2012, Methods Mol Biol 844:183-7). Preparation of virals lysates, infection and measurements are performed as described herein above. Example 6: Biodistribution of viral genomes in different organs The in vivo biodistribution of AAV8 vectors was determined by quantification of viral genomes present in different organs of mice that had been injected with AAV8 vectors. Mice were injected intravenously with 2x10¹⁰ viral genomes. After seven days, mice were sacrificed and the following organs were extracted: lung, liver, heart, spleen, thymus, muscle and lymphnodes (submandibular and axillar). DNA was extracted using the Qiagen Blood and Tissue Kit from 25 mg tissue from each organ, except for the spleen and the lymphnodes. Due to their high cell density DNA was extracted from 10 mg of tissue. The number of viral genomes was determined by qRT-PCR of the CMV promoter of the reporter gene. Results were normalized to the amount of total DNA of each extract. For this set of experiments the vectors displaying the peptides NYSRGVD and NEARVRE as well as the wt vector of serotype AAV8 were used for injection. Three mice per group were injected intravenously and subsequently analyzed. Results of the quantification are presented as mean values of the organ extracts from three animals (Fig. 6). Both peptides mediate a significant redistribution of AAV8, with a high preference for transduction of the spleen, which is in contrast to wt AAV8, which preferentially infects the liwer and, to a lesser extent, the heart and the lung.

Example 7 The gene encoding the humanized form of HPV1 LI was packaged into the AAV8 vectors. The immunization procedure was carried out analogous to the immunization experiment described in Example 6, however, mice were injected intramusculary. Briefly, mice were immunized with 4x10¹⁰ viral genomes. After 14 weeks, the LI -specific IgG titers were determined by VLP capture ELISA; Sera were titrated in 1 :2 dilution steps beginning with a serum dilution of 1 :400 up to 1 :409.600. Additionally, the AAV capsid- specific antibody titer was determined to further characterize the immunogenicity of the vectors. For that, in an ELISA each serum was tested for antibodies against the capsid that was used to immunize this mouse. Each serum was titrated in threefold dilutions, starting with 1 :100 up to 1 :72900.

The vectors displaying the peptides induced a stronger LI -specific immune response than wtAAV8. The mean titer of the group AAV8 + NEARVRE was around 35.000 and of the group 8+NYSRGVD around 20.000 compared to the group of wtAAV8 with a mean titer of around 12.000. In contrast, the capsid-specific titer was either decreased (NYSRGVD) compared to wtAAV8, or low compared to the transgene- specific titer of the same construct (NEARVRE).

Claims

A polynucleotide encoding an adeno- associated virus (AAV) capsid polypeptide comprising the amino acid sequence of SEQ ID NO:l or the amino acid sequence of SEQ ID NO:2.

The polynucleotide of claim 1, wherein said amino acid sequence is inserted into the site of the AAV capsid polypeptide corresponding to the region of the primary receptor binding site of AAV2.

The polynucleotide of claim 1 or 2, wherein the capsid polypeptide is the capsid polypeptide of AAV7, AAV8, AAV9, or AAVrhlO.

The polynucleotide of any one of claims 1 to 3, wherein the first amino acid of said sequence is inserted at position 591 of the AAV7 capsid polypeptide, at position 592 of the AAV8 capsid polypeptide, at position 590 of the AAV9 capsid polypeptide, or at position 592 of the AAVrhlO capsid polypeptide.

The polynucleotide of any one of claims 1 to 4 comprising the nucleic acid sequence of any one of SEQ ID NOs: 15-22.

An AAV capsid polypeptide encoded by a polynucleotide of any one of claims 1 to 5.

The AAV capsid polypeptide of claim 6 for use as a medicament.

The AAV capsid polypeptide of claim 6 for use in preventing and / or treating infectious disease.

The AAV capsid polypeptide of any one of claims 6 for use in preventing and / or treating cancer.

The polynucleotide of any one of claims 1 to 5 or the AAV capsid polypeptide of any one of claims 6 to 9, wherein said polynucleotide or said AAV capsid polypeptide is comprised in an adeno associated viral particle.

11. A method of presenting at least one antigen on the surface of an antigen presenting cell (APC) comprising:

a) contacting said APC with the AAV capsid polypeptide of any one of claims 6 to 10 transporting at least one antigen,

b) allowing the APC to present said at least one antigen,

thereby presenting at least one antigen on an APC.

12. The method of claim 11, wherein the antigen is transported as an expressible gene encoded on an AAV genome.

13. A method for identifying a peptide mediating binding of a virus to a target cell comprising:

a) providing a library of peptides presented on the surface of said virus,

b) providing a receptor expressed on the surface of said target cell bound to a solid surface,

c) contacting said library to said receptor,

d) amplifying virus particles bound to the receptor in step c) by growth on a cell line expressing said receptor of the target cell,

thereby identifying peptides mediating binding of a virus to a target cell.

14. A kit comprising the polynucleotide of any one of claims 1 to 5 and / or the AAV capsid polypeptide of any one of claims 6 to 10 and an instruction manual for carrying out the method of any one of claims 11 to 13.

15. A device comprising the polynucleotide of any one of claims 1 to 5 and / or the AAV capsid polypeptide of any one of claims 6 to 10.

16. Use of a polynucleotide according to any one of claims 1 to 5 and/or an AAV capsid polypeptide according to any one of claims 6 to 10 for the manufacture of a medicament for preventing and/or treating infectious disease.

17. Use of a polynucleotide according to any one of claims 1 to 5 and/or an AAV capsid polypeptide according to any one of claims 6 to 10 for the manufacture of a medicament for preventing and/or treating cancer.

18. A method of preventing and/or treating infectious disease comprising applying a polynucleotide according to any one of claims 1 to 5 and/or an AAV capsid polypeptide according to any one of claims 6 to 10 to a subject afflicted with infectious disease, thereby preventing and/or treating infectious disease.

A method of preventing and/or treating cancer comprising applying a polynucleotide and/or an AAV capsid polypeptide of the present invention to a subject afflicted with cancer, thereby preventing and/or treating cancer.

A method for identifying a peptide mediating binding of a virus to a target cell comprising:

a) providing a library of peptides presented on the surface of said virus,

b) providing a receptor expressed on the surface of said target cell bound to a solid surface,

c) contacting said library to said receptor,

d) amplifying virus particles bound to the receptor in step c) by growth on a cell line expressing said receptor of the target cell, and

e) thereby identifying peptides mediating binding of a virus to a target cell.