WO2013165607A1 - Novel bacillus amyloliquefaciens strain bac03 and methods of using same - Google Patents

Novel bacillus amyloliquefaciens strain bac03 and methods of using same Download PDF

Info

Publication number
WO2013165607A1
WO2013165607A1 PCT/US2013/032246 US2013032246W WO2013165607A1 WO 2013165607 A1 WO2013165607 A1 WO 2013165607A1 US 2013032246 W US2013032246 W US 2013032246W WO 2013165607 A1 WO2013165607 A1 WO 2013165607A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
strain
bac03
composition
streptomyces
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/032246
Other languages
French (fr)
Inventor
Jianjun Hao
Qingxiao MENG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Michigan State University MSU
Original Assignee
Michigan State University MSU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Michigan State University MSU filed Critical Michigan State University MSU
Publication of WO2013165607A1 publication Critical patent/WO2013165607A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20Bacteria; Substances produced thereby or obtained therefrom
    • A01N63/22Bacillus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07Bacillus

Definitions

  • Streptomyces species like Streptomyces scabies, cause scabby diseases in potatoes, radishes, and other crops. Most of the current plant disease control methods have proven ineffective. Moreover, many synthetic fungicides are not permitted especially for organic production, and chemical fungicides do not prevent all diseases and often release toxic chemicals into the soil or food chain. The use of many agrochemicals are also banned or restricted due to environmental and health risks.
  • a novel strain of Bacillus amyloliquefaciens strain BAC03 is isolated and described.
  • the strain is one which has the identifying characteristics of the B. amyloliquefaciens BAC03 strain a representative sample of which has been deposited with the American Type Culture Collection (ATCC) as Deposit No. PTA- 12890 (hereinafter "ATCC No. PTA-12890).
  • ATCC American Type Culture Collection
  • PTA- 12890 accession No. PTA-12890
  • antimicrobial protein produced by this strain has 99% homology to reported LCI DNA sequences.
  • the bacterial strain promotes plant growth and enhances disease resistance.
  • the strain and mutants thereof are useful as a biological control agent. Use in reducing adverse impact of a pathogen on a plant or plant part is provided. Plants, plant parts or soils are treated by applying an effective amount of BAC03, a supernatant of the strain or cell suspension or other forms of BAC03.
  • FIGS. 1A-B Effect of Bacillus amyloliquefaciens BAC03 on disease severity and plant growth in potato and radish.
  • Panels Al and A2 Potato was planted in potting mix treated with 200 ml of S. scabies at final concentrations 10 6 CFU/cm 3 (treatment S), BAC03 atlO 5 CFU/cm 3 (treatment Bl), BAC03 at 10 6 CFU/cm 3 (treatment B2), and tryptic soy broth as a control (CK).
  • Panels B l and B2 Radish was planted in potting mix treated with 30 ml of BAC03 at final concentration of 10 5 CFU/cm 3 each time in the following treatments: bO (non- treated), bl [one time of application after planting (TAP)], b2 (2 TAPs), b3 (3 TAPs), and b4 (1 time before and 3 TAPs), with weekly intervals between applications. All pots were infested with Streptomyces scabies at 10 7 CFU/cm 3 potting mix. Fresh plant weight was measured in the end of experiment.
  • FIGS. 3A-B (A) Antimicrobial activity of Bacillus amyloliquefaciens BAC03 ammonium sulfate precipitation fraction (AS) against Streptomyces scabies; and (B) Test for bactericidal versus bacteriostatic activity of BAC03 AS. Streptomyces scabies was recovered after incubation with AS for 0, 1, 3, and 5 days, followed by rinsing off AS through a 0.22 ⁇ membrane.
  • FIG. 4 Scanning electron microscopy (SEM) of mycelial morphology of
  • Streptomyces scabies grown on yeast malt extract medium plates Ten microliters of sodium phosphate buffer (untreated), or AS (treated) was directly dropped onto a S. scabies 2-day-old colony. Five days later, the untreated colonies produced white spores, but the treated culture did not show any sporulation.
  • the culture specimen were processed following the method of Fan et al. (2011) and coated with metallic osmium in preparation for SEM.
  • FIG. 5 Test for active fraction of ammonium sulfate precipitate (AS) from Bacillus amyloliquefaciens BAC03 by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After fractionation on SDS-PAGE, the gel was overlaid with yeast malt extract medium containing Streptomyces scabies (10 7 CFU/ml), and the inhibition zone was observed after 2 days of incubation at 28°C. Growth was detected by staining with thiazolyl blue tetrazolium bromide (MTT). The atomic mass of the active compound(s) was estimated by comparison to the position of the markers (in kDa).
  • AS ammonium sulfate precipitate
  • SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
  • FIGS. 6A and 6B Effect of BAC03 to induce systemic resistance in potato against common scab.
  • Figure 6 A shows disease severity of four treatment groups, when exposed to BAC03, with or without exposure to S. scabies, and in control plants.
  • Figure 6B shows biomass measurements.
  • FIGS. 7 A and 7B Effect of biomaterials on potato common scab in the field in location 1.
  • Figure 7 A shows disease severity and
  • Figure 7B shows plant weight.
  • FIGS. 8 A and B Effect of biomaterials on potato common scab in the field in location 2.
  • Figure 8A shows disease severity and
  • Figure 8B shows plant weight.
  • Bacillus amyloliquefaciens is an aerobic bacterium that is a gram-positive motile, rod-shaped bacterium. See, for example Kang et al., US20110274673.
  • strain BAC03 Bacillus amyloliquefaciens
  • An embodiment is to a strain having all the identifying, biological and genetic characteristics of strain BAC03.
  • the bacterial strain is an alternative to chemical control strategies since they are environmentally friendly and safe to humans.
  • the bacteria produce antimicrobial substances that serve as antibiotics used to inhibit other microorganisms, such as plant pathogens.
  • This strain has been isolated from a disease-suppressive soil and sequenced.
  • the bacteria have been shown to have antimicrobial activity.
  • the antimicrobial portion which is able to kill or inhibit a range of microorganisms, especially soilborne plant pathogens, was isolated and identified as having 99% homology to reported nucleotide sequences encoding an LCI protein, an antimicrobial substance, and disclosed here as SEQ ID NO: 1.
  • the term "the bacteria”, “the strain”, “the bacterial strain”, depending on the context may be used interchangeably to refer to the BAC03 strain, the antimicrobial portion of BAC03 (viz., LCI) or both.
  • the bacterial strain also stimulates plant growth by increasing biomass and inducing the plant to defend against soil borne pathogens.
  • the strain has been demonstrated to have antimicrobial activity on plant pathogens including bacterial and fungal pathogens. Examples include, without limitation, agronomically important crop, vegetable and nut pathogens such as Streptomyces scabies (potato common scab), Agrobacterium tumefaciens, Clavibacter michiganensi, Phytophthora cambivora, Phytophthora capsici, Rhizactonia solani and Sclerotinia sclerotiorum. Still further examples of pathogens include those listed in Table 2 below.
  • the strain In some cases of pathogen inhibition, the strain possesses a greater antimicrobial effect (inhibition zone) than a known biocontrol product containing Bacillus subtilis sold under the trade name SERENADETM and produced by AgraQuest. Furthermore, BAC03 promotes plant growth (e.g. increasing plant biomass) in plants such as potato, radish, tomato, turnip, beet, cucumber, pepper and carrot.
  • a plant is used broadly herein to include any plant at any stage of development, or to part of a plant, including a plant cutting, a plant cell, a plant cell culture, a plant organ, a plant seed, and a plantlet.
  • a plant cell is the structural and physiological unit of the plant, having a protoplast and a cell wall.
  • a plant cell can be in the form of an isolated single cell or aggregate of cells such as a friable callus, a cultured cell, or can be part of a higher organized unit, for example, a plant tissue, plant organ, or plant.
  • a plant cell can be a protoplast, a gamete producing cell, or a cell or collection of cells that can regenerate into a whole plant.
  • a seed which includes multiple plant cells and is capable of regenerating into a whole plant, is considered a plant cell for purposes of this disclosure.
  • a plant tissue or plant organ can be a seed, protoplast, callus, or any other groups of plant cells that is organized into a structural or functional unit.
  • Particularly useful parts of a plant include harvestable parts and parts useful for propagation of progeny plants.
  • a harvestable part of a plant can be any useful part of a plant, for example, flowers, pollen, seedlings, tubers, leaves, stems, fruit, seeds, roots, and the like.
  • a part of a plant useful for propagation includes, for example, seeds, fruits, cuttings, seedlings, tubers, rootstocks, and the like.
  • Tissue culture is capable of regenerating plants.
  • the regenerable cells in such tissue cultures will be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, stalks or the like.
  • plants may be regenerated from the tissue cultures.
  • the disclosed bacterial strain may be used with any plant species, whether monocotyledonous or dicotyledonous. Examples of monocotyledonous plants include, but are not limited to, asparagus, field and sweet corn, barley, wheat, rice, sorghum, onion, pearl millet, rye and oats.
  • dicotyledonous plants include, but are not limited to tomato,potato tobacco, cotton, rapeseed, field beans, soybeans, peppers, lettuce, peas, alfalfa, clover, cole crops or Brassica oleracea (e.g., cabbage, broccoli, cauliflower, Brussels sprouts), radish, carrot, beets, eggplant, spinach, cucumber, squash, melons, cantaloupe, sunflowers and various ornamentals.
  • Brassica oleracea e.g., cabbage, broccoli, cauliflower, Brussels sprouts
  • radish, carrot, beets eggplant, spinach, cucumber, squash, melons, cantaloupe, sunflowers and various ornamentals.
  • a culture of the microbial strain has been deposited with the ATCC, 10801 University Boulevard., Manassas, Va. 20110-2209 USA on May 10, 2012 and, as noted above, has been designated as ATCC No. PTA- 12890.
  • the strain or the antimicrobial protein when referred to as biologically pure or isolated refers to the strain or protein separated from materials with which it is normally associated in nature.
  • a representative sample of a biologically pure or isolated culture of BAC03 strain refers to the strain deposited as ATCC No. PTA- 12890.
  • a monoculture of a strain, or a strain associated with other strains, or with compounds or materials that it is not normally found in nature, are examples of a biologically pure strain.
  • the strain encompasses its various forms, including by way of example without limitation, cell suspensions, spores, vegetative cells or whole culture of the strain which may be used to provide the antimicrobial properties of BAC03.
  • the whole culture obtained may be prepared into whole culture powder, for example, by freeze-drying the whole culture as it is.
  • the vegetative cells may be prepared as a cell precipitate, for example, by centrifuging whole culture after the cultivation to remove contaminants, further centrifuging the resulting supernatant, and then washing the cells precipitated.
  • the spores may be prepared as freeze-dried spore powder, for example, by suspending the cell precipitate obtained above in distilled water and freeze-drying the resulting suspension.
  • the strain may be a mutant (also referred to as a variant) of BAC03, a representative sample of which has been deposited as ATCC PTA- 12890 that has all the identifying characteristics of the strain and retains antimicrobial properties to the pathogens described.
  • Such mutants may be those having a genome that hybridizes under conditions of high stringency to the genome of the strain a representative sample of which has been deposited as ATCC PTA- 12890.
  • the mutants may be those having recA, recN, cheA and gyrA sequences which hybridize under stringent conditions to the recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA sequences (SEQ ID NO. 5) of BAC03, a representative sample of which has been deposited as ATCC PTA- 12890.
  • hybridization techniques all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (e.g., genomic or cDNA libraries) from a chosen organism.
  • the hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32 P, or any other detectable marker.
  • probes for hybridization can be made by labeling synthetic oligonucleotides based on the DNA sequences disclosed.
  • Methods for probe preparation for hybridization and for cDNA or genomic libraries construction are generally known in the art and are disclosed (see e.g.
  • the nucleic acid sequences disclosed herein, or one or more portions thereof may be used as a probe capable of specifically hybridizing to corresponding sequences.
  • probes include sequences that are unique among the sequences to be screened and are preferably at least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length.
  • sequences may alternatively be used to amplify corresponding sequences from a chosen plant by polymerase chain reaction (PCR). This technique may be used to isolate sequences from a desired plant or as a diagnostic assay to determine the presence of sequences in a plant.
  • Hybridization techniques include hybridization screening of DNA libraries plated as either plaques or colonies (Sambrook et al., 1989). Hybridization of such sequences may be carried out under stringent conditions. By “stringent conditions” or “stringent
  • hybridization condition is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background).
  • Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization or washing conditions or both, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
  • a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g. , 10 to 50 nucleotides) and at least about 60°C for long probes (e.g. , greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 50°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 0.1% SDS at 37°C, and a wash in 0.1X SSC at about 60 to 65°C.
  • sequences that correspond to and which hybridize to the nucleotide sequence disclosed herein will be at least about 50% to about 99% homologous; about 70% homologous, and even about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous or more with the disclosed sequence. That is, the sequence similarity between probe and target may range, sharing at least about 50%, about 70%, and even about 85% or more sequence similarity.
  • T m can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem. , 138:267-284
  • T m 81.5°C + 16.6 (log M) + 0.41 (%GC) -0.61 (% form) - 500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe.
  • T m is reduced by about 1°C for each 1 % of mismatching; thus, T m , hybridization or wash conditions or both can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
  • a mutant may also be a strain having a genomic sequence having at least about 85% to about 95% identity to the genome of BAC03 as represented in ATCC No. PTA-12890.
  • the mutant may be a strain having a recA, recN, cheA and gyrA sequences which have at least about 85% to about 95% identity to the recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA (SEQ ID NO. 5) sequences of BAC03, a representative sample of which has been deposited as ATCC No. PTA-12890. Any such mutant is one which retains the antimicrobial properties described herein.
  • a mutant may be one which produces the antimicrobial protein, an LCI protein.
  • reference sequence is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length promoter sequence, or the complete promoter sequence.
  • comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (e.g., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least about 20 to about 100 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
  • Optimal alignment of sequences for comparison can use any means to analyze sequence identity (homology) known in the art, e.g., by the progressive alignment method of termed "PILEUP" (Morrison, (1997) Mol. Biol. Evol. 14:428-441 , as an example of the use of PILEUP); by the local homology algorithm of Smith & Waterman ⁇ Adv. Appl. Math. 2: 482 (1981)); by the homology alignment algorithm of Needleman & Wunsch (/. Mol. Biol. 48:443-453 (1970)); by the search for similarity method of Pearson ⁇ Proc. Natl. Acad. Sci.
  • BLAST algorithm Another example of algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul et al, (1990) /. Mol. Biol. 215: 403- 410.
  • the BLAST programs (Basic Local Alignment Search Tool) of Altschul, S. F., et al., (1993) J. Mol. Biol. 215:403-410) searches under default parameters for identity to sequences contained in the BLAST "GENEMBL" database.
  • a sequence can be analyzed for identity to all publicly available DNA sequences contained in the GENEMBL database using the BLASTN algorithm under the default parameters.
  • HSPs high scoring sequence pairs
  • Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • BLAST refers to the BLAST algorithm which performs a statistical analysis of the similarity between two sequences; see, e.g., Karlin (1993), Proc. Natl. Acad. Sci. USA 90:5873-5787.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • GAP Global Alignment Program
  • GAP uses the algorithm of Needleman and Wunsch (/. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
  • Default gap creation penalty values and gap extension penalty values in the commonly used Version 10 of the Wisconsin PackageTM (Accelrys, Inc., San Diego, CA) for protein sequences are 8 and 2, respectively.
  • the default gap creation penalty is 50 while the default gap extension penalty is 3.
  • Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored.
  • a similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold.
  • a general purpose scoring system is the BLOSUM62 matrix (Henikoff and Henikoff (1993), Proteins 17: 49-61), which is currently the default choice for BLAST programs. BLOSUM62 uses a combination of three matrices to cover all contingencies. Altschul, J. Mol. Biol. 36: 290-300 (1993), herein incorporated by reference in its entirety and is the scoring matrix used in Version 10 of the Wisconsin PackageTM (Accelrys, Inc., San Diego, CA) (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).
  • sequence identity or “identity” in the context of two nucleic acid sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (e,g., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • Identity to the sequences disclosed would mean a polynucleotide sequence having at least about 65% to about 99% sequence identity, at least 70% sequence identity, at least 75% sequence identity, at least 80% identity, at least 85% 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity.
  • “application” of the disclosed strain is intended to refer to exposing the plant, plant part, or soil with or without the plant or plant part to the strain in any convenient manner, such that adverse impact of a pathogen is reduced.
  • the adverse impact of a pathogen on a plant or plant part may be measured by any of a variety of options available to one skilled in the art, including by way of example without limitation, determination of improved plant growth, growth rate, biomass, increased survival rates, plant length, weight, leaf area, flower fertility, pollen fertility, seed weight or yield, seed germination, tuber weight or any combination of these, as compared to a plant exposed to the pathogen but which has not had the disclosed strain applied.
  • the strain may be applied to plants and soil in any convenient manner.
  • the strain may be applied as a stand-alone living organism, since its spores can tolerate extreme environmental conditions. It may be provided as a suspension in whole broth culture (liquid culture containing cells and media) or supernatant of whole broth culture (liquid broth with cells removed by centrifugation, filtration or other of the many available methods) or precipitants having the antimicrobial LCI protein or an extraction of the protein or granular formulas.
  • the application method is not limited by manner of producing or combining the strain with other components and one skilled in the art appreciates many variables exist.
  • the strain or supernatant or cell suspension or the like may also be combined with other compositions of interest, and provided in a convenient form, such as a formula, liquid, granule, suspension, microencapsulation or powder, for example.
  • liquid compositions may include water, a saline solution or other aqueous solution.
  • inactive additives, plant health enhancing compositions, stabilizers or other components desired may be added.
  • the strain or any compositions combined with the strain may be applied in any advantageous manner, and may, for example, be applied prior to pathogen infection, at the time of infection, after infection, or as a seed treatment, and in multiple treatments.
  • Application can also include, for example, applying to the soil in contact with the plant or plant part.
  • the concentration of the strain may need to be determined such that it does not affect seedling germination.
  • the strain may be applied in a convenient strength to the seedling or in the soil.
  • An effective amount of the strain is an amount sufficient to reduce adverse impact of a pathogen compared to a plant to which the strain has not been applied.
  • the concentration of the strain may be dictated by economical considerations. For example, concentrations of 10 7 CFU cm "3 would be effective, yet costs may indicate a range of up to 10 6 CFU cm " .
  • economic considerations may also impact a concentration.
  • an inhibition rate of about 15% was observed when the concentration of purified antimicrobial substance was 15 ⁇ g/ml and an inhibition of almost 100% was observed with a concentration of 75 ⁇ g/ml.
  • kits for the control, prevention or treatment of plant disease or inducing or promoting plant growth where the kit includes the bacterial strain or protein composition and instructional material for applying the bacterial composition to control, prevent or treat a plant pathogen infection, or induce or promote plant growth as described herein.
  • the instructions for applying the disclosed bacterial composition can be any form of instruction means. Such instructions include, but are not limited to, written instruction material (e.g., a label, a booklet, a brochure, a pamphlet), oral instructional material (such as on an audio cassette or CD) or video instructions (such as on a video tape or DVD).
  • a biologically pure or isolated bacterial culture having a gene sequence possessing at least 85% sequence identity to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
  • An isolated polynucleotide having SEQ ID NO: 1 and having antimicrobial or plant growth promoting activity having SEQ ID NO: 1 and having antimicrobial or plant growth promoting activity.
  • a composition comprising any of the embodiments 1-12.
  • a composition of embodiment 13 further comprising one or more other compositions.
  • a composition comprising any of the embodiments of 1-14 in a concentration up to 10 7 CFU.
  • composition comprising spores, cells, whole culture or cell suspension of any of the embodiments 1-15.
  • a composition comprising an ammonium sulfate precipitated fraction of a supernatant of a whole cell culture of Bacillus amyloliquefaciens BAC03.
  • kits for increasing plant growth comprising a bacterial culture of any of
  • kits for reducing disease severity of a plant pathogen comprising a bacterial culture of any of embodiments 1-17, and instructions for use of the culture for reducing disease severity of a plant pathogen.
  • a method of reducing adverse impact of a plant pathogen on a plant or plant part comprising applying to the plant, plant part or a soil an effective amount of any of embodiments 1-17.
  • a method of reducing adverse impact of a plant pathogen on a plant or plant part comprising applying to the plant, plant part or a soil an effective amount of a composition comprising:
  • a a polynucleotide having SEQ ID NO: 1 ;
  • a method of producing a composition for reducing adverse impact of a soil plant pathogen on a plant or plant part comprising producing a composition comprising biologically pure or isolated culture of a Bacillus amyloliquefaciens strain BAC03 deposited as ATCC No. PTA- 12890.
  • Streptomyces scabies selected from Streptomyces scabies, Streptomyces acidiscabies, Streptomyces stelliscabiei, Streptomyces aureofaciens, Streptomyces sp., Agrobacterium tumefaciens, Pseudomonas syringae, Clavibacter michiganensi, Cladosporium cucumerinum, Fusarium solani, Cryphonectria parasitica, Phytophthora capsici, Penicillium citrinum, Phytophthora cambivora, Phytophthora cinnamomi, Botrytis cinerea, Rhizactonia solani and Sclerotinia sclerotiorum.
  • a method for promoting plant growth comprising:
  • a plant growth promoting bacteria comprising a biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 deposited as ATCC NO. PTA- 12890 and mutants or variants thereof.
  • BAC03 A bacterial strain, designated BAC03, was isolated from a Michigan potato field that is suppressive to potato common scab.
  • Bacillus subtilis QST713 was obtained from the commercial biocontrol product SERENADETM (AgraQuest Inc. Davis, CA, USA) as a positive control.
  • Bacillus amyloliquefaciens FZB42 was obtained from the Bacillus Genetic Stock Center (Columbus, OH, USA). All other microorganisms used in this study are listed in Table 1.
  • BAC03 was identified based on sequence analysis of selected genes. BAC03 cultured in 200 ⁇ tryptic soy broth (TSB, EMB Chemical Inc., Gibbstown, NJ, USA) for 24 hours was used for DNA extraction. The FastDNA Spin Kit (MP Biomedicals, Solon, OH, USA) was used following the manufacturer's instructions. Polymerase chain reaction (PCR) was conducted to amplify fragments of the 16S rDNA, recA and recN (DNA repair and recombination proteins), cheA (a histidine kinase), and gyrA (gyrase subunit A) genes with primers listed in Table 1.
  • TAB tryptic soy broth
  • recA and recN DNA repair and recombination proteins
  • cheA a histidine kinase
  • gyrA gyrase subunit A
  • Primers for gene cheA and gyrA were designed based on the consensus sequence of these two genes retrieved from several B. amyloliquefaciens strains in National Center for Biotechnology Information (NCBI) database, and validated with DNAMAN software (Lynnon Corporation, Quebec, Canada).
  • Each PCR reaction had a total volume of 25 ⁇ , containing 5 U Taq DNA polymerase, IX Taq polymerase PCR buffer (Promega, Madison, WI, USA), 200 mM dNTP mixture, 0.2 mM of each primer, and 1 ⁇ (2 to 25 ng) of template DNA.
  • Thermocycler (Bio-Rad Scientific Inc, Hercules, CA, USA) settings were as follows: an initial denaturation for 5 min at 94°C, followed by 36 cycles of 40 s at 94°C, 40 s at 58°C, and 1.5 min at 72°C; and extension for 7 min at 72°C.
  • the PCR products were purified with a PCR purification kit (Denville Scientific Inc, Metuchen, NJ, USA), and sequenced at the Michigan State University Genomic Technology Support Facility (East Lansing, MI, USA). The sequences were analyzed using the BLAST algorithm against the GenBank database.
  • subtilis QST713 which were cultured for 24 hours in TSB, were placed as a drop on a sterile filter paper disk (5 mm diam., Whatman #1, Piscataway, NJ, USA), which was placed on the agar medium with 2 disks per plate, at 2 cm distance from each other. After the plates were incubated at 28°C in darkness for 3 days, the diameter of the inhibition zone (if any) was measured with a ruler. Each isolate was replicated four times. The experiment was conducted twice.
  • BAC03 Bacillus subtilis
  • a dual culture method was used. Briefly, one mycelial plug (5 mm diam.) were cut from freshly growing cultures using a sterile cork borer (5 mm diam), and transferred to approximately the center of a potato dextrose agar (PDA, EMB Chemical Inc., Gibbstown, NJ, USA) plate. Two paper discs (5 mm diam.) were placed on either side of the plug at 2 cm distance from the plug. An aliquot of 15 ⁇ of BAC03 or QST713 was added to each filter paper disc using a pipette. The plates were incubated at 22°C for 3 to 4 days. The inhibition zone was measured as described above.
  • PDA potato dextrose agar
  • the potato seedlings were transferred to a 3.78 L plastic pot with potting mix, infested with S. scabies by pouring the inoculum to the top of the potting mix at a final concentration of 10 6 colony forming unit (CFU)/cm 3 .
  • Liquid culture of B AC03 was added to the potting mix as a drench to give a final concentration of 10 5 (treatment B l) and 10 6 (treatment B2) CFU/cm 3 .
  • Treatment with BAC03 was done two times; once when seedlings were transplanted and a second 20 days later.
  • a positive control using S. scabies inoculum only (S), and a negative control of non-infested potting mix mixed with tryptic soy broth at a level similar to the amount added with B2 (CK) were used.
  • S. scabies inoculum only (S) S. scabies inoculum only
  • CK non-infested potting mix mixed with tryptic soy broth at a level similar to the amount added with B2
  • Radish cv. "Cherry Belle”, Burpee Inc. Warminster, PA, USA
  • seeds were pre- germinated in a Petri dish (VWR International, LLC, Radnor, PA, USA) with moist filter paper overnight at 25 °C. After germination, seedlings were sown in a 1 L pot containing autoclaved potting mix infested with S. scabies (10 7 CFU/cm 3 ), in a growth chamber (23°C and 14 h light).
  • BAC03 was applied (10 5 CFU/cm 3 for each time) as the following treatments: bO: non-treated; bl : 1 time after planting (TAP); b2: 2 TAPs; b3: 3 TAPs; and b4: 1 time before planting and 3 TAP.
  • TAP time after planting
  • b2 2 TAPs
  • b3 3 TAPs
  • b4 1 time before planting and 3 TAP.
  • the intervals between BAC03 applications were one week.
  • Reactions were prepared in triplicate in 96-well optical plates using the following master mix: 10 ⁇ of ABI SYBR Green PCR master mix (2 X) (Applied Biosystems, Carlsbad, CA, USA), 2 ⁇ of 1/10 diluted potting mix DNA, 0.5 ⁇ of each primer (10 ⁇ ), and 7 ⁇ of sterile ddH 2 0. External standards for quantification consisted of six
  • the potting mix in the pots was covered with a plastic film to avoid contamination from foliar spray.
  • S. scabies (10 6 CFU/cm 3 potting mix) was slowly poured onto the surface of potting mix evenly 5 days after transplanting, and repeated two weeks later. A negative control of inoculation with S. scabies only, and 5 replicates were used for each treatment. Potato tubers were harvested after 3 months and the lesion severity was rated as above.
  • BAC03 was grown in 200 ml of TSB at 28°C on a shaker incubator at 180 rpm for 48 h. The culture was centrifuged at 15,000 g for 20 min at 4°C and the supernatant was collected for all extractions.
  • BAC03 culture supernatant was extracted using ammonium sulfate precipitation as described by Sutyak et al. (2008) with a little modification as follows. Eighty percent ammonium sulfate was added to the supernatant, and incubated at 4°C overnight. The mixture was centrifuged at 15,000 g for 30 min at 4°C, and the supernatant was discarded. The precipitate was dissolved in 10 mM sodium phosphate buffer (pH 6.0), and applied to a Sephadex G-50 column (Pure Biotech LLC, Middlesex, NJ, USA) and centrifuged at 2000 g for 3 min.
  • the eluted fluid was passed through a 0.22 ⁇ filter membrane (Millipore, Billerica, MA, USA), and the antimicrobial activity of this substance against S. scabies was tested by the agar diffusion assay as described above.
  • This extract was designated as ammonium sulfate precipitated material (AS) for the rest of the study.
  • AS ammonium sulfate precipitated material
  • the material from the ammonium sulfate precipitation produced larger inhibition zones (> 2 cm) and thus further study concentrated on this material.
  • the lipopeptide fraction showed low activity ( ⁇ 0.5 cm) and was not examined further.
  • the concentration of protein in the AS was determined using a Bradford Protein assay kit (Thermo Fisher Scientific Inc., Rockford, IL, USA) with a
  • Nanodrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) based on a standard curve constructed for colorimetric absorbance at 595nm.
  • Both BAC03 liquid culture and its derived AS fraction were examined for their reaction to various factors, including temperatures, pH levels, enzymes, and chemicals.
  • temperature the antimicrobial activity was assessed after being incubated at temperatures of 40, 60, 80, and 100°C for 30 min, or 121°C (autoclaving) for 15 min.
  • pH was adjusted from 1.0 to 14.0 by whole pH units using sterile 1 N HC1 or 1 N NaOH. Material was incubated at these pH levels overnight at 4°C. Prior to assessing activity, the pH was readjusted to pH 7.0.
  • Enzymes were tested for their effect on activity by incubating the BAC03 culture or the AS fraction with 10 mg/ml of the following enzymes for 2 h at the optimal temperature for each enzyme according to the manufacturer's instruction. Enzymes were trypsin (MP Biomedicals, Solon, OH, USA, 25°C, pH 7.6); proteinase K (Sigma-Aldrich, Inc. St Louis, MO, 37°C, pH 7.5); pepsin (Sigma- Aldrich, Inc., 37°C, pH 2.0); a-chymotrypsin (Sigma-Aldrich, Inc., 25°C, pH 7.8); and catalase (MP Biomedicals, 25°C, pH 7.0). Effect of various chemical solvents (Table 3) was tested by incubating 5 h at 25°C with 10% organic solvents. Antimicrobial activities of the treated culture and the AS fraction were tested against S. scabies using the disc diffusion assay as described above.
  • the AS fraction was obtained by dodecyl sulfate-polyacrylamide gel
  • SDS PAGE electrophoresis
  • the gel was vertically cut into two parts. One part of the gel, containing the sample and molecular weight standards, was stained with Coomassie Blue protein stain. The other part, containing the same sample, was tested for antimicrobial activity using the method of Naclerio et al. (1993). Briefly, the gel was treated with 20% isopropanol-10 mM Tris-HCl (pH 7.5) for 3 h, rinsed for 1.5 h in 10 mM Tris-HCl (pH 7.5), and washed twice with distilled water for a total of 1 h.
  • the gel was placed in a Petri dish with 1% water agar, and overlaid with 0.8% YME mixed with a bacterial suspension of S. scabies (10 7 CFU/ml).
  • the plate was incubated at 28°C for 48 h, then dyed with thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich Co. LLC, St. Louis, MO, USA) to stain living organisms, and observed for any unstained zone(s).
  • MTT thiazolyl blue tetrazolium bromide
  • LC/MS/MS chromatography-mass spectrometry
  • the 16s rDNA sequence of BAC03 had a similarity higher than 99% with both B. subtilis and B. amyloliquefaciens. However, based on fragment sequences of recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA sequences (SEQ ID NO. 5), the results showed the highest similarity between strain BAC03 and B. amyloliquefaciens. Antimicrobial activity of BAC03
  • z LB Lysogeny broth medium
  • PDA potato dextrose agar
  • 523 bacterial screening medium (SigmaAldrich, Inc. St Louis, MO, USA).
  • Table 2 shows that BAC03 displays antagonistic activity against a broad spectrum of bacteria, fungi, and oomycetes. BAC03 showed significantly greater inhibition zones (P ⁇ 0.05) than QST713 on 13 out of 21 test organisms.
  • Foliar spray with BAC03 did not affect potato growth or disease severity; sprayed plants had disease severity average ratings of 0.76 ⁇ 0.16, and tuber weight of 48.04 + 2.09 g/pot; non-treated plants had disease severity of 0.75 + 0.17 and tuber weight of 47.82 + 1.55 g/pot.
  • BAC03 Effects of BAC03 on Plant Emergence [0073] Emergence of potato and radish reacted differently to BAC03 treatment. BAC03 did not affect the amount of emergence of potato seedlings, regardless of concentrations. However for radish, only 20 + 5.8 % plants emerged during the course of experiment when treated with BAC03 culture at 10 4 CFU/cm 3 potting mix, compared to 100% radish emerged for the control. No radish emergence was visible following treatments with BAC03 at 10 5 and 10 6 CFU/cm 3 potting mix.
  • the AS fraction was picked for further study.
  • the AS fraction significantly reduced the S. scabies population when evaluated by the co- culturing method, and the antimicrobial effect was positively correlated with the AS concentration (Fig. 3 A).
  • the inhibition was almost 100% when the AS concentration was 75 ⁇ g/ml.
  • a reduction in the number of S. scabies colonies following the removal of the AS fraction was observed after co-incubation for different times, and the antimicrobial effect was enhanced with increasing exposure time to the AS fraction (Fig. 3B).
  • the culture broth and ammonium sulfate precipitate (AS) were exposed to various treatments, including:chemical solvent (10%) for 5 h at 25°C temperatures of 40, 60, 80, and 100°C for 30 min, and 121°C (autoclaving) for 15 minpH levels from 1.0 to 14.0 (every single unit) using sterile 1 N HQ or 1 N NaOH, and was readjusted to pH 7.0 after incubation overnight at 4°C.
  • a subset of levels is shown as pH 1, 3, 5, 10, 12, 14 in the table enzymes (10 mg/ml) for 2 h, including trypsin (25°C, pH 7.6), proteinase K (37°C, pH 7.5), pepsin (37°C, pH 2.0), oc-chymotrypsin (25°C, pH 7.8), and catalase (25°C, pH 7.0).
  • Culture broth strain BAC03 was cultured in TSB for 24 hours (10 6 CFU/ml) in a shaker with 180 rpm.
  • AS crude antimicrobial substance, which was extracted by ammonium sulfate precipitation from the culture broth supernatant, and filtered through Sephadex G-50 column and 0.22 ⁇ filter membrane.
  • the AS fraction affected S. scabies sporulation.
  • the S. scabies colonies showed no color change throughout the 7 day incubation period, compared to non-treated colonies, which changed to white or whitish grey.
  • the morphology of the mycelia observed by SEM displayed spiral spore chain formation on non- treated plates but no such structure formed on AS-treated cultures during the time period examined (Fig. 4).
  • the sequence similarity of the amplified putative LCI was 99% between strains BAC03 and B. amyloliquefaciens FZB42 (accession number: CP000560.1) or C-31 (accession number: FJ904931.1).
  • the DNA sequence and putative translated protein sequence were compared to those of reported B. amyloliquefaciens strains. All of the strains had a putative protein of 94 amino acids.
  • the LCI protein sequence for BAC03 was 100% identical with strain C31 (Hu et al. 2010), but had one amino acid different from FZB42. [0078]
  • a reduction in scab severity was observed in both potato and radish, where the population of S. scabies was significantly suppressed by BAC03, and suppression was increased as the time of application was increased.
  • the experiment is repeated with measurement including shoot length, fresh and dry shoot weight, fresh and dry root weight and compared to other strains of biocontrol product.
  • Table 4 Effect of BAC on growth of seven plant types. Two applications of BAC03 (10 s CFU/cm "3 ) were drenched into the soil after plant germination and two weeks later. The same volume of media was used for control.
  • BAC03 The ability of BAC03 to induce systemic resistance is determined by a split root system.
  • potato roots of a plant were split into two parts, A and B, and each part placed in a separate pot when the root system was well developed.
  • Four groups were created including: Group I, roots inoculated with BAC3 and S. scabies in root part A and with S. scabies in root part B; Group II, root inoculated with BAC03 in root part A and S. scabies in root part B; Group III, roots inoculated with S. scabies in root part A and non- treated in root part B; and Group IV, roots not treated in both root parts A and B.
  • Example 3 The experiment of Example 3 may be repeated using radish, pepper or tomato. Briefly, the plant roots may be split and placed into two separate pots infested with a pathogen. To one of the two pots may be applied the Bacillus solution and disease suppression may be evaluated. Assessing of disease suppression may be done by evaluating plant defense-related enzymes such as peroxidase (POX), polyphenol oxidase (PPO) or phenylalanine ammonia lyase (PAL). The plant growth promoting effect of the bacteria may also be evaluated by assaying for the production of indoleacetic acid (IAA), NH 3 , or HCN, and presence of phosphate solubilization and ACC-deaminase. These secreted substances or reactions are correlated with the plant growth promotion.
  • POX peroxidase
  • PPO polyphenol oxidase
  • PAL phenylalanine ammonia lyase
  • IAA indoleacetic acid

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Mobile Radio Communication Systems (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Description

NOVEL BACILLUS AMYLOLIQUE FACIE NS STRAIN BAC03 AND METHODS OF
USING SAME
RELATED APPLICATIONS
[0001] This application claims priority from United States Provisional Application No. 61/640,204, filed on April, 30 2012, which is hereby incorporated by reference in its entirety.
Background
[0002] In agricultural production, poor quality and bad cosmetic appearance due to soilborne diseases are responsible for significant economic crop loss. For example,
Streptomyces species, like Streptomyces scabies, cause scabby diseases in potatoes, radishes, and other crops. Most of the current plant disease control methods have proven ineffective. Moreover, many synthetic fungicides are not permitted especially for organic production, and chemical fungicides do not prevent all diseases and often release toxic chemicals into the soil or food chain. The use of many agrochemicals are also banned or restricted due to environmental and health risks.
Summary
[0003] The use of microbial biopesticides (biocontrol) offers alternatives to chemical control of plant pests and diseases. A novel strain of Bacillus amyloliquefaciens strain BAC03 is isolated and described. The strain is one which has the identifying characteristics of the B. amyloliquefaciens BAC03 strain a representative sample of which has been deposited with the American Type Culture Collection (ATCC) as Deposit No. PTA- 12890 (hereinafter "ATCC No. PTA-12890). The sequence of LCI (SEQ ID NO:l), an
antimicrobial protein produced by this strain, has 99% homology to reported LCI DNA sequences. The bacterial strain promotes plant growth and enhances disease resistance. The strain and mutants thereof are useful as a biological control agent. Use in reducing adverse impact of a pathogen on a plant or plant part is provided. Plants, plant parts or soils are treated by applying an effective amount of BAC03, a supernatant of the strain or cell suspension or other forms of BAC03.
Sequence Listing
[0004] This application hereby incorporates by reference the material of the electronic Sequence Listing filed concurrently herewith.
Brief Description of the Drawings [0005] FIGS. 1A-B. Effect of Bacillus amyloliquefaciens BAC03 on disease severity and plant growth in potato and radish. Panels Al and A2: Potato was planted in potting mix treated with 200 ml of S. scabies at final concentrations 106 CFU/cm3 (treatment S), BAC03 atlO5 CFU/cm3 (treatment Bl), BAC03 at 106 CFU/cm3 (treatment B2), and tryptic soy broth as a control (CK). Panels B l and B2: Radish was planted in potting mix treated with 30 ml of BAC03 at final concentration of 105 CFU/cm3 each time in the following treatments: bO (non- treated), bl [one time of application after planting (TAP)], b2 (2 TAPs), b3 (3 TAPs), and b4 (1 time before and 3 TAPs), with weekly intervals between applications. All pots were infested with Streptomyces scabies at 107 CFU/cm3 potting mix. Fresh plant weight was measured in the end of experiment.
[0006] FIGS. 2. Detection of S. scabies population in potting mix using quantitative realtime polymerase chain reaction assay. Radish was planted in potting mix treated with BAC03 at final concentrations of 105 CFU/cm3 in the following treatments: bO (non- treated), bl [one time after planting (TAP)], b2 (2 TAPs), b3 (3 TAPs), and b4 (1 time before and 3 TAPs). All pots were infested with Streptomyces scabies at 107 CFU/cm3 of potting mix. Soil-less potting mix (0.1 g) was collected from each treated pot for DNA extraction and PCR analyses. The quantity of S. scabies DNA was estimated based on external standards. The means of groups annotated with the same letters were not significantly different, tested by Fisher's Least Significant Difference method (P > 0.05).
[0007] FIGS. 3A-B (A) Antimicrobial activity of Bacillus amyloliquefaciens BAC03 ammonium sulfate precipitation fraction (AS) against Streptomyces scabies; and (B) Test for bactericidal versus bacteriostatic activity of BAC03 AS. Streptomyces scabies was recovered after incubation with AS for 0, 1, 3, and 5 days, followed by rinsing off AS through a 0.22 μιη membrane.
[0008] FIG. 4 Scanning electron microscopy (SEM) of mycelial morphology of
Streptomyces scabies grown on yeast malt extract medium plates. Ten microliters of sodium phosphate buffer (untreated), or AS (treated) was directly dropped onto a S. scabies 2-day-old colony. Five days later, the untreated colonies produced white spores, but the treated culture did not show any sporulation. The culture specimen were processed following the method of Fan et al. (2011) and coated with metallic osmium in preparation for SEM.
[0009] FIG. 5. Test for active fraction of ammonium sulfate precipitate (AS) from Bacillus amyloliquefaciens BAC03 by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After fractionation on SDS-PAGE, the gel was overlaid with yeast malt extract medium containing Streptomyces scabies (107 CFU/ml), and the inhibition zone was observed after 2 days of incubation at 28°C. Growth was detected by staining with thiazolyl blue tetrazolium bromide (MTT). The atomic mass of the active compound(s) was estimated by comparison to the position of the markers (in kDa).
[0010] FIGS. 6A and 6B. Effect of BAC03 to induce systemic resistance in potato against common scab. Figure 6 A shows disease severity of four treatment groups, when exposed to BAC03, with or without exposure to S. scabies, and in control plants. Figure 6B shows biomass measurements.
[0011] FIGS. 7 A and 7B. Effect of biomaterials on potato common scab in the field in location 1. Figure 7 A shows disease severity and Figure 7B shows plant weight.
[0012] FIGS. 8 A and B. Effect of biomaterials on potato common scab in the field in location 2. Figure 8A shows disease severity and Figure 8B shows plant weight.
Detailed Description of the Embodiments
[0013] In the following detailed description, embodiments are described in sufficient detail to enable those skilled in the art to practice them, and it is to be understood that other embodiments may be utilized and that changes (e.g. chemical and procedural) may be made without departing from the spirit and scope of the present subject matter. The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of embodiments of the present invention is defined only by the appended claims.
[0014] Bacillus amyloliquefaciens is an aerobic bacterium that is a gram-positive motile, rod-shaped bacterium. See, for example Kang et al., US20110274673. Disclosed is a novel bacterial strain, Bacillus amyloliquefaciens (strain BAC03), having strong antimicrobial activity against a variety of bacterial and fungal pathogens. An embodiment is to a strain having all the identifying, biological and genetic characteristics of strain BAC03. The bacterial strain is an alternative to chemical control strategies since they are environmentally friendly and safe to humans. The bacteria produce antimicrobial substances that serve as antibiotics used to inhibit other microorganisms, such as plant pathogens. This strain has been isolated from a disease-suppressive soil and sequenced. The bacteria have been shown to have antimicrobial activity. The antimicrobial portion which is able to kill or inhibit a range of microorganisms, especially soilborne plant pathogens, was isolated and identified as having 99% homology to reported nucleotide sequences encoding an LCI protein, an antimicrobial substance, and disclosed here as SEQ ID NO: 1. As used here, the term "the bacteria", "the strain", "the bacterial strain", depending on the context may be used interchangeably to refer to the BAC03 strain, the antimicrobial portion of BAC03 (viz., LCI) or both.
[0015] The bacterial strain also stimulates plant growth by increasing biomass and inducing the plant to defend against soil borne pathogens. The strain has been demonstrated to have antimicrobial activity on plant pathogens including bacterial and fungal pathogens. Examples include, without limitation, agronomically important crop, vegetable and nut pathogens such as Streptomyces scabies (potato common scab), Agrobacterium tumefaciens, Clavibacter michiganensi, Phytophthora cambivora, Phytophthora capsici, Rhizactonia solani and Sclerotinia sclerotiorum. Still further examples of pathogens include those listed in Table 2 below. In some cases of pathogen inhibition, the strain possesses a greater antimicrobial effect (inhibition zone) than a known biocontrol product containing Bacillus subtilis sold under the trade name SERENADE™ and produced by AgraQuest. Furthermore, BAC03 promotes plant growth (e.g. increasing plant biomass) in plants such as potato, radish, tomato, turnip, beet, cucumber, pepper and carrot.
[0016] The term plant is used broadly herein to include any plant at any stage of development, or to part of a plant, including a plant cutting, a plant cell, a plant cell culture, a plant organ, a plant seed, and a plantlet. A plant cell is the structural and physiological unit of the plant, having a protoplast and a cell wall. A plant cell can be in the form of an isolated single cell or aggregate of cells such as a friable callus, a cultured cell, or can be part of a higher organized unit, for example, a plant tissue, plant organ, or plant. Thus, a plant cell can be a protoplast, a gamete producing cell, or a cell or collection of cells that can regenerate into a whole plant. As such, a seed, which includes multiple plant cells and is capable of regenerating into a whole plant, is considered a plant cell for purposes of this disclosure. A plant tissue or plant organ can be a seed, protoplast, callus, or any other groups of plant cells that is organized into a structural or functional unit. Particularly useful parts of a plant include harvestable parts and parts useful for propagation of progeny plants. A harvestable part of a plant can be any useful part of a plant, for example, flowers, pollen, seedlings, tubers, leaves, stems, fruit, seeds, roots, and the like. A part of a plant useful for propagation includes, for example, seeds, fruits, cuttings, seedlings, tubers, rootstocks, and the like.
Tissue culture is capable of regenerating plants. For example, the regenerable cells in such tissue cultures will be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, stalks or the like. Still further, plants may be regenerated from the tissue cultures. [0017] The disclosed bacterial strain may be used with any plant species, whether monocotyledonous or dicotyledonous. Examples of monocotyledonous plants include, but are not limited to, asparagus, field and sweet corn, barley, wheat, rice, sorghum, onion, pearl millet, rye and oats. Examples of dicotyledonous plants include, but are not limited to tomato,potato tobacco, cotton, rapeseed, field beans, soybeans, peppers, lettuce, peas, alfalfa, clover, cole crops or Brassica oleracea (e.g., cabbage, broccoli, cauliflower, Brussels sprouts), radish, carrot, beets, eggplant, spinach, cucumber, squash, melons, cantaloupe, sunflowers and various ornamentals.
[0018] A culture of the microbial strain has been deposited with the ATCC, 10801 University Blvd., Manassas, Va. 20110-2209 USA on May 10, 2012 and, as noted above, has been designated as ATCC No. PTA- 12890.
[0019] The strain or the antimicrobial protein when referred to as biologically pure or isolated refers to the strain or protein separated from materials with which it is normally associated in nature. A representative sample of a biologically pure or isolated culture of BAC03 strain refers to the strain deposited as ATCC No. PTA- 12890. A monoculture of a strain, or a strain associated with other strains, or with compounds or materials that it is not normally found in nature, are examples of a biologically pure strain. The strain encompasses its various forms, including by way of example without limitation, cell suspensions, spores, vegetative cells or whole culture of the strain which may be used to provide the antimicrobial properties of BAC03. They may be prepared, for example, from a culture obtained by cultivating the strain by a conventional method. The whole culture obtained may be prepared into whole culture powder, for example, by freeze-drying the whole culture as it is. The vegetative cells may be prepared as a cell precipitate, for example, by centrifuging whole culture after the cultivation to remove contaminants, further centrifuging the resulting supernatant, and then washing the cells precipitated. In addition, the spores may be prepared as freeze-dried spore powder, for example, by suspending the cell precipitate obtained above in distilled water and freeze-drying the resulting suspension.
[0020] The strain may be a mutant (also referred to as a variant) of BAC03, a representative sample of which has been deposited as ATCC PTA- 12890 that has all the identifying characteristics of the strain and retains antimicrobial properties to the pathogens described.
[0021] Such mutants may be those having a genome that hybridizes under conditions of high stringency to the genome of the strain a representative sample of which has been deposited as ATCC PTA- 12890. In another embodiment the mutants may be those having recA, recN, cheA and gyrA sequences which hybridize under stringent conditions to the recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA sequences (SEQ ID NO. 5) of BAC03, a representative sample of which has been deposited as ATCC PTA- 12890.
[0022] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (e.g., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the DNA sequences disclosed. Methods for probe preparation for hybridization and for cDNA or genomic libraries construction are generally known in the art and are disclosed (see e.g.
Sambrook et al., 1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
[0023] For example, the nucleic acid sequences disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding sequences. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among the sequences to be screened and are preferably at least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length. Such sequences may alternatively be used to amplify corresponding sequences from a chosen plant by polymerase chain reaction (PCR). This technique may be used to isolate sequences from a desired plant or as a diagnostic assay to determine the presence of sequences in a plant.
[0024] Hybridization techniques include hybridization screening of DNA libraries plated as either plaques or colonies (Sambrook et al., 1989). Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent
hybridization condition" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization or washing conditions or both, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.
[0025] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g. , 10 to 50 nucleotides) and at least about 60°C for long probes (e.g. , greater than 50 nucleotides).
Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 50°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 0.1% SDS at 37°C, and a wash in 0.1X SSC at about 60 to 65°C.
[0026] In general, sequences that correspond to and which hybridize to the nucleotide sequence disclosed herein will be at least about 50% to about 99% homologous; about 70% homologous, and even about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous or more with the disclosed sequence. That is, the sequence similarity between probe and target may range, sharing at least about 50%, about 70%, and even about 85% or more sequence similarity.
[0027] Specificity is typically the function of post-hybridization washes, the factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem. , 138:267-284
(1984): Tm=81.5°C + 16.6 (log M) + 0.41 (%GC) -0.61 (% form) - 500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1°C for each 1 % of mismatching; thus, Tm, hybridization or wash conditions or both can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at about 1 to about 4°C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at about 6 to about 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at about 1 lto about 20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than about 45 °C (aqueous solution) or about 32°C (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids may for example be found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology "Hybridization with Nucleic Acid Probes" Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and Haymes et al. (1985) In: Nucleic Acid Hybridization, a Practical Approach, IRL Press, Washington, D.C. Thus, mutant strains that have the antimicrobial activity described herein and which hybridize under stringent conditions to the sequences disclosed are encompassed by the various embodiments described herein.
[0028] A mutant may also be a strain having a genomic sequence having at least about 85% to about 95% identity to the genome of BAC03 as represented in ATCC No. PTA-12890. In another embodiment the mutant may be a strain having a recA, recN, cheA and gyrA sequences which have at least about 85% to about 95% identity to the recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA (SEQ ID NO. 5) sequences of BAC03, a representative sample of which has been deposited as ATCC No. PTA-12890. Any such mutant is one which retains the antimicrobial properties described herein. In other embodiments, a mutant may be one which produces the antimicrobial protein, an LCI protein.
[0029] The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence", (b) "comparison window", (c) "sequence identity" and (d) "percentage of sequence identity." [0030] (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length promoter sequence, or the complete promoter sequence.
[0031] (b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (e.g., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least about 20 to about 100 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to accurately reflect the similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
[0032] Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.
[0033] Optimal alignment of sequences for comparison can use any means to analyze sequence identity (homology) known in the art, e.g., by the progressive alignment method of termed "PILEUP" (Morrison, (1997) Mol. Biol. Evol. 14:428-441 , as an example of the use of PILEUP); by the local homology algorithm of Smith & Waterman {Adv. Appl. Math. 2: 482 (1981)); by the homology alignment algorithm of Needleman & Wunsch (/. Mol. Biol. 48:443-453 (1970)); by the search for similarity method of Pearson {Proc. Natl. Acad. Sci. USA 85: 2444 (1988)); by computerized implementations of these algorithms (e.g., GAP, BEST FIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.); ClustalW (CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif., described by, e.g., Higgins(1988), Gene 73: 237-244; Corpet (1988), Nucleic Acids Res. 16: 10881-10890; Huang, Computer
Applications in the Biosciences 8: 155-165 (1992); and Pearson (1994), Methods in Mol. Biol. 24:307-331); Pfam (Sonnhammer (1998), Nucleic Acids Res. 26:322-325); TreeAlign (Hein (1994), Methods Mol. Biol. 25:349-364); MEG-ALIGN, and SAM sequence alignment computer programs; or, by manual visual inspection.
[0034] Another example of algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul et al, (1990) /. Mol. Biol. 215: 403- 410. The BLAST programs (Basic Local Alignment Search Tool) of Altschul, S. F., et al., (1993) J. Mol. Biol. 215:403-410) searches under default parameters for identity to sequences contained in the BLAST "GENEMBL" database. A sequence can be analyzed for identity to all publicly available DNA sequences contained in the GENEMBL database using the BLASTN algorithm under the default parameters.
[0035] Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information, www.ncbi.nlm.nih.gov/; see also Zhang (1997), Genome Res. 7:649-656 for the "PowerBLAST" variation. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see Henikoff (1992), Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The term BLAST refers to the BLAST algorithm which performs a statistical analysis of the similarity between two sequences; see, e.g., Karlin (1993), Proc. Natl. Acad. Sci. USA 90:5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
[0036] In an embodiment, GAP (Global Alignment Program) can be used. GAP uses the algorithm of Needleman and Wunsch (/. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. Default gap creation penalty values and gap extension penalty values in the commonly used Version 10 of the Wisconsin Package™ (Accelrys, Inc., San Diego, CA) for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. A general purpose scoring system is the BLOSUM62 matrix (Henikoff and Henikoff (1993), Proteins 17: 49-61), which is currently the default choice for BLAST programs. BLOSUM62 uses a combination of three matrices to cover all contingencies. Altschul, J. Mol. Biol. 36: 290-300 (1993), herein incorporated by reference in its entirety and is the scoring matrix used in Version 10 of the Wisconsin Package™ (Accelrys, Inc., San Diego, CA) (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).
[0037] (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
[0038] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (e,g., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
[0039] Identity to the sequences disclosed would mean a polynucleotide sequence having at least about 65% to about 99% sequence identity, at least 70% sequence identity, at least 75% sequence identity, at least 80% identity, at least 85% 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity.
[0040] When referring to "application" of the disclosed strain is intended to refer to exposing the plant, plant part, or soil with or without the plant or plant part to the strain in any convenient manner, such that adverse impact of a pathogen is reduced. The adverse impact of a pathogen on a plant or plant part may be measured by any of a variety of options available to one skilled in the art, including by way of example without limitation, determination of improved plant growth, growth rate, biomass, increased survival rates, plant length, weight, leaf area, flower fertility, pollen fertility, seed weight or yield, seed germination, tuber weight or any combination of these, as compared to a plant exposed to the pathogen but which has not had the disclosed strain applied.
[0041] The strain may be applied to plants and soil in any convenient manner. The strain may be applied as a stand-alone living organism, since its spores can tolerate extreme environmental conditions. It may be provided as a suspension in whole broth culture (liquid culture containing cells and media) or supernatant of whole broth culture (liquid broth with cells removed by centrifugation, filtration or other of the many available methods) or precipitants having the antimicrobial LCI protein or an extraction of the protein or granular formulas. The application method is not limited by manner of producing or combining the strain with other components and one skilled in the art appreciates many variables exist. Where desired, the strain or supernatant or cell suspension or the like may also be combined with other compositions of interest, and provided in a convenient form, such as a formula, liquid, granule, suspension, microencapsulation or powder, for example. Examples of liquid compositions may include water, a saline solution or other aqueous solution. Further, inactive additives, plant health enhancing compositions, stabilizers or other components desired may be added.
[0042] The strain or any compositions combined with the strain may be applied in any advantageous manner, and may, for example, be applied prior to pathogen infection, at the time of infection, after infection, or as a seed treatment, and in multiple treatments.
Application can also include, for example, applying to the soil in contact with the plant or plant part. In some embodiments, the concentration of the strain may need to be determined such that it does not affect seedling germination. For plants whose seedling emergence is not affected, the strain may be applied in a convenient strength to the seedling or in the soil. An effective amount of the strain is an amount sufficient to reduce adverse impact of a pathogen compared to a plant to which the strain has not been applied. The concentration of the strain may be dictated by economical considerations. For example, concentrations of 107 CFU cm"3 would be effective, yet costs may indicate a range of up to 106 CFU cm" . When the antimicrobial substance is used, economic considerations may also impact a concentration. By way of example without limitation, when tested in vitro, an inhibition rate of about 15% was observed when the concentration of purified antimicrobial substance was 15μg/ml and an inhibition of almost 100% was observed with a concentration of 75μg/ml.
[0043] Disclosed is also a kit for the control, prevention or treatment of plant disease or inducing or promoting plant growth, where the kit includes the bacterial strain or protein composition and instructional material for applying the bacterial composition to control, prevent or treat a plant pathogen infection, or induce or promote plant growth as described herein. The skilled artisan will appreciate that the instructions for applying the disclosed bacterial composition can be any form of instruction means. Such instructions include, but are not limited to, written instruction material (e.g., a label, a booklet, a brochure, a pamphlet), oral instructional material (such as on an audio cassette or CD) or video instructions (such as on a video tape or DVD).
[0044] Some additional non-limiting exemplary embodiments are provided below.
1. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03.
2. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03
deposited as ATCC NO. PTA- 12890.
3. A biologically pure or isolated bacterial culture having the physiological and
morphological characteristics of the culture depositedas ATCC NO. PTA- 12890.
4. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 and mutants or variants thereof.
5. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 strain deposited as ATCC No. PTA- 12890 and having antagonistic or antimicrobial activity against plant soil pathogens.
6. A biologically pure or isolated bacterial culture having a gene sequence possessing at least 85% sequence identity to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
7. An isolated protein from Bacillus amyloliquefaciens BAC03 having antimicrobial activity.
8. An isolated polynucleotide having SEQ ID NO: 1 and having antimicrobial or plant growth promoting activity.
9. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 having antagonist activity against soil pathogens.
10. A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 having antagonist activity against Streptomyces species. A biologically pure or isolated culture of Bacillus amyloliquefaciens B AC03 having antagonist activity against common scab.
A biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 having plant growth promoting activity.
A composition comprising any of the embodiments 1-12.
A composition of embodiment 13 further comprising one or more other compositions. A composition comprising any of the embodiments of 1-14 in a concentration up to 107 CFU.
A composition comprising spores, cells, whole culture or cell suspension of any of the embodiments 1-15.
A composition comprising an ammonium sulfate precipitated fraction of a supernatant of a whole cell culture of Bacillus amyloliquefaciens BAC03.
A kit for increasing plant growth, comprising a bacterial culture of any of
embodiments 1-17, and instructions for use of the culture for promoting plant growth. A kit for reducing disease severity of a plant pathogen, comprising a bacterial culture of any of embodiments 1-17, and instructions for use of the culture for reducing disease severity of a plant pathogen.
A method of reducing adverse impact of a plant pathogen on a plant or plant part, the method comprising applying to the plant, plant part or a soil an effective amount of any of embodiments 1-17.
The method of embodiment 20, wherein applying to the plant or plant part is more than once.
The method of embodiment 20, wherein the plant part is a seed.
A method of reducing adverse impact of a plant pathogen on a plant or plant part, the method comprising applying to the plant, plant part or a soil an effective amount of a composition comprising:
a. a polynucleotide having SEQ ID NO: 1 ;
b. a BAC03 strain deposited as ATCC No. PTA- 12890;
c. a strain having at least 80 % identity to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5.
A method of producing a composition for reducing adverse impact of a soil plant pathogen on a plant or plant part, the method comprising producing a composition comprising biologically pure or isolated culture of a Bacillus amyloliquefaciens strain BAC03 deposited as ATCC No. PTA- 12890.
25. The method of embodiment 24, wherein the strain comprises spores, cells or whole culture of the strain.
26. The method of any of embodiments 20, 23 or 24, wherein the plant pathogen is
selected from Streptomyces scabies, Streptomyces acidiscabies, Streptomyces stelliscabiei, Streptomyces aureofaciens, Streptomyces sp., Agrobacterium tumefaciens, Pseudomonas syringae, Clavibacter michiganensi, Cladosporium cucumerinum, Fusarium solani, Cryphonectria parasitica, Phytophthora capsici, Penicillium citrinum, Phytophthora cambivora, Phytophthora cinnamomi, Botrytis cinerea, Rhizactonia solani and Sclerotinia sclerotiorum.
27. A method for promoting plant growth, comprising:
applying to a plant a plant growth promoting bacteria comprising a biologically pure or isolated culture of Bacillus amyloliquefaciens BAC03 deposited as ATCC NO. PTA- 12890 and mutants or variants thereof.
28. The method of embodiment 27, wherein the plant growth promoting bacteria have a gene sequence possessing at least 80% sequence identity to SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
29. The method of embodiment 26, wherein the applying is effected by a method selected from applying:
a) to soil before or contemporaneously with sowing plant seeds in the soil;
b) to seeds before or contemporaneously with sowing plant seeds in the soil; and,
c) to seeds after plant seeds have been sown in the soil, or to growing plants or to the roots, stems, leaves or other parts thereof.
[0045] The various embodiments will be further described by reference to the following examples, which are offered to further illustrate various embodiments of the present invention. It should be understood, however, that many variations and modifications may be made while remaining within the scope of the present invention.
EXAMPLE 1
Materials and Methods
Collection of Microorganisms And Identification ofBAC03 [0046] A bacterial strain, designated BAC03, was isolated from a Michigan potato field that is suppressive to potato common scab. Bacillus subtilis QST713 was obtained from the commercial biocontrol product SERENADE™ (AgraQuest Inc. Davis, CA, USA) as a positive control. Bacillus amyloliquefaciens FZB42 was obtained from the Bacillus Genetic Stock Center (Columbus, OH, USA). All other microorganisms used in this study are listed in Table 1.
[0047] BAC03 was identified based on sequence analysis of selected genes. BAC03 cultured in 200 μΐ tryptic soy broth (TSB, EMB Chemical Inc., Gibbstown, NJ, USA) for 24 hours was used for DNA extraction. The FastDNA Spin Kit (MP Biomedicals, Solon, OH, USA) was used following the manufacturer's instructions. Polymerase chain reaction (PCR) was conducted to amplify fragments of the 16S rDNA, recA and recN (DNA repair and recombination proteins), cheA (a histidine kinase), and gyrA (gyrase subunit A) genes with primers listed in Table 1. Primers for gene cheA and gyrA were designed based on the consensus sequence of these two genes retrieved from several B. amyloliquefaciens strains in National Center for Biotechnology Information (NCBI) database, and validated with DNAMAN software (Lynnon Corporation, Quebec, Canada). Each PCR reaction had a total volume of 25 μΐ, containing 5 U Taq DNA polymerase, IX Taq polymerase PCR buffer (Promega, Madison, WI, USA), 200 mM dNTP mixture, 0.2 mM of each primer, and 1 μΐ (2 to 25 ng) of template DNA. Thermocycler (Bio-Rad Scientific Inc, Hercules, CA, USA) settings were as follows: an initial denaturation for 5 min at 94°C, followed by 36 cycles of 40 s at 94°C, 40 s at 58°C, and 1.5 min at 72°C; and extension for 7 min at 72°C. After PCR product visualization by electrophoresis on 1.2% (w/v) agarose gel stained with GelGreen (Biotium, Inc., Hayward, CA, USA), the PCR products were purified with a PCR purification kit (Denville Scientific Inc, Metuchen, NJ, USA), and sequenced at the Michigan State University Genomic Technology Support Facility (East Lansing, MI, USA). The sequences were analyzed using the BLAST algorithm against the GenBank database.
Antimicrobial Activity of BAC03
[0048] In vitro assay. Antimicrobial activity of B AC03 was determined against Streptomyces spp. using an agar-disk diffusion assay as described by Kimura et al. 1998. One hundred microliter spore suspension (105 CFU/ml, determined by dilution plating) of various Streptomyces spp. isolates were spread onto yeast malt extract agar (YME, EMB Chemical Inc., Gibbstown, NJ, USA) plates. Fifteen microliters of a 106 CFU/ml BAC03 or B. subtilis QST713, which were cultured for 24 hours in TSB, were placed as a drop on a sterile filter paper disk (5 mm diam., Whatman #1, Piscataway, NJ, USA), which was placed on the agar medium with 2 disks per plate, at 2 cm distance from each other. After the plates were incubated at 28°C in darkness for 3 days, the diameter of the inhibition zone (if any) was measured with a ruler. Each isolate was replicated four times. The experiment was conducted twice.
[0049] To determine the potential antimicrobial activities of BAC03 against various microorganisms (fungi and oomycetes), a dual culture method was used. Briefly, one mycelial plug (5 mm diam.) were cut from freshly growing cultures using a sterile cork borer (5 mm diam), and transferred to approximately the center of a potato dextrose agar (PDA, EMB Chemical Inc., Gibbstown, NJ, USA) plate. Two paper discs (5 mm diam.) were placed on either side of the plug at 2 cm distance from the plug. An aliquot of 15 μΐ of BAC03 or QST713 was added to each filter paper disc using a pipette. The plates were incubated at 22°C for 3 to 4 days. The inhibition zone was measured as described above.
[0050] For other bacteria, the same technique was used as described for testing
Streptomyces spp. All the microorganisms and media used are listed in Table 1. The experiment was conducted twice with 4 replicates for each isolate.
[0051] In plant assay. A pot assay was conducted in a greenhouse. Streptomyces scabies (Deposited as ATCC No. 49173) was cultured in oatmeal broth at 28°C for 4 to 5 days in an incubator shaker at 180 rpm, and the concentration of liquid culture was determined by plating on YME. Potato tuber pieces with one eye (cv. 'Snowden') at least were surface disinfested with 1 % NaCIO for 5 min, and then rinsed with sterile distilled water three times. After air-drying, the tuber was incubated in potting mix (ASB Greenworld Inc., New Brunswick, VA, USA) in a growth chamber at 25°C until seedling emergence. The potato seedlings were transferred to a 3.78 L plastic pot with potting mix, infested with S. scabies by pouring the inoculum to the top of the potting mix at a final concentration of 106 colony forming unit (CFU)/cm3. Liquid culture of B AC03 was added to the potting mix as a drench to give a final concentration of 105 (treatment B l) and 106 (treatment B2) CFU/cm3.
Treatment with BAC03 was done two times; once when seedlings were transplanted and a second 20 days later. A positive control using S. scabies inoculum only (S), and a negative control of non-infested potting mix mixed with tryptic soy broth at a level similar to the amount added with B2 (CK) were used. Six weeks after transplanting, the height of the plant from the soil line to the apical meristem of potato was measured with a ruler. Plants were harvested 10 weeks after transplanting. Tubers were examined for lesions and given a severity rating using the 0 to 5 scale where 0 = no disease, and 5 = the whole tuber is covered by scabby lesions. Tuber yield was determined by measuring the weight of potato tubers from each pot.
[0052] Radish (cv. "Cherry Belle", Burpee Inc. Warminster, PA, USA) seeds were pre- germinated in a Petri dish (VWR International, LLC, Radnor, PA, USA) with moist filter paper overnight at 25 °C. After germination, seedlings were sown in a 1 L pot containing autoclaved potting mix infested with S. scabies (107 CFU/cm3), in a growth chamber (23°C and 14 h light). BAC03 was applied (105 CFU/cm3 for each time) as the following treatments: bO: non-treated; bl : 1 time after planting (TAP); b2: 2 TAPs; b3: 3 TAPs; and b4: 1 time before planting and 3 TAP. The intervals between BAC03 applications were one week.
There were 4 replicates for each treatment. The disease severity was determined by giving a severity rating of lesions with 0 to 5 scale, where 0 = no disease, and 5 = the whole tuber is covered by scabby lesions. And the weight of leaves and roots were determined at harvest, 6 weeks after planting.
Detection of S. Scabies Population in BAC03-Potting Mix Using Quantitative Polymerase Chain Reaction (qPCR) Assay
[0053] After radish plants were pulled out for disease rating, the remnant potting mix from each pot was air-dried and mixed for 5 min by hand. Two samples (0.1 g each) of the potting mix were collected from each pot (eight samples/treatment). Total genomic DNA was extracted with the FastDNA Spin kit for soil (MP Biomedicals). DNA was analyzed using qPCR to quantify S. scabies population in potting mix by amplifying the genes txtA and txtC (Table 2), which were an indicator of quantity of pathogenic S. scabies (Loria et al. 2006). Reactions were prepared in triplicate in 96-well optical plates using the following master mix: 10 μΐ of ABI SYBR Green PCR master mix (2 X) (Applied Biosystems, Carlsbad, CA, USA), 2 μΐ of 1/10 diluted potting mix DNA, 0.5 μΐ of each primer (10 μΜ), and 7 μΐ of sterile ddH20. External standards for quantification consisted of six
concentrations of serially diluted S. scabies genomic DNA (10, 1, 0.1, 0.01, 0.001, 0.0001 ng/μΐ), and were included in triplicate in each PCR run to calculate quantities of S. scabies in the unknown potting mix samples. The PCR was carried out in a StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) using the conditions described by the manufacturer with 45 amplification cycles. To confirm single products, the melting curve and gel electrophoresis were used. The response of potato plant to foliar spray application of BAC03. Twenty ml of BAC03 culture broth (106 CFU/ml) was sprayed onto potato leaves when the plants reached 15 cm in height. Applications were sprayed weekly for 5 weeks. The potting mix in the pots was covered with a plastic film to avoid contamination from foliar spray. S. scabies (106 CFU/cm3 potting mix) was slowly poured onto the surface of potting mix evenly 5 days after transplanting, and repeated two weeks later. A negative control of inoculation with S. scabies only, and 5 replicates were used for each treatment. Potato tubers were harvested after 3 months and the lesion severity was rated as above.
Effects of BAC03 on Seedling Emergence
[0054] Cut potato tubers, with at least one eye per piece, were surface disinfested with 1% NaCIO for 5 min, and rinsed with sterile water three times. After air-drying overnight, the potato tubers were sown in 3.78 L pots containing 2.5 L of potting mix. The seed tubers were placed on the potting soil surface, with 4 tuber pieces per pot, followed by covering with the potting mix (5 cm depth). BAC03 cultured in TSB for 24 hours was mixed into the potting mix at potting to make the final concentrations of 104, 105, and 106 CFU/cm3 potting mix. Each treatment had five replicates. For radish (cv. Cherry Belle), 40 seeds were sown at a 2 cm depth in eight 1 L pots with five seeds each. BAC03 liquid culture was drenched into the potting mix to concentrations of 104, 105, and 106 CFU/cm3 potting mix. Potting mix with TSB only (same volume with 106 CFU/cm3 treatment) was prepared as a negative control. The total number of emerged seedlings was recorded when the seeds in control pots all were at approximately 2 cm high.
Isolation and Characterization of Potential Antimicrobial Substances
[0055] Precipitation. Two extraction methods were used to separate different types of secondary metabolites. BAC03 was grown in 200 ml of TSB at 28°C on a shaker incubator at 180 rpm for 48 h. The culture was centrifuged at 15,000 g for 20 min at 4°C and the supernatant was collected for all extractions.
[0056] For proteinaceous secondary metabolites, BAC03 culture supernatant was extracted using ammonium sulfate precipitation as described by Sutyak et al. (2008) with a little modification as follows. Eighty percent ammonium sulfate was added to the supernatant, and incubated at 4°C overnight. The mixture was centrifuged at 15,000 g for 30 min at 4°C, and the supernatant was discarded. The precipitate was dissolved in 10 mM sodium phosphate buffer (pH 6.0), and applied to a Sephadex G-50 column (Pure Biotech LLC, Middlesex, NJ, USA) and centrifuged at 2000 g for 3 min. The eluted fluid was passed through a 0.22 μιη filter membrane (Millipore, Billerica, MA, USA), and the antimicrobial activity of this substance against S. scabies was tested by the agar diffusion assay as described above. This extract was designated as ammonium sulfate precipitated material (AS) for the rest of the study.
[0057] Extraction of lipopeptides was carried out according to the combination of acid precipitation and solvent extraction described by Vater et al. (2002) with slight modifications. The pH of the culture filtrate was adjusted to 2.0 by adding 6 N HC1 followed by
precipitation at 4°C overnight. The pellet derived from centrifugation (15,000 g for 30 min at 4°C) following precipitation was dissolved in 100% methanol. The mixture was passed through a 0.22 μιη filter membrane (Millipore, Billerica, MA, USA). The antimicrobial activity of the extract against S. scabies was tested with the agar diffusion assay described above. This material was designated acid precipitate material (AP) for the rest of the study.
[0058] Based on the results of the agar diffusion assay, the material from the ammonium sulfate precipitation produced larger inhibition zones (> 2 cm) and thus further study concentrated on this material. The lipopeptide fraction showed low activity (< 0.5 cm) and was not examined further. The concentration of protein in the AS was determined using a Bradford Protein assay kit (Thermo Fisher Scientific Inc., Rockford, IL, USA) with a
Nanodrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) based on a standard curve constructed for colorimetric absorbance at 595nm.
[0059] To test the quantitative effect of the AS fraction on S. scabies, a spore suspension of S. scabies (105 CFU/ml) was mixed with BAC03 AS at concentrations equivalent to 0, 15, 30, 45, 60, 75, and 90 μg of protein/ml as determined by the Bradford assay described above. The mixture was spread on YME plates and incubated at 28°C in the dark. Any inhibitory effect was evaluated by counting S. scabies colonies on the plate after 3 -day incubation in comparison with a control of plating spore suspension only.
[0060] To determine whether the extract was bactericidal or bacteriostatic, 105 CFU/ml of a S. scabies spore suspension was incubated with the AS fraction at a final concentration of 30, 60, and 90 μg/ml. After 0, 1, 3 and 5-day incubation at 28°C in the dark, the mixture was filtered through a 0.22 μιη membrane, and the S. scabies collected from the filter surface was spread on YME to determine the concentration of viable S. scabies.
Effects of Temperature, pH, Enzymes, and Chemical Solvents On Antimicrobial Activity of Liquid Culture and AS of BAC03
[0061] Both BAC03 liquid culture and its derived AS fraction were examined for their reaction to various factors, including temperatures, pH levels, enzymes, and chemicals. To test the effect of temperature, the antimicrobial activity was assessed after being incubated at temperatures of 40, 60, 80, and 100°C for 30 min, or 121°C (autoclaving) for 15 min. To test the effect of pH levels, the pH was adjusted from 1.0 to 14.0 by whole pH units using sterile 1 N HC1 or 1 N NaOH. Material was incubated at these pH levels overnight at 4°C. Prior to assessing activity, the pH was readjusted to pH 7.0. Several enzymes were tested for their effect on activity by incubating the BAC03 culture or the AS fraction with 10 mg/ml of the following enzymes for 2 h at the optimal temperature for each enzyme according to the manufacturer's instruction. Enzymes were trypsin (MP Biomedicals, Solon, OH, USA, 25°C, pH 7.6); proteinase K (Sigma-Aldrich, Inc. St Louis, MO, 37°C, pH 7.5); pepsin (Sigma- Aldrich, Inc., 37°C, pH 2.0); a-chymotrypsin (Sigma-Aldrich, Inc., 25°C, pH 7.8); and catalase (MP Biomedicals, 25°C, pH 7.0). Effect of various chemical solvents (Table 3) was tested by incubating 5 h at 25°C with 10% organic solvents. Antimicrobial activities of the treated culture and the AS fraction were tested against S. scabies using the disc diffusion assay as described above.
Scanning Electron Microscope Analysis
[0062] To examine the effect of the AS fraction on S. scabies, scanning electron microscopy (SEM) was used to observe the morphology of mycelia on media. Ten microliters of the AS fraction was dropped onto a S. scabies 2-day-old colony. Sodium phosphate buffer was used as a control. The plates were incubated at 28°C in the dark. Five days later when the control colonies became white with sporulation, the culture was coated with metallic osmium and processed according to the methods of Fan et al. (2011) by the Center for Advanced Mycology at Michigan State University, and examined with a scanning electron microscope (JEOL JSM 6400 (Japan Electron Optics Laboratories) at high voltage (10 kV).
Molecular Mass, Chemical Structure of the AS Fraction
[0063] The AS fraction was obtained by dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS PAGE). Following electrophoresis, the gel was vertically cut into two parts. One part of the gel, containing the sample and molecular weight standards, was stained with Coomassie Blue protein stain. The other part, containing the same sample, was tested for antimicrobial activity using the method of Naclerio et al. (1993). Briefly, the gel was treated with 20% isopropanol-10 mM Tris-HCl (pH 7.5) for 3 h, rinsed for 1.5 h in 10 mM Tris-HCl (pH 7.5), and washed twice with distilled water for a total of 1 h. The gel was placed in a Petri dish with 1% water agar, and overlaid with 0.8% YME mixed with a bacterial suspension of S. scabies (107 CFU/ml). The plate was incubated at 28°C for 48 h, then dyed with thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich Co. LLC, St. Louis, MO, USA) to stain living organisms, and observed for any unstained zone(s). Molecular weight of the AS fraction was measured according to the standard molecular marker that was also run on SDS-PAGE gel.
[0064] The active band associated with the antimicrobial activity above was excised, eluted from the gel, and digested according to Shevchenko et al. (1996). Liquid
chromatography-mass spectrometry (LC/MS/MS) was conducted at the Michigan State University Proteomics Facility Center. The resulting MS/MS spectra were converted to peak lists using BioWorks Browser v3.3.1 (Thermo Fisher Scientific Inc, Pittsburgh, PA, USA) and searched against all gram-positive bacterial protein sequences downloaded from NCBI. The Mascot output was analyzed using Scaffold v3.08 to probabilistically validate protein identifications using the ProteinProphet2 computer algorithm. Assignments validated above the Scaffold 95% confidence filter were considered valid.
PCR Detection
[0065] Based on the identified protein, the corresponding predicted nucleotide sequence was amplified with specific primers (Table 1 and reported by Hu et al. (2010)) using PCR. DNA extraction, PCR amplification and sequence determination were conducted as described above.
Table 1. Primers for polymerase chain reactions used in this study to amplify portions of bacterial genes.
Gene Primer Sequence (5 '-3') SEQ ID NO:
16s rDNA 63-F CAGGCCTAACACATGCAAGTC 7
1387-R GGGCGGWGTGTACAAGGC 8 recA recA-F TGAGTGATCGTCAGGCAGCCTTAG 9
recA-R TTCTTCATAAGAATACCACGAACCGC 10 recN recN-F CTTTTGCGATCAGAAGGTGCGTATCCG 11
recN-R GC C ATTAT AGAGG A ACTG AC G ATTTC 12 cheA cheA-F GTTTGAAGCGCTTGATCATCTAGAA 13
cheA-R GGTTCATTGAAGAATCCAGTCTTTC 14 gyrA gyrA-F CGTACGCAATGAATGATTTAGGCATG 15
gyrA-R ATTATG A A AG AC GTCTGC AGGGCC GTT 16 lci lci-F C GCGG ATC C ATG AA ATTC A A A A A AG 17
lci-R GCGTCGACTTATTTATCTACACTTTCAT 18 txtA txtA-F TGCTCAACTCCGTGATCCAGTA 19 txtA-R GGGACACCTCGCGCAGTA 20 txtC txtC-F ACCATCTCGCTGTCCTTGGT 21
txtC-R CGTGGACGACGGAGAACTTC 22
Statistical Analysis
[0066] Data were analyzed using SAS software (Version 9.2, SAS Inc., Cary, NC, USA). Procedure GLM was used for analysis of variance, and Fisher's least significance difference (LSD) multiple comparisons were performed for mean separation. Procedure REG was used for linear regression.
Identification of BAC03
[0067] The 16s rDNA sequence of BAC03 had a similarity higher than 99% with both B. subtilis and B. amyloliquefaciens. However, based on fragment sequences of recA (SEQ ID NO. 2), recN (SEQ ID NO. 3), cheA (SEQ ID NO. 4) and gyrA sequences (SEQ ID NO. 5), the results showed the highest similarity between strain BAC03 and B. amyloliquefaciens. Antimicrobial activity of BAC03
[0068] In vitro assay. Growth inhibition of microorganisms were evaluated on agar media by Bacillus amyloliquefaciens strains BAC03 and B. subtilis QST713, with 15 μΐ bacterial suspension (106 CFU/ml) applied on a sterile filter paper disc.
Table 2. BAC03 Antimicrobial Activity.
Test microorganism x Source, Inhibition zone diameter z Media location (cm)y
BAC03 QST713
Streptomyces scabies 49173 ATCC, USA 2.53* 1.70 YME
Streptomyces. scabies 1231 NRRL, USA 1.08* 0.62 YME
Streptomyces acidiscabies 49003 ATCC, USA 0.86* 0.23 YME
Streptomyces stelliscabiei Her21 Hao, MI 1.45 1.45 YME
Streptomyces aureofaciens 5404 NRRL, USA 0.78 0.58 YME
Streptomyces sp. DS3024 Hao, MI 1.16 0.90 YME
Agrobacterium tumefaciens Day, USA 2.18* 1.80 LB
Pseudomonas syringae Kirk, MI 1.48 1.30 LB
Clavibacter michiganensis ssp. Kirk, MI 2.40* 1.90 523 michiganensis
Cladosporium cucumerinum Hammerschmidt, 0.80 0.70 PDA
M IVlIl
Fusarium solani Hao, MI 0.60 0.50 PDA
Cryphonectria parasitica Fulbright, MI 1.50* 1.20 PDA
Phytophthora capsici Hao, MI 1.05* 0.70 PDA
Penicillium citrinum Hao, MI 0.25 0.15 PDA Phytophthora cambivora Fulbright, MI 1.15* 0.70 PDA
Phytophthora cinnamomi Fulbright, MI 1.30 1.30 PDA
Botrytis cinerea Hao, MI 2.00* 0.85 PDA
Rhizoctonia solani Hao, MI 1.60* 0.85 PDA
Sclerotinia sclerotiorum Hao, MI 1.80* 0.50 PDA x ATCC: American Type Culture Collection (http://www.atcc.org/), Manassas, VA, USA. NRRL: USDA-ARS Agriculture Collection (http://nrrl.ncaur.usda.gov/), Peoria, IL, USA. Kirk, Hao, Fulbright, and Hammerschmidt are from collections of professors at Michigan State University.
y Each number is the average of 8 measurements.
z LB: Lysogeny broth medium; PDA: potato dextrose agar; 523: bacterial screening medium (SigmaAldrich, Inc. St Louis, MO, USA).
* indicates significant difference between the average inhibition zone size using strain BAC03 and QST713 by Student i-test (a = 0.05).
[0069] Table 2 shows that BAC03 displays antagonistic activity against a broad spectrum of bacteria, fungi, and oomycetes. BAC03 showed significantly greater inhibition zones (P < 0.05) than QST713 on 13 out of 21 test organisms.
[0070] In the greenhouse, the severity of potato common scab was significantly reduced (P < 0.05, Fig. 1 Al), and potato growth (plant height and tuber weight) was significantly increased (P < 0.05, Fig. 1 A2) by BAC03 application compared to pathogen control; these effects were enhanced by increasing the concentration of BAC03 applied (Fig. 1 A).
[0071] For radish, high concentrations of S. scabies inhibited root expansion, which interfered with the disease evaluation as indicative lesions were not visible (Fig. 1 Bl). However, application of BAC03 reduced this inhibition, as radish root expansion was observed. The greatest response was obtained when BAC03 was applied before radish seeding; this resulted in no disease symptoms. One, two, or three times of applications after seeding also reduced the disease severity with the rating scale below 1 (Fig. 1 Bl). The biomass, including weights of leaves and roots, of radish was significantly increased (P < 0.05, Fig. 1 B2), when BAC03 concentration increased. QPCR analysis showed that S. scabies population in potting mix inoculated with BAC03 before radish seeding was significantly (P < 0.05) lower than that in all other treatments (Fig. 2).
Effect of B AC03 on Disease Suppression with Foliar Spray
[0072] Foliar spray with BAC03 did not affect potato growth or disease severity; sprayed plants had disease severity average ratings of 0.76 ± 0.16, and tuber weight of 48.04 + 2.09 g/pot; non-treated plants had disease severity of 0.75 + 0.17 and tuber weight of 47.82 + 1.55 g/pot.
Effects of BAC03 on Plant Emergence [0073] Emergence of potato and radish reacted differently to BAC03 treatment. BAC03 did not affect the amount of emergence of potato seedlings, regardless of concentrations. However for radish, only 20 + 5.8 % plants emerged during the course of experiment when treated with BAC03 culture at 104 CFU/cm3 potting mix, compared to 100% radish emerged for the control. No radish emergence was visible following treatments with BAC03 at 105 and 106 CFU/cm3 potting mix.
Characterization of an Antimicrobial Substance
[0074] Based on the agar diffusion assay, the AS fraction was picked for further study. The AS fraction significantly reduced the S. scabies population when evaluated by the co- culturing method, and the antimicrobial effect was positively correlated with the AS concentration (Fig. 3 A). The inhibition was almost 100% when the AS concentration was 75 μg/ml. In an assay for bactericidal effect, a reduction in the number of S. scabies colonies following the removal of the AS fraction was observed after co-incubation for different times, and the antimicrobial effect was enhanced with increasing exposure time to the AS fraction (Fig. 3B).
[0075] The antimicrobial activity was not affected by catalase, or any of the organic solvents tested (Table 3), but activity was completely removed by treatments with proteinase
K, trypsin, pepsin, or chymotrypsin. The activity was relatively heat stable, and maintained the same level when treated by temperature up to 60°C, but activity was totally lost following autoclaving. The culture broth and AS fraction were also active over a wide pH range, but the effect was reduced in extremely acid (pH<3) or alkaline (pH >12) conditions (Table 3).
Overall, the culture broth was more tolerant to adverse conditions than extracted AS fraction
Table 3. Effects of temperatures, pH levels, enzyme treatment, and chemical solvents on the activity of Bacillus amy lolique facie ns BAC03 as liquid culture in tryptic soy broth of the bacterium or as the ammonium sulfate precipitate fraction from BAC03 liquid culture.
Residual activity of BAC03 (% + standard
deviation) x
Treatment z Li¾uid culture
None 100 100
Chemicals Acetone 100 100
Ethyl acetate 100 100
Ethyl alcohol 100 100
Chloroform 100 100
Methyl alcohol 100 100
Enzymes Proteinase K 5 + 3 0
Trypsin 7 + 2 0
Pepsin 15 + 4 0
Chymotrypsin 8 + 4 0 Catalase 100 100
Temperature 40 (30 min) 100 100
60 (30 min) 100 100
80 (30 min) 89 + 3 61 + 4
100 (30 min) 26 + 6 10 + 3
121 (15 min) 0 0
pH 1 76 + 3 55 + 6
3 100 100
5 100 100
10 100 100
12 100 100
14 0 0
zThe culture broth and ammonium sulfate precipitate (AS) were exposed to various treatments, including:chemical solvent (10%) for 5 h at 25°C temperatures of 40, 60, 80, and 100°C for 30 min, and 121°C (autoclaving) for 15 minpH levels from 1.0 to 14.0 (every single unit) using sterile 1 N HQ or 1 N NaOH, and was readjusted to pH 7.0 after incubation overnight at 4°C. A subset of levels is shown as pH 1, 3, 5, 10, 12, 14 in the table enzymes (10 mg/ml) for 2 h, including trypsin (25°C, pH 7.6), proteinase K (37°C, pH 7.5), pepsin (37°C, pH 2.0), oc-chymotrypsin (25°C, pH 7.8), and catalase (25°C, pH 7.0).
x Residual activity was measured by an agar disc diffusion assay, and calculated as [(diameter of inhibition zone on treated plate)/ (diameter of inhibition zone of control)]* 100%
" Culture broth: strain BAC03 was cultured in TSB for 24 hours (106 CFU/ml) in a shaker with 180 rpm. AS: crude antimicrobial substance, which was extracted by ammonium sulfate precipitation from the culture broth supernatant, and filtered through Sephadex G-50 column and 0.22 μπι filter membrane.
[0076] The AS fraction affected S. scabies sporulation. When treated with the AS fraction, the S. scabies colonies showed no color change throughout the 7 day incubation period, compared to non-treated colonies, which changed to white or whitish grey. The morphology of the mycelia observed by SEM displayed spiral spore chain formation on non- treated plates but no such structure formed on AS-treated cultures during the time period examined (Fig. 4).
Molecular Mass and Chemical Structure Determination Of AS And PCR Testing
[0077] The AS fractioned on SDS-PAGE displayed a clear band with a molecular mass of approximately 10 kDa after MTT staining, indicating no bacterial growth at an area (Fig. 5). LC/MS/MS results suggested that the most probable compound was the 10 kDa
(molecular weight) LCI protein. The sequence similarity of the amplified putative LCI (SEQ ID NO. 1) was 99% between strains BAC03 and B. amyloliquefaciens FZB42 (accession number: CP000560.1) or C-31 (accession number: FJ904931.1). The DNA sequence and putative translated protein sequence were compared to those of reported B. amyloliquefaciens strains. All of the strains had a putative protein of 94 amino acids. The LCI protein sequence for BAC03 was 100% identical with strain C31 (Hu et al. 2010), but had one amino acid different from FZB42. [0078] A reduction in scab severity was observed in both potato and radish, where the population of S. scabies was significantly suppressed by BAC03, and suppression was increased as the time of application was increased.
EXAMPLE 2
[0079] Plant growth promotion assay. In a growth chamber (23 °C, 14h/8h light/dark cycle) the growth promoting effect of BAC03 (105 CFU/cm3) was evaluated on radish, pepper, beet, carrot, turnip, cucumber and tomato. Three seeds were planted per pot with four pots per treatment. Media only was used as a control. Weight and length of plant shoots and roots were measured after matured. See Table 4 for results.
[0080] The experiment is repeated with measurement including shoot length, fresh and dry shoot weight, fresh and dry root weight and compared to other strains of biocontrol product.
Table 4. Effect of BAC on growth of seven plant types. Two applications of BAC03 (10s CFU/cm"3) were drenched into the soil after plant germination and two weeks later. The same volume of media was used for control.
Measurement objective BAC03 Control
Radish Aboveground weight (g) 34.6 + 4.1* 6.1 + 1.9
Weight of tubers (g) 46.0 + 4.9* 8.6 + 3.1
Tomato Height (cm) 38.2 + 4.1* 30.7 + 2.2
Aboveground weight (g) 29.1 + 9.2* 15.2 + 2.3
Turnip Weight of tubers (g) 19.9 + 9.7* 7.5 + 5.4
Beet Weight of tubers (g) 18.4 + 3.4* 8.0 + 2.2
Cucumber Aboveground weight (g) 29.5 + 2.8* 19.3 + 3.1
Pepper Aboveground weight (g) 26.5 + 11.2 21.0 + 3.5
Carrot Weight of tubers (g) 13.5 + 3* 7.7 + 1.8
* indicates significant difference between the treated and control.
EXAMPLE 3
[0081] The ability of BAC03 to induce systemic resistance is determined by a split root system. In a greenhouse, potato roots of a plant were split into two parts, A and B, and each part placed in a separate pot when the root system was well developed. Four groups were created including: Group I, roots inoculated with BAC3 and S. scabies in root part A and with S. scabies in root part B; Group II, root inoculated with BAC03 in root part A and S. scabies in root part B; Group III, roots inoculated with S. scabies in root part A and non- treated in root part B; and Group IV, roots not treated in both root parts A and B. See the results in Figure 6A, measuring disease severity, and Figure 6B measuring potato tuber weight. Where BAC03 was applied to one root part, the separated plant part had reduced disease severity and increased tuber weight. In the absence of exposure to BAC03, both plant parts did not show a decrease in disease severity nor enhanced growth. Thus it can be seen BAC03 was able to induce systemic resistance in plants.
EXAMPLE 4
[0082] Field trials were conducted by applying BAC03 liquid culture at two locations, where soil was naturally infested with high population of Streptomyces scabies, along with other biomaterial applications. To prepare liquid culture, strain BAC03 was cultured in the YME liquid medium (yeast extract 4.0 g, malt extract 10.0 g, dextrose 4.0 g, and agar 20.0 g per liter) for 24 h at 180 rpm. The cell concentration (106 CFU/ml) was determined by plating the diluted cultures on YME agar medium.
[0083] The field trial was conducted in a randomized block design with plot size of 2 feet by 25 feet in four replicates within each location. A common scab susceptible cultivar (cv. 'Snowden') was used in the field experiment. In the field, chestnut tissues (shells and pellicles) were applied at a rate of 15 tons/acre and oregano essential oil at a rate of 13.5 quarts/acre and pressed horseradish root applied at one ton per acre. Each of these three treatments was applied two weeks before planting. The BAC03 spore suspension (106 CFU/ml) and the tryptic soy broth are applied at 360 quarts/acre four times after planting at two week intervals. A non-treated control is also provided. Four replications were set for each treatment.
[0084] Potatoes were harvested and the tubers scored for common scab disease. Fifty tubers were arbitrarily selected from each plot for disease evaluation. Disease lesions on potato tubers were scored: 0 = no symptoms, 1 = 1 to 10% surface area with superficial or raised lesions, 2 = 11 to 25% surface area with superficial or raised lesions, 3 = 26 to 50% surface area with superficial or raised lesions, 4 = > 50% surface area with superficial or raised lesions or < 25% pitted lesion area, and 5 = >50% surface area with superficial or raised lesions or >25% pitted area. The disease severity index was calculated as∑(score * number of tubers with that score) / total number of potato tubers evaluated. For yield assessment, all the potatoes in the middle area with 10 feet long in each plot were gathered and weighted. Yield and disease severity are assessed at harvest. Measurement of disease severity and weight (evaluated at harvest) is shown for location 1 in Figure 7A and 7B and for location 2 in Figure 8 A and 8B.
EXAMPLE 5
[0085] The experiment of Example 3 may be repeated using radish, pepper or tomato. Briefly, the plant roots may be split and placed into two separate pots infested with a pathogen. To one of the two pots may be applied the Bacillus solution and disease suppression may be evaluated. Assessing of disease suppression may be done by evaluating plant defense-related enzymes such as peroxidase (POX), polyphenol oxidase (PPO) or phenylalanine ammonia lyase (PAL). The plant growth promoting effect of the bacteria may also be evaluated by assaying for the production of indoleacetic acid (IAA), NH3, or HCN, and presence of phosphate solubilization and ACC-deaminase. These secreted substances or reactions are correlated with the plant growth promotion.
[0086] All publications, patents, and patent documents are incorporated by reference herein, as though individually incorporated by reference. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the various embodiments described herein.
[0087] Although specific embodiments have been illustrated and described herein, it will be appreciated by those of ordinary skill in the art that any procedure that is calculated to achieve the same purpose may be substituted for the specific embodiments shown. For example, although the process has been discussed using potato plants, any other plant such as tomato, radish or pepper, for example, may be used. This application is intended to cover any adaptations or variations of the present subject matter. Therefore, it is manifestly intended that embodiments of this invention be limited only by the claims and the equivalents thereof.

Claims

WHAT IS CLAIMED IS:
1. A biologically pure or isolated culture deposited as ATCC NO. PTA- 12890.
2. A composition comprising the culture of claim 1.
3. A composition for controlling plant disease severity of soil plant pathogens comprising Bacillus amyloliquefaciens BAC03 strain.
4. The composition of claim 2 or comprising spores, cells or whole culture of the strain.
5. The composition of claim 2 or comprising a substance isolated from a whole cell culture of the strain, an ammonium sulfate precipitated fraction of a whole cell culture of the strain, and spores of the strain.
6. The composition of claim 5 wherein the substance comprises an LCI protein.
7. The composition of claim 5 wherein the substance comprises sequence possessing at least 85% sequence identity to SEQ ID NO: l.
8. The composition claim 2 or 3 further comprising one or more other compositions.
9. The composition of claim 2 or wherein the strain is present in a concentration of up to 107 CFU cm"3.
10. The composition of claim 3 wherein the plant disease is common scab.
11. The composition of claim 2 or having plant growth promoting activity.
12. The composition of claim 2 or having antagonistic or antimicrobial activity against plant soil pathogens.
13. The composition of claim 12 wherein the plant pathogen is selected from Streptomyces scabies, Streptomyces acidiscabies, Streptomyces stelliscabiei, Streptomyces aureofaciens, Streptomyces sp., Agrobacterium tumefaciens, Pseudomonas syringae, Clavibacter michiganensi, Cladosporium cucumerinum, Fusarium solani, Cryphonectria parasitica, Phytophthora capsici, Penicillium citrinum, Phytophthora cambivora, Phytophthora cinnamomi, Botrytis cinerea, Rhizactonia solani and Sclerotinia sclerotiorum.
14. A method of reducing disease severity of a plant pathogen, the method comprising applying to soil or a plant or plant part an effective amount of the B. amyloliquefaciens strain BAC03 deposited as ATCC NO. PTA- 12890, or a substance selected from a whole cell culture of the strain, an ammonium sulfate precipitated fraction of a whole cell culture of the strain, and spores of the strain.
15. The method of claim 14 wherein the plant part is a root, stem or leaf.
16. The method of claim 14 wherein the plant part is a seed.
17. The method of claim 14 wherein applying is to the soil, plant, plant part and is more than once.
18. The method of claim 14 wherein applying is to soil before or contemporaneously with sowing plant seeds in soil.
19. The method of claim 14 wherein apply is to seeds after plant seeds have been sown in the soil or to growing plants.
20. The method of claim 14 wherein the plant pathogen is selected from Streptomyces scabies, Streptomyces acidiscabies, Streptomyces stelliscabiei, Streptomyces aureofaciens, Streptomyces sp., Agrobacterium tumefaciens, Pseudomonas syringae, Clavibacter michiganensi, Cladosporium cucumerinum, Fusarium solani, Cryphonectria parasitica, Phytophthora capsici, Penicillium citrinum, Phytophthora cambivora, Phytophthora cinnamomi, Botrytis cinerea, Rhizactonia solani and Sclerotinia sclerotiorum.
PCT/US2013/032246 2012-04-30 2013-03-15 Novel bacillus amyloliquefaciens strain bac03 and methods of using same Ceased WO2013165607A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261640204P 2012-04-30 2012-04-30
US61/640,204 2012-04-30

Publications (1)

Publication Number Publication Date
WO2013165607A1 true WO2013165607A1 (en) 2013-11-07

Family

ID=48040456

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/032246 Ceased WO2013165607A1 (en) 2012-04-30 2013-03-15 Novel bacillus amyloliquefaciens strain bac03 and methods of using same

Country Status (2)

Country Link
CN (1) CN103378895B (en)
WO (1) WO2013165607A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016046155A1 (en) * 2014-09-24 2016-03-31 Biotecnologie B.T. S.R.L. New bacterial strains of the species bacillus amyloliquefaciens and related applications
US9622484B2 (en) 2014-12-29 2017-04-18 Fmc Corporation Microbial compositions and methods of use for benefiting plant growth and treating plant disease
RU2689530C2 (en) * 2014-08-16 2019-05-28 ДиСиЭм ШРИРАМ ЛТД. Novel bacteria of bacillus kind and using thereof
CN110438011A (en) * 2019-07-30 2019-11-12 浙江理工大学 Superfine branch spore is mould and its promotes the purposes of Radix Salviae Miltiorrhizae root system effective component synthesis
EP3485733A4 (en) * 2016-07-12 2020-03-11 Kyung Nong Corporation COMPOSITION FOR PROMOTING PLANT GROWTH THROUGH AMYLOLIC BACILLUS
WO2020069436A1 (en) * 2018-09-27 2020-04-02 Concentric Ag Corporation Methods and compositions for bioprotection of potatoes from streptomyces scabies
WO2020102423A3 (en) * 2018-11-13 2020-08-13 Van Grow, Llc Crop pathogen control using competitive probiotic competition
CN112143672A (en) * 2020-09-18 2020-12-29 北京农学院 Pseudomonas aurantiaca CM-7 and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100486144C (en) * 2003-04-15 2009-05-06 大唐移动通信设备有限公司 Method of raising transmission speed in multi-slot CDMA radio communication system
CN101136889A (en) * 2006-08-30 2008-03-05 大唐移动通信设备有限公司 Feedback channel scheduling method and apparatus for multi-carrier wireless communication
CN101355798B (en) * 2008-05-20 2011-05-11 中国移动通信集团设计院有限公司 Transmission method for TD-SCDMA/HSDPA multi-code channel
CN102281620B (en) * 2010-06-11 2015-05-13 中兴通讯股份有限公司 Multi-code-channel power matching method and device
CN102137481B (en) * 2011-04-28 2014-03-19 意法·爱立信半导体(北京)有限公司 Method and device for controlling multi-code channel uplink transmission power

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
ARGUELLES-ARIAS ANTHONY ET AL: "Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens", MICROBIAL CELL FACTORIES, BIOMED CENTRAL, LONDON, NL, vol. 8, no. 1, 26 November 2009 (2009-11-26), pages 63, XP021063197, ISSN: 1475-2859, DOI: 10.1186/1475-2859-8-63 *
CHEN XIAO-HUA ET AL: "More than anticipated - production of antibiotics and other secondary metabolites by Bacillus amyloliquefaciens FZB42", JOURNAL OF MOLECULAR MICROBIOLOGY AND BIOTECHNOLOGY,, vol. 16, no. 1-2, 1 January 2009 (2009-01-01), pages 14 - 24, XP009127778, DOI: 10.1159/000142891 *
DATABASE UniProt [online] 3 October 2012 (2012-10-03), "SubName: Full=Uncharacterized protein;", XP002697480, retrieved from EBI accession no. UNIPROT:J0DN49 Database accession no. J0DN49 *
DEQUAN LI ET AL: "Screening of high-yielding biocontrol bacterium Bs-916 mutant by ion implantation", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 75, no. 6, 5 June 2007 (2007-06-05), pages 1401 - 1408, XP019513765, ISSN: 1432-0614, DOI: 10.1007/S00253-007-0951-7 *
HAN QIAO HU ET AL: "Characterization of an antimicrobial material from a newly isolated Bacillus amyloliquefaciens from mangrove for biocontrol of Capsicum bacterial wilt", BIOLOGICAL CONTROL, vol. 54, no. 3, 27 June 2010 (2010-06-27), pages 359 - 365, XP055063584, ISSN: 1049-9644, DOI: 10.1016/j.biocontrol.2010.06.015 *
MENG Q ET AL: "An inhibitory effect of a novel Bacillus sp strain against potato common scab", PHYTOPATHOLOGY, vol. 101, no. 6, Suppl. S, June 2011 (2011-06-01), & AMERICAN PHYTOPATHOLOGICAL SOCIETY (APS)/INTERNATIONAL PLANT PROTECTION CONGRESS(IPPS) JOINT MEETING; HONOLULU, HI, USA; AUGUST 06 -10, 2011, pages S119 - S120, XP009169718, ISSN: 0031-949X *
Q.X. MENG ET AL: "Characterizing a novel strain of Bacillus amyloliquefaciens BAC03 for potential biological control application", JOURNAL OF APPLIED MICROBIOLOGY, vol. 113, no. 5, 1 November 2012 (2012-11-01), pages 1165 - 1175, XP055063435, ISSN: 1364-5072, DOI: 10.1111/j.1365-2672.2012.05420.x *
QINGXIAO MENG ET AL: "Culture-Based Assessment of Microbial Communities in Soil Suppressive to Potato Common Scab", PLANT DISEASE, vol. 96, no. 5, 1 May 2012 (2012-05-01), pages 712 - 717, XP055063434, ISSN: 0191-2917, DOI: 10.1094/PDIS-05-11-0441 *
R. BORRISS ET AL: "Relationship of Bacillus amyloliquefaciens clades associated with strains DSM 7T and FZB42T: a proposal for Bacillus amyloliquefaciens subsp. amyloliquefaciens subsp. nov. and Bacillus amyloliquefaciens subsp. plantarum subsp. nov. based on complete genome sequence comparisons", INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, vol. 61, no. 8, 1 August 2011 (2011-08-01), pages 1786 - 1801, XP055043359, ISSN: 1466-5026, DOI: 10.1099/ijs.0.023267-0 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2689530C2 (en) * 2014-08-16 2019-05-28 ДиСиЭм ШРИРАМ ЛТД. Novel bacteria of bacillus kind and using thereof
WO2016046155A1 (en) * 2014-09-24 2016-03-31 Biotecnologie B.T. S.R.L. New bacterial strains of the species bacillus amyloliquefaciens and related applications
US9622484B2 (en) 2014-12-29 2017-04-18 Fmc Corporation Microbial compositions and methods of use for benefiting plant growth and treating plant disease
US10375964B2 (en) 2014-12-29 2019-08-13 Fmc Corporation Microbial compositions and methods of use for benefiting plant growth and treating plant disease
EP3485733A4 (en) * 2016-07-12 2020-03-11 Kyung Nong Corporation COMPOSITION FOR PROMOTING PLANT GROWTH THROUGH AMYLOLIC BACILLUS
WO2020069436A1 (en) * 2018-09-27 2020-04-02 Concentric Ag Corporation Methods and compositions for bioprotection of potatoes from streptomyces scabies
CN113473859A (en) * 2018-09-27 2021-10-01 麦吉尔大学皇家学习促进机构 Methods and compositions for bioprotection of streptomyces scabiosus in potatoes
US12070037B2 (en) 2018-09-27 2024-08-27 The Royal Institution For The Advancement Of Learning/Mcgill University Methods and compositions for bioprotection of potatoes from Streptomyces scabies
WO2020102423A3 (en) * 2018-11-13 2020-08-13 Van Grow, Llc Crop pathogen control using competitive probiotic competition
CN110438011A (en) * 2019-07-30 2019-11-12 浙江理工大学 Superfine branch spore is mould and its promotes the purposes of Radix Salviae Miltiorrhizae root system effective component synthesis
CN112143672A (en) * 2020-09-18 2020-12-29 北京农学院 Pseudomonas aurantiaca CM-7 and application thereof
CN112143672B (en) * 2020-09-18 2021-08-10 北京农学院 Pseudomonas aurantiaca CM-7 and application thereof

Also Published As

Publication number Publication date
CN103378895B (en) 2017-12-19
CN103378895A (en) 2013-10-30

Similar Documents

Publication Publication Date Title
Sreevidya et al. Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea
Abdallah et al. Involvement of lipopeptide antibiotics and chitinase genes and induction of host defense in suppression of Fusarium wilt by endophytic Bacillus spp. in tomato
WO2013165607A1 (en) Novel bacillus amyloliquefaciens strain bac03 and methods of using same
Qu et al. Sensitivity of Phytophthora nicotianae from tobacco to fluopicolide, mandipropamid, and oxathiapiprolin
Aleandri et al. Use of nursery potting mixes amended with local Trichoderma strains with multiple complementary mechanisms to control soil-borne diseases
Lee et al. Isolation and characterization of endophytic actinomycetes from Chinese cabbage roots as antagonists to Plasmodiophora brassicae
Berg et al. Seed rot and damping-off of alfalfa in Minnesota caused by Pythium and Fusarium species
Gutiérrez-Barranquero et al. Pantoea agglomerans as a new etiological agent of a bacterial necrotic disease of mango trees
Cao et al. An endophytic Streptomyces sp. strain DHV3-2 from diseased root as a potential biocontrol agent against Verticillium dahliae and growth elicitor in tomato (Solanum lycopersicum)
Inderiati et al. Isolation and identification of endophytic actinomycetes and their antifungal activity
Hernández-Rodríguez et al. A practical guide to isolation of fluorescent Pseudomonas antagonic to Phytophthora palmivora (Butler) in Theobroma cacao L.
Osdaghi et al. Clavibacter michiganensis reframed: The story of how the genomics era made a new face for an old enemy
Pathom-aree et al. Potential of selected mangrove streptomyces as plant growth promoter and rice bakanae disease control agent
WO2022234569A1 (en) Bacterial strains having fungicidal activity, compositions comprising same and use thereof
Ashwitha et al. Characterization of abiotic stress tolerant Pseudomonas spp. occurring in Indian soils.
Kamath et al. Bacillus amyloliquefaciens D5 as a biocontrol agent against Cercospora Leaf Spot Disease in Vigna radiata L.
Abd Al-Qader et al. Molecular Identification of Rhizoctonia solani Isolated from Cucumber (Cucumis sativus L.) and Its Biological Control
Bhaskar Bio-Management of Sarocladium oryzae, incitant of sheath rot disease of rice by Bacillus sp. and deciphering the bioprotection mechanism
Mu et al. Role of the beneficial phyllosphere microbiome in the defense against red clover anthracnose caused by Colletotrichum americae-borealis
Moya Development of genetic mapping and DNA markers for tolerance to bacterial stem blight caused by Pseudomonas syringae pv. syringae in alfalfa
Prakash et al. Downy Mildew disease of pearl millet and its control
Sierra Moya Development of genetic mapping and DNA markers for tolerance to bacterial stem blight caused by Pseudomonas syringae pv. syringae in alfalfa
Taha et al. Phenotypic and Molecular Characterization of Streptomyces enissocaesilis and Streptomyces caviscabies Induced Potato Common Scab in Egypt.
Abd Oun Investigation of molecular and cellular aspects of cotton black root rot disease and the potential for biological control
Ishieze et al. Phylogeny and Molecular Characterisation of Bacterial Pathogens Associated with Selected Tomato (Solanum lycopersicum L.) Varieties in Enugu State

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13713319

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13713319

Country of ref document: EP

Kind code of ref document: A1