WO2013149136A1 - ISOXAZOLE β-LACTAMASE INHIBITORS - Google Patents

ISOXAZOLE β-LACTAMASE INHIBITORS Download PDF

Info

Publication number
WO2013149136A1
WO2013149136A1 PCT/US2013/034589 US2013034589W WO2013149136A1 WO 2013149136 A1 WO2013149136 A1 WO 2013149136A1 US 2013034589 W US2013034589 W US 2013034589W WO 2013149136 A1 WO2013149136 A1 WO 2013149136A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
compounds
compound
lactam antibiotic
spp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/034589
Other languages
French (fr)
Inventor
Yu Gui Gu
Yong He
Ning Yin
Dylan C. ALEXANDER
Jason B. CROSS
Chester A. METCALF, III.
Robert Busch
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cubist Pharmaceuticals LLC
Original Assignee
Cubist Pharmaceuticals LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201380027972.3A priority Critical patent/CN104334555A/en
Priority to JP2015503634A priority patent/JP2015512419A/en
Priority to MX2014011825A priority patent/MX2014011825A/en
Priority to CA2869051A priority patent/CA2869051A1/en
Priority to KR1020147030476A priority patent/KR20150003777A/en
Priority to EP13769389.1A priority patent/EP2831069B1/en
Application filed by Cubist Pharmaceuticals LLC filed Critical Cubist Pharmaceuticals LLC
Priority to AU2013237869A priority patent/AU2013237869A1/en
Priority to SG11201406120SA priority patent/SG11201406120SA/en
Publication of WO2013149136A1 publication Critical patent/WO2013149136A1/en
Priority to IL234845A priority patent/IL234845A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/439Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/397Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having four-membered rings, e.g. azetidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/407Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with other heterocyclic ring systems, e.g. ketorolac, physostigmine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4365Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/542Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/545Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/542Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/545Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine
    • A61K31/546Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine containing further heterocyclic rings, e.g. cephalothin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/08Bridged systems
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure is directed to ⁇ -lactamase inhibitors (BLIs) which are effective as inhibitors of ⁇ -lactamases and, when used in combination with ⁇ -lactam antibiotics are useful in the treatment of bacterial infections.
  • BLIs ⁇ -lactamase inhibitors
  • the compounds when combined with a ⁇ -lactam antibiotic are effective in treating infections caused by bacteria that are resistant to ⁇ -lactam antibiotics due to the presence of ⁇ -lactamases.
  • Pharmaceutical compositions comprising such compounds, methods of using such compounds, and processes for preparing such compounds are also disclosed.
  • ⁇ -lactamases Bacterial resistance to ⁇ -lactam antibiotics, especially in Gram-negative bacteria, is most commonly mediated by ⁇ -lactamases.
  • ⁇ -lactamases are enzymes that catalyze the hydrolysis of the ⁇ -lactam ring, which inactivates the antibacterial activity of the ⁇ -lactam antibiotic and allows the bacteria to become resistant. Inhibition of the ⁇ -lactamase with a BLI slows or prevents degradation of the ⁇ -lactam antibiotic and restores ⁇ -lactam antibiotic susceptibility to ⁇ -lactamase producing bacteria. Many of these ⁇ -lactamases are not effectively inhibited by BLIs currently on the market rendering the ⁇ -lactam antibiotics ineffective in treating bacteria that produce these ⁇ -lactamases.
  • the present invention provides, in one aspect, compounds of chemical formula (I), or pharmaceutically-acceptable salts thereof, which are BLIs and are useful in combination with ⁇ -lactam antibiotics for the treat
  • R is selected from 3 ⁇ 4 3 ⁇ 4 3 ⁇ 4 s 3 ⁇ 4 ;
  • R 1 is se
  • R is selected from
  • each of R 3 , R 4 and R 5 is independently selected from hydrogen, (Ci- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
  • R is selected from
  • R 7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
  • each of p and q is independently selected from 1 and 2.
  • the invention provides compounds of chemical Formula (A-I) or a pharmaceutically acceptable salt thereof, which are BLIs and are useful in combination with ⁇ -lactam antibiotics for the treatment of bacterial infections.
  • R* is selected from
  • R 1* is selec a.
  • R 2* is selected from
  • each of R 4* , R 5* , R 6* and R 7* is independently selected from hydrogen, (Q- Ce)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R 4* , R 5* , R 6 * and R 7* is hydrogen ,
  • n is selected from 1, 2, 3 and 4, and
  • R is selected from -NH(Ci-C3)-alkyl
  • Z is selected from CR 9 R 10 and NR 11 ,
  • each of R 9 and R 10 is independently selected from H, NH 2 , -NH(Ci-C3)-alkyl
  • R 9 and R 10 together with the carbon to which they are attached, form a cycloalkylor heterocyclyl ring containing 4-6 ring members,
  • R 11 is selected from H and each of R 12 , R 13 and R 14 is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R , R and
  • R is hydrogen
  • R is selected from NH 2 and , wherein each of R > ' 4 * * , R. J 5* ,
  • each of p* and q* is independently selected from 0, 1, 2 and 3
  • T is selected from NH and O
  • t is selected from 0, 1, 2, 3, and 4, and
  • each of r and y is independently selected from 0 and 1 ;
  • R is selected from NH 2 , -NH(Ci-C3)-alkyl and , wherein each of R 4 , R 5 , R 6 and R 7 is as described previously,
  • s is selected from 0 and 1 , and,
  • v is selected from 0, 1, 2, and 3;
  • R is selected from NH 2 and , wherein each of R 4* , R 5* , R 6* and R 7* is as described previously,
  • R 17 is selected from amino and hydroxyl
  • M is selected from NR 19 , CR 20 R 21 and O,
  • R 19 is selected from H and , where each of R , R and R is as described previously,
  • Z 2 1 1 is independently selected from H, NH 2 and , wherein each of R 4* , R 5* , R 6 * and R 7* is as described previously, and
  • the invention provides use of a compound of Formula I for inhibiting ⁇ -lactamases.
  • the invention provides use of a compound of Formula A-I for inhibiting ⁇ -lactamases.
  • the invention provides compounds of Formula I with high binding affinity for ⁇ -lactamase enzymes.
  • the invention provides compounds of Formula A-I with high binding affinity for ⁇ -lactamase enzymes.
  • the present invention also provides antibacterial compositions comprising compounds of Formula I and at least one ⁇ -lactam antibiotic.
  • the present invention also provides antibacterial compositions comprising compounds of Formula A-I and at least one ⁇ -lactam antibiotic.
  • the present invention provides pharmaceutical compositions comprising compounds of Formula I and at least one ⁇ -lactam antibiotic and methods of use thereof.
  • the present invention provides pharmaceutical compositions comprising compounds of Formula A-I and at least one ⁇ -lactam antibiotic and methods of use thereof.
  • the invention provides methods of use of the compounds of Formula I to treat bacterial infections in a subject.
  • the invention provides methods of use of the compounds of
  • FIGS 1A-1D show Table I, Representative Compounds of Formula A-II
  • Figures 2A-2B show Table II, Standard BLI potentiation MIC assay against a panel of isogenic and clinical strains expressing ⁇ -lactamases.
  • Figures 3A-3B show Table III, the synergy MIC of representative compounds of
  • Figure 4 shows Table IV, an assay to determine inhibition kinetics of representative compounds of Formula II-A for the KPC-2 ⁇ -lactamase.
  • Figures 5A-5B show Table V, Synergy MICof Comparator Compounds against a Panel of Isogenic and Clinical Strains Expressing ⁇ -lactamases
  • alkyl is defined as a linear or branched, saturated radical having one to about twenty carbon atoms unless otherwise specified. Preferred alkyl radicals are "lower alkyl” radicals having one to about five carbon atoms. Examples of alkyl groups include, without limitation, methyl, ethyl, ieri-butyl, isopropyl, and hexyl. A subset of the term alkyl is "(Ci-C 3 )-unsubstituted alkyl” which is defined as an alkyl group that bears no substituent groups. Examples of (Ci-C 3 )-unsubstituted alkyl groups include methyl, ethyl, propyl and isopropyl. It is understood that if a (Ci-C 3 )-alkyl is "substituted” that one or more hydrogen atoms is replaced by a substitutent.
  • amino denotes a NH 2 radical.
  • aminoalkyl denotes an alkyl in which one or more of the alkyl hydrogen atoms has been replaced by an amino group.
  • aminocycloalkyl denotes a cycloalkyl in which one of the cycloalkyl hydrogen atoms has been replaced by an amino group.
  • cycloalkyl or "cycloalkyl ring” is defined as a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to twelve ring members.
  • a cycloalkyl is a ring system having three to seven ring members.
  • Examples of a cycloalkyl group include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl.
  • hydroxyalkyl denotes an alkyl radical in which one or more of the alkyl hydrogen atoms has been replaced by a hydroxyl group.
  • ⁇ or - denote the point of attachment of a substituent group where indicated.
  • the salts of the compounds of the invention include acid addition salts and base addition salts.
  • the salt is a pharmaceutically acceptable salt of the compound of Formula I.
  • pharmaceutically acceptable salts embraces salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically-acceptable.
  • Suitable pharmaceutically acceptable acid addition salts of the compounds of the invention may be prepared from an inorganic acid or an organic acid. Examples of such inorganic acids include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid.
  • Examples of appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, arylaliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include, without limitation, formic, acetic, propionic, succinic, glycolic, gluconic, maleic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2- hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, ⁇ -hydroxybutyric, malonic, galactic, and galacturonic acid.
  • Suitable pharmaceutically-acceptable base addition salts of compounds of the invention include, but are not limited to, metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from ⁇ , ⁇ '- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N- methylglucamine, lysine and procaine. All of these salts may be prepared by conventional means from the corresponding compound of the invention by treating, for example, the compound of the invention with the appropriate acid or base.
  • the compounds of the invention can possess one or more asymmetric carbon atoms and are thus capable of existing in the form of optical isomers as well as in the form of racemic or non-racemic mixtures thereof.
  • the compounds of the invention can be utilized in the present invention as a single isomer or as a mixture of stereochemical isomeric forms.
  • Diastereoisomers, i.e., nonsuperimposable stereochemical isomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example by formation of diastereoisomeric salts by treatment with an optically active acid or base.
  • Examples of appropriate acids include, without limitation, tartaric, diacetyltartaric, dibenzoyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • the mixture of diastereomers can be separated by crystallization followed by liberation of the optically active bases from the optically active salts.
  • An alternative process for separation of optical isomers includes the use of a chiral chromatography column optimally chosen to maximize the separation of the enantiomers.
  • Still another available method involves synthesis of covalent diastereoisomeric molecules by treating compounds of the invention with an optically pure acid in an activated form or an optically pure isocyanate.
  • the synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation, and then hydro lyzed to obtain the enantiomerically pure compound.
  • the optically active compounds of the invention can likewise be obtained by utilizing optically active starting materials. These isomers may be in the form of a free acid, a free base, an ester or a salt.
  • Compounds described herein also include isotopically- labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes suitable for inclusion in the compounds described herein include and are not limited to H, H, C, C, C, CI, F, I, I, N, N, O, O, O, P, and S.
  • isotopically- labeled compounds are useful in drug and/or substrate tissue distribution studies.
  • substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements).
  • substitution with positron emitting isotopes is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy.
  • Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically- labeled reagent in place of the non- labeled reagent otherwise employed.
  • the invention also embraces isolated compounds.
  • An isolated compound refers to a compound which represents at least 10%, such as at least 20%, such as at least 50% and further such as at least 80% of the compound present in the mixture.
  • the compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound exhibits detectable (i.e. statistically significant) activity when tested in conventional biological assays such as those described herein.
  • ⁇ -Lactamase Inhibitors BBIs
  • the invention provides compounds of Formula I or pharmaceutically- acceptable salts thereof:
  • Substituent R of Formula I is selected from
  • R is
  • the group R of Formula I is selected from:
  • R 2 is selected from
  • each of R 3 , R 4 and R 5 is independently selected from hydrogen, (Q- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
  • R is selected from
  • R 7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
  • each of p and q is independently selected from 1 and 2.
  • n is 1. In another aspect of the invention n is 2. In another aspect of the invention n is 3.
  • R 1 is selected from
  • R is selected from In one embodiment of the invention, the compounds of the invention are of the stereochemistry disclosed in Formula II.
  • the compound is of Formula II and R is OSO 3 H and R 1 is -CH 2 NH 2 .
  • the compound is of Formula II and R is OSO 3 H and R 1 is -CH 2 CH 2 NH 2 .
  • the compound is of Formula II and R is OSO 3 H and R 1 is -CONH(CH 2 ) 2 NH 2 .
  • the compound is of Formula II and R is
  • the compound is of Formula II and R is
  • the compound is of Formula II and R is
  • the compound is of Formula II and R is
  • the compound is of Formula II and R is
  • OSO3H and R is Preferred compounds of Formula I are the compounds:
  • the invention provides compounds of Formula A-I or pharmaceutically- acceptable salts thereof:
  • R * is
  • R 1* is selected from: wherein R 2 * is selected from:
  • each of R 4 *, R 5 *, R 6 *and R 7 * is independently selected from hydrogen, (Ci-Ce)- alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R 4 *, R 5 *, R 6 *and R 7 *is hydrogen ,
  • n is selected from 1 , 2, 3 and 4, and
  • R is selected from -NH(Ci-C3)-alkyl and , wherein each of R 4 *, R 5 *, R 6 *and R 7 is as described previously;
  • Z is selected from CR 9 R 10 and NR 11 ,
  • each of R 9 and R 10 is independently selected from H, NH 2 , -NH(d-C3)-alkyl
  • R 9 and R 10 together with the carbon to which they are attached, form a cycloalkyl or heterocyclyl ring containing 4-6 ring members, R 11 is selected from H and , EACH OF R 12 5 R 13 AND R 14
  • R 12 , R 13 and R 14 independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R 12 , R 13 and
  • R , 14 is hydrogen
  • R 1J is selected from NH 2 and , wherein each of R 4* , R 5* , R 6* and R 7 is as described previously,
  • each of p* and q* is independently selected from 0, 1, 2 and 3,
  • T is selected from NH and O
  • t is selected from 0, 1, 2, 3, and 4, and
  • R is selected from NH 2 , -NH(Ci-C3)-alkyl and , wherein each of R 4 , R 5 , R 6 and R 7 is as described previously,
  • s is selected from 0 and 1, and,
  • v is selected from 0, 1, 2, and 3;
  • R is selected from NH 2 and . w..1here :in eac 1h o rf n R4 R 5* , R 6* and R 7* is as described previously,
  • R 17 is selected from amino and hydroxyl
  • w is selected from 0 and 1 ;
  • M is selected from NR 19 , CR 20 R 21 and O,
  • R 19 is selected from H and , where each of R 12 , R 13 and R 14 is as described previously,
  • each of R 20 and R 21 is independently selected from H, N3 ⁇ 4 and , wherein each of R 4* , R 5* , R 6 * and R 7 is as described previously, and
  • R 1* is selected from
  • the compounds of the invention are of the stereochemistry disclosed in Formula A-II.
  • R * and R 1* are chosen from the substituents listed in Table I (See Figure I).
  • Preferred compounds of Formula A-I are
  • the compounds of the invention are effective in inhibiting ⁇ -lactamase.
  • the compounds of Table I are effective ⁇ -lactamase inhibitors.
  • the compound of Table I are effective ⁇ -lactamase inhibitors.
  • the compounds of the invention When used in combination with ⁇ -lactam antibiotics, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate the activity of the ⁇ -lactam antibiotic against microorganisms that are normally resistant to ⁇ -lactam antibiotics due to the presence of a ⁇ - lactamase or multiple ⁇ -lactamases.
  • the compounds of the invention inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula A- I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula II inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula A-II inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases. In one aspect of the invention the compounds of Table I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases. In one aspect of the invention the compound of Formula
  • ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • Class A ⁇ - lactamases for example, include, but are not limited to, TEM, SHV, CTX-M, KPC, GES, VEB, SME, and GEX.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • KPC ⁇ -lactamases inhibit KPC ⁇ -lactamases.
  • the compounds of Formula A-I inhibit KPC ⁇ -lactamases.
  • the compounds of Formula II inhibit KPC ⁇ -lactamases.
  • the compounds of Formula A-II inhibit KPC ⁇ -lactamases. More preferably the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC- 3 ⁇ -lactamases. More preferably the compounds of Formula I inhibit KPC-2 or KPC-3 ⁇ - lactamases. More preferably the compounds of Formula A-I inhibit KPC-2 or KPC-3 ⁇ - lactamases. More preferably the compounds of Formula II inhibit KPC-2 or KPC-3 ⁇ - lactamases.
  • the compounds of Formula A-II inhibit KPC-2 or KPC-3 ⁇ - lactamases.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains Figure 2, Table II.
  • the compounds of Formula I inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II).
  • the compounds of Formula A-I inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II).
  • the compounds of Formula II inhibit KPC-2 or KPC-3 ⁇ - lactamases in clinical strains ( Figure 2, Table II).
  • the compounds of Formula A-II inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II).
  • Class C ⁇ -lactamases for example, include, but are not limited to chromosomal AmpCs, and plasmid based ACC, DHA, CMY, FOX, ACT, MIR, LAT, MOX ⁇ -lactamases.
  • Class D ⁇ -lactamase enzymes for example, include, but are not limited to oxacillinases or OXA ⁇ -lactamases.
  • the compounds of the invention inhibit OXA-15 ⁇ -lactamases.
  • the compounds of Formula I inhibit OXA-15 ⁇ -lactamases.
  • the compounds of Formula A-I inhibit OXA-15 ⁇ -lactamases.
  • the compounds of Formula II inhibit OXA-15 ⁇ -lactamases.
  • the compounds of Formula A-II inhibit OXA- 15 ⁇ - lactamases.
  • the activity of the BLI compounds can be described by the MIC value obtained from a Synergy MIC assay or a BLI potentiation assay (e.g as described herein), both of which are run in the presence of a ⁇ -lactam.
  • the sMIC and BLI potentiation assay data supports that the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate (i.e. make more potent) the activity of the ⁇ -lactam antibiotic against ⁇ -lactamase producing strains by inhibiting the ⁇ -lactamase.
  • the BLI activity is measured by growth inhibition of a ⁇ - lactamase producing bacterial strains in a Synergy MIC (sMIC) assay.
  • sMIC Synergy MIC
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of
  • Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 ⁇ g/mL or less.
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the sMIC value for the compounds of the invention is 4 ⁇ g/mL to 8 ⁇ g/mL.
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • the sMIC value for the compounds of the invention is 0.2 to 0.5 ⁇ g/mL.
  • the BLI activity is measured by growth inhibition of a ⁇ - lactamase producing bacterial strains in a standard BLI potentiation assay using a fixed concentration of BLI.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention is 8 ⁇ g/mL or less.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention e.g.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention is 0.2 ⁇ g/mL to 0.5 ⁇ g/mL.
  • the compounds of the present invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the present invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the present invention are active against a wide variety of bacterial strains that express class A and C ⁇ -lactamases and also, surprisingly are active against bacterial strains that express the class D cephalosporinase OXA-15 (Tables II and III).
  • This increased activity against the class D ⁇ -lactamase is critical because differential effectiveness against different types of ⁇ -lactamase producing bacteria is necessary in order to effectively use ⁇ -lactam antibiotics to treat resistant strains of bacteria (vide infra).
  • the compounds the invention are unexpectedly more active against bacterial strains that express OXA-15 ⁇ -lactamases than the most structurally similar compound, Avibactam (comparator compound CCC).
  • Compounds that are more active than Avibactam against bacterial strains that express the class D cephalosporinase OXA-15 are, for example, compounds 603, 604, 611, 614, 618.
  • the compounds of the invention are unexpectedly more active against and/or show broader spectrum of activity against bacterial strains that express KPC ⁇ -lactamases than the most structurally similar compound,
  • Avibactam Compounds that are more active than Avibactam for at least one, bacterial strain that expresses KPC ⁇ -lactamase and/or show a better spectrum of activity against bacterial strains that express KPC ⁇ -lactamases than Avibactam are, for example, compounds 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 620, 621, 622, 623, 624, 625, 626, and 627.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • the compounds of the invention have high binding affinity for the ⁇ -lactamase enzyme. Consequently these compounds are better inhibitors of the ⁇ -lactamase enzyme.
  • the inhibition kinetics of the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • Compounds that have a binding affinity of 1000- 5000 mM ' V 1 are, for example, compound 604 and 608 (Table IV).
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • Compounds that have a binding affinity of 100-999 rnM ' V 1 are, for example, compounds 601, 603, 605, 606, 607, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, and 627 (Table IV).
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • have a binding affinity of 1-99 mM ' V 1 e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • Compounds that have a binding affinity of 1-99 mM ' V 1 are, for example, 602 (Table IV).
  • compositions Comprising the Compounds of The Invention and Use Thereof
  • Another object of the invention is pharmaceutical compositions or formulations comprising compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • compounds the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • salts thereof preferably further comprising a ⁇ -lactam antibiotic.
  • compositions or formulations comprising compounds of Formula I, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula A-I, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula II, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula A-II, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Table I In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula
  • compositions or formulations comprising compounds of Formula
  • the pharmaceutical compositions can be formulated for oral, intravenous, intramuscular, subcutaneous or parenteral administration for the therapeutic or prophylactic treatment of diseases, such as bacterial infections.
  • the pharmaceutical composition is formulated for intravenous administration.
  • compositions disclosed herein may be prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent or eliminate infection (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing
  • compositions can comprise one or more of the compounds disclosed herein (e.g. one or more compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula
  • pharmaceutically-acceptable carrier refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical
  • Non-limiting examples of carriers and excipients include corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid.
  • the compositions may contain croscarmellose sodium, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid.
  • Tablet binders that can be included are acacia, methylcellulose, sodium
  • Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.
  • Flavoring agents such as peppermint, oil of wintergreen, cherry flavoring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product.
  • compounds of the present invention e.g., compounds of the present invention
  • compositions comprising a compound of this invention may contain from about 0.1% to about 99% by weight of the active compound, such as from about 10% to about 30%.
  • solid formulations such as tablets and capsules are useful. Sustained release or enterically coated preparations may also be devised.
  • one embodiment provides suspensions, syrups and chewable tablets.
  • the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid.
  • the pharmaceutical compositions may be made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient.
  • dosage units are tablets and capsules.
  • the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose;
  • Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs, preparations of the invention may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents.
  • Non-limiting examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl
  • the pharmaceutical composition e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic
  • Intravenous fluids include, without limitation, physiological saline or Ringer's solution.
  • Intravenous administration may be accomplished by using, without limitation, syringe, mini-pump or intravenous line.
  • compositions of this invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • aqueous and non-aqueous carriers, diluents, solvents or vehicles examples include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate.
  • aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • the compositions can include various buffers
  • compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. They may also contain taggants or other anti-counterfeiting agents, which are well known in the art. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, and phenol sorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • Injectable depot forms can be made by forming microencapsulating matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly( anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
  • biodegradable polymers such as polylactide-polyglycolide.
  • Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. Such forms may include forms that dissolve or disintegrate quickly in the oral environment.
  • the active compound preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic
  • suitable excipients include, for example, (a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders such as cellulose and cellulose derivatives (such as
  • the dosage forms may also comprise buffering agents.
  • Solid dosage forms including those of tablets, dragees, capsules, pills, and granules, can be prepared with coatings and shells such as functional and aesthetic enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and colorants. They may also be in a form capable of controlled or sustained release. Examples of embedding compositions that can be used for such purposes include polymeric substances and waxes.
  • compositions can be delivered using controlled (e.g., capsules) or sustained release (e.g., bioerodable matrices) delivery systems.
  • controlled e.g., capsules
  • sustained release e.g., bioerodable matrices
  • Exemplary delayed release delivery systems for drug delivery that are suitable for administering the pharmaceutical compositions are described in U.S. Patent Nos. 4,452,775 (issued to Kent), 5,039,660 (issued to Leonard), and 3,854,480 (issued to Zaffaroni).
  • the rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
  • delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle.
  • a sterile formulation of compounds preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or suitable soluble salt forms thereof, for example hydrochloride salts
  • a pharmaceutical diluent such as Water- for- Injection (WFI), physiological saline or 5% glucose.
  • WFI Water- for- Injection
  • a suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g., an ester of a long chain fatty acid such as ethyl oleate.
  • a dose of an intravenous, intramuscular, or parental formulation of compounds may be administered as a bolus or by slow infusion.
  • a bolus is a dose that is administered in less than 30 minutes. In one embodiment, a bolus is administered in less than 15 or less than 10 minutes. In another embodiment, a bolus is administered in less than 5 minutes. In yet another embodiment, a bolus is administered in one minute or less.
  • An infusion is a dose that is administered at a rate of 30 minutes or greater. In one embodiment, the infusion is one hour or greater. In another embodiment, the infusion is substantially constant.
  • compositions preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints.
  • topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
  • DMSO dimethylsulfoxide
  • the pharmaceutical composition can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
  • the pharmaceutical compositions preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, polyethylene glycol or a suppository wax or other glyceride that are solid at room
  • the pharmaceutical compositions can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery.
  • Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can be a solution of one or more compounds, or salts thereof, in a suitable diluent, in sterile hermetically sealed ampoules or sterile syringes.
  • concentration of the compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, in the unit dosage may vary, e.g. from about 1 percent to about 50 percent, depending on the compound used and its solubility and the dose desired by the physician.
  • each dosage unit can contain from 1-500 mg of the active material.
  • the dosage employed can range from 5 mg to 10 g, per day, depending on the route and frequency of administration.
  • compositions disclosed herein can be placed in a
  • the methods of delivering the pharmaceutical compositions in vivo utilize art-recognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention for the drugs in the art-recognized protocols.
  • compositions for treating cells in culture for example, to eliminate or reduce the level of bacterial contamination of a cell culture
  • methods for using the claimed compositions for treating cell cultures with antibacterial agent(s) with the only substantial procedural modification being the substitution of the compounds of the present invention, preferably in combination with a ⁇ -lactam antibiotic for the drugs in the art-recognized protocols.
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous).
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous) to treat an infection caused by ⁇ -lactam resistant bacteria.
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally to treat an infection caused by ⁇ -lactamase producing bacteria.
  • therapeutically-effective dose and “therapeutically- effective amount” refer to an amount of a compound that prevents the onset, alleviates the symptoms, stops the progression of a bacterial infection, or results in another desired biological outcome such as, e.g., improved clinical signs or reduced/elevated levels of lymphocytes and/or antibodies.
  • treating is defined as administering, to a subject, a therapeutically-effective amount of one or more compounds both to prevent the occurrence of an infection and to control or eliminate an infection.
  • Those in need of treatment may include individuals already having a particular medical disease as well as those at risk for the disease (i.e., those who are likely to ultimately acquire the disorder).
  • subject refers to a mammal, a plant, a lower animal, or a cell culture. In one embodiment, a subject is a human or other animal patient in need of antibacterial treatment.
  • administering refers to providing the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) to the subject in need of treatment.
  • the subject is a mammal, more preferably a human.
  • the present invention comprises administering the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a ⁇ -lactam antiobiotic.
  • a compound of the invention e.g.
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antiobiotic can be administered at the same time or different times.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antiobiotic can be administered at the same time, they can be administered as a single composition or pharmaceutical composition or they can be administered separately. It is understood that when a compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a ⁇ -lactam antibiotic, that the active agents can be administered in a single combination or in multiple combinations.
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a compound of Formula I can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • a pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) and a ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula I, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-I, and a ⁇ - lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula II, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-II, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula A-I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula II.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula A-II.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Table I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formul
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula
  • a method of treating or preventing a bacterial infection in a subject comprising the steps of
  • the compound in step a is a compound of Formula I. In one embodiment the compound in step a is a compound of Formula A-I. In one embodiment the compound in step a is a compound of Formula II. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Table I. In one embodiment the compound in step a is a compound of Formula A-II. In one mpound of Formula
  • the ⁇ -lactam antibiotic in step b is Ceftolozane or Ceftazidime.
  • the ⁇ -lactam antibiotic in step b is Ceftolozane or Ceftazidime.
  • step a is a compound of Formula
  • step b is Ceftolozane.
  • a method of treating or preventing a bacterial infection in a subject comprising the steps of
  • the compound in step b is a compound of Formula I. In one embodiment the compound in step b is a compound of Formula A-I. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Formula A- II. In one embodiment the compound in step b is a compound of in step b is a compound of Formula
  • the ⁇ -lactam antibiotic in step a is Ceftolozane or Ceftazidime.
  • the ⁇ -lactam antibiotic in step a is Ceftolozane or Ceftazidime.
  • step a is Ceftolozane.
  • the compound in step a is b compound of Formula
  • the invention provides a method for treating an infection in a subject by administering a therapeutically- effective amount of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or compositions thereof.
  • the method comprises administering to a subject in need thereof a pharmaceutical composition comprising at least one of the compounds described herein, preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic.
  • the compound is of Formula
  • the compound in conjunction with a ⁇ -lactam antibiotic, preferably Ceftoloz
  • a ⁇ -lactam antibiotic preferably Ceftoloz
  • the compound is of
  • the pharmaceutical composition can comprise any one of the compounds described herein as the sole active compound or in combination with another compound, composition, or biological material.
  • the compound may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally, vaginally, or by an implanted reservoir, external pump or catheter.
  • the compound may be prepared for opthalmic or aerosolized uses.
  • the compounds of the present invention can be administered as an aerosol for the treatment of pneumonia or other lung-based infections.
  • the aerosol delivery vehicle is an anhydrous or dry powder inhaler.
  • One or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof also may be directly injected or administered into an abscess, ventricle or joint.
  • Parenteral administration includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, cisternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered intravenously, subcutaneously or orally.
  • the one or more compounds according to the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • the one or more compounds may be administered in a nutrient medium.
  • one or more compounds according to the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or A-II in conjunction with a ⁇ - lactam antibiotic may be used to treat a subject having a bacterial infection in which the infection is caused or exacerbated by any type of bacteria, such as Gram-negative bacteria.
  • the bacterial infection is caused by ⁇ -lactam resistant bacteria.
  • the bacterial infection is caused by ⁇ -lactamase producing bacteria.
  • the bacterial infection is caused by class A, class C or class D ⁇ -lactamase producing bacteria.
  • the bacterial infection is caused by class A ⁇ -lactamase producing bacteria.
  • the infection is caused by class C ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by class D ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by KPC ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by OXA ⁇ -lactamase producing bacteria. In still another aspect, the bacterial infection is caused by a bacteria that produces multiple ⁇ - lactamases. Bacteria that produce multiple ⁇ -lactamases may produce ⁇ -lactamases of the same class or of different classes (e.g class A and class A or class A and class C or class A and class D etc).
  • Gram-negative pathogens known to express ⁇ -lactamases include, but are not limited to Acinetobacter spp. (including Acinetobacter baumannii), Citrobacter spp., Escherichia spp. (including Escherichia coli), Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp. (including Klebsiella pneumoniae), Enterobacter spp. (including Enterobacter cloacae and Enterobacter aerogenes), Pasteurella spp., Proteus spp. (including Proteus mirabilis), Serratia spp.
  • Bacterial infections can be caused or exacerbated by Gram-negative bacteria including strains which express ⁇ -lactamases that may confer resistance to penicillins, cephalosporins, monobactams and/or carbapenems.
  • the coadministration of a novel BLI that inhibits these ⁇ -lactamases with a ⁇ -lactam antibiotic could be used to treat infections caused by ⁇ -lactam resistant bacteria.
  • the infection is caused by a ⁇ -lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae), Haemophilus influenzae, Pseudomonas aeruginosa, Proteus mirabilis, Serratia marcescens, and Klebsiella pneumoniae, ⁇ -Lactam antibiotics that may be administered concurrently with compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) include, but are not limited to cephalosporin, carbapenem, monobactam, penem and penicillin classes of antibiotics.
  • a ⁇ -lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae
  • Haemophilus influenzae Pseudomonas aeruginosa
  • the ⁇ -lactam antibiotic is a cephalosporin.
  • cephalosporins include, but are not limited to, Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl), Cef alexin (cephalexin), Cefaloglycin (cephaloglycin), Cefalonium (cephalonium), Cefaloridine (cephaloradine), Cefalotin (cephalothin), Cefapirin (cephapirin), Cefatrizine,Cefazaflur, Cefazedone, Cefazolin (cephazolin), Cefradine (cephradine), Cefroxadine, Ceftezole, Cefaclor, Cefamandole, Cefmetazole, Cefonicid, Cefotetan,
  • Cefoxitin Cefprozil (cefproxil), Cefuroxime, Cefuzonam, Cefcapene, Cefdaloxime, Cefdinir, Cefditoren, Cefetamet, Cefixime, Cefmenoxime, Cefodizime, Cefotaxime, Cefpimizole, Cefpodoxime, Cefteram, Ceftibuten, Ceftiofur, Ceftiolene, Ceftizoxime, Ceftriaxone, Cefoperazone, Ceftazidime, Cefclidine, Cefepime, Cefluprenam, Cefoselis, Cefozopran, Cefpirome, Cefquinome, Cefaclomezine, Cefaloram, Cefaparole, Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril, Cefmatilen, Cefmepidium, Cefovecin
  • the ⁇ -lactam antibiotic is a carbapenen.
  • carbapenem antibiotics examples include, but are not limited to, Imipenem,
  • the Carbapenem is Imipenem/Cilastatin or Meropenem.
  • the ⁇ -lactam antibiotic is a monobactam.
  • monobactam antibiotics include, but are not limited to Aztreonam, Tigemonam, Carumonam, BAL30072 and Nocardicin A.
  • the ⁇ -lactam antibiotic is a penem. In one embodiment of the invention, the ⁇ -lactam antibiotic is a penicillin.
  • penicillin antibiotics include, but are not limited to Amoxicillin, Ampicillin, Azlocillin, Mezlocillin, Apalcillin, Hetacillin, Becampicillin, Carbenicillin, Sulbenicillin, Ticarcillin, Piperacillin, Azlocillin, Mecillinam, Pivmecillinam, Methicillin, Ciclacillin, Talampicillin, Aspoxicillin, Oxacillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Nafcillin and Pivampicillin.
  • the pharmaceutical compositions preferably a compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a ⁇ -lactam antibiotic can be used to treat a bacterial infection of any organ or tissue in the body caused by ⁇ -lactam resistant bacteria, preferably, Gram-negative ⁇ -lactam resistant bacteria.
  • organs or tissue include, without limitation, skeletal muscle, skin, bloodstream, kidneys, heart, lung and bone.
  • a pharmaceutical composition comprising at least one compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can be administered to a subject to treat, without limitation, skin and soft tissue infections (e.g., complex skin infections), bacteremia, intra-abdominal infections and urinary tract infections (e.g., cUTI).
  • skin and soft tissue infections e.g., complex skin infections
  • bacteremia bacteremia
  • intra-abdominal infections e.g., cUTI
  • urinary tract infections e.g., cUTI
  • a compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II may be used to treat community acquired respiratory infections, including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa .
  • community acquired respiratory infections including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa .
  • At least one compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can be administered to a subject to treat mixed infections that comprise different types of Gram-negative bacteria, or which comprise both Gram-positive and Gram-negative bacteria. These types of infections include intra-abdominal infections and
  • At least one compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic may also be administered to a subject to treat an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis.
  • an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis.
  • At least one compound of the invention e.g.
  • compositions of the invention may also be directly injected or administered into an abscess, ventricle or joint.
  • Pharmaceutical compositions of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, may be administered as an aerosol for the treatment of pneumonia or other lung-based infections.
  • the aerosol delivery vehicle is an anhydrous, liquid or dry powder inhaler.
  • Actual dosage levels of active ingredients in the pharmaceutical compositions of one or more compounds according to the invention may be varied so as to obtain a therapeutically-effective amount of the active compound(s) to achieve the desired therapeutic response for a particular patient, compositions, and mode of administration.
  • the effective amount can be determined as described herein.
  • the selected dosage level will depend upon the activity of the particular compound, the route of administration, the severity of the condition being treated, and the condition and prior medical history of the patient being treated.
  • the data obtained from the assays can be used in formulating a range of dosage for use in humans.
  • the composition comprises a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a ⁇ -lactam antibiotic
  • both the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antibiotic are active compounds.
  • the method comprises administering to the subject an effective dose of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably in conjunction with a ⁇ lactam antibiotic.
  • An effective dose of a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • An effective dose is generally between 125 mg/day to 2000 mg/day.
  • an effective dose is from about 0.1 to about 100 mg/kg of one or more compounds of the invention (e.g.
  • the dose is from about 0.1 to about 50 mg/kg of one or more compounds of the invention (e.g.
  • the dose is from about 1 to about 25 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof.
  • the dose is from about 1 to about 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • the dose is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg of one or more compounds of the invention (e.g.
  • the compounds of the invention are administered to a human at a dose of 100 mg to 1000 mg per dose up to four times per day.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 250 mg to 500 mg per dose up to four times a day.
  • An effective dose for cell culture is usually between about 0.1 and about 1000 ⁇ g/mL. In one embodiment, the effect dose for cell culture is between about 0.1 and about 200 ⁇ g/mL.
  • a ⁇ -lactam antibiotic and a compound of the invention are administered in ratio of 1:4 to 8:1 antibiotic: compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • the ratio is 1 :4.
  • the ratio is 3:4.
  • the ratio is 5:4.
  • the ratio is 7:4.
  • the ratio is 1:2.
  • the ratio is 3:2.
  • the ratio is 5:2.
  • the ratio is 7:2.
  • the ratio is 1:3.
  • the ratio is 2:3.
  • the ratio is 4:3. In another embodiment the ratio is 5:3. In another embodiment the ratio is 7:3. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:1. In another embodiment the ratio is 2:1. In another embodiment the ratio is 3:1. In another embodiment the ratio is 4:1. In another embodiment the ratio is 5:1. In another embodiment the ratio is 6:1. In another embodiment the ratio is 7:1. In another embodiment the ratio is 8:1. It will be understood by one of skill in the art that the ⁇ - lactam antibiotic and compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II can be administered within the range of ratios provided regardless of the method of drug delivery. It will also be understood by one of skill in the art that the ⁇ -lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided together, for example, in a pharmaceutical composition, or sequentially, i.e. the ⁇ -lactam antibiotic is administered, followed by administration of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or vice versa.
  • a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • One or more compounds of the invention may also be administered in the diet or feed of a patient or animal. If administered as part of a total dietary intake, the amount of compound employed can be less than 1% by weight of the diet, such as no more than 0.5% by weight.
  • the diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
  • One or more compounds of the invention can be administered as a single daily dose or in multiple doses per day.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered as a single dose per day.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered as a single dose per day.
  • one or more compounds of the invention e.g.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered in three equal doses per day.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered in four equal doses per day.
  • the treatment regime may require administration over extended periods of time, e.g., for several days or for from two to four weeks.
  • the amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the infection, the age and general health of the patient, the tolerance of the patient to the compound of the invention and the ⁇ -lactam antibiotic and the microorganism or microorganisms involved in the infection.
  • the treatment regimen for one type of infection may differ greatly from the treatment regimen of another infection. For example, one type of infection may require administration via intravenous administration once daily, while another infection may require a treatment regimen of multiple dosing orally.
  • One or more compounds of the invention may be administered according to this method until the bacterial infection is eradicated or reduced.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for a period of time from 3 days to 6 months.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for 7 to 56 days.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for 7 to 28 days.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, are administered for 7 to 14 days.
  • Compounds of the present invention may be administered for a longer or shorter time period if it is so desired.
  • Other embodiments of the invention include:
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • novel compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • novel compounds of the invention e.g.
  • a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • synthetic routes including synthetic schemes described herein. These synthetic routes can be applied to large scale synthesis with appropriate adjustment of reaction sequence, reaction conditions, isolation/purification methods and choice of solvents which are environmentally friendly and cost-effective.
  • Boc ieri-butoxycarbonyl
  • Boc 2 0 di-ieri-butyldicarbonate
  • Burgess reagent methyl N-triethylammoniumsulfonyl)carbamate
  • CDI carbonyldiimidazole
  • DIAD diisopropyl azodicarboxylate
  • DIPEA diisopropylethylamine
  • HATU 2- (7 - aza- 1 H-benzotriazole- 1 - yl) - 1 , 1 ,3 , 3 - tetramethyluronium hexafluoropho sphate
  • the compounds of Formula (I) can be prepared from intermediate 1, according to the following reaction schemes and examples, or modifications thereof, using readily available starting materials, reagents and conventional synthetic procedures including, for example, procedures described in US7112592 and WO2009/091856.
  • Compound 3 can be synthesized following standard isoxazole ring formation chemistry from the chlorooxime intermediate 2d , which can be prepared from ester intermediate 1 (see, e.g., Abele, E.; Lukevics, E.
  • the benzylic ether protecting group in 3 can be removed via standard hydrogenolysis conditions, such as, but not limited to, Pd/H 2 in MeOH or THF or by acid-catalysed hydrolysis, such as, but not limited to, BCI 3 in DCM to provide the hydroxy-urea intermediate 4, which can be used directly in the next step without further purification.
  • Sulfation of 4 can be achieved by treatment with a sulfating reagent, such a, but not limited to, SC .pyridine complex, in an appropriate solvent, such as pyridine, DMF or DMAc at a temperature of 0-80 °C, preferable at room temperature.
  • Compound 5 can then be isolated and purified via conventional methods.
  • 5 can be purified by standard reverse phase prep-HPLC using an appropriate buffer system, i.e. ammonium formate buffer.
  • 5 can be purified by normal phase silica gel chromatography after converting to an appropriate salt form, such as sulfate tetrabutyl ammonium salt.
  • the tetrabutyl ammonium salt can then be converted to a sodium salt by cation exchange.
  • a protecting group(s) i.e. Boc or Fmoc for amine and guanidine protection, TBS or TES for alcohol protection, etc
  • a deprotection step is needed to convert 5 to its final product 6, which can be purified by reverse phase prep-HPLC using the conditions mentioned above.
  • N-Boc deprotection 5 can be treated with an acid, such as TFA, in an appropriate solvent, such as DCM at a temperature of 0-30 °C, preferable at 0 °C to rt to give 6.
  • an acid such as TFA
  • an appropriate solvent such as DCM
  • a fluoride reagent such as
  • HF.pyridine HF.NEt 3
  • TBAF TBAF
  • Fmoc deprotection amines, such as diethylamine, DBU, piperidine, etc can be used.
  • the nuclear magnetic resonance (NMR) spectral characteristics refer to chemical shifts ( ⁇ ) expressed in parts per million (ppm) versus tetramethylsilane (TMS) as reference standard.
  • the relative area reported for the various shifts in the proton NMR spectral data corresponds to the number of hydrogen atoms of a particular functional type in the molecule.
  • the nature of the shifts as to multiplicity is reported as broad singlet (br s), broad doublet (br d), singlet (s), multiplet (m), doublet (d), quartet (q), doublet of doublet (dd), doublet of triplet (dt), and doublet of quartet (dq).
  • the solvents employed for taking NMR spectra are DMSO-d6 (perdeuterodimethysulfoxide), D 2 0 (deuterated water), CDCI 3 (deuterochloroform) and other conventional deuterated solvents.
  • the prep-HPLC conditions are: Waters SunFire ® C18 (30x100 mm, 5 ⁇ OBD) column; flow rate: 30-80 mL/minute, ELSD or Mass-triggered fraction collection; sample loading: Each injection loading varied from 30 -300 mg for different crude samples depending on their solubility and purity profiles; Solvent system using ammonium formate buffer: solvent A: water with 20 mM ammonium formate, solvent B: 85% of acetonitrile in water with 20 mM ammonium formate.
  • Solvent system using NH 4 HCO 3 buffer solvent A: water with 10 mM NH 4 HCO 3 , solvent B: acetonitrile.
  • Solvent system using NH4OH buffer solvent A: water with 0.1% NH4OH, solvent B: acetonitrile with 0.1% NH4OH.
  • Step 1 Synthesis of (S)-l-tert-butyl 2-ethyl 5-oxopiperidine-l ,2 -dicarboxylate
  • n-BuLi 600 mL, 1.5 mol was added dropwise to a solution of TMSCHN 2 (690 mL, 1.38 mol ) in dry THF (3 L) at -78 °C, and the mixture was stirred at -78 °C for 30 minutes.
  • the mixture was then transferred to a solution of (5')-l-ieri-butyl 2-ethyl 5-oxopyrrolidine-l ,2- dicarboxylate (300 g, 1.17 mol) in dry THF (3 L) via cannula, and the mixture was stirred at - 78 °C for 30 minutes.
  • the reaction mixture was then quenched with sat. NH 4 CI solution, and extracted with DCM (3x).
  • Step 2 Synthesis of (2S,5S)-1 -tert-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate
  • Step 3 Synthesis of (2S,5R)-1 -tert-butyl 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l,2-dicarboxylate
  • reaction mixture was then concentrated under reduced pressure and purified by silica gel column chromatography (3: 1 petroleum ether/EtOAc) to afford (25,5 ?)-l-ieri-butyl 2-ethyl 5-(N-(benzyloxy)-2-nitrophenylsulfonamido)piperidine-l,2-dicarboxylate (283.8 g, 80%) as a yellow oil.
  • Step 4 Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-((benzyloxy)amino)piperidine-l,2- dicarboxylate
  • Triphosgene (21.3 g, 72 mmol) was added in portions to a 0 °C solution of (25',5 ?)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (50 g, 0.18 mol) and DIPEA (128 mL, 0.72 mol) in DCM (2000 mL).
  • the reaction mixture was allowed to warm to rt. After stirring at rt overnight, the reaction mixture was washed with H 3 PO 4 (10%), sat. NaHCC>3 and saturated NaCl.
  • L1BH 4 (0.54 g, 24.67 mmol) was added to a -10 °C solution of (25",5 «)-ethyl 6-(benzyloxy)-7- oxo- 1,6-diazabicyclo [3.2.1 ]octane-2-carboxylate (5 g, 16.44 mmol) in MeOH (50 mL). After 15 minutes another portion of L1BH 4 (0.54 g, 24.67 mmol) was added and the mixture was stirred at -10 to 0 °C for 4-5 h. The reaction mixture was carefully quenched by addition of sat. NaH 2 P0 4 (50 mL) at 0 °C.
  • TEMPO 48 mg, 0.3 mmol was added in portions to a 0 °C solution of (2S,5R)-6- (benzyloxy)-2-(hydroxymethyl)- l ,6-diazabicyclo[3.2.1 ]octan-7-one (7.8 g, 30 mmol) and l ,3,5-trichloro-l ,3,5-triazinane-2,4,6-trione (7.0g, 30mmol) in DCM (100 mL). The mixture was stirred at 0 °C for 2 h, and filtered through Celite®.
  • Step 1 NCS (295 mg, 2.2 mmol) was added to a solution of 6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octane-2-carbaldehyde oxime (560 mg, 2.0 mmol) in dry DCM (15 mL) at rt. Pyridine (one drop) was then added, and the reaction mixture was stirred at rt for 18 hrs. The solution was evaporated to afford (25,5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbimidoyl chloride, which was directly used in the next step.
  • ESI- MS EI + , m/z
  • Step 2 tert- Butyl prop-2-yn-l-ylcarbamate (0.37 g, 2.4 mmol) was added to the solution of (25',5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbimidoyl chloride ( ⁇ 2.0 mmol) in dry DCM (20 mL), followed by the addition of TEA (0.31 mL, 2.2 mmol) in dry DCM (2.0 mL) over a period of 30 minutes. The reaction mixture was stirred at rt overnight, then the mixture was diluted with EtOAc, washed with water and saturated sodium chloride.
  • Step 3 To a solution of ieri-butyl (3-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)isoxazol-5-yl)methylcarbamate (210 mg, 0.5 mmol) in THF (5 mL) was added 10% Pd/C (100 mg).
  • Step 4 To a solution of ieri-butyl (3-((25',5 ?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)isoxazol-5-yl)methylcarbamate (180 mg, 0.5 mmol) in dry pyridine (2.5 mL) was added SC>3-Py (480 mg, 3.0 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under reduced pressure. The residue was re-dissolved in aqueous
  • Step 6 TFA (0.40 mL) was added to a 0 °C solution of sodium (25, 5R)-2-(5-(tert- butoxycarbonylaminomethyl)- isoxazol-3-yl)-7-oxo-l,6-diaza-bicyclo[3.2.1 ]octan-6-yl sulfate (54 mg, 0.12 mmol) in dry DCM (1.2 mL). The reaction mixture was stirred at 0 °C for 30 minutes to 1 h and then diluted with diethyl ether.
  • the TFA salt ( ⁇ 30 mg) was further purified by prep-HPLC using ammonium formate buffer to provide (2S ,5R)-2-(5- (aminomethyl)isoxazol-3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (601, 10 mg, 26%) as a white solid.
  • ESI-MS (EI + , m/z): 319.21.
  • Step 1 Synthesis of 1 -(2,3-bis(tert-butoxycarbonyl)guanidino)prop-2-yne:
  • Step 2 Synthesis of(2S,5R)-6-(benzyloxy)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-l,6-diaz -bicyclo[3.2.1 ]octan-7-one: l-(2,3-bis(ieri-butoxycarbonyl)guanidino)prop-2-yne (362 mg, 1.22 mmol) was added to the solution of (25',5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbimidoyl chloride (473 mg, 1.53 mmol) in dry DCM (20 mL) at rt , followed by dropwise addition of TEA (0.16 g, 1.53 mmol).
  • Step 3 Synthesis of(2S,5R)-6-(hydroxy)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-l,6-diaz -bicyclo[3.2.1 ]octan-7-one:
  • Step 4 Synthesis oftetrabutylammonium(2S,5R)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diaz -bicyclo[3.2.1 ]octan-6-yl sulfate:
  • Step 5 TFA (2.20 mL) was added to a 0 °C solution of tetrabutylammonium (25,5/?)-2-(5- ((2,3-bis(ieri-butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate (465 mg, 0.60 mmol) in dry DCM (6.60 mL). The reaction mixture was allowed to warm to rt. The reaction mixture was stirred at rt for 2 hrs and then diluted with ether.
  • the precipitate was collected via centrifugation, washed with diethyl ether (3x) and further dried under high vacuum.
  • the crude TFA salt was purified by prep- HPLC using ammonium formate buffer to provide (25',5 ?)-2-(5-(guanidinomethyl)isoxazol- 3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (603, 60 mg, 20%) as a white solid.
  • ESI-MS EI + , m/z
  • Step 1 Synthesis of tert-butyl 4-(but-3-ynylamino)piperidine-l -carboxylate:
  • Step 2 Synthesis of ' tert-butyl 4-(but-3-ynyl(tert-butoxycarbonyl)amino)piperidine-l- carboxylate:
  • Step 1 The reaction mixture in Step 1 was cooled to 0 °C and Et 3 N (88.0 mL, 0.63 mol) and (Boc) 2 0 (91.6 g, 0.42 mol) were added. The solution was allowed to warm to rt, then was stirred at rt for 17 hrs. The reaction mixture was concentrated, and then EtOAc (800 mL) was added. The organic layer was washed with saturated sodium chloride (3x), dried over Na 2 S0 4 , and concentrated.
  • Step 3-6 Following Steps 2-5 in Example 5, replacing l-(2,3-bis(ieri- butoxycarbonyl)guanidino)prop-2-yne in Step 2 with tert-butyl 4-(but-3-yn-l-yl(ieri- butoxycarbonyl)amino)piperidine-l-carboxylate; (2S,5R)-7-oxo-2-(5-(2-(piperidin-4- ylamino)ethyl)isoxazol-3-yl)-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (609, 220 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer.
  • Step 3 Synthesis of di-tert-butyl(4-(but-3-ynylamino)piperidin-l - yljmethanediylidenedicarbamate: A mixture of but-3-yn-l-amine hydrochloride (3.0 g, 28.4 mmol), K2CO 3 (2.0 g, 14.2 mmol), MeOH (150 mL), di-ieri-butyl (4-oxopiperidin-l-yl)methylene-dicarbamate (8.1 g, 23.7 mmol) and 4 A molecular sieve (6.0 g) was stirred at rt for 3 hrs.
  • Step 4 Synthesis of di-tert-butyl (4-(but-3-ynyl(tert-butylcarbamate))piperidin-l- yljmethanedi- ylidenedicarbamate:
  • Step 5-8 Following Steps 2-5 in Example 5, replacing l-(2,3-bis(tert- butoxycarbonyl)guanidino)prop-2-yne in Step 2 with ieri-butyl (l-(N,N'-bis(tert- butoxycarbonyl)carbamimidoyl)piperidin-4-yl)(but-3-yn-l-yl)carbamate;(2S,5R)-2-(5-(2-((l- carbamimidoylpiperidin-4-yl)amino)ethyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (610, 502 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer.
  • a set of ⁇ -lactamase expressing isogenic E. coli strains was constructed by cloning a ⁇ -lactamase gene into a customized derivative of pBR322 (GenBank Accession Number JO 1749) and transforming the engineered plasmids into E. coli.
  • the Ndel restriction site within the plasmid backbone of pBR322 was removed to generate pBR322 ANdel.
  • the chloramphenicol resistance gene, cat was generated by PCR amplification from pKD3 (GenBank Accession Number
  • coli DH10B harboring the recombinant plasmids were selected on LB agar (supplemented with 25 ⁇ g/mL tetracycline) and single isolated colonies were then inoculated into 5 mL LB media (supplemented with 25 ⁇ g/mL tetracycline), and incubated at 37°C with aeration (250 rpm) for 18 hrs. The cultures were frozen back at -80°C in 20% glycerol. The DNA sequence of the cloned ⁇ - lactamase genes was confirmed. The ⁇ -lactamase gene expression in the recombinant E.
  • coli strains was driven by the blaTEM-l promoter in the pBR-CBST plasmid and was characterized by MIC profiling of the E. coli recombinant strains against comparator ⁇ - lactam/BLI combinations in broth microdilution assay.
  • KPC-2 pBR-CBST-KPC-2 A K. pneumoniae EU784136
  • frozen glycerol stocks of clinical isolates ⁇ Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB).
  • Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned ⁇ -lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 ⁇ g/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
  • the two compound components of the assay were each diluted in CAMHB and added to the 96-well broth microdilution assay plates. 50 ⁇ L ⁇ of the ⁇ -lactam was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 ⁇ g/mL. 25 ⁇ L ⁇ of the BLI compound was added to all wells in the broth microdilution plates at a final concentration of 4 ⁇ g/mL.
  • each well was 100 ⁇ L ⁇ and contained a ⁇ - lactam at different concentrations, a BLIcompound at 4 ⁇ g/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 ⁇ g/mL.
  • the synergy MIC (sMIC) assay determines the concentration of the BLI required to potentiate the activity of a fixed concentration of a ⁇ -lactam antibiotic against ⁇ -lactamase producing bacterial strains.
  • the experimental protocol was performed according to Clinical and Laboratory Standards Institute (CLSI) guidelines with modifications as described below (CLSI guidelines can be derived from the CLSI document M07-A9 published in January 2012: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition").
  • the assay is set-up by serially diluting the BLI across 11 of the 12 wells in each row of a 96-well broth microdilution assay plate, adding the ⁇ -lactam at a fixed concentration to all wells in the assay plate, inoculating the assay plate with bacterial strains, and determining the lowest concentration of BLI required to inhibit overnight bacterial growth.
  • Bacterial growth in the 12 th well of the assay plate, which contains the ⁇ -lactam at a fixed concentration but does not contain any BLI demonstrates that the bacterial strains are resistant to the ⁇ -lactam antibiotic (e.g ceftolozane) at the fixed concentration of 4 ⁇ g/mL.
  • frozen glycerol stocks of clinical isolates ⁇ Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB).
  • Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned ⁇ -lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 ⁇ g/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
  • the two compound components of the assay were each prepared in CAMHB and added to the 96-well broth microdilution assay plates. 50 ⁇ L ⁇ of the BLI was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 ⁇ g/mL. 25 ⁇ L ⁇ of the ⁇ -lactam was added to all wells in the broth microdilution plates at a final concentration of 4 ⁇ g/mL.
  • each well was 100 ⁇ L ⁇ and contained a BLI at different concentrations, a ⁇ -lactam at 4 ⁇ g/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 ug/mL.
  • the sMIC values represent the amount of BLI required to potentiate the activity of 4 ⁇ g/ml of CXA-101 (Ceftolozane) or ceftazidime to inhibit the growth of the ⁇ -lactamase producing bacteria.
  • NCF nitrocefin
  • the enzyme activity in the presence of varying concentrations of test inhibitor was determined by monitoring the hydrolysis of NCF spectrophotometrically at 486 nm, for 5 minutes, 25 °C, using a SpectraMax Plus384 microplate reader with SoftMax Pro software (Molecular Devices). Data analysis was performed using GraphPad Prism (GraphPad Software, Inc.).
  • K m is the KPC-2 K m for NCF

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

β-Lactamase inhibitor compounds (BLIs) are disclosed, including compounds that have activity against class A, class C or class D β-lactamases. Methods of manufacturing the BLIs, and uses of the compounds in the preparation of pharmaceutical compositions and antibacterial applications are also disclosed.

Description

ISOXAZOLE β-LACTAMASE INHIBITORS
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application No. 61/618,127, filed March 30, 2012, and U.S. Provisional Application No. 61/790,248, filed March 15, 2013. The entire contents of these applications are incorporated herein by reference in their entireties.
TECHNICAL FIELD
This disclosure is directed to β-lactamase inhibitors (BLIs) which are effective as inhibitors of β-lactamases and, when used in combination with β-lactam antibiotics are useful in the treatment of bacterial infections. The compounds when combined with a β-lactam antibiotic are effective in treating infections caused by bacteria that are resistant to β-lactam antibiotics due to the presence of β-lactamases. Pharmaceutical compositions comprising such compounds, methods of using such compounds, and processes for preparing such compounds are also disclosed.
BACKGROUND
Bacterial resistance to β-lactam antibiotics, especially in Gram-negative bacteria, is most commonly mediated by β-lactamases. β-lactamases are enzymes that catalyze the hydrolysis of the β-lactam ring, which inactivates the antibacterial activity of the β-lactam antibiotic and allows the bacteria to become resistant. Inhibition of the β-lactamase with a BLI slows or prevents degradation of the β-lactam antibiotic and restores β-lactam antibiotic susceptibility to β-lactamase producing bacteria. Many of these β-lactamases are not effectively inhibited by BLIs currently on the market rendering the β-lactam antibiotics ineffective in treating bacteria that produce these β-lactamases. There is an urgent need for novel BLIs that inhibit β-lactamases that are not effectively inhibited by the current clinical BLIs (e.g. KPC, class C and class D β-lactamases) and that could be used in combination with β-lactam antibiotics to treat infections caused by β-lactam resistant bacteria. SUMMARY OF INVENTION
The present invention provides, in one aspect, compounds of chemical formula (I), or pharmaceutically-acceptable salts thereof, which are BLIs and are useful in combination with β-lactam antibiotics for the treat
Figure imgf000003_0001
(I)
wherein
— -OS03H ; — &-S03H ; — >-OP03H ; — >-CH2C02H ; and— ?-CF2C02H
R is selected from ¾ ¾ ¾ s ¾ ; and
R1 is se
Figure imgf000003_0002
wherein R is selected from
Figure imgf000003_0003
wherein each of R3, R4 and R5 is independently selected from hydrogen, (Ci- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
Figure imgf000003_0004
wherein R is selected from
Figure imgf000003_0005
H and ^^ N H2 ;
Figure imgf000004_0001
wherein R7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000004_0002
and wherein each of p and q is independently selected from 1 and 2.
In another aspect, the invention provides compounds of chemical Formula (A-I) or a pharmaceutically acceptable salt thereof, which are BLIs and are useful in combination with β-lactam antibiotics for the treatment of bacterial infections.
Figure imgf000004_0003
wherein
R* is selected from
— ^-OS03H ; — ^-S03H -0PO3H -CH2C02H ; and— ¾-CF2C02H
; and
R1* is selec a.
Figure imgf000004_0004
wherein R2* is selected from
Figure imgf000004_0005
selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
hydroxyalkyl,
Figure imgf000004_0006
each of R4*, R5*, R6*and R7* is independently selected from hydrogen, (Q- Ce)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R4*, R5*, R6 *and R7*is hydrogen ,
n is selected from 1, 2, 3 and 4, and
b.
Figure imgf000005_0001
wherein R is selected from -NH(Ci-C3)-alkyl and
wherein each of R4*, R5*, R6*and R7 is as described previously;
Figure imgf000005_0002
wherein Z is selected from CR9R10 and NR11,
each of R9 and R10 is independently selected from H, NH2, -NH(Ci-C3)-alkyl
and
Figure imgf000005_0003
, wherein each of R4*, R5*, R6 *and R7*is as described previously,
alternatively, R9 and R10 together with the carbon to which they are attached, form a cycloalkylor heterocyclyl ring containing 4-6 ring members,
R11 is selected from H and
Figure imgf000005_0004
each of R12, R13 and R14 is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R , R and
R is hydrogen,
R is selected from NH2 and
Figure imgf000005_0005
, wherein each of R >'4** , R.J5* ,
R6*and R7" is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3, T is selected from NH and O,
t is selected from 0, 1, 2, 3, and 4, and
each of r and y is independently selected from 0 and 1 ;
Figure imgf000006_0001
wherein R is selected from NH2, -NH(Ci-C3)-alkyl and
Figure imgf000006_0002
, wherein each of R4 , R5 , R6 and R7 is as described previously,
s is selected from 0 and 1 , and,
v is selected from 0, 1, 2, and 3;
Figure imgf000006_0003
wherein R is selected from NH2 and , wherein each of R4*, R5*, R6*and R7* is as described previously,
R17 is selected from amino and hydroxyl, and
d 1 ;
Figure imgf000006_0004
wherein M is selected from NR19, CR20R21 and O,
wherein R19 is selected from H and
Figure imgf000006_0005
, where each of R , R and R is as described previously,
each of R and R .Z211 is independently selected from H, NH2 and
Figure imgf000007_0001
, wherein each of R4*, R5*, R6 *and R7*is as described previously, and
0, 1 and 2; and h.
Figure imgf000007_0002
In one embodiment, the invention provides use of a compound of Formula I for inhibiting β-lactamases.
In one embodiment, the invention provides use of a compound of Formula A-I for inhibiting β-lactamases.
In one embodiment, the invention provides compounds of Formula I with high binding affinity for β-lactamase enzymes.
In one embodiment, the invention provides compounds of Formula A-I with high binding affinity for β-lactamase enzymes.
In one embodiment, the present invention also provides antibacterial compositions comprising compounds of Formula I and at least one β-lactam antibiotic.
In one embodiment, the present invention also provides antibacterial compositions comprising compounds of Formula A-I and at least one β-lactam antibiotic.
In one embodiment, the present invention provides pharmaceutical compositions comprising compounds of Formula I and at least one β-lactam antibiotic and methods of use thereof.
In one embodiment, the present invention provides pharmaceutical compositions comprising compounds of Formula A-I and at least one β-lactam antibiotic and methods of use thereof.
In one embodiment, the invention provides methods of use of the compounds of Formula I to treat bacterial infections in a subject.
In one embodiment, the invention provides methods of use of the compounds of
Formula A-I to treat bacterial infections in a subject. BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1D show Table I, Representative Compounds of Formula A-II
Figures 2A-2B show Table II, Standard BLI potentiation MIC assay against a panel of isogenic and clinical strains expressing β-lactamases.
Figures 3A-3B show Table III, the synergy MIC of representative compounds of
Formula II-A against a panel of isogenic and clinical strains expressing β-lactamases.
Figure 4 shows Table IV, an assay to determine inhibition kinetics of representative compounds of Formula II-A for the KPC-2 β-lactamase.
Figures 5A-5B show Table V, Synergy MICof Comparator Compounds Against a Panel of Isogenic and Clinical Strains Expressing β-lactamases
DETAILED DESCRIPTION
Definitions:
Molecular terms, when used in this application, have their common meaning unless otherwise specified.
The term "alkyl" is defined as a linear or branched, saturated radical having one to about twenty carbon atoms unless otherwise specified. Preferred alkyl radicals are "lower alkyl" radicals having one to about five carbon atoms. Examples of alkyl groups include, without limitation, methyl, ethyl, ieri-butyl, isopropyl, and hexyl. A subset of the term alkyl is "(Ci-C3)-unsubstituted alkyl" which is defined as an alkyl group that bears no substituent groups. Examples of (Ci-C3)-unsubstituted alkyl groups include methyl, ethyl, propyl and isopropyl. It is understood that if a (Ci-C3)-alkyl is "substituted" that one or more hydrogen atoms is replaced by a substitutent.
The term amino denotes a NH2 radical.
The term "aminoalkyl" denotes an alkyl in which one or more of the alkyl hydrogen atoms has been replaced by an amino group.
The term "aminocycloalkyl" denotes a cycloalkyl in which one of the cycloalkyl hydrogen atoms has been replaced by an amino group.
The term "cycloalkyl" or "cycloalkyl ring" is defined as a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to twelve ring members. In a preferred embodiment, a cycloalkyl is a ring system having three to seven ring members. Examples of a cycloalkyl group include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl. The term "hydroxyalkyl" denotes an alkyl radical in which one or more of the alkyl hydrogen atoms has been replaced by a hydroxyl group.
It will be understood by one of skill in the art that a
^ or - denote the point of attachment of a substituent group where indicated. For example
Figure imgf000009_0001
represent that the point of attachment of the amide moiety is at the carbonyl carbon.
The functional classification of β-lactamases and terms "Class A", "Class C", and "Class D" β-lactamases are understood by one of skill in the art and are described in "Updated Functinal Classification of β -Lactamases", Bush, K.; Jacob y, G. A.; Antimicrob. Agents Chemother. 2010, 54, 969-976, herein incorporated by reference.
The salts of the compounds of the invention include acid addition salts and base addition salts. In a one embodiment, the salt is a pharmaceutically acceptable salt of the compound of Formula I. The term "pharmaceutically acceptable salts" embraces salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically-acceptable. Suitable pharmaceutically acceptable acid addition salts of the compounds of the invention may be prepared from an inorganic acid or an organic acid. Examples of such inorganic acids include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid. Examples of appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, arylaliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include, without limitation, formic, acetic, propionic, succinic, glycolic, gluconic, maleic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2- hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, β-hydroxybutyric, malonic, galactic, and galacturonic acid. Suitable pharmaceutically-acceptable base addition salts of compounds of the invention include, but are not limited to, metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from Ν,Ν'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N- methylglucamine, lysine and procaine. All of these salts may be prepared by conventional means from the corresponding compound of the invention by treating, for example, the compound of the invention with the appropriate acid or base.
The compounds of the invention can possess one or more asymmetric carbon atoms and are thus capable of existing in the form of optical isomers as well as in the form of racemic or non-racemic mixtures thereof. The compounds of the invention can be utilized in the present invention as a single isomer or as a mixture of stereochemical isomeric forms. Diastereoisomers, i.e., nonsuperimposable stereochemical isomers, can be separated by conventional means such as chromatography, distillation, crystallization or sublimation. The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example by formation of diastereoisomeric salts by treatment with an optically active acid or base. Examples of appropriate acids include, without limitation, tartaric, diacetyltartaric, dibenzoyltartaric, ditoluoyltartaric and camphorsulfonic acid. The mixture of diastereomers can be separated by crystallization followed by liberation of the optically active bases from the optically active salts. An alternative process for separation of optical isomers includes the use of a chiral chromatography column optimally chosen to maximize the separation of the enantiomers. Still another available method involves synthesis of covalent diastereoisomeric molecules by treating compounds of the invention with an optically pure acid in an activated form or an optically pure isocyanate. The synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation, and then hydro lyzed to obtain the enantiomerically pure compound. The optically active compounds of the invention can likewise be obtained by utilizing optically active starting materials. These isomers may be in the form of a free acid, a free base, an ester or a salt.
Compounds described herein also include isotopically- labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to H, H, C, C, C, CI, F, I, I, N, N, O, O, O, P, and S. In one embodiment, isotopically- labeled compounds are useful in drug and/or substrate tissue distribution studies. In another embodiment, substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements). In yet another embodiment, substitution with positron emitting isotopes, such as C, F, O and N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically- labeled reagent in place of the non- labeled reagent otherwise employed.
The invention also embraces isolated compounds. An isolated compound refers to a compound which represents at least 10%, such as at least 20%, such as at least 50% and further such as at least 80% of the compound present in the mixture. In one embodiment, the compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound exhibits detectable (i.e. statistically significant) activity when tested in conventional biological assays such as those described herein. β-Lactamase Inhibitors (BLIs)
In one aspect, the invention provides compounds of Formula I or pharmaceutically- acceptable salts thereof:
Figure imgf000011_0001
Substituent R of Formula I is selected from
>-OS03H — -S03H — >-OP03H — ¾-CH2C02H , and— ¾-CF2C02H
In a preferred embodiment, R is
Figure imgf000011_0002
The group R of Formula I is selected from:
Figure imgf000011_0003
wherein R2 is selected from
Figure imgf000011_0004
wherein each of R3, R4 and R5 is independently selected from hydrogen, (Q- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
Figure imgf000012_0001
wherein R is selected from
Figure imgf000012_0002
Figure imgf000012_0003
wherein R7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000012_0004
and
and wherein each of p and q is independently selected from 1 and 2.
In one aspect of the invention n is 1. In another aspect of the invention n is 2. In another aspect of the invention n is 3.
In one aspect R1 is selected from
-CH2NH2, -CH2CH2NH2, -CONH(CH2)2NH2
Figure imgf000012_0005
embodiment of the invention, R is selected from
Figure imgf000012_0006
In one embodiment of the invention, the compounds of the invention are of the stereochemistry disclosed in Formula II.
Figure imgf000013_0001
In another embodiment of the invention, the compound is of Formula II and R is OSO3H and R1 is -CH2NH2.
In another embodiment of the invention, the compound is of Formula II and R is OSO3H and R1 is -CH2CH2NH2.
In another embodiment of the invention, the compound is of Formula II and R is OSO3H and R1 is -CONH(CH2)2NH2.
In another embodiment of the invention, the compound is of Formula II and R is
Figure imgf000013_0002
In another embodiment of the invention, the compound is of Formula II and R is
Figure imgf000013_0003
In another embodiment of the invention, the compound is of Formula II and R is
Figure imgf000013_0004
In another embodiment of the invention, the compound is of Formula II and R is
Figure imgf000013_0005
In another embodiment of the invention, the compound is of Formula II and R is
OSO3H and R is
Figure imgf000013_0006
Preferred compounds of Formula I are the compounds:
Figure imgf000014_0001
It will be understood by one of skill in the art that depending on the nature of R1 and R, compounds of Formula I may exist in a salt or zwitterionic form.
In one aspect, the invention provides compounds of Formula A-I or pharmaceutically- acceptable salts thereof:
Figure imgf000014_0002
Substituent R* of Formula A-I is selected from
— ^-OS03H ; — ^-S03H ;t -OP03H CH2C02H ; and— -CF2C02H
In a preferred embodiment, R* is
-OSO3H
The group R1* is selected from:
Figure imgf000015_0001
wherein R2* is selected from
selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
hydroxyalkyl,
Figure imgf000015_0002
,
each of R4*, R5*, R6*and R7* is independently selected from hydrogen, (Ci-Ce)- alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R4*, R5*, R6 *and R7*is hydrogen ,
n is selected from 1 , 2, 3 and 4, and
b.
Figure imgf000015_0003
wherein R is selected from -NH(Ci-C3)-alkyl and , wherein each of R4*, R5*, R6*and R7 is as described previously;
Figure imgf000015_0004
wherein Z is selected from CR9R10 and NR11,
each of R9 and R10 is independently selected from H, NH2, -NH(d-C3)-alkyl
and
Figure imgf000015_0005
as described previously,
alternatively, R9 and R10 together with the carbon to which they are attached, form a cycloalkyl or heterocyclyl ring containing 4-6 ring members, R11 is selected from H and
Figure imgf000016_0001
, EACH OF R 12 5 R 13 AND R14
independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R12, R13 and
R , 14 is hydrogen,
R1J is selected from NH2 and
Figure imgf000016_0002
, wherein each of R4*, R5*, R6*and R7 is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3,
T is selected from NH and O,
t is selected from 0, 1, 2, 3, and 4, and
ependently selected from 0 and 1 ;
d.
Figure imgf000016_0003
wherein R is selected from NH2, -NH(Ci-C3)-alkyl and
Figure imgf000016_0004
, wherein each of R4 , R5 , R6 and R7 is as described previously,
s is selected from 0 and 1, and,
v is selected from 0, 1, 2, and 3;
Figure imgf000016_0005
wherein R is selected from NH2 and . w..1here :in eac 1h o rf n R4 R5*, R6*and R7* is as described previously,
R17 is selected from amino and hydroxyl, and
w is selected from 0 and 1 ;
Figure imgf000017_0001
wherein M is selected from NR19, CR20R21 and O,
wherein R19 is selected from H and
Figure imgf000017_0002
, where each of R12, R13 and R14 is as described previously,
each of R20 and R21 is independently selected from H, N¾ and
Figure imgf000017_0003
, wherein each of R4*, R5*, R6 *and R7 is as described previously, and
0, 1 and 2; and
Figure imgf000017_0004
In one aspect of the invention R1* is selected from
Figure imgf000017_0005
Figure imgf000018_0001
In one embodiment of the invention, the compounds of the invention are of the stereochemistry disclosed in Formula A-II.
Figure imgf000018_0002
In another embodiment of the invention, R* and R1* are chosen from the substituents listed in Table I (See Figure I). Preferred compounds of Formula A-I are
Figure imgf000018_0003
It will be understood by one of skill in the art that depending on the nature of R1* and R*, compounds of Formula I may exist in a salt or zwitterionic form.
Enzyme Inhibition and Binding Affinity
The compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are effective in inhibiting β-lactamase. In one aspect of the invention the compounds of Table I are effective β-lactamase inhibitors. In one aspect the compound
Figure imgf000019_0001
is effective in inhibiting β-lactamase. In one aspect the compound
Figure imgf000019_0002
is effective in inhibiting β-lactamase
When used in combination with β-lactam antibiotics, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate the activity of the β-lactam antibiotic against microorganisms that are normally resistant to β-lactam antibiotics due to the presence of a β- lactamase or multiple β-lactamases.
In one aspect of the invention the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula I, inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula A- I inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula II inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula A-II inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Table I inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compound of Formula
Figure imgf000020_0001
inhibits β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compound of Formula
Figure imgf000020_0002
inhibits β-lactamases selected from class A, class C or class D β-lactamases. Class A β- lactamases for example, include, but are not limited to, TEM, SHV, CTX-M, KPC, GES, VEB, SME, and GEX. In a preferred aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula I inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-I inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula II inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-II inhibit KPC β-lactamases. More preferably the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC- 3 β-lactamases. More preferably the compounds of Formula I inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula A-I inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula II inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula A-II inhibit KPC-2 or KPC-3 β- lactamases. In one aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II). In one aspect of the invention, the compounds of Formula I inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II). In one aspect of the invention, the compounds of Formula A-I inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II). In one aspect of the invention, the compounds of Formula II inhibit KPC-2 or KPC-3 β- lactamases in clinical strains (Figure 2, Table II). In one aspect of the invention, the compounds of Formula A-II inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II). Class C β-lactamases for example, include, but are not limited to chromosomal AmpCs, and plasmid based ACC, DHA, CMY, FOX, ACT, MIR, LAT, MOX β-lactamases. Class D β-lactamase enzymes, for example, include, but are not limited to oxacillinases or OXA β-lactamases. In a preferred aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit OXA-15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula I inhibit OXA-15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-I inhibit OXA-15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula II inhibit OXA-15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-II inhibit OXA- 15 β- lactamases.
Unless otherwise indicated, the activity of the BLI compounds can be described by the MIC value obtained from a Synergy MIC assay or a BLI potentiation assay (e.g as described herein), both of which are run in the presence of a β-lactam. The lower the sMIC or MIC value the more active the BLI, regardless of the mechanism of action of the BLI compound (e.g., including inhibition of β-lactamases by the BLI or any other mechanism of action or combination of mechanisms of action). The sMIC and BLI potentiation assay data supports that the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate (i.e. make more potent) the activity of the β-lactam antibiotic against β-lactamase producing strains by inhibiting the β-lactamase.
In one embodiment, the BLI activity is measured by growth inhibition of a β- lactamase producing bacterial strains in a Synergy MIC (sMIC) assay. Preferably, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of
Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 μg/mL or less. In a more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 4 μg/mL to 8 μg/mL. In an even more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) is 1 to 2 μg/mL. In a still more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 0.2 to 0.5 μg/mL. Synergy MICs for
representative compounds of the invention are described in Table III (See Figure 3). It will be understood by one of skill in the art that the growth inhibition of β-lactamase producing strains can also be measured by a checkerboard synergy assay like that disclosed in
International Patent Application Number WO 2008/039420 or a standard BLI potentiation assay using a fixed concentration of BLI.
In one embodiment, the BLI activity is measured by growth inhibition of a β- lactamase producing bacterial strains in a standard BLI potentiation assay using a fixed concentration of BLI. Preferably, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 μg/mL or less. In a more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 4 to 8 μg/mL. In an even more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 1 to 2 μg/mL. In a still more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 0.2 μg/mL to 0.5 μg/mL.
The compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a broad spectrum of activity across a wide variety of β-lactamase producing bacteria. It was surprisingly found that the compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are active in potentiating activity of β-lactam antibiotics, in particular, Ceftolozane, against strains expressing class D β-lactamase OXA-15 β-lactamase. Currently marketed BLIs inhibit most of the class A β-lactamases, but poorly inhibit class A KPC β-lactamases and class C β- lactamases and have variable success in inhibiting penicillinase and carbapenemase-type class D β-lactamases. The compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are active against a wide variety of bacterial strains that express class A and C β-lactamases and also, surprisingly are active against bacterial strains that express the class D cephalosporinase OXA-15 (Tables II and III). This increased activity against the class D β-lactamase is critical because differential effectiveness against different types of β-lactamase producing bacteria is necessary in order to effectively use β-lactam antibiotics to treat resistant strains of bacteria (vide infra).
In one embodiment, the compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) are unexpectedly more active against bacterial strains that express OXA-15 β-lactamases than the most structurally similar compound, Avibactam (comparator compound CCC). Compounds that are more active than Avibactam against bacterial strains that express the class D cephalosporinase OXA-15 are, for example, compounds 603, 604, 611, 614, 618.
In one embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) are unexpectedly more active against and/or show broader spectrum of activity against bacterial strains that express KPC β-lactamases than the most structurally similar compound,
Avibactam. Compounds that are more active than Avibactam for at least one, bacterial strain that expresses KPC β-lactamase and/or show a better spectrum of activity against bacterial strains that express KPC β-lactamases than Avibactam are, for example, compounds 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 620, 621, 622, 623, 624, 625, 626, and 627.
In another aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have high binding affinity for the β-lactamase enzyme. Consequently these compounds are better inhibitors of the β-lactamase enzyme. The inhibition kinetics of the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) was measured according to the procedure outlined in Example 37. The compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a high binding affinity for the β-lactamase enzyme.
In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a binding affinity of 1000-5000 mM'V1. Compounds that have a binding affinity of 1000- 5000 mM'V1 are, for example, compound 604 and 608 (Table IV).
In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have a binding affinity of 100-999 mM'V1. Compounds that have a binding affinity of 100-999 rnM'V1 are, for example, compounds 601, 603, 605, 606, 607, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, and 627 (Table IV).
In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have a binding affinity of 1-99 mM'V1. Compounds that have a binding affinity of 1-99 mM'V1 are, for example, 602 (Table IV).
It was surprisingly found that the compounds of the present invention have a higher binding affinity for the β-lactamase enzyme than the closest structural comparator Avibactam (Table IV, See Figure 4).
The compounds of the invention were also shown to be better BLIs than other comparator compounds as shown in Figure 5.
Pharmaceutical Compositions Comprising the Compounds of The Invention and Use Thereof Another object of the invention is pharmaceutical compositions or formulations comprising compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is
pharmaceutical compositions or formulations comprising compounds of Formula I, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula A-I, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula II, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula A-II, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Table I. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula
Figure imgf000025_0001
or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula
Figure imgf000025_0002
or salts thereof, preferably further comprising a β-lactam antibiotic.
The pharmaceutical compositions can be formulated for oral, intravenous, intramuscular, subcutaneous or parenteral administration for the therapeutic or prophylactic treatment of diseases, such as bacterial infections. Preferably, the pharmaceutical composition is formulated for intravenous administration.
The pharmaceutical preparations disclosed herein may be prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent or eliminate infection (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing
Company, Easton, PA and Goodman and Oilman's "The Pharmaceutical Basis of
Therapeutics," Pergamon Press, New York, NY, the contents of which are incorporated herein by reference, for a general description of the methods for administering various antimicrobial agents for human therapy).
The pharmaceutical compositions can comprise one or more of the compounds disclosed herein (e.g. one or more compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula
A-I or Formula A-II, in conjunction with a β-lactam antibiotic, in association with one or more nontoxic, pharmaceutically-acceptable carriers and/or diluents and/or adjuvants and/or excipients. As used herein, the phrase "pharmaceutically-acceptable carrier" refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical
administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Non-limiting examples of carriers and excipients include corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid. The compositions may contain croscarmellose sodium, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid.
Tablet binders that can be included are acacia, methylcellulose, sodium
carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropyl methylcellulose, sucrose, starch and ethylcellulose.
Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.
Flavoring agents such as peppermint, oil of wintergreen, cherry flavoring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product.
For oral or parenteral administration, compounds of the present invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) preferably a compound of Formula A-I or Formula A-II, in conjunction with a β-lactam antibiotic, can be mixed with conventional pharmaceutical carriers and excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, wafers and the like. The compositions comprising a compound of this invention may contain from about 0.1% to about 99% by weight of the active compound, such as from about 10% to about 30%.
For oral use, solid formulations such as tablets and capsules are useful. Sustained release or enterically coated preparations may also be devised. For pediatric and geriatric applications, one embodiment provides suspensions, syrups and chewable tablets. For oral administration, the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid.
The pharmaceutical compositions may be made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient. Examples of such dosage units are tablets and capsules. For therapeutic purposes, the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose;
lubricants, for example, magnesium stearate, polyethylene glycol, silica, or talc; disintegrants, for example, potato starch, flavoring or coloring agents, or acceptable wetting agents. Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs, preparations of the invention may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents. Non-limiting examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl
para-hydroxybenzoate, propylene glycol, sorbitol, or sorbic acid.
For intravenous (IV) use, the pharmaceutical composition (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) preferably a compound of Formula A-I or Formula A-II, in conjunction with a β-lactam antibiotic, can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Intravenous fluids include, without limitation, physiological saline or Ringer's solution. Intravenous administration may be accomplished by using, without limitation, syringe, mini-pump or intravenous line.
Pharmaceutical compositions of this invention ( e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) preferably a compound of Formula A-I or Formula A-II, for parenteral injection comprise pharmaceutically-acceptable aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The compositions can include various buffers.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. They may also contain taggants or other anti-counterfeiting agents, which are well known in the art. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, and phenol sorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
Injectable depot forms can be made by forming microencapsulating matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly( anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. Such forms may include forms that dissolve or disintegrate quickly in the oral environment. In such solid dosage forms, the active compound preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be mixed with at least one inert, pharmaceutically-acceptable excipient or carrier. Suitable excipients include, for example, (a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders such as cellulose and cellulose derivatives (such as
hydroxypropylmethylcellulose, hydroxypropylcellulose, and carboxymethylcellulose), alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants such as glycerol; (d) disintegrating agents such as sodium starch glycolate, croscarmellose, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (e) solution retarding agents such as paraffin; (f) absorption accelerators such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate, fatty acid esters of sorbitan, poloxamers, and polyethylene glycols; (h) absorbents such as kaolin and bentonite clay; (i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (j) glidants such as talc, and silicone dioxide. Other suitable excipients include, for example, sodium citrate or dicalcium phosphate. The dosage forms may also comprise buffering agents. Solid dosage forms, including those of tablets, dragees, capsules, pills, and granules, can be prepared with coatings and shells such as functional and aesthetic enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and colorants. They may also be in a form capable of controlled or sustained release. Examples of embedding compositions that can be used for such purposes include polymeric substances and waxes.
The pharmaceutical compositions can be delivered using controlled (e.g., capsules) or sustained release (e.g., bioerodable matrices) delivery systems. Exemplary delayed release delivery systems for drug delivery that are suitable for administering the pharmaceutical compositions are described in U.S. Patent Nos. 4,452,775 (issued to Kent), 5,039,660 (issued to Leonard), and 3,854,480 (issued to Zaffaroni).
In some cases, in order to prolong the effect of the drug, it may be desirable to slow the absorption of the drug following subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. Amorphous material may be used alone or together with stabilizers as necessary. The rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle.
For intramuscular preparations, a sterile formulation of compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or suitable soluble salt forms thereof, for example hydrochloride salts, can be dissolved and administered in a pharmaceutical diluent such as Water- for- Injection (WFI), physiological saline or 5% glucose. A suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g., an ester of a long chain fatty acid such as ethyl oleate.
A dose of an intravenous, intramuscular, or parental formulation of compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered as a bolus or by slow infusion. A bolus is a dose that is administered in less than 30 minutes. In one embodiment, a bolus is administered in less than 15 or less than 10 minutes. In another embodiment, a bolus is administered in less than 5 minutes. In yet another embodiment, a bolus is administered in one minute or less. An infusion is a dose that is administered at a rate of 30 minutes or greater. In one embodiment, the infusion is one hour or greater. In another embodiment, the infusion is substantially constant.
For topical use the pharmaceutical compositions, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints. Such topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
For application to the eyes or ears, the pharmaceutical composition can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
For rectal administration, the pharmaceutical compositions, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, polyethylene glycol or a suppository wax or other glyceride that are solid at room
temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.
Alternatively, the pharmaceutical compositions can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery. In another embodiment, the unit dosage form of compounds, preferably a compound of
Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be a solution of one or more compounds, or salts thereof, in a suitable diluent, in sterile hermetically sealed ampoules or sterile syringes. The concentration of the compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, in the unit dosage may vary, e.g. from about 1 percent to about 50 percent, depending on the compound used and its solubility and the dose desired by the physician. If the compositions contain dosage units, each dosage unit can contain from 1-500 mg of the active material. For adult human treatment, the dosage employed can range from 5 mg to 10 g, per day, depending on the route and frequency of administration.
The pharmaceutical compositions disclosed herein can be placed in a
pharmaceutically acceptable carrier and are delivered to a recipient subject (e.g., a human) in accordance with known methods of drug delivery. In general, the methods of delivering the pharmaceutical compositions in vivo utilize art-recognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention for the drugs in the art-recognized protocols. Likewise, methods for using the claimed compositions for treating cells in culture, for example, to eliminate or reduce the level of bacterial contamination of a cell culture, utilize art-recognized protocols for treating cell cultures with antibacterial agent(s) with the only substantial procedural modification being the substitution of the compounds of the present invention, preferably in combination with a β-lactam antibiotic for the drugs in the art-recognized protocols.
Exemplary procedures for delivering an antibacterial agent are described in U.S. Patent Nos. 6,468,967; 6,852,689; and 5,041,567, issued to Rogers and in PCT patent application number EP94/02552 (publication no. WO 95/05384), the disclosures of which are incorporated herein by reference in their entirety. In one embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous). In another embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous) to treat an infection caused by β-lactam resistant bacteria. In another embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally to treat an infection caused by β-lactamase producing bacteria.
As used herein, the phrases "therapeutically-effective dose" and "therapeutically- effective amount" refer to an amount of a compound that prevents the onset, alleviates the symptoms, stops the progression of a bacterial infection, or results in another desired biological outcome such as, e.g., improved clinical signs or reduced/elevated levels of lymphocytes and/or antibodies.
The term "treating" or "treatment" is defined as administering, to a subject, a therapeutically-effective amount of one or more compounds both to prevent the occurrence of an infection and to control or eliminate an infection. Those in need of treatment may include individuals already having a particular medical disease as well as those at risk for the disease (i.e., those who are likely to ultimately acquire the disorder). The term "subject," as used herein, refers to a mammal, a plant, a lower animal, or a cell culture. In one embodiment, a subject is a human or other animal patient in need of antibacterial treatment.
The term "administering "or "administration" and the like, refers to providing the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) to the subject in need of treatment. Preferably the subject is a mammal, more preferably a human. The present invention comprises administering the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a β-lactam antiobiotic. When a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a β-lactam antiobiotic, the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antiobiotic can be administered at the same time or different times. When the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antiobiotic are administered at the same time, they can be administered as a single composition or pharmaceutical composition or they can be administered separately. It is understood that when a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a β-lactam antibiotic, that the active agents can be administered in a single combination or in multiple combinations. For example, when administered by IV, the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Conversely the β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a compound of Formula I can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Alternatively, a pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) and a β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula I, and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-I, and a β- lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula II, and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-II, and a β-lactam antibiotic.
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula A-I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula II. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula A-II. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Table I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formul
Figure imgf000034_0001
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of Formula
Figure imgf000034_0002
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection in a subject comprising the steps of
a. administering to the subject a compound of the invention; and
b. administering to the subject a therapeutically-effective amount of a β-lactam
antibiotic.
In one embodiment the compound in step a is a compound of Formula I. In one embodiment the compound in step a is a compound of Formula A-I. In one embodiment the compound in step a is a compound of Formula II. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Table I. In one embodiment the compound in step a is a compound of Formula A-II. In one mpound of Formula
is a compound of Formula
Figure imgf000035_0001
In one embodiment, the β-lactam antibiotic in step b is Ceftolozane or Ceftazidime. In one a compound of Formula
Figure imgf000035_0002
and the β-lactam antibiotic in step b is Ceftolozane. In one embodiment the compound in step a is a compound of Formula
Figure imgf000036_0001
and the β-lactam antibiotic in step b is Ceftolozane.
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection in a subject comprising the steps of
a. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic; and
b. administering to the subject a compound of the invention .
In one embodiment the compound in step b is a compound of Formula I. In one embodiment the compound in step b is a compound of Formula A-I. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Formula A- II. In one embodiment the compound in step b is a compound of in step b is a compound of Formula
is a compound of Formula
Figure imgf000036_0002
In one embodiment, the β-lactam antibiotic in step a is Ceftolozane or Ceftazidime. In one a compound of Formula
Figure imgf000037_0001
and the β-lactam antibiotic in step a is Ceftolozane. In one embodiment the compound in step a is b compound of Formula
Figure imgf000037_0002
and the β-lactam antibiotic in step a is Ceftolozane. In one embodiment, the invention provides a method for treating an infection in a subject by administering a therapeutically- effective amount of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β -lactam antibiotic, or compositions thereof. In one embodiment, the method comprises administering to a subject in need thereof a pharmaceutical composition comprising at least one of the compounds described herein, preferably a compound of Formula A-I or Formula A-II in conjunction with a β -lactam antibiotic. In one embodiment the compound is of Formula
Figure imgf000037_0003
in conjunction with a β -lactam antibiotic, preferably Ceftoloz In one embodiment the compound is of
Formula
Figure imgf000038_0001
in conjunction with a β -lactam antibiotic, preferably Ceftolozane or Ceftazidime, or compositions thereof. In one embodiment, the pharmaceutical composition can comprise any one of the compounds described herein as the sole active compound or in combination with another compound, composition, or biological material. The compound may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally, vaginally, or by an implanted reservoir, external pump or catheter. The compound may be prepared for opthalmic or aerosolized uses. The compounds of the present invention can be administered as an aerosol for the treatment of pneumonia or other lung-based infections. In one embodiment, the aerosol delivery vehicle is an anhydrous or dry powder inhaler. One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β -lactam antibiotic, or pharmaceutical compositions thereof also may be directly injected or administered into an abscess, ventricle or joint. Parenteral administration includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, cisternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β -lactam antibiotic, are administered intravenously, subcutaneously or orally. In one embodiment for administering one or more compounds according to the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β -lactam antibiotic to a cell culture, the one or more compounds may be administered in a nutrient medium. In one embodiment, one or more compounds according to the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or A-II in conjunction with a β- lactam antibiotic, may be used to treat a subject having a bacterial infection in which the infection is caused or exacerbated by any type of bacteria, such as Gram-negative bacteria. In one aspect of the invention, the bacterial infection is caused by β-lactam resistant bacteria. In one aspect the bacterial infection is caused by β-lactamase producing bacteria. In another aspect the bacterial infection is caused by class A, class C or class D β-lactamase producing bacteria. In another aspect the bacterial infection is caused by class A β-lactamase producing bacteria. In another aspect the infection is caused by class C β-lactamase producing bacteria. In still another aspect the infection is caused by class D β-lactamase producing bacteria. In still another aspect the infection is caused by KPC β-lactamase producing bacteria. In still another aspect the infection is caused by OXA β-lactamase producing bacteria. In still another aspect, the bacterial infection is caused by a bacteria that produces multiple β- lactamases. Bacteria that produce multiple β-lactamases may produce β-lactamases of the same class or of different classes (e.g class A and class A or class A and class C or class A and class D etc).
Representative Gram-negative pathogens known to express β-lactamases include, but are not limited to Acinetobacter spp. (including Acinetobacter baumannii), Citrobacter spp., Escherichia spp. (including Escherichia coli), Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp. (including Klebsiella pneumoniae), Enterobacter spp. (including Enterobacter cloacae and Enterobacter aerogenes), Pasteurella spp., Proteus spp. (including Proteus mirabilis), Serratia spp. (including Serratia marcescens), and Providencia spp. Bacterial infections can be caused or exacerbated by Gram-negative bacteria including strains which express β-lactamases that may confer resistance to penicillins, cephalosporins, monobactams and/or carbapenems. The coadministration of a novel BLI that inhibits these β-lactamases with a β-lactam antibiotic could be used to treat infections caused by β-lactam resistant bacteria.
In one aspect of the invention the infection is caused by a β-lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae), Haemophilus influenzae, Pseudomonas aeruginosa, Proteus mirabilis, Serratia marcescens, and Klebsiella pneumoniae, β-Lactam antibiotics that may be administered concurrently with compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) include, but are not limited to cephalosporin, carbapenem, monobactam, penem and penicillin classes of antibiotics.
In one embodiment of the invention, the β-lactam antibiotic is a cephalosporin.
Examples of cephalosporins include, but are not limited to, Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl), Cef alexin (cephalexin), Cefaloglycin (cephaloglycin), Cefalonium (cephalonium), Cefaloridine (cephaloradine), Cefalotin (cephalothin), Cefapirin (cephapirin), Cefatrizine,Cefazaflur, Cefazedone, Cefazolin (cephazolin), Cefradine (cephradine), Cefroxadine, Ceftezole, Cefaclor, Cefamandole, Cefmetazole, Cefonicid, Cefotetan,
Cefoxitin, Cefprozil (cefproxil), Cefuroxime, Cefuzonam, Cefcapene, Cefdaloxime, Cefdinir, Cefditoren, Cefetamet, Cefixime, Cefmenoxime, Cefodizime, Cefotaxime, Cefpimizole, Cefpodoxime, Cefteram, Ceftibuten, Ceftiofur, Ceftiolene, Ceftizoxime, Ceftriaxone, Cefoperazone, Ceftazidime, Cefclidine, Cefepime, Cefluprenam, Cefoselis, Cefozopran, Cefpirome, Cefquinome, Cefaclomezine, Cefaloram, Cefaparole, Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril, Cefmatilen, Cefmepidium, Cefovecin, Cefoxazole, Cefrotil, Cefsumide, Ceftaroline, Ceftioxide, Cefuracetime, cefbuperazone, cefminox, ceforanide, cefotiam, cefpiramide, cefsulodin, ceftobiprole latamoxef, loracarbef and Ceftolozane. In one embodiment the cephalosporin is Ceftolozane or Ceftazidime.
In one embodiment of the invention, the β-lactam antibiotic is a carbapenen.
Examples of carbapenem antibiotics include, but are not limited to, Imipenem,
Imipenem/Cilastatin, Biapenem, Doripenem, Meropenem, Ertapenem and Panipenem. In one embodiment the Carbapenem is Imipenem/Cilastatin or Meropenem.
In one embodiment of the invention, the β-lactam antibiotic is a monobactam.
Examples of monobactam antibiotics include, but are not limited to Aztreonam, Tigemonam, Carumonam, BAL30072 and Nocardicin A.
In one embodiment of the invention, the β-lactam antibiotic is a penem. In one embodiment of the invention, the β -lactam antibiotic is a penicillin. Examples of penicillin antibiotics include, but are not limited to Amoxicillin, Ampicillin, Azlocillin, Mezlocillin, Apalcillin, Hetacillin, Becampicillin, Carbenicillin, Sulbenicillin, Ticarcillin, Piperacillin, Azlocillin, Mecillinam, Pivmecillinam, Methicillin, Ciclacillin, Talampicillin, Aspoxicillin, Oxacillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Nafcillin and Pivampicillin. The pharmaceutical compositions, preferably a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a β-lactam antibiotic, can be used to treat a bacterial infection of any organ or tissue in the body caused by β-lactam resistant bacteria, preferably, Gram-negative β-lactam resistant bacteria. These organs or tissue include, without limitation, skeletal muscle, skin, bloodstream, kidneys, heart, lung and bone. For example, a pharmaceutical composition comprising at least one compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered to a subject to treat, without limitation, skin and soft tissue infections (e.g., complex skin infections), bacteremia, intra-abdominal infections and urinary tract infections (e.g., cUTI). In addition, a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) may be used to treat community acquired respiratory infections, including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa . At least one compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered to a subject to treat mixed infections that comprise different types of Gram-negative bacteria, or which comprise both Gram-positive and Gram-negative bacteria. These types of infections include intra-abdominal infections and
obstetrical/gynecological infections. At least one compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may also be administered to a subject to treat an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis. At least one compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof, may also be directly injected or administered into an abscess, ventricle or joint. Pharmaceutical compositions of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered as an aerosol for the treatment of pneumonia or other lung-based infections. In one embodiment, the aerosol delivery vehicle is an anhydrous, liquid or dry powder inhaler.
Actual dosage levels of active ingredients in the pharmaceutical compositions of one or more compounds according to the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be varied so as to obtain a therapeutically-effective amount of the active compound(s) to achieve the desired therapeutic response for a particular patient, compositions, and mode of administration. The effective amount can be determined as described herein. The selected dosage level will depend upon the activity of the particular compound, the route of administration, the severity of the condition being treated, and the condition and prior medical history of the patient being treated. However, it is within the skill of the art to start doses of the compound at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. In one embodiment, the data obtained from the assays can be used in formulating a range of dosage for use in humans. It will be understood by one of skill in the art that the when the composition comprises a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a β-lactam antibiotic, both the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antibiotic are active compounds.
The method comprises administering to the subject an effective dose of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably in conjunction with a β lactam antibiotic. An effective dose of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) is generally between 125 mg/day to 2000 mg/day. In one embodiment, an effective dose is from about 0.1 to about 100 mg/kg of one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In one embodiment, the dose is from about 0.1 to about 50 mg/kg of one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In another embodiment, the dose is from about 1 to about 25 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In another embodiment, the dose is from about 1 to about 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In another embodiment, the dose is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 100 mg to 1000 mg per dose up to four times per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 125 mg to 750 mg per dose up to four times per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 250 mg to 500 mg per dose up to four times a day. An effective dose for cell culture is usually between about 0.1 and about 1000 μg/mL. In one embodiment, the effect dose for cell culture is between about 0.1 and about 200 μg/mL.
In one embodiment, a β-lactam antibiotic and a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered in ratio of 1:4 to 8:1 antibiotic: compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In one embodiment the ratio is 1 :4. In another embodiment the ratio is 3:4. In another embodiment the ratio is 5:4. In another embodiment the ratio is 7:4. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:3. In another embodiment the ratio is 2:3. In another embodiment the ratio is 4:3. In another embodiment the ratio is 5:3. In another embodiment the ratio is 7:3. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:1. In another embodiment the ratio is 2:1. In another embodiment the ratio is 3:1. In another embodiment the ratio is 4:1. In another embodiment the ratio is 5:1. In another embodiment the ratio is 6:1. In another embodiment the ratio is 7:1. In another embodiment the ratio is 8:1. It will be understood by one of skill in the art that the β- lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided regardless of the method of drug delivery. It will also be understood by one of skill in the art that the β-lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided together, for example, in a pharmaceutical composition, or sequentially, i.e. the β-lactam antibiotic is administered, followed by administration of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or vice versa.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) may also be administered in the diet or feed of a patient or animal. If administered as part of a total dietary intake, the amount of compound employed can be less than 1% by weight of the diet, such as no more than 0.5% by weight. The diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered as a single daily dose or in multiple doses per day. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, is administered as a single dose per day. In another embodiment, one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I of Formula A-II in conjunction with a β-lactam antibiotic is administered as two equal doses per day. In another
embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic is administered in three equal doses per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic is administered in four equal doses per day. The treatment regime may require administration over extended periods of time, e.g., for several days or for from two to four weeks. The amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the infection, the age and general health of the patient, the tolerance of the patient to the compound of the invention and the β-lactam antibiotic and the microorganism or microorganisms involved in the infection. The treatment regimen for one type of infection may differ greatly from the treatment regimen of another infection. For example, one type of infection may require administration via intravenous administration once daily, while another infection may require a treatment regimen of multiple dosing orally.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered according to this method until the bacterial infection is eradicated or reduced. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for a period of time from 3 days to 6 months. In another embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 56 days. In another embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 28 days. In a further embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 14 days. Compounds of the present invention may be administered for a longer or shorter time period if it is so desired. Other embodiments of the invention include:
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 β- lactam antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 cephalosporin antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and Ceftolozane or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 carbapenem antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 monobactam antibiotic or a pharmaceutically acceptable salt thereof.
The embodiments described herein provide compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II that are novel and active β-lactamase inhibitors. Other embodiments described herein provide novel compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with β-lactam antibiotics for treatment of infections. Further embodiments described herein provide novel compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II that show unexpected activity against β-lactamases that other compounds in the class do not have.
Preparation of Compounds of the Invention A compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be prepared by a variety of synthetic routes, including synthetic schemes described herein. These synthetic routes can be applied to large scale synthesis with appropriate adjustment of reaction sequence, reaction conditions, isolation/purification methods and choice of solvents which are environmentally friendly and cost-effective.
The following abbreviations have the following meanings unless otherwise indicated. Abbreviations not defined below have their generally accepted meaning.
Bn = benzyl
Boc = ieri-butoxycarbonyl
Boc20 = di-ieri-butyldicarbonate
Burgess reagent = methyl N-triethylammoniumsulfonyl)carbamate
CDI = carbonyldiimidazole
CFU = colony- forming units
CLSI = Clinical Laboratory Standards Institute cSSSI = complicated skin and skin structure infections
DBU = 1 ,8-diazabicyclo[5.4.0]undec-7-ene
DCM = dichloromethane
DEAD = diethyl azodicarboxylate
DIAD = diisopropyl azodicarboxylate
DIPEA = diisopropylethylamine
DMF = Ν,Ν-dimethylformamide
DMAc = Ν,Ν-dimethylacetamide
DMSO = dimethyl sulfoxide
EDCI l-ethyl-3-(3'- dimethylaminopropyl)carbodiimide
ELSD evaporative light scattering detector
EtOAc ethyl acetate
ESI-MS electrospray ionization mass spectrometry
Fmoc Fluorenylmethyloxycarbonyl
HAP Hospital- Acquired Pneumonia
HATU 2- (7 - aza- 1 H-benzotriazole- 1 - yl) - 1 , 1 ,3 , 3 - tetramethyluronium hexafluoropho sphate
HC1 hydrochloride 1 -hydroxybenzotrizole
hours
high performance liquid chromatography N,N-Diisopropylethylamine
2,4-bis(4-methoxyphenyl)- 1 ,3 ,2,4- dithiadiphosphetane-2,4-disulfide
minimum inhibitory concentration
milliliter
mass spectrometry
methicillin-resistant Staphylococcus aureus nuclear magnetic resonance
nitrobenzenesulfonyl
Pseudomonas aeruginosa
preparative
parts per million
pyridine
saturated
room temperature
tetrabutylammonium fluride
t-butyldimethylsilyl
triethylsilyl
triethylamine
2,2,6,6-tetramethyl- 1 -piperidinyloxy, free radical
tetrahydrofuran
trifluoroacetic acid
trimethylsilyl
thin layer chromatography
Ventilator- Associated Pneumonia
The compounds of Formula (I) can be prepared from intermediate 1, according to the following reaction schemes and examples, or modifications thereof, using readily available starting materials, reagents and conventional synthetic procedures including, for example, procedures described in US7112592 and WO2009/091856. Compound 3 can be synthesized following standard isoxazole ring formation chemistry from the chlorooxime intermediate 2d , which can be prepared from ester intermediate 1 (see, e.g., Abele, E.; Lukevics, E.
Heterocycles 2000, 53, 2285-2336; Barr, L. ; Lincoln, S. F. ; Easton, C. J. Chemistry-A European Journal 2006, 12, 8571-8580; Walker, D. G.; Brodfuehrer, P. R.; Brundidge, S. P. Shih, K. M.; Sapino, C. Jr. /. Org. Chem. 1988, 53, 983-991 and references cited therein).
It may be necessary to protect certain functionalities in the molecule depending on the nature of the R1 group. Protecting these functionalities should be within the expertise of one skilled in the art. See, e.g P. G. M. Wuts and T. W. Greene, Protective Groups in Organic Synthesis, Fourth Edition, John Wiley and Sons, 2006, hereafter Greene.
Scheme 1
Figure imgf000049_0001
2b 2c 2d
DCM, DIPEA or
protecting gr
deprotection if n
Figure imgf000049_0002
6
The benzylic ether protecting group in 3 can be removed via standard hydrogenolysis conditions, such as, but not limited to, Pd/H2 in MeOH or THF or by acid-catalysed hydrolysis, such as, but not limited to, BCI3 in DCM to provide the hydroxy-urea intermediate 4, which can be used directly in the next step without further purification. Sulfation of 4 can be achieved by treatment with a sulfating reagent, such a, but not limited to, SC .pyridine complex, in an appropriate solvent, such as pyridine, DMF or DMAc at a temperature of 0-80 °C, preferable at room temperature. Compound 5 can then be isolated and purified via conventional methods. For example, 5 can be purified by standard reverse phase prep-HPLC using an appropriate buffer system, i.e. ammonium formate buffer. In some cases, 5 can be purified by normal phase silica gel chromatography after converting to an appropriate salt form, such as sulfate tetrabutyl ammonium salt. The tetrabutyl ammonium salt can then be converted to a sodium salt by cation exchange. When a protecting group(s) is present in the sidechain (i.e. Boc or Fmoc for amine and guanidine protection, TBS or TES for alcohol protection, etc), a deprotection step is needed to convert 5 to its final product 6, which can be purified by reverse phase prep-HPLC using the conditions mentioned above. For example, for N-Boc deprotection, 5 can be treated with an acid, such as TFA, in an appropriate solvent, such as DCM at a temperature of 0-30 °C, preferable at 0 °C to rt to give 6. For an O-TBS, or O-TES deprotection, a fluoride reagent such as
HF.pyridine, HF.NEt3, or TBAF can be used. For Fmoc deprotection, amines, such as diethylamine, DBU, piperidine, etc can be used.
EXAMPLES
The specific examples which follow illustrate the synthesis of certain compounds. The methods disclosed may be adopted to variations in order to produce compounds of Formula (I), but not otherwise specifically disclosed. Further, the disclosure includes variations of the methods described herein to produce the compounds of Formula (I) that would be understood by one skilled in the art based on the instant disclosure.
All temperatures are understood to be in Centigrade (C) when not specified. The nuclear magnetic resonance (NMR) spectral characteristics refer to chemical shifts (γ) expressed in parts per million (ppm) versus tetramethylsilane (TMS) as reference standard. The relative area reported for the various shifts in the proton NMR spectral data corresponds to the number of hydrogen atoms of a particular functional type in the molecule. The nature of the shifts as to multiplicity is reported as broad singlet (br s), broad doublet (br d), singlet (s), multiplet (m), doublet (d), quartet (q), doublet of doublet (dd), doublet of triplet (dt), and doublet of quartet (dq). The solvents employed for taking NMR spectra are DMSO-d6 (perdeuterodimethysulfoxide), D20 (deuterated water), CDCI3 (deuterochloroform) and other conventional deuterated solvents. The prep-HPLC conditions are: Waters SunFire® C18 (30x100 mm, 5 μιη OBD) column; flow rate: 30-80 mL/minute, ELSD or Mass-triggered fraction collection; sample loading: Each injection loading varied from 30 -300 mg for different crude samples depending on their solubility and purity profiles; Solvent system using ammonium formate buffer: solvent A: water with 20 mM ammonium formate, solvent B: 85% of acetonitrile in water with 20 mM ammonium formate. Solvent system using NH4HCO3 buffer: solvent A: water with 10 mM NH4HCO3, solvent B: acetonitrile. Solvent system using NH4OH buffer: solvent A: water with 0.1% NH4OH, solvent B: acetonitrile with 0.1% NH4OH.
Example 1: Synthesis of (2S,5R)-ethyl 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 loctane-2- carbox late (Intermediate Compound 1 )
Figure imgf000051_0001
1
Step 1: Synthesis of (S)-l-tert-butyl 2-ethyl 5-oxopiperidine-l ,2 -dicarboxylate
Method A:
Boc Boc O Boc O
~ .N TMSCHN2 N^ HI!L ,JL R 2(OAc)4 A OEt
~ ubt o "^ J
n-BuLi (600 mL, 1.5 mol) was added dropwise to a solution of TMSCHN2 (690 mL, 1.38 mol ) in dry THF (3 L) at -78 °C, and the mixture was stirred at -78 °C for 30 minutes. The mixture was then transferred to a solution of (5')-l-ieri-butyl 2-ethyl 5-oxopyrrolidine-l ,2- dicarboxylate (300 g, 1.17 mol) in dry THF (3 L) via cannula, and the mixture was stirred at - 78 °C for 30 minutes. The reaction mixture was then quenched with sat. NH4CI solution, and extracted with DCM (3x). The combined organic layer was concentrated under reduced pressure and the crude product was purified by silica gel column chromatography (3 : 1 petroleum ether/EtOAc ) to afford (5')-ethyl 2-((ieri-butoxycarbonyl)amino)-6-diazo-5- oxohexanoate (262 g, 75 %) as a yellow solid.
A solution of (S^-ethyl 2-((ieri-butoxycarbonyl)amino)-6-diazo-5-oxohexanoate (350 g, 1.18 mol ) in DCM (1500 mL) was added to a 0 °C solution of Rh2(OAc)4 (3.5 g, 7.9 mmol ) in DCM (750 mL). The reaction mixture was then stirred at 20 °C overnight and then concentrated under reduced pressure. The crude sample was purified by silica gel column chromatography (5:1 petroleum ether/EtOAc) to afford (5')-l-ieri-butyl 2-ethyl 5- oxopiperidine- 1 ,2-dicarboxylate (175.9 g, 55%) as a yellow oil.
Method B:
Figure imgf000052_0001
DMSO
i-BuOK (330 g, 2.9 mol) was added to a solution of trimethylsulfoxonium iodide (750 g, 3.5mol) in dry DMSO (3 L) and the mixture was stirred at rt for 1 h. (S)-l-tert- Butyl 2-ethyl 5-oxopyrrolidine-l,2-dicarboxylate (900 g, 3.5 mol) was added and the mixture was stirred at rt for 2-3 hrs. Water was added to quench the reaction and the mixture was extracted with EtOAc (5x). The combined organic layer was concentrated under reduced pressure and the crude sample was purified by silica gel column chromatography (1 :1 petroleum ether/EtOAc then 1 :10 MeOH/DCM) to afford sulfoxonium ylide intermediate (977 g, 80%) as a white solid.
A solution of sulfoxonium ylide intermediate (156 g, 0.446 mol) and [Ir(COD)Cl]2 (3 g, 4.46 mmol) in toluene (4 L) was degassed by bubbling nitrogen through the solution for 10 minutes. The reaction mixture was heated to 80-90 °C for 2-3 hrs and then cooled to 20 °C. The toluene was concentrated under reduced pressure and the resulting residue was purified by silica gel column chromatography (10:1 to 3 :lgradient elution petroleum ether/EtOAc) to afford (5)-l-ieri-butyl 2-ethyl 5-oxopiperidine-l,2-dicarboxylate (140 g, 57.8%) as a yellow oil.
Step 2: Synthesis of (2S,5S)-1 -tert-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate
Figure imgf000052_0002
NaBRt (36 g, 1.0 mol) was added in portions to a -40 °C solution of (5)-l-ieri-butyl 2-ethyl 5-oxopiperidine-l,2-dicarboxylate (250 g, 0.92 mol) in EtOH (1500 mL). The reaction mixture was then stirred at -40 °C for 0.5 hr then quenched with 10% HO Ac solution. After diluting with water, the mixture was extracted with DCM (3x). The combined organic layer was concentrated under reduced pressure and purified by silica gel column chromatography (1 : 1 petroleum ether/EtOAc) to afford (25,55')- 1 -tert-butyl 2-ethyl 5-hydroxypiperidine-l ,2- dicarboxylate (205 g, 80%) as a yellow oil.
Step 3: Synthesis of (2S,5R)-1 -tert-butyl 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l,2-dicarboxylate
Figure imgf000053_0001
A solution of 2-nitrobenzene-l-sulfonyl chloride (500 g, 2.26 mol) in pyridine (1500 mL) was added dropwise to a 0 °C solution of 0-benzylhydroxylamine hydrochloride (400 g, 2.51 mol) in pyridine (1500 mL). The reaction mixture was allowed to warm to room temperature then was stirred at 20 °C overnight. The mixture was concentrated under reduced pressure, diluted with DCM and washed with HC1 (10%, 3x). The combined organic layer was concentrated under reduced pressure and re-crystallized with DCM to afford N-(benzyloxy)- 2-nitrobenzenesulfonamide (485 g, 62.6%) as a yellow solid. To a solution of N-(benzyloxy)-2-nitrobenzenesulfonamide (212 g, 0.69 mol) in THF (1000 mL) was added (25,55)- 1-ieri-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate (171 g, 0.63 mol) and PP1¾ (275 g, 1.05 mol), followed by dropwise addition of a solution of DEAD (195 g, 1.12 mol) in THF (500 mL). The mixture was then stirred at 20 °C overnight. The reaction mixture was then concentrated under reduced pressure and purified by silica gel column chromatography (3: 1 petroleum ether/EtOAc) to afford (25,5 ?)-l-ieri-butyl 2-ethyl 5-(N-(benzyloxy)-2-nitrophenylsulfonamido)piperidine-l,2-dicarboxylate (283.8 g, 80%) as a yellow oil.
Step 4: Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-((benzyloxy)amino)piperidine-l,2- dicarboxylate
Figure imgf000053_0002
LiOH'H20 (95 g, 2.3 mol) and 2-mercaptoacetic acid (124 g, 1.3 mol) were added to a solution of (2S,5R)-l-tert-buty\ 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l ,2-dicarboxylate (251 g, 0.45 mol) in DMF (1200 mL) . The reaction mixture was then stirred at 20 °C overnight. The reaction mixture was diluted with water and extracted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (3x), concentrated under reduced pressure and purified by silica gel column chromatography (3: 1 petroleum ether/EtOAc) to afford (25',5 ?)-l-ieri-butyl 2-ethyl 5-((benzyloxy)amino)piperidine-l ,2-dicarboxylate (122.9 g, 85%) as a yellow solid.
Synthesis of (2S,5R)-ethyl 5-((benzyloxy)amino)piperidine-2-carboxylate
Figure imgf000054_0001
TFA (600 mL) was added to a solution of (2S,5R)-l-tert-buty\ 2-ethyl 5- ((benzyloxy)amino)piperidine-l,2-dicarboxylate (263 g, 0.7 mol) in DCM (600 mL) at 20 °C. The mixture was stirred at rt overnight and then concentrated under reduced pressure. The crude product was adjusted to pH 10 with sat. NaHCC>3 solution then extracted with DCM (3x). The combined organic layer was concentrated under reduced pressure and purified by silica gel column chromatography (20: 1 DCM/MeOH) to afford (2S,5R)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (184.9 g, 95%) as a yellow oil. Step 6: Synthesis of (2S,5R)-ethyl 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 ]octane-2- carboxylate
Figure imgf000054_0002
Triphosgene (21.3 g, 72 mmol) was added in portions to a 0 °C solution of (25',5 ?)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (50 g, 0.18 mol) and DIPEA (128 mL, 0.72 mol) in DCM (2000 mL). The reaction mixture was allowed to warm to rt. After stirring at rt overnight, the reaction mixture was washed with H3PO4 (10%), sat. NaHCC>3 and saturated NaCl. The combined organic layer was concentrated under reduced pressure and purified by silica gel column chromatography (3 :1 petroleum ether/EtOAc) to afford (25',5 ?)-ethyl 6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carboxylate (27.4 g, 50%) as a yellow solid. lH NMR (400Mz, CDC13): δ 7.43-7.36 (m, 5H), 5.06 (d, / = 11.4 Hz, 1H), 4.90 (d, / = 11.4 Hz, 1H), 4.24 (q, 7 = 7.1 Hz, 2H), 4.11-4.08 (m, 1H), 3.32-3.31 (m, 1H), 3.08-3.05 (m, 1H), 2.93 (d, / = 11.9 Hz, 1H), 2.14-2.05 (m, 2H), 2.05-2.00 (m, 1H), 1.71-1.63 (m, 1H), 1.29 (t, 7 = 7.1 Hz, 3H). Example 2: Synthesis of(2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 loctane-2- carbaldehyde (Intermediate Compound 2b )
Figure imgf000055_0001
L1BH4 (0.54 g, 24.67 mmol) was added to a -10 °C solution of (25",5«)-ethyl 6-(benzyloxy)-7- oxo- 1,6-diazabicyclo [3.2.1 ]octane-2-carboxylate (5 g, 16.44 mmol) in MeOH (50 mL). After 15 minutes another portion of L1BH4 (0.54 g, 24.67 mmol) was added and the mixture was stirred at -10 to 0 °C for 4-5 h. The reaction mixture was carefully quenched by addition of sat. NaH2P04 (50 mL) at 0 °C. The mixture was diluted with water (20 mL) and extracted with DCM (3x). The combined organic layer was concentrated and purified by silica gel column chromatography (gradient elution 0-100% EtOAc /petroleum ether, then 0-2% MeOH/EtOAc) to give (25',5«)-6-(benzyloxy)-2-(hydroxymethyl)- 1 ,6- diazabicyclo [3.2.1 ]octan-7-one (3.8 g, 88%) as a white solid. ESI-MS (EI+, m/z): 263.1. 1H NMR (500M, CDCI3): 7.44-7.35 (m, 5H), 5.05 (d, / = 11.5 Hz, 1H), 4.90 (d, / = 11.5 Hz, 1H), 3.73-3.69 (m, 1H), 3.61-3.58 (m, 2H), 3.33 (m, 1H), 3.01 (br d, / = 12.0 Hz, 1H), 2.91 (m, 1H), 2.03-1.95 (m, 2H), 1.58- 1.54 (m, 1H), 1.39-1.24 (m, 1H).
TEMPO (48 mg, 0.3 mmol) was added in portions to a 0 °C solution of (2S,5R)-6- (benzyloxy)-2-(hydroxymethyl)- l ,6-diazabicyclo[3.2.1 ]octan-7-one (7.8 g, 30 mmol) and l ,3,5-trichloro-l ,3,5-triazinane-2,4,6-trione (7.0g, 30mmol) in DCM (100 mL). The mixture was stirred at 0 °C for 2 h, and filtered through Celite®. The filtrate was dried over Na2S04 and concentrated to afford (25',5 ?)-6-(benzyloxy)-7-oxo-l ,6-diazabicyclo[3.2.1 ]octane-2- carbaldehyde (7.0 g, 90%) as a yellow oil. ESI-MS (EI+, m/z): 261.1. *H NMR (500M, CDCI3): 9.74 (s, 1H), 7.45-7.36 (m, 5H), 5.07 (d, / = 11.5 Hz, 1H), 4.92 (d, " = 11.5 Hz, 1H), 3.89 (d, 7 =8.0 Hz, 1H), 3.27 (m, 1H), 3.21-3.05 (m, 1H), 2.56 (d, / = 12.0 Hz, 1H), 2.20- 2.15 (m, 1H), 2.05-2.01 (m, 1H), 1.95- 1.93 (m, 1H), 1.49-1.46 (m, 1H). Example 3: Synthesis of (E)-6-(benzyloxy)-7 -oxo-1 ,6-diazabicyclot 3.2.1 loctane-2- carbaldehyde oxime (Intermediate Compound 2c)
Figure imgf000056_0001
A solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l ,6-diazabicyclo[3.2.1]octane-2-carbaldehyde (510 mg, 1.96 mmol), hydroxylamine hydrochloride (158 mg, 2.27 mmol) and pyridine (621 mg, 7.85 mmol) in EtOH (15 rriL) was stirred at rt for 2 hrs. Then, the reaction mixture was concentrated and the residue was diluted with DCM (25 rriL), washed with water (3x), and saturated sodium chloride, dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (3 :1 to 3:2 petroleum ether/EtOAC) to afford (E)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbaldehyde oxime (228 mg, 42%) as a white solid. ESI-MS (EI+, m/z): 276 [M+H]+.
Example 4: Synthesis of (2S,5R)-2-( 5 -(aminomethyl)isoxaz.ol-3-yl)-7 -oxo-1 ,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 601 )
Figure imgf000056_0002
Figure imgf000056_0003
Step 1: NCS (295 mg, 2.2 mmol) was added to a solution of 6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octane-2-carbaldehyde oxime (560 mg, 2.0 mmol) in dry DCM (15 mL) at rt. Pyridine (one drop) was then added, and the reaction mixture was stirred at rt for 18 hrs. The solution was evaporated to afford (25,5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbimidoyl chloride, which was directly used in the next step. ESI- MS (EI+, m/z): 21 '4 [M-C1]+.
Step 2: tert- Butyl prop-2-yn-l-ylcarbamate (0.37 g, 2.4 mmol) was added to the solution of (25',5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbimidoyl chloride (~ 2.0 mmol) in dry DCM (20 mL), followed by the addition of TEA (0.31 mL, 2.2 mmol) in dry DCM (2.0 mL) over a period of 30 minutes. The reaction mixture was stirred at rt overnight, then the mixture was diluted with EtOAc, washed with water and saturated sodium chloride. The organic layer was dried over Na2SC>4, concentrated and purified by silica gel column chromatography (1 :2 petroleum ether/EtOAc) to afford ieri-butyl ((3- ((25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)isoxazol-5- yl)methyl)carbamate (180 mg, 21 % for two steps) as a white solid. ESI-MS (EI+, m/z): 429.1 [M+H]+. lH NMR (500 MHz, CDC13): δ 7.45-7.35 (m, 5H), 6.24 (s, 1H), 5.09 (d, / = 11.5 Hz, 1H), 4.93 (d, " = 11.5 Hz, 1H), 4.58 (d, / = 7.5 Hz, 1H), 4.43 (m, 2H), 3.32 (s, 1H), 2.86- 2.84 (m, 1H), 2.68 (d, / = 11.5 Hz, 1H), 2.34-2.30 (m, 1H), 2.23-2.18 (m, 1H), 2.10-2.04 (m, 1H), 1.82-1.78 (m, 1H), 1.45 (s, 9H).
Step 3: To a solution of ieri-butyl (3-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)isoxazol-5-yl)methylcarbamate (210 mg, 0.5 mmol) in THF (5 mL) was added 10% Pd/C (100 mg). The reaction mixture was then filtered and concentrated to afford ieri-butyl ((3-((25',5 ?)-6-hydroxy-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)isoxazol-5- yl)methyl)carbamate (180 mg, 99%) as a light yellow solid, which was used directly in the next step. ESI-MS (EI+, m/z): 339.1 [M+H]+. Step 4: To a solution of ieri-butyl (3-((25',5 ?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)isoxazol-5-yl)methylcarbamate (180 mg, 0.5 mmol) in dry pyridine (2.5 mL) was added SC>3-Py (480 mg, 3.0 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under reduced pressure. The residue was re-dissolved in aqueous
NaH2P04 (1.5 M, 20 mL) then tetrabutylammonium hydrogensulphate (230 mg, 0.67 mmol) was added. The mixture was stirred at rt for 20 minutes then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 3: 1 DCM/acetone) to afford
tetrabutylammonium (25',5 ?)-2-(5-(((ieri-butoxycarbonyl)amino)methyl)isoxazol-3-yl)-7- oxo- 1,6-diazabicyclo [3.2. l]octan-6-yl sulfate (180 mg, 54%) as a white solid. ESI-MS (EL, m/z) 417.0 [M-H]\ lU NMR (500 MHz, CDC13): δ 6.28 (s, 1H), 4.97 (bs, 1H), 4.54 (d, / = 7 Hz, 1H), 4.44-4.30 (m, 2H), 4.35 (m, 1H), 3.35-3.28 (m, 8H), 3.19-3.17 (m, 1H), 2.76 (d, / = 11.5 Hz, 1H), 2.36-2.32 (m, 1H), 2.27-2.24 (m, 1H), 2.18-2.12 (m, 1H), 1.87-1.81 (m, 1H), 1.71 -1.65 (m, 8H), 1.50- 1.47 (m, 17H), 1.01 (t, 7 = 7.0 Hz, 12H).
Step 5, Resin Exchange: Tetrabutylammonium (25, 5R)-2-(5-(tert- butoxycarbonylaminomethyl)-isoxazol-3-yl)-7-oxo- l,6-diaza-bicyclo[3.2.1 ]octan-6-yl sulfate (180 mg, 0.27 mmol) was dissolved in a minimum amount of HPLC grade water (- 10 mL) and passed through a column of 20 g of DOWEX 50WX 8 Na+ resin (the resin was pre- washed with > 0.5 L of HPLC grade water) and eluted with HPLC grade water to afford sodium (25,5 ?)-2-(5-(((ieri-butoxycarbonyl)amino)methyl)isoxazol-3-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 ]octan-6-yl sulfate (109 mg, 92%) was obtained after lyophilization as a white solid. ESI-MS (EL, m/z): 417.0 [M-H]~. 1H NMR (500 MHz, D20): J6.32 (s, 1H), 4.61 (d, / = 6.5 Hz, 1H), 4.32 (s, 2H), 4.13 (m, 1H), 3.10-3.08 (m, 1H), 2.91 (d, / = 12.5 Hz, 1H), 2.21 -2.17 (m, 1H), 2.09-2.02 (m, 2H), 1.86-1.82 (m, 1H), 1.34 (s, 9H).
Step 6: TFA (0.40 mL) was added to a 0 °C solution of sodium (25, 5R)-2-(5-(tert- butoxycarbonylaminomethyl)- isoxazol-3-yl)-7-oxo-l,6-diaza-bicyclo[3.2.1 ]octan-6-yl sulfate (54 mg, 0.12 mmol) in dry DCM (1.2 mL). The reaction mixture was stirred at 0 °C for 30 minutes to 1 h and then diluted with diethyl ether. The precipitate was collected via centrifugation, washed with ether (3x) and further dried under high vacuum to provide (25,5 ?)-2-(5-(aminomethyl)isoxazol-3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate as a TFA salt (~ 30 mg). ESI-MS (EI+, m/z): 319.2. The TFA salt (~ 30 mg) was further purified by prep-HPLC using ammonium formate buffer to provide (2S ,5R)-2-(5- (aminomethyl)isoxazol-3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (601, 10 mg, 26%) as a white solid. ESI-MS (EI+, m/z): 319.21. 1H NMR (300 MHz, D20) δ 6.61 (s, lH),4.68-4.65 (m, 1H), 4.35 (s, 2H), 4.17-4.14 (m, 1H), 3.14-3.10 (m, 1H), 2.95-2.91 (m, 1H), 2.31 -1.80 (m, 4H). Example 5: Synthesis of (2S,5R)-2-(5-(guanidinomethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 603 )
Figure imgf000059_0001
Figure imgf000059_0002
Step 1: Synthesis of 1 -(2,3-bis(tert-butoxycarbonyl)guanidino)prop-2-yne:
Di-ieri-butyl (lH-pyrazol-l-yl)methanediylidenedicarbamate (1.71 g, 5.5 mmol) was added to a 0 °C solution of prop-2-yn-l -amine (275 mg, 5.0 mmol) and TEA (1.5 g, 15 mmol) in MeOH (40 mL). The reaction mixture was stirred at 0 °C for 3 hrs and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (1 :10 EtOAc/Hexanes) to give l-(2,3-bis(ieri-butoxycarbonyl)guanidino) prop-2-yne (1.4 g, 93%) as a white solid. ESI-MS (EI+, m/z): 298.1 [M+H]+.
Step 2: Synthesis of(2S,5R)-6-(benzyloxy)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-l,6-diaz -bicyclo[3.2.1 ]octan-7-one: l-(2,3-bis(ieri-butoxycarbonyl)guanidino)prop-2-yne (362 mg, 1.22 mmol) was added to the solution of (25',5 ?)-6-(benzyloxy)-N-hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbimidoyl chloride (473 mg, 1.53 mmol) in dry DCM (20 mL) at rt , followed by dropwise addition of TEA (0.16 g, 1.53 mmol). The mixture was stirred at rt for 2 hrs and then concentrated. The residue was purified by silica gel column chromatography (gradient elution 1 : 15 to 1 :5 EtOAc/Hexanes) to give (25,,5«)-6-(benzyloxy)-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)- l,6-diaza-bicyclo[3.2.1]octan-7-one (190 mg, 22% for two steps) as a white solid. ESI-MS (EI+, m/z): 571.2 [M+H]+. lH NMR (500 MHz, CDCI3): δ 11.49 (s, 1H), 8.86 (bs, 1H), 7.47-7.34 (m, 5H), 6.32 (s, 1H), 5.09 (d, / = 11.5 Hz, 1H), 4.93 (d, / = 12.0 Hz, 1H), 4.87-4.76 (m, 2H), 4.59 (d, / = 7.0 Hz, 1H), 3.36 (s, 1H), 2.87-2.85 (m, 1H), 2.70 (d, / = 12 Hz, 1H), 2.35-2.30 (m, 1H), 2.24-2.18 (m, 1H), 2.10- 2.05 (m, 1H), 1.81-1.78 (m, 1H), 1.50 (s, 18H).
Step 3: Synthesis of(2S,5R)-6-(hydroxy)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-l,6-diaz -bicyclo[3.2.1 ]octan-7-one:
To a solution of (25,,5«)-6-(benzyloxy)-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)- l,6-diaza-bicyclo[3.2.1]octan-7-one (240 mg, 0.42 mmol) in THF (20 mL) was added 10% Pd/C (120 mg). The mixture was stirred under H2 atmosphere at rt for 1.5 hrs. The reaction mixture was then filtered and
concentrated to afford (25,,5 ?)-6-(hydroxy)-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)- l,6-diaza-bicyclo[3.2.1]octan-7-one (200 mg, 99%) as white solid, which was directly used in the next step. ESI-MS (EI+, m/z): 481.2 [M+H]+.
Step 4: Synthesis oftetrabutylammonium(2S,5R)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diaz -bicyclo[3.2.1 ]octan-6-yl sulfate:
To a solution of (25,,5«)-6-(hydroxy)-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)- l,6-diaza-bicyclo[3.2.1]octan-7-one (200 mg, 0.42 mmol) in dry pyridine (2.5 mL) was added SC>3- Py (400 mg, 2.5 mmol). The mixture was stirred at rt for 3 hrs then concentrated under reduced pressure. The residue was re-dissolved in aqueous NaH2P04 (1.5 M, 20 mL). Tetrabutylammonium hydrogensulphate (200 mg, 0.58 mmol) was added. The mixture was stirred at rt for 20 minutes then was extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 5:1 DCM/acetone) to give tetrabutylammonium (2S,5R)-2-(5-((2,3-bis(tert- butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-6-yl sulfate (220 mg, 66%) as a white solid. ESI-MS (EL, m/z): 559.0 [M-H]\ lH NMR (500 MHz, CDCI3): δ 11.48 (s, 1H), 8.78 (bs, 1H), 6.34 (s, 1H), 4.77-4.76 (m, 2H), 4.55 (d, / = 7.5 Hz, 1H), 4.35 (m, 1H), 3.38-3.28 (m, 8H), 3.20-3.18 (m, 1H), 2.78 (d, / = 11.5 Hz, 1H), 2.37-2.30 (m, 1H), 2.28-2.24 (m, 1H), 2.17-2.11 (m, 1H), 1.88-1.82(m, 1H), 1.71-1.63 (m, 8H), 1.50-1.44 (m, 26H), 1.01 (t, 7 = 7.0 Hz, 12H). Step 5: TFA (2.20 mL) was added to a 0 °C solution of tetrabutylammonium (25,5/?)-2-(5- ((2,3-bis(ieri-butoxycarbonyl)guanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate (465 mg, 0.60 mmol) in dry DCM (6.60 mL). The reaction mixture was allowed to warm to rt. The reaction mixture was stirred at rt for 2 hrs and then diluted with ether. The precipitate was collected via centrifugation, washed with diethyl ether (3x) and further dried under high vacuum. The crude TFA salt was purified by prep- HPLC using ammonium formate buffer to provide (25',5 ?)-2-(5-(guanidinomethyl)isoxazol- 3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (603, 60 mg, 20%) as a white solid. ESI-MS (EI+, m/z): 361.2. lH NMR (300 MHz, D20/DMSO-d6) δ 6.58 (s, 1H), 4.74- 4.71 (m, 1H), 4.67 (s, 2H), 4.23 (br s, 1H), 3.22-3.17 (m, 1H), 2.99 (d, / = 12.0 Hz, 1H), 2.36-2.26 (m, 1H), 2.24-2.10 (m, 2H), 2.02-1.91 (m, 1H).
Example 6: Synthesis of (2S,5R)-2-( 5 -(2-aminoethyl)isoxaz.ol-3 -yl)-7 -oxo-1 ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 602 )
Figure imgf000061_0001
Following Steps 1-6 in Example 4, replacing ieri-butyl prop-2-yn-l-ylcarbamate in Step 2 with ieri-butyl but-3-yn-l-ylcarbamate; (25',5 ?)-2-(5-(2-aminoethyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate TFA salt (602, 8 mg) was obtained as a light yellow solid. ESI-MS (EI+, m/z): 333.2. 1 H NMR (300 MHz, D20) δ 6.39 (s, 1H),
4.62 (d, / = 6.8 Hz, 1H), 4.16-4.12 (m, 1H), 3.32 (t, / = 7.1 Hz, 3H), 3.25-3.04 (m, 4H), 2.97- 2.93 (m, 1H), 2.30-1.79 (m, 4H).
Example 7: Synthesis of(2S,5R)-2-(5-(2-guanidinoethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 604)
Figure imgf000061_0002
Following Steps 1-5 in Example 5, replacing prop-2-yn-l -amine in Step 1 with but-3-yn-l- amine; (25,5 ?)-2-(5-(2-g^anidinoethyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6- yl hydrogen sulfate (604, 48 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z) 375.1. 1H NMR (300 MHz, D20/DMSO-d6) δ 6.33 (s, 1H), 4.62 (d, / = 6.6 Hz, 1H), 4.14 (br s, 1H), 3.51 (t, / = 6.4 Hz, 2H), 3.15 - 3.07 (m, 1H), 3.05 (t, / = 6.4 Hz, 2H), 2.88 (d, / = 6.4 Hz, 1H), 2.26-1.99 (m, 3H), 1.85-1.80 (m, 1H).
Example 8: Synthesis of (2S,5R)-7-oxo-2-(5-(piperidin-4-yl)isoxazol-3-yl)-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 606)
Figure imgf000062_0001
Following Steps 1-6 in Example 4, replacing ieri-butyl prop-2-yn- l-ylcarbamate in Step 2 with ieri-butyl 4-ethynylpiperidine- 1 -carboxylate, (25', 5 ?)-7-oxo-2-(5-(piperidin-4- yl)isoxazol-3-yl)- l ,6-diazabicyclo[3.2.1 ]octan-6-yl hydrogen sulfate (606, 35 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 371.3.
Example 9: Synthesis of (2S,5R)-2-(5-(l-carbamimidoylpiperidin-4-yl)isoxazol-3-yl)-7-oxo- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 607)
Figure imgf000062_0002
Following Steps 1-5 in Example 5 , replacing prop-2-yn- l -amine in Step 1 with 4- ethynylpiperidine; (25',5 ?)-2-(5-(l-carbamimidoylpiperidin-4-yl)isoxazol-3-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 ]octan-6-yl hydrogen sulfate TFA salt (607, 32 mg) was obtained. ESI-MS (EI+, m/z): 415.2.
Example 10: Synthesis of (2S,5R)-2-(5-((2-aminoethyl)carbamoyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 605)
Figure imgf000063_0001
Following Steps 1-6 in Example 4, replacing ieri-butyl prop-2-yn-l-ylcarbamate in Step 2 with ieri-butyl (2-propiolamidoethyl)carbamate, (25,5 ?)-2-(5-((2- aminoethyl)carbamoyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate TFA salt (605, 20 mg) was obtained as a light yellow solid. ESI-MS (Ε , m/z): 376.1. 1H NMR (300 MHz, D20) δ 7.05 (s, IH), 4.70 (m, IH, overlapped with D20 peak) 4.16 (br s, IH), 3.66 (t, / = 5.8 Hz, 2H), 3.19 (t, / = 5.8 Hz, 2H), 3.16-3.08 (m, IH), 2.93 (d, / = 12.0 Hz, IH), 2.31-2.24 (m, IH), 2.16-2.04 (m, 2H), 1.94-1.85 (m, IH). Example 11: Synthesis of(2S,5R)-2-(5-((2-guanidinoethyl)carbamoyl)isoxazol-3-yl)-7-oxo- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 608)
Figure imgf000063_0002
Following Steps 1-5 in Example 5, replacing prop-2-yn-l -amine in Step 1 with N-(2- aminoethyl)propiolamide; (25',5 ?)-2-(5-((2-guanidinoethyl)carbamoyl)isoxazol-3-yl)-7-oxo- l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (608, 25 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 418.12. 1H NMR (300 MHz, D20) δ 4.79-4.76 (m, IH), 4.16 (br s, IH), 4.47-4.32 (m, 4H), 4.17-4.11 (m, 2H), 3.19 - 3.16 (m, IH), 2.92 (d, / = 12.0 Hz, IH), 2.32-2.22 (m, IH), 2.20- 2.06 (m, 2H), 1.97-1.88 (m, IH).
Example 12: Synthesis of (2S,5R)-7-oxo-2-(5-(2-(piperidin-4-ylamino)ethyl)isoxazol-3-yl)- l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 609)
Figure imgf000064_0001
Procedures and characterization:
Step 1: Synthesis of tert-butyl 4-(but-3-ynylamino)piperidine-l -carboxylate:
A mixture of but-3-yn-l-amine hydrochloride (26.4 g, 0.25 mol), K2CO3 (17.4 g, 0.13 mol), and ieri-butyl 4-oxopiperidine- 1 -carboxylate (41.8 g, 0.21 mol) in MeOH (500 mL) was stirred at rt for 5 hrs. Then, NaBH(OAc)3 (133.6 g, 0.63 mol) was added and the suspension was stirred at rt for 17 hrs. The crude reaction mixture was used directly in the next step. ESI- MS (EI+, m/z): 253.2 [M+H]+.
Step 2: Synthesis of 'tert-butyl 4-(but-3-ynyl(tert-butoxycarbonyl)amino)piperidine-l- carboxylate:
The reaction mixture in Step 1 was cooled to 0 °C and Et3N (88.0 mL, 0.63 mol) and (Boc)20 (91.6 g, 0.42 mol) were added. The solution was allowed to warm to rt, then was stirred at rt for 17 hrs. The reaction mixture was concentrated, and then EtOAc (800 mL) was added. The organic layer was washed with saturated sodium chloride (3x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-10% EtOAC/petroleum ether) to afford tert-butyl 4-(but-3-ynyl(tert- butoxycarbonyl)amino)piperidine-l-carboxylate (66.0 g, 90%) as a colorless oil. ESI-MS (EI+, m/z): 353.2 [M+H]+. Step 3-6: Following Steps 2-5 in Example 5, replacing l-(2,3-bis(ieri- butoxycarbonyl)guanidino)prop-2-yne in Step 2 with tert-butyl 4-(but-3-yn-l-yl(ieri- butoxycarbonyl)amino)piperidine-l-carboxylate; (2S,5R)-7-oxo-2-(5-(2-(piperidin-4- ylamino)ethyl)isoxazol-3-yl)-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (609, 220 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 416.4. 1H NMR (300 MHz, D20) δ 6.29 (s, 1H), 4.59 (d, / = 6.3 Hz, 1H), 4.12 (s, 1H), 3.39 (d, / = 13.3 Hz, 2H), 3.10 - 2.91 (m, 9H), 2.23 - 1.95 (m, 5H), 1.87 - 1.76 (m, 1H), 1.54 - 1.40 (m, 2H).
Example 13: Synthesis of '(2S,5R)-2-(5-(2-« 1 -carbamimidoylpiperidin-4- yl)amino)ethyl)isoxazol-3-yl)-7-oxo-l , 6-diaz bicyclof 3.2.1 loctan-6-yl hydrogen sulfate
(Compound 610 )
Figure imgf000065_0001
Synthetic scheme:
Figure imgf000066_0001
Procedures and characterization:
Step 1: Synthesis of piperidin-4-one:
A mixture of ieri-butyl 4-oxopiperidine-l-carboxylate (10.0 g, 50 mmol), TFA (20 mL) and CH2CI2 (100 mL) was stirred at rt for 1 h. The reaction mixture was then concentrated to afford piperidin-4-one (15.0 g, 100%) as a colorless oil. 1H NMR: (500 MHz, DMSO-d6): δ 2.51 (m, 4H), 3.43 (m, 4H), 9.03 (m, 2H). Step 2: Synthesis of di-tert-butyl (4-oxopiperidin-l-yl)methylenedicarbamate:
(Z)-di-tert-butyl (lH-imidazol-l-yl)methylenedicarbamate (16.3 g, 52.5 mmol) was add to a O °C solution of piperidin-4-one (15 g, 50 mmol) and Et3N (25.4 g, 251 mmol) in MeOH (200 mL). The reaction mixture was allowed to warm to rt then was stirred at rt for 17 hrs. The reaction mixture was concentrated, and then EtOAc (300 mL) was added. The organic layer was washed with saturated sodium chloride (3x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-20%
EtO Ac/petroleum ether) to afford di-ieri-butyl (4-oxopiperidin-l-yl)methylenedicarbamate (12.8 g, 75%) as a white solid. ESI-MS (EI+, m/z): 342.1 [M+H]+. Step 3: Synthesis of di-tert-butyl(4-(but-3-ynylamino)piperidin-l - yljmethanediylidenedicarbamate: A mixture of but-3-yn-l-amine hydrochloride (3.0 g, 28.4 mmol), K2CO3 (2.0 g, 14.2 mmol), MeOH (150 mL), di-ieri-butyl (4-oxopiperidin-l-yl)methylene-dicarbamate (8.1 g, 23.7 mmol) and 4 A molecular sieve (6.0 g) was stirred at rt for 3 hrs. Then, NaBH(OAc)3 (15.1 g, 71.1 mmol) was added, and the suspension was stirred at 70 °C for 1 h. The reaction mixture was filtered and concentrated to afford di-ieri-butyl(4-(but-3-ynylamino)piperidin-l- yl)methanediylidenedicarbamate as a yellow oil (-15.0 g), which was used directly in the next step.
Step 4: Synthesis of di-tert-butyl (4-(but-3-ynyl(tert-butylcarbamate))piperidin-l- yljmethanedi- ylidenedicarbamate:
A mixture of di-ieri-butyl(4-(but-3-ynylamino)piperidin-l-yl) methanediylidenedicarbamate (-15.0 g), di-tert-butyl dicarbonate (10.3 g, 47.4 mmol), aq. NaHC03 (60 mL) in THF (120 mL) was stirred at rt for 2 hrs. The reaction mixture was then concentrated and extracted with EtOAc (3x). The combined organics were dried (Na2SC>4) and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-20% EtOAc/petroleum ether) to afford di-ieri-butyl(4-(but-3-ynyl(tert-butylcarbamate))piperidin-l-yl)methanedi- ylidenedicarbamate as a colorless oil (7.1 g, 60%). ESI-MS (Ef , m/z): 495.3 [M+H]+.
Step 5-8: Following Steps 2-5 in Example 5, replacing l-(2,3-bis(tert- butoxycarbonyl)guanidino)prop-2-yne in Step 2 with ieri-butyl (l-(N,N'-bis(tert- butoxycarbonyl)carbamimidoyl)piperidin-4-yl)(but-3-yn-l-yl)carbamate;(2S,5R)-2-(5-(2-((l- carbamimidoylpiperidin-4-yl)amino)ethyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (610, 502 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 458.0. 1H NMR (300 MHz, D20) δ 6.35 (s, 1H), 4.59 (d, / = 7.0 Hz, 1H), 4.12 (s, 1H), 3.85 (d, / = 14.5 Hz, 2H), 3.40 - 3.30 (m, 3H), 3.20 - 2.90 (m, 6H), 2.20 - 1.75 (m, 6H), 1.62 - 1.46 (m, 2H).
The compounds described in Examples 14-33 were prepared as desribed in the reation schemes following similar procedures of Examples 1-13
Example 14: Synthesis of '(2S,5R)-2-( 5-((R*)-2-guanidino-l -hydroxy ethyl)isoxaz.ol-3-yl)-7- oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 611 )
Figure imgf000068_0001
Characterization:
(2S,5R)-2-(5-((/?*)-2-guanidino-l-hydroxyethyl)isoxazol-3-yl)-7-oxo-l ,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (611, 46 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z) 391.0 . 1H NMR (300 MHz, D20) δ 6.46 (s, 1H), 5.04 (t, / = 5.2 Hz, 1H), 4.62 (d, J = 6.1 Hz, 1H), 4.11 (s, 1H), 3.56 (d, 7 = 5.2 Hz, 2H), 3.08 (d, / = 11.6 Hz, 1H), 2.85 (d, / = 12.1 Hz, 1H), 2.24 - 2.14 (m, 1H), 2.12 - 2.00 (m, 2H), 1.86 - 1.76 (m, 1H). Example 15 Synthesis of (2S,5R)-2-(5-((S*)-2-guanidino-l-hydroxyethyl)isoxazol-3-yl)-7-
Figure imgf000069_0001
Synthetic scheme:
Figure imgf000069_0002
Characterization:
(2S,5R)-2-(5-((5*)-2-guanidino-l-hydroxyethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (612, 72 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 391.0. 1H NMR (300 MHz, D20) δ 6.47 (s, 1H), 5.04 (t, / = 5.4 Hz, 1H), 4.63 (d, J = 6.2 Hz, 1H), 4.12 (s, 1H), 3.65 - 3.49 (m, 2H), 3.09 (br d, / = 12.7 Hz, 1H), 2.87 (d, / = 12.2 Hz, 1H), 2.20 - 1.98 (m, 3H), 1.86-1.78 (m, 1H).
Example 16: Synthesis of (2S,5R)-2-( 5-( ( 1 -guanidinocyclopropyl)methyl)isoxaz.ol-3-yl)-7-
Figure imgf000069_0003
Synthetic scheme: TBSCI, imidazole
DMF, rt, 17 h
Figure imgf000070_0001
75% 30% 90%
Figure imgf000070_0002
Figure imgf000070_0003
Characterization:
(2S,5R)-2-(5-((l-guanidinocyclopropyl)methyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (613, 28 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z) 401.3. 1H NMR (300 MHz, D20) δ 6.35 (s, 1H), 4.61 (d, / = 6.6 Hz, 1H), 4.12 (br s, 1H), 3.11 - 3.09 (m, 1H), 3.08 - 2.98 (m, 2H), 2.89 (d, / = 12.0 Hz, 1H), 2.20 - 2.00 (m, 3H), 1.89 - 1.78 (m, 1H), 0.97 - 0.95 (m, 4H). Example 17: Synthesis of (2S,5R)-2-(5-(( 1 -methylguanidino)methyl)isoxazol-3-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 614)
Figure imgf000070_0004
Synthetic scheme:
Figure imgf000071_0001
(2S,5R)-2-(5-((l-methylguanidino)methyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (614, 12 mg) was obtained as a white solid after prep-HPLC
purification using ammonium formate buffer. ESI-MS (EI+, m/z): 375.1. *H NMR (300 MHz, D20 with coupe of drops of DMSO-d6) δ 6.55 (s, 1H), 4.73 (s, 2H), 4.64 (d, / = 6.0 Hz, 1H), 4.14 (br s, 1H), 3.15-3.07 (m, 1H), 3.06 (s, 3H), 2.89 (d, / = 12.2 Hz, 1H), 2.26 - 2.20 (m, 1H), 2.15 - 2.09 (m, 2H), 1.92 - 1.85 (m, 1H).
Example 18: Synthesis of(2S,5R)-2-(5-(3-guanidinopropyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 615)
Figure imgf000071_0002
Synthetic scheme:
Figure imgf000072_0001
Characterization:
(2S,5R)-2-(5-(3-guanidinopropyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (615, 18 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 389.1. *H NMR (300 MHz, D20 with couple of drops of DMSO-d6) δ 6.28 (s, 1H), 4.57 (d, / = 6.5 Hz, 1H), 4.11 (s, 1H), 3.17 (t, J = 6.7 Hz, 2H), 3.07 (br d, / = 11.5 Hz, 1H), 2.88 (d, / = 12.4 Hz, 1H), 2.83 (t, J = 6.1 Hz, 2H), 2.22 - 1.75 (m, 6H). Example 19: Synthesis of (2S,5R)-2-(5-(( 1 s,3R)-3-aminocyclobutyl)isoxaz.ol-3-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 616)
Figure imgf000072_0002
Synthetic scheme: ci
/v °VV° TEMPO / H
BocHN- -^ ► Π 1 Γ
V O- THF,0 °C,1 h BocHN ΟΙ'ΝγΝ¾ DCM, 0 °C, 2 h v
86% O 92%
O O K2CQ3
BocHN- ^-( + A<P¾Me " BocHN"
v O Π MeOH, rt, 17 h
36%
Figure imgf000073_0001
Characterization:
(2S,5R)-2-(5-((ls,3R)-3-aminocyclobutyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (616, 7 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 359.0. 1H NMR (300 MHz, DMSO) δ 6.43 (s, 1H), 4.46 (d, / = 6.1 Hz, 1H), 4.02 (br s, 1H), 3.75 - 3.68 (m, 1H), 3.51 - 3.45 (m, 1H), 2.94 - 2.85 (m, 1H), 2.72 - 2.60 (m, 3H), 2.36 - 2.30 (m, 2H), 2.15 - 1.95 (m, 1H), 1.99 - 1.90 (m, 2H), 1.78 - 1.72 (m, 1H). Example 20: Synthesis of (2S,5R)-2-(5-((ls,3R)-3-guanidinocyclobutyl)isoxazol-3-yl)-7-oxo- 6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 617)
Figure imgf000073_0002
Synthetic scheme: h
Figure imgf000074_0001
56% for 2 steps
Figure imgf000074_0002
Characterization:
(2S,5R)-2-(5-((ls,3R)-3-guanidinocyclobutyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (617, 37 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 401.0. *H NMR (300 MHz, DMSO) δ 8.11 (br s, IH), 7.14 (brs , 4H), 6.41 (s, IH), 4.45 (d, / = 6.3 Hz, IH), 4.02 (br s, 2H), 3.40 - 3.30 (m, IH), 2.91 (br d, / = 10.3 Hz, IH), 2.80 - 2.63 (m, 3H), 2.30 - 2.10 (m, 3H), 2.00 - 1.85 (m, 2H), 1.82 - 1.66 (m, IH). Example 21: Synthesis of(2S,5R)-2-(5-(az.etidin-3-ylmethyl)isoxaz.ol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 618, )
Figure imgf000074_0003
Synthetic scheme:
Figure imgf000075_0001
Characterization:
(2S,5R)-2-(5-(azetidin-3-ylmethyl)isoxazol-3-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (618, 75 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 359.0. 1H NMR (300 MHz, D20) δ 6.23 (s, 1H), 4.56 (d, / = 6.6 Hz, 1H), 4.15 - 4.08 (m, 2H), 3.93 - 3.82 (m, 2H), 3.44 (dd, / = 14.3, 7.2 Hz, 1H), 3.28 (dt, / = 15.9, 7.9 Hz, 1H), 3.10 - 3.03 (m, 3H), 2.87 (d, / = 12.1 Hz, 1H), 2.21 - 1.94 (m, 3H), 1.84 - 1.76 (m, 1H). Example 22: Synthesis of ( 2S,5R)-2-( 5-((l -carbamimidoylazetidin-3-yl)methyl)isoxazol-3- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 619, )
Figure imgf000075_0002
Synthetic scheme:
Figure imgf000076_0001
(2S,5R)-2-(5-((l-carbamimidoylazetidin-3-yl)methyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (619, 45 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 401.0. *H NMR (300 MHz, DMSO) δ 7.28 (br s, 4H), 6.36 (s, 1H), 4.45 (d, / = 6.8 Hz, 1H), 4.18 (t, / = 8.4 Hz, 2H), 4.02 (br s, 1H), 3.86 - 3.71 (m, 2H), 3.16 (d, / = 7.0 Hz, 2H), 3.09 - 3.04 (m, 1H), 2.90 (br d, / = 8.7 Hz, 1H), 2.67 (d, " = 11.8 Hz, 1H), 2.16 - 2.09 (m, 1H), 2.00 - 1.90 (m, 2H), 1.80 - 1.72 (m, 1H).
Example 23: Synthesis of(2S,5R)-2-(5-(2-((2-aminoethyl)amino)ethyl)isoxazol-3-yl)-7-oxo- l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 620)
Figure imgf000076_0002
Synthetic scheme:
Figure imgf000077_0001
Figure imgf000077_0002
Characterization:
(2S,5R)-2-(5-(2-((2-aminoethyl)amino)ethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (620, 20 mg, as formate salt) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 376.3. 1H NMR (300 MHz, D20) δ 8.32 (s, 1H), 6.35 (s, 1H), 4.59 (d, / = 6.5 Hz, 1H), 4.11 (br s, 1H), 3.34 (t, / = 6.8 Hz, 2H), 3.30 - 3.13 (m, 6H), 3.11 - 3.03 (m, 1H), 2.91 (d, / = 12.2 Hz, 1H), 2.21 - 1.98 (m, 3H), 1.88 - 1.78 (m, 1H). Example 24: Synthesis of(2S,5R)-2-(5-(2-((2-guanidinoethyl)amino)ethyl)isoxazol-3-yl)-7-
Figure imgf000077_0003
Synthetic scheme:
Figure imgf000078_0001
Characterization:
(2S,5R)-2-(5-(2-((2-guanidinoethyl)amino)ethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (612, 15 mg, as formate salt) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 418.0. 1H NMR (300 MHz, D20) δ 8.28 (s, 1H), 6.30 (s, 1H), 4.55 (d, / = 5.9 Hz, 1H), 4.07 (br s, 1H), 3.40 (t, / = 5.9 Hz, 2H), 3.25 (t, / = 6.1 Hz, 2H), 3.14 - 3.01 (m, 5H), 2.87 (d, / = 12.1 Hz, 1H), 2.16 - 2.09 (m, 1H), 2.07 - 1.92 (m, 2H), 1.83 - 1.74 (m, 1H). Example 25: Synthesis of(2S,5R)-2-(5-((azetidin-3-ylamino)methyl)isoxazol-3-yl)-7-oxo-l,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 622, )
Figure imgf000078_0002
Synthetic scheme: ,NH2 Boc20, Et3N NHBoc ^
I—f ► I— ^-→- BocN NBoc
BocN— 1 DCM, rt. BocN— ' NaH, DMF, 0-70 °C
90% 75%
Figure imgf000079_0001
60% for 2 steps
Figure imgf000079_0002
Characterization:
(2S,5R)-2-(5-((azetidin-3-ylamino)methyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (622, 267 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 374.0. *H NMR (400 MHz, D20) δ 6.55 (s, 1H), 4.66 (d, / = 6.6 Hz, 1H), 4.29 - 4.10 (m, 5H), 4.10 - 3.98 (m, 2H), 3.12 (d, / = 12.0 Hz, 1H), 2.91 (d, / = 12.1 Hz, 1H), 2.30 - 2.18 (m, 1H), 2.18 - 1.99 (m, 2H), 1.97 - 1.78 (m, 1H). Example 26: Synthesis of(2S,5R)-2-(5-(2-(azetidin-3-ylamino)ethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 623, )
Figure imgf000079_0003
Synthetic scheme: MsCI, Et3N, DCM Et3N, NBu4l
H2N— NBoc
HO- rt, 16 hrs MsO- CH3CN, 70 °C,
90% 48 hrs
Figure imgf000080_0001
14% of 2 steps
Figure imgf000080_0002
Characterization:
(2S,5R)-2-(5-(2-(azetidin-3-ylamino)ethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (623, 41 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 388.0.
Example 27: Synthesis of(2S,5R)-2-(5-((azetidin-3-yloxy)methyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 624)
Figure imgf000080_0003
Synthetic scheme:
Figure imgf000081_0001
62% by 3 steps
Figure imgf000081_0002
Characterization:
(2S,5R)-2-(5-((azetidin-3-yloxy)methyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 6-yl hydrogen sulfate (624, 349 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z) 375.2. 1H NMR (300 MHz, D20) δ 6.51 (s, 1H), 4.64 (s, 2H), 4.62 (d, / = 7.2 Hz, 1H), 4.56 -4.52 (m, 1H), 4.20 (dd, / = 12.5, 6.7 Hz, 2H), 4.11 (br s, 1H), 3.93 (dd, / = 12.3, 5.2 Hz, 2H), 3.08 (br d, / = 12.4 Hz, 1H), 2.87 (d, / = 12.2 Hz, 1H), 2.22 - 2.14 (m, 1H), 2.12 - 2.00 (m, 2H), 187 - 1.78 (m, 1H).
Example 28: Synthesis of (2S,5R)-2-(5-( 1 -methylpyridin-1 -ium-4-yl)isoxaz.ol-3-yl)-7-oxo-l .6- diazabicyclo[3.2.1 loctan-6-yl sulfate (Compound 625)
Figure imgf000081_0003
Synthetic scheme:
Figure imgf000082_0001
Figure imgf000082_0002
Characterization:
(2S,5R)-2-(5-(l-methylpyridin-l-ium-4-yl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl sulfate (625, 20 mg) was obtained as a white solid. ESI-MS (ΕΓ, m/z): 379.0. 1H NMR (400 MHz, d6-DMSO) δ 9.15 (d, / = 5.2 Hz, 2H), 8.60 (d, / = 5.2 Hz, 2H), 7.86 (s, 1H), 4.66 (d, / = 5.6 Hz, 1H), 4.36 (s, 3H), 4.07 (br s, 1H), 3.00 - 2.98 (m, 1H), 2.79 (d, / = 12.2 Hz, 1H), 2.24 - 2.20 (m, 1H), 2.10 - 2.00 (m, 2H), 1.82 - 1.78 (m, 1H). Example 29: Synthesis of (2S,5R)-2-(5-(l ,1 -dimethylpiperidin-1 -ium-4-yl)isoxazol-3-yl)-7-
Figure imgf000082_0003
Synthetic scheme:
Figure imgf000083_0001
Characterization:
(2S,5R)-2-(5-(l,l-dimethylpiperidin-l-ium-4-yl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl sulfate (626, 86 mg) was obtained as a white solid after prep- HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 399.2. lU NMR (400 MHz, CF3COOD): δ 7.24 (s, 1H), 6.03 (d, / = 6.8 Hz, 1H), 5.44 (br s, 1H), 4.76 - 4.72 (m, 1H), 4.51 (d, / = 12.2 Hz, 1H), 4.26 - 4.12 (m, 4H), 3.99 - 3.92 (m, 1H), 3. 85 (s, 3H), 3.82 (s, 3H), 3.26 - 3.22 (m, 1H), 3.21 - 2.85 (m, 7H).
Example 30: Synthesis of (2S,5R)-7-oxo-2-(5-(piperidin-4-ylmethyl)isoxazol-3-yl)-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 627)
Figure imgf000083_0002
Synthetic scheme:
Figure imgf000084_0001
Characterization:
(2S,5R)-7-oxo-2-(5-(piperidin-4-ylmethyl)isoxazol-3-yl)-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (627, 31 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 387.0.
Example 31: Synthesis of(2S,5R)-2-(5-(az.etidin-3-yl)isoxaz.ol-3-yl)-7-oxo-l,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 628 )
Figure imgf000084_0002
Characterization:
(2S,5R)-2-(5-(azetidin-3-yl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (628, 15 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 345.0. *H NMR (300 MHz, D20) δ 6.48 (s, 1H), 4.62 (d, / = 5.2 Hz, 1H), 4.47 - 4.22 (m, 5H), 4.15 - 4.12 (m, 1H), 3.17 - 3.03 (m, 1H), 2.91 (d, / = 12.0 Hz, 1H), 2.24 - 2.17 (m, 1H), 2.12 - 2.00 (m, 2H), 1.90 - 1.80 (m, 1H). CB- 606,122. Example 32: Synthesis of (2S,5R)-2-(5-(2-(azetidin-3-yl)ethyl)isoxazol-3-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 629)
Figure imgf000085_0001
Synthetic scheme:
y\ LiAIH4 TsCI, DCM NaCN, DMSO
BocN
^OMe THF, 0 °C,1 h TEA, 40 °C, 17h OTs 100 °C, 17h
86% 64%
Figure imgf000085_0002
(2S,5R)-2-(5-(2-(azetidin-3-yl)ethyl)isoxazol-3-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (629, 34 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 373.0. 1H NMR (300 MHz, DMSO) δ 8.33 (br s, 2H), 6.33 (s, 1H), 4.45 (d, / = 6.4 Hz, 1H), 4.01 (br s, 1H), 3.92 (t, / = 9.0 Hz, 2H), 3.61 (t, / = 9.0 Hz, 2H), 3.40 - 3.26 (m, 1H), 2.94- 2.88 (m, 1H), 2.85 - 2.70 (m, 4H), 2.16 - 2.08 (m, 1H), 2.06 - 1.87 (m, 3H), 1.84 - 1.67 (m, 1H). Example 33: Synthesis of(2S,5R)-7-oxo-2-(5-(pyrrolidin-3-ylmethyl)isoxazol-3-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 630)
Figure imgf000086_0001
Synthetic scheme:
Pd/C, H2
Figure imgf000086_0002
95%
Figure imgf000086_0003
Characterization:
(2S,5R)-7-oxo-2-(5-(pyrrolidin-3-ylmethyl)isoxazol-3-yl)-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (630, 9 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 371.0. 1H NMR (300 MHz, D20) δ 6.29 (s, 1H), 4.59 (d, / = 6.6 Hz, 1H), 4.12 (br s, 1H), 3.43 (dd, / = 7.6, 5.0 Hz, 1H), 3.39 - 3.29 (m, 1H), 3.26 - 3.14 (m, 1H), 3.12 - 3.03 (m, 1H), 2.97 - 2.85 (m, 4H), 2.74 - 2.61 (m, 1H), 2.20 - 2.00 (m, 4H), 1.87 - 1.78 (m, 1H), 1.74 - 1.60 (m, 1H).
Example 34: Construction of Isogenic β-lactamase strains
A set of β-lactamase expressing isogenic E. coli strains was constructed by cloning a β-lactamase gene into a customized derivative of pBR322 (GenBank Accession Number JO 1749) and transforming the engineered plasmids into E. coli. The Ndel restriction site within the plasmid backbone of pBR322 was removed to generate pBR322 ANdel. The pBR322 ANdel vector itself, minus the bla TEM-l gene, was amplified using two primers: (1) pBR-Pbla 5 ' -cgcatatgactcttcctttttcaatattattg-3 , SEQ ID 1, a primer with an engineered Ndel restriction site at the 3' end of the WaTEM-1 promoter and (2) pBR-vec-1 5'- gcggatccctgtcagaccaagtttactc-3 ' , SEQ ID 2, a primer with an engineered BamHl restriction site at the 3' end of the WaTEM-1 open reading frame. The chloramphenicol resistance gene, cat, was generated by PCR amplification from pKD3 (GenBank Accession Number
AY048742) using primers with an engineered Ndel restriction site at the 5 ' end (Pb la-cat 5'- gccatatgatggagaaaaaaatcactgg-3 ' , SEQ ID 3) and an engineered BamHl restriction site at the 3' end ( Vec- 1 -cat 5 ' -cgggatccctagagaataggaacttcgg-3 ' , SEQ ID 4)of the resistance gene. The two PCR products, pBR322 ANdel and cat were ligated together generating pBR-CBST (pBR322 ANdel ATEM-l wcat Seq. ID 5) which retains both the pBR322 tetracycline resistance cassette, tetA, and the plasmid origin of replication but the WaTEM-1 gene was replaced by the cat gene.
Using this engineering strategy a number of plasmids producing β-lactamase genes from different classes (see below) were generated using synthetic genes with an engineered Ndel restriction site at the 5 ' end and BamHl restriction site at the 3 ' end of each gene (GenScript). Both the synthetic β-lactamase genes and cat gene were ligated into the NdeUBamHl sites of the pBR322 ANdel PCR product and transformed into electrocompetent E. coli ElectroMax DH10B (Invitrogen/Life Technologies). E. coli DH10B harboring the recombinant plasmids were selected on LB agar (supplemented with 25 μg/mL tetracycline) and single isolated colonies were then inoculated into 5 mL LB media (supplemented with 25 μg/mL tetracycline), and incubated at 37°C with aeration (250 rpm) for 18 hrs. The cultures were frozen back at -80°C in 20% glycerol. The DNA sequence of the cloned β- lactamase genes was confirmed. The β-lactamase gene expression in the recombinant E. coli strains was driven by the blaTEM-l promoter in the pBR-CBST plasmid and was characterized by MIC profiling of the E. coli recombinant strains against comparator β- lactam/BLI combinations in broth microdilution assay.
Figure imgf000087_0001
β-Lactamase
Gene
Sequence
KPC-2 pBR-CBST-KPC-2 A K. pneumoniae EU784136
SEQID 6
CTX-M-15 pBR-CBST-CTX-M-15 A K. pneumoniae JF775516
SEQ ID 7
SHV-12 pBR-CBST-SHV-12 A K. pneumoniae AY008838
SEQ ID 8
P99 AmpC pBR-CBST-P99 AMPC C E. cloacea X07274
SEQ ID 9
OXA-15 pBR-CBST-OXA-15 D P. aeruginosa PAU63835
SEQ ID 10
pBR-CBST-KPC-4
KPC-4 A K. pneumoniae EU447304
SEQ ID 11
pBR-CBST-DHA-1
DHA-1 C K. pneumoniae AY585202
SEQ ID 12
pBR-CBST-ADC-33
ADC-33 C A.baumannii EU687478
SEQ ID 13
Nucleotide Sequences of pBR-CBST Plasmids (Containing β-Lactamase or cat Genes) Used in the E. coli Isogenic Strains (relevant restriction sites are underlined; β-lactamase sequences in all caps, tetA sequence is in italics) pBR-CBST-cat SEQ ID 5
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGAGAAAAAAATCACTGGATATACCACCGTTGATATAT CCCAATGGCATCGT AAAGA ACATTTTGAGGCATTTCAGTCAGTTGCTC AATGTAC CTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAA AATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGC TCATACGGAATTTCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAG TGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCT GGAGTGAATACCACGACGATTTCCGGCAGTTTCTAC ACATATATTCGCAAGATGT GGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATG TTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGC CAATATGGACAACTTCTTCGCCCCCGTTTTCACTATGGGCAAATATTATACGCAA GGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATG GCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCA GGGCGGGGCGTAAGTGGCAGGGCGGGGCGTAAGGCGCGCCATTTAAATGAAGTT CCTATTCCGAAGTTCCTATTCTCTAGggatccctgtcagaccaagtttactcatatatactttagattgatttaaaa cttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttc tagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgc cagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttc gtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccg aagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaa acgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataa ccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaa gagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgc atagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccct gacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatca ccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagct cgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccg tgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcc cggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcg cttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgac ttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttc acgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgat catgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttct gccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgcc ggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgccta caatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggct ggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatc ccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagccc agcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcg agggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgac ccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgc ccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcag cccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtc ggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacg ggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcgga cagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtc ggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccg aggfligflcgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttat cgatgataagctgtcaaacatgagaa pBR-CBST-KPC-2 SEP ID 6
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcalATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCA TGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGACCAACCTCGTCGCGGAACCAT TCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATAC CGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAG CTCATTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCC GGCTTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCCGTGGTCAC CCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGG CCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGG CGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGT CTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGAT ACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCT GCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACG ACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGAC AAAACCGGAACCTGCGGAGTGTATGGCACGGCAAATGACTATGCCGTCGTCTGG CCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGG ATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCTAGACTCGCGCTCGAGG GATTGGGCGTCAACGGGCAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcgg tggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgc acacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-CTX-M-15 SEP ID 7 ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCT GACCTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCAC TGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATA AGCTGATTGCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCT GGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCAT TCCGGGCGATCCGCGTGATACCACTTCACCTCGGGCAATGGCGCAAACTCTGCGG AATCTGACGCTGGGTAAAGCATTGGGCGACAGCCAACGGGCGCAGCTGGTGACA TGGATGAAAGGCAATACCACCGGTGCAGCGAGCATTCAGGCTGGACTGCCTGCT TCCTGGGTTGTGGGGGATAAAACCGGCAGCGGTGGCTATGGCACCACCAACGAT ATCGCGGTGATCTGGCCAAAAGATCGTGCGCCGCTGATTCTGGTCACTTACTTCA CCCAGCCTCAACCTAAGGCAGAAAGCCGTCGCGATGTATTAGCGTCGGCGGCTA AAATCGTCACCGACGGTTTGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttca tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacc ccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggt ggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtg gcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gflcgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-SHV-12 SEP ID 8
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGCGTTATATTCGCCTGTGTATTATCTCCCTGTTAGCCACC CTGCCGCTGGCGGTACACGCCAGCCCGCAGCCGCTTGAGCAAATTAAACAAAGC GAAAGCCAGCTGTCGGGCCGCGTAGGCATGATAGAAATGGATCTGGCCAGCGGC CGCACGCTGACCGCCTGGCGCGCCGATGA ACGCTTTCCCATGATGAGCACCTTTA AAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGC TGGAGCGAAAGATCCACTATCGCCAGCAGGATCTGGTGGACTACTCGCCGGTCA GCGAAAAACACCTTGCCGACGGCATGACGGTCGGCGAACTCTGCGCCGCCGCCA TTACCATGAGCGATAACAGCGCCGCCAATCTGCTGCTGGCCACCGTCGGCGGCCC CGCAGGATTGACTGCCTTTTTGCGCCAGATCGGCGAC AACGTCACCCGCCTTGAC CGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACT ACCCCGGCCAGCATGGCCGCGACCCTGCGCAAGCTGCTGACCAGCCAGCGTCTG AGCGCCCGTTCGCAACGGCAGCTGCTGCAGTGGATGGTGGACGATCGGGTCGCC GGACCGTTGATCCGCTCCGTGCTGCCGGCGGGCTGGTTTATCGCCGATAAGACCG GAGCTAGCAAGCGGGGTGCGCGCGGGATTGTCGCCCTGCTTGGCCCGAATAACA AAGCAGAGCGCATTGTGGTGATTTATCTGCGGGATACCCCGGCGAGCATGGCCG AGCGAAATCAGCAAATCGCCGGGATCGGCGCGGCGCTGATCGAGCACTGGCAAC GCTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaa ctctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaa ctctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggac tcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacct acaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaag cggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacct ctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgg ccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgct cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatct gtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacg tgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacag acaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctc atcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttc tgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgata ccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactg gcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggt agccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaa ccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgcta accagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgct gcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctc cgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccaticflggicgflggiggcccggcic catgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgc cgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctg tccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcat aatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatg gcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagc gacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgag ttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaagg ctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcacc gccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccg aaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacct gtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatgatcgcgtagtcgata gtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcataga aattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggccc ggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttca iacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaa pBR-CBST-P99 SEP ID 9
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGATGAGAAAATCCCTTTGCTGCGCCCTGCTGCTCGGCAT CTCTTGCTCTGCTCTCGCCACGCCAGTGTCAGAAAAACAGCTGGCGGAGGTGGTC GCGAATACGATTACCCCGCTGATGAAAGCCCAGTCTGTTCCAGGCATGGCGGTG GCCGTTATTTATCAGGGAAAACCGCACTATTACACATTTGGCAAGGCCGATATCG CGGCGAATAAACCCGTTACGCCTCAGACCCTGTTCGAGCTGGGTTCTATAAGTAA AACCTTCACCGGCGTTTTAGGTGGGGATGCCATTGCTCGCGGTGAAATTTCGCTG GACGATGCGGTGACCAGATACTGGCCACAGCTGACGGGCAAGCAGTGGCAGGGT ATTCGTATGCTGGATCTCGCCACCTACACCGCTGGCGGCCTGCCGCTACAGGTAC CGGATGAGGTCACGGATAACGCCTCCCTGCTGCGCTTTTATCAAAACTGGCAGCC GCAGTGGAAGCCTGGCACAACGCGTCTTTACGCCAACGCCAGCATCGGTCTTTTT GGTGCGCTGGCGGTCAAACCTTCTGGCATGCCCTATGAGCAGGCCATGACGACG CGGGTCCTTAAGCCGCTCAAGCTGGACCATACCTGGATTAACGTGCCGAAAGCG GAAGAGGCGCATTACGCCTGGGGCTATCGTGACGGTAAAGCGGTGCGCGTTTCG CCGGGTATGCTGGATGCACAAGCCTATGGCGTGAAAACCAACGTGCAGGATATG GCGAACTGGGTCATGGCAAACATGGCGCCGGAGAACGTTGCTGATGCCTCACTT AAGCAGGGCATCGCGCTGGCGCAGTCGCGCTACTGGCGTATCGGGTCAATGTAT CAGGGTCTGGGCTGGGAGATGCTCAACTGGCCCGTGGAGGCCAACACGGTGGTC GAGGGCAGCGACAGTAAGGTAGCACTGGCGCCGTTGCCCGTGGCAGAAGTGAAT CCACCGGCTCCCCCGGTCAAAGCGTCCTGGGTCCATAAAACGGGCTCTACTGGCG GGTTTGGCAGCTACGTGGCCTTTATTCCTGAAAAGCAGATCGGTATTGTGATGCT CGCGAAT ACAAGCTATCCGAACCCGGC ACGCGTTGAGGCGGCATACCATATCCT CGAGGCGCTACAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaa aggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaa gatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgcc ggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcg tgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccag cttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcg gacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtc ctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgc ggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgccttt gagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcg gtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat acactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgc tcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgag gcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccag aagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttct gttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgtt gtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatg taggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagact ttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtat cggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtgg ccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggttt gcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattoflggi cgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaa cccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcg agcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccgga agcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgc catgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagatt ccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccg gcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggag ctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttg aggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgcca ccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgc cagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatg atcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaa cgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatc ccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagc gcaiigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtca aacatgagaa pBR-CBST-OXA-15 SEP ID 10
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGCAATCCGAATCTTCGCGATACTTTTCTCCATTTTTTCT CTTGCCACTTTCGCGCATGCGCAAGAAGGCACGCTAGAACGTTCTGACTGGAGG AAGTTTTTCAGCGAATTTCAAGCCAAAGGCACGATAGTTGTGGCAGACGAACGC CAAGCGGATCGTGCCATGTTGGTTTTTGATCCTGTGCGATCGAAGAAACGCTACT CGCCTGCATCGACATTCAAGATACCTCATACACTTTTTGCACTTGATGCAGGCGC TGTTCGTGATGAGTTCCAGATTTTTCGATGGGACGGCGTTAACAGGGGCTTTGCA GGCCACAATCAAGACCAAGATTTGCGATCAGCAATGCGGAATTCTACTGTTTGGG TGTATGAGCTATTTGCAAAGGAAATTGGTGATGACAAAGCTCGGCGCTATTTGAA GAAAATCGACTATGGCAACGCCGGTCCTTCGACAAGTAATGGCGATTACTGGAT AGAAGGCAGCCTTGCAATCTCGGCGCAGGAGCAAATTGCATTTCTCAGGAAGCT CTATCGTAACGAGCTGCCCTTTCGGGTAGAACATCAGCGCTTGGTCAAGGATCTC ATGATTGTGGAAGCCGGTCGCAACTGGATACTGCGTGCAAAGACGGGCTGGGAA GGCCGTATGGGTTGGTGGGTAGGATGGGTTGAGTGGCCGACTGGCTCCGTATTCT TCGCACTGAATATTGATACGCCAAACAGAATGGATGATCTTTTCAAGAGGGAGG CAATCGTGCGGGCAATCCTTCGCTCTATTGAAGCGTTACCGCCCAACCCGGCAGT CAACTCGGACGCTGCGCGATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcat ttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacc ccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggt ggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtg gcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcg atgataagctgtcaaacatgagaa pBR-CBST-KPC-4 SEQ ID 11
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCA TGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGACCAACCTCGTCGCGGAACCAT TCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATAC CGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAG CTCATTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCC GGCTTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCGGTGGTCAC CCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGG CCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGG CGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGT CTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGAT ACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCT GCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACG ACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGAC AAAACCGGAACCTGCGGAGGGTATGGCACGGCAAATGACTATGCCGTCGTCTGG CCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGG ATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCTAGACTCGCGCTCGAGG GATTGGGCGTCAACGGGCAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcgg tggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgc acacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gflcgaigflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-DHA-1 SEQ ID 12
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGAAAAAATCGTTATCTGCAACACTGATTTCCGCTCTGCT GGCGTTTTCCGCCCCGGGGTTTTCTGCCGCTGATAATGTCGCGGCGGTGGTGGAC AGCACCATTAAACCGCTGATGGCACAGCAGGATATTCCCGGGATGGCGGTTGCC GTCTCCGTAAAGGGTAAGCCCTATTATTTCAATTATGGTTTTGCCGATATTCAGGC AAAACAGCCGGTCACTGAAAATACACTATTTGAGCTCGGATCTGTAAGTAAAAC TTTCACAGGTGTGCTGGGTGCGGTTTCTGTGGCGAAAAAAGAGATGGCGCTGAAT GATCCGGCGGCAAAATACCAGCCGGAGCTGGCTCTGCCGCAGTGGAAGGGGATC ACATTGCTGGATCTGGCTACCTATACCGCAGGCGGACTGCCGTTACAGGTGCCGG ATGCGGTAAAAAGCCGTGCGGATCTGCTGAATTTCTATCAGCAGTGGCAGCCGTC CCGGAAACCGGGCGATATGCGTCTGTATGCAAACAGCAGTATCGGCCTGTTTGGT GCTCTGACCGCAAACGCGGCGGGGATGCCGTATGAGCAGTTGCTGACTGCACGC ATCCTGGCACCGCTGGGGTTATCTCACACCTTTATTACTGTGCCGGAAAGTGCGC AAAGCCAGTATGCGTACGGTTATAAAAACAAAAAACCGGTCCGCGTGTCGCCGG GACAGCTTGATGCGGAATCTTACGGCGTGAAATCCGCCTCAAAAGATATGCTGC GCTGGGCGGAAATGAAT ATGGAGCCGTCACGGGCCGGTAATGCGGATCTGGAAA TGGCAATGTATCTCGCCCAGACCCGCTACTATAAAACCGCCGCGATTAACCAGG GGCTGGGCTGGGAAATGTATGACTGGCCGCAGCAGAAAGATATGATCATTAACG GTGTGACCAACGAGGTCGCATTGCAGCCGCATCCGGTAACAGACAACCAGGTTC AGCCGTATAACCGTGCTTCCTGGGTGCATAAAACGGGCGCAACAACTGGTTTCGG CGCCTATGTCGCCTTTATTCCGGAAAAACAGGTGGCGATTGTGATTCTGGCGAAT AAAAACTACCCGAATACCGAAAGAGTCAAAGCTGCACAGGCTATTTTGAGTGCA CTGGAATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggt gaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaagga tcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagag ctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccact tcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgg gttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga acgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatc cggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggttt cgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacg gttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctg ataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctcctt acgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgcta tcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatcc gcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggt aaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgt ctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatggggg taatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaa acaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttcca cagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacac ggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcatt ctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggaccca acgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcaca gttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccaticflggicgflggiggcc cggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgt gctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttg aagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaag aatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcg ataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccg caagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcct acgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttga gcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccac gccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccg cacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatgatcgcgtagtc gatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgca tagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagag gcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttaga iiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaa pBR-CBST-ADC-33 SEQ ID 13
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGCGATTTAAAAAAATTTCTTGTCTACTTTTATCCCCGCTT TTTATTTTTAGTACCTCAATTTATGCGGGCAATACACCAAAAG ACCAAGAAATTA AAAAACTGGTAGATCAAAACTTTAAACCGTTATTAGAAAAATATGATGTGCCAG GTATGGCTGTGGGTGTTATTCAAAATAATAAAAAGTATGAAATGTATTATGGTCT TCAATCTGTTCAAGATAAAAAAGCCGTAAATAGCAGTACCATTTTTGAGCTAGGT TCTGTCAGTAAATTATTTACCGCGACAGCAGGTGGATATGCAAAAAATAAAGGA AAAATCTCTTTTGACGATACGCCTGGT AAATATTGGAAAGAACTAAAAAACACA CCGATTGACCAAGTTAACTTACTTCAACTCGCGACGTATACAAGTGGTAACCTTG CCTTGCAGTTTCCAGATGAAGTAAAAACAGACCAACAAGTTTTAACTTTTTTCAA AGACTGGAAACCTAAAAACTCAATCGGTGAATACAGACAATATTCAAATCCAAG TATTGGCCTATTTGGAAAGGTTGTGGCTTTGTCTATGAATAAACCTTTCGACCAA GTCTTAGAAAAAACAATTTTTCCGGCCCTTGGCTTAAAACATAGCTATGTAAATG TACCTAAGACCCAGATGCAAAACTATGCATTTGGTTATAACCAAGAAAATCAGC CGATTCGAGTTAACCGCGGCCCACTCGATGCCGCCCCTGCGTATGGCGTCAAATC GACACTACCCGACATGTTGAGTTTTATTCATGCCAACCTTAACCCACAGAAATAT CCGGCTGATATTCAACGGGCAATTAATGAAACACATCAAGGGCGCTATCAAGTA AATACCATGTATCAGGCACTCGGTTGGGAAGAGTTTTCTTATCCGGCAACGTTAC AAACTTTATTAGACAGTAATTCAGAACAGATTGTGATGAAACCTAATAAAGTGA CTGCTATTTCAAAGGAACCTTCAGTTAAGATGTACCATAAAACTGGCTCAACCAA CGGTTTCGGAACGTATGTAGTGTTTATTCCTAAAGAAAATATTGGCTTAGTCATG TTAACCAATAAACGTATTCCAAATGAAGAGCGCATTAAGGCAGCTTATGCTGTGC TGAATGCAATAAAGAAATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcattttt aatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccg tagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt tgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagc cgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacac agcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggag aaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatct ttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccag caacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattac cgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcct gatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaag ccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggct tgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacg cgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtt tctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaaggg ggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttact ggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaa tacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtt tccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgc tcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgc acccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaag ggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttcc attcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatcc atgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaag agccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgc cgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgt cggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgt gcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagag cgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccg gaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagt agtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacgg ggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcga tataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtg gtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtg ctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaat ggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa Example 35: Standard BLI Potentiation MIC Assay
The ability of compounds to potentiate the activity of β-lactams was demonstrated by determining the minimum inhibitory concentrations (MIC) of β-lactam and BLI compound combinations against various β-lactamase producing bacterial strains using the broth microdilution method. The experimental protocol was performed according to Clinical and Laboratory Standards Institute (CLSI) guidelines with modifications as described below (CLSI guidelines can be derived from the CLSI document M07-A9 published in January 2012: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition").
To prepare for MIC testing, frozen glycerol stocks of clinical isolates {Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB). Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned β-lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 μg/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
On the day of testing, primary cultures were started by scraping off 5-10 colonies from the TSAB plates containing clinical strains or the tetracycline supplemented LB plates containing engineered strains. The clinical strain material was suspended in ~5 mL of cation adjusted Mueller Hinton Broth (CAMHB) in 14 mL culture tubes. The engineered strain material was suspended in CAMHB (supplemented with 25 μg/mL tetracycline) in 14 mL culture tubes. All strains were incubated at 37°C with aeration (200 rpm) for ~2 hrs until the optical density at 600 nm (OD600) was >0.1.
The two compound components of the assay were each diluted in CAMHB and added to the 96-well broth microdilution assay plates. 50 μL· of the β-lactam was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 μg/mL. 25 μL· of the BLI compound was added to all wells in the broth microdilution plates at a final concentration of 4 μg/mL. Inoculum cultures were prepared by standardizing the primary cultures to OD600 = 0.1 and then adding 20 μL· of the adjusted primary culture per 1 mL CAMHB for clinical strains or CAMHB (supplemented with tetracycline at 100 μg/mL) for engineered strains, so that the final inoculum density was ~105 colony forming units per milliliter. Diluted inoculum cultures were used to inoculate 25 μL· per well in 96-well broth microdilution assay plates. The final volume of each well was 100 μL· and contained a β- lactam at different concentrations, a BLIcompound at 4 μg/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 μg/mL.
Plates were incubated for 18-20 hours at 37°C with aeration (200 rpm). Following incubation, growth was confirmed visually placing plates over a viewing apparatus (stand with a mirror underneath) and then OD600 was measured using a SpectraMax 340PC384 plate reader (Molecular Devices, Sunnyvale, CA). Growth was defined as turbidity that could be detected with the naked eye or achieving minimum OD600 of 0.1. MIC values were defined as the lowest concentration producing no visible turbidity.
MIC values of representative compounds are shown in Table II.
Example 36: Synergy MIC (sMIC) Assay
The synergy MIC (sMIC) assay determines the concentration of the BLI required to potentiate the activity of a fixed concentration of a β-lactam antibiotic against β-lactamase producing bacterial strains. The experimental protocol was performed according to Clinical and Laboratory Standards Institute (CLSI) guidelines with modifications as described below (CLSI guidelines can be derived from the CLSI document M07-A9 published in January 2012: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition"). The assay is set-up by serially diluting the BLI across 11 of the 12 wells in each row of a 96-well broth microdilution assay plate, adding the β-lactam at a fixed concentration to all wells in the assay plate, inoculating the assay plate with bacterial strains, and determining the lowest concentration of BLI required to inhibit overnight bacterial growth. Bacterial growth in the 12th well of the assay plate, which contains the β-lactam at a fixed concentration but does not contain any BLI, demonstrates that the bacterial strains are resistant to the β-lactam antibiotic (e.g ceftolozane) at the fixed concentration of 4 μg/mL.
To prepare for MIC testing, frozen glycerol stocks of clinical isolates {Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB). Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned β-lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 μg/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
On the day of testing, primary cultures were started by scraping off 5-10 colonies from the TSAB plates containing clinical strains or the tetracycline supplemented LB plates containing engineered strains. The clinical strain material was suspended in ~5 mL of cation adjusted Mueller Hinton Broth (CAMHB) in 14 mL culture tubes. The engineered strain material was suspended in CAMHB (supplemented with tetracycline at 25 μg/mL) in 14 mL culture tubes. All strains were incubated at 37°C with aeration (200 rpm) for ~2 hrs until the OD600 was >0.1.
The two compound components of the assay were each prepared in CAMHB and added to the 96-well broth microdilution assay plates. 50 μL· of the BLI was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 μg/mL. 25 μL· of the β-lactam was added to all wells in the broth microdilution plates at a final concentration of 4 μg/mL. Inoculum cultures were prepared by standardizing the primary cultures to OD600 = 0.1 and then adding 20 μL· of the adjusted primary culture per 1 mL CAMHB for clinical strains or CAMHB (supplemented with tetracycline at 100 μg/mL) for isogenic strains, so that the final inoculum density was ~105 colony forming units per milliliter. Diluted inoculum cultures were used to inoculate 25 μL· per well in 96-well broth microdilution assay plates. The final volume of each well was 100 μL· and contained a BLI at different concentrations, a β-lactam at 4 μg/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 ug/mL.
Interpreting the sMIC data:
Plates were incubated for 18-20 hours at 37°C with aeration (200 rpm). Following incubation, growth was confirmed visually placing plates over a viewing apparatus (stand with a mirror underneath) and then OD600 was measured using a SpectraMax 340PC384 plate reader (Molecular Devices, Sunnyvale, CA). Growth was defined as turbidity that could be detected with the naked eye or achieving minimum OD600 of 0.1. sMIC values were defined as the lowest concentration producing no visible turbidity.
The sMIC values represent the amount of BLI required to potentiate the activity of 4 μg/ml of CXA-101 (Ceftolozane) or ceftazidime to inhibit the growth of the β-lactamase producing bacteria.
sMIC values of representative compounds are shown in Table III. Example 37: Inhibition Kinetics
Inhibition or inactivation of KPC-2 by test inhibitors was assessed using 100 μΜ nitrocefin (NCF) as a reporter substrate. Assays were performed in lx PBS pH 7.4, 0.1 mg/ml BSA, in 96-well half area plates, 50 μΐ reaction volume. NCF was dissolved in DMSO and diluted in assay buffer. Test inhibitors were dissolved in water or DMSO and serially diluted in the assay with final concentrations between 2000 - 0.195 μΜ.
The enzyme activity in the presence of varying concentrations of test inhibitor was determined by monitoring the hydrolysis of NCF spectrophotometrically at 486 nm, for 5 minutes, 25 °C, using a SpectraMax Plus384 microplate reader with SoftMax Pro software (Molecular Devices). Data analysis was performed using GraphPad Prism (GraphPad Software, Inc.).
Progress curves were fit to a first-order rate decay equation (Eq. 1) to determine ^observed
(fcobs)- kobs vs. inhibitor concentration [I] curves were then fit to Eq.2 to determine the inhibitor dissociation constant (K) and the first order rate constant of enzyme inactivation at infinite inhibitor concentration (fcnact). Table IV shows kinetics results from representative test compounds. A larger fcnact / ratio indicates a more effective enzyme inactivator.
Eq. 1
Figure imgf000102_0001
Where Y is the absorbance at time t, Vo is the uninhibited enzyme velocity, fcC S is the observed rate constant of the enzyme inactivation.
Eq. 2
Figure imgf000102_0002
Where S is the NCF concentration, Km is the KPC-2 Km for NCF

Claims

CLAIMS We claim:
1. A compound of Formula (I) or a pharmaceutically acceptable salt thereof:
Figure imgf000103_0001
wherein
— 5-OSO3H ; — ?-S03H ; — 5-OPO3H ; — -CH2C02H ; and— -CF2C02H
R is selected from ; and R1 is selected from:
Figure imgf000103_0002
wherein each of R3, R4 and R5 is independently selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1, 2 and 3;
Figure imgf000103_0003
wherein R6 is selected from
Figure imgf000104_0001
Figure imgf000104_0002
from H, (Ci-C3)-unsubstituted alkyl, amino-(C2- C3)-alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000104_0003
and wherein each of p and q is independently selected from 1 and 2. 2. A compound of Formula (A-I) or a pharmaceutically acceptable salt thereof:
Figure imgf000104_0004
wherein
R* is selected from
-^-OS03H ; — E>-S03H ; — £-OP03H ; — J>-CH2C02H ; and— £-CF2C02H
; and
, 1* selected from:
Figure imgf000104_0005
selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl,
aminocycloalkyl, hydroxyalkyl,
Figure imgf000105_0001
each of R , R , R and R is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R , R , R and R is hydrogen ,
n is selected from 1, 2, 3 and 4, and
Figure imgf000105_0002
wherein R is selected from -NH(Ci-C3)-alkyl and
wherein each of R , R , R and R is as described previously;
Figure imgf000105_0003
wherein Z is selected from CR9R10 and NR11,
each of R9 and R10 is independently selected from H, NH2, -NH(Ci-C3)-
alkyl and
Figure imgf000105_0004
, wherein each of R , R , R and R is as described previously,
alternatively, R9 and R10 together with the carbon to which they are attached, form a cycloalkyl or heterocyclyl ring containing 4-6 ring members,
R11 is selected from H and
Figure imgf000105_0005
, each of R12, R13 and R14 is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aammiinnooccyyccllooaallkkyyll,, aanndd hydroxyalkyl, provided that at least one of R , R and R14 is hydrogen,
R is selected from NH2 and
Figure imgf000106_0001
,
RJ* , R 6u* and R 7'* is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3, T is selected from NH and O,
t is selected from 0, 1, 2, 3, and 4, and
each of r and y is independently selected from 0 and 1 ;
d.
Figure imgf000106_0002
wherein R1& is selected from NH -NH C -C -alk l and
Figure imgf000106_0003
and R is as described previously,
s is selected from 0 and 1 , and,
v is selected from 0, 1,
2, and 3;
Figure imgf000106_0004
wherein R 18 is selected from NH2 and , wherein each
4 ζ
of IT , R , Ru and R' is as described previously,
R 17 is selected from amino and hydroxyl, and
w is selected from 0 and 1 ;
Figure imgf000107_0001
wherein M is selected from NR. , CR/URZ1 and O,
wherein R19 is selected from H and R
Figure imgf000107_0002
, where each of R , R13 and R14 is as described previously,
is independently selected from H, N¾ and
Figure imgf000107_0003
, wherein each of R , R , R and R is as described previously, and
0, 1 and 2; and h.
Figure imgf000107_0004
3. A pharmaceutical composition comprising a compound of claim 2 and at least 1 β-lactam antibiotic or a pharmaceutically acceptable salt thereof.
4. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a cephalosporin.
5. The pharmaceutical composition of claim 4 wherein the cephalosporin is
Ceftolozane.
6. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a carbapenem.
7. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a monobactam.
8. A method of treating or preventing a bacterial infection comprising
administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition according to claim 3.
9. A method of treating a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of claim 2.
10. The method of claim 9 wherein the β-lactam antibiotic is a cephalosporin.
11. The method of claim 10 wherein the cephalosporin is Ceftolozane.
12. The method of claim 9 wherein the β-lactam antibiotic is a carbapenem.
13. The method of claim 9 wherein the β-lactam antibiotic is a monobactam.
14. The method of either of claims 8 or 9 wherein the bacterial infection is caused by bacteria that produce a class A, class C or class D β-lactamase.
15. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce a class A or class C β-lactamase.
16. The method of claim 14 wherein the bacterial infections is caused by bacteria selected from Acinetobacter spp., Acinetobacter baumannii, Citrobacter spp., Escherichia spp., Escherichia coli, Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp., Klebsiella pneumoniae, Enterobacter spp., Entewbacter cloacae and Enterobacter aero genes
Pasteurella spp, Proteus spp., Proteus mirabilis, Serratia spp, Serratia marcescens, and Providencia spp.
17. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce a KPC-2 or KPC-3 β-lactamase.
18. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce an OXA-15 β-lactamase.
19. The method of either of claims 8 or 9 wherein the bacterial infection is caused by β-lactam resistant bacteria.
20. A method of treating or a bacterial infection in a subject in need thereof,
comprising the steps of
a. administering to the subject a compound of claim 2; and b. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic.
21. A method of treating a bacterial infection in a subject in need thereof,
comprising the steps of a. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic; and
b. administering to the subject a compound of claim 2.
22. Use of a compound of claim 2 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
23. Use of a composition of claim 3 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
24. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a class A, class C or class D β-lactamase.
25. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a class A or class C β-lactamase.
26. The use according to either of claims 22 or 23 wherein the bacterial infections is caused by bacteria selected from from Acinetobacter spp., Acinetobacter baumannii, Citrobacter spp., Escherichia spp., Escherichia coli, Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp., Klebsiella pneumoniae, Enterobacter spp., Enterobacter cloacae and
Enterobacter aerogenes Pasteurella spp, Proteus spp., Proteus mirabilis, Serratia spp, Serratia marcescens, and Providencia spp
27. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a KPC-2 or KPC-3 β-lactamase.
28. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce an OXA-15 β-lactamase.
29. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by β-lactam resistant bacteria.
30. Use of a compound of claim 2 to inhibit β-lactamase
31. A method of inhibiting β-lactamase comprising administering to a subject a compound of claim 2.
32. A compound of claim 2 wherein the binding affinity of the compound is at least 250 mM'V1.
33. The compound of claim 2, wherein the compound of Formula A-I has the
stereochemistry specified in Formula A-II \ (A-II)
or a pharmaceutically acceptable salt thereof.
34. The compound of claim 33, or a pharmaceutically acceptable salt thereof selected from
Figure imgf000110_0001
Figure imgf000111_0001
Figure imgf000112_0001
zu
Figure imgf000113_0001
Figure imgf000114_0001
35. The compound according to either of claims 2 or 3 wherein R is selected from
Figure imgf000114_0002
36. The compound according to claim 34 selected from
Figure imgf000114_0003
37. The compound according to claim 36 or a pharmaceutically- acceptable salt thereof of the Formula
Figure imgf000115_0001
38. The compound according to claim 36 or a pharmaceutically-acceptable salt thereof of the Formula
Figure imgf000115_0002
39. A pharmaceutical composition comprising a compound of claim 37 and
Ceftolozane.
40. A pharmaceutical composition comprising a compound of claim 38 and
Ceftolozane.
41. A method of treating or preventing a bacterial infection comprising
administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition according to claim 39.
42. A method of treating or preventing a bacterial infection comprising
administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition according to claim 40.
43. The method according to claim 9 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000116_0001
44. The method according to claim 9 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000116_0002
45. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000116_0003
46. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is .
Figure imgf000117_0001
47. The method according to claim 21 wherein β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000117_0002
48. The method according to claim 21 wherein β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is .
Figure imgf000117_0003
49. The use according to claim 22, wherein the compound is
Figure imgf000118_0001
50. The use according to claim 22, wherein the compound is
Figure imgf000118_0002
PCT/US2013/034589 2012-03-30 2013-03-29 ISOXAZOLE β-LACTAMASE INHIBITORS Ceased WO2013149136A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2015503634A JP2015512419A (en) 2012-03-30 2013-03-29 Isooxazole β-lactamase inhibitor
MX2014011825A MX2014011825A (en) 2012-03-30 2013-03-29 Isoxazole î²-lactamase inhibitors.
CA2869051A CA2869051A1 (en) 2012-03-30 2013-03-29 Isoxazole .beta.-lactamase inhibitors
KR1020147030476A KR20150003777A (en) 2012-03-30 2013-03-29 ISOXAZOLE β-LACTAMASE INHIBITORS
EP13769389.1A EP2831069B1 (en) 2012-03-30 2013-03-29 Isoxazole beta-lactamase inhibitors
CN201380027972.3A CN104334555A (en) 2012-03-30 2013-03-29 Isoxazole beta-lactamase inhibitors
AU2013237869A AU2013237869A1 (en) 2012-03-30 2013-03-29 Isoxazole beta-lactamase inhibitors
SG11201406120SA SG11201406120SA (en) 2012-03-30 2013-03-29 ISOXAZOLE β-LACTAMASE INHIBITORS
IL234845A IL234845A0 (en) 2012-03-30 2014-09-28 Isoxazole β-lactamase inhibitors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261618127P 2012-03-30 2012-03-30
US61/618,127 2012-03-30
US201361790248P 2013-03-15 2013-03-15
US61/790,248 2013-03-15

Publications (1)

Publication Number Publication Date
WO2013149136A1 true WO2013149136A1 (en) 2013-10-03

Family

ID=49261287

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/034589 Ceased WO2013149136A1 (en) 2012-03-30 2013-03-29 ISOXAZOLE β-LACTAMASE INHIBITORS

Country Status (14)

Country Link
US (3) US8927724B2 (en)
EP (1) EP2831069B1 (en)
JP (1) JP2015512419A (en)
KR (1) KR20150003777A (en)
CN (1) CN104334555A (en)
AR (1) AR090589A1 (en)
AU (1) AU2013237869A1 (en)
CA (1) CA2869051A1 (en)
CO (1) CO7091182A2 (en)
IL (1) IL234845A0 (en)
MX (1) MX2014011825A (en)
SG (1) SG11201406120SA (en)
TW (1) TW201343646A (en)
WO (1) WO2013149136A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015066413A1 (en) 2013-11-01 2015-05-07 Novartis Ag Oxazolidinone hydroxamic acid compounds for the treatment of bacterial infections
WO2015136473A1 (en) * 2014-03-14 2015-09-17 Wockhardt Limited A process for preparation of sodium (2s, 5r)-6-(benzyloxy)-7-oxo-1,6-diazabicyclo[3.2.1]octane-2-carboxylate
WO2015148379A1 (en) 2014-03-24 2015-10-01 Novartis Ag Monobactam organic compounds for the treatment of bacterial infections
US9309245B2 (en) 2012-04-02 2016-04-12 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
WO2017055922A1 (en) * 2015-10-02 2017-04-06 Legochem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
CN106699756A (en) * 2016-12-30 2017-05-24 淄博鑫泉医药技术服务有限公司 Method for synthesizing beta-lactamase inhibitor Avibactam
WO2018060926A1 (en) 2016-09-28 2018-04-05 Novartis Ag Beta-lactamase inhibitors
WO2019105479A1 (en) 2017-12-01 2019-06-06 南京明德新药研发股份有限公司 CRYSTAL FORM OF β-LACTAMASE INHIBITOR AND PREPARATION METHOD THEREFOR
US10376499B2 (en) 2014-11-17 2019-08-13 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
WO2019145784A3 (en) * 2018-01-26 2019-09-06 Legochem Biosciences, Inc. Combination therapies for multi-drug resistant pathogens
US10800778B2 (en) 2016-09-16 2020-10-13 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
US11046694B2 (en) 2017-05-08 2021-06-29 Entasis Therapeutics, Inc. Compounds and methods for treating bacterial infections
US11905286B2 (en) 2018-08-09 2024-02-20 Antabio Sas Diazabicyclooctanones as inhibitors of serine beta-lactamases
US12378244B2 (en) 2018-08-09 2025-08-05 Antabio Sas Diazabicyclooctanones as inhibitors of serine β-lactamases

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8969570B2 (en) * 2012-03-30 2015-03-03 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
US20150038482A1 (en) * 2012-03-30 2015-02-05 Cubist Pharmaceuticals, Inc. Isoxazole beta-lactamase inhibitors
US8916709B2 (en) * 2012-03-30 2014-12-23 Cubist Pharmaceuticals, Inc. 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors
MX2014011825A (en) 2012-03-30 2015-02-20 Cubist Pharm Inc Isoxazole î²-lactamase inhibitors.
KR20140144254A (en) * 2012-03-30 2014-12-18 큐비스트 파마슈티컬즈 인코포레이티드 1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE β-LACTAMASE INHIBITORS
WO2014152996A1 (en) 2013-03-14 2014-09-25 Cubist Pharmaceuticals, Inc. Crystalline form of a beta-lactamase inhibitor
US20140274996A1 (en) 2013-03-15 2014-09-18 Cubist Pharmaceuticals, Inc. Tazobactam and ceftolozane antibiotic compositions
US9872906B2 (en) 2013-03-15 2018-01-23 Merck Sharp & Dohme Corp. Ceftolozane antibiotic compositions
WO2015051101A1 (en) 2013-10-02 2015-04-09 Cubist Pharmaceuticals, Inc. B-lactamase inhibitor picoline salt
CN105348173B (en) * 2015-12-02 2017-12-15 中山奕安泰医药科技有限公司 The method of asymmetric catalytic hydrogenation method synthesis AVM hereinafter Batan intermediate 5
KR102392350B1 (en) * 2016-06-03 2022-04-29 치루 파머수티컬 컴퍼니 리미티드 Novel β-lactamase inhibitors
CN108239089B (en) * 2016-12-27 2020-05-22 浙江医药股份有限公司新昌制药厂 Method for synthesizing avibactam sodium
CN109970625B (en) * 2017-12-28 2021-02-26 新发药业有限公司 Preparation method of 5R-benzyloxyaminopiperidine-2S-formic acid or derivative thereof
EP3744722A4 (en) 2018-01-25 2021-11-03 Suzhou Sinovent Pharmaceuticals Co., Ltd. SS LACTAMASE INHIBITORS AND USES THEREOF
CN117384169B (en) * 2022-07-05 2025-10-17 福安药业集团重庆三禾兴医药科技有限公司 Thiazole amine-diazabicyclo octanone conjugated derivative and application thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US5039660A (en) 1988-03-02 1991-08-13 Endocon, Inc. Partially fused peptide pellet
WO2008039420A2 (en) 2006-09-27 2008-04-03 Merck & Co., Inc. Novel inhibitors of beta-lactamase
WO2009133442A1 (en) * 2008-04-29 2009-11-05 Novexel Azabicyclic compounds, preparation thereof and use of same as drugs, especially beta-lactamase inhibitors
KR20100130176A (en) * 2008-01-18 2010-12-10 머크 샤프 앤드 돔 코포레이션 Betazalactamase inhibitor

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2812635B1 (en) 2000-08-01 2002-10-11 Aventis Pharma Sa NOVEL HETEROCYCLIC COMPOUNDS, PREPARATION AND USE AS MEDICAMENTS IN PARTICULAR AS ANTI-BACTERIALS
US20130059774A1 (en) 2000-08-01 2013-03-07 Mahesh Vithalbhai Patel Efflux pump inhibitors
FR2835186B1 (en) 2002-01-28 2006-10-20 Aventis Pharma Sa NOVEL HETEROCYCLIC COMPOUNDS ACTIVE AS BETA-LACTAMASES INHIBITORS
US20090275552A1 (en) 2006-04-28 2009-11-05 Mahesh Vithalbhai Patel Therapy for Treating Resistant Bacterial Infections
FR2921060B1 (en) 2007-09-14 2012-06-15 Novexel NOVEL PROCESS FOR PREPARING DISUBSIDED PIPERIDINE AND NOVEL INTERMEDIATES
US20100120715A1 (en) 2007-11-13 2010-05-13 Burns Christopher J Beta-lactamase inhibitors
EP3260551A1 (en) 2008-06-19 2017-12-27 Astra Zeneca Holding France Use of (1r,2s,5r) 1,6-diazabicyclo [3.2.1] octane-2-carboxamide, 7-oxo-6-(sulfooxy)-, monosodium salt as a diagnostic reagent for detecting serine beta-lactamases
FR2936798B1 (en) * 2008-10-03 2012-09-28 Novexel NOVEL HETEROCYCLIC NITROGEN COMPOUNDS, THEIR PREPARATION AND THEIR USE AS ANTIBACTERIAL MEDICINES.
WO2010118361A1 (en) 2009-04-09 2010-10-14 Sopharmia, Inc. Beta lactamase inhibitors
WO2010126820A2 (en) 2009-04-30 2010-11-04 Merck Sharp & Dohme Corp. Preparation of alkyl esters of n-protected oxo-azacycloalkylcarboxylic acids
FR2951171A1 (en) 2009-10-09 2011-04-15 Novexel NOVEL SODIUM SALT OF A CRYSTALLIZED ENANTIOMER AZABICYCLIC COMPOUND AND NOVEL POLYMORPHIC AND PSEUDOPOLYMORPHIC FORMS AND THEIR PREPARATION
EP2536408A1 (en) 2010-02-16 2012-12-26 Wockhardt Research Centre Efflux pump inhibitors
CN103328476B (en) 2010-12-22 2016-12-28 明治制果药业株式会社 Optically active diazacyclooctane derivatives and preparation methods thereof
US8772490B2 (en) 2010-12-22 2014-07-08 Meiji Seika Pharma Co., Ltd. Optically active diazabicyclooctane derivatives and process for preparing the same
US8829191B2 (en) 2011-06-17 2014-09-09 Melanie Simone Ronsheim Processes for preparing heterocyclic compounds including trans-7-oxo-6-(sulphooxy)-1,6-diazabicyclo[3,2,1]octane-2-carboxamide and salts thereof
MX362683B (en) 2011-07-26 2019-01-31 Wockhardt Ltd Pharmaceutical compositions comprising beta-lactam antibiotic, sulbactam and beta-lactamase inhibitor.
MX338610B (en) 2011-07-26 2016-04-25 Wockhardt Ltd Pharmaceutical compositions comprising sulbactam and beta-lactamase inhibitor.
KR101618424B1 (en) 2011-08-30 2016-05-04 욱크하르트 리미티드 1,6-diazabicyclo[3,2,1]octan-7-one derivatives and their use in the treatment of bacterial infections
BR112014003476A2 (en) 2011-09-13 2017-03-01 Wockhardt Ltd nitrogen-containing compounds and their use
KR20140144254A (en) * 2012-03-30 2014-12-18 큐비스트 파마슈티컬즈 인코포레이티드 1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE β-LACTAMASE INHIBITORS
US8969570B2 (en) * 2012-03-30 2015-03-03 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
MX2014011825A (en) 2012-03-30 2015-02-20 Cubist Pharm Inc Isoxazole î²-lactamase inhibitors.
US8916709B2 (en) * 2012-03-30 2014-12-23 Cubist Pharmaceuticals, Inc. 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US5039660A (en) 1988-03-02 1991-08-13 Endocon, Inc. Partially fused peptide pellet
WO2008039420A2 (en) 2006-09-27 2008-04-03 Merck & Co., Inc. Novel inhibitors of beta-lactamase
KR20100130176A (en) * 2008-01-18 2010-12-10 머크 샤프 앤드 돔 코포레이션 Betazalactamase inhibitor
WO2009133442A1 (en) * 2008-04-29 2009-11-05 Novexel Azabicyclic compounds, preparation thereof and use of same as drugs, especially beta-lactamase inhibitors

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", MACK PUBLISHING COMPANY
BUSH, K.; JACOBY, G. A.: "Updated Functinal Classification of P-Lactamases", ANTIMICROB. AGENTS CHEMOTHER., vol. 54, 2010, pages 969 - 976, XP055036576, DOI: doi:10.1128/AAC.01009-09
GOODMAN; GILMAN'S: "The Pharmaceutical Basis of Therapeutics", PERGAMON PRESS
IAN K. MANGION ET AL.: "A Concise of a beta-Lactamase Inhibitor", ORGANIC LETTERS, vol. 13, no. 20, 21 October 2011 (2011-10-21), pages 5480 - 5483, XP055033007 *
See also references of EP2831069A4

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9309245B2 (en) 2012-04-02 2016-04-12 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
US9623014B2 (en) 2012-04-02 2017-04-18 Entasis Therapeutics Limited β-lactamase inhibitor compounds
WO2015066413A1 (en) 2013-11-01 2015-05-07 Novartis Ag Oxazolidinone hydroxamic acid compounds for the treatment of bacterial infections
WO2015136473A1 (en) * 2014-03-14 2015-09-17 Wockhardt Limited A process for preparation of sodium (2s, 5r)-6-(benzyloxy)-7-oxo-1,6-diazabicyclo[3.2.1]octane-2-carboxylate
CN106458896A (en) * 2014-03-14 2017-02-22 沃克哈特有限公司 A process for preparation of sodium (2s, 5r)-6-(benzyloxy)-7-oxo-1,6-diazabicyclo[3.2.1]octane-2-carboxylate
US9790223B2 (en) 2014-03-14 2017-10-17 Wockhardt Limited Process for preparation of sodium (2S,5R)-6-(benzyloxy)-7-oxo-1,6-diazabicyclo[3.2.1]octane-2-carboxylate
WO2015148379A1 (en) 2014-03-24 2015-10-01 Novartis Ag Monobactam organic compounds for the treatment of bacterial infections
EP3511328A1 (en) 2014-03-24 2019-07-17 Novartis AG Monobactam organic compounds for the treatment of bacterial infections
US10376499B2 (en) 2014-11-17 2019-08-13 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
EP3356357A4 (en) * 2015-10-02 2019-02-20 LegoChem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
WO2017055922A1 (en) * 2015-10-02 2017-04-06 Legochem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
US9951072B2 (en) 2015-10-02 2018-04-24 Legochem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
US10273235B2 (en) 2015-10-02 2019-04-30 Legochem Biosciences, Inc. Compositions and methods for inhibiting β-lactamase
US10800778B2 (en) 2016-09-16 2020-10-13 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
WO2018060926A1 (en) 2016-09-28 2018-04-05 Novartis Ag Beta-lactamase inhibitors
US10065957B2 (en) 2016-09-28 2018-09-04 Novartis Ag Beta-lactamase inhibitors
US10597396B2 (en) 2016-09-28 2020-03-24 Novartis Ag Beta-lactamase inhibitors
EP3698796A1 (en) 2016-09-28 2020-08-26 Novartis AG Pharmaceutical combination of a tricyclic beta-lactamase inhibitor with specific beta-lactam antibiotics
CN106699756A (en) * 2016-12-30 2017-05-24 淄博鑫泉医药技术服务有限公司 Method for synthesizing beta-lactamase inhibitor Avibactam
US11046694B2 (en) 2017-05-08 2021-06-29 Entasis Therapeutics, Inc. Compounds and methods for treating bacterial infections
WO2019105479A1 (en) 2017-12-01 2019-06-06 南京明德新药研发股份有限公司 CRYSTAL FORM OF β-LACTAMASE INHIBITOR AND PREPARATION METHOD THEREFOR
US11180501B2 (en) 2017-12-01 2021-11-23 Qilu Pharmaceutical Co., Ltd. Crystal form of β-lactamase inhibitor and preparation method therefor
WO2019145784A3 (en) * 2018-01-26 2019-09-06 Legochem Biosciences, Inc. Combination therapies for multi-drug resistant pathogens
US11905286B2 (en) 2018-08-09 2024-02-20 Antabio Sas Diazabicyclooctanones as inhibitors of serine beta-lactamases
US12378244B2 (en) 2018-08-09 2025-08-05 Antabio Sas Diazabicyclooctanones as inhibitors of serine β-lactamases

Also Published As

Publication number Publication date
TW201343646A (en) 2013-11-01
AU2013237869A1 (en) 2014-10-23
CN104334555A (en) 2015-02-04
CA2869051A1 (en) 2013-10-03
AR090589A1 (en) 2014-11-26
KR20150003777A (en) 2015-01-09
US20130345190A1 (en) 2013-12-26
US20140323459A1 (en) 2014-10-30
IL234845A0 (en) 2014-12-31
JP2015512419A (en) 2015-04-27
US20150038479A1 (en) 2015-02-05
SG11201406120SA (en) 2014-10-30
EP2831069A4 (en) 2015-06-03
EP2831069A1 (en) 2015-02-04
CO7091182A2 (en) 2014-10-21
US8927724B2 (en) 2015-01-06
MX2014011825A (en) 2015-02-20
EP2831069B1 (en) 2017-07-12

Similar Documents

Publication Publication Date Title
EP2831069B1 (en) Isoxazole beta-lactamase inhibitors
EP2831075B1 (en) 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors
US8916709B2 (en) 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors
EP2872510B1 (en) 1,6-diazabicyclo[3,2,1]octan-7-one derivatives and their use in the treatment of bacterial infections
CA2833241C (en) 1,6-diazabicyclo [3,2,1] octan-7-one derivatives and their use in the treatment of bacterial infections
US9120795B2 (en) Crystalline form of a β-lactamase inhibitor
US20140315876A1 (en) Beta-lactamase inhibitors
US20150038482A1 (en) Isoxazole beta-lactamase inhibitors
US11865108B2 (en) Nitrogen containing bicyclic compounds

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13769389

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2015503634

Country of ref document: JP

Kind code of ref document: A

Ref document number: 2869051

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/011825

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 14222853

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014024442

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2013237869

Country of ref document: AU

Date of ref document: 20130329

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2013769389

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013769389

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147030476

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112014024442

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140930