WO2013149121A1 - 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors - Google Patents

1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors Download PDF

Info

Publication number
WO2013149121A1
WO2013149121A1 PCT/US2013/034562 US2013034562W WO2013149121A1 WO 2013149121 A1 WO2013149121 A1 WO 2013149121A1 US 2013034562 W US2013034562 W US 2013034562W WO 2013149121 A1 WO2013149121 A1 WO 2013149121A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
formula
compounds
oxo
lactam antibiotic
Prior art date
Application number
PCT/US2013/034562
Other languages
French (fr)
Other versions
WO2013149121A8 (en
Inventor
Yu Gui Gu
Yong He
Ning Yin
Dylan C. ALEXANDER
Jason B. CROSS
Chester A. Metcalf
Robert Busch
Original Assignee
Cubist Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201380028018.6A priority Critical patent/CN104334558A/en
Application filed by Cubist Pharmaceuticals, Inc. filed Critical Cubist Pharmaceuticals, Inc.
Priority to MX2014011827A priority patent/MX2014011827A/en
Priority to KR1020147030475A priority patent/KR20140144254A/en
Priority to SG11201406123TA priority patent/SG11201406123TA/en
Priority to CA2868553A priority patent/CA2868553A1/en
Priority to JP2015503631A priority patent/JP2015514095A/en
Priority to AU2013237939A priority patent/AU2013237939A1/en
Priority to RU2014143821A priority patent/RU2014143821A/en
Priority to EP13769724.9A priority patent/EP2831075B1/en
Publication of WO2013149121A1 publication Critical patent/WO2013149121A1/en
Publication of WO2013149121A8 publication Critical patent/WO2013149121A8/en
Priority to IL234842A priority patent/IL234842A0/en
Priority to PH12014502196A priority patent/PH12014502196A1/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/542Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/545Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine
    • A61K31/546Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine containing further heterocyclic rings, e.g. cephalothin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/407Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with other heterocyclic ring systems, e.g. ketorolac, physostigmine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/439Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/542Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/545Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/08Bridged systems
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure is directed to ⁇ -lactamase inhibitors (BLIs) which are effective as inhibitors of ⁇ -lactamases and, when used in combination with ⁇ -lactam antibiotics are useful in the treatment of bacterial infections.
  • BLIs ⁇ -lactamase inhibitors
  • the compounds when combined with a ⁇ -lactam antibiotic are effective in treating infections caused by bacteria that are resistant to ⁇ -lactam antibiotics due to the presence of ⁇ -lactamases.
  • Pharmaceutical compositions comprising such compounds, methods of using such compounds, and processes for preparing such compounds are also disclosed.
  • ⁇ -lactamases Bacterial resistance to ⁇ -lactam antibiotics, especially in Gram-negative bacteria, is most commonly mediated by ⁇ -lactamases.
  • ⁇ -lactamases are enzymes that catalyze the hydrolysis of the ⁇ -lactam ring, which inactivates the antibacterial activity of the ⁇ -lactam antibiotic and allows the bacteria to become resistant. Inhibition of the ⁇ -lactamase with a BLI slows or prevents degradation of the ⁇ -lactam antibiotic and restores ⁇ -lactam antibiotic susceptibility to ⁇ -lactamase producing bacteria. Many of these ⁇ -lactamases are not effectively inhibited by BLIs currently on the market rendering the ⁇ -lactam antibiotics ineffective in treating bacteria that produce these ⁇ -lactamases.
  • the present invention provides, in one aspect, compounds of chemical formula (I), or pharmaceutically-acceptable salts thereof, which are BLIs and are useful in combination with ⁇ -lactam antibiotics for the treatment of bacterial infections.
  • X is selected from O and S ;
  • R is selected from
  • R is selected from
  • each of R 3 , R 4 and R 5 is independently selected from hydrogen, (Q- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
  • R is H, (C 2 -C 3 ) alkylamino, and d. amino;
  • R 7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C 2 -C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
  • each of p and q is independently selected from 1 and 2; and f. -CH(R 8 )CH 2 NH 2
  • R 8 is selected from amino and hydroxyl.
  • the invention provides compounds of chemical Formula (A-I) or a pharmaceutically acceptable salt thereof, which are BLIs and are useful in combination with ⁇ -lactam antibiotics for the treatment of bacterial infections.
  • X* is selected from O and S;
  • R* is selected from
  • R is selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
  • each of R 4* , R 5* , R 6* and R 7* is independently selected from hydrogen or (Q- C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R 4* , R 5* , R 6 * and R 7* is hydrogen,
  • n is selected from 1, 2, 3 and 4, and
  • n is selected from 1, 2 and 3;
  • R is selected from NH 2 , R 9 R 1 ° 0 NN ⁇ NNRR 1 1 1 3 ⁇ 4 ⁇ -. or , wherein each of R 4* , R 5* , R 6* and R 7 is as described previously and each of R 9 , R 10 , and R 11 is independently selected from hydrogen or (Ci-C6)-alkyl, provided that at least one of R 9 , R 10 , and R 11 hydrogen; amino;
  • Z is selected from CR 12 R 13 or NR 14 ,
  • each of R 12 and R 13 is independently selected from H, NH 2 and is as described previously,
  • R 12 and R 13 together with the carbon to which they are attached, form a cycloalkylor heterocyclyl ring containing 4-6 ring members,
  • R 14 is selected from H and , wherein each of R 15 , R 16 and R 17 is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R , R and
  • R , 17 is hydrogen
  • R is selected from NH 2 and , wherein each of R 4* , R 5* , R 6* and R 7* is as described previously,
  • each of p* and q* is independently selected from 0, 1, 2 and 3,
  • T is selected from NH and O
  • t is selected from 0, 1, 2, 3, and 4, and
  • R is selected from NH 2 and , wherein each of R 4* , R 5* , R 6* and R 7* is as described previously,
  • R 20 is selected from amino and hydroxyl
  • R is selected from NH 2 , -NH(C 1 -C 3 )-alkyl and
  • each of R 4* , R 5* , R 6* and R 7* is as described previously, s is selected from 0 and 1 , and
  • v is selected from 0, 1, 2, and 3;
  • M is selected from NR 22 , CR 23 R 24 and O,
  • R 22 is H or , wherein each of R , R and R is as described previously,
  • each of R 23 and R 24 is independently selected from H, NH 2 and wherein each of R 4* , R 5* , R 6 * and R 7* is as described previously, and
  • the invention provides use of a compound of Formula I for inhibiting ⁇ -lactamases.
  • the invention provides use of a compound of Formula A-I for inhibiting ⁇ -lactamases.
  • the invention provides compounds of Formula I with high binding affinity for ⁇ -lactamase enzymes.
  • the invention provides compounds of Formula A-I with high binding affinity for ⁇ -lactamase enzymes.
  • the present invention also provides antibacterial compositions comprising compounds of Formula I and at least one ⁇ -lactam antibiotic.
  • the present invention also provides antibacterial compositions comprising compounds of Formula A-I and at least one ⁇ -lactam antibiotic. In one embodiment, the present invention provides pharmaceutical compositions comprising compounds of Formula I and at least one ⁇ -lactam antibiotic and methods of use thereof.
  • the present invention provides pharmaceutical compositions comprising compounds of Formula A-I and at least one ⁇ -lactam antibiotic and methods of use thereof.
  • the invention provides methods of use of the compounds of Formula I to treat bacterial infections in a subject.
  • the invention provides methods of use of the compounds of Formula A-I to treat bacterial infections in a subject.
  • FIGS 1A-1I show Table I, Representative Compounds of Formula A-II
  • Figures 2A-2G show Table II, Standard BLI potentiation MIC assay against a panel of isogenic and clinical strains expressing ⁇ -lactamases.
  • Figures 3A-3F show Table III, the synergy MIC of representative compounds of Formula II-A against a panel of isogenic and clinical strains expressing ⁇ -lactamases.
  • Figures 4A-4C show Table IV, an assay to determine inhibition kinetics of representative compounds of Formula II-A for the KPC-2 ⁇ -lactamase.
  • Figures 5A-5B show Table V, Synergy MICof Comparator Compounds against a Panel of Isogenic and Clinical Strains Expressing ⁇ -lactamases
  • Figure 6 shows Table VI, Standard BLI Potentiation MIC Assay of Compounds Partnered with CXA-101 against a Panel of Isogenic and Clinical Strains Expressing ⁇ - Lactamases
  • Figure 7 shows Table VII, Standard BLI Potentiation MIC Assay of Compounds Partnered with Ceftazidime against a Panel of Isogenic and Clinical Strains Expressing ⁇ - Lactamases
  • Figure 8 shows Table VIII, Standard BLI Potentiation MIC Assay of Compounds Partnered with Aztreonam against a Panel of Isogenic and Clinical Strains Expressing ⁇ - Lactamases
  • Figure 9 shows Table IX, Standard BLI Potentiation MIC Assay of Compounds Partnered with Meropenem against a Panel of Isogenic and Clinical Strains Expressing ⁇ - Lactamases
  • alkyl is defined as a linear or branched, saturated radical having one to about twenty carbon atoms unless otherwise specified. Preferred alkyl radicals are "lower alkyl” radicals having one to about five carbon atoms. Examples of alkyl groups include, without limitation, methyl, ethyl, ieri-butyl, isopropyl, and hexyl. A subset of the term alkyl is "(Ci-C 3 )-unsubstituted alkyl” which is defined as an alkyl group that bears no substituent groups. Examples of (Ci-C 3 )-unsubstituted alkyl groups include methyl, ethyl, propyl and isopropyl. It is understood that if a (Ci-C 3 )-alkyl is "substituted” that one or more hydrogen atoms is replaced by a substitutent.
  • amino denotes a NH 2 radical.
  • aminoalkyl denotes an alkyl in which one or more of the alkyl hydrogen atoms has been replaced by an amino group.
  • aminocycloalkyl denotes a cycloalkyl in which one of the cycloalkyl hydrogen atoms has been replaced by an amino group.
  • cycloalkyl or "cycloalkyl ring” is defined as a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to twelve ring members.
  • a cycloalkyl is a ring system having three to seven ring members.
  • Examples of a cycloalkyl group include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl.
  • hydroxyalkyl denotes an alkyl radical in which one or more of the alkyl hydrogen atoms has been replaced by a hydroxyl group.
  • ' or - denote the point of attachment of a substituent group where indicated.
  • the point of attachment of the amide moiety is at the carbonyl carbon.
  • the salts of the compounds of the invention include acid addition salts and base addition salts.
  • the salt is a pharmaceutically acceptable salt of the compound of Formula I.
  • pharmaceutically acceptable salts embraces salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically-acceptable.
  • Suitable pharmaceutically acceptable acid addition salts of the compounds of the invention may be prepared from an inorganic acid or an organic acid. Examples of such inorganic acids include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid.
  • Examples of appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, arylaliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include, without limitation, formic, acetic, propionic, succinic, glycolic, gluconic, maleic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2- hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, ⁇ -hydroxybutyric, malonic, galactic, and galacturonic acid.
  • Suitable pharmaceutically-acceptable base addition salts of compounds of the invention include, but are not limited to, metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from ⁇ , ⁇ '- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N- methylglucamine, lysine and procaine. All of these salts may be prepared by conventional means from the corresponding compound of the invention by treating, for example, the compound of the invention with the appropriate acid or base.
  • the compounds of the invention can possess one or more asymmetric carbon atoms and are thus capable of existing in the form of optical isomers as well as in the form of racemic or non-racemic mixtures thereof.
  • the compounds of the invention can be utilized in the present invention as a single isomer or as a mixture of stereochemical isomeric forms.
  • Diastereoisomers, i.e., nonsuperimposable stereochemical isomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example by formation of diastereoisomeric salts by treatment with an optically active acid or base.
  • Examples of appropriate acids include, without limitation, tartaric, diacetyltartaric, dibenzoyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • the mixture of diastereomers can be separated by crystallization followed by liberation of the optically active bases from the optically active salts.
  • An alternative process for separation of optical isomers includes the use of a chiral chromatography column optimally chosen to maximize the separation of the enantiomers.
  • Still another available method involves synthesis of covalent diastereoisomeric molecules by treating compounds of the invention with an optically pure acid in an activated form or an optically pure isocyanate.
  • the synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation, and then hydro lyzed to obtain the enantiomerically pure compound.
  • the optically active compounds of the invention can likewise be obtained by utilizing optically active starting materials. These isomers may be in the form of a free acid, a free base, an ester or a salt.
  • Compounds described herein also include isotopically- labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes suitable for inclusion in the compounds described herein include and are not limited to 2 H, 3 H, U C, 13 C, 14 C, 36 C1, 18 F, 123 I, 125 I, 13 N, 15 N, 15 0, 17 0, 18 0, 32 P, and 35 S.
  • isotopically- labeled compounds are useful in drug and/or substrate tissue distribution studies.
  • substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements).
  • substitution with positron emitting isotopes, such as n C, 18 F, 15 0 and 13 N is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy.
  • Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non- labeled reagent otherwise employed.
  • the invention also embraces isolated compounds.
  • An isolated compound refers to a compound which represents at least 10%, such as at least 20%, such as at least 50% and further such as at least 80% of the compound present in the mixture.
  • the compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound exhibits detectable (i.e. statistically significant) activity when tested in conventional biological assays such as those described herein.
  • ⁇ -Lactamase Inhibitors BBIs
  • the invention provides compounds of Formula I or pharmaceutically- acceptable salts thereof:
  • the substituent X of Formula I is selected from O and S. In one aspect of the invention X is S. In another aspect of the invention X is O.
  • Substituent R of Formula I is selected from
  • R is
  • the group R 1 of Formula I is selected from:
  • R is selected from
  • each of R 3 , R 4 and R 5 is independently selected from hydrogen, (O- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
  • R is H, (C2-C3) alkylamino, and d. amino;
  • R 7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C 2 -C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
  • each of p and q is independently selected from 1 and 2; and f. -CH (R 8 )CH 2 NH 2
  • R 8 is selected from amino and hydroxyl.
  • n is 1. In another aspect of the invention n is 2. In another aspect of the invention n is 3.
  • R 1 is selected from H, -CH 2 NH 2 , -CH 2 CH 2 NH 2 , -CONH 2 , -NH 2 , -CH(OH)CH 2 NH 2 , -CH(NH 2 )CH 2 NH 2 , -CH 2 CH 2 NHCH 2 CH 2 NH 2 ,
  • the compounds of the invention are of the stereochemistry disclosed in Formula II.
  • the compound is of Formula II and X is O, R is -OSO 3 H and R 1 is H.
  • the compound is of Formula II and X is O, R is -OSO3H and R 1 is -CH 2 NH 2 .
  • the compound is of Formula II and X is O, R is -OSO 3 H and R 1 is -CH 2 CH 2 NH 2 .
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R -OSO 3 H and R 1 is -NH 2 .
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula II and X is O, R
  • R is in another embodiment of the invention, the compound is of Formula II and X is O, R -OSO 3 H and R 1 is -CH(OH)CH 2 NH 2 .
  • the compound is of Formula II and X is O, R -OSO 3 H and R 1 is -CH 2 CH 2 NHCH 2 CH 2 NH 2 .
  • the compound is of Formula II and X is O, R -OSO 3 H and R 1 is -CH(NH 2 )CH 2 NH 2 .
  • the compound is of Formula II and X is S, R -OSO 3 H and R 1 is -CH 2 CH 2 NH 2 .
  • the compound is of Formula II and X is S, R
  • the compound is of Formula II and X is O, R
  • the compound is of Formula and II X is S, R
  • the invention provides compounds of Formula A-I or pharmaceutically- acceptable salts thereof:
  • the substituent X of Formula A-I is selected from O and S. In one aspect of the invention X* is S. In another aspect of the invention X* is O.
  • R* is
  • the group R 1 * of Formula I is selected from:
  • each of R 4 *, R 5 *, R 6 *and R 7 * is independently selected from hydrogen or (Ci-Ce)- alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R 4 *, R 5 *, R 6 *and R 7 *is hyd]
  • n is selected from 1 , 2, 3 and 4, and
  • n is selected from 1 , 2 and 3 ;
  • R is selected from NH 2 , r9r
  • each of R 4* , R 5* , R 6* and R 7 is as described previously and each of R , R 10 , and R 11 is independently selected from hydrogen or (Ci-C6)-alkyl, provided that at least one of R 9 , R 10 , and R 11 is hydrogen; d. amino;
  • Z is selected from CR 1Z R 1J or NR ,
  • each of R and R is independently selected from H, NH 2 and
  • R 12 and R 13 together with the carbon to which they are attached, form a cycloalkyl or heterocyclyl ring containing 4-6 ring members,
  • R 14 is selected from H and and R 1 ' is
  • each of p* and q* is independently selected from 0, 1, 2 and 3,
  • T is selected from NH and O t is selected from 0, 1, 2, 3, and 4, and
  • R is selected from N3 ⁇ 4 and , wherein each of R 4* ,
  • R 5* , R 6* and R 7* is as described previously,
  • R 20 is selected from amino and hydroxyl
  • R is selected from NH 2 , -NH(C 1 -C 3 )-alkyl and
  • s is selected from 0 and 1 , and
  • v is selected from 0, 1, 2, and 3;
  • M is selected from NR , CR ZJ R Z4 and O,
  • R is H and , wherein each of R , R and R is as described previously,
  • wwhheerreeiinn eeaacchh ooff RR 44** ,, RR 55** ,, RR 66 ** and R 7* is as described previously, and u is selected from 0, 1 and 2;
  • the compounds of the invention are of the stereochemistry disclosed in Formula A-II.
  • X " , R and R 1* are chosen from the substituents listed in Table I (See Figure I).
  • the compounds of the invention are effective in inhibiting ⁇ -lactamase.
  • the compounds of Table I are effective ⁇ -lactamase inhibitors.
  • the compounds of the invention e.g. compounds of
  • Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula A- I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula II inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Formula A-II inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compounds of Table I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • the compound of the Formula I inhibit ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • ⁇ -lactamases selected from class A, class C or class D ⁇ -lactamases.
  • Class A ⁇ - lactamases for example, include, but are not limited to, TEM, SHV, CTX-M, KPC, GES, VEB, SME, and GEX.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • KPC ⁇ -lactamases inhibit KPC ⁇ -lactamases.
  • the compounds of Formula A-I inhibit KPC ⁇ -lactamases.
  • the compounds of Formula II inhibit KPC ⁇ -lactamases.
  • the compounds of Formula A-II inhibit KPC ⁇ -lactamases. More preferably the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC- 3 ⁇ -lactamases. More preferably the compounds of Formula I inhibit KPC-2 or KPC-3 ⁇ - lactamases. More preferably the compounds of Formula A-I inhibit KPC-2 or KPC-3 ⁇ - lactamases. More preferably the compounds of Formula II inhibit KPC-2 or KPC-3 ⁇ - lactamases.
  • the compounds of Formula A- II inhibit KPC-2 or KPC-3 ⁇ - lactamases.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains Figure 2, Table II and Figures 6-9, Tables VI-IX.
  • the compounds of Formula I inhibit KPC- 2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II and Figures 6-9, Tables VI- ⁇ ).
  • the compounds of Formula A-I inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II and Figures 6-9, Tables VT- ⁇ ). In one aspect of the invention, the compounds of Formula II inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II and Figures 6-9, Tables VI-IX). In one aspect of the invention, the compounds of Formula A-II inhibit KPC-2 or KPC-3 ⁇ -lactamases in clinical strains ( Figure 2, Table II and Figures 6-9, Tables VI- ⁇ ).
  • Class C ⁇ -lactamases for example, include, but are not limited to chromosomal AmpCs, and plasmid based ACC, DHA, CMY, FOX, ACT, MIR, LAT, MOX ⁇ -lactamases.
  • Class D ⁇ -lactamase enzymes for example, include, but are not limited to oxacillinases or OXA ⁇ -lactamases.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of Formula I inhibit OXA- 15 ⁇ -lactamases.
  • the compounds of Formula A-I inhibit OXA- 15 ⁇ -lactamases. In a preferred aspect of the invention, the compounds of Formula II inhibit OXA-15 ⁇ -lactamases. In a preferred aspect of the invention, the compounds of Formula A-II inhibit OXA-15 ⁇ -lactamases.
  • the activity of the BLI compounds can be described by the MIC value obtained from a Synergy MIC assay or a BLI potentiation assay (e.g as described herein), both of which are run in the presence of a ⁇ -lactam.
  • the sMIC and BLI potentiation assay data supports that the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate (i.e. make more potent) the activity of the ⁇ -lactam antibiotic against ⁇ -lactamase producing strains by inhibiting the ⁇ -lactamase.
  • the BLI activity is measured by growth inhibition of a ⁇ - lactamase producing bacterial strains in a Synergy MIC (sMIC) assay.
  • sMIC Synergy MIC
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of
  • Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 ⁇ g/mL or less.
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the sMIC value for the compounds of the invention is 4 ⁇ g/mL to 8 ⁇ g/mL.
  • the sMIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the sMIC value for the compounds of the invention e.g.
  • the BLI activity is measured by growth inhibition of a ⁇ - lactamase producing bacterial strains in a standard BLI potentiation assay using a fixed concentration of BLI.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention is 8 ⁇ g/mL or less.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention e.g.
  • the MIC value for the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the MIC value for the compounds of the invention is 0.2 ⁇ g/mL to 0.5 ⁇ g/mL.
  • the compounds of the present invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the present invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the present invention are active against a wide variety of bacterial strains that express class A and C ⁇ -lactamases and also, surprisingly are active against bacterial strains that express the class D cephalosporinase OXA-15 (Tables II and III).
  • This increased activity against the class D ⁇ -lactamase is critical because differential effectiveness against different types of ⁇ -lactamase producing bacteria is necessary in order to effectively use ⁇ -lactam antibiotics to treat resistant strains of bacteria (vide infra).
  • the compounds the invention are unexpectedly more active against bacterial strains that express OXA-15 ⁇ -lactamases than the most structurally similar compound, Avibactam (comparator compound CCC).
  • Compounds that are more active than Avibactam against bacterial strains that express the class D cephalosporinase OXA-15 are, for example, compounds 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 776, 777, 778, 779
  • the compounds of the invention are unexpectedly more active against and/or show broader spectrum of activity against bacterial strains that express KPC ⁇ -lactamases than the most structurally similar compound,
  • Avibactam Compounds that are more active than Avibactam for at least one, bacterial strain that expresses KPC ⁇ -lactamase and/or show a better spectrum of activity against bacterial strains that express KPC ⁇ -lactamases than Avibactam are, for example, compounds 701,
  • the compounds of the invention e.g. compounds of
  • Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have high binding affinity for the ⁇ -lactamase enzyme. Consequently these compounds are better inhibitors of the ⁇ -lactamase enzyme.
  • the inhibition kinetics of the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • Compounds that have a binding affinity of 100-999 inM ' V 1 are, for example, compounds 701, 702, 703, 705, 706, 707, 709, 711, 712, 713, 714, 720, 730, 740, 741, 742, 743, 745, 746, 748, 749, 752, 753, 767, 770, 775, 779, 781, 782, 785, 794, 798 (Table IV).
  • the compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have a binding affinity of 1-99 mM ' V 1 .
  • Compounds that have a binding affinity of 1-99 mM ' V 1 are, for example, compounds 704, 706, 708, 710, 715, 716, 717, 718, 719, 721, 722, 723, 724, 725, 726, 727, 728, 729, 731, 732, 733, 734, 735, 736, 737, 738, 739, 744, 747, 750, 751, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 769, 771, 772, 773, 774, 776, 777, 778, 780, 783, 784, 786, 792, 796, and 797 (Table IV).
  • compositions Comprising the Compounds of The Invention and Use Thereof
  • Another object of the invention is pharmaceutical compositions or formulations comprising compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • compounds the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • salts thereof preferably further comprising a ⁇ -lactam antibiotic.
  • compositions or formulations comprising compounds of Formula I, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula A-I, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula II, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Formula A-II, or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • pharmaceutical compositions or formulations comprising compounds of Table I.
  • compositions or formulations comprising
  • the invention is pharmaceutical
  • formulations comprising compounds of Formula , or salts thereof, preferably further comprising a ⁇ -lactam antibiotic.
  • the pharmaceutical compositions can be formulated for oral, intravenous, intramuscular, subcutaneous or parenteral administration for the therapeutic or prophylactic treatment of diseases, such as bacterial infections.
  • the pharmaceutical composition is formulated for intravenous administration.
  • compositions disclosed herein may be prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent or eliminate infection (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA and Goodman and Oilman's "The Pharmaceutical Basis of
  • compositions can comprise one or more of the compounds disclosed herein (e.g. one or more compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II, in conjunction with a ⁇ -lactam antibiotic, in association with one or more nontoxic, pharmaceutically-acceptable carriers and/or diluents and/or adjuvants and/or excipients.
  • pharmaceutically-acceptable carrier refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical
  • Non-limiting examples of carriers and excipients include corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid.
  • the compositions may contain croscarmellose sodium, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid.
  • Tablet binders that can be included are acacia, methylcellulose, sodium
  • Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.
  • Flavoring agents such as peppermint, oil of wintergreen, cherry flavoring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product.
  • compounds of the present invention e.g., compounds of the present invention
  • compositions comprising a compound of this invention may contain from about 0.1% to about 99% by weight of the active compound, such as from about 10% to about 30%.
  • solid formulations such as tablets and capsules are useful. Sustained release or enterically coated preparations may also be devised.
  • one embodiment provides suspensions, syrups and chewable tablets.
  • the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid.
  • the pharmaceutical compositions may be made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient.
  • dosage units are tablets and capsules.
  • the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose;
  • Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs, preparations of the invention may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents.
  • Non-limiting examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl
  • the pharmaceutical composition e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic
  • Intravenous fluids include, without limitation, physiological saline or Ringer's solution.
  • Intravenous administration may be accomplished by using, without limitation, syringe, mini-pump or intravenous line.
  • compositions of this invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • aqueous and non-aqueous carriers, diluents, solvents or vehicles examples include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate.
  • aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • the compositions can include various buffers
  • compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. They may also contain taggants or other anti-counterfeiting agents, which are well known in the art. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, and phenol sorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • Injectable depot forms can be made by forming microencapsulating matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly( anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
  • biodegradable polymers such as polylactide-polyglycolide.
  • Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. Such forms may include forms that dissolve or disintegrate quickly in the oral environment.
  • the active compound preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic
  • suitable excipients include, for example, (a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders such as cellulose and cellulose derivatives (such as
  • Solid dosage forms including those of tablets, dragees, capsules, pills, and granules, can be prepared with coatings and shells such as functional and aesthetic enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and colorants. They may also be in a form capable of controlled or sustained release. Examples of embedding compositions that can be used for such purposes include polymeric substances and waxes.
  • compositions can be delivered using controlled (e.g., capsules) or sustained release (e.g., bioerodable matrices) delivery systems.
  • controlled e.g., capsules
  • sustained release e.g., bioerodable matrices
  • Exemplary delayed release delivery systems for drug delivery that are suitable for administering the pharmaceutical compositions are described in U.S. Patent Nos. 4,452,775 (issued to Kent), 5,039,660 (issued to Leonard), and 3,854,480 (issued to Zaffaroni).
  • the rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
  • delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle.
  • a sterile formulation of compounds preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or suitable soluble salt forms thereof, for example hydrochloride salts
  • a pharmaceutical diluent such as Water- for- Injection (WFI), physiological saline or 5% glucose.
  • WFI Water- for- Injection
  • a suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g., an ester of a long chain fatty acid such as ethyl oleate.
  • a dose of an intravenous, intramuscular, or parental formulation of compounds may be administered as a bolus or by slow infusion.
  • a bolus is a dose that is administered in less than 30 minutes. In one embodiment, a bolus is administered in less than 15 or less than 10 minutes. In another embodiment, a bolus is administered in less than 5 minutes. In yet another embodiment, a bolus is administered in one minute or less.
  • An infusion is a dose that is administered at a rate of 30 minutes or greater. In one embodiment, the infusion is one hour or greater. In another embodiment, the infusion is substantially constant.
  • compositions preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints.
  • Such topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
  • DMSO dimethylsulfoxide
  • the pharmaceutical composition can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
  • the pharmaceutical compositions preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, polyethylene glycol or a suppository wax or other glyceride that are solid at room
  • the pharmaceutical compositions can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery.
  • the unit dosage form of compounds preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, can be a solution of one or more compounds, or salts thereof, in a suitable diluent, in sterile hermetically sealed ampoules or sterile syringes.
  • the concentration of the compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, in the unit dosage may vary, e.g. from about 1 percent to about 50 percent, depending on the compound used and its solubility and the dose desired by the physician.
  • each dosage unit can contain from 1-500 mg of the active material. For adult human treatment, the dosage employed can range from 5 mg to 10 g, per day, depending on the route and frequency of administration.
  • compositions disclosed herein can be placed in a
  • the methods of delivering the pharmaceutical compositions in vivo utilize art-recognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention for the drugs in the art-recognized protocols.
  • compositions for treating cells in culture for example, to eliminate or reduce the level of bacterial contamination of a cell culture
  • methods for using the claimed compositions for treating cell cultures with antibacterial agent(s) with the only substantial procedural modification being the substitution of the compounds of the present invention, preferably in combination with a ⁇ -lactam antibiotic for the drugs in the art-recognized protocols.
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous).
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous) to treat an infection caused by ⁇ -lactam resistant bacteria.
  • one or more compounds of the invention preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof are administered orally to treat an infection caused by ⁇ -lactamase producing bacteria.
  • therapeutically-effective dose and “therapeutically- effective amount” refer to an amount of a compound that prevents the onset, alleviates the symptoms, stops the progression of a bacterial infection, or results in another desired biological outcome such as, e.g., improved clinical signs or reduced/elevated levels of lymphocytes and/or antibodies.
  • treating is defined as administering, to a subject, a therapeutically-effective amount of one or more compounds both to prevent the occurrence of an infection and to control or eliminate an infection.
  • Those in need of treatment may include individuals already having a particular medical disease as well as those at risk for the disease (i.e., those who are likely to ultimately acquire the disorder).
  • subject refers to a mammal, a plant, a lower animal, or a cell culture.
  • a subject is a human or other animal patient in need of antibacterial treatment.
  • administering refers to providing the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) to the subject in need of treatment.
  • the subject is a mammal, more preferably a human.
  • the present invention comprises administering the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a ⁇ -lactam antiobiotic.
  • a compound of the invention e.g.
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antiobiotic can be administered at the same time or different times.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antiobiotic can be administered at the same time, they can be administered as a single composition or pharmaceutical composition or they can be administered separately. It is understood that when a compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a ⁇ -lactam antibiotic, that the active agents can be administered in a single combination or in multiple combinations.
  • the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a compound of Formula I can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • a pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) and a ⁇ -lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula I, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-I, and a ⁇ - lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula II, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-II, and a ⁇ -lactam antibiotic.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula A-I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula II.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula A-II.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Table I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Table I.
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula
  • a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a ⁇ -lactam antibiotic in conjunction with a compound of Formula
  • a method of treating or preventing a bacterial infection in a subject comprising the steps of
  • the compound in step a is a compound of Formula I. In one embodiment the compound in step a is a compound of Formula A-I. In one embodiment the compound in step a is a compound of Formula II. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Table I. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Formula
  • the ⁇ -lactam antibiotic in step b is Ceftolozane, Ceftazidime,
  • step a is a compound of Formula
  • step a is a compound of Formula
  • step b is Ceftolozane.
  • step b is Ceftolozane.
  • step b is Ceftolozane.
  • ⁇ -lactam antibiotic in step b is Ceftolozane.
  • a method of treating or preventing a bacterial infection in a subject comprising the steps of
  • the compound in step b is a compound of Formula I. In one embodiment the compound in step b is a compound of Formula A-I. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Formula A- II. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Table I. In one
  • step b is a compound of Formula
  • step b is a compound of Formula
  • step b is a compound of Formula
  • the ⁇ -lactam antibiotic in step a is Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime.
  • the compound in step b is a compound of Formula
  • step b is a compound of Formula
  • step a is Ceftolozane.
  • step b is a compound of Formula
  • step a is Ceftolozane.
  • step b is a compound of Formula
  • step a is Ceftolozane.
  • the invention provides a method for treating an infection in a subject by administering a therapeutically- effective amount of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ - lactam antibiotic, or compositions thereof.
  • the method comprises administering to a subject in need thereof a pharmaceutical composition comprising at least one of the compounds described herein, preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic.
  • the co-olactam antibiotic e.g., a compound of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a ⁇ -lactam antibiotic preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftoloz ns thereof.
  • the compound is of Formula in conjunction with a ⁇ -lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime, or compositions thereof.
  • a ⁇ -lactam antibiotic preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime, or compositions thereof.
  • a ⁇ -lactam antibiotic preferably Ceftolozane, Ceftazidime, Aztreonam Meropenem, or more preferably, Ceftolozane f.
  • a ⁇ -lactam antibiotic preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftoloz thereof.
  • a ⁇ -lactam antibiotic preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftoloz thereof.
  • the pharmaceutical composition can comprise any one of the compounds described herein as the sole active compound or in combination with another compound, composition, or biological material.
  • the compound may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally, vaginally, or by an implanted reservoir, external pump or catheter.
  • the compound may be prepared for opthalmic or aerosolized uses.
  • the compounds of the present invention can be administered as an aerosol for the treatment of pneumonia or other lung-based infections.
  • the aerosol delivery vehicle is an anhydrous or dry powder inhaler.
  • One or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, or pharmaceutical compositions thereof also may be directly injected or administered into an abscess, ventricle or joint.
  • Parenteral administration includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, cisternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered intravenously, subcutaneously or orally.
  • the one or more compounds according to the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • the one or more compounds may be administered in a nutrient medium.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or A-II in conjunction with a ⁇ - lactam antibiotic may be used to treat a subject having a bacterial infection in which the infection is caused or exacerbated by any type of bacteria, such as Gram-negative bacteria.
  • the bacterial infection is caused by ⁇ -lactam resistant bacteria.
  • the bacterial infection is caused by ⁇ -lactamase producing bacteria.
  • the bacterial infection is caused by class A, class C or class D ⁇ -lactamase producing bacteria.
  • the bacterial infection is caused by class A ⁇ -lactamase producing bacteria.
  • the infection is caused by class C ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by class D ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by KPC ⁇ -lactamase producing bacteria. In still another aspect the infection is caused by OXA ⁇ -lactamase producing bacteria. In still another aspect, the bacterial infection is caused by a bacteria that produces multiple ⁇ - lactamases. Bacteria that produce multiple ⁇ -lactamases may produce ⁇ -lactamases of the same class or of different classes (e.g class A and class A or class A and class C or class A and class D etc).
  • Gram-negative pathogens known to express ⁇ -lactamases include, but are not limited to Acinetobacter spp. (including Acinetobacter baumannii), Citrobacter spp., Escherichia spp. (including Escherichia coli), Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp. (including Klebsiella pneumoniae), Enterobacter spp. (including Enterobacter cloacae and Enterobacter aerogenes), Pasteurella spp., Proteus spp. (including Proteus mirabilis), Serratia spp.
  • Bacterial infections can be caused or exacerbated by Gram-negative bacteria including strains which express ⁇ -lactamases that may confer resistance to penicillins, cephalosporins, monobactams and/or carbapenems.
  • the coadministration of a novel BLI that inhibits these ⁇ -lactamases with a ⁇ -lactam antibiotic could be used to treat infections caused by ⁇ -lactam resistant bacteria.
  • the infection is caused by a ⁇ -lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae), Haemophilus influenzae, Pseudomonas aeruginosa, Proteus mirabilis, Serratia marcescens, and Klebsiella pneumoniae,
  • a ⁇ -lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae
  • Haemophilus influenzae Pseudomonas aeruginosa
  • Proteus mirabilis Proteus mirabilis
  • Serratia marcescens and Klebsiella pneumoniae
  • the ⁇ -lactam antibiotic is a cephalosporin.
  • cephalosporins include, but are not limited to, Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl), Cef alexin (cephalexin), Cefaloglycin (cephaloglycin), Cefalonium (cephalonium), Cefaloridine (cephaloradine), Cefalotin (cephalothin), Cefapirin (cephapirin), Cefatrizine,Cefazaflur, Cefazedone, Cefazolin (cephazolin), Cefradine (cephradine), Cefroxadine, Ceftezole, Cefaclor, Cefamandole, Cefmetazole, Cefonicid, Cefotetan, Cefoxitin, Cefprozil (cefproxil), Cefuroxime, Cefuzonam, Cefcapene, Cefdaloxime, Cefdinir, Cefditoren, Cefetamet
  • Cefoperazone Ceftazidime, Cefclidine, Cefepime, Cefluprenam, Cefoselis, Cefozopran, Cefpirome, Cefquinome, Cefaclomezine, Cefaloram, Cefaparole, Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril, Cefmatilen, Cefmepidium, Cefovecin, Cefoxazole, Cefrotil, Cefsumide, Ceftaroline, Ceftioxide, Cefuracetime, cefbuperazone, cefminox, ceforanide, cefotiam, cefpiramide, cefsulodin, ceftobiprole latamoxef, loracarbef and Ceftolozane.
  • the cephalosporin is Ceftolozane or Ceftazidime.
  • the ⁇ -lactam antibiotic is a carbapenen.
  • carbapenem antibiotics include, but are not limited to, Imipenem, Imipenem/Cilastatin, Biapenem, Doripenem, Meropenem, Ertapenem and Panipenem.
  • the Carbapenem is Imipenem/Cilastatin or Meropenem.
  • the ⁇ -lactam antibiotic is a monobactam.
  • monobactam antibiotics include, but are not limited to Aztreonam, Tigemonam, Carumonam, BAL30072 and Nocardicin A.
  • the ⁇ -lactam antibiotic is a penem. In one embodiment of the invention, the ⁇ -lactam antibiotic is a penicillin.
  • penicillin antibiotics include, but are not limited to Amoxicillin, Ampicillin, Azlocillin, Mezlocillin, Apalcillin, Hetacillin, Becampicillin, Carbenicillin, Sulbenicillin, Ticarcillin, Piperacillin, Azlocillin, Mecillinam, Pivmecillinam, Methicillin, Ciclacillin, Talampicillin, Aspoxicillin, Oxacillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Nafcillin and Pivampicillin.
  • cephalosporin is Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime.
  • compositions preferably a compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a ⁇ -lactam antibiotic can be used to treat a bacterial infection of any organ or tissue in the body caused by ⁇ -lactam resistant bacteria, preferably, Gram-negative ⁇ -lactam resistant bacteria.
  • organs or tissue include, without limitation, skeletal muscle, skin, bloodstream, kidneys, heart, lung and bone.
  • a pharmaceutical composition comprising at least one compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can be administered to a subject to treat, without limitation, skin and soft tissue infections (e.g., complex skin infections), bacteremia, intra-abdominal infections and urinary tract infections (e.g., cUTI).
  • skin and soft tissue infections e.g., complex skin infections
  • bacteremia bacteremia
  • intra-abdominal infections e.g., cUTI
  • urinary tract infections e.g., cUTI
  • a compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II may be used to treat community acquired respiratory infections, including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa .
  • community acquired respiratory infections including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa .
  • At least one compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic can be administered to a subject to treat mixed infections that comprise different types of Gram-negative bacteria, or which comprise both Gram-positive and Gram-negative bacteria. These types of infections include intra-abdominal infections and
  • At least one compound of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic may also be administered to a subject to treat an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis.
  • an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis.
  • At least one compound of the invention e.g.
  • compositions of the invention may also be directly injected or administered into an abscess, ventricle or joint.
  • Pharmaceutical compositions of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, may be administered as an aerosol for the treatment of pneumonia or other lung-based infections.
  • the aerosol delivery vehicle is an anhydrous, liquid or dry powder inhaler.
  • Actual dosage levels of active ingredients in the pharmaceutical compositions of one or more compounds according to the invention may be varied so as to obtain a therapeutically-effective amount of the active compound(s) to achieve the desired therapeutic response for a particular patient, compositions, and mode of administration.
  • the effective amount can be determined as described herein.
  • the selected dosage level will depend upon the activity of the particular compound, the route of administration, the severity of the condition being treated, and the condition and prior medical history of the patient being treated.
  • the data obtained from the assays can be used in formulating a range of dosage for use in humans.
  • the composition comprises a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a ⁇ -lactam antibiotic
  • both the compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the ⁇ -lactam antibiotic are active compounds.
  • the method comprises administering to the subject an effective dose of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably in conjunction with a ⁇ lactam antibiotic.
  • An effective dose of a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • An effective dose is generally between 125 mg/day to 2000 mg/day.
  • an effective dose is from about 0.1 to about 100 mg/kg of one or more compounds of the invention (e.g.
  • the dose is from about 0.1 to about 50 mg/kg of one or more compounds of the invention (e.g.
  • the dose is from about 1 to about 25 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof.
  • the dose is from about 1 to about 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • the dose is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg of one or more compounds of the invention (e.g.
  • the compounds of the invention are administered to a human at a dose of 100 mg to 1000 mg per dose up to four times per day.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • the compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 250 mg to 500 mg per dose up to four times a day.
  • An effective dose for cell culture is usually between about 0.1 and about 1000 ⁇ g/mL. In one embodiment, the effect dose for cell culture is between about 0.1 and about 200 ⁇ g/mL.
  • a ⁇ -lactam antibiotic and a compound of the invention are administered in ratio of 1:4 to 8:1 antibiotic: compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II).
  • the ratio is 1 :4.
  • the ratio is 3:4.
  • the ratio is 5:4.
  • the ratio is 7:4.
  • the ratio is 1:2.
  • the ratio is 3:2.
  • the ratio is 5:2.
  • the ratio is 7:2.
  • the ratio is 1:3.
  • the ratio is 2:3.
  • the ratio is 4:3. In another embodiment the ratio is 5:3. In another embodiment the ratio is 7:3. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:1. In another embodiment the ratio is 2:1. In another embodiment the ratio is 3:1. In another embodiment the ratio is 4:1. In another embodiment the ratio is 5:1. In another embodiment the ratio is 6:1. In another embodiment the ratio is 7:1. In another embodiment the ratio is 8:1. It will be understood by one of skill in the art that the ⁇ - lactam antibiotic and compound of the invention (e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II can be administered within the range of ratios provided regardless of the method of drug delivery. It will also be understood by one of skill in the art that the ⁇ -lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided together, for example, in a pharmaceutical composition, or sequentially, i.e. the ⁇ -lactam antibiotic is administered, followed by administration of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or vice versa.
  • a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • One or more compounds of the invention may also be administered in the diet or feed of a patient or animal. If administered as part of a total dietary intake, the amount of compound employed can be less than 1% by weight of the diet, such as no more than 0.5% by weight.
  • the diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
  • One or more compounds of the invention can be administered as a single daily dose or in multiple doses per day.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered as a single dose per day.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered as a single dose per day.
  • one or more compounds of the invention e.g.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered in three equal doses per day.
  • the compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic is administered in four equal doses per day.
  • the treatment regime may require administration over extended periods of time, e.g., for several days or for from two to four weeks.
  • the amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the infection, the age and general health of the patient, the tolerance of the patient to the compound of the invention and the ⁇ -lactam antibiotic and the microorganism or microorganisms involved in the infection.
  • the treatment regimen for one type of infection may differ greatly from the treatment regimen of another infection. For example, one type of infection may require administration via intravenous administration once daily, while another infection may require a treatment regimen of multiple dosing orally.
  • One or more compounds of the invention may be administered according to this method until the bacterial infection is eradicated or reduced.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for a period of time from 3 days to 6 months.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for 7 to 56 days.
  • one or more compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic are administered for 7 to 28 days.
  • one or more compounds of the invention e.g.
  • compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a ⁇ -lactam antibiotic, are administered for 7 to 14 days.
  • Compounds of the present invention may be administered for a longer or shorter time period if it is so desired.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • a pharmaceutical composition comprising a compound of the invention (e.g.
  • novel compounds of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • novel compounds of the invention e.g.
  • a compound of the invention e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II
  • synthetic routes including synthetic schemes described herein. These synthetic routes can be applied to large scale synthesis with appropriate adjustment of reaction sequence, reaction conditions, isolation/purification methods and choice of solvents which are environmentally friendly and cost-effective.
  • Boc ieri-butoxycarbonyl
  • Boc 2 0 di-ieri-butyldicarbonate
  • Burgess reagent methyl N-triethylammoniumsulfonyl)carbamate
  • CDI carbonyldiimidazole
  • HATU 2- (7 - aza- 1 H-benzotriazole- 1 - yl) - 1 , 1 ,3 , 3 - tetramethyluronium hexafluoropho sphate
  • the compounds of the invention can be prepared from intermediate 1, according to the following reaction schemes and examples, or modifications thereof, using readily available starting materials, reagents and conventional synthetic procedures including, for example, procedures described in US7112592 and
  • compound 3 can be synthesized following standard oxadiazole ring formation chemistry from the diacylhydrazide intermediate 2g (see, e.g., Jakopin, Z.; Dolenc, M. S. Curr. Org. Chem. 2008, 12, 850-898; Walker, D. G.; Brodfuehrer, P. R.; Brundidge, S. P. Shih, K. M.; Sapino, C. Jr. /. Org. Chem. 1988, 53, 983-991 and references cited therein).
  • Diacylhydrazide intermediate 2g can be prepared via standard amide coupling reactions from acylhydrazide intermediate 2f.
  • 2g can be made by an amide coupling reaction of acylhydrazine derivative 2h and acid intermediate 2a, which can be prepared from ester intermediate 1. It may be necessary to protect certain functionalities in the molecule depending on the nature of the R 1 group. Protecting these functionalities should be within the expertise of one skilled in the art. See, e.g P. G. M. Wuts and T. W. Greene, Protective Groups in Organic Synthesis, Fourth Edition, John Wiley and Sons, 2006, hereafter Greene.
  • the benzylic ether protecting group in 3 can be removed via standard hydrogenolysis conditions, such as, but not limited to, Pd/3 ⁇ 4 in MeOH or THF or by acid-catalysed hydrolysis, such as, but not limited to, BCI 3 in DCM to provide the hydroxy-urea
  • Sulfation of 4 can be achieved by treatment with a sulfating reagent, such a, but not limited to, SC .pyridine complex, in an appropriate solvent, such as pyridine, DMF or DMAc at a temperature of 0-80 °C, preferable at room temperature.
  • a sulfating reagent such as a, but not limited to, SC .pyridine complex
  • an appropriate solvent such as pyridine, DMF or DMAc
  • Compound 5 can then be isolated and purified via conventional methods.
  • 5 can be purified by standard reverse phase prep-HPLC using appropriate buffer system, i.e. ammonium formate buffer.
  • 5 can be purified by normal phase silica gel chromatography after converting to an appropriate salt form, such as sulfate tetrabutyl ammonium salt.
  • the tetrabutyl ammonium salt can then be converted to a sodium salt by cation exchange.
  • a protecting group(s) i.e. Boc or Fmoc for amine and guanidine protection, TBS or TES for alcohol protection, etc
  • a deprotection step is needed to convert 5 to its final product 6, which can be purified by prep-HPLC using the conditions mentioned above.
  • 5 can be treated with an acid, such as TFA, in an appropriate solvent, such as DCM at a temperature of 0-30 °C, preferable at 0 °C to rt to give 6.
  • a fluoride reagent such as HF.pyridine, HF.NEt 3 , or TBAF can be used.
  • Fmoc deprotection amines can be used, such as diethylamine, DBU, piperidine, etc can be used.
  • thiadiazole derivative 3a can be synthesized from diacylhydrazide intermediate 2g by treatment with Lawesson's reagent under heating. 3a can then be converted to the final product 6a using similar chemistry as described previously.
  • the nuclear magnetic resonance (NMR) spectral characteristics refer to chemical shifts ( ⁇ ) expressed in parts per million (ppm) versus tetramethylsilane (TMS) as reference standard.
  • the relative area reported for the various shifts in the proton NMR spectral data corresponds to the number of hydrogen atoms of a particular functional type in the molecule.
  • the nature of the shifts as to multiplicity is reported as broad singlet (br s), broad doublet (br d), singlet (s), multiplet (m), doublet (d), quartet (q), doublet of doublet (dd), doublet of triplet (dt), and doublet of quartet (dq).
  • the solvents employed for taking NMR spectra are DMSO-d6 (perdeuterodimethysulfoxide), D 2 0 (deuterated water), CDCI 3 (deuterochloroform) and other conventional deuterated solvents.
  • the prep-HPLC conditions are: Waters SunFire ® C18 (30x100 mm, 5 ⁇ OBD) column; flow rate: 30-80 mL/minute, ELSD or Mass-triggered fraction collection; sample loading: Each injection loading varied from - 300 mg for different crude samples depending on their solubility and purity profiles; Solvent system using ammonium formate buffer: solvent A: water with 20 mM ammonium formate, solvent B: 85% of acetonitrile in water with 20 mM ammonium formate. Solvent system using
  • NH4HCO3 buffer solvent A: water with 10 mM NH4HCO3, solvent B: acetonitrile.
  • Solvent system using NH 4 OH buffer solvent A: water with 0.1% NH 4 OH, solvent B: acetonitrile with 0.1% NH 4 OH.
  • n-BuLi was added dropwise to a solution of TMSCHN 2 (690 mL, 1.38 mol ) in dry THF (3 L) (600 mL, 1.5 mol ) at -78 °C, and the mixture was stirred at -78 °C for 30 minutes.
  • the mixture was then transferred to a solution of (5')-l-tert-butyl 2-ethyl 5-oxopyrrolidine-l,2- dicarboxylate (300 g, 1.17 mol) in dry THF (3 L) via cannula, and the mixture was stirred at - 78 °C for 30 minutes.
  • the reaction mixture was then quenched with sat. NH 4 CI solution, and extracted with DCM three times.
  • Step 2 Synthesis of (2S,5S)-1 -tert-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate NaB3 ⁇ 4 (36 g, 1.0 mol) was added in portions to a solution of (5)- 1-tert-butyl 2-ethyl 5- oxopiperidine-l ,2-dicarboxylate (250 g, 0.92 mol) in EtOH (1500 mL) at -40 °C. The reaction mixture was then stirred at -40 °C for 0.5 hr then quenched with 10% HOAc solution. After diluting with water, the mixture was extracted with DCM three times.
  • Step 3 Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l,2-dicarboxylate
  • reaction mixture was then concentrated in vacuum and purified by silica gel column chromatography (3:1 petroleum ether/EtOAc) to afford (25,5 ?)-l-tert-butyl 2-ethyl 5-(N- (benzyloxy)-2-nitrophenylsulfonamido)piperidine-l,2-dicarboxylate (283.8 g, 80%) as a yellow oil.
  • Step 4 Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-((benzyloxy)amino)piperidine-l,2- dicarboxylate
  • Step 6 Synthesis of (2S,5R)-ethyl 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 ]octane-2- carboxylate
  • Triphosgene (21.3 g, 72 mmol) was added in portions to a solution of (2S ,5R)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (50 g, 0.18 mol) and DIPEA (128 mL, 0.72 mol) in DCM (2000 mL) at 0 °C . After stirring at 20 °C overnight, the reaction mixture was washed with H 3 PO4 (10%), sat. NaHCC>3 and saturated NaCl.
  • Step 1 ⁇ , ⁇ -Carbonyldiimidazole (5.8 g, 36.2 mmol) was added to a 0 °C solution of (2S,5R)- 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carboxylic acid (5.0 g, 18.1 mmol) in dry THF (200 mL). The reaction mixture was allowed to warm to rt then was stirred at rt for 3 hrs. Formohydrazide (5.4 g, 90.5 mmol) was added in one portion, and the reaction mixture was stirred for additional 3 hrs. The mixture was then diluted with saturated sodium chloride and exatracted with EtOAc (3x).
  • Step 2 To a -10 °C solution of (25',5 «)-6-(benzyloxy)-N-formyl-7-oxo-l,6- diazabicyclo[3.2.1]octane-2-carbohydrazide (11 g) in dry DCM (200 mL) was added pyridine (28 mL), followed by dropwise addition of (CF 3 S0 2 ) 2 0 (28 mL). The reaction mixture was allowed to warm to rt and was stirred for 3 hrs. The reaction mixture was then cooled to -10 °C and quenched with sat. NaHCC>3. The organic layer was separated and the aqueous layer was extracted with EtOAc (3x).
  • Step 3 To a solution of (25,5/?)-6-(benzyloxy)-2-(l,3,4-oxadiazol-2-yl)-l ,6- diazabicyclo[3.2.1]octan-7-one (4.6 g, 15.3 mmol) in THF (150 mL) was added 10% Pd/C (1 g). The mixture was stirred under H 2 atmosphere at rt for 3 hrs. The reaction mixture was then filtered and concentrated to afford (25,5/?)-6-hydroxy-2-(l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1]octan-7-one (2.9 g, 91 %), which was used directly in the next step.
  • Step 5 Resin Exchange: Tetrabutylammonium (25, 5R)-2-(l, 3, 4-oxadiazol-2-yl)-7-oxo-l, 6-diaza-bicyclo[3.2.1]octan-6-yl sulfate (4.1 g, 7.72 mmol) was dissolved in a minimum amount of HPLC grade water ( ⁇ 40 mL) and passed through a column of 80 g of DOWEX 50WX 8 Na + resin (the resin was prewased with >4 L of HPLC grade water) and eluted with HPLC grade water to afford sodium (25,5fl)-2-(l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl sulfate (2.2 g, 91 %) as a white solid after lyophilization.
  • Step 1 DIPEA (1.1 g, 8.3 mmol) was added to a O °C solution of (25", 5#)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]ctane-2-carbohydrazide (1.0 g, 2.48 mmol) in DMF (10 mL). 3- ((tert-Butoxycarbonyl)amino)propanoic acid (0.39 g, 2.07 mmol) and HATU (0.90 g, 2.48 mmol) were then added. The reaction mixture was stirred at 0 °C for 1 h and then quenched with saturated sodium chloride (50 mL).
  • Step 2 (CF 3 S0 2 ) 2 0 (1.0 mL) was slowly added to a -10 °C solution of ieri-butyl (3-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3- oxopropyl)carbamate (1.0 g, 2.17 mmol) and pyridine (1.0 mL) in dry DCM (10 mL). The reaction mixture was allowed to warm to rt and then was stirred at rt for 1 h. Then saturated NaHCC>3 was added at 0 °C very slowly.
  • Step 3 A mixture of ieri-butyl (2-(5-((2S,5fl)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl)carbamate (400 mg, 0.90mmol) and 10% Pd/C (50 mg) in THF (20 mL) was stirred under 3 ⁇ 4 atmosphere at rt for 3 h.
  • Step 4 To a solution of ieri-butyl (2-(5-((25,5/?)-6-hydroxy-7-oxo-l,6- diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl)carbamate (300 mg, 0.85 mmol) in dry pyridine (4.0 mL) was added SC>3- Py (542 mg, 3.4 mmol). The mixture was stirred at rt overnight and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH 2 P04 (1.5 M, 20 mL) then tetrabutylammonium hydrogensulphate (345 mg, 1.02 mmol) was added.
  • Step 5 TFA (0.80 mL) was added to a 0 °C solution of tetrabutylammonium (2S,5fl)-2-(5-(2- ((ieri-butoxycarbonyl)amino)ethyl)- 1 ,3 ,4-oxadiazol-2-yl)-7-oxo- 1 ,6- diazabicyclo[3.2.1]octan-6-yl sulfate (238 mg, 0.71 mmol) in dry DCM (2.0 mL). The reaction mixture was stirred at 0 °C for 30 minutes to 1 h and then diluted with ether. The precipitate was collected via centrifugation, washed with ether (3x) and further dried under high vacuum.
  • the crude product TFA salt was purified by prep-HPLC using ammonium formate buffer to provide (25,5 ?)-2-(5-(2-aminoethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (75 mg, 32%) as a white solid.
  • ESI-MS (EI + , m/z) 334.1.
  • Step 1 DIPEA (1.1 g, 8.3 mmol) was added to a 0 °C solution of (25", 5 «)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbohydrazide (1.0 g, 2.48 mmol) in DMF (10 mL). 3-((ieri-Butoxycarbonyl)amino)propanoic acid (0.39 g, 2.07 mmol) and HATU (0.90 g, 2.48 mmol) were then added. The reaction mixture was stirred at 0 °C for 1 h and then was quenched with saturated sodium chloride (50 mL).
  • Step 2 (CF 3 S0 2 ) 2 0 (1.0 mL) was slowly added to a -10 °C solution of ieri-butyl (3-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3- oxopropyl)carbamate (1.0 g, 2.17 mmol) and pyridine (1.0 mL) in dry DCM (10 mL). The reaction mixture was allowed to warm to rt, was stirred at rt for 1 h then sat. NaHCC>3 was added at 0 °C very slowly.
  • Step 3 TFA (0.5 mL) was added to a 0 °C solution of teri-butyl 2-(5-((2S,5R)-6-(benzyloxy)- 7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethylcarbamate (85 mg, 0.192 mmol) in CH 2 C1 2 (2.0 mL).
  • Step 4 TEA (77 mg, 0.764 mmol) was added to a 0 °C solution of (25,5R)-2-(5-(2- aminoethyl)- 1 ,3 ,4-oxadiazol-2-yl)-6-(benzyloxy)- 1 ,6-diaza-bicyclo[3.2.1 ]octan-7-one TFA salt from the previous step in MeOH (3.0 mL).
  • Step 5 To a solution of (25',5 ?)-2-(5-((2,3-bis(ieri-butoxycarbonyl)guanidino)ethyl)- 1,3,4- oxadiazol-2-yl)-6-(benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one (80 mg, 0.136 mmol) in THF (15 mL) was added 10% Pd/C (45 mg) and the mixture was stirred under 3 ⁇ 4 atmosphere at rt for 1 h.
  • Step 6 To a solution of (25 , ,5 «)-6-hydroxy-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)ethyl)-l ,3,4-oxadiazol-2-yl)-l,6-diaza-bicyclo[3.2.1]octan-7-one from the previous step in dry pyridine (2.0 mL) was added SC>3- Py (152 mg, 0.962 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH 2 P0 4 (1.5 M, 15 mL) then tetrabutylammonium
  • Step 4 Synthesis of tert-butyl4-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[ 3.2.1 ]octane-2-carbonyl)hydrazinyl)-4-oxobutylcarbamate:
  • Step 6-8 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)propyl)carbamate; (25',5 ?)-2-(5-(3-aminopropyl)-l,3,4-oxadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (1.48 g)
  • Step 1 DIPEA (105 g, 0.81mol) was added to a 0 °C solution of ieri-butyl piperazine-1- carboxylate (25.0 g, 0.134 mol) in DCM (250 mL), followed by the addition of triphosgene (92 g, 0.27 mol) in portions over a 40 minute time period. The reaction mixture was allowed to warm to rt then was stirred at rt for 3 hrs, filtered and concentrated to afford 1-ieri-butyl 4- trichloro methyl piperazine- 1 ,4-dicarboxylate (50 g) as an oil.
  • Step 2 DIPEA (3.7 g, 10 mmol) was added to a 0 °C solution of (2S,5R)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (1.45 g, 5.3 mmol, 0.8 eq.) and tert- butyl 4-(hydrazinecarbonyl)piperazine-l-carboxylate (1.6 g, 6.6 mmol) in dry DMF (50 mL), followed by the addition of HATU (1.45 g, 5.3 mmol). The reaction mixture was allowed to warm to rt then was stirred at rt overnight.
  • Step 3 To a solution of ieri-butyl 4-(2-((25 , ,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazine-carbonyl)piperazine-l-carboxylate (903 mg, 1.8 mmol) in DCM (200 mL) was added pyridine (2.8 mL, 36.0 mmol). (CF 3 S0 2 )20 (2.8 ml, 9.0 mmol) was then slowly added at -10 °C. The reaction mixture was stirred at rt for 3 hrs. Sat. NaHCC>3 was added at -10 °C very slowly.
  • Step 4 To a solution of ieri-butyl 4-(5-((25,5 ?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l-carboxylate (50 mg, 0.1 mmol) in THF (5.0 mL) was added 10% Pd/C (20 mg).
  • Step 5 To a solution of ieri-butyl 4-(5-((25 , ,5/?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l-carboxylate (30 mg, 0.077 mmol) in dry pyridine (3 ml) was added SC ⁇ - Py (97 mg, 0.61 mmol). The mixture was stirred at rt for 3 hrs. The pyridine was evaporated under vacuum at 25 °C. The residue was re-dissolved in aqueous NaH 2 P0 4 (1.5 M, 20 mL) and tetrabutylammonium
  • Step 1 Saturated NaHC0 3 (7.0 mL, 6.26 mmol) was added to a solution of (2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbohydrazide TFA salt (2.3 g, 5.69 mmol) in dioxane (11.4 mL) and the reaction mixture was stirred at rt for 5 minutes. Cyanic bromide (3 M solution, 2.3 mL, 6.90 mmol) was added and the reaction mixture was stirred at rt for 30 minutes.
  • reaction mixture was then loaded on a silica gel cartridge and purified by silica gel column chromatography (gradient elution 0-10% MeOH/DCM) to give (2S,5R)- 2-(5-amino-l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l ,6-diazabicyclo[3.2.1]octan-7-one (0.57 g, 32%).
  • ESI-MS EI + , m/z: 316.4 [M+H] + .
  • Step 2 N,N-Dimethylpyridin-4-amine (155 mg, 1.27 mmol) was added to a 0 °C solution of (25',5 ?)-2-(5-amino-l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l,6-diazabicyclo[3.2.1]octan-7-one (0.20 g, 0.63 mmol), Boc 2 0 (0.27 g, 1.27 mmol), and triethylamine (0.18 mL, 1.27 mmol) in DMF. The reaction mixture was allowed to warm to rt and was stirred for 2-3 hrs. The reaction mixture was then concentrated, re-dissolved in DCM (50 mL), washed with water
  • Step 3-5 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((25,5 ?)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (5-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazol-2-yl)carbamate, (25,5 ?)-2-(5 -amino- 1,3, 4-oxadiazol-2-yl)-7-oxo- 1,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate was obtained (64 mg) after prep-HPLC using ammonium formate buffer.
  • Step 1 HATU (0.95 g, 2.5 mmol) was added to a 0 °C solution of (2S,5R)-6-(benzyloxy)-7- oxo-l,6-diazabicyclo[3.2.1]octane-2-carbohydrazide (1.00 g, 2.5 mmol), 2-amino-2- oxoacetic acid (0.18 g, 2.1 mmol) and DIPEA (1.08 g, 8.4 mmol) in DMF (10 mL). The reaction mixture was stirred at 0 °C for 1 h then quenched with saturated sodium chloride (50 mL) and the organic layer was separated. The aqueous layer was exacted with EtOAc (3x).
  • Step 2 (CF 3 S0 2 ) 2 0 (0.58 g, 2.08 mmol) was slowly added to a -10 °C solution of 2-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2- oxoacetamide (0.30 g, 0.83 mmol) and pyridine (0.6 mL) in dry DCM (5 mL). The reaction mixture was allowed to warm to rt. The reaction mixture was stirred at rt for 1 h then quenched with sat. NaHCC>3 very slowly.
  • Step 3 To a solution of 5-((25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazole-2-carboxamide (0.14 g, 0.41 mmol) in THF (10 mL) was added 10% Pd/C (0.14 g).
  • Step 4 To a solution of 5-((25,5 ?)-6-hydroxy-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazole-2-carboxamide (103 mg, 0.41 mmol) in dry pyridine (2.0 rriL) was added SC>3- Py (323 mg, 2.03 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH 2 P0 4 (1.5 M, 10 mL) then tetrabutylammonium hydrogen sulphate (166 mg, 0.49 mmol) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography
  • Step 1 HATU (3.3 g, 8.7 mmol) and ieri-butyl 4-(hydrazinecarbonyl)piperidine-l- carboxylate (2.29 g, 9.42 mmol) were added to a 0 °C solution of (25',5 ?)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (2 g, 7.25 mmol) in CH2CI2 (50 mL), followed by the addition of DIPEA (2.8 g, 21.8 mmol).
  • Step 2 Lawesson's reagent (0.16 g, 6 mol) was added to a solution of ieri-butyl 4-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinecarbonyl)piperidine- 1 -carboxylate (0.16 g, 0.319 mmol) in THF (20 mL). The reaction mixture was stirred at 70 °C for 0.5 h. The solution was cooled to room temperature and sat. NaHCC>3 was added. The organic layer was separated and the aqueous layer was exacted with EtOAc (2x).
  • Step 3 To a solution of ieri-butyl 4-(5-((25 , ,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate (120 mg, 0.24 mmol) in THF (30 mL) was added 10% Pd(OH) 2 /C (200 mg).
  • Step 4 To a solution of ieri-butyl 4-(5-((25 , ,5/?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate from the former step in dry pyridine (3 mL) was added SC>3-Py (266 mg, 1.1 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous
  • Step 5 Tetrabutylammonium ieri-butyl 4-(5-((25,5 ?)-7-oxo-6-(sulfooxy)-l ,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate (110 mg, 0.15 mmol) was dissolved in a minimum amount of HPLC grade water (- 15 mL) and passed through a column of 16 g of DOWEX 50WX 8 Na + resin (the resin was pre-washed with >0.5 L of HPLC grade water) and eluted with HPLC grade water to afford sodium (25,5 ?)-2-(5-(l- (tert-butoxycarbonyl)piperidin-4-yl)-l,3,4-thiadiazol-2-yl)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate
  • Step 6 TFA (0.20 mL) was added to a 0 °C mixture of sodium (25,5R)-2-(5-(l-(tert- butoxycarbonyl)piperidin-4-yl)-l,3,4-thiadiazol-2-yl)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-6- yl sulfate (50 mg, 0.10 mmol) in dry DCM (0.60 mL). The reaction mixture was stirred at 0 °C for 2-3 hrs and then diluted with ether (-10 mL).
  • Step 1 Synthesis of methyl 3-(tert-butoxycarbonyl (methyl) amino )propanoate:
  • Step 2 Synthesis of ' tert-butyl 3 -hydrazinyl-3-oxopropyl (methyl) carbamate:
  • Step 3 Synthesis of tert-butyl 3 -(2-((2S, 5R)-6-(benzyloxy)-7-oxo-l, 6-diaza-bicyclo
  • Step 4 Synthesis of tert-butyl 2-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl(methyl)carbamate:
  • Step 5-7 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (2-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)ethyl)(methyl)carbamate; (2S,5R)-2-(5-(2-(methylamino)ethyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate
  • Step 1 Synthesis of tert-butyl 3-(2-ethoxy-2-oxoethylamino)azetidine-l-carboxylate:
  • Step 2 Synthesis of tert-butyl 3-(tert-butoxycarbonyl(2-ethoxy-2-oxoethyl)amino)azetidine-l- carboxylate:
  • Step 3 Synthesis of tert-butyl 3-(tert-butoxycarbonyl(2-hydrazinyl-2- oxoethyl)amino )azetidine-l -carboxylate:
  • Step 4 Synthesis of tert-butyl 3-((2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)(tert- butoxycarbonyl)amino )azetidine-l -carboxylate:
  • DIPEA 14 g, 0.11 mol was added to a 0 °C solution of ieri-butyl 3-(ieri-butoxycarbonyl(2- hydrazinyl-2-oxoethyl)amino)azetidine-l -carboxylate (15 g, 0.044 mol), (5 ?)-6-(benzyloxy)- 7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (10 g, 0.036 mol) and HATU (15 g, 0.04 mol) in CH2CI2 (250 mL) . The mixture was allowed to warm to rt then was stirred at rt for 2 hrs.
  • Step 5 Synthesis of tert-butyl 3-(((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl)(tert-butoxycarbonyl)amino)azetidine- 1 -carboxylate :
  • Et 3 N (8.3 g, 0.082 mol) was added to a 0 °C solution of I 2 (10.43 g, 0.041 mol) and PPh 3 (10.76 g, 0.041 mol) in CH 2 C1 2 (250 mL).
  • Step 6-8 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl 3-(((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)- 1 ,3 ,4-oxadiazol-2-yl)methyl)(tert-butoxycarbonyl)amino)azetidine- 1 -carboxylate; (2S,5R)-2-(5-((azetidin-3-ylamino)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diaza
  • Step 2 Synthesis oftert-butyl((lS,3r)-3-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1 ] octane-2-carbonyl) hydrazinecarbonyl)cyclobutyl )carbamate:
  • HATU (56.4 g, 148 mmol), and DIPEA (27.8 mL, 160 mmol) were added to a solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (31.6 g, 114 mmol) and ieri-butyl 4-hydrazinyl-4-oxobutylcarbamate (28.8 g, 126 mmol) in CH 2 C1 2 (460 mL).
  • Step 3 Synthesis oftert-butyl((lS,3r)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diaz bicycl[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclobutyl)carbamate:
  • reaction mixture was stirred at rt 12 hrs and then diluted with CH2CI2 (300 mL), washed with water (2x) and saturated sodium chloride (2x), dried over Na 2 S04, and concentrated. The residue was purified by silica gel column
  • Step 1 Synthesis of tert-butyl(l -(hydrazinecarbonyl)cyclopropyl)methylcarbamate:
  • CDI (12.5 g, 0.077 mol) was added to a 0 °C solution of l-((tert- butoxycarbonylamino)methyl)cyclopropanecarboxylic acid (15.0 g, 0.07 mol) in THF (250 mL). The mixture was allowed to warm to rt, and stirred at rt. for 2 hrs, and then
  • Step 2 Synthesis of tert-butyl(l-(2-((5R)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[ 3.2.1 Joctane- 2-carbonyl)hydrazinecarbonyl)cyclopropyl)methylcarbamate:
  • Step 3 Synthesis of tert-b tyl(l-(5-((5R)-6-(benzyloxy)-7-oxo-l ,6-diaza-bicyclo[3.2.1 Joctan- 2- yl)-l,3,4-oxadiazol-2-yl)cyclopropyl)methylcarbamate:
  • Et 3 N (8.3 g, 0.082 mol) was added to a 0 ° C solution of I 2 (10.43 g, 0.041 mol), PPh 3 (10.76 g, 0.041 mol) in CH 2 C1 2 (250 mL). The mixture was allowed to warm to rt. After stirring at rt for 0.5 hr, 1 ⁇ 2ri-butyl(l-(2-((5 «)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2- carbonyl)hydrazinecarbonyl)cyclopropyl)methylcarbamate (10 g, 0.0205 mol) was added.
  • Step 4 Synthesis of (5R)-2-(5-(l-(aminomethyl)cyclopropyl)-l,3,4-oxadiazol-2-yl)-6- (benzyloxy)-l ,6-diaza-bicyclo[3.2.1 ]octan-7-one:
  • Step 5 Synthesis of (5R)-2-(5-(l-(2,3-bis-(tert-butoxycarbonyl)- guanidinomethyl)cyclopropyl)- 1 ,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l ,6-diaza- bicyclo[3.2.1]octan-7-one:
  • Et 3 N (5 g, 0.05 mol) and tert-butyl (((tert-butoxycarbonyl)amino)(lH-pyrazol-l- yl)methylene)carbamate (5.5 g, 17.5 mmol) were added to a solution of (5R)-2-(5-(l- (aminomethyl)cyclopropyl)- 1 ,3,4-oxadiazol-2-yl)- 6-(benzyloxy)- 1 ,6-diaza- bicyclo[3.2.1]octan-7-one (7 g, 0.017 mol) in CH 3 OH (500 mL) . The mixture was stirred at rt for 4 hrs and then concentrated. The residue was purified by silica gel column
  • Step 6-8 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with (5 ?)-2-(5-(l-(2,3-bis-(ieri-butoxycarbonyl)-guanidinomethyl) cyclopropyl)- l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one; (2S,5R)-2-(5-(l- (guanidinomethyl)cyclopropyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-
  • Step 2 Synthesis of 1 -(2-(tert-butyldimethylsilyloxy)ethyl)cyclopropanamine:
  • Step 3 Synthesis of tert-butyl 1 -(2-(tert-butyldimethylsilyloxy)ethyl)cyclopropyl-carbamate: A solution of l-(2-(ieri-butyldimethylsilyloxy)ethyl)cyclopropanamine (1.9 g, 8.8 mmol), (Boc) 2 0 (2.9 g, 13.2 mmol), NaHC0 3 (1.5 g, 17.6 mmol) in THF/H 2 0 (20 mL/20 mL) was stirred at rt for 17 hrs. The mixture was extracted with EtOAc (3x). The combined organic layer was dried over Na 2 S0 4 and concentrated.
  • Step 4 Synthesis of tert-butyl l-(2-hydroxyethyl)cyclopropylcarbamate:
  • RuCi 3 .H 2 0 (124 mg, 0.6 mmol) was added to a solution of ieri-butyl l-(2- hydroxyethyl)cyclopropylcarbamate (6.1 g, 30 mmol), and NaI0 4 (19.0 g, 90 mmol) in DCM/H 2 0/CH 3 CN (20 mL/40 mL/20 mL). The mixture was stirred at rt for 3 hrs. The mixture was then diluted with H 2 0 (100 mL), and extracted with DCM (3x). The combined organic layer was dried over Na 2 S0 4 and concentrated.
  • Step 6 Synthesis of tert-butyl l-(2-(2-((2S, 5R)-6-(benzyloxy)-7-oxo-l, 6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)cyclopropylcarbamate: A solution of 2-(l-(ieri-butoxycarbonylamino)cyclopropyl)acetic acid (1.5 g, 6.9 mmol), (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbohydrazide (3.1 g, 7.6 mmol), DIPEA (2.7 g, 21.0 mmol), and HATU (3.9 g, 10.45 mmol) in DMF (20 mL) was stirred at 0 °C for 1 hr.
  • Step 7 Synthesis of ' tert-butyl l-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[ 3.2.1 ]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclopropylcarbamate: Method A:
  • Step 8-10 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (l-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclopropyl)carbamate; (2S,5R)-2-(5-((l- aminocyclopropyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulf
  • Step 1 Synthesis of tert-butyl 3-(2-hydrazinyl-2-oxoethyl)azetidine-l -carboxylate: To a solution of teri-butyl 3-(2-methoxy-2-oxoethyl)azetidine-l-carboxylate (25.0 g, 109 mmol) in MeOH (150 mL) was added ⁇ 2 ⁇ 2 ⁇ 2 0 (27.3 g, 546 mmol) at rt. The mixture was heated at 65 °C for 12 hrs and then concentrated.
  • Step 2 Synthesis of ' tert-butyl 3-(2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza
  • HATU (19.6 g, 52.2 mmol) and DIPEA (16.6 g, 130.5 mmol) were added to a 0 °C solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (12.0 g, 43.5 mmol), ieri-butyl 3-(2-hydrazinyl-2-oxoethyl)azetidine-l-carboxylate(11.3 g, 49.8 mmol) in CH 2 C1 2 (360 mL). The mixture was allowed to warm to rt then the mixture was stirred at rt for 12 hrs.
  • Step 3 Synthesis of tert-butyl 3 -((5-((2S, 5R)-6-(benzyloxy )-7-oxo-l, 6-diaza- bicyclo[3.2. l]octan-2-yl)-l, 3, 4-oxadiazol-2-yl)methyl)azetidine-l -carboxylate:
  • Step 4-6 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl 3-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)methyl)azetidine-l -carboxylate, (2S,5R)-2-(5-(azetidin-3-ylmethyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sul
  • Example 25 Synthesis of ' (2S,5R)-2-(5-((( 1 s,3R)-3-aminocyclobutyl)methyl)-l ,3,4-oxadiazol- 2-yl)-7-oxo- 6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 728) and (2S,5R)-2-(5-(((lr,3S)-3-aminocyclobutyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfatei Compound 751)
  • Step 1 Synthesis of ethyl 2-(3-(tert-butoxycarbonylamino)cyclobutylidene) acetate:
  • Step 4 Synthesis of ' tert-butyl 3-(2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo
  • Step 5 Synthesis of tert-butyl 3-((5-((25, 5 ?)-6-(benzyloxy)-7-oxo-l, 6-diaza-bicyclo [3.2.1] octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl) cyclobutylcarbamate:
  • Step 6-8 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (3-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclobutyl)carbamate, (2S,5R)-2-(5-(((ls,3R)-3- aminocyclobutyl)methyl)- 1 ,3 ,4-oxadiazol-2-yl)-7-oxo- 1 ,6-diazabicyclo[3.2.1 ]oct
  • Step 1 Synthesis of tert-butyl(lR,3S)-3-(2-((2S,5R)-6-(benzyloxy)-7 -oxo-1 ,6-diaza-bicyclo [3.2.1 ]octane-2-carbonyl)hydrazinecarbonyl)cyclopentylcarbamate:
  • Step 2 Synthesis oftert-butyl(lR,3S)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo [3.2.1 ]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclopentylcarbamate:
  • Step 3-5 Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl ((lR,3S)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo [3.2.1 ]octan-2-yl)- 1 ,3 ,4-oxadiazol-2-yl)cyclopentyl)carbamate; (2S,5R)-2-(5 - ((lS,3R)-3-aminocyclopentyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6-diazabicyclo[3.2.1
  • Example 62 Synthesis of(2S,5R)-2-(5-((2R,4S)-4-aminopyrrolidin-2-yl)-l,3,4-oxadiazol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 763)
  • Example 63 Synthesis of(2S,5R)-2-(5-((2R,4R)-4-aminopyrrolidin-2-yl)-l,3,4-oxadiaz.ol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 761)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

β-Lactamase inhibitor compounds (BLIs) are disclosed, including compounds that have activity against class A, class C or class D β-lactamases. Methods of manufacturing the BLIs, and uses of the compounds in the preparation of pharmaceutical compositions and antibacterial applications are also disclosed.

Description

1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE β-LACTAMASE INHIBITORS
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application No. 61/618,131, filed March 30, 2012, and U.S. Provisional Application No. 61/790,579, filed March 15, 2013. The entire contents of these applications are incorporated herein by reference in their entireties.
TECHNICAL FIELD
This disclosure is directed to β-lactamase inhibitors (BLIs) which are effective as inhibitors of β-lactamases and, when used in combination with β-lactam antibiotics are useful in the treatment of bacterial infections. The compounds when combined with a β-lactam antibiotic are effective in treating infections caused by bacteria that are resistant to β-lactam antibiotics due to the presence of β-lactamases. Pharmaceutical compositions comprising such compounds, methods of using such compounds, and processes for preparing such compounds are also disclosed.
BACKGROUND
Bacterial resistance to β-lactam antibiotics, especially in Gram-negative bacteria, is most commonly mediated by β-lactamases. β-lactamases are enzymes that catalyze the hydrolysis of the β-lactam ring, which inactivates the antibacterial activity of the β-lactam antibiotic and allows the bacteria to become resistant. Inhibition of the β-lactamase with a BLI slows or prevents degradation of the β-lactam antibiotic and restores β-lactam antibiotic susceptibility to β-lactamase producing bacteria. Many of these β-lactamases are not effectively inhibited by BLIs currently on the market rendering the β-lactam antibiotics ineffective in treating bacteria that produce these β-lactamases. There is an urgent need for novel BLIs that inhibit β-lactamases that are not effectively inhibited by the current clinical BLIs (e.g. KPC, class C and class D β-lactamases) and that could be used in combination with β-lactam antibiotics to treat infections caused by β-lactam resistant bacteria.
SUMMARY OF INVENTION
The present invention provides, in one aspect, compounds of chemical formula (I), or pharmaceutically-acceptable salts thereof, which are BLIs and are useful in combination with β-lactam antibiotics for the treatment of bacterial infections.
Figure imgf000004_0001
wherein X is selected from O and S ;
R is selected from
OSO3H ^ — < S03H -ΟΡΟ,Η -CH2C02H ancj — S-CF2C02H
and, selected from:
a. hydrogen;
Figure imgf000004_0002
wherein R is selected from
Figure imgf000004_0003
wherein each of R3, R4 and R5 is independently selected from hydrogen, (Q- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
Figure imgf000004_0004
wherein R is H, (C2-C3) alkylamino, and
Figure imgf000004_0005
d. amino;
Figure imgf000005_0001
wherein R7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000005_0002
and
and each of p and q is independently selected from 1 and 2; and f. -CH(R8)CH2NH2
wherein R8 is selected from amino and hydroxyl.
In another aspect, the invention provides compounds of chemical Formula (A-I) or a pharmaceutically acceptable salt thereof, which are BLIs and are useful in combination with β-lactam antibiotics for the treatment of bacterial infections.
Figure imgf000005_0003
wherein X* is selected from O and S;
R* is selected from
-OSO3H — ?-S03H -OPO3H -CH2C02H and — -CF2C02H
; and
: selected from:
a. hydrogen;
Figure imgf000005_0004
R is selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
ixyalkyl,
Figure imgf000005_0005
each of R4*, R5*, R6*and R7* is independently selected from hydrogen or (Q- C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R4*, R5*, R6 *and R7*is hydrogen,
n is selected from 1, 2, 3 and 4, and
m is selected from 1, 2 and 3;
Figure imgf000006_0001
wherein R is selected from NH2, R9R1°0NN^ NNRR 1111 ¾ <-. or
Figure imgf000006_0002
, wherein each of R4*, R5*, R6*and R7 is as described previously and each of R9, R10, and R11 is independently selected from hydrogen or (Ci-C6)-alkyl, provided that at least one of R9, R10, and R11 hydrogen; amino;
Figure imgf000006_0003
wherein Z is selected from CR12R13 or NR14,
each of R12 and R13 is independently selected from H, NH2 and
Figure imgf000006_0004
is as described previously,
alternatively, R12 and R13 together with the carbon to which they are attached, form a cycloalkylor heterocyclyl ring containing 4-6 ring members,
R14 is selected from H and
Figure imgf000006_0005
, wherein each of R15, R16 and R17 is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R , R and
R , 17 is hydrogen,
R is selected from NH2 and
Figure imgf000007_0001
, wherein each of R4*, R5*, R6*and R7* is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3,
T is selected from NH and O
t is selected from 0, 1, 2, 3, and 4, and
ependently selected from 0 and 1 ;
Figure imgf000007_0002
wherein R is selected from NH2 and
Figure imgf000007_0003
, wherein each of R4*, R5*, R6*and R7* is as described previously,
R 20 is selected from amino and hydroxyl, and
and 1 ;
wherein each of R4*, R5*, R6*and R7* is as described
Figure imgf000007_0004
wherein R is selected from NH2, -NH(C1-C3)-alkyl and
Figure imgf000007_0005
, wherein each of R4*, R5*, R6*and R7* is as described previously, s is selected from 0 and 1 , and
v is selected from 0, 1, 2, and 3;
Figure imgf000008_0001
wherein M is selected from NR22, CR23R24 and O,
wherein R22 is H or
Figure imgf000008_0002
, wherein each of R , R and R is as described previously,
each of R 23 and R 24 is independently selected from H, NH2 and
Figure imgf000008_0003
wherein each of R4*, R5*, R6 *and R7*is as described previously, and
0, 1 and 2;
Figure imgf000008_0004
In one embodiment, the invention provides use of a compound of Formula I for inhibiting β-lactamases.
In one embodiment, the invention provides use of a compound of Formula A-I for inhibiting β-lactamases.
In one embodiment, the invention provides compounds of Formula I with high binding affinity for β-lactamase enzymes.
In one embodiment, the invention provides compounds of Formula A-I with high binding affinity for β-lactamase enzymes.
In one embodiment, the present invention also provides antibacterial compositions comprising compounds of Formula I and at least one β-lactam antibiotic.
In one embodiment, the present invention also provides antibacterial compositions comprising compounds of Formula A-I and at least one β-lactam antibiotic. In one embodiment, the present invention provides pharmaceutical compositions comprising compounds of Formula I and at least one β-lactam antibiotic and methods of use thereof.
In one embodiment, the present invention provides pharmaceutical compositions comprising compounds of Formula A-I and at least one β-lactam antibiotic and methods of use thereof.
In one embodiment, the invention provides methods of use of the compounds of Formula I to treat bacterial infections in a subject.
In one embodiment, the invention provides methods of use of the compounds of Formula A-I to treat bacterial infections in a subject.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1I show Table I, Representative Compounds of Formula A-II
Figures 2A-2G show Table II, Standard BLI potentiation MIC assay against a panel of isogenic and clinical strains expressing β-lactamases.
Figures 3A-3F show Table III, the synergy MIC of representative compounds of Formula II-A against a panel of isogenic and clinical strains expressing β-lactamases.
Figures 4A-4C show Table IV, an assay to determine inhibition kinetics of representative compounds of Formula II-A for the KPC-2 β-lactamase.
Figures 5A-5B show Table V, Synergy MICof Comparator Compounds Against a Panel of Isogenic and Clinical Strains Expressing β-lactamases
Figure 6 shows Table VI, Standard BLI Potentiation MIC Assay of Compounds Partnered with CXA-101 Against a Panel of Isogenic and Clinical Strains Expressing β- Lactamases
Figure 7 shows Table VII, Standard BLI Potentiation MIC Assay of Compounds Partnered with Ceftazidime Against a Panel of Isogenic and Clinical Strains Expressing β- Lactamases
Figure 8 shows Table VIII, Standard BLI Potentiation MIC Assay of Compounds Partnered with Aztreonam Against a Panel of Isogenic and Clinical Strains Expressing β- Lactamases Figure 9 shows Table IX, Standard BLI Potentiation MIC Assay of Compounds Partnered with Meropenem Against a Panel of Isogenic and Clinical Strains Expressing β- Lactamases
DETAILED DESCRIPTION
Definitions:
Molecular terms, when used in this application, have their common meaning unless otherwise specified.
The term "alkyl" is defined as a linear or branched, saturated radical having one to about twenty carbon atoms unless otherwise specified. Preferred alkyl radicals are "lower alkyl" radicals having one to about five carbon atoms. Examples of alkyl groups include, without limitation, methyl, ethyl, ieri-butyl, isopropyl, and hexyl. A subset of the term alkyl is "(Ci-C3)-unsubstituted alkyl" which is defined as an alkyl group that bears no substituent groups. Examples of (Ci-C3)-unsubstituted alkyl groups include methyl, ethyl, propyl and isopropyl. It is understood that if a (Ci-C3)-alkyl is "substituted" that one or more hydrogen atoms is replaced by a substitutent.
The term amino denotes a NH2 radical.
The term "aminoalkyl" denotes an alkyl in which one or more of the alkyl hydrogen atoms has been replaced by an amino group.
The term "aminocycloalkyl" denotes a cycloalkyl in which one of the cycloalkyl hydrogen atoms has been replaced by an amino group.
The term "cycloalkyl" or "cycloalkyl ring" is defined as a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to twelve ring members. In a preferred embodiment, a cycloalkyl is a ring system having three to seven ring members. Examples of a cycloalkyl group include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl.
The term "hydroxyalkyl" denotes an alkyl radical in which one or more of the alkyl hydrogen atoms has been replaced by a hydroxyl group.
It will be understood by one of skill in the art that a
' or - denote the point of attachment of a substituent group where indicated. For example
Figure imgf000010_0001
represent that the point of attachment of the amide moiety is at the carbonyl carbon.
The functional classification of β-lactamases and terms "Class A", "Class C", and "Class D" β-lactamases are understood by one of skill in the art and are described in "Updated Functinal Classification of β -Lactamases", Bush, K.; Jacob y, G. A.; Antimicrob. Agents Chemother. 2010, 54, 969-976, herein incorporated by reference.
The salts of the compounds of the invention include acid addition salts and base addition salts. In a one embodiment, the salt is a pharmaceutically acceptable salt of the compound of Formula I. The term "pharmaceutically acceptable salts" embraces salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically-acceptable. Suitable pharmaceutically acceptable acid addition salts of the compounds of the invention may be prepared from an inorganic acid or an organic acid. Examples of such inorganic acids include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid. Examples of appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, arylaliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include, without limitation, formic, acetic, propionic, succinic, glycolic, gluconic, maleic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2- hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, β-hydroxybutyric, malonic, galactic, and galacturonic acid. Suitable pharmaceutically-acceptable base addition salts of compounds of the invention include, but are not limited to, metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from Ν,Ν'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N- methylglucamine, lysine and procaine. All of these salts may be prepared by conventional means from the corresponding compound of the invention by treating, for example, the compound of the invention with the appropriate acid or base.
The compounds of the invention can possess one or more asymmetric carbon atoms and are thus capable of existing in the form of optical isomers as well as in the form of racemic or non-racemic mixtures thereof. The compounds of the invention can be utilized in the present invention as a single isomer or as a mixture of stereochemical isomeric forms. Diastereoisomers, i.e., nonsuperimposable stereochemical isomers, can be separated by conventional means such as chromatography, distillation, crystallization or sublimation. The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example by formation of diastereoisomeric salts by treatment with an optically active acid or base. Examples of appropriate acids include, without limitation, tartaric, diacetyltartaric, dibenzoyltartaric, ditoluoyltartaric and camphorsulfonic acid. The mixture of diastereomers can be separated by crystallization followed by liberation of the optically active bases from the optically active salts. An alternative process for separation of optical isomers includes the use of a chiral chromatography column optimally chosen to maximize the separation of the enantiomers. Still another available method involves synthesis of covalent diastereoisomeric molecules by treating compounds of the invention with an optically pure acid in an activated form or an optically pure isocyanate. The synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation, and then hydro lyzed to obtain the enantiomerically pure compound. The optically active compounds of the invention can likewise be obtained by utilizing optically active starting materials. These isomers may be in the form of a free acid, a free base, an ester or a salt.
Compounds described herein also include isotopically- labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to 2H, 3H, UC, 13C, 14C, 36C1, 18F, 123I, 125I, 13N, 15N, 150, 170, 180, 32P, and 35S. In one embodiment, isotopically- labeled compounds are useful in drug and/or substrate tissue distribution studies. In another embodiment, substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements). In yet another embodiment, substitution with positron emitting isotopes, such as nC, 18F, 150 and 13N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non- labeled reagent otherwise employed.
The invention also embraces isolated compounds. An isolated compound refers to a compound which represents at least 10%, such as at least 20%, such as at least 50% and further such as at least 80% of the compound present in the mixture. In one embodiment, the compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound exhibits detectable (i.e. statistically significant) activity when tested in conventional biological assays such as those described herein. β-Lactamase Inhibitors (BLIs)
In one aspect, the invention provides compounds of Formula I or pharmaceutically- acceptable salts thereof:
Figure imgf000013_0001
The substituent X of Formula I is selected from O and S. In one aspect of the invention X is S. In another aspect of the invention X is O.
Substituent R of Formula I is selected from
— ^-OS03H ^ — ^-S03H ^ — ^-OP03H ; — ^-CH2C02H ; ancJ— ^-CF2C02H
In a preferred embodiment, R is
Figure imgf000013_0002
The group R1 of Formula I is selected from:
a. hydrogen;
Figure imgf000013_0003
wherein R is selected from
Figure imgf000013_0004
wherein each of R3, R4 and R5 is independently selected from hydrogen, (O- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
Figure imgf000014_0001
wherein R is H, (C2-C3) alkylamino, and
Figure imgf000014_0002
d. amino;
Figure imgf000014_0003
wherein R7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000014_0004
and
and each of p and q is independently selected from 1 and 2; and f. -CH (R8)CH2NH2
wherein R8 is selected from amino and hydroxyl.
In one aspect of the invention n is 1. In another aspect of the invention n is 2. another aspect of the invention n is 3.
In one aspect of the invention R1 is selected from H, -CH2NH2, -CH2CH2NH2, -CONH2, -NH2, -CH(OH)CH2NH2, -CH(NH2)CH2NH2, -CH2CH2NHCH2CH2NH2,
Figure imgf000015_0001
In one embodiment of the invention R is selected from H and
Figure imgf000015_0002
In one embodiment of the invention, the compounds of the invention are of the stereochemistry disclosed in Formula II.
Figure imgf000015_0003
In another embodiment of the invention, the compound is of Formula II and X is O, R is -OSO3H and R1 is H.
In another embodiment of the invention, the compound is of Formula II and X is O, R is -OSO3H and R1 is -CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is O, R is -OSO3H and R1 is -CH2CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000015_0004
is -OSO3H and R is H In another n, the compound is of Formula II and X is O, R
-OSO3H and R
Figure imgf000016_0001
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0002
In another embodiment of the invention, the compound is of Formula II and X is O, R -OSO3H and R1 is -NH2.
In another invention, the compound is of Formula II and X is O, R
-OSO3H and R
Figure imgf000016_0003
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0004
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0005
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0006
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0007
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0008
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000016_0009
and R is In another embodiment of the invention, the compound is of Formula II and X is O, R -OSO3H and R1 is -CH(OH)CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is O, R -OSO3H and R1 is -CH2CH2NHCH2CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is O, R -OSO3H and R1 is -CH(NH2)CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is S, R -OSO3H and R1 is -CH2CH2NH2.
In another embodiment of the invention, the compound is of Formula II and X is S, R
Figure imgf000017_0001
In another embodiment of the invention, the compound is of Formula II and X is O, R
Figure imgf000017_0002
In another embodiment of the invention, the compound is of Formula and II X is S, R
Figure imgf000017_0003
It will be understood by one of skill in the art that depending on the nature of R and R, compounds of Formula I may exist in a salt or zwitterionic form.
In one aspect, the invention provides compounds of Formula A-I or pharmaceutically- acceptable salts thereof:
Figure imgf000018_0001
The substituent X of Formula A-I is selected from O and S. In one aspect of the invention X* is S. In another aspect of the invention X* is O.
Substituent R* of Formula A-I is selected from
-OSO3H ^ — ^-S03H ^ — ^-OP03H ^ — ^-CH2C02H ; and— ^-CF2C02H
In a preferred embodiment, R* is
Figure imgf000018_0002
The group R1* of Formula I is selected from:
Figure imgf000018_0003
selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
hydroxyalkyl,
Figure imgf000018_0004
each of R4*, R5*, R6*and R7* is independently selected from hydrogen or (Ci-Ce)- alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R4*, R5*, R6 *and R7*is hyd]
n is selected from 1 , 2, 3 and 4, and
m is selected from 1 , 2 and 3 ;
Figure imgf000019_0001
wherein R is selected from NH2, r9r
Figure imgf000019_0002
wherein each of R4*, R5*, R6*and R7 is as described previously and each of R , R10, and R11 is independently selected from hydrogen or (Ci-C6)-alkyl, provided that at least one of R9, R10, and R11 is hydrogen; d. amino;
Figure imgf000019_0003
Z is selected from CR1ZR1J or NR ,
each of R and R is independently selected from H, NH2 and
Figure imgf000019_0004
wherein each of R4*, R5*, R6 *and R7*is as described previously,
alternatively, R12 and R13 together with the carbon to which they are attached, form a cycloalkyl or heterocyclyl ring containing 4-6 ring members,
R14 is selected from H and
Figure imgf000019_0005
and R1' is
independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl,
aminocycloalkyl, and hydroxyalkyl, provided that at least one of R15, R16 and R is hydrogen,
Figure imgf000019_0006
, wherein each of R4*, R5*, R6*and
R is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3,
T is selected from NH and O t is selected from 0, 1, 2, 3, and 4, and
each of r
wherein R
Figure imgf000020_0001
is selected from N¾ and , wherein each of R4*,
R5*, R6*and R7* is as described previously,
R 20 is selected from amino and hydroxyl, and
w is selec
h.
described
wherein R
Figure imgf000020_0002
is selected from NH2, -NH(C1-C3)-alkyl and
wherein each of R4*, R5*, R6*and R7* is as described previously,
s is selected from 0 and 1 , and
v is selected from 0, 1, 2, and 3;
Figure imgf000020_0003
wherein M is selected from NR , CRZJRZ4 and O,
wherein R is H and
Figure imgf000020_0004
, wherein each of R , R and R is as described previously,
Figure imgf000021_0001
wwhheerreeiinn eeaacchh ooff RR44**,, RR55**,, RR66 **and R7* is as described previously, and u is selected from 0, 1 and 2;
Figure imgf000021_0002
Figure imgf000021_0003
Figure imgf000022_0001
Figure imgf000023_0001
In one embodiment of the invention R is selected from
Figure imgf000023_0002
one embodiment of the invention R is selected from
Figure imgf000023_0003
In one embodiment of the invention, the compounds of the invention are of the stereochemistry disclosed in Formula A-II.
Figure imgf000024_0001
In another embodiment of the invention, X", R and R1* are chosen from the substituents listed in Table I (See Figure I).
Preferred compounds of Formula A-I are
Figure imgf000024_0002
Figure imgf000025_0001
It will be understood by one of skill in the art that depending on the nature of R1* and R*, compounds of Formula I may exist in a salt or zwitterionic form.
Enzyme Inhibition and Binding Affinity
The compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are effective in inhibiting β-lactamase. In one aspect of the invention the compounds of Table I are effective β-lactamase inhibitors.
the compound
Figure imgf000025_0002
is effective in inhibiting β-lactamase.
Figure imgf000025_0003
is effective in inhibiting β-lactamase.
Figure imgf000026_0001
is effective in inhibiting β-lactamase.
In one aspect the compound
Figure imgf000026_0002
is effective in inhibiting β-lactamase.
In one aspect the compound
Figure imgf000026_0003
is effective in inhibiting β-lactamase.
When used in combination with β-lactam antibiotics, the compounds of the invention
(e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate the activity of the β-lactam antibiotic against microorganisms that are normally resistant to β-lactam antibiotics due to the presence of a β- lactamase or multiple β-lactamases.
In one aspect of the invention the compounds of the invention (e.g. compounds of
Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula I, inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula A- I inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula II inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Formula A-II inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compounds of Table I inhibit β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compound of the Formula
Figure imgf000027_0001
inhibits β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of the invention the compound of the Formula
Figure imgf000027_0002
inhibits β-lactamases selected from class A, class D β-lactamases. In one aspect of the invention the compound of the Formula
Figure imgf000027_0003
inhibits β-lactamases selected from class A, class C or class D β-lactamases. In one aspect of
the invention the compound of the Formula
Figure imgf000027_0004
inhibits β-lactamases selected from class A, class D β-lactamases. In one aspect of the invention the compound of the Formula
Figure imgf000027_0005
inhibits β-lactamases selected from class A, class C or class D β-lactamases. Class A β- lactamases for example, include, but are not limited to, TEM, SHV, CTX-M, KPC, GES, VEB, SME, and GEX. In a preferred aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula I inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-I inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula II inhibit KPC β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-II inhibit KPC β-lactamases. More preferably the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC- 3 β-lactamases. More preferably the compounds of Formula I inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula A-I inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula II inhibit KPC-2 or KPC-3 β- lactamases. More preferably the compounds of Formula A- II inhibit KPC-2 or KPC-3 β- lactamases. In one aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II and Figures 6-9, Tables VI-IX). In one aspect of the invention, the compounds of Formula I inhibit KPC- 2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II and Figures 6-9, Tables VI- ΓΧ). In one aspect of the invention, the compounds of Formula A-I inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II and Figures 6-9, Tables VT-ΓΧ). In one aspect of the invention, the compounds of Formula II inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II and Figures 6-9, Tables VI-IX). In one aspect of the invention, the compounds of Formula A-II inhibit KPC-2 or KPC-3 β-lactamases in clinical strains (Figure 2, Table II and Figures 6-9, Tables VI-ΓΧ). Class C β-lactamases for example, include, but are not limited to chromosomal AmpCs, and plasmid based ACC, DHA, CMY, FOX, ACT, MIR, LAT, MOX β-lactamases. Class D β-lactamase enzymes, for example, include, but are not limited to oxacillinases or OXA β-lactamases. In a preferred aspect of the invention, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) inhibit OXA- 15 β- lactamases. In a preferred aspect of the invention, the compounds of Formula I inhibit OXA- 15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-I inhibit OXA- 15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula II inhibit OXA-15 β-lactamases. In a preferred aspect of the invention, the compounds of Formula A-II inhibit OXA-15 β-lactamases.
Unless otherwise indicated, the activity of the BLI compounds can be described by the MIC value obtained from a Synergy MIC assay or a BLI potentiation assay (e.g as described herein), both of which are run in the presence of a β-lactam. The lower the sMIC or MIC value the more active the BLI, regardless of the mechanism of action of the BLI compound (e.g., including inhibition of β-lactamases by the BLI or any other mechanism of action or combination of mechanisms of action). The sMIC and BLI potentiation assay data supports that the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) potentiate (i.e. make more potent) the activity of the β-lactam antibiotic against β-lactamase producing strains by inhibiting the β-lactamase.
In one embodiment, the BLI activity is measured by growth inhibition of a β- lactamase producing bacterial strains in a Synergy MIC (sMIC) assay. Preferably, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of
Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 μg/mL or less. In a more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 4 μg/mL to 8 μg/mL. In an even more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 1 to 2 μg/mL. In a still more preferred aspect of the invention, the sMIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 0.2 to 0.5 μg/mL. Synergy MICs for representative compounds of the invention are described in Table III (See Figure 3). It will be understood by one of skill in the art that the growth inhibition of β-lactamase producing strains can also be measured by a checkerboard synergy assay like that disclosed in
International Patent Application Number WO 2008/039420 or a standard BLI potentiation assay using a fixed concentration of BLI.
In one embodiment, the BLI activity is measured by growth inhibition of a β- lactamase producing bacterial strains in a standard BLI potentiation assay using a fixed concentration of BLI. Preferably, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 8 μg/mL or less. In a more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 4 to 8 μg/mL. In an even more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 1 to 2 μg/mL. In a still more preferred aspect of the invention, the MIC value for the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is 0.2 μg/mL to 0.5 μg/mL.
The compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a broad spectrum of activity across a wide variety of β-lactamase producing bacteria. It was surprisingly found that the compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are active in potentiating activity of β-lactam antibiotics, in particular, Ceftolozane, against strains expressing class D β-lactamase OXA-15 β-lactamase. Currently marketed BLIs inhibit most of the class A β-lactamases, but poorly inhibit class A KPC β-lactamases and class C β- lactamases and have variable success in inhibiting penicillinase and carbapenemase-type class D β-lactamases. The compounds of the present invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are active against a wide variety of bacterial strains that express class A and C β-lactamases and also, surprisingly are active against bacterial strains that express the class D cephalosporinase OXA-15 (Tables II and III). This increased activity against the class D β-lactamase is critical because differential effectiveness against different types of β-lactamase producing bacteria is necessary in order to effectively use β-lactam antibiotics to treat resistant strains of bacteria (vide infra).
In one embodiment, the compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are unexpectedly more active against bacterial strains that express OXA-15 β-lactamases than the most structurally similar compound, Avibactam (comparator compound CCC). Compounds that are more active than Avibactam against bacterial strains that express the class D cephalosporinase OXA-15 are, for example, compounds 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 776, 777, 778, 779, 780, 781, 782, 783, 784, 792, 794, 795 and 797.
In one embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are unexpectedly more active against and/or show broader spectrum of activity against bacterial strains that express KPC β-lactamases than the most structurally similar compound,
Avibactam. Compounds that are more active than Avibactam for at least one, bacterial strain that expresses KPC β-lactamase and/or show a better spectrum of activity against bacterial strains that express KPC β-lactamases than Avibactam are, for example, compounds 701,
702, 703, 705, 706, 708, 709, 710, 711, 712714, 720, 721, 722, 723, 724, 726, 727, 728, 729, 730, 731, 732, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 749, 750, 751, 752, 753, 754, 755, 756, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 770, 771, 772, 774, 775, 776, 777, 779, 782, 783, 784, 786, 794, and 795.
In another aspect of the invention, the compounds of the invention (e.g. compounds of
Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have high binding affinity for the β-lactamase enzyme. Consequently these compounds are better inhibitors of the β-lactamase enzyme. The inhibition kinetics of the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) was measured according to the procedure outlined in Example 102. The compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a high binding affinity for the β-lactamase enzyme.
In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a binding affinity of 1000-5000 mM'V1.
In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) have a binding affinity of 100-999 mM'V1. Compounds that have a binding affinity of 100-999 inM'V1 are, for example, compounds 701, 702, 703, 705, 706, 707, 709, 711, 712, 713, 714, 720, 730, 740, 741, 742, 743, 745, 746, 748, 749, 752, 753, 767, 770, 775, 779, 781, 782, 785, 794, 798 (Table IV). In one embodiment the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) have a binding affinity of 1-99 mM'V1. Compounds that have a binding affinity of 1-99 mM'V1 are, for example, compounds 704, 706, 708, 710, 715, 716, 717, 718, 719, 721, 722, 723, 724, 725, 726, 727, 728, 729, 731, 732, 733, 734, 735, 736, 737, 738, 739, 744, 747, 750, 751, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 769, 771, 772, 773, 774, 776, 777, 778, 780, 783, 784, 786, 792, 796, and 797 (Table IV).
It was surprisingly found that the compounds of the present invention have a higher binding affinity for the β-lactamase enzyme than the closest structural comparator Avibactam (Table IV, See Figure 4).
The compounds of the invention were also shown to be better BLIs than other comparator compounds as shown in Figure 5.
Pharmaceutical Compositions Comprising the Compounds of The Invention and Use Thereof Another object of the invention is pharmaceutical compositions or formulations comprising compounds the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is
pharmaceutical compositions or formulations comprising compounds of Formula I, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula A-I, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Formula II, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment ofthe invention is pharmaceutical compositions or formulations comprising compounds of Formula A-II, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising compounds of Table I. In one embodiment of the invention is
ositions or formulations comprising compounds of Formula
Figure imgf000032_0001
, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or formulations comprising
compounds of Formula
Figure imgf000033_0001
, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment the invention is pharmaceutical
compounds of Formula
Figure imgf000033_0002
thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the invention is pharmaceutical compositions or
formulations comprising compounds of Formula
Figure imgf000033_0003
, or salts thereof, preferably further comprising a β-lactam antibiotic. In one embodiment of the
itions or formulations comprising compounds of Formula
Figure imgf000033_0004
or salts thereof, preferably further comprising a β-lactam antibiotic.
The pharmaceutical compositions can be formulated for oral, intravenous, intramuscular, subcutaneous or parenteral administration for the therapeutic or prophylactic treatment of diseases, such as bacterial infections. Preferably, the pharmaceutical composition is formulated for intravenous administration.
The pharmaceutical preparations disclosed herein may be prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent or eliminate infection (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA and Goodman and Oilman's "The Pharmaceutical Basis of
Therapeutics," Pergamon Press, New York, NY, the contents of which are incorporated herein by reference, for a general description of the methods for administering various antimicrobial agents for human therapy).
The pharmaceutical compositions can comprise one or more of the compounds disclosed herein (e.g. one or more compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II, in conjunction with a β-lactam antibiotic, in association with one or more nontoxic, pharmaceutically-acceptable carriers and/or diluents and/or adjuvants and/or excipients. As used herein, the phrase "pharmaceutically-acceptable carrier" refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical
administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Non-limiting examples of carriers and excipients include corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid. The compositions may contain croscarmellose sodium, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid.
Tablet binders that can be included are acacia, methylcellulose, sodium
carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropyl methylcellulose, sucrose, starch and ethylcellulose.
Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.
Flavoring agents such as peppermint, oil of wintergreen, cherry flavoring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product.
For oral or parenteral administration, compounds of the present invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) preferably a compound of Formula A-I or Formula A-II, in conjunction with a β-lactam antibiotic, can be mixed with conventional pharmaceutical carriers and excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, wafers and the like. The compositions comprising a compound of this invention may contain from about 0.1% to about 99% by weight of the active compound, such as from about 10% to about 30%. For oral use, solid formulations such as tablets and capsules are useful. Sustained release or enterically coated preparations may also be devised. For pediatric and geriatric applications, one embodiment provides suspensions, syrups and chewable tablets. For oral administration, the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid.
The pharmaceutical compositions may be made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient. Examples of such dosage units are tablets and capsules. For therapeutic purposes, the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose;
lubricants, for example, magnesium stearate, polyethylene glycol, silica, or talc; disintegrants, for example, potato starch, flavoring or coloring agents, or acceptable wetting agents. Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs, preparations of the invention may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents. Non-limiting examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl
para-hydroxybenzoate, propylene glycol, sorbitol, or sorbic acid.
For intravenous (IV) use, the pharmaceutical composition (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) preferably a compound of Formula A-I or Formula A-II, in conjunction with a β-lactam antibiotic, can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Intravenous fluids include, without limitation, physiological saline or Ringer's solution. Intravenous administration may be accomplished by using, without limitation, syringe, mini-pump or intravenous line.
Pharmaceutical compositions of this invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) preferably a compound of Formula A-I or Formula A-II, for parenteral injection comprise pharmaceutically-acceptable aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, benzyl alcohol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils (such as corn oil or olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The compositions can include various buffers.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. They may also contain taggants or other anti-counterfeiting agents, which are well known in the art. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, and phenol sorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
Injectable depot forms can be made by forming microencapsulating matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly( anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissues.
The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. Such forms may include forms that dissolve or disintegrate quickly in the oral environment. In such solid dosage forms, the active compound preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be mixed with at least one inert, pharmaceutically-acceptable excipient or carrier. Suitable excipients include, for example, (a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders such as cellulose and cellulose derivatives (such as
hydroxypropylmethylcellulose, hydroxypropylcellulose, and carboxymethylcellulose), alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants such as glycerol; (d) disintegrating agents such as sodium starch glycolate, croscarmellose, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (e) solution retarding agents such as paraffin; (f) absorption accelerators such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate, fatty acid esters of sorbitan, poloxamers, and polyethylene glycols; (h) absorbents such as kaolin and bentonite clay; (i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (j) glidants such as talc, and silicone dioxide. Other suitable excipients include, for example, sodium citrate or dicalcium phosphate. The dosage forms may also comprise buffering agents.
Solid dosage forms, including those of tablets, dragees, capsules, pills, and granules, can be prepared with coatings and shells such as functional and aesthetic enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and colorants. They may also be in a form capable of controlled or sustained release. Examples of embedding compositions that can be used for such purposes include polymeric substances and waxes.
The pharmaceutical compositions can be delivered using controlled (e.g., capsules) or sustained release (e.g., bioerodable matrices) delivery systems. Exemplary delayed release delivery systems for drug delivery that are suitable for administering the pharmaceutical compositions are described in U.S. Patent Nos. 4,452,775 (issued to Kent), 5,039,660 (issued to Leonard), and 3,854,480 (issued to Zaffaroni).
In some cases, in order to prolong the effect of the drug, it may be desirable to slow the absorption of the drug following subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. Amorphous material may be used alone or together with stabilizers as necessary. The rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle.
For intramuscular preparations, a sterile formulation of compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or suitable soluble salt forms thereof, for example hydrochloride salts, can be dissolved and administered in a pharmaceutical diluent such as Water- for- Injection (WFI), physiological saline or 5% glucose. A suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g., an ester of a long chain fatty acid such as ethyl oleate.
A dose of an intravenous, intramuscular, or parental formulation of compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered as a bolus or by slow infusion. A bolus is a dose that is administered in less than 30 minutes. In one embodiment, a bolus is administered in less than 15 or less than 10 minutes. In another embodiment, a bolus is administered in less than 5 minutes. In yet another embodiment, a bolus is administered in one minute or less. An infusion is a dose that is administered at a rate of 30 minutes or greater. In one embodiment, the infusion is one hour or greater. In another embodiment, the infusion is substantially constant.
For topical use the pharmaceutical compositions, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints.
Such topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
For application to the eyes or ears, the pharmaceutical composition can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
For rectal administration, the pharmaceutical compositions, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, polyethylene glycol or a suppository wax or other glyceride that are solid at room
temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.
Alternatively, the pharmaceutical compositions can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery. In another embodiment, the unit dosage form of compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be a solution of one or more compounds, or salts thereof, in a suitable diluent, in sterile hermetically sealed ampoules or sterile syringes. The concentration of the compounds, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, in the unit dosage may vary, e.g. from about 1 percent to about 50 percent, depending on the compound used and its solubility and the dose desired by the physician. If the compositions contain dosage units, each dosage unit can contain from 1-500 mg of the active material. For adult human treatment, the dosage employed can range from 5 mg to 10 g, per day, depending on the route and frequency of administration.
The pharmaceutical compositions disclosed herein can be placed in a
pharmaceutically acceptable carrier and are delivered to a recipient subject (e.g., a human) in accordance with known methods of drug delivery. In general, the methods of delivering the pharmaceutical compositions in vivo utilize art-recognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention for the drugs in the art-recognized protocols. Likewise, methods for using the claimed compositions for treating cells in culture, for example, to eliminate or reduce the level of bacterial contamination of a cell culture, utilize art-recognized protocols for treating cell cultures with antibacterial agent(s) with the only substantial procedural modification being the substitution of the compounds of the present invention, preferably in combination with a β-lactam antibiotic for the drugs in the art-recognized protocols.
Exemplary procedures for delivering an antibacterial agent are described in U.S. Patent Nos. 6,468,967; 6,852,689; and 5,041,567, issued to Rogers and in PCT patent application number EP94/02552 (publication no. WO 95/05384), the disclosures of which are incorporated herein by reference in their entirety. In one embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous). In another embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally, rectally or via injection (intravenous, intramuscular or subcutaneous) to treat an infection caused by β-lactam resistant bacteria. In another embodiment, one or more compounds of the invention, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof are administered orally to treat an infection caused by β-lactamase producing bacteria.
As used herein, the phrases "therapeutically-effective dose" and "therapeutically- effective amount" refer to an amount of a compound that prevents the onset, alleviates the symptoms, stops the progression of a bacterial infection, or results in another desired biological outcome such as, e.g., improved clinical signs or reduced/elevated levels of lymphocytes and/or antibodies.
The term "treating" or "treatment" is defined as administering, to a subject, a therapeutically-effective amount of one or more compounds both to prevent the occurrence of an infection and to control or eliminate an infection. Those in need of treatment may include individuals already having a particular medical disease as well as those at risk for the disease (i.e., those who are likely to ultimately acquire the disorder).
The term "subject," as used herein, refers to a mammal, a plant, a lower animal, or a cell culture. In one embodiment, a subject is a human or other animal patient in need of antibacterial treatment.
The term "administering "or "administration" and the like, refers to providing the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) to the subject in need of treatment. Preferably the subject is a mammal, more preferably a human. The present invention comprises administering the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a β-lactam antiobiotic. When a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a β-lactam antiobiotic, the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antiobiotic can be administered at the same time or different times. When the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antiobiotic are administered at the same time, they can be administered as a single composition or pharmaceutical composition or they can be administered separately. It is understood that when a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) is administered in conjunction with a β-lactam antibiotic, that the active agents can be administered in a single combination or in multiple combinations. For example, when administered by IV, the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Conversely the β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion, then a compound of Formula I can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Alternatively, a pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) and a β-lactam antibiotic can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition comprising a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula I, and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-I, and a β- lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula II, and a β-lactam antibiotic. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically-effective amount of the pharmaceutical composition comprising a compound of Formula A-II, and a β-lactam antibiotic.
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula A-I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula II. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Formula A-II. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of Table I. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of
Figure imgf000042_0001
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of Formula
Figure imgf000042_0002
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of Formula
Figure imgf000043_0001
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of Formula
Figure imgf000043_0002
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection comprising administering to a subject in need thereof, a therapeutically- effective amount of a β-lactam antibiotic in conjunction with a compound of Formula
Figure imgf000043_0003
In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection in a subject comprising the steps of
a. administering to the subject a compound of the invention; and
b. administering to the subject a therapeutically-effective amount of a β-lactam
antibiotic.
In one embodiment the compound in step a is a compound of Formula I. In one embodiment the compound in step a is a compound of Formula A-I. In one embodiment the compound in step a is a compound of Formula II. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Table I. In one embodiment the compound in step a is a compound of Formula A-II. In one embodiment the compound in step a is a compound of Formula
Figure imgf000044_0001
In one embodiment the compound in step a is a compound of Formula
Figure imgf000044_0002
embodiment the compound in step a is a compound of Formula
Figure imgf000044_0003
embodiment the compound in step a is a compound of Formula
Figure imgf000044_0004
embodiment the compound in step a is a compound of Formula
Figure imgf000044_0005
In one embodiment, the β-lactam antibiotic in step b is Ceftolozane, Ceftazidime,
Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime. ment the compound in step a is a compound of Formula
Figure imgf000045_0001
and the β-lactam antibiotic in step b is Ceftolozane. In one embodiment the compound in step a is a compound of Formula
Figure imgf000045_0002
and the β-lactam antibiotic in step b is Ceftolozane.
In one embodiment the compound in step a is a compound of Formula
Figure imgf000045_0003
and the β-lactam antibiotic in step b is Ceftolozane.
In one embodiment the compound in step a is a compound of Formula
Figure imgf000045_0004
and the β-lactam antibiotic in step b is Ceftolozane.
In one embodiment the compound in step a is a compound of Formula
Figure imgf000045_0005
and the β-lactam antibiotic in step b is Ceftolozane. In one embodiment of the invention, is provided a method of treating or preventing a bacterial infection in a subject comprising the steps of
a. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic; and
b. administering to the subject a compound of the invention .
In one embodiment the compound in step b is a compound of Formula I. In one embodiment the compound in step b is a compound of Formula A-I. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Formula A- II. In one embodiment the compound in step b is a compound of Formula II. In one embodiment the compound in step b is a compound of Table I. In one
embodiment the compound in step b is a compound of Formula
Figure imgf000046_0001
step b is a compound of Formula
step b is a compound of Formula
step b is a compound of Formula
Figure imgf000046_0002
In one embodiment the compound in step b is a compound of Formula
Figure imgf000047_0001
In one embodiment, the β-lactam antibiotic in step a is Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime. In one embodiment the compound in step b is a compound of Formula
Figure imgf000047_0002
and the β-lactam antibiotic in step a is Ceftolozane. In one embodiment the compound in step b is a compound of Formula
Figure imgf000047_0003
and the β-lactam antibiotic in step a is Ceftolozane.
In one embodiment the compound in step b is a compound of Formula
Figure imgf000047_0004
and the β-lactam antibiotic in step a is Ceftolozane. ound in step b is a compound of Formula
Figure imgf000048_0001
and the β-lactam antibiotic in step a is Ceftolozane.
ound in step b is a compound of Formula
Figure imgf000048_0002
and the β-lactam antibiotic in step a is Ceftolozane.
In one embodiment, the invention provides a method for treating an infection in a subject by administering a therapeutically- effective amount of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β- lactam antibiotic, or compositions thereof. In one embodiment, the method comprises administering to a subject in need thereof a pharmaceutical composition comprising at least one of the compounds described herein, preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic. In one embodiment the co
Figure imgf000048_0003
in conjunction with a β-lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftoloz ns thereof. In one
embodiment the compound is of Formula
Figure imgf000048_0004
in conjunction with a β-lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime, or compositions thereof. In s of Formula
Figure imgf000049_0001
in conjunction with a β-lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam Meropenem, or more preferably, Ceftolozane f. In
one embodiment the compound is of Formula
Figure imgf000049_0002
in conjunction with a β-lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftoloz thereof. In one
embodiment the compound is of Formula
Figure imgf000049_0003
in conjunction with a β-lactam antibiotic, preferably Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime, or compositions thereof. In one embodiment, the pharmaceutical composition can comprise any one of the compounds described herein as the sole active compound or in combination with another compound, composition, or biological material. The compound may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally, vaginally, or by an implanted reservoir, external pump or catheter. The compound may be prepared for opthalmic or aerosolized uses. The compounds of the present invention can be administered as an aerosol for the treatment of pneumonia or other lung-based infections. In one embodiment, the aerosol delivery vehicle is an anhydrous or dry powder inhaler. One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof also may be directly injected or administered into an abscess, ventricle or joint. Parenteral administration includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, cisternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered intravenously, subcutaneously or orally. In one embodiment for administering one or more compounds according to the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic to a cell culture, the one or more compounds may be administered in a nutrient medium.
In one embodiment, one or more compounds according to the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or A-II in conjunction with a β- lactam antibiotic, may be used to treat a subject having a bacterial infection in which the infection is caused or exacerbated by any type of bacteria, such as Gram-negative bacteria. In one aspect of the invention, the bacterial infection is caused by β-lactam resistant bacteria. In one aspect the bacterial infection is caused by β-lactamase producing bacteria. In another aspect the bacterial infection is caused by class A, class C or class D β-lactamase producing bacteria. In another aspect the bacterial infection is caused by class A β-lactamase producing bacteria. In another aspect the infection is caused by class C β-lactamase producing bacteria. In still another aspect the infection is caused by class D β-lactamase producing bacteria. In still another aspect the infection is caused by KPC β-lactamase producing bacteria. In still another aspect the infection is caused by OXA β-lactamase producing bacteria. In still another aspect, the bacterial infection is caused by a bacteria that produces multiple β- lactamases. Bacteria that produce multiple β-lactamases may produce β-lactamases of the same class or of different classes (e.g class A and class A or class A and class C or class A and class D etc).
Representative Gram-negative pathogens known to express β-lactamases include, but are not limited to Acinetobacter spp. (including Acinetobacter baumannii), Citrobacter spp., Escherichia spp. (including Escherichia coli), Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp. (including Klebsiella pneumoniae), Enterobacter spp. (including Enterobacter cloacae and Enterobacter aerogenes), Pasteurella spp., Proteus spp. (including Proteus mirabilis), Serratia spp. (including Serratia marcescens), and Providencia spp. Bacterial infections can be caused or exacerbated by Gram-negative bacteria including strains which express β-lactamases that may confer resistance to penicillins, cephalosporins, monobactams and/or carbapenems. The coadministration of a novel BLI that inhibits these β-lactamases with a β-lactam antibiotic could be used to treat infections caused by β-lactam resistant bacteria.
In one aspect of the invention the infection is caused by a β-lactamase producing bacteria selected from Acinetobacter spp, Citrobacter spp, Escherichia coli, Enterobacter cloacae), Haemophilus influenzae, Pseudomonas aeruginosa, Proteus mirabilis, Serratia marcescens, and Klebsiella pneumoniae,
β-Lactam antibiotics that may be administered concurrently with compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) include, but are not limited to cephalosporin, carbapenem, monobactam, penem and penicillin classes of antibiotics.
In one embodiment of the invention, the β-lactam antibiotic is a cephalosporin.
Examples of cephalosporins include, but are not limited to, Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl), Cef alexin (cephalexin), Cefaloglycin (cephaloglycin), Cefalonium (cephalonium), Cefaloridine (cephaloradine), Cefalotin (cephalothin), Cefapirin (cephapirin), Cefatrizine,Cefazaflur, Cefazedone, Cefazolin (cephazolin), Cefradine (cephradine), Cefroxadine, Ceftezole, Cefaclor, Cefamandole, Cefmetazole, Cefonicid, Cefotetan, Cefoxitin, Cefprozil (cefproxil), Cefuroxime, Cefuzonam, Cefcapene, Cefdaloxime, Cefdinir, Cefditoren, Cefetamet, Cefixime, Cefmenoxime, Cefodizime, Cefotaxime, Cefpimizole, Cefpodoxime, Cefteram, Ceftibuten, Ceftiofur, Ceftiolene, Ceftizoxime, Ceftriaxone,
Cefoperazone, Ceftazidime, Cefclidine, Cefepime, Cefluprenam, Cefoselis, Cefozopran, Cefpirome, Cefquinome, Cefaclomezine, Cefaloram, Cefaparole, Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril, Cefmatilen, Cefmepidium, Cefovecin, Cefoxazole, Cefrotil, Cefsumide, Ceftaroline, Ceftioxide, Cefuracetime, cefbuperazone, cefminox, ceforanide, cefotiam, cefpiramide, cefsulodin, ceftobiprole latamoxef, loracarbef and Ceftolozane. In one embodiment the cephalosporin is Ceftolozane or Ceftazidime.
In one embodiment of the invention, the β-lactam antibiotic is a carbapenen.
Examples of carbapenem antibiotics include, but are not limited to, Imipenem, Imipenem/Cilastatin, Biapenem, Doripenem, Meropenem, Ertapenem and Panipenem. In one embodiment the Carbapenem is Imipenem/Cilastatin or Meropenem.
In one embodiment of the invention, the β-lactam antibiotic is a monobactam.
Examples of monobactam antibiotics include, but are not limited to Aztreonam, Tigemonam, Carumonam, BAL30072 and Nocardicin A.
In one embodiment of the invention, the β-lactam antibiotic is a penem. In one embodiment of the invention, the β -lactam antibiotic is a penicillin. Examples of penicillin antibiotics include, but are not limited to Amoxicillin, Ampicillin, Azlocillin, Mezlocillin, Apalcillin, Hetacillin, Becampicillin, Carbenicillin, Sulbenicillin, Ticarcillin, Piperacillin, Azlocillin, Mecillinam, Pivmecillinam, Methicillin, Ciclacillin, Talampicillin, Aspoxicillin, Oxacillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Nafcillin and Pivampicillin.
In one embodiment the cephalosporin is Ceftolozane, Ceftazidime, Aztreonam or Meropenem, or more preferably, Ceftolozane or Ceftazidime.
The pharmaceutical compositions, preferably a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) in conjunction with a β-lactam antibiotic, can be used to treat a bacterial infection of any organ or tissue in the body caused by β-lactam resistant bacteria, preferably, Gram-negative β-lactam resistant bacteria. These organs or tissue include, without limitation, skeletal muscle, skin, bloodstream, kidneys, heart, lung and bone. For example, a pharmaceutical composition comprising at least one compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered to a subject to treat, without limitation, skin and soft tissue infections (e.g., complex skin infections), bacteremia, intra-abdominal infections and urinary tract infections (e.g., cUTI). In addition, a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) may be used to treat community acquired respiratory infections, including, without limitation, otitis media, sinusitis, chronic bronchitis and pneumonia (including community- acquired pneumonia, hospital-acquired pneumonia and ventilator associated pneumonia), including pneumonia caused by drug-resistant Pseudomonas aeruginosa . At least one compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered to a subject to treat mixed infections that comprise different types of Gram-negative bacteria, or which comprise both Gram-positive and Gram-negative bacteria. These types of infections include intra-abdominal infections and
obstetrical/gynecological infections. At least one compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may also be administered to a subject to treat an infection including, without limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections and osteomyelitis. At least one compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, or pharmaceutical compositions thereof, may also be directly injected or administered into an abscess, ventricle or joint. Pharmaceutical compositions of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered as an aerosol for the treatment of pneumonia or other lung-based infections. In one embodiment, the aerosol delivery vehicle is an anhydrous, liquid or dry powder inhaler.
Actual dosage levels of active ingredients in the pharmaceutical compositions of one or more compounds according to the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be varied so as to obtain a therapeutically-effective amount of the active compound(s) to achieve the desired therapeutic response for a particular patient, compositions, and mode of administration. The effective amount can be determined as described herein. The selected dosage level will depend upon the activity of the particular compound, the route of administration, the severity of the condition being treated, and the condition and prior medical history of the patient being treated. However, it is within the skill of the art to start doses of the compound at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. In one embodiment, the data obtained from the assays can be used in formulating a range of dosage for use in humans. It will be understood by one of skill in the art that the when the composition comprises a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and a β-lactam antibiotic, both the compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) and the β-lactam antibiotic are active compounds.
The method comprises administering to the subject an effective dose of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably in conjunction with a β lactam antibiotic. An effective dose of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II) is generally between 125 mg/day to 2000 mg/day. In one embodiment, an effective dose is from about 0.1 to about 100 mg/kg of one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In one embodiment, the dose is from about 0.1 to about 50 mg/kg of one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In another embodiment, the dose is from about 1 to about 25 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or pharmaceutically acceptable salts thereof. In another embodiment, the dose is from about 1 to about 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In another embodiment, the dose is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg of one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 100 mg to 1000 mg per dose up to four times per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 125 mg to 750 mg per dose up to four times per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered to a human at a dose of 250 mg to 500 mg per dose up to four times a day. An effective dose for cell culture is usually between about 0.1 and about 1000 μg/mL. In one embodiment, the effect dose for cell culture is between about 0.1 and about 200 μg/mL.
In one embodiment, a β-lactam antibiotic and a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) are administered in ratio of 1:4 to 8:1 antibiotic: compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II). In one embodiment the ratio is 1 :4. In another embodiment the ratio is 3:4. In another embodiment the ratio is 5:4. In another embodiment the ratio is 7:4. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:3. In another embodiment the ratio is 2:3. In another embodiment the ratio is 4:3. In another embodiment the ratio is 5:3. In another embodiment the ratio is 7:3. In another embodiment the ratio is 1:2. In another embodiment the ratio is 3:2. In another embodiment the ratio is 5:2. In another embodiment the ratio is 7:2. In another embodiment the ratio is 1:1. In another embodiment the ratio is 2:1. In another embodiment the ratio is 3:1. In another embodiment the ratio is 4:1. In another embodiment the ratio is 5:1. In another embodiment the ratio is 6:1. In another embodiment the ratio is 7:1. In another embodiment the ratio is 8:1. It will be understood by one of skill in the art that the β- lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided regardless of the method of drug delivery. It will also be understood by one of skill in the art that the β-lactam antibiotic and compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be administered within the range of ratios provided together, for example, in a pharmaceutical composition, or sequentially, i.e. the β-lactam antibiotic is administered, followed by administration of a compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) or vice versa.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) may also be administered in the diet or feed of a patient or animal. If administered as part of a total dietary intake, the amount of compound employed can be less than 1% by weight of the diet, such as no more than 0.5% by weight. The diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, can be administered as a single daily dose or in multiple doses per day. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, is administered as a single dose per day. In another embodiment, one or more compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I of Formula A-II in conjunction with a β-lactam antibiotic is administered as two equal doses per day. In another
embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic is administered in three equal doses per day. In another embodiment, the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic is administered in four equal doses per day. The treatment regime may require administration over extended periods of time, e.g., for several days or for from two to four weeks. The amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the infection, the age and general health of the patient, the tolerance of the patient to the compound of the invention and the β-lactam antibiotic and the microorganism or microorganisms involved in the infection. The treatment regimen for one type of infection may differ greatly from the treatment regimen of another infection. For example, one type of infection may require administration via intravenous administration once daily, while another infection may require a treatment regimen of multiple dosing orally.
One or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, may be administered according to this method until the bacterial infection is eradicated or reduced. In one embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for a period of time from 3 days to 6 months. In another embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 56 days. In another embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 28 days. In a further embodiment, one or more compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A- II), preferably a compound of Formula A-I or Formula A-II in conjunction with a β-lactam antibiotic, are administered for 7 to 14 days. Compounds of the present invention may be administered for a longer or shorter time period if it is so desired.
Other embodiments of the invention include:
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 β- lactam antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 cephalosporin antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and Ceftolozane or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 carbapenem antibiotic or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising a compound of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II and at least 1 monobactam antibiotic or a pharmaceutically acceptable salt thereof.
The embodiments described herein provide compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II that are novel and active β-lactamase inhibitors. Other embodiments described herein provide novel compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II in conjunction with β-lactam antibiotics for treatment of infections. Further embodiments described herein provide novel compounds of the invention (e.g.
compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II), preferably a compound of Formula A-I or Formula A-II that show unexpected activity against β-lactamases that other compounds in the class do not have. Preparation of Compounds of the Invention
A compound of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be prepared by a variety of synthetic routes, including synthetic schemes described herein. These synthetic routes can be applied to large scale synthesis with appropriate adjustment of reaction sequence, reaction conditions, isolation/purification methods and choice of solvents which are environmentally friendly and cost-effective.
The following abbreviations have the following meanings unless otherwise indicated. Abbreviations not defined below have their generally accepted meaning.
Bn = benzyl
Boc = ieri-butoxycarbonyl
Boc20 = di-ieri-butyldicarbonate
Burgess reagent = methyl N-triethylammoniumsulfonyl)carbamate
CDI = carbonyldiimidazole
CFU = colony- forming units
CLSI = Clinical Laboratory Standards Institute cSSSI = complicated skin and skin structure infections
DBU = 1 ,8-diazabicyclo[5.4.0]undec-7-ene
DCM = dichloromethane
DEAD = diethyl azodicarboxylate DIAD diisopropyl azodicarboxylate
DIPEA diisoprop ylethylamine
DMF N,N-dimethylformamide
DMAc N,N-dimethylacetamide
DMSO dimethyl sulfoxide
EDCI 1- ethyl-3-(3'- dimethylaminopropyl)carbodiimide
ELSD evaporative light scattering detector
EtOAc ethyl acetate
ESI-MS electrospray ionization mass spectrometry
Fmoc Fluorenylmethyloxycarbonyl
HAP Hospital- Acquired Pneumonia
HATU 2- (7 - aza- 1 H-benzotriazole- 1 - yl) - 1 , 1 ,3 , 3 - tetramethyluronium hexafluoropho sphate
HC1 hydrochloride
HOBt 1 -hydroxybenzotrizole
I Irs hours
HPLC high performance liquid chromatography
Hunig's base Ν,Ν-Diisoprop ylethylamine
Lawesson's reagent 2,4-bis(4-methoxyphenyl)- 1 ,3 ,2,4- dithiadiphosphetane-2,4-disulfide
MIC minimum inhibitory concentration mL milliliter
MS mass spectrometry
MRSA methicillin-resistant Staphylococcus aureus
NMR nuclear magnetic resonance
Ns nitrobenzenesulfonyl
Pa Pseudomonas aeruginosa
Prep preparative
Ppm parts per million
Py pyridine
sat. saturated
rt room temperature
TBAF tetrabutylammonium fluride TBS t-butyldimethylsilyl
TES triethylsilyl
TEA triethylamine
TEMPO 2,2,6,6-tetramethyl- 1 -piperidinyloxy, free
radical
THF tetrahydrofuran
TFA trifluoroacetic acid
TMS trimethylsilyl
TLC thin layer chromatography
VAP Ventilator- Associated Pneumonia
The compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) can be prepared from intermediate 1, according to the following reaction schemes and examples, or modifications thereof, using readily available starting materials, reagents and conventional synthetic procedures including, for example, procedures described in US7112592 and
WO2009/091856.
As depicted in Scheme 1 , compound 3 can be synthesized following standard oxadiazole ring formation chemistry from the diacylhydrazide intermediate 2g (see, e.g., Jakopin, Z.; Dolenc, M. S. Curr. Org. Chem. 2008, 12, 850-898; Walker, D. G.; Brodfuehrer, P. R.; Brundidge, S. P. Shih, K. M.; Sapino, C. Jr. /. Org. Chem. 1988, 53, 983-991 and references cited therein). Diacylhydrazide intermediate 2g can be prepared via standard amide coupling reactions from acylhydrazide intermediate 2f. Alternatively, 2g can be made by an amide coupling reaction of acylhydrazine derivative 2h and acid intermediate 2a, which can be prepared from ester intermediate 1. It may be necessary to protect certain functionalities in the molecule depending on the nature of the R1 group. Protecting these functionalities should be within the expertise of one skilled in the art. See, e.g P. G. M. Wuts and T. W. Greene, Protective Groups in Organic Synthesis, Fourth Edition, John Wiley and Sons, 2006, hereafter Greene.
Scheme I
Figure imgf000061_0001
R-COOH
HATU, DIPEA
DCM
Figure imgf000061_0002
2g
S03 pyridine
Figure imgf000061_0003
5 6
The benzylic ether protecting group in 3 can be removed via standard hydrogenolysis conditions, such as, but not limited to, Pd/¾ in MeOH or THF or by acid-catalysed hydrolysis, such as, but not limited to, BCI3 in DCM to provide the hydroxy-urea
intermediate 4, which can be used directly in the next step without further purification.
Sulfation of 4 can be achieved by treatment with a sulfating reagent, such a, but not limited to, SC .pyridine complex, in an appropriate solvent, such as pyridine, DMF or DMAc at a temperature of 0-80 °C, preferable at room temperature. Compound 5 can then be isolated and purified via conventional methods. For example, 5 can be purified by standard reverse phase prep-HPLC using appropriate buffer system, i.e. ammonium formate buffer. In some cases, 5 can be purified by normal phase silica gel chromatography after converting to an appropriate salt form, such as sulfate tetrabutyl ammonium salt. The tetrabutyl ammonium salt can then be converted to a sodium salt by cation exchange. When a protecting group(s) is present in the sidechain (i.e. Boc or Fmoc for amine and guanidine protection, TBS or TES for alcohol protection, etc), a deprotection step is needed to convert 5 to its final product 6, which can be purified by prep-HPLC using the conditions mentioned above. For example, for N-Boc deprotection, 5 can be treated with an acid, such as TFA, in an appropriate solvent, such as DCM at a temperature of 0-30 °C, preferable at 0 °C to rt to give 6. For an O-TBS, or O-TES deprotection, a fluoride reagent such as HF.pyridine, HF.NEt3, or TBAF can be used. For Fmoc deprotection, amines can be used, such as diethylamine, DBU, piperidine, etc can be used.
Similarly, as shown in Scheme 2, thiadiazole derivative 3a can be synthesized from diacylhydrazide intermediate 2g by treatment with Lawesson's reagent under heating. 3a can then be converted to the final product 6a using similar chemistry as described previously.
Scheme 2
Figure imgf000062_0001
3a 4a
S03 pyridine
Figure imgf000062_0002
EXAMPLES
The specific examples which follow illustrate the synthesis of certain compounds. The methods disclosed may be adopted to variations in order to produce compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) but not otherwise specifically disclosed. Further, the disclosure includes variations of the methods described herein to produce the compounds of the invention (e.g. compounds of Formula I, compounds of Formula A-I, compounds of Formula II, compounds of Formula A-II) that would be understood by one skilled in the art based on the instant disclosure.
All temperatures are understood to be in Centigrade (C) when not specified. The nuclear magnetic resonance (NMR) spectral characteristics refer to chemical shifts (γ) expressed in parts per million (ppm) versus tetramethylsilane (TMS) as reference standard. The relative area reported for the various shifts in the proton NMR spectral data corresponds to the number of hydrogen atoms of a particular functional type in the molecule. The nature of the shifts as to multiplicity is reported as broad singlet (br s), broad doublet (br d), singlet (s), multiplet (m), doublet (d), quartet (q), doublet of doublet (dd), doublet of triplet (dt), and doublet of quartet (dq). The solvents employed for taking NMR spectra are DMSO-d6 (perdeuterodimethysulfoxide), D20 (deuterated water), CDCI3 (deuterochloroform) and other conventional deuterated solvents. The prep-HPLC conditions are: Waters SunFire® C18 (30x100 mm, 5 μιη OBD) column; flow rate: 30-80 mL/minute, ELSD or Mass-triggered fraction collection; sample loading: Each injection loading varied from - 300 mg for different crude samples depending on their solubility and purity profiles; Solvent system using ammonium formate buffer: solvent A: water with 20 mM ammonium formate, solvent B: 85% of acetonitrile in water with 20 mM ammonium formate. Solvent system using
NH4HCO3 buffer: solvent A: water with 10 mM NH4HCO3, solvent B: acetonitrile. Solvent system using NH4OH buffer: solvent A: water with 0.1% NH4OH, solvent B: acetonitrile with 0.1% NH4OH.
Example 1: Synthesis of (2S,5R)-ethyl 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 loctane-2- carboxylate (Intermediate Compound 1 )
Figure imgf000063_0001
1
Synthesis of (S)-l-tert-butyl 2-ethyl 5-oxopiperidine-l ,2-dicarboxylate
Method A:
Boc Boc O Boc
N TMSCHN2 Ν,^ ΗΝ. ,J R 2(OAc)4 N
"OEt
X J ± J
O'
n-BuLi was added dropwise to a solution of TMSCHN2 (690 mL, 1.38 mol ) in dry THF (3 L) (600 mL, 1.5 mol ) at -78 °C, and the mixture was stirred at -78 °C for 30 minutes. The mixture was then transferred to a solution of (5')-l-tert-butyl 2-ethyl 5-oxopyrrolidine-l,2- dicarboxylate (300 g, 1.17 mol) in dry THF (3 L) via cannula, and the mixture was stirred at - 78 °C for 30 minutes. The reaction mixture was then quenched with sat. NH4CI solution, and extracted with DCM three times. The combined organic layer was concentrated in vacuum and the crude product was purified by silica gel column chromatography (3 : 1 petroleum ether :EtOAc ) to afford (5')-ethyl 2-((tert-butoxycarbonyl)amino)-6-diazo-5-oxohexanoate (262 g, 75 %) as a yellow solid.
A solution of (S^-ethyl 2-((ieri-butoxycarbonyl)amino)-6-diazo-5-oxohexanoate (350 g, 1.18 mol ) in DCM (1500 rriL) was added to a solution of Rh2(OAc)4 (3.5 g, 7.9 mmol ) in DCM (750 mL) at 0 °C. The reaction was then stirred at 20 °C overnight and then concentrated in vacuum. The crude sample was purified by silica gel column chromatography (5:1 petroleum ether/EtOAc) to afford (^-l-tert-butyl 2-ethyl 5-oxopiperidine-l,2-dicarboxylate (175.9 g, 55%) as a yellow oil.
Method B
Figure imgf000064_0001
DMSO
t-BuOK (330 g, 2.9 mol) was added to a solution of trimethylsulfoxonium iodide (750 g, 3.5mol) in dry DMSO (3 L) and the mixture was stirred at rt for 1 h. (^-l-tert-Butyl 2-ethyl 5-oxopyrrolidine-l,2-dicarboxylate (900 g, 3.5 mol) was added and the mixture was stirred at rt for 2-3 hrs. Water was added to quench the reaction and the mixture was extracted with EtOAc 5 times. The combined organic layer was concentrated in vacuum and the crude sample was purified by silica gel column chromatography (l:lpetroleum ether/EtOAc then 1:10 MeOH/DCM) to afford sulfoxonium ylide intermediate (977 g, 80%) as a white solid.
A solution of sulfoxonium ylide intermediate (156 g, 0.446 mol) and [Ir(COD)Cl]2 (3 g, 4.46 mmol) in toluene(4 L) was degassed by bubbling nitrogen through the solution for 10 minutes. The reaction mixture was heated to 80-90 °C for 2-3 hrs and then cooled to 20 °C. Then toluene was concentrated in vacuum, the residue was purified by silica gel column chromatography (10:1 to 3:1 gradient petroleum ether/EtOA) to afford (^-l-tert-butyl 2-ethyl 5-oxopiperidine-l,2-dicarboxylate (140 g, 57.8%) as a yellow oil.
Step 2: Synthesis of (2S,5S)-1 -tert-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate
Figure imgf000064_0002
NaB¾ (36 g, 1.0 mol) was added in portions to a solution of (5)- 1-tert-butyl 2-ethyl 5- oxopiperidine-l ,2-dicarboxylate (250 g, 0.92 mol) in EtOH (1500 mL) at -40 °C. The reaction mixture was then stirred at -40 °C for 0.5 hr then quenched with 10% HOAc solution. After diluting with water, the mixture was extracted with DCM three times. The combined organic layer was concentrated in vacuum and purified by silica gel column chromatography (1 :1 petroleum ether/EtOAc) to afford (25,55)- 1-tert-butyl 2-ethyl 5- hydroxypiperidine-l,2-dicarboxylate (205 g, 80%) as a yellow oil.
Step 3: Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l,2-dicarboxylate
Figure imgf000065_0001
A solution of 2-nitrobenzene-l-sulfonyl chloride (500 g, 2.26 mol) in pyridine (1500 mL) was added dropwise to a solution of 0-benzylhydroxylamine hydrochloride (400 g, 2.51 mol) in pyridine (1500 mL) at 0 °C. The reaction mixture was then stirred at 20 °C overnight. The mixture was concentrated in vacuum, diluted with DCM and washed with HC1 (10%) three times. The combined organic layer was concentrated in vacuum and re-crystallized with DCM to afford N-(benzyloxy)-2-nitrobenzenesulfonamide (485 g, 62.6%) as a yellow solid.
To a solution of N-(benzyloxy)-2-nitrobenzenesulfonamide (212 g, 0.69 mol) in THF (1000 mL) was added (25,55)- 1-tert-butyl 2-ethyl 5-hydroxypiperidine-l,2-dicarboxylate (171 g, 0.63 mol) and PP1¾ (275 g, 1.05 mol), followed by dropwise addition of a solution of DEAD (195 g, 1.12 mol) in THF (500 mL). The mixture was then stirred at 20 °C overnight. The reaction mixture was then concentrated in vacuum and purified by silica gel column chromatography (3:1 petroleum ether/EtOAc) to afford (25,5 ?)-l-tert-butyl 2-ethyl 5-(N- (benzyloxy)-2-nitrophenylsulfonamido)piperidine-l,2-dicarboxylate (283.8 g, 80%) as a yellow oil.
Step 4: Synthesis of (2S,5R)-l-tert-butyl 2-ethyl 5-((benzyloxy)amino)piperidine-l,2- dicarboxylate
Figure imgf000066_0001
LiOH'H20 (95 g, 2.3 mol) and 2-mercaptoacetic acid (124 g, 1.3 mol) were added to a solution of (2S,5fl)-l-tert-butyl 2-ethyl 5-(N-(benzyloxy)-2- nitrophenylsulfonamido)piperidine-l ,2-dicarboxylate (251 g, 0.45 mol) in DMF (1200 mL) . The reaction mixture was then stirred at 20 °C overnight. The reaction mixture was diluted with water and extracted with EtOAc (3x). The combined organic layer was washed with brine (3x), concentrated in vacuum and purified by silica gel column chromatography (3:1 petroleum ether/EtOAc) to afford (2S,5fl)-l-tert-butyl 2-ethyl 5- ((benzyloxy)amino)piperidine-l,2-dicarboxylate (122.9 g, 85%) as a yellow solid.
Step 5: Synthesis of (2S,5R)-ethyl 5-((benzyloxy)amino)piperidine-2-carboxylate
Figure imgf000066_0002
TFA (600 mL) was added to a solution of (2S,5fl)-l-tert-butyl 2-ethyl 5- ((benzyloxy)amino)piperidine-l,2-dicarboxylate (263 g, 0.7 mol) in DCM (600 mL) at 20 °C. The mixture was stirred at rt overnight and then concentrated in vacuum. The crude product was adjusted to pH 10 with sat. NaHCC>3 solution, and then extracted with DCM three times. The combined organic layer was concentrated in vacuum and purified by silica gel column chromatography (20:1 DCM/MeOH) to afford (25,5R)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (184.9 g, 95%) as a yellow oil.
Step 6: Synthesis of (2S,5R)-ethyl 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1 ]octane-2- carboxylate
Figure imgf000066_0003
Triphosgene (21.3 g, 72 mmol) was added in portions to a solution of (2S ,5R)-ethyl 5- ((benzyloxy)amino)piperidine-2-carboxylate (50 g, 0.18 mol) and DIPEA (128 mL, 0.72 mol) in DCM (2000 mL) at 0 °C . After stirring at 20 °C overnight, the reaction mixture was washed with H3PO4 (10%), sat. NaHCC>3 and saturated NaCl. The combined organic layer was concentrated in vacuum and purified by silica gel column chromatography (3 : 1 petroleum ether/EtOAc) to afford (2S,5R)-ethy\ 6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1]octane-2-carboxylate (27.4 g, 50%) as a yellow solid. 1H NMR (400Mz, CDCI3): δ 7.43-7.36 (m, 5H), 5.06 (d, / = 11.4 Hz, 1H), 4.90 (d, / = 11.4 Hz, 1H), 4.24 (q, / = 7.1 Hz, 2H), 4.11-4.08 (m, 1H), 3.32-3.31 (m, 1H), 3.08-3.05 (m, 1H), 2.93 (d, / = 11.9 Hz, 1H), 2.14-2.05 (m, 2H), 2.05-2.00 (m, 1H), 1.71-1.63 (m, 1H), 1.29 (t, / = 7.1 Hz, 3H).
Example 2: Synthesis of(2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclot3.2.1 loctane-2- carboxylic acid (Intermediate Compound 2a)
Figure imgf000067_0001
LiOH (1.2 g, 29.6 mmol) was added to a solution of (2S,5.R)-ethyl 6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1]octane-2-carboxylate (9 g, 29.6 mmol) in THF/H20 (3 :1, 240 mL). The mixture was then stirred at rt overnight. The reaction mixture was washed with EtOAc twice, then the aqueous solution was adjusted pH 2-3 with IN HC1. The resulting mixture was extracted with DCM three times, and the combined organic layer was dried over saturated Na2S04 and concentrated in vacuum to provide (25',5 ?)-6-(benzyloxy)-7-oxo-l ,6- diazabicyclo[3.2.1]octane-2-carboxylic acid (7.0 g, 77.7%), which was directly used in the next step without further purification. ESI-MS (Ef, m/z): 277.31. 1H NMR (300 MHz, CDCI3) δ 7.49-7.29 (m, 5H), 5.06 (d, / = 11.4 Hz, 1H), 4.91 (d, / = 11.4 Hz, 1H), 4.15-4.10 (m, 1H), 3.36-3.34 (m, 1H), 3.15-3.11 (m, 1H), 2.83 (d, / = 11.8 Hz, 1H), 2.32-2.15 (m, 1H), 2.11-2.01 (m, 2H), 1.74-1.56 (m, 1H). Example 3: Synthesis of (2S,5R)-2-(l ,3,4-oxadiazol-2-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 701 )
Figure imgf000068_0001
Step 1: Ι,Γ-Carbonyldiimidazole (5.8 g, 36.2 mmol) was added to a 0 °C solution of (2S,5R)- 6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carboxylic acid (5.0 g, 18.1 mmol) in dry THF (200 mL). The reaction mixture was allowed to warm to rt then was stirred at rt for 3 hrs. Formohydrazide (5.4 g, 90.5 mmol) was added in one portion, and the reaction mixture was stirred for additional 3 hrs. The mixture was then diluted with saturated sodium chloride and exatracted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated to afford crude (25,5 ?)- 6-(benzyloxy)-N-formyl-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbohydrazide (-11 g), which was directly used in the next step. ESI-MS (Ef , m/z): 319.1 [M+H]+.
Step 2: To a -10 °C solution of (25',5«)-6-(benzyloxy)-N-formyl-7-oxo-l,6- diazabicyclo[3.2.1]octane-2-carbohydrazide (11 g) in dry DCM (200 mL) was added pyridine (28 mL), followed by dropwise addition of (CF3S02)20 (28 mL). The reaction mixture was allowed to warm to rt and was stirred for 3 hrs. The reaction mixture was then cooled to -10 °C and quenched with sat. NaHCC>3. The organic layer was separated and the aqueous layer was extracted with EtOAc (3x). The combined organic layer was dried over Na2S04, concentrated and purified by silica gel column chromatography (gradient elution 1 :3 to 2: 1 EtOAc/hexanes) to give (25,5/?)-6-(benzyloxy)-2-(l,3,4-oxadiazol-2-yl)-l ,6- diazabicyclo[3.2.1]octan-7 -one (4.6 g, 86% for two steps) as a slightly yellow solid. ESI-MS (EI+, m/z): 301.0 [M+H]+.
Step 3: To a solution of (25,5/?)-6-(benzyloxy)-2-(l,3,4-oxadiazol-2-yl)-l ,6- diazabicyclo[3.2.1]octan-7-one (4.6 g, 15.3 mmol) in THF (150 mL) was added 10% Pd/C (1 g). The mixture was stirred under H2 atmosphere at rt for 3 hrs. The reaction mixture was then filtered and concentrated to afford (25,5/?)-6-hydroxy-2-(l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1]octan-7-one (2.9 g, 91 %), which was used directly in the next step. ESI- MS (EI+, m/z): 211.1 [M+H]+. Step 4: To a solution of (25,5fl)-6-hydroxy-2-(l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1]octan-7-one (2.9 g, 13.8 mmol) in dry pyridine (60 mL) was added SC>3- Py (11.0 g, 69.0 mmol). The reaction mixture was stirred at rt for 8 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH2PC>4 (1.5 M, 100 mL) then tetrabutylammonium hydrogensulphate (5.88 g, 17.3 mmol) was added. The mixture was stirred at rt for 20 minutes, then was extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 2:1 DCM/acetone) to afford tetrabutylammonium (25,5/?)-2-(l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl sulfate (4.1 g, 97%) as a white solid. ESI-MS (EL, m/z): 289.0 [M-H]\ lH NMR (400 MHz, CDC13): δ 8.48 (s, 1H), 4.75 (d, / = 6.5 Hz, 1H), 4.40 (br s, 1H), 3.34-3.26 (m, 9H), 2.82 (d, / = 12.0 Hz, 1H), 2.37-2.25 (m, 3H), 2.06-1.98 (m, 1H), 1.71-1.65 (m, 8H), 1.49-1.42 (m, 8H), 1.01 (t, / = 7.5 Hz, 12H).
Step 5: Resin Exchange: Tetrabutylammonium (25, 5R)-2-(l, 3, 4-oxadiazol-2-yl)-7-oxo-l, 6-diaza-bicyclo[3.2.1]octan-6-yl sulfate (4.1 g, 7.72 mmol) was dissolved in a minimum amount of HPLC grade water (~ 40 mL) and passed through a column of 80 g of DOWEX 50WX 8 Na+ resin (the resin was prewased with >4 L of HPLC grade water) and eluted with HPLC grade water to afford sodium (25,5fl)-2-(l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl sulfate (2.2 g, 91 %) as a white solid after lyophilization. ESI- MS (EI+, m/z): 291.2 [M+H]+. lH NMR (300 MHz, D20) δ 8.92 (s, 1H), 4.84 (d, J = 6.1 Hz, 1H), 4.20 (br s, 1H), 3.25-3.16 (m, 1H), 2.92 (d, / = 12.3 Hz, 1H), 2.41-2.26 (m, 1H), 2.26- 2.11 (m, 2H), 2.04-1.89 (m, 1H). Example 4: Synthesis of(2S,5R)-2-(5-(2-aminoethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 703 )
Figure imgf000070_0001
Step 1: DIPEA (1.1 g, 8.3 mmol) was added to a O °C solution of (25", 5#)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]ctane-2-carbohydrazide (1.0 g, 2.48 mmol) in DMF (10 mL). 3- ((tert-Butoxycarbonyl)amino)propanoic acid (0.39 g, 2.07 mmol) and HATU (0.90 g, 2.48 mmol) were then added. The reaction mixture was stirred at 0 °C for 1 h and then quenched with saturated sodium chloride (50 mL). The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried overNa2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 10:1 to 2:1 hexanes/EtOAc) to afford tert- butyl (3-(2-((25',5«)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2- carbonyl)hydrazinyl)-3-oxopropyl)carbamate (1.0 g, 87%). ESI-MS (Ef , m/z): 462
[M+H]+.
Step 2: (CF3S02)20 (1.0 mL) was slowly added to a -10 °C solution of ieri-butyl (3-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3- oxopropyl)carbamate (1.0 g, 2.17 mmol) and pyridine (1.0 mL) in dry DCM (10 mL). The reaction mixture was allowed to warm to rt and then was stirred at rt for 1 h. Then saturated NaHCC>3 was added at 0 °C very slowly. The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04and concentrated. The residue was purified by silica gel column chromatography (gradient elution 10:1 to 4:1 petroleum ether/EtOAc) to give ieri-butyl (2-(5-((25",5 ?)-6-(benzyloxy)-7- oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate (0.40 g, 42%) as a slight yellow solid. ESI-MS (EI+, m/z) 444 [M+H]+. lU NMR (500 MHz, OMSO-d6) δ 7.48-7.46 (m, 2H), 7.45-7.37 (m, 3H), 6.99 (t, / = 5.5 Hz, 1H) , 4.99-4.94 (m, 2H), 4.59 (d, / = 7.0 Hz, 1H), 3.73 (br s, 1H), 3.32-3.26 (m, 2H), 2.96-2.92 (m, 2H), 2.85-2.81 (m, 2H), 2.19-2.15 (m, 1H), 2.05-1.99 (m, 2H), 1.86-1.83 (m, 1H), 1.34 (s, 9H).
Step 3: A mixture of ieri-butyl (2-(5-((2S,5fl)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl)carbamate (400 mg, 0.90mmol) and 10% Pd/C (50 mg) in THF (20 mL) was stirred under ¾ atmosphere at rt for 3 h. The reaction mixture was then filtered and concentrated to afford ieri-butyl (2-(5-((25,5 ?)-6- hydroxy-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl)carbamate (300 mg, 94%) as a white solid, which was used directly in the next step. ESI-MS (EI+, m/z): 354.24 [M+H]+.
Step 4: To a solution of ieri-butyl (2-(5-((25,5/?)-6-hydroxy-7-oxo-l,6- diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl)carbamate (300 mg, 0.85 mmol) in dry pyridine (4.0 mL) was added SC>3- Py (542 mg, 3.4 mmol). The mixture was stirred at rt overnight and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH2P04 (1.5 M, 20 mL) then tetrabutylammonium hydrogensulphate (345 mg, 1.02 mmol) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 1 :1 DCM/acetone) to afford tetrabutylammonium (25,5 ?)-2-(5-(2-((tert-butoxycarbonyl)amino)ethyl)-l ,3,4-oxadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl sulfate (286 mg, 50%) as a white solid. ESI-MS (EI+, m/z): 434.22 [M+H]+.
Step 5: TFA (0.80 mL) was added to a 0 °C solution of tetrabutylammonium (2S,5fl)-2-(5-(2- ((ieri-butoxycarbonyl)amino)ethyl)- 1 ,3 ,4-oxadiazol-2-yl)-7-oxo- 1 ,6- diazabicyclo[3.2.1]octan-6-yl sulfate (238 mg, 0.71 mmol) in dry DCM (2.0 mL). The reaction mixture was stirred at 0 °C for 30 minutes to 1 h and then diluted with ether. The precipitate was collected via centrifugation, washed with ether (3x) and further dried under high vacuum. The crude product TFA salt was purified by prep-HPLC using ammonium formate buffer to provide (25,5 ?)-2-(5-(2-aminoethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (75 mg, 32%) as a white solid. ESI-MS (EI+, m/z) 334.1. lU NMR (300 MHz, D20) δ 4.78 (d, J = 6.2 Hz, 1H), 4.19 (br s, 1H), 3.44 (t, / = 6.0 Hz, 2H), 3.31 (t, / = 6.0 Hz, 2H), 3.20 (br d, / = 12.8 Hz, 1H), 2.96 (d, / = 12.3 Hz, 1H), 2.35-2.23 (m, 1H), 2.23-2.08 (m, 2H), 2.01-1.87 (m, 1H).
Example 5: Synthesis of '(2S,5R)-2-(5-(2-guanidinoethyl)-l,3A-oxadiaz.ol-2-yl)-7-oxo- 6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 705)
Figure imgf000072_0001
Step 1 : DIPEA (1.1 g, 8.3 mmol) was added to a 0 °C solution of (25", 5«)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbohydrazide (1.0 g, 2.48 mmol) in DMF (10 mL). 3-((ieri-Butoxycarbonyl)amino)propanoic acid (0.39 g, 2.07 mmol) and HATU (0.90 g, 2.48 mmol) were then added. The reaction mixture was stirred at 0 °C for 1 h and then was quenched with saturated sodium chloride (50 mL). The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 10:1 to 2:1 hexanes/EtOAc) to afford ieri-butyl (3-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2- carbonyl)hydrazinyl)-3-oxopropyl)carbamate (1.0 g, 87%). ESI-MS (EI+, m/z): 462
[M+H]+. Step 2: (CF3S02)20 (1.0 mL) was slowly added to a -10 °C solution of ieri-butyl (3-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3- oxopropyl)carbamate (1.0 g, 2.17 mmol) and pyridine (1.0 mL) in dry DCM (10 mL). The reaction mixture was allowed to warm to rt, was stirred at rt for 1 h then sat. NaHCC>3 was added at 0 °C very slowly. The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (gradient elution 10:1 to 4:1 petroleum ether/EtOAc) to give ieri-butyl (2-(5-((25,5/?)-6-(benzyloxy)-7- oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate (0.40 g, 42%) as a slight yellow solid. ESI-MS (EI+, m/z): 444 [M+H]+. 1H NMR (500 MHz, DMSO-i¾) δ 7.48-7.46 (m, 2H), 7.45-7.37 (m, 3H), 6.99 (t, / = 5.5 Hz, 1H) , 4.99-4.94 (m, 2H), 4.59 (d, / = 7.0 Hz, 1H), 3.73 (br s, 1H), 3.32-3.26 (m, 2H), 2.96-2.92 (m, 2H), 2.85-2.81 (m, 2H), 2.19-2.15 (m, 1H), 2.05-1.99 (m, 2H), 1.86-1.83 (m, 1H), 1.34 (s, 9H). Step 3: TFA (0.5 mL) was added to a 0 °C solution of teri-butyl 2-(5-((2S,5R)-6-(benzyloxy)- 7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethylcarbamate (85 mg, 0.192 mmol) in CH2C12 (2.0 mL). The reaction mixture was stirred at 0 °C for 2 hrs and was then concentrated under vacuum to provide (25',5 ?)-2-(5-(2-aminoethyl)-l ,3,4-oxadiazol-2-yl)-6- (benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one TFA salt as a sticky oil, which was used directly in the next step. ESI-MS (EI+, m/z): 344.2 [M+H]+.
Step 4: TEA (77 mg, 0.764 mmol) was added to a 0 °C solution of (25,5R)-2-(5-(2- aminoethyl)- 1 ,3 ,4-oxadiazol-2-yl)-6-(benzyloxy)- 1 ,6-diaza-bicyclo[3.2.1 ]octan-7-one TFA salt from the previous step in MeOH (3.0 mL). Tert-Butyl (((tert-butoxycarbonyl)amino)(lH- pyrazol-l-yl)methylene)carbamate (65 mg, 0.209 mmol) was then added at 0 °C and the reaction mixture was stirred at 0 °C for 4 hrs. The reaction mixture was evaporated and the residue was purified by silica gel column chromatography (gradient elution 30%-50% EtOAc/petroleum ether) to give (25',5 ?)-2-(5-((2,3-bis(ieri-butoxycarbonyl)guanidino)ethyl)- l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one (80 mg, 70% in 2 steps) as a colorless oil. ESI-MS (EI+, m/z): 586.3 [M+H]+.
Step 5: To a solution of (25',5 ?)-2-(5-((2,3-bis(ieri-butoxycarbonyl)guanidino)ethyl)- 1,3,4- oxadiazol-2-yl)-6-(benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one (80 mg, 0.136 mmol) in THF (15 mL) was added 10% Pd/C (45 mg) and the mixture was stirred under ¾ atmosphere at rt for 1 h. The reaction mixture was filtered and concentrated to afford (25',5 ?)-6-hydroxy- 2-(5-((2,3-bis(ieri-butoxycarbonyl)guanidino)ethyl)-l,3,4-oxadiazol-2-yl)-l ,6-diaza- bicyclo[3.2.1]octan-7-one, which was directly used in the next step. ESI-MS (EI+, m/z): 496.2 [M+H]+.
Step 6: To a solution of (25,,5«)-6-hydroxy-2-(5-((2,3-bis(iiri- butoxycarbonyl)guanidino)ethyl)-l ,3,4-oxadiazol-2-yl)-l,6-diaza-bicyclo[3.2.1]octan-7-one from the previous step in dry pyridine (2.0 mL) was added SC>3- Py (152 mg, 0.962 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH2P04 (1.5 M, 15 mL) then tetrabutylammonium
hydrogensulphate (50 mg, 0.15 mmol) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 3:1 DCM/acetone) to afford tetrabutylammonium (25,5/?)-2-(5-(2-(2,3- bis(tert-butoxycarbonyl)guanidino)ethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate (60 mg, 53%) as a white solid. ESI-MS (EL, m/z): 574.1 [M- H]\ Step 7: TFA (0.23 mL) was added to a 0 °C solution of tetrabutylammonium (25,5/?)-2-(5-(2- (2,3-bis(ieri-butoxycarbonyl)guanidino)ethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate (50 mg, 0.06 mmol) in dry DCM (0.68 mL). The reaction mixture was stirred at 0 °C for 2 h and then diluted with ether. The precipitate was collected via centrifugation, washed with ether (3x) and further dried under high vacuum to provide (25',5«)-2-(5-(2-guanidinoethyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6- yl hydrogen sulfate as TFA salt (~ 12 mg). ESI-MS (EI+, m/z): 376.18. *H NMR (300 MHz, D20) 4.77 (d, J = 6.1 Hz, 1H), 4.19 (br s, 1H), 3.62 (t, / = 6.4 Hz, 2H), 3.21-3.18 (m, 1H), 3.18 (t, / = 6.4 Hz, 2H), 2.89 (d, / = 12.3 Hz, 1H), 2.32 -2.20 (m, 1H), 2.20-2.11 (m, 2H), 1.98-1.86 (m, 1H).
Example 6: Synthesis of (2S,5R)-7-oxo-2-(5-(piperidin-4-yl)-l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 711 )
Figure imgf000075_0001
Following Steps 1-5 in Example 4, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with l-(ieri-butoxycarbonyl)piperidine-4-carboxylic acid, (25,5 ?)-7-oxo-2-(5- (piperidin-4-yl)-l ,3,4-oxadiazol-2-yl)-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (89 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 374.26 *H NMR (300 MHz, D20) δ 4.77 (d, / = 5.9 Hz, 1H), 4.20 (br s, 1H), 3.52-3.33 (m, 3H), 3.25-3.09 (m, 3H), 2.92 (d, / = 12.3 Hz, 1H), 2.40- 2.23 (m, 3H), 2.22-2.10 (m, 2H), 2.09-1.88 (m, 3H).
Example 7: Synthesis of(2S,5R)-2-(5-(l-carbamimidoylpiperidin-4-yl)-l,3,4-oxadiazol-2-yl)- -oxo-1 ,6-diazabicyclot 3.2.1 loctan-6-yl hydrogen sulfate (Compound 712)
Figure imgf000075_0002
Following Steps 1-7 in Example 5, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with l-(ieri-butoxycarbonyl)piperidine-4-carboxylic acid, (2S,5.R)-2-(5-(l- carbamimidoylpiperidin-4-yl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (35 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 416.24. lH NMR (300 MHz, D20) δ 4.77 (d, / = 5.9 Hz, 1H), 4.19 (br s, 1H), 3.84-3.79 (m, 2H), 3.42-3.14 (m, 4H), 2.91 (d, / = 12.0 Hz, 1H), 2.36-2.07 (m, 5H), 2.05-1.75 (m, 3H).
Example 8: Synthesis of (2S,5R)-2-( 5 -(az.etidin-3 -yl)-l ,3A-oxadiaz.ol-2-yl)-7 -oxo-1 ,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 708 )
Figure imgf000075_0003
Following Steps 1-5 in Example 4, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with l-(ieri-butoxycarbonyl)azetidine-3-carboxylic acid, (25,5 ?)-2-(5-(azetidin-3- yl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (18 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 346.17. 1H NMR (300 MHz, D20) δ 4.81 (d, / = 6.6 Hz, 1H), 4.58-4.32 (m, 4H), 4.20 (s, 1H), 3.21 (br d, / = 12.1 Hz, 1H), 2.95 (d, / = 12.3 Hz, 1H), 2.30 (dt, / = 13.9, 6.8 Hz, 1H), 2.35-2.25 (m, 1H), 2.20-2.10 (m, 2H), 2.01-1.91 (m, 1H).
Example 9: Synthesis of(2S,5R)-2-(5-(l-carbamimidoylazetidin-3-yl)-l,3,4-ox diazol-2-yl)- -oxo-1 ,6-diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 709)
Figure imgf000076_0001
Following Steps 1-7 in Example 5, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with l-(ieri-butoxycarbonyl)azetidine-3-carboxylic acid, (2S,5.R)-2-(5-(l- carbamimidoylazetidin-3-yl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (280 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 388.12. 1H NMR (300 MHz, D20) δ 4.77 (br d, J = 6.2 Hz, 1H), 4.57-4.44 (m, 2H), 4.39-4.22 (m, 3H), 4.17 (br s, 1H), 3.18 (br d, / = 12.1 Hz, 1H), 2.91 (d, / = 12.3 Hz, 1H), 2.31-2.19 (m, 1H), 2.19-2.06 (m, 2H), 2.00-1.84 (m, 1H).
Example 10: Synthesis of(2S,5R)-2-(5-(aminomethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 702 )
Figure imgf000076_0002
Following Steps 1-5 in Example 4, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with 2-((ieri-butoxycarbonyl)amino)acetic acid, (25',5 ?)-2-(5-(aminomethyl)-l ,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (34 mg) as TFA salt. ESI-MS (EI+, m/z): 320.16 .
Example 11: Synthesis of (2S,5R)-2-( 5-( guanidinomethyl)-! ,3 ,4-oxadiazol-2-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 704)
Figure imgf000077_0001
Following Steps 1-7 in Example 5, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with 2-((ieri-butoxycarbonyl)amino)acetic acid, (25',5 ?)-2-(5-(guanidinomethyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (745 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 362.2.
Example 12: Synthesis of (2S,5R)-2-(5-(3-aminopropyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l ,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 720)
Figure imgf000077_0002
Step 1: Synthesis of 4-(tert-butoxycarbonylamino)butanoic acid:
To an aqueous solution of 4-aminobutanoic acid (25 g, 242 mmol) in H20 (500 mL) at rt was added Na2C03 (75 g, 726 mmol), followed by Boc20 (95 g, 435 mmol) in THF (200 mL). The reaction mixture was stirred at rt for 12 hrs then concentrated under reduced pressure. The aqueous residue was extracted with Et20, then the aqueous layer was acidified to pH 4-5 with citric acid and extracted with EtOAc. The combined organic layer was dried over Na2S04, and concentrated to afford 4-(ieri-butoxycarbonylamino)butanoic acid (45 g, 90%) as a colorless oil. ESI-MS (EI+, m/z): 226 [M+Na]+.
Step 2: Synthesis of methyl 4-(tert-butoxycarbonylamino)butanoate:
To a solution of 4-(ieri-butoxycarbonylamino)butanoic acid (7.0 g, 34.5 mmol) and K2CO3 (9.5 g, 68.9 mmol) in acetone (70 mL) was added Mel (7.5 g, 51.8 mmol) at rt. The reaction solution was stirred at 45 °C for 12 hrs. The mixture was washed with water and saturated sodium chloride, dried over Na2S04, and concentrated to afford methyl 4-(tert- butoxycarbonylamino)butanoate (6.2 g, 83%) as a yellow oil. ESI-MS (EI+, m/z) 240
[M+Na]+.
Step 3: Synthesis of tert-butyl 4-hydrazinyl-4-oxobutylcarbamate:
To a solution of methyl 4-(ieri-butoxycarbonylamino)butanoate (21.0 g, 96.8 mmol) in
MeOH (180 mL) was added NH2NH2.H20 (28.0 g, 483mmol) at rt. The mixture was stirred at 65 °C for 12 hrs then concentrated under reduced pressure. The crude material was dissolved in DCM (400 mL). The organic layer was washed with water (2x), and saturated sodium chloride (2x), dried over Na2S04, and concentrated to afford ieri-butyl 4-hydrazinyl- 4-oxobutylcarbamate (18.9 g, 90%) as a white solid. ESI-MS (EI+, m/z): 240 [M+Na]+.
Step 4: Synthesis of tert-butyl4-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[ 3.2.1 ]octane-2-carbonyl)hydrazinyl)-4-oxobutylcarbamate:
To a 0 °C solution of (25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carboxylic acid (12.0 g, 43.5 mmol) and ieri-butyl 4-hydrazinyl-4-oxobutylcarbamate (10.5 g, 47.8 mmol) in CH2C12 (360 mL) was added HATU (19.6 g, 52.2 mmol) and DIPEA (16.6 g, 130.5 mmol). The mixture was allowed to warm to rt, was stirred at rt for 12 hrs then diluted with CH2C12 (300 mL), washed with water (2x) and saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 50-80% EtO Ac/petroleum ether) to afford ieri-butyl 4-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo [3.2.1]octane-2-carbonyl)hydrazinyl)-4- oxobutylcarbamate (19.3 g, 93%) as a white solid. ESI-MS (EI+, m/z): 476 [M+H]+. Step 5: Synthesis of tert-butyl 3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)propylcarbamate:
Method A:
Tf20 (8.0 mL, 0.0474 mol) was added drop wise to a -78 °C solution of tert-butyl 4-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo [3.2.1]octane-2-carbonyl)hydrazinyl)-4- oxobutylcarbamate (7.5 g, 0.0158 mol) and Py (10.2 mL, 0.126 mol) in dry DCM (120 mL). The reaction mixture was allowed to warm to 0 °C then the reaction mixture was stirred at 0 °C for 3 hrs. Sat. NaHCC>3 was added at 0 °C very slowly. The organic layer was separated and the water layer was exacted with DCM (3x). The combined organic layer was washed with water, saturated sodium chloride, dried over Na2S04, and concentrated. The residue was purified by silica gel column (gradient elution 0-25% EtO Ac/petroleum ether) to afford ieri- butyl 3-(5-((25',5«)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4- oxadiazol-2-yl)propylcarbamate (3.9 g, 54%) as a yellow solid. ESI-MS (EI+, m/z): 458
[M+H]+. 1H NMR (500 MHz, CDC13) δ 7.45-7.37 (m, 5H), 5.08 (d, / = 14.5 Hz, 1H), 4.93 (d, / = 14.5 Hz, 1H), 4.70-4.66 (m, 1H), 3.37 (br s, 1H), 3.23-3.21 (m, 2H), 2.94-2.88 (m, 3H), 2.79 (d, / = 14.5 Hz, 1H), 2.30-2.28 (m, 2H), 2.11-1.97 (m, 4H), 1.45 (s, 9H).
Method B:
To s solution of PPh3 (2.6 g, 10.0 mmol) in dry DCM (60 mL) was added I2 (2.6 g, 10.0 mmol). After I2 was dissolved completely, TEA (3.5 mL, 25.0 mmol) was added quickly at rt. The mixture was stirred for 15 mins. 7¾ri-butyl 4-(2-((25,,5/?)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo [3.2.1]octane-2-carbonyl)hydrazinyl)-4-oxobutylcarbamate (2.4 g, 5.0 mmol) was added. The mixture was stirred at rt for 1 hr. The solvent was concentrated. EtO Ac (250 mL) was added, and the solution was filtrated to remove POPI13. The filtrate was concentrated. The resulting residue was purified by silica gel column chromatography (gradient elution 0-40% EtOAc/petroleum ether) to afford ieri-butyl 3-(5-((25',5«)-6-(benzyloxy)-7-oxo-l,6- diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)propylcarbamate (2.0 g, 86%) as a white solid. ESI-MS (EI+, m/z): 458 [M+H]+.
Step 6-8: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)propyl)carbamate; (25',5 ?)-2-(5-(3-aminopropyl)-l,3,4-oxadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (1.48 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 348.1. 1H NMR (300 MHz, D20) δ 4.74 (d, / = 6.2 Hz, 1H), 4.17 (br s, 1H), 3.17 (br d, / = 12.1 Hz, 1H), 3.05 - 2.95 (m, 4H), 2.89 (d, / = 12.3 Hz, 1H), 2.31 - 2.20 (m, 1H), 2.20 - 2.02 (m, 4H), 2.00 - 1.82 (m, 1H).
Example 13: Synthesis of(2S,5R)-2-(5-(3-guanidinopropyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 714)
Figure imgf000080_0001
Following Steps 1-7 in Example 5, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with 4-((ieri-butoxycarbonyl)amino)butanoic acid, (2S,5R)-2-(5-(3- guanidinopropyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (42 mg) was obtained as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 390.13.
Example 14: Synthesis of(2S,5R)-7-oxo-2-(5-(pyrrolidin-3-yl)-l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 710)
Figure imgf000080_0002
Following Steps 1-5 in Example 4, replacing 3-((ieri-butoxycarbonyl)amino)propanoic acid in Step 1 with l-(ieri-butoxycarbonyl)pyrrolidine-3-carboxylic acid, (2S,5R)-7-oxo-2-(5- (pyrrolidin-3-yl)- 1 ,3,4-oxadiazol-2-yl)- 1 ,6-diazabicyclo[3.2.1 ]octan-6-yl hydrogen sulfate (20 mg) was obtained as TFA salt. ESI-MS (EI+, m/z): 360.20. 1H NMR (300 MHz, D20) δ 4.78 (d, / = 6.5 Hz, 1H), 4.20 (br s, 1H), 4.05-3.94 (m, 1H), 3.80-3.73 (m, 1H), 3.66-3.60 (m, 1H), 3.53-3.38 (m, 2H), 3.20 (br d, J = 12.5 Hz, 1H), 2.94 (d, J = 12.3 Hz, 1H), 2.59-2.48 (m, 1H), 2.40-2.26 (m, 2H), 2.23-2.08 (m, 2H), 2.00-1.90 (m, 1H). Example 15: Synthesis of(2S,5R)-7-oxo-2-(5-(piperazin-l-yl)- 3A-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 713 )
Figure imgf000081_0001
Step 1: DIPEA (105 g, 0.81mol) was added to a 0 °C solution of ieri-butyl piperazine-1- carboxylate (25.0 g, 0.134 mol) in DCM (250 mL), followed by the addition of triphosgene (92 g, 0.27 mol) in portions over a 40 minute time period. The reaction mixture was allowed to warm to rt then was stirred at rt for 3 hrs, filtered and concentrated to afford 1-ieri-butyl 4- trichloro methyl piperazine- 1 ,4-dicarboxylate (50 g) as an oil.
A solution of 1-ieri-butyl 4-trichloromethyl piperazine- 1,4-dicarboxylate (50 g, 0.145 mol) in THF (50 mL) was added dropwise over a 30 minute time period to a solution of hydrazine hydrate (18 mL, 0.434 mol) in THF (150 mL).The reaction mixture was stirred at rt for 2 hrs then diluted with saturated sodium chloride (50 mL) and exacted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by crystallization (3 :1 petroleum ether/EtOAc) to provide ieri-butyl 4-(hydrazinecarbonyl)piperazine-l-carboxylate (13 g, 40% for two steps). ESI-MS (EI+, m/z): 245 [M+H]+. 'H-NMR (500 MHz, CDC13): £5.92 (s, 1H), 3.45-3.35 (m, 8H), 1.41 (s, 9H).
Step 2: DIPEA (3.7 g, 10 mmol) was added to a 0 °C solution of (2S,5R)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (1.45 g, 5.3 mmol, 0.8 eq.) and tert- butyl 4-(hydrazinecarbonyl)piperazine-l-carboxylate (1.6 g, 6.6 mmol) in dry DMF (50 mL), followed by the addition of HATU (1.45 g, 5.3 mmol). The reaction mixture was allowed to warm to rt then was stirred at rt overnight. The mixture was then diluted with water (200 mL) and the resulting precipitated material was collected by filtration, rinsed with water, and then recrystalized (3: 1 petroleum ether/EtOAc) to afford ieri-butyl 4-(2-((25,5 ?)-6-(benzyloxy)-7- oxo- 1 ,6-diazabicyclo [3.2.1 ]octane-2-carbonyl)hydrazinecarbonyl)piperazine- 1 -carboxylate (1.4 g, 54%), ESI-MS (EI+, m/z): 503 [M+H]+.
Step 3: To a solution of ieri-butyl 4-(2-((25,,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazine-carbonyl)piperazine-l-carboxylate (903 mg, 1.8 mmol) in DCM (200 mL) was added pyridine (2.8 mL, 36.0 mmol). (CF3S02)20 (2.8 ml, 9.0 mmol) was then slowly added at -10 °C. The reaction mixture was stirred at rt for 3 hrs. Sat. NaHCC>3 was added at -10 °C very slowly. The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated. The crude product was purified by silica gel column chromatography (2:1 EtOAc/hexanes) to give ieri-butyl 4-(5-((25,,5/?)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l-carboxylate (723 mg, 83%) as a slight yellow solid. ESI-MS (EI+, m/z): 485.2 [M+H]+.
Step 4: To a solution of ieri-butyl 4-(5-((25,5 ?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l-carboxylate (50 mg, 0.1 mmol) in THF (5.0 mL) was added 10% Pd/C (20 mg). The mixture was stirred under H2 atmosphere at rt for 3 hrs then filtered and concentrated to afford ieri-butyl 4-(5-((25',5 ?)-6- hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l- carboxylate (30 mg, 75 %), which was used directly in the next step. ESI-MS (EI+, m/z): 385 [M+H]+.
Step 5: To a solution of ieri-butyl 4-(5-((25,,5/?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)piperazine-l-carboxylate (30 mg, 0.077 mmol) in dry pyridine (3 ml) was added SC^- Py (97 mg, 0.61 mmol). The mixture was stirred at rt for 3 hrs. The pyridine was evaporated under vacuum at 25 °C. The residue was re-dissolved in aqueous NaH2P04 (1.5 M, 20 mL) and tetrabutylammonium
hydrogensulphate (300 mg) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 1 :1 DCM/acetone) to give tetrabutylammonium (25',5 ?)-2-(5-(4-(ieri-butoxycarbonyl)piperazin- l-yl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl sulfate (20 mg, 20%). ESI-MS (ΕΓ, m/z): 473 [M-H]~. Step 6: TFA (0.30 mL) was added to a 0 °C mixture of tetrabutylammonium ieri-butyl 4-(5- ((25',5 ?)-7-oxo-6-(sulfooxy)-l,6-diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2- yl)piperazine- 1 -carboxylate (21 mg, 0.03 mmol) in dry DCM (0.80 mL). The reaction mixture was stirred at 0 °C for 2-3 hrs then diluted with ether (-15 mL). The precipitate was collected via centrifugation, washed with ether (3x) and dried under high vacuum to afford (25',5 ?)-7-oxo-2-(5-(piperazin-l-yl)-l,3,4-oxadiazol-2-yl)-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (4 mg, 35%) as a light yellow solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 375.2. 1H NMR (300 MHz, D20) δ 4.65 (d, J = 6.6 Hz, 1H), 4.19 (br s, 1H), 3.80-3.65 (m, 2H), 3.38-3.28 (m, 2H), 3.20-3.16 (m, 1H), 2.99-2.95 (m, 1H), 2.32-1.88 (m, 4H).
Example 16: Synthesis of (2S,5R)-2-(5-amino-l ,3,4-oxadiazol-2-yl)-7-oxo-l ,6- diazabicyclo [3.2.1 loctan-6-yl hydrogen sulfate (Compound 707)
Figure imgf000083_0001
Figure imgf000083_0002
Step 1 : Saturated NaHC03 (7.0 mL, 6.26 mmol) was added to a solution of (2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbohydrazide TFA salt (2.3 g, 5.69 mmol) in dioxane (11.4 mL) and the reaction mixture was stirred at rt for 5 minutes. Cyanic bromide (3 M solution, 2.3 mL, 6.90 mmol) was added and the reaction mixture was stirred at rt for 30 minutes. The reaction mixture was then loaded on a silica gel cartridge and purified by silica gel column chromatography (gradient elution 0-10% MeOH/DCM) to give (2S,5R)- 2-(5-amino-l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l ,6-diazabicyclo[3.2.1]octan-7-one (0.57 g, 32%). ESI-MS (EI+, m/z): 316.4 [M+H]+.
Step 2: N,N-Dimethylpyridin-4-amine (155 mg, 1.27 mmol) was added to a 0 °C solution of (25',5 ?)-2-(5-amino-l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l,6-diazabicyclo[3.2.1]octan-7-one (0.20 g, 0.63 mmol), Boc20 (0.27 g, 1.27 mmol), and triethylamine (0.18 mL, 1.27 mmol) in DMF. The reaction mixture was allowed to warm to rt and was stirred for 2-3 hrs. The reaction mixture was then concentrated, re-dissolved in DCM (50 mL), washed with water
(50 mL), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-50% EtOAc/hexane) to give ieri-butyl (5-((2S,5.R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)carbamate (0.16 g, 60.7%). ESI-MS (EI+, m/z): 416.4 [M+H]+.
Step 3-5: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((25,5 ?)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (5-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazol-2-yl)carbamate, (25,5 ?)-2-(5 -amino- 1,3, 4-oxadiazol-2-yl)-7-oxo- 1,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate was obtained (64 mg) after prep-HPLC using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 306.25 [M+H]+. 1H NMR (300 MHz, D20) δ 4.61 (d, / = 6.6 Hz, 1H), 4.19 (br s, 1H), 3.17 (br d, / = 12.2 Hz, 1H), 2.98 (d, / = 12.3 Hz, 1H), 2.27-1.81 (m, 4H). Example 17: Synthesis of (2S, 5R)-2-(5-carbamoyl-l,3,4-oxadiazol-2-yl)-7-oxo-l, 6-diaza- bicyclo[3. 2. 1 loctan-6-yl hydrogen sulfate (Compound 706)
Figure imgf000084_0001
Figure imgf000085_0001
Step 1: HATU (0.95 g, 2.5 mmol) was added to a 0 °C solution of (2S,5R)-6-(benzyloxy)-7- oxo-l,6-diazabicyclo[3.2.1]octane-2-carbohydrazide (1.00 g, 2.5 mmol), 2-amino-2- oxoacetic acid (0.18 g, 2.1 mmol) and DIPEA (1.08 g, 8.4 mmol) in DMF (10 mL). The reaction mixture was stirred at 0 °C for 1 h then quenched with saturated sodium chloride (50 mL) and the organic layer was separated. The aqueous layer was exacted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (1 : 1 EtOAc/hexane) to give 2-(2-((2S,5fl)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoacetamide (0.57 g, 64%). ESI-MS (EI+, m/z): 362 [M+H] +.
Step 2: (CF3S02)20 (0.58 g, 2.08 mmol) was slowly added to a -10 °C solution of 2-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2- oxoacetamide (0.30 g, 0.83 mmol) and pyridine (0.6 mL) in dry DCM (5 mL). The reaction mixture was allowed to warm to rt. The reaction mixture was stirred at rt for 1 h then quenched with sat. NaHCC>3 very slowly. The organic layer was separated and the aqueous layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 1 : 10 to 2:1 EtOAc/hexane followed by 10:1 to 2:1 petroleum ether/EtOAC) to give 5- ((25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazole-2- carboxamide (0.18 g, 47%) as a slight yellow solid. ESI-MS (EI+, m/z): 344.0 [M+H]+.
Step 3: To a solution of 5-((25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazole-2-carboxamide (0.14 g, 0.41 mmol) in THF (10 mL) was added 10% Pd/C (0.14 g). The mixture was stirred under H2 atmosphere at rt for 3 hrs then filtered and concentrated to provide 5-((25,5 ?)-6-hydroxy-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazole-2-carboxamide (103 mg, 100 %), which was directly used in the next step. ESI-MS (EI+, m/z): 254 [M+H]+.
Step 4: To a solution of 5-((25,5 ?)-6-hydroxy-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazole-2-carboxamide (103 mg, 0.41 mmol) in dry pyridine (2.0 rriL) was added SC>3- Py (323 mg, 2.03 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous NaH2P04 (1.5 M, 10 mL) then tetrabutylammonium hydrogen sulphate (166 mg, 0.49 mmol) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography
(gradient elution 10: 1 to 8:1 DCM/acetone) to afford tetrabutylammonium (25,5 ?)-2-(l,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl sulfate(110 mg, 36%). ESI-MS (ΕΓ, m/z): 333.0 [M-H]\ Step 5 Sodium Resin Exchange: tetrabutylammonium (2S,5.R)-2-(l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1]octan-6-yl sulfate (110 mg) was dissolved in a minimum amount of HPLC grade water (~ 80 mL) and passed through a column of 20 g of DOWEX 50WX 8 Na+ resin (the resin was pre- washed with >5L of HPLC grade water) and eluted with HPLC grade water to provide sodium (25,5 ?)-2-(l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl sulfate (55 mg, 80%) as a white solid after lyophilization. ESI- MS (EL, m/z): 332.0 [M-H]~. 1H NMR (500 MHz, D20): 4.97-4.93 (m, 1H), 4.27 (br s, 1H), 3.29 (d, / = 11.0 Hz, 1H), 3.04 (d, / = 12.0 Hz, 1H), 2.43-2.39 (m, 1H), 2.31-2.23 (m, 2H), 2.04-1.98 (m, 1H). Example 18: Synthesis of (2S,5R)-7-oxo-2-(5-(piperidin-4-yl)-l ,3,4-thiadiaz.ol-2-yl)-l ,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 719 )
Figure imgf000086_0001
Figure imgf000087_0001
Step 1: HATU (3.3 g, 8.7 mmol) and ieri-butyl 4-(hydrazinecarbonyl)piperidine-l- carboxylate (2.29 g, 9.42 mmol) were added to a 0 °C solution of (25',5 ?)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (2 g, 7.25 mmol) in CH2CI2 (50 mL), followed by the addition of DIPEA (2.8 g, 21.8 mmol). The reaction mixture was stirred at 0 °C for 12 hrs then washed with water and saturated sodium chloride, dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 1%-10% MeOH/CH2Cl2) to give ieri-butyl 4-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diaza-bicyclo[3.2.1]octane-2-carbonyl)hydrazinecarbonyl)piperidine-l-carboxylate as a white solid. (2.2 g, 62%). ESI-MS (EI+, m/z): 502.2 [M+H]+.
Step 2: Lawesson's reagent (0.16 g, 6 mol) was added to a solution of ieri-butyl 4-(2- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinecarbonyl)piperidine- 1 -carboxylate (0.16 g, 0.319 mmol) in THF (20 mL). The reaction mixture was stirred at 70 °C for 0.5 h. The solution was cooled to room temperature and sat. NaHCC>3 was added. The organic layer was separated and the aqueous layer was exacted with EtOAc (2x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (gradient elution 20%-50% EtOAc/petroleum ether) to give ieri-butyl 4-(5-((2S,5fl)-6-(benzyloxy)-7- oxo- l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l ,3,4-thiadiazol-2-yl)piperidine-l -carboxylate (90 mg, 50%) as a white solid. ESI-MS (EI+, m/z): 500.2 [M+H]+ . 1H NMR (500 MHz, DMSO- d6): δ 7.48-7.37 (m, 5H), 4.99-4.94 (m, 2H), 4.77 (d, / = 7.0 Hz, 1H), 3.99 (d, / = 11 Hz, 2H), 3.69 (s, 1H), 3.39-3.35 (m, 1H), 2.88-2.85 (m, 3H), 2.68 (d, J = 12 Hz, 1H), 2.44 (dd, / = 7.5, 5.5 Hz, 1H), 2.05-1.96 (m, 4H), 1.79-1.77 (m, 1H), 1.62-1.55 (m, 2H), 1.40 (s, 9H).
Step 3: To a solution of ieri-butyl 4-(5-((25,,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate (120 mg, 0.24 mmol) in THF (30 mL) was added 10% Pd(OH)2/C (200 mg). The mixture was stirred under H2 atmosphere at rt for 3 h, filtered and concentrated to afford ieri-butyl 4-(5-((25',5 ?)-6- hydroxy-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l- carboxylate as a yellow solid, which was directly used in the next step. ESI-MS (EI+, m/z): 410.2 [M+H]+.
Step 4: To a solution of ieri-butyl 4-(5-((25,,5/?)-6-hydroxy-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate from the former step in dry pyridine (3 mL) was added SC>3-Py (266 mg, 1.1 mmol). The mixture was stirred at rt for 3 hrs and then concentrated under vacuum. The residue was re-dissolved in aqueous
NaH2P04 (1.5 M, 20 mL) then tetrabutylammonium hydrogensulphate (150 mg, 0.44 mmol) was added. The mixture was stirred at rt for 20 minutes, then extracted with EtOAc (4x). The combined organic layer was dried and concentrated and the residue was purified by silica gel column chromatography (gradient elution 10:1 to 1 :1 DCM/acetone) to afford tetrabutylammonium ieri-butyl 4-(5-((25,,5/?)-7-oxo-6-(sulfooxy)-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate as a white solid (110 mg, 62%). ESI-MS (EL, m/z): 488.1 [M-H]\
Step 5: Tetrabutylammonium ieri-butyl 4-(5-((25,5 ?)-7-oxo-6-(sulfooxy)-l ,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-thiadiazol-2-yl)piperidine-l-carboxylate (110 mg, 0.15 mmol) was dissolved in a minimum amount of HPLC grade water (- 15 mL) and passed through a column of 16 g of DOWEX 50WX 8 Na+ resin (the resin was pre-washed with >0.5 L of HPLC grade water) and eluted with HPLC grade water to afford sodium (25,5 ?)-2-(5-(l- (tert-butoxycarbonyl)piperidin-4-yl)-l,3,4-thiadiazol-2-yl)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-6-yl sulfate after lyophilization as a white solid (50 mg, 65%). ESI-MS (EL, m/z): 488.0 [M-H]~. 1H NMR (500 MHz, D20) δ 4.88 (d, 7 =7.0 Hz, 1H), 4.15 (s, 1H), 4.06 (d, 7 =10.5 Hz, 2H), 3.39-3.35 (m, 1H), 3.13 (d, 7 =2 Hz, 1H), 2.94-2.87 (m, 3H), 2.45- 2.41 (m, 1H), 2.17-2.04 (m, 4H), 1.89-1.86 (m, 1H), 1.67-1.62 (m, 2H), 1.36 (s, 9H). Step 6: TFA (0.20 mL) was added to a 0 °C mixture of sodium (25,5R)-2-(5-(l-(tert- butoxycarbonyl)piperidin-4-yl)-l,3,4-thiadiazol-2-yl)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-6- yl sulfate (50 mg, 0.10 mmol) in dry DCM (0.60 mL). The reaction mixture was stirred at 0 °C for 2-3 hrs and then diluted with ether (-10 mL). The precipitate was collected via centrifugation, washed with ether (3x) and dried under high vacuum to afford (25 ,5R)-7 -oxo- 2-(5-(piperidin-4-yl)- 1 ,3 ,4-thiadiazol-2-yl)- 1 ,6-diazabicyclo [3.2.1 ]octan-6-yl hydrogen sulfate (10 mg, 25%) after prep-HPLC using ammonium formate buffer. ESI-MS (EI+, m/z): 390.12.
Example 19: Synthesis of (2S,5R)-2-(5-(2-(methylamino)ethyl)-l,3,4-oxadiazol-2-yl)-7-oxo- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 722)
Figure imgf000089_0001
Figure imgf000089_0002
Step 1: Synthesis of methyl 3-(tert-butoxycarbonyl (methyl) amino )propanoate:
To a solution of 3 -(ieri-butoxycarbonyl(methyl)amino)propanoic acid (7.0 g, 0.032 mol) and K2CO3 (13.3 g, 0.096 mol) in DMF (100 mL) was added Mel (9.0 g, 0.064 mol) at rt. The resultant solution was stirred at rt for 3 hrs. The reaction mixture was quenched with ice water and extracted with ethyl acetate (2x). The combined organic layer was dried over Na2S04, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (gradient elution 0%~10% EtOAc/petroleum ether) to afford methyl 3-(ieri-butoxycarbonyl (methyl) amino)propanoate (6.9 g, 92%) as a white solid. ESI-MS (EI+, m/z): 118 [M-100+H]+.
Step 2: Synthesis of 'tert-butyl 3 -hydrazinyl-3-oxopropyl (methyl) carbamate:
To a solution of methyl 3-(ieri-butoxycarbonyl (methyl) amino)propanoate (6.9 g, 0.0317 mol) in EtOH (15 mL) was added hydrazine monohydrate (7.7 mL, 0.158 mol) at rt. The reaction mixture was heated to 80 °C and stirred at 80 °C overnight. The reaction mixture was concentrated, and then DCM (300 mL) was added. The organic layer was washed with water and saturated sodium chloride, dried over Na2S04, and concenreated to afford tert- butyl 3-hydrazinyl-3-oxopropyl(methyl)carbamate (6.8 g, 98%) as sticky oil, which was used directly in the next step. ESI-MS (EI+, m/z): 118 [M-100+H]+.
Step 3: Synthesis of tert-butyl 3 -(2-((2S, 5R)-6-(benzyloxy)-7-oxo-l, 6-diaza-bicyclo
[3.2.1 ]octane-2-carbonyl)hydrazinyl)-3-oxopropyl(methyl)carbamate:
To a O °C solution of ieri-butyl 3-hydrazinyl-3-oxopropyl(methyl)carbamate (4.3 g, 19.8 mmol) and (2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octane-2-carboxylic acid (4.9 g, 0.0178 mol) in DMF (100 mL) was added HATU (8.2 g, 0.0218mol), followed by drop wise addition of DIPEA (9.6 mL, 0.0594 mol) slowly. The mixture was stirred at 0 °C for 1 h, and then quenched with ice water. The aqueous layer was extracted with EtOAc (2x). The combined organic layer was dried over Na2S04, filtered and concentrated. The residue was purified by silica gel column chromatography (gradient elution 20-60%
EtOAc/petroleum ether) to afford ieri-butyl 3-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3-oxopropyl(methyl)carbamate (6.7 g, 78%) as a white solid. ESI-MS (EI+, m/z): 476 [M+H]+. Step 4: Synthesis of tert-butyl 2-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl(methyl)carbamate:
Method A:
Tf20 (7.2 mL, 0.0423 mol) was added slowly, drop-wise to a -78 °C solution of ieri-butyl 3- (2-((25',5 ?)-6-(benzyloxy)-7-oxo-l ,6-diaza-bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-3- oxopropyl(methyl)carbamate (6.7 g, 14.1 mmol) and pyridine (9.1 mL, 0.113 mol) in dry DCM (110 mL). The reaction mixture was allowed to warm to 0 °C then was stirred at 0 °C for 3 hrs. Aqueous NaHCC>3 was added at 0 °C very slowly. The organic layer was separated and the water layer was washed with DCM (3x). The combined organic layer was dried over Na2S04, and concentrated. The crude product was purified by reverse-phase biotage
(water/acetonitrile gradient) to afford ieri-butyl 2-(5-((25,,5/?)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)ethyl(methyl)carbamate (3.3 g, 51%) as a light yellow solid. ESI-MS (EI+, m/z): 458.0 [M+H]+; 1H NMR (500 MHz, CDC13): δ 7.45-7.36 (m, 5H), 5.09 (d, / = 11.5 Hz, 1H), 4.94 (d, / = 11.5 Hz, 1H), 4.71 (t, / = 4.5 Hz, 1H),3.67- 3.59 (m, 2H), 3.37 (s, 1H), 3.31 (t, / = 6.5 Hz, 2H), 2.94-2.86 (m, 2H), 2.82 (s, 3H), 2.32- 2.28 (m, 2H), 2.15-2.12 (m, 1H), 2.00-1.95 (m, 1H), 1.45 (s, 9H).
Method B:
To a solution of PPh3 (5.3 g, 20.0 mmol) in CH2C12 (250 mL) at rt was added I2 (5.2 g, 20.0 mmol). After I2 was dissolved completely, the solution was cooled to 0 °C and TEA (7.0 mL, 50.0 mmol) was added. reri-butyl3-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl) hydrazinyl)-3-oxopropyl(methyl)carbamate (4.8 g, 10.0 mol) was added and the mixture was stirred at rt for 1 hr. The mixture was concentrated, EtOAc(250 mL) was added, and the solution was filtered to remove POPI13. The filtrate was concentrated and the residue was purified by silica gel column chromatography (gradient elution 30 to 50% EtO Ac/petroleum ether) to afford ieri-butyl 2-(5-((2S,5fl)-6-(benzyloxy)-7- oxo- 1 ,6-diaza-bicyclo [3.2.1 ]octan-2-yl)- 1 ,3 ,4-oxadiazol-2-yl)ethyl(methyl)carbamate (4.1 g, 85%) as a white solid. ESI-MS (EI+, m/z): 458 [M+H]+.
Step 5-7: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (2-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)ethyl)(methyl)carbamate; (2S,5R)-2-(5-(2-(methylamino)ethyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (1.2 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 348.2. 1H NMR (300 MHz, D20) δ 4.76 (d, / = 6.3 Hz, 1H), 4.18 (br s, 1H), 3.44 (t, / = 7.1 Hz, 2H), 3.32 (t, / = 6.6 Hz, 2H), 3.18 (br d, / = 12.0 Hz, 1H), 2.93 (d, J = 12.3 Hz, 1H), 2.68 (s, 3H), 2.33 - 2.06 (m, 3H), 1.98 - 1.86 (m, 1H).
Example 20: Synthesis of (2S,5R)-2-(5-((azetidin-3-ylamino)methyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 726)
Figure imgf000092_0001
O , K OCN'^ _C O K OCN' N OC O
^k ► N/ <
Figure imgf000092_0002
Step 1: Synthesis of tert-butyl 3-(2-ethoxy-2-oxoethylamino)azetidine-l-carboxylate:
A mixture of tert-butyl 3-aminoazetidine-l-carboxylate (10.0 g, 58 mmol), ethyl 2- bromoacetate (10.7 g, 64 mmol) and potassium carbonate (24.0 g, 174 mmol) in MeCN (200 mL) was stirred at rt for 13 hrs. The reaction mixture was filtered and concentrated. The crude material was purified by silica gel column chromatography (gradient elution 0-66% EtOAc/petroleum ether) to afford ieri-butyl 3-(2-ethoxy-2-oxoethylamino)azetidine-l- carboxylate (12.1 g, 81%) as a white solid. ESI-MS (EI+, m/z): 259.0 [M+H]+.
Step 2: Synthesis of tert-butyl 3-(tert-butoxycarbonyl(2-ethoxy-2-oxoethyl)amino)azetidine-l- carboxylate:
A mixture of ieri-butyl 3-(2-ethoxy-2-oxoethylamino)azetidine-l-carboxylate (10.3 g, 40 mmol), di-ieri-butyl dicarbonate (10.4 g, 48 mmol) and potassium carbonate (16.6 g, 120 mmol) in MeCN (200 mL) was stirred at rt for 6 hrs. The reaction mixture wasthen filtered and concentrated. The crude product was purified by silica gel column chromatography (gradient elution 0-80% EtOAc/petroleum ether) to afford ieri-butyl 3-(tert- butoxycarbonyl(2-ethoxy-2-oxoethyl)amino)azetidine-l-carboxylate (13.0 g, 90%) as a white solid. ESI-MS (EI+, m/z): 359.0 [M+H]+.
Step 3: Synthesis of tert-butyl 3-(tert-butoxycarbonyl(2-hydrazinyl-2- oxoethyl)amino )azetidine-l -carboxylate:
A mixture of ieri-butyl 3-(ieri-butoxycarbonyl(2-ethoxy-2-oxoethyl)amino)azetidine-l- carboxylate (7.2 g, 20 mmol), hydrazine (5.0 g, 100 mmol) and ethanol (50 mL) was stirred at 80 °C for 17 hrs. The reaction mixture was then concentrated to afford the crude ieri-butyl 3-(ieri-butoxycarbonyl(2-hydrazinyl-2-oxoethyl)amino)azetidine-l-carboxylate (6.4 g, 94%) as a white solid, which was used directly in the next step. ESI-MS (EI+, m/z): 345.0 [M+H]+.
Step 4: Synthesis of tert-butyl 3-((2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)(tert- butoxycarbonyl)amino )azetidine-l -carboxylate:
DIPEA (14 g, 0.11 mol) was added to a 0 °C solution of ieri-butyl 3-(ieri-butoxycarbonyl(2- hydrazinyl-2-oxoethyl)amino)azetidine-l -carboxylate (15 g, 0.044 mol), (5 ?)-6-(benzyloxy)- 7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (10 g, 0.036 mol) and HATU (15 g, 0.04 mol) in CH2CI2 (250 mL) . The mixture was allowed to warm to rt then was stirred at rt for 2 hrs. The mixture was quenched with saturated sodium chloride (50 mL) and the organic layer was separated. The water layer was extracted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2SC>4, and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-50% EtO Ac/petroleum ether) to afford ieri-butyl 3-((2-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)(ieri- butoxycarbonyl)amino)azetidine-l-carboxylate (18.5 g, 86%). ESI-MS (Ef , m/z): 603.3 [M+H]+.
Step 5: Synthesis of tert-butyl 3-(((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl)(tert-butoxycarbonyl)amino)azetidine- 1 -carboxylate :
Et3N (8.3 g, 0.082 mol) was added to a 0 °C solution of I2 (10.43 g, 0.041 mol) and PPh3 (10.76 g, 0.041 mol) in CH2C12 (250 mL). After the mixture was stirred at rt for 0.5 hr, ieri- butyl 3-((2-(2-((25,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinyl)-2-oxoethyl)(ieri-butoxycarbonyl)amino)azetidine-l -carboxylate (12.34 g, 0.0205 mol) was added. The mixture was stirred for another 1 hr. The mixture was then concentrated and EtOAc (250 rriL) was added to the resulting residue. The residue, was stirred and then filtrated to remove Ρ1¾ΡΟ. The filtrate was concentrated and purified by silica gel column chromatography (gradient elution 33-50% EtO Ac/petroleum ether) to afford ieri-butyl 3-(((5-((25,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)- l,3,4-oxadiazol-2-yl)methyl)(ieri-butoxycarbonyl)amino) azetidine- 1 -carboxylate (9.6 g, 80%). ESI-MS (EI+, m/z): 585.3 [M+H]+.
Step 6-8: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl 3-(((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)- 1 ,3 ,4-oxadiazol-2-yl)methyl)(tert-butoxycarbonyl)amino)azetidine- 1 -carboxylate; (2S,5R)-2-(5-((azetidin-3-ylamino)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (1.5 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (ΕΓ, m/z): 375.1. 1H NMR (300 MHz, D20) δ 5.00 (d, / = 5.4 Hz, 1H), 4.39 - 4.34 (m, 3H), 4.25 (s, 2H), 4.21 - 4.08 (m, 3H), 3.41 (br d, / = 13.1 Hz, 1H), 3.11 (d, / = 12.3 Hz, 1H), 2.57 - 2.28 (m, 3H), 2.19 - 2.08 (m, 1H). Example 21: Synthesis of(2S,5R)-2-( 5-( ( 1 r,3S)-3-aminocyclobutyl)-l,3,4-oxadiazol-2-yl)-7-
Figure imgf000094_0001
bso3H
Figure imgf000095_0001
5ΐ i: Synthesis of tert-butyl ((ls,3s)-3-(hydrazinecarbonyl)cyclobutyl)carbamate:
A solution of (ls,3s)-methyl 3-((ieri-butoxycarbonyl)amino)cyclobutanecarboxylate (1.0 g, 4.36 mmol) in NH2NH2.H20 (2 mL, 65.4 mmol) was stirred at rt for 12 hrs. Et20 (20 mL) was then added to the mixture and the product was obtain by filtration. The solid material was dried under vacuum to give ieri-butyl ((ls,3s)-3-
(hydrazinecarbonyl)cyclobutyl)carbamate (0.8 g, 80%) as a white solid. ESI-MS (EI+, m/z): 230.4.
Step 2: Synthesis oftert-butyl((lS,3r)-3-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1 ] octane-2-carbonyl) hydrazinecarbonyl)cyclobutyl )carbamate:
HATU (56.4 g, 148 mmol), and DIPEA (27.8 mL, 160 mmol) were added to a solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (31.6 g, 114 mmol) and ieri-butyl 4-hydrazinyl-4-oxobutylcarbamate (28.8 g, 126 mmol) in CH2C12 (460 mL). The mixture was stirred at rt for 4 hrs then diluted with CH2C12 (300 mL), washed with water (2x) and saturated sodium chloride (2x), dried over Na2S04, and concentrated to give a slightly yellow solid that was used in the next step without further purification. ESI-MS (EI+, m/z): 488.5.
Step 3: Synthesis oftert-butyl((lS,3r)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diaz bicycl[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclobutyl)carbamate:
To a solution of tert-butyl((lS,3r)-3-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo[3.2.1 ]octane-2-carbonyl)hydrazinecarbonyl)cyclobutyl)carbamate (65 g, 133 mmol) in DCM (445 mL) was added DIPEA (45 mL, 267 mmol), followed by and Burgess reagent (63.5 g, 267 mmol). The reaction mixture was stirred at rt 12 hrs and then diluted with CH2CI2 (300 mL), washed with water (2x) and saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column
chromatography (gradient elution 0-50% DCM/acetone) to afford tert-butyl((lS,3r)-3-(5- ((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicycl[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2- yl)cyclobutyl)carbamate as a slightly pink solid (29 g, 62 mmol, 54% over 2 steps). ESI-MS (EI+, m/z): 470.5. Step 4-6: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6-
(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl ((lS,3r)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo [3.2.1 ]octan-2-yl)- 1 ,3 ,4-oxadiazol-2-yl)cyclobutyl)carbamate; (2S,5R)-2-(5-
((lr,3S)-3-aminocyclobutyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (3.3 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 360.2. 1H NMR (300 MHz, D20) δ 4.74 (d, J = 7.6 Hz, 1H), 4.17 (br s, 1H), 3.96 - 3.80 (m, 1H), 3.72 - 3.55 (m, 1H), 3.17 (br d, / = 13.1 Hz, 1H), 2.90 (d, / = 12.3 Hz, 1H), 2.82-2.73 (m, 2H), 2.53-2.43 (m, 2H), 2.30-2.08 (m, 3H), 2.00 - 1.83 (m, 1H).
Example 22: Synthesis of(2S,5R)-2-(5-(l-(guanidinomethyl)cyclopropyl)-l,3,4-oxadiaz.ol-2- yl)-7-oxo- 6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 723)
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000097_0002
Step 1: Synthesis of tert-butyl(l -(hydrazinecarbonyl)cyclopropyl)methylcarbamate:
CDI (12.5 g, 0.077 mol) was added to a 0 °C solution of l-((tert- butoxycarbonylamino)methyl)cyclopropanecarboxylic acid (15.0 g, 0.07 mol) in THF (250 mL). The mixture was allowed to warm to rt, and stirred at rt. for 2 hrs, and then
ΝΗ2ΝΗ2Ή2Ο (10.5 g, 0.21 mol) was added rapidly. The mixture was stirred for another 1 hr. The reaction mixture was concentrated, and then CH2CI 2 (500 mL) was added. The combined organic layer was washed with H2O (100 mL), dried over Na2S04, and concentrated to afford ieri-butyl(l-(hydrazinecarbonyl)cyclopropyl)methylcarbamate (13.5 g, 84%). ESI-MS (EI+, m/z): 230.2 [M+H]+.
Step 2: Synthesis of tert-butyl(l-(2-((5R)-6-(benzyloxy)-7-oxo-l ,6-diaza- bicyclo[ 3.2.1 Joctane- 2-carbonyl)hydrazinecarbonyl)cyclopropyl)methylcarbamate:
DIPEA (14 g, 0.11 mol) was added to a solution of ieri-butyl (1-
(hydrazinecarbonyl)cyclopropyl)methylcarbamate (10.0 g, 0.044 mol), (5 ?)-6-(benzyloxy)-7- oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (10 g, 0.036 mol), and HATU (15 g, 0.04 mol) in CH2CI 2 (250 mL). The mixture was stirred at rt for 2 hrs. The mixture was diluted with CH2C12 (500 mL), washed with H20 (300 mL), dried over Na2S04, and concentrated. The crude product was washed with EtOAc (200 mL), and filtrated to afford ieri-butyl(l-(2-((5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinecarbonyl)cyclopropyl)methylcarbamate (15 g, 85%) as a white solid. ESI- MS (EI+, m/z): 488.3 [M+H]+.
Step 3: Synthesis of tert-b tyl(l-(5-((5R)-6-(benzyloxy)-7-oxo-l ,6-diaza-bicyclo[3.2.1 Joctan- 2- yl)-l,3,4-oxadiazol-2-yl)cyclopropyl)methylcarbamate:
Et3N (8.3 g, 0.082 mol) was added to a 0 ° C solution of I2 (10.43 g, 0.041 mol), PPh3 (10.76 g, 0.041 mol) in CH2C12 (250 mL). The mixture was allowed to warm to rt. After stirring at rt for 0.5 hr, ½ri-butyl(l-(2-((5«)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2- carbonyl)hydrazinecarbonyl)cyclopropyl)methylcarbamate (10 g, 0.0205 mol) was added. The mixture was stirred at rt for another 1 hr. The mixture was concentrated, EtOAc(250 mL) was added, and the mixture was filtered to remove Ρ1¾ΡΟ. The filtrate was concentrated and the residue was purified by silica gel column chromatography (gradient elution 33-50% EtOAc/petroleum ether) to afford ieri-butyl (l-(5-((5 ?)-6- (benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclopropyl)methylcarbamate (8 g, 83%) as a white solid. ESI-MS (EI+, m/z): 470.3 [M+H]+.
Step 4: Synthesis of (5R)-2-(5-(l-(aminomethyl)cyclopropyl)-l,3,4-oxadiazol-2-yl)-6- (benzyloxy)-l ,6-diaza-bicyclo[3.2.1 ]octan-7-one:
TFA (30 mL) was added to a O °C solution of tert-butyl(l-(5-((5 ?)-6-(benzyloxy)-7-oxo-l,6- diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclopropyl)methylcarbamate (8 g, 0.017 mol) in DCM (100 mL). The mixture was allowed to warm to rt and was stirred at rt for 1 h. The mixture was concentrated and the residue was washed with Et20 (50 mL), and then filtrated to afford (5 ?)-2-(5-(l-(aminomethyl)cyclopropyl)- l,3,4-oxadiazol-2-yl)-6- (benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one (7 g, 99%), which was used directly in the next step. ESI-MS (EI+, m/z): 370.2 [M+H]+.
Step 5: Synthesis of (5R)-2-(5-(l-(2,3-bis-(tert-butoxycarbonyl)- guanidinomethyl)cyclopropyl)- 1 ,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l ,6-diaza- bicyclo[3.2.1]octan-7-one:
Et3N (5 g, 0.05 mol) and tert-butyl (((tert-butoxycarbonyl)amino)(lH-pyrazol-l- yl)methylene)carbamate (5.5 g, 17.5 mmol) were added to a solution of (5R)-2-(5-(l- (aminomethyl)cyclopropyl)- 1 ,3,4-oxadiazol-2-yl)- 6-(benzyloxy)- 1 ,6-diaza- bicyclo[3.2.1]octan-7-one (7 g, 0.017 mol) in CH3OH (500 mL) . The mixture was stirred at rt for 4 hrs and then concentrated. The residue was purified by silica gel column
chromatography (gradient elution 50 to 66% EtOAc/petroleum ether) to afford (5/?)-2-(5-(l- (2,3-bis- (ieri-butoxycarbonyl)-guanidinomethyl)cyclopropyl)- 1 ,3 ,4-oxadiazol-2-yl)-6- (benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one (9 g, 86%) as a white solid. ESI-MS (EI+, m/z): 612.3 [M+H]+.
Step 6-8: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with (5 ?)-2-(5-(l-(2,3-bis-(ieri-butoxycarbonyl)-guanidinomethyl) cyclopropyl)- l,3,4-oxadiazol-2-yl)-6-(benzyloxy)-l,6-diaza-bicyclo[3.2.1]octan-7-one; (2S,5R)-2-(5-(l- (guanidinomethyl)cyclopropyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6- yl hydrogen sulfate (0.74 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 402.1. lH NMR (300 MHz, D20) δ 4.74 (d, J = 7.9 Hz, 1H), 4.17 (s, 1H), 3.57 (s, 2H), 3.17 (br d, / = 12.9 Hz, 1H), 2.88 (d, / = 12.3 Hz, 1H), 2.32 - 2.05 (m, 3H), 1.98-1.82 (m, 1H), 1.38 (br s, 2H), 1.23 (br s, 2H).
Example 23: Synthesis of (2S,5R)-2-( 5-( ( 1 -aminocyclopropyl)methyl)-l ,3 ,4-oxadiazol-2-yl)- -oxo-l,6-diazabicyclo[3.2.11octan-6-yl hydrogen sulfate ( Compound 724):
Figure imgf000099_0001
Figure imgf000100_0001
Figure imgf000100_0002
Step 1: Synthesis of 3-(tert-butyldimethylsilyloxy)propanenitrile:
Imidazole (33.6 g, 495 mmol) and ieri-butyldimethylsilyl chloride (27.2 g, 180 mmol) were added to a 0 °C solution of 3-hydroxypropanenitrile (10.6 g, 150 mmol) in DMF 50 mL). The mixture was allowed to warm to rt, then was stirred at rt for 12 hrs. The mixture was quenched with water (500 mL), and then extracted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-5% EtO Ac/petroleum ether) to give 3-(tert- butyldimethylsilyloxy) propanenitrile (18 g, 75%) as a colorless oil. 1H NMR (400 MHz, CDCI3): δ 3.74 (t, / = 6.0 Hz, 2H), 2.43 (t, / = 6.0 Hz, 2H), 0.81 (s, 9H), 0.00 (s, 6H).
Step 2: Synthesis of 1 -(2-(tert-butyldimethylsilyloxy)ethyl)cyclopropanamine:
To a solution of 3-(ieri-butyldimethylsilyloxy)propanenitrile (11.1 g, 60 mmol) in Et20 (400 mL) was added titanium tetraisopropanolate (28.9 g, 102 mmol) under N2 atmosphere.
Ethylmagnesium bromide (3M in Et20, 50 mL) was slowly added drop-wise at 0 °C. The mixture was stirred at rt for 1 hr. Boron trifluoride etherate (17.0 g, 120 mmol) was slowly added at 0 °C. The mixture was stirred at rt for 1 hr. The mixture was quenched with 10% aq. NaOH (300 mL) and then extracted with DCM (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (gradient elution 5-50% EtOAc/petroleum ether) to afford \-{2-{tert- butyldim ethylsilyloxy )ethyl)cyclopropanamine (3.9 g, 30%) as a colorless oil. ESI-MS (EI+, m/z): 216.2 [M+H]+.
Step 3: Synthesis of tert-butyl 1 -(2-(tert-butyldimethylsilyloxy)ethyl)cyclopropyl-carbamate: A solution of l-(2-(ieri-butyldimethylsilyloxy)ethyl)cyclopropanamine (1.9 g, 8.8 mmol), (Boc)20 (2.9 g, 13.2 mmol), NaHC03 (1.5 g, 17.6 mmol) in THF/H20 (20 mL/20 mL) was stirred at rt for 17 hrs. The mixture was extracted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (0-15% gradient elution EtO Ac/petroleum ether) to afford ieri-butyl l-(2- (ieri-butyldimethylsilyloxy)ethyl)cyclopropylcarbamate (2.5 g, 90%) as a colorless oil. ESI- MS (EI+, m/z): 316 [M+H]+.
Step 4: Synthesis of tert-butyl l-(2-hydroxyethyl)cyclopropylcarbamate:
A solution of ieri-butyl l-(2-(ieri-butyldimethylsilyloxy)ethyl)cyclopropylcarbamate (11.9 g, 37.8 mmol) and 3HF TEA (22.0 g) in DCM (50 mL) was stirred at rt for 17 hrs. The mixture was concentrated and the residue was purified by silica gel column chromatography (0-20% gradient elution EtO Ac/petroleum ether) to afford ieri-butyl l-(2- hydroxyethyl)cyclopropylcarbamate (4.6 g, 60%) as a white solid.
Step 5: Synthesis of2-(l-(tert-butoxycarbonylamino)cyclopropyl)acetic acid:
RuCi3.H20 (124 mg, 0.6 mmol) was added to a solution of ieri-butyl l-(2- hydroxyethyl)cyclopropylcarbamate (6.1 g, 30 mmol), and NaI04 (19.0 g, 90 mmol) in DCM/H20/CH3CN (20 mL/40 mL/20 mL). The mixture was stirred at rt for 3 hrs. The mixture was then diluted with H20 (100 mL), and extracted with DCM (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (0-30% gradient elution EtO Ac/petroleum ether) to afford 2-(l- (ieri-butoxycarbonylamino)cyclopropyl)acetic acid (6.0 g, 90%) as a white solid. ESI-MS (EI+, m/z): 238 [M+Na]+.
Step 6: Synthesis of tert-butyl l-(2-(2-((2S, 5R)-6-(benzyloxy)-7-oxo-l, 6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)cyclopropylcarbamate: A solution of 2-(l-(ieri-butoxycarbonylamino)cyclopropyl)acetic acid (1.5 g, 6.9 mmol), (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carbohydrazide (3.1 g, 7.6 mmol), DIPEA (2.7 g, 21.0 mmol), and HATU (3.9 g, 10.45 mmol) in DMF (20 mL) was stirred at 0 °C for 1 hr. The mixture was quenched with saturated sodium chloride (150 mL) and EtOAc (150 mL). The organic layer was separated and washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (0-80% gradient elution EtO Ac/petroleum ether) to afford ieri-butyl l-(2-(2-((25,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinyl)-2-oxoethyl)cyclopropylcarbamate (2.4 g, 70%) as a white solid. ESI- MS (EI+, m/z): 488 [M+H]+.
Step 7: Synthesis of 'tert-butyl l-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[ 3.2.1 ]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclopropylcarbamate: Method A:
Pyridine (5.2 g, 65.6 mmol) was added to a O °C solution of ieri-butyl l-(2-(2-((25,5/?)-6- (benzyloxy)-7-oxo-l,6-diaza-bicyclo [3.2.1 ]octane-2-carbonyl)hydrazinyl)-2- oxoethyl)cyclopropylcarbamate (4.0 g, 8.2 mmol) in DCM (40 mL). Tf20 (5.7 g, 20.5 mmol) was added slowly at 0 °C. The reaction mixture was stirred at 0 °C for 3.5 hrs. Sat. NaHCC>3 was added very slowly at 0 °C. The organic layer was separated and washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (0-70% gradient elution EtOAc/petroleum ether) to afford ieri-butyl l-((5-((25,5/?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4- oxadiazol-2-yl)methyl)cyclopropylcarbamate (2.6 g, 65%) as a yellow solid. ESI-MS (EI+, m/z): 470 [M+H]+.
Method B:
To s solution of PPh3 (5.2 g, 20.0 mmol) in dry DCM (60 mL) was added I2 (5.1 g, 20.0 mmol). After I2 was dissolved completely, TEA (7.0 mL, 50.0 mmol) was added quickly at rt. The mixture was stirred for 15 mins. 7¾ri-butyl l-(2-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6- diaza-bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)cyclopropyl-carbamate (4.9 g, 10.0 mmol) was added and the mixture was stirred at rt for 1 hr. The solvent was
concentrated. EtO Ac (250 mL) was added, and the solution was filtered to remove ΡΡ1¾0. The filtrate was concentrated and the residue was purified by silica gel column
chromatography (0-60% gradient elution EtOAc/petroleum ether) to afford ieri-butyl l-((5- ((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2- yl)methyl)cyclopropyl-carbamate (4.1 g, 87%) as a white solid. ESI-MS (EI+, m/z): 470
[M+H]+.
Step 8-10: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (l-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclopropyl)carbamate; (2S,5R)-2-(5-((l- aminocyclopropyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (0.78 g) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 360.1. *H NMR (300 MHz, D20) δ 4.75 (d, J = 6.4 Hz, 1H), 4.16 (br s, 1H), 3.25 (s, 2H), 3.17 (br d, / = 12.7 Hz, 1H), 2.95 (d, / = 12.4 Hz, 1H), 2.34 - 2.03 (m, 3H), 2.00 - 1.82 (m, 1H), 1.08 - 0.86 (m, 4H).
Figure imgf000103_0001
diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 725)
Figure imgf000103_0002
Figure imgf000103_0003
Step 1: Synthesis of tert-butyl 3-(2-hydrazinyl-2-oxoethyl)azetidine-l -carboxylate: To a solution of teri-butyl 3-(2-methoxy-2-oxoethyl)azetidine-l-carboxylate (25.0 g, 109 mmol) in MeOH (150 mL) was added ΝΗ2ΝΗ2Ή20 (27.3 g, 546 mmol) at rt. The mixture was heated at 65 °C for 12 hrs and then concentrated. The residue was diluted with DCM (400 mL), washed with water (2x) and saturated sodium chloride (2x), dried over Na2S04, and concentrated to give ieri-butyl 3-(2-hydrazinyl-2-oxoethyl)azetidine-l-carboxylate (24.0 g, 96%) as a yellow gum. ESI-MS (EI+, m/z): 252 [M+Na]+.
Step 2: Synthesis of 'tert-butyl 3-(2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza
bicyclo[3.2. l]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)azetidine-l -carboxylate:
HATU (19.6 g, 52.2 mmol) and DIPEA (16.6 g, 130.5 mmol) were added to a 0 °C solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2-carboxylic acid (12.0 g, 43.5 mmol), ieri-butyl 3-(2-hydrazinyl-2-oxoethyl)azetidine-l-carboxylate(11.3 g, 49.8 mmol) in CH2C12 (360 mL). The mixture was allowed to warm to rt then the mixture was stirred at rt for 12 hrs. The mixture was then diluted with CH2C12 (300 mL), washed with water (2x)and saturated sodium chloride(2x), dried and concentrated. The residue was purified by silica gel column chromatography (0-20% gradient elution EtOAc/petroleum ether) to afford ieri-butyl 3-(2-(2-((25',5«)-6-(benzyloxy)-7-oxo-l,6-diaza
bicyclo[3.2.1 ]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)azetidine- 1 -carboxylate ( 19.3 g, 93%) as a white solid. ESI-MS (EI+, m/z): 488 [M+H]+.
Step 3: Synthesis of tert-butyl 3 -((5-((2S, 5R)-6-(benzyloxy )-7-oxo-l, 6-diaza- bicyclo[3.2. l]octan-2-yl)-l, 3, 4-oxadiazol-2-yl)methyl)azetidine-l -carboxylate:
To s solution of PPh3 (2.2 g, 8.2 mmol) in dry DCM (60 mL) was added I2 (2.1 g, 8.2 mmol).
After I2 was dissolved completely, TEA (1.7 g, 16.4 mmol) was added quickly at rt. The mixture was stirred for 15 mins. 7¾ri-butyl 3-(2-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l ,6-diaza bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)azetidine-l-carboxylate (2.0 g, 4.1 mmol) was added. The mixture was stirred at rt for 1 h. The reaction mixture was
concentrated and the residue was purified by silica gel column chromatography (gradient elution 0-40% EtOAc/petroleum ether) to afford ieri-butyl 3-((5-((2S,5fl)-6-(benzyloxy)-7- oxo- l,6-diaza-bicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)methyl)azetidine-l-carboxylate (1.3 g, 66%) as a white solid. ESI-MS (EI+, m/z): 470 [M+H]+.
Step 4-6: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl 3-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2- yl)-l,3,4-oxadiazol-2-yl)methyl)azetidine-l -carboxylate, (2S,5R)-2-(5-(azetidin-3-ylmethyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 360.2. 1H NMR (300 MHz, D20) 4.74 (d, / = 6.4 Hz, 1H), δ 4.23 - 4.15 (m, 3H), 3.95 (dd, / = 11.5, 7.5 Hz, 2H), 3.50 - 3.30 (m, 1H), 3.25 (d, / = 6.0 Hz, 2H), 3.17 - 3.14 (m, 1H), 2.88 (d, / = 12.0 Hz, 1H), 2.27 - 2.05 (m, 3H), 1.95-1.85 (m, 1H).
Example 25: Synthesis of '(2S,5R)-2-(5-((( 1 s,3R)-3-aminocyclobutyl)methyl)-l ,3,4-oxadiazol- 2-yl)-7-oxo- 6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 728) and (2S,5R)-2-(5-(((lr,3S)-3-aminocyclobutyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfatei Compound 751)
Figure imgf000105_0001
Step 1: Synthesis of ethyl 2-(3-(tert-butoxycarbonylamino)cyclobutylidene) acetate:
To a solution of ieri-butyl 3-oxocyclobutylcarbamate (1.0 g, 5.4 mmol) in toluene (10 iriL) was added ethyl 2-(triphenylphosphoranylidene)acetate (2.1 g, 5.9 mmol). The reaction mixture was heated at 100 °C for 2 hrs, and then concentrated. The residue was purified by silica gel column chromatography(10% EtOAc/petroleum ether) to afford ethyl 2-(3-(tert- butoxycarbonylamino)cyclobutylidene)acetate (1.2 g, 89%). ESI-MS (Ε , m/z): 256 [M+H]+. Step 2: Synthesis of ethyl 2-(3-(tert-butoxycarbonylamino) cyclobutyl) acetate:
10% Pd/C (360 mg) was added to a solution of ethyl 2-(3-(tert- butoxycarbonylamino)cyclobutylidene) acetate (1.2 g, 4.8 mmol) in MeOH (10 mL) at 23 °C. The reaction mixture was stirred under a H2 balloon at rt for 1.5 hrs. The mixture was filtered and concentrated. The residue was purified by silica gel column (10% EtOAc/petroleum ether) to afford ethyl 2-(3-(ieri-butoxycarbonylamino)cyclobutyl)-acetate (1.2 g, 96%). ESI- MS (EI+, m/z): 258 [M+H]+.
Step 3: Synthesis oftert-butyl 3-(2-hydrazinyl-2-oxoethyl)cyclobutylcarbamate:
A solution of ethyl 2-(3-(ieri-butoxycarbonylamino)cyclobutyl) acetate (1.2 g, 4.7 mmol) and hydrazine hydrate (1.4 g, 23.5 mmol) in EtOH (8 mL) was heated at 80 °C for 17 hrs. The reaction mixture was concentrated and the residue was dissolved in DCM (20 mL). The organic phase was washed with saturated sodium chloride (10 mL) and water (10 mL). The water layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated to afford ieri-butyl 3-(2-hydrazinyl-2-oxoethyl)
cyclobutylcarbamate (1.1 g, 97%). ESI-MS (EI+, m/z): 244 [M+H]+.
Step 4: Synthesis of 'tert-butyl 3-(2-(2-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo
[3.2.1 ]octane-2-carbonyl)hydrazinyl)-2-oxoethyl) cyclobutylcarbamate:
HATU (1.6 g, 4.3 mmol) and DIPEA (0.93 g, 7.2 mmol) were added to a 0 °C solution of (25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1] octane-2-carboxylic acid (1.0 g, 3.6 mmol), ieri-butyl 3-(2-hydrazinyl-2-oxoethyl) cyclobutylcarbamate (0.97 g, 3.9 mmol) in DMF (10 mL) at . The reaction mixture was stirred at 0 °C for 1 nr. The mixture was quenched with saturated sodium chloride (50 mL) and the organic layer was separated. The water layer was exacted with EtOAc (3x). The combined organic layer was washed with saturated sodium chloride (2x), dried over Na2S04, and concentrated. The residue was purified by silica gel column chromatography (50% EtOAc/petroleum ether) to afford ieri- butyl 3-(2-(2-((25',5«)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbonyl)hydrazinyl)-2-oxoethyl) cyclobutylcarbamate (1.5 g, 88%). ESI-MS (Ef , m/z): 502 [M+H]
Step 5: Synthesis of tert-butyl 3-((5-((25, 5 ?)-6-(benzyloxy)-7-oxo-l, 6-diaza-bicyclo [3.2.1] octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl) cyclobutylcarbamate:
Method A:
To a solution of ieri-butyl 3-(2-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl) cyclobutylcarbamate (1.0 g, 1.99 mmol) in DCM (20 mL) was added pyridine (1.5 mL). (CF3S02)20 (1.4 g, 4.97 mmol) was added slowly at -10 °C. The reaction mixture was stirred at 0 °C for 1 h. Sat. NaHCC>3 was added at 0 °C very slowly. The organic layer was separated and the water layer was exacted with EtOAc (3x). The combined organic layer was dried over Na2S04 and concentrated. The residue was purified by silica gel column chromatography (gradient elution 10 -50%
EtOAc/petroleum ether) to afford ieri-butyl 3-((5-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza- bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl) cyclobutylcarbamate (0.7 g, 48%) as a slight yellow solid. ESI-MS (EI+, m/z): 484.0 [M+H]+.
Method B:
To s solution of PPh3 (7.9 g, 30.0 mmol) in dry DCM (60 mL) was added I2 (7.8 g, 30.0 mmol). After I2 was dissolved completely, TEA (10.5 mL, 75.0 mmol) was added quickly at rt. The mixture was stirred for 15 mins. 7¾ri-butyl 3-(2-(2-((25',5 ?)-6-(benzyloxy)-7-oxo-l,6- diaza-bicyclo[3.2.1]octane-2-carbonyl)hydrazinyl)-2-oxoethyl)cyclobutyl-carbamate (4.9 g, 15.0 mmol) was added. The mixture was stirred at rt for 1 hr. The solvent was concentrated. EtOAc (300 mL) was added, and the solution was filtered to remove ΡΡ1¾0. The filtrate was concentrated. The residue was purified by silica gel column chromatography (gradient elution 0-50% EtOAc/petroleum ether) to afford ieri-butyl 3-((5-((25",5«)-6-(benzyloxy)-7-oxo-l,6- diaza-bicyclo[3.2.1]octan-2-yl)-l,3,4-oxadiazol-2-yl)methyl) cyclobutyl-carbamate (6.2 g, 85%) as a white solid. ESI-MS (EI+, m/z): 484.0 [M+H]+.
Step 6-8: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl (3-((5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan- 2-yl)-l,3,4-oxadiazol-2-yl)methyl)cyclobutyl)carbamate, (2S,5R)-2-(5-(((ls,3R)-3- aminocyclobutyl)methyl)- 1 ,3 ,4-oxadiazol-2-yl)-7-oxo- 1 ,6-diazabicyclo[3.2.1 ]octan-6-yl hydrogen sulfate (245 mg) and (2S,5R)-2-(5-(((lr,3S)-3-aminocyclobutyl)methyl)-l ,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (178 mg) were obtained as white solids after prep-HPLC purification using ammonium formate buffer. (2S,5R)-2-(5-(((ls,3R)-3-aminocyclobutyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (Compound 728): ESI-MS (Ε , m/z): 374.3. *H NMR (300 MHz, D20) δ 4.76 (d, / = 6.5 Hz, 1H), 4.15 (br s, 1H), 3.71 - 3.55 (m, 1H), 3.16 (br d, " = 11.5 Hz, 1H), 3.00 (d, / = 6.7 Hz, 2H), 2.86 (d, / = 12.3 Hz, 1H), 2.58-2.40 (m, 3H), 2.32 - 2.03 (m, 3H), 1.96-1.78 (m, 3H).
(2S,5R)-2-(5-(((lr,3S)-3-aminocyclobutyl)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (Compound 751): ESI-MS (Ε , m/z): 374.0. *H NMR (300 MHz, D20) δ 4.75 (d, / = 6.5 Hz, 1H), 4.15 (br s, 1H), 3.89-3.79 (m, 1H), 3.16 (br d, / = 12.0 Hz, 1H), 3.07 (d, / = 6.0 Hz, 2H), 2.87 (d, / = 8.0 Hz, 1H), 2.86-2.78 (m, 1H), 2.35 - 2.05 (m, 7H), 1.99 - 1.83 (m, 1H).
Example 26: Synthesis of '(2S,5R)-2-(5-(( 1 S,3R)-3 -aminocyclopentyl)-! ,3 A-oxadiazol-2-yl)- -oxo-1 ,6-diazabicyclot 3.2.1 loctan-6-yl hydrogen sulfate ( Compound 729)
Figure imgf000108_0001
Figure imgf000108_0002
Step 1: Synthesis of tert-butyl(lR,3S)-3-(2-((2S,5R)-6-(benzyloxy)-7 -oxo-1 ,6-diaza-bicyclo [3.2.1 ]octane-2-carbonyl)hydrazinecarbonyl)cyclopentylcarbamate:
To a O °C solution of (15',3 ?)-3-(ieri-butoxycarbonylamino)cyclopentanecarboxylic acid (3.8 g, 16.6 mmol) and (25,5 ?)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo[3.2.1]octane-2- carbohydrazide (5.3 g, 18.26 mmol) in DMF (30 mL) were added HATU (7.6 g, 19.92 mmol) and DIPEA (11.6 ml, 66.4 mmol). The reaction mixture was stirred at 0 °C for 1.5 hrs. The reaction mixture was diluted with water and extracted with EtOAc (2x). The combined organic layer was washed with saturated sodium chloride (4x) and citric acid (5% aq.), dried over Na2S04, and concentrated. The residue was purified by silica gel column (gradient elution 50-80% EtOAc/petroleum ether ) to afford ieri-butyl (lR,3S)-3-(2-((2S,5R)-6- (benzyloxy)-7-oxo- 1 ,6-diaza-bicyclo [3.2.1 ]octane-2-carbonyl) hydrazinecarbonyl) cyclopentylcarbamate (4.5 g, 55%) as a white solid. ESI-MS (ΕΓ, m/z): 502.3 [M+H]+.
Step 2: Synthesis oftert-butyl(lR,3S)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6-diaza-bicyclo [3.2.1 ]octan-2-yl)-l,3,4-oxadiazol-2-yl)cyclopentylcarbamate:
To a 0 °C solution of PPh3 (2.2 g 8.4 mmol) in dry DCM (20 mL) was added I2 (2.1 g, 8.4 mmol). After I2 was dissolved, TEA (2.4 mL, 16.8 mmol) was added quickly at rt. The reaction mixture was stirred for 15 min. ieri-Butyl (l/?,35')-3-(2-((25',5 ?)-6-(benzyloxy)-7- oxo- l,6-diaza-bicyclo[3.2.1]octane-2-carbonyl)hydrazinecarbonyl) cyclopentylcarbamate (2.1 g, 4.2 mmol) was added. The reaction mixture was stirred at rt for 1 h. The reaction mixture was concentrated and the residue was purified by silica gel column (gradient elution 0-50% EtOAc/petroleum ether ) to afford the crude teri-butyl (lR,3S)-3-(5-((2S,5R)-6- (benzyloxy)-7-oxo- 1 ,6-diaza-bicyclo [3.2.1 ]octan-2-yl)- 1 ,3 ,4-oxadiazol-2-yl)
cyclopentylcarbamate (-1.7 g) as a white solid. ESI-MS (EI+, m/z): 484.1.
Step 3-5: Following Steps 3-5 in Example 4, replacing ieri-butyl (2-(5-((2S,5R)-6- (benzyloxy)-7-oxo-l,6-diazabicyclo[3.2.1]octan-2-yl)-l ,3,4-oxadiazol-2-yl)ethyl)carbamate in Step 3 with ieri-butyl ((lR,3S)-3-(5-((2S,5R)-6-(benzyloxy)-7-oxo-l,6- diazabicyclo [3.2.1 ]octan-2-yl)- 1 ,3 ,4-oxadiazol-2-yl)cyclopentyl)carbamate; (2S,5R)-2-(5 - ((lS,3R)-3-aminocyclopentyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l ,6-diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (286 mg) was obtained as a white solid after prep-HPLC purification using ammonium formate buffer. ESI-MS (EI+, m/z): 314.2. lU NMR (300 MHz, D20) δ 4.74 (d, J = 6.5 Hz, 1H), 4.16 (br s, 1H), 3.82 - 3.66 (m, 1H), 3.56 - 3.41 (m, 1H), 3.15 (br d, / = 12.3 Hz, 1H), 2.89 (d, / = 12.3 Hz, 1H), 2.67 - 2.51 (m, 1H), 2.30 - 1.69 (m, 9H). The compounds described in Examples 27-87 were prepared as described in the reaction schemes following similar procedures of Examples 1-26.
Example 27: Synthesis of(2S,5R)-2-(5-(4-aminobutyl)-l,3A-oxadiaz.ol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 735)
Figure imgf000110_0001
Figure imgf000110_0002
ESI-MS (EI+, m/z): 362.1. H NMR (300 MHz, D20) δ 4.73 (d, / = 6.3 Hz, 1H), 4.15 (br s, 1H), 3.28 - 3.10 (m, 1H), 3.02 - 2.79 (m, 5H), 2.38 - 2.03 (m, 4H), 2.06 - 1.45 (m, 4H).
Example 28: Synthesis of (2S,5R)-2-( 5-(2-iminoimidazolidin-4-yl)-l ,3 ,4-oxadiazol-2-yl)-7 - oxo-l 6-dia abic clo 3.2.1 octan-6-yl hydrogen sulfate (Compound 767)
Figure imgf000110_0003
Figure imgf000111_0001
ESI-MS (EI+, m/z): 374.2. 1H NMR (300 MHz, D20) δ 5.41 (dd, / = 10.1, 4.9 Hz, 1H), 4.76 (d, / = 6.3 Hz, 1H), 4.26 - 4.00 (m, 2H), 3.98 - 3.78 (m, 1H), 3.27 - 3.09 (m, 1H), 2.90 (d, / = 12.4 Hz, 1H), 2.34 - 2.01 (m, 3H), 2.01 - 1.70 (m, 1H).
Example 29: Synthesis of (2S,5R)-2-(5-(2-amino-l-hydroxyethyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 715)
Figure imgf000111_0002
Figure imgf000112_0001
ESI-MS (EI+, m/z): 350.1. 'H NMR (300 MHz, D20) δ 5.25 (dd, / = 8.4, 3.9 Hz, 1H), 4.78 (d, 7 = 6.7 Hz, 1H), 4.22 - 4.11 (m, 1H), 3.56 - 3.32 (m, 2H), 3.23 - 3.12 (m, 1H), 2.92 (dd, / = 12.3, 1.4 Hz, 1H), 2.34 - 2.02 (m, 3H), 2.03 - 1.83 (m, 1H).
Example 30: Synthesis of(2S,5R)-2-(5-((R)-2-guanidino-l-hydroxyethyl)-l,3,4-oxadiaz.ol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate
(Compound 731)
Figure imgf000112_0002
was arbitrarily assigned.
Figure imgf000113_0001
ESI-MS (EI+, m/z): 392.2. *H NMR (300 MHz, D20) δ 5.15 (t, / = 4.9 Hz, 1H), 4.78 (d, / = 6.5 Hz, 1H), 4.18 (s, 1H), 3.78 - 3.57 (m, 2H), 3.26 - 3.11 (m, 1H), 2.89 (d, / = 12.1 Hz, 1H), 2.39 - 2.08 (m, 3H), 2.03 - 1.78 (m, 1H).
Example 31: Synthesis of (2S,5R)-2-( 5-( ( S)-2-guanidino-l -hydroxy ethyl)-l ,3 A-oxadiaz.ol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 732)
Figure imgf000113_0002
70%) in 2 steps
Figure imgf000113_0003
76% for 2 steps
Figure imgf000113_0004
ESI-MS (EI+, m/z) 392.2. lU NMR (300 MHz, D20) δ 5.14 (t, / = 4.9 Hz„ 1H), 4.78 (d, / = 6.5 Hz, 1H), 4.16 (s, 1H), 3.66 (dd, J = 5.3, 3.2 Hz, 2H), 3.17 (br d, / = 12.1 Hz, 1H), 2.87 (d, / = 12.4 Hz, 1H), 2.35 - 2.00 (m, 3H), 1.97 - 1.85 (m, 1H). Example 32: Synthesis of(2S,5R)-2-(5-(3-amino-2-hydroxypropyl)-l,3,4-oxadiaz.ol-2-yl)-7-
Figure imgf000114_0001
ESI-MS (EI+, m/z): 364.2. lU NMR (300 MHz, D20) δ 4.77 (d, J = 6.5 Hz, 1H), 4.38 - 4.22 (m, 1H), 4.18 (br s, 1H), 3.46 - 2.84 (m, 6H), 2.36 - 2.03 (m, 3H), 2.05 - 1.74 (m, 1H). Example 33: Synthesis of(2S,5R)-2-(5-(3-guanidino-2-hydroxypropyl)-l,3,4-oxadiazol-2-yl)- 7-oxo-l,6-diazabicyclo[3.2.11octan-6-yl hydrogen sulfate ( Compound 730)
Figure imgf000115_0001
ESI-MS (EI+, m/z): 406.2. 'H NMR (300 MHz, D20) δ 4.75 (d, / = 6.5 Hz, 1H), 4.41 - 4.03 (m, 2H), 3.37 (d, / = 10.8 Hz, 1H), 3.31 - 2.95 (m, 4H), 2.89 (d, / = 12.1 Hz, 1H),
2.34-2.02 (m, 3H), 2.02 - 1.78 (m, 1H).
Example 34 : Synthesis of (2S,5R)-2-(5-(2-((2-aminoethyl)amino)ethyl)-L3,4-oxadiaz.ol-2- yl)-7-oxo-L6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 716)
Figure imgf000115_0002
Figure imgf000116_0001
ESI-MS (EI , m/z): 377.3. H NMR (300 MHz, D20) δ 4.78 (d, / = 6.7 Hz, 1H), 4.20 (br s, 1H), 3.57 - 3.42 (m, 2H), 3.42 - 3.26 (m, 6H), 3.26 - 3.11 (m, 1H), 2.95 (d, / = 12.3 Hz, 1H), 2.33 - 2.07 (m, 3H), 2.06 - 1.83 (m, 1H).
Example 35: Synthesis of (2S,5R)-2-(5-(l,2-diaminoethyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 717)
Figure imgf000116_0002
ESI-MS (EI+, m/z) 349.2. lU NMR (300 MHz, D20) δ 4.79 (d, / = 6.5 Hz, 1H), 4.56 - 4.43 (m, 1H), 4.19 (br s, 1H), 3.52 - 3.41 (m, 1H), 3.35 - 3.13 (m, 2H), 2.97 (d, / = 12.4 Hz, 1H), 2.35 - 2.09 (m, 3H), 2.09 - 1.81 (m, 1H).
Example 36: Synthesis of (2S,5R)-2-(5-(2-amino-2-methylpropyl)- 3A-oxadiaz.ol-2-yl)-7-
Figure imgf000117_0001
Figure imgf000117_0002
ESI-MS (EI+, m/z): 362.3. *H NMR (300 MHz, D20) δ 4.78 (d, / = 7.3 Hz, 1H), 4.18 (br s, 1H), 3.28 (s, 2H), 3.20-3.06 (m, 1H), 2.94 (d, / = 12.3 Hz, 1H), 2.34 - 2.07 (m, 3H), 2.01 - 1.87 (m, 1H), 1.41 - 1.33 (m, 6H).
Example 37: Synthesis of (2S,5R)-2-( 5-( ( 1 -guanidinocyclopropyl)methyl)-l ,3 ,4-oxadiazol-2- yl)-7 -oxo-1 ,6-diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 739)
Figure imgf000117_0003
Figure imgf000118_0001
ESI-MS (EI+, m/z): 402.3. lH NMR (300 MHz, D20) δ 4.75 (d, / = 6.4 Hz, 1H), 4.17 (br s, 1H), 3.27 - 3.00 (m, 3H), 2.90 (d, / = 12.3 Hz, 1H), 2.36 - 2.04 (m, 3H), 2.03 - 1.79 (m, 1H), 1.09 - 0.84 (m, 4H).
Example 38 : Synthesis of (2S,5R)-7-oxo-2-(5-((R)-pyrrolidin-3-yl)-l,3,4-oxadiaz.ol-2-yl)- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 759)
Figure imgf000118_0002
ESI-MS (EI , m/z): 360.1. T H NMR (300 MHz, D20) δ 4.78 (d, / = 6.4 Hz, 1H), 4.20 (br s, 1H), 4.05 - 3.95 (m, 1H), 3.83 - 3.71 (m, 1H), 3.68 - 3.54 (m, 1H), 3.54 - 3.38 (m, 2H), 3.26 - 3.16 (m, 1H), 2.94 (d, / = 12.3 Hz, 1H), 2.62 - 2.45 (m, 1H), 2.43 - 2.09 (m, 4H), 2.04 - 1.85 (m, 1H). Example 39: Synthesis of(2S,5R)-7-oxo-2-(5-((S)-pyrrolidin-3-yl)-l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 ]octan-6-yl hydrogen sulfate (Compound 758)
Figure imgf000119_0001
ESI-MS (EI+, m/z): 360.1.
Example 40: Synthesis of(2S,5R)-2-(5-(2-azaspiro[3.3]heptan-6-yl)-l,3,4-oxadiazol-2-yl)-7-
Figure imgf000119_0002
ESI-MS (EI+, m/z): 386.3.
Example 41: Synthesis of(2S,5R)-2-(5-((l-carbamimidoylazetidin-3-yl)methyl)-l,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate
(Compound 741)
111
Figure imgf000120_0001
ESI-MS (EI+, m/z) 402.1. lU NMR (300 MHz, DMSO-d6) δ 4.63 (d, / = 6.4 Hz, 1H), 4.27 - 4.12 (m, 2H), 4.07 (br s, 1H), 3.84 (dd, / = 8.7, 4.8 Hz, 2H), 3.32 - 3.25 (m, 3H), 3.03 - 2.89 (m, 1H), 2.71 (d, / = 11.9 Hz, 1H), 2.21 - 2.10 (m, 1H), 2.08 - 1.94 (m, 2H), 1.94 - 1.79 (m, 1H).
Example 42: Synthesis of(2S,5R)-2-(5-(2-(azetidin-3-yl)ethyl)-l,3,4-oxadiazol-2-yl)-7-oxo- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 742)
Figure imgf000120_0002
Figure imgf000121_0001
ESI-MS (EI+, m/z): 374.2. 1H NMR (300 MHz, D20) δ 4.73 (d, / = 6.4 Hz, 1H), 4.16 (brs, 1H), 4.12 - 4.00 (m, 2H), 3.81 - 3.71 (m, 2H), 3.22 - 3.09 (m, 1H), 3.02 - 2.74 (m, 4H), 2.32 - 1.76 (m, 6H).
Example 43: Synthesis of(2S,5R)-2-(5-((azetidin-3-yloxy)methyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 744)
Figure imgf000121_0002
Figure imgf000122_0001
ESI-MS (EI+, m/z): 376.2. 'H NMR (300 MHz, D20) δ 4.78 (s, 2H), 4.74 (d, / = 6.4 Hz, 1 H), 4.66 - 4.56 (m, 1H), 4.34 - 4.22 (m, 2H), 4.16 (br s, 1H), 4.06 - 3.91 (m, 2H), 3.23 - 3.04 (m, 1H), 2.88 (d, / = 12.3 Hz, 1H), 2.35 - 2.00 (m, 3H), 2.00 - 1.80 (m, 1H).
Example 44: Synthesis of(2S,5R)-2-(5-(3-(az.etidin-3-yl)propyl)-l,3,4-oxadiaz.ol-2-yl)-7-oxo- l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 743)
Figure imgf000122_0002
Figure imgf000123_0001
Figure imgf000123_0002
ESI-MS (EI+, m/z): 388.2. 1H NMR (300 MHz, D20) δ 4.75 (d, / = 6.5 Hz, 1H), 4.16 (br s, 1H), 4.11 - 3.99 (m, 2H), 3.72 (dd, / = 11.4, 7.6 Hz, 2H), 3.22 - 3.10 (m, 1H), 2.95 - 2.74 (m, 4H), 2.34 - 2.03 (m, 3H), 2.01 - 1.77 (m, 1H), 1.72 - 1.50 (m, 4H).
Example 45: Synthesis of(2S,5R)-7-oxo-2-(5-(pyrrolidin-3-ylmethyl)-l,3,4-ox diazol-2-yl)- -diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 764)
Figure imgf000123_0003
Figure imgf000124_0001
OBn 32% for 2 steps O OBn
Figure imgf000124_0002
ESI-MS (EI+, m/z): 374.2. 1H NMR (300 MHz, D20) δ 4.74 (d, / = 6.4 Hz, IH), 4.16 (b IH), 3.50 (dd, / = 11.8, 7.7 Hz, IH), 3.45 - 3.31 (m, IH), 3.30 - 3.10 (m, 2H), 3.11 - 2. (m, 5H), 2.33 - 2.02 (m, 4H), 2.01-1.80 (m, IH), 1.80-1.53 (m, IH).
Example 46: Synthesis of (2S,5R)-2-(5-((lR,3S)-3-aminocyclopentyl)-l,3,4-oxadiazol-2-yl)- -oxo-l,6-diaz.abicyclo[3.2.1 ]octan-6-yl hydrogen sulfate ( Compound 768)
Figure imgf000124_0003
Figure imgf000124_0004
ESI-MS (EI+, m/z): 374.3.
Example 47: Synthesis of (2S,5R)-2-(5-(3-az.abicyclof3.1.0]hexan-6-yl)-l,3A-oxadiazol-2- -7-oxo-l ,6-diaz.abicyclol 3.2.1 loctan-6-yl hydrogen sulfate (Compound 740)
Figure imgf000125_0001
ESI-MS (Ε , m/z): 372.3.
Example 48: Synthesis of (2S,5R)-2-(5-(l-methylpyridin-l-ium-4-yl)- 3A-oxadiaz.ol-2-yl)-7- oxo-l6-dia abic clo 3.2.1 octan-6- l sulfate (Com ound782)
Figure imgf000125_0002
ESI-MS (EI+, m/z): 382.1. :H NMR (300 MHz, D20) δ 8.95 (d, J= 6.8 Hz, 2H), 8.53 (d, / = 6.9 Hz, 2H), 4.92 (d, / = 7.0 Hz, IH), 4.38 (s, 3H), 4.20 (br s, IH), 3.22 (br d, / = 13.2 Hz, IH), 2.98 (d, / = 12.4 Hz, IH), 2.42-2.33 (m, IH), 2.31-2.10 (m, 2H), 2.03 - 1.90 (m, IH).
Example 49: Synthesis of(2S,5R)-7-oxo-2-(5-(piperazin-l-ylmethyl)-l,3,4-oxadiazol-2-yl)- -diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 777)
Figure imgf000126_0001
ESI-MS (EI+, m/z): 389.2. 1H NMR (300 MHz, D20) δ 4.77 (d, / = 6.4 Hz, IH), 4.16 (br s, IH), 3.96 (s, 2H), 3.22 - 3.11 (m, 5H), 2.88 (d, / = 12.3 Hz, IH), 2.85 - 2.76 (m, 4H), 2.31 - 2.02 (m, 3H), 1.98 - 1.78 (m, IH).
Example 50: Synthesis of ( 2S,5R)-2-( 5-( (4-aminopiperidin-l -yl)methyl)-l ,3 A-oxadiazol-2- yl)-7-oxo-L6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 774)
Figure imgf000126_0002
Figure imgf000127_0001
ESI-MS (EI+, m/z): 403.2. lH NMR (300 MHz, D20) δ 4.77 (d, / = 6.5 Hz, 1H), 4.16 (br s, 1H), 3.87 (s, 2H), 3.20 - 3.05 (m, 2H), 3.00-2.91 (m, 2H), 2.87 (d, / = 12.3 Hz, 1H), 2.32 - 2.04 (m, 5H), 2.03 - 1.85 (m, 3H), 1.57 (q, / = 11.7 Hz, 2H).
Example 51: Synthesis of(2S, 5R)-2-(5-((lr, 3S)-3-aminocyclobutyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diaza-bicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 747)
Figure imgf000127_0002
Figure imgf000127_0003
ESI-MS (EI+, m/z): 360.2.
Example 52: Synthesis of(2S,5R)-2-(5-((lr,3S)-3-guanidinocyclobutyl)-l,3,4-ox diazol-2- yl)-7 -oxo-1 ,6-diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 748)
Figure imgf000128_0001
ESI-MS (EI+, m/z): 402.3.
Example 53: (2S,5R)-2-(5-((ls,3R)-3-guanidinocyclobutyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 749)
Figure imgf000128_0002
ESI-MS (ΕΓ, m/z): 402.2. Example 54: Synthesis of (2S,5R)-2-(5-(2-(( 1 s,3S)-3-aminocyclobutyl)ethyl)-l ,3,4-oxadiazol- 2-yl)-7-oxo-l,6-diazabicyclo[3.2.11octan-6-yl hydrogen sulfate (Compound 754)
BocHN
CQ2Et
Figure imgf000129_0001
H2, Pd/C NH2NH2 H20 BocHN O
■ BocHN
MeOH, rt, 1 h C02Et EtOH, 80 C, 17 h HN-NH,
72% 91 %
BocHN
Figure imgf000129_0002
BocHN
BocHN
Pd/C, H2
Tf20, pyridine
THF, rt, 3 h
DCM, 0 °C, 2 h
99%
62%
Figure imgf000129_0003
ESI-MS (EI+, m/z): 388.2. H NMR (300 MHz, D20) δ 4.68 (d, / = 6.5 Hz, 1H), 4.11 (br s, 1H), 3.56-3.45 (m, 1H), 3.10 (br d, / = 12.4 Hz, 1H), 2.86 - 2.67 (m, 3H), 2.38 - 1.94 (m, 6H), 1.95-1.70 (m, 3H), 1.66-1.52 (m, 2H). Example 55: Synthesis of ( 2S,5R)-2-( 5-(((l -carbamimidoylazetidin-3-yl)amino )methyl)- l,3,4-oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 746)
Figure imgf000130_0001
Figure imgf000130_0002
O OBn 48% for 2 steps η
Figure imgf000130_0003
ESI-MS (EI+, m/z): 417.1. 1H NMR (300 MHz, D20) δ 4.75 (d, / = 5.8 Hz, 1H), 4.26 - 4.15 (m, 3H), 4.00 (s, 2H), 3.82 - 3.72 (m, 3H), 3.21 - 3.12 (m, 1H), 2.88 (d, / = 12.3 Hz, 1H), 2.32 - 2.02 (m, 3H), 1.99 - 1.84 (m, 1H).
Example 56: Synthesis of (2S,5R)-2-(5-(2-(azetidin-3-ylamino)ethyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 745)
Figure imgf000131_0001
ESI-MS (Ef , m/z): 389.2. Example 57: Synthesis of (2S,5R)-2-(5-((((ls,3R)-3-aminocyclobutyl)amino)methyl)-l,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 756) and (2S,5R)-2-(5-((((lr S)-3-aminocyclobutyl)amino)methyl)-l ,4-oxadiazol-2-yl)-7-oxo- 6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 757)
Figure imgf000131_0002
Figure imgf000132_0001
Figure imgf000132_0002
(2S,5R)-2-(5-((((ls,3R)-3-aminocyclobutyl)amino)methyl)-l ,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (Compound 756): ESI-MS (Ε , m/z): 389.2. *H NMR (300 MHz, D20) δ 4.75 (d, / = 6.5 Hz, 1H), 4.15 (br s, 1H), 3.91 (s, 2H), 3.85 - 3.60 (m, 1H), 3.60 - 3.35 (m, 1H), 3.31 - 3.04 (m, 1H), 2.86 (d, / = 12.2 Hz, 1H), 2.36 - 2.02 (m, 7H), 1.99 - 1.83 (m, 1H).
(2S,5R)-2-(5-((((lr,3S)-3-aminocyclobutyl)amino)methyl)-l,3,4-oxadiazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1]octan-6-yl hydrogen sulfate (Compound 757). ESI-MS (Ef , m/z): 389.2. *H NMR (300 MHz, D20, as formate salt) δ 8.30 (s, 1H), 4.76 (d, / = 6.5 Hz, 1H), 4.16 (br s, 1H), 4.01 (s, 2H), 3.44 (dt, / = 16.1, 8.0 Hz, 1H), 3.23 - 3.07 (m, 2H), 2.86 (d, / = 12.2 Hz, 1H), 2.65 - 2.47 (m, 2H), 2.33 - 2.03 (m, 3H), 1.98 - 1.76 (m, 3H)
Example 58: Synthesis of (2S,5R)-7-oxo-2-(5-(((R)-pyrrolidin-3-ylamino)methyl)-L3,4- oxadiazol-2-yl)-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 766)
Figure imgf000132_0003
Figure imgf000133_0001
80% for 2 steps
Figure imgf000133_0002
ESI-MS (EI+, m/z): 389.1.1H NMR (300 MHz, D20) δ 4.77 (d, /= 6.5 Hz, 1H), 4.17 (br s, 1H), 4.03 (s, 2H), 3.60 - 3.45 (m, 1H), 3.36 (dd,/= 12.5, 6.0 Hz, 2H), 3.29 - 3.12 (m, 2H), 3.06 (dd,/= 12.2, 4.4 Hz, 1H), 2.89 (d,/= 12.2 Hz, 1H), 2.32 - 2.07 (m, 5H), 1.99-1.75 (m, 1H).
Example 59: Synthesis of (2S,5R)-7-oxo-2-(5-(((S)-pyrrolidin-3-ylamino)methyl)-l,3A- oxadiaz.ol-2- l)-l,6-diaz.abic clo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 765)
Figure imgf000133_0003
- NH * °
Figure imgf000134_0001
rt, 17 h BBooccNN'- g0%
Boc ' 82% for 2 steps
Figure imgf000134_0002
ESI-MS (EI+, m/zY 389.2. Ή NMR (300 MHz, D20) δ 4.75 (d, J = 6.5 Hz, 1H), 4.12 (br s, 1H), 3.98 (s, 2H), 3.54 - 3.41 (m, 1H), 3.39 - 3.26 (m, 2H), 3.27 - 3.06 (m, 2H), 3.01 (dd, / = 12.3, 5.1 Hz, 1H), 2.84 (d, / = 12.3 Hz, 1H), 2.29 - 1.97 (m, 4H), 1.98 - 1.61 (m, 2H).
Example 60: Synthesis of (2S,5R)-2-(5-((2SAS)-4-aminopyrrolidin-2-yl)-l A-oxadiazol-2- yl)-7-oxo-l,6-diazabicyclof3.2.1 loctan-6-yI hydrogen sulfate (Compound 760)
Figure imgf000134_0003
I SOCI2, MeOH H°'"-, \ J? TEA, Boc20 H0--^\ P~
~N OH rt 20 h N O— CH2CI2, rt, 12 h N O CH2CI2, 0 °C, 3 h
H ' H Boc
92% 95%
Figure imgf000135_0001
ESI-MS (EI+, m/z) 375.2. 1H NMR (300 MHz, D20) δ 4.76 (d, / = 6.7 Hz, 1H), 4.65 - 4.55 (m, 1H), 4.18 (br s, 1H), 3.93 - 3.80 (m, 1H), 3.40 - 3.28 (m, 1H), 3.24 - 3.13 (m, 1H), 2.96 - 2.83 (m, 2H), 2.75 (dd, / = 14.6, 7.9 Hz, 1H), 2.34 - 1.82 (m, 5H).
Example 61: Synthesis of (2S,5R)-2-(5-((2S,4R)-4-aminopyrrolidin-2-yl)-l,3,4-oxadiazol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 762)
Figure imgf000135_0002
Figure imgf000136_0001
ESI-MS (EI , m/z) 375.3.
Example 62: Synthesis of(2S,5R)-2-(5-((2R,4S)-4-aminopyrrolidin-2-yl)-l,3,4-oxadiazol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 763)
Figure imgf000136_0002
ESI-MS (EI+, m/z): 375.3.
Example 63: Synthesis of(2S,5R)-2-(5-((2R,4R)-4-aminopyrrolidin-2-yl)-l,3,4-oxadiaz.ol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 761)
Figure imgf000137_0001
ESI-MS (EI , m/z): 375.2. H NMR (300 MHz, D20) δ 4.75 (d, /= 6.5 Hz, 1H), 4.59 (t, / = 7.7 Hz, lH),4.16(brs, 1H), 3.92 - 3.78 (m, 1H), 3.32 (dd,/= 11.9, 7.2 Hz, 1H), 3.22-3.09 (m, 1H), 2.96 - 2.84 (m, 2H), 2.73 (dt, /= 15.8, 8.3 Hz, 1H), 2.33 - 1.76 (m, 5H).
Example 64: Synthesis of (2S,5R)-7-oxo-2-(5-((piperidin-4-ylamino)methyl)-l,3,4-oxadiazol- -yl)-l ,6-diazabic clo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 769)
Figure imgf000137_0002
Figure imgf000138_0001
ESI-MS (EI+, m/z): 403.1. 1H NMR (300 MHz, D20) δ 4.81 (d, / = 6.5 Hz, 1H), 4.40 (s, 2H), 4.19 (br s, 1H), 3.55 - 3.41 (m, 2H), 3.34 - 3.23 (m, 1H), 3.20 (br d, / = 13.2 Hz, 1H), 3.01 - 2.94 (m, 2H), 2.91 (d, / = 12.3 Hz, 1H), 2.38 - 2.07 (m, 5H), 2.03 - 1.85 (m, 1H), 1.79 - 1.58 (m, 2H).
Example 65: Synthesis of (2S,5R)-7-oxo-2-(5-(2-(piperidin-4-ylamino)ethyl)-l,3,4-oxadiazol- 2-yl)-l,6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 770)
Figure imgf000138_0002
Figure imgf000139_0001
ESI-MS (EI+, m/z) 417.2. lU NMR (300 MHz, D20) δ 4.79 (d, / = 6.9 Hz, 1H), 4.20 (br s, 1H), 3.61 - 3.51 (m, 5H), 3.38 (t, / = 7.0 Hz, 2H), 3.21 (br d, / = 12.4 Hz, 1H), 3.11 - 3.01 (m, 2H), 2.97 (d, / = 12.3 Hz, 1H), 2.39 - 2.10 (m, 5H), 2.01 - 1.76 (m, 3H).
Example 66: Synthesis of (2S,5R)-7-oxo-2-(5-(3-(piperidin-4-ylamino)propyl)-l ,3,4- oxadiazol-2-yl)-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 771)
Figure imgf000139_0002
Figure imgf000140_0001
ESI-MS (EI+, m/z): 431.1. 'I! NMR (300 MHz, D20, as formate salt) δ 8.34 (s, 1H), 4.74 (d, J = 6.5 Hz, 1H), 4.17 (br s, 1H), 3.71 - 3.21 (m, 3H), 3.23 - 2.69 (m, 8H), 2.34 - 2.06 (m, 7H), 2.02 - 1.59 (m, 3H).
Example 67: Synthesis of(2S,5R)-7-oxo-2-(5-(4-(piperidin-4-ylamino)butyl)-l,3A-oxadiaz.ol- -yl)-l ,6-diazabic clo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 772)
Figure imgf000140_0002
Figure imgf000141_0001
ESI-MS (EI+, m/z): 445.3. 1H NMR (300 MHz, D20, as formate salt) δ 8.28 (s, 1H), 4.72 (d, / = 6.5 Hz, 1H), 4.12 (br s, 1H), 3.50 - 3.24 (m, 3H), 3.11 (d, / = 13.6 Hz, 1H), 3.06 - 2.72 (m, 7H), 2.35 - 2.00 (m, 5H), 1.97 - 1.51 (m, 7H).
Example 68 : Synthesis of(2S,5R)-7-oxo-2-(5-(2-(piperazin-l-yl)ethyl)-l,3,4-oxadiazol-2-yl)- -diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 776)
Figure imgf000141_0002
Figure imgf000142_0001
1
ESI-MS (EI , m/z): 403.2. H NMR (300 MHz, D20) δ 4.75 (d, / = 6.4 Hz, 1H), 4.16 (br s, 1H), 3.21 - 3.02 (m, 6H), 2.96 - 2.83 (m, 4H), 2.71 (br s, 4H), 2.32 - 2.03 (m, 3H), 1.96-1.84 (m, 1H).
Example 69: Syntehsis of(2S,5R)-7-oxo-2-(5-((R)-piperazin-2-yl)-l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 779)
Figure imgf000142_0002
Figure imgf000143_0001
ESI-MS (EI+, m/z): 375.3. 1H NMR (300 MHz, D20) δ 4.81 (d, / = 6.5 Hz, IH), 4.57 (dd, 7 = 8.8, 3.5 Hz, IH), 4.19 (br s, IH), 3.65 (dd, 7 = 13.0, 3.4 Hz, IH), 3.46 - 2.98 (m, 6H), 2.92 (d, J = 12.4 Hz, IH), 2.34 - 2.05 (m, 3H), 2.02 - 1.82 (m, IH).
Example 70: Syntehsis of (2S,5R)-7-oxo-2-(5-((S)-piperaz.in-2-yl)-l,3,4-oxadiazol-2-yl)-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 778)
Figure imgf000143_0002
ESI-MS (EI+, m/z): 375.3. Example 71: Synthesis of (2S,5R)-2-(5-(4-aminopiperidin-l -yl)-l ,3,4-oxadiazol-2-yl)-7-oxo- l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 773)
Figure imgf000144_0001
ESI-MS (EI+, m/z): 389.1. 1H NMR (300 MHz, D20) δ 4.61 (d, / = 6.4 Hz, 1H), 4.17 (br s, 1H), 3.96 (d, / = 13.5 Hz, 2H), 3.52 - 3.36 (m, 1H), 3.26 - 3.06 (m, 3H), 2.97 (d, / = 12.2 Hz, 1H), 2.31 - 1.83 (m, 6H), 1.80 - 1.45 (m, 2H). Example 72: Synthesis of (2S,5R)-2-( 5-(2-(4-aminopiperidin-l -yl)ethyl)-l ,3 ,4-oxadiazol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 775)
Figure imgf000144_0002
Figure imgf000145_0001
ESI-MS (EI+, m/z): ll .2. lU NMR (300 MHz, D20, as formate salt) δ 8.31 (s, 1H), 4.74 (d, J = 6.1 Hz, 1H), 4.16 (br s, 1H), 3.78 - 3.55 (m, 4H), 3.55 - 3.32 (m, 3H), 3.25 - 3.04 (m, 3H), 2.90 (d, / = 12.2 Hz, 1H), 2.32 - 2.04 (m, 5H), 1.97 - 1.75 (m, 3H).
Example 73: Synthesis of(2S,5R)-2-(5-((3-guanidinocyclobutyl)methyl)-l,3,4-oxadiazol-2- -7 -oxo-1 ,6-diazabicyclot 3.2.1 loctan-6-yl hydrogen sulfate (Compound 752)
Figure imgf000145_0002
ESI-MS (EI+, m/z): 416.2.
Example 74: Synthesis of (2S,5R)-2-(5-(2-((lr,3R)-3-aminocyclobutyl)ethyl)-l,3,4-oxadiazol- ]octan-6-yl hydrogen sulfate (Compound 753)
Figure imgf000146_0001
ESI-MS (EI+, m/z): 388.3. 1H NMR (300 MHz, D20) δ 4.74 (d, / = 6.5 Hz, 1H), 4.15 (br s, 1H), 3.81 - 3.69 (m, 1H), 3.20 - 3.08 (m, 1H), 2.92 - 2.72 (m, 3H), 2.43 - 1.75 (m, 11H). Example 75: Synthesis of (2S,5R)-2-(5-(( 1 s,4R)-4-aminocyclohexyl)-l ,3,4-oxadiaz.ol-2-yl)-7- oxo-l,6-diazabicyclol 3.2.1 loctan-6-yl hydrogen sulfate (Compound 780)
Figure imgf000146_0002
Figure imgf000147_0001
ESI-MS (ΕΓ, m/z): 388.2.
Example 76: Synthesis of (2S,5R)-2-(5-((lr,4S)-4-aminocyclohexyl)-l,3,4-oxadiazol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound
781)
Figure imgf000147_0002
ESI-MS (EI+, m/z): 388.2. 1H NMR (300 MHz, D20) δ 4.72 (d, / = 6.6 Hz, 1H), 4.15 (br s, 1H), 3.24 - 3.03 (m, 3H), 3.01 - 2.89 (m, 1H), 2.86 (d, / = 12.3 Hz, 1H), 2.30 - 1.98 (m, 4H), 1.98 - 1.79 (m, 1H), 1.69 - 1.37 (m, 4H), 1.32 - 1.10 (m, 2H). Example 77: Synthesis of (2S,5R)-2-(5-guanidino-l,3,4-ox diazol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 738)
Figure imgf000148_0001
Figure imgf000148_0002
ESI-MS (EI+, m/z): 348.1. 1H NMR (300 MHz, D20) δ 4.60 (d, / = 6.6 Hz, 1H), 4.15 (br s, 1H), 3.20 - 3.10 (m, 1H), 2.97 (d, / = 12.3 Hz, 1H), 2.27 - 1.85 (m, 4H).
Example 78: Synthesis of (2S,5R)-2-(5-(2-((2-hydroxyethyl)amino)ethyl)-L3,4-oxadiaz.ol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 736)
Figure imgf000148_0003
Figure imgf000149_0001
ESI-MS (EI+, m/z): 378.2.
Example 79: (2S,5R)-2-(5-(3-(methylamino)propyl)-l,3,4-oxadiaz.ol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 734)
Figure imgf000149_0002
Figure imgf000150_0001
ESI-MS (EI+, m/z): 362.2. lH NMR (300 MHz, D20) δ 4.73 (d, / = 6.5 Hz, 1H), 4.15 (br s, 1H), 3.15 (br d, / = 12.1 Hz, 1H), 3.08 - 2.99 (m, 2H), 2.96 (t, 7 = 7.5 Hz, 2H), 2.87 (d, J = 12.3 Hz, 1H), 2.61 (s, 3H), 2.32 - 2.02 (m, 5H), 1.99 - 1.78 (m, 1H).
Example 80: Synthesis of(2S,5R)-2-(5-(guanidinomethyl)-l,3A-thiadiaz.ol-2-yl)-7-oxo-l,6- diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 721)
Figure imgf000150_0002
ESI-MS (EI+, m/z): 378.1.
Example 81: Synthesis of(2S,5R)-2-(5-(2-aminoethyl)-l,3,4-thiadiaz.ol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 718)
Figure imgf000151_0001
ESI-MS (EI , m/z): 350.1. H NMR (300 MHz, D20) δ 4.89 (d, / = 6.3 Hz, 1H), 4.14 (br s, 1H), 3.50 - 3.35 (m, 4H), 3.14 (br d, / = 12.2 Hz, 1H), 2.90 (d, / = 12.2 Hz, 1H), 2.50 - 2.38 (m, 1H), 2.20 - 2.05 (m, 2H), 1.90 - 1.80 (m, 1H).
Example 82: Synthesis of(2S,5R)-2-(5-(2-guanidinoethyl)-l,3A-thiadiaz.ol-2-yl)-7-oxo-l,6- diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 794)
Figure imgf000151_0002
Figure imgf000152_0001
ESI-MS (EI+, m/z): 392.1. lU NMR (300 MHz, D20) δ 4.89 (d, / = 6.7 Hz, 1H), 4.14 (br s, 1H), 3.57 (t, / = 6.3 Hz, 2H), 3.34 (t, / = 6.3 Hz, 2H), 3.14 (br d, / = 12.2 Hz, 1H), 2.84 (d, / = 12.2 Hz, 1H), 2.46 - 2.40 (m, 1H), 2.20 - 2.05 (m, 2H), 1.92 - 1.80 (m, 1H).
Example 83: Synthesis of (2S 5R)-2-(5-((lr.3S)-3-aminocyclobutyl)-1.3A-thiadiazol-2-yl)-7- oxo-l,6-diaz.abicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Com ound 783)
Figure imgf000152_0002
ESI-MS (EI+, m/z): 376.3. lU NMR (300 MHz, D20) δ 4.90 (d, / = 6.6 Hz, 1H), 4.15 - 4.00 (m, 3H), 3.15 (br d, / = 12.2 Hz, 1H), 2.90 (d, / = 12.4 Hz, 1H), 2.74 - 2.69 (m, 4H), 2.48 - 2.40 (m, 1H), 2.19 - 2.10 (m, 2H), 1.93 - 1.82 (m, 1H). Example 84: Synthesis of (2S,5R)-2-(5-((l s,3R)-3-aminocyclobutyl)-l ,3,4-thiadiaz.ol-2-yl)-7- oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 795)
Figure imgf000153_0001
ESI-MS (EI+, m/z): 376.0. 1H NMR (300 MHz, D20 with a few drops of DMSO-d6) δ 4.87 (d, / = 6.0 Hz, 1H), 4.14 (br s, 1H), 3.90 - 3.82 (m, 2H), 3.14 (d, / = 11.4 Hz, 1H), 2.92 - 2.89 (m, 3H), 2.55 - 2.37 (m, 3H), 2.20 - 2.14 (m, 2H), 1.93 - 1.88 (m, 1H).
Example 85: Synthesis of (2S,5R)-2-(5-((ls,3R)-3-guanidinocyclobutyl)-l,3,4-thiadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 784)
Figure imgf000153_0002
Figure imgf000154_0001
ESI-MS (EI+, m/z) 418. lU NMR (300 MHz, DMSO-d6) δ 8.08 (br s, 1H), 7.13 (br s, 4H), 4.78 (d, / = 6.4 Hz, 1H), 4.09 - 4.01 (m, 2H), 3.70 - 3.62 (m, 1H), 2.95 - 2.88 (m, 2H), 2.70 (d, / = 11.9 Hz, 1H), 2.58 - 2.40 (m, 2H), 2.37 - 2.26 (m, 2H), 2.10 - 1.90 (m, 2H), 1.82 - 1.70 (m, 1H).
Example 86: Synthesis of ( 25, 5R)-2-( 5-((l r,3S)-3-guanidinocyclobutyl)-l,3,4-thiadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 785)
Figure imgf000154_0002
ESI-MS (EI+, m/z): 418.4. 1H NMR (300 MHz, D20) δ 4.87 (d, / = 14.3 Hz, 1H), 4.27 - 4.12 (m, 2H), 4.09 - 3.94 (m, 1H), 3.21 - 3.10 (m, 1H), 2.91 (d, / = 12.3 Hz, 1H), 2.78 - 2.52 (m, 4H), 2.50 - 2.38 (m, 1H), 2.22 - 2.04 (m, 2H), 1.96 - 1.81 (m, 1H). 5 Example 87: Synthesis of (2S,5R)-2-(5-( 1 -methylpyridin-1 -ium-4-yl)-l ,3,4-thiadiazol-2-yl)-7-
Figure imgf000155_0001
ESI-MS (ΕΓ, m/z):. 396.0.
The compounds described in Examples 88-98 were prepared followin2 similar chemistry and procedures of Examples 1-87.
Example 88: Synthesis of (2S,5R)-2-( 5-( 1 ,1 -dimethylpiperidin-1 -ium-4-yl)-l ,3,4-thiadiazol-2- -7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl sulfate (Compound 796)
Figure imgf000155_0002
ESI-MS (ΕΓ, m/z): 416.1.
Example 89: Synthesis of (2S,5R)-2-( 5-( 3-(azetidin-3-ylamino)propyl)-l ,3 ,4-oxadiazol-2-yl)- 7-oxo-l, 6-diazabicyclol 3.2. l loctan-6-yl hydrogen sulfate ( Compound 793)
Figure imgf000155_0003
ESI-MS (EI+, m/z): 403.3.
Example 90: Synthesis of(2S,5R)-7-oxo-2-(5-(3-(piperazin-l-yl)propyl)-l,3,4-oxadiazol-2- yl)-l ,6-diazabicyclof 3.2.1 loctan-6-yl hydrogen sulfate (Compound 792)
Figure imgf000156_0001
ESI-MS (EI+, m/z) 417.2. lU NMR (300 MHz, D20) δ 4.73 (d, / = 7.6 Hz, 1H), 4.16 (br s, 1H), 3.51 - 3.35 (m, 4H), 3.28 (brs, 4H), 3.22 - 3.12 (m, 1H), 3.12 - 2.84 (m, 5H), 2.34 - 2.03 (m, 5H), 2.02 - 1.82 (m, 1H).
Example 91: Synthesis of(2S,5R)-2-(5-(6-aminospiro[3.3]heptan-2-yl)-l,3,4-oxadiazol-2- yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 787)
Figure imgf000156_0002
ESI-MS (EI+, m/z): 400.0.
Example 92: Synthesis of (2S,5R)-2-( 5-(7-az.aspirof 3.5lnonan-2-yl)-l,3,4-oxadiazol-2-yl)-7-
Figure imgf000156_0003
ESI-MS (EI+, m/z): 414.0.
Example 93: Synthesis of (2S,5R)-2-( 5-( ( ( 3-aminocyclobutyl)amino )methyl)-l,3,4-oxadiazol- -yl)-7-oxo-L6-diaz.abicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 755)
Figure imgf000156_0004
ESI-MS (EI+, m/z): 389.4
Example 94: Synthesis of(2S,5R)-2-(5-(((ls,3R)-3-aminocyclobutoxy)methyl)-l,3,4- oxadiazol-2-yl)-7-oxo-l,6-diazabicyclo[3.2.1 loctan-6-yl hydrogen sulfate (Compound 789)
Figure imgf000157_0001
ESI-MS (ΕΙ+, m/z): 390.1.
Example 95: Synth esis of ( 25, 7? )- 7-οχο-2-ί5-ί f 5' )-pyrrolidin-3-ylmethyl )-l,3, 4-oxadiazol-2 - -l,6-diazabicyclol3.2.1 loctan-6-yl hydrogen sulfate (Compound 790)
Figure imgf000157_0002
ESI-MS (EI+, m/z): 374.2.
Example 96: Synthesis of (2S,5R)-7-oxo-2-(5-((R)-pyrrolidin-3-ylmethyl)-L3,4-oxadiaz.ol-2- -l ,6-diazabicyclo[ 3.2.1 loctan-6-yl hydrogen sulfate (Compound 791)
Figure imgf000157_0003
ESI-MS (EI+, m/z): 374.3.
Example 97: Synthesis of (2S,5R)-7-oxo-2-(5-(piperazin-l-yl)-l,3,4-thiadiazol-2-yl)-l,6- diazabicyclo 13.2.1 loctan-6-yl hydrogen sulfate (Compound 797)
Figure imgf000157_0004
ESI-MS (EI+, m/z) 391.1.
Example 98: Synthesis of (2S,5R)-7-oxo-2-(5-(pyridin-4-yl)-L3,4-thiadiaz.ol-2-yl)-L6- diazabicyclo [3.2.1 loctan-6-yl hydrogen sulfate (Compound 798)
Figure imgf000158_0001
ESI-MS (ΕΓ, m/z) . 382.0.
Example 99: Construction of Isogenic ^-lactamase strains
A set of β-lactamase expressing isogenic E. coli strains was constructed by cloning a β-lactamase gene into a customized derivative of pBR322 (GenBank Accession Number JO 1749) and transforming the engineered plasmids into E. coli. The Ndel restriction site within the plasmid backbone of pBR322 was removed to generate pBR322 ANdel. The pBR322 ANdel vector itself, minus the WaTEM-1 gene, was amplified using two primers: (1) pBR-Pbla 5 ' -cgcatatgactcttcctttttcaatattattg-3 , SEQ ID 1, a primer with an engineered Ndel restriction site at the 3' end of the WaTEM-1 promoter and (2) pBR-vec-1 5'- gcggatccctgtcagaccaagtttactc-3 ' , SEQ ID 2, a primer with an engineered BamHl restriction site at the 3' end of the WaTEM-1 open reading frame. The chloramphenicol resistance gene, cat, was generated by PCR amplification from pKD3 (GenBank Accession Number
AY048742) using primers with an engineered Ndel restriction site at the 5 ' end (Pb la-cat 5'- gccatatgatggagaaaaaaatcactgg-3 ' , SEQ ID 3) and an engineered BamHl restriction site at the 3' end ( Vec- 1 -cat 5 ' -cgggatccctagagaataggaacttcgg-3 ' , SEQ ID 4)of the resistance gene. The two PCR products, pBR322 ANdel and cat were ligated together generating pBR-CBST (pBR322 ANdel ATEM-l wcat Seq. ID 5) which retains both the pBR322 tetracycline resistance cassette, tetA, and the plasmid origin of replication but the WaTEM-1 gene was replaced by the cat gene.
Using this engineering strategy a number of plasmids producing β-lactamase genes from different classes (see below) were generated using synthetic genes with an engineered Ndel restriction site at the 5 ' end and BamHl restriction site at the 3 ' end of each gene (GenScript). Both the synthetic β-lactamase genes and cat gene were ligated into the
NdeUBamHl sites of the pBR322 ANdel PCR product and transformed into electrocompetent E. coli ElectroMax DH10B (Invitrogen/Life Technologies). E. coli DH10B harboring the recombinant plasmids were selected on LB agar (supplemented with 25 μg/mL tetracycline) and single isolated colonies were then inoculated into 5 mL LB media (supplemented with 25 μg/mL tetracycline), and incubated at 37°C with aeration (250 rpm) for 18 hrs. The cultures were frozen back at -80°C in 20% glycerol. The DNA sequence of the cloned β- lactamase genes was confirmed. The β-lactamase gene expression in the recombinant E. coli strains was driven by the blaTEM-l promoter in the pBR-CBST plasmid and was characterized by MIC profiling of the E. coli recombinant strains against comparator β- lactam/BLI combinations in broth microdilution assay.
Figure imgf000159_0001
Nucleotide Sequences of pBR-CBST Plasmids (Containing β-Lactamase or cat Genes) Used in the E. coli Isogenic Strains (relevant restriction sites are underlined; β-lactamase sequences in all caps, tetA sequence is in italics) pBR-CBST-cat SEQ ID 5
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGAGAAAAAAATCACTGGATATACCACCGTTGATATAT CCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTAC CTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAA AATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGC TCATACGGAATTTCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAG TGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCT GGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGT GGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATG TTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGC CAATATGGACAACTTCTTCGCCCCCGTTTTCACTATGGGCAAATATTATACGCAA GGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATG GCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCA GGGCGGGGCGTAAGTGGCAGGGCGGGGCGTAAGGCGCGCCATTTAAATGAAGTT CCTATTCCGAAGTTCCTATTCTCTAGggatccctgtcagaccaagtttactcatatatactttagattgatttaaaa cttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttc tagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgc cagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttc gtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccg aagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaa acgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataa ccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaa gagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgc atagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccct gacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatca ccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagct cgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccg tgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcc cggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcg cttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgac ttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttc acgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgat catgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttct gccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgcc ggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgccta caatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggct ggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatc ccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagccc agcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcg agggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgac ccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgc ccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcag cccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtc ggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacg ggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcgga cagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtc ggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccg aggfligflcgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttat cgatgataagctgtcaaacatgagaa pBR-CBST-KPC-2 SEP ID 6
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCA TGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGACCAACCTCGTCGCGGAACCAT TCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATAC CGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCC ACTGTGCAG CTCATTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCC GGCTTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCCGTGGTCAC CCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGG CCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGG CGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGT CTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGAT ACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCT GCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACG ACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGAC AAAACCGGAACCTGCGGAGTGTATGGCACGGCAAATGACTATGCCGTCGTCTGG CCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGG ATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCTAGACTCGCGCTCGAGG GATTGGGCGTCAACGGGCAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcgg tggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgc acacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gflcgaigflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-CTX-M-15 SEP ID 7
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCT GACCTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCAC TGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATA AGCTGATTGCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCT GGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCAT TCCGGGCGATCCGCGTGATACCACTTCACCTCGGGCAATGGCGCAAACTCTGCGG AATCTGACGCTGGGTAAAGCATTGGGCGACAGCCAACGGGCGCAGCTGGTGACA TGGATGAAAGGCAATACCACCGGTGCAGCGAGCATTCAGGCTGGACTGCCTGCT TCCTGGGTTGTGGGGGATAAAACCGGCAGCGGTGGCTATGGCACCACCAACGAT ATCGCGGTGATCTGGCCAAAAGATCGTGCGCCGCTGATTCTGGTCACTTACTTCA CCCAGCCTCAACCTAAGGCAGAAAGCCGTCGCGATGTATTAGCGTCGGCGGCTA AAATCGTCACCGACGGTTTGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttca tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacc ccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggt ggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtg gcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-SHV-12 SEP ID 8
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGCGTTATATTCGCCTGTGTATTATCTCCCTGTTAGCCACC CTGCCGCTGGCGGTACACGCCAGCCCGCAGCCGCTTGAGCAAATTAAACAAAGC GAAAGCCAGCTGTCGGGCCGCGTAGGCATGATAGAAATGGATCTGGCCAGCGGC CGCACGCTGACCGCCTGGCGCGCCGATGAACGCTTTCCCATGATGAGCACCTTTA AAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGC TGGAGCGAAAGATCCACTATCGCCAGCAGGATCTGGTGGACTACTCGCCGGTCA GCGAAAAACACCTTGCCGACGGCATGACGGTCGGCGAACTCTGCGCCGCCGCCA TTACCATGAGCGATAACAGCGCCGCCAATCTGCTGCTGGCCACCGTCGGCGGCCC CGCAGGATTGACTGCCTTTTTGCGCCAGATCGGCGACAACGTCACCCGCCTTGAC CGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACT ACCCCGGCCAGCATGGCCGCGACCCTGCGCAAGCTGCTGACCAGCCAGCGTCTG AGCGCCCGTTCGCAACGGCAGCTGCTGCAGTGGATGGTGGACGATCGGGTCGCC GGACCGTTGATCCGCTCCGTGCTGCCGGCGGGCTGGTTTATCGCCGATAAGACCG GAGCTAGCAAGCGGGGTGCGCGCGGGATTGTCGCCCTGCTTGGCCCGAATAACA AAGCAGAGCGCATTGTGGTGATTTATCTGCGGGATACCCCGGCGAGCATGGCCG AGCGAAATCAGCA AATCGCCGGGATCGGCGCGGCGCTGATCGAGCACTGGCAAC GCTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaa ctctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaa ctctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggac tcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacct acaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaag cggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacct ctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgg ccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgct cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatct gtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacg tgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacag acaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctc atcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttc tgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgata ccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactg gcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggt agccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaa ccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgcta accagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgct gcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctc cgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccaticflggicgflggiggcccggcic catgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgc cgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctg tccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcat aatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatg gcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagc gacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgag ttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaagg ctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcacc gccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccg aaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacct gtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatgatcgcgtagtcgata gtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcataga aattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggccc ggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttca iacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaa pBR-CBST-P99 SEP ID 9
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGATGAGAAAATCCCTTTGCTGCGCCCTGCTGCTCGGCAT CTCTTGCTCTGCTCTCGCCACGCCAGTGTCAGAAAAACAGCTGGCGGAGGTGGTC GCGAATACGATTACCCCGCTGATGAAAGCCCAGTCTGTTCCAGGCATGGCGGTG GCCGTTATTTATCAGGGAAAACCGCACTATTACACATTTGGCAAGGCCGATATCG CGGCGAATAAACCCGTTACGCCTCAGACCCTGTTCGAGCTGGGTTCTATAAGTAA AACCTTCACCGGCGTTTTAGGTGGGGATGCCATTGCTCGCGGTGAAATTTCGCTG GACGATGCGGTGACCAGATACTGGCCACAGCTGACGGGCAAGCAGTGGCAGGGT ATTCGTATGCTGGATCTCGCCACCTACACCGCTGGCGGCCTGCCGCTACAGGTAC CGGATGAGGTCACGGATAACGCCTCCCTGCTGCGCTTTTATCAAAACTGGCAGCC GCAGTGGAAGCCTGGCACAACGCGTCTTTACGCCAACGCCAGCATCGGTCTTTTT GGTGCGCTGGCGGTCAAACCTTCTGGCATGCCCTATGAGCAGGCCATGACGACG CGGGTCCTTAAGCCGCTCAAGCTGGACCATACCTGGATTAACGTGCCGAAAGCG GAAGAGGCGCATTACGCCTGGGGCTATCGTGACGGTAAAGCGGTGCGCGTTTCG CCGGGTATGCTGGATGCACAAGCCTATGGCGTGAAAACCAACGTGCAGGATATG GCGAACTGGGTCATGGCAAACATGGCGCCGGAGAACGTTGCTGATGCCTCACTT AAGCAGGGCATCGCGCTGGCGCAGTCGCGCTACTGGCGTATCGGGTCAATGTAT CAGGGTCTGGGCTGGGAGATGCTCAACTGGCCCGTGGAGGCCAACACGGTGGTC GAGGGCAGCGACAGTAAGGTAGCACTGGCGCCGTTGCCCGTGGCAGAAGTGAAT CCACCGGCTCCCCCGGTCAAAGCGTCCTGGGTCCATAAAACGGGCTCTACTGGCG GGTTTGGCAGCTACGTGGCCTTTATTCCTGAAAAGCAGATCGGTATTGTGATGCT CGCGAATACAAGCTATCCGAACCCGGCACGCGTTGAGGCGGCATACCATATCCT CGAGGCGCTACAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaa aggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaa gatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgcc ggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcg tgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccag cttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcg gacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtc ctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgc ggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgccttt gagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcg gtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat acactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgc tcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgag gcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccag aagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttct gttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgtt gtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatg taggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagact ttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtat cggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtgg ccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggttt gcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattoflggi cgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaa cccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcg agcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccgga agcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgc catgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagatt ccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccg gcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggag ctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttg aggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgcca ccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgc cagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatg atcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaa cgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatc ccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagc gcaiigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtca aacatgagaa pBR-CBST-OXA-15 SEP ID 10
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGGCAATCCGAATCTTCGCGATACTTTTCTCCATTTTTTCT CTTGCCACTTTCGCGCATGCGCAAGAAGGCACGCTAGAACGTTCTGACTGGAGG AAGTTTTTCAGCGAATTTCAAGCCAAAGGCACGATAGTTGTGGCAGACGAACGC CAAGCGGATCGTGCCATGTTGGTTTTTGATCCTGTGCGATCGAAGAAACGCTACT CGCCTGCATCGACATTCAAGATACCTCATACACTTTTTGCACTTGATGCAGGCGC TGTTCGTGATGAGTTCCAGATTTTTCGATGGGACGGCGTTAACAGGGGCTTTGCA GGCCACAATCAAGACCAAGATTTGCGATCAGCAATGCGGAATTCTACTGTTTGGG TGTATGAGCTATTTGCAAAGGAAATTGGTGATGACAAAGCTCGGCGCTATTTGAA GAAAATCGACTATGGCAACGCCGGTCCTTCGACAAGTAATGGCGATTACTGGAT AGAAGGCAGCCTTGCAATCTCGGCGCAGGAGCAAATTGCATTTCTCAGGAAGCT CTATCGTAACGAGCTGCCCTTTCGGGTAGAACATCAGCGCTTGGTCAAGGATCTC ATGATTGTGGAAGCCGGTCGCAACTGGATACTGCGTGCAAAGACGGGCTGGGAA GGCCGTATGGGTTGGTGGGTAGGATGGGTTGAGTGGCCGACTGGCTCCGTATTCT TCGCACTGAATATTGATACGCCAAACAGAATGGATGATCTTTTCAAGAGGGAGG CAATCGTGCGGGCAATCCTTCGCTCTATTGAAGCGTTACCGCCCAACCCGGCAGT CAACTCGGACGCTGCGCGATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcat ttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacc ccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggt ggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtg gcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcg atgataagctgtcaaacatgagaa pBR-CBST-KPC-4 SEQ ID 11
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCA TGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGACCAACCTCGTCGCGGAACCAT TCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATAC CGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAG CTCATTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCC GGCTTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCGGTGGTCAC CCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGG CCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGG CGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGT CTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGAT ACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCT GCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACG ACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGAC AAAACCGGAACCTGCGGAGGGTATGGCACGGCAAATGACTATGCCGTCGTCTGG CCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGG ATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCT AGACTCGCGCTCGAGG GATTGGGCGTCAACGGGCAGTAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcgg tggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgc acacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggt atctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgc cagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgta ttaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcg cctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagtta agccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgg gcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttga gtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaag ggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggtta ctggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgtt aatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgc gtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttc gctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgc gcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgcca agggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggctt cc&itcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaat ccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggta agagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccga tgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcg cgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgaggg cgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccag agcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccac cggaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagccca gtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtg tggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagt gctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaa tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gacgfligflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa pBR-CBST-DHA-1 SEQ ID 12
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGAAAAAATCGTTATCTGCAACACTGATTTCCGCTCTGCT GGCGTTTTCCGCCCCGGGGTTTTCTGCCGCTGATAATGTCGCGGCGGTGGTGGAC AGCACCATTAAACCGCTGATGGCACAGCAGGATATTCCCGGGATGGCGGTTGCC GTCTCCGTAAAGGGTAAGCCCTATTATTTCAATTATGGTTTTGCCGATATTCAGGC AAAACAGCCGGTCACTGAAAATACACTATTTGAGCTCGGATCTGTAAGTAAAAC TTTCACAGGTGTGCTGGGTGCGGTTTCTGTGGCGAAAAAAGAGATGGCGCTGAAT GATCCGGCGGCAAAATACCAGCCGGAGCTGGCTCTGCCGCAGTGGAAGGGGATC ACATTGCTGGATCTGGCTACCTATACCGCAGGCGGACTGCCGTTACAGGTGCCGG ATGCGGTAAAAAGCCGTGCGGATCTGCTGAATTTCTATCAGCAGTGGCAGCCGTC CCGGAAACCGGGCGATATGCGTCTGTATGCAAACAGCAGTATCGGCCTGTTTGGT GCTCTGACCGCAAACGCGGCGGGGATGCCGTATGAGCAGTTGCTGACTGCACGC ATCCTGGCACCGCTGGGGTTATCTCACACCTTTATTACTGTGCCGGAAAGTGCGC AAAGCCAGTATGCGTACGGTTATAAAAACAAAAAACCGGTCCGCGTGTCGCCGG GACAGCTTGATGCGGAATCTTACGGCGTGAAATCCGCCTCAAAAGATATGCTGC GCTGGGCGGAAATGAATATGGAGCCGTCACGGGCCGGTAATGCGGATCTGGAAA TGGCAATGTATCTCGCCCAGACCCGCTACTATAAAACCGCCGCGATTAACCAGG GGCTGGGCTGGGAAATGTATGACTGGCCGCAGCAGAAAGATATGATCATTAACG GTGTGACCAACGAGGTCGCATTGCAGCCGCATCCGGTAACAGACAACCAGGTTC AGCCGTATAACCGTGCTTCCTGGGTGCATAAAACGGGCGCAACAACTGGTTTCGG CGCCTATGTCGCCTTTATTCCGGAAAAACAGGTGGCGATTGTGATTCTGGCGAAT AAAAACTACCCGAATACCGAAAGAGTCAAAGCTGCACAGGCTATTTTGAGTGCA CTGGAATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggt gaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaagga tcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagag ctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccact tcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgg gttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga acgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatc cggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggttt cgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacg gttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctg ataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctcctt acgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgcta tcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatcc gcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggt aaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgt ctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatggggg taatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaa acaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttcca cagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacac ggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcatt ctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggaccca acgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcaca gttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccaticflggicgflggiggcc cggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgt gctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttg aagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaag aatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcg ataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccg caagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcct acgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttga gcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccac gccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccg cacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtggtcgccatgatcgcgtagtc gatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgca tagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagag gcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttaga iiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaa pBR-CBST-ADC-33 SEQ ID 13
ttcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaat aatattgaaaaaggaagagtcatATGCGATTTAAAAAAATTTCTTGTCTACTTTTATCCCCGCTT TTTATTTTTAGTACCTCAATTTATGCGGGCAATACACCAAAAGACCAAGAAATTA AAAAACTGGTAGATCAAAACTTTAAACCGTTATTAGAAAAATATGATGTGCCAG GTATGGCTGTGGGTGTTATTCAAAATAATAAAAAGTATGAAATGTATTATGGTCT TCAATCTGTTCAAGATAAAAAAGCCGTAAATAGCAGTACCATTTTTGAGCTAGGT TCTGTCAGTAAATTATTTACCGCGACAGCAGGTGGATATGCAAAAAATAAAGGA AAAATCTCTTTTGACGATACGCCTGGTAAATATTGGAAAGAACTAAAAAACACA CCGATTGACCAAGTTAACTTACTTCAACTCGCGACGTATACAAGTGGTAACCTTG CCTTGCAGTTTCCAGATGAAGTAAAAACAGACCAACAAGTTTTAACTTTTTTCAA AGACTGGAAACCTAAAAACTCAATCGGTGAATACAGACAATATTCAAATCCAAG TATTGGCCTATTTGGAAAGGTTGTGGCTTTGTCTATGAATAAACCTTTCGACCAA GTCTTAGAAAAAACAATTTTTCCGGCCCTTGGCTTAAAACATAGCTATGTAAATG TACCTAAGACCCAGATGCAAAACTATGCATTTGGTTATAACCAAGAAAATCAGC CGATTCGAGTTAACCGCGGCCCACTCGATGCCGCCCCTGCGT ATGGCGTCAAATC GACACTACCCGACATGTTGAGTTTTATTCATGCCAACCTTAACCCACAGAAATAT CCGGCTGATATTCAACGGGCAATTAATGAAACACATCAAGGGCGCTATCAAGTA AATACCATGTATCAGGCACTCGGTTGGGAAGAGTTTTCTTATCCGGCAACGTTAC AAACTTTATTAGACAGTAATTCAGAACAGATTGTGATGAAACCTAATAAAGTGA CTGCTATTTCAAAGGAACCTTCAGTTAAGATGTACCATAAAACTGGCTCAACCAA CGGTTTCGGAACGTATGTAGTGTTTATTCCTAAAGAAAATATTGGCTTAGTCATG TTAACCAATAAACGTATTCCAAATGAAGAGCGCATTAAGGCAGCTTATGCTGTGC TGAATGCAATAAAGAAATAAggatccctgtcagaccaagtttactcatatatactttagattgatttaaaacttcattttt aatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccg tagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt tgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagc cgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacac agcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggag aaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatct ttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccag caacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattac cgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcct gatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatttggtgcactctcagtacaatctgctctgatgccgcatagttaag ccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggct tgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacg cgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtt tctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaaggg ggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttact ggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaa tacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtt tccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgc tcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgc acccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaag ggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttcc attcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatcc atgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaag agccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgc cgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgt cggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgt gcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagag cgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccg gaaggagctgactgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagt agtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacgg ggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcga tataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggattcacaggacgggtgtg gtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtg ctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaat ggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggat gflcgaigflgcgcfliigiiflgfliiicfliacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatg ataagctgtcaaacatgagaa
Example 100: Standard B LI Potentiation MIC Assay
The ability of compounds to potentiate the activity of β-lactams was demonstrated by determining the minimum inhibitory concentrations (MIC) of β-lactam and BLI compound combinations against various β-lactamase producing bacterial strains using the broth microdilution method. The experimental protocol was performed according to Clinical and Laboratory Standards Institute (CLSI) guidelines with modifications as described below (CLSI guidelines can be derived from the CLSI document M07-A9 published in January 2012: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition").
To prepare for MIC testing, frozen glycerol stocks of clinical isolates (Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB). Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned β-lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 μg/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
On the day of testing, primary cultures were started by scraping off 5-10 colonies from the TSAB plates containing clinical strains or the tetracycline supplemented LB plates containing engineered strains. The clinical strain material was suspended in ~5 mL of cation adjusted Mueller Hinton Broth (CAMHB) in 14 mL culture tubes. The engineered strain material was suspended in CAMHB (supplemented with 25 μg/mL tetracycline) in 14 mL culture tubes. All strains were incubated at 37°C with aeration (200 rpm) for ~2 hrs until the optical density at 600 nm (OD600) was >0.1.
The two compound components of the assay were each diluted in CAMHB and added to the 96-well broth microdilution assay plates. 50 μL· of the β-lactam was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 μg/mL. 25 μL· of the BLI compound was added to all wells in the broth microdilution plates at a final concentration of 4 μg/mL. Inoculum cultures were prepared by standardizing the primary cultures to OD600 = 0.1 and then adding 20 μL· of the adjusted primary culture per 1 mL CAMHB for clinical strains or CAMHB (supplemented with tetracycline at 100 μg/mL) for engineered strains, so that the final inoculum density was ~105 colony forming units per milliliter. Diluted inoculum cultures were used to inoculate 25 μL· per well in 96-well broth microdilution assay plates. The final volume of each well was 100 μL· and contained a β- lactam at different concentrations, a BLIcompound at 4 μg/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 μg/mL.
Plates were incubated for 18-20 hours at 37°C with aeration (200 rpm). Following incubation, growth was confirmed visually placing plates over a viewing apparatus (stand with a mirror underneath) and then OD600 was measured using a SpectraMax 340PC384 plate reader (Molecular Devices, Sunnyvale, CA). Growth was defined as turbidity that could be detected with the naked eye or achieving minimum OD600 of 0.1. MIC values were defined as the lowest concentration producing no visible turbidity.
MIC values of representative compounds are shown in Table II.
Example 101: Synergy MIC (sMIC) Assay
The synergy MIC (sMIC) assay determines the concentration of the BLI required to potentiate the activity of a fixed concentration of a β-lactam antibiotic against β-lactamase producing bacterial strains. The experimental protocol was performed according to Clinical and Laboratory Standards Institute (CLSI) guidelines with modifications as described below (CLSI guidelines can be derived from the CLSI document M07-A9 published in January 2012: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition"). The assay is set-up by serially diluting the BLI across 11 of the 12 wells in each row of a 96-well broth microdilution assay plate, adding the β-lactam at a fixed concentration to all wells in the assay plate, inoculating the assay plate with bacterial strains, and determining the lowest concentration of BLI required to inhibit overnight bacterial growth. Bacterial growth in the 12th well of the assay plate, which contains the β-lactam at a fixed concentration but does not contain any BLI, demonstrates that the bacterial strains are resistant to the β-lactam antibiotic (e.g ceftolozane) at the fixed concentration of 4 μg/mL.
To prepare for MIC testing, frozen glycerol stocks of clinical isolates {Klebsiella pneumoniae, Eschericia coli, Enterobacter spp, Citrobacter spp, or Pseudomonas aeruginosa) were used to streak for isolated colonies on rich, non-selective, tryptic soy agar containing 5% sheep's blood (TSAB). Frozen glycerol stocks of laboratory engineered, isogenic E. coli strains, which contain cloned β-lactamase expressing plasmids were used to streak for isolated colonies on rich, selective LB agar supplemented with 25 μg/mL tetracycline to maintain the plasmid. All strains were incubated at 37°C for 18-24 hrs.
On the day of testing, primary cultures were started by scraping off 5-10 colonies from the TSAB plates containing clinical strains or the tetracycline supplemented LB plates containing engineered strains. The clinical strain material was suspended in ~5 mL of cation adjusted Mueller Hinton Broth (CAMHB) in 14 mL culture tubes. The engineered strain material was suspended in CAMHB (supplemented with tetracycline at 25 μg/mL) in 14 mL culture tubes. All strains were incubated at 37°C with aeration (200 rpm) for ~2 hrs until the OD600 was >0.1.
The two compound components of the assay were each prepared in CAMHB and added to the 96-well broth microdilution assay plates. 50 μL· of the BLI was added to each well of the assay plate in 2-fold dilutions with final concentrations ranging from 128 to 0.13 μg/mL. 25 μL· of the β-lactam was added to all wells in the broth microdilution plates at a final concentration of 4 μg/mL. Inoculum cultures were prepared by standardizing the primary cultures to OD600 = 0.1 and then adding 20 μL· of the adjusted primary culture per 1 mL CAMHB for clinical strains or CAMHB (supplemented with tetracycline at 100 μg/mL) for isogenic strains, so that the final inoculum density was ~105 colony forming units per milliliter. Diluted inoculum cultures were used to inoculate 25 μL· per well in 96-well broth microdilution assay plates. The final volume of each well was 100 μL· and contained a BLI at different concentrations, a β-lactam at 4 μg/mL concentration, the bacterial culture at an OD600 of approximately 0.001 and when necessary tetracycline at 25 ug/mL.
Interpreting the sMIC data:
Plates were incubated for 18-20 hours at 37°C with aeration (200 rpm). Following incubation, growth was confirmed visually placing plates over a viewing apparatus (stand with a mirror underneath) and then OD600 was measured using a SpectraMax 340PC384 plate reader (Molecular Devices, Sunnyvale, CA). Growth was defined as turbidity that could be detected with the naked eye or achieving minimum OD600 of 0.1. sMIC values were defined as the lowest concentration producing no visible turbidity.
The sMIC values represent the amount of BLI required to potentiate the activity of 4 μg/ml of CXA-101 (Ceftolozane) or ceftazidime to inhibit the growth of the β-lactamase producing bacteria.
sMIC values of representative compounds are shown inTable III.
Example 102: Inhibition Kinetics
Inhibition or inactivation of KPC-2 by test inhibitors was assessed using 100 μΜ nitrocefin (NCF) as a reporter substrate. Assays were performed in lx PBS pH 7.4, 0.1 mg/ml BSA, in 96-well half area plates, 50 μΐ reaction volume. NCF was dissolved in DMSO and diluted in assay buffer. Test inhibitors were dissolved in water or DMSO and serially diluted in the assay with final concentrations between 2000 - 0.195 μΜ.
The enzyme activity in the presence of varying concentrations of test inhibitor was determined by monitoring the hydrolysis of NCF spectrophotometrically at 486 nm, for 5 minutes, 25 °C, using a SpectraMax Plus384 microplate reader with SoftMax Pro software (Molecular Devices). Data analysis was performed using GraphPad Prism (GraphPad Software, Inc.).
Progress curves were fit to a first-order rate decay equation (Eq. 1) to determine ^observed
(fcobs).
fcobs vs. inhibitor concentration [I] curves were then fit to Eq.2 to determine the inhibitor dissociation constant (K) and the first order rate constant of enzyme inactivation at infinite inhibitor concentration (¾nact)- Table IV shows kinetics results from representative test compounds. A larger ¾nact /K ratio indicates a more effective enzyme inactivator.
Eq. 1
Figure imgf000174_0001
Where Y is the absorbance at time t, Vo is the uninhibited enzyme velocity, k0bs is the observed rate constant of the enzyme inactivation.
Eq. 2
^obs- ^inact^ [I]/([I] + K(l + S/Km))
Where S is the NCF concentration, Km is the KPC-2 Km for NCF.
Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the invention being indicated by the following claims.

Claims

CLAIMS We claim:
1. A compound of Formula (I) or a pharmaceutically acceptable salt thereof:
Figure imgf000175_0001
wherein X is selected from O and S ;
R is selected from
— ^-OS03H ; — ^-S03H ; — ^-OP03H CH2CO2H ajid ? CF2CO2H
¾ ; and
R1 is selected from:
a. hydrogen;
Figure imgf000175_0002
wherein R2 is selected from
Figure imgf000175_0003
wherein each of R3, R4 and R5 is independently selected from hydrogen, (Q- C3)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, and n is selected from 1 , 2 and 3 ;
Figure imgf000175_0004
wherein R6 is H, (C2-C3) alkylamino, and
Figure imgf000176_0001
d. amino;
Figure imgf000176_0002
wherein R7 is selected from H, (Ci-C3)-unsubstituted alkyl, amino-(C2-C3)- alkyl, aminocycloalkyl, hydroxyalkyl,
Figure imgf000176_0003
and wherein each of p and q is independently selected from 1 and 2; and f. -CH(R8)CH2NH2
wherein R8 is selected from amino and hydroxyl.
2. A compound of Formula (A-I) or a pharmaceutically acceptable salt thereof:
Figure imgf000176_0004
wherein X is selected from O and S;
R* is selected from
— ^-OS03H ; — ^-S03H ; — ^-OP03H CH2CO2H ajid ? CF2CO2H
¾ ; and
R1* is selected from:
a. hydrogen; b. -Hi
wherein R2* is selected from
Figure imgf000177_0001
R3* is selected from hydrogen, (Ci-C3)-alkyl, aminoalkyl, aminocycloalkyl,
hydroxyalkyl,
Figure imgf000177_0002
each of R4*, R5*, R6*and R7* is independently selected from hydrogen or (Q- C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R4*, R5*, R6 *and R7*is hydrogen,
n is selected from 1, 2, 3 and 4, and
Figure imgf000177_0003
wherein R is selected from NH2, R9R10N or
wherein each of R4*, R5*, R6*and R7*is as described previously and each of R9, R10, and R11 is independently selected from hydrogen or (Ci-C6)-alkyl, provided that at least one of R9, R10, and R11 is hydro gen; d. amino;
Figure imgf000177_0004
wherein Z is selected from CR12R13 or NR14,
each of R12 and R13 is independently selected from H, NH2 and
Figure imgf000178_0001
, wherein each of R4*, R5*, R6 *and R7 is as described previously,
alternatively, R12 and R13 together with the carbon to which they are attached, form a cycloalkylor heterocyclyl ring containing 4-6 ring members,
R14 is selected from H and
Figure imgf000178_0002
, wherein each of R , R and R is independently selected from hydrogen, (Ci-C6)-alkyl, aminoalkyl, aminocycloalkyl, and hydroxyalkyl, provided that at least one of R15, R16 and R17 is hydrogen,
R is selected from N¾ and
Figure imgf000178_0003
, wherein each of R4*, R5*, R6*and R7* is as described previously,
each of p* and q* is independently selected from 0, 1, 2 and 3,
T is selected from NH and O
t is selected from 0, 1, 2, 3, and 4, and
ependently selected from 0 and 1 ;
wherein R is selected from N¾ and
Figure imgf000178_0005
, wherein each of R4*, R5*, R6*and R7* is as described previously,
R20 is selected from amino and hydroxyl, and
0 and 1 ;
Figure imgf000178_0006
h.
Figure imgf000179_0001
wherein R is selected from NH2, -NH(Ci-C3)-alkyl and
, wherein each of R4*, R5*, R6*and R7* is as described previously, s is selected from 0 and 1 , and
2, and 3;
Figure imgf000179_0002
wherein M is selected from NR22, CR23R24 and O,
wherein R22 is H,
Figure imgf000179_0003
, wherein each of R , R and R is as described previously,
each of R and R is independently selected from H, NH2 and
Figure imgf000179_0004
wherem of R** 5 R5* 5 R6 * an(j R7* 1S as described previously, and
0, 1 and 2;
Figure imgf000179_0005
3. A pharmaceutical composition comprising a compound of claim 2 and at least 1 β- lactam antibiotic.
4. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a cephalosporin.
5. The pharmaceutical composition of claim 4 wherein the cephalosporin is
Ceftolozane.
6. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a carbapenem.
7. The pharmaceutical composition of claim 3 wherein the β-lactam antibiotic is a monobactam.
8. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 3.
9. A method of treating a bacterial infection comprising administering to a subject in need thereof, a therapeutically-effective amount of a β-lactam antibiotic in conjunction with a compound of claim 2.
10. The method of claim 9 wherein the β-lactam antibiotic is a cephalosporin.
11. The method of claim 10 wherein the cephalosporin is Ceftolozane.
12. The method of claim 9 wherein the β-lactam antibiotic is a carbapenem.
13. The method of claim 9 wherein the β-lactam antibiotic is a monobactam.
14. The method of either of claims 8 or 9 wherein the bacterial infection is caused by bacteria that produce a class A, class C or class D β-lactamase.
15. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce a class A or class C β-lactamase.
16. The method of claim 14 wherein the bacterial infections is caused by bacteria
selected from Acinetobacter spp., Acinetobacter baumannii, Citrobacter spp., Escherichia spp., Escherichia coli, Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp., Klebsiella pneumoniae, Enterobacter spp., Enterobacter cloacae and Enterobacter aerogenes Pasteurella spp, Proteus spp., Proteus mirabilis, Serratia spp, Serratia marcescens, and Providencia spp.
17. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce a KPC-2 or KPC-3 β-lactamase.
18. The method of claim 14 wherein the bacterial infection is caused by bacteria that produce an OXA-15 β-lactamase.
19. The method of either of claims 8 or 9 wherein the bacterial infection is caused by β- lactam resistant bacteria.
20. A method of treating or a bacterial infection in a subject in need thereof, comprising the steps of
a. administering to the subject a compound of claim 2; and
b. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic.
21. A method of treating a bacterial infection in a subject in need thereof, comprising the steps of
a. administering to the subject a therapeutically-effective amount of a β-lactam antibiotic; and
b. administering to the subject a compound of claim 2.
22. Use of a compound of claim 2 for the manufacture of a medicament for the
treatment of a bacterial infection in a subject.
23. Use of a composition of claim 3 for the manufacture of a medicament for the
treatment of a bacterial infection in a subject.
24. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a class A, class C or class D β-lactamase.
25. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a class A or class C β-lactamase.
26. The use according to either of claims 22 or 23 wherein the bacterial infections is caused by bacteria selected from from Acinetobacter spp., Acinetobacter baumannii, Citrobacter spp., Escherichia spp., Escherichia coli, Haemophilus influenzae, Morganella morganii, Pseudomonas aeruginosa, Klebsiella spp., Klebsiella pneumoniae, Enterobacter spp., Enterobacter cloacae and Enterobacter aerogenes Pasteurella spp, Proteus spp., Proteus mirabilis, Serratia spp, Serratia marcescens, and Providencia spp
27. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce a KPC-2 or KPC-3 β-lactamase.
28. The use according to either of claims 22 or 23 wherein the bacterial infection is caused by bacteria that produce an OXA-15 β-lactamase.
29. The use according to either of claims 22or 23 wherein the bacterial infection is caused by β-lactam resistant bacteria.
30. Use of a compound of claim 2 to inhibit β-lactamase
31. A method of inhibiting β-lactamase comprising administering to a subject a compound of claim 2.
32. A compound of claim 2 wherein the binding affinity of the compound is at least
250 mM'V1.
33. The compound of claim 2, wherein the compound of Formula A-I has the
stereochemistry specified in Formula A-II
Figure imgf000182_0001
or a pharmaceutically acceptable salt thereof.
34. The compound of claim 33, or a pharmaceutically acceptable salt thereof selected from
Figure imgf000182_0002
Figure imgf000183_0001
Z9£t£0/£lOZSil/I3d ΪΖΐ6Η/£ΐΟΖ OAV
Figure imgf000184_0001
Figure imgf000185_0001
Z9£t£0/£lOZSil/I3d ΪΖΐ6Η/£ΐΟΖ OAV
Figure imgf000186_0001
184 £81
Figure imgf000187_0001
Z9£t£0/£lOZSil/I3d ιζΐόη/ειοζ OA
Figure imgf000188_0001
Δ8ΐ
Figure imgf000189_0001
Z9£t£0/£lOZSil/I3d ιζΐόη/ειοζ OA
Figure imgf000190_0001
35. The compound according to either of claims 2 or 3 wherein R1* is selected from H,
Figure imgf000190_0002
36. The compound according to claim 35 wherein X is O
Figure imgf000190_0003
Figure imgf000191_0001
38. The compound according to claim 2 or a pharmaceutically-acceptable salt thereof of
Figure imgf000191_0002
39. The compound according to claim 2 or a pharmaceutically-acceptable salt thereof of
Figure imgf000192_0001
40. The compound according to claim 2 or a pharmaceutically-acceptable salt thereof of
Figure imgf000192_0002
41. The compound according to claim 2 or a pharmaceutically-acceptable salt thereof of
Figure imgf000192_0003
42. The compound according to claim 2 or a pharmaceutically-acceptable salt thereof of
Figure imgf000192_0004
43. A pharmaceutical composition comprising a compound of claim 37 and
Ceftolozane.
44. omposition of claim 43 wherein the compound is
Figure imgf000193_0001
45. The pharmaceutical composition of claim 43 wherein the compound is
Figure imgf000193_0002
46. claim 43 wherein the compound is
47. claim 43 wherein the compound is
48. claim 43 wherein the compound is
Figure imgf000193_0003
49. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 44.
50. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 45.
51. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 46.
52. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 47.
53. A method of treating or preventing a bacterial infection comprising administering to a subject in need thereof a therapeutically- effective amount of the pharmaceutical composition according to claim 48.
54. The method according to claim 9 wherein β-lactam antibiotic is Ceftolozane and the
compound of claim 2 is
Figure imgf000194_0001
.
55. The method according to claim 9 wherein β-lactam antibiotic is Ceftolozane and the
compound of claim 2 is
Figure imgf000194_0002
.
56. The method according to claim 9 wherein β-lactam antibiotic is Ceftolozane and the
compound of claim 2 is
Figure imgf000194_0003
57. The method according to claim 9 wherein β-lactam antibiotic is Ceftolozane and the
compound of claim 2 is
Figure imgf000195_0001
58. The method according to claim 9 wherein β-lactam antibiotic is Ceftolozane and the
compound of claim 2 is
Figure imgf000195_0002
59. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane and
the compound of claim 2 is
Figure imgf000195_0003
60. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane and
the compound of claim 2 is
Figure imgf000195_0004
61. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane and
the compound of claim 2 is
Figure imgf000195_0005
62. The method according to claim 20 wherein β-lactam antibiotic is Ceftolozane and
the compound of claim 2 is
Figure imgf000196_0001
63. The method according to claim 20 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
64. The method according to claim Ceftolozane
and the compound of claim 2 is
Figure imgf000196_0002
65. The method according to claim 21 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000196_0003
66. The method according to claim 21 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000196_0004
67. The method according to claim 21 wherein the β-lactam antibiotic is Ceftolozane
and the compound of claim 2 is
Figure imgf000197_0001
68. The method according to claim 21 wherein the β-lactam antibiotic is Ceftolozane
69.
70.
Figure imgf000197_0002
. The use according to claim 22, wherein the compound
Figure imgf000197_0003
72. The use according to claim 22, wherein the compound is
Figure imgf000197_0004
73 The use according to claim 22, wherein the compound is
Figure imgf000198_0001
74. Use of a composition of claims 44 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
75. Use of a composition of claims 45 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
76. Use of a composition of claims 46 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
77. Use of a composition of claims 47 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
78. Use of a composition of claims 48 for the manufacture of a medicament for the treatment of a bacterial infection in a subject.
79 The use according to claim 30, wherein the compound is
Figure imgf000198_0002
80. n the compound is
81 n the compound is
Figure imgf000198_0003
82. The use according to claim 30, wherein the compound is
Figure imgf000199_0001
83. The use according to claim 30, wherein the compound is
Figure imgf000199_0002
PCT/US2013/034562 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors WO2013149121A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2015503631A JP2015514095A (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole β-lactamase inhibitors
MX2014011827A MX2014011827A (en) 2012-03-30 2013-03-29 1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE ß-LACTAMASE INHIBITORS.
KR1020147030475A KR20140144254A (en) 2012-03-30 2013-03-29 1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE β-LACTAMASE INHIBITORS
SG11201406123TA SG11201406123TA (en) 2012-03-30 2013-03-29 1,3,4-OXADIAZOLE AND 1,3,4-THIADIAZOLE β-LACTAMASE INHIBITORS
CA2868553A CA2868553A1 (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole .beta.-lactamase inhibitors
CN201380028018.6A CN104334558A (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole Beta-lactamase inhibitors
AU2013237939A AU2013237939A1 (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors
RU2014143821A RU2014143821A (en) 2012-03-30 2013-03-29 1, 3, 4-oxadiazole and 1, 3, 4-thiadiazole β-lactamase inhibitors
EP13769724.9A EP2831075B1 (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors
IL234842A IL234842A0 (en) 2012-03-30 2014-09-28 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors
PH12014502196A PH12014502196A1 (en) 2012-03-30 2014-09-30 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261618131P 2012-03-30 2012-03-30
US61/618,131 2012-03-30
US201361790579P 2013-03-15 2013-03-15
US61/790,579 2013-03-15

Publications (2)

Publication Number Publication Date
WO2013149121A1 true WO2013149121A1 (en) 2013-10-03
WO2013149121A8 WO2013149121A8 (en) 2014-05-01

Family

ID=49261280

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/034562 WO2013149121A1 (en) 2012-03-30 2013-03-29 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors

Country Status (16)

Country Link
US (7) US8933233B2 (en)
EP (1) EP2831075B1 (en)
JP (1) JP2015514095A (en)
KR (1) KR20140144254A (en)
CN (1) CN104334558A (en)
AR (1) AR090590A1 (en)
AU (1) AU2013237939A1 (en)
CA (1) CA2868553A1 (en)
CO (1) CO7091178A2 (en)
IL (1) IL234842A0 (en)
MX (1) MX2014011827A (en)
PH (1) PH12014502196A1 (en)
RU (1) RU2014143821A (en)
SG (1) SG11201406123TA (en)
TW (1) TW201343645A (en)
WO (1) WO2013149121A1 (en)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8796257B2 (en) 2011-12-02 2014-08-05 Naeja Pharmaceutical Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
WO2014152996A1 (en) * 2013-03-14 2014-09-25 Cubist Pharmaceuticals, Inc. Crystalline form of a beta-lactamase inhibitor
US9006421B2 (en) 2013-03-14 2015-04-14 Cubist Pharmaceuticals, Inc. Cephalosporin compositions and methods of manufacture
US9040712B2 (en) 2013-01-23 2015-05-26 Novartis Ag Thiadiazole analogs thereof and methods for treating SMN-deficiency-related-conditions
WO2015110963A1 (en) * 2014-01-21 2015-07-30 Wockhardt Limited 2-(1,3,4-oxadiazol-2-yl)-7-oxo-1,6-diazabicyclo[3.2.1 ]octane derivatives and their use as antibacterial agents
US9108966B2 (en) 2012-03-30 2015-08-18 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
US9120796B2 (en) 2013-10-02 2015-09-01 Cubist Pharmaceuticals, Inc. B-lactamase inhibitor picoline salt
WO2015148379A1 (en) 2014-03-24 2015-10-01 Novartis Ag Monobactam organic compounds for the treatment of bacterial infections
WO2015150891A1 (en) * 2014-03-29 2015-10-08 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-[2-(5-azetidin-3-ylmethyl-[1,3,4]oxadiazol-2-yl)-7-oxo-1,6-diazabicyclo [3.2.1]oct-6-yl]ester
WO2015150890A1 (en) * 2014-03-29 2015-10-08 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-(5-(3-amino-propyl)-[1,3,4]oxadiazol-2-yl]-7-oxo-1,6-diazabicyclo [3.2.1] oct-6-yl}ester
WO2015159263A1 (en) * 2014-04-18 2015-10-22 Wockhardt Limited Pharmaceutical compositions comprising antibacterial agents
WO2015159265A1 (en) * 2014-04-18 2015-10-22 Wockhardt Limited Pharmaceutical compositions comprising antibacterial agents
EP2857401A4 (en) * 2012-05-30 2015-11-04 Meiji Seika Pharma Co Ltd Novel -lactamase inhibitor and method for producing same
WO2015173663A1 (en) * 2014-05-14 2015-11-19 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-[5-(2-methylamino-ethyl)-[1,3,4]-oxadiazol-2-yl]-7-oxo-1,6-diaza-bicyclo [3.2.1]oct-6-yl} ester
WO2015173665A1 (en) * 2014-05-14 2015-11-19 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-[5-(3-azetidinylamino)-methyl-[1,3,4]- oxadiazol-2-yl]-7-oxo-1,6-diazabicyclo[3.2.1] oct-6-yl} ester trifluoroacetate
US9309245B2 (en) 2012-04-02 2016-04-12 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
WO2016081452A1 (en) 2014-11-17 2016-05-26 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
WO2016118565A1 (en) 2015-01-20 2016-07-28 Millennium Pharmaceuticals, Inc. Quinazoline and quinoline compounds and uses thereof
WO2016157057A1 (en) * 2015-03-27 2016-10-06 Wockhardt Limited A process for preparation of sodium salt of (2s, 5r) sulfuric acid mono-(2-[1,3,4]oxadiazol-2-yl-7-oxo-1,6-diazabicyclo[3.2.1 ]oct-6-yl)ester
US9505761B2 (en) 2011-12-02 2016-11-29 Fedora Pharmaceuticals Inc. Bicyclic compounds and their use as antibacterial agents and beta-lactamase inhibitors
WO2017203266A1 (en) 2016-05-25 2017-11-30 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
WO2018060926A1 (en) 2016-09-28 2018-04-05 Novartis Ag Beta-lactamase inhibitors
US9951072B2 (en) 2015-10-02 2018-04-24 Legochem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
JP2018515504A (en) * 2015-05-07 2018-06-14 ミュタビリスMutabilis Heterocyclic compounds and their use in the treatment or prevention of bacterial infections
WO2018193369A1 (en) * 2017-04-18 2018-10-25 Wockhardt Limited Antibacterial compositions
WO2019105479A1 (en) 2017-12-01 2019-06-06 南京明德新药研发股份有限公司 CRYSTAL FORM OF β-LACTAMASE INHIBITOR AND PREPARATION METHOD THEREFOR
WO2019144912A1 (en) 2018-01-25 2019-08-01 苏州信诺维医药科技有限公司 β-LACTAMASE INHIBITOR AND USE THEREOF
US10800778B2 (en) 2016-09-16 2020-10-13 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
US11046694B2 (en) 2017-05-08 2021-06-29 Entasis Therapeutics, Inc. Compounds and methods for treating bacterial infections
EP3854786A4 (en) * 2018-09-21 2022-09-14 API Corporation Method for producing amino acid derivatives
WO2023088375A1 (en) 2021-11-17 2023-05-25 苏州信诺维医药科技股份有限公司 β-LACTAMASE INHIBITOR INTERMEDIATE AND PREPARATION METHOD THEREFOR
US11905286B2 (en) 2018-08-09 2024-02-20 Antabio Sas Diazabicyclooctanones as inhibitors of serine beta-lactamases

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8916709B2 (en) * 2012-03-30 2014-12-23 Cubist Pharmaceuticals, Inc. 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors
US8933233B2 (en) * 2012-03-30 2015-01-13 Cubist Pharmaceuticals, Inc. 1,3,4-oxadiazole and 1,3,4-thiadiazole β-lactamase inhibitors
KR20150003777A (en) * 2012-03-30 2015-01-09 큐비스트 파마슈티컬즈 인코포레이티드 ISOXAZOLE β-LACTAMASE INHIBITORS
US20140274991A1 (en) 2013-03-15 2014-09-18 Cubist Pharmaceuticals, Inc. Ceftolozane pharmaceutical compositions
US9872906B2 (en) 2013-03-15 2018-01-23 Merck Sharp & Dohme Corp. Ceftolozane antibiotic compositions
US20140315876A1 (en) * 2013-03-15 2014-10-23 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
US10404592B2 (en) * 2017-03-24 2019-09-03 Cisco Technology, Inc. System and method to facilitate content forwarding using bit index explicit replication (BIER) in an information-centric networking (ICN) environment
CN111777607A (en) * 2020-07-21 2020-10-16 海南海灵化学制药有限公司 Preparation method of abamectin
CN116514696B (en) * 2023-06-29 2023-12-01 艾斯拓康医药科技(北京)有限公司 Ionizable lipids and uses thereof

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US5039660A (en) 1988-03-02 1991-08-13 Endocon, Inc. Partially fused peptide pellet
US5041567A (en) 1982-02-27 1991-08-20 Beecham Group Plc Antibacterial monic acid derivatives
WO1995005384A1 (en) 1993-08-13 1995-02-23 Smithkline Beecham Plc Derivatives of monic acids a and c having antibacterial, antimycoplasmatical, antifungal and herbicidal activity
US6468967B1 (en) 1998-09-25 2002-10-22 Cubist Pharmaceuticals, Incorporated Methods for administration of antibiotics
US7112592B2 (en) 2000-08-01 2006-09-26 Aventis Pharma S.A. Azabicyclic compounds, preparation thereof and use as medicines, in particular as antibacterial agents
WO2008039420A2 (en) 2006-09-27 2008-04-03 Merck & Co., Inc. Novel inhibitors of beta-lactamase
WO2009091856A2 (en) 2008-01-18 2009-07-23 Merck & Co., Inc. Beta-lactamase inhibitors
WO2010056827A1 (en) * 2008-11-13 2010-05-20 Protez Pharmaceuticals, Inc. Beta-lactamase inhibitors
WO2010118361A1 (en) * 2009-04-09 2010-10-14 Sopharmia, Inc. Beta lactamase inhibitors

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130059774A1 (en) 2000-08-01 2013-03-07 Mahesh Vithalbhai Patel Efflux pump inhibitors
FR2835186B1 (en) 2002-01-28 2006-10-20 Aventis Pharma Sa NOVEL HETEROCYCLIC COMPOUNDS ACTIVE AS BETA-LACTAMASES INHIBITORS
US7618978B2 (en) 2004-04-22 2009-11-17 Eli Lilly And Company Amides as BACE inhibitors
RU2007147413A (en) 2005-05-24 2009-06-27 Астразенека Аб (Se) AMINOPIPERIDINCHINOLINS AND THEIR AZAISOSTERIC ANALOGUES WITH ANTIBACTERIAL ACTIVITY
WO2007129176A2 (en) 2006-04-28 2007-11-15 Wockhardt Ltd Improvements in therapy for treating resistant bacterial infections
FR2921060B1 (en) 2007-09-14 2012-06-15 Novexel NOVEL PROCESS FOR PREPARING DISUBSIDED PIPERIDINE AND NOVEL INTERMEDIATES
WO2009064414A1 (en) * 2007-11-13 2009-05-22 Protez Pharmaceuticals, Inc. Beta-lactamase inhibitors
FR2930553B1 (en) 2008-04-29 2010-05-21 Novexel AZABICYCLIC COMPOUNDS, THEIR PREPARATION AND THEIR USE AS MEDICAMENTS, IN PARTICULAR BETA-LACTAMASES INHIBITORS
EP2921559A1 (en) 2008-06-19 2015-09-23 Astra Zeneca Holding France Use of (1r,2s,5r) 1,6-diazabicyclo [3.2.1]octane-2-carboxamide, 7-oxo-6-(sulfooxy)-, monosodium salt as a diagnostic reagent for detecting serine beta-lactamases
US20120053350A1 (en) 2009-04-30 2012-03-01 Ian Mangion Preparation of alkyl esters of n-protected oxo-azacycloalkylcarboxylic acids
FR2951171A1 (en) 2009-10-09 2011-04-15 Novexel NOVEL SODIUM SALT OF A CRYSTALLIZED ENANTIOMER AZABICYCLIC COMPOUND AND NOVEL POLYMORPHIC AND PSEUDOPOLYMORPHIC FORMS AND THEIR PREPARATION
EP2536408A1 (en) 2010-02-16 2012-12-26 Wockhardt Research Centre Efflux pump inhibitors
US8630784B2 (en) 2010-07-19 2014-01-14 Honda Motor Co., Ltd. Method and system for detecting and compensating weather condition effects on wireless signals
US8772490B2 (en) 2010-12-22 2014-07-08 Meiji Seika Pharma Co., Ltd. Optically active diazabicyclooctane derivatives and process for preparing the same
TWI599355B (en) 2010-12-22 2017-09-21 明治製菓藥業股份有限公司 Optically active diazabicyclooctane derivatives and process for preparring the same
AU2012270051B2 (en) 2011-06-17 2016-12-22 Pfizer Anti-Infectives Ab Process for preparing heterocyclic compounds including trans-7-oxo-6-(sulphooxy)-1,6-diazabicyclo[3,2,1]octane-2-carboxamide and salts thereof
CA2842777C (en) 2011-07-26 2015-12-29 Wockhardt Limited Pharmaceutical compositions comprising sulbactam and beta-lactamase inhibitor
EP2768503A1 (en) 2011-07-26 2014-08-27 Wockhardt Limited Pharmaceutical compositions comprising beta-lactam antibiotic, sulbactam and beta-lactamase inhibitor
CN103649088B (en) 2011-08-30 2016-05-11 沃克哈特有限公司 1,6-diazabicyclo [3,2,1] is pungent-7-ketone derivatives and the purposes in treatment bacterium infects thereof
ES2640520T3 (en) 2011-09-13 2017-11-03 Wockhardt Limited Compounds containing nitrogen and its use
US8796257B2 (en) 2011-12-02 2014-08-05 Naeja Pharmaceutical Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
US8969570B2 (en) * 2012-03-30 2015-03-03 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
KR20150003777A (en) * 2012-03-30 2015-01-09 큐비스트 파마슈티컬즈 인코포레이티드 ISOXAZOLE β-LACTAMASE INHIBITORS
US8933233B2 (en) * 2012-03-30 2015-01-13 Cubist Pharmaceuticals, Inc. 1,3,4-oxadiazole and 1,3,4-thiadiazole β-lactamase inhibitors
US8916709B2 (en) * 2012-03-30 2014-12-23 Cubist Pharmaceuticals, Inc. 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors
MX366948B (en) 2012-05-30 2019-07-30 Meiji Seika Pharma Co Ltd NOVEL ß-LACTAMASE INHIBITOR AND METHOD FOR PRODUCING SAME.
WO2014152996A1 (en) * 2013-03-14 2014-09-25 Cubist Pharmaceuticals, Inc. Crystalline form of a beta-lactamase inhibitor

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US5041567A (en) 1982-02-27 1991-08-20 Beecham Group Plc Antibacterial monic acid derivatives
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US5039660A (en) 1988-03-02 1991-08-13 Endocon, Inc. Partially fused peptide pellet
WO1995005384A1 (en) 1993-08-13 1995-02-23 Smithkline Beecham Plc Derivatives of monic acids a and c having antibacterial, antimycoplasmatical, antifungal and herbicidal activity
US6852689B2 (en) 1998-09-25 2005-02-08 Cubist Pharmaceuticals, Inc. Methods for administration of antibiotics
US6468967B1 (en) 1998-09-25 2002-10-22 Cubist Pharmaceuticals, Incorporated Methods for administration of antibiotics
US7112592B2 (en) 2000-08-01 2006-09-26 Aventis Pharma S.A. Azabicyclic compounds, preparation thereof and use as medicines, in particular as antibacterial agents
WO2008039420A2 (en) 2006-09-27 2008-04-03 Merck & Co., Inc. Novel inhibitors of beta-lactamase
WO2009091856A2 (en) 2008-01-18 2009-07-23 Merck & Co., Inc. Beta-lactamase inhibitors
US20110294777A1 (en) * 2008-01-18 2011-12-01 Merck Sharp & Dohme Corp. Beta-lactamase inhibitors
WO2010056827A1 (en) * 2008-11-13 2010-05-20 Protez Pharmaceuticals, Inc. Beta-lactamase inhibitors
WO2010118361A1 (en) * 2009-04-09 2010-10-14 Sopharmia, Inc. Beta lactamase inhibitors

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
"CLSI guidelines can be derived from the CLSI document M07-A9", January 2012, article "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth Edition"
.: "Remington's Pharmaceutical Sciences", MACK PUBLISHING COMPANY
BUSH, K; JACOBY, G. A.: "Updated Functinal Classification of P-Lactamases", ANTIMICROB. AGENTS CHEMOTHER, vol. 54, 2010, pages 969 - 976
CROMPTON, I. E. ET AL.: "Beta-Lactamase inhibitors: The inhibition of serine beta-lactamases by specific boronic acids", BIOCHEM. J., vol. 251, 1988, pages 453 - 459, XP055170895 *
GOODMAN; GILMAN'S: "The Pharmaceutical Basis of Therapeutics", PERGAMON PRESS
JAKOPIN, Z.; DOLENC, M. S, CURR. ORG. CHEM., vol. 12, 2008, pages 850 - 898
P. G. M. WUTS; T. W. GREENE: "Protective Groups in Organic Synthesis, Fourth Edition,", 2006, JOHN WILEY AND SONS
See also references of EP2831075A4
WALKER, D. G.; BRODFUEHRER, P. R.; BRUNDIDGE, S. P; SHIH, K. M.; SAPINO, C. JR, J. ORG. CHEM., vol. 53, 1988, pages 983 - 991

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9393239B2 (en) 2011-12-02 2016-07-19 Fedora Pharmaceuticals Inc. Bicyclic compounds and their use as antibacterial agents and betalactamase inhibitors
US10030019B2 (en) 2011-12-02 2018-07-24 Fedora Pharmaceuticals Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
US8877743B2 (en) 2011-12-02 2014-11-04 Naeja Pharmaceutical Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
US9505761B2 (en) 2011-12-02 2016-11-29 Fedora Pharmaceuticals Inc. Bicyclic compounds and their use as antibacterial agents and beta-lactamase inhibitors
US10544146B2 (en) 2011-12-02 2020-01-28 Fedora Pharmaceuticals Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
US8796257B2 (en) 2011-12-02 2014-08-05 Naeja Pharmaceutical Inc. Bicyclic compounds and their use as antibacterial agents and β-lactamase inhibitors
US9108966B2 (en) 2012-03-30 2015-08-18 Cubist Pharmaceuticals, Inc. Beta-lactamase inhibitors
US9309245B2 (en) 2012-04-02 2016-04-12 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
US9623014B2 (en) 2012-04-02 2017-04-18 Entasis Therapeutics Limited β-lactamase inhibitor compounds
EP2857401A4 (en) * 2012-05-30 2015-11-04 Meiji Seika Pharma Co Ltd Novel -lactamase inhibitor and method for producing same
AU2013268415B2 (en) * 2012-05-30 2017-05-25 Meiji Seika Pharma Co., Ltd. Novel beta-lactamase inhibitor and method for producing same
US9040712B2 (en) 2013-01-23 2015-05-26 Novartis Ag Thiadiazole analogs thereof and methods for treating SMN-deficiency-related-conditions
US9120795B2 (en) 2013-03-14 2015-09-01 Cubist Pharmaceuticals, Inc. Crystalline form of a β-lactamase inhibitor
US9006421B2 (en) 2013-03-14 2015-04-14 Cubist Pharmaceuticals, Inc. Cephalosporin compositions and methods of manufacture
WO2014152996A1 (en) * 2013-03-14 2014-09-25 Cubist Pharmaceuticals, Inc. Crystalline form of a beta-lactamase inhibitor
US9120796B2 (en) 2013-10-02 2015-09-01 Cubist Pharmaceuticals, Inc. B-lactamase inhibitor picoline salt
WO2015110963A1 (en) * 2014-01-21 2015-07-30 Wockhardt Limited 2-(1,3,4-oxadiazol-2-yl)-7-oxo-1,6-diazabicyclo[3.2.1 ]octane derivatives and their use as antibacterial agents
US9845323B2 (en) 2014-01-21 2017-12-19 Wockhardt Limited 2-(1,3,4-oxadiazol-2-yl)-7-oxo-1,6-diazabicyclo[3.2.1 ]octane derivatives and their use as antibacterial agents
EP3511328A1 (en) 2014-03-24 2019-07-17 Novartis AG Monobactam organic compounds for the treatment of bacterial infections
WO2015148379A1 (en) 2014-03-24 2015-10-01 Novartis Ag Monobactam organic compounds for the treatment of bacterial infections
WO2015150890A1 (en) * 2014-03-29 2015-10-08 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-(5-(3-amino-propyl)-[1,3,4]oxadiazol-2-yl]-7-oxo-1,6-diazabicyclo [3.2.1] oct-6-yl}ester
WO2015150891A1 (en) * 2014-03-29 2015-10-08 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-[2-(5-azetidin-3-ylmethyl-[1,3,4]oxadiazol-2-yl)-7-oxo-1,6-diazabicyclo [3.2.1]oct-6-yl]ester
KR20160138305A (en) 2014-04-18 2016-12-02 욱크하르트 리미티드 Pharmaceutical compositions comprising antibacterial agents
US10857138B2 (en) 2014-04-18 2020-12-08 Wockhardt Limited Pharmaceutical compositions comprising antibacterial agents
WO2015159263A1 (en) * 2014-04-18 2015-10-22 Wockhardt Limited Pharmaceutical compositions comprising antibacterial agents
JP2017511368A (en) * 2014-04-18 2017-04-20 ウォックハート リミテッド Pharmaceutical composition comprising an antibacterial agent
WO2015159265A1 (en) * 2014-04-18 2015-10-22 Wockhardt Limited Pharmaceutical compositions comprising antibacterial agents
WO2015173665A1 (en) * 2014-05-14 2015-11-19 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-[5-(3-azetidinylamino)-methyl-[1,3,4]- oxadiazol-2-yl]-7-oxo-1,6-diazabicyclo[3.2.1] oct-6-yl} ester trifluoroacetate
WO2015173663A1 (en) * 2014-05-14 2015-11-19 Wockhardt Limited A process for preparation of trans-sulfuric acid mono-{2-[5-(2-methylamino-ethyl)-[1,3,4]-oxadiazol-2-yl]-7-oxo-1,6-diaza-bicyclo [3.2.1]oct-6-yl} ester
US10376499B2 (en) 2014-11-17 2019-08-13 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
WO2016081452A1 (en) 2014-11-17 2016-05-26 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
WO2016118565A1 (en) 2015-01-20 2016-07-28 Millennium Pharmaceuticals, Inc. Quinazoline and quinoline compounds and uses thereof
WO2016157057A1 (en) * 2015-03-27 2016-10-06 Wockhardt Limited A process for preparation of sodium salt of (2s, 5r) sulfuric acid mono-(2-[1,3,4]oxadiazol-2-yl-7-oxo-1,6-diazabicyclo[3.2.1 ]oct-6-yl)ester
JP2018515504A (en) * 2015-05-07 2018-06-14 ミュタビリスMutabilis Heterocyclic compounds and their use in the treatment or prevention of bacterial infections
US9951072B2 (en) 2015-10-02 2018-04-24 Legochem Biosciences, Inc. Compositions and methods for inhibiting beta-lactamase
US10273235B2 (en) 2015-10-02 2019-04-30 Legochem Biosciences, Inc. Compositions and methods for inhibiting β-lactamase
WO2017203266A1 (en) 2016-05-25 2017-11-30 Entasis Therapeutics Limited Combination therapy for treatment of resistant bacterial infections
US10800778B2 (en) 2016-09-16 2020-10-13 Entasis Therapeutics Limited Beta-lactamase inhibitor compounds
US10065957B2 (en) 2016-09-28 2018-09-04 Novartis Ag Beta-lactamase inhibitors
US10597396B2 (en) 2016-09-28 2020-03-24 Novartis Ag Beta-lactamase inhibitors
EP3698796A1 (en) 2016-09-28 2020-08-26 Novartis AG Pharmaceutical combination of a tricyclic beta-lactamase inhibitor with specific beta-lactam antibiotics
WO2018060926A1 (en) 2016-09-28 2018-04-05 Novartis Ag Beta-lactamase inhibitors
WO2018193369A1 (en) * 2017-04-18 2018-10-25 Wockhardt Limited Antibacterial compositions
US11046694B2 (en) 2017-05-08 2021-06-29 Entasis Therapeutics, Inc. Compounds and methods for treating bacterial infections
WO2019105479A1 (en) 2017-12-01 2019-06-06 南京明德新药研发股份有限公司 CRYSTAL FORM OF β-LACTAMASE INHIBITOR AND PREPARATION METHOD THEREFOR
US11180501B2 (en) 2017-12-01 2021-11-23 Qilu Pharmaceutical Co., Ltd. Crystal form of β-lactamase inhibitor and preparation method therefor
WO2019144912A1 (en) 2018-01-25 2019-08-01 苏州信诺维医药科技有限公司 β-LACTAMASE INHIBITOR AND USE THEREOF
US11905286B2 (en) 2018-08-09 2024-02-20 Antabio Sas Diazabicyclooctanones as inhibitors of serine beta-lactamases
EP3854786A4 (en) * 2018-09-21 2022-09-14 API Corporation Method for producing amino acid derivatives
US11897844B2 (en) 2018-09-21 2024-02-13 Api Corporation Method for producing amino acid derivatives
WO2023088375A1 (en) 2021-11-17 2023-05-25 苏州信诺维医药科技股份有限公司 β-LACTAMASE INHIBITOR INTERMEDIATE AND PREPARATION METHOD THEREFOR

Also Published As

Publication number Publication date
SG11201406123TA (en) 2014-10-30
CN104334558A (en) 2015-02-04
AR090590A1 (en) 2014-11-26
AU2013237939A1 (en) 2014-10-30
CA2868553A1 (en) 2013-10-03
KR20140144254A (en) 2014-12-18
US8933233B2 (en) 2015-01-13
TW201343645A (en) 2013-11-01
US8962843B2 (en) 2015-02-24
CO7091178A2 (en) 2014-10-21
US8940897B2 (en) 2015-01-27
US20130296291A1 (en) 2013-11-07
PH12014502196A1 (en) 2014-12-10
EP2831075B1 (en) 2017-11-08
EP2831075A4 (en) 2015-09-09
IL234842A0 (en) 2014-12-31
US20130296292A1 (en) 2013-11-07
WO2013149121A8 (en) 2014-05-01
US20150031665A1 (en) 2015-01-29
US8933232B2 (en) 2015-01-13
EP2831075A1 (en) 2015-02-04
MX2014011827A (en) 2015-02-20
US20150031659A1 (en) 2015-01-29
US20130296290A1 (en) 2013-11-07
US20130303504A1 (en) 2013-11-14
US20130296293A1 (en) 2013-11-07
RU2014143821A (en) 2016-05-27
US8962844B2 (en) 2015-02-24
JP2015514095A (en) 2015-05-18

Similar Documents

Publication Publication Date Title
EP2831075B1 (en) 1,3,4-oxadiazole and 1,3,4-thiadiazole beta-lactamase inhibitors
EP2831069B1 (en) Isoxazole beta-lactamase inhibitors
US8916709B2 (en) 1,2,4-oxadiazole and 1,2,4-thiadiazole β-lactamase inhibitors
US9132133B2 (en) Nitrogen containing compounds
EP2872510B1 (en) 1,6-diazabicyclo[3,2,1]octan-7-one derivatives and their use in the treatment of bacterial infections
US9120795B2 (en) Crystalline form of a β-lactamase inhibitor
US20140315876A1 (en) Beta-lactamase inhibitors
KR20180051559A (en) Compositions and methods for inhibiting beta-lactamase
US20150038482A1 (en) Isoxazole beta-lactamase inhibitors
NZ616959B2 (en) 1,6- diazabicyclo [3,2,1] octan- 7 - one derivatives and their use in the treatment of bacterial infections

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13769724

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2868553

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2015503631

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: P1055/2014

Country of ref document: AE

Ref document number: 14216414

Country of ref document: CO

Ref document number: MX/A/2014/011827

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014024471

Country of ref document: BR

REEP Request for entry into the european phase

Ref document number: 2013769724

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013769724

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147030475

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013237939

Country of ref document: AU

Date of ref document: 20130329

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014143821

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 112014024471

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140930