WO2013148183A2 - Compositions and methods for inhibiting drusen - Google Patents

Compositions and methods for inhibiting drusen Download PDF

Info

Publication number
WO2013148183A2
WO2013148183A2 PCT/US2013/030755 US2013030755W WO2013148183A2 WO 2013148183 A2 WO2013148183 A2 WO 2013148183A2 US 2013030755 W US2013030755 W US 2013030755W WO 2013148183 A2 WO2013148183 A2 WO 2013148183A2
Authority
WO
WIPO (PCT)
Prior art keywords
drusen
rpe
composition
imatinib mesylate
subject
Prior art date
Application number
PCT/US2013/030755
Other languages
French (fr)
Inventor
Sally Temple STERN
Jeffrey Stern
Original Assignee
Regenerative Research Foundatoin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Regenerative Research Foundatoin filed Critical Regenerative Research Foundatoin
Priority to CA2868785A priority Critical patent/CA2868785A1/en
Priority to US14/388,131 priority patent/US20150051212A1/en
Publication of WO2013148183A2 publication Critical patent/WO2013148183A2/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/5025Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/06Free radical scavengers or antioxidants

Definitions

  • the present invention relates to compositions that modulate the formation of drusen, including compositions and agents that inhibit or reduce drusen formation.
  • the invention also related to compositions and methods which use these compositions to modulate (e.g., reduce or inhibit) drusen formation and are useful, e.g., for treating or preventing diseases and disorders associated with abnormal drusen formation, including age- related macular degeneration (AMD).
  • AMD age- related macular degeneration
  • the invention also relates to novel assays, including in vitro, cell-based assays, that can be used to identify drusen-modulating compositions of the invention.
  • AMD Age-related macular degeneration
  • Neovascular or exudative AMD the "wet" form of the disorder, is characterized by choroidal neovascularization; i.e., abnormal blood vessel growth arising from the capillary layer beneath the RPE. Bleeding and scarring from these blood vessels cause irreversible damage to the photoreceptors, resulting in rapid vision loss.
  • wet AMD may be treated, moreover, with anti-angiogenic or anti-VEGF agents. No medical treatment is available for the more prevalent dry form of AMD, however, although vitamin supplements with high doses of antioxidant may slow its progression. For review, see Jager et al, N. Engl. J. Med. (2008) 358:2606-2617.
  • Drusen deposits are widely regarded as the "hallmark lesion" of AMD. Anderson et al, Am. J. Opthalmology (2002) 134:411-431. The appearance of numerous or large confluent drusen strongly correlates with the disease's development and progression. Id. Yet, while they undisputedly play an important role, the exact functional relationship between drusen and AMD remains poorly understood. Electron micrographs have shown RPE exuding cytoplasm from their basal membranes on top of and into drusen, suggesting that drusen may be, at least in part, products of RPE cells. Ishibashi et al, Invest. Ophthalmol. Vis. Sci.
  • ⁇ peptide deposition may play at least some role in the pathogenesis of AMD. For example, see Ding et al. (2011), supra; Anderson et al., Exp. Eye Res. (2004) 78:243-256; Dentchev et al, Mol. Vis.
  • the present invention is based, in part, on the discovery that a recently discovered retinal pigment epithelial stem cell (RPESC) can be differentiated into mature retinal pigment epithelial (RPE) cells.
  • RPESC retinal pigment epithelial stem cell
  • RPE retinal pigment epithelial
  • the invention is also based in part on the discovery RPE cells derived from such RPESC may be used in vitro to study drusen formation and, in particular, to identify compounds and other compositions that modulate drusen formation in such cells.
  • the invention is based in part on the discovery that the expression of proteins associated with drusen formation, and also of genes encoding such proteins, is upregulated in the RPESC-derived RPE cells after subjecting the RPE cells to conditions of oxidative stress, e.g., by exposing them to oxidative agents such as hydrogen peroxide (3 ⁇ 4(3 ⁇ 4) or tert-butyl hydroperoxide (TBHP).
  • oxidative agents such as hydrogen peroxide (3 ⁇ 4(3 ⁇ 4) or tert-butyl hydroperoxide (TBHP).
  • drusen-associated genes and proteins include, but are not limited to, the exemplary drusen-associated genes listed in Table I, infra, as well as their gene products - e.g., polypeptides encoded by such drusen- associated genes.
  • the invention is also based, in part, on the identification of compounds that inhibit the upregulation of such drusen-associate genes in proteins in the assays of this invention.
  • Such compounds include, inter alia, the compound imatinib and pharmaceutically acceptable salts thereof, such as the mesylate salt.
  • Such compounds are therefore useful, in the novel methods and compositions of these invention, for modulating drusen formation in vitro or in vivo, including methods and compositions for inhibiting or reducing the formation of drusen in vitro or in vivo.
  • Compounds identified in the methods of this invention can also be used in novel therapeutic methods, e.g., to reduce or inhibt drusen formation in a subject, and therefore ameliorate, prevent or inhibit drusen-associated disorders such as age-related macular degeneration (AMD).
  • AMD age-related macular degeneration
  • a subject in need thereof e.g., a patient (e.g., a mammal, preferably, a human) suffering from or at risk of developing dry age related macular degeneration (AMD) a composition comprising an inhibitor of one or more, preferably two or more, and most preferably all of the polypeptides selected from the group consisting of gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c-Abl tyrosine kinase (BRC-Abl) and up-regulators of neprilysin.
  • the composition comprises an effective amount for inhibiting drusen of imatinib mesylate.
  • inhibition of drusen comprises inhibiting the expression of one or more drusen-associated polypeptides, e.g., amyloid protein beta ( ⁇ ), amyloid precursor protein (APP), apolipoprotein E (APOE), apolipoprotein J (APOJ), ⁇ -crystallin, ⁇ -site ⁇ cleaving enzyme 1 (BACE-1), presenilin 1 (PS1), and vascular endothelial growth factor (VEGF)-A.
  • the method can comprise administering imatinib mesylate in combination with another drug or therapy (i.e., a combination therapy) for inhibiting drusen.
  • imatinib mesylate may be co-administered with a small molecule inhibitor of drusen and/or of amyloid beta ( ⁇ ) and/or an antibody that is specific for a drusen-associated protein (e.g., ⁇ , APP, BACE-1, etc.).
  • a small molecule inhibitor of drusen and/or of amyloid beta ( ⁇ ) and/or an antibody that is specific for a drusen-associated protein e.g., ⁇ , APP, BACE-1, etc.
  • imatinib mesylate or related compound is directly conjugated to the drusen-associated protein- specific antibody.
  • Figure 1 is a bar graph quantifying the fold induction of the indicated drusen- associated proteins over control in an RPE cell based in vitro model of drusen formation.
  • the "*" indicates statistical significance as determined by the Student's t test (p ⁇ 0.05).
  • Figure 2 is a bar graph quantifying the percent (%) cell death as determined by LDH assay in adult human RPE cells subjected to oxidative stress and treated with the indicated doses of imatinib mesylate ("Gleevec"), DAPT, or ponatinib.
  • Figure 3 is a bar graph quantifying the transepithelial resistance (n » cm 2 ) of stressed RPE cells following treatment with the indicated doses of imatinib mesylate ("Gleevec"), DAPT, ponatinib or bosutinib, or vehicle control.
  • Figure 4 is a bar graph quantifying the mRNA expression level (fold induction over control) of the indicated drusen-associated proteins.
  • the present invention is based, at least in part, on the discovery that retinal pigment epithelial (RPE) cells derived from an RPE stem cell (RPESC) may be used in vitro to study drusen formation and, in particular, to identify compounds and other compositions that modulate drusen formation in such cells. More specifically, the invention is based in part on the discovery that the expression of proteins associated with drusen formation, and also of genes encoding such proteins, is upregulated in the RPESC-derived stems cells after subjecting the cells to conditions of oxidative stress, e.g., by exposing them to oxidative agents such as hydrogen peroxide (H 2 O 2 ) or tert-butyl hydroperoxide (TBHP).
  • RPE retinal pigment epithelial
  • RPESC RPE stem cell
  • Such drusen- associated genes and proteins include, but are not limited to, the exemplary drusen-associated genes listed in Table I, infra, as well as their gene products - e.g., polypeptides encoded by such drusen-associated genes.
  • the invention is also based, in part, on the identification of compounds that inhibit the upregulation of such drusen-associate genes in proteins in the assays of this invention.
  • Such compounds include, inter alia, the compound imatinib and pharmaceutically acceptable salts thereof, such as the mesylate salt.
  • Such compounds are therefore useful, in the novel methods and compositions of these invention, for modulating drusen formation in vitro or in vivo, including methods and compositions for inhibiting or reducing the formation of drusen in vitro or in vivo.
  • Compounds identified in the methods of this invention can also be used in novel therapeutic methods, e.g., to reduce or inhibt drusen formation in a subject, and therefore ameliorate, prevent or inhibit drusen-associated disorders such as age-related macular degeneration (AMD).
  • AMD age-related macular degeneration
  • Drusen are small, extracellular deposits that form between the retinal pigment epithelium (RPE) and the underlying Bruch's membrane, which separates the RPE from the choriocapillaria that supply blood to the eye. They are visible in an ophthalmoscopic examination as focal yellow dots. See, for example, Figure 1 of Williams, Age and Ageing (2009) 38:468-654.
  • Drusen deposits contain a number of different denatured proteins and protein fragments, as well as lipids, carbohydrates and trace elements such as zinc. Protein components include, without limitation, apolipoproteins and members of the complement system, such as complement factor H.
  • drusen-associated proteins include ⁇ -crystallin, ⁇ -crystallin, ⁇ 1 -crystallin, ⁇ 2 -crystallin, Ps-crystallin, aA4-crystallin, ⁇ . APP, APOE, APOJ, BACE-1, PS1, VEGF, VEGF Rl, VEGF R2, PEDF, CC9, serum amyloid P, TIMP3, vitronectin, as well as fragments and derivatives of those proteins that may be created, e.g., by oxidative damage.
  • Exemplary sequences for these drusen-associated proteins, and/or for genes encoding them are known in the art and include, by way of example, the sequences identified in Table 1 below, by their GenBank® Accession numbers.
  • compounds and other compositions that modulate or affect drusen formation are preferably identified using in vitro cell-based models and assays for drusen formation, such as those described in the Examples, infra.
  • models and assays preferably use cells or cell lines that are derived from a retinal pigment epithelial stem cell (RPESC).
  • RPESC retinal pigment epithelial stem cell
  • the models and assays of this invention make use of retinal pigment epithelial (RPE) cells that are derived from the RPESC.
  • RPE retinal pigment epithelial
  • Cells used in the assays and models of the invention overexpress drusen- associated polypeptides and/or genes encoding the same when subject to conditions of oxidative stress, such as treating the cells with hydrogen peroxide (H 2 O 2 ) or with tert-butyl hydroperoxide (TBHP).
  • H 2 O 2 hydrogen peroxide
  • TBHP tert-butyl hydroperoxide
  • Preferred drusen-associated polypeptides and genes include those identified, supra, including, without limitation, drusen-associated polypeptides and genes comprising the sequences identified in Table 1, supra, by their GenBank® accession numbers. Specific, preferred examples include, without limitation, ap2-crystallin, ⁇ , APP, APOJ, APOE, BACE-1, PS1, TMP3, CC9 and VEGF.
  • assays of the invention involving culturing RPE derived from the RPESC under conditions of oxidative stress (e.g., in the presence of 3 ⁇ 4(3 ⁇ 4, TBHP or another oxidative reagent).
  • the cells may then be incubated with a test compound, either before, after or during their exposure to the oxidative stress conditions, and the expression of one or more drusen-associate polypeptides and/or genes is determined.
  • Those expression levels may then be compared to one or more controls, and are preferably compared to expression levels of the same drusen-associated polypeptides and/or genes in the same cell line that are cultured under identical conditions of oxidative stress but without exposure to the test compounds.
  • the expression levels are also compared to expression levels of the same drusen-associated polypeptides and/or genes in cells of the same cell line that are not cultured under conditions of oxidative stress.
  • the determined expression levels, under the oxidative stress conditions, of the one or more drusen-associated polypeptides and/or genes are down regulated, compared to their expression levels, under the oxidative stress conditions, in cells that are not incubated with the test compound, the compound is thus identified as a compound which affects drusen formation and, in particular, as a compound that reduces or inhibits drusen formation.
  • the test compound is identified as a compound that reduces or inhibits drusen formation when determined expression levels of the one or more drusen- associated polypeptides and/or genes under oxidative stress conditions, in the cells incubated with that test compound, are identical or substantially similar to their expression levels in cells not cultured under conditions of oxidative stress.
  • RPESCs RPE Stem Cells
  • Such pathologic, drusen protein-expressing RPESC progeny serve as a "disease-in-a-dish" model for drusen formation in RPE cells, and the RPE screening assay described in the present Examples can thus be used to characterize one or more effects of a test compound on the RPE cells, and, in particular, to identify candidate drusen inhibitors.
  • the pathologic, drusen-forming progeny RPE cells of the assay can be treated in conditions, such as, e.g., induction of cellular stress using, e.g., tert-butyl hydroperoxide (TBHP) or H2O2, that cause further upregulation of drusen-associated polypeptides, as well as affect other characteristics of the cells that are associated with drusen formation and/or AMD.
  • characteristics may include, for example, cell viability and epithelial integrity, and then the ability of a test substance to inhibit one or more of the characteristics induced by the cellular stress (e.g., upregulated drusen-associated polypeptide expression levels, cell death, and decreased epithelial integrity) can be determined.
  • the RPE cells can be used in the screening assay to identify candidate drusen inhibitors without first inducing artificial cellular stress because there is a low level of background oxidative stress normally present in the culture media that is sufficient to induce a low level of expression of drusen protein and other characteristics of drusen and AMD .
  • a candidate compound identified by the present RPE assay inhibits 1 or more, or 2 or more, of the characteristics of the drusen- protein expressing RPE cells (e.g., decreased viability, decreased epithelial integrity, and increased drusen protein expression).
  • a candidate compound may inhibit expression of one or more drusen-associated polypeptides (i.e., is an inhibitor of drusen) and/or one or more other characteristics of RPE cells of the assay (e.g., decreased viability and decreased epithelial integrity).
  • the RPE cells may be treated with an inducer of cellular stress (e.g., H202, TBHP or ⁇ ).
  • an inhibitor identified as an inhibitor of drusen may also inhibit cell death and loss of epithelial integrity, e.g., as induced, e.g., by cellular stress and/or by the presence of drusen or drusen-like deposits.
  • Expression levels of a drusen-associated polypeptide in the cultured RPE cells can be determined according to any suitable method known in the art, such as, e.g., quantitative, real-time reverse transcriptase polymerase chain reaction (qPCR) or Northern blot (to quantify mRNA expression), and/or immunocytochemical staining, Western blot, and/or ELISA (to quantify protein expression).
  • qPCR quantitative, real-time reverse transcriptase polymerase chain reaction
  • Northern blot to quantify mRNA expression
  • immunocytochemical staining Western blot
  • Western blot Western blot
  • ELISA to quantify protein expression
  • the expression or level of such proteins can be detected using immunohistochemistry, immunofluorescence, Western blotting, protein chip technology, immunoprecipitation, ELISA assay, or mass spectrometry using standard methods known in the art.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta- galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I, 131 1, 35 S or 3 H.
  • a test substance may be identified in the screening assay as a drusen inhibitor, if the expression level one or more of the drusen-associated polypeptides described herein (e.g., ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PS1, TMP3, CC9 and VEGF A) is decreased following treatment of the cells with the test substance. More preferably, the expression level of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 or more drusen-associated polypeptides is decreased, compared to the level in the absence of treatment with the test substance.
  • the expression level one or more of the drusen-associated polypeptides described herein e.g., ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PS1, TMP3, CC9 and VEGF A
  • a test substance may be identified as an inhibitor of drusen if the test substance decreases the upregulated expression level of one or more of the drusen-associated polypeptides described herein (e.g., as ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PS 1, TMP3, CC9 and VEGF A) resulting from induction of cellular stress (e.g., with TBHP, H202 or ⁇ ).
  • the test substance decreases the upregulated expression level of one or more of the drusen-associated polypeptides described herein (e.g., as ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PS 1, TMP3, CC9 and VEGF A) resulting from induction of cellular stress (e.g., with TBHP, H202 or ⁇ ).
  • the upregulated expression levels of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 or more drusen-associated polypeptides are decreased, compared to the levels in the absence of treatment with the test substance.
  • the upregulated expression level of one or more drusen-associated polypeptides e.g., mRNA and/or protein level
  • the negative control e.g., no treatment or treatment with a vehicle
  • Libraries screened using the methods of the present invention can comprise a variety of types of test compounds.
  • a given library can comprise a set of structurally related or unrelated test compounds.
  • the test compounds are peptide or peptidomimetic molecules.
  • the test compounds are nucleic acids.
  • test compounds and libraries thereof can be obtained by systematically altering the structure of a first test compound, e.g., a first test compound that is structurally similar to a known natural binding partner of the target polypeptide, or a first small molecule identified as capable of binding the target polypeptide, e.g., using methods known in the art and/or described herein, and correlating that structure to a resulting biological activity, e.g., a structure-activity relationship study. As one of skill in the art will appreciate, there are a variety of standard methods for creating such a structure-activity relationship.
  • the work may be largely empirical, and in others, the three-dimensional structure of an endogenous polypeptide or portion thereof can be used as a starting point for the rational design of a small molecule compound or compounds.
  • a general library of small molecules is screened, e.g., using the methods described herein.
  • a monoclonal antibody directed against a polypeptide can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with the polypeptide of interest.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No.
  • the antigen-binding antibody fragment is a Fab fragment, a F(ab')2 fragment, and a scFv fragment. Methods f or generating these antibody fragments are known in the art.
  • test compounds e.g., polypeptides, polynucleotides, inorganic or organic large or small molecule test compounds, antibodies
  • small molecules refers to small organic or inorganic molecules of molecular weight below about 3,000 Daltons. In general, small molecules useful for the invention have a molecular weight of less than 3,000 Daltons (Da).
  • the small molecules can be, e.g., from at least about 100 Da to about 3,000 Da (e.g., between about 100 to about 3,000 Da, about 100 to about 2500 Da, about 100 to about 2,000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da).
  • the test compounds can be natural products, known therapeutics, small molecules, nucleic acids, or members of a combinatorial chemistry library.
  • a set of diverse molecules should be used to cover a variety of functions such as charge, aromaticity, hydrogen bonding, flexibility, size, length of side chain, hydrophobicity, and rigidity.
  • Combinatorial techniques suitable for synthesizing small molecules are known in the art, e.g., as exemplified by Obrecht and Villalgordo, Solid- Supported Combinatorial and Parallel Synthesis of Small-Molecular- Weight Compound Libraries, Pergamon-Elsevier Science Limited (1998), and include those such as the "split and pool” or "parallel” synthesis techniques, solid-phase and solution-phase techniques, and encoding techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio. 1 :60-6 (1997)).
  • a number of small molecule libraries are commercially available.
  • a number of suitable small molecule test compounds are listed in U.S. Patent No. 6,503,713, incorporated herein by reference in its entirety.
  • Cell viability can be measured according to any suitable method. For example, cell death can be measured using an LDH assay, which measures the amount of lactate dehydrogenase released from dead and dying cells. Other assays for cell viability include measuring Annexin V expression. Typically, a test substance may be identified as a candidate inhibitor of drusen in the assay, if the test substance restores cell viability in RPE cells overexpressing drusen proteins (e.g., following induction of cellular stress).
  • Restoration of cell viability can be determined, e.g., by measuring decreases in cell death compared to a control (e.g., cell lysate or RPE cells that had been treated with a cell stress inducer (e.g., TBHP), but no test substance).
  • a control e.g., cell lysate or RPE cells that had been treated with a cell stress inducer (e.g., TBHP), but no test substance.
  • cell death is decreased, relative to the control, by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% (i.e., completely).
  • the ability of a test substance to restore transepithelial resistance may also be determined in the RPE cell-based assay.
  • RPE cells are a tight junctioned epithelia and compromised epithelial integrity is a hallmark of RPE-associated diseases, such as, e.g., dry AMD. Healthy epithelial cells exhibit a high resistance measurement that can be easily experimentally assessed.
  • Transepithelial resistance can be measured using, e.g., the WPI EVOM Voltohmmeter protocol (described by the manufacturer of the volt-ohm meter available from World Precision Instruments (Sarasota, FL).
  • the RPE cells are permitted to reach a resistance of >200n»cm 2 prior to beginning the experiment.
  • Compromised cells i.e., poor epithelial integrity
  • Compromised cells will typically have a resistance of less than 200n » cm 2 .
  • Table 2 shows exemplary compounds identified by screening assays of the invention, which may be useful in methods of the invention, e.g., for treating AMD and/or inhibiting drusen formation.
  • a test compound is applied to a test sample, e.g., a cell or living tissue or organ (e.g., an eye) and one or more effects of the test compound is evaluated.
  • a test sample e.g., a cell or living tissue or organ (e.g., an eye) and one or more effects of the test compound is evaluated.
  • a cultured or primary cell for example, the ability of the test compound to decrease the expression levels of one or more of the drusen associated polypeptides following treatment of the cells with the test sample.
  • the ability of the test compound to decrease the expression levels of one or more of the drusen associated polypeptides resulting from induction of oxidative stress following treatment of the cells with the test sample are examples of the ability of the test compound to decrease the expression levels of one or more of the drusen associated polypeptides resulting from induction of oxidative stress following treatment of the cells with the test sample.
  • the test sample is, or is derived from (e.g., a sample taken from) an in vivo model of a disorder as described herein.
  • an animal model e.g., a rodent such as a rat, can be used.
  • a test compound that has been screened by a method described herein and determined to affect drusen associated proteins can be considered a candidate compound.
  • a candidate compound that has been screened e.g., in an in vivo model of a disorder, e.g.,AMD and determined to have a desirable effect on the disorder, e.g., on one or more symptoms of the disorder, can be considered a candidate therapeutic agent.
  • Candidate therapeutic agents once screened in a clinical setting, are therapeutic agents.
  • Candidate compounds, candidate therapeutic agents, and therapeutic agents can be optionally optimized and/or derivatized, and formulated with physiologically acceptable excipients to form pharmaceutical compositions.
  • test compounds identified as "hits” e.g., test compounds that show a marked decreased in drusen associated proteins in a first screen can be selected and systematically altered, e.g., using rational design, to optimize binding affinity, avidity, specificity, or other parameter. Such optimization can also be screened for using the methods described herein.
  • the invention includes screening a first library of compounds using a method known in the art and/or described herein, identifying one or more hits in that library, subjecting those hits to systematic structural alteration to create a second library of compounds structurally related to the hit, and screening the second library using the methods described herein.
  • Test compounds identified as hits can be considered candidate therapeutic compounds, useful in treating disorders associated with the eye as described herein, e.g., AMD.
  • a variety of techniques useful for determining the structures of "hits” can be used in the methods described herein, e.g., NMR, mass spectrometry, gas chromatography equipped with electron capture detectors, fluorescence and absorption spectroscopy.
  • the invention also includes compounds identified as "hits” by the methods described herein, and methods for their administration and use in the treatment, prevention, or delay of development or progression of a disorder described herein.
  • Test compounds identified as candidate therapeutic compounds can be further screened by administration to cell model of a disorder described herein e.g. AMD.
  • the cell line or tissue
  • the cell line can be monitored for a change in the disorder, e.g., for an improvement in a parameter of the disorder, e.g., a parameter related to clinical outcome.
  • the parameter is viability of the cell, and an improvement would be decreased cell death.
  • the parameter is epithelial integrity or resistance, and an improvement would be increased integrity or resistance of the epithelial cell layer.
  • Test compounds identified as candidate therapeutic compounds can be further screened by administration to an animal model of a disorder described herein.
  • the animal can be monitored for a change in the disorder, e.g., for an improvement in a parameter of the disorder, e.g., a parameter related to clinical outcome.
  • the parameter may be reduced appearance of drusen, and an improvement may be be decreased leakage from blood vessels or decreased atrophy of the RPE layer.
  • the subject is a human, e.g., a human with AMD.
  • the parameter used may be, e.g., reduced drusen and an improvement may be decreased leakage from blood vessels or decreased atrophy of the RPE layer.
  • imatinib mesylate also known as Gleevec® ( ovartis Pharmaceuticals, East Hanover, NJ) was identified using the RPE cell-based screening assay described, above, as an inhibitor of drusen. Imatinib mesylate is approved by the FDA for use in humans for the treatment of cancer.
  • Imatinib mesylate has the formula C2 9 H 3 1N7O and the IUPAC name 4-[(4- methylpiperazin- 1 -yl)methyl] -N-(4-methyl-3 - ⁇ [4-(pyridin-3 -yl)pyrimidin-2- yl]amino ⁇ phenyl)benzamide.
  • Imatinib mesylate is described in detail in U.S. Patent No. 6,894,051.
  • the free form, imatinib is also encompassed by the present invention.
  • Imatinib mesylate-like compounds and imatinib mesylate-related compounds may be used to inhibit drusen, as described herein.
  • AMN107 is a modified form of imatinib mesylate that is 20-fold more potent that imatinib mesylate.
  • Other examples include BMS-354825 and ON012380, also described in O'Hare et al.
  • Other derivatives of imatinib mesylate can be designed by one of skill in the art, and such derivatives are also encompassed herein.
  • the piperazine moiety of imatinib mesylate can be modified to improve binding.
  • an imatinib mesylate related compound is encompassed by the present invention, e.g., by testing the compound in the RPE screening assay described above.
  • an imatinib mesylate-related compound encompassed by the present invention will decrease the expression level of at least one drusen-associated polypeptide (e.g., at least one of ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PSl, TMP3, CC9 and VEGF A) in the RPE assay compared to a control group (e.g., no test compound).
  • a control group e.g., no test compound
  • an imatinib mesylate-related compound and/or imatinib mesylate derivative will preferably inhibit one or more, more preferably two or more, and most preferably all of the polypeptides selected from the group consisting of gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR), and c- Abl tyrosine kinase (BRC-Abl) to inhibit APP and ⁇ production and upregulation of neprilysin to increase abeta breakdown
  • GSAP gamma secretase activating protein
  • PDGFR platelet derived growth factor receptor
  • BRC-Abl c- Abl tyrosine kinase
  • drugs e.g., small molecules
  • GSAP gamma secretase activating protein
  • PDGFR platelet derived growth factor receptor
  • BRC-Abl c- Abl tyrosine kinase
  • such drugs preferably decrease the expression level of at least one drusen-associated polypeptide (e.g., at least one of ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PSl, TMP3, CC9 and VEGF A), e.g., in the RPE assay described herein, compared to a control group (e.g., no drug).
  • a control group e.g., no drug.
  • the upregulation of drugs that accelerate ⁇ Preakdown such as up-regulates neprilysin are considered.
  • compositions of the invention may be administered alone, in certain embodiments, it may be preferable to formulate the composition in combination with a pharmaceutically acceptable carrier.
  • the phrase "pharmaceutically acceptable” refers to molecular entities and compositions that are generally believed to be physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant.
  • a binder for compressed pills
  • a glidant for compressed pills
  • an encapsulating agent for a glidant
  • a flavorant for a flavorant
  • a colorant for a colorant for injectable solutions.
  • suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • pharmaceutically acceptable derivative means any pharmaceutically acceptable salt, solvate or prodrug, e.g., ester, of a compound of the invention, which upon administration to the recipient is capable of providing (directly or indirectly) a compound of the invention, or an active metabolite or residue thereof.
  • pharmaceutically acceptable derivatives are salts, solvates, esters, carbamates, and phosphate esters.
  • Particularly preferred pharmaceutically acceptable derivatives are salts, solvates, and esters.
  • Most preferred pharmaceutically acceptable derivatives are salts and esters.
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • Solutions or suspensions used for parenteral application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injection or infusion typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition should be sterile and should be fluid to the extent that easy syringability exists.
  • Pharmaceutical formulations are ideally stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the relevant carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active agent (e.g., imatinib mesylate) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • active agent e.g., imatinib mesylate
  • dispersions are prepared by incorporating the purified antibody or antigen binding fragment into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • exemplary methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the active agent e.g., imatinib mesylate
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
  • the pharmaceutical formulation is preferably delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the purified polypeptide or protein and delivery agents are formulated into ointments, salves, gels, or creams as generally known in the art.
  • compositions are prepared with carriers that will protect the active agent (e.g., imatinib mesylate) against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
  • the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.
  • compositions can be included as part of the formulation.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • Formulations for oral delivery may advantageously incorporate agents to improve stability within the gastrointestinal tract and/or to enhance absorption.
  • Formulations for intraocular administration can include formulation suitable for injection or infusion described above which typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, PLGA, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • a composition can be adapted to be used as eye drops, or injected into or around the eye, e.g., using peribulbar or intravitreal injection.
  • Such compositions should be sterile and substantially endotoxin-free, and within an acceptable range of pH. Certain preservatives are thought not to be good for the eye, so that in some embodiments a non-preserved formulation is used.
  • Formulation of eye medications is known in the art, see, e.g., Ocular Therapeutics and Drug Delivery: A Multi- Disciplinary Approach, Reddy, Ed. (CRC Press 1995); Kaur and Kanwar, Drug Dev Ind Pharm. 2002 May;28(5):473-93; Clinical Ocular Pharmacology, Bartlett et al.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active agent (e.g., imatinib mesylate) calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • active agent e.g., imatinib mesylate
  • Described herein are methods for inhibiting drusen (e.g., decreasing drusen deposits and/or inhibiting drusen deposits).
  • the presence of drusen deposits in the RPE is the hallmark feature of dry AMD.
  • dry AMD can be treated according to the method described herein.
  • the treatment methods described herein are thought to treat drusen, at least in part, by reducing the expression level of one or more drusen-associated polypeptides (e.g., APP, ⁇ , APOE, APOJ, ⁇ -crystallin, BACEl, PSl, VEGF-A), thereby reducing drusen biosynthesis and/or the size and/or number of existing drusen and/or drusen-like deposits.
  • drusen-associated polypeptides e.g., APP, ⁇ , APOE, APOJ, ⁇ -crystallin, BACEl, PSl, VEGF-A
  • efficacy of treatment with a composition or formulation described herein in a subject suffering from or at risk of developing a drusen-associated disease or condition can be determined, e.g., by quantifying the number of drusen (and/or drusen-like) deposits at the affected site (e.g., RPE layer of retina) and/or by measuring the size of one or more drusen and/or drusen-like deposits, wherein, preferably, the treatment reduces the size and/or number of drusen and/or drusen-like deposits at the affected site.
  • the size and/or number of drusen and/or drusen-like deposits at the affected site is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% (i.e., completely), compared to the size and/or number of drusen and/or drusen-like deposits prior to or at the beginning of the treatment.
  • compositions and formulations can be administered topically, intraocularly, parenterally, orally, by inhalation, as a suppository, or by other methods known in the art.
  • parenteral includes injection (for example, intravitreous, intravenous, intraperitoneal, epidural, intrathecal, intramuscular, intraluminal, intratracheal or subcutaneous).
  • a preferred route of administration is intraocular, for example by intravitreous injection.
  • compositions may be administered as needed, e.g., once a day, twice a day, or more often. However, those skilled in the art will appreciate that it is preferable to minimize the frequency of administration needed to obtain a therapeutic effect, to minimize or reduce the risk of damage, e.g., from excessive intravitreous injection into a patient's eye. Frequency may be decreased during a treatment maintenance phase of the disease or disorder, e.g., once every second or third day instead of every day or twice a day. The dose and the administration frequency will depend on the clinical signs (e.g., presence or absence or decreased levels of drusen or drusen-like deposits).
  • compositions will typically contain an effective amount (e.g., therapeutically effective amount) of the active agent(s), alone or in combination.
  • an effective amount e.g., therapeutically effective amount
  • Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration can be performed according to art-accepted practices.
  • the initial dose may be larger, followed by smaller maintenance doses.
  • the dose may be administered, e.g., weekly, biweekly, daily, semi-weekly, etc., to maintain an effective dosage level.
  • An effective amount of the composition may be the amount administered after a single administration, or may be the total amount administered over a plurality of administrations, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, etc., administrations of the composition.
  • Therapeutically effective dosages can be determined stepwise by combinations of approaches such as (i) characterization of effective doses of the composition or compound in in vitro cell culture assays, e.g., using the RPE cell-based model described herein (see, e.g., Example 1) in which drusen protein expression and/or cell viability is used as a readout, followed by (ii) characterization in animal studies using drusen formation as a readout, followed by (iii) characterization in human trials using decreased drusen formation (e.g., in the RPE) as a readout.
  • approaches such as (i) characterization of effective doses of the composition or compound in in vitro cell culture assays, e.g., using the RPE cell-based model described herein (see, e.g., Example 1) in which drusen protein expression and/or cell viability is used as a readout, followed by (ii) characterization in animal studies using drusen formation as a readout, followed by (
  • Exemplary dosages of imatinib mesylate are 400-800 mg/day for adult patients. A starting dose of 100 mg/day may be considered for some patients, and the dose may then be subsequently increased, depending on the response and the experience of side effects. Intraocular dosages of 1, 10, 100 and 1000 micrograms are contemplated with the preferred dose of 10 or 100 microgrqams.
  • the drusen-inhibitors of the invention can be administered in combination with other therapeutic agents, e.g., for the treatment of drusen.
  • a drusen inhibitor can be administered with an agent that reduces amyloid beta ( ⁇ ), a peptide which has been found to be associated with drusen formation, or other drusen-associated polypeptides.
  • a drusen inhibitor can be co-administered with a therapeutic agent that increases cellular integrity and/or reduces the effect of reactive oxygen species and/or other cell damage associated with amyloid and/or amyloid-like deposits such as drusen.
  • a drusen inhibitor described herein can be coadministered with a Bcr-Abl inhibitor, such as, e.g., ponatinib, bosutinib, dasatinib or PD180970 (La Rosee et al.
  • retinoid X receptor agonists such as bexarotene that increase APP and ⁇ clearance, or an inhibitor of ⁇ -secretase APP/Notch (e.g., DAPT), or sunitinib (a PDGFR inhibitor).
  • DAPT ⁇ -secretase APP/Notch
  • PDGFR inhibitor sunitinib
  • a drusen inhibitor e.g., imatinib mesylate or related compound
  • the other agent can be another therapeutic agent (e.g., small molecule drug or antibody).
  • the drusen inhibitor is conjugated to an antibody that specifically binds to amyloid beta ( ⁇ ) or another polypeptide found in drusen deposits (e.g., ap2-crystallin, ⁇ , APP, APOE, APOJ, BACE-1, PS 1, TMP3, CC9 or VEGF A).
  • the antibody may be a therapeutic antibody (e.g., one that itself inhibits drusen, e.g., by promoting clearance of deposits and/or by decreasing expression of one or more drusen-associated polypeptides) and/or may aid in targeting the drusen inhibitor (e.g., imatinib mesylate or related compound) to the drusen deposit through specific binding.
  • a therapeutic antibody e.g., one that itself inhibits drusen, e.g., by promoting clearance of deposits and/or by decreasing expression of one or more drusen-associated polypeptides
  • the drusen inhibitor e.g., imatinib mesylate or related compound
  • Combination therapy can be sequential therapy where the subject is treated first with one composition or drug and then the other, or alternatively, the two drugs can be given simultaneously and administered to the same or different sites in the same or different frequencies and amounts. If administered at different times, the time interval between the initial and/or subsequent administrations of each drug or therapy can be determined by the subject's physician. However, exemplary intervals can include 1 hour or more, 2 hours or more, 3 hours or more, 4 hours or more, 5 hours or more, 6 hours or more, 7 hours or more, 8 hours or more, 9 hours or more, 10 hours or more, 12 hours or more, 24 hours or more, 2 days or more 5 days or more, and 7 days or more, between the administration of the first and second drugs or therapies.
  • This example describes experiments showing that the expression of various drus en-related proteins, and genes encoding them, is unregulated in RPE derived from RPESC, after exposing the RPE to oxidative stress in vivo.
  • the results show that RPE derived from such stem cells can be used as an in vivo model for drusen formation, e.g., to indentify compounds that modulate drusen formation.
  • retinal pigment epithelial (RPE) cells are derived from RPE stem cells (RPESCs) and cultured using methods described, e.g., by Salero et al. (Cell Stem Cell (201 1) 10:88-95) and/or in U.S. patent application publication No. 2009/0274667. Briefly, human RPE cells are dissected from cadaveric human eyes and cultured in RPE-THT media (DMEM/F12, lx THT, 1% L-glutamine, 1% penicillin/streptomycin, 1% Nl supplement) from Sigma-Aldrich (St.
  • RPE-THT media DMEM/F12, lx THT, 1% L-glutamine, 1% penicillin/streptomycin, 1% Nl supplement
  • FBS fetal bovine serum
  • RPE RPE Classic media (DMEM/F12, 1% sodium pyruvate, 1% L- glutamine, 1% penicillin/streptomycin) with 5% FBS for the remainder of the experiment(s).
  • RPE Classic media DMEM/F12, 1% sodium pyruvate, 1% L- glutamine, 1% penicillin/streptomycin
  • Primary hRPE are passage 1-3 for the experiments described here.
  • Chronic oxidative stress may be induced following the protocol described by Glotin et al. (Free Radio. Biol. Med. (2008) 44: 1348-136), adapted and modified as described herein. Specifically, RPE cells in confluent wells are fed with RPE Classic media with 5% FBS and containing between 500 ⁇ and 2 mM tert-butyl hydroperoxide (TBHP) or H2O2 (to induce oxidative stress) or vehicle (for controls) for two hours each day over a period of five consecutive days, and then rested in RPE Classic media for 24 hours.
  • TBHP tert-butyl hydroperoxide
  • H2O2 to induce oxidative stress
  • vehicle for controls
  • RNA is isolated from the RPE cells at the end of the 24 hour rest period, according to the protocol in the Qiagen RNeasy Micro/Mini Kits. Once isolated, the RNA is converted into cDNA using a high-capacity RNA to cDNA conversion kit (Applied Biosystems).
  • the resulting cDNA is then used in a qPCR assay, to quantitate expression of various drusen-associated genes, including genes encoding: aA-crystallin, aB-crystallin, ⁇ ⁇ -crystallin, pB2-crystallin, Ps-crystallin, aA4-crystallin, APP, APOE, APOJ, BACE-1, PS1, VEGF, VEGF Rl, VEGF R2, PEDF, CC9, serum amyloid P, TIMP3, vitronectin, and H2AE.
  • the expression level of one or more housekeeping genes, such as ribosomal S18 and GAPDH is also quantitated.
  • Forward and reverse PCR primers having the nucleotide sequences shown in Table 2, below, may be used with a SYBR green reporter from Applied Biosystems.
  • This example describes experiments in which the RPESC-based model of drusen formation, exemplified in Example 1, supra, is used to identify compound that modulate (e.g., reduce or inhibit) drusen formation in vitro.
  • Compounds identified in such assays are thus useful for modulating (e.g., reducing or inhibiting) the formation of drusen in vitro or in vivo, and may therefore be useful, e.g., in therapeutic compositions and methods for treating or inhibiting conditions associated with drusen formation, including AMD and, in particular, dry AMD.
  • RPE cells are prepared from RPESC and treated with either TBHP or H2O2 (to induce oxidative stress) or vehicle (for control) as described in Example 1, above.
  • RPESC are incubated in media containing test compound or vehicle (as a control) during treatment with H2O2 or TBHP as described in Example 1, supra.
  • the RPESC-derived RPE cells are incubated with either imatinib mesylate (1 ⁇ ), DAPT (1 ⁇ ), ponatinib (500 nM or 1 ⁇ ) or bosutinib (1 ⁇ ) as test compounds.
  • These test compounds are inhibitors of either ⁇ -secretase (imatinib mesylate and DAPT) or c-Abl tyrosine kinase (ponatinib and bosutinib).
  • DAPT in particular, is a specific inhibitor of many functions of ⁇ -secretase, including APP/Notch.
  • imatinib mesylate has a broader range of actions: it inhibits ⁇ -secretase cleavage of APP, but not Notch, by binding to and inhibiting the ⁇ -secretase activating protein (GSAP). Imatinib mesylate also inhibits PDGFR, as well as c-Abl tyrosine kinase, and upregulates neprilysin, an enzyme that degrads ⁇ .
  • the RPESC-derived RPE may be assayed for one or more of the following criteria: restored viability, restored resistance, and reduced drusen expression. Each of these criteria, which are described in detail below, is indicative of drusen formation and/or drusen-associated diseases such as "dry" and other forms of AMD.
  • viability of the stressed RPE following treatment with a test compound may be assayed by measuring lactate dehydrogenase levels in media, which is released by lysed or porous cells and accounts for both apoptosis and necrosis. More specifically, media from the RPE culture(s) is collected twenty-two (22) hours after inducing oxidative stress, and assayed using a Roche Cytotoxicity Detection Kit Plus (LDH) kit following the manufacturer's instructions.
  • LDH Roche Cytotoxicity Detection Kit Plus
  • Treatment of the RPESC-derived RPE with 1 ⁇ imatinib mesylate completely restores cells viability to 100% compared to untreated controls (i.e., 0% cell death in treated cells, compared to 100% cell death in untreated controls).
  • treatment with 1 ⁇ DAPT and/or 1 ⁇ ponatinib has no effect on cytotoxicity in this experiment.
  • a beneficial effect is seen from treatment with just 500 nM ponatinib (about 80% reduction in cell death compared to the cell lysis control).
  • DAPT does not attenuate cell death at in this experiment at any does tested between 0.1 ⁇ and 10 ⁇ . This suggests that c-Abl, which is inhibited by ponatinib but not by DAPT, is the target responsible for cell death in these experiments.
  • Transepithelial resistance is preferably measured prior to each treatment period, using the WPI EVOM Voltohmmeter protocol (Sheldon & Steinberg, Exp. Eye Res. (1977) 25(3):235-248; Li et al, Investigative Ophthal. (2007) 48:5722-5732), to confirm that cells in both treatment and control groups have similar or comparable levels of polarization.
  • each well of primary human RPE cells has a resistance greater than 200 ⁇ -cm 2 before beginning the experiment. Resistance of RPE treated with a test compound is measured again, after oxidative stress, and compared to the resistance in untreated RPE subjected to the same oxidative stress procedure. The results from such experiments are shown in Figure 3. Imatinib mesylate, as well as DAPT and ponatinib, attenuate the decrease in transepithelial resistance observed upon after inducing oxidative stress by treatment with TBHP.
  • a test compound's ability to inhibit drusen formation may also be assayed by assaying expression levels of drusen-related proteins (or of genes encoding such proteins) as demonstrated, e.g., in Example 1 above, for both treated and untreated (control) cells. Results from such experiments are depicted in Figure 4. Imatinib mesylate attenuates TBHP-induced up-regulation of drusen-associated protein transcripts, as do DAPT, ponatinib and bosutinib.
  • imatinib mesylate is the most effective at restoring all three of the criteria investigated: RPE cell viability, epithelial resistance and the expression of drusen-related proteins.
  • Test compounds including imatinib mesylate and other compounds identified as candidate drusen inhibitors, e.g., in the in vitro assays demonstrated supra, may also be tested in vivo, using animal models of AMD.
  • Malek et al. Proc. Natl. Acad. Sci. U.S.A. (2005) 102: 1 1900-11905 describe a mouse model, referred to as the APOE4-HFC mouse of AMD that can be used to test compounds in vivo.
  • a candidate or test compound's effect on drusen formation can be tested by administering the compound to such as mouse (e.g., orally, intravenously, parentally or intraocularly) and its effect on drusen formation evaluated by comparing histological changes in the retina or RPE of treated and untreated mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

COMPOSITIONS AND METHODS FOR INHIBITING DRUSEN
SEQUENCE LISTING
[0001] This application includes a Sequence Listing, which is submitted concurrently with the application, via EFS-Web, as an ASCII format text file 174, 166 bytes in size, which was created on March 30, 2012 and named 2756215P.txt. The entire contents of the accompanying Sequence Listing is incorporated herein by reference and in its entirety.
CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to provisional applications Serial No. 61/616,687 filed in the United States Patent and Trademark Office on March 28, 2012 and 61/620,210 filed in the United States Patent and Trademark Office on April 4, 2012. The contents of the prior applications are incorporated herein by reference, in their entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions that modulate the formation of drusen, including compositions and agents that inhibit or reduce drusen formation. The invention also related to compositions and methods which use these compositions to modulate (e.g., reduce or inhibit) drusen formation and are useful, e.g., for treating or preventing diseases and disorders associated with abnormal drusen formation, including age- related macular degeneration (AMD). The invention also relates to novel assays, including in vitro, cell-based assays, that can be used to identify drusen-modulating compositions of the invention.
BACKGROUND
[0004] Age-related macular degeneration (AMD) is a highly prevalent disease and the leading cause of irreversible vision loss among patients over 65 in first world countries. J. Ambati et al, Surv. Opthalmol. (2003) 48(3):257-293; N. Congdon et al. , Arch. Ophthalmol. (2004) 122(4):477-485. Between 6 million and 10 million Americans are estimated to have AMD, and thousands of new cases are diagnosed each year in the United States alone. For example, see Klein et al, Arch. Ophthalmol. (2011) 129(l):75-80; Friedman et al, Arch. Ophthalmol. (2004) 122(4):564-572. [0005] AMD is a progressive disease. Early stages are characterized by the formation of deposits between the retinal pigment epithelium (RPE) and the underlying choroid, which contains the blood supply to the eye. Typically this early stage of the disorder, known as age- related maculopathy, does not affect day-to-day vision. However, people with drusen deposits may go on to form more advanced forms of AMD. Two forms are generally, referred to as "dry" and "wet" AMD. Approximately 90% of AMD patients suffer from the "dry" form of AMD. Dry AMD is characterized by drusen and atrophy of the RPE layer, which causes vision loss through the loss of macular photoreceptor function. Neovascular or exudative AMD, the "wet" form of the disorder, is characterized by choroidal neovascularization; i.e., abnormal blood vessel growth arising from the capillary layer beneath the RPE. Bleeding and scarring from these blood vessels cause irreversible damage to the photoreceptors, resulting in rapid vision loss. Although more severe, the wet form of AMD is less prevalent; only about 10% of AMD patients suffer from wet AMD. Wet AMD may be treated, moreover, with anti-angiogenic or anti-VEGF agents. No medical treatment is available for the more prevalent dry form of AMD, however, although vitamin supplements with high doses of antioxidant may slow its progression. For review, see Jager et al, N. Engl. J. Med. (2008) 358:2606-2617.
[0006] Drusen deposits are widely regarded as the "hallmark lesion" of AMD. Anderson et al, Am. J. Opthalmology (2002) 134:411-431. The appearance of numerous or large confluent drusen strongly correlates with the disease's development and progression. Id. Yet, while they undisputedly play an important role, the exact functional relationship between drusen and AMD remains poorly understood. Electron micrographs have shown RPE exuding cytoplasm from their basal membranes on top of and into drusen, suggesting that drusen may be, at least in part, products of RPE cells. Ishibashi et al, Invest. Ophthalmol. Vis. Sci. (1986) 27(2): 184-193; Ishibashi et al, Am. J. Ophthalmol. (1986) 101(3):342-353. Proteomic analysis of harvested human drusen from both normal and AMD-inflicted eyes have identified a number of proteins that differ in levels of expression. Crabb et al, Proc. Natl. Acad. Sci. U.S.A. (2002) 99: 14682-14687. Interestingly, a number of oxidative protein modifications were also observed in drusen from AMD patients, suggesting that oxidative injury may contribute to the pathogenesis of AMD and that oxidative protein modification plays a critical role in drusen formation. Id. Indeed, epidemiological studies of diet, environmental and behavioral risk factors have also suggested that oxidative stress may be a contributing factor of AMD. Cai et al, Prog. Retin. Eye Res. (2000) 19:205-221.
[0007] Interestingly, many constituents of drusen are also found in pathophysiological deposits associated with other disorders, such as Alzheimer's disease and atherosclerosis; including apoE, complement and amyloid β ("Αβ") peptides, to name a few. Ding et al. Proc. Natl. Acad. Sci. U.S.A. (2011) 108:E279-E287 (published online June 20, 201 1). A number of reports have suggested that Αβ peptide deposition, in particular, may play at least some role in the pathogenesis of AMD. For example, see Ding et al. (2011), supra; Anderson et al., Exp. Eye Res. (2004) 78:243-256; Dentchev et al, Mol. Vis. (2003) 9: 184- 190; Johnson et al, Proc. Natl. Acad. Sci. U.S.A. (2002) 99: 11830-1 1835; Luibl et al, J. Clin. Invest. (2006) 116:378-385; Isas et al, Invest Ophthalmol. Vis. Sci. (2010) 51 : 1304- 1310; Ding et al, Vision Res. (2008) 48:339-345; Malek et al., Proc. Natl. Acad. Sci. U.S.A. (2005) 102: 1 1900-11905; Burban et al, Agin Cell (2009) 8: 162-177. Administration of anti- Αβ antibodies in a mouse model of AMD is reported to partially attenuate the decline in visual function associated with that model. Ding et al. (2008), supra. See also, Ding et al. (201 1), supra; U.S. 2009/0022728 by Lin.
[0008] Subsequent studies have used the human RPE cell line ARPE-19 to model oxidative stress in vitro and have reported up-regulation of a number of proteins in response thereto. See Weigel et al, Free Radic. Biol. Med. (2002) 33(10): 1419-1432; Weigel et al. Free Radic. Biol. Med. (2003) 35(5):465-474; Strunnikova et al, Invest. Ophthalmol. Vis. Sci. (2004) 45(10):3767-3777. See also, Glotin et al, Free Radic. Biol. Med. (2008) 44: 1348-1361. However, studies using these ARPE-19 cells have not been able to demonstrate increased expression of many of the most highly up regulated drusen related proteins identified by Crabb et al, supra. Hence, there remains an ongoing need for in vitro, cell-based models and other assays to study drusen formation and its role in the progression and development of drusen-associated disorders, such as AMD. There also remains an ongoing need for assays that can be used to identify compounds and other agents that modulate (e.g., reduce or inhibit) drusen formation and may be useful for treating drusen- associated disorder such as AMD. SUMMARY OF THE INVENTION
[0009] The present invention is based, in part, on the discovery that a recently discovered retinal pigment epithelial stem cell (RPESC) can be differentiated into mature retinal pigment epithelial (RPE) cells. See Salero et al. Cell Stem Cell (Jan. 6, 2012) 10(1): 1-2; see also U.S. Patent Application Publication No. 2009/0274667 Al and International Patent Application Publication No. WO 2009/132156. The invention is also based in part on the discovery RPE cells derived from such RPESC may be used in vitro to study drusen formation and, in particular, to identify compounds and other compositions that modulate drusen formation in such cells. More specifically, the invention is based in part on the discovery that the expression of proteins associated with drusen formation, and also of genes encoding such proteins, is upregulated in the RPESC-derived RPE cells after subjecting the RPE cells to conditions of oxidative stress, e.g., by exposing them to oxidative agents such as hydrogen peroxide (¾(¾) or tert-butyl hydroperoxide (TBHP). Such drusen-associated genes and proteins include, but are not limited to, the exemplary drusen-associated genes listed in Table I, infra, as well as their gene products - e.g., polypeptides encoded by such drusen- associated genes.
[0010] The invention is also based, in part, on the identification of compounds that inhibit the upregulation of such drusen-associate genes in proteins in the assays of this invention. Such compounds include, inter alia, the compound imatinib and pharmaceutically acceptable salts thereof, such as the mesylate salt. Such compounds are therefore useful, in the novel methods and compositions of these invention, for modulating drusen formation in vitro or in vivo, including methods and compositions for inhibiting or reducing the formation of drusen in vitro or in vivo. Compounds identified in the methods of this invention, including imatinib and pharmaceutically acceptable salts thereof, can also be used in novel therapeutic methods, e.g., to reduce or inhibt drusen formation in a subject, and therefore ameliorate, prevent or inhibit drusen-associated disorders such as age-related macular degeneration (AMD).
[001 1] In conjunction with these discoveries, described herein are methods for inhibiting drusen in a subject comprising administering to a subject in need thereof (e.g., a patient (e.g., a mammal, preferably, a human) suffering from or at risk of developing dry age related macular degeneration (AMD) a composition comprising an inhibitor of one or more, preferably two or more, and most preferably all of the polypeptides selected from the group consisting of gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c-Abl tyrosine kinase (BRC-Abl) and up-regulators of neprilysin. Preferably, the composition comprises an effective amount for inhibiting drusen of imatinib mesylate.
[0012] Preferably, inhibition of drusen comprises inhibiting the expression of one or more drusen-associated polypeptides, e.g., amyloid protein beta (Αβ), amyloid precursor protein (APP), apolipoprotein E (APOE), apolipoprotein J (APOJ), αβ-crystallin, β-site ΑβΡΡ cleaving enzyme 1 (BACE-1), presenilin 1 (PS1), and vascular endothelial growth factor (VEGF)-A. In certain instances, the method can comprise administering imatinib mesylate in combination with another drug or therapy (i.e., a combination therapy) for inhibiting drusen. For example, imatinib mesylate may be co-administered with a small molecule inhibitor of drusen and/or of amyloid beta (Αβ) and/or an antibody that is specific for a drusen-associated protein (e.g., Αβ, APP, BACE-1, etc.). In some instances, imatinib mesylate (or related compound) is directly conjugated to the drusen-associated protein- specific antibody.
[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0014] In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989 (herein "Sambrook et al, 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel, F.M. et al. (eds.). Current Protocols in Molecular Biology. John Wiley & Sons, Inc., 1994. These techniques include site directed mutagenesis as described in Kunkel, Proc. Natl. Acad. Set USA 82: 488- 492 (1985), U. S. Patent No. 5,071, 743, Fukuoka et al. , Biochem. Biophys. Res. Commun. 263 : 357-360 (1999); Kim and Maas, BioTech. 28: 196-198 (2000); Parikh and Guengerich, BioTech. 24: 4 28-431 (1998); Ray and Nickoloff, BioTech. 13 : 342-346 (1992); Wang et al, BioTech. 19: 556-559 (1995); Wang and Malcolm, BioTech. 26: 680-682 (1999); Xu and Gong, BioTech. 26: 639-641 (1999), U.S. Patents Nos. 5,789, 166 and 5,932, 419, Hogrefe, Strategies 14. 3 : 74-75 (2001), U. S. Patents Nos. 5,702,931, 5,780,270, and 6,242,222, Angag and Schutz, Biotech. 30: 486-488 (2001), Wang and Wilkinson, Biotech. 29: 976-978 (2000), Kang et al, Biotech. 20: 44-46 (1996), Ogel and McPherson, Protein Engineer. 5: 467-468 (1992), Kirsch and Joly, Nuc. Acids. Res. 26: 1848-1850 (1998), Rhem and Hancock, J. Bacteriol. 178: 3346-3349 (1996), Boles and Miogsa, Curr. Genet. 28: 197- 198 (1995), Barrenttino et al., Nuc. Acids. Res. 22: 541-542 (1993), Tessier and Thomas, Meths. Molec. Biol. 57: 229-237, and Pons et al, Meth. Molec. Biol. 67: 209-218. The skilled person will know and be able to use these and other techniques routine in the art to practice the present invention.
[0015] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 is a bar graph quantifying the fold induction of the indicated drusen- associated proteins over control in an RPE cell based in vitro model of drusen formation. The "*" indicates statistical significance as determined by the Student's t test (p<0.05).
[0017] Figure 2 is a bar graph quantifying the percent (%) cell death as determined by LDH assay in adult human RPE cells subjected to oxidative stress and treated with the indicated doses of imatinib mesylate ("Gleevec"), DAPT, or ponatinib.
[0018] Figure 3 is a bar graph quantifying the transepithelial resistance (n»cm2) of stressed RPE cells following treatment with the indicated doses of imatinib mesylate ("Gleevec"), DAPT, ponatinib or bosutinib, or vehicle control. [0019] Figure 4 is a bar graph quantifying the mRNA expression level (fold induction over control) of the indicated drusen-associated proteins.
DETAILED DESCRIPTION
[0020] The present invention is based, at least in part, on the discovery that retinal pigment epithelial (RPE) cells derived from an RPE stem cell (RPESC) may be used in vitro to study drusen formation and, in particular, to identify compounds and other compositions that modulate drusen formation in such cells. More specifically, the invention is based in part on the discovery that the expression of proteins associated with drusen formation, and also of genes encoding such proteins, is upregulated in the RPESC-derived stems cells after subjecting the cells to conditions of oxidative stress, e.g., by exposing them to oxidative agents such as hydrogen peroxide (H2O2) or tert-butyl hydroperoxide (TBHP). Such drusen- associated genes and proteins include, but are not limited to, the exemplary drusen-associated genes listed in Table I, infra, as well as their gene products - e.g., polypeptides encoded by such drusen-associated genes.
[0021] The invention is also based, in part, on the identification of compounds that inhibit the upregulation of such drusen-associate genes in proteins in the assays of this invention. Such compounds include, inter alia, the compound imatinib and pharmaceutically acceptable salts thereof, such as the mesylate salt. Such compounds are therefore useful, in the novel methods and compositions of these invention, for modulating drusen formation in vitro or in vivo, including methods and compositions for inhibiting or reducing the formation of drusen in vitro or in vivo. Compounds identified in the methods of this invention, including imatinib and pharmaceutically acceptable salts thereof, can also be used in novel therapeutic methods, e.g., to reduce or inhibt drusen formation in a subject, and therefore ameliorate, prevent or inhibit drusen-associated disorders such as age-related macular degeneration (AMD).
Drusen
[0022] Drusen are small, extracellular deposits that form between the retinal pigment epithelium (RPE) and the underlying Bruch's membrane, which separates the RPE from the choriocapillaria that supply blood to the eye. They are visible in an ophthalmoscopic examination as focal yellow dots. See, for example, Figure 1 of Williams, Age and Ageing (2009) 38:468-654. [0023] Drusen deposits contain a number of different denatured proteins and protein fragments, as well as lipids, carbohydrates and trace elements such as zinc. Protein components include, without limitation, apolipoproteins and members of the complement system, such as complement factor H. Other, non-limiting examples of drusen-associated proteins include αΑ-crystallin, αΒ-crystallin, βΒ 1 -crystallin, βΒ2 -crystallin, Ps-crystallin, aA4-crystallin, Αβ. APP, APOE, APOJ, BACE-1, PS1, VEGF, VEGF Rl, VEGF R2, PEDF, CC9, serum amyloid P, TIMP3, vitronectin, as well as fragments and derivatives of those proteins that may be created, e.g., by oxidative damage. Exemplary sequences for these drusen-associated proteins, and/or for genes encoding them, are known in the art and include, by way of example, the sequences identified in Table 1 below, by their GenBank® Accession numbers.
TABLE 1; EXEMPLARY DRUSEN ASSOCIATED SEQUENCES
Figure imgf000009_0001
TABLE 1; EXEMPLARY DRUSEN ASSOCIATED SEQUENCES
Figure imgf000010_0001
RPE Cell-based Screening Assay
[0024] In the present invention, compounds and other compositions that modulate or affect drusen formation are preferably identified using in vitro cell-based models and assays for drusen formation, such as those described in the Examples, infra. Such models and assays preferably use cells or cell lines that are derived from a retinal pigment epithelial stem cell (RPESC). In preferred embodiments, the models and assays of this invention make use of retinal pigment epithelial (RPE) cells that are derived from the RPESC.
[0025] Cells used in the assays and models of the invention overexpress drusen- associated polypeptides and/or genes encoding the same when subject to conditions of oxidative stress, such as treating the cells with hydrogen peroxide (H2O2) or with tert-butyl hydroperoxide (TBHP). Preferred drusen-associated polypeptides and genes include those identified, supra, including, without limitation, drusen-associated polypeptides and genes comprising the sequences identified in Table 1, supra, by their GenBank® accession numbers. Specific, preferred examples include, without limitation, ap2-crystallin, Αβ, APP, APOJ, APOE, BACE-1, PS1, TMP3, CC9 and VEGF.
[0026] Generally speaking, assays of the invention involving culturing RPE derived from the RPESC under conditions of oxidative stress (e.g., in the presence of ¾(¾, TBHP or another oxidative reagent). The cells may then be incubated with a test compound, either before, after or during their exposure to the oxidative stress conditions, and the expression of one or more drusen-associate polypeptides and/or genes is determined. Those expression levels may then be compared to one or more controls, and are preferably compared to expression levels of the same drusen-associated polypeptides and/or genes in the same cell line that are cultured under identical conditions of oxidative stress but without exposure to the test compounds. Preferably, the expression levels are also compared to expression levels of the same drusen-associated polypeptides and/or genes in cells of the same cell line that are not cultured under conditions of oxidative stress. Where, in cells incubated with the test compound, the determined expression levels, under the oxidative stress conditions, of the one or more drusen-associated polypeptides and/or genes are down regulated, compared to their expression levels, under the oxidative stress conditions, in cells that are not incubated with the test compound, the compound is thus identified as a compound which affects drusen formation and, in particular, as a compound that reduces or inhibits drusen formation. In preferred embodiments, the test compound is identified as a compound that reduces or inhibits drusen formation when determined expression levels of the one or more drusen- associated polypeptides and/or genes under oxidative stress conditions, in the cells incubated with that test compound, are identical or substantially similar to their expression levels in cells not cultured under conditions of oxidative stress.
RPE Stem Cells (RPESCs)
[0027] Methods for isolation and culture of RPESCs are known and described in detail, e.g., in U.S. Patent Application Publication No. 2009/0274667 by Temple et al. See also, Salero et al, Cell Stem Cell (2012) 10:88-95. In the in vitro RPE cell-based assay, isolated RPE cells are activated to a stem cell state, the RPESC, and then cultured to produce diverse progeny. Some of the RPESC progeny are pathologic in that they over-express drusen proteins. De et al, Arch Ophthalmol. (2007) 125:641-646; and Salero et al. Cell Stem Cell (2012) 10:88-95. Such pathologic, drusen protein-expressing RPESC progeny serve as a "disease-in-a-dish" model for drusen formation in RPE cells, and the RPE screening assay described in the present Examples can thus be used to characterize one or more effects of a test compound on the RPE cells, and, in particular, to identify candidate drusen inhibitors.
[0028] The pathologic, drusen-forming progeny RPE cells of the assay can be treated in conditions, such as, e.g., induction of cellular stress using, e.g., tert-butyl hydroperoxide (TBHP) or H2O2, that cause further upregulation of drusen-associated polypeptides, as well as affect other characteristics of the cells that are associated with drusen formation and/or AMD. Such characteristics may include, for example, cell viability and epithelial integrity, and then the ability of a test substance to inhibit one or more of the characteristics induced by the cellular stress (e.g., upregulated drusen-associated polypeptide expression levels, cell death, and decreased epithelial integrity) can be determined. However, in certain instances, the RPE cells can be used in the screening assay to identify candidate drusen inhibitors without first inducing artificial cellular stress because there is a low level of background oxidative stress normally present in the culture media that is sufficient to induce a low level of expression of drusen protein and other characteristics of drusen and AMD .
[0029] Preferably, although not necessarily, a candidate compound identified by the present RPE assay inhibits 1 or more, or 2 or more, of the characteristics of the drusen- protein expressing RPE cells (e.g., decreased viability, decreased epithelial integrity, and increased drusen protein expression). For example, a candidate compound may inhibit expression of one or more drusen-associated polypeptides (i.e., is an inhibitor of drusen) and/or one or more other characteristics of RPE cells of the assay (e.g., decreased viability and decreased epithelial integrity). In some embodiments, the RPE cells may be treated with an inducer of cellular stress (e.g., H202, TBHP or Αβ). Most preferably, although not necessarily, an inhibitor identified as an inhibitor of drusen may also inhibit cell death and loss of epithelial integrity, e.g., as induced, e.g., by cellular stress and/or by the presence of drusen or drusen-like deposits.
[0030] Expression levels of a drusen-associated polypeptide in the cultured RPE cells can be determined according to any suitable method known in the art, such as, e.g., quantitative, real-time reverse transcriptase polymerase chain reaction (qPCR) or Northern blot (to quantify mRNA expression), and/or immunocytochemical staining, Western blot, and/or ELISA (to quantify protein expression). For example, the expression or level of such proteins can be detected using immunohistochemistry, immunofluorescence, Western blotting, protein chip technology, immunoprecipitation, ELISA assay, or mass spectrometry using standard methods known in the art. These methods can be performed using antibodies or antigen- binding antibody fragments that specifically bind to that mammalian (e.g., human) protein. Detection using these antibodies or antigen-binding antibody fragments can be facilitated by coupling the antibody or antigen-binding antibody fragment to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta- galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 1311, 35S or 3H.
[0031] Preferably, a test substance may be identified in the screening assay as a drusen inhibitor, if the expression level one or more of the drusen-associated polypeptides described herein (e.g., ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PS1, TMP3, CC9 and VEGF A) is decreased following treatment of the cells with the test substance. More preferably, the expression level of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 or more drusen-associated polypeptides is decreased, compared to the level in the absence of treatment with the test substance.
[0032] In another embodiment, a test substance may be identified as an inhibitor of drusen if the test substance decreases the upregulated expression level of one or more of the drusen-associated polypeptides described herein (e.g., as ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PS 1, TMP3, CC9 and VEGF A) resulting from induction of cellular stress (e.g., with TBHP, H202 or Αβ ). More preferably, the upregulated expression levels of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 or more drusen-associated polypeptides are decreased, compared to the levels in the absence of treatment with the test substance.
[0033] Preferably, for a test substance that is identified as an inhibitor of drusen, the upregulated expression level of one or more drusen-associated polypeptides (e.g., mRNA and/or protein level) that results from induction of cellular stress is decreased relative to the negative control (e.g., no treatment or treatment with a vehicle) by at least 1.5-fold, at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 10-fold, or more.
[0034] Libraries screened using the methods of the present invention can comprise a variety of types of test compounds. A given library can comprise a set of structurally related or unrelated test compounds. In some embodiments, the test compounds are peptide or peptidomimetic molecules. In some embodiments, the test compounds are nucleic acids. In some embodiments, the test compounds and libraries thereof can be obtained by systematically altering the structure of a first test compound, e.g., a first test compound that is structurally similar to a known natural binding partner of the target polypeptide, or a first small molecule identified as capable of binding the target polypeptide, e.g., using methods known in the art and/or described herein, and correlating that structure to a resulting biological activity, e.g., a structure-activity relationship study. As one of skill in the art will appreciate, there are a variety of standard methods for creating such a structure-activity relationship. Thus, in some instances, the work may be largely empirical, and in others, the three-dimensional structure of an endogenous polypeptide or portion thereof can be used as a starting point for the rational design of a small molecule compound or compounds. For example, in one embodiment, a general library of small molecules is screened, e.g., using the methods described herein. In some embodiments, a monoclonal antibody directed against a polypeptide can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with the polypeptide of interest. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01 ; and the Stratagene SurfZAP* Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Pat. No. 5,223,409; WO 92/18619; WO 91/17271; WO 92/20791 ; WO 92/15679; WO 93/01288; WO 92/01047; WO 92/09690; WO 90/02809; Fuchs et al, Bio/Technology 9: 1370-1372, 1991 ; Hay et al, Hum. Antibod. Hybridomas 3:81-85, 1992; Huse et al, Science 246: 1275-1281, 1989; Griffiths et al, EMBO J. 12:725-734, 1993. In some embodiments, the antigen-binding antibody fragment is a Fab fragment, a F(ab')2 fragment, and a scFv fragment. Methods f or generating these antibody fragments are known in the art.
[0035] Included herein are methods for screening test compounds, e.g., polypeptides, polynucleotides, inorganic or organic large or small molecule test compounds, antibodies, to identify agents which are inhibitors of drusen formation. As used herein, "small molecules" refers to small organic or inorganic molecules of molecular weight below about 3,000 Daltons. In general, small molecules useful for the invention have a molecular weight of less than 3,000 Daltons (Da). The small molecules can be, e.g., from at least about 100 Da to about 3,000 Da (e.g., between about 100 to about 3,000 Da, about 100 to about 2500 Da, about 100 to about 2,000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da). The test compounds can be natural products, known therapeutics, small molecules, nucleic acids, or members of a combinatorial chemistry library. A set of diverse molecules should be used to cover a variety of functions such as charge, aromaticity, hydrogen bonding, flexibility, size, length of side chain, hydrophobicity, and rigidity. Combinatorial techniques suitable for synthesizing small molecules are known in the art, e.g., as exemplified by Obrecht and Villalgordo, Solid- Supported Combinatorial and Parallel Synthesis of Small-Molecular- Weight Compound Libraries, Pergamon-Elsevier Science Limited (1998), and include those such as the "split and pool" or "parallel" synthesis techniques, solid-phase and solution-phase techniques, and encoding techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio. 1 :60-6 (1997)). In addition, a number of small molecule libraries are commercially available. A number of suitable small molecule test compounds are listed in U.S. Patent No. 6,503,713, incorporated herein by reference in its entirety.
[0036] Cell viability can be measured according to any suitable method. For example, cell death can be measured using an LDH assay, which measures the amount of lactate dehydrogenase released from dead and dying cells. Other assays for cell viability include measuring Annexin V expression. Typically, a test substance may be identified as a candidate inhibitor of drusen in the assay, if the test substance restores cell viability in RPE cells overexpressing drusen proteins (e.g., following induction of cellular stress). Restoration of cell viability can be determined, e.g., by measuring decreases in cell death compared to a control (e.g., cell lysate or RPE cells that had been treated with a cell stress inducer (e.g., TBHP), but no test substance). Preferably, cell death is decreased, relative to the control, by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% (i.e., completely).
[0037] The ability of a test substance to restore transepithelial resistance may also be determined in the RPE cell-based assay. RPE cells are a tight junctioned epithelia and compromised epithelial integrity is a hallmark of RPE-associated diseases, such as, e.g., dry AMD. Healthy epithelial cells exhibit a high resistance measurement that can be easily experimentally assessed. Transepithelial resistance can be measured using, e.g., the WPI EVOM Voltohmmeter protocol (described by the manufacturer of the volt-ohm meter available from World Precision Instruments (Sarasota, FL). Typically, in the assay, the RPE cells are permitted to reach a resistance of >200n»cm2 prior to beginning the experiment. Compromised cells (i.e., poor epithelial integrity) will typically have a resistance of less than 200n»cm2. Table 2 below shows exemplary compounds identified by screening assays of the invention, which may be useful in methods of the invention, e.g., for treating AMD and/or inhibiting drusen formation.
TABLE 2:
EXEMPLARY CANDIDATE COMPOUNDS
Figure imgf000016_0001
[0038] In some embodiments, a test compound is applied to a test sample, e.g., a cell or living tissue or organ (e.g., an eye) and one or more effects of the test compound is evaluated. In a cultured or primary cell for example, the ability of the test compound to decrease the expression levels of one or more of the drusen associated polypeptides following treatment of the cells with the test sample. Further, in a cultured or primary cell for example, the ability of the test compound to decrease the expression levels of one or more of the drusen associated polypeptides resulting from induction of oxidative stress following treatment of the cells with the test sample.
[0039] In some embodiments, the test sample is, or is derived from (e.g., a sample taken from) an in vivo model of a disorder as described herein. For example, an animal model, e.g., a rodent such as a rat, can be used.
[0040] A test compound that has been screened by a method described herein and determined to affect drusen associated proteins, can be considered a candidate compound. A candidate compound that has been screened, e.g., in an in vivo model of a disorder, e.g.,AMD and determined to have a desirable effect on the disorder, e.g., on one or more symptoms of the disorder, can be considered a candidate therapeutic agent. Candidate therapeutic agents, once screened in a clinical setting, are therapeutic agents. Candidate compounds, candidate therapeutic agents, and therapeutic agents can be optionally optimized and/or derivatized, and formulated with physiologically acceptable excipients to form pharmaceutical compositions.
[0041] Thus, test compounds identified as "hits" e.g., test compounds that show a marked decreased in drusen associated proteins in a first screen can be selected and systematically altered, e.g., using rational design, to optimize binding affinity, avidity, specificity, or other parameter. Such optimization can also be screened for using the methods described herein. Thus, in one embodiment, the invention includes screening a first library of compounds using a method known in the art and/or described herein, identifying one or more hits in that library, subjecting those hits to systematic structural alteration to create a second library of compounds structurally related to the hit, and screening the second library using the methods described herein.
[0042] Test compounds identified as hits can be considered candidate therapeutic compounds, useful in treating disorders associated with the eye as described herein, e.g., AMD. A variety of techniques useful for determining the structures of "hits" can be used in the methods described herein, e.g., NMR, mass spectrometry, gas chromatography equipped with electron capture detectors, fluorescence and absorption spectroscopy. Thus, the invention also includes compounds identified as "hits" by the methods described herein, and methods for their administration and use in the treatment, prevention, or delay of development or progression of a disorder described herein.
[0043] Test compounds identified as candidate therapeutic compounds can be further screened by administration to cell model of a disorder described herein e.g. AMD. The cell line (or tissue) can be monitored for a change in the disorder, e.g., for an improvement in a parameter of the disorder, e.g., a parameter related to clinical outcome. In some embodiments, the parameter is viability of the cell, and an improvement would be decreased cell death. In some embodiments, the parameter is epithelial integrity or resistance, and an improvement would be increased integrity or resistance of the epithelial cell layer.
[0044] Test compounds identified as candidate therapeutic compounds can be further screened by administration to an animal model of a disorder described herein. The animal can be monitored for a change in the disorder, e.g., for an improvement in a parameter of the disorder, e.g., a parameter related to clinical outcome. In some embodiments, the parameter may be reduced appearance of drusen, and an improvement may be be decreased leakage from blood vessels or decreased atrophy of the RPE layer. In some embodiments, the subject is a human, e.g., a human with AMD. In such embodiments, the parameter used may be, e.g., reduced drusen and an improvement may be decreased leakage from blood vessels or decreased atrophy of the RPE layer.
Imatinib mesylate
[0045] As demonstrated in Example 2, imatinib mesylate (also known as Gleevec® ( ovartis Pharmaceuticals, East Hanover, NJ)) was identified using the RPE cell-based screening assay described, above, as an inhibitor of drusen. Imatinib mesylate is approved by the FDA for use in humans for the treatment of cancer.
[0046] Imatinib mesylate has the formula C29H31N7O and the IUPAC name 4-[(4- methylpiperazin- 1 -yl)methyl] -N-(4-methyl-3 - { [4-(pyridin-3 -yl)pyrimidin-2- yl]amino}phenyl)benzamide. Imatinib mesylate is described in detail in U.S. Patent No. 6,894,051. The free form, imatinib, is also encompassed by the present invention.
[0047] Imatinib mesylate-like compounds and imatinib mesylate-related compounds (e.g., derivatives), as well as different crystalline forms (e.g., beta form described in USP 6,894,051) may be used to inhibit drusen, as described herein. Such compounds are known and described in the art. For example, AMN107 is a modified form of imatinib mesylate that is 20-fold more potent that imatinib mesylate. (See, O'Hare et al. 2005 Cancer Cell; 7: 117- 119.) Other examples include BMS-354825 and ON012380, also described in O'Hare et al. Other derivatives of imatinib mesylate can be designed by one of skill in the art, and such derivatives are also encompassed herein. For example, the piperazine moiety of imatinib mesylate can be modified to improve binding.
[0048] The skilled artisan can readily determine whether an imatinib mesylate related compound is encompassed by the present invention, e.g., by testing the compound in the RPE screening assay described above. For example, an imatinib mesylate-related compound encompassed by the present invention will decrease the expression level of at least one drusen-associated polypeptide (e.g., at least one of ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PSl, TMP3, CC9 and VEGF A) in the RPE assay compared to a control group (e.g., no test compound). Further, an imatinib mesylate-related compound and/or imatinib mesylate derivative will preferably inhibit one or more, more preferably two or more, and most preferably all of the polypeptides selected from the group consisting of gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR), and c- Abl tyrosine kinase (BRC-Abl) to inhibit APP and Αβ production and upregulation of neprilysin to increase abeta breakdown
[0049] Modified, crystalline imatinib mesylate compounds and/or imatinib mesylate- related compounds are described e.g., in U.S. Patent No. 6,894,051 to Zimmermann.
[0050] Other drugs (e.g., small molecules) that may or may not be related to (i.e., have a similar chemical structure) or derived from imatinib mesylate are also encompassed by the present invention, provided that they inhibit one or more, more preferably two or more, and most preferably all of the polypeptides selected from the group consisting of gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c- Abl tyrosine kinase (BRC-Abl). Further, such drugs preferably decrease the expression level of at least one drusen-associated polypeptide (e.g., at least one of ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PSl, TMP3, CC9 and VEGF A), e.g., in the RPE assay described herein, compared to a control group (e.g., no drug). Also, the upregulation of drugs that accelerate Αβ Preakdown such as up-regulates neprilysin are considered. Pharmaceutical Formulations
[0051] While the compositions of the invention may be administered alone, in certain embodiments, it may be preferable to formulate the composition in combination with a pharmaceutically acceptable carrier.
[0052] As used herein, the phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are generally believed to be physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
[0053] The term "pharmaceutically acceptable derivative" as used herein means any pharmaceutically acceptable salt, solvate or prodrug, e.g., ester, of a compound of the invention, which upon administration to the recipient is capable of providing (directly or indirectly) a compound of the invention, or an active metabolite or residue thereof. Such derivatives are recognizable to those skilled in the art, without undue experimentation. Nevertheless, reference is made to the teaching of Burger's Medicinal Chemistry and Drug Discovery, 5th Edition, Vol 1 : Principles and Practice, which is incorporated herein by reference to the extent of teaching such derivatives. Preferred pharmaceutically acceptable derivatives are salts, solvates, esters, carbamates, and phosphate esters. Particularly preferred pharmaceutically acceptable derivatives are salts, solvates, and esters. Most preferred pharmaceutically acceptable derivatives are salts and esters.
[0054] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Solutions or suspensions used for parenteral application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0055] Pharmaceutical compositions suitable for injection or infusion typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. Pharmaceutical formulations are ideally stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. In general, the relevant carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0056] Sterile injectable solutions can be prepared by incorporating the active agent (e.g., imatinib mesylate) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the purified antibody or antigen binding fragment into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, exemplary methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0057] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active agent (e.g., imatinib mesylate) can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
[0058] For administration by inhalation, the pharmaceutical formulation is preferably delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
[0059] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the purified polypeptide or protein and delivery agents are formulated into ointments, salves, gels, or creams as generally known in the art.
[0060] In certain embodiments, compositions are prepared with carriers that will protect the active agent (e.g., imatinib mesylate) against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,81 1, the disclosure of which is incorporated herein by reference in its entirety. [0061] Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the formulation. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. Formulations for oral delivery may advantageously incorporate agents to improve stability within the gastrointestinal tract and/or to enhance absorption.
[0062] Formulations for intraocular administration can include formulation suitable for injection or infusion described above which typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravitreous administration, suitable carriers include physiological saline, bacteriostatic water, PLGA, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). For review, see, Kuno & Fujii, Polymers (2011) 3 : 193-221. In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. Further, a composition can be adapted to be used as eye drops, or injected into or around the eye, e.g., using peribulbar or intravitreal injection. Such compositions should be sterile and substantially endotoxin-free, and within an acceptable range of pH. Certain preservatives are thought not to be good for the eye, so that in some embodiments a non-preserved formulation is used. Formulation of eye medications is known in the art, see, e.g., Ocular Therapeutics and Drug Delivery: A Multi- Disciplinary Approach, Reddy, Ed. (CRC Press 1995); Kaur and Kanwar, Drug Dev Ind Pharm. 2002 May;28(5):473-93; Clinical Ocular Pharmacology, Bartlett et al. (Butterworth- Heinemann; 4th edition (March 15, 2001)); and Ophthalmic Drug Delivery Systems (Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs), Mitra (Marcel Dekker; 2nd Rev&Ex edition (March 1, 2003)).
[0063] It is advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active agent (e.g., imatinib mesylate) calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
Methods of Treatment
[0064] Described herein are methods for inhibiting drusen (e.g., decreasing drusen deposits and/or inhibiting drusen deposits). The presence of drusen deposits in the RPE is the hallmark feature of dry AMD. Thus dry AMD can be treated according to the method described herein.
[0065] While not intending to be bound by one particular theory or mechanism of action, the treatment methods described herein are thought to treat drusen, at least in part, by reducing the expression level of one or more drusen-associated polypeptides (e.g., APP, Αβ, APOE, APOJ, αβ-crystallin, BACEl, PSl, VEGF-A), thereby reducing drusen biosynthesis and/or the size and/or number of existing drusen and/or drusen-like deposits. Thus, efficacy of treatment with a composition or formulation described herein in a subject suffering from or at risk of developing a drusen-associated disease or condition (e.g., dry AMD) can be determined, e.g., by quantifying the number of drusen (and/or drusen-like) deposits at the affected site (e.g., RPE layer of retina) and/or by measuring the size of one or more drusen and/or drusen-like deposits, wherein, preferably, the treatment reduces the size and/or number of drusen and/or drusen-like deposits at the affected site.
[0066] Preferably, the size and/or number of drusen and/or drusen-like deposits at the affected site (e.g., RPE) is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% (i.e., completely), compared to the size and/or number of drusen and/or drusen-like deposits prior to or at the beginning of the treatment.
Administration and Dosage
[0067] Compositions and formulations can be administered topically, intraocularly, parenterally, orally, by inhalation, as a suppository, or by other methods known in the art. The term "parenteral" includes injection (for example, intravitreous, intravenous, intraperitoneal, epidural, intrathecal, intramuscular, intraluminal, intratracheal or subcutaneous). A preferred route of administration is intraocular, for example by intravitreous injection.
[0068] Compositions may be administered as needed, e.g., once a day, twice a day, or more often. However, those skilled in the art will appreciate that it is preferable to minimize the frequency of administration needed to obtain a therapeutic effect, to minimize or reduce the risk of damage, e.g., from excessive intravitreous injection into a patient's eye. Frequency may be decreased during a treatment maintenance phase of the disease or disorder, e.g., once every second or third day instead of every day or twice a day. The dose and the administration frequency will depend on the clinical signs (e.g., presence or absence or decreased levels of drusen or drusen-like deposits).
[0069] It will be appreciated that the amount of active agent (e.g., imatinib mesylate or related compound) required for use in treatment will vary with the route of administration, the nature of the condition for which treatment is required, and the age, body weight and condition of the patient, and will be ultimately at the discretion of the attendant physician or veterinarian. Compositions will typically contain an effective amount (e.g., therapeutically effective amount) of the active agent(s), alone or in combination. Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration can be performed according to art-accepted practices.
[0070] The initial dose may be larger, followed by smaller maintenance doses. The dose may be administered, e.g., weekly, biweekly, daily, semi-weekly, etc., to maintain an effective dosage level. An effective amount of the composition may be the amount administered after a single administration, or may be the total amount administered over a plurality of administrations, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, etc., administrations of the composition.
[0071] Therapeutically effective dosages can be determined stepwise by combinations of approaches such as (i) characterization of effective doses of the composition or compound in in vitro cell culture assays, e.g., using the RPE cell-based model described herein (see, e.g., Example 1) in which drusen protein expression and/or cell viability is used as a readout, followed by (ii) characterization in animal studies using drusen formation as a readout, followed by (iii) characterization in human trials using decreased drusen formation (e.g., in the RPE) as a readout.
[0072] Exemplary dosages of imatinib mesylate, e.g., for administration in tablet form, are 400-800 mg/day for adult patients. A starting dose of 100 mg/day may be considered for some patients, and the dose may then be subsequently increased, depending on the response and the experience of side effects. Intraocular dosages of 1, 10, 100 and 1000 micrograms are contemplated with the preferred dose of 10 or 100 microgrqams.
Combination Therapy
[0073] The drusen-inhibitors of the invention (e.g., imatinib mesylate and its related compounds) can be administered in combination with other therapeutic agents, e.g., for the treatment of drusen. For example, a drusen inhibitor can be administered with an agent that reduces amyloid beta (Αβ), a peptide which has been found to be associated with drusen formation, or other drusen-associated polypeptides.
[0074] In certain embodiments, a drusen inhibitor can be co-administered with a therapeutic agent that increases cellular integrity and/or reduces the effect of reactive oxygen species and/or other cell damage associated with amyloid and/or amyloid-like deposits such as drusen. In certain embodiments, a drusen inhibitor described herein can be coadministered with a Bcr-Abl inhibitor, such as, e.g., ponatinib, bosutinib, dasatinib or PD180970 (La Rosee et al. 2002; Cancer Res 62:7149-7153), or retinoid X receptor agonists such as bexarotene that increase APP and Αβ clearance, or an inhibitor of γ-secretase APP/Notch (e.g., DAPT), or sunitinib (a PDGFR inhibitor). Such inhibitors are available commercially, e.g., from Axon Medchem (Netherlands).
[0075] In another embodiment, a drusen inhibitor (e.g., imatinib mesylate or related compound) can be directly conjugated to another agent. The other agent can be another therapeutic agent (e.g., small molecule drug or antibody). In a preferred embodiment, the drusen inhibitor is conjugated to an antibody that specifically binds to amyloid beta (Αβ) or another polypeptide found in drusen deposits (e.g., ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PS 1, TMP3, CC9 or VEGF A). The antibody may be a therapeutic antibody (e.g., one that itself inhibits drusen, e.g., by promoting clearance of deposits and/or by decreasing expression of one or more drusen-associated polypeptides) and/or may aid in targeting the drusen inhibitor (e.g., imatinib mesylate or related compound) to the drusen deposit through specific binding. Such antibodies are known and have been described. See, e.g., U.S. Patent Application Publication Nos. 201 1/0020237 by Glabe et al. and 2009/0069258 by Chain, and U.S. Patent No. 7,901,689 by Chain.
[0076] Combination therapy can be sequential therapy where the subject is treated first with one composition or drug and then the other, or alternatively, the two drugs can be given simultaneously and administered to the same or different sites in the same or different frequencies and amounts. If administered at different times, the time interval between the initial and/or subsequent administrations of each drug or therapy can be determined by the subject's physician. However, exemplary intervals can include 1 hour or more, 2 hours or more, 3 hours or more, 4 hours or more, 5 hours or more, 6 hours or more, 7 hours or more, 8 hours or more, 9 hours or more, 10 hours or more, 12 hours or more, 24 hours or more, 2 days or more 5 days or more, and 7 days or more, between the administration of the first and second drugs or therapies.
[0077] Certain embodiments of methods and compositions provided herein are further illustrated by the following Examples, which are provided for illustrative purposes only. The Examples are not to be construed as limiting the scope or content of the invention in any way.
EXAMPLES
Example 1 :
Retinal Pigment Epithelial Stem Cell (RPESQ-Based Model of Drusen Formation
[0078] This example describes experiments showing that the expression of various drus en-related proteins, and genes encoding them, is unregulated in RPE derived from RPESC, after exposing the RPE to oxidative stress in vivo. The results show that RPE derived from such stem cells can be used as an in vivo model for drusen formation, e.g., to indentify compounds that modulate drusen formation.
[0079] More specifically, retinal pigment epithelial (RPE) cells are derived from RPE stem cells (RPESCs) and cultured using methods described, e.g., by Salero et al. (Cell Stem Cell (201 1) 10:88-95) and/or in U.S. patent application publication No. 2009/0274667. Briefly, human RPE cells are dissected from cadaveric human eyes and cultured in RPE-THT media (DMEM/F12, lx THT, 1% L-glutamine, 1% penicillin/streptomycin, 1% Nl supplement) from Sigma-Aldrich (St. Louis, MO) containing 10% fetal bovine serum (FBS) tapered down to 5FBS for approximately 60 days or until confluent on a Falcon Primaria 24- well plate or on a placental extracellular matrix-coated transwell membrane. Once confluent, the passage zero RPE are split into wells to be used for experiments, and again tapered from 10% to 5% FBS in RPE-THT media. The RPE are then allowed to grow until transepithelial resistance (measured weekly using a WPI Voltohmeter) is greater than 200 Ω-cm2. The RPE are then transferred into RPE Classic media (DMEM/F12, 1% sodium pyruvate, 1% L- glutamine, 1% penicillin/streptomycin) with 5% FBS for the remainder of the experiment(s). Primary hRPE are passage 1-3 for the experiments described here.
[0080] Chronic oxidative stress may be induced following the protocol described by Glotin et al. (Free Radio. Biol. Med. (2008) 44: 1348-136), adapted and modified as described herein. Specifically, RPE cells in confluent wells are fed with RPE Classic media with 5% FBS and containing between 500 μΜ and 2 mM tert-butyl hydroperoxide (TBHP) or H2O2 (to induce oxidative stress) or vehicle (for controls) for two hours each day over a period of five consecutive days, and then rested in RPE Classic media for 24 hours.
[0081] RNA is isolated from the RPE cells at the end of the 24 hour rest period, according to the protocol in the Qiagen RNeasy Micro/Mini Kits. Once isolated, the RNA is converted into cDNA using a high-capacity RNA to cDNA conversion kit (Applied Biosystems). The resulting cDNA is then used in a qPCR assay, to quantitate expression of various drusen-associated genes, including genes encoding: aA-crystallin, aB-crystallin, βΒ Ι-crystallin, pB2-crystallin, Ps-crystallin, aA4-crystallin, APP, APOE, APOJ, BACE-1, PS1, VEGF, VEGF Rl, VEGF R2, PEDF, CC9, serum amyloid P, TIMP3, vitronectin, and H2AE. The expression level of one or more housekeeping genes, such as ribosomal S18 and GAPDH, is also quantitated. Forward and reverse PCR primers having the nucleotide sequences shown in Table 2, below, may be used with a SYBR green reporter from Applied Biosystems.
Table 2: Primer Sequences for Detecting Drusen-Associated Protein Expression
Figure imgf000028_0001
mR A Transcript Forward Primer (5'-3') Reverse Primer (5'-3')
AAGGGAGAGCAGTTTGTGTTTGAG CTTGTGCTCTTGGCTGTCCACTTT
pB2-crystallin
(SEQ ID NO:47) (SEQ ID NO:48)
GTATGAAACCACCGAAGATTGCCCTTCC AGACACCCTCCAGCACCTTACA
Ps-crystallin
(SEQ ID NO:49) (SEQ ID NO:50)
ATGGGATGGGAAGGCAATGAAGTAGG CCGGAAATGTTTGTAGTCACCGGAATG
aA4-crystallin
(SEQ ID NO:51) (SEQ ID NO:52)
Amyloid-β Related Proteins
CCGCTGCTTAGTTGGTGAGTTTGT ACGGTGTGCCAGTGAAGATGAGTT
APP
(SEQ ID NO:53) (SEQ ID NO:54)
AACTGGCACTGGGTCGCTTT GCCTTCAACTCCTTCATGGTCTCGT
APOE
(SEQ ID NO:55) (SEQ ID NO:56)
ATTTATGGAGACCGTGGCGGAGAAAG CTGGTTACTTGGTGACGTGCAGAG
APOJ
(SEQ ID NO:57) (SEQ ID NO:58)
CAGACAAGTTCTTCATCAACGGCTCCAAC TTGGGAACGTGGGTCTGCTTTAC
BACE-1
(SEQ ID NO: 59) (SEQ ID NO:60)
GAGTTACCTGCACCGTTGTCCTACTT TGTGCTCCTGCCGTTCTCTATTGT
PSl
(SEQ ID NO:61) (SEQ ID NO:62)
Vascular Proteins
TCTTCAAGCCATCCTGTGTG ATCCGCATAATCTGCATGGT
VEGF A
(SEQ ID NO:63) (SEQ ID NO:64)
TCTGGGACAGTAGAAAGGGCTTCATC ACTGGGCGTGGTGTGCTTATTT
VEGF Rl
(SEQ ID NO:65) (SEQ ID NO:66)
CCTCTGTGGGTTTGCCTAGTGTTTCT CCCTTTGCTCACTGCCACTCTGATTATTG
VEGR R2
(SEQ ID NO: 67) (SEQ ID NO:68)
GCCCTGGTGCTACTCCTCT GCATCGAGACTATCGCTAATGAG
PEDF
(SEQ ID NO: 69) (SEQ ID NO:70)
Inflammation-Related Proteins
ACGAACAGCAGGCTATGGGATCAA CACGTTCCAAGGTCTTCGGTAGTATGT
CC9
(SEQ ID NO:71) (SEQ ID NO:72)
AGACCTCAGTGGGAAGGTGTTTGT CTTGGGTATTGTAGGAGAAGAGGCTGTAGG
Serum Amyloid P
(SEQ ID NO:73) (SEQ ID NO:74)
Basement Membrane Proteins
TTCCCTTTGCCCTTCTCCTCCAATAC CCTTGAGTCTATCTGCTTGCTGCCTTT
TIMP3
(SEQ ID NO:75) (SEQ ID NO:76)
TTTAGGCATCGCAACCGCAAAGG GCCAGTCCATCCTGTAGTCATCATAGTT
Vitronectin
(SEQ ID NO: 77) (SEQ ID NO:78)
Misc. Drusen Proteins
TGCTGTTAGGAAGCCACTATGTCTGG ACACGGCCAACTGGAAACTGAA
H2AE
(SEQ ID NO: 79) (SEQ ID NO:80)
Housekeeping Genes
GATGGGCGGCGGAAAATAG GCGTGGATTCTGCATAATGGT
Ribosomal SI 8
(SEQ ID NO:81) (SEQ ID NO:82)
ACAGTCGCCGCATCTTCTT ACGACCAAATCCGTTGACTC
GAPDH
(SEQ ID NO:83) (SEQ ID NO:84)
[0082] Transcripts for the drusen-associated proteins ap2-crystallin, Αβ, APP, APOE, APOJ, BACE-1, PSl, TMP3, CC9 and VEGF A were significantly upregulated in the RPE cells after oxidative stress, compared to controls treated with only vehicle. Increased expression of the αΒ-crystallin and Αβ proteins in those cells was confirmed by immunocytochemical staining. Example 2:
RPE Cell-based Screening Assay
[0083] This example describes experiments in which the RPESC-based model of drusen formation, exemplified in Example 1, supra, is used to identify compound that modulate (e.g., reduce or inhibit) drusen formation in vitro. Compounds identified in such assays are thus useful for modulating (e.g., reducing or inhibiting) the formation of drusen in vitro or in vivo, and may therefore be useful, e.g., in therapeutic compositions and methods for treating or inhibiting conditions associated with drusen formation, including AMD and, in particular, dry AMD.
[0084] Specifically, RPE cells are prepared from RPESC and treated with either TBHP or H2O2 (to induce oxidative stress) or vehicle (for control) as described in Example 1, above. To investigate a test compound's effect on drusen expression, RPESC are incubated in media containing test compound or vehicle (as a control) during treatment with H2O2 or TBHP as described in Example 1, supra.
[0085] In this example, the RPESC-derived RPE cells are incubated with either imatinib mesylate (1 μΜ), DAPT (1 μΜ), ponatinib (500 nM or 1 μΜ) or bosutinib (1 μΜ) as test compounds. These test compounds are inhibitors of either γ-secretase (imatinib mesylate and DAPT) or c-Abl tyrosine kinase (ponatinib and bosutinib). DAPT, in particular, is a specific inhibitor of many functions of γ-secretase, including APP/Notch. In contrast, imatinib mesylate has a broader range of actions: it inhibits γ-secretase cleavage of APP, but not Notch, by binding to and inhibiting the γ-secretase activating protein (GSAP). Imatinib mesylate also inhibits PDGFR, as well as c-Abl tyrosine kinase, and upregulates neprilysin, an enzyme that degrads Αβ.
[0086] After treatment with a test compound, the RPESC-derived RPE may be assayed for one or more of the following criteria: restored viability, restored resistance, and reduced drusen expression. Each of these criteria, which are described in detail below, is indicative of drusen formation and/or drusen-associated diseases such as "dry" and other forms of AMD.
[0087] Restored viability. Briefly, viability of the stressed RPE following treatment with a test compound may be assayed by measuring lactate dehydrogenase levels in media, which is released by lysed or porous cells and accounts for both apoptosis and necrosis. More specifically, media from the RPE culture(s) is collected twenty-two (22) hours after inducing oxidative stress, and assayed using a Roche Cytotoxicity Detection Kit Plus (LDH) kit following the manufacturer's instructions. Treatment of the RPESC-derived RPE with 1 μΜ imatinib mesylate completely restores cells viability to 100% compared to untreated controls (i.e., 0% cell death in treated cells, compared to 100% cell death in untreated controls). As shown in Figure 2, treatment with 1 μΜ DAPT and/or 1 μΜ ponatinib has no effect on cytotoxicity in this experiment. However, a beneficial effect is seen from treatment with just 500 nM ponatinib (about 80% reduction in cell death compared to the cell lysis control). DAPT does not attenuate cell death at in this experiment at any does tested between 0.1 μΜ and 10 μΜ. This suggests that c-Abl, which is inhibited by ponatinib but not by DAPT, is the target responsible for cell death in these experiments.
[0088] Restored resistance. Healthy RPE form tight-junctioned epithelia layers with high electrical resistance. Compromising the integrity of these layers decreases the resistance and is indicative of a diseased state, such as dry or other forms of AMD. Hence, an increased electrical resistance in treated RPE, compared to untreated cells, is another indicator that a test compound inhibits drusen formation and prevents or reduces a diseased state, such as AMD.
[0089] Transepithelial resistance is preferably measured prior to each treatment period, using the WPI EVOM Voltohmmeter protocol (Sheldon & Steinberg, Exp. Eye Res. (1977) 25(3):235-248; Li et al, Investigative Ophthal. (2007) 48:5722-5732), to confirm that cells in both treatment and control groups have similar or comparable levels of polarization. Preferably, each well of primary human RPE cells has a resistance greater than 200 Ω-cm2 before beginning the experiment. Resistance of RPE treated with a test compound is measured again, after oxidative stress, and compared to the resistance in untreated RPE subjected to the same oxidative stress procedure. The results from such experiments are shown in Figure 3. Imatinib mesylate, as well as DAPT and ponatinib, attenuate the decrease in transepithelial resistance observed upon after inducing oxidative stress by treatment with TBHP.
[0090] Reduced drusen expression. A test compound's ability to inhibit drusen formation may also be assayed by assaying expression levels of drusen-related proteins (or of genes encoding such proteins) as demonstrated, e.g., in Example 1 above, for both treated and untreated (control) cells. Results from such experiments are depicted in Figure 4. Imatinib mesylate attenuates TBHP-induced up-regulation of drusen-associated protein transcripts, as do DAPT, ponatinib and bosutinib.
Conclusion
[0091] The above-described experiments indicate pathways that inhibit amyloid beta (Αβ) synthesis and other mechanisms of imatinib action, which may contribute to the restoration of cell viability and function in imatinib mesylate treated RPE. In particular, compounds that inhibit Αβ production by more specific mechanisms thatn imatinib mesylate - including DAPT, ponatinib and bosutanib - are tested in the in vitro RPE-based model of drusen formation as described above. At 1 μΜ only imatinib mesylate restores all three of the criteria tested in the above experiments, suggesting that the compound may have a combined effect on multiple targets contributing to drusen formation and effecting epithelial integrity; such as kinase inhibition and/or decreased Αβ formation.
[0092] Out of the drugs tested in these experiments, imatinib mesylate is the most effective at restoring all three of the criteria investigated: RPE cell viability, epithelial resistance and the expression of drusen-related proteins.
Example 3 :
In vivo testing of candidate drusen inhibitors
[0093] Test compounds, including imatinib mesylate and other compounds identified as candidate drusen inhibitors, e.g., in the in vitro assays demonstrated supra, may also be tested in vivo, using animal models of AMD. For example, Malek et al. (Proc. Natl. Acad. Sci. U.S.A. (2005) 102: 1 1900-11905) describe a mouse model, referred to as the APOE4-HFC mouse of AMD that can be used to test compounds in vivo. Generally speaking, a candidate or test compound's effect on drusen formation can be tested by administering the compound to such as mouse (e.g., orally, intravenously, parentally or intraocularly) and its effect on drusen formation evaluated by comparing histological changes in the retina or RPE of treated and untreated mice. [0094] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

What is claimed is:
1. A method of inhibiting drusen in a subject, which comprises administering to a subject in need thereof an effective amount for inhibiting drusen of a composition comprising imatinib mesylate.
2. A method of inhibiting drusen in a subject, which comprises administering to a subject in need thereof an effective amount for inhibiting drusen of a composition comprising a composition that inhibits gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c-Abl tyrosine kinase, as well as drugs that upregulate . neprilysin to accelerate Αβ resortption.
3. The method of claim 2, wherein the composition is a member selected from the group consisting of imatinib mesylate, ponatinib, bosutanib, DAPT.and bexarotene.
4. The method of claim 1 or 2, wherein the subject is suffering from or is at risk of developing dry age-related macular degeneration.
5. The method of claim 1 or 2, wherein the administration is preferably intraocular and also oral or parental.
6. The method of claim 1 or 2, wherein the composition is administered daily at least once.
7. The method of claim 1 or 2, wherein the subject is a patient.
8. The method of claim 7, wherein the patient is a mammal.
9. The method of claim 8, wherein the mammal is a human
10. The method of claim 1 or 2, wherein the method comprises decreasing the expression level of one or more drusen-related polypeptides.
11. The method of claim 10, wherein the one or more drusen-related polypeptides is a member selected from the group consisting of amyloid precursor protein (APP), apolipoprotein J (APOJ), apolipoprotein E (APOE), amyloid beta (Αβ), alphaB -crystallin, β- site ΑβΡΡ cleaving enzyme 1 (BACE-1), presenilin 1 (PSl), and vascular endothelial growth factor (VEGF)-A.
12. A method of treating drusen which comprises administering to a patient in need of such treatment, an effective amount for treating drusen of a composition comprising imatinib mesylate.
13. A method of treating drusen which comprises administering to a patient in need of such treatment an effective amount for treating drusen of a composition that inhibits gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c-Abl tyrosine kinase.
14. The method of claim 13 wherein the composition comprises imatinib mesylate.
15. The method of treating dry AMD which comprises administering to a subject in need of such treatment an effective amount for treating dry AMD of a composition that inhibits gamma secretase activating protein (GSAP), platelet derived growth factor receptor (PDGFR) and c-Abl tyrosine kinase.
PCT/US2013/030755 2012-03-28 2013-03-13 Compositions and methods for inhibiting drusen WO2013148183A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA2868785A CA2868785A1 (en) 2012-03-28 2013-03-13 Compositions and methods for inhibiting drusen
US14/388,131 US20150051212A1 (en) 2012-03-28 2013-03-13 Compositions And Methods For Inhibiting Drusen

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261616687P 2012-03-28 2012-03-28
US61/616,687 2012-03-28
US201261620210P 2012-04-04 2012-04-04
US61/620,210 2012-04-04

Publications (1)

Publication Number Publication Date
WO2013148183A2 true WO2013148183A2 (en) 2013-10-03

Family

ID=49261382

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/030755 WO2013148183A2 (en) 2012-03-28 2013-03-13 Compositions and methods for inhibiting drusen

Country Status (3)

Country Link
US (1) US20150051212A1 (en)
CA (1) CA2868785A1 (en)
WO (1) WO2013148183A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2898896A1 (en) 2014-01-22 2015-07-29 Université Pierre et Marie Curie (Paris 6) Agents for use in the treatment of retinal inflammation

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11352625B2 (en) 2017-01-12 2022-06-07 Duke University Compositions and methods for disrupting the molecular mechanisms associated with mitochondrial dysfunction and neurodegenerative disease

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060121039A1 (en) * 2004-12-07 2006-06-08 Alcon, Inc. Use of agents that prevent the generation of amyloid-like proteins and/or drusen, and/or use of agents that promote sequestration and/or degradation of, and/or prevent the neurotoxic effects of such proteins in the treatment of macular degeneration
US20080003219A1 (en) * 2005-09-26 2008-01-03 Minu, L.L.C. Delivery of an ocular agent
US20070072933A1 (en) * 2005-09-26 2007-03-29 Peyman Gholam A Delivery of an ocular agent

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2898896A1 (en) 2014-01-22 2015-07-29 Université Pierre et Marie Curie (Paris 6) Agents for use in the treatment of retinal inflammation
US10519232B2 (en) 2014-01-22 2019-12-31 Sorbonne Universite Agents for use in the treatment of retinal inflammation

Also Published As

Publication number Publication date
US20150051212A1 (en) 2015-02-19
CA2868785A1 (en) 2013-10-03

Similar Documents

Publication Publication Date Title
Li et al. Proteasome inhibition activates autophagy-lysosome pathway associated with TFEB dephosphorylation and nuclear translocation
Girodet et al. Airway remodeling in asthma: new mechanisms and potential for pharmacological intervention
Wolf et al. The role of autophagy in acute brain injury: A state of flux?
Nencioni et al. Nicotinamide phosphoribosyltransferase inhibition reduces intraplaque CXCL1 production and associated neutrophil infiltration in atherosclerotic mice
AU2009313562B2 (en) Leptin compositions and methods for treating progressive cognitive function disorders resulting from accumulation of neurofibrillary tangles and amlyoid beta
Lin et al. The protective effect of hesperetin in osteoarthritis: an in vitro and in vivo study
KR20220070232A (en) Pharmacological target to treat retinal degeneration
US20220105059A1 (en) Method of treating or preventing neurodegeneration
US20190201430A1 (en) Treating ocular neovascularization
WO2017208174A2 (en) Methods of treating disease with pfkfb3 inhibitors
US20160271157A1 (en) Beta-catenin
Song et al. Poria cocos polysaccharide attenuates RANKL-induced osteoclastogenesis by suppressing NFATc1 activity and phosphorylation of ERK and STAT3
US10881642B2 (en) Autophagy enhancer and use thereof
US20150051212A1 (en) Compositions And Methods For Inhibiting Drusen
JP2023518375A (en) Method of treatment
JP2008517584A (en) Metabolic regulators and uses therefor
Ren et al. Autophagy and cardiometabolic diseases: from molecular mechanisms to translational medicine
US9618511B2 (en) Methods and compositions for treating alzheimer&#39;s disease
KR101077179B1 (en) A method for protecting DNA damage using PIG3
KR101832052B1 (en) Composition for treating diabetic retinopathy comprising inhibitors of Integrin αvβ5 and Screening method for the said inhibitors
Shi et al. Pathological high intraocular pressure induces glial cell reactive proliferation contributing to neuroinflammation of the blood-retinal barrier via the NOX2/ET-1 axis-controlled ERK1/2 pathway
CN109789129B (en) Autophagy-improving material and use thereof
Ninfole Involvement of autophagy in cholestatic liver diseases
Gayban et al. (Pro) Renin Receptor Antagonism Attenuates High-Fat-Diet–Induced Hepatic Steatosis in Non-Alcoholic Fatty Liver Disease
板野精之 Colchicine attenuates renal fibrosis in a murine unilateral ureteral obstruction model

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13770243

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 14388131

Country of ref document: US

ENP Entry into the national phase in:

Ref document number: 2868785

Country of ref document: CA

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13770243

Country of ref document: EP

Kind code of ref document: A2