WO2013131981A1 - Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs) - Google Patents

Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs) Download PDF

Info

Publication number
WO2013131981A1
WO2013131981A1 PCT/EP2013/054542 EP2013054542W WO2013131981A1 WO 2013131981 A1 WO2013131981 A1 WO 2013131981A1 EP 2013054542 W EP2013054542 W EP 2013054542W WO 2013131981 A1 WO2013131981 A1 WO 2013131981A1
Authority
WO
WIPO (PCT)
Prior art keywords
chromosome
genomic locus
fxs
hydroxy
hydroxymethylation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2013/054542
Other languages
French (fr)
Inventor
Remi TERRANOVA
Baltazar Gomez-Mancilla
Jonathan MOGGS
Olivier Grenet
Florian HAHNE
Sarah BRASA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Publication of WO2013131981A1 publication Critical patent/WO2013131981A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers

Definitions

  • FXS Fragile X Syndrome
  • the present invention provides methods and compositions directed to identification of genetic and epigenetic markers associated with Fragile X syndrome (FXS) disorders.
  • FXS Fragile X syndrome
  • Fragile X syndrome is the most common cause of inherited mental retardation with a worldwide prevalence of 1/4000 in males and 1/8000 in females. The incidence of FXS is 10-20 times higher than other X-linked mental retardations.
  • FXS is a monogenetic disease and mainly caused by a CGG-repeat expansion that triggers hypermethylation and silencing of the fragile X mental retardation 1 (FMRl) gene.
  • FMRl fragile X mental retardation 1
  • FMRP FMRl protein
  • mGluR5 antagonists have the potential to reduce the mGluR5 signaling and normalize the deficits caused by the lack of fragile X mental retardation protein.
  • SSRIs selective serotonin reuptake inhibitors
  • alpha-adreno-receptor agonists e.g., clonidine
  • mood stabilizers e.g. carbamazepine
  • antipsychotic medication e.g., risperidone, olazapine
  • FMRl epigenetic silencing in FXS are still elusive and their characterization may enhance the development of novel clinical biomarkers of disease and/or drug response as well as support the identification of novel therapeutic targets. This would contribute as well to the identification of epigenetic biomarkers for selecting a sub-population of FXS patients that might respond to particular FXS therapies.
  • the present invention is based on the finding of novel regions of epigenetic modifications within the FMRl genomic locus. Specifically, two methylation markers, DNA methylation and DNA
  • the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS including detecting at an epigenetic biomarker selected from DNA methylation or hydroxymethylation at a predetermined region on chromosome X of an FMR1 genomic locus, and comparing the amount of methylation or hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
  • FXS Fragile X syndrome
  • a predisposition for FXS including detecting at an epigenetic biomarker selected from DNA methylation or hydroxymethylation at a predetermined region on chromosome X of an FMR1 genomic locus, and comparing the amount of methylation or hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
  • the predetermined chromosome X region for detecting DNA methylation can be between position 146993800 to 147048300 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., any predetermined chromosome X region as shown in Table 1, 2 or 3, or portion thereof.
  • one or more of the DNA methylation regions shown in Table 1 can be assayed.
  • the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the predetermined chromosome X region for detecting DNA hydroxymethylation can be between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., any predetermined chromosome X region as shown in Table 1, 2 or 3, or portion thereof.
  • one or more of the hydroxymethylation regions shown in Table 1 can be assayed.
  • the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS including detecting at least two epigenetic biomarkers selected from DNA methylation and hydroxymethylation at a predetermined region on chromosome X of an FMR1 genomic locus, comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
  • the predetermined chromosome X region for detecting DNA methylation can be between position 146993800 to 147048300 and for hydroxymethylation is between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9).
  • a diagnostic or prognostic determination can be made based on the amount of DNA methylation compared to a control and amount of hydroxymethylation compared to a control.
  • the predetermined region for detecting DNA methylation includes one or more of the regions shown in Table 1 , 2 or 3 (regions listed under "coordinates") and the predetermined region for detecting hydroxymethylation includes one or more of the regions shown in Table 1, 2 or 3 (regions listed under "coordinates").
  • the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the predetermined region for detecting hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the predetermined region for detecting hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting DNA methylation in a sample, e.g., Peripheral Blood Mononuclear Cells (PBMC), comprising one or more of the following predetermined regions:
  • FXS Fragile X syndrome
  • PBMC Peripheral Blood Mononuclear Cells
  • the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample, e.g., PBMC comprising one or more of the following predetermined regions:
  • the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample, e.g., PBMC comprising one or more of the following predetermined regions:
  • the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with an mGluR antagonist, the method comprising:
  • the predetermined region for detecting DNA methylation comprises one or more of the following regions:
  • the predetermined region for detecting 5- hydroxymethylcytosine comprises one or more of the following regions:
  • the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with a test molecule such as an mGluR antagonist, the method comprising:
  • the predetermined region comprises one or more of the following regions:
  • the individual is selected for treatment with an mGluR antagonist such as (-)-(3aR, 4S, 7aR)-4-Hydroxy-4- m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
  • an mGluR antagonist such as (-)-(3aR, 4S, 7aR)-4-Hydroxy-4- m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
  • the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with an mGlur5 antagonist, the method comprising:
  • a sample e.g., PBMC, from an individual having Fragile X Syndrome; and detecting hydroxymethylation at a predetermined region in the sample, wherein the
  • predetermined region comprises one or more of the following regions:
  • the mGlur5 antagonist can be any known mGluR5 antagonist such as (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l- carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
  • the predetermined region comprises one or more of the following regions:
  • the invention includes a method of selecting an individual with Fragile X
  • FXS Factorized Hass syndrome
  • the method comprising detecting hydroxymethylation at a predetermined region in the sample, wherein the predetermined region comprises one or more of the following regions:
  • the individual is selected for treatment on the basis of the subject having an amount of hydroxymethylation indicative that the individual will respond to treatment with (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
  • the method can further include administering (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a
  • the method can further include administering a compound other than (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl- octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof to an individual on the basis of that individual on the basis of the individual not having an amount of hydroxymethylation compared to a control indicative that the individual will respond to treatment with (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester.
  • the invention includes a method of selectively treating a subject having FXS, comprising selectively administering a therapeutically effective amount of ( ⁇ -Pyrrolidine- 1,2- dicarboxylic acid 2-amide 1 -( ⁇ 4-methyl-5-[2-(2,2,2-trifluoro- 1 , 1 -dimethyl-ethyl)-pyridin-4-yl]-thiazol- 2-yl ⁇ -amide), or a pharmaceutically acceptable salt thereof, to the subject on the basis of the amount of hydroxymethylation compared to a control at a predetermined region in the sample, wherein the predetermined region comprises one or more of the following regions:
  • the invention includes a method of screening for an agent that modulates an epigenetic biomarker including contacting an agent with a mammalian cell; and detecting at least two biomarkers selected from DNA methylation and hydroxymethylation at a predetermined region as described in Table 1 or 3 within the FMRl genomic locus, wherein a change in biomarker status relative to a control is indicative that the agent is an epigenetic biomarker modulating agent.
  • the invention includes an mGluR5 antagonist, e.g., (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, for use in treating Fragile X, characterized in that a therapeutically effective amount of said compound or its pharmaceutically acceptable salt is administered to the individual on the basis of the amount of hydroxymethylation compared to a control at one or more of the following positions:
  • the invention includes an mGluR5 antagonist, e.g., (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, for use in treating Fragile X, characterized in that a therapeutically effective amount of said compound or its pharmaceutically acceptable salt is administered to the individual on the basis of said individual having an amount of hydroxymethylation compared to a control indicative that the subject will respond to treatment with the an mGluR5 antagonist at one or more of the following positions:
  • an mGluR5 antagonist e.g., (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, for use in treating Fragile X,
  • the invention includes detecting methylation which can be performed using any assay known in the art including methylation-sensitive restriction enzyme digestion combined with PCR or bisulfite DNA modification combined with at least one of: methylation specific PCR (MSP), , probe-based methylation specific PCR or pyrosequencing.
  • MSP methylation specific PCR
  • probe-based methylation specific PCR or pyrosequencing.
  • the invention includes detecting for hydroxymethylation using any assay known in the art.
  • detecting hydroxymethylation can include enriching for 5-hmC- marked DNA by immunoprecipitation and determining the level of enrichment of 5-hmC in the sample.
  • the enrichment level can be determined by, e.g., sequencing, qPCR, or an array.
  • the invention is directed to a diagnostic kit for diagnosing an individual as having Fragile X Syndrome (FXS), including an agent for detecting methylation or hydroxymethylation within one or more regions on chromosome X of the FMRl genomic locus.
  • FXS Fragile X Syndrome
  • the agent can be used to detect DNA hydroxymethylation between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., a predetermined chromosome X region as shown in Table 1, 2 or 3.
  • the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • the invention is directed to a diagnostic kit for diagnosing an individual as having Fragile X Syndrome (FXS), including an agent for detecting at least two epigenetic biomarkers selected from the group consisting of DNA methylation and hydroxymethylation within a region on chromosome X of the FMRl genomic locus.
  • FXS Fragile X Syndrome
  • Fig. 1 depicts a schematic of the experimental overview of methylated DNA ImmunoPrecipitation ((h)MeDIP) assays combined to a custom DNA microarray platform covering a broad FMRl locus to profile DNA methylation (5mC) and hydroxymethylation (5hmC) in genomic DNA obtained from control and Fragile X syndrome patient samples.
  • (h)MeDIP methylated DNA ImmunoPrecipitation
  • Fig 2 depicts graphs that illustrate the relative enrichment of 5mC and 5hmC (log2 fold enrichment) in control (grey) and FXS (black) fibroblast and PBMC samples (annotated 5mC or 5hmC Fibro or PBMC) over a region covering 79kb on ChrX: 146,971,000-147,050,000).
  • hMeDIP-qPCR individual hydroxymethylation
  • Fig. 4 depicts a graph showing the partial anti-correlation between measured 5mC and 5hmC in the blood of 16 FXS male patients.
  • Fig. 5A depicts a linear regression graph for assay B3 showing the relationship between the methylation (5mC) values (x-axis) and the ABC score (y-axis, the higher the more severe);
  • Fig. 5B shows a table overview of the relationship between the methylation and the ABC score for all assays;
  • Fig 5C depicts a linear regression graph for assay 3F9-G1 showing the relationship between the hydroxymethylation (5hmC) values (x-axis) and the ABC score (y-axis);
  • Fig. 5D shows a table overview of the relationship between hydroxymethylation (5hmC) and the ABC score for all regions assayed.
  • Fig. 6A shows bar graphs of Individual hMeDIP-qPCR assays along the FMRl gene region measuring different levels of 5hmC along the FMRl genomic locus and across a group of control patient (white bars) or clinically treated patient samples and 6B depicts the FMRl genomic locus showing exons, indicated with grey boxes and transcriptional orientation with arrows.
  • the present invention is based, in part, on the finding of novel regions within the FMRl genomic locus that show changes in epigenetic biomarker status compared to a control.
  • the present invention provides critical regions in the FMRl genomic locus that can be used to diagnose subjects suspected of having FXS, or to predict a subject's predisposition thereto.
  • the epigenetic changes in the FMRl gene locus can be used in the selection of particular FXS patients who are likely responders to FXS therapies such as treatment with an mGluR5 antagonist.
  • the sequence of the FMRl gene is known in the art (GenBank L29074 L38501) (Nucleic Acids Res. 2002 Jul 15;30(14):3278-85) (Hum Mol Genet. 2010 Apr 15;19(8): 1618-32. Epub 2010 Jan 29).
  • the FMRl genomic locus covers the FMRl gene sequence and sequences upstream and downstream of the gene sequence.
  • the FMRl genomic locus on chromosome X is between position 146981500 to position 147048300. This region can include a 67 kb region and can include the FMRl coding region, a regionl2 kb upstream of the FMRl coding region and a 16 kb downstream region of the FMRl coding region. All reported chromosomal coordinates as disclosed herein are based on the Human Reference Genome HG19 (Feb. 2009 (GRCh37/hgl9).
  • the epigenetic status in a sample from an individual is detected by determining the presence of one or more epigenetic biomarkers as described herein.
  • the methods of the invention include determining amount or level of the epigenetic biomarker in a sample of interest compared to a control.
  • the epigenetic biomarkers of the invention include DNA methylation (also referred to herein as 5-methylcytosine or 5mC) and hydroxymethylation (also referred to herein as 5- hydroxymethylcytosine or 5hmC).
  • the invention provides predetermined regions, or a portion thereof, (as shown in Table 1, 2 and 3 under "coordinates") within the FMRl genomic locus that can be used in the method of the invention.
  • a portion of a predetermined region includes a region which has a single or group of CpGs.
  • a control as used herein can include a clinically defined sample which has a predefined level of methylation or hydroxymethylation indicative of FXS diagnosis or therapeutic efficiacy, or can be a sample from a healthy subject which is performed at the same time as the methods of the invention. Alternatively, the control can be a statistically validated reference value for use in the methods.
  • Region ID cell type-mark-number
  • kb transcriptional start site
  • 3'UTR 3' untranslated region
  • Table 2 shows the FMRl locus specific methylation and hydroxymethylation assays, the ID used as it corresponds to the figures, the sequence of primers used, the position of each assay along the FMRl regions and the genomic DNA sequence covered by each assay are indicated.
  • the presence of a single epigenetic biomarker such as either methylation or hydroxymethylation can be detected as outlined in Tables 1, 2, or 3, or a combination thereof.
  • the predetermined region for hydroxymethylation can include a region selected from the group consisting of one or more of the following predetermined regions:
  • any two of the regions a-d are assayed, e.g., a and b; or a and c; or b and c, or b and d, etc.
  • any three of the regions a-d are assayed, e.g., a, b and c; or a, c and d; or b, c, and d, etc are assayed.
  • the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
  • any two of the regions a-f are assayed, e.g., a and b; or a and f; or b and c, or b and d, etc.
  • any three of the regions a-f are assayed, e.g., a, b and c; or a, c and d; or b, c, and d, d, e, and f, etc, are assayed.
  • any four of the regions a-f are assayed, e.g., a, b, c and d; or a, c, d and f; or b, c, d and f; etc, are assayed. Similarly, any five, six or all of the regions a-f are assayed.
  • the presence of at least two or more biomarkers as described herein are detected.
  • the presence of the epigenetic biomarkers as described herein can be determined in any appropriate sample, e.g., blood samples or from other origins (other body fluids, mouth swabs), from an individual of interest.
  • the sample can include a fluid sample such as blood, a cell sample such as PBMCs or buccal cells or fibroblasts, or a tissue sample such as skin or a hair follicle.
  • the methods described herein provide information to enable a health care provider to determine the likelihood that a subject suspected of having FXS, has FXS or a predisposition thereto, or whether an FXS subject will respond to treatment, e.g., using an mGluR5 antagonist.
  • the individual following a positive determination of the relevant epigenetic biomarker(s) in a sample of interest, the individual can be treated with an agent of interest such as an mGluR5 antagonist.
  • an agent of interest such as an mGluR5 antagonist.
  • the individual can be treated with an agent of interest other than an mGluR5 antagonist.
  • DNA methylation includes the epigenetic modification that is catalyzed by DNA cytosine-5- methyltransferases (DNMTs) and occurs at the 5-position (C5) of the cytosine ring within CpG dinucleotides.
  • DNMTs DNA cytosine-5- methyltransferases
  • C5 5-position of the cytosine ring within CpG dinucleotides.
  • changes in methylation include detecting hypermethylation or
  • the extent of FMRl gene methylation in the FMRl gene body can be determined using any method known in the art.
  • the method of the invention includes detecting DNA methylation within the FMRl genomic locus, wherein a change in biomarker status relative to a control is indicative of FXS or the predisposition for FXS.
  • the FMRl gene region of interest to be analyzed for its methylation status according to the present invention can be of any length as long as it includes at least one CpG site, e.g., for DNA methylation can be between position 146993800 to 147048300 and for hydroxymethylation is between 146982000 to 147027400of an FMRl gene sequence.
  • the DNA methylation and hydroxymethylation status of the FMRl gene region to be analyzed is shown in Table 1, 2, and 3.
  • the CGG repeats that are located in the 3'-UTR of the FMRl gene are analyzed for their methylation status and the present invention can be used to complement CGG repeat analysis and enhance diagnosis of FXS in a subject or for use in selecting patients for FXS therapy.
  • Various methods can be used to determine methylation status of an individual of interest such as a qualitative assay such as MSP.
  • Another method useful in the method of the invention is a quantitative assay method such as methylation-sensitive restriction enzyme digestion combined with quantitative PCR, matrix-assisted laser desorption/ionization time-to-flight mass spectrometry (MALDI-TOF- MS), real-time PCR (methyl light).
  • MALDI-TOF- MS matrix-assisted laser desorption/ionization time-to-flight mass spectrometry
  • real-time PCR methyl light
  • the invention is not limited by the types of assays used to assess the extent of methylation of the FMRl gene region in the sample. Indeed, any assay that can be employed to determine the methylation status of a gene can be employed for the purposes of the present invention. Examples of types of assays used to assess the methylation pattern include, but are not limited to:
  • methylation-sensitive restriction enzyme digestion combined with at least one of: hybridization, quantitative PCR, restriction landmark genomic scanning (RLGS), or array-based profiling of reference-independent methylation status (aPRIMEs);
  • RNA modification combined with at least one of: methylation specific PCR (MS-PCR), quantitative methylation specific PCR (qMS-PCR), probe-based methylation specific PCR, pyrosequencing, cloning/sequencing, MS-nested PCR, quantitative analysis of methylated alleles (QUAMA), heavy methyl detection, methylation-sensitive high resolution melting (MS-HRM), methyl-binding (MB)- PCR, PCR and deoxyribonucleoside monophosphate (dNMP) analysis, or methylation-dependent fragment separation (MDFS);
  • MS-PCR methylation specific PCR
  • qMS-PCR quantitative methylation specific PCR
  • probe-based methylation specific PCR probe-based methylation specific PCR
  • pyrosequencing pyrosequencing
  • cloning/sequencing MS-nested PCR
  • quantitative analysis of methylated alleles QUAMA
  • heavy methyl detection methylation-sensitive high resolution melting (MS-HRM
  • the extent of methylation can be determined using Methylation Specific PCR (MSP).
  • MSP is a bisulfite conversion based PCR technique that can be used to determine DNA CpG
  • MSP involves the initial modification of DNA by sodium bisulfite which converts all unmethylated, but not methylated, cytosines to uracil.
  • the DNA is then amplified with two pairs of primers specific for methylated DNA and unmethylated DNA, respectively, and the methylation status determined.
  • the primers typically include at least two CpG sites.
  • the MSP methods are described in U.S. Pat. No. 5,786,146; U.S. Pat. No. 6,017,704; U.S. Pat. No. 6,200,756; and U.S. Pat. No. 6,265,171; the entire contents of each of which is incorporated herein by reference.
  • an individual would be assigned as an mGluR5 responder when the methylated FMR1 is detected by the primers specific for methylated DNA and unmethylated FMR1 is not detected by the primers specific for unmethylated DNA in the region of interest of the FMR1 gene.
  • the extent of methylation can be determined using a method that includes an amplification process such as quantitative PCR (qPCR) in the FMR1 gene region of interest.
  • qPCR quantitative PCR
  • the qPCR method described in WO2011/137206 can be used.
  • the method described in WO2011/137206 is incorporated herein by reference.
  • Various other different qPCR methods which detect methylation are known in the art and include HeavyMethyl or Methylight.
  • the FMR1 gene region is initially modificated by sodium bisulfite.
  • the DNA is then contacted with non-extendable oligonucleotide blockers that provide specificity by binding to bisulfite-treated DNA in a methylation-specific manner.
  • the DNA is then contacted with a primer set that has binding sites that overlap with non-extendable oligonucleotide blockers.
  • the primer cannot bind and therefore no amplicon is generated.
  • the primers can bind and generate an amplicon (Cottrell et al. Nucleic Acids Res. 2004; 32(1), 2004).
  • the FMR1 gene region of interest is initially modified by sodium bisulfite.
  • the gene region is then amplified using PCR primers that hybridize to regions containing no CpG dinucleotides.
  • fluorescent probe detection can indicate methylation status of sequences where the probes hybridize.
  • Methods for detecting methylation of a region of interest by cutting the DNA with a methylation-sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA are known in the art.
  • the method can encompass amplifying intact DNA after restriction enzyme digestion see, e.g., U.S. patent application Ser. Nos. 10/971,986; 11/071,013; and 10/971,339.
  • the method of the invention includes digesting the FMR1 gene region of interest with a methylation sensitive restriction enzyme and amplifying up the region of interest.
  • the methylation status of the DNA can be determined by detecting for the presence of an amplifiable product. Only DNA that was not cleaved by the restriction enzyme will be amplified.
  • a methylation sensitive restriction enzyme can be for example, McrBC, which includes CG as part of its recognition site and can cleave when the C is methylated.
  • McrBC which includes CG as part of its recognition site and can cleave when the C is methylated.
  • the sample can be contacted with a restriction enzyme which includes CG as part of its recognition site and can cleave only when the C is unmethylated.
  • the desired FMR1 region can be amplified by real-time PCR using a
  • the probe for detecting nucleic acid sequence typically has a fluorescent reporter or fluorophore such as 6-carboxyfluorescein (FAM) and
  • TET tetrachlorofluorescin
  • TAMRA tetramethylrhodamine
  • BHQ black hole quencher
  • the methods described above can be used with a methylation analyzer.
  • the method includes determining the extent of FMR1 methylation in the sample, transforming the results into a computer readable form and applying a mathematical algorithm to classify the results into a classification group, i.e., diagnosis of FXS.
  • the methods described above include control samples such as samples that are fully methylated and samples that are partially methylated. DNA purified from fragile X patient's B- lymphocytes (Camden, NJ) can be used to generate appropriate controls or clinical samples which are already determined to have a particular methylation status can be used.
  • the methods described above include control samples.
  • Such samples are readily available in the art or can be commercially purchased from, e.g., ATCC (American Type Culture Collection (ATCC), The National Institute for Biological Standards and Control (NIBSC) or Coriell institute for medical research.
  • ATCC American Type Culture Collection
  • NBISC National Institute for Biological Standards and Control
  • the control can either be run simultaneously with the test sample or can be represented as a predetermined value based on the technology used to determine the methylation status of the sample.
  • the predetermined value is a Delta Ct value which is obtained using quantitative PCR (as described herein).
  • the oligonucleotides of the invention can include any oligonucleotide as disclosed in Table 1 , 2 and 3 and any other oligonucleotide that can be used to detect a predetermined region as described herein.
  • the oligonucleotides of the invention include variants of the sequences or sequences that are
  • substantially similar to the oligonucleotides of the invention Variants include sequences that are altered by one or more bases, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 but can still anneal to the specific locations on the FMRl sequence of interest.
  • the term "substantially” when used in relation to annealing or hybridisation means that the oligonucleotide or probe nucleic acid sequence should be sufficiently complementary to hybridise or anneal to its respective nucleic acid. As used herein, the term
  • hybridisation refers to the process by which a strand of nucleic acid joins with a complementary strand.
  • the oligonucleotide is between 14-30 bases. In another example, the oligonucleotide is between 18-30.
  • Oligonucleotides may be prepared by chemical synthesis using any suitable methodology known in the art, or may be derived from a biological sample, for example, by restriction digestion.
  • oligonucleotides may be labeled, according to any technique known in the art, including use of radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like.
  • the invention further includes detecting hydroxymethylation in the FMRl locus, wherein the amountof hydroxymethylation (5-hmC) relative to a control is indicative of FXS or the predisposition for FXS, or can be used to stratify patients receiving an mGluR5 antagonist as described herein.
  • 5-hmC is a hydroxylated and methylated form of cytosine.
  • the FMRl gene region of interest to be analyzed for its 5-hmC status according to the present invention can be of any length. Examples of regions are shown in Tables 1 and 2.
  • 5-hmC in a sample of interest can be detected by first enriching for 5-hmC-marked DNA by immunoprecipitation and then quantifying for the presence of 5-hmC by either sequencing, qPCR, or arrays.
  • 5-hmC can be detected by using either HPLC, LC/MS or single molecule real-time DNA sequencing (SMRT sequencing)
  • hydroxymethylation can be measured as described herein using hMeDIP- qPCR with selected primers (see Tables land 2).
  • the present invention of detecting hydroxymethylation as described herein can be used in combination with the standard methylation clinical diagnostic assays such as detecting methylation at the FMRl promoter (e.g., SEQ ID NO: l or a portion thereof) or using the assay as described in WO2011/137206, which is incorporated in its entirety herein by reference in order to stratify patients who are more likely to respond to an mGluR5 antagonist.
  • the FMRl gene promoter is analyzed for its methylation status.
  • the FMRl promoter region being analyzed is the full length promoter region.
  • a portion of the FMRl promoter region is analyzed for its methylation status.
  • the FMRl gene promoter region has the nucleotide sequence of SEQ ID NO: 67 (shown below; CpG islands are shown in bold and underlined).
  • the present invention can be used to determine if an individual will respond to FXS drug therapies.
  • the invention can be used to determine if an individual having FXS are likely to respond to treatment with an FXS treating agent such as an Metabotropic Glutamate Receptor 5 (mGluR5) antagonist.
  • an mGluR5 responder is an individual having FXS who is likely following therapeutic treatment with an mGluR5 antagonist to show improved behavioral symptoms as assessed using the Aberrant Behavior Checklist - Community Edition (ABC-C) measure of behavior (Bihm et al., Am. J. Ment Retard 96:209-211).
  • the ABC-C measurement looks at various behaviors including stereotypic behavior, hyperactivity, inappropriate speech, and restricted interests.
  • An individual who shows a decrease in ABC-C scores following treatment with an mGluR5 antagonist is classified as an mGluR5 responder.
  • the behavioral symptoms may also be assessed by other methods, such as Clinical Global Impression (CGI) scale, Social Responsiveness Scale (SRS), or Repetitive Behavior Scale - Revised (RBS-R). Individuals showing an improvement according to these tests will also be determined to be an mGluR5 responder.
  • CGI Clinical Global Impression
  • SRS Social Responsiveness Scale
  • RBS-R Repetitive Behavior Scale - Revised
  • an mGluR5 non-responder is an individual having FXS who is unlikely following therapeutic treatment with an mGluR5 antagonist to show improved behavioral symptoms as assessed using the Aberrant Behavior Checklist - Community Edition (ABC-C) measure of behavior (Bihm et al, Am. J. Ment Retard 96:209-211). Such an individual should based on a negative finding using the methods of the invention, be administered a compound other than an mGluR5 antagonist.
  • mGluR5 antagonists include eptidomimetics, proteins, peptides, nucleic acids, small molecules, or other drug candidates.
  • An example of an mGluR5 antagonist is (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester.
  • the mGluR5 antagonist, (- )-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, as well as methods of making the same, are disclosed in U.S.
  • mGLUR5 antagonists such as those disclosed in U.S. Patent No. 7,348,353 are contemplated for use in the methods of the present invention.
  • the method can be used to select those individuals having FXS who are likely to respond to therapy with an mGluR5 antagonist based on the amount of methylation or
  • the mGluR5 antagonist is a compound of the formula (I)
  • R represents optionally substituted alkyl or optionally substituted benzyl
  • R 2 represents hydrogen (H), optionally substituted alkyl or optionally substituted benzyl; or
  • R 1 and R 2 form together with the nitrogen atom to which they are attached an optionally substituted heterocycle with less than 14 ring atoms;
  • R 3 represents halogen, alkyl, alkoxy, alkylamino or dialkylamino
  • R 4 represents hydroxy (OH), halogen, alkyl or alkoxy
  • Q represents CH, CR 4 or N
  • Y represents CH, CR 4 or N
  • W represents CH, CR 4 or N
  • X represents CH or N
  • Y represents CH, CR 3 or N
  • Z represents CH 2 , NH or O
  • the mGluR5 antagonist is a compound of the formula (II), wherein a compound of the formula (II) is a compound of formula (I) in which at least one of Q, V and W is N; in free base or acid addition salt form.
  • mGluR5 antagonist is a compound of the formula (III), wherein the compound of formula (III) is a compound of formula (II) in which Y is CR 3 ; in free base or acid addition salt form.
  • X preferably represents CH.
  • Y preferably represents CH or CR 3 , wherein R 3 preferably represents halogen, particular preferably chloro.
  • Z preferably represents NH.
  • R 3 preferably represents fluoro, chloro, Ci_ 4 alkyl, e.g. methyl.
  • R 3 particularly preferably represents chloro.
  • R 1 and R 2 form together with the nitrogen atom to which they are attached form an
  • R 1 and R 2 preferably form together with the nitrogen atom to which they are attached an unsubstituted, a single or twofold substituted heterocycle selected from the group
  • substituents being selected from the group consisting of fluoro, chloro, methyl, ethyl, propyl, butyl, trifluoromethyl, fluoropropyl and difluoropropyl.
  • R 1 and R 2 preferably represent, independently from each other, Ci-C 4 alkyl or benzyl,
  • Ci-C 4 alkoxy or halogen optionally substituted by Ci-C 4 alkoxy or halogen.
  • radical definitions apply both to the end products of the formulae (I), (II) and (III) and also, correspondingly, to the starting materials or intermediates required in each case for the preparation. These radical definitions can be combined with one another at will, i.e. including combinations between the given preferred ranges. Further, individual definitions may not apply. Preference according to the invention is given to compounds of the formulae (I), (II) and (III) which contain a combination of the meanings mentioned above as being preferred.
  • R represents halogen, preferably chloro, and the other substituents have the meaning given in this specification.
  • the mGluR5 antagonist is a compound of the formula (IV):
  • n 0 or 1
  • n 0 or 1
  • A is hydroxy
  • X is hydrogen and
  • Y is hydrogen, or
  • A forms a single bond with X or with Y;
  • Ro is hydrogen, (Ci_ 4 )alkyl, (Ci_ 4 )alkoxy, trifluoromethyl, halogen, cyano, nitro, -COORi wherein Ri is (Ci_ 4 )alkyl or -COR 2 wherein R 2 is hydrogen or (Ci_ 4 )alkyl, and
  • R is -COR 3 , -COOR 3 , -CONR 4 R 5 or -S0 2 Re, wherein R 3 is (Ci_ 4 )alkyl, (C 3 - 7 )cycloalkyl or optionally substituted phenyl, 2-pyridyl or 2-thienyl; R 4 and R 5 , independently, are hydrogen or (Ci_ 4 )alkyl; and 5 is (Ci_ 4 )alkyl, (C 3 _ 7 )cycloalkyl or optionally substituted phenyl, R is hydrogen or (Ci_ 4 )alkyl and R" is hydrogen or (Ci_ 4 )alkyl, or
  • R and R" together form a group -CH 2 -(CH 2 ) m - wherein m is 0, 1 or 2, in which case one of n and m is different from 0,
  • Ro is different from hydrogen, trifluoromethyl and methoxy when n is 0,
  • A is hydroxy, X and Y are both hydrogen, R is COOEt and R' and R" together form a group -' (CH 2 )2-, in free base or acid addition salt form.
  • Exemplary compounds of formula (IV) include:
  • the mGluR modulator is a compound of the formula (V):
  • R represents hydrogen or alkyl
  • R 2 represents an unsubstituted or substituted heterocycle
  • R 2 represents an unsubstituted or substituted aryl
  • R 3 represents alkyl or halogen
  • X represents a single bond or an alkandiyl-group, optionally interrupted by one or more oxygen atoms or carbonyl groups or carbonyloxy groups in free base or acid addition salt form.
  • Exemplary compounds of formula (V) include:
  • Furan-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • Furan-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • Furan-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • Furan-3-carboxylic acid ((1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-3-carboxylic acid ((1 S,3S)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-3-carboxylic acid (( ⁇ )-(l R.3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-2-carboxylic acid ((1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-2-carboxylic acid ((1 S,3S)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-2-carboxylic acid (( ⁇ )-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
  • Furan-3-carboxylic acid [(1 S,3S)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • Furan-2-carboxylic acid [(1 R,3R)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • Furan-2-carboxylic acid [(1 S,3S)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
  • 6-Chloro-pyridine-2-carboxylic acid [( IS, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -amide 5 -Chloro-1 -methyl- 1 H-pyrrole-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy- cyclohexyl]-amide
  • the mGluR modulator is a compound of the formula (VI)
  • R 1 represents hydrogen or alkyl
  • R R 2 represents an unbubstituted or substituted heterocycle
  • R 2 represents an unsubstituted or substituted aryl
  • R 3 represents alkyl or halogen
  • mGluR5 antagonists include compounds of the formula (I) as defined in WO
  • the methods described herein can be utilized as a diagnostic assay to identify those subjects having Fragile X Syndrome or a predisposition thereto.
  • the methods described herein can be used to identify subjects who are likely to respond to an FXS therapy such as an mGluR5 antagonist or can be used as a prognostic assay to identify subjects who are at risk of developing Fragile X Syndrome and who would benefit from receiving an FXS therapy such as an mGluR5 antagonist.
  • Prognostic assays can be used for predictive purposes or prophylactic purposes to treat an individual who is at risk of developing FXS.
  • the methods of the invention include determining the amount of DNA methylation and/or
  • hydroxymethylation in a predetermined region as described in Table 1, 2, or 3 in a test subject and comparing the amount determined to a control.
  • a diagnosis as to whether that subject has FXS or a predisposition thereto, or whether that subject will respond to particular therapy can be made.
  • control for use in the methods for detecting methylation or hydroxymethylation as described herein can be any appropriate control or set of controls.
  • the control can be a clinical sample which has a defined amount of methylation indicative of FXS or predisposition thereto, or positive response to an mGluR5 therapy.
  • controls can be fully methylated or partially methylated, or can be from a subject which does not have FXS (healthy subject).
  • Clinical samples taken from individuals that are fully methylated (or more than 95% methylated), or are fully methylated and mGluR5 responders, can serve as positive controls and samples that are partially methylated or from subjects not having FXS can serve as negative controls.
  • the control is a sample from a subject that does not have FXS.
  • an increase in methylation in a test sample compared to the control is indicative that the subject has FXS or will likely respond to an mGluR5 antagonist.
  • the control is a threshold value which has been previously determined from clinically relevant samples (such as samples positive for FXS or positive for response to an mGluR5 antagonist) at one or more of the predetermined regions described herein. The amount of methylation in the test sample can then be compared against the threshold value and a diagnostic or appropriate therapy determination can be made.
  • a control can be a sample or value generated from a clinical sample that has already been determined to have a particular clinically relevant hydroxymethylation status.
  • the control can be generated from clinical samples where the subject is an mGluR5 responder and has a defined hydroxymethylation status. Samples taken from individuals that are an mGluR5 responder can serve as positive controls and samples that are from subjects not having FXS or non responders can serve as negative controls. In one example, where the control is from a subject that does not have FXS, a decrease in hydroxymethylation in a test sample compared to the control is indicative that the subject will respond to an mGluR5 antagonist. In another example, the control is a threshold value which has been determined by measuring the relative level of hydroxymethylation for one or more of the predetermined regions in a clinically relevant sample. The amount of hydroxymethylation in the test samples can then be compared against the threshold value and a diagnostic or therapy determinations can be made.
  • the control can either be run simultaneously with the test sample or can be represented as a
  • the predetermined value based on the technology used to determine the methylation or hydroxymethylation status of the sample.
  • the predetermined value is a Delta Ct value which is obtained using quantitative PCR.
  • the amount of DNA methylation and/or hydroxymethylation in a predetermined region as described in Table 1, 2 and 3 compared to a control can be indicative as to whether that subject will respond to an FXS therapy such as an mGluR5 responder.
  • the method of the invention can be used as a prognostic assay to determine whether a subject should be administered an FXS therapy such as an mGluR5 antagonist so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome.
  • an individual can be determined to be at risk of developing FXS using any of the standard methods known in the art such as detecting CGG repeats, evaluating the family history of that individual or using the method described herein.
  • an individual is further evaluated for the presence of any one or more of the above described epigenetic biomarkers.
  • the presence of one or more of the biomarkers described herein can be used to indicate that that individual should be administered an mGluR5 antagonist so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome.
  • newborn infants determined to be at risk of developing FXS should be monitored for the presence of one or more of the biomarkers described herein so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome.
  • the use of the present method to intervene early will maximize the therapeutic benefits of mGluR5.
  • the prognostic assay described herein can also be used in any individual who exhibits CGG repeat length expansion in the FMRl gene. If an individual is determined based on the methods described herein to be an individual who will respond clinically to an mGluR5 antagonist, an mGluR5 antagonist will be administered to the individual. In general, a daily dosage in the range from about 5 to 1500 mg, preferably about 10 to about 1000 mg of the compound is conveniently administered to an individual having FXS. In one example, a daily dosage of 10 mg, 25 mg or 100 mg will be administered to the individual having FXS.
  • the epigenetic biomarkers described herein can be used to further characterize subjects having FXS who have varying amounts of methylation associated with the FMRl promoter region.
  • the DNA methylation and/or hydroxymethylation profile in the broader FMRl genomic locus as detailed in Table 1 further information about subjects having a fully methylated promoter or a partially methylated promoter can be obtained which will be useful for determining the best options with respect to therapeutic treatments.
  • kits for detecting the status of methylation of the FMRl genomic locus can be used to determine if a subject has FXS or if a subject having FXS is likely to respond to treatment with an FXS therapy such as mGluR5 antagonist.
  • the kit can comprise a labeled compound or agent capable of detecting the status of DNA methylation and/or hydroxymethylation in the broader FMRl genomic locus.
  • the kit can also include primers that can be used to determine the status of DNA methylation and/or hydroxymethylation in the broader genomic locus , e.g., as disclosed in Table 1, 2, and 3 and an appropriate control sample.
  • the kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent.
  • the kit can also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate).
  • the kit can also contain a control sample or a series of control samples that can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container, and all of the various containers are within a single package along with instructions for it's use.
  • the result can be cast in a transmittable form of information that can be communicated or transmitted to other researchers or physicians or genetic counselors or patients.
  • a form can vary and can be tangible or intangible.
  • the result can be embodied in descriptive statements, diagrams, photographs, charts, images or any other visual forms.
  • images of gel electrophoresis of PCR products can be used in explaining the results or graphs of qPCR can be used.
  • These statements and visual forms can be recorded on a tangible media such as papers, computer readable media such as floppy disks, compact disks, etc., or on an intangible media, e.g., an electronic media in the form of email or website on internet or intranet.
  • the result can also be recorded in a sound form and transmitted through any suitable media, e.g., analog or digital cable lines, fiber optic cables, etc., via telephone, facsimile, wireless mobile phone, internet phone and the like. All such forms (tangible and intangible) would constitute a "transmittable form of information".
  • the information and data on a test result can be produced anywhere in the world and transmitted to a different location.
  • the present disclosure also encompasses a method for producing a transmittable form of information containing data on the status of methylation and/or hydroxymethylation in the broader FMRl genomic locus in a test sample. This form of information is useful for diagnosis of FXS or predisposition thereto, or to select a test patient who will respond to FXS treatment such as mGluR5 treatment, or for selectively treating a patient based upon that information.
  • Example 1 Methylome and hydroxymethylome mapping of the broader FMRl genomic locus was performed. Chromatin profiling assays (Methylated DNA Immunoprecipitation (MeDIP)) combined to a DNA microarray covering a broad genomic region encompassing the FMRl gene sequence. Broader epigenomic profiling of the FMRl locus of FXS fibroblasts.
  • 5-Methylcytosine (5mC) and 5-Hydroxymethylcytosine (5hmC) MeDIP assays using highly specific anti-5mC and anti-5hmC antibodies were carried out on genomic DNA from 3 FXS fibroblasts lines and 2 control lines. The same assays were also run on genomic DNA obtained from 5 control PBMC samples and up to 11 FXS samples (Fig. 1).
  • MeDIP enrichment was validated using qPCR at candidate loci previously identified as being marked by the indicated epigenetic modifications. MeDIP enriched input and IP fractions were labeled and applied onto a custom designed array covering the entire FMRl genomic region on chromosome X (ChrX: 146,911,760 - 147,159,387: 82 kb of upstream and 126kb of downstream regions flanking the 40kb FMRl gene. This overall experimental design generated 40 independent microarray datasets, enabling the first epigenomic profiling of the broader FMRl locus in control and FXS cells across a variety of control and FXS individuals (fibroblasts and PBMCs).
  • Analyses of epigenome landscape using genome visualization tools detected the expected DNA hypermethylation in the region surrounding the FMRl promoter and transcriptional start site, including the upstream (5') part of FMRl intron 1 (TSS -lkb/+2.5kb, referred as to "Fibro-5mC-C” and “Fibro- 5mC-D” regions in Table 3) in FXS fibroblasts.
  • MeDIP profiles from single cell lines showed that methylation patterns were consistent across fibroblast lines (data not shown).
  • PCR primers were designed and quantitative PCRs run on MeDIP and input material from FXS and control cells, confirming decreased methylation in the newly identified regions of FMRl methylation changes in FXS fibroblasts, while illustrating the robust TSS region hypermethylation.
  • additional control regions were investigated and did not show change in methylation across cell lines (GAPDH, APRT: constitutive ly hypomethylated and HI 9, NNAT, IGF2R: constitutively hypermethylated) (data not shown).
  • Table 3 summarizes all region of 5mC change in fibroblasts with functional location, and chromosomal coordinates.
  • DNA methylation changes are associated to hydroxymethylation perturbations at specific locations along the FMRl locus in FXS fibroblasts.
  • PCR analyses of relative 5mC and 5hmC enrichments in the TSS region identified, compared to control PBMC samples, varying levels of increased methylation and decreased hydroxymethylation across the FXS PBMC samples.
  • PCR data and array data were found consistent, with in particular patient samples #8 and #12 showing highest levels of 5hmC, patients #8, #15 and #17, intermediate levels of 5hmC and patients #9, #10, #11 and #13 the lowest levels of 5hmC. Comparing DNA methylation and hydroxymethylation in selected patients showed correlation between 5mC and 5hmC (compare patient #9, high 5mC, low 5hmC and patient #12, low 5mC and high 5hmC).
  • Hypermethylation at the region surrounding the TSS is accompanied by a strong hypermethylation peak within the first intron of FMRl, in a region with lower CpG density as compared to FMRl promoter, as previously reported by Golder et al. (Godler et al., 2010 Hum Mol Genet. 2010 Apr 15;19(8): 1618-32).
  • Increased methylation upstream and downstream of the CGG repeats participate to the suppression of FMRl gene expression and may be a consequence of the repeat expansion and associated epigenetic switch.
  • the other regions of methylation changes in fibroblast cells show hypomethylation in FXS cells (region 5' and gene body).
  • the novel pyrosequencing assays developed herein provide an enhanced method for molecular characterization of FXS patient samples.
  • hMeDIP-qPCR assays at 6 regions of differential 5hmC encompassing the FMRl genomic region (Table 1, Table 2, Figure 3B) were developed.
  • Assay 3H3-4 lOkb upstream of FMRl transcriptional start site (TSS) localizes with the transcriptional start site of a 534bp non-coding RNA entitled L29074.3 (ENST00000597190) of unknown function.
  • Assays 3C1-2, and 213-4 are localized in the vicinity of FMR1 promoter region, upstream of the TSS.
  • Assays 3C7-9 and 3E8-9 are localized within the intron 1 of FMR1 and assay 3F9- Gl is localized 31.4 kb downstream of FMR1 TSS, within alternative-splicing rich regions of FMR1.
  • the deployment of these assays on 5 control DNA samples from healthy patient PBMCs confirmed our previous MeDIP-array data (Figure 2) with strong enrichment of the 5hmC mark in the promoter and intron 1 areas of the FMR1 locus.
  • the relative enrichment of 5hmC across individual control samples was highly consistent (Figure 3B, white bars).
  • the graphs illustrate the relative enrichment of 5mC (top) and 5hmC (bottom) (log2 fold enrichment) in 5 control PBMC (grey) and 1 illustrative FXS (black) PBMC samples over a region covering 79kb on ChrX: 146,971,000-147,050,000).
  • the position of the FMR1 gene and non-coding RNA L29074.3 is indicated. Exons are indicated with grey boxes and transcriptional orientation with arrows.
  • TSS Transcriptional Start Site.
  • the regions of change of methylation and hydroxymethylation are indicated with dashed lines and refer to the regions listed in Table 1.
  • Example 3 Combined 5mC and 5hmC measurements enhance molecular and functional characterization of FXS patient samples
  • Figure 4 illustrates the relationship between 5mC and 5hmC at two independent regions of FMRl, showing a significant correlation between 5mC levels at the peri-promoter region of FMRl (commercial Qiagen assay HsFMRl) and 5hmC levels within the intron 1 of FMRl, 8kb downstream of the TSS (assay 3E8-9).
  • figure 4 shows the relationship between the methylation (5mC) and the hydroxymethylation (5hmC) values is shown using simple linear regression analysis (see methods).
  • the coefficient of determination, denoted R 2 and the p-value for the data correlation are indicated.
  • the mRNA expression levels are expressed by the color intensity, the darker the more FMRl mRNA measured.
  • Example 4 FMRl methylation and hydroxymethylation is significantly correlated with ABC scores in FXS male patients.
  • the relationship between the methylation (5mC) values (x-axis) and the ABC score (y-axis, the higher the more severe) is indicated in the linear regression graph for assay B3 (5A) and for all assays in the table overview (5B).
  • the relationship between the hydroxymethylation (5hmC) values (x- axis) and the ABC score (y-axis) is indicated in the linear regression graph for assay 3F9-G1 (5C) and for all assays in the table overview (5D). Simple linear regression analysis were used for these analyses (see methods).
  • the middle panel graphs illustrate the relative enrichment of 5mC (top) and 5hmC (bottom) (log2 fold enrichment) as in Figure 1 and 3.
  • the data confirms the utility of 5mC to predict FXS disease severity and suggests for the first time that 5hmC measurements within the FMRl locus may be equally indicative of disease severity. Combined assessment of 5mC and 5hmC within selected regions of the FMRl locus may thus significantly enhance clinical diagnostics for Fragile X syndrome.
  • the Partial (PM) or Full (FM) methylation status of the FXS samples 1 to 5 is indicated as well as each patient's response to (-)-(3aR, 4S, 7aR)-4-Hydroxy- 4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester (Responder, R; Non-responder, NR).
  • Responder, R; Non-responder, NR Non-responder, NR.
  • GM04858 fibroblasts from a 4 year old fragile X patient GM07072 fetal lung fibroblasts from 22 week old fetus with a fragile mutation and GM09497 fibroblasts from a 28 year old fragile X patient, from Coriell Institute for Medical Research were grown in D-MEM supplemented with 15% FBS, penicillin/streptomycin, 2-mercaptoethanol (O. lmM) and sodium pyruvate.
  • the cell lines used as controls, BJ1 fibroblasts and MG63 osteosarcoma cell line from ATCC were cultured in the same condition.
  • PBMC were purified from blood using an 8 mL capacity PBMC separator tubes (BD Vacutainer CPT, BD).
  • Genomic DNA from fibroblasts and control cell lines was prepared by overnight Proteinase K (pK) treatment in lysis buffer (10 mM Tris-HCl pH 8.0, 50 mM EDTA pH 8.0, 100 mM NaCl, 0.5% SDS), phenol-chloroform extraction, ethanol precipitation and RNaseA digestion. Genomic DNA was sonicated (Bioruptor, Diagenode) to produce random fragments ranging in size from 300 to 1,000 bp and 4 ⁇ g of fragmented DNA was used for a standard hMeDIP assay.
  • DNA was denatured for 10 min at 95°C and immunoprecipitated for 3 hrs at 4°C with 15 ⁇ of monoclonal antibody against 5- methylcytidine (BI-MECY-1000, Eurogentec) (MeDIP) or with ⁇ of a rabbit polyclonal antibody against 5-hydroxymethylcytosine (#39769, active Motif) (hMeDIP) in a final volume of 500 ⁇ IP buffer (10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100).
  • IP buffer 10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100.
  • the mixture was incubated with 40 ⁇ magnetic beads (MeDIP: Dynabeads M-280 Sheep anti-mouse IgG (Invitrogen) for 2 hrs at 4°C / hMeDIP: Dynabeads Protein G (#100.03D, Invitrogen) for lhr at 4°C) and washed three times with 1ml of IP buffer. Beads were subsequently treated with proteinase K for 3 hrs at 50°C and the methylated DNA recovered by phenol-chloroform extraction followed by ethanol precipitation.
  • MeDIP Dynabeads M-280 Sheep anti-mouse IgG (Invitrogen) for 2 hrs at 4°C / hMeDIP: Dynabeads Protein G (#100.03D, Invitrogen) for lhr at 4°C
  • Table 5 List of primers used for methylation profiling at the FMR1 genomic locus
  • lug of genomic DNA was sonicated (Bioruptor, Diagenode) to produce random fragments ranging in size from 300 to 1,000 bp and 500ng of fragmented DNA was used for the hMeDIP assay.
  • DNA was denatured for 10 min at 95°C and immunoprecipitated for 3 hrs at 4°C with 400ng of a rabbit polyclonal antibody against 5-hydroxymethylcytosine (#39769, active Motif) (hMeDIP) in a final volume of 200 ul IP buffer (10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100).
  • the temperature profile of the cycles was DNA polymerase activation at 95°C for 15min, denaturation at 95°C for 30sec, annealing at 61°C for 30 sec, and extension at 72°C for 1 min for the first cycle.
  • the annealing temperature was decreased by 0.5°C per cycle.
  • 36 cycles of amplification were performed at 53°C, the final annealing temperature.
  • Biotinylated PCR product were then purified and immobilized onto streptavidin-coated Sepharose beads (GE Healthcare). Pyrosequencing was performed on the PyroMark Q96 MD (Biotage/Qiagen) following the manufacturer's instructions. Pyro QCpG 1.0.9 (Bioatage/Qiagen) was used to quantify DNA methylation at single CpGs. Data analyses Statistical analyses
  • Percentage of methylation per CpG obtained by pyrosequencing was summarized by averaging the value of all CpGs per assay, 0% being unmethylated and 100% fully methylated. 5hmC MeDIP-qPCR data were first normalized using the efficacy of each qPCR assay. The ratio IP/Input was calculated and is expressed as percent of Input, with higher values representing a stronger enrichment for the measured mark, 5hmC. The relationship between the methylation and the hydroxymethylation values to the clinical score (Aberrant Behavior Checklist (ABC C) score (Aman et al, 1995, supra)) was assessed via simple linear regression analysis. The coefficient of determination, denoted R 2 and the p-value for the clinical vs methylation data correlation are indicated. All analyses were conducted with TIBCO Spotfire 4.0.2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Description

Predictive Markers Useful in the Diagnosis and Treatment of Fragile X Syndrome (FXS)
FIELD OF THE INVENTION
The present invention provides methods and compositions directed to identification of genetic and epigenetic markers associated with Fragile X syndrome (FXS) disorders.
BACKGROUND OF THE INVENTION
Fragile X syndrome (FXS) is the most common cause of inherited mental retardation with a worldwide prevalence of 1/4000 in males and 1/8000 in females. The incidence of FXS is 10-20 times higher than other X-linked mental retardations. FXS is a monogenetic disease and mainly caused by a CGG-repeat expansion that triggers hypermethylation and silencing of the fragile X mental retardation 1 (FMRl) gene. The absence of the FMRl protein (FMRP) may result in overstimulation of protein synthesis mediated by metabotropic glutamate receptor 5 (mGluR5) signaling and consequently lead to the diversity of FXS phenotypes. mGluR5 antagonists have the potential to reduce the mGluR5 signaling and normalize the deficits caused by the lack of fragile X mental retardation protein.
There is no specific treatment for FXS and clinical practice varies in different countries. The most frequent medications used to treat the FXS symptoms are stimulants (i.e. methylphenidate), selective serotonin reuptake inhibitors (SSRIs) (e.g. fluoxetine), alpha-adreno-receptor agonists (e.g., clonidine), mood stabilizers (e.g. carbamazepine), and antipsychotic medication (e.g., risperidone, olazapine). The use of any of these drugs is compromised by their limited efficacy and the potential for undesirable side effects. In recent years, a role for mGluR antagonists has also been suggested.
The molecular pathways associated with FMRl epigenetic silencing in FXS are still elusive and their characterization may enhance the development of novel clinical biomarkers of disease and/or drug response as well as support the identification of novel therapeutic targets. This would contribute as well to the identification of epigenetic biomarkers for selecting a sub-population of FXS patients that might respond to particular FXS therapies.
SUMMARY OF THE INVENTION
The present invention is based on the finding of novel regions of epigenetic modifications within the FMRl genomic locus. Specifically, two methylation markers, DNA methylation and DNA
hydroxymethylation, were identified in novel regions of the FMRl genomic locus. These novel regions exhibiting these DNA methylation markers can be used as novel biomarkers for enhanced FXS disease diagnosis and patient stratification.
In one aspect the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS including detecting at an epigenetic biomarker selected from DNA methylation or hydroxymethylation at a predetermined region on chromosome X of an FMR1 genomic locus, and comparing the amount of methylation or hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
In one example, the predetermined chromosome X region for detecting DNA methylation can be between position 146993800 to 147048300 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., any predetermined chromosome X region as shown in Table 1, 2 or 3, or portion thereof. In one example, one or more of the DNA methylation regions shown in Table 1 can be assayed. For example, the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146993800-146996000, or a portion thereof;
146999000-147002900, or a portion thereof; and
147043300-147048300, or a portion thereof.
In another example, the predetermined chromosome X region for detecting DNA hydroxymethylation can be between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., any predetermined chromosome X region as shown in Table 1, 2 or 3, or portion thereof. In one example, one or more of the hydroxymethylation regions shown in Table 1 can be assayed. For example, the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146982000-146984500, or a portion thereof;
146991500-146993600, or a portion thereof;
146994300-147005500, or a portion thereof; and
147023800-147027400, or a portion thereof.
In another aspect the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS including detecting at least two epigenetic biomarkers selected from DNA methylation and hydroxymethylation at a predetermined region on chromosome X of an FMR1 genomic locus, comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed. The predetermined chromosome X region for detecting DNA methylation can be between position 146993800 to 147048300 and for hydroxymethylation is between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9). A diagnostic or prognostic determination can be made based on the amount of DNA methylation compared to a control and amount of hydroxymethylation compared to a control. In one example, the predetermined region for detecting DNA methylation includes one or more of the regions shown in Table 1 , 2 or 3 (regions listed under "coordinates") and the predetermined region for detecting hydroxymethylation includes one or more of the regions shown in Table 1, 2 or 3 (regions listed under "coordinates"). In one example, the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146993800-146996000, or a portion thereof;
146999000-147002900, or a portion thereof; and
147043300-147048300, or a portion thereof;
and the predetermined region for detecting hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146982000-146984500, or a portion thereof;
146991500-146993600, or a portion thereof;
146994300-147005500, or a portion thereof; and
147023800-147027400, or a portion thereof. In another example, the predetermined region for detecting DNA methylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146994193 to 146994355, or a portion thereof;
146994704 to 146994966, or a portion thereof;
146995178 to 146995495, or a portion thereof;
146999650 to 146999804, or a portion thereof; and
147046041 to 147046187, or a portion thereof;
and the predetermined region for detecting hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146983408 to 146983532, or a portion thereof;
146992564 to 146992704, or a portion thereof;
146992896 to 146993045, or a portion thereof;
146995564-146995705, or a portion thereof; 147001747-147001869, or a portion thereof; and
147024937-147025078, or a portion thereof.
In another aspect, the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting DNA methylation in a sample, e.g., Peripheral Blood Mononuclear Cells (PBMC), comprising one or more of the following predetermined regions:
a) position 146994193 to 146994355, or a portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146994704 to 146994966, or a portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146995178 to 146995495, or a portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146999650 to 146999804, or a portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147046041 to 147046187, or a portion thereof, on chromosome X of an FMR1 genomic locus; and
comparing the amount of methylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
In yet another aspect, the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample, e.g., PBMC comprising one or more of the following predetermined regions:
(a) position 146982000 to 146984500, or a portion thereof, on chromosome X of an FMR1 genomic locus;
(b) position 146991500 to 146993600, or a portion thereof, on chromosome X of an FMR1 genomic locus;
(c) position 146994300 to 147005500, or a portion thereof, on chromosome X of an FMR1 genomic locus; or
(d) position 147023800 to 147027400, or a portion thereof, on chromosome X of an FMR1 genomic locus;
comparing the amount of methylation to a control, whereby FXS or the predisposition for FXS can be diagnosed herein the amount of hydroxymethylation is indicative as to whether the has FXS or a predisposition for FXS. In still yet another example, the invention includes a method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample, e.g., PBMC comprising one or more of the following predetermined regions:
position 146983408 to 146983532, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 146992564 to 146992704, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 146992896 to 146993045, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 146995564-146995705, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 147001747-147001869, or a portion thereof, on chromosome X of an FMRl genomic locus; or
position 147024937-147025078, or a portion thereof, on chromosome X of an FMRl genomic locus;
comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
In another example, the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with an mGluR antagonist, the method comprising:
providing a sample such as PBMC from an individual having Fragile X Syndrome;
detecting DNA methylation and/or hydroxymethylation at a predetermined region on chromosome X of an FMRl genomic locus in the sample, wherein the predetermined region for detecting DNA methylation comprises one or more of the following regions:
a) position 146994193 to 146994355, or a portion thereof;
b) position 146994704 to 146994966, or a portion thereof ;
c) position 146995178 to 146995495, or a portion thereof;
d) position 146999650 to 146999804, or a portion thereof; or
e) position 147046041 to 147046187, or a portion thereof; and
wherein the predetermined region for detecting 5- hydroxymethylcytosine comprises one or more of the following regions:
a) position 146983408 to 146983532, or a portion thereof; b) position 146992564 to 146992704, or a portion thereof;
c) position 146992896 to 146993045, or a portion thereof;
d) position 146995564-146995705, or a portion thereof;
e) position 147001747-147001869, or a portion thereof;
f) position 147024937-147025078, or a portion thereof; and
comparing the amount of methylation to a control and the amount of hydroxymethylation to a control, to determine the likelihood of the individual being a responder to compound.
In another aspect, the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with a test molecule such as an mGluR antagonist, the method comprising:
detecting hydroxymethylation at a predetermined region, or a portion thereof, in a sample from an individual having Fragile X Syndrome, wherein the predetermined region comprises one or more of the following regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus;
wherein the amount of hydroxymethylation is indicative whether that the individual is a responder or non-responder to the test molecule. In one example for the method described above, the individual is selected for treatment with an mGluR antagonist such as (-)-(3aR, 4S, 7aR)-4-Hydroxy-4- m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof. In another aspect, the invention includes a method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with an mGlur5 antagonist, the method comprising:
providing a sample, e.g., PBMC, from an individual having Fragile X Syndrome; and detecting hydroxymethylation at a predetermined region in the sample, wherein the
predetermined region comprises one or more of the following regions:
(a) position 146982000 to 146984500, or portion thereof, on chromosome X of an FMR1 genomic locus;
(b) position 146991500 to 146993600, or portion thereof, on chromosome X of an FMR1 genomic locus;
(c) position 146994300 to 147005500, or portion thereof, on chromosome X of an FMR1 genomic locus;
(d) position 147023800 to 147027400, or portion thereof, on chromosome X of an FMR1 genomic locus; wherein the amount of hydroxymethylation in one or more regions is indicative whether the individual is a responder or non-responder to the test molecule . The mGlur5 antagonist can be any known mGluR5 antagonist such as (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l- carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
In another aspect, the invention includes a method for treating an individual with Fragile X Syndrome (FXS), comprising selectively administering a therapeutically effective amount of (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, to the subject on the basis of the subject having an amount of
hydroxymethylation indicative that the individual will respond to (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m- tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, wherein the predetermined region comprises one or more of the following regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus; e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus.
In yet another aspect, the invention includes a method of selecting an individual with Fragile X
Syndrome (FXS) for treatment with a therapeutically effective amount of (-)-(3aR, 4S, 7aR)-4-Hydroxy- 4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, the method comprising detecting hydroxymethylation at a predetermined region in the sample, wherein the predetermined region comprises one or more of the following regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus,
wherein the individual is selected for treatment on the basis of the subject having an amount of hydroxymethylation indicative that the individual will respond to treatment with (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof. In one example, the method can further include administering (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a
pharmaceutically acceptable salt thereof to the selected individual. In another example, the method can further include administering a compound other than (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl- octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof to an individual on the basis of that individual on the basis of the individual not having an amount of hydroxymethylation compared to a control indicative that the individual will respond to treatment with (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester. In yet another example, the invention includes a method of selectively treating a subject having FXS, comprising selectively administering a therapeutically effective amount of (^-Pyrrolidine- 1,2- dicarboxylic acid 2-amide 1 -( {4-methyl-5-[2-(2,2,2-trifluoro- 1 , 1 -dimethyl-ethyl)-pyridin-4-yl]-thiazol- 2-yl} -amide), or a pharmaceutically acceptable salt thereof, to the subject on the basis of the amount of hydroxymethylation compared to a control at a predetermined region in the sample, wherein the predetermined region comprises one or more of the following regions:
(a) position 146982000 to 146984500, or a portion thereof, on chromosome X of an FMRl genomic locus;
(b) position 146991500 to 146993600, or a portion thereof, on chromosome X of an FMRl genomic locus;
(c) position 146994300 to 147005500, or a portion thereof, on chromosome X of an FMRl genomic locus; and
(d) position 147023800 to 147027400, or a portion thereof, on chromosome X of an FMRl genomic locus.
In yet another aspect, the invention includes a method of screening for an agent that modulates an epigenetic biomarker including contacting an agent with a mammalian cell; and detecting at least two biomarkers selected from DNA methylation and hydroxymethylation at a predetermined region as described in Table 1 or 3 within the FMRl genomic locus, wherein a change in biomarker status relative to a control is indicative that the agent is an epigenetic biomarker modulating agent.
In still another aspect, the invention includes an mGluR5 antagonist, e.g., (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, for use in treating Fragile X, characterized in that a therapeutically effective amount of said compound or its pharmaceutically acceptable salt is administered to the individual on the basis of the amount of hydroxymethylation compared to a control at one or more of the following positions:
(a) position 146982000 to 146984500, or a portion thereof, on chromosome X of an FMRl genomic locus;
(b) position 146991500 to 146993600, or a portion thereof, on chromosome X of an FMRl genomic locus; (c) position 146994300 to 147005500, or a portion thereof, on chromosome X of an FMR1 genomic locus; and
(d) position 147023800 to 147027400, or a portion thereof, on chromosome X of an FMR1 genomic locus.
In still another aspect, the invention includes an mGluR5 antagonist, e.g., (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, for use in treating Fragile X, characterized in that a therapeutically effective amount of said compound or its pharmaceutically acceptable salt is administered to the individual on the basis of said individual having an amount of hydroxymethylation compared to a control indicative that the subject will respond to treatment with the an mGluR5 antagonist at one or more of the following positions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus.
As described herein, the invention includes detecting methylation which can be performed using any assay known in the art including methylation-sensitive restriction enzyme digestion combined with PCR or bisulfite DNA modification combined with at least one of: methylation specific PCR (MSP), , probe-based methylation specific PCR or pyrosequencing.
In another example, the invention includes detecting for hydroxymethylation using any assay known in the art. In one particular example, detecting hydroxymethylation can include enriching for 5-hmC- marked DNA by immunoprecipitation and determining the level of enrichment of 5-hmC in the sample. The enrichment level can be determined by, e.g., sequencing, qPCR, or an array.
In another aspect, the invention is directed to a diagnostic kit for diagnosing an individual as having Fragile X Syndrome (FXS), including an agent for detecting methylation or hydroxymethylation within one or more regions on chromosome X of the FMRl genomic locus. Specifically, the agent can be used to detect DNA hydroxymethylation between 146982000 to 147027400 (herein coordinates based on Human reference genome GRCh37/hgl9), e.g., a predetermined chromosome X region as shown in Table 1, 2 or 3. Specifically, one or more of the hydroxymethylation regions shown in Table 1 can be assayed. For example, the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146982000-146984500, or a portion thereof;
146991500-146993600, or a portion thereof;
146994300-147005500, or a portion thereof; and
147023800-147027400, or a portion thereof.
Alternatively, the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMRl genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMRl genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMRl genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMRl genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMRl genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMRl genomic locus.
In another aspect, the invention is directed to a diagnostic kit for diagnosing an individual as having Fragile X Syndrome (FXS), including an agent for detecting at least two epigenetic biomarkers selected from the group consisting of DNA methylation and hydroxymethylation within a region on chromosome X of the FMRl genomic locus.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 depicts a schematic of the experimental overview of methylated DNA ImmunoPrecipitation ((h)MeDIP) assays combined to a custom DNA microarray platform covering a broad FMRl locus to profile DNA methylation (5mC) and hydroxymethylation (5hmC) in genomic DNA obtained from control and Fragile X syndrome patient samples.
Fig 2 depicts graphs that illustrate the relative enrichment of 5mC and 5hmC (log2 fold enrichment) in control (grey) and FXS (black) fibroblast and PBMC samples (annotated 5mC or 5hmC Fibro or PBMC) over a region covering 79kb on ChrX: 146,971,000-147,050,000).
Fig. 3A depicts two graphs illustrating the relative enrichment of 5mC (top) and 5hmC (bottom) (log2 fold enrichment) in control PBMC (grey) and in FXS (black) PBMC samples over a region covering 79kb on ChrX: 146,971,000-147,050,000) and Fig.3B (A-F) depict bar graphs showing individual hydroxymethylation (hMeDIP-qPCR) assays along the FMRl locus which measure different levels of 5hmC along the FMRl locus and across a group of FXS patients (black bars, n=16) and controls (white bars, n=5).
Fig. 4 depicts a graph showing the partial anti-correlation between measured 5mC and 5hmC in the blood of 16 FXS male patients.
Fig. 5A depicts a linear regression graph for assay B3 showing the relationship between the methylation (5mC) values (x-axis) and the ABC score (y-axis, the higher the more severe); Fig. 5B shows a table overview of the relationship between the methylation and the ABC score for all assays; Fig 5C depicts a linear regression graph for assay 3F9-G1 showing the relationship between the hydroxymethylation (5hmC) values (x-axis) and the ABC score (y-axis); and Fig. 5D shows a table overview of the relationship between hydroxymethylation (5hmC) and the ABC score for all regions assayed.
Fig. 6A shows bar graphs of Individual hMeDIP-qPCR assays along the FMRl gene region measuring different levels of 5hmC along the FMRl genomic locus and across a group of control patient (white bars) or clinically treated patient samples and 6B depicts the FMRl genomic locus showing exons, indicated with grey boxes and transcriptional orientation with arrows.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, in part, on the finding of novel regions within the FMRl genomic locus that show changes in epigenetic biomarker status compared to a control. The present invention provides critical regions in the FMRl genomic locus that can be used to diagnose subjects suspected of having FXS, or to predict a subject's predisposition thereto. Moreover, the epigenetic changes in the FMRl gene locus can be used in the selection of particular FXS patients who are likely responders to FXS therapies such as treatment with an mGluR5 antagonist.
The sequence of the FMRl gene is known in the art (GenBank L29074 L38501) (Nucleic Acids Res. 2002 Jul 15;30(14):3278-85) (Hum Mol Genet. 2010 Apr 15;19(8): 1618-32. Epub 2010 Jan 29). The FMRl genomic locus covers the FMRl gene sequence and sequences upstream and downstream of the gene sequence. In one example, the FMRl genomic locus on chromosome X is between position 146981500 to position 147048300. This region can include a 67 kb region and can include the FMRl coding region, a regionl2 kb upstream of the FMRl coding region and a 16 kb downstream region of the FMRl coding region. All reported chromosomal coordinates as disclosed herein are based on the Human Reference Genome HG19 (Feb. 2009 (GRCh37/hgl9).
Epigenetic Biomarkers
In the methods of the invention, the epigenetic status in a sample from an individual is detected by determining the presence of one or more epigenetic biomarkers as described herein. The methods of the invention include determining amount or level of the epigenetic biomarker in a sample of interest compared to a control. The epigenetic biomarkers of the invention include DNA methylation (also referred to herein as 5-methylcytosine or 5mC) and hydroxymethylation (also referred to herein as 5- hydroxymethylcytosine or 5hmC). Specifically, the invention provides predetermined regions, or a portion thereof, (as shown in Table 1, 2 and 3 under "coordinates") within the FMRl genomic locus that can be used in the method of the invention. As described herein a portion of a predetermined region includes a region which has a single or group of CpGs. A control as used herein can include a clinically defined sample which has a predefined level of methylation or hydroxymethylation indicative of FXS diagnosis or therapeutic efficiacy, or can be a sample from a healthy subject which is performed at the same time as the methods of the invention. Alternatively, the control can be a statistically validated reference value for use in the methods.
Below is a table that lists regions of methylation and hydroxymethylation changes identified in FXS fibroblasts and PBMCs. Any one or more of these regions can be used in the methods of the invention. Each region is indicated with a unique Region ID (cell type-mark-number) and the functional location (position of the methylation change in kilo-base-pairs (kb) with regards to the transcriptional start site (TSS) or 3' untranslated region (3'UTR)), the chromosomal coordinates are also indicated. The locus specific assays, their ID used throughout the figures, the sequence of primers used and the position of each assay along the FMRl regions are indicated. Fig. 5 illustrates the genomic position of all regions listed in Table 1.
Figure imgf000015_0001
Figure imgf000016_0001
Figure imgf000017_0001
Table 1
Examples of specific predetermined regions are shown in Table 2 below. Any one or more of these regions can be used in the methods of the invention. Specifically, Table 2 shows the FMRl locus specific methylation and hydroxymethylation assays, the ID used as it corresponds to the figures, the sequence of primers used, the position of each assay along the FMRl regions and the genomic DNA sequence covered by each assay are indicated.
Coordinates Sequence to analyse Size (also referred to
Assay Pyrosequencing /
herein as
ID* qPCR Assay
predetermined
regions)
5mC Pyrosequencing Assays
Figure imgf000018_0001
Figure imgf000019_0001
Figure imgf000020_0001
Table 2
In one embodiment of the invention, the presence of a single epigenetic biomarker such as either methylation or hydroxymethylation can be detected as outlined in Tables 1, 2, or 3, or a combination thereof.
In one example, one or more of the hydroxymethylation regions shown in Table 1 or Table 2 is assayed. For example, the predetermined region for hydroxymethylation can include a region selected from the group consisting of one or more of the following predetermined regions:
a. 146982000-146984500, or a portion thereof;
b. 146991500-146993600, or a portion thereof;
c. 146994300-147005500, or a portion thereof; and
d. 147023800-147027400, or a portion thereof.
In one example, only one region of a-d as listed above is assayed. In another example, any two of the regions a-d are assayed, e.g., a and b; or a and c; or b and c, or b and d, etc. Similarly, any three of the regions a-d are assayed, e.g., a, b and c; or a, c and d; or b, c, and d, etc are assayed.
In another example, the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus; e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMRl genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMRl genomic locus.
In one example, only one region of a-f as listed above is assayed. In another example, any two of the regions a-f are assayed, e.g., a and b; or a and f; or b and c, or b and d, etc. Similarly, any three of the regions a-f are assayed, e.g., a, b and c; or a, c and d; or b, c, and d, d, e, and f, etc, are assayed.
Similarly, any four of the regions a-f are assayed, e.g., a, b, c and d; or a, c, d and f; or b, c, d and f; etc, are assayed. Similarly, any five, six or all of the regions a-f are assayed.
In another embodiment, the presence of at least two or more biomarkers as described herein are detected.
The presence of the epigenetic biomarkers as described herein can be determined in any appropriate sample, e.g., blood samples or from other origins (other body fluids, mouth swabs), from an individual of interest. Specifically, the sample can include a fluid sample such as blood, a cell sample such as PBMCs or buccal cells or fibroblasts, or a tissue sample such as skin or a hair follicle.
The methods described herein provide information to enable a health care provider to determine the likelihood that a subject suspected of having FXS, has FXS or a predisposition thereto, or whether an FXS subject will respond to treatment, e.g., using an mGluR5 antagonist. In one example, following a positive determination of the relevant epigenetic biomarker(s) in a sample of interest, the individual can be treated with an agent of interest such as an mGluR5 antagonist. Alternatively, following a negative determination of the relevant epigenetic biomarker(s) in a sample of interest, the individual can be treated with an agent of interest other than an mGluR5 antagonist.
FMRl Methylation and Hydroxymethylation Analysis
DNA methylation includes the epigenetic modification that is catalyzed by DNA cytosine-5- methyltransferases (DNMTs) and occurs at the 5-position (C5) of the cytosine ring within CpG dinucleotides. As used herein changes in methylation include detecting hypermethylation or
hypomethylation compared to a control. The extent of FMRl gene methylation in the FMRl gene body can be determined using any method known in the art. In one example, the method of the invention includes detecting DNA methylation within the FMRl genomic locus, wherein a change in biomarker status relative to a control is indicative of FXS or the predisposition for FXS. The FMRl gene region of interest to be analyzed for its methylation status according to the present invention can be of any length as long as it includes at least one CpG site, e.g., for DNA methylation can be between position 146993800 to 147048300 and for hydroxymethylation is between 146982000 to 147027400of an FMRl gene sequence. In another example, the DNA methylation and hydroxymethylation status of the FMRl gene region to be analyzed is shown in Table 1, 2, and 3.
In yet another example, the CGG repeats that are located in the 3'-UTR of the FMRl gene are analyzed for their methylation status and the present invention can be used to complement CGG repeat analysis and enhance diagnosis of FXS in a subject or for use in selecting patients for FXS therapy.
Methylation
Various methods can be used to determine methylation status of an individual of interest such as a qualitative assay such as MSP. Another method useful in the method of the invention is a quantitative assay method such as methylation-sensitive restriction enzyme digestion combined with quantitative PCR, matrix-assisted laser desorption/ionization time-to-flight mass spectrometry (MALDI-TOF- MS), real-time PCR (methyl light).
The invention is not limited by the types of assays used to assess the extent of methylation of the FMRl gene region in the sample. Indeed, any assay that can be employed to determine the methylation status of a gene can be employed for the purposes of the present invention. Examples of types of assays used to assess the methylation pattern include, but are not limited to:
(i) methylation-sensitive restriction enzyme digestion combined with at least one of: hybridization, quantitative PCR, restriction landmark genomic scanning (RLGS), or array-based profiling of reference-independent methylation status (aPRIMEs);
(ii) bisulfite DNA modification combined with at least one of: methylation specific PCR (MS-PCR), quantitative methylation specific PCR (qMS-PCR), probe-based methylation specific PCR, pyrosequencing, cloning/sequencing, MS-nested PCR, quantitative analysis of methylated alleles (QUAMA), heavy methyl detection, methylation-sensitive high resolution melting (MS-HRM), methyl-binding (MB)- PCR, PCR and deoxyribonucleoside monophosphate (dNMP) analysis, or methylation-dependent fragment separation (MDFS);
(iii) total hydrolysis followed by high-performance liquid chromatography (HPLC);
(iv) combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS);
(v) combined bisulfite restriction analysis (COBRA); direct or indirect detection of
methylated DNA molecules in a nano transistor or other electronic based device; and;
(vi) methyl-BEAMing (beads, emulsion, amplification and magnetics) technology or single molecule real-time DNA sequencing (SMRT sequencing)
In one example, the extent of methylation can be determined using Methylation Specific PCR (MSP). MSP is a bisulfite conversion based PCR technique that can be used to determine DNA CpG
methylation. MSP involves the initial modification of DNA by sodium bisulfite which converts all unmethylated, but not methylated, cytosines to uracil. The DNA is then amplified with two pairs of primers specific for methylated DNA and unmethylated DNA, respectively, and the methylation status determined. The primers typically include at least two CpG sites. The MSP methods are described in U.S. Pat. No. 5,786,146; U.S. Pat. No. 6,017,704; U.S. Pat. No. 6,200,756; and U.S. Pat. No. 6,265,171; the entire contents of each of which is incorporated herein by reference. In one example, using the MSP assay, an individual would be assigned as an mGluR5 responder when the methylated FMR1 is detected by the primers specific for methylated DNA and unmethylated FMR1 is not detected by the primers specific for unmethylated DNA in the region of interest of the FMR1 gene.
In another example, the extent of methylation can be determined using a method that includes an amplification process such as quantitative PCR (qPCR) in the FMR1 gene region of interest. In one example, the qPCR method described in WO2011/137206 can be used. The method described in WO2011/137206 is incorporated herein by reference. Various other different qPCR methods which detect methylation are known in the art and include HeavyMethyl or Methylight. Using the
HeavyMethyl method, the FMR1 gene region is initially modificated by sodium bisulfite. The DNA is then contacted with non-extendable oligonucleotide blockers that provide specificity by binding to bisulfite-treated DNA in a methylation-specific manner. The DNA is then contacted with a primer set that has binding sites that overlap with non-extendable oligonucleotide blockers. When the blocker is bound, the primer cannot bind and therefore no amplicon is generated. Conversely, if the blocker is not bound, the primers can bind and generate an amplicon (Cottrell et al. Nucleic Acids Res. 2004; 32(1), 2004).
Using the MethyLight method, the FMR1 gene region of interest is initially modified by sodium bisulfite. The gene region is then amplified using PCR primers that hybridize to regions containing no CpG dinucleotides. By using fluorescent-labeled probes that hybridize only to sequences resulting from bisulfite conversion of unmethylated DNA, (or alternatively to methylated sequences that are converted), fluorescent probe detection can indicate methylation status of sequences where the probes hybridize.
Methods for detecting methylation of a region of interest by cutting the DNA with a methylation- sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA are known in the art. The method can encompass amplifying intact DNA after restriction enzyme digestion see, e.g., U.S. patent application Ser. Nos. 10/971,986; 11/071,013; and 10/971,339.
In one example, the method of the invention includes digesting the FMR1 gene region of interest with a methylation sensitive restriction enzyme and amplifying up the region of interest. The methylation status of the DNA can be determined by detecting for the presence of an amplifiable product. Only DNA that was not cleaved by the restriction enzyme will be amplified. A methylation sensitive restriction enzyme can be for example, McrBC, which includes CG as part of its recognition site and can cleave when the C is methylated. Additionally the sample can be contacted with a restriction enzyme which includes CG as part of its recognition site and can cleave only when the C is unmethylated.
Following digestion, the desired FMR1 region can be amplified by real-time PCR using a
forward/reverse oligonucleotide and a detecting probe. The probe for detecting nucleic acid sequence typically has a fluorescent reporter or fluorophore such as 6-carboxyfluorescein (FAM) and
tetrachlorofluorescin (TET) and a quencher such as tetramethylrhodamine (TAMRA) or black hole quencher (BHQ) covalently attached to its 5' and 3' ends, respectively.
The methods described above can be used with a methylation analyzer. Typically, the method includes determining the extent of FMR1 methylation in the sample, transforming the results into a computer readable form and applying a mathematical algorithm to classify the results into a classification group, i.e., diagnosis of FXS. Typically the methods described above include control samples such as samples that are fully methylated and samples that are partially methylated. DNA purified from fragile X patient's B- lymphocytes (Camden, NJ) can be used to generate appropriate controls or clinical samples which are already determined to have a particular methylation status can be used. Typically the methods described above include control samples. Such samples are readily available in the art or can be commercially purchased from, e.g., ATCC (American Type Culture Collection (ATCC), The National Institute for Biological Standards and Control (NIBSC) or Coriell institute for medical research. The control can either be run simultaneously with the test sample or can be represented as a predetermined value based on the technology used to determine the methylation status of the sample. In one example, the predetermined value is a Delta Ct value which is obtained using quantitative PCR (as described herein).
The oligonucleotides of the invention can include any oligonucleotide as disclosed in Table 1 , 2 and 3 and any other oligonucleotide that can be used to detect a predetermined region as described herein. The oligonucleotides of the invention include variants of the sequences or sequences that are
substantially similar to the oligonucleotides of the invention. Variants include sequences that are altered by one or more bases, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 but can still anneal to the specific locations on the FMRl sequence of interest. The term "substantially" when used in relation to annealing or hybridisation, means that the oligonucleotide or probe nucleic acid sequence should be sufficiently complementary to hybridise or anneal to its respective nucleic acid. As used herein, the term
"hybridisation" refers to the process by which a strand of nucleic acid joins with a complementary strand. In one example, the oligonucleotide is between 14-30 bases. In another example, the oligonucleotide is between 18-30.
Oligonucleotides may be prepared by chemical synthesis using any suitable methodology known in the art, or may be derived from a biological sample, for example, by restriction digestion. The
oligonucleotides may be labeled, according to any technique known in the art, including use of radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like.
Hydroxymethylation (5-hmC)
The invention further includes detecting hydroxymethylation in the FMRl locus, wherein the amountof hydroxymethylation (5-hmC) relative to a control is indicative of FXS or the predisposition for FXS, or can be used to stratify patients receiving an mGluR5 antagonist as described herein. 5-hmC is a hydroxylated and methylated form of cytosine. The FMRl gene region of interest to be analyzed for its 5-hmC status according to the present invention can be of any length. Examples of regions are shown in Tables 1 and 2. Methods of detecting 5-hmC are known in the art such as described in WOl 1127136 (incorporated herein by reference) or any other assay which can measure enrichment or base resolution 5hmC within the FMRl locus in genomic DNA purified from samples of interest.
In one example, 5-hmC in a sample of interest can be detected by first enriching for 5-hmC-marked DNA by immunoprecipitation and then quantifying for the presence of 5-hmC by either sequencing, qPCR, or arrays. In another example, 5-hmC can be detected by using either HPLC, LC/MS or single molecule real-time DNA sequencing (SMRT sequencing)
In one preferred example, hydroxymethylation can be measured as described herein using hMeDIP- qPCR with selected primers (see Tables land 2).
The present invention of detecting hydroxymethylation as described herein can be used in combination with the standard methylation clinical diagnostic assays such as detecting methylation at the FMRl promoter (e.g., SEQ ID NO: l or a portion thereof) or using the assay as described in WO2011/137206, which is incorporated in its entirety herein by reference in order to stratify patients who are more likely to respond to an mGluR5 antagonist. As described in WO2011/137206, the FMRl gene promoter is analyzed for its methylation status. In one example, the FMRl promoter region being analyzed is the full length promoter region. In another example, a portion of the FMRl promoter region is analyzed for its methylation status. In a particular example the FMRl gene promoter region has the nucleotide sequence of SEQ ID NO: 67 (shown below; CpG islands are shown in bold and underlined). ccaaaccaaaccaaaccagaccagacaccccctcccgcggaatcccagagaggccgaactgggataaccggatgcatttgatttcccacgccactg agtgcacctctgcagaaatgggcgttctggccctcgcgaggcagtgcgacctgtcaccgcccttcagccttcccgccctccaccaagcccgcgcacg cccggcccgcgcgtctgtctttcgacccggcaccccggccggttcccagcagcgcgcatgcgcgcgctcccaggccacttgaagagagagggcg gggccgaggggctgagcccgcggggggagggaacagcgttgatcacgtgacgtggtttcagtgtttacacccgcagcgggccgggggttcg (SEQ ID NO:67)
FXS Drug Therapies The present invention can be used to determine if an individual will respond to FXS drug therapies. In one example, the invention can be used to determine if an individual having FXS are likely to respond to treatment with an FXS treating agent such as an Metabotropic Glutamate Receptor 5 (mGluR5) antagonist. As used herein, "an mGluR5 responder" is an individual having FXS who is likely following therapeutic treatment with an mGluR5 antagonist to show improved behavioral symptoms as assessed using the Aberrant Behavior Checklist - Community Edition (ABC-C) measure of behavior (Bihm et al., Am. J. Ment Retard 96:209-211). The ABC-C measurement looks at various behaviors including stereotypic behavior, hyperactivity, inappropriate speech, and restricted interests. An individual who shows a decrease in ABC-C scores following treatment with an mGluR5 antagonist is classified as an mGluR5 responder. The behavioral symptoms may also be assessed by other methods, such as Clinical Global Impression (CGI) scale, Social Responsiveness Scale (SRS), or Repetitive Behavior Scale - Revised (RBS-R). Individuals showing an improvement according to these tests will also be determined to be an mGluR5 responder. Also as used herein, "an mGluR5 non-responder" is an individual having FXS who is unlikely following therapeutic treatment with an mGluR5 antagonist to show improved behavioral symptoms as assessed using the Aberrant Behavior Checklist - Community Edition (ABC-C) measure of behavior (Bihm et al, Am. J. Ment Retard 96:209-211). Such an individual should based on a negative finding using the methods of the invention, be administered a compound other than an mGluR5 antagonist.
Examples of mGluR5 antagonists include eptidomimetics, proteins, peptides, nucleic acids, small molecules, or other drug candidates. An example of an mGluR5 antagonist is (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester. The mGluR5 antagonist, (- )-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, as well as methods of making the same, are disclosed in U.S. Patent No. 7,348,353, which disclosure is incorporated by reference herein. The mGluR5 antagonist, (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m- tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester has the following structural formula:
Figure imgf000028_0001
Other mGLUR5 antagonists such as those disclosed in U.S. Patent No. 7,348,353 are contemplated for use in the methods of the present invention.
As described herein the method can be used to select those individuals having FXS who are likely to respond to therapy with an mGluR5 antagonist based on the amount of methylation or
hydroxymethylation in the FMRl genomic locus compared to a control. If the individual having FXS does not show an amount of methylation or hydroxymethylation indicative that the individual will respond to an mGluR5 antagonist, an alternative therapy other than an mGluR5 antagonist should be administered.
In one embodiment, the mGluR5 antagonist is a compound of the formula (I)
Figure imgf000028_0002
wherein
R represents optionally substituted alkyl or optionally substituted benzyl; and
R2 represents hydrogen (H), optionally substituted alkyl or optionally substituted benzyl; or
R1 and R2 form together with the nitrogen atom to which they are attached an optionally substituted heterocycle with less than 14 ring atoms;
R3 represents halogen, alkyl, alkoxy, alkylamino or dialkylamino;
R4 represents hydroxy (OH), halogen, alkyl or alkoxy;
Q represents CH, CR4 or N; Y represents CH, CR4 or N;
W represents CH, CR4 or N;
X represents CH or N;
Y represents CH, CR3 or N;
Z represents CH2, NH or O; and
provided that Q, V and W are not N at the same time;
in free base or acid addition salt form.
In another embodiment, the mGluR5 antagonist is a compound of the formula (II), wherein a compound of the formula (II) is a compound of formula (I) in which at least one of Q, V and W is N; in free base or acid addition salt form.
In yet a further embodiment, mGluR5 antagonist is a compound of the formula (III), wherein the compound of formula (III) is a compound of formula (II) in which Y is CR3; in free base or acid addition salt form.
Preferred substituents, preferred ranges of numerical values or preferred ranges of the radicals present in the formula (I), (II) and (III) and the corresponding intermediate compounds are defined below.
X preferably represents CH.
Y preferably represents CH or CR3, wherein R3 preferably represents halogen, particular preferably chloro.
Z preferably represents NH.
R3 preferably represents fluoro, chloro, Ci_4 alkyl, e.g. methyl. R3 particularly preferably represents chloro.
R1 and R2 preferably form together with the nitrogen atom to which they are attached an unsubstituted or substituted heterocycle having 3 - 11 ring atoms and 1 - 4 hetero atoms; the hetero atoms being selected from the group consisting of N, O, S, the substituents being selected from the group consisting of oxo (=0), hydroxy, halogen, amino, nitro, cyano, Ci_4 alkyl, Ci_4 alkoxy, Ci_4 alkoxyalkyl, Ci_4 alkoxycarbonyl, Ci_4 alkoxycarbonylalkyl, Ci_4 halogenalkyl, C6-1o aryl, halogen- C6-1o aryl, C6-io aryloxy and C6-io-aryl-Ci_4 alkyl.
R1 and R2 form together with the nitrogen atom to which they are attached form an
unsubstituted, a single or twofold substituted heterocycle having 5 - 9 ring atoms and 1 - 3 hetero atoms; the hetero atoms being selected from the group consisting of N and O; the substituents being selected from the group consisting of halogen and Ci_4 alkyl.
R1 and R2 preferably form together with the nitrogen atom to which they are attached an unsubstituted, a single or twofold substituted heterocycle selected from the group
consisting of
Figure imgf000030_0001
and the substituents being selected from the group consisting of fluoro, chloro, methyl, ethyl, propyl, butyl, trifluoromethyl, fluoropropyl and difluoropropyl.
R1 and R2 preferably represent, independently from each other, Ci-C4 alkyl or benzyl,
optionally substituted by Ci-C4 alkoxy or halogen.
The above mentioned general or preferred radical definitions apply both to the end products of the formulae (I), (II) and (III) and also, correspondingly, to the starting materials or intermediates required in each case for the preparation. These radical definitions can be combined with one another at will, i.e. including combinations between the given preferred ranges. Further, individual definitions may not apply. Preference according to the invention is given to compounds of the formulae (I), (II) and (III) which contain a combination of the meanings mentioned above as being preferred.
Particular preference according to the invention is given to compounds of the formulae (I), (II) and (III) which contain a combination of the meanings listed above as being particularly preferred.
Very particular preference according to the invention is given to the compounds of the formula (I) which contain a combination of the meanings listed above as being very particularly preferred.
Preferred are those compounds of formulae (I), (II) and (III) wherein R2 represents an unsubstituted or substituted heterocycle.
Particular preferred are compounds of formulae (Ila to He) as shown below:
Figure imgf000031_0001
wherein the substituents have the meaning given in this specification;
Figure imgf000031_0002
wherein the substituents have the meaning given in this specification;
Figure imgf000031_0003
wherein the substituents have the meaning given in this specification;
Figure imgf000031_0004
(Hd) wherein R represents C1-C4 alkyl, preferably methyl, and the other substituents have the meaning given in this specification;
Figure imgf000032_0001
wherein R represents halogen, preferably chloro, and the other substituents have the meaning given in this specification.
Further preferred compounds of the present invention have the formulae (Ilia to Hie) as shown below:
Figure imgf000032_0002
wherein all of the substituents have the meaning given in this specification;
Figure imgf000032_0003
wherein the substituents have the meaning given in this specification;
Figure imgf000032_0004
wherein the substituents have the meaning given in this specification;
Figure imgf000032_0005
(Hid) wherein R represents C1-C4 alkyl, preferably methyl, and the other substituents have the meaning given in this specification;
Figure imgf000033_0001
wherein R4 represents halogen, preferably chloro, and the other substituents have the meaning given in this specification.
Particular compounds of the formulae (I), (II) and (III) include those described in the Examples given herein.
In another embodiment, the mGluR5 antagonist is a compound of the formula (IV):
Figure imgf000033_0002
wherein
m is 0 or 1 ,
n is 0 or 1 and
A is hydroxy
X is hydrogen and
Y is hydrogen, or
A forms a single bond with X or with Y;
Ro is hydrogen, (Ci_4)alkyl, (Ci_4)alkoxy, trifluoromethyl, halogen, cyano, nitro, -COORi wherein Ri is (Ci_4)alkyl or -COR2 wherein R2 is hydrogen or (Ci_4)alkyl, and
R is -COR3, -COOR3, -CONR4R5 or -S02Re, wherein R3 is (Ci_4)alkyl, (C3-7)cycloalkyl or optionally substituted phenyl, 2-pyridyl or 2-thienyl; R4 and R5, independently, are hydrogen or (Ci_4)alkyl; and 5 is (Ci_4)alkyl, (C3_7)cycloalkyl or optionally substituted phenyl, R is hydrogen or (Ci_4)alkyl and R" is hydrogen or (Ci_4)alkyl, or
R and R" together form a group -CH2-(CH2)m- wherein m is 0, 1 or 2, in which case one of n and m is different from 0,
with the proviso that Ro is different from hydrogen, trifluoromethyl and methoxy when n is 0, A is hydroxy, X and Y are both hydrogen, R is COOEt and R' and R" together form a group -' (CH2)2-, in free base or acid addition salt form.
Exemplary compounds of formula (IV) include:
(-)-(3aR,4S,7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester
(-)-(3aR,4S,7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid ethyl ester
(-)-(3aR,4S,7aR)-Furan-2-yl-(4-hydroxy-4-m-tolylethynyl-octahydro-indol-l-yl)-methanone
(±)- (3aRS,4SR,7aRS)-4-(3-Chlorophenylethynyl)-4-hydroxy-octahydro-indole- 1 -carboxylic acid ethyl ester
(±)-(3aRS,4SR,7aRS)-4-(3-Fluoro-phenylethynyl)-4-hydroxy-octahydro-indole- 1 -carboxylic acid ethyl ester
(3aRS,4SR,7aRS)-4-Hydroxy-4-phenylethynyl-octahydro-indole-i-carboxylic acid(S)(tetrahydrofuran- 3-yl)ester
(3aRS,4SR,7aRS)-Hydroxy-4-phenylethynyl-octahydro-indole-i-carboxylic acid(R)(tetrahydrofuran-3- yl)ester
(3aRS,4SR,7aRS)-4-Hydroxy-4-(3-chlorophenylethynyl)-octahydro-indol-l -carboxylic acid- (S)(tetrahydrofuran-3yl)ester
(±)-(3aRS,4SR,7aRS)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid ethyl ester (±)-(3aRS,4SR,7aRS)-4-(4-Fluoro-phenylethynyl)-4-hydroxy-octahydro-indole- 1 -carboxylic acid ethyl ester
(±)-(3aRS,4SR,7aRS)-4-(3-chlorophenylethynyl)-4-hydroxy- 1 -methanesulfonyl-octahydro- indole (±)-(3aRS,7aRS)-4-Phenylethynyl-2,3,3a,6,7,7a-hexahydro-indole-l-carboxylic acid ethyl ester and (±)-(RS)-4-phenylethynyl-2,3,5,6,7,7a-hexahydro-indole-l -carboxylic acid ethyl ester
(±)-(3RS,7aRS)-2,2,2-Trifluoro-l-(4-phenylethynyl-2,3,3a,6,7,7a-hexahydro-indol-i-yl)-ethanone
(±)-(RS)-4-m-Tolylethynyl-2, 3, 5, 6, 7,7a-hexahydro-indole-l -carboxylic acid ethyl ester
(±)-(3RS,7aRS)-4-m-Tolylethynyl-2,3,3a,6,7,7a-hexahydro-indole-l -carboxylic acid ethyl ester (±)-(3RS, 7aRS)-4-(4-Chloro-phenylethynyl)-2,3,3a, 6, 7,7a-hexahydro-indole-l -carboxylic acid ethyl ester
(±)-(3RS, 7aRS)-4-(2-Fluoro-phenylethynyl)-2, 3,3a, 6, 7, 7a-hexahydro-indole-l -carboxylic acid ethyl ester
(±)-(3RS,7aRS)-4-(3-Fluoro-phenylethynyl)-2,3,3a,6,7,7a-hexahydro-indole-l-carboxylic acid ethyl ester
(±)-(RS)-4-(3-Fluoro-phenylethynyl)-2,3,5,6,7,7a-hexahydro-indole-l -carboxylic acid ethyl ester (±)-(3RS,7aRS)- 4-(3-Methoxy-phenylethynyl)-2,3,3a,6,7,7a-hexahydro-indole-l-carboxylic acid ethyl ester
(±)-(RS)-4-(3-Methoxy-phenylethynyl)-2, 3,5,6, 7, 7a-hexahydro-indole-l -carboxylic acid ethyl ester (±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-phenylethynyl-octahydro-isoindole-2-carboxylic acid ethyl ester (±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-m-tolylethynyl-octahydro-isoindole-2-carboxylic acid ethyl ester (±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-p-tolylethynyl-octahydro-isoindole-2-carboxylic acid ethyl ester (±)-(3aRS,4RS,7aSR)-4-(3-Cyano-phenylethynyl)-4-hydroxy-octahydro-isoindole-2-carboxylic acid ethyl ester
(±)-(3aRS, 4ARS, 7aSR)-4-Hydroxy-4-(3-methoxy-phenylethynyl)-octahydro-isoindole-2-carboxylic acid ethyl ester
(±)-(3aRS,4RS,7aSR)-4-(3-Fluoro-phenylethynyl)-4-hydroxy-octahydro-isoindole-2-carboxylic acid ethyl ester
(±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-phenylethynyl-octahydro-isoindole-2-carboxylic acid tert-butyl ester
(±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-m-tolylethynyl-octahydro-isoindole-2-carboxylic acid tert-butyl ester
(±)-(3aRS,4RS,7aSR)-4-Hydroxy-4-m-tolylethynyl-octahydro-isoindole-2-carboxylic acid methyl ester
(±)-(3aRS,4RS,7aSR)-Furan-2-yl-(4-hydroxy-4-m-tolylethynyl-octahydro-isoindol-2-yl)-methanone
(±)-(3aRS,4RS,7aSR)-Cyclopropyl-(4-hydroxy-4-m-tolylethynyl-octahydro-isoindol-2-yl)-methanone
(±)-(3aRS,4RS,7aSR)- (4-Hydroxy-4-m-tolylethynyl-octahydro-isoindol-2-yl)-pyridin-3-yl-methanone
(±)-(( lSR,3SR)-3-Hydroxy-3-/r7 -to lylethynyl-cyclohexyl)-methyl-carbamic acid methyl ester and
(±)-((l RS,3SR)-3-hydroxy-3-/n-tolylethynyl-cyclohexyl)-methyl-carbamic acid methyl ester
(±)-( 1 RS ,3 SR)-((3 -Hydroxy-3 -/n-tolylethynyl-cyclohexyl)-(4-methoxy-benzyl)-carbamic acid ethyl ester
(±)-(l RS,3RS)-((3-Hydroxy-3-/r7-tolylethynyl-cyclohexyl)-(4-methoxy-benzyl)-carbamic acid ethyl ester
(±)-[(l RS,3SR)-3-Hydroxy-3-(3-methoxy-phenylethynyl)-5,5-dimethyl-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-( 1 RS ,3 SR)-(3 -Hydroxy-5 ,5 -dimethyl-3 -/r7-tolylethynyl-cyclohexyl)-methyl-carbamic acid methyl ester
(±)-[(l RS,3SR)-3-(3-Fluoro-phenylethynyl)-3-hydroxy-5,5-dimethyl-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-[(l RS,3RS)-3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-methyl-carbamic acid methyl ester (±)-[(l RS,3SR)-3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-methyl-carbamic acid methyl ester (±)-[(l RS,3RS)-3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-[(l RS,3SR)-3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-[(l RS,3RS)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-[(l RS,3SR)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-methyl-carbamic acid methyl ester
(±)-(l RS,3RS)-N-(3-hydroxy-3-m-tolylethynyl-cyclohexyl)-acetamide
(±)-(l RS,3SR)-N-(3-hydroxy-3-m-tolylethynyl-cyclohexyl)-acetamide
(±)-(l RS,3RS)-(3-Hydroxy-3-m-tolylethynyl-cyclohexyl)-carbamic acid ethyl ester
(±)-(l RS,3SR)-(3-Hydroxy-3-m-tolylethynyl-cyclohexyl)-carbamic acid ethyl ester
(±)-(l RS,3RS)-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid ethyl ester
(±)-(l RS,3SR)-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid ethyl ester
(±)-(l RS,3RS)-[3-(3-Methoxy-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid ethyl ester
(±)-(l RS,3RS)-N-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-acetamide.
(±)-(l RS,3SR)-N-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-acetamide
(±)-(l RS,3SR)-[3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-carbamic acid ethyl ester
(±)-(l RS,3RS)-N-[3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-acetamide
(±)-(l RS,3SR)-N-[3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-acetamide.
(±)-(l RS,3RS)-[3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-carbamic acid terf-butyl ester
(±)-(l RS,3SR)-[3-Hydroxy-3-(3-methoxy-phenylethynyl)-cyclohexyl]-carbamic acid terf-butyl ester
(±)-(l RS,3RS)-(3-Hydroxy-3-m-tolylethynyl-cyclohexyl)-carbamic acid tert-butyl ester
(±)-(l RS,3SR)-(3-Hydroxy-3-m-tolylethynyl-cyclohexyl)-carbamic acid tert-butyl ester
(±)-(l RS,3RS)-(3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid tert-butyl ester
(±)-(l RS,3SR)-(3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid tert-butyl ester
(±)-(l RS,3RS)-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid methyl ester
(±)-(l RS,3SR)-[3-(3-Fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-carbamic acid methyl ester
(±)-(3-Phenylethynyl-cyclohex-2-enyl)-carbamic acid ethyl ester and (±)-3-phenylethynyl-cyclohex-3-enyl)-carbamic acid ethyl ester
(±)-Methyl-(3-phenylethynyl-cyclohex-3-enyl)-carbamic acid ethyl ester
(±)-(4aRS,5RS,8aSR)-5-Hydroxy-5-phenylethynyl-octahydro-quinoline-l-carboxylic acid ethyl ester (±)-[(4aRS,5SR,8aSR)- 5-(3-Chloro-phenylethynyl)-5-hydroxy-octahydro-quinolin-l-yl]-furan- 2-yl- methanone
(±)-[(4aRS,5RS,8aSR)-5-(3-Chloro-phenylethynyl)-5-hydroxy-octahydro-quinolin-l-yl]-furan-2-yl- methanone
(±)-(4aRS,5RS,8aSR)-5-(3-Chloro-phenylethynyl)-5-hydroxy-octahydro-quinoline-l-carboxylic acid tert-butyl ester
(±)-[(4aRS,5SR,8aSR)-5-(3-Chloro-phenylethynyl)-5-hydroxy-octahydro-quinolin-l-yl]-morpholin-4- yl-methanone
(±)-[(4aRS,5SR,8aSR)-5-(3-chloro-phenylethynyl)-5-hydroxy-octahydro-quinolin-l-yl]-(4-methyl- piperazin- 1 -yl)-methanone
(±)-(4aRS,5RS,8aSR)-5-(3-chloro-phenylethynyl)-5-hydroxy-octahydro-quinoline-l-carboxylic acid ethyl ester and
(±)-(4aRS,5SR,8aSR)- 5-(3-chloro-phenylethynyl)-5-hydroxy-octahydro-quinoline-l -carboxylic acid ethyl ester
(±)-(4aRS,5SR,8aSR)- 5-Hydroxy-5-m-tolylethynyl-octahydro-quinoline-l -carboxylic acid ethyl ester (±)-(4aRS,5RS,8aSR)- 5-Hydroxy-5-m-tolylethynyl-octahydro-quinoline-l -carboxylic acid ethyl ester.
In a further embodiment, the mGluR modulator is a compound of the formula (V):
Figure imgf000037_0001
wherein
R represents hydrogen or alkyl;
R2 represents an unsubstituted or substituted heterocycle or
R2 represents an unsubstituted or substituted aryl; R3 represents alkyl or halogen;
X represents a single bond or an alkandiyl-group, optionally interrupted by one or more oxygen atoms or carbonyl groups or carbonyloxy groups in free base or acid addition salt form.
Exemplary compounds of formula (V) include:
Furan-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Furan-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Furan-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
3H-lmidazole-4-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide 3H-lmidazole-4-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide 4H-[1 ,2,4]Triazole-3-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
4H-[1 ,2,4]Triazole-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
2-Methyl-furan-3-carboxylic acid [(±)-(l R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N-[(±)-(l R,3R)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-3,4-difluoro-benzamide
Benzo[l ,3]dioxole-2-carboxylic acid [(±)-(l R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
5-Methyl-pyrazine-2-carboxylic acid [(±)-(lR,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
Quinoxaline-2-carboxylic acid [(±)-(l R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide Benzofuran-2-carboxylic acid [(±)- (1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide Benzooxazole-2-carboxylic acid [(±)- (1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
2,5-Dimethyl-furan-3-carboxylic acid [(±)- (1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy- cyclohexyl]-amide
(R,S)-Tetrahydro-furan-3-carboxylic acid [(±)-(l R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy- cyclohexyl]-amide
Furan-3-carboxylic acid ((1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
Furan-3-carboxylic acid ((1 S,3S)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
Furan-3-carboxylic acid ((±)-(l R.3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
Furan-2-carboxylic acid ((1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide Furan-2-carboxylic acid ((1 S,3S)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
Furan-2-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
lsoxazole-5-carboxylic acid ((1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
lsoxazole-5-carboxylic acid ((1 S,3S)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
lsoxazole-5-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
5-Methyl-pyrazine-2-carboxylic acid ((±) -(1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide 4H-[1 ,2,4]Triazole-3-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide 3H-lmidazole-4-carboxylic acid ((±)- (1 R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
Tetrahydro-pyran-4-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide
1- Methyl-l H-imidazole-4-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)- amide
(R,S)-Tetrahydro-furan-2-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide (R,S)-Tetrahydro-furan-3-carboxylic acid ((±)-(l R,3R)-3-hydroxy-3-m-tolylethynyl-cyclohexyl)-amide Furan-3-carboxylic acid [(1 R,3R)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Furan-3-carboxylic acid [(1 S,3S)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Furan-2-carboxylic acid [(1 R,3R)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Furan-2-carboxylic acid [(1 S,3S)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
3H-lmidazole-4-carboxylic acid [(±)-(l R,3R)-3-(3-fluoro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-3,4-difluoro-benzamide
N-[(l R,3R)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-3,4-difluoro-benzamide
Pyridine-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Pyridine-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-nicotinamide
N- [( 1 R,3R)-3 -(3 -Chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -nicotinamide
Benzo[l ,3]dioxole-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
5-Methyl-pyrazine-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
2- Methyl-furan-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide (R)-Tetrahydro-furan-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
(S)-Tetrahydro-furan-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
lsoxazole-5-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide 5-Methyl-pyrazine-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
2-Methyl-furan-3-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide lsoxazole-5-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide 5-Chloro-furan-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
5- Chloro-furan-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide (S)-Tetrahydro-furan-3-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
(R)-Tetrahydro-furan-3 -carboxylic acid [(1 R,3R)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] - amide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-isonicotinamide
N-[(l R,3R)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-isonicotinamide
3,5-Difluoro-pyridine-2-carboxylicacid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
3,5-Difluoro-pyridine-2-carboxylicacid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
6- Methyl-pyridine-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
6-Methyl-pyridine-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
5-Chloro-pyridine-2-carboxylic acid [(lR,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
5- Chloro-pyridine-2-carboxylic acid [( IS, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -amide
6- Chloro-pyridine-2-carboxylic acid [(lR,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
6-Chloro-pyridine-2-carboxylic acid [( IS, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -amide 5 -Chloro-1 -methyl- 1 H-pyrrole-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy- cyclohexyl]-amide
5-Chloro-l -methyl- 1 H-pyrrole-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy- cyclohexyl]-amide
5-Chloro-l H-pyrrole-2-carboxylic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
5-Chloro-l H-pyrrole-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-dimethyl amino- benzamide
1 H-Pyrrole-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-methyl-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-methyl-benzamide
N- [(IS, 3 S)-3 -(3 -Chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -3 -fluoro-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-ethyl-butyramide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-(2,5-dimethoxy-phenyl)-4-oxo- butyramide
2- (2-Benzyloxy-ethoxy)-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-acetamide N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-phenyl-acetamide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-3-(l H-indol-4-yl)-propionamide 2-
Benzo[l ,3]dioxol-5-yl-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-acetamide
N- [(IS, 3 S)-3 -(3 -Chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -2 -phenoxy-propionamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-(2-fluoro-phenyl)-acetamide
5 -Hydroxy- 1 H-indole-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
1 -Methyl-1 H-pyrrole-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-terephthalamic acid methyl ester
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-(2-trifluoromethoxy-phenyl)- acetamide
5-Chloro-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-hydroxy-benzamide N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-hydroxy-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-hydroxy-benzamide
4- Amino-N- [( 1 S,3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -benzamide
4-Amino-5-chloro-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy- 3-Amino-4-chloro-N-[(l S,3S)- 3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -benzamide
3- Amino-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-methyl-benzamide 2- Amino-N- [( 1 S, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -nicotinamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-hydroxy-3-methoxy-benzamide N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-fluoro-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-methanesulfonyl-benzamide
Pyridine-2-carboxylic acid [(1 S, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -amide
3- Amino-pyrazine-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
6- Amino-N- [( 1 S, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -nicotinamide
4- (4-Amino-benzoylamino)-benzoic acid [(1 R,3R)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
2,6-Dioxo-l ,2,3,6-tetrahydro-pyrimidine-4-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3- hy droxy-cy clohexy 1] -amide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-isonicotinamide
3-Chloro-N-[(lS,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2,3-dimethoxy-benzamide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-4-oxo-4-phenyl-butyramide
2- Chloro-N-[(lS,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-nicotinamide
5 - Bromo-N- [( 1 S ,3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -nicotinamide lsoquinoline- 1 - carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
Pyrazine-2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide
3 - Benzoyl-pyridine -2-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N- [(IS, 3 S)-3 -(3 -Chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -2 -methyl-nicotinamide
Quinoxaline-2-carboxylic acid [(1 S, 3 S)-3 -(3 -chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -amide Pyridazine-4-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-methylsulfanyl-nicotinamide
N- [( 1 S ,3 S)-3 -(3 -Chloro-phenylethynyl)-3 -hydroxy-cyclohexyl] -4-trifluoromethyl-nicotinamide
2-Chloro-N-[(lS,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-isonicotinamide
2-Chloro-N-[(l S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-6-methyl-nicotinamide 6-Chloro-N-[(lS,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-nicotinamide
2-Chloro-N-[(lS,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-6-methyl-isonicotinamide N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-(4,5-dimethoxy-3-oxo-l ,3-dihydro- isobenzofuran- 1 -yl)-acetamide
1 ,4,5,6-Tetrahydro-cyclopentapyrazole-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3- hydroxy-cyclohexyl]-amide
N-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-3-(lH-indol-2-yl)-propionamide 6-[(l S,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexylcarbamoyl]-pyridine-2-carboxylic acid isopropyl ester
Quinoline-6-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-amide 5-Methyl-isoxazole-4-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide Benzofuran-3-carboxylic acid [(1 S,3S)-3-(3-chloro-phenylethynyl)-3-hydroxy-cyclohexyl]- amide
N-[(lS,3S)-3-(3-Chloro-phenylethynyl)-3-hydroxy-cyclohexyl]-2-(2-methoxy-phenoxy)-acetamide. In a further embodiment, the mGluR modulator is a compound of the formula (VI)
Figure imgf000043_0001
wherein
R1 represents hydrogen or alkyl;
R R2 represents an unbubstituted or substituted heterocycle or
R2 represents an unsubstituted or substituted aryl;
R3 represents alkyl or halogen;
in free base or acid addition salt form.
Further examples mGluR5 antagonists include compounds of the formula (I) as defined in WO
2004/014881 and compounds of the formula (I) as defined in WO 2007/021575; the contents of these publications are incorporated herein by reference. Diagnostic and Prognostic Assays
The methods described herein can be utilized as a diagnostic assay to identify those subjects having Fragile X Syndrome or a predisposition thereto. In addition the methods described herein can be used to identify subjects who are likely to respond to an FXS therapy such as an mGluR5 antagonist or can be used as a prognostic assay to identify subjects who are at risk of developing Fragile X Syndrome and who would benefit from receiving an FXS therapy such as an mGluR5 antagonist. Prognostic assays can be used for predictive purposes or prophylactic purposes to treat an individual who is at risk of developing FXS.
The methods of the invention include determining the amount of DNA methylation and/or
hydroxymethylation in a predetermined region as described in Table 1, 2, or 3 in a test subject and comparing the amount determined to a control. By comparing the amount of DNA methylation and/or hydroxymethylation to a control, a diagnosis as to whether that subject has FXS or a predisposition thereto, or whether that subject will respond to particular therapy, can be made.
The control for use in the methods for detecting methylation or hydroxymethylation as described herein can be any appropriate control or set of controls.
In one embodiment, for the methods described herein which detect methylation, the control can be a clinical sample which has a defined amount of methylation indicative of FXS or predisposition thereto, or positive response to an mGluR5 therapy. For methods which detect methylation, controls can be fully methylated or partially methylated, or can be from a subject which does not have FXS (healthy subject). Clinical samples taken from individuals that are fully methylated (or more than 95% methylated), or are fully methylated and mGluR5 responders, can serve as positive controls and samples that are partially methylated or from subjects not having FXS can serve as negative controls. In one example, the control is a sample from a subject that does not have FXS. If using such a control, an increase in methylation in a test sample compared to the control is indicative that the subject has FXS or will likely respond to an mGluR5 antagonist. In another example, the control is a threshold value which has been previously determined from clinically relevant samples (such as samples positive for FXS or positive for response to an mGluR5 antagonist) at one or more of the predetermined regions described herein. The amount of methylation in the test sample can then be compared against the threshold value and a diagnostic or appropriate therapy determination can be made. Similarly for the methods described herein which detect hydroxymethylation, a control can be a sample or value generated from a clinical sample that has already been determined to have a particular clinically relevant hydroxymethylation status. In one example, the control can be generated from clinical samples where the subject is an mGluR5 responder and has a defined hydroxymethylation status. Samples taken from individuals that are an mGluR5 responder can serve as positive controls and samples that are from subjects not having FXS or non responders can serve as negative controls. In one example, where the control is from a subject that does not have FXS, a decrease in hydroxymethylation in a test sample compared to the control is indicative that the subject will respond to an mGluR5 antagonist. In another example, the control is a threshold value which has been determined by measuring the relative level of hydroxymethylation for one or more of the predetermined regions in a clinically relevant sample. The amount of hydroxymethylation in the test samples can then be compared against the threshold value and a diagnostic or therapy determinations can be made.
The control can either be run simultaneously with the test sample or can be represented as a
predetermined value based on the technology used to determine the methylation or hydroxymethylation status of the sample. In one example, the predetermined value is a Delta Ct value which is obtained using quantitative PCR.
Moreover, the amount of DNA methylation and/or hydroxymethylation in a predetermined region as described in Table 1, 2 and 3 compared to a control can be indicative as to whether that subject will respond to an FXS therapy such as an mGluR5 responder. Thus, the method of the invention can be used as a prognostic assay to determine whether a subject should be administered an FXS therapy such as an mGluR5 antagonist so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome. In one example, an individual can be determined to be at risk of developing FXS using any of the standard methods known in the art such as detecting CGG repeats, evaluating the family history of that individual or using the method described herein. Once an individual has been determined to be at risk of FXS, that individual is further evaluated for the presence of any one or more of the above described epigenetic biomarkers. The presence of one or more of the biomarkers described herein can be used to indicate that that individual should be administered an mGluR5 antagonist so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome. In one example, newborn infants determined to be at risk of developing FXS should be monitored for the presence of one or more of the biomarkers described herein so as to prevent the onset of Fragile X syndrome or to reduce the severity of Fragile X syndrome. The use of the present method to intervene early will maximize the therapeutic benefits of mGluR5.
The prognostic assay described herein can also be used in any individual who exhibits CGG repeat length expansion in the FMRl gene. If an individual is determined based on the methods described herein to be an individual who will respond clinically to an mGluR5 antagonist, an mGluR5 antagonist will be administered to the individual. In general, a daily dosage in the range from about 5 to 1500 mg, preferably about 10 to about 1000 mg of the compound is conveniently administered to an individual having FXS. In one example, a daily dosage of 10 mg, 25 mg or 100 mg will be administered to the individual having FXS.
In another example, the epigenetic biomarkers described herein can be used to further characterize subjects having FXS who have varying amounts of methylation associated with the FMRl promoter region. By determining the DNA methylation and/or hydroxymethylation profile in the broader FMRl genomic locus as detailed in Table 1 further information about subjects having a fully methylated promoter or a partially methylated promoter can be obtained which will be useful for determining the best options with respect to therapeutic treatments.
Kits
The invention also encompasses kits for detecting the status of methylation of the FMRl genomic locus as described herein. Such kits can be used to determine if a subject has FXS or if a subject having FXS is likely to respond to treatment with an FXS therapy such as mGluR5 antagonist. For example, the kit can comprise a labeled compound or agent capable of detecting the status of DNA methylation and/or hydroxymethylation in the broader FMRl genomic locus. The kit can also include primers that can be used to determine the status of DNA methylation and/or hydroxymethylation in the broader genomic locus , e.g., as disclosed in Table 1, 2, and 3 and an appropriate control sample.
The kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent. The kit can also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit can also contain a control sample or a series of control samples that can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container, and all of the various containers are within a single package along with instructions for it's use.
Data
In performing any of the methods described herein that require determining the status of DNA methylation and/or hydroxymethylation in the broader FMRl genomic locus in a test sample, physicians or genetic counselors or patients or other researchers may be informed of the result.
Specifically the result can be cast in a transmittable form of information that can be communicated or transmitted to other researchers or physicians or genetic counselors or patients. Such a form can vary and can be tangible or intangible. The result can be embodied in descriptive statements, diagrams, photographs, charts, images or any other visual forms. For example, images of gel electrophoresis of PCR products can be used in explaining the results or graphs of qPCR can be used. These statements and visual forms can be recorded on a tangible media such as papers, computer readable media such as floppy disks, compact disks, etc., or on an intangible media, e.g., an electronic media in the form of email or website on internet or intranet. In addition, the result can also be recorded in a sound form and transmitted through any suitable media, e.g., analog or digital cable lines, fiber optic cables, etc., via telephone, facsimile, wireless mobile phone, internet phone and the like. All such forms (tangible and intangible) would constitute a "transmittable form of information". Thus, the information and data on a test result can be produced anywhere in the world and transmitted to a different location. Accordingly, the present disclosure also encompasses a method for producing a transmittable form of information containing data on the status of methylation and/or hydroxymethylation in the broader FMRl genomic locus in a test sample. This form of information is useful for diagnosis of FXS or predisposition thereto, or to select a test patient who will respond to FXS treatment such as mGluR5 treatment, or for selectively treating a patient based upon that information.
The following non-limiting Examples illustrate the invention.
Examples
Example 1: Methylome and hydroxymethylome mapping of the broader FMRl genomic locus was performed. Chromatin profiling assays (Methylated DNA Immunoprecipitation (MeDIP)) combined to a DNA microarray covering a broad genomic region encompassing the FMRl gene sequence. Broader epigenomic profiling of the FMRl locus of FXS fibroblasts.
5-Methylcytosine (5mC) and 5-Hydroxymethylcytosine (5hmC) MeDIP assays using highly specific anti-5mC and anti-5hmC antibodies were carried out on genomic DNA from 3 FXS fibroblasts lines and 2 control lines. The same assays were also run on genomic DNA obtained from 5 control PBMC samples and up to 11 FXS samples (Fig. 1).
MeDIP enrichment was validated using qPCR at candidate loci previously identified as being marked by the indicated epigenetic modifications. MeDIP enriched input and IP fractions were labeled and applied onto a custom designed array covering the entire FMRl genomic region on chromosome X (ChrX: 146,911,760 - 147,159,387: 82 kb of upstream and 126kb of downstream regions flanking the 40kb FMRl gene. This overall experimental design generated 40 independent microarray datasets, enabling the first epigenomic profiling of the broader FMRl locus in control and FXS cells across a variety of control and FXS individuals (fibroblasts and PBMCs).
Broader epigenomic profiling of the FMRl locus identifies novel regions of DNA methylation (5mC) changes in FXS fibroblasts.
Analyses of epigenome landscape using genome visualization tools detected the expected DNA hypermethylation in the region surrounding the FMRl promoter and transcriptional start site, including the upstream (5') part of FMRl intron 1 (TSS -lkb/+2.5kb, referred as to "Fibro-5mC-C" and "Fibro- 5mC-D" regions in Table 3) in FXS fibroblasts. Additional regions of methylation perturbations were apparent in genomic regions upstream (5') and downstream (3') of FMRl as well as within the gene body (named Fibro-5mC-A, -B, -E, -F, -G, -H in Table 3), indicating that DNA methylation perturbations occur beyond the region surrounding the TSS of FMRl in FXS cells. Interestingly, while hypermethylation is a hallmark of the region surrounding the TSS, all other region of methylation change displayed hypomethylation in FXS fibroblasts. These regions are less dense in CpGs and may provide novel regions for quantitative methylation measurements for enhanced FXS disease diagnosis and patient stratification. The analysis of MeDIP profiles from single cell lines showed that methylation patterns were consistent across fibroblast lines (data not shown). To validate methylation perturbations at these regions, PCR primers were designed and quantitative PCRs run on MeDIP and input material from FXS and control cells, confirming decreased methylation in the newly identified regions of FMRl methylation changes in FXS fibroblasts, while illustrating the robust TSS region hypermethylation. To validate the specificity of FMRl DNA methylation perturbations, additional control regions were investigated and did not show change in methylation across cell lines (GAPDH, APRT: constitutive ly hypomethylated and HI 9, NNAT, IGF2R: constitutively hypermethylated) (data not shown). Table 3 summarizes all region of 5mC change in fibroblasts with functional location, and chromosomal coordinates.
DNA methylation changes are associated to hydroxymethylation perturbations at specific locations along the FMRl locus in FXS fibroblasts.
Discrete hydroxymethylation (5hmC) perturbations were detected using genome visualization tools). In particular, the robust increase in DNA methylation in the TSS region, 5' of intron 1 (Fibro-5mC-D, Table 3) was found associated to a sharp decrease in 5hmC levels (Fibro-5hmC-A, Table 3) suggesting anticorrelation between 5mC and 5hmC levels at this genomic location (Chr X: 146,993,800- 146,996,000). A separate FMRl region located lOkb downstream of FMRl 3' UTR also showed co- perturbation of 5mC (Fibro-5mC-H, decreased) and 5hmC (Fibro-5hmC-B, increased) (Figure 2B, Table 3). Thus beyond FMRl promoter/intronl hypermethylation, new regions of the FMRl locus show methylation and hydroxymethylation perturbations in FXS fibroblasts. Some of the identified regions when investigated both for 5mC and 5hmC using quantitative assays open the door to the development of potentially enhanced bioassays for quantitative assessment of FXS methylation status and patient stratification.
Broader epigenomic profiling of the FMRl locus identifies novel, cell-type-specific regions of 5mC and 5hmC changes in clinically relevant FXS PBMC samples. PBMC samples from a FXS biomarker study were used (n=l l out of 19) to investigate, using MeD IP-array the levels of DNA methylation and hydroxymethylation in clinically relevant samples. 3 mains regions showed 5mC changes in FXS PBMCs (n=l l), compared to control PBMC samples (n=5) . The TSS region showed the expected hypermethylation, both at the promoter and upstream region of FMRl intronl (PBMCs-5mC-A and B, Table3). Notably two new regions, in the middle of intron 1 (PBMCs-5mC-C) and downstream of FMRl (PBMCs-5mC-D) also showed local DNA hypermethylation. These perturbations are observed to different extent across all individual PBMC samples, and identify new, PBMC-specific (because not observed in FXS fibroblasts) regions of methylation perturbations in FXS.
The same experiment using a 5hmC-specific antibody revealed broad 5hmC perturbations in FXS PBMCs. 4 regions of perturbations (hypo-hydroxymethylation) were observed, upstream of FMRl, at the TSS, throughout the intronl and in a gene body region between intron 13 and 16 of FMRl (Table 3). Notably, 5hmC in a region encompassing FMRl promoter (PBMC-5hmC-B) distinguished different patterns of 5hmC enrichment in the 9 FXS patient samples with high, intermediate and low levels of this mark, as confirmed by qPCR (. In contrast to FXS fibroblast, no change in 5hmC was observed in the region 5' of intronl of FMRl . Thus 5hmC pattern in FXS cells shows strong cell-type specificity.
PCR analyses of relative 5mC and 5hmC enrichments in the TSS region (covering a 5kb region around the TSS) identified, compared to control PBMC samples, varying levels of increased methylation and decreased hydroxymethylation across the FXS PBMC samples. PCR data and array data were found consistent, with in particular patient samples #8 and #12 showing highest levels of 5hmC, patients #8, #15 and #17, intermediate levels of 5hmC and patients #9, #10, #11 and #13 the lowest levels of 5hmC. Comparing DNA methylation and hydroxymethylation in selected patients showed correlation between 5mC and 5hmC (compare patient #9, high 5mC, low 5hmC and patient #12, low 5mC and high 5hmC).
Overall, the identification of novel regions of methylation and hydroxymethylation changes in FXS patient samples will allow establishing quantitative 5mC and 5hmC bioassays which may enhance the molecular characterization of FXS patient samples in clinically relevant samples such as blood tissue. 5hmC adds value to the classification of FXS patients and the development of quantitative assays within FMRl TSS or other regions of 5hmC change in FXS PBMCs may highly enhance patient stratification with regards to determining the responsiveness of a partially methylated (PM) individual with FXS syndrome to treatment with an mGluR5 test molecule.
Cell-type specific DNA methylation perturbations in FXS fibroblasts and PBMCs.
In fibroblasts, Hypermethylation at the region surrounding the TSS is accompanied by a strong hypermethylation peak within the first intron of FMRl, in a region with lower CpG density as compared to FMRl promoter, as previously reported by Golder et al. (Godler et al., 2010 Hum Mol Genet. 2010 Apr 15;19(8): 1618-32). Increased methylation upstream and downstream of the CGG repeats participate to the suppression of FMRl gene expression and may be a consequence of the repeat expansion and associated epigenetic switch. The other regions of methylation changes in fibroblast cells show hypomethylation in FXS cells (region 5' and gene body).
In PBMCs, while the hypermethylation pattern was also observed at the TSS, no hypomethylation was observed within FMRl gene body. In contrast, we observed a discrete region of hypermethylation suggesting differential epigenetic regulation and perturbation of FMRl in normal and pathological conditions. DNA hydroxymethylation at FMR1 promoter in FXS clinical samples
This study highlights cell-type-specific perturbations of a novel epigenetic mark, 5hmC in FXS cells. While discrete changes are observed in FXS fibroblasts, broad changes in the levels of 5hmC are observed in FXS PBMCs compared to control samples. Notably, a l l .2kb region, overlapping with the FMR1-AS locus shows strong decrease in 5hmC in FXS cells. Importantly changes in 5hmC are observed both in FXS fibroblasts and PBMCs, making this feature clinically relevant.
Overall, the results presented here and summarized in Table 3 and Fig 2 identify novel regions of (hydroxy)methylation perturbations that can be used to complement the existing epigenetic biomarkers for FXS disease and patient stratification.
Figure imgf000051_0001
Gene body Intron 1-5'
PBMCs-5mC-B 5mC up ChrX: 146993800-146996000 2.2 60
TSS -0.3kb/ +2.5kb
Gene body Intron 1-3'
PBMCs-5mC-C 5mC up ChrX: 146999000-147002900 3.9 26
TSS +5.5kb/ +9.4kb
Downstream
PBMCs-5mC-D 5mC up ChrX: 147043300-147048300 5 47
3'UTR +10.6kb/+15.6kb
Figure imgf000052_0001
Table 3
Example 2: Development of locus specific FMRl (hydroxy)methylation assays in FXS patient samples.
Based on the identification of novel regions of methylation (5mC) changes in FXS PBMC samples, pyrosequencing assays at 5 regions encompassing FMRl within regions B, C and D located in intronl and in a region downstream of the FMRl gene (Figure 3A, top panel, Table 1 and 2) were developed. The deployment of these assays on control DNA extracted from healthy patients identified a switch in DNA methylation levels within intron 1 of the FMRl gene. In normal PBMCs, FMRl was shown to be unmethylated at the promoter (as measured with the commercial assay HsFMRl from Qiagen, #Hs_FMRl_01_PM), increasingly methylated in the upstream part of the first intron, and reaching high levels of methylation throughout the body of the gene (n=4, Table 3A). The deployment of the novel pyrosequencing assays in FXS patient blood samples (n=18) yielded variable levels of measured DNA methylation (raw data available in Table 3A), and may provide additional granularity to the standard measurement of FMRl promoter methylation. Thus, the novel pyrosequencing assays developed herein provide an enhanced method for molecular characterization of FXS patient samples.
Based on the identification of novel regions of hydroxymethylation (5hmC) changes in FXS PBMC- derived DNA samples (illustrated in Figure 3, bottom panel), hMeDIP-qPCR assays at 6 regions of differential 5hmC encompassing the FMRl genomic region (Table 1, Table 2, Figure 3B) were developed. Assay 3H3-4, lOkb upstream of FMRl transcriptional start site (TSS) localizes with the transcriptional start site of a 534bp non-coding RNA entitled L29074.3 (ENST00000597190) of unknown function. Assays 3C1-2, and 213-4 are localized in the vicinity of FMR1 promoter region, upstream of the TSS. Assays 3C7-9 and 3E8-9 are localized within the intron 1 of FMR1 and assay 3F9- Gl is localized 31.4 kb downstream of FMR1 TSS, within alternative-splicing rich regions of FMR1. The deployment of these assays on 5 control DNA samples from healthy patient PBMCs confirmed our previous MeDIP-array data (Figure 2) with strong enrichment of the 5hmC mark in the promoter and intron 1 areas of the FMR1 locus. The relative enrichment of 5hmC across individual control samples was highly consistent (Figure 3B, white bars). The deployment of these novel hMeDIP-qPCR assays on 16 FXS patient blood samples, showed overall decreased levels of 5hmC enrichment compared to control samples at all regions interrogated (Figure 3B). Notably, we observed variable 5hmC enrichment across FXS samples and the linear range of 5hmC levels across FXS patients was very significant (up to 10 fold change in 5hmC enrichment in selected patients/regions) (Table 4B, Figure 3B). The measurement of 5hmC by hMeDIP-qPCR in selected areas of the FMR1 genomic region may thus provide a novel molecular endpoint for enhancing the molecular characterization and stratification of FXS patients.
Thus for figure 3A the graphs illustrate the relative enrichment of 5mC (top) and 5hmC (bottom) (log2 fold enrichment) in 5 control PBMC (grey) and 1 illustrative FXS (black) PBMC samples over a region covering 79kb on ChrX: 146,971,000-147,050,000). The position of the FMR1 gene and non-coding RNA L29074.3 is indicated. Exons are indicated with grey boxes and transcriptional orientation with arrows. TSS: Transcriptional Start Site. The regions of change of methylation and hydroxymethylation are indicated with dashed lines and refer to the regions listed in Table 1. For fig 3B individual hMeDIP- qPCR assays along the FMR1 locus measure different levels of 5hmC along the FMR1 locus and across a group of FXS patients (black bars, n=16) and controls (white bars, n=5). The sequence of primers for each indicated assays is available from Table 1. Primary 5mC and 5hmC data is available in Table 4A and 4B below. Locus specific assays measure variable levels of methylation (5mC) and hydroxymethylation (5hmC) across this cohort of FXS patient samples. Table 4A shows the percentage of methylation (5mC) obtained from the novel pyrosequencing assays (B3, B6a, Clbl) across 18 patient samples and 4 control samples and Table 4B shows 5hmC enrichment (% of input) measured by hMeDIP-qPCR assays (3H3-4, 3C1-2, 213-4, 3C7-9, 3E8-9, 3F9-G1) across 16 patient samples (study CPJMR0022107) and 5 control samples. Sequence of primers for each indicated assay is available from Table l . Nd =No data. Sample ID HsFMRl B3 B6a Clbl
Blood FXS
01 87.94 51.68 81.82 46.38
Blood FXS
02 63.82 60.79 70.36 45.32
Blood FXS
04 73.61 70.30 84.38 52.85
Blood FXS
05 90.05 79.23 80.92 61.85
Blood FXS
06 96.81 85.11 84.68 83.55
Blood FXS
07 81.35 73.66 81.64 79.76
Blood FXS
08 58.87 51.55 67.20 38.18
Blood FXS
09 Nd Nd Nd Nd
Blood FXS
10 97.16 79.58 82.62 64.70
Blood FXS
11 95.98 81.59 83.68 66.96
Blood FXS
12 47.47 52.67 63.34 44.24
Blood FXS
13 92.91 77.05 84.54 46.91
Blood FXS
14 90.23 72.53 82.86 56.52
Blood FXS
15 75.45 63.58 77.24 49.16
Blood FXS
16 63.85 61.90 85.76 60.19
Blood FXS
17 75.03 70.41 80.67 50.46
Blood FXS
18 90.19 82.92 86.45 62.08
Blood FXS
19 96.05 74.81 84.31 62.85
Blood FXS
20 93.15 79.89 84.35 63.37
Ctrl 61 0.97 11.88 60.47 Nd
Ctrl 62 1.17 9.96 48.64 Nd
Ctrl 67 1.64 7.23 55.13 Nd
Ctrl 68 3.07 25.02 66.44 Nd
Table 4A
Figure imgf000055_0001
Table 4B
Example 3: Combined 5mC and 5hmC measurements enhance molecular and functional characterization of FXS patient samples
Next simple linear regression analyses was used to explore the molecular correlation between 5mC, as measured by pyrosequencing, and 5hmC as measured by hMeDIP-qPCR. Figure 4 illustrates the relationship between 5mC and 5hmC at two independent regions of FMRl, showing a significant correlation between 5mC levels at the peri-promoter region of FMRl (commercial Qiagen assay HsFMRl) and 5hmC levels within the intron 1 of FMRl, 8kb downstream of the TSS (assay 3E8-9). Specifically, figure 4 shows the relationship between the methylation (5mC) and the hydroxymethylation (5hmC) values is shown using simple linear regression analysis (see methods). The coefficient of determination, denoted R2 and the p-value for the data correlation are indicated. The mRNA expression levels are expressed by the color intensity, the darker the more FMRl mRNA measured.
The same analyses were run for all pyrosequencing and hMeDIP-qPCR assays and show variable levels of 5mC/5hmC correlation along the FMRl locus (data not shown), highlighting that both molecular endpoints are partially, but not fully correlated. Importantly, our data confirm that increased methylation is associated with decreased FMRl gene expression (compare color of circles, indicative of FMRl mRNA levels in Figure 4) and show for the first time at the FMRl locus that increased hydroxymethylation is associated with increased gene expression.
Overall, the combined measurement of 5mC and 5hmC, regardless of the method utilized may provide enhanced molecular and functional characterization of FXS patient samples.
Example 4: FMRl methylation and hydroxymethylation is significantly correlated with ABC scores in FXS male patients.
It has been reported that the severity of FXS phenotypes can be influenced by the FMRl methylation status or the magnitude of the FMRP deficit. Aberrant Behavioral Checklist - Community Edition (ABC-C) (Aman et al, Am. J. Ment. Retard.100, 283-292 (1995)) was used as the primary endpoint. FMRl methylation status in whole blood has been shown to be significantly associated with the ABC-C subscale irritability at baseline (Jacquemont et al., Sci Transl Med. Jan 5;3(64):64ra1 . (201 1 )). Linear regression was used to correlate pyrosequencing and hMeDIP-qPCR data to the available ABC score for the groups of study patients. As shown in Figure 5, we identified significant (p=0.0294 to p=0.0748) correlations between FMRl gene body methylation and ABC score (Figure 5A and 5B; B3>HsFMRl>B6a>Clbl). A significant correlation between 5hmC and ABC was also identified using assay 3F9-G1 (p=0.0319) (Figure 5C and 5D).
Specifically, the relationship between the methylation (5mC) values (x-axis) and the ABC score (y-axis, the higher the more severe) is indicated in the linear regression graph for assay B3 (5A) and for all assays in the table overview (5B). The relationship between the hydroxymethylation (5hmC) values (x- axis) and the ABC score (y-axis) is indicated in the linear regression graph for assay 3F9-G1 (5C) and for all assays in the table overview (5D). Simple linear regression analysis were used for these analyses (see methods). The middle panel graphs illustrate the relative enrichment of 5mC (top) and 5hmC (bottom) (log2 fold enrichment) as in Figure 1 and 3.
The data confirms the utility of 5mC to predict FXS disease severity and suggests for the first time that 5hmC measurements within the FMRl locus may be equally indicative of disease severity. Combined assessment of 5mC and 5hmC within selected regions of the FMRl locus may thus significantly enhance clinical diagnostics for Fragile X syndrome.
Example 5: FMRl hydroxymethylation discriminates partial methylated (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester responders from non- responders in a small cohort of clinically anchored patients (n=5).
(-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester is a mGluR5 antagonist and the proof of concept for the symptomatic treatment of adults with Fragile X syndrome was evaluated in a clinical trial (Jacquemont et al., Sci Transl Med. Jan 5;3(64):64ral . (2011)). Importantly, a significant beneficial effect of AFQ056 over placebo was observed in patients who were fully methylated (FM), or nearly fully methylated as described in WO2011137206 and did not express the FMRl mRNA. By contrast, there was an unpredictable treatment response (between AFQ056 and placebo) in those patients who were partially methylated (PM) and expressed detectable levels the FMRl mRNA (Jacquemont et al., 2011, supra). To evaluate the utility of 5hmC for enhancing the characterization and stratification of FXS patients who respond to (-)-(3aR, 4S, 7aR)-4-Hydroxy-4- m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, hMeDIP-qPCR was performed on a subset of samples from the clinical trial (Figure 6). The Partial (PM) or Full (FM) methylation status of the FXS samples 1 to 5 is indicated as well as each patient's response to (-)-(3aR, 4S, 7aR)-4-Hydroxy- 4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester (Responder, R; Non-responder, NR). Importantly it was found that 5hmC enrichment along distinct regions of the FMR1 locus separates the partially methylated, non-responder sample (FXS 1, PM-NR, n=l) from the partially methylated, responder samples (FXS 4 and FXS 5, PM-R, n=2). The fully methylated, responder patient samples (FXS 2 and FXS 3, FM-R, n=2) show even stronger separation, with lowest levels of 5hmC enrichment. Thus, hydroxymethylation (5hmC) discriminates partial methylated (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m- tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester responders from non-responders in a small cohort of clinically anchored patients (n=5) (Figure 6).
Overall this data highlights the utility of measuring, optionally in combination with the standard methylation clinical diagnostic (FM/PM) assay as described in WO2011/137206, which is incorporated in its entirety herein by reference, the levels of 5hmC in FXS patients for enhanced prediction of clinical severity and response to (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester.
MATERIAL AND METHODS
Cell culture
GM04858 fibroblasts from a 4 year old fragile X patient, GM07072 fetal lung fibroblasts from 22 week old fetus with a fragile mutation and GM09497 fibroblasts from a 28 year old fragile X patient, from Coriell Institute for Medical Research were grown in D-MEM supplemented with 15% FBS, penicillin/streptomycin, 2-mercaptoethanol (O. lmM) and sodium pyruvate. The cell lines used as controls, BJ1 fibroblasts and MG63 osteosarcoma cell line from ATCC were cultured in the same condition.
Clinical Specimen
PBMC samples from the 'biomarker study to assess the status of FMR1 methylation and FMRP expression in Fragile X Syndrome (FXS) patients' were used (n=l l). PBMC were purified from blood using an 8 mL capacity PBMC separator tubes (BD Vacutainer CPT, BD). PBMCs from healthy patients were obtained from Bioreclamation, LLC (n=5)
(h)MeDIP Genomic DNA from fibroblasts and control cell lines was prepared by overnight Proteinase K (pK) treatment in lysis buffer (10 mM Tris-HCl pH 8.0, 50 mM EDTA pH 8.0, 100 mM NaCl, 0.5% SDS), phenol-chloroform extraction, ethanol precipitation and RNaseA digestion. Genomic DNA was sonicated (Bioruptor, Diagenode) to produce random fragments ranging in size from 300 to 1,000 bp and 4 μg of fragmented DNA was used for a standard hMeDIP assay. DNA was denatured for 10 min at 95°C and immunoprecipitated for 3 hrs at 4°C with 15 μΐ of monoclonal antibody against 5- methylcytidine (BI-MECY-1000, Eurogentec) (MeDIP) or with Ιμΐ of a rabbit polyclonal antibody against 5-hydroxymethylcytosine (#39769, active Motif) (hMeDIP) in a final volume of 500 μΐ IP buffer (10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100). The mixture was incubated with 40 μΐ magnetic beads (MeDIP: Dynabeads M-280 Sheep anti-mouse IgG (Invitrogen) for 2 hrs at 4°C / hMeDIP: Dynabeads Protein G (#100.03D, Invitrogen) for lhr at 4°C) and washed three times with 1ml of IP buffer. Beads were subsequently treated with proteinase K for 3 hrs at 50°C and the methylated DNA recovered by phenol-chloroform extraction followed by ethanol precipitation. For microarray analysis, 50ng of input DNA and 1/2 (h)MeDIP enriched DNA was amplified using WGA2: GenomePlex Complete Whole Genome kit (Sigma). Amplified DNA was used for real-time qPCR quantification and sent to Roche Nimblegen (Madison, USA) for Cy3 and Cy5 labeling and hybridization on 12 X 135k NimbleGen custom arrays. qPCR validation and microarray analyses
Real-time PCR was carried out using SYBR Green PCR Master Mix (Applied Biosystems) and using an ABI PRISM SDS 7900HT machine (Applied biosystems). Primers and conditions used are listed in Table 5.
Figure imgf000059_0001
FMR1 intron 1-3 ' 3E8-9 60 chrX: 147001747+147001869
FMR1 intron 1-3 ' 3F1-2 60 chrX: 147001896+147002039
FMR1 intron 10-11 3F3-4 60 chrX: 147019584+147019691
FMR1 intron 10-11 3F5-6 60 chrX: 147020003+147020124
FMR1 intron 13-14 3F7-8 60 chrX: 147,023,257-147,023,401
FMR1 intron 14 -15 3F9-G1 60 chrX: 147024937-147025078
FMR1 intron 14 -15 3G2-3 60 chrX: 147025727+147025855
Table 5: List of primers used for methylation profiling at the FMR1 genomic locus
FMR1 array design and data analyses
There are 27,656 different targeted (with known genomic location) probes and 30,039 random probes (no matches in the human hgl9 genome) on the custom Nimblegen array (Table 1). M-values (log2(IP- channel/Input-channel)) were calculated per targeted probe and normalized for each chip using Loess to account for non-linear dye bias. Chips of the same IP antibody were then normalized across arrays by scaling to the same median-absolute value. Targeted probes are present four times on the array (with different location on the array), and these were summarized by averaging after normalization. All preprocessing was performed in the R-programming language, the limma package of Bioconductor was used for normalization. G-graph was used to visualize and illustrate array data.
Clinical Specimens for locus specific assay
8mL of blood was collected from FXS patients participating to the 'Biomarker study to assess the status of FMR1 methylation and FMRP expression in Fragile X Syndrome (FXS) patients'. Healthy patient (control) PBMC samples were acquired from Bioreclamation, LLC (n=5). Additional clinical samples from the clinical trial AFQ056A2204 were obtained for which methylation status and clinical response to the mGluR5 antagonist AFQ056 data was available (Jacquemont et al., 2011, supra) as indicated in the table 6 below.
Sample Id Methylation status Response
FXS1 Partial (PM) Non-resp (NR)
FXS2 Complete (FM) AFQ resp (R)
FXS 3 Complete (FM) AFQ resp (R)
FXS4 Partial (PM) AFQ resp (R) FXS5 Partial (PM) | AFQ resp (R)
Table 6
Downscaling of (h)MeDIP to analyse samples from patients treated with (-)-(3aR, 4S, 7aR)-4- Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester
lug of genomic DNA was sonicated (Bioruptor, Diagenode) to produce random fragments ranging in size from 300 to 1,000 bp and 500ng of fragmented DNA was used for the hMeDIP assay. DNA was denatured for 10 min at 95°C and immunoprecipitated for 3 hrs at 4°C with 400ng of a rabbit polyclonal antibody against 5-hydroxymethylcytosine (#39769, active Motif) (hMeDIP) in a final volume of 200 ul IP buffer (10 mM sodium phosphate (pH 7.0), 140 mM NaCl, 0.05% Triton X-100). The mixture was incubated with 10 ul Dynabeads Protein G (#100.03D, Invitrogen) for lhr at 4°C and washed three times with 500ul of IP buffer. Beads were subsequently treated with proteinase K for 3 hrs at 50°C and the methylated DNA recovered by phenol-chloroform extraction followed by ethanol precipitation. 50ng of input DNA and the entire (h)MeDIP enriched DNA was amplified using WGA2: GenomePlex Complete Whole Genome kit (Sigma). Amplified DNA was used for real-time qPCR quantification (primer sequence and sequences covered by the qPCR assays are available in Table 2).
Pyrosequencing
200-3 OOng of genomic DNA was bisulfite treated using the EZ DNA MethylationTM Kit (ZYMO Research) according to the manufacturer's protocol and eluted in 30ul. Pyrosequencing probes were designed with the Pyromark Design 2.0 software package (Qiagen). Primers for PCR amplification and sequencing as well as the sequence covered by each assay are indicated in Table 2. 2ul of converted DNA were used as input for PCR amplification using the AmpliTaq Gold DNA Polymerase (Applied Biosystems, N8080247), with one of two primers was biotinylated. The temperature profile of the cycles was DNA polymerase activation at 95°C for 15min, denaturation at 95°C for 30sec, annealing at 61°C for 30 sec, and extension at 72°C for 1 min for the first cycle. For the next 19 cycles the annealing temperature was decreased by 0.5°C per cycle. Then 36 cycles of amplification were performed at 53°C, the final annealing temperature. Biotinylated PCR product were then purified and immobilized onto streptavidin-coated Sepharose beads (GE Healthcare). Pyrosequencing was performed on the PyroMark Q96 MD (Biotage/Qiagen) following the manufacturer's instructions. Pyro QCpG 1.0.9 (Bioatage/Qiagen) was used to quantify DNA methylation at single CpGs. Data analyses Statistical analyses
Percentage of methylation per CpG obtained by pyrosequencing, was summarized by averaging the value of all CpGs per assay, 0% being unmethylated and 100% fully methylated. 5hmC MeDIP-qPCR data were first normalized using the efficacy of each qPCR assay. The ratio IP/Input was calculated and is expressed as percent of Input, with higher values representing a stronger enrichment for the measured mark, 5hmC. The relationship between the methylation and the hydroxymethylation values to the clinical score (Aberrant Behavior Checklist (ABC C) score (Aman et al, 1995, supra)) was assessed via simple linear regression analysis. The coefficient of determination, denoted R2 and the p-value for the clinical vs methylation data correlation are indicated. All analyses were conducted with TIBCO Spotfire 4.0.2.

Claims

What is claimed is:
1. A method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation at a predetermined region on chromosome X of the FMR1 genomic locus, wherein the predetermined region for detecting hydroxymethylation is between 146982000 to
147027400, and comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
2. The method of claim 1, wherein the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146982000-146984500, or a portion thereof;
146991500-146993600, or a portion thereof;
146994300-147005500, or a portion thereof; and
147023800-147027400, or a portion thereof.
3. The method of claim 1, wherein the predetermined region for hydroxymethylation comprises a region selected from the group consisting of one or more of the following predetermined regions:
146983408 to 146983532, or a portion thereof;
146992564 to 146992704, or a portion thereof;
146992896 to 146993045, or a portion thereof;
146995564-146995705, or a portion thereof;
147001747-147001869, or a portion thereof; and
147024937-147025078, or a portion thereof.
4. A method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting DNA methylation in a sample comprising one or more of the following predetermined regions:
a) position 146994193 to 146994355, or a portion thereof, on chromosome X of an FMR1
genomic locus;
b) position 146994704 to 146994966, or a portion thereof, on chromosome X of an FMR1
genomic locus;
c) position 146995178 to 146995495, or a portion thereof, on chromosome X of an FMR1
genomic locus; d) position 146999650 to 146999804, or a portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147046041 to 147046187, or a portion thereof, on chromosome X of an FMR1 genomic locus; and
comparing the amount of methylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
5. A method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample comprising one or more of the following predetermined regions:
(a) position 146982000 to 146984500, or a portion thereof, on chromosome X of an FMR1 genomic locus;
(b) position 146991500 to 146993600, or a portion thereof, on chromosome X of an FMR1 genomic locus;
(c) position 146994300 to 147005500, or a portion thereof, on chromosome X of an FMR1 genomic locus; or
(d) position 147023800 to 147027400, or a portion thereof, on chromosome X of an FMR1 genomic locus; and
comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
6. The method of claim 5, wherein the predetermined region comprises position 146982000 to 146984500, or a portion thereof, on chromosome X of an FMR1 genomic locus.
7. The method of claim 5, wherein the predetermined region comprises position 146991500 to 146993600, or a portion thereof, on chromosome X of an FMR1 genomic locus.
8. The method of claim 5, wherein the predetermined region comprises position 146994300 to 147005500, or a portion thereof, on chromosome X of an FMR1 genomic locus.
9. The method of claim 5, wherein the predetermined region comprises position 147023800 to 147027400, or a portion thereof, on chromosome X of an FMR1 genomic locus.
10. A method for the diagnosis of Fragile X syndrome (FXS) or a predisposition for FXS comprising detecting hydroxymethylation in a sample at one or more of the following predetermined regions comprising:
position 146983408 to 146983532, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 146992564 to 146992704, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 146992896 to 146993045, or a portion thereof, on chromosome X of an FMRl genomic locus; or
position 146995564-146995705, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 147001747-147001869, or a portion thereof, on chromosome X of an FMRl genomic locus;
position 147024937-147025078, or a portion thereof, on chromosome X of an FMRl genomic locus; and
comparing the amount of hydroxymethylation to a control, whereby FXS or the predisposition for FXS can be diagnosed.
11. A method for determining if an individual with Fragile X Syndrome (FXS) is likely to respond to treatment with an mGluR5 antagonist, the method comprising:
providing a sample from an individual having Fragile X Syndrome;
detecting hydroxymethylation at a predetermined region on chromosome X of an FMRl genomic locus in the sample, wherein the predetermined region for hydroxymethylation comprises one or more of the following regions:
g) 146982000-146984500, or a portion thereof;
h) 146991500-146993600, or a portion thereof;
i) 146994300-147005500, or a portion thereof; or
j) 147023800-147027400, or a portion thereof; and
comparing the amount of hydroxymethylation to a control whereby a determination is made as to the likelihood of the individual being a responder or a non-responder to the compound.
12. A method for determining responsiveness of an individual with Fragile X Syndrome (FXS) to treatment with an mGlur5 antagonist, the method comprising: detecting hydroxymethylation at a predetermined region, or a portion thereof, in a sample from an individual having Fragile X Syndrome, wherein the predetermined region comprises one or more of the following regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; or
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus; and
comparing the amount of hydroxymethylation to a control whereby a determination is made as to the likelihood of the individual being a responder or a non-responder to the compound.
13. The method of any of claims 11-12, wherein the mGluR antagonist comprises (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a
pharmaceutically acceptable salt thereof.
14. A method for treating an individual with Fragile X Syndrome (FXS), the method comprising: providing a sample from an individual having Fragile X Syndrome; and
detecting hydroxymethylation at a predetermined region in the sample, wherein the
predetermined region comprises one or more of the following regions:
(a) position 146982000 to 146984500, or portion thereof, on chromosome X of an FMR1 genomic locus;
(b) position 146991500 to 146993600, or portion thereof, on chromosome X of an FMR1 genomic locus;
(c) position 146994300 to 147005500, or portion thereof, on chromosome X of an FMR1 genomic locus; (d) position 147023800 to 147027400, or portion thereof, on chromosome X of an FMR1 genomic locus; and either
administering a therapeutically effective amount of an mGluR5 antagonist, e..g, (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a
pharmaceutically acceptable salt thereof, to the subject on the basis of the subject having an amount of hydroxymethylation indicative that the individual will respond to a mGluR5 antagonist; or
administering a therapeutically effective amount of a compound other than an mGluR5 antagonist to the subject on the basis of the subject not having an amount of hydroxymethylation indicative that the individual will respond to an mGluR5 antagonist.
15 The method of claim 14, wherein the mGlur5 antagonist is (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m- tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof.
16. A method for treating an individual with Fragile X Syndrome (FXS), comprising selectively administering a therapeutically effective amount of (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl- octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, to the subject on the basis of the subject having an amount of hydroxymethylation at one or more
predetermined regions indicative that the individual will respond to (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m- tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, wherein the predetermined region comprises one or more of the following regions:
g) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
h) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
i) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
j) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
k) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
1) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus.
17. A method of selecting an individual with Fragile X Syndrome (FXS) for treatment with a therapeutically effective amount of (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l- carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof, the method comprising detecting the amount of hydroxymethylation at a predetermined region in the sample, wherein the predetermined region comprises one or more of the following regions:
a) position 146983408 to 146983532, or portion thereof, on chromosome X of an FMR1 genomic locus;
b) position 146992564 to 146992704, or portion thereof, on chromosome X of an FMR1 genomic locus;
c) position 146992896 to 146993045, or portion thereof, on chromosome X of an FMR1 genomic locus;
d) position 146995564 to 146995705, or portion thereof, on chromosome X of an FMR1 genomic locus;
e) position 147001747 to 147001869, or portion thereof, on chromosome X of an FMR1 genomic locus; and
f) position 147024937 to 147025078, or portion thereof, on chromosome X of an FMR1 genomic locus;
wherein the individual is selected for treatment with a therapeutically effective amount of (-)-(3aR, 4S, 7aR)-4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a
pharmaceutically acceptable salt thereof, on the basis of the individual having an amount of
hydroxymethylation at one or more of the predetermined regions indicative that the individual will respond to treatment.
18. The method of claim 11, claim 12 or claim 17, further comprising administering (-)-(3aR, 4S, 7aR)- 4-Hydroxy-4-m-tolylethynyl-octahydro-indole-l-carboxylic acid methyl ester, or a pharmaceutically acceptable salt thereof to the selected individual.
19. The method of any of the preceeding claims, wherein the sample is a PBMC.
20. The method of any of the preceding claims, wherein the detecting methylation can be performed using an assay selected from methylation-sensitive restriction enzyme digestion combined with PCR or bisulfite DNA modification combined with at least one of: methylation specific PCR (MSP), methylation specific PCR (qMS-PCR), probe-based methylation specific PCR or pyrosequencing.
21. The method of any of the preceding claims, wherein the detecting for hydroxymethylation comprises enriching for 5-hmC-marked DNA by immunoprecipitation and determining the amount of enrichment of 5-hmC.
22. The method of claim 21, wherein the enrichment level is determined by sequencing, qPCR, or an array.
23. A diagnostic kit for diagnosing an individual as having Fragile X Syndrome (FXS), comprising an agent for detecting hydroxymethylation within a region on chromosome X of the FMR1 genomic locus and instructions for use.
24. The diagnostic kit of claim 23, wherein the kit comprises a qPCR primer that can amplify a sequence, or portion thereof, wherein the sequence is selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12.
25. The method of claim 23, wherein the primers are selected from the primers listed in Table 2.
PCT/EP2013/054542 2012-03-08 2013-03-06 Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs) Ceased WO2013131981A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261608295P 2012-03-08 2012-03-08
US61/608,295 2012-03-08

Publications (1)

Publication Number Publication Date
WO2013131981A1 true WO2013131981A1 (en) 2013-09-12

Family

ID=47845992

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/054542 Ceased WO2013131981A1 (en) 2012-03-08 2013-03-06 Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs)

Country Status (1)

Country Link
WO (1) WO2013131981A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114807360A (en) * 2022-06-27 2022-07-29 北京贝瑞和康生物技术有限公司 Method and kit for detecting fragile X syndrome mutation

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786146A (en) 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6017704A (en) 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
WO2004014881A2 (en) 2002-08-09 2004-02-19 Astra Zeneca Ab '1,2,4'oxadiazoles as modulators of metabotropic glutamate receptor-5
US7101305B2 (en) 2003-05-27 2006-09-05 Toyota Jidosha Kabushiki Kaisha Planetary-gear-type multiple-step transmission for vehicle
WO2007021575A2 (en) 2005-08-15 2007-02-22 Astrazeneca Ab Acetylenic piperazines as metabotropic glutamate receptor antagonists
US7348353B2 (en) 2001-12-04 2008-03-25 Novartis Ag Acetylene derivatives having mGluR 5 antagonistic activity
WO2011127136A1 (en) 2010-04-06 2011-10-13 University Of Chicago Composition and methods related to modification of 5-hydroxymethylcytosine (5-hmc)
WO2011137206A1 (en) 2010-04-30 2011-11-03 Novartis Ag Predictive markers useful in the treatment of fragile x syndrome (fxs)
WO2012019235A1 (en) * 2010-08-11 2012-02-16 Murdoch Childrens Research Institute Treatment and diagnosis of epigenetic disorders and conditions
WO2012031021A2 (en) * 2010-09-01 2012-03-08 Orion Genomics Llc Improved detection of nucleic acid sequences adjacent to repeated sequences
WO2012174610A1 (en) * 2011-06-24 2012-12-27 Murdoch Childrens Research Institute Treatment and diagnosis of epigenetic disorders and conditions

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6017704A (en) 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6200756B1 (en) 1996-06-03 2001-03-13 The Johns Hopkins University School Of Medicine Methods for identifying methylation patterns in a CpG-containing nucleic acid
US6265171B1 (en) 1996-06-03 2001-07-24 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids
US5786146A (en) 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US7348353B2 (en) 2001-12-04 2008-03-25 Novartis Ag Acetylene derivatives having mGluR 5 antagonistic activity
WO2004014881A2 (en) 2002-08-09 2004-02-19 Astra Zeneca Ab '1,2,4'oxadiazoles as modulators of metabotropic glutamate receptor-5
US7101305B2 (en) 2003-05-27 2006-09-05 Toyota Jidosha Kabushiki Kaisha Planetary-gear-type multiple-step transmission for vehicle
WO2007021575A2 (en) 2005-08-15 2007-02-22 Astrazeneca Ab Acetylenic piperazines as metabotropic glutamate receptor antagonists
WO2011127136A1 (en) 2010-04-06 2011-10-13 University Of Chicago Composition and methods related to modification of 5-hydroxymethylcytosine (5-hmc)
WO2011137206A1 (en) 2010-04-30 2011-11-03 Novartis Ag Predictive markers useful in the treatment of fragile x syndrome (fxs)
WO2012019235A1 (en) * 2010-08-11 2012-02-16 Murdoch Childrens Research Institute Treatment and diagnosis of epigenetic disorders and conditions
WO2012031021A2 (en) * 2010-09-01 2012-03-08 Orion Genomics Llc Improved detection of nucleic acid sequences adjacent to repeated sequences
WO2012174610A1 (en) * 2011-06-24 2012-12-27 Murdoch Childrens Research Institute Treatment and diagnosis of epigenetic disorders and conditions

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
AMAN ET AL., AM. J. MENT. RETARD., vol. 100, 1995, pages 283 - 292
BIHM ET AL., AM. J. MENT RETARD, vol. 96, pages 209 - 211
BURMAN R W ET AL: "Hypomethylation of an expanded FMR1 allele is not associated with a global DNA methylation defect", AMERICAN JOURNAL OF HUMAN GENETICS, AMERICAN SOCIETY OF HUMAN GENETICS, CHICAGO, IL, US, vol. 65, no. 5, 1 November 1999 (1999-11-01), pages 1375 - 1386, XP002265795, ISSN: 0002-9297, DOI: 10.1086/302628 *
COTTRELL ET AL., NUCLEIC ACIDS RES. 2004, vol. 32, no. 1, 2004
DATABASE Geneseq [online] 29 March 2012 (2012-03-29), "Fragile X mental retardation 1 (FMR1) gene intron 1 DNA, SEQ:3.", retrieved from EBI accession no. GSN:AZT50284 Database accession no. AZT50284 *
DATABASE Geneseq [online] 29 March 2012 (2012-03-29), "Fragile X related epigenetic element 2 (FREE2) (B) DNA, SEQ:4.", retrieved from EBI accession no. GSN:AZT50285 Database accession no. AZT50285 *
DATABASE Geneseq [online] 29 March 2012 (2012-03-29), "Genomic target sequence FREE2 (D), SEQ:48.", retrieved from EBI accession no. GSN:AZT50329 Database accession no. AZT50329 *
DATABASE Geneseq [online] 29 March 2012 (2012-03-29), "Genomic target sequence FREE2 (E), SEQ:49.", retrieved from EBI accession no. GSN:AZT50330 Database accession no. AZT50330 *
GODLER ET AL., HUM MOL GENET., vol. 19, no. 8, 15 April 2010 (2010-04-15), pages 1618 - 32
HUM MOL GENET., vol. 19, no. 8, 15 April 2010 (2010-04-15), pages 1618 - 32
JACQUEMONT ET AL., SCI TRANSL MED., vol. 3, no. 64, 5 January 2011 (2011-01-05), pages 64RA1
JACQUEMONT ET AL., SCI TRANSL MED., vol. 3, no. 64, 5 January 2011 (2011-01-05), pages 64RAL
JACQUEMONT S ET AL: "Epigenetic modification of the FMR1 gene in fragile X syndrome is associated with differential response to the mGluR5 antagonist AFQ056", SCIENCE TRANSLATION MEDICINE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 3, no. 64, 5 January 2011 (2011-01-05), pages 1 - 9, XP008138076, ISSN: 1946-6234, DOI: 10.1126/SCITRANSLMED.3001708 *
NUCLEIC ACIDS RES., vol. 30, no. 14, 15 July 2002 (2002-07-15), pages 3278 - 85
S.-G. JIN ET AL: "Genomic mapping of 5-hydroxymethylcytosine in the human brain", NUCLEIC ACIDS RESEARCH, vol. 39, no. 12, 1 July 2011 (2011-07-01), pages 5015 - 5024, XP055061776, ISSN: 0305-1048, DOI: 10.1093/nar/gkr120 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114807360A (en) * 2022-06-27 2022-07-29 北京贝瑞和康生物技术有限公司 Method and kit for detecting fragile X syndrome mutation
CN114807360B (en) * 2022-06-27 2022-09-02 北京贝瑞和康生物技术有限公司 Method and kit for detecting fragile X syndrome mutation

Similar Documents

Publication Publication Date Title
US20130052644A1 (en) Predictive Markers Useful in the Treatment of Fragile X Syndrome (FXS)
US12618111B2 (en) Methods of diagnosing inflammatory bowel disease through RNASET2
Von Deimling et al. The next generation of glioma biomarkers: MGMT methylation, BRAF fusions and IDH1 mutations
Johnson et al. 5-Hydroxymethylcytosine localizes to enhancer elements and is associated with survival in glioblastoma patients
ES2498274T3 (en) Genetic polymorphisms in age-related macular degeneration
Menezes et al. AXIS inhibition protein 2, orofacial clefts and a family history of cancer
Ou et al. Catalog of 5′ fusion partners in RET+ NSCLC Circa 2020
Colacino et al. Comprehensive analysis of DNA methylation in head and neck squamous cell carcinoma indicates differences by survival and clinicopathologic characteristics
US9982304B2 (en) ARID1A and PPP2R1A mutations in cancer
US8728732B2 (en) Global DNA hypomethylation and biomarkers for clinical indications in cancer
Scheie et al. Biomarkers in tumors of the central nervous system–a review
Brasa et al. Reciprocal changes in DNA methylation and hydroxymethylation and a broad repressive epigenetic switch characterize FMR1 transcriptional silencing in fragile X syndrome
Misawa et al. Epigenetic silencing of SALL3 is an independent predictor of poor survival in head and neck cancer
Chen et al. Identification of chromosomal copy number variations and novel candidate loci in hereditary nonpolyposis colorectal cancer with mismatch repair proficiency
Lu et al. Nucleosomes correlate with in vivo progression pattern of de novo methylation of p16 CpG islands in human gastric carcinogenesis
JP2019503176A (en) Method for predicting response to treatment
Erichsen et al. Aberrant methylated key genes of methyl group metabolism within the molecular etiology of urothelial carcinogenesis
He et al. TRIM36 hypermethylation is involved in polycyclic aromatic hydrocarbons-induced cell transformation
An et al. Characteristic methylation profile in CpG island methylator phenotype‐negative distal colorectal cancers
Condorelli et al. Positive caricature transcriptomic effects associated with broad genomic aberrations in colorectal cancer
Weng et al. Genotyping of common EGFR mutations in lung cancer patients by electrochemical biosensor
Asmar et al. DNA methylation and hydroxymethylation in cancer
Ida et al. Real-time methylation-specific polymerase chain reaction for MGMT promoter methylation clinical testing in glioblastoma: an alternative detection method for a heterogeneous process
Leoni et al. Reduced DNA methylation and hydroxymethylation in patients with systemic mastocytosis
US10457992B2 (en) Hypermethylation biomarkers associated with poor survival outcomes for head and neck squamous cell cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13708773

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13708773

Country of ref document: EP

Kind code of ref document: A1