WO2013123559A1 - Rna tagging method - Google Patents

Rna tagging method Download PDF

Info

Publication number
WO2013123559A1
WO2013123559A1 PCT/AU2013/000161 AU2013000161W WO2013123559A1 WO 2013123559 A1 WO2013123559 A1 WO 2013123559A1 AU 2013000161 W AU2013000161 W AU 2013000161W WO 2013123559 A1 WO2013123559 A1 WO 2013123559A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
method
poly
rna
tail
Prior art date
Application number
PCT/AU2013/000161
Other languages
French (fr)
Inventor
Traude Helene BEILHARZ
Original Assignee
Monash University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2012900663 priority Critical
Priority to AU2012900663A priority patent/AU2012900663A0/en
Application filed by Monash University filed Critical Monash University
Publication of WO2013123559A1 publication Critical patent/WO2013123559A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

Abstract

The invention provides methods for tagging (and detecting, analysing and/or sequencing) polyadenylated RNA within the transcriptome in a manner enabling transcript identification, adenylation site recognition and the measure of poly(A)-tail length (eg by sequencing, gel electrophoresis or size-exclusion chromatography (SEC)).

Description

RNA TAGGING METHOD

TECHNICAL FIELD

[0001] The invention relates to the analysis of gene expression, transcription and translation, particularly through the study of the polyadenylation-state of the transcriptome. The invention J provides methods for tagging (and detecting, analysing and/or sequencing) polyadenylated RNA within the transcriptome in a manner enabling transcript identification, adenylation site recognition and the measure of poly(A)-tail length (eg by sequencing, gel electrophoresis or size-exclusion chromatography (SEC)).

INCORPORATION BY REFERENCE

[0002] This patent application claims priority from: Australian Patent Application No 2012900663 filed 22 February 2012. The entire, content of this application is hereby incorporated by reference.

BACKGROUND

[0003] The addition of a poly(A)-tail is important for all aspects of RNA metabolism and is the final "quality control" step that nascent messenger RNA (mRNA) undergoes prior to nuclear export [I]. In this context, it is thought that the poly(A)-tail promotes circularisation of the RNA molecule into a closed-loop configuration that promotes translation initiation [2], At synthesis, the length of the poly(A)-tail is uniform in any given system with the absolute length being species dependent; for example, in yeast this is -90 adenosine residues and in mammalian cells the length is -250 adenosine residues. However, in the cytoplasm, the steady-state length distribution of poly(A)-tails can vary dramatically for transcripts of different functional classes due to differential, transcript-specific, deadenylation rates [3-5]. For example, targeted deadenylation is provoked by microRNA binding [6- 8] and by other modes of translation repression, such as in the storage of maternal mRNA in the germline (reviewed: [9-1 1]). Further, compensatory and activating cytoplasmic adenylation can also modulate the polyadenylation state of the transcriptomes of many eukaryotes. Finally, eukaryotic cells also employ the ancient, prokaryotic function of RNA adenylation to destabilise mitochondrial, structural and non-coding RNA [12] (reviewed: [13]). The present applicant has previously shown that the polyadenylation state of the transcriptome is highly correlated with other gene expression parameters such as ribosome occupancy and protein abundance [5, 14] leading to the proposal that the measure of mRNA poly(A)-tail length can serve as a surrogate for translation-state measurements.

[0004] There are several well characterised methods for the measure of poly( A)-tail length. The most direct of these is the combined use of RNAse H digest (+/- Oligo dT) and high-resolution Northern blotting [3, 15]. Other methods include the so-called Ligation Mediated-Poly(A) Test (LM-PAT) assay [5, 8, 14, 16-18] and T4 RNA ligase techniques to either circularise mRNA [19] or to ligate adaptors to the 3' end of mRNA [20], While each of these can serve to measure poly(A)-tail length, each has its own limitations. In particular, high-resolution Northern blotting is labour intensive and requires high input material, the LM-PAT method has limited resolution and a tendency toward exaggerated apparent short-tailed mRNA, and ligation techniques are considered to be relatively inefficient.

[0005] Accordingly, the present applicant sought to develop a simple and accurate method to measure the poly(A)-tail length of RNA molecules such as mRNA.

SUMMARY

[0006] The present invention provides, in a first aspect, a method of detecting a ribonucleic acid (RNA) molecule in a sample, wherein said RNA molecule comprises a 3' poly(A)-tail, said method comprising the steps of:

(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule;

(ii) producing a polynucleotide product molecule comprising said tag sequence by

(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and

(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail,

wherein (a) and (b) may be conducted in either order; and

(iii) detecting or analysing said polynucleotide product molecule by said tag sequence.

[0007] In a second aspect, the present invention provides a method of tagging a ribonucleic acid (RNA) molecule in a sample with a 3' tag sequence, wherein said RNA molecule comprises a 3' poly(A)-tail, said method comprising the steps of:

(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule; (ii) producing a polynucleotide product molecule comprising said tag sequence by

(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and

(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail,

wherein (a) and (b) may be conducted in either order; and optionally

(iii) amplifying or otherwise increasing the copy number of said polynucleotide product molecule comprising said 3' tag sequence.

BRIEF DESCRIPTION OF FIGURES

[0008] Figure 1 shows: (A) a schematic diagram of an embodiment of the extension Poly(A) Test (ePAT) method of the present invention. In the first step, a DNA oligo is annealed to adenylated RNA via an oligo-(T) stretch. The second step then involves the addition of Klenow polymerase and dNTPs to bring about the templated extension of the 3' terminus of the poly(A) tract to fill in the recessed end. In the third step, incubation is performed with reverse transcriptase at 55°C to produce cDNA and ensure that the primer used for extension can only remain annealed to end-extended molecules, not internal poly( Attracts via oligo-(T) alone. In the fourth step, PGR amplification of the cDNA is conducted using a gene-specific primer (primer 1 ) and a universal reverse primer (primer 2), resulting in a range of amplicon sizes that reflect the position of the gene-specific primer relative to the poly(A)-site and the length distribution of poly(A)-tails in the sample; and (B) a schematic diagram of an embodiment of the ePAT method, wherein the embodiment is adapted for parallel sequencing of amplicons using the SOLiD™ sequencing system (Life Technologies, Inc., Carlsbad, CA, United States of America);

[0009] Figure 2 provides: (A) a schematic representation of the time course of galactose induction and glucose repression used in the experiment described in Example 1 to assess the abi lity of the ePAT method to monitor the polyadenylation-state of specific transcripts in response to a transcriptional pulse chase regimen in S. cerevisiae. The arrows indicate the time-points at which cells were harvested; (B) an image showing PCR amplicons from the anchored Poly(A) Test (TVN-PAT), ePAT and LM-PAT reactions run on 2% high resolution agarose gel. The TVN-PAT reaction represents the size of the amplicon with a fixed (Ai2)-tail. The 10 minute time-point represents newly synthesised GAL1 transcript with a long poly(A)-tail. The GALl-(\ong) and &4ZJ -(short) transcripts are generated by alternate poly(A)-site usage; and (C) graphical results showing the time-dependent shortening of the two GAL I amplicons (quantified relative to the lOObp ladder and the migration of the TVN-PAT product). This result is really only achievable using the ePAT method as laddering in the LM-PAT assay res ults in two peaks of similar intensity in the last time-point of this reaction (20 minutes);

[0010] Figure 3 provides: (A) a schematic representation of the time course of galactose induction and glucose repression used in the experiment described in Example 1 to assess the decrease in

HXKI -(long) transcript and accumulation of HA¾T/-(short) transcript with transcriptional pulse chase. Arrows indicate the time-points at which cells were harvested; (B) an image of a gel indicating that HXKI transcription is rapidly repressed by glucose. During this repression phase, the ratio between HAST/ -(long) and /£¾7-(short) changes as the short form is transiently induced without a significant increase in poly( A)-tail length. GCV1 is transiently induced with a long poly(A)-tail by glucose addition. The faster migrating GCVl amplicon indicated by ** is a product of internal priming in the TVN-PAT reaction. The GAL JO and APQ12 panels are included as pulse-chase,and ePAT method controls respectively;

[001 1 ] Figure 4 provides a gel image showing results indicating that the cytoplasmic poly(A)- polymerase gld-2 is required for normal polyadenylation of transcripts in the C. elegans germline. The polyadenylation-state of four maternal mRNAs (namely mRNA from egg-I, pup-2, oma-2 and gpd-4) were analysed in Bristal normal (N2) and gld-2 mutant worms. In each case, the mRNA is short-tailed in the mutant reflecting the inactive state. The polyadenylation-state of the somatic transcript gpd-2 is not majorly affected by the loss of gld-2. Yeast total RNA was spiked into the assay and the yeast APQI2 panel was included to demonstrate equal ePAT method efficiency across samples and as ballast for low input;

[0012] Figure 5 provides a schematic representation of a whole transeriptome application of an embodiment of the ePAT method of the invention to the detection of alternate polyadenylation (APA): (A) the fragmented RNA is cut by limiting RNase Tl digestion to an average length of 200 bases in length; (B) RNA fragments are separated by 6% LTREA-PAGE electrophoresis and imaged by fluorescence staining, and subsequently, the area encompassing 100-250 bases is excised and eluted from the gel slice; and (C) once the sequencing is complete, the reads are aligned to the genome. The vast majority of reads will map to within 150 bases of a poly(A)-site and, for transcripts which utilise alternate polyadenylation sites, the number of reads within the alternative peaks will represent the number of transcripts ending at that site. This is a quantitative read-out (**); ie 2x long (a + b) over short (c) 3' UTR transcript variants;

[0013] Figure 6 provides a representation of an experiment using an embodiment of the ePAT method to analyse gene-expression and APA: (A) inset: Yeast cells were grown in rich media with glycerol as a sole carbon source. The addition of galactose to the media induces large-scale transcriptional changes, however, the addition of the preferred carbon source (glucose) represses may of these changes and induces others; (B) snapshot of 3'-Seq data visualised in an integrative genomics viewer (IGV) browser. The reads were aligned to annotated transcript coordinates (Crick strand = grey; Watson strand = black). The vast majority of the reads aligned to the 3' end of the transcript (black bar, arrow indicates transcript direction). The number next to 3' peaks indicates the number of reads that map to the transcript in each condition. Note: in this view, the peak height was set at 500 and "clips off the tops of the GAL2 and SRL2 peaks; and

[0014] Figure 7 shows the results of an experiment using an embodiment of the ePAT method to analyse condition-dependent APA in yeast: (A) the IGV snapshot shows two distinct polyadenylation sites, one proximal (P) and one distal (D) to the stop codon; and (B) PCR-based 3' RACE experiments confirm both the position and switch between dominant adenylation-site.

DETAILED DESCRIPTION

[0015] The present applicant has found that the intrinsic activity of the Klenow fragment of DNA polymerase I [21] and like enzymes, can be harnessed to efficiently tag the 3' end of RNA molecules as an extension mediated poly(A)-tail length measure, or to identify and/or unambiguously assign the 3' untranslated region (UTR) of specific RNA transcripts.

[0016] In a first aspect, the present invention provides a method of detecting or analysing a ribonucleic acid (RNA) molecule in a sample, wherein said RNA molecule comprises a 3' poly(A)- tail, said method comprising the steps of:

(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule;

(ii) producing a polynucleotide product molecule comprising said tag sequence by

(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and

(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail,

wherein (a) and (b) may be conducted in either order; and

(iii) detecting or analysing said polynucleotide product molecule by said tag sequence. [0017] The method is suitable for detecting or analysing an RNA molecule comprising a 3' poly(A)- tail. As is well known to persons skilled in the art, the term "3' poly(A)-tail" refers to a sequence of adenosine residues at the 3' end of eukaryotic RNA molecules such as coding, messenger RNA (mRNA) and mitochondrial RNA, as well as some non-coding RNA molecules such as structural RNA, transfer RNA (tRNA). ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nuceolar RNA (snoRNA) and regulatory RNA including RNA Xist (X-inactive specific transcript). It is to be understood that the method of the first aspect is suitable for detecting or analysing any of such RNA molecules comprising a 3' poly(A)-tail. Typically, the RNA molecule will be single-stranded, however the method may be adapted for double-stranded or partially double-stranded RNA molecules comprising a 3' poly(A)-tail (eg by denaturing the RNA molecules into single strands prior to the step of annealing the oligonucleotide template). The method may be performed such that a specific RNA molecule (comprising a 3' poly(A)-tail) within the sample is tagged at the 3' end (ie with the tag sequence), thereby enabling detection of that specific RNA molecule.

[0018] The sample may be any nucleic acid-containing sample such as, for example, purified or partially purified samples of total RNA prepared from tissue/cell cultures or tissue samples.

Alternatively, the sample may have been enriched for RNA comprising 3' poly(A)-tails by, for example, passing an RNA-containing sample though an oligo-(T) chromotography column as is well known to persons skilled in the art. However, samples enriched for RNA comprising 3' poly(A)-tails may be less preferable in some circumstances since the enrichment process may introduce an undesirable selection bias. Further, since the method may be conducted using a total RNA sample, rRNA depletion steps may be avoided if desired.

[0019] The step of annealing an oligonucleotide template to the RNA molecule (step (i)) may be conducted under suitable conditions as will be known to persons skilled in the art. For example, typically, the oligonucleotide template used in the step will be of 25-40 nucleotides in length and comprises a 3' hybridising sequence of 10-20 nucleotides; it will be readily apparent to persons skilled in the art that suitable annealing conditions for such an oligonucleotide template include an incubation at a temperature in the range of 60°-85°C to melt secondary structure followed by an incubation in the range of 20°-42°C in a suitable buffer such as a reverse transcription buffer (eg 50 niM Tris-HCl, 85 mM KC1, 3 raM MgCl2, 10 mM dithiothreitol, pH 8.3).

[0020] The 3' sequence of the oligonucleotide template comprises a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule. The hybridising sequence preferably comprises an oligo-(T) or oligo-(U) sequence. Throughout this specification, it is to be understood that the term "oligo-(T)" encompasses oligonucleotide molecules comprising solely thymine (T) residues and/or deoxythymidine (dT) residues; accordingly, the term oligo-(T) is to be understood as also encompassing "oligo-(dT)". Similarly, it is to be understood that the term "oligo-(U)" encompasses oligonucleotide molecules comprising solely uridine (U) residues and/or deoxyuridine (dU) residues; accordingly, the term oligo-(U) is to be understood as encompassing "oligo-(dU)". The hybridising sequence may also comprise a combination of thymine (T)/deoxythymidine (dT) and uridine (U)/deoxyuridine (dU) residues.

[0021] The 5' sequence of the oligonucleotide template is of a preferably known nucleotide sequence coding for a tag sequence and, upon hybridisation of the oligonucleotide template to the 3' poly(A)- tail of the RNA molecule, provides a 5' overhang. Typically, the 5' sequence comprises 12-25 nucleotides. In an embodiment, the 5' sequence provides a template for a sequence that may be targeted by an oligonucleotide primer molecule, preferably a "universal" oligonucleotide primer molecule. The oligonucleotide template preferably consists of a DNA oligo comprising

deoxythymidine, deoxyadenosine, deoxycytidine and deoxyguanosine with a backbone of 5'-3' phosphodiester linkages, however the DNA oligo may also comprise one or more non-natural nucleotides such as deoxyuridine nucleotides and/or one or more linkages other than 5'-3' phosphodiester linkages (eg to increase the stability of the DNA oligo) as are well known to persons skilled in the art.

[0022] The oligonucleotide template may comprise one or more labelled dNTPs (eg labelled with a label including, but not limited to radioisotopes, haptens such as, for example, biotin, and fluorescent labels such as fluorescein derivatives (eg FITC) and rhodamine derivatives (eg TAMRA)). The use of a hapten such as biotin, preferably provided as a label on the 5' terminal nucleotide of the oligonucleotide template, provides a convenient means for anchoring the oligonucleotide template to a solid surface (eg through the use of avidin streptavidin conjugated to the surface), as may be provided by magnetic beads well known to persons skilled in the art, for use in the method of the present invention (eg to assist in the purification and handling of duplex nucleic acid formed in step (i) for, for example, cDNA synthesis (eg such as may be comprise step (ii)(b)), enrichment, and ligation of 5' adapters).

[0023] The step of extending the RNA molecule from said 3' poly(A)-tail to generate the tag sequence (step (ii)(a)) is preferably conducted using the Klenow polymerase (Klenow fragment) of DNA polymerase I [21 ] and like enzymes (eg E. coli DNA polymerase I, exo-Klenow fragments (such as the Ambion® Exonuclease-free Klenow Fragment; Ambion Inc, Austin, TX, United States of America) and other enzymes with 5'→3' polymerase activity that can sequence-specifically extend an RNA molecule). Typically, the Klenow fragment (or like enzyme) is provided with a standard dNTPs mixture [22] such that the 3' poly(A)-tail is end-extended to generate a DNA tag sequence. One or more of the dNTPs may be optionally labelled with a label (eg a label such as a radioisotope label or hapten such as those mentioned above) or alkyne group (eg for use in the well known Click chemistry (Click-iT® Nascent RNA Capture Kit; Life Technologies) for anchoring the polyadenylated RNA molecule to a solid surface Or attaching other useful groups or entities such as biotin, to assist in, for example, the purification and handling of the RNA molecule or the duplex nucleic acid formed in step (i) for, for example, cDNA synthesis (eg such as may be comprise step (ii)(b)), enrichment, and ligation of 5' adapters).

[0024] Following the completion of this step, the Klenow fragment (or like enzyme) may be inactivated by exposure to heat (eg 80°C for 10 minutes). Further, the sample may be subjected to limited endonuclease digestion (eg with RNAse Tl) and, optionally, suitable fragments (eg of 50-500 bases) selected for the following step.

[0025] The step (ii)(b) of extending the oligonucleotide template from a 3' end of the hybridising sequence ("priming") may be conveniently conducted using reverse transcriptase (RT) (eg Superscript III; Life Technologies) or like enzyme, typically in the presence of a standard dNTPs mixture. This step is conducted under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail (ie so as to prevent internal priming). Accordingly, this step is preferably conducted such that the temperature is maintained at a temperature in the range of 42° to 70°C as appropriate for the reverse transcriptase of choice. Where conducted following step (ii)(a), this step is preferably conducted at a temperature at or above 55°C, as this substantially restricts priming to only those RNA molecules that have been end-extended to generate the tag sequence. Optionally, this step may be conducted with one or more labelled dNTPs (eg labelled with a detectable label such as a radioisotope label or hapten such as those mentioned above). Following the completion of this step, the reverse transcriptase (or like enzyme) may be inactivated by exposure to heat (eg 80°C for 10 minutes).

[0026] This result of step (ii)(a) and (b) is the production of a polynucleotide product molecule (eg a double-stranded polynucleotide molecule such as a cDNA:RNA duplex) which comprises the tag sequence.

[0027] Optionally, step (ii) may comprise a step of linking (eg by ligation) an additional polynucleotide molecule to provide a desired 5' nucleotide sequence (eg a 5' tag sequence). The additional polynucleotide molecule may comprise a 5' linker (eg a splinted linker) or 5' adapter molecule. Typically, this optional step is conducted following limited endonuclease digestion (of the polynucleotide molecules extended in step (ii)(a)) and size selection of suitable fragments. Where the optional step is conducted, the polynucleotide product molecule of step (ii)(a) and (b) will further comprise the additional 5' nucleotide sequence. [0028] The polynucleotide product molecule may be detected or analysed in the detecting/analysing step (iii) of the method of the first aspect, by any means well known to persons skilled in the art. For example, where the tag sequence is generated with labelled dNTPs, the polynucleotide product molecule may be detected by detecting the labelled tag sequence. However, more preferably, the polynucleotide product molecule is detected or analysed by amplifying the sequence of the polynucleotide product molecule including the tag sequence, and thereafter detecting/analysing the amplicon product. The method for amplifying the sequence of the polynucleotide product molecule may comprise any of the nucleic acid amplification methods well known to persons skilled in the art. This may, optionally, first involve treating the polynucleotide product molecule with an enzyme such as RNAse H to digest the RNA component according to any of the standard methods well known to persons skilled in the art. In one embodiment, the amplification is performed using a standard polymerase chain reaction (PCR) amplification method to amplify sequence of the extended oligonucleotide template (eg cDNA) using first and second oligonucleotide primers, wherein said first (forward) oligonucleotide primer comprises a sequence that is targeted, for example, to a specific RNA molecule (eg a gene-specific primer) or a group of related RNA molecules (eg including at least a region of common sequence that can be targeted by the first oligonucleotide primer, or a region of sequence that is sufficiently related to be targeted by the first oligonucleotide primer especially where provided as degenerate primer molecules), and said second (reverse) oligonucleotide primer comprises a sequence that is targeted to said 5' sequence of the oligonucleotide template (ie the sequence complementary to the tag sequence). The first oligonucleotide primer may be targeted to any region of the RNA molecule upstream of the poly(A)-tail. Thus, for example, the first oligonucleotide primer may be targeted to a sequence at or adjacent to the 5' end of the RNA molecule (or a fragment thereof where the sample had been subjected to limited endonuclease digestion) or, alternatively, at or close to the 5' end of the poly(A)-tail. Preferably, the second oligonucleotide primer comprises a universal oligonucleotide primer molecule. The amplicon product(s) of the amplification may be subjected to, for example, sequencing, gel electrophoresis or size-exclusion chromatography (SEC) to identify or analyse the RNA molecule. By ensuring that the amplicon product(s) includes sequence corresponding to the complete poly(A)-tail of the RN A molecule, the method thereby provides a means for analysing the polyadenylation status of the RNA molecule, since the size of the amplicon product(s) will reflect the position of the target site for the first oligonucleotide primer and the length or lengths of the 3' poly(A)-tails of the RNA molecule in the sample.

[0029] Accordingly, the method of the first aspect can be used for, for example, the measure of poly(A)-tail length of one or more RNA molecules (eg in the transcriptome). As such, the method may be used in the study of 3' poly(A)-tail length change to regulate mRNA translation. As such, the nucleic acid-containing sample used in the method may be prepared from cells having been subjected to gene induction, repression or other stimulation (eg in a transcriptional pulse regimen), and changes in 3' poly(A)-tail length assessed by repeating the method with samples prepared from cells harvested at various times following the induction, repression or other stimulation.

[0030] Further, by ensuring that the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted under conditions to prevent internal priming, the method of the first aspect can be used for analysing the RNA molecule for alternate poly(A)-sites to identify and/or unambiguously assign the 3' UTR of specific transcripts. Again, the nucleic acid-containing sample used in the method may be prepared from cells having been subjected to gene induction, repression or other stimulation (eg in a transcriptional pulse regimen), and changes in poly(A)-site usage assessed by repeating the method with samples prepared from cells harvested at various times following the induction, repression or other stimulation. Knowledge of the site at which an RNA molecule such as mRNA is polyadenylated can be important for several reasons. For example, if an mRNA is subject to alternate polyadenylation (APA), the use of a shorter 3' UTR may remove the influence of regulatory elements such as micro-RNA binding sites [23]. Alternatively, an mRNA may show condition- dependent or disease-dependent APA.

[0031] In a second aspect; the present invention provides a method of tagging a ribonucleic acid (RNA) molecule in a sample with a 3' tag sequence, wherein said RNA molecule comprises a 3' poly(A)-tail, said method comprising the steps of:

(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule;

(ii) producing a polynucleotide product molecule comprising said tag sequence by

(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and

(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly( A) sequence of said RNA molecule other than the 3' poly(A)-tail,

wherein (a) and (b) may be conducted in either order; and optionally

(iii) amplifying or otherwise increasing the copy number of said polynucleotide product molecule comprising said 3' tag sequence.

[0032] The conduct of the step of annealing an oligonucleotide template to the RNA molecule (step (i)) and the features of the oligonucleotide template may be as described above in respect of the method of the first aspect. Most preferably, the oligonucleotide template consists of a DNA oligo of 25-40 nucleotides in length comprising a 3' oligo-(dT) sequence of 10-20 deoxythymidine residues and a 5' sequence (coding for the 3' tag sequence) comprising 12-25 nucleotides. The step of extending the RNA molecule from said 3' poly(A)-tail to generate the 3' tag sequence (step (ii)(a)) is preferably conducted using the Klenow fragment (or like enzyme) as described above in respect of the first aspect. Also, the step of extending the oligonucleotide template from a 3' end of the hybridising sequence ("priming") (step (ii)(b)) may be conducted as described above. In the optional step of amplifying or otherwise increasing the copy number of the polynucleotide product molecule comprising the 3' tag sequence (step (iii), this may comprise the use of any of the nucleic acid amplification methods well known to persons skilled in the art or, otherwise, any other suitable method such as introducing the polynucleotide product molecule into a standard cloning vector for replication in a suitable host cell.

[0033] The method of the second aspect can be used for, for example, usefully tagging any RNA molecule which comprises a 3' poly(A)-tail. One particular application resides in 3' end-labelling of amplicons of 3' Rapid Amplification of cDNA ends (3' RACE) for, inter alia, detecting and identifying APA in an RNA molecule.

[0034] It will be readily understood that the methods of the present invention may be conducted in "multiplex" contexts. That is, the method of the first aspect may be conducted in a manner to simultaneously detect or analyse more than one RNA molecule in the sample. Similarly, the method of the second aspect may be conducted in a manner to simultaneously tag more than one RNA molecule in the sample. In a multiplexed method of the first aspect, the polynucleotide product molecules (eg amplicons) are preferably detected or analysed by a parallel sequencing methodology such as the SOLiD™ sequencing system utilising magnetic beads, and other high-throughput and deep sequencing techniques such as the HiSeq and MiSeq systems (Illumina, Inc., San Diego, CA, United States of America), Ion Torrent PGM™ and Ion Proton™ (Life Technologies), and SMRT (Pacific Biosciences, Menlo Park, CA, United States of America) sequencing techniques.

[0035] Utilising the SOLiD™ sequencing system, the method of the first aspect may be conducted by, for example, the following protocol:

(1) Anneal SOLiD™ specific DNA oligo to polyadenylated RNA

(eg 5' CTGCTGTACGGCCAAGGCGTTrTTTTTTTTT 3' (SEQ ID NO: l ); which provides a "universal tag" for subsequent barcoded amplification);

(2) Extend 3' end of RNA molecule with Klenow fragment (This step generates the 3' tag sequence on polyadenylated RNA ensuring that reverse transcription (step (7) below) is only possible from true 3' ends (ie not internal poly(A)-tracts) thereby avoiding all internal priming); (3) Fragment RNA with RNAse IT (This enzyme cuts RNA after G residues and thus a limited digestion leaves all poly( Attracts and the DNA comprising the 3' tag sequence intact);

(4) 5' phosphorylate RNA fragments with polynucleotide kinase (PNK) (The RNAse Tl enzyme generates a 5' hydroxyl and a 3' phosphate, however a 5' phosphate is required for ligation of SOLiD™'5' linkers). Note: this step is specific to the use of RNA-ligase 2 for ligation of the 5' tag;

(5) Size select RNA with Urea-PAGE (Select RNA between 80 and 200 bases for yeast and 100 and 300 bases for mammalian samples. This removes excess 3' primer and selects the RNA species of interest);

(6) Ligate "best-guess" 5' SOLiD™ linkers (This adds the sequence necessary at the 3' end of the cDNA in the RT step for directional sequencing);

(7) Reverse transcribe with primer complementary to the 3' extended sequence (Use the 3' tag sequence to reverse transcribe specifically only 3' sequences such that the full poly(A)-tail is thereby reverse transcribed);

(8) Isolate cDNA (The cDNA may be purified by column clean-up);

(9) PCR amplify the library (Amplify -50% of the library with barcoded primers (-15-18 cycles)); and

(10) Introduce into the SOLiD™ Emulsion PCR workflow.

This protocol is illustrated in Figure I B.

[0036] Utilising the Ion Torrent PGM™ and Ion Proton™ sequencing system, the method of the first aspect may be conducted by, for example, the following protocol:

(1) Anneal Ion Torrent-compatible specific DNA oligo to polyadenylated RNA

(eg 5' CTGCGTGTCTCCGACTCAGTTTTTTTTTTTT 3' (SEQ ID NO:2); which provides a "universal tag" for subsequent amplification);

(2) Extend 3' end of RNA molecule with Klenow fragment;

(3) Fragment RNA with RNAse T 1 ;

(4) 5' phosphorylate RNA fragments with polynucleotide kinase (PNK);

(5) Size select RNA with Urea-PAGE (Select RNA between 80 and 200 bases for yeast and 100 and 300 bases for mammalian samples);

(6) Ligate splinted 5' linkers (This adds the sequence necessary at the 3' end of the cDNA in the RT step for directional sequencing);

(7) Reverse transcribe with primer complementary to the 3' extended sequence (Use the 3' tag sequence to reverse transcribe specifically only 3' sequences such that the full poly(A)-tail is thereby reverse transcribed);

(8) Isolate cDNA;

(9) PCR amplify the library (Amplify -50% of the library with barcoded primers (-15-18 cycles)); and ( 10) Introduce into the PGM workflow.

[0037] In a further aspect, the present invention provides a kit comprising, for example, one or more enzymes (eg Klenow fragment) and/or reagents (eg validated oligonucleotide primers, dNTPs, etc) together with instructions for use in a method according to the first or second aspect. In a particular embodiment, the kit comprises an oligonucleotide molecule comprising the nucleotide sequence:

5' CTGCTGTACGGCC AAGGCGTTTTTTTTTTTT 3' (SEQ ID NO: 1 ),

5' CTGCGTGTCTCCGACTCAGTTTTTTTTTTTT 3' (SEQ ID NO:2), or

5' GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT 3' (SEQ ID NO:3)

[0038] The invention is hereinafter described by way of the following non-limiting examples.

EXAMPLES

[0039] Example 1

[0040] Materials and Methods

Saccharomvces cerevisiae

[0041] The By4741 yeast strain {MA Ta his3A0 leu2A0 metJ5A0 uraS&O) was grown to exponential phase (OD600-0.6) in rich media (2% peptone; 1% yeast extract) with 2% raffinose as a sole carbon source. Transcription of GAL genes were transiently induced by the addition of galactose (2%) and then repressed after 10 minutes by the addition of glucose (2%). At each indicated time-point, 5 ml of media was removed into 15ml tubes containing 0.1 % sodium azide pre-chilled in an ice bath. Once all samples were collected, cells were harvested by centrifugation (4000g for 2 min), washed once in ice cold water containing 0.1 % sodium azide, snap frozen and stored at -80°C.

Caenorhabditis elegans

[0042] C. elegans wild-type Bristol N2 and gld-2(q497) strains were maintained at 20°C using standard methods [24].

RNA extraction

[0043] Total RNA from yeast cells was prepared according to the hot phenol method [25]. Total C. elegans RNA was prepared by suspending between 50 and 100 snap frozen worms in 1 ml of Trizol (Life Technologies) and then, after the addition of -200 μΐ zirconia beads, the sample was homogenised for 30 seconds using a Mini-Beadbeater 8™ (Bio Spec Products Inc., Bartlesville, OK, United States of America). Trizol extraction was performed according to the manufacturer's instructions except that 2 μΐ Glycogen was added prior to precipitation with isopropanol. To improve the A260/A230 ratios that result from Trizol purifications, the resulting pellet was re-suspended in 100 μΐ dH20 and then re-precipitated with 1/10 volumes of 3 M NaOac [pH 5.2] and 2.5 volumes of ethanol. RNA quantitation was by Nano-drop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States of America).

Extension Poly(A) Test (ePAT) method

[0044] The method of this example utilised a PAT-anchor primer with the following nucleotide sequence: 5' GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT 3' .(SEQ ID NO:3); which was stored at 100 μΜ at -20°C in small aliquots. The incubation steps of the method were performed in a thermocyler with an accessible lid programmed with a series of temperature hold/pause settings, where the pause maintains temperature while allowing access to the tubes.

[0045] To assemble the ePAT reaction, 1 μg of total RNA (or less) was combined with 1 μΐ of PAT- anchor primer, which was then brought up to 8 μΐ with d¾0 in a 200 μΐ PGR tube. The mixture was then incubated at 80°C for 5 min then cooled to room temperature. Once cooled, the mixture was flash-spun and 12 μΐ added of a master mix (containing, per reaction, 4 μΐ d¾0; 4 μΐ 5x Superscript III buffer; 1 μΐ 100 inM DTT; 1 μΐ 10 mM dNTPs; 1 μΐ RNAseOUT; 1 μΐ lenow polymerase). The mixture was then mixed thoroughly by inversion, flash-spun and incubated at 25°C for 1 hour. The Klenow fragment was inactivated by increasing the temperature to 80°C for 10 minutes, then cooled to 55°C for 1 min. The tubes were then maintained at temperature, and Ι μΐ of Superscript III added to the tubes in the block, with mixing by rapid flick-inversion. Incubation was then continued at 55°C for 1 hour before inactivation of the reverse transcriptase by increasing the temperature to 80°C for 10 minutes.

[0046] Optionally, "spike-in RNA" from an unrelated organism can be included as ballast for low input reactions and to control for equal efficiency across samples. For example, total Hela RNA may be spiked into yeast samples and RNA from a deadenylase-deficient yeast strain into metazoan RNA samples (see Figure 4).

[0047] For PGR reactions, the cDNA was diluted 1 :6 by addition of 120 μΐ d¾0. The PGR reaction is typically conducted with a volume of 20 μΐ using 5 μΐ of diluted cDNA input and a fast-starting DNA polymerase such as FastStart (Roche Molecular Biochemicals, Mannheim, Germany) or Amplitaq Gold 360 master (Life Technologies). Other Poly(A) Test methods

[0048] The anchored Poly(A) Test (TVN-PAT) and Ligation Mediated-Poly(A) Test (LM-PAT) reactions were also performed. The TVN-PAT reaction may provide a useful size control for the size of the amplicon that reports a 3' UTR sequence with a fixed Ai2 poly(A)-tail. Both the TVN-PAT and LM-PAT reactions were performed exactly as previously described [26].

Amplicon product detection

[0049] To detect the PCR amplicons from the ePAT, TVN-PAT and LM-PAT PGR reactions, 50% of a 20 μΐ PGR reaction was loaded per lane of a 2% high resolution agarose gel (Ultra pure 1000; Life Technologies) pre-stained with sybr safe (Life Technologies). The primers used in this example were of the following sequences: ePAT assay GCGAGCTCCGCGGCCGCGTTnTTTT'ITTT (SEQ ID NO:3)

PAT-TVN GCGAGCTCCGCGGCCGCGI TTTTTTTTTTVN (SEQ ID NO:4)

S.c GallO PAT CGGGTCCAAGATTGTCTAC (SEQ ID NO:5)

S.c Gal 1 -PAT CAGCATTGGGCAGCTGT (SEQ ID NO:6)

S.c Apql -PAT GAAACGCCTCTGCTTACTCGG (SEQ ID NO:7)

S.c HXK1 -PAT GTCTCTTGGTATCATTGGCG (SEQ ID NO:8)

S.c GCV1 -PAT GCCTCTTGTGCCCACACATTAC (SEQ ID NO:9)

C.e gpd-4 PAT CCCGTGGATAATTCTATCAGG (SEQ ID NO: 10)

C .e oma-2 PAT CGTATCCTCTCCCC AC ACT AAC (SEQ ID NO : 1 1 )

C.e egg-1 PAT CTCCAAGTTGACCCTGAACTATTC (SEQ ID NO: 12)

C.e pup-2 PAT CAAGTCCCTCCTCACTAATTCC (SEQ ID NO: 13)

C.e eft-3 PAT CAACTCTTTACTTTTTAATGGGTTATG (SEQ ID NO: 14)

C.e gpd-2 PAT GCTGTCTCATCCTACTTTCACC (SEQ ID NO: 15)

[0050] To quantify the PGR amplicon product mass, and to estimate the deadenylation kinetics from the gels, the band intensity and migration was determined relative to a 100 bp ladder (New England Biolabs Inc., Ipswich, MA, United States of America) using an LAS 3000 imager and multigauge software (Fujifilm Holdings Corp, Tokyo, Japan). For deadenylation kinetics, the migration of the highest peak intensity of each band was determined for each lane and expressed relative to the migration of the TVN-PAT peak. The length of poly(A) at time zero was then normalised to 100% and the peak of subsequent time-points expressed relative to this. By this approach, highly linear deadenylation curves (ie R: of 0.9997 and 0.9682 for GAL I -(long) and GAL1 -(short) respectively) were possible from ePAT samples but not from LM-PAT samples (cf R2 of 0.1751 and 0.4049 for GAL I -(long) and GviL/-(short) respectively). Graphs and statistical analyses were prepared using Prism software. Efficiency calculations estimating the number of cDNA input molecules were based on a calculated mass of 1 10 ng and an amplicon length of 120 bp at an estimated efficiency of 98% as user inputs for oma-2.

[0051 ] Results and Discussion

A simple method for 3' tagging of polyadenylated RNA

[0052] The ePAT approach is a simple two-step (one-tube) method that relies on the intrinsic property of the Klenow polymerase to extend RNA molecules with DNA bases from an annealed DNA template in standard reverse transcription buffers (Figure 1 A). Increasing the temperature to 55°C prior to the addition of reverse transcriptase ensures that only the DNA oligos annealed to an extended 3' terminus have a melt-temperature sufficiently high to prime reverse transcription, thereby eliminating priming from internal poly(A)-tracts. Subsequent amplification using a gene-specific forward primer and a universal reverse primer results in PCR amplicons that reflect the length distribution of the poly(A)-tail on endogenous mRNA.

[0053] The efficacy of ePAT was demonstrated by direct comparison to the standard LM-PAT method that relies on serial ligation of poly(dT)i2_i 8 and an anchor primer to generate cDNA encompassing the full poly(A)-tail [16]. The polyadenylation-state of specific transcripts was monitored in response to a transcriptional pulse chase regimen in S. cerevisiae involving activation of gene expression by galactose followed by repression by the addition of glucose [3,5]. Yeast cells were harvested 10 minutes after galactose induction and at indicated time-points in the pulse period after glucose repression (Figure 2A). It was found that at the point of transcriptional shut-down (glucose), the two 3' UTR isoforms of the GALI transcript have a long (-50 A) poly(A)-tail that is shortened over time (Figure 2B). The two assay methods are equally efficient at generating cDNA that reflects the polyadenylation-state of the transcripts; that is, the amount and size of the product is similar. However, the ePAT method better reflects the distribution of poly(A)-tails in the sample, because the LM-PAT method depends upon serial annealing of fixed length oligo-(dT) oligonucleotides, the consequence of which is that only limited resolution can be achieved (see also [26]).

[0054] The kinetics of deadenylation of both GALI isoforms after transcriptional repression by densitometry and peak-finding was monitored and is shown at Figure 2C. Linear deadenylation rates for both the GALI transcript isoforms can be calculated from ePAT data. Such decay curves were previously only possible by high resolution Northern blotting [3]. Thus, in comparison to LM-PAT, ePAT allows a more accurate measure of the poly(A)-tail length distribution and more detailed estimation of the deadenylation kinetics. Note: the GALI transcript has previously been shown to undergo an additional non-standard post-transcriptional cleavage and adenylation step to generate the GAL I -(short) transcript -10 minutes after glucose repression [27]. However, the similar initial length and decay kinetics of the poly( A)-tail at the start of the chase period here, suggests that both forms are generated by the canonical transcript cleavage and adenylation machinery; any additional cleavage products would remain invisible to the assay method until they become adcnylated.

Alternate poly(A) site usage is revealed by ePAT

[0055] Recent evidence has shown that the use of alternate poly(A)-sites is wide-spread and dynamic in eukaryotic transcriptomes [28-33]. Often, the use of shorter .3 'UTRs provides a mechanism to remove the influence of post-transcriptional regulatory modules within 3' UTRs such as microRNA and regulatory protein binding sites [23]. Since cDNA priming for ePAT requires extension of the 3' end of the RNA molecule, internal poly( Attracts are avoided. Thus, in contrast to other oligo-(dT) based priming methods, the ePAT approach allows identification of bona fide alternate poly(A)-sites. For example, HXK1 is one of a number of genes (including GAL1) that changes its sub-nuclear position in response to activation by galactose in a 3' UTR-dependent manner, suggestive of a role for 3' processing in gene activation and/or repression [27, 34, 35].

[0056] In this example, it has been shown by transcriptional pulse chase (see Figure 3 A) that while HA¾7-(long) transcript steadily decays after glucose addition, the abundance of HXKl -(short) transiently increases (Figure 3B) similarly to previously observed G4Z/-(short) accumulation [27]. Sequencing of the two HXKl PCR amplicons allowed precise mapping of the alternate poly(A)-sites to sites 65 bases and 175 bases after the stop-codon for the short and long UTRs respectively. This highlights that a switch to the shorter UTR removes two of three canonical UGUA pumilio consensus sites previously identified as candidate Pufl sites in the 3' UTR of HXKl [36].

3'-tagging by ePAT is efficient

[0057] An alternative method to the measure of poly(A)-tail length has been the use of T4-ligase to append pre-adenylated linkers to the 3' end of mRNA using methods analogous to those applied to the cloning of microRNA [20, 37] and/or circularisation of mRNA [19, 38]. These approaches are conceptually appealing in that they do not require knowledge of the bases that terminate the RNA of interest, and can thus be used to identify 3' uridylation and other heteropolymeric 3' extensions on RNA. However, their disadvantage is that they are inefficient, often requiring high PCR cycle numbers (commonly 40 cycles) to detect a product.

[0058] To assess the performance of the ePAT method in applications where a T4-RNA ligation- based assay had been previously applied, the present applicant replicated the results of Kim et al.

[37], who elegantly demonstrated the dependence of several transcripts on the cytoplasmic deadenylase Gld-2 in the C. elegans germline. By using 10-fold less RNA input, 2-fold less cDNA and 12 fewer cycles of PCR amplification (28 versus 40), the ePAT method replicates and extends the Kim et al. data (Figure 4). The polyadenylation-state of egg-l, pup-2 and oma-2 were re-confirmed to depend on gld-2 as does the germline specific GAPDH (gpd-4). The adenylation state of somatic GAPDH (gpd-2) and eft-3 (data not shown) were not significantly altered in steady-state poly(A)-tail length.

[0059] To infer the efficiency of the ePAT method, a PCR calculator was designed that uses the PCR cycle number, an estimated PCR efficiency, the amplicon length and mass, in combination with the molecular weight of a DNA base-pair to estimate the number of cDNA input molecules that contribute to the final PCR product. For example, at least 5000 templating egg- J cDNA molecules in the PCR reaction mix are required to generate the 1 10 ng of the 120 bp PCR amplicon as measured by densitometry (Figure 4; N2). However, had 40 cycles of amplification been required to generate this amount of product, the number of contributing cDNA molecules would reduce to approximately two. Thus, with every additional PCR cycle necessary to produce detectable product, there is an increased risk of biased sampling. A striking difference between the results reported here, and those of Kim et al. [37], is that by the ePAT method, a tail-length distribution of between about 12-100 adenosine residues was observed for most transcripts in wild-type (N2) worms. By the ligation approach, and 40 cycles of amplification, Kim et al. reported a uniform tail-length of -40 bases for oma-2. The length is significantly reduced in gld-2 mutant worms as measured by both studies. Thus, it has been shown here that the ePAT method provides similar and, possibly, more detailed information on poly(A)- status than do T4-ligase based approaches, and at significantly higher efficiency.

[0060] Conclusion

[0061] The present invention provides a simple method to tag polyadenylated RNA within a population that is useful for, for example, the measure of poly(A)-tail length of mRNA and in the identification of alternate 3' UTRs. The method has been successfully applied to very low input material, and also to the detection of adenylated non-coding RNA (data not shown). To the best of the present applicant's knowledge, the method represents the closest approach yet to match the sensitivity observed by high resolution Northern blotting, but avoids radioisotope-labelled probes, and may be performed in only a fraction of the time, and with considerably less input material, and still generates enough cDNA for analysis of over 20 specific transcripts from a single ePAT reaction. Moreover, the method may be performed with standard molecular biology reagents and apparatus.

[0062] Example 2

[0063] The development of methodologies to sequence cDNA that has been reverse transcribed from RNA (ie "RNA-Seq") has provided a powerful tool for transcriptome analysis. In particular, this has facilitated a "whole-transcriptome" approach involving the generation, from RNA that has undergone either poly(A) selection and/or ribosome depletion, of libraries encompassing the full-length of RNA by overlapping fragments. The data returned are millions of individually sequenced fragments called trans-frags or simply "reads" that are bioinformatically mapped to a genomic position. However, while the whole-transcriptome approach is conceptually appealing, early users analysing such data were confronted with a problem. That is, their RNA-Seq data did not match previously well- supported expression data and led to the identification of the "length bias"; the longer a transcript, the more likely it was of being significantly regulated [39]. This comes about because the present cost of sequencing is proportional to sequence depth, and very few libraries have been sequenced deeply enough to reach saturation. This bias can now be normalised bioinformatically [40], and some software packages also take it into consideration, but presently this is far from straight-forward. For gene expression studies, multiple fragments of abundant transcripts take valuable "reads" away from perhaps more interesting rare transcripts. What's more, for many applications, full coverage of the transcript is simply not necessary; it is often enough to know the difference in transcript abundance in condition "A" versus condition "B". That is, by digital gene expression.

Digital Gene Expression: Counting of mRNA

[0064] The first versions of digital gene expression were based on short, randomly selected and concatemerised cDNA fragments analysed by Sanger sequencing. This approach was quickly adapted to massively parallel sequencing and variously termed SAGE-Seq, TAG-Seq and EDGE-Seq; each of which are variations on a theme, where a single ~25bp fragment is generated from each cDNA by addition of a long-range restriction endonuclease site near the poly(A)-tail. Recent work in this area has elegantly shown that mRNA expression can be accurately quantified by this counting approach [41 -43]. Importantly, because each mRNA is counted only once, the library complexity is much reduced and sequencing is normally saturated by ~ 5 million reads (~10 fold fewer than generally suggested for whole transcriptome sequencing). Some conceptual problems with the approach are that short reads are more likely than longer ones of being ambiguously assigned to multiple genomic sites, and that the approach depends on transcripts having a specific 4-base restriction site near the 3' end and in a region of suitably high complexity to allow mapping. The protocol is also generally considered as being labour intensive with cumulative error. ePAT approach for digital gene expression

[0065] An ePAT method of the present invention may be applied to the digital gene-expression tool, but unlike the SAGE approaches described above, the length of the reads is dictated by the next generation sequencing (NGS) platform used (eg 75 bases with SOLiD™). This involves the utilisation of a limited digestion step using RNase Tl which cuts RNA after G residues and can thus leave both the poly(A)-tail and any 3* DNA tag sequence intact. Limiting the time and temperature of the digestion reaction controls the RNA fragment length. The remaining steps are similar or analogous to other library preparation methodologies; for example, 5' splinted linkers may be subsequently ligated and the RNA reverse transcribed using a primer complementary to the tag sequence. Importantly, cDNA synthesis proceeds only from the 3'-most fragment ensuring that each transcript is "read" just once. This removes the need for data transformation to account for the "length bias". The library may then be amplified and subject to NGS. The present applicant has generated several examples of such libraries, and the data from one set is described in detail below (Note: SOLiD™ sequencing reads have a 3' UTR→ poly(A)-tail orientation). Further, to harness the possibility for APA detection in the ePAT method, a size selection step can be included in the protocol (Figure 5). In practice, this means that sequenced reads align to the genome within a window of -100-150 bases of the poly(A)-site, and reads that include un-templated A-tracts define the site of polyadenylation. The application of the ePAT method to such a deep-sequencing approach, can provide a highly quantitative result. That is, as shown in Figure 5 , if two of three transcripts have a long 3' UTR, this would be reflected by a result wherein the number of reads align to each site.

[0066] Results and Discussion

[0067] Several libraries prepared using the ePAT method were sequenced. Figure 6 below shows a vignette of one experiment that illustrates the sensitivity of the approach. Briefly, four libraries were prepared from total RNA isolated from yeast cultured with a sequential change in carbon source, from unfavourable (glycerol) => to improved (galactose) => to preferred (glucose)(see Figure 6A). The 3'- Seq libraries were multiplexed 4-ways and sequenced on one single lane of a SOLiD™-5500 sequencer. A portion of reads in the raw sequencing data included non-templated poly(A)-tails that have the potential to introduce noise into the mapping pipeline. To avoid this, a short Python script was written to trim these and split reads into those with and without poly-(A) tails. The reads with the poly(A)-tails allowed for the precise mapping of the poly(A)-site.

[0068] Approximately 5 million reads per library mapped uniquely in the yeast genome. All reads with multiple genomic sites of "best fit" were removed from the analysis. The unique mapping, un- normalised reads were directly visualised using the publically available Integrated Genomics Viewer (IGV) browser (Broad Institute, Cambridge, MA, United States of America). The ability to visualise un-normalised data allows the user to "see" (i) the enormous dynamic range of gene expression, (ii) the presence of alternate 3' ends, and (iii) the reproducibly of the approach (the expression of many genes is unchanged by these carbon source changes: see Figure 6B).

[0069] The data to date has been drawn from a first and, likely, imperfect round of mapping.

However, it is nevertheless clear that the data are in excellent accord with both biological and deep- sequencing expectations. For example, there was an overall shift in gene expression from

"respiratory" to "fermentative" as the cells shifted carbon metabolism from glycerol to glucose, since most genes with mitochondrial functions were observed to decrease over the time course, whereas the transcripts for most of the ribosomal biogenesis genes increased. Further, it was seen that the most abundant transcripts were enriched for functions in protein translation (p-value 10"'4). Moreover, from the deep-sequencing perspective, 50% of the reads mapped to the top 200 expressed transcripts consistent with previous predictions that the majority of the measurement power in RNA-seq is spent on a minority of the transcriptome. It has also been possible to show that condition-dependent APA can be detected in 3'-Seq data. In particular, condition-dependent APA was identified and validated in the candidate gene, IES5. The IES5 transcript has a sort (proximal) poly(A)-site in glycerol but shifts to the use of a long (distal) 3' UTR in glucose (Figure 7). Interestingly, by extension of the UTR to the distal polyadenylation site, a consensus-binding site for the RNA binding protein, Puf2p is included in the 3' UTR. PUF proteins are known regulators of translation. This is reflected in some preliminary data using affinity purification of translating ribosomes, where the shorter UTR isoform is better associated with ribosomes than the longer form (data not shown).

[0070] Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0071 ] All publications mentioned in this specification are herein incorporated by reference. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia or elsewhere before the priority date of each claim of this application.

[0072] It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. REFERENCES

1. Proudfoot NJ, Furger A, Dye MJ (2002) Integrating mRNA processing with transcription.

Cell 108: 501 -512.

2. Sachs AB, Varani G (2000) Eukaryotic translation initiation: there are (at least) two sides to every story. Nat Struct Biol 7: 356-361.

3. Decker CJ, Parker R (1993) A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev 7: 1632-1643.

4. Brown CE, Sachs AB (1998) Poly(A) tail length control in Saccharomyces cerevisiae occurs by message-specific deadenylation. Mot Cell Biol 18: 6548-6559.

5. Beilharz TH, Preiss T (2007) Widespread use of poly(A) tail length control to accentuate expression of the yeast transcriptome. RNA 13: 982-997.

6. Fabian MR, Mathonnet G, Sundermeier T, Mathys H, Zipprich JT, et al. (2009) Mammalian miRNA RISC recruits CAF1 and PABP to affect PABP -dependent deadenylation. Mol Cell 35: 868-880.

7. Eulalio A, Huntzinger E, Nishihara T, Rehwinkel J, Fauser M, et al. (2009) Deadenylation is a widespread effect of miRNA regulation. RNA 15: 21 -32.

8. Beilharz TH, Humphreys DT, Clancy JL, Thermann R, Martin DI, et al. (2009) microRNA- mediated messenger RNA deadenylation contributes to translational repression in mammalian cetts. PLoS One 4: e6783.

9. Goldstrohm AC, Wickens M (2008) Multifunctional deadenylase complexes diversify mRNA control. Nat Rev Mol Cell Biol 9: 337-344.

10. Radford HE, Meijer HA, de Moor CH (2008) Translational control by cytoplasmic

polyadenylation in Xenopus oocytes. Biochim Biophys Acta 1779: 217-229.

1 1. Rouget C, Papin C, Boureux A, Meunier AC, Franco B, et al. (2010) Maternal mRNA

deadenylation and decay by the piRNA pathway in the early Drosophila embryo. Nature 467: 1128-1 132.

12. Slomovic S, Fremder E, Staals RH. Pruijn GJ, Schuster G (2010) Addition of poly(A) and poly(A)-rich tails during RNA degradation in the cytoplasm of human cells. Proc Natl Acad Sci USA 107: 7407-7412.

13. Eckmann CR, Rammelt C, Wahle E (2011) Control of poly(A) tail length. Wiley Interdiscip Rev RNA 2: 348-361.

14. Lackner DH, Beilharz TH, Marguerat S, Mata J, Watt S, et al. (2007) A network of multiple regulatory layers shapes gene expression in fission yeast. Mol Cell 26: 145-155.

15. Sippel AE, Stavrianopoulos JG, Schutz G, Feigelson P (1974) Translational properties of rabbit globin mRNA after specific removal of poly(A) with ribonuclease H. Proc Natl Acad Sci USA 71 : 4635-4639. Salles FJ, Strickland S (1995) Rapid and sensitive analysis of mRNA polyadenylation states by PCR. PCR Methods Appl 4: 317-321 .

Traven A, Beilharz TH, Lo TL, Lueder F, Preiss T, et al. (2009) The Ccr4-Pop2-NOT mRNA deadenylase contributes to septin organization in Saccharomyces cerevisiae. Genetics 182: 955-966.

Dag!ey MJ, Gentle IE, Beilharz TH, Pettolino FA, Djordjevic JT, et al. (201. 1 ) Cell wall integrity is linked to mitochondria and phospholipid homeostasis in Candida albicans through the activity of the post-transcriptional regulator Ccr4-Pop2. Mol Microbiol 79: 968-989. Couttet P, Fromont-Racine M, Steel D, Pictet R, Grange T ( 1997) Messenger RNA deadenylylation precedes decapping in mammalian cells. Proc Natl Acad Set USA 94: 5628- 5633.

Charlesworth A, Cox LL, MacNicol AM (2004) Cytoplasmic polyadenylation element (CPE)- and CPE-binding protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes. J Biol Chem 279: 17650-17659. Okazaki T, Okazaki R (1969) Mechanism of DNA chain growth. IV. Direction of synthesis of T4 short DNA chains as revealed by exonucleolytic degradation. Proc Natl Acad Sci USA 64: 1242-1248.

Huang Z, Szostak JW (1 96) A simple method for 3'-labeling of RNA. Nucleic Acids Res 24: 4360-4361,

Sandberg R, Neilson JR, Sarma A, Sharp PA, Burge CB (2008) Proliferating cells express mRNAs with shortened 3' untranslated regions and fewer microRNA target sites. Science 320: 1643-1647.

Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77: 71 -94.

Kohrer , Domdey H ( 1991 ) Preparation of high molecular weight RNA. Methods Enzymol 194: 398-405.

Beilharz TH, Preiss T (2009) Transcriptome-wide measurement of mRNA polyadenylation state. Methods 48: 294-300.

Vodala S, Abruzzi KC, Rosbash M (2008) The nuclear exosome and adenylation regulate posttranscriptional tethering of yeast GAL genes to the nuclear periphery. Mol Cell 31 : 104- 1 13.

Mangone M, Manoharan AP, Thierry-Mieg D, Thierry-Mieg J, Han T, et al. (2010) The landscape of C. elegans 3'UTRs. Science 329: 432-435.

Ozsolak F, Kapranov P, Foissac S, Kim SW, Fishilevich E, et al. (2010) Comprehensive polyadenylation site maps in yeast and human reveal pervasive alternative polyadenylation'. Cell 143: 1018-1029.

Yoon OK, Brem RB (2010) Noncanonical transcript forms in yeast and their regulation during environmental stress. RNA 16: 1256-1267. Jan CH, Friedman RC, Ruby JG, Bartel DP (201 1 ) Formation, regulation and evolution of Caenorhabditis elegans 3UTRs. Nature 469: 97-101.

Shepard PJ, Choi EA, Lu J, Flanagan LA, Hertel KJ, et al. (2011) Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq. RNA 17: 761-772.

Wu X, Liu , Downie B, Liang C, Ji G, et al (201 1) Genome-wide landscape of polyadenylation in Arabidopsis provides evidence for extensive alternative polyadenylation. Proc Natl Acad Sci USA 108: 12533-12538.

Taddei A, Van Houwe G, Hediger F, Kalck V, Cubizolles F, et al. (2006) Nuclear pore association confers optimal expression levels for an inducible yeast gene. Nature 441 : 774- 778.

Abruzzi KC, Belostotsky DA, Chekanova JA, Dower K, Rosbash M (2006) 3'-end formation signals modulate the association of genes with the nuclear periphery as well as mRNP dot formation. EMBO J '25: 4253-4262.

Ulbricht RJ, Olivas WM (2008) Puflp acts in combination with other yeast Puf proteins to control mRNA stability. RNA 14: 246-262.

Kim KW, Nykamp K, Suh N, Bachorik JL, Wang L, et al. (2009) Antagonism between GLD- 2 bindin partners controls gamete sex. Dev Cell 16: 723-733.

Rissland OS, Norbury CJ (2009) Decapping is preceded by 3' uridylation in a novel pathway of bulk mRNA turnover. Nat Struct Mo I Biol 16:616-623.

Oshlack A, Wakefield MJ (2009) Transcript length bias in RNA-Seq data confounds systems bilogy. Biol Direct 4: 14.

Young MD, Wakefield MJ, Smyht GK, Oshlack A (2010) Gene ontology analysis for RNA- Seq: accounting for selection bias. Genome Biol 1 1:R14.

Hong LZ, Li J, Schmidt-Kuntzel A, Warren WC. Barsh GS (201 1) Digital gene expression for non-model organisms. Genome Res 21 : 1905-1915.

Wu ZJ, Meyer CA, Choudhury S, Shipitsin M, Maruyama R, et al. (2010) Gene expression profiling of human breast tissue samples using SAGE-Seq. Genome Res 20: 1730-1739. Ruzanov P, Riddle DL (2010) Deep SAGE analysis of the Caenorhabditis elegans transcriptome. Nucleic Acids Res 38:3252-3262.

Claims

1. A method of detecting or analysing a ribonucleic acid (RNA) molecule in a sample, wherein said RNA molecule comprises a 3' poly(A)-tail, said method comprising the steps of:
(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule;
(ii) producing a polynucleotide product molecule comprising said tag sequence by
(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and
(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail,
wherein (a) and (b) may be conducted in either order; and
(iii) detecting or analysing said polynucleotide product molecule by said tag sequence.
2. The method of claim I, wherein the RNA molecule is messenger RNA (inRNA).
3. The method of claim 1 or 2, wherein the sample comprises total RNA.
4. The method of any one of claims 1 to 3, wherein the hybridising sequence is an oligo-(T) sequence.
5. The method of any one of claims 1 to 4, wherein the step of extending the RNA molecule from said 3' poly(A)-tail to generate the tag sequence is conducted using Klenow fragment.
6. The method of any one of claims 1 to 5, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted using reverse transcriptase.
7. The method of claim 6, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted at a temperature of 53° to 57°C.
8. The method of claim 6, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted at a temperature of about 55°C.
9. The method of any one of claims 1 to 8, wherein in step (iii) the polynucleotide product molecule is detected or analysed by amplifying the sequence of the polynucleotide product molecule including the tag sequence, and thereafter detecting/analysing amplicon product.
10. The method of claim 9, wherein the amplification is performed using first and second
oligonucleotide primers, and wherein said first (forward) oligonucleotide primer comprises a sequence targeted to a specific RNA molecule and said second (reverse) oligonucleotide primer comprises a sequence that is targeted to said 5' sequence of the oligonucleotide template.
11. The method of claim 9 or 10, wherein the amplicon product is subjected to sequencing.
12. A method of tagging a ribonucleic acid (RNA) molecule in a sample with a 3' tag sequence, wherein said RNA molecule comprises a 3' poly(A)-tail, said method comprising the steps of:
(i) annealing to said RNA molecule an oligonucleotide template comprising 5' and 3' linked sequences, said 5' sequence coding for a tag sequence and said 3' sequence comprising a hybridising sequence that hybridises to the 3' poly(A)-tail of the RNA molecule;
(ii) producing a polynucleotide product molecule comprising said tag sequence by
(a) extending the RNA molecule from said 3' poly(A)-tail to generate said tag sequence, and
(b) extending the oligonucleotide template from a 3' end of the hybridising sequence to generate complementary sequence to said RNA molecule under conditions preventing extension of any oligonucleotide template hybridised to a poly(A) sequence of said RNA molecule other than the 3' poly(A)-tail,
wherein (a) and (b) may be conducted in either order; and optionally
(iii) amplifying or otherwise increasing the copy number of said polynucleotide product molecule comprising said 3' tag sequence.
13. The method of claim 12, wherein the RNA molecule is messenger RNA (inR A) .
14. The method of claim 12 or 13, wherein the sample comprises total RNA.
15. The method of any one of claims 12 to 14, wherein the hybridising sequence is an oligo-(T) sequence.
16. The method of any one of claims 12 to 15, wherein the step of extending the RNA molecule from said 3' poly(A)-tail to generate the 3' tag sequence is conducted using Klenow fragment.
17. The method of any one of claims 12 to 16, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted using reverse transcriptase.
18. The method of claim 17, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted at a temperature of 53° to 57°C.
19. The method of claim 17, wherein the step of extending the oligonucleotide template from a 3' end of the hybridising sequence is conducted at a temperature of about 55°C.
20. A kit comprising one or more enzymes and/or reagents together with instructions for use in the method of any one of claims 1 to 19.
PCT/AU2013/000161 2012-02-22 2013-02-21 Rna tagging method WO2013123559A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2012900663 2012-02-22
AU2012900663A AU2012900663A0 (en) 2012-02-22 RNA tagging method

Publications (1)

Publication Number Publication Date
WO2013123559A1 true WO2013123559A1 (en) 2013-08-29

Family

ID=49004857

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/000161 WO2013123559A1 (en) 2012-02-22 2013-02-21 Rna tagging method

Country Status (1)

Country Link
WO (1) WO2013123559A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9943612B2 (en) 2014-10-09 2018-04-17 Seattle Children's Hospital Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6291170B1 (en) * 1989-09-22 2001-09-18 Board Of Trustees Of Leland Stanford University Multi-genes expression profile
US20040058373A1 (en) * 2001-01-31 2004-03-25 Winkler Matthew M. Competitive amplification of fractionated targets from multiple nucleic acid samples
US6852494B2 (en) * 2003-01-10 2005-02-08 Linden Technologies, Inc. Nucleic acid amplification

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6291170B1 (en) * 1989-09-22 2001-09-18 Board Of Trustees Of Leland Stanford University Multi-genes expression profile
US20040058373A1 (en) * 2001-01-31 2004-03-25 Winkler Matthew M. Competitive amplification of fractionated targets from multiple nucleic acid samples
US6852494B2 (en) * 2003-01-10 2005-02-08 Linden Technologies, Inc. Nucleic acid amplification

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FAN ET AL.: 'A versatile assay for high-throughput gene expression profiling on universal array matrices' GENOME RESEARCH vol. 14, no. 5, 31 May 2004, pages 878 - 885, XP002384242 *
REINARTZ ET AL.: 'Massively parallel signature sequencing (MPSS) as a tool for in-depth quantitative gene expression profiling in all organisms' BRIEFINGS IN FUNCTIONAL GENOMICS AND PROTEOMICS vol. 1, no. 1, 01 February 2002, pages 95 - 104, XP008148437 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9943612B2 (en) 2014-10-09 2018-04-17 Seattle Children's Hospital Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid

Similar Documents

Publication Publication Date Title
Saletore et al. The birth of the Epitranscriptome: deciphering the function of RNA modifications
Derti et al. A quantitative atlas of polyadenylation in five mammals
Morozova et al. Applications of next-generation sequencing technologies in functional genomics
Ke et al. A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation
Takahashi et al. 5′ end–centered expression profiling using cap-analysis gene expression and next-generation sequencing
Gu et al. Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling
Lu et al. Construction of small RNA cDNA libraries for deep sequencing
Newman et al. Deep sequencing of microRNA precursors reveals extensive 3′ end modification
US8039214B2 (en) Synthesis of tagged nucleic acids
Voellenkle et al. Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
Dalmay Mechanism of miRNA-mediated repression of mRNA translation
Ingolia Genome-wide translational profiling by ribosome footprinting
AU2014268710B2 (en) Transposition into native chromatin for personal epigenomics
Ntini et al. Polyadenylation site–induced decay of upstream transcripts enforces promoter directionality
Lim et al. Uridylation by TUT4 and TUT7 marks mRNA for degradation
Lahens et al. IVT-seq reveals extreme bias in RNA sequencing
Pan N6-methyl-adenosine modification in messenger and long non-coding RNA
Vijayan et al. A high resolution map of a cyanobacterial transcriptome
US20120003657A1 (en) Targeted sequencing library preparation by genomic dna circularization
Adey et al. Ultra-low-input, tagmentation-based whole-genome bisulfite sequencing
CN104946737B (en) For detecting the composition and method of rare sequence variants
Arribere et al. Roles for transcript leaders in translation and mRNA decay revealed by transcript leader sequencing
CN102268428A (en) The method of encoding one strand of a double stranded promoter primer
Chang et al. TAIL-seq: genome-wide determination of poly (A) tail length and 3′ end modifications
Munafó et al. Optimization of enzymatic reaction conditions for generating representative pools of cDNA from small RNA

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13751951

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct app. not ent. europ. phase

Ref document number: 13751951

Country of ref document: EP

Kind code of ref document: A1