WO2013122609A1

WO2013122609A1 - Methods of using cdk8 antagonists

Info

Publication number: WO2013122609A1
Application number: PCT/US2012/025729
Authority: WO
Inventors: Ron Firestein; Adam Schultz ADLER
Original assignee: Genentech, Inc.; F. Hoffmann-La Roche Ag
Priority date: 2012-02-17
Filing date: 2012-02-17
Publication date: 2013-08-22

Abstract

Provided herein are CDK8 antagonists and methods of using the same, including methods of inducing differentiation and treating cancer.

Description

METHODS OF USING CDK8 ANTAGONISTS

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] None.

FIELD

[0002] The present invention relates to methods of inducing differentiation, particularly differentiation of tumor cells, by inhibition of CDK8.

BACKGROUND

[0003] Recent studies have highlighted the ability of tumors to employ genetic programs normally found active in the embryonic state. Young, R. A., Cell 144, 940-954 (201 1); Takebe, N. et al, Nat Rev Clin Oncol 8, 97-106 (201 1); Ben-Porath, I. et al, Nat Genet 40, 499-507 (2008); Wong D.J. et al, Cell Stem Cell 2:333-344 (2008). In embryonic stem cells, pluripotency-related gene signatures are often re-expressed in multiple cancer types, and expression of these stem cell-related genes strongly correlate with poor clinical outcome. Ben-Porath, I. et al, Nat Genet 40, 499-507 (2008); Wong D.J. et al, Cell Stem Cell 2:333-344 (2008). Identifying new draggable targets that are critical to the stem cell-like properties of tumors offers a new avenue of therapeutic intervention. The MYC oncogene is a critical transcriptional regulator in many tumor types (Meyer N. & Penn L.Z. Nat Rev Cancer 8:976-90 (2008)) and has also been demonstrated to play an essential role in ES cell proliferation and pluripotency but has been an intractable therapeutic target. Young, R. A., Cell 144, 940-954 (201 1); Cartwright P. et al, Development 132:885-96 (2005).

[0004] CDK8 is a cyclin dependent kinase that has a conserved function in transcription as part of the Mediator complex. Taatjes, D. J., Trends Biochem Sci 35, 315-322 (2010); Conaway, R. C. and Conaway, J. W., Curr Opin Genet Dev il, 225-230 (201 1). More recently, CDK8 has been reported to as an oncogene in both colon cancer (Firestein R. et al, Nature 455:547-51 (2008); Morris E.J. et al, Nature 455:552-6 (2008); Starr T.K. et al, Science 323: 1747-50 (2009)) and melanoma (Kapoor A. et al, Nature 468: 1 105-9 (2010)). CDK8 is upregulated and amplified in a subset of human colon tumors. CDK8 transforms immortalized cells and is required for colon cancer proliferation in vitro. Firestein, R. et al, Nature 455, 547-551 (2008). CDK8 has also been found to be overexpressed and essential for proliferation in melanoma. Kapoor, A. et al, Nature 468, 1105- 1 109 (2010). CDK8 has been shown to regulate several signaling pathways that are key regulators of both ES pluripotency and cancer. CDK8 activates the Wnt pathway by promoting expression of β-Catenin target genes (Firestein, R. et al, Nature 455, 547-551 (2008)) or by inhibiting E2F1, a potent inhibitor of β-Catenin transcriptional activity. Morris, E. J. et al, Nature 455, 552-556 (2008). CDK8 promotes Notch target gene expression by phosphorylating the Notch intracellular domain, activating Notch enhancer complexes at target genes. Fryer C.J. et al, Mol Cell 16:509-20 (2004). Lastly, CDK8

phosphorylation of SMAD proteins leads to activation of TGF-β/ΒΜΡ target genes followed by degradation of the SMAD proteins to limit the target gene expression. Alarcon, C. et al, Cell 139, 757-769 (2009). Many of these studies, however, were conducted in vitro, in cell based assays that miss certain aspects of tumor growth in vivo.

[0005] There is a need to understand the functional and molecular consequences of CDK8 loss in both fully formed tumors and ES cells and better predict clinical outcome and differentiation status in colon cancer patients.

SUMMARY

[0006] The invention provides CDK8 antagonist and methods of using the same. Provided herein methods of screening for and/or identifying a CDK8 antagonist which promotes cell differentiation said method comprising: contacting a reference cell, wherein the reference cell is a stem cell and/or a cancer stem cell, with a CDK8 candidate antagonist, wherein the CDK8 candidate antagonist binds CDK8, and whereby differentiation of the reference cell into a differentiated cell identifies the CDK8 candidate antagonist as a CDK8 antagonist which promotes cell differentiation. In some embodiments, the reference cell is a cancer stem cell. In some embodiments, the differentiated cell is a goblet cell and/or enterocyte cell. In some embodiments, the CDK8 candidate antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide.

[0007] In anther aspect, provided herein are methods of inducing differentiation comprising contacting the cell with an effective amount of CDK8 antagonist. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a cancer stem cell.

[0008] Provided herein are methods of treating a cancer cell, wherein the cancer cell differentially expresses one or more biomarkers of a CDK8 gene signature (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), the method comprising providing an effective amount of a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0009] Further provided herein are methods of treating cancer in an individual comprising

administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is based upon the cancer comprising cancer stem cell-like properties. In some embodiments, the cancer stem celllike properties comprise differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0010] Further provided herein are methods of treating a disease or disorder in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0011] Provided herein are methods of treating a disease or disorder in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is continued based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8- induced biomarkers of the CDK8 gene signature.

[0012] Further provided herein are methods for treating a disease or disorder in an individual, the method comprising: determining that a sample obtained from the individual comprises differential expression levels of one or more biomarkers of a CDK8 gene signature (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), and administering an effective amount of a CDK8 antagonist to the individual, whereby the disease or disorder is treated. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0013] Provided herein are methods of treating disease or disorder in an individual, comprising: (a) selecting an individual having differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)); and (b) administering to the individual thus selected an effective amount of a CDK8 antagonist, whereby the disease or disorder is treated. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature. [0014] Also provided herein are methods of identifying an individual with a disease or disorder who is more or less likely to exhibit benefit from treatment with a therapy comprising a CDK8 antagonist, the method comprising: determining the expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is more likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is less likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0015] Provided herein are methods for predicting whether an individual with a disease or disorder is more or less likely to respond effectively to treatment with a therapy comprising a CDK8 antagonist, the method comprising assessing expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, whereby differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is more likely to respond effectively to treatment with the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is less likely to respond effectively to treatment with the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0016] Provided herein are methods of predicting the response or lack of response of an individual with a disease or disorder to a therapy comprising a CDK8 antagonist comprising measuring expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) is predictive of response of the individual to the therapy comprising the CDK8 antagonist and non-differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) is predictive of lack of response of the individual to the therapy comprising the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0017] Further provided herein are methods of determining whether an individual having a disease or disorder is more or less likely responding to therapy, wherein therapy comprises a CDK8 antagonist, based upon levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) identifies the individual as more likely responding to therapy comprising the CDK8 antagonist and non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g. , housekeeping gene)) identifies the individual as less likely responding to therapy comprising the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature.

[0018] In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of the CDK8 cancer cell gene signature. In some embodiments, the one or more biomarkers of the CDK8 cancer cell gene signature comprises one or more genes listed in Table 2. In some embodiments, the one or more genes listed in Table 2 comprises one or more ES cell- related genes, MYC ES target genes, p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes.

[0019] In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of the CDK8 embryonic stem cell gene signature. In some embodiments, the one or more biomarkers of the CDK8 embryonic stem cell gene signature comprises one or more genes listed in Table 3.

[0020] In some embodiments of any of the methods, the disease or disorder is cancer.

[0021] In some embodiments of any of the methods, the CDK8 antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 antagonist is an antibody. In some embodiments, the CDK8 antagonist is a small molecule. In some embodiments, the small molecule is a small molecule kinase inhibitor. In some embodiments, the small molecule kinase inhibitor is selected from the group consisting of flavopiridol, ABT-869, AST-487, BMS- 387032/SNS032, BIRB-796, sorafenib, staurosporine, cortistatin, cortistatin A, and/or a steroidal alkaloid or derivative thereof. In some embodiments, the CDK8 antagonist induces cell cycle arrest or is capable of promoting differentiation. In some embodiments, wherein the CDK8 antagonist is capable of promoting a change in cell fate and promoting differentiation is indicated by reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-reduced biomarkers of the CDK8 gene signature.

BRIEF DESCRIPTION OF THE FIGURES

[0022] Figure 1 | CDK8 was required for tumor growth and maintenance of a de-differentiated state in vivo. A Xenograft tumor volume measurements over time (n = 10 mice per group). The tumor growth inhibition values were determined by an area under the curve calculation. Mean ± s.e.m. is shown *, P=0.00\ compared to all other groups, Student's ?-test. B Western blot of CDK8 protein levels in shCDK8 xenograft tumors at Day 8 (HT-29) or Day 12 (COLO 205) (top). Immunohistochemistry of CDK8 protein in HT-29 shCDK8 tumors from the end of the study (bottom). C Images of hematoxylin and eosin (H&E) stained tumors from the end of the study. HT-29 shCDK8 tumors were stained with alcian blue that stains secreted mucin.

Asterisks indicate the lumen of well-formed glands seen in COLO 205 shCDK8 tumors. D Quantitative RT- PCR and Western blot analysis of CDK8 three days after siRNA transfection in HT-29 human colon cancer cells. Mean ± s.d. is shown *, P = 10^"5, Student's i-test. E The top 1500 genes that change after CDK8 knockdown in HT-29 cells relative to siNTC ( O.001, Student's i-test between siNTC and siCDK8 -1/-2). GO, gene ontology.

[0023] Figure 2 | CDK8 maintained ES cells in an undifferentiated state. A, Images of alkaline phosphatase stained Rl mouse ES cells before and after induced differentiation. Positive staining (red) indicates undifferentiated stem cells. B, C, Quantitative RT-PCR and Western blot detection of NANOG (B) and CDK8 (C) at the indicated times after ES cell differentiation. CDK8 protein levels were quantified relative to ACTIN and normalized to Day 0. Mean ± s.d. is shown. *, P = 10^"5, Student's t-test. D, Alkaline phosphatase staining and phase contrast images of ES cells at the indicated times following shRNA infection. The staining in shNTC samples was representative of all subsequent time points. The requirement for CDK8 to maintain ES cells in an undifferentiated state was observed in at least three independent knockdown experiments. The number of alkaline phosphatase stained ES cell colonies observed per 24 mm² field is shown to the right. *, P = 0.001 compared to shNTC, Student's i-test. E, Western blot of shRNA infected ES cells at Day 13 after infection. F, Alkaline phosphatase staining and phase contrast images of ES cells at Day 1 1 after exogenous expression of CDK8 or empty vector in the presence of the indicated shRNA. G,

Quantitation of alkaline phosphatase stained ES cell colonies observed per 24 mm² field. Mean ± s.d. is shown. P = 10^"5 between shCdk8 + vector and shCdk8 + CDK8, Student's i-test. H, Western blot of CDK8- rescued ES cells at Day 1 1. Exogenously expressed human CDK8 protein was shifted slightly higher on the gel due to it being FLAG-tagged.

[0024] Figure 3 | CDK8 regulated MYC target gene and protein levels. A, Shown are the top 1500 genes that change after CDK8 knockdown in Rl ES cells at Day 8 relative to shNTC control (P = 0.003, Student's i-test between shNTC and two independent CDK8 shRNAs). The expression of these same genes at Day 13 is shown. B, Quantitative RT-PCR analysis of two representative ES cell genes (H2afx and Tell) at the indicated times after shCDK8 treatment. Mean ± s.d. is shown. *, P = 0.05, Student's i-test. C, Western blot of infected ES cells at the indicated time after shRNA infection. A schematic of common MYC

phosphorylation modifications is on the left. D, OCT4, NANOG, and MYC proteins levels were quantified relative to ACTIN, and then normalized to their respective shNTC for each time point. E, For each time point MYC-pS62 and MYC-pT58 protein levels were quantified relative to total MYC and then normalized to their respective shNTC.

[0025] Figure 4 | CDK8 partially regulated ES cell pluripotency through MYC. A Western blot of ES cells stably expressing MYC, MYC^T58A, MYC^S62A, or GFP in the presence of the indicated shRNA at Day 1 1. Total MYC protein was quantified relative to ACTIN and normalized to their respective shNTC. The anti- MYC antibody detects mouse and human MYC. B, Alkaline phosphatase staining and phase contrast images of ES cells at Day 1 1 after expression of MYC, MYC^T58A, MYC^S62A, or GFP control in the presence of the indicated shRNA. The number of alkaline phosphatase stained ES cell colonies observed per 24 mm² field is shown to the right of each group. The dashed gray line indicated the number of colonies observed in shNTC + GFP control cells. Mean ± s.d. is shown *, P = 0.005 compared to the respective GFP expression control, Student's i-test.

[0026] Figure 5 | Coordinated expression of CDK8 -regulated MYC targets in primary human colon cancer. A, Gene set enrichments in HT-29 CDK8-induced and CDK8-repressed genes. B, Quantitative RT-PCR of four MYC-driven ES cell target genes in HT-29 cells. Mean ± s.d. is shown. *, P = 0.01, Student's i-test. C, The log₂ mean centered expression of CDK8-induced MYC ES cell target genes (from Fig. 5A) was shown for 227 primary and metastatic human colon tumors (from Gene Logic). The tumors were sorted based on high to low average expression of the CDK8-induced MYC ES cell targets and split in two at the mean expression level. Bar graph depicted average ± s.e.m. log₂ expression of CDK8 in the two groups (P = 0.002, Student's t-test). D, Western blot analysis of normal colon, primary colon tumors, and metastatic colon tumors. CDK8 and MYC levels were quantified relative to ACTIN then normalized to their average in normal colon. Phospho-specific MYC (S62 and T58) levels were quantified relative to MYC, then the ratio was normalized to their average ratio in normal colon. -values for Pearson correlations are one -tailed ?-tests.

E, The average log₂ expression of the CDK8-induced MYC ES cell targets was sorted high to low for 213 primary human colon tumors with known tumor differentiation status (Smith JJ. et al. , Gastroenterology 138:958-68 (2010)). Hash marks indicated poorly differentiated tumors; the remaining tumors are either well or moderately differentiated. -values were calculated with a fisher exact test using a 2x2 contingency table.

F, The average log₂ expression of the CDK8-induced MYC ES cell targets for 50 primary human colon tumors that underwent recurrence (Jorissen R.N. et al. , Colorectal Cancer. Clin Cancer Res 15 :7642-51 (2009).); time to recurrence was indicated below each tumor. The average time to recur ± s.e.m. for each group is shown (P = 0.02, Student's ?-test).

[0027] Figure 6 | Gene expression analysis of ES cell-related genes in HT-29 siCDK8 cells. Quantitative RT-PCR of multiple ES cell-related genes three days after CDK8 siRNA transfection in HT-29 human colon cancer cells. Expression was normalized to siNTC treated cells. Mean +/- s.d. is shown. *, P = 0.01, Student's ?-test).

[0028] Figure 7 | CDK8 maintained multiple ES cell lines in an undifferentiated state. A, Western blot of the indicated shRNA infected ES cell lines at Day 7 after infection. B, Alkaline phosphatase staining and phase contrast images at Day 7. The number of alkaline phosphatase stained ES cell colonies observed per 24 mm² filed is shown below. *, P = 10^, Student's i-test).

[0029] Figure 8 | CDK8 and MED 12 regulated distinct gene expression programs in ES cells. A,

Quantitative RT-PCR of Medl2 levels at Day 13 after MED 12 shRNA infection in Rl ES cells. Mean +/- s.d. is shown. *, P = 10^"6, Student's ?-test). B, Alkaline phosphatase staining and phase contrast images of ES cells at Day 13 after MED 12 shRNA treatment. C, Shown are the top 1500 genes that changed after CDK8 knockdown at Day 8 in Rl ES cells relative to shNTC control. The expression of these same genes following MED 12 knockdown at Day 13 is shown. D, Shown are a set of genes found to be regulated by MED 12 in mouse ES cells (Kagey et al, Nature (2010)). Expression data of these genes from the previous study is sorted low to high. Next to this is expression of the same genes from this study in mouse ES cells and from mouse ES cells that have undergone forced differentiation through three different chemical methods or mouse ES cells that have differentiated following siNanog or siOct4 treatment (data from Gene Expression Omnibus accession GSE4189; Loh et al, Nature Genetics (2006)). The fold change scale for each data set relative to shNTC or siNTC controls is indicated on the right. E, The bar graph shows the Pearson correlations of the gene expression pattern for each indicated data set with the shMedl2 expression pattern from Kagey et al. -values of various Pearson correlations were calculated with one -tailed ?-tests.

[0030] Figure 9 | A, B, Loss of CDK8 leads to decreased MYC protein level but does not alter its subcellular localization. A, Immunofluorescence images of MYC and CDK8 in Rl ES cells at Day 8 after shRNA infection. Cell nuclei are indicated by Hoechst staining. B, Immunofluorescence images of MYC and phosphor-specific MYC proteins in ES cells at Day 13 after shRNA infection. C, Myc expression weakly changes upon CDK8 loss in ES cells. Quantitative RT-PCR analysis of Myc at Day 8 and Day 13 of shCdk8 treatment in Rl ES cells. Mean +/- s.d. is shown. *, P = 0.002, Student's i-test).

[0031] Figure 10 | Gene expression analysis of MYC ES cell targets in HT-29 siCDK8 cells. Quantitative RT-PCR of multiple MYC ES cell targets (previously identified through chromatin IP experiments in mouse ES cells; Kim et al, Cell (2008)) three days after CDK8 siRNA transfection in HT-29 human colon cancer cells. Expression is normalized to siNTC treated cells. Mean +/- s.d. is shown. *, P = 0.01, Student's i-test).

[0032] Figure 1 1 | MYC is co-expressed with the HT-29 CDK8-regulated gene signature in human colon cancer. A, Bar graph shows Pearson correlations of the indicated transcription factor and pathway genes with expression of the CDK8-regulated HT-29 signature (from Fig. IE) in human tumors («=230 total). Genes with a positive Pearson correlation indicate that the gene is co-expressed with the CDK8 signature. Dashed lines specify -value cut-offs for low and high correlations (P- values calculated with one -tailed i-test). B, Correlation of high MYC expression with increased expression of the HT-29 CDK8-regulated signature. Bar graph depicts log₂ mean centered MYC expression for individual human colon tumor samples. Tumors were sorted from high to low based on expression of the CDK8 signature (the dark bar on the left indicates CDK8- induced genes; the grey bar indicates CDK8-repressed genes). Higher MYC expression was seen in tumors that express the CDK8 -regulated signature, while low MYC expression is seen in tumors with the opposite pattern of the CDK8 signature (Pearson = 0.57, P = 10^"12, Student's i-test).

DETAILED DESCRIPTION

/. Definitions

[0033] The terms "CDK8" and "cyclin-dependent kinase 8" refer herein to a native CDK8 from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise indicated. The term encompasses "full-length," unprocessed CDK8 as well as any form of CDK8 that results from processing in the cell. The term also encompasses naturally occurring variants of CDK8, e.g., splice variants or allelic variants. The sequence of an exemplary human CDK8 nucleic acid sequence is NM 001260 (gi:4502744) or an exemplary human CDK8 is amino acid sequence of CDK8 NP 001251.1, UniProtKB/Swiss-Prot:P49336, P49336.2, and/or P49336.1.

[0034] "CDK8 variant" or variations thereof, means a CDK8 polypeptide or polynucleotide, generally being or encoding an active CDK8 polypeptide, as defined herein having at least about 80% amino acid sequence identity with any of the native sequence CDK8 polypeptide sequences as disclosed herein. Such CDK8 variants include, for instance, CDK8 wherein one or more nucleic acid or amino acid residues are added or deleted. Ordinarily, a CDK8 variant will have at least about 80% sequence identity, alternatively at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, to CDK8 as disclosed herein. Ordinarily, CDK8 variant are at least about 10 residues in length, alternatively at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600 in length, or more. Optionally, CDK8 variant will have or encode a sequence having no more than one conservative amino acid substitution as compared to CDK8, alternatively no more than 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitution as compared to CDK8.

[0035] The term "CDK8 antagonist" as defined herein is any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity mediated by a native sequence CDK8. In certain embodiments such antagonist binds to CDK8. According to one embodiment, the antagonist is a polypeptide. According to another embodiment, the antagonist is an anti-CDK8 antibody. According to another embodiment, the antagonist is a small molecule antagonist. According to another embodiment, the antagonist is a

polynucleotide antagonist.

[0036] "Polynucleotide," or "nucleic acid," as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and R A. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after synthesis, such as by conjugation with a label. Other types of modifications include, for example, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g. , nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the

polynucleotide(s). Further, any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid or semi-solid supports. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms. Other hydroxyls may also be derivatized to standard protecting groups. Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(0)S("thioate"), P(S)S ("dithioate"), "(0)NR₂ ("amidate"), P(0)R, P(0)OR, CO or CH₂ ("formacetal"), in which each R or R is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (-0-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.

[0037] "Oligonucleotide," as used herein, generally refers to short, single stranded, polynucleotides that are, but not necessarily, less than about 250 nucleotides in length. Oligonucleotides may be synthetic. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The description above for

polynucleotides is equally and fully applicable to oligonucleotides.

[0038] The term "primer" refers to a single stranded polynucleotide that is capable of hybridizing to a nucleic acid and following polymerization of a complementary nucleic acid, generally by providing a free 3'- OH group.

[0039] The term "small molecule" refers to any molecule with a molecular weight of about 2000 daltons or less, preferably of about 500 daltons or less.

[0040] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.

[0041] The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors." [0042] An "isolated" antibody is one which has been separated from a component of its natural environment. In some embodiments, an antibody is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC). For review of methods for assessment of antibody purity, see, e.g., Flatman et ah, J. Chromatogr. B 848:79-87 (2007).

[0043] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present

extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0044] The term "antibody" herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.

[0045] The terms "anti-CDK8 antibody" and "an antibody that binds to CDK8" refer to an antibody that is capable of binding CDK8 with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting CDK8. In one embodiment, the extent of binding of an anti-CDK8 antibody to an unrelated, non-CDK8 protein is less than about 10% of the binding of the antibody to CDK8 as measured, e.g., by a radioimmunoassay (RIA). In certain embodiments, an anti-CDK8 antibody binds to an epitope of CDK8 that is conserved among CDK8 from different species.

[0046] A "blocking" antibody or an "antagonist" antibody is one which inhibits or reduces biological activity of the antigen it binds. Preferred blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen.

[0047] "Affinity" refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity" refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Specific illustrative and exemplary embodiments for measuring binding affinity are described in the following.

[0048] An "affinity matured" antibody refers to an antibody with one or more alterations in one or more hypervariable regions (HVRs), compared to a parent antibody which does not possess such alterations, such alterations resulting in an improvement in the affinity of the antibody for antigen.

[0049] An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')₂; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0050] An "antibody that binds to the same epitope" as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more. An exemplary competition assay is provided herein.

[0051] The term "chimeric" antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.

[0052] The "class" of an antibody refers to the type of constant domain or constant region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGi, IgG₂, IgG₃, IgG/_t, IgAi, and IgA₂. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[0053] The terms "full length antibody," "intact antibody," and "whole antibody" are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.

[0054] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.

[0055] A "human antibody" is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.

[0056] A "humanized" antibody refers to a chimeric antibody comprising amino acid residues from non- human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non- human antibody, and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.

[0057] An "immunoconjugate" is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent.

[0058] "Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S.

Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, California, or may be compiled from the source code. The ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0059] In situations where ALIGN-2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:

100 times the fraction X/Y where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

[0060] The term "detection" includes any means of detecting, including direct and indirect detection.

[0061] The terms "cancer stem cell-like properties" and "cancer stem cell" as used herein refers to a population of cells from a tumor that: (1) have extensive proliferative capacity; (2) are capable of asymmetric cell division to generate one or more kinds of differentiated progeny with reduced proliferative or developmental potential; (3) are capable of symmetric cell divisions for self-renewal or self-maintenance; and/or, (4) are capable of forming palpable tumors upon serial transplantation in a xenograft model. In some embodiments, the properties of enhanced proliferative capacity and asymmetric and symmetric cell division of "cancer stem cells" confer on those cancer stem cells the ability to form palpable tumors upon serial transplantation into an immuno-compromised mouse compared to the majority of tumor cells that fail to generate tumors.

[0062] The term "biomarker" as used herein refers to an indicator, e.g., predictive, diagnostic, and/or prognostic, which can be detected in a sample. The biomarker may serve as an indicator of a particular subtype of a disease or disorder (e.g., cancer) characterized by certain, molecular, pathological, histological, and/or clinical features. In some embodiments, a biomarker is a gene. Biomarkers include, but are not limited to, polynucleotides (e.g., DNA, and/or RNA), polypeptides, polypeptide and polynucleotide modifications (e.g. posttranslational modifications), carbohydrates, and/or glycolipid-based molecular markers.

[0063] The terms "biomarker signature," "signature," "biomarker expression signature," or "expression signature" are used interchangeably herein and refer to one or a combination of biomarkers whose expression is an indicator, e.g., predictive, diagnostic, and/or prognostic. The biomarker signature may serve as an indictor of a particular subtype of a disease or disorder (e.g., cancer) characterized by certain molecular, pathological, histological, and/or clinical features. In some embodiments, the biomarker signature is a "gene signature." The term "gene signature" is used interchangeably with "gene expression signature" and refers to one or a combination of polynucleotides whose expression is an indicator, e.g., predictive, diagnostic, and/or prognostic. In some embodiments, the biomarker signature is a "protein signature." The term "protein signature" is used interchangeably with "protein expression signature" and refers to one or a combination of polypeptides whose expression is an indicator, e.g., predictive, diagnostic, and/or prognostic. [0064] The "amount" or "level" of a biomarker associated with an increased clinical benefit to an individual is a detectable level in a biological sample. These can be measured by methods known to one skilled in the art and also disclosed herein. The expression level or amount of biomarker assessed can be used to determine the response to the treatment.

[0065] The terms "level of expression" or "expression level" in general are used interchangeably and generally refer to the amount of a biomarker in a biological sample. "Expression" generally refers to the process by which information (e.g., gene-encoded and/or epigenetic) is converted into the structures present and operating in the cell. Therefore, as used herein, "expression" may refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and/or polypeptide modifications (e.g., posttranslational modification of a polypeptide). Fragments of the transcribed polynucleotide, the translated polypeptide, or polynucleotide and/or polypeptide modifications (e.g., posttranslational modification of a polypeptide) shall also be regarded as expressed whether they originate from a transcript generated by alternative splicing or a degraded transcript, or from a post-translational processing of the polypeptide, e.g., by proteolysis. "Expressed genes" include those that are transcribed into a polynucleotide as mR A and then translated into a polypeptide, and also those that are transcribed into RNA but not translated into a polypeptide (for example, transfer and ribosomal R As).

[0066] "Elevated expression," "elevated expression levels," or "elevated levels" refers to an increased expression or increased levels of a biomarker in an individual relative to a control, such as an individual or individuals who are not suffering from the disease or disorder (e.g. , cancer) or an internal control (e.g. , housekeeping biomarker).

[0067] "Reduced expression," "reduced expression levels," or "reduced levels" refers to a decrease expression or decreased levels of a biomarker in an individual relative to a control, such as an individual or individuals who are not suffering from the disease or disorder (e.g. , cancer) or an internal control (e.g. , housekeeping biomarker).

[0068] The term "housekeeping biomarker" refers to a biomarker or group of biomarkers (e.g.,

polynucleotides and/or polypeptides) which are typically similarly present in all cell types. In some embodiments, the housekeeping biomarker is a "housekeeping gene." A "housekeeping gene" refers herein to a gene or group of genes which encode proteins whose activities are essential for the maintenance of cell function and which are typically similarly present in all cell types.

[0069] "Amplification," as used herein generally refers to the process of producing multiple copies of a desired sequence. "Multiple copies" mean at least two copies. A "copy" does not necessarily mean perfect sequence complementarity or identity to the template sequence. For example, copies can include nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations introduced through a primer comprising a sequence that is hybridizable, but not complementary, to the template), and/or sequence errors that occur during amplification.

[0070] The term "multiplex-PCR" refers to a single PCR reaction carried out on nucleic acid obtained from a single source (e.g., an individual) using more than one primer set for the purpose of amplifying two or more DNA sequences in a single reaction.

[0071] "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et ah, Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

[0072] "Stringent conditions" or "high stringency conditions", as defined herein, can be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) overnight hybridization in a solution that employs 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with a 10 minute wash at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) followed by a 10 minute high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

[0073] "Moderately stringent conditions" can be identified as described by Sambrook et ah, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like. [0074] The term "diagnosis" is used herein to refer to the identification or classification of a molecular or pathological state, disease or condition (e.g., cancer). For example, "diagnosis" may refer to identification of a particular type of cancer. "Diagnosis" may also refer to the classification of a particular subtype of cancer, e.g., by histopathological criteria, or by molecular features (e.g., a subtype characterized by expression of one or a combination of biomarkers (e.g., particular genes or proteins encoded by said genes)).

[0075] The term "aiding diagnosis" is used herein to refer to methods that assist in making a clinical determination regarding the presence, or nature, of a particular type of symptom or condition of a disease or disorder (e.g., cancer). For example, a method of aiding diagnosis of a disease or condition (e.g., cancer) can comprise measuring certain biomarkers in a biological sample from an individual.

[0076] The term "sample," as used herein, refers to a composition that is obtained or derived from a subject and/or individual of interest that contains a cellular and/or other molecular entity that is to be characterized and/or identified, for example based on physical, biochemical, chemical and/or physiological characteristics. For example, the phrase "disease sample" and variations thereof refers to any sample obtained from a subject of interest that would be expected or is known to contain the cellular and/or molecular entity that is to be characterized. Samples include, but are not limited to, primary or cultured cells or cell lines, cell supematants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph fluid, synovial fluid, follicular fluid, seminal fluid, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebro-spinal fluid, saliva, sputum, tears, perspiration, mucus, tumor lysates, and tissue culture medium, tissue extracts such as homogenized tissue, tumor tissue, cellular extracts, and combinations thereof.

[0077] By "tissue sample" or "cell sample" is meant a collection of similar cells obtained from a tissue of a subject or individual. The source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ, tissue sample, biopsy, and/or aspirate; blood or any blood constituents such as plasma; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject. The tissue sample may also be primary or cultured cells or cell lines. Optionally, the tissue or cell sample is obtained from a disease tissue/organ. The tissue sample may contain compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.

[0078] A "reference sample", "reference cell", "reference tissue", "control sample", "control cell", or "control tissue", as used herein, refers to a sample, cell, tissue, standard, or level that is used for comparison purposes. In one embodiment, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a healthy and/or non-diseased part of the body (e.g., tissue or cells) of the same subject or individual. For example, healthy and/or non-diseased cells or tissue adjacent to the diseased cells or tissue (e.g., cells or tissue adjacent to a tumor). In another embodiment, a reference sample is obtained from an untreated tissue and/or cell of the body of the same subject or individual. In yet another embodiment, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a healthy and/or non-diseased part of the body (e.g., tissues or cells) of an individual who is not the subject or individual. In even another embodiment, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from an untreated tissue and/or cell of the body of an individual who is not the subject or individual.

[0079] For the purposes herein a "section" of a tissue sample is meant a single part or piece of a tissue sample, e.g. a thin slice of tissue or cells cut from a tissue sample. It is understood that multiple sections of tissue samples may be taken and subjected to analysis, provided that it is understood that the same section of tissue sample may be analyzed at both morphological and molecular levels, or analyzed with respect to both polypeptides and polynucleotides.

[0080] By "correlate" or "correlating" is meant comparing, in any way, the performance and/or results of a first analysis or protocol with the performance and/or results of a second analysis or protocol. For example, one may use the results of a first analysis or protocol in carrying out a second protocols and/or one may use the results of a first analysis or protocol to determine whether a second analysis or protocol should be performed. With respect to the embodiment of polynucleotide analysis or protocol, one may use the results of the polynucleotide expression analysis or protocol to determine whether a specific therapeutic regimen should be performed.

[0081] "Individual response" or "response" can be assessed using any endpoint indicating a benefit to the individual, including, without limitation, (1) inhibition, to some extent, of disease progression (e.g., cancer progression), including slowing down and complete arrest; (2) a reduction in tumor size; (3) inhibition (i.e., reduction, slowing down or complete stopping) of cancer cell infiltration into adjacent peripheral organs and/or tissues; (4) inhibition (i.e. reduction, slowing down or complete stopping) of metasisis; (5) relief, to some extent, of one or more symptoms associated with the disease or disorder (e.g., cancer); (6) increase in the length of progression free survival; and/or (9) decreased mortality at a given point of time following treatment.

[0082] The term "substantially the same" or "non- differential" as used herein, denotes a sufficiently high degree of similarity between two numeric values, such that one of skill in the art would consider the difference between the two values to be of little or no biological and/or statistical significance within the context of the biological characteristic measured by said values (e.g., Kd values or expression). The difference between said two values is, for example, less than about 50%, less than about 40%, less than about 30%, less than about 20%, and/or less than about 10% as a function of the reference/comparator value.

[0083] The phrase "substantially different" or "differential" as used herein, denotes a sufficiently high degree of difference between two numeric values such that one of skill in the art would consider the difference between the two values to be of statistical significance within the context of the biological characteristic measured by said values (e.g., Kd values). The difference between said two values is, for example, greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, and/or greater than about 50% as a function of the value for the reference/comparator molecule.

[0084] The word "label" when used herein refers to a detectable compound or composition. The label is typically conjugated or fused directly or indirectly to a reagent, such as a polynucleotide probe or an antibody, and facilitates detection of the reagent to which it is conjugated or fused. The label may itself be detectable (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which results in a detectable product.

[0085] An "effective amount" of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.

[0086] A "therapeutically effective amount" of a substance/molecule of the invention, agonist or antagonist may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule, agonist or antagonist to elicit a desired response in the individual. A

therapeutically effective amount is also one in which any toxic or detrimental effects of the

substance/molecule, agonist or antagonist are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[0087] The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.

[0088] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject., A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.

[0089] As used herein, "treatment" (and grammatical variations thereof such as "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, antibodies of the invention are used to delay development of a disease or to slow the progression of a disease. [0090] The term "anti-cancer therapy" refers to a therapy useful in treating cancer. Examples of anti-cancer therapeutic agents include, but are limited to, e.g., chemotherapeutic agents, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti-angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer , anti-CD20 antibodies, platelet derived growth factor inhibitors (e.g., Gleevec^™ (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the following targets PDGFR-beta, BlyS, APRIL, BCMA receptor(s), TRAIL/Apo2, and other bioactive and organic chemical agents, etc. Combinations thereof are also included in the invention.

[0091] The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g., At²¹¹, I¹³¹, 1¹²⁵, Y⁹⁰, Re¹⁸⁶, Re¹⁸⁸, Sm¹⁵³, Bi²¹², P³² and radioactive isotopes of Lu), chemotherapeutic agents e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents, enzymes and fragments thereof such as nucleolytic enzymes, antibiotics, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof, and the various antitumor or anticancer agents disclosed below. Other cytotoxic agents are described below. A tumoricidal agent causes destruction of tumor cells.

[0092] A "chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer.

Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and

trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); delta-9-tetrahydrocannabinol (dronabinol, MARTNOL®); beta-lapachone; lapachol; colchicines; betulinic acid; a camptothecin (including the synthetic analogue topotecan (HYCAMTIN®), CPT- 1 1 (irinotecan, CAMPTOSAR®),

acetylcamptothecin, scopolectin, and 9-aminocamptothecin); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); podophyllotoxin; podophyllinic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e. g., calicheamicin, especially calicheamicin gamma II and calicheamicin omegall (see, e.g., Nicolaou et ah, Angew. Chem Intl. Ed. Engl, 33: 183- 186 (1994)); CDP323, an oral alpha-4 integrin inhibitor; dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including ADRIAMYCIN®, morpholino-doxorubicin, cyanomorpholino- doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HC1 liposome injection (DOXIL®), liposomal doxorubicin TLC D-99 (MYOCET®), peglylated liposomal doxorubicin (CAELYX®), and

deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur (UFTORAL®), capecitabine (XELODA®), an epothilone, and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2'- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine (ELDISINE®, FILDESIN®); dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); thiotepa; taxoid, e.g., paclitaxel (TAXOL®), albumin-engineered nanoparticle formulation of paclitaxel (ABRAXANE™), and docetaxel (TAXOTERE®); chloranbucil; 6- thioguanine; mercaptopurine; methotrexate; platinum agents such as cisplatin, oxaliplatin (e.g.,

ELOXATIN®), and carboplatin; vincas, which prevent tubulin polymerization from forming microtubules, including vinblastine (VELBAN®), vincristine (ONCOVIN®), vindesine (ELDISINE®, FILDESIN®), and vinorelbine (NAVELBINE®); etoposide (VP- 16); ifosfamide; mitoxantrone; leucovorin; novantrone;

edatrexate; daunomycin; aminopterin; ibandronate; topoisomerase inhibitor RFS 2000;

difluoromethylornithine (DMFO); retinoids such as retinoic acid, including bexarotene (TARGRETIN®); bisphosphonates such as clodronate (for example, BONEFOS® or OSTAC®), etidronate (DIDROCAL®), NE-58095, zoledronic acid/zoledronate (ZOMETA®), alendronate (FOSAMAX®), pamidronate

(AREDIA®), tiludronate (SKELID®), or risedronate (ACTONEL®); troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those that inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R); vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine;

topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELIX®); BAY439006 (sorafenib; Bayer); SU-1 1248 (sunitinib, SUTENT®, Pfizer); perifosine, COX-2 inhibitor (e.g., celecoxib or etoricoxib), proteosome inhibitor (e.g., PS341); bortezomib (VELCADE®); CCI-779; tipifarnib (Rl 1577); orafenib, ABT510; Bcl-2 inhibitor such as oblimersen sodium (GENASENSE®); pixantrone; EGFR inhibitors (see definition below); tyrosine kinase inhibitors (see definition below); serine -threonine kinase inhibitors such as rapamycin (sirolimus, RAPAMUNE®); farnesyltransferase inhibitors such as lonafarnib (SCH 6636, SARASAR™); and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above such as CHOP, an abbreviation for a combined therapy of cyclophosphamide, doxorubicin, vincristine, and prednisolone; and FOLFOX, an abbreviation for a treatment regimen with oxaliplatin (ELOXATIN™) combined with 5-FU and leucovorin.

[0093] Chemotherapeutic agents as defined herein include "anti-hormonal agents" or "endocrine therapeutics" which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer. They may be hormones themselves, including, but not limited to: anti- estrogens with mixed agonist/antagonist profile, including, tamoxifen (NOLVADEX®), 4-hydroxytamoxifen, toremifene (FARESTON®), idoxifene, droloxifene, raloxifene (EVISTA®), trioxifene, keoxifene, and selective estrogen receptor modulators (SERMs) such as SERM3; pure anti-estrogens without agonist properties, such as fulvestrant (FASLODEX®), and EM800 (such agents may block estrogen receptor (ER) dimerization, inhibit DNA binding, increase ER turnover, and/or suppress ER levels); aromatase inhibitors, including steroidal aromatase inhibitors such as formestane and exemestane (AROMASIN®), and nonsteroidal aromatase inhibitors such as anastrazole (ARIMIDEX®), letrozole (FEMARA®) and aminoglutethimide, and other aromatase inhibitors include vorozole (RIVISOR®), megestrol acetate (MEGASE®), fadrozole, and 4(5)-imidazoles; lutenizing hormone -releaseing hormone agonists, including leuprolide (LUPRON® and ELIGARD®), goserelin, buserelin, and tripterelin; sex steroids, including progestines such as megestrol acetate and medroxyprogesterone acetate, estrogens such as diethylstilbestrol and premarin, and

androgens/retinoids such as fluoxymesterone, all transretionic acid and fenretinide; onapristone; anti- progesterones; estrogen receptor down-regulators (ERDs); anti-androgens such as flutamide, nilutamide and bicalutamide; and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above.

[0094] The term "prodrug" as used in this application refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form. See, e.g., Wilman, "Prodrugs in Cancer Chemotherapy" Biochemical Society Transactions, 14, pp. 375-382, 615th Meeting Belfast (1986) and Stella et ah, "Prodrugs: A Chemical Approach to Targeted Drug Delivery," Directed Drug Delivery, Borchardt et al, (ed.), pp. 247-267, Humana Press (1985). The prodrugs of this invention include, but are not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate- containing prodrugs, peptide-containing prodrugs, D-amino acid-modified prodrugs, glycosylated prodrugs, β-lactam-containing prodrugs, optionally substituted phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5-fluorocytosine and other 5-fluorouridine prodrugs which can be converted into the more active cytotoxic free drug. Examples of cytotoxic drugs that can be derivatized into a prodrug form for use in this invention include, but are not limited to, those

chemotherapeutic agents described above.

[0095] A "growth inhibitory agent" when used herein refers to a compound or composition which inhibits growth of a cell (e.g., a cell whose growth is dependent upon CDK8 expression either in vitro or in vivo). Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest. Classical M-phase blockers include the vincas (vincristine and vinblastine), taxanes, and topoisomerase II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that arrest Gl also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled "Cell cycle regulation, oncogenes, and antineoplastic drugs" by Murakami et al, (WB Saunders: Philadelphia, 1995), especially p. 13. The taxanes (paclitaxel and docetaxel) are anticancer drugs both derived from the yew tree. Docetaxel (TAXOTERE®, Rhone-Poulenc Rorer), derived from the European yew, is a semisynthetic analogue of paclitaxel (TAXOL®, Bristol-Myers Squibb). Paclitaxel and docetaxel promote the assembly of microtubules from tubulin dimers and stabilize microtubules by preventing depolymerization, which results in the inhibition of mitosis in cells.

[0096] By "radiation therapy" is meant the use of directed gamma rays or beta rays to induce sufficient damage to a cell so as to limit its ability to function normally or to destroy the cell altogether. It will be appreciated that there will be many ways known in the art to determine the dosage and duration of treatment. Typical treatments are given as a one time administration and typical dosages range from 10 to 200 units (Grays) per day.

[0097] An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non- human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human. [0098] The term "concurrently" is used herein to refer to administration of two or more therapeutic agents, where at least part of the administration overlaps in time. Accordingly, concurrent administration includes a dosing regimen when the administration of one or more agent(s) continues after discontinuing the administration of one or more other agent(s).

[0099] By "reduce or inhibit" is meant the ability to cause an overall decrease of 20%, 30%, 40%, 50%,

60%, 70%, 75%, 80%, 85%, 90%, 95%, or greater. Reduce or inhibit can refer to the symptoms of the disorder being treated, the presence or size of metastases, or the size of the primary tumor.

[0100] The term "package insert" is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage,

administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.

[0101] An "article of manufacture" is any manufacture (e.g., a package or container) or kit comprising at least one reagent, e.g., a medicament for treatment of a disease or disorder (e.g., cancer), or a probe for specifically detecting a biomarker described herein. In certain embodiments, the manufacture or kit is promoted, distributed, or sold as a unit for performing the methods described herein.

[0102] A "target audience" is a group of people or an institution to whom or to which a particular medicament is being promoted or intended to be promoted, as by marketing or advertising, especially for particular uses, treatments, or indications, such as individuals, populations, readers of newspapers, medical literature, and magazines, television or internet viewers, radio or internet listeners, physicians, drug companies, etc.

[0103] As is understood by one skilled in the art, reference to "about" a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to "about X" includes description of "X".

[0104] It is understood that aspect and embodiments of the invention described herein include "consisting" and/or "consisting essentially of aspects and embodiments. As used herein, the singular form "a", "an", and "the" includes plural references unless indicated otherwise.

//. Methods and Uses

[0105] Provided herein are methods utilizing a CDK8 antagonist. For example, in some embodiments, provided herein are methods of treating a disease or disorder in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0106] Also provided herein are methods of treating a cancer cell, wherein the cancer cell differentially expresses one or more biomarkers of a CDK8 gene signature (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), the method comprising providing an effective amount of a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0107] Also provided are methods of treating a disease or disorder in an individual comprising

administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is continued based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8- repressed biomarkers of the CDK8 gene signature.

[0108] Provided herein are methods for treating a disease or disorder in an individual, the method comprising: determining that a sample obtained from the individual comprises differential expression levels of one or more biomarkers of a CDK8 gene signature (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), and administering an effective amount of a CDK8 antagonist to the individual, whereby the disease or disorder is treated. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-reduced biomarkers of the CDK8 gene signature.

[0109] Methods are also provided herein for treating disease or disorder in an individual, comprising: (a) selecting an individual having differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)); and (b) administering to the individual thus selected an effective amount of a CDK8 antagonist, whereby the disease or disorder is treated. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature. [0110] Provided are methods of identifying an individual with a disease or disorder who is more or less likely to exhibit benefit from treatment with a therapy comprising a CDK8 antagonist, the method comprising: determining the expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is more likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is less likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0111] Further provided herein are methods for predicting whether an individual with a disease or disorder is more or less likely to respond effectively to treatment with a therapy comprising a CDK8 antagonist, the method comprising assessing expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, whereby differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is more likely to respond effectively to treatment with the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is less likely to respond effectively to treatment with the CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8- repressed biomarkers of the CDK8 gene signature.

[0112] Further provided are methods of predicting the response or lack of response of an individual with a disease or disorder to a therapy comprising a CDK8 antagonist comprising measuring expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) is predictive of response of the individual to the therapy comprising the CDK8 antagonist and non-differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) is predictive of lack of response of the individual to the therapy comprising the CDK8 antagonist. In some embodiments, the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

[0113] Provided herein are methods of determining whether an individual having a disease or disorder is more or less likely responding to therapy, wherein therapy comprises a CDK8 antagonist, based upon levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) identifies the individual as more likely responding to therapy comprising the CDK8 antagonist and non-differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) identifies the individual as less likely responding to therapy comprising the CDK8 antagonist. In some embodiments, differential expression of one or more biomarkers of the CDK8 gene signature is reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature.

[0114] Also provided herein are methods of promoting differentiation of a stem cell and/or a cancer stem cell comprising contacting the cell with an effective amount of CDK8 antagonist. Provided herein are methods of treating cancer, wherein the cancer comprises cancer stem cell-like properties comprising administering to an individual an effective amount of a therapy comprising a CDK8 antagonist. In some embodiments, the CDK8 antagonist promotes differentiation of the cancer stem cell. In some embodiments, the cancer stem cell differentiates into a goblet cell and/or enterocyte cell. In some embodiments, the CDK8 antagonist inhibits growth and/or proliferation of the cancer. In some embodiments, the cancer stem cell-like properties comprise differential expression of one or more gene of the CDK8 signature.

[0115] In some embodiments, the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of a CDK8 cancer cell gene signature. In some embodiments, the cancer cell is a colorectal cancer cell. In some embodiments, the cancer cell is a colon cancer cell. In some embodiments, the one or more biomarkers of a CDK8 cancer cell gene signature comprises one or more biomarkers of Table 2. In some embodiments, the one or more biomarkers listed in Table 2 comprises one or more ES cell-related genes. In some embodiments, the one or more biomarkers listed in Table 2 comprises one or more MYC ES target genes. In some embodiments, the one or more biomarkers listed in Table 2 comprises one or more p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes. In some embodiments, the one or more biomarkers listed in Table 2 does not comprise (e.g., excludes) ES genes and/or MYC ES target genes. In some embodiments, the one or more biomarkers listed in Table 2 comprises one or more p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes, but is not a MYC ES target gene and/or ES genes. In some embodiments, the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of a CDK8 embryonic stem cell gene signature. In some embodiments, the one or more biomarkers of a CDK8 embryonic stem cell gene signature comprises one or more biomarkers of Table 3. In some embodiments, the one or more biomarkers of the CDK8 gene signature comprises one or more genes selected from the group consisting of SABP5, LEAP2, SKP2, CDK6, DICERl, LYAR, RNF138, STIL, POLD3, JAG2, OBRC2A, PPARGCIB, TPD52L2, MRPL12, NUCKS 1, and GEMIN5.

[0116] In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature in Tables 2 and/or 3 have a P-value of greater than about any of lxlO^"2, lxlO^"3, lxlO^"4, lxlO^"5, lxl 0^"6, lxlO^"7, lxl 0^"8, lxlO^"9, and/or lxl 0^"10.

[0117] In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature, one or more biomarkers of a CDK8 cancer cell gene signature, and/or one or more biomarkers of a CDK8 embryonic stem cell gene signature includes greater than about any of 5, 10, 25, 50, 100, 175, 250, 375, 500, 625, 750, 875, 1000, 1 125, 1250, 1375 and/or 1500 biomarkers listed in Table 2 and/or 3. In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature, one or more biomarkers of a CDK8 cancer cell gene signature, and/or one or more biomarkers of a CDK8 embryonic stem cell gene signature includes all of the biomarkers listed in Table 2 and/or 3. In some embodiments of any of the methods, the one or more biomarkers of the CDK8 gene signature includes all of the biomarkers listed in Table 2 and 3.

[0118] In some embodiments of any of the methods, the disease or disorder is an angiogenesis disease or disorder, proliferative disease or disorder, and/or an angiogenic disease or disorder. In some embodiments, the disease or disorder is a tumor and/or cancer. Examples of cancers and cancer cells include, but are not limited to, carcinoma, lymphoma, blastoma (including medulloblastoma and retinoblastoma), sarcoma (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinoma, and islet cell cancer), mesothelioma, schwannoma (including acoustic neuroma), meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include squamous cell cancer (e.g., epithelial squamous cell cancer), lung cancer including small-cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer (including metastatic breast cancer), colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, testicular cancer, esophageal cancer, tumors of the biliary tract, as well as head and neck cancer. In some embodiments, the cancer is metastatic cancer. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is colon cancer.

[0119] In some embodiments of any of the methods, differential expression levels of one or more biomarkers of a CDK8 gene signature is elevated expression. In some embodiments, elevated expression refers to an overall increase of about any of 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater, in the level of biomarker (e.g., protein or nucleic acid (e.g., gene or mRNA)), detected by standard art known methods such as those described herein, as compared to a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In certain

embodiments, the elevated expression refers to the increase in expression level/amount of a biomarker in the sample wherein the increase is at least about any of 1.5X, 1.75X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 25X, 50X, 75X, or 100X the expression level/amount of the respective biomarker in a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In some embodiments, elevated expression refers to an overall increase of greater than about any of 1.05 fold, 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, about 1.75 fold, about 2 fold, about 2.25 fold, about 2.5 fold, about 2.75 fold, about 3.0 fold, or about 3.25 fold as compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene).

[0120] In some embodiments of any of the methods, differential expression levels of one or more biomarkers of a CDK8 gene signature is reduced expression. In some embodiments, reduced expression refers to an overall reduction of about any of 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater, in the level of biomarker (e.g., protein or nucleic acid (e.g., gene or mRNA)), detected by standard art known methods such as those described herein, as compared to a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In certain

embodiments, reduced expression refers to the decrease in expression level/amount of a biomarker in the sample wherein the decrease is at least about any of 0.9X, 0.8X, 0.7X, 0.6X, 0.5X, 0.4X, 0.3X, 0.2X, 0.1X, 0.05X, or 0.0 IX the expression level/amount of the respective biomarker in a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. [0121] Presence and/or expression levels/amount of a biomarker of the CDK8 gene signature can be determined qualitatively and/or quantitatively based on any suitable criterion known in the art, including but not limited to DNA, mR A, cDNA, proteins, protein fragments and/or gene copy number. In certain embodiments, presence and/or expression levels/amount of a biomarker in a first sample is increased as compared to presence/absence and/or expression levels/amount in a second sample. In certain embodiments, presence/absence and/or expression levels/amount of a biomarker in a first sample is decreased as compared to presence and/or expression levels/amount in a second sample. In certain embodiments, the second sample is a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue.

Additional disclosures for determining presence/absence and/or expression levels/amount of a gene are described herein. In some embodiments, the reference gene is CD 133 and/or CD44.

[0122] Presence and/or expression level/amount of various biomarkers in a sample can be analyzed by a number of methodologies, many of which are known in the art and understood by the skilled artisan, including, but not limited to, immunohistochemical ("IHC"), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, fluorescence activated cell sorting ("FACS"), MassARRAY, proteomics, quantitative blood based assays (as for example Serum ELISA), biochemical enzymatic activity assays, in situ hybridization, Southern analysis, Northern analysis, whole genome sequencing, polymerase chain reaction ("PCR") including quantitative real time PCR ("qRT-PCR") and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like), RNA-Seq, FISH, microarray analysis, gene expression profiling, and/or serial analysis of gene expression ("SAGE"), as well as any one of the wide variety of assays that can be performed by protein, gene, and/or tissue array analysis. Typical protocols for evaluating the status of genes and gene products are found, for example in Ausubel et ah, eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). Multiplexed immunoassays such as those available from Rules Based Medicine or Meso Scale Discovery ("MSD") may also be used.

[0123] In some embodiments, presence and/or expression level/amount of a biomarker is determined using a method comprising: (a) performing gene expression profiling, PCR (such as rtPCR), RNA-seq, microarray analysis, SAGE, MassARRAY technique, or FISH on a sample (such as an subject cancer sample); and b) determining presence and/or expression level/amount of a biomarker in the sample. In some embodiments, the microarray method comprises the use of a microarray chip having one or more nucleic acid molecules that can hybridize under stringent conditions to a nucleic acid molecule encoding a gene mentioned above or having one or more polypeptides (such as peptides or antibodies) that can bind to one or more of the proteins encoded by the genes mentioned above. In one embodiment, the PCR method is qRT-PCR. In one embodiment, the PCR method is multiplex-PCR. In some embodiments, gene expression is measured by micro-array. In some embodiments, gene expression is measured by qRT-PCR. In some embodiments, expression is measured by multiplex-PCR.

[0124] Methods for the evaluation of mRNAs in cells are well known and include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled riboprobes specific for the one or more genes, Northern blot and related techniques) and various nucleic acid amplification assays (such as RT-PCR using complementary primers specific for one or more of the genes, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).

[0125] Samples from mammals can be conveniently assayed for mRNAs using Northern, dot blot or PCR analysis. In addition, such methods can include one or more steps that allow one to determine the levels of target mRNA in a biological sample (e.g., by simultaneously examining the levels a comparative control mRNA sequence of a "housekeeping" gene such as an actin family member). Optionally, the sequence of the amplified target cDNA can be determined.

[0126] Optional methods of the invention include protocols which examine or detect mRNAs, such as target mRNAs, in a tissue or cell sample by microarray technologies. Using nucleic acid microarrays, test and control mRNA samples from test and control tissue samples are reverse transcribed and labeled to generate cDNA probes. The probes are then hybridized to an array of nucleic acids immobilized on a solid support. The array is configured such that the sequence and position of each member of the array is known. For example, a selection of genes whose expression correlates with increased or reduced clinical benefit of anti- angiogenic therapy may be arrayed on a solid support. Hybridization of a labeled probe with a particular array member indicates that the sample from which the probe was derived expresses that gene.

[0127] According to some embodiments, presence and/or expression level/amount is measured by observing protein expression levels of an aforementioned gene. In certain embodiments, the method comprises contacting the biological sample with antibodies to a biomarker described herein under conditions permissive for binding of the biomarker, and detecting whether a complex is formed between the antibodies and biomarker. Such method may be an in vitro or in vivo method. In one embodiment, an antibody is used to select subjects eligible for therapy with CDK8 antagonist, e.g., a biomarker for selection of individuals.

[0128] In certain embodiments, the presence and/or expression level/amount of biomarker proteins in a sample is examined using IHC and staining protocols. IHC staining of tissue sections has been shown to be a reliable method of determining or detecting presence of proteins in a sample. In one aspect, expression level of biomarker is determined using a method comprising: (a) performing IHC analysis of a sample (such as a subject cancer sample) with an antibody; and b) determining expression level of a biomarker in the sample. In some embodiments, IHC staining intensity is determined relative to a reference value. [0129] IHC may be performed in combination with additional techniques such as morphological staining and/or fluorescence in-situ hybridization. Two general methods of IHC are available; direct and indirect assays. According to the first assay, binding of antibody to the target antigen is determined directly. This direct assay uses a labeled reagent, such as a fluorescent tag or an enzyme-labeled primary antibody, which can be visualized without further antibody interaction. In a typical indirect assay, unconjugated primary antibody binds to the antigen and then a labeled secondary antibody binds to the primary antibody. Where the secondary antibody is conjugated to an enzymatic label, a chromogenic or fluorogenic substrate is added to provide visualization of the antigen. Signal amplification occurs because several secondary antibodies may react with different epitopes on the primary antibody.

[0130] The primary and/or secondary antibody used for IHC typically will be labeled with a detectable moiety. Numerous labels are available which can be generally grouped into the following categories: (a) Radioisotopes, such as 35S, 14C, 1251, 3H, and 1311; (b) colloidal gold particles; (c) fluorescent labels including, but are not limited to, rare earth chelates (europium chelates), Texas Red, rhodamine, fluorescein, dansyl, Lissamine, umbelliferone, phycocrytherin, phycocyanin, or commercially available fluorophores such SPECTRUM ORANGE7 and SPECTRUM GREEN7 and/or derivatives of any one or more of the above; (d) various enzyme-substrate labels are available and U.S. Patent No. 4,275, 149 provides a review of some of these. Examples of enzymatic labels include luciferases (e.g., firefly luciferase and bacterial luciferase; U.S. Patent No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidase such as horseradish peroxidase (HRPO), alkaline phosphatase, β-galactosidase, glucoamylase, lysozyme, saccharide oxidases (e.g., glucose oxidase, galactose oxidase, and glucoses- phosphate dehydrogenase), heterocyclic oxidases (such as uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like.

[0131] Examples of enzyme-substrate combinations include, for example, horseradish peroxidase (HRPO) with hydrogen peroxidase as a substrate; alkaline phosphatase (AP) with para-Nitrophenyl phosphate as chromogenic substrate; and β-D-galactosidase (β-D-Gal) with a chromogenic substrate (e.g., p-nitrophenyl- β-D-galactosidase) or fluorogenic substrate (e.g., 4-methylumbelliferyl^-D-galactosidase). For a general review of these, see XJ.S. Patent Nos. 4,275, 149 and 4,318,980.

[0132] Specimens thus prepared may be mounted and coverslipped. Slide evaluation is then determined, e.g., using a microscope, and staining intensity criteria, routinely used in the art, may be employed. In some embodiments, a staining pattern score of about 1+ or higher is diagnostic and/or prognostic. In certain embodiments, a staining pattern score of about 2+ or higher in an IHC assay is diagnostic and/or prognostic. In other embodiments, a staining pattern score of about 3 or higher is diagnostic and/or prognostic. In one embodiment, it is understood that when cells and/or tissue from a tumor or colon adenoma are examined using IHC, staining is generally determined or assessed in tumor cell and/or tissue (as opposed to stromal or surrounding tissue that may be present in the sample). [0133] In alternative methods, the sample may be contacted with an antibody specific for said biomarker under conditions sufficient for an antibody-biomarker complex to form, and then detecting said complex. The presence of the biomarker may be detected in a number of ways, such as by Western blotting and ELISA procedures for assaying a wide variety of tissues and samples, including plasma or serum. A wide range of immunoassay techniques using such an assay format are available, see, e.g., U.S. Pat. Nos. 4,016,043, 4,424,279 and 4,018,653. These include both single-site and two-site or "sandwich" assays of the noncompetitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labeled antibody to a target biomarker.

[0134] Presence and/or expression level/amount of a selected biomarker in a tissue or cell sample may also be examined by way of functional or activity-based assays. For instance, if the biomarker is an enzyme, one may conduct assays known in the art to determine or detect the presence of the given enzymatic activity in the tissue or cell sample.

[0135] In certain embodiments, the samples are normalized for both differences in the amount of the biomarker assayed and variability in the quality of the samples used, and variability between assay runs. Such normalization may be accomplished by detecting and incorporating the expression of certain normalizing biomarkers, including well known housekeeping genes, such as ACTB. Alternatively, normalization can be based on the mean or median signal of all of the assayed genes or a large subset thereof (global normalization approach). On a gene-by-gene basis, measured normalized amount of a subject tumor mRNA or protein is compared to the amount found in a reference set. Normalized expression levels for each mRNA or protein per tested tumor per subject can be expressed as a percentage of the expression level measured in the reference set. The presence and/or expression level/amount measured in a particular subject sample to be analyzed will fall at some percentile within this range, which can be determined by methods well known in the art.

[0136] In certain embodiments, relative expression level of a gene is determined as follows:

Relative expression genel sample 1 = 2 exp (Ct housekeeping gene - Ct genel) with Ct determined in a sample.

Relative expression genel reference RNA = 2 exp (Ct housekeeping gene - Ct genel) with Ct determined in the reference sample.

Normalized relative expression genel sample 1 = (relative expression genel sample 1 / relative expression gene 1 reference RNA) x 100

Ct is the threshold cycle. The Ct is the cycle number at which the fluorescence generated within a reaction crosses the threshold line.

[0137] All experiments are normalized to a reference RNA, which is a comprehensive mix of RNA from various tissue sources (e.g., reference RNA #636538 from Clontech, Mountain View, CA). Identical reference RNA is included in each qRT-PCR run, allowing comparison of results between different experimental runs.

[0138] In one embodiment, the sample is a clinical sample. In another embodiment, the sample is used in a diagnostic assay. In some embodiments, the sample is obtained from a primary or metastatic tumor. Tissue biopsy is often used to obtain a representative piece of tumor tissue. Alternatively, tumor cells can be obtained indirectly in the form of tissues or fluids that are known or thought to contain the tumor cells of interest. For instance, samples of lung cancer lesions may be obtained by resection, bronchoscopy, fine needle aspiration, bronchial brushings, or from sputum, pleural fluid or blood. Genes or gene products can be detected from cancer or tumor tissue or from other body samples such as urine, sputum, serum or plasma. The same techniques discussed above for detection of target genes or gene products in cancerous samples can be applied to other body samples. Cancer cells may be sloughed off from cancer lesions and appear in such body samples. By screening such body samples, a simple early diagnosis can be achieved for these cancers. In addition, the progress of therapy can be monitored more easily by testing such body samples for target genes or gene products.

[0139] In certain embodiments, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is a single sample or combined multiple samples from the same subject or individual that are obtained at one or more different time points than when the test sample is obtained. For example, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained at an earlier time point from the same subject or individual than when the test sample is obtained. Such reference sample, reference cell, reference tissue, control sample, control cell, or control tissue may be useful if the reference sample is obtained during initial diagnosis of cancer and the test sample is later obtained when the cancer becomes metastatic.

[0140] In certain embodiments, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is a combined multiple samples from one or more healthy individuals who are not the subject or individual. In certain embodiments, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is a combined multiple samples from one or more individuals with a disease or disorder (e.g., cancer) who are not the subject or individual. In certain embodiments, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is pooled RNA samples from normal tissues or pooled plasma or serum samples from one or more individuals who are not the subject or individual. In certain embodiments, a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is pooled RNA samples from tumor tissues or pooled plasma or serum samples from one or more individuals with a disease or disorder (e.g., cancer) who are not the subject or individual.

[0141] In some embodiments of any of the methods, the CDK8 antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 antagonist is an antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is an antibody fragment and the antibody fragment binds CDK8. In some embodiments, the CDK8 antagonist is a small molecule. In some embodiments, the small molecule is a small molecule kinase inhibitor. In some embodiments, the small molecule kinase inhibitor is selected from the group consisting of flavopiridol, ABT-869, AST-487, BMS-387032/SNS032, BIRB-796, sorafenib, staurosporine, cortistatin, cortistatin A, and/or a steroidal alkaloid or derivative thereof. In some embodiments, the CDK8 antagonist induces cell cycle arrest or is capable of promoting differentiation. In some embodiments, the CDK8 antagonist is capable of promoting a change in cell fate and promoting differentiation is indicated by reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature.

[0142] In some embodiments of any of the methods, the individual according to any of the above embodiments may be a human.

[0143] In some embodiments of any of the methods, the method comprises administering to an individual having such cancer an effective amount of a CDK8 antagonist. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, as described below. In some embodiments, the individual may be a human.

[0144] The CDK8 antagonist described herein can be used either alone or in combination with other agents in a therapy. For instance, a CDK8 antagonist, described herein may be co-administered with at least one additional therapeutic agent including another CDK8 antagonist. In certain embodiments, an additional therapeutic agent is a chemotherapeutic agent.

[0145] Such combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate administration, in which case, administration of the CDK8 antagonist can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent and/or adjuvant. CDK8 antagonist can also be used in combination with radiation therapy.

[0146] A CDK8 antagonist (e.g., an antibody, binding polypeptide, and/or small molecule) described herein (and any additional therapeutic agent) can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, e.g., by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. Various dosing schedules including but not limited to single or multiple administrations over various time -points, bolus administration, and pulse infusion are contemplated herein.

[0147] CDK8 antagonist (e.g., an antibody, binding polypeptide, and/or small molecule) described herein may be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The CDK8 antagonist, need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents depends on the amount of the CDK8 antagonist, present in the formulation, the type of disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as described herein, or about from 1 to 99% of the dosages described herein, or in any dosage and by any route that is empirically/clinically determined to be appropriate.

[0148] For the prevention or treatment of disease, the appropriate dosage of a CDK8 antagonist, described herein (when used alone or in combination with one or more other additional therapeutic agents) will depend on the type of disease to be treated, the severity and course of the disease, whether the CDK8 antagonist, is administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the CDK8 antagonist, and the discretion of the attending physician. The CDK8 antagonist is suitably administered to the individual at one time or over a series of treatments. One typical daily dosage might range from about 1 μg/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment would generally be sustained until a desired suppression of disease symptoms occurs. Such doses may be administered intermittently, e.g., every week or every three weeks (e.g., such that the individual receives from about two to about twenty, or e.g., about six doses of the CDK8 antagonist). An initial higher loading dose, followed by one or more lower doses may be administered. An exemplary dosing regimen comprises administering. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.

[0149] It is understood that any of the above formulations or therapeutic methods may be carried out using an immunoconjugate of the invention in place of or in addition to the CDK8 antagonist.

///. Therapeutic Compositions

[0150] Provided herein are CDK8 antagonists useful in the methods described herein. In some

embodiments, the CDK8 antagonists are an antibody, binding polypeptide, small molecule, and/or polynucleotide.

A. Antibodies [0151] In one aspect, provided herein isolated antibodies that bind to CDK8. In any of the above embodiments, an antibody is humanized. In a further aspect of the invention, an anti-CDK8 antibody according to any of the above embodiments is a monoclonal antibody, including a chimeric, humanized or human antibody. In one embodiment, an anti-CDK8 antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a full length antibody, e.g., an intact IgGl" antibody or other antibody class or isotype as defined herein.

[0152] In a further aspect, an anti-CDK8 antibody according to any of the above embodiments may incorporate any of the features, singly or in combination, as described in Sections below:

1. Antibody Affinity

[0153] In certain embodiments, an antibody provided herein has a dissociation constant (Kd) of < Ι μΜ. In one embodiment, Kd is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay. Solution binding affinity of Fabs for antigen is measured by equilibrating Fab with a minimal concentration of (¹²⁵I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti- Fab antibody-coated plate (see, e.g., Chen et al, J. Mol. Biol. 293:865-881(1999)). To establish conditions for the assay, MICROTITER^® multi-well plates (Thermo Scientific) are coated overnight with 5 μg/ml of a capturing anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to five hours at room temperature (approximately 23°C). In a non- adsorbent plate (Nunc #269620), 100 pM or 26 pM [¹²⁵I]-anti gen are mixed with serial dilutions of a Fab of interest (e.g., consistent with assessment of the anti-VEGF antibody, Fab- 12, in Presta et al, Cancer Res. 57:4593-4599 (1997)). The Fab of interest is then incubated overnight; however, the incubation may continue for a longer period (e.g., about 65 hours) to ensure that equilibrium is reached. Thereafter, the mixtures are transferred to the capture plate for incubation at room temperature (e.g., for one hour). The solution is then removed and the plate washed eight times with 0.1% polysorbate 20 (TWEEN- 20^®) in PBS. When the plates have dried, 150 μΐ/well of scintillant (MICROSCTNT-20™; Packard) is added, and the plates are counted on a TOPCOU T™ gamma counter (Packard) for ten minutes. Concentrations of each Fab that give less than or equal to 20% of maximal binding are chosen for use in competitive binding assays.

[0154] According to another embodiment, Kd is measured using surface plasmon resonance assays using a BIACORE^®-2000 or a BIACORE ^®-3000 (BIAcore, Inc., Piscataway, NJ) at 25°C with immobilized antigen CM5 chips at ~10 response units (RU). Briefly, carboxymethylated dextran biosensor chips (CM5,

BIACORE, Inc.) are activated with N-ethyl-N'- (3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. Antigen is diluted with 10 mM sodium acetate, pH 4.8, to 5 μg/ml (-0.2 μΜ) before injection at a flow rate of 5 μΐ/minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1 M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% polysorbate 20 (TWEEN-20™) surfactant (PBST) at 25°C at a flow rate of approximately 25 μΐ/min. Association rates (k_on) and dissociation rates (k₀ff) are calculated using a simple one-to-one Langmuir binding model (BIACORE ^® Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgrams. The equilibrium dissociation constant (Kd) is calculated as the ratio k₀f k_on See, e.g., Chen et al, J. Mol. Biol. 293:865-881 (1999). If the on-rate exceeds 10⁶M s by the surface plasmon resonance assay above, then the on-rate can be determined by using a fluorescent quenching technique that measures the increase or decrease in

fluorescence emission intensity (excitation = 295 nm; emission = 340 nm, 16 nm band-pass) at 25°C of a 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2, in the presence of increasing concentrations of antigen as measured in a spectrometer, such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000- series SLM-AMINCO™ spectrophotometer (ThermoSpectronic) with a stirred cuvette.

2. Antibody Fragments

[0155] In certain embodiments, an antibody provided herein is an antibody fragment. Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab')2, Fv, and scFv fragments, and other fragments described below. For a review of certain antibody fragments, see Hudson et al, Nat. Med. 9: 129-134 (2003). For a review of scFv fragments, see, e.g., Pluckthiin, in The Pharmacology of Monoclonal Antibodies , vol. 1 13, Rosenburg and Moore eds., (Springer- Verlag, New York), pp. 269-315 (1994); see also WO 93/16185; and U.S. Patent Nos. 5,571,894 and 5,587,458. For discussion of Fab and F(ab')2 fragments comprising salvage receptor binding epitope residues and having increased in vivo half-life, see U.S. Patent No.

5,869,046.

[0156] Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, for example, EP 404,097; WO 1993/01 161 ; Hudson et al. , Nat. Med. 9: 129-134 (2003); and Hollinger et al, Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al, Nat. Med. 9: 129-134 (2003).

[0157] Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain embodiments, a single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 B l).

[0158] Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells (e.g., E. coli or phage), as described herein. 3. Chimeric and Humanized Antibodies

[0159] In certain embodiments, an antibody provided herein is a chimeric antibody. Certain chimeric antibodies are described, e.g., in U.S. Patent No. 4,816,567; and Morrison et al, Proc. Natl. Acad. Sci. USA, 81 :6851-6855 (1984)). In one example, a chimeric antibody comprises a non-human variable region {e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region. In a further example, a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen- binding fragments thereof.

[0160] In certain embodiments, a chimeric antibody is a humanized antibody. Typically, a non-human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. Generally, a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody, and FRs (or portions thereof) are derived from human antibody sequences. A humanized antibody optionally will also comprise at least a portion of a human constant region. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR residues are derived), e.g., to restore or improve antibody specificity or affinity.

[0161] Humanized antibodies and methods of making them are reviewed, e.g., in Almagro and Fransson, Front. Biosci. 13: 1619- 1633 (2008), and are further described, e.g., in Riechmann et al, Nature 332:323-329 (1988); Queen et al, Proc. Nat l Acad. Sci. USA 86: 10029-10033 (1989); US Patent Nos. 5, 821,337, 7,527,791, 6,982,321, and 7,087,409; Kashmiri et al, Methods 36:25-34 (2005) (describing SDR (a-CDR) grafting); Padlan, Mol. Immunol. 28:489-498 (1991) (describing "resurfacing"); Dall'Acqua et al, Methods 36:43-60 (2005) (describing "FR shuffling"); and Osbourn et al, Methods 36:61-68 (2005) and Klimka et al, Br. J. Cancer, 83:252-260 (2000) (describing the "guided selection" approach to FR shuffling).

[0162] Human framework regions that may be used for humanization include but are not limited to:

framework regions selected using the "best- fit" method (see, e.g., Sims et al, J. Immunol. 151 :2296 (1993)); framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions (see, e.g., Carter et al, Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al, J. Immunol, 151 :2623 (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008)); and framework regions derived from screening FR libraries (see, e.g., Baca et al, J. Biol. Chem. 272: 10678- 10684 (1997) and Rosok e? al, J. Biol. Chem. 271 :2261 1-22618 (1996)). 4. Human Antibodies

[0163] In certain embodiments, an antibody provided herein is a human antibody. Human antibodies can be produced using various techniques known in the art. Human antibodies are described generally in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450- 459 (2008).

[0164] Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the human

immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal's chromosomes. In such transgenic mice, the endogenous immunoglobulin loci have generally been inactivated. For review of methods for obtaining human antibodies from transgenic animals, see Lonberg, Nat. Biotech. 23: 1 1 17-1 125 (2005). See also, e.g., U.S. Patent Nos. 6,075, 181 and 6,150,584 describing XENOMOUSE™ technology; U.S. Patent No.

5,770,429 describing HuMab® technology; U.S. Patent No. 7,041,870 describing K-M MOUSE® technology, and U.S. Patent Application Publication No. US 2007/0061900, describing VelociMouse® technology). Human variable regions from intact antibodies generated by such animals may be further modified, e.g., by combining with a different human constant region.

[0165] Human antibodies can also be made by hybridoma-based methods. Human myeloma and mouse- human heteromyeloma cell lines for the production of human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol, 133: 3001 (1984); and Boerner et al, J. Immunol., 147: 86 (1991).) Human antibodies generated via human B-cell hybridoma technology are also described in Li et al, Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006). Additional methods include those described, for example, in U.S. Patent No. 7, 189,826 (describing production of monoclonal human IgM antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26(4):265-268 (2006) (describing human-human hybridomas). Human hybridoma technology (Trioma technology) is also described in Vollmers and Brandlein, Histology and Histopathology, 20(3):927-937 (2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clin. Pharma., 27(3): 185-91 (2005).

[0166] Human antibodies may also be generated by isolating Fv clone variable domain sequences selected from human-derived phage display libraries. Such variable domain sequences may then be combined with a desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.

5. Library-Derived Antibodies

[0167] Antibodies of the invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, a variety of methods are known in the art for generating phage display libraries and screening such libraries for antibodies possessing the desired binding characteristics. Such methods are reviewed, e.g., in Hoogenboom et al, in METHODS IN MOL. BIOL. 178: 1-37 (O'Brien et al, ed., Human Press, Totowa, NJ, 2001) and further described, e.g., in the McCafferty et al, Nature 348:552-554; Clackson et al, Nature 352: 624-628 (1991); Marks et al, J. Mol Biol 222: 581-597 (1992); Marks and Bradbury, in METHODS IN MOL. BIOL. 248: 161-175 (Lo, ed., Human Press, Totowa, NJ, 2003); Sidhu et al, J. Mol Biol 338(2): 299-310 (2004); Lee et al, J. Mol. Biol. 340(5): 1073-1093 (2004);

Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467- 12472 (2004); and Lee et al, J. Immunol. Methods 284(1-2): 1 19-132(2004).

[0168] In certain phage display methods, repertoires of VH and VL genes are separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be screened for antigen-binding phage as described in Winter et al, Ann. Rev. Immunol, 12: 433-455 (1994). Phage typically display antibody fragments, either as single-chain Fv (scFv) fragments or as Fab fragments.

Libraries from immunized sources provide high-affinity antibodies to the immunogen without the requirement of constructing hybridomas. Alternatively, the naive repertoire can be cloned {e.g., from human) to provide a single source of antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al, EMBO J, 12: 725-734 (1993). Finally, naive libraries can also be made synthetically by cloning unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro, as described by Hoogenboom and Winter, J. Mol. Biol, 227: 381-388 (1992). Patent publications describing human antibody phage libraries include, for example: US Patent No. 5,750,373, and US Patent Publication Nos. 2005/0079574, 2005/01 19455, 2005/0266000, 2007/01 17126, 2007/0160598,

2007/0237764, 2007/0292936, and 2009/0002360.

[0169] Antibodies or antibody fragments isolated from human antibody libraries are considered human antibodies or human antibody fragments herein.

6. Multispeciflc Antibodies

[0170] In certain embodiments, an antibody provided herein is a multispeciflc antibody, e.g., a bispecific antibody. Multispeciflc antibodies are monoclonal antibodies that have binding specificities for at least two different sites. In certain embodiments, one of the binding specificities is for CDK8 polypeptide and the other is for any other antigen. In certain embodiments, bispecific antibodies may bind to two different epitopes of CDK8 polypeptide. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express CDK8 polypeptide. Bispecific antibodies can be prepared as full length antibodies or antibody fragments.

[0171] Techniques for making multispeciflc antibodies include, but are not limited to, recombinant co- expression of two immunoglobulin heavy chain-light chain pairs having different specificities {see Milstein and Cuello, Nature 305: 537 (1983)), WO 93/08829, and Traunecker et al, EMBO J. 10: 3655 (1991)), and "knob-in-hole" engineering (see, e.g., U.S. Patent No. 5,731, 168). Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc-heterodimeric molecules

(WO 2009/089004A1); cross-linking two or more antibodies or fragments (see, e.g., US Patent No.

4,676,980, and Brennan et al, Science, 229: 81 (1985)); using leucine zippers to produce bi-specific antibodies (see, e.g., Kostelny et al, J. Immunol, 148(5): 1547-1553 (1992)); using "diabody" technology for making bispecific antibody fragments (see, e.g., Hollinger et al, Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); and using single-chain Fv (sFv) dimers (see, e.g., Gruber et al, J. Immunol, 152:5368 (1994)); and preparing trispecific antibodies as described, e.g., in Tutt et al, J. Immunol. 147: 60 (1991).

[0172] Engineered antibodies with three or more functional antigen binding sites, including "Octopus antibodies," are also included herein (see, e.g., US 2006/0025576).

[0173] The antibody or fragment herein also includes a "Dual Acting FAb" or "DAF" comprising an antigen binding site that binds to a CDK8 polypeptide as well as another, different antigen (see, US 2008/0069820, for example).

7. Antibody Variants

a) Glycosylation variants

[0174] In certain embodiments, an antibody provided herein is altered to increase or decrease the extent to which the antibody is glycosylated. Addition or deletion of glycosylation sites to an antibody may be conveniently accomplished by altering the amino acid sequence such that one or more glycosylation sites is created or removed.

[0175] Where the antibody comprises an Fc region, the carbohydrate attached thereto may be altered. Native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al, TIBTECH 15:26-32 (1997). The oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the "stem" of the biantennary oligosaccharide structure. In some embodiments, modifications of the oligosaccharide in an antibody of the invention may be made in order to create antibody variants with certain improved properties.

[0176] In one embodiment, antibody variants are provided having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region. For example, the amount of fucose in such antibody may be from 1% to 80%, from 1% to 65%, from 5% to 65% or from 20% to 40%. The amount of fucose is determined by calculating the average amount of fucose within the sugar chain at Asn297, relative to the sum of all glycostructures attached to Asn 297 (e. g. complex, hybrid and high mannose structures) as measured by MALDI-TOF mass spectrometry, as described in WO 2008/077546, for example. Asn297 refers to the asparagine residue located at about position 297 in the Fc region (Eu numbering of Fc region residues); however, Asn297 may also be located about ± 3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300, due to minor sequence variations in antibodies. Such fucosylation variants may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd). Examples of publications related to "defucosylated" or "fucose-deficient" antibody variants include: US 2003/0157108; WO 2000/61739; WO 2001/29246; US 2003/01 15614; US 2002/0164328; US 2004/0093621 ; US 2004/0132140; US 2004/01 10704; US

2004/01 10282; US 2004/0109865; WO 2003/0851 19; WO 2003/084570; WO 2005/035586; WO

2005/035778; WO2005/053742; WO2002/031 140; Okazaki et al, J. Mol. Biol. 336: 1239- 1249 (2004); Yamane-Ohnuki et al, Biotech. Bioeng. 87: 614 (2004). Examples of cell lines capable of producing defucosylated antibodies include Led 3 CHO cells deficient in protein fucosylation (Ripka et al, Arch. Biochem. Biophys. 249:533-545 (1986); US 2003/0157108, Presta, L; and WO 2004/056312, Adams et al, especially at Example 1 1), and knockout cell lines, such as alpha- 1,6-fucosyltransferase gene, FUT8, knockout CHO cells (see, e.g., Yamane-Ohnuki et al, Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al, Biotechnol. Bioeng, 94(4):680-688 (2006); and WO2003/085107).

[0177] Antibodies variants are further provided with bisected oligosaccharides, e.g., in which a biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc. Such antibody variants may have reduced fucosylation and/or improved ADCC function. Examples of such antibody variants are described, e.g., in WO 2003/01 1878 (Jean-Mairet et al.); US Patent No. 6,602,684 (Umana et al.); and US 2005/0123546 (Umana et al). Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CDC function. Such antibody variants are described, e.g., in WO 1997/30087 (Patel et al); WO 1998/58964 (Raju, S.); and WO 1999/22764 (Raju, S.).

b) Fc region variants

[0178] In certain embodiments, one or more amino acid modifications may be introduced into the Fc region of an antibody provided herein, thereby generating an Fc region variant. The Fc region variant may comprise a human Fc region sequence (e.g., a human IgGl, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification (e.g., a substitution) at one or more amino acid positions.

[0179] In certain embodiments, the invention contemplates an antibody variant that possesses some but not all effector functions, which make it a desirable candidate for applications in which the half life of the antibody in vivo is important yet certain effector functions (such as complement and ADCC) are unnecessary or deleterious. In vitro and/or in vivo cytotoxicity assays can be conducted to confirm the reduction/depletion of CDC and/or ADCC activities. For example, Fc receptor (FcR) binding assays can be conducted to ensure that the antibody lacks FcyR binding (hence likely lacking ADCC activity), but retains FcRn binding ability. The primary cells for mediating ADCC, NK cells, express FcyRIII only, whereas monocytes express FcyRI, FcyRII and FcyRIII. FcR expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991). Non-limiting examples of in vitro assays to assess ADCC activity of a molecule of interest is described in U.S. Patent No. 5,500,362 (see, e.g.,

Hellstrom, I. et al, Proc. Nat Ί Acad. Sci. USA 83:7059-7063 (1986)) and Hellstrom, I et al, Proc. Nat 'l Acad. Sci. USA 82: 1499- 1502 (1985); 5,821,337 (see Bruggemann, M. et al., J. Exp. Med. 166: 1351-1361 (1987)). Alternatively, non-radioactive assays methods may be employed (see, for example, ACTI™ nonradioactive cytotoxicity assay for flow cytometry (CellTechnology, Inc. Mountain View, CA; and CytoTox 96^® non-radioactive cytotoxicity assay (Promega, Madison, WI). Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and Natural Killer (NK) cells. Alternatively, or additionally, ADCC activity of the molecule of interest may be assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al., Proc. Natl. Acad. Sci. USA 95:652-656 (1998). Clq binding assays may also be carried out to confirm that the antibody is unable to bind Clq and hence lacks CDC activity. See, e.g., Clq and C3c binding ELISA in WO 2006/029879 and WO 2005/100402. To assess complement activation, a CDC assay may be performed (see, for example, Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996); Cragg, M.S. et al., Blood 101 : 1045-1052 (2003); and Cragg, M.S. and M.J. Glennie, Blood

103:2738-2743 (2004)). FcRn binding and in vivo clearance/half life determinations can also be performed using methods known in the art (see, e.g., Petkova, S.B. et al., Int'l. Immunol. 18(12): 1759-1769 (2006)).

[0180] Antibodies with reduced effector function include those with substitution of one or more of Fc region residues 238, 265, 269, 270, 297, 327 and 329 (U.S. Patent No. 6,737,056). Such Fc mutants include Fc mutants with substitutions at two or more of amino acid positions 265, 269, 270, 297 and 327, including the so-called "DANA" Fc mutant with substitution of residues 265 and 297 to alanine (US Patent No.

7,332,581).

[0181] Certain antibody variants with improved or diminished binding to FcRs are described. (See, e.g., U.S. Patent No. 6,737,056; WO 2004/056312, and Shields et al, J. Biol. Chem. 9(2): 6591-6604 (2001).) In certain embodiments, an antibody variant comprises an Fc region with one or more amino acid substitutions which improve ADCC, e.g., substitutions at positions 298, 333, and/or 334 of the Fc region (EU numbering of residues). In some embodiments, alterations are made in the Fc region that result in altered (i.e., either improved or diminished) Clq binding and/or Complement Dependent Cytotoxicity (CDC), e.g., as described in US Patent No. 6,194,551, WO 99/51642, and Idusogie et al, J. Immunol. 164: 4178-4184 (2000).

[0182] Antibodies with increased half lives and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgGs to the fetus (Guyer et al, J. Immunol. 1 17:587 (1976) and Kim et al, J. Immunol. 24:249 (1994)), are described in US2005/0014934A1 (Hinton et al). Those antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to FcRn. Such Fc variants include those with substitutions at one or more of Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 31 1, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, e.g., substitution of Fc region residue 434 (US Patent No. 7,371,826). See also Duncan & Winter, Nature 322:738-40 (1988); U.S. Patent No. 5,648,260; U.S. Patent No. 5,624,821; and WO 94/29351 concerning other examples of Fc region variants.

c) Cysteine engineered antibody variants

[0183] In certain embodiments, it may be desirable to create cysteine engineered antibodies, e.g.,

"thioMAbs," in which one or more residues of an antibody are substituted with cysteine residues. In particular embodiments, the substituted residues occur at accessible sites of the antibody. By substituting those residues with cysteine, reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein. In certain embodiments, any one or more of the following residues may be substituted with cysteine: V205 (Kabat numbering) of the light chain; Al 18 (EU numbering) of the heavy chain; and S400 (EU numbering) of the heavy chain Fc region. Cysteine engineered antibodies may be generated as described, e.g., in U.S. Patent No. 7,521,541.

B. Immunoconjugates

[0184] Further provided herein are immunoconjugates comprising an anti-CDK8 antibody conjugated to one or more cytotoxic agents, such as chemotherapeutic agents or drugs, growth inhibitory agents, toxins {e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes.

[0185] In one embodiment, an immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody is conjugated to one or more drugs, including but not limited to a maytansinoid (see U.S. Patent Nos.

5,208,020, 5,416,064 and European Patent EP 0 425 235 B l); an auristatin such as monomethylauristatin drug moieties DE and DF (MMAE and MMAF) (see U.S. Patent Nos. 5,635,483 and 5,780,588, and 7,498,298); a dolastatin; a calicheamicin or derivative thereof (see U.S. Patent Nos. 5,712,374, 5,714,586, 5,739,1 16, 5,767,285, 5,770,701, 5,770,710, 5,773,001, and 5,877,296; Hinman et al, Cancer Res. 53:3336- 3342 (1993); and Lode et al, Cancer Res. 58:2925-2928 (1998)); an anthracycline such as daunomycin or doxorubicin (see Kratz et al, Current Med. Chem. 13:477-523 (2006); Jeffrey et al, Bioorganic & Med. Chem. Letters 16:358-362 (2006); Torgov et al, Bioconj. Chem. 16:717-721 (2005); Nagy et al, Proc. Natl Acad. Sci. USA 97:829-834 (2000); Dubowchik et al, Bioorg. & Med. Chem. Letters 12: 1529-1532 (2002); King et al, J. Med. Chem. 45:4336-4343 (2002); and U.S. Patent No. 6,630,579); methotrexate; vindesine; a taxane such as docetaxel, paclitaxel, larotaxel, tesetaxel, and ortataxel; a trichothecene; and CC1065.

[0186] In another embodiment, an immunoconjugate comprises an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. [0187] In another embodiment, an immunoconjugate comprises an antibody as described herein conjugated to a radioactive atom to form a radioconjugate. A variety of radioactive isotopes are available for the production of radioconjugates. Examples include At²¹¹, 1¹³¹, 1¹²⁵, Y⁹⁰, Re¹⁸⁶, Re¹⁸⁸, Sm¹⁵³, Bi²¹², P³², Pb²¹² and radioactive isotopes of Lu. When the radioconjugate is used for detection, it may comprise a radioactive atom for scintigraphic studies, for example Tc" or I¹²³, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, MRI), such as iodine- 123 again, iodine-131, indium- 1 1 1, fluorine- 19, carbon- 13, nitrogen- 15, oxygen- 17, gadolinium, manganese or iron.

[0188] Conjugates of an antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N- maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HQ), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6- diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2,4-dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al, Science 238: 1098 (1987). Carbon-14- labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See W094/1 1026. The linker may be a "cleavable linker" facilitating release of a cytotoxic drug in the cell. For example, an acid-labile linker, peptidase-sensitive linker, photolabile linker, dimethyl linker or disulfide-containing linker (Chari et al, Cancer Res. 52: 127-131 (1992); U.S. Patent No. 5,208,020) may be used.

[0189] The immunuoconjugates or ADCs herein expressly contemplate, but are not limited to such conjugates prepared with cross-linker reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo- KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and SVSB (succinimidyl-(4- vinylsulfone)benzoate) which are commercially available {e.g., from Pierce Biotechnology, Inc., Rockford, IL., USA).

C. Binding Polypeptides

[0190] Binding polypeptides are polypeptides that bind, preferably specifically, to CDK8 as described herein. In some embodiments, the binding polypeptides are CDK8 antagonists.

[0191] Binding polypeptides may be chemically synthesized using known polypeptide synthesis methodology or may be prepared and purified using recombinant technology. Binding polypeptides are usually at least about 5 amino acids in length, alternatively at least about 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acids in length or more, wherein such binding polypeptides that are capable of binding, preferably specifically, to a target, CDK8, as described herein. Binding polypeptides may be identified without undue experimentation using well known techniques. In this regard, it is noted that techniques for screening polypeptide libraries for binding polypeptides that are capable of specifically binding to a polypeptide target are well known in the art (see, e.g., U.S. Patent Nos. 5,556,762, 5,750,373, 4,708,871, 4,833,092, 5,223,409, 5,403,484, 5,571,689, 5,663,143; PCT Publication Nos. WO 84/03506 and WO84/03564; Geysen et al, Proc. Natl. Acad. Sci. U.S.A., 81 :3998-4002 (1984); Geysen et al, Proc. Natl. Acad. Sci. U.S.A., 82: 178- 182 (1985); Geysen et al., in Synthetic Peptides as Antigens, 130-149 (1986); Geysen et al, J. Immunol. Meth_^, 102:259-274 (1987); Schoofs et al, J. Immunol, 140:61 1-616 (1988), Cwirla, S. E. et al, (1990) Proc. Natl. Acad. Sci. USA, 87:6378; Lowman, H.B. et al, (1991) Biochemistry, 30: 10832; Clackson, T. et al, (1991) Nature, 352: 624; Marks, J. D. et al, (1991), J. Mol. Biol, 222:581 ; Kang, A.S. et al, (1991) Proc. Natl. Acad. Sci. USA, 88:8363, and Smith, G. P. (1991) Current Opin. Biotechnol, 2:668).

[0192] In this regard, bacteriophage (phage) display is one well known technique which allows one to screen large polypeptide libraries to identify member(s) of those libraries which are capable of specifically binding to a target polypeptide, CDK8 polypeptide. Phage display is a technique by which variant polypeptides are displayed as fusion proteins to the coat protein on the surface of bacteriophage particles (Scott, J.K. and Smith, G. P. (1990) Science, 249: 386). The utility of phage display lies in the fact that large libraries of selectively randomized protein variants (or randomly cloned cDNAs) can be rapidly and efficiently sorted for those sequences that bind to a target molecule with high affinity. Display of peptide (Cwirla, S. E. et al, (1990) Proc. Natl. Acad. Sci. USA, 87:6378) or protein (Lowman, H.B. et al, (1991) Biochemistry, 30: 10832; Clackson, T. et al, (1991) Nature, 352: 624; Marks, J. D. et al, (1991), J. Mol. Biol, 222:581 ; Kang, A.S. et al, (1991) Proc. Natl. Acad. Sci. USA, 88:8363) libraries on phage have been used for screening millions of polypeptides or oligopeptides for ones with specific binding properties (Smith, G. P. (1991) Current Opin. Biotechnol, 2:668). Sorting phage libraries of random mutants requires a strategy for constructing and propagating a large number of variants, a procedure for affinity purification using the target receptor, and a means of evaluating the results of binding enrichments. U.S. Patent Nos. 5,223,409, 5,403,484, 5,571,689, and 5,663, 143.

[0193] Although most phage display methods have used filamentous phage, lambdoid phage display systems (WO 95/34683; U.S. 5,627,024), T4 phage display systems (Ren et al, Gene, 215: 439 (1998); Zhu et al, Cancer Research, 58(15): 3209-3214 (1998); Jiang et al, Infection & Immunity, 65(1 1): 4770-4777 (1997); Ren et al, Gene, 195(2):303-31 1 (1997); Ren, Protein Sci., 5: 1833 (1996); Efimov et al, Virus Genes, 10: 173 (1995)) and T7 phage display systems (Smith and Scott, Methods in Enzymology, 217: 228- 257 (1993); U.S. 5,766,905) are also known. [0194] Additional improvements enhance the ability of display systems to screen peptide libraries for binding to selected target molecules and to display functional proteins with the potential of screening these proteins for desired properties. Combinatorial reaction devices for phage display reactions have been developed (WO 98/14277) and phage display libraries have been used to analyze and control bimolecular interactions (WO 98/20169; WO 98/20159) and properties of constrained helical peptides (WO 98/20036). WO 97/35196 describes a method of isolating an affinity ligand in which a phage display library is contacted with one solution in which the ligand will bind to a target molecule and a second solution in which the affinity ligand will not bind to the target molecule, to selectively isolate binding ligands. WO 97/46251 describes a method of biopanning a random phage display library with an affinity purified antibody and then isolating binding phage, followed by a micropanning process using microplate wells to isolate high affinity binding phage. The use of Staphylococcus aureus protein A as an affinity tag has also been reported (Li et ah, (1998) Mol Biotech., 9: 187). WO 97/47314 describes the use of substrate subtraction libraries to distinguish enzyme specificities using a combinatorial library which may be a phage display library. A method for selecting enzymes suitable for use in detergents using phage display is described in WO

97/09446. Additional methods of selecting specific binding proteins are described in U.S. Patent Nos.

5,498,538, 5,432,018, and WO 98/15833.

[0195] Methods of generating peptide libraries and screening these libraries are also disclosed in U.S. Patent Nos. 5,723,286, 5,432,018, 5,580,717, 5,427,908, 5,498,530, 5,770,434, 5,734,018, 5,698,426, 5,763, 192, and 5,723,323.

D. Small molecules

[0196] Provided herein are small molecules for use as a CDK8 small molecule antagonist. In some embodiments, the CDK8 small molecule antagonist is flavopiridol or derivative thereof. In some

embodiments, the CDK8 small molecule antagonist is ABT-869 or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is AST-487 or derivative thereof. In some embodiments, the CDK8 small molecule BMS-387032/SNS032 or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is BIRB-796 or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is CP-724714 or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is sorafenib or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is staurosporine or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is cortistatin or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is cortistatin A or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is a steroidal alkaloid or derivative thereof. In some embodiments, the CDK8 small molecule antagonist is a small molecule kinase inhibitor disclosed in Karman M.W. et al. , Nature Biotech. 26(1): 127-132 (2008), Schneider E.V. et al., J. Mol. Biol. 412:251-266 (201 1), Cee V.J. et al, Angew. Chem. Int. Ed. 48:8952-8957 (2009), which are incorporated by reference in their entireties. Methods of screening for CDK8 small molecule antagonists are known in the art and described in Karman M.W. et al, Nature Biotech. 26(1): 127-132 (2008), Schneider E.V. et al, J. Mol Biol. 412:251-266 (201 1), Cee V.J. et al, Angew. Chem. Int. Ed. 48:8952-8957 (2009), which are incorporated by reference in their entireties.

[0197] Small molecules are preferably organic molecules other than binding polypeptides or antibodies as defined herein that bind, preferably specifically, to CDK8 polypeptide as described herein. Organic small molecules may be identified and chemically synthesized using known methodology (see, e.g., PCT

Publication Nos. WOOO/00823 and WOOO/39585). Organic small molecules are usually less than about 2000 Daltons in size, alternatively less than about 1500, 750, 500, 250 or 200 Daltons in size, wherein such organic small molecules that are capable of binding, preferably specifically, to a polypeptide as described herein may be identified without undue experimentation using well known techniques. In this regard, it is noted that techniques for screening organic small molecule libraries for molecules that are capable of binding to a polypeptide target are well known in the art (see, e.g., PCT Publication Nos. WOOO/00823 and

WOOO/39585). Organic small molecules may be, for example, aldehydes, ketones, oximes, hydrazones, semicarbazones, carbazides, primary amines, secondary amines, tertiary amines, N-substituted hydrazines, hydrazides, alcohols, ethers, thiols, thioethers, disulfides, carboxylic acids, esters, amides, ureas, carbamates, carbonates, ketals, thioketals, acetals, thioacetals, aryl halides, aryl sulfonates, alkyl halides, alkyl sulfonates, aromatic compounds, heterocyclic compounds, anilines, alkenes, alkynes, diols, amino alcohols, oxazolidines, oxazolines, thiazolidines, thiazolines, enamines, sulfonamides, epoxides, aziridines, isocyanates, sulfonyl chlorides, diazo compounds, acid chlorides, or the like.

E. Antagonist Polynucleotides

[0198] Provided are polynucleotide CDK8 antagonists for use in any of the methods described herein. In some embodiments, the polynucleotide CDK8 antagonists is AGCCAAGAGGAAAGAUGGG (SEQ ID NO: l), GCGAAUUACUCAGAACAG (SEQ ID NO:2), AGGUGUUUCUGUCUCAUGC (SEQ ID NO:3), UAGAAGGAACUGGGAUCUC (SEQ ID NO:4), GAATGGTGAAGTCACTATTAT (SEQ ID NO:5), CCCGATTATTTAATTCACCTT (SEQ ID NO:7), CAGGGATTTGAAACCTGCTAA (SEQ ID NO:8); shNanog, GCCAGTGATTTGGAGGTGAAT (SEQ ID NO:9), CAAAACTAGTAATCCTTATTT (SEQ ID NO: 12), CCCTTACCCAAAACGAGAATT (SEQ ID NO: 13), CCCATCTTTCCTCTTGGCTT (SEQ ID NO: 14), CTGTTCTGAGGTAATTCGCT (SEQ ID NO: 15), GCATGAGACAGAAACACCCTT (SEQ ID NO: 16), GAGATCCCAGTTCCTTCTAT (SEQ ID NO: 17), and/or GUUUUUFCCGGUUGUCAAA (SEQ ID NO: 18). In some embodiments, the polynucleotide CDK8 antagonist is a polynucleotide CDK8 antagonist disclosed in US 2004/0180848.

[0199] The polynucleotide may be an antisense nucleic acid and/or a ribozyme. The antisense nucleic acids comprise a sequence complementary to at least a portion of an RNA transcript of a CDK8 gene. However, absolute complementarity, although preferred, is not required. [0200] A sequence "complementary to at least a portion of an RNA," referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded CDK8 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of

complementarity and the length of the antisense nucleic acid. Generally, the larger the hybridizing nucleic acid, the more base mismatches with a CDK8 RNA it may contain and still form a stable duplex (or triplex as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

[0201] Polynucleotides that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus, oligonucleotides complementary to either the 5'- or 3 '-non-translated, non-coding regions of the CDK8 gene, could be used in an antisense approach to inhibit translation of endogenous CDK8 mRNA. Polynucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense polynucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of CDK8 mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

[0202] In one embodiment, the CDK8 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of the CDK8 gene. Such a vector would contain a sequence encoding the CDK8 antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others know in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding CDK8, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al, Cell 22:787-797 (1980), the herpes thymidine promoter (Wagner et al, Proc. Natl. Acad. Sci. U.S.A. 78: 1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster et al, Nature 296:39-42 (1982)), etc. F. Antibody and Binding Polypeptide Variants

[0203] In certain embodiments, amino acid sequence variants of the antibodies and/or the binding polypeptides provided herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of the antibody and/or binding polypeptide. Amino acid sequence variants of an antibody and/or binding polypeptides may be prepared by introducing appropriate

modifications into the nucleotide sequence encoding the antibody and/or binding polypeptide, or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into and/or substitutions of residues within the amino acid sequences of the antibody and/or binding polypeptide. Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g., target-binding.

[0204] In certain embodiments, antibody variants and/or binding polypeptide variants having one or more amino acid substitutions are provided. Sites of interest for substitutional mutagenesis include the HVRs and FRs. Conservative substitutions are shown in Table 1 under the heading of "conservative substitutions." More substantial changes are provided in Table 1 under the heading of "exemplary substitutions," and as further described below in reference to amino acid side chain classes. Amino acid substitutions may be introduced into an antibody and/or binding polypeptide of interest and the products screened for a desired activity, e.g., retained/improved antigen binding, decreased immunogenicity, or improved ADCC or CDC.

TABLE 1

Original Residue Exemplary Substitutions Preferred Substitutions

Pro (P) Ala Ala

Ser (S) Thr Thr

Thr (T) Val; Ser Ser

Trp (W) Tyr; Phe Tyr

Tyr (Y) Trp; Phe; Thr; Ser Phe

Val (V) He; Leu; Met; Phe; Ala; Norleucine Leu

[0205] Amino acids may be grouped according to common side-chain properties:

(1) hydrophobic: Norleucine, Met, Ala, Val, Leu, He;

(2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin;

(3) acidic: Asp, Glu;

(4) basic: His, Lys, Arg;

(5) residues that influence chain orientation: Gly, Pro;

(6) aromatic: Trp, Tyr, Phe.

[0206] Non-conservative substitutions will entail exchanging a member of one of these classes for another class.

[0207] One type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g., a humanized or human antibody). Generally, the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and/or will have substantially retained certain biological properties of the parent antibody. An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display -based affinity maturation techniques such as those described herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g., binding affinity).

[0208] Alterations (e.g., substitutions) may be made in HVRs, e.g., to improve antibody affinity. Such alterations may be made in HVR "hotspots," i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol. 207: 179-196 (2008)), and/or SDRs (a-CDRs), with the resulting variant VH or VL being tested for binding affinity. Affinity maturation by constructing and reselecting from secondary libraries has been described, e.g., in Hoogenboom et al, in METHODS IN MOL. BIOL. 178: 1-37 (O'Brien et al, ed., Human Press, Totowa, NJ, (2001).) In some embodiments of affinity maturation, diversity is introduced into the variable genes chosen for maturation by any of a variety of methods (e.g., error-prone PCR, chain shuffling, or oligonucleotide- directed mutagenesis). A secondary library is then created. The library is then screened to identify any antibody variants with the desired affinity. Another method to introduce diversity involves HVR-directed approaches, in which several HVR residues (e.g., 4-6 residues at a time) are randomized. HVR residues involved in antigen binding may be specifically identified, e.g., using alanine scanning mutagenesis or modeling. CDR-H3 and CDR-L3 in particular are often targeted.

[0209] In certain embodiments, substitutions, insertions, or deletions may occur within one or more HVRs so long as such alterations do not substantially reduce the ability of the antibody to bind antigen. For example, conservative alterations (e.g., conservative substitutions as provided herein) that do not substantially reduce binding affinity may be made in HVRs. Such alterations may be outside of HVR "hotspots" or SDRs. In certain embodiments of the variant VH and VL sequences provided above, each HVR either is unaltered, or contains no more than one, two or three amino acid substitutions.

[0210] A useful method for identification of residues or regions of the antibody and/or the binding polypeptide that may be targeted for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells (1989) Science, 244: 1081- 1085. In this method, a residue or group of target residues (e.g., charged residues such as arg, asp, his, lys, and glu) are identified and replaced by a neutral or negatively charged amino acid (e.g., alanine or polyalanine) to determine whether the interaction of the antibody with antigen is affected. Further substitutions may be introduced at the amino acid locations demonstrating functional sensitivity to the initial substitutions. Alternatively, or additionally, a crystal structure of an antigen-antibody complex to identify contact points between the antibody and antigen. Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution. Variants may be screened to determine whether they contain the desired properties.

[0211] Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N- terminal methionyl residue. Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g., for ADEPT) or a polypeptide which increases the serum half-life of the antibody.

G. Antibody and Binding Polypeptide Derivatives

[0212] In certain embodiments, an antibody and/or binding polypeptide provided herein may be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available. The moieties suitable for derivatization of the antibody and/or binding polypeptide include but are not limited to water soluble polymers. Non-limiting examples of water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n- vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof.

Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water. The polymer may be of any molecular weight, and may be branched or unbranched. The number of polymers attached to the antibody and/or binding polypeptide may vary, and if more than one polymer is attached, they can be the same or different molecules. In general, the number and/or type of polymers used for

derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody and/or binding polypeptide to be improved, whether the antibody derivative and/or binding polypeptide derivative will be used in a therapy under defined conditions, etc.

[0213] In another embodiment, conjugates of an antibody and/or binding polypeptide to nonproteinaceous moiety that may be selectively heated by exposure to radiation are provided. In one embodiment, the nonproteinaceous moiety is a carbon nanotube (Kam et ah, Proc. Natl. Acad. Sci. USA 102: 11600- 1 1605 (2005)). The radiation may be of any wavelength, and includes, but is not limited to, wavelengths that do not harm ordinary cells, but which heat the nonproteinaceous moiety to a temperature at which cells proximal to the antibody and/or binding polypeptide-nonproteinaceous moiety are killed.

H. Recombinant Methods and Compositions

[0214] Antibodies and/or binding polypeptides may be produced using recombinant methods and compositions, e.g., as described in U.S. Patent No. 4,816,567. In one embodiment, isolated nucleic acid encoding an anti-CDK8 antibody. Such nucleic acid may encode an amino acid sequence comprising the VL and/or an amino acid sequence comprising the VH of the antibody (e.g., the light and/or heavy chains of the antibody). In a further embodiment, one or more vectors (e.g., expression vectors) comprising such nucleic acid encoding the antibody and/or binding polypeptide are provided. In a further embodiment, a host cell comprising such nucleic acid is provided. In one such embodiment, a host cell comprises (e.g. , has been transformed with): (1) a vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and an amino acid sequence comprising the VH of the antibody, or (2) a first vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and a second vector comprising a nucleic acid that encodes an amino acid sequence comprising the VH of the antibody. In one embodiment, the host cell is eukaryotic, e.g., a Chinese Hamster Ovary (CHO) cell or lymphoid cell (e.g., Y0, NS0, Sp20 cell). In one embodiment, a method of making an antibody such as an anti-CDK8 antibody and/or binding polypeptide is provided, wherein the method comprises culturing a host cell comprising a nucleic acid encoding the antibody and/or binding polypeptide, as provided above, under conditions suitable for expression of the antibody and/or binding polypeptide, and optionally recovering the antibody and/or polypeptide from the host cell (or host cell culture medium).

[0215] For recombinant production of an antibody such as an anti-CDK8 antibody and/or a binding polypeptide, nucleic acid encoding the antibody and/or the binding polypeptide, e.g., as described above, is isolated and inserted into one or more vectors for further cloning and/or expression in a host cell. Such nucleic acid may be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).

[0216] Suitable host cells for cloning or expression of vectors include prokaryotic or eukaryotic cells described herein. For example, antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed. For expression of antibody fragments and polypeptides in bacteria, see, e.g., U.S. Patent Nos. 5,648,237, 5,789,199, and 5,840,523. (See also Charlton, METHODS IN MOL. BIOL., Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ, 2003), pp. 245-254, describing expression of antibody fragments in E. coli.) After expression, the antibody may be isolated from the bacterial cell paste in a soluble fraction and can be further purified.

[0217] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for vectors, including fungi and yeast strains whose glycosylation pathways have been "humanized," resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22: 1409- 1414 (2004), and Li et al, Nat. Biotech. 24:210-215 (2006).

[0218] Suitable host cells for the expression of glycosylated antibody and/or glycosylated binding polypeptides are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera frugiperda cells.

[0219] Plant cell cultures can also be utilized as hosts. See, e.g., US Patent Nos. 5,959,177, 6,040,498, 6,420,548, 7, 125,978, and 6,417,429 (describing PLANTIBODIES™ technology for producing antibodies in transgenic plants).

[0220] Vertebrate cells may also be used as hosts. For example, mammalian cell lines that are adapted to grow in suspension may be useful. Other examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7); human embryonic kidney line (293 or 293 cells as described, e.g., in Graham et al, J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK); mouse Sertoli cells (TM4 cells as described, e.g., in Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor (MMT 060562); TRI cells, as described, e.g., in Mather et al, Annals N. Y. Acad. Sci. 383:44-68 (1982); MRC 5 cells; and FS4 cells. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR^" CHO cells (Urlaub et al, Proc. Natl. Acad. Sci. USA 77:4216 (1980)); and myeloma cell lines such as Y0, NS0 and Sp2/0. For a review of certain mammalian host cell lines suitable for antibody production and/or binding polypeptide production, see, e.g., Yazaki and Wu, METHODS IN MOL. BIOL., Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003). [0221] While the description relates primarily to production of antibodies and/or binding polypeptides by culturing cells transformed or transfected with a vector containing antibody- and binding polypeptide- encoding nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare antibodies and/or binding polypeptides. For instance, the appropriate amino acid sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et ah, Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc, 85:2149-2154 (1963)]. In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the antibody and/or binding polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the desired antibody and/or binding polypeptide.

///. Methods of Screening and/or Identifying CDK8 Antagonists With Desired Function

[0222] Techniques for generating CDK8 antagonists such as antibodies, binding polypeptides, and/or small molecules have been described above. Additional CDK8 antagonists such as anti-CDK8 antibodies, binding polypeptides, and/or small molecules provided herein may be identified, screened for, or characterized for their physical/chemical properties and/or biological activities by various assays known in the art.

[0223] Provided herein are methods of screening for and/or identifying a CDK8 antagonist which promotes cell differentiation said method comprising: contacting a reference cell, wherein the reference cell is a stem cell and/or a cancer stem cell, with a CDK8 candidate antagonist, wherein the CDK8 candidate antagonist binds CDK8, and whereby differentiation of the reference cell into a differentiated cell identifies the CDK8 candidate antagonist as promoting cell differentiation. In some embodiments, the reference cell is a cancer tern cell. In some embodiments, the differentiated cell is a goblet cell and/or enterocyte cell. In some embodiments, the CDK8 candidate antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 candidate antagonist induces cancer cell cycle arrest, inhibits cancer cell proliferation, and/or promotes cancer cell death.

[0224] Provided herein are methods of screening for and/or identifying a CDK8 antagonist which alters a CDK8 gene signature said method comprising: (a) contacting a reference cell with a CDK8 candidate antagonist, wherein the CDK8 candidate antagonist binds CDK8, (b) determining expression levels of one or more biomarkers of a CDK8 gene signature at one time-point and a second time-point, wherein differential expression levels of one or more biomarkers of a CDK8 gene signature identifies the CDK8 candidate antagonist as a CDK8 antagonist In some embodiments, the CDK8 candidate antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 candidate antagonist induces cancer cell cycle arrest, inhibits cancer cell proliferation, and/or promotes cancer cell death. [0225] In some embodiments of any of the articles of manufacture, the one or more biomarkers of the CDK8 gene signature comprises one or more genes listed in Table 2 and/or Table 3. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more ES cell-related genes. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more MYC ES target genes. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes.

[0226] In some embodiments of any of the methods of screening for and/or identifying an CDK8 antagonist, the cancer cell, cancer tissue, or cancer sample is bladder cancer, pancreatic cancer, lung cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, head & neck cancer, kidney cancer, ovarian cancer, hypopharyngeal, prostate cancer, esophageal, hepatocellular carcinoma, and/or urinary cancer. In some embodiments of any of the methods of screening for and/or identifying an CDK8 antagonist, the cancer cell, cancer tissue, or cancer sample is from a cancer selected from the group of bladder cancer, pancreatic cancer, lung cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, head & neck cancer, kidney cancer, ovarian cancer, and/or urinary cancer. In some embodiments, the cancer cell, cancer tissue, or cancer sample is from a cancer selected from the group of bladder cancer, pancreatic cancer, endometrial cancer, head & neck cancer, kidney cancer, ovarian cancer, and/or urinary cancer.

[0227] In some embodiments of any of the methods of screening for and/or identifying an CDK8 antagonist, differential expression levels of one or more biomarkers of a CDK8 gene signature is elevated expression. In some embodiments, elevated expression refers to an overall increase of about any of 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater, in the level ofbiomarker (e.g., protein or nucleic acid (e.g., gene or mR A)), detected by standard art known methods such as those described herein, as compared to a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In certain embodiments, the elevated expression refers to the increase in expression level/amount of a biomarker in the sample wherein the increase is at least about any of 1.5X, 1.75X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 25X, 50X, 75X, or 100X the expression level/amount of the respective biomarker in a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In some embodiments, elevated expression refers to an overall increase of greater than about 1.5 fold, about 1.75 fold, about 2 fold, about 2.25 fold, about 2.5 fold, about 2.75 fold, about 3.0 fold, or about 3.25 fold as compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene).

[0228] In some embodiments of any of the methods of screening for and/or identifying an CDK8 antagonist, differential expression levels of one or more biomarkers of a CDK8 gene signature is reduced expression. In some embodiments, reduced expression refers to an overall reduction of about any of 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater, in the level ofbiomarker (e.g. , protein or nucleic acid (e.g. , gene or mRNA)), detected by standard art known methods such as those described herein, as compared to a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue. In certain embodiments, reduced expression refers to the decrease in expression level/amount of a biomarker in the sample wherein the decrease is at least about any of 0.9X, 0.8X, 0.7X, 0.6X, 0.5X, 0.4X, 0.3X, 0.2X, 0.1X, 0.05X, or 0.01X the expression level/amount of the respective biomarker in a reference sample, reference cell, reference tissue, control sample, control cell, or control tissue.

[0229] The growth inhibitory effects of a CDK8 antagonist described herein may be assessed by methods known in the art, e.g. , using cells which express CDK8 either endogenously or following transfection with the respective gene(s). For example, appropriate tumor cell lines, and CDK8 polypeptide-transfected cells may be treated with a CDK8 antagonist described herein at various concentrations for a few days (e.g., 2-7) days and stained with crystal violet or MTT or analyzed by some other colorimetric assay. Another method of measuring proliferation would be by comparing ³H-thymidine uptake by the cells treated in the presence or absence an antibody, binding polypeptide or small molecule of the invention. After treatment, the cells are harvested and the amount of radioactivity incorporated into the DNA quantitated in a scintillation counter. Appropriate positive controls include treatment of a selected cell line with a growth inhibitory antibody known to inhibit growth of that cell line. Growth inhibition of tumor cells in vivo can be determined in various ways known in the art.

[0230] Methods of determining the distribution of cell cycle stage, level of cell proliferation, and/or level of cell death are known in the art and are described in the examples herein. In some embodiments, cancer cell cycle arrest is arrest in Gl .

[0231] In some embodiments, the CDK8 antagonist will inhibit cancer cell proliferation of the cancer cell, cancer tissue, or cancer sample in vitro or in vivo by about 25-100% compared to the untreated cancer cell, cancer tissue, or cancer sample, more preferably, by about 30-100%, and even more preferably by about 50- 100% or about 70- 100%. For example, growth inhibition can be measured at a CDK8 antagonist concentration of about 0.5 to about 30 μg/ml or about 0.5 nM to about 200 nM in cell culture, where the growth inhibition is determined 1-10 days after exposure of the tumor cells to the CDK8 candidate antagonist. The CDK8 antagonist is growth inhibitory in vivo if administration of the CDK8 candidate antagonist at about 1 μg/kg to about 100 mg/kg body weight results in reduction in tumor size or reduction of tumor cell proliferation within about 5 days to 3 months from the first administration of the CDK8 candidate antagonist, preferably within about 5 to 30 days.

[0232] To select for a CDK8 antagonists which induces cancer cell death, loss of membrane integrity as indicated by, e.g., propidium iodide (PI), trypan blue or 7AAD uptake may be assessed relative to a reference. A PI uptake assay can be performed in the absence of complement and immune effector cells. CDK8-expressing tumor cells are incubated with medium alone or medium containing the appropriate a CDK8 antagonist. The cells are incubated for a 3-day time period. Following each treatment, cells are washed and aliquoted into 35 mm strainer-capped 12 x 75 tubes (1 ml per tube, 3 tubes per treatment group) for removal of cell clumps. Tubes then receive PI (10 μg/ml). Samples may be analyzed using a

FACSCAN® flow cytometer and FACSCONVERT® CellQuest software (Becton Dickinson). Those CDK8 antagonists that induce statistically significant levels of cell death as determined by PI uptake may be selected as cell death-inducing antibodies, binding polypeptides or small molecules.

[0233] To screen for CDK8 antagonists which bind to an epitope on or interact with a polypeptide bound by an antibody of interest, a routine cross-blocking assay such as that described in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be performed. This assay can be used to determine if a candidate CDK8 antagonist binds the same site or epitope as a known antibody. Alternatively, or additionally, epitope mapping can be performed by methods known in the art. For example, the antibody and/or binding polypeptide sequence can be mutagenized such as by alanine scanning, to identify contact residues. The mutant antibody is initially tested for binding with polyclonal antibody and/or binding polypeptide to ensure proper folding. In a different method, peptides corresponding to different regions of a polypeptide can be used in competition assays with the candidate antibodies and/or polypeptides or with a candidate antibody and/or binding polypeptide and an antibody with a characterized or known epitope.

[0234] In some embodiments of any of the methods of screening and/or identifying, the CDK8 candidate antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 candidate antagonist is an antibody. In some embodiments, the CDK8 antagonist is a small molecule.

[0235] In one aspect, a CDK8 antagonist is tested for its antigen binding activity, e.g., by known methods such as ELISA, Western blot, etc.

K. Pharmaceutical Formulations

[0236] Pharmaceutical formulations of a CDK8 antagonist as described herein are prepared by mixing such antibody having the desired degree of purity with one or more optional pharmaceutically acceptable carriers (REMINGTON'S PHARMA. SCI. 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. In some embodiments, the CDK8 antagonist is a small molecule, an antibody, binding polypeptide, and/or polynucleotide. Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride;

benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt- forming counter- ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG). Exemplary pharmaceutically acceptable carriers herein further include insterstitial drug dispersion agents such as soluble neutral-active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20 (HYLENEX^®, Baxter International, Inc.). Certain exemplary sHASEGPs and methods of use, including rHuPH20, are described in US Patent Publication Nos. 2005/0260186 and 2006/0104968. In one aspect, a sHASEGP is combined with one or more additional glycosaminoglycanases such as chondroitinases.

[0237] Exemplary lyophilized formulations are described in US Patent No. 6,267,958. Aqueous antibody formulations include those described in US Patent No. 6,171,586 and WO2006/044908, the latter formulations including a histidine-acetate buffer.

[0238] The formulation herein may also contain more than one active ingredients as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended.

[0239] Active ingredients may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in REMINGTON'S PHARMA. SCI. 16th edition, Osol, A. Ed. (1980).

[0240] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the CDK8 antagonist, which matrices are in the form of shaped articles, e.g., films, or microcapsules.

[0241] The formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.

L. Articles of Manufacture

[0242] In another aspect of the invention, an article of manufacture containing materials useful for the treatment, prevention and/or diagnosis of the disorders described above is provided. The article of manufacture comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is by itself or combined with another composition effective for treating, preventing and/or diagnosing the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is a CDK8 antagonist described herein. The label or package insert indicates that the composition is used for treating the condition of choice. Moreover, the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the composition comprises a CDK8 antagonist; and (b) a second container with a composition contained therein, wherein the composition comprises a further cytotoxic or otherwise therapeutic agent.

[0243] In some embodiments, the article of manufacture comprises a container, a label on said container, and a composition contained within said container; wherein the composition includes one or more reagents (e.g., primary antibodies that bind to one or more biomarkers or probes and/or primers to one or more of the biomarkers described herein), the label on the container indicating that the composition can be used to evaluate the presence of one or more biomarkers in a sample, and instructions for using the reagents for evaluating the presence of one or more biomarkers in a sample. The article of manufacture can further comprise a set of instructions and materials for preparing the sample and utilizing the reagents. In some embodiments, the article of manufacture may include reagents such as both a primary and secondary antibody, wherein the secondary antibody is conjugated to a label, e.g., an enzymatic label. In some embodiments, the article of manufacture one or more probes and/or primers to one or more of the biomarkers of a CDK8 gene signature described herein.

[0244] In some embodiments of any of the articles of manufacture, the one or more biomarkers of the CDK8 gene signature comprises one or more genes listed in Table 2 and/or Table 3. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more ES cell-related genes. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more MYC ES target genes. In some embodiments, the one or more genes listed in Table 2 and/or Table 3 comprises one or more p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes.

[0245] In some embodiments of any of the articles of manufacture, the articles of manufacture comprise primers.

[0246] In some embodiments of any of the article of manufacture, the CDK8 antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide. In some embodiments, the CDK8 antagonist is a small molecule. In some embodiments, the small molecule is a small molecule kinase inhibitor. In some embodiments, the small molecule kinase inhibitor is selected from the group consisting of flavopiridol, ABT- 869, AST-487, BMS-387032/SNS032, BIRB-796, sorafenib, staurosporine, cortistatin, cortistatin A, and/or a steroidal alkaloid or derivative thereof. In some embodiments, the CDK8 antagonist is an antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is an antibody fragment and the antibody fragment binds CDK8. [0247] The article of manufacture in this embodiment of the invention may further comprise a package insert indicating that the compositions can be used to treat a particular condition. Alternatively, or additionally, the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0248] Other optional components in the article of manufacture include one or more buffers (e.g., block buffer, wash buffer, substrate buffer, etc), other reagents such as substrate (e.g., chromogen) which is chemically altered by an enzymatic label, epitope retrieval solution, control samples (positive and/or negative controls), control slide(s) etc.

[0249] It is understood that any of the above articles of manufacture may include an immunoconjugate described herein in place of or in addition to a CDK8 antagonist.

EXAMPLES

[0250] The following are examples of methods and compositions of the invention. It is understood that various other embodiments may be practiced, given the general description provided above.

Materials and Methods for the Examples

Cell Lines

[0251] HT-29 and COLO 205 human colon cancer cells and 293T human embryonic kidney packaging cells were grown in DMEM (high glucose), 10% Fetal Bovine Serum (FBS), and 1% Penicillin- Streptomycin (Invitrogen). Rl mouse embryonic stem (ES) cells (courtesy of Merone Roose-Girma, Genentech) , which were derived from a (129Xl/SvJ-129Sl/SvImJ)Fl mouse embryo (Nagy A. et al, Proc Natl Acad Sci USA 90:8424-8 (1993)) were grown on 0.1% gelatin in the following media: Knockout DMEM (Invitrogen), 15% FBS, 1000 units/ml leukemia inhibitory factor (LIF; Millipore), 5 mM HEPES (MP Biomedicals), 1.4 mM L-Glutamine (MP Biomedicals), 0.05 mM 2-Mercaptoethanol (Sigma), 10 μg/ml Gentamicin (Quality Biological), and 1% Penicillin- Streptomycin (Invitrogen). TCI ES cells, which were derived from

129S6/SvEvTac mice (Deng C. et al, Cell 84:91 1-21(1996)), and GSI-1 ES cells, which were derived from 129Xl/SvJ mice (Genome Systems), were grown on mitotically inactivated mouse embryonic fibroblast cells (MEFs) in the following media: Knockout DMEM, 15% FBS, 1000 units/ml LIF, 0.1 mM MEM Non- Essential Amino Acids (Gibco), 2 mM L-Glutamine, 0.1 mM 2-Mercaptoethanol, and 1% Penicillin- Streptomycin. To remove MEFs from downstream analyses, TCI and GSI-1 ES cells were re -plated on 0.1% gelatin prior to analysis. To differentiate the Rl ES cells, LIF was removed from the media and 5 μΜ retinoic acid (Sigma) was added (Rohwedel, J. et al, Cells Tissues Organs 165, 190-202 (1999)). All cell line stocks are maintained at Genentech and undergo genotyping to verify their identity every six months.

Infection/Transfection Procedures [0252] Short hairpin R As (shR As) and cDNA expression plasmids were expressed in HT-29, COLO 205, and Rl cells using a lentiviral packaging system. Briefly, 293T cells were transfected with pLKO. l- shRNA vector, pHush-shRNA vector, pHush-cDNA vector, or pLenti6.2-cDNA vector, along with pCMV- VSVG and pCMV-dR8.9 to make replication-incompetent lentiviral particles. Viral particles were added to cells with 5-8 μg/ml polybrene and spin infected at room temperature (1800 rpm, 30-45 minutes). Stable integration of shRNAs was selected with 6-8 μg/ml puromycin (for pLKO.1 Rl knockdown experiments) or with 2 μg/ml puromycin (for pHush xenograft knockdown experiments). Stable integration of cDNAs was selected with 10 μg/ml blasticidin (for pLenti6.2 MYC rescue experiments) or by flow sorting for GFP- positive cells (for pHush CDK8 rescue experiments). HT-29 cells were transiently transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen).

Xenograft Tumor Models

[0253] HT-29 and COLO 205 cells were infected with doxycycline-inducible pHush-shRNAs targeting CDK8 (or NTC control) and selected for stable integration with 2 μg/ml puromycin (Clontech). For each cell line, 5 x 10⁶ cells were injected subcutaneously into the backs of 26 female NCr nude mice (Taconic) to initiate tumor growth. The size of each tumor was measured using a calliper. Once tumors reached 225 mm³, the animals from each cell line were split into two groups. For each cell line, the first group of 13 mice was fed 5% sucrose in their water (control group) while the second group of 13 mice was fed 5% sucrose + 1 mg/ml doxycycline (Clontech) to induced hairpin expression. After 8 days (HT-29) or 12 days (COLO 205), three of the mice from each group were euthanized and the tumors were harvested for Western blot analysis. The remaining 10 mice per group were monitored until Day 16, and the tumor volume was measured every 3-4 days. In parallel, the weight of the mice was also measured and recorded. Tumor growth inhibition values were determined by an area under the curve calculation.

Human Colon Tissue Samples

[0254] Frozen normal human colon, colon tumors, and metastatic colon tumors were obtained from

Asterand, Integrated Laboratory Services, Cooperative Human Tissue Network, or ProteoGenex. Prior to Western blot analysis, each tumor was verified by a board certified pathologist (R.F.) to contain a high percentage of tumor cells.

Plasmids and RNAi Constructs

[0255] Human CDK8 cDNA (Origene) was cloned into pAcGP67 vector (BD Biosciences) that contained an N-terminal FLAG tag. FLAG-tagged CDK8 was PCR amplified and cloned into pSHUTTLE-CMV-TO and then Gateway recombined (Invitrogen) into pHush-GFP expression vector (Gray, D. C. et ah, BMC Biotechnol 7, 61 (2007)). Human MYC cDNA (Invitrogen) was cloned into pLenti6.2 vector by Gateway recombination (Invitrogen). The T58A and S62A mutations were introduced by QuikChange site directed mutagenesis kit (Agilent/Stratagene) and verified by sequencing. [0256] For the xenograft studies, a doxycycline-inducible pHush-shRNA system was utilized as described in Gray et ah, BMC Biotechnol. 7, 61 (2007). The pHush-shNTC control was obtained from David Davis (Genentech). The shCDK8 targeting sequence (GAATGGTGAAGTCACTATTAT (SEQ ID NO: 5)) was first cloned into the pSHUTTLE-Hl vector. Then the pSHUTTLE-H 1 -shRNA was Gateway (Invitrogen) recombined into a puromycin-selectable pHush vector (Gray, D. C. et ah, BMC Biotechnol 7, 61 (2007)). For the Rl ES cell experiments, the following shRNA target sequences in pLKO.1 vector were utilized (from Open Biosystems unless otherwise stated): shNTC, CAACAAGATGAAGAGCACCAA (Sigma (SEQ ID NO:6); shCdk8 -1, CCCGATTATTTAATTCACCTT (SEQ ID NO:7); shCdk8 -2,

CAGGGATTTGAAACCTGCTAA [mouse-specific] (SEQ ID NO: 8); shNanog,

GCCAGTGATTTGGAGGTGAAT (SEQ ID NO:9); shMedl2 -1, CCTCTCCCTTTGATGATCCTA (SEQ ID NO: 10); shMedl2 -2, CCGTGCGATTACCAATGCAAA (SEQ ID NO: 1 1). For the HT-29 colon cancer experiments, the following siRNA target sequences were utilized (from Ambion): siNTC (Negative Control #1); siCDK8 -1, CAAAACTAGTAATCCTTATTT (SEQ ID NO: 12); siCDK8 -2,

CCCTTACCCAAAACGAGAATT (SEQ ID NO: 13).

Antibodies

[0257] The following antibodies were utilized: ACTIN (clone C4; MP Biomedicals), CDK8 (clone C-19; Santa Cruz Biotechnology), NANOG (Millipore), OCT4 (Abeam), c-MYC (clone D84C12; Cell Signaling Technology), c-MYC-pT58 (Sigma), c-MYC-pS62 (Abeam), c-MYC-pT58/S62 (Abeam), Alexa Fluor 488 donkey anti-rabbit IgG (Invitrogen), Alexa Fluor 568 donkey anti-goat IgG (Invitrogen), CD44-PE/Cy5 (Biolegend), and CD133-PE (Miltenyi Biotec).

Histological, Immunohistochemical, and FACS analyses

[0258] HT-29 xenograft tumors were stained for alcian blue as described in Sheehan, Dezna C. and Hrapchak, Barbara B., THEORY AND PRACTICE OF HISTOTECHNOLOGY, 2d ed. (Mosby, St. Louis, 1980). Hematoxylin and eosin stained xenograft tumors analysis were performed by a clinical pathologist (R.F.) to determine the differentiation status. Immunohistochemistry of CDK8 was performed as previously described in Firestein, R. et al, Nature 455, 547-551 (2008). Rl ES cells were stained for alkaline phosphatase activity using an alkaline phosphatase detection kit (Millipore). To quantify the ES cell colonies, alkaline phosphatase positively stained colonies were manually counted under a low magnification microscope (each field was 24 mm²). A minimum of four different fields were counted and then averaged. For

immunofluorescence, cells were grown in 96-well, black-walled plates. Cells were fixed with 4%

paraformaldehyde for 5 min. and permeabilized/blocked with PBS containing 10% normal horse serum, 0.1% Triton X- 100. Primary antibody was added for 1 hour followed by secondary antibody for 30 minutes. Hoechst 33342 (Invitrogen) was added for 5 min. to stain nuclei. For FACS analysis, xenograft tumor cells were dissociated with collagenase for 30 minutes, washed in PBS + 2% FBS, stained 10 minutes for CD 133, CD44, and a mouse lineage antibody panel (BD Biosciences) to exclude mouse cells, and analyzed on a FACSCalibur flow cytometer (BD Biosciences).

Gene Expression Analysis

[0259] For quantitative RT-PCR, total RNA was isolated with the RNeasy mini kit (Qiagen). Reverse transcription followed by quantitative PCR was performed with the TaqMan one-step RT-PCR master mix using Taqman gene-specific probes (Applied Biosystems).

Microarray Hybridization

[0260] For microarray studies, total RNA was harvested from cells in triplicate using RNeasy mini kit with on-column DNase digestion (Qiagen). For HT-29 cells, RNA was harvested three days after siRNA transfection. For Rl cells, RNA was harvested at Day 8 or Day 13 after shRNA infection. RNA was quantified using UV-spec Nanodrop (Thermo Scientific) and then profiled on Agilent Bioanalyzer. RNA was amplified and hybridized to whole human or mouse genome 4x44K gene expression arrays according to manufacturer protocol (Agilent). Universal human or mouse reference RNA (Agilent/Stratagene) was used as reference control.

Microarray Data Analysis

CDK8-regulated genes in HT-29 cells

[0261] The microarray data output was a ratio of the sample RNA to the reference control RNA. Only genes with data in at least 70% of experiments were analyzed. Microarray data was log₂-transformed, mean centered, then zero-transformed on the siNTC samples. Genes that significantly changed upon siCDK8 in HT-29 cells were identified by carrying out a Student's /-test between all siNTC controls and all replicates of siCDK8 -1/-2. The top 1500 induced or repressed genes/probes were selected ( =0.001, Student's /-test between siNTC and two independent CDK8 siRNAs).

CDK8-regulated genes in Rl ES cells

[0262] The microarray data was processed in the same way as the HT-29 cells described above. The top 1500 genes/probes significantly changing upon shCdk8 at Day 8 in Rl cells were identified as described above for HT-29 cells ( =0.003, Student's /-test between shNTC and two independent CDK8 shRNAs).

Gene set enrichment/pathway analysis

[0263] Gene set enrichment analysis was carried out using Genomica (http://genomica.weizmann.ac.il/) as described in Segal, E. et al, Nat Genet 36, 1090- 1098 (2004). -values were determined by the

hypergeometric distribution. The following gene sets were used: gene ontology (Ashburner, M. et al. , Nat Genet 25, 25-29 (2000)), chromatin immunoprecipitation-microarray target gene sets for mouse ES cell transcription factors (Kim, J. et al, Cell 132, 1049- 1061 (2008)); and mouse ES cell-related and adult stem cell-related gene signatures (Wong, D. J. et al, Cell Stem Cell 2, 333-344 (2008)). Enrichment analysis for signalling pathways was carried out using Ingenuity Pathway Analysis (Ingenuity Systems,

www.ingenuity.com). -values were determined using a fisher exact test. Comparison to MED12 knockdown data

[0264] Focusing on the mediator component MED12-regulated gene as defined by Kagey et ah, Nature 467, 430-435 (2010), the gene expression pattern was compared to data following CDK8 or MED12 knockdown in ES cells, as well as to data following forced differentiation of ES cells and NANOG or OCT4 knockdown in ES cells from Gene Expression Omnibus accession GSE4189; Loh, Y. H. et ah, Nat Genet 38, 431-440 (2006)). To determine the similarity of the expression patterns, a Pearson correlation was calculated between the shMedl2 expression pattern from Kagey, M. H. et ah, Nature 467, 430-435 (2010) and the expression pattern from all other data sets.

Correlation of HT-29 CDK8-regulated signature to individual genes in colon cancer

[0265] The expression pattern of the top 1500 genes that change upon siCDK8 in HT-29 human colon cancer cells (the HT-29 CDK8 -regulated signature) was collapsed into a single expression value for each gene by subtracting the average log₂ expression value of each gene in siCDK8 samples from the average log₂ expression value in siNTC samples. CDK8-induced genes were positive values and CDK8-repressed genes were negative values. Expression of this signature was then correlated to the expression of individual genes in two primary human colon cancer expression data sets: 100 tumors from Gene Expression Omnibus accession GSE5206 and 130 tumors from Gene Logic. First, a Pearson correlation was calculated between the collapsed HT-29 CDK8 -regulated signature and the expression values for these genes in each tumor. This was essentially a score for the level of expression of the CDK8 -regulated signature in each tumor, where a high correlation value indicates high expression of the CDK8-induceu7repressed expression signature. Then a second Pearson correlation was calculated for each tumor between the Pearson value obtained in the first step and the expression of individual genes. High correlation values indicated a concordance between expression of the gene with expression of the CDK8 -regulated signature.

CDK8-induced MYC ES cell target gene expression in colon tumors

[0266] For comparison to CDK8 expression, CDK8-induced MYC ES cell target genes from HT-29 cells were selected out of microarray data from 227 primary human colon cancer tumors (Gene Logic). The average log₂ expression of the CDK8-induced MYC ES targets was calculated for each tumor, and the tumors were sorted from high to low average target gene expression (for comparison, the average expression of all MYC ES cell targets (Kim, J. et al., Cell 132, 1049-1061 (2008)) in each tumor was determined). The tumors were split into two groups by high versus low target gene expression, and CDK8 expression levels in each group were averaged. For correlation to differentiation status, CDK8-induced MYC ES cell target genes were selected out of microarray data from 213 primary human colon tumors that had known differentiation status (Gene Expression Omnibus accession GSE17538; (Smith JJ. et al, Gastroenterology 138:958-68 (2010)). The average expression of the targets was calculated for each tumor, and the tumors were sorted from high to low expression (the same procedure was also carried out for all MYC ES targets). The tumors were split into two groups by high versus low target gene expression, and the number of poorly differentiated tumors in each group was counted. The enrichment of poorly differentiated tumors in one group over the other was calculated with a fisher exact test using a 2x2 contingency table. For correlation to clinical outcome, the same procedure described above was carried out on 50 tumors that had undergone recurrence (Gene Expression Omnibus accession GSE14333; Jorissen R.N. et al, Colorectal Cancer. Clin Cancer Res 15:7642-51 (2009)). After splitting the tumors into high versus low expression of CDK8-induced MYC ES targets, the average time to recurrence was calculated for each group. For comparison, the same process was carried out for all MYC ES cell targets.

Example 1-Characterization of CDK8 Loss on Tumor Growth and Gene Expression

[0267] To characterize the effect of acute loss of CDK8 on tumor growth in vivo, an inducible short hairpin RNA (shRNA) system (Hoeflich, K. P. et al, Cancer Res 66, 999-1006 (2006)) was used to deplete endogenous CDK8 in fully formed tumors. shRNAs to CDK8 and a non-targeting control (shNTC) were introduced into two human colon cancer cell lines (HT-29 and COLO 205) and grown as xenograft tumors. These cell lines harbour genomic copy number gain and overexpression of CDK8 and were sensitive to CDK8 loss in vitro. Firestein, R. et al., Nature 455, 547-551 (2008). Xenograft tumor volume was measured over time (n = 10 mice per group). The tumor growth inhibition values were determined by an area under the curve calculation. As shown in Fig. 1A, doxycycline-induced acute knockdown of CDK8 protein in fully formed tumors led to profound growth inhibition in both HT-29 and COLO 205 xenograft tumors when compared to either the shNTC controls and the non-doxycycline induced shCDK8 tumors. No significant weight changes were observed throughout the duration of the study for any of the treatment groups, consistent with the notion that loss of CDK8 in the tumor itself was causing growth inhibition (data not shown). Knockdown of CDK8 in the tumors after doxycycline treatment was confirmed by both Western blot and immunohistochemistry (Fig. IB).

[0268] Initial immunohistochemical analyses revealed that HT-29 tumor cells with depleted CDK8 showed histological changes characterized by the formation of large cytoplasmic inclusions. Further morphological examination of these tumors showed that while the HT-29 and COLO 205 models normally grow as sheets of cells characteristic of poorly differentiated tumors, loss of CDK8 led to a well-differentiated tumor state in both tumor models (Fig. 1C). CDK8 depletion led to accumulation of mucin rich deposits in HT-29 xenografts, consistent with goblet cell differentiation, and led to well-formed glands with evidence of polarization in COLO 205 xenografts, consistent with enterocyte differentiation. In contrast, when CDK8 loss was induced in SW837 tumors, a colon cancer xenograft characterized by lack of CDK8 amplification and lower protein expression (Firestein R. et al., Nature 455:547-51 (2008)), little effect on tumor growth and differentiation was seen (data not shown).

[0269] It has been proposed that colon tumor growth may be maintained by a small population of "cancer stem cells" (Clarke M.F. et al., Cell 124: 11 1 1-5 (2006)). However, as shown herein, CDK8 was widely expressed in all xenograft tumor cells (Fig. IB), mimicking the broad expression pattern of CDK8 in primary colon tumors (Firestein R. et al, Int J Cancer 126:2863-73 (2010)). Further, CDK8 inhibition in xenograft tumors and in culture had little effect on the levels of the proposed colon cancer stem cell makers CD 133 and CD44 (O'Brien C.A. et al, Nature 445: 106- 10 (2007); Ricci-Vitiani L. et al, Nature 445: 1 1 1-5 (2007); Dalerba P. et al, Proc Natl Acad Sci USA 104: 10158-63(2007)) (data not shown). Together these observations demonstrate that CDK8 was required for tumor growth and maintenance of a de-differentiated state in vivo.

[0270] To gain insight into potential mechanisms for CDK8-mediated regulation of tumor growth and differentiation, the primary gene expression changes that occur after CDK8 knockdown in HT-29 cells was accessed using two independent small interfering RNAs (siRNAs) (Fig. ID). The expression of 1500 genes were changed in CDK8 depleted cells compared to the siNTC control, which included genes that were enriched in pathways implicated in CDK8 biology (p53 signalling (Donner, A. J. et al, Mol Cell 27, 121-133 (2007)), cell cycle, Wnt signalling (Firestein, R. et al, Nature 455, 547-551 (2008); Morris, E. J. et al, Nature 455, 552-556 (2008) and SMAD/BMP signalling (Alarcon, C. et al, Cell 139, 757-769 (2009)); Fig. IE and Table 2).

[0271] Given the effect of CDK8 loss on tumor differentiation (Fig. 1C), enrichment of defined embryonic stem cell-related and adult stem cell-related gene sets derived by integrating over 100 different expression profiles of a wide array of stem cells (Wong, D. J. et al, Cell Stem Cell 2, 333-344 (2008)) was evaluated. CDK8-induced genes were specifically enriched for ES cell-related genes, but not for adult stem cell-related genes (Fig. IE). This was unique to CDK8-induced genes, as CDK8-repressed genes showed no enrichment for ES or adult stem cell-related genes. Quantitative RT-PCR confirmed the reduced expression of multiple ES cell-related genes after CDK8 knockdown (Fig. 6). These observations indicated that CDK8 positively regulates an ES cell gene expression program in colon cancer cells and suggested a common role for CDK8 function in ES and cancer cells.

Example 2-Characterization of CDK8 in Embryonic Stem (ES) Cells

[0272] To directly test this hypothesis, CDK8 expression was characterized in murine ES cells subjected to forced differentiation by removal of leukaemia inhibitory factor (LIF) and addition of retinoic acid

(Rohwedel, J. et al, Cells Tissues Organs 165, 190-202 (1999)). Loss of ES pluripotency was marked by reduced alkaline phosphatase staining (Pease, S. et al, Dev Biol 141, 344-352 (1990)) and loss of expression of the ES cell core regulator NANOG (Fig. 2A, B). Concomitant with ES cell differentiation, that CDK8 levels were reduced at both the mRNA and protein level (Fig. 2C). To determine whether CDK8 was directly required to maintain ES cells in an undifferentiated state, murine ES cells were treated with shCdk8 or positive (shNanog) and negative (shNTC) controls. Loss of CDK8 in ES cells led to a significant reduction in ES cell pluripotency as evidenced by reduced alkaline phosphatase staining, reduced ES cell colony formation, and reduced NANOG and OCT4 protein levels 1 1 days after shRNA treatment (Fig. 2D, E, and data not shown). CDK8 inhibition in two additional murine ES cell lines, TCI and GSI-1, also significantly reduced ES cell pluripotency (Fig. 7). All three ES cell lines analyzed had a normal karyotype (data not shown) and were disomic for Cdk8 copy number (data not shown). To determine whether the observed ES cell differentiation was mediated directly by CDK8 and not an off-target effect, we rescued the RNAi phenotype by simultaneously expressing human CDK8 in ES cells treated with mouse-specific shCdk8. Expression of CDK8 was sufficient to prevent the cells from undergoing shCdk8-induced differentiation (Fig. 2F-H). These data indicate that CDK8 is required to maintain ES cells in an undifferentiated state, and similar to the observation in the tumor models, reduced CDK8 expression promotes differentiation.

[0273] To determine which transcriptional pathways CDK8 regulates in ES cells, gene expression analysis was conducted following CDK8 loss in Rl mouse ES cells both prior to the onset of differentiation (Day 8) and after differentiation (Day 13). The top 1500 genes that significantly changed upon CDK8 loss prior to differentiation at Day 8 were indentified (Fig. 3A and Table 3). Consistent with its observed effects on ES cell pluripotency, both CDK8-induced and CDK8-repressed gene signatures identified at the onset of differentiation (Day 8) were enriched for genes involved in ES cell function (Fig. 3A). Reduced expression of a subset of these ES cell-related genes (Andang, M. et al, Nature 451, 460-464 (2008); Glover, C. H. et al, PLoS Comput Biol 2, el 58 (2006)) after CDK8 knockdown was confirmed by quantitative RT-PCR (Fig. 3B). CDK8 -regulated genes maintained a very similar expression pattern post differentiation at Day 13 (Fig. 3A), suggesting that the gene expression program introduced prior to differentiation remained present after differentiation occurred. In contrast, the expression pattern of ES cells depleted of the Mediator component MED 12 was distinct from CDK8 knockdown cells (Fig. 8), suggesting that CDK8 and MED 12 regulate ES cell pluripotency via distinct mechanisms.

[0274] In ES cells, a small number of core transcription factors (NANOG, OCT4, SOX2, and c-MYC) and their downstream target genes were essential for maintaining the proliferative capacity and pluripotent state of ES cells. Young RA. Cell 144:940-54 (201 1); Cartwright, P. et al, Development 132, 885-896 (2005); Chambers, I. & Smith, A., Oncogene 23, 7150-7160 (2004). Target genes for NANOG, OCT4, and SOX2, identified through genome-wide chromatin immunoprecipitation experiments in mouse ES cells (Kim, J. et al, Cell 132, 1049-1061 (2008)), showed weak enrichment for CDK8-regulated genes in ES cells, while target genes for c-MYC (referred to as MYC from here on) were more strongly enriched (Fig. 3A).

Specifically, MYC ES cell targets were strongly enriched in CDK8-induced genes but not in CDK8- repressed genes. This suggested that CDK8 may regulate target gene expression of core transcription factors in ES cells by promoting MYC target gene expression.

[0275] To dissect the temporal relationship between CDK8 loss and the transcriptional output from MYC, OCT4 and NANOG, the expression of these essential transcriptional factors was examined at multiple time points before, during, and after the ES cells underwent CDK8-loss induced differentiation. MYC levels were specifically reduced (Days 6, 8) well before either phenotypic changes of differentiation or changes in NANOG and OCT4 levels were observed (Fig. 3C, D). Myc mRNA levels were either weakly reduced (Day 8) or unchanged (Day 13) upon CDK8 loss (Fig. 9C), suggesting that MYC was regulated by post- transcriptional mechanisms. A critical step in regulating MYC activity involves priming the protein for degradation or transcriptional activation by phosphorylation on threonine 58 (T58) and serine 62 (S62), respectively (Sears, R. et al, Genes Dev 14, 2501-2514 (2000); Sears, R. C, Cell Cycle 3, 1 133- 1 137 (2004)). Using phospho-specific antibodies to both T58-MYC and S62-MYC, a relative increase in the proportion of the unstable T58-phospho-specific MYC was found and a decrease in the active S62-phospho- specific MYC after CDK8 depletion (Fig. 3C, E and Fig. 9A, B). Conversely, overexpression of CDK8 in either shNTC or shCdk8 treated ES cells increased MYC protein levels (Fig. 2H). These data suggest that CDK8 regulates ES pluripotency by maintaining sufficient levels of active MYC protein, which in turn can alter the expression levels of specific MYC target genes.

[0276] Next the sufficiency of MYC for CDK8-mediated ES cell pluripotency was examined. Wildtype MYC, degradation resistant MYC^T58A, or inactive MYC^S62A was expressed in conjunction with CDK8 knockdown, and the ability of MYC protein levels was able to restore and rescue the differentiation phenotype caused by loss of CDK8. Exogenous expression of either wildtype MYC or MYC^T58A in ES cells, which increased MYC levels to that seen in control shNTC cells, partially rescued the loss of ES cell pluripotency imparted by CDK8 depletion (Fig. 4A, B). In contrast, expression of MYC^S62A, which disrupts the active phosphorylation site, increased total MYC levels but was unable to rescue the defect in pluripotency. These data reveal that CDK8 regulation of ES cell pluripotency was mediated through MYC. Example 3-Further Characterization of CDK8 Loss in Tumor Cells

[0277] To determine whether a common genetic circuitry underlies the ability of CDK8 to regulate both ES cell pluripotency and cancer, the effect of loss of CDK8 in human colon cancer cells on ES cell transcription factor related gene expression was evaluated. Similar to our findings in ES cells, CDK8-induced genes in colon cancer cells were more strongly enriched for MYC-mediated ES cell target genes than for OCT4, NANOG, and SOX2 ES cell targets (Fig. 5A). Quantitative RT-PCR confirmed the reduced expression of multiple MYC ES cell target genes after CDK8 knockdown in these colon cancer cells (Fig. 5B and Fig. 10). The data implied that CDK8 regulates a specific set of ES cell-related MYC target genes in both colon cancer and embryonic stem cells.

[0278] To characterize the interplay between CDK8 and MYC in human colon tumors, two independent cohorts of 100 and 130 human colon cancers were analyzed. Consistent with the observation that MYC targets were regulated by CDK8 in HT-29 colon cancer cells (Fig. 5A), increased MYC expression in both cohorts of human tumors was strongly associated with the presence of the HT-29 CDK8-regulated gene signature (Fig. 1 1). MYC overexpression can confer stem cell- like properties to epithelial cancer cells (Wong, D. J. et al, Cell Stem Cell 2, 333-344 (2008)), and a MYC-centric gene expression program was found to be similarly expressed in both ES cells and multiple tumor types. Kim, J. et al, Cell 143, 313-324 (2010). To determine whether CDK8 specifically regulates the subset of MYC target genes important for ES cell pluripotency in human tumors, the expression of the CDK8-induced MYC ES cell target genes was evaluated (identified in Fig. 5A and listed in Table 2). High CDK8 levels correlated with increased expression of the CDK8-induced MYC ES cell targets in colon tumors; in contrast, expression of the whole set of MYC ES target genes (Kim, J. et al, Cell 132, 1049- 1061 (2008)) was not associated with high CDK8 levels (Fig. 5C). Consistent with this, high CDK8 protein expression in primary and metastatic colon tumors was characterized by increased total and active S62-phosphorylated MYC when compared to the unstable T58-phosphorylated MYC (Fig. 5D). These data implied that the ability of CDK8 to regulate MYC in ES cells extends to human tumors as well.

[0279] Genetic signatures related to ES cell pluripotency have been found to predict high tumor grade and poor clinical outcome in several cancer types. Ben-Porath, I. et al, Nat Genet 40, 499-507 (2008); Wong, D. J. et al, Cell Stem Cell 2, 333-344 (2008); Kim, J. et al, Cell 143, 313-324 (2010). Consistent with these observations that CDK8 expression was important for maintaining tumors in a poorly differentiated state in vivo (Fig. 1C) and ES cells in an undifferentiated state (Fig. 2D), the CDK8-induced MYC ES cell signature was enriched in colon tumors characterized by both poor differentiation and poor patient outcome (Fig. 5E, F). Notably, this effect was CDK8 specific as signatures that include all MYC ES cell target genes were not found to be strongly associated with either tumor grade or patient survival (Fig. 5E, F). These data showed that CDK8 regulation of a MYC-centric ES cell signature was active and clinically defines a subset of colon cancers with poor differentiation and poor prognosis.

[0280] Here a novel role for the CDK8 oncogene in regulating tumor differentiation and stem cell

Pluripotency has been found. Specifically, in xenograft tumor models CDK8 was required to promote rapid tumor growth as well as maintain the tumors in an undifferentiated state. Similarly, CDK8 was highly expressed in ES cells and was required to maintain ES cells in an undifferentiated, pluripotent state. CDK8 regulates MYC protein levels and MYC target gene expression to promote ES cell pluripotency, and expression of CDK8 -regulated MYC target genes was predictive of tumor differentiation and clinical outcome of primary human colon tumors.

[0281] Recent studies have identified a role for Mediator components in regulating ES cell pluripotency. In ES cells, the Mediator component MED 12 binds to the master ES cell regulator NANOG, and MED 12 and NANOG were found to co-occupy and regulate the expression of specific NANOG target genes. Tutter, A. V. et al, J Biol Chem 284, 3709-3718 (2009). And recently, multiple Mediator components, including MED 12, were found to interact with cohesin at many target genes in ES cells to regulate their expression and modulate ES cell Pluripotency. Kagey, M. H. et al, Nature 467, 430-435 (2010). The expression pattern of ES cells depleted of the Mediator component MED 12 was found distinct from CDK8 knockdown cells. This implies that in ES cells, CDK8 and MED 12 act divergently to regulate ES cell pluripotency through different mechanisms and the unique Mediator-independent functions of CDK8. [0282] The finding that CDK8 regulates MYC at the protein levels raises an important distinction however been cancer and ES cell biology. Previous work in colon cancer cells revealed that CDK8 inhibition reduced both MYC mRNA and protein levels, suggesting that CDK8 regulates MYC on a transcriptional level. Firestein, R. et al, Nature 455, 547-551 (2008). In stem cells, however, CDK8 inhibition had little effect on MYC transcript levels but strongly reduced MYC protein levels and altered the MYC post-translational modification landscape. Thus in cancer cells and in stem cells, CDK8 may regulate MYC through distinct mechanisms. MYC was known to undergo extensive post-translational modifications from a multitude of inputs, including other CDK proteins (Vervoorts J. et al, J Biol Chem 281 :34725-9 (2006); Hann SR. Semin Cancer Biol 16:288-302 (2006)). While the CDK8-MYC connection in stem cells was important to maintain pluripotency, it was unknown whether CDK8 was directly acting on MYC (such as through phosphorylation of S62 or other residues) or though indirect mechanisms on MYC or MYC target genes.

[0283] While the data imply that CDK8 regulates MYC activity, alternatively it is plausible that CDK8 and MYC may function convergently yet independently to regulate ES cell gene expression. For example, MYC regulation of RNA polymerase II pause release at ES cell target genes (Rahl P.B. et al, Cell 141 :432-45

(2010) ) could act in tandem with CDK8-Mediator regulation of RNA polymerase II (Taatjes D.J. Trends Biochem Sci 35:315-22 (2010)). CDK9, another transcriptional CDK family member that has shared functions with CDK8 (Fryer C.J. et al, Mol Cell 16:509-20 (2004); Alarcon C. et al, Cell 139:757-69 (2009)), has also been shown to regulate ES cell pluripotency (Kaichi S. et al, J Cell Physiol 226:248-54

(201 1) ). And since both CDK8 and CDK9 have been found to phosphorylate RNA polymerase II in similar ways (Pinhero R. et al, Eur J Biochem 271 : 1004-14 (2004).), CDK8 and CDK9 may cooperate to modulate the transcription of ES cell-related genes, either in combination with or independently of MYC. Further, because MYC is not able to fully rescue the differentiation phenotype caused by CDK8 loss, further investigation is needed to identify MYC-independent mechanisms that CDK8 may be acting through to maintain tumors and stem cells in an undifferentiated state.

[0284] CDK8 inhibition in colon cancer cells leads to a significant decrease in the expression of ES cell- related genes, and these genes were particularly enriched for MYC target genes previously identified in ES cells. The subset of MYC target genes whose expression was CDK8 dependent was unique in its ability to predict tumor differentiation and clinical outcome. Specifically, increased expression of the CDK8-regulated MYC target genes singled out tumors that were poorly differentiated and were more prone to undergo rapid recurrence. This is in contrast to expression of the full set of MYC target genes, which were unable to identify these same tumors. These data suggest that the CDK8-regulated subset of MYC ES cell target genes are coordinately expressed in poorly differentiated, poor prognosis primary colon tumors. However it remains to be determined whether CDK8 is directly responsible for maintaining this coordinated expression.

[0285] In conclusion, convergent roles for CDK8 were defined regulating both tumor and ES cell differentiation states through regulating MYC. A CDK8-regulated MYC signature that was specifically expressed in poor prognosis colon tumors that were poorly differentiated was identified. Together these observations raise the possibility that the stem cell-like properties of cancer cells may be specifically inhibited by therapeutically targeting CDK8.

[0286] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated in their entirety by reference.

Table 2: CDK8-regulated genes in human HT-29 colon cancer cells.

Provided are the top 1500 genes that significantly changed upon CDK8 loss in HT-29 cells. The fold change is relative to siNTC control. P-value is a Student's ί-Test between siNTC and two independent CDK8 siRNAs. Genes that overlap the mouse ES cell-related gene signature (Wong et al., Cell Stem Cell, 2008) or MYC targets in ES cells (Kim et al., Cell, 2008) are indicated.

CDK8-induced/ ES cell-related MYC ES

Human Entrez ID Gene Symbol repressed P-value Fold chanqe qene cell tarqet

1024 CDK8 CDK8- nduced 4.03E-10 8.39 Yes Yes

9441 CRSP7 CDK8- nduced 5.72E-10 1.49

2171 FABP5 CDK8- nduced 6.05E-10 1.93 Yes

9221 NOLC1 CDK8- nduced 1.46E-09 1.73 Yes Yes

6158 RPL28 CDK8- nduced 2.19E-09 1.32 Yes Yes

159090 FAM122B CDK8- nduced 2.79E-08 1.75

55622 TTC27 CDK8- nduced 3.51 E-08 1.48 Yes Yes

7165 TPD52L2 CDK8- nduced 3.72E-08 2.02 Yes

26502 NARF CDK8- nduced 3.86E-08 1.75

10528 NOL5A CDK8- nduced 4.91 E-08 1.42 Yes

2534 FYN CDK8- nduced 7.75E-08 1.51 Yes

29803 REPIN1 CDK8- nduced 8.74E-08 1.31 Yes

29980 DONSON CDK8- nduced 8.86E-08 1.46

60386 SLC25A19 CDK8- nduced 1.16E-07 1.57

64710 NUCKS1 CDK8- nduced 1.27E-07 1.84 Yes Yes

131474 CHCHD4 CDK8- nduced 1.40E-07 1.35 Yes

79000 C1 orf135 CDK8- nduced 1.69E-07 1.23

90390 THRAP6 CDK8- nduced 1.78E-07 1.29

3985 LIMK2 CDK8- nduced 1.80E-07 1.45

84705 GTPBP3 CDK8- nduced 1.82E-07 1.36 Yes Yes

3491 CYR61 CDK8- nduced 2.17E-07 1.78

84916 CIRH1A CDK8- nduced 2.27E-07 1.29 Yes

54997 TESC CDK8- nduced 2.34E-07 1.79

7422 VEGF CDK8- nduced 3.47E-07 1.31

8623 ASMTL CDK8- nduced 3.88E-07 1.69

1 1 1 1 CHEK1 CDK8- nduced 3.97E-07 1.51 Yes Yes

1 16842 LEAP-2 CDK8- nduced 4.52E-07 1.89 Yes

6502 SKP2 CDK8- nduced 4.55E-07 1.73 Yes

51 1 1 PCNA CDK8- nduced 4.58E-07 1.48 Yes Yes

338756 LOC338756 CDK8- nduced 4.83E-07 1.44

56655 POLE4 CDK8- nduced 5.33E-07 1.19

9943 OXSR1 CDK8- nduced 5.35E-07 1.28

3837 KPNB1 CDK8- nduced 5.61 E-07 1.27 Yes Yes

440145 RP1 1 -1 1 C5.2 CDK8- nduced 5.70E-07 1.44

1 122 CHML CDK8- nduced 5.82E-07 1.55 Yes

26973 CHORDC1 CDK8- nduced 6.16E-07 1.56 Yes

29078 C6orf66 CDK8- nduced 6.53E-07 1.49 Yes Yes

10914 PAPOLA CDK8- nduced 8.16E-07 1.40

8318 CDC45L CDK8- nduced 8.18E-07 1.52 Yes

9329 GTF3C4 CDK8- nduced 8.86E-07 1.51 Yes

3008 HIST1 H1 E CDK8- nduced 9.74E-07 1.38

8569 MKNK1 CDK8- nduced 1.01 E-06 1.55

8358 HIST1 H3B CDK8- nduced 1.04E-06 1.20

56941 C3orf37 CDK8- nduced 1.05E-06 1.75

8438 RAD54L CDK8- nduced 1.07E-06 1.32 Yes Yes

55055 ZWILCH CDK8- nduced 1.12E-06 1.56 Yes

9088 PKMYT1 CDK8- nduced 1.19E-06 1.29

9775 DDX48 CDK8- nduced 1.36E-06 1.28 Yes

55326 AGPAT5 CDK8- nduced 1.42E-06 1.38 Yes Yes

51406 NOL7 CDK8- nduced 1.43E-06 1.33 YesT 10038 PARP2 CDK8-induced 1.51 E-06 1.38 Yes Yes

10189 THOC4 CDK8-induced 1.52E-06 1.35 Yes Yes

6322 SCML1 CDK8-induced 1.53E-06 3.48

204 AK2 CDK8-induced 1.58E-06 1.36 Yes Yes

23650 TRIM29 CDK8-induced 1.82E-06 1.34

152024 LOC 152024 CDK8-induced 1.86E-06 1.48

9255 SCYE1 CDK8-induced 2.10E-06 1.25 Yes

7170 TPM3 CDK8-induced 2.12E-06 1.30

7167 TPI1 CDK8-induced 2.33E-06 1.31

57213 C13orf1 CDK8-induced 2.37E-06 1.56

55646 LYAR CDK8-induced 2.46E-06 1.63 Yes

57332 CBX8 CDK8-induced 2.57E-06 1.36

25904 CNOT10 CDK8-induced 2.57E-06 1.20 Yes

90417 C15orf23 CDK8-induced 2.62E-06 1.50

126789 PUSL1 CDK8-induced 2.86E-06 1.15

221035 REEP3 CDK8-induced 2.89E-06 1.24

56992 KIF15 CDK8-induced 2.90E-06 1.41 Yes

388886 LOC388886 CDK8-induced 2.93E-06 1.51

2745 GLRX CDK8-induced 3.06E-06 1.37

1058 CENPA CDK8-induced 3.18E-06 1.46

8677 STX10 CDK8-induced 3.31 E-06 1.19

55839 CENPN CDK8-induced 3.43E-06 1.50 Yes

51013 EXOSC1 CDK8-induced 3.78E-06 1.14 Yes Yes

55132 LARP2 CDK8-induced 3.83E-06 1.34

27335 EIF3S12 CDK8-induced 4.00E-06 1.34 Yes Yes

10744 PTTG2 CDK8-induced 4.09E-06 1.31

221823 PRPS1 L1 CDK8-induced 4.35E-06 1.54

79912 FLJ22028 CDK8-induced 4.58E-06 1.29

51218 GLRX5 CDK8-induced 4.83E-06 1.36 Yes

890 CCNA2 CDK8-induced 4.83E-06 1.55 Yes

6427 SFRS2 CDK8-induced 5.09E-06 1.15 Yes Yes

10588 MTHFS CDK8-induced 5.22E-06 1.29

1021 CDK6 CDK8-induced 5.24E-06 1.91 Yes

5464 PPA1 CDK8-induced 5.55E-06 1.25 Yes Yes

7088 TLE1 CDK8-induced 5.69E-06 1.41 Yes

23421 ITGB3BP CDK8-induced 5.71 E-06 1.33 Yes

708 C1 QBP CDK8-induced 5.77E-06 1.27 Yes

1 15106 CCDC5 CDK8-induced 6.39E-06 1.34 Yes

8847 DLEU2 CDK8-induced 6.49E-06 2.03

8367 HIST1 H4E CDK8-induced 6.77E-06 1.41

3007 HIST1 H1 D CDK8-induced 6.84E-06 1.65

7486 WRN CDK8-induced 7.89E-06 1.26

5757 PTMA CDK8-induced 7.96E-06 1.49 Yes

93081 RP1 1 -48416.3 CDK8-induced 8.01 E-06 1.71 Yes

6947 TCN1 CDK8-induced 8.02E-06 3.62

1 1200 CHEK2 CDK8-induced 8.24E-06 1.27 Yes Yes

28977 MRPL42 CDK8-induced 8.91 E-06 1.28 Yes

10920 COPS8 CDK8-induced 9.21 E-06 1.30 Yes

5465 PPARA CDK8-induced 9.33E-06 1.43

1 1332 ACOT7 CDK8-induced 9.53E-06 1.52

4678 NASP CDK8-induced 9.74E-06 1.43 Yes Yes

26127 FGFR10P2 CDK8-induced 9.75E-06 1.36

140809 SRXN1 CDK8-induced 9.98E-06 1.45

7329 UBE2I CDK8-induced 1.05E-05 1.14 Yes

84321 THOC3 CDK8-induced 1.10E-05 1.12 Yes

3735 KARS CDK8-induced 1.12E-05 1.49 Yes

9631 NUP155 CDK8-induced 1.14E-05 1.31 Yes

81624 DIAPH3 CDK8-induced 1.18E-05 1.62 Yes

348235 FAM33A CDK8-induced 1.19E-05 1.54 Yes 4172 MCM3 CDK8-induced 1.21 E-05 1 50 Yes Yes

8883 APPBP1 CDK8-induced 1.24E-05 1 27 Yes

2237 FEN1 CDK8-induced 1.25E-05 1 55 Yes Yes

388965 LOC388965 CDK8-induced 1.31 E-05 1 44

4869 NPM1 CDK8-induced 1.31 E-05 1 45 Yes Yes

55559 UIP1 CDK8-induced 1.32E-05 1 31

29902 C12orf24 CDK8-induced 1.34E-05 1 69 Yes

10460 TACC3 CDK8-induced 1.36E-05 1 25 Yes Yes

6004 RGS16 CDK8-induced 1.36E-05 1 81

1062 CENPE CDK8-induced 1.38E-05 1 24

51444 RNF138 CDK8-induced 1.44E-05 1 79 Yes

216 ALDH1A1 CDK8-induced 1.47E-05 1 33

64425 POLR1 E CDK8-induced 1.53E-05 1 51 Yes Yes

10901 DHRS4 CDK8-induced 1.55E-05 1 37

284427 MGC34725 CDK8-induced 1.57E-05 1 58

221710 LOC221710 CDK8-induced 1.64E-05 1 58

9882 TBC1 D4 CDK8-induced 1.68E-05 1 40

4698 NDUFA5 CDK8-induced 1.69E-05 1 17 Yes

25948 KBTBD2 CDK8-induced 1.71 E-05 1 18

1841 DTYMK CDK8-induced 1.72E-05 1 22 Yes Yes

9854 TMEM24 CDK8-induced 1.76E-05 1 25 Yes

9093 DNAJA3 CDK8-induced 1.89E-05 1 35

57405 SPBC25 CDK8-induced 1.89E-05 1 43 Yes

9442 CRSP8 CDK8-induced 1.90E-05 1 38

55573 CDV3 CDK8-induced 1.93E-05 1 21 Yes Yes

2147 F2 CDK8-induced 1.93E-05 1 26

10162 MBOAT5 CDK8-induced 1.99E-05 1 42

1515 CTSL2 CDK8-induced 2.01 E-05 1 52

3070 HELLS CDK8-induced 2.04E-05 1 62 Yes

6832 SUPV3L1 CDK8-induced 2.07E-05 1 35 Yes Yes

26084 SGEF CDK8-induced 2.08E-05 1 44

84920 ALG10 CDK8-induced 2.09E-05 1 40

4234 METTL1 CDK8-induced 2.10E-05 1 22 Yes

6625 SNRP70 CDK8-induced 2.14E-05 1 21 Yes

27309 ZNF330 CDK8-induced 2.14E-05 1 40 Yes

51678 MPP6 CDK8-induced 2.19E-05 1 89

54819 ZCCHC10 CDK8-induced 2.21 E-05 1 19

2958 GTF2A2 CDK8-induced 2.21 E-05 1 18

64793 CCDC21 CDK8-induced 2.22E-05 1 42

440577 LOC440577 CDK8-induced 2.22E-05 1 48

7320 UBE2B CDK8-induced 2.22E-05 1 41 Yes

79929 MAP6D1 CDK8-induced 2.25E-05 1 23

84138 SLC7A60S CDK8-induced 2.30E-05 1 16 Yes

79172 CENPO CDK8-induced 2.38E-05 1 31 Yes

2023 EN01 CDK8-induced 2.38E-05 1 29 Yes Yes

23137 SMC5 CDK8-induced 2.38E-05 1 45

387103 C6orf173 CDK8-induced 2.42E-05 1 18

80324 PUS1 CDK8-induced 2.43E-05 1 34 Yes Yes

55604 LRRC16 CDK8-induced 2.43E-05 1 33

81034 SLC25A32 CDK8-induced 2.46E-05 1 31 Yes

55840 EAF2 CDK8-induced 2.46E-05 1 31

580 BARD1 CDK8-induced 2.46E-05 1 25 Yes

132001 C3orf31 CDK8-induced 2.50E-05 1 1 1 Yes

151987 PPP4R2 CDK8-induced 2.51 E-05 1 29

79084 WDR77 CDK8-induced 2.55E-05 1 33 Yes Yes

9657 IQCB1 CDK8-induced 2.59E-05 1 29

54955 C1 orf109 CDK8-induced 2.61 E-05 1 34

5091 PC CDK8-induced 2.72E-05 1 33

4257 MGST1 CDK8-induced 2.81 E-05 1 12 84706 GPT2 CDK8-induced 2.81 E-05 1 31

79731 NARS2 CDK8-induced 2.82E-05 1 23 Yes

9933 KIAA0020 CDK8-induced 2.85E-05 1 27

27338 UBE2S CDK8-induced 2.86E-05 1 16

5359 PLSCR1 CDK8-induced 2.88E-05 1 31

259266 ASPM CDK8-induced 2.89E-05 1 42 Yes Yes

8882 ZNF259 CDK8-induced 2.92E-05 1 28 Yes

26519 TIMM10 CDK8-induced 2.93E-05 1 27 Yes

133522 PPARGC1 B CDK8-induced 2.94E-05 1 95 Yes

25929 GEMIN5 CDK8-induced 2.95E-05 1 99 Yes

3009 HIST1 H1 B CDK8-induced 2.95E-05 1 74

79621 DLEU8 CDK8-induced 2.95E-05 1 17 Yes

231 AKR1 B1 CDK8-induced 3.02E-05 1 42 Yes

3796 KIF2 CDK8-induced 3.03E-05 1 32

55227 LRRC1 CDK8-induced 3.07E-05 1 58

6636 SNRPF CDK8-induced 3.07E-05 1 20

131076 CCDC58 CDK8-induced 3.10E-05 1 30 Yes Yes

384 ARG2 CDK8-induced 3.16E-05 1 65

7444 VRK2 CDK8-induced 3.16E-05 1 16

84287 ZDHHC16 CDK8-induced 3.20E-05 1 30 Yes

57129 MRPL47 CDK8-induced 3.29E-05 1 15 Yes

55254 TMEM39A CDK8-induced 3.36E-05 1 21 Yes

494514 C18orf56 CDK8-induced 3.37E-05 1 65

6390 SDHB CDK8-induced 3.38E-05 1 32

252983 STXBP4 CDK8-induced 3.41 E-05 1 52

57185 NPAL3 CDK8-induced 3.46E-05 1 43

2920 CXCL2 CDK8-induced 3.53E-05 1 72

26018 LRIG1 CDK8-induced 3.54E-05 1 48

348926 LOC348926 CDK8-induced 3.64E-05 1 22

1302 COL1 1A2 CDK8-induced 3.65E-05 1 34

10885 WDR3 CDK8-induced 3.72E-05 1 23 Yes

10714 POLD3 CDK8-induced 3.80E-05 1 79 Yes

56942 C16orf61 CDK8-induced 3.83E-05 1 15

9491 PSMF1 CDK8-induced 3.88E-05 1 14

7533 YWHAH CDK8-induced 3.92E-05 1 22

51018 CGI-1 15 CDK8-induced 3.93E-05 1 36 Yes

83903 GSG2 CDK8-induced 3.97E-05 1 40 Yes

1 1 130 ZWINT CDK8-induced 4.06E-05 1 40

2288 FKBP4 CDK8-induced 4.13E-05 1 43

7430 VI L2 CDK8-induced 4.19E-05 1 24 Yes

9295 SFRS1 1 CDK8-induced 4.37E-05 1 21

83608 C18orf21 CDK8-induced 4.42E-05 1 20

84289 ING5 CDK8-induced 4.45E-05 1 18 Yes

55034 MOCOS CDK8-induced 4.56E-05 1 35

79682 MLF1 IP CDK8-induced 4.61 E-05 1 71 Yes

9824 ARHGAP1 1A CDK8-induced 4.61 E-05 1 21 Yes

51053 GMNN CDK8-induced 4.74E-05 1 20 Yes Yes

26092 TOR1AIP1 CDK8-induced 4.84E-05 1 21

701 BUB1 B CDK8-induced 4.89E-05 1 22 Yes Yes

26986 PABPC1 CDK8-induced 4.98E-05 1 66 Yes Yes

7520 XRCC5 CDK8-induced 4.99E-05 1 15 Yes Yes

101 13 PREB CDK8-induced 5.00E-05 1 30

148789 B3GALNT2 CDK8-induced 5.04E-05 1 54

23062 GGA2 CDK8-induced 5.08E-05 1 13 Yes Yes

9213 XPR1 CDK8-induced 5.14E-05 1 58

4043 LRPAP1 CDK8-induced 5.14E-05 1 53

29107 NXT1 CDK8-induced 5.21 E-05 1 29 Yes

26255 PTTG3 CDK8-induced 5.31 E-05 1 33

1 1212 PROSC CDK8-induced 5.42E-05 1 35 Yes 25764 HYPK CDK8-induced 5.50E-05 1.20 Yes

650 BMP2 CDK8-induced 5.51 E-05 2.63

5289 PIK3C3 CDK8-induced 5.52E-05 1.22

205 AK3L1 CDK8-induced 5.53E-05 1.27 Yes

55127 HEATR1 CDK8-induced 5.58E-05 1.38

148304 C1 orf74 CDK8-induced 5.59E-05 1.28

7913 DEK CDK8-induced 5.60E-05 1.44 Yes

85025 TMEM60 CDK8-induced 5.61 E-05 1.39

1 176 AP3S1 CDK8-induced 5.66E-05 1.23 Yes

27161 EIF2C2 CDK8-induced 5.73E-05 1.18

51654 CDK5RAP1 CDK8-induced 5.76E-05 1.25 Yes

1 1072 DUSP14 CDK8-induced 5.84E-05 1.34

993 CDC25A CDK8-induced 5.85E-05 1.87

9020 MAP3K14 CDK8-induced 5.89E-05 1.31

29080 CCDC59 CDK8-induced 5.94E-05 1.27 Yes

286016 LOC286016 CDK8-induced 5.95E-05 1.29

91298 C12orf29 CDK8-induced 5.99E-05 1.33

23405 DICER1 CDK8-induced 6.00E-05 1.72 Yes

4999 ORC2L CDK8-induced 6.02E-05 1.34

291 16 MYLIP CDK8-induced 6.03E-05 1.29

3622 ING2 CDK8-induced 6.07E-05 1.30

26574 AATF CDK8-induced 6.07E-05 1.15 Yes Yes

2030 SLC29A1 CDK8-induced 6.22E-05 1.25 Yes

664727 LOC664727 CDK8-induced 6.35E-05 1.54

84128 WDR75 CDK8-induced 6.35E-05 1.21 Yes

10939 AFG3L2 CDK8-induced 6.38E-05 1.34 Yes

386757 SLC6A10P CDK8-induced 6.46E-05 1.46

27346 TMEM97 CDK8-induced 6.51 E-05 1.19 Yes Yes

64151 HCAP-G CDK8-induced 6.61 E-05 1.48

64318 NOC3L CDK8-induced 6.69E-05 1.15 Yes

168620 BHLHB8 CDK8-induced 6.75E-05 1.33

1921 1 1 PGAM5 CDK8-induced 6.79E-05 1.38

58495 OVOL2 CDK8-induced 7.02E-05 1.42

1 16254 C6orf72 CDK8-induced 7.15E-05 1.46

8896 BUD31 CDK8-induced 7.16E-05 1.1 1

57621 ZBTB2 CDK8-induced 7.24E-05 1.31 Yes

122704 MRPL52 CDK8-induced 7.31 E-05 1.14

6418 SET CDK8-induced 7.36E-05 1.37 Yes Yes

79145 CHCHD7 CDK8-induced 7.41 E-05 1.30

85002 FAM86B1 CDK8-induced 7.54E-05 1.16 Yes

10606 PAICS CDK8-induced 7.57E-05 1.55

494143 CHAC2 CDK8-induced 7.57E-05 1.34

84328 LZIC CDK8-induced 7.76E-05 1.24

53371 NUP54 CDK8-induced 7.79E-05 1.53 Yes

1786 DNMT1 CDK8-induced 7.92E-05 1.33 Yes

26156 RSL1 D1 CDK8-induced 7.98E-05 1.59 Yes Yes

55825 PECR CDK8-induced 8.18E-05 1.52

1019 CDK4 CDK8-induced 8.25E-05 1.55 Yes Yes

55234 SMU1 CDK8-induced 8.30E-05 1.22

81929 SEH1 L CDK8-induced 8.31 E-05 1.32 Yes

7919 BAT1 CDK8-induced 8.42E-05 1.18

91942 mimitin CDK8-induced 8.50E-05 1.42

6584 SLC22A5 CDK8-induced 8.53E-05 1.31

4552 MTRR CDK8-induced 8.60E-05 1.52 Yes

84798 C19orf48 CDK8-induced 8.68E-05 1.30

150468 CKAP2L CDK8-induced 8.85E-05 1.33 Yes

83540 CDCA1 CDK8-induced 8.91 E-05 1.23 Yes

6491 STIL CDK8-induced 8.93E-05 1.81 Yes

6182 MRPL12 CDK8-induced 9.05E-05 1.21 Yes Yes 92140 MTDH CDK8-induced 9.19E-05 1.44 Yes

79657 FLJ21908 CDK8-induced 9.26E-05 1.24

54478 FAM64A CDK8-induced 9.34E-05 1.28 Yes

9747 KIAA0738 CDK8-induced 9.37E-05 1.89

58515 SELK CDK8-induced 9.37E-05 1.17 Yes

387851 AK3L2 CDK8-induced 9.38E-05 1.47

478 ATP1A3 CDK8-induced 9.41 E-05 1.34

9791 PTDSS1 CDK8-induced 9.51 E-05 1.39

147804 LOC147804 CDK8-induced 9.62E-05 1.37

10419 PRMT5 CDK8-induced 9.63E-05 1.28 Yes

646200 LOC646200 CDK8-induced 9.91 E-05 1.13

10988 METAP2 CDK8-induced 9.95E-05 1.24 Yes

8533 COPS3 CDK8-induced 9.95E-05 1.26 Yes

7579 ZNF31 CDK8-induced 1.03E-04 1.18

6232 RPS27 CDK8-induced 1.03E-04 1.17 Yes

7322 UBE2D2 CDK8-induced 1.03E-04 1.15 Yes

788 SLC25A20 CDK8-induced 1.03E-04 1.58

29028 ATAD2 CDK8-induced 1.04E-04 1.78 Yes

23246 BOP1 CDK8-induced 1.04E-04 1.26 Yes

3987 LIMS1 CDK8-induced 1.04E-04 1.78

5306 PITPNA CDK8-induced 1.05E-04 1.32

4927 NUP88 CDK8-induced 1.05E-04 1.39 Yes

284349 ZNF283 CDK8-induced 1.05E-04 1.28

51514 DTL CDK8-induced 1.05E-04 1.63 Yes Yes

274 BIN1 CDK8-induced 1.06E-04 1.27

3327 HSP90AB3P CDK8-induced 1.09E-04 1.67

55844 PPP2R2D CDK8-induced 1.09E-04 1.18

55872 PBK CDK8-induced 1.09E-04 1.14

54442 KCTD5 CDK8-induced 1.13E-04 1.26 Yes

1 1073 TOPBP1 CDK8-induced 1.14E-04 1.69 Yes

1 1 157 LSM6 CDK8-induced 1.14E-04 1.38

23082 PPRC1 CDK8-induced 1.16E-04 1.25 Yes

1 104 RCC1 CDK8-induced 1.17E-04 1.27 Yes Yes

55835 CENPJ CDK8-induced 1.17E-04 1.37

1514 CTSL CDK8-induced 1.18E-04 1.26

10884 MRPS30 CDK8-induced 1.19E-04 1.29 Yes Yes

7846 TUBA3 CDK8-induced 1.20E-04 1.43

51497 TH1 L CDK8-induced 1.20E-04 1.39

10514 MYBBP1A CDK8-induced 1.20E-04 1.25 Yes

9270 ITGB1 BP1 CDK8-induced 1.22E-04 1.26 Yes

262 AMD1 CDK8-induced 1.22E-04 1.31 Yes Yes

6256 RXRA CDK8-induced 1.24E-04 1.33

5542 PRB1 CDK8-induced 1.24E-04 3.35

5074 PAWR CDK8-induced 1.25E-04 1.68 Yes Yes

3308 HSPA4 CDK8-induced 1.26E-04 1.15 Yes Yes

1075 CTSC CDK8-induced 1.26E-04 1.23 Yes

27101 CACYBP CDK8-induced 1.26E-04 1.32 Yes

22824 HSPA4L CDK8-induced 1.27E-04 1.60

23016 EXOSC7 CDK8-induced 1.28E-04 1.23 Yes

2332 FMR1 CDK8-induced 1.30E-04 1.26

1 1277 TREX1 CDK8-induced 1.32E-04 1.14

134266 GRPEL2 CDK8-induced 1.33E-04 1.15 Yes

55854 LEREP04 CDK8-induced 1.34E-04 1.27 Yes

147968 CAPN12 CDK8-induced 1.34E-04 1.70

6932 TCF7 CDK8-induced 1.35E-04 1.31

22995 CEP152 CDK8-induced 1.37E-04 1.68

10549 PRDX4 CDK8-induced 1.38E-04 1.28

8338 HIST2H2AC CDK8-induced 1.38E-04 1.26

591 1 RAP2A CDK8-induced 1.40E-04 1.41 Yes 84817 TXNL5 CDK8-induced 1.40E-04 1 20

27342 RABGEF1 CDK8-induced 1.40E-04 1 21

5610 EIF2AK2 CDK8-induced 1.40E-04 1 30

85028 C1 orf79 CDK8-induced 1.40E-04 1 32

23404 EXOSC2 CDK8-induced 1.41 E-04 1 36 Yes

140462 ASB9 CDK8-induced 1.41 E-04 1 89

6632 SNRPD1 CDK8-induced 1.42E-04 1 22 Yes Yes

4085 MAD2L1 CDK8-induced 1.43E-04 1 28 Yes

10966 RAB40B CDK8-induced 1.44E-04 1 56

5496 PPM1 G CDK8-induced 1.46E-04 1 17 Yes

6478 SIAH2 CDK8-induced 1.48E-04 1 39

152137 CCDC50 CDK8-induced 1.51 E-04 1 12

55787 CXorf15 CDK8-induced 1.51 E-04 1 30

55746 NUP133 CDK8-induced 1.51 E-04 1 18 Yes

7443 VRK1 CDK8-induced 1.52E-04 1 42 Yes

9555 H2AFY CDK8-induced 1.58E-04 1 47

79080 CCDC86 CDK8-induced 1.59E-04 1 35 Yes Yes

10622 POLR3G CDK8-induced 1.60E-04 1 72

1 1252 PACSIN2 CDK8-induced 1.60E-04 1 34

12381 1 C16orf63 CDK8-induced 1.68E-04 1 17

317781 DDX51 CDK8-induced 1.68E-04 1 33 Yes

4590 MUC8 CDK8-induced 1.68E-04 1 15

6392 SDHD CDK8-induced 1.69E-04 1 15 Yes Yes

6510 SLC1A5 CDK8-induced 1.70E-04 1 27

23034 SAMD4A CDK8-induced 1.70E-04 1 48

140460 ASB7 CDK8-induced 1.71 E-04 1 29

7371 UCK2 CDK8-induced 1.72E-04 1 35 Yes Yes

23483 TGDS CDK8-induced 1.74E-04 1 23

26249 KLHL3 CDK8-induced 1.74E-04 1 37

57602 USP36 CDK8-induced 1.75E-04 1 58

595 CCND1 CDK8-induced 1.77E-04 1 38 Yes Yes

10403 KNTC2 CDK8-induced 1.78E-04 1 30 Yes

27348 TOR1 B CDK8-induced 1.82E-04 1 22

1353 COX1 1 CDK8-induced 1.85E-04 1 25

9377 COX5A CDK8-induced 1.86E-04 1 12 Yes

2280 FKBP1A CDK8-induced 1.86E-04 1 23

7083 TK1 CDK8-induced 1.87E-04 1 18 Yes Yes

1506 CTRL CDK8-induced 1.87E-04 1 36 Yes

9984 THOC1 CDK8-induced 1.88E-04 1 54 Yes

79848 CSPP1 CDK8-induced 1.89E-04 1 79

8802 SUCLG1 CDK8-induced 1.90E-04 1 15

8634 RTCD1 CDK8-induced 1.93E-04 1 17 Yes

646197 LOC646197 CDK8-induced 1.93E-04 1 21

23468 CBX5 CDK8-induced 1.93E-04 1 64 Yes Yes

8726 EED CDK8-induced 1.94E-04 1 32 Yes Yes

3326 HSP90AB1 CDK8-induced 1.94E-04 1 37 Yes

9100 USP10 CDK8-induced 1.94E-04 1 55 Yes

1032 CDKN2D CDK8-induced 1.96E-04 1 55 Yes

1 1232 POLG2 CDK8-induced 1.98E-04 1 18 Yes

23047 APRIN CDK8-induced 1.99E-04 1 29

2935 GSPT1 CDK8-induced 2.00E-04 1 51 Yes

2932 GSK3B CDK8-induced 2.01 E-04 1 26

56548 CHST7 CDK8-induced 2.03E-04 1 31

30850 CDR2L CDK8-induced 2.04 E-04 1 19

8405 SPOP CDK8-induced 2.04 E-04 1 19

509 ATP5C1 CDK8-induced 2.05E-04 1 23 Yes

55723 ASF1 B CDK8-induced 2.06E-04 1 61 Yes Yes

121053 C12orf45 CDK8-induced 2.09E-04 1 14

159013 CXorf38 CDK8-induced 2.10E-04 1 19 622 BDH1 CDK8-induced 2.17E-04 1 23 Yes

25799 ZNF324 CDK8-induced 2.23E-04 1 12

4645 MY05B CDK8-induced 2.24E-04 1 15

551 19 PRPF38B CDK8-induced 2.27E-04 1 19 Yes

205564 SENP5 CDK8-induced 2.28E-04 1 42 Yes

9527 GOSR1 CDK8-induced 2.29E-04 1 30

2091 FBL CDK8-induced 2.30E-04 1 51 Yes Yes

9801 MRPL19 CDK8-induced 2.32E-04 1 18

51495 PTPLAD1 CDK8-induced 2.32E-04 1 32

79960 PHF17 CDK8-induced 2.36E-04 1 61

8208 CHAF1 B CDK8-induced 2.38E-04 1 35 Yes

81610 FAM83D CDK8-induced 2.39E-04 1 40

7874 USP7 CDK8-induced 2.40E-04 1 21

10036 CHAF1A CDK8-induced 2.40E-04 1 14 Yes

51 184 ATPBD1 C CDK8-induced 2.40E-04 1 29 Yes

10813 UTP14A CDK8-induced 2.41 E-04 1 35 Yes

56255 TXNDC13 CDK8-induced 2.42E-04 1 48

7268 TTC4 CDK8-induced 2.43E-04 1 15

129787 TMEM18 CDK8-induced 2.43E-04 1 21

55274 PHF10 CDK8-induced 2.47E-04 1 27

10084 PQBP1 CDK8-induced 2.48E-04 1 22

4735 2-Sep CDK8-induced 2.49E-04 1 34 Yes

3833 KIFC1 CDK8-induced 2.49E-04 1 13 Yes

642480 LOC642480 CDK8-induced 2.50E-04 1 53

84154 BXDC1 CDK8-induced 2.56E-04 1 35 Yes Yes

9126 SMC3 CDK8-induced 2.56E-04 1 15 Yes

9015 TAF1A CDK8-induced 2.60E-04 1 35

3192 HNRPU CDK8-induced 2.63E-04 1 24

55355 DKFZp762E1312 CDK8-induced 2.68E-04 1 40 Yes

51065 RPS27L CDK8-induced 2.70E-04 1 16 Yes

4946 OAZ1 CDK8-induced 2.72E-04 1 38

81689 HBLD2 CDK8-induced 2.74 E-04 1 24 Yes

1 1325 DDX42 CDK8-induced 2.74 E-04 1 35

81853 TMEM14B CDK8-induced 2.75E-04 1 15

23097 CDC2L6 CDK8-induced 2.78E-04 1 29

55353 LAPTM4B CDK8-induced 2.80E-04 1 15

4839 NOL1 CDK8-induced 2.81 E-04 1 19 Yes Yes

3306 HSPA2 CDK8-induced 2.81 E-04 1 45

6749 SSRP1 CDK8-induced 2.82E-04 1 26 Yes

4998 ORC1 L CDK8-induced 2.83E-04 1 47 Yes Yes

4841 NONO CDK8-induced 2.86E-04 1 35 Yes Yes

7171 TPM4 CDK8-induced 2.86E-04 1 1 1 Yes

1207 CLNS1A CDK8-induced 2.87E-04 1 12 Yes

7464 COR02A CDK8-induced 2.88E-04 1 54

388817 LOC388817 CDK8-induced 2.89E-04 1 17

3601 IL15RA CDK8-induced 2.90E-04 1 18

10465 PPIH CDK8-induced 2.96 E-04 1 29

6929 TCF3 CDK8-induced 2.97E-04 1 46

8607 RUVBL1 CDK8-induced 2.97E-04 1 20 Yes Yes

291 SLC25A4 CDK8-induced 3.00E-04 1 30

9232 PTTG1 CDK8-induced 3.01 E-04 1 26

5036 PA2G4 CDK8-induced 3.01 E-04 1 66 Yes Yes

55388 MCM10 CDK8-induced 3.02E-04 1 67 Yes

4928 NUP98 CDK8-induced 3.05E-04 1 26

1723 DHODH CDK8-induced 3.05E-04 1 12 Yes

54984 PINX1 CDK8-induced 3.06E-04 1 61

344967 LOC344967 CDK8-induced 3.07E-04 1 29

4189 DNAJB9 CDK8-induced 3.07E-04 1 10 Yes

79944 L2HGDH CDK8-induced 3.08E-04 1 53 55178 RNMTL1 CDK8-induced 3.13E-04 1.30 Yes

63875 MRPL17 CDK8-induced 3.15E-04 1.17 Yes Yes

1 105 CHD1 CDK8-induced 3.16E-04 1.39 Yes

26010 DNAPTP6 CDK8-induced 3.18E-04 1.16

4953 ODC1 CDK8-induced 3.21 E-04 1.55 Yes Yes

23647 ARFIP2 CDK8-induced 3.22E-04 1.22

8504 PEX3 CDK8-induced 3.24E-04 1.26 Yes

89927 C16orf45 CDK8-induced 3.29E-04 1.20

94056 SYAP1 CDK8-induced 3.29E-04 1.94

57157 PHTF2 CDK8-induced 3.29E-04 1.36 Yes

129401 NUP35 CDK8-induced 3.31 E-04 1.24 Yes Yes

9319 TRIP13 CDK8-induced 3.36E-04 1.37 Yes Yes

5434 POLR2E CDK8-induced 3.37E-04 1.12

51605 CGI-09 CDK8-induced 3.38E-04 1.37 Yes

5290 PIK3CA CDK8-induced 3.40E-04 1.15

25996 REX02 CDK8-induced 3.41 E-04 1.1 1 Yes Yes

1 1 143 MYST2 CDK8-induced 3.43E-04 1.20 Yes

55973 BCAP29 CDK8-induced 3.45E-04 1.38 Yes Yes

23299 BICD2 CDK8-induced 3.46E-04 1.34 Yes

84196 USP48 CDK8-induced 3.48E-04 1.17 Yes

55251 PCMTD2 CDK8-induced 3.49E-04 1.26

64928 MRPL14 CDK8-induced 3.51 E-04 1.15

3927 LASP1 CDK8-induced 3.53E-04 1.18

10283 SDCCAG10 CDK8-induced 3.55E-04 1.15

29128 UHRF1 CDK8-induced 3.57E-04 1.78 Yes Yes

23517 SKIV2L2 CDK8-induced 3.58E-04 1.15

28990 ASTE1 CDK8-induced 3.61 E-04 1.39

7247 TSN CDK8-induced 3.62E-04 1.1 1

23196 FAM120A CDK8-induced 3.69E-04 1.36

2992 GYG1 CDK8-induced 3.69E-04 1.23

57062 DDX24 CDK8-induced 3.70E-04 1.28 Yes

96764 NCOA6IP CDK8-induced 3.71 E-04 1.57

79709 GLT25D1 CDK8-induced 3.71 E-04 1.30 Yes

84515 MCM8 CDK8-induced 3.73E-04 1.19 Yes

4691 NCL CDK8-induced 3.74 E-04 1.33 Yes Yes

9585 MPHOSPH1 CDK8-induced 3.76E-04 1.43

4174 MCM5 CDK8-induced 3.76E-04 1.19 Yes Yes

9816 KIAA0133 CDK8-induced 3.77E-04 1.37

55720 TSR1 CDK8-induced 3.80E-04 1.21 Yes Yes

29093 MRPL22 CDK8-induced 3.82E-04 1.16 Yes

2909 GRLF1 CDK8-induced 3.83E-04 1.24

5042 PABPC3 CDK8-induced 3.84 E-04 1.55

355 FAS CDK8-induced 3.91 E-04 1.44

8560 DEGS1 CDK8-induced 3.92 E-04 1.36 Yes

23174 ZCCHC14 CDK8-induced 3.92 E-04 1.16

5202 PFDN2 CDK8-induced 4.00E-04 1.22 Yes Yes

8428 STK24 CDK8-induced 4.02E-04 1.17

2921 CXCL3 CDK8-induced 4.04 E-04 1.63

29066 ZC3H7A CDK8-induced 4.08E-04 1.61 Yes

10452 TOMM40 CDK8-induced 4.09E-04 1.38 Yes Yes

480 ATP1A4 CDK8-induced 4.12E-04 1.29

8364 HIST1 H4C CDK8-induced 4.14E-04 2.16

27000 ZRF1 CDK8-induced 4.14E-04 1.21 Yes

4092 SMAD7 CDK8-induced 4.16E-04 1.19

722 C4BPA CDK8-induced 4.17E-04 1.15

10313 RTN3 CDK8-induced 4.19E-04 1.09

58478 MASA CDK8-induced 4.21 E-04 1.22 Yes

4602 MYB CDK8-induced 4.21 E-04 1.45 Yes

5393 EXOSC9 CDK8-induced 4.25E-04 1.42 28982 FLVCR CDK8-induced 4.26E-04 1 09

7325 UBE2E2 CDK8-induced 4.27E-04 1 31

220042 FLJ25416 CDK8-induced 4.27E-04 1 39

79863 C18orf22 CDK8-induced 4.30E-04 1 50

3842 TNP01 CDK8-induced 4.30E-04 1 41 Yes

7174 TPP2 CDK8-induced 4.37E-04 1 17 Yes Yes

157570 ESC02 CDK8-induced 4.42E-04 1 44

23133 PHF8 CDK8-induced 4.45E-04 1 35

10575 CCT4 CDK8-induced 4.50E-04 1 25 Yes Yes

87178 PNPT1 CDK8-induced 4.54E-04 1 27 Yes

7419 VDAC3 CDK8-induced 4.56E-04 1 1 1

64969 MRPS5 CDK8-induced 4.59E-04 1 22 Yes

86 ACTL6A CDK8-induced 4.61 E-04 1 20

7004 TEAD4 CDK8-induced 4.66E-04 1 20

84081 CCDC55 CDK8-induced 4.70E-04 1 30

84522 JAGN1 CDK8-induced 4.75E-04 1 09 Yes Yes

7706 TRIM25 CDK8-induced 4.81 E-04 1 20 Yes

2653 GCSH CDK8-induced 4.85E-04 1 19 Yes Yes

80304 FLJ21945 CDK8-induced 4.85E-04 1 28

9531 BAG 3 CDK8-induced 4.90E-04 1 31

2395 FXN CDK8-induced 4.90E-04 1 51

56952 PRTFDC1 CDK8-induced 4.92 E-04 1 25

8833 GMPS CDK8-induced 4.92 E-04 1 28 Yes

3954 LETM1 CDK8-induced 4.93E-04 1 33

2919 CXCL1 CDK8-induced 4.94 E-04 1 92

51073 MRPL4 CDK8-induced 4.96 E-04 1 24 Yes Yes

64794 DDX31 CDK8-induced 4.98E-04 1 52 Yes

5427 POLE2 CDK8-induced 5.00E-04 1 36 Yes

284339 TMEM145 CDK8-induced 5.00E-04 1 19

56997 CABC1 CDK8-induced 5.01 E-04 1 47 Yes

55802 DCP1A CDK8-induced 5.10E-04 1 54

5033 P4HA1 CDK8-induced 5.18E-04 1 25

128178 EDARADD CDK8-induced 5.18E-04 1 21

4176 MCM7 CDK8-induced 5.18E-04 1 42 Yes Yes

839 CASP6 CDK8-induced 5.20E-04 1 36

23367 LARP1 CDK8-induced 5.22E-04 1 20

51660 BRP44L CDK8-induced 5.30E-04 1 61

401397 LOC401397 CDK8-induced 5.30E-04 1 26

9262 STK17B CDK8-induced 5.31 E-04 1 58

29889 GNL2 CDK8-induced 5.40E-04 1 12 Yes Yes

93621 MRFAP1 CDK8-induced 5.42E-04 1 27

1 13174 SAAL1 CDK8-induced 5.48E-04 1 19

902 CCNH CDK8-induced 5.48E-04 1 63

51307 FAM53C CDK8-induced 5.51 E-04 1 26

51537 MTP18 CDK8-induced 5.55E-04 1 22 Yes

55775 TDP1 CDK8-induced 5.56E-04 1 17 Yes Yes

29105 GTL3 CDK8-induced 5.57E-04 1 22

5631 PRPS1 CDK8-induced 5.60E-04 1 43 Yes Yes

26155 NOC2L CDK8-induced 5.62E-04 1 17

5162 PDHB CDK8-induced 5.66E-04 1 16

9690 UBE3C CDK8-induced 5.72E-04 1 71 Yes

55968 NSFL1 C CDK8-induced 5.77E-04 1 15 Yes

154807 VKORC1 L1 CDK8-induced 5.82E-04 1 27

1 13691 MGC16703 CDK8-induced 5.88E-04 1 30

2519 FUCA2 CDK8-induced 5.93E-04 1 19

84790 TUBA6 CDK8-induced 5.94 E-04 1 42

399655 ZNF539 CDK8-induced 5.97E-04 1 27

85365 ALG2 CDK8-induced 5.98E-04 1 23 Yes

4621 MYH3 CDK8-induced 5.99E-04 1 51 6599 SMARCC1 CDK8-induced 6.02E-04 1.92

9183 ZW10 CDK8-induced 6.03E-04 1.23

7752 ZNF200 CDK8-induced 6.10E-04 1.16

51270 TFDP3 CDK8-induced 6.15E-04 3.58

55722 CEP72 CDK8-induced 6.24E-04 1.24

10412 TINP1 CDK8-induced 6.28E-04 1.10 Yes Yes

3182 HNRPAB CDK8-induced 6.30E-04 1.40 Yes Yes

6523 SLC5A1 CDK8-induced 6.32E-04 1.89

55142 CEP27 CDK8-induced 6.32E-04 1.35 Yes

3945 LDHB CDK8-induced 6.36E-04 1.31

51069 MRPL2 CDK8-induced 6.36E-04 1.12 Yes

64919 BCL1 1 B CDK8-induced 6.41 E-04 1.42 Yes

3315 HSPB1 CDK8-induced 6.44E-04 1.16

751 1 XPNPEP1 CDK8-induced 6.58E-04 1.24 Yes Yes

9043 SPAG9 CDK8-induced 6.59E-04 1.53

9212 AURKB CDK8-induced 6.61 E-04 1.46 Yes Yes

10199 MPHOSPH10 CDK8-induced 6.68E-04 1.34 Yes Yes

64795 RMND5A CDK8-induced 6.71 E-04 1.51 Yes

645013 LOC645013 CDK8-induced 6.76E-04 1.15

8140 SLC7A5 CDK8-induced 6.78E-04 1.28 Yes Yes

58477 SRPRB CDK8-induced 6.79E-04 1.19

55341 LSG1 CDK8-induced 6.85E-04 1.23 Yes

1478 CSTF2 CDK8-induced 6.87E-04 1.25 Yes

64859 OBFC2A CDK8-induced 6.91 E-04 1.84 Yes

92086 GGTLA4 CDK8-induced 6.94 E-04 1.19

27292 HSA9761 CDK8-induced 6.96 E-04 1.31 Yes

84246 MEDI O CDK8-induced 7.04 E-04 1.12

55540 IL17RB CDK8-induced 7.09E-04 2.08

5982 RFC2 CDK8-induced 7.10E-04 1.31

10056 FARSLB CDK8-induced 7.15E-04 1.14 Yes

2553 GABPB2 CDK8-induced 7.17E-04 1.46

3265 HRAS CDK8-induced 7.20E-04 1.17

348825 TPRXL CDK8-induced 7.21 E-04 1.33

26148 C10orf12 CDK8-induced 7.32E-04 1.39

92703 C1 orf37 CDK8-induced 7.37E-04 1.17

55758 RCOR3 CDK8-induced 7.46E-04 1.19

8602 C4orf9 CDK8-induced 7.48E-04 1.38 Yes

51491 HSPC1 1 1 CDK8-induced 7.48E-04 1.40 Yes

79598 LRRIQ2 CDK8-induced 7.53E-04 1.57

51659 GINS2 CDK8-induced 7.62E-04 1.83

1 1007 CCDC85B CDK8-induced 7.66E-04 1.37 Yes

9833 MELK CDK8-induced 7.71 E-04 1.29 Yes

29841 GRHL1 CDK8-induced 7.72E-04 1.32

83461 CDCA3 CDK8-induced 7.73E-04 1.32 Yes Yes

6187 RPS2 CDK8-induced 7.78E-04 1.14 Yes

9694 KIAA0103 CDK8-induced 8.00E-04 1.27

8360 HIST1 H4D CDK8-induced 8.00E-04 1.86

3714 JAG2 CDK8-induced 8.02E-04 1.67 Yes

2802 GOLGA3 CDK8-induced 8.02E-04 1.52

51 122 COMMD2 CDK8-induced 8.10E-04 1.39

10592 SMC2 CDK8-induced 8.12E-04 1.40 Yes

203068 TUBB CDK8-induced 8.15E-04 1.25

29089 UBE2T CDK8-induced 8.17E-04 1.14 Yes Yes

2888 GRB14 CDK8-induced 8.20E-04 1.42

54499 TMC01 CDK8-induced 8.23E-04 1.10 Yes

79135 FAM121 B CDK8-induced 8.24E-04 1.32

317786 C14orf62 CDK8-induced 8.24E-04 1.35

5001 ORC5L CDK8-induced 8.24E-04 1.23 Yes

23310 hCAP-D3 CDK8-induced 8.25E-04 1.46 476 ATP1A1 CDK8-induced 8.27E-^■04 1.22

5813 PURA CDK8-induced 8.29E- ^■04 1 .35

51072 C2orf4 CDK8-induced 8.35E- ^■04 1 .17

7982 ST7 CDK8-induced 8.43E- ^■04 1 .31

1039 CDR2 CDK8-induced 8.44E- ^■04 1 .22 Yes

23519 ANP32D CDK8-induced 8.49E- ^■04 1 .73

10915 TCERG1 CDK8-induced 8.56E- ^■04 1 .32 Yes

23683 PRKD3 CDK8-induced 8.61 E- ^■04 1 .52

3835 KIF22 CDK8-induced 8.64E- ^■04 1 .13 Yes Yes

54822 TRPM7 CDK8-induced 8.68E- ^■04 1 .19

1 1 104 KATNA1 CDK8-induced 8.75E- ^■04 1 .40

206426 MGC26597 CDK8-induced 8.75E- ^■04 1 .32

374393 FAM1 1 1 B CDK8-induced 8.77E- ^■04 1 .71

51538 ZCCHC17 CDK8-induced 8.77E- ^■04 1 .46

644063 LOC644063 CDK8-induced 8.77E- ^■04 1 .28

57695 USP37 CDK8-induced 8.79E- ^■04 1 .47

58492 ZNF77 CDK8-induced 8.82E- ^■04 1 .54

8050 PDHX CDK8-induced 8.94E- ^■04 1 .28

25896 INTS7 CDK8-induced 9.01 E- ^■04 1 .23 Yes

339287 LOC339287 CDK8-induced 9.14E- ^■04 1 .33

6574 SLC20A1 CDK8-induced 9.14E- ^■04 1 .38 Yes

51 132 RNF12 CDK8-induced 9.17E- ^■04 1 .29

1 1080 DNAJB4 CDK8-induced 9.22E- ^■04 1 .21 Yes

388272 LOC388272 CDK8-induced 9.30E- ^■04 1 .26

6696 SPP1 CDK8-induced 9.31 E- ^■04 1 .88

6272 SORT1 CDK8-induced 9.37E- ^■04 1 .15

26470 SEZ6L2 CDK8-repressed 2.47E- ^■10 2 .10

8337 HIST2H2AA3 CDK8-repressed 4.88E- ^■10 1 .91

332 BIRC5 CDK8-repressed 6.31 E- ^■10 1 .75 Yes

55194 C1 orf78 CDK8-repressed 4.43E- ^■09 2 .31

51571 FAM49B CDK8-repressed 1.28E- ^■08 2 .22

9948 WDR1 CDK8-repressed 1.79E- ^■08 1 .88

1398 CRK CDK8-repressed 2.76E- ^■08 1 .73

55624 POMGNT1 CDK8-repressed 3.39E- ^■08 1 .68

29058 C20orf30 CDK8-repressed 3.74E- ^■08 1 .29 Yes

3133 HLA-E CDK8-repressed 4.48E- ^■08 1 .39

65990 C16orf24 CDK8-repressed 4.61 E- ^■08 1 .62

93487 C14orf32 CDK8-repressed 5.07E- ^■08 1 .46

400 ARL1 CDK8-repressed 5.29E- ^■08 1 .76 Yes

56925 LXN CDK8-repressed 5.69E- ^■08 1 .56

219902 TMEM136 CDK8-repressed 5.79E- ^■08 4 .53

4128 MAOA CDK8-repressed 6.05E- ^■08 1 .73 Yes Yes

10519 CIB1 CDK8-repressed 6.60E- ^■08 1 .23

2817 GPC1 CDK8-repressed 7.31 E- ^■08 1 .92

1020 CDK5 CDK8-repressed 7.46E- ^■08 1 .38

373156 GSTK1 CDK8-repressed 7.70E- ^■08 1 .61

8631 SCAP1 CDK8-repressed 8.10E- ^■08 1 .62

2073 ERCC5 CDK8-repressed 8.28E- ^■08 2 .27

6416 MAP2K4 CDK8-repressed 9.95E- ^■08 2 .33

474343 SPIN-2 CDK8-repressed 1.04E- ^■07 1 .58

2274 FHL2 CDK8-repressed 1.04E- ^■07 1 .73

6924 TCEB3 CDK8-repressed 1.05E- ^■07 1 .58

10099 TSPAN3 CDK8-repressed 1.1 1 E- ^■07 1 .38

149345 TMEM58 CDK8-repressed 1.13E- ^■07 1 .72

79109 MAPKAP1 CDK8-repressed 1.15E- ^■07 2 .01

124220 LOC 124220 CDK8-repressed 1.30E- ^■07 1 .99

360 AQP3 CDK8-repressed 1.33E- ^■07 3 .61

55268 ECHDC2 CDK8-repressed 1.38E- ^■07 2 .02 56950 SMYD2 CDK8- repressed 1.45E-07 1.40

10581 IFITM2 CDK8- repressed 1.46E-07 1.45 Yes

122970 ACOT4 CDK8- repressed 1.55E-07 2.05

51282 SCAND1 CDK8- repressed 1.59E-07 1.51

217 ALDH2 CDK8- repressed 1.75E-07 1.17

738 C1 1 orf2 CDK8- repressed 1.81 E-07 1.54

9804 TOMM20 CDK8- repressed 1.91 E-07 1.63 Yes

51222 ZNF219 CDK8- repressed 2.07E-07 1.42

130576 OC130576/LYPD6 CDK8- repressed 2.17E-07 6.13

1793 DOCK1 CDK8- repressed 2.44E-07 1.62 Yes

83982 FAM14A CDK8- repressed 2.54E-07 1.89

5880 RAC2 CDK8- repressed 2.88E-07 1.47

84727 SPSB2 CDK8- repressed 2.95E-07 1.69

51015 ISOC1 CDK8- repressed 2.97E-07 1.77

59277 NTN4 CDK8- repressed 3.01 E-07 1.98

54974 ICF45 CDK8- repressed 3.09E-07 1.32

65056 GPBP1 CDK8- repressed 3.27E-07 1.35

84627 ZNF469 CDK8- repressed 3.48E-07 2.64

3108 HLA-DMA CDK8- repressed 3.89E-07 1.95

131601 GPR175 CDK8- repressed 4.10E-07 1.18

8644 AKR1 C3 CDK8- repressed 4.13E-07 1.65

84514 LGP1 CDK8- repressed 4.39E-07 2.08

8099 CDK2AP1 CDK8- repressed 4.53E-07 1.70 Yes

1 13655 MFSD3 CDK8- repressed 4.78E-07 1.63

1307 COL16A1 CDK8- repressed 4.95E-07 1.59

55062 WIPI1 CDK8- repressed 5.00E-07 1.40

84248 FYTTD1 CDK8- repressed 5.1 1 E-07 1.59

64219 PJA1 CDK8- repressed 5.80E-07 1.51

261 18 WSB1 CDK8- repressed 5.87E-07 2.22

57176 VARSL CDK8- repressed 5.94E-07 1.61

285613 C5orf16 CDK8- repressed 6.46E-07 1.49 Yes

63027 C6orf85 CDK8- repressed 6.83E-07 1.26

81621 KAZALD1 CDK8- repressed 7.18E-07 2.47

8738 CRADD CDK8- repressed 7.24E-07 1.71

55625 ZDHHC7 CDK8- repressed 7.39E-07 1.33

29982 NRBF2 CDK8- repressed 7.61 E-07 2.23

57491 AHRR CDK8- repressed 7.72E-07 2.05

8815 BANF1 CDK8- repressed 8.34E-07 2.05 Yes Yes

2629 GBA CDK8- repressed 8.35E-07 2.17

5281 PIGF CDK8- repressed 8.41 E-07 1.58

84000 TMPRSS13 CDK8- repressed 8.86E-07 1.63

441964 LOC441964 CDK8- repressed 9.09E-07 1.63

27352 RUTBC3 CDK8- repressed 9.18E-07 1.65

400684 LOC400684 CDK8- repressed 9.49E-07 2.37

27258 LSM3 CDK8- repressed 9.98E-07 1.29 Yes

57521 KIAA1303 CDK8- repressed 1.04E-06 1.62 Yes

7162 TPBG CDK8- repressed 1.08E-06 1.57

79639 TMEM53 CDK8- repressed 1.1 1 E-06 1.38

25898 RCHY1 CDK8- repressed 1.17E-06 1.53

1 13452 TMEM54 CDK8- repressed 1.24E-06 1.39

84878 ZNF499 CDK8- repressed 1.27E-06 1.45

41 1 1 MAGEA12 CDK8- repressed 1.32E-06 1.25

254170 FBX033 CDK8- repressed 1.35E-06 1.36

92305 TMEM129 CDK8- repressed 1.35E-06 1.98 Yes

91523 FAM1 13B CDK8- repressed 1.36E-06 1.41

85455 DISP2 CDK8- repressed 1.36E-06 2.39

10524 HTATIP CDK8- repressed 1.43E-06 1.55 Yes

9454 HOMER3 CDK8- repressed 1.44E-06 2.22

51646 YPEL5 CDK8- repressed 1.47E-06 1.45 9403 15-Sep CDK8- repressed 1.48E-06 1.13 Yes

203054 ADCK5 CDK8- repressed 1.49E-06 1.51

29984 RHOD CDK8- repressed 1.51 E-06 1.63

9518 GDF15 CDK8- repressed 1.68E-06 2.15

5358 PLS3 CDK8- repressed 1.70E-06 1.75

79102 RNF26 CDK8- repressed 1.77E-06 1.22 Yes

2067 ERCC1 CDK8- repressed 1.77E-06 1.47 Yes

79258 MMEL1 CDK8- repressed 1.80E-06 2.38

5696 PSMB8 CDK8- repressed 1.82E-06 1.20

3106 HLA-B CDK8- repressed 1.85E-06 1.38

5863 RGL2 CDK8- repressed 1.92E-06 1.48

6888 TALD01 CDK8- repressed 1.95E-06 1.37 Yes

23231 KIAA0746 CDK8- repressed 2.02E-06 1.38

6817 SULT1A1 CDK8- repressed 2.08E-06 1.40

64780 MICAL1 CDK8- repressed 2.12E-06 1.71

644 BLVRA CDK8- repressed 2.14E-06 2.48 Yes

3020 H3F3A CDK8- repressed 2.15E-06 1.97

284185 C17orf55 CDK8- repressed 2.16E-06 1.18

60682 SMAP1 CDK8- repressed 2.16E-06 1.71

6609 SMPD1 CDK8- repressed 2.21 E-06 2.71

1 13263 GLCCI1 CDK8- repressed 2.36E-06 1.65

1509 CTSD CDK8- repressed 2.40E-06 1.53 Yes

157567 ANKRD46 CDK8- repressed 2.60E-06 1.90

1 14790 STK1 1 IP CDK8- repressed 2.63E-06 1.54

5682 PSMA1 CDK8- repressed 2.71 E-06 1.19 Yes

9205 ZMYM5 CDK8- repressed 2.71 E-06 1.34

65983 GRAMD3 CDK8- repressed 2.76E-06 2.18

6799 SULT1A2 CDK8- repressed 2.83E-06 1.37

51035 LOC51035 CDK8- repressed 2.90E-06 1.15

55206 SBN01 CDK8- repressed 2.95E-06 1.31

23564 DDAH2 CDK8- repressed 2.99E-06 1.94

7423 VEGFB CDK8- repressed 3.10E-06 1.50

132299 OCIAD2 CDK8- repressed 3.25E-06 1.46

54938 SARS2 CDK8- repressed 3.27E-06 1.27 Yes

64847 SPATA20 CDK8- repressed 3.34E-06 1.45

896 CCND3 CDK8- repressed 3.35E-06 2.00

2752 GLUL CDK8- repressed 3.44E-06 2.01 Yes

9267 PSCD1 CDK8- repressed 3.47E-06 1.46

93082 LINCR CDK8- repressed 3.62E-06 5.20

6734 SRPR CDK8- repressed 3.64E-06 2.06 Yes

5570 PKIB CDK8- repressed 3.73E-06 2.30

2819 GPD1 CDK8- repressed 3.78E-06 1.27

150737 TTC30B CDK8- repressed 3.92E-06 2.19

56981 PRDM1 1 CDK8- repressed 3.99E-06 1.31

221908 MGC22793 CDK8- repressed 4.23E-06 1.59 Yes

1 1244 ZHX1 CDK8- repressed 4.34E-06 1.38

3134 HLA-F CDK8- repressed 4.45E-06 1.40

8537 BCAS1 CDK8- repressed 4.49E-06 1.45

55699 IARS2 CDK8- repressed 4.83E-06 1.40

10058 ABCB6 CDK8- repressed 5.05E-06 1.54 Yes Yes

29970 SCHIP1 CDK8- repressed 5.08E-06 2.37

257054 D2HGDH CDK8- repressed 5.47E-06 1.28

57701 KIAA1602 CDK8- repressed 5.82E-06 1.22 Yes

5002 SLC22A18 CDK8- repressed 5.90E-06 1.47

51329 ARL6IP4 CDK8- repressed 5.96E-06 1.54

23271 CAM SAP 1 L1 CDK8- repressed 6.01 E-06 1.67

90835 LOC90835 CDK8- repressed 6.19E-06 1.56

79778 MICAL-L2 CDK8- repressed 6.23E-06 1.29

81669 CCNL2 CDK8- repressed 6.24E-06 1.35 Yes 30815 ST6GALNAC6 CDK8- repressed 6.34E-06 1.31

57120 GOPC CDK8- repressed 6.63E-06 1.34

23484 LEPROTL1 CDK8- repressed 6.66E-06 1.58 Yes

51079 NDUFA13 CDK8- repressed 6.72E-06 1.30 Yes

8991 SELENBP1 CDK8- repressed 6.74E-06 1.86

784 CACNB3 CDK8- repressed 6.89E-06 1.45

8718 TNFRSF25 CDK8- repressed 7.08E-06 1.51

55902 ACSS2 CDK8- repressed 7.18E-06 2.16

79176 FBXL15 CDK8- repressed 7.20E-06 1.54

79086 C19orf42 CDK8- repressed 7.25E-06 1.32

3156 HMGCR CDK8- repressed 7.36E-06 1.33

55231 CCDC87 CDK8- repressed 7.57E-06 3.1 1 Yes

1 16540 MRPL53 CDK8- repressed 7.60E-06 1.21

55565 LOC55565 CDK8- repressed 7.67E-06 1.29

6164 RPL34 CDK8- repressed 7.81 E-06 1.24 Yes

222699 LOC222699 CDK8- repressed 7.95E-06 1.28

79095 C9orf16 CDK8- repressed 8.01 E-06 1.31

9961 MVP CDK8- repressed 8.1 1 E-06 1.45

90843 TCEAL8 CDK8- repressed 8.27E-06 1.23

4052 LTBP1 CDK8- repressed 8.49E-06 2.38

90780 PYG02 CDK8- repressed 8.63E-06 1.49

1 19032 C10orf32 CDK8- repressed 8.67E-06 1.75 Yes

3091 HIF1A CDK8- repressed 8.68E-06 1.37

284346 ZNF575 CDK8- repressed 8.68E-06 1.42

84078 KBTBD7 CDK8- repressed 8.79E-06 1.73 Yes

1 1264 PXMP4 CDK8- repressed 8.86E-06 1.46

5287 PIK3C2B CDK8- repressed 8.89E-06 1.55

4718 NDUFC2 CDK8- repressed 9.07E-06 1.56

9064 MAP3K6 CDK8- repressed 9.15E-06 1.35 Yes

56288 PARD3 CDK8- repressed 9.20E-06 1.53

128 ADH5 CDK8- repressed 9.33E-06 1.72 Yes Yes

2064 ERBB2 CDK8- repressed 9.36E-06 1.36

55520 ELAC1 CDK8- repressed 9.57E-06 1.35

27345 KCNMB4 CDK8- repressed 9.65E-06 2.14

25824 PRDX5 CDK8- repressed 9.65E-06 1.42 Yes

90993 CREB3L1 CDK8- repressed 9.79E-06 1.58

51608 C7orf20 CDK8- repressed 1.00E-05 1.21

219402 MTIF3 CDK8- repressed 1.01 E-05 1.48

81627 C1 orf25 CDK8- repressed 1.09E-05 1.53 Yes

10712 C1 orf2 CDK8- repressed 1.1 1 E-05 1.31

284018 C17orf58 CDK8- repressed 1.12E-05 1.58

25950 RWDD3 CDK8- repressed 1.17E-05 1.60

8764 TNFRSF14 CDK8- repressed 1.17E-05 1.30

23536 ADAT1 CDK8- repressed 1.18E-05 1.40 Yes

54469 ZFAND6 CDK8- repressed 1.18E-05 1.41

3384 ICAM2 CDK8- repressed 1.20E-05 1.36

5783 PTPN13 CDK8- repressed 1.21 E-05 2.84

51635 DHRS7 CDK8- repressed 1.22E-05 1.34

51324 SPG21 CDK8- repressed 1.25E-05 1.72 Yes

23138 N4BP3 CDK8- repressed 1.28E-05 1.60

3107 HLA-C CDK8- repressed 1.31 E-05 1.38

92922 CCDC102A CDK8- repressed 1.32E-05 1.38

4192 MDK CDK8- repressed 1.34E-05 1.39

54843 SYTL2 CDK8- repressed 1.35E-05 2.42

10481 HOXB13 CDK8- repressed 1.35E-05 1.32

389432 RP5-875H10.1 CDK8- repressed 1.36E-05 3.15

26297 SERGEF CDK8- repressed 1.37E-05 1.40

23132 RAD54L2 CDK8- repressed 1.40E-05 1.52

1 13246 C12orf57 CDK8- repressed 1.42E-05 1.83 81628 TSC22D4 CDK8- repressed 1.42E-05 1.33 Yes

5645 PRSS2 CDK8- repressed 1.44E-05 1.23

25897 RNF19 CDK8- repressed 1.47E-05 1.46

642649 DKFZP779L1068 CDK8- repressed 1.48E-05 1.73

4938 OAS1 CDK8- repressed 1.50E-05 1.56

10123 ARL4C CDK8- repressed 1.50E-05 1.77

284266 CD33L3 CDK8- repressed 1.50E-05 1.52

9399 STOML1 CDK8- repressed 1.53E-05 1.30

348093 RBPMS2 CDK8- repressed 1.53E-05 4.98

10567 RABAC1 CDK8- repressed 1.54E-05 1.47

57666 KIAA1545 CDK8- repressed 1.57E-05 1.34

441320 LOC441320 CDK8- repressed 1.61 E-05 1.48

643155 DKFZP686E2158 CDK8- repressed 1.61 E-05 1.32

64787 EPS8L2 CDK8- repressed 1.62E-05 1.24

54620 FBXL19 CDK8- repressed 1.62E-05 1.18 Yes

9158 FIBP CDK8- repressed 1.66E-05 1.28 Yes

50619 DEF6 CDK8- repressed 1.67E-05 1.46 Yes

9552 SPAG7 CDK8- repressed 1.68E-05 1.42 Yes

3136 HLA-H CDK8- repressed 1.70E-05 1.42

5561 1 OTUB1 CDK8- repressed 1.71 E-05 1.28 Yes

4521 NUDT1 CDK8- repressed 1.72E-05 1.23 Yes

5193 PEX12 CDK8- repressed 1.72E-05 1.74 Yes

203328 SUSD3 CDK8- repressed 1.74E-05 1.45

23673 STX12 CDK8- repressed 1.75E-05 1.90 Yes

5777 PTPN6 CDK8- repressed 1.75E-05 1.36

8350 HIST1 H3A CDK8- repressed 1.77E-05 1.85

4105 MAGEA6 CDK8- repressed 1.83E-05 1.21

400451 LOC400451 CDK8- repressed 1.84E-05 1.72

51596 CUTA CDK8- repressed 1.85E-05 1.44

22920 KIFAP3 CDK8- repressed 1.88E-05 1.14

7844 RNF103 CDK8- repressed 1.91 E-05 1.43

221749 C6orf145 CDK8- repressed 1.94E-05 1.35

404217 CTXN1 CDK8- repressed 1.95E-05 1.26

1 14926 C8orf40 CDK8- repressed 1.95E-05 1.32

79154 MGC4172 CDK8- repressed 1.98E-05 1.31 Yes

8742 TNFSF12 CDK8- repressed 2.03E-05 2.07

29883 CNOT7 CDK8- repressed 2.05E-05 1.68

7866 IFRD2 CDK8- repressed 2.05E-05 1.33 Yes Yes

257236 CCDC96 CDK8- repressed 2.10E-05 1.81

200185 KRTCAP2 CDK8- repressed 2.12E-05 1.13 Yes

51093 C1 orf66 CDK8- repressed 2.15E-05 1.41

51291 GMIP CDK8- repressed 2.16E-05 1.71

1 15399 LRRC56 CDK8- repressed 2.17E-05 1.52

151 146 LOC151 146 CDK8- repressed 2.18E-05 1.29

83480 PUS3 CDK8- repressed 2.22E-05 1.13 Yes

55160 ARHGEF10L CDK8- repressed 2.24E-05 1.48

9545 RAB3D CDK8- repressed 2.31 E-05 1.54 Yes

79792 GSDMDC1 CDK8- repressed 2.34E-05 1.48

64420 SUSD1 CDK8- repressed 2.35E-05 2.23

5501 PPP1 CC CDK8- repressed 2.38E-05 1.18

161882 ZFPM1 CDK8- repressed 2.39E-05 1.24

196383 MGC7036 CDK8- repressed 2.39E-05 1.91 Yes

64839 FBXL17 CDK8- repressed 2.41 E-05 1.87

55898 UNC45A CDK8- repressed 2.43E-05 1.22

84269 CHCHD5 CDK8- repressed 2.44E-05 1.16 Yes

2887 GRB10 CDK8- repressed 2.47E-05 1.56

170463 SSBP4 CDK8- repressed 2.59E-05 1.39 Yes

8563 THOC5 CDK8- repressed 2.59E-05 1.39

90864 SPSB3 CDK8- repressed 2.60E-05 1.25 Yes 4494 MT1 F CDK8- repressed 2.63E-05 2.97

64771 C6orf106 CDK8- repressed 2.71 E-05 1.1 1

64946 CENPH CDK8- repressed 2.83E-05 1.50 Yes

26017 FAM32A CDK8- repressed 2.88E-05 1.55

5305 PIP5K2A CDK8- repressed 3.01 E-05 1.83

1774 DNASE1 L1 CDK8- repressed 3.05E-05 1.17

55317 C20orf29 CDK8- repressed 3.09E-05 1.52

3105 HLA-A CDK8- repressed 3.13E-05 1.41

79767 ELM03 CDK8- repressed 3.19E-05 1.35 Yes

54344 DPM3 CDK8- repressed 3.19E-05 1.21

27092 CACNG4 CDK8- repressed 3.20E-05 1.21

129303 TMEM150 CDK8- repressed 3.22E-05 1.47

2302 FOXJ1 CDK8- repressed 3.23E-05 1.51

78999 LRFN4 CDK8- repressed 3.23E-05 1.43

445329 SULT1A4 CDK8- repressed 3.25E-05 1.27

285313 IGSF10 CDK8- repressed 3.32E-05 3.81

2535 FZD2 CDK8- repressed 3.38E-05 1.52 Yes Yes

28956 MAPBPIP CDK8- repressed 3.38E-05 1.25 Yes

79874 RABEP2 CDK8- repressed 3.44E-05 1.38

27243 CHMP2A CDK8- repressed 3.48E-05 1.44

3109 HLA-DMB CDK8- repressed 3.50E-05 2.29

222229 DKFZp434K1815 CDK8- repressed 3.50E-05 1.22 Yes

57410 SCYL1 CDK8- repressed 3.53E-05 1.23

9891 NUAK1 CDK8- repressed 3.57E-05 1.67

7263 TST CDK8- repressed 3.57E-05 1.42 Yes

5754 PTK7 CDK8- repressed 3.58E-05 1.57

51264 MRPL27 CDK8- repressed 3.61 E-05 1.31 Yes Yes

58506 SR-A1 CDK8- repressed 3.67E-05 1.43

3006 HIST1 H1 C CDK8- repressed 3.67E-05 1.31 Yes

826 CAPNS1 CDK8- repressed 3.75E-05 1.21 Yes

22931 RAB18 CDK8- repressed 3.80E-05 1.22 Yes

57210 SLC45A4 CDK8- repressed 3.81 E-05 3.19

55332 FLJ1 1259 CDK8- repressed 3.85E-05 2.60

51287 CHCHD8 CDK8- repressed 3.87E-05 1.16 Yes

29844 TFPT CDK8- repressed 3.87E-05 1.17 Yes

90 ACVR1 CDK8- repressed 3.91 E-05 1.75

50855 PARD6A CDK8- repressed 3.97E-05 1.27

1 18471 PRAP1 CDK8- repressed 3.97E-05 1.48

9537 TP53I1 1 CDK8- repressed 3.99E-05 2.09

26509 FER1 L3 CDK8- repressed 4.00E-05 1.38

57698 KIAA1598 CDK8- repressed 4.04E-05 2.07

55717 BRWD2 CDK8- repressed 4.07E-05 1.26

1 13402 SFT2D1 CDK8- repressed 4.09E-05 1.09

79027 ZNF655 CDK8- repressed 4.09E-05 1.69 Yes

56674 TMEM9B CDK8- repressed 4.24E-05 1.32

57142 RTN4 CDK8- repressed 4.25E-05 1.38

5530 PPP3CA CDK8- repressed 4.26E-05 1.50

140465 MYL6B CDK8- repressed 4.35E-05 1.44

374907 B3GNT8 CDK8- repressed 4.46E-05 2.19

85378 TUBGCP6 CDK8- repressed 4.54E-05 1.38

55150 FLJ 10490 CDK8- repressed 4.64E-05 1.16

23396 PIP5K1 C CDK8- repressed 4.64E-05 1.19

79676 OGFOD2 CDK8- repressed 4.69E-05 1.54

83719 YPEL3 CDK8- repressed 4.73E-05 1.79

8460 TPST1 CDK8- repressed 4.79E-05 1.53

6923 TCEB2 CDK8- repressed 4.85E-05 1.18

84236 RHBDD1 CDK8- repressed 4.90E-05 1.36

3013 HIST1 H2AD CDK8- repressed 4.93E-05 1.49

1788 DNMT3A CDK8- repressed 4.95E-05 2.07 4232 MEST CDK8- repressed 5.00E-05 1.87 Yes Yes

254359 ZDHHC24 CDK8- repressed 5.01 E-05 1.54

257364 SH3PX3 CDK8- repressed 5.02E-05 1.65

23370 ARHGEF18 CDK8- repressed 5.03E-05 1.51

57720 GPR107 CDK8- repressed 5.05E-05 1.68

84286 MGC4618 CDK8- repressed 5.06E-05 1.14

197258 FUK CDK8- repressed 5.07E-05 1.35

54785 C17orf59 CDK8- repressed 5.14E-05 1.36 Yes

163033 ZNF579 CDK8- repressed 5.26E-05 1.24

57623 ZNF406 CDK8- repressed 5.38E-05 1.17

81533 ITFG1 CDK8- repressed 5.46E-05 1.27

23318 ZCCHC1 1 CDK8- repressed 5.48E-05 1.38

2589 GALNT1 CDK8- repressed 5.48E-05 1.48

25807 RHBDD3 CDK8- repressed 5.51 E-05 1.27 Yes

5270 SERPINE2 CDK8- repressed 5.56E-05 1.30 Yes

7005 TEAD3 CDK8- repressed 5.67E-05 1.1 1

9032 TM4SF5 CDK8- repressed 5.67E-05 1.37

55763 EXOC1 CDK8- repressed 5.69E-05 1.37

1 1258 DCTN3 CDK8- repressed 5.71 E-05 1.12

51586 PCQAP CDK8- repressed 5.75E-05 1.27

9159 PCSK7 CDK8- repressed 5.81 E-05 1.64

6253 RTN2 CDK8- repressed 5.86E-05 1.36

55653 BCAS4 CDK8- repressed 5.86E-05 1.29

1 1236 RNF139 CDK8- repressed 5.90E-05 1.31 Yes

9147 SDCCAG1 CDK8- repressed 6.00E-05 1.27

6499 SKIV2L CDK8- repressed 6.03E-05 1.20

53938 PPIL3 CDK8- repressed 6.14E-05 1.23 Yes

192670 EIF2C4 CDK8- repressed 6.15E-05 1.71

57192 MCOLN1 CDK8- repressed 6.16E-05 1.42

26086 GPSM1 CDK8- repressed 6.16E-05 1.50

84034 EMILIN2 CDK8- repressed 6.18E-05 2.64

55529 TMEM55A CDK8- repressed 6.23E-05 1.26

4580 MTX1 CDK8- repressed 6.25E-05 1.34

55629 PNRC2 CDK8- repressed 6.28E-05 1.35

5447 POR CDK8- repressed 6.28E-05 1.19

440335 LOC440335 CDK8- repressed 6.31 E-05 1.26

80301 PLEKHQ1 CDK8- repressed 6.37E-05 1.37

55640 C14orf58 CDK8- repressed 6.54E-05 3.10

4507 MTAP CDK8- repressed 6.58E-05 1.59

51 109 RDH1 1 CDK8- repressed 6.73E-05 1.18 Yes

648245 LOC648245 CDK8- repressed 6.74E-05 1.18

4217 MAP3K5 CDK8- repressed 6.86E-05 1.81

54765 TRIM44 CDK8- repressed 7.05E-05 1.35

93949 CXorfl O CDK8- repressed 7.16E-05 1.36

84952 CGNL1 CDK8- repressed 7.21 E-05 2.65

828 CAPS CDK8- repressed 7.34E-05 2.40

84717 HDGF2 CDK8- repressed 7.38E-05 1.33

26039 SS18L1 CDK8- repressed 7.45E-05 1.25 Yes

9605 C16orf7 CDK8- repressed 7.51 E-05 1.36

2633 GBP1 CDK8- repressed 7.56E-05 2.24

148223 C19orf25 CDK8- repressed 7.57E-05 1.16 Yes

5828 PXMP3 CDK8- repressed 7.61 E-05 1.27

9049 AIP CDK8- repressed 7.67E-05 1.36

53349 ZFYVE1 CDK8- repressed 7.75E-05 1.56

155061 ZNF746 CDK8- repressed 7.85E-05 1.09

6908 TBP CDK8- repressed 7.87E-05 1.1 1 Yes

84958 SYTL1 CDK8- repressed 7.87E-05 1.89

25894 PLEKHG4 CDK8- repressed 7.91 E-05 1.86

5600 MAPK1 1 CDK8- repressed 8.03E-05 1.39 548593 GIYD1 CDK8- repressed 8.05E-05 1.36

255743 NPNT CDK8- repressed 8.05E-05 1.49

130535 KCTD18 CDK8- repressed 8.40E-05 2.74

1 14908 TMEM123 CDK8- repressed 8.40E-05 1.37

23158 TBC1 D9 CDK8- repressed 8.58E-05 1.43

284361 LOC284361 CDK8- repressed 8.61 E-05 1.32

10591 C6orf108 CDK8- repressed 8.66E-05 1.78

9185 REPS2 CDK8- repressed 8.74E-05 1.26

79991 OBFC1 CDK8- repressed 8.80E-05 1.28

1652 DDT CDK8- repressed 8.88E-05 1.57

79717 PPCS CDK8- repressed 9.01 E-05 1.27 Yes

51430 C1 orf9 CDK8- repressed 9.16E-05 1.16

54461 FBXW5 CDK8- repressed 9.21 E-05 1.36

837 CASP4 CDK8- repressed 9.34E-05 1.28

10445 MCRS1 CDK8- repressed 9.43E-05 1.53

5607 MAP2K5 CDK8- repressed 9.48E-05 1.91 Yes

4157 MC1 R CDK8- repressed 9.48E-05 1.69

5652 PRSS8 CDK8- repressed 9.58E-05 1.47 Yes

391356 LOC391356 CDK8- repressed 9.59E-05 1.28

80736 SLC44A4 CDK8- repressed 9.63E-05 1.20 Yes

5873 RAB27A CDK8- repressed 9.68E-05 1.69 Yes

1 14904 C1 QTNF6 CDK8- repressed 9.83E-05 2.17

63906 GPATC3 CDK8- repressed 1.00E-04 1.71

5380 PMS2L2 CDK8- repressed 1.01 E-04 1.41

10025 THRAP5 CDK8- repressed 1.01 E-04 1.24

387733 IFITM5 CDK8- repressed 1.02E-04 1.25 Yes

836 CASP3 CDK8- repressed 1.04E-04 1.19

6455 SH3GL1 CDK8- repressed 1.04E-04 1.13

8567 MADD CDK8- repressed 1.05E-04 1.38

286053 NSMCE2 CDK8- repressed 1.06E-04 1.33

56204 KIAA1370 CDK8- repressed 1.06E-04 1.46

8086 AAAS CDK8- repressed 1.08E-04 1.18 Yes Yes

79903 FLJ14154 CDK8- repressed 1.08E-04 1.42

10106 CTDSP2 CDK8- repressed 1.09E-04 1.30

26000 TBC1 D10B CDK8- repressed 1.09E-04 1.15

79415 C17orf62 CDK8- repressed 1.09E-04 1.33

54910 SEMA4C CDK8- repressed 1.10E-04 1.65

84292 MORG1 CDK8- repressed 1.1 1 E-04 1.58 Yes

29082 CHMP4A CDK8- repressed 1.12E-04 1.15

1 16541 MRPL54 CDK8- repressed 1.13E-04 1.37 Yes Yes

1 1284 PNKP CDK8- repressed 1.14E-04 1.17 Yes

192286 HIGD2A CDK8- repressed 1.14E-04 1.12 Yes

92017 LOC92017 CDK8- repressed 1.15E-04 1.47

7108 TM7SF2 CDK8- repressed 1.16E-04 1.36

1 12495 C6orf51 CDK8- repressed 1.17E-04 1.31 Yes

51504 HSPC152 CDK8- repressed 1.17E-04 1.60 Yes

8353 HIST1 H3E CDK8- repressed 1.19E-04 1.64

26995 TRUB2 CDK8- repressed 1.21 E-04 1.53 Yes

387921 RP1 1 -50D16.3 CDK8- repressed 1.22E-04 1.26 Yes

8356 HIST1 H3J CDK8- repressed 1.22E-04 1.38

29886 SNX8 CDK8- repressed 1.23E-04 1.29 Yes

80006 FLJ1361 1 CDK8- repressed 1.23E-04 1.39 Yes

10213 PSMD14 CDK8- repressed 1.24E-04 1.16 Yes

4130 MAP1A CDK8- repressed 1.26E-04 1.35

51614 ERGIC3 CDK8- repressed 1.26E-04 1.15

54432 YIPF1 CDK8- repressed 1.27E-04 1.44

9601 PDIA4 CDK8- repressed 1.29E-04 1.89 Yes Yes

3566 IL4R CDK8- repressed 1.31 E-04 1.20

10610 ST6GALNAC2 CDK8- repressed 1.32E-04 1.56 8720 MBTPS1 CDK8- repressed 1.34E-04 1.82 Yes

55049 FLJ20850 CDK8- repressed 1.36E-04 1.45 Yes

266740 MAGEA2B CDK8- repressed 1.37E-04 1.34

130074 LOC130074 CDK8- repressed 1.37E-04 1.40

51063 FAM26B CDK8- repressed 1.38E-04 1.81

392 ARHGAP1 CDK8- repressed 1.39E-04 1.21 Yes

514 ATP5E CDK8- repressed 1.39E-04 1.1 1 Yes Yes

79671 NOD9 CDK8- repressed 1.40E-04 1.97

81573 ANKRD13C CDK8- repressed 1.42E-04 1.50

489 ATP2A3 CDK8- repressed 1.42E-04 2.20

6692 SPINT1 CDK8- repressed 1.42E-04 1.24

90522 YIF1 B CDK8- repressed 1.43E-04 1.20 Yes

8694 DGAT1 CDK8- repressed 1.43E-04 1.26

57418 WDR18 CDK8- repressed 1.45E-04 1.16 Yes

10908 PNPLA6 CDK8- repressed 1.45E-04 1.33

4695 NDUFA2 CDK8- repressed 1.46E-04 1.23

60312 AFAP CDK8- repressed 1.47E-04 1.92 Yes

130814 PQLC3 CDK8- repressed 1.49E-04 1.74

9655 SOCS5 CDK8- repressed 1.49E-04 1.57

2815 GP9 CDK8- repressed 1.50E-04 1.16

84304 NUDT22 CDK8- repressed 1.51 E-04 1.58

1870 E2F2 CDK8- repressed 1.51 E-04 1.23 Yes

6398 SECTM1 CDK8- repressed 1.52E-04 1.33

5794 PTPRH CDK8- repressed 1.54E-04 1.21

7091 TLE4 CDK8- repressed 1.57E-04 1.97 Yes

435 ASL CDK8- repressed 1.57E-04 1.41

29100 HSPC171 CDK8- repressed 1.57E-04 1.20 Yes

83707 TRPT1 CDK8- repressed 1.59E-04 1.24

80024 SLC24A6 CDK8- repressed 1.59E-04 1.34

326624 RAB37 CDK8- repressed 1.59E-04 2.95

6659 SOX4 CDK8- repressed 1.60E-04 1.73

130355 LOC130355 CDK8- repressed 1.63E-04 1.32

9604 RNF14 CDK8- repressed 1.63E-04 1.35

345757 TMEM157 CDK8- repressed 1.65E-04 1.49

84525 HOP CDK8- repressed 1.65E-04 2.66

5585 PKN1 CDK8- repressed 1.65E-04 1.24

9653 HS2ST1 CDK8- repressed 1.66E-04 1.23 Yes

240 ALOX5 CDK8- repressed 1.67E-04 1.66

378 ARF4 CDK8- repressed 1.69E-04 1.26 Yes

339983 FLJ37478 CDK8- repressed 1.71 E-04 5.66

9445 ITM2B CDK8- repressed 1.71 E-04 1.36

1465 CSRP1 CDK8- repressed 1.72E-04 1.18

1 1201 POL I CDK8- repressed 1.72E-04 2.03 Yes

9513 FXR2 CDK8- repressed 1.74E-04 1.38

10094 ARPC3 CDK8- repressed 1.74E-04 1.28 Yes

421 ARVCF CDK8- repressed 1.75E-04 1.59

94121 SYTL4 CDK8- repressed 1.75E-04 1.37

5641 LGMN CDK8- repressed 1.76E-04 1.29

10769 PLK2 CDK8- repressed 1.76E-04 1.23

1 18487 CHCHD1 CDK8- repressed 1.78E-04 1.17 Yes

57148 KIAA1219 CDK8- repressed 1.80E-04 1.32

1201 CLN3 CDK8- repressed 1.81 E-04 1.14 Yes

389058 SP5 CDK8- repressed 1.83E-04 1.99

23263 MCF2L CDK8- repressed 1.84E-04 1.49 Yes

256281 NUDT14 CDK8- repressed 1.87E-04 1.50

1 14782 KIAA1881 CDK8- repressed 1.87E-04 2.41

5693 PSMB5 CDK8- repressed 1.89E-04 1.30 Yes

6913 TBX15 CDK8- repressed 1.90E-04 3.09

1 1334 TUSC2 CDK8- repressed 1.90E-04 1.12 1801 DPH1 CDK8- repressed 1.91 E-04 1.1 1 Yes

7125 TNNC2 CDK8- repressed 1.95E-04 2.50

63935 C20orf67 CDK8- repressed 1.99E-04 1.23

55684 C9orf86 CDK8- repressed 2.00E-04 1.18

5428 POLG CDK8- repressed 2.02E-04 1.25

83998 REG4 CDK8- repressed 2.02E-04 5.01

89845 ABCC10 CDK8- repressed 2.05E-04 1.25

340348 TSPAN33 CDK8- repressed 2.06E-04 3.29

318 NUDT2 CDK8- repressed 2.06E-04 1.35

5364 PLXNB1 CDK8- repressed 2.06E-04 1.29

51 129 ANGPTL4 CDK8- repressed 2.07E-04 1.47 Yes

57630 SH3RF1 CDK8- repressed 2.07E-04 1.17

22933 SIRT2 CDK8- repressed 2.08E-04 1.33

1645 AKR1 C1 CDK8- repressed 2.13E-04 1.36

54585 LZTFL1 CDK8- repressed 2.13E-04 1.58

4696 NDUFA3 CDK8- repressed 2.15E-04 1.08

1 14609 TIRAP CDK8- repressed 2.15E-04 1.41

157927 C9orf62 CDK8- repressed 2.19E-04 1.33

55890 GPRC5C CDK8- repressed 2.19E-04 2.04 Yes

1603 DAD1 CDK8- repressed 2.20E-04 1.15

8517 I KB KG CDK8- repressed 2.20E-04 1.10

2717 GLA CDK8- repressed 2.20E-04 1.19 Yes

80164 FLJ22184 CDK8- repressed 2.20E-04 1.22

6845 SYBL1 CDK8- repressed 2.20E-04 1.45

1001 CDH3 CDK8- repressed 2.21 E-04 1.27

123036 MTAC2D1 CDK8- repressed 2.22E-04 1.88

64081 MAWBP CDK8- repressed 2.23E-04 1.74

3636 INPPL1 CDK8- repressed 2.24E-04 1.31 Yes

4779 NFE2L1 CDK8- repressed 2.24E-04 1.22 Yes

10840 ALDH1 L1 CDK8- repressed 2.25E-04 1.56

124936 CYB5D2 CDK8- repressed 2.28E-04 1.65 Yes

3292 HSD17B1 CDK8- repressed 2.29E-04 1.24

4682 NUBP1 CDK8- repressed 2.30E-04 1.17 Yes

27249 C2orf25 CDK8- repressed 2.32E-04 1.38 Yes

571 16 ZNF695 CDK8- repressed 2.33E-04 1.28

51368 TEX264 CDK8- repressed 2.33E-04 1.26 Yes

5493 PPL CDK8- repressed 2.34 E-04 1.63

7016 TESK1 CDK8- repressed 2.38E-04 1.19 Yes

55225 RAVER2 CDK8- repressed 2.38E-04 1.80

84364 ZNF289 CDK8- repressed 2.39E-04 1.21

5480 PPIC CDK8- repressed 2.39E-04 1.24 Yes

3663 IRF5 CDK8- repressed 2.39E-04 1.80

389692 MAFA CDK8- repressed 2.42E-04 1.24

256329 C1 1 orf35 CDK8- repressed 2.45E-04 1.57

79652 C16orf30 CDK8- repressed 2.45E-04 2.03

389289 LOC389289 CDK8- repressed 2.47E-04 1.21

7084 TK2 CDK8- repressed 2.48E-04 1.31 Yes

10735 STAG2 CDK8- repressed 2.51 E-04 1.32

5728 PTEN CDK8- repressed 2.53E-04 1.21 Yes

353134 LCE1 D CDK8- repressed 2.55E-04 1.21

2178 FANCE CDK8- repressed 2.55E-04 1.07

54998 AURKAIP1 CDK8- repressed 2.55E-04 1.08 Yes

23129 PLXND1 CDK8- repressed 2.59E-04 1.42

26007 DAK CDK8- repressed 2.62E-04 1.48 Yes

51734 SEPX1 CDK8- repressed 2.63E-04 1.16

79144 C20orf149 CDK8- repressed 2.64E-04 1.30

56654 NPDC1 CDK8- repressed 2.64E-04 1.81

91272 FAM44B CDK8- repressed 2.66E-04 2.05

6714 SRC CDK8- repressed 2.68E-04 1.27 6905 TBCE CDK8- repressed 2.69E-04 1.18

5531 1 ZNF444 CDK8- repressed 2.73E-04 1.14 Yes

6690 SPINK1 CDK8- repressed 2.74E-04 1.59

84299 C17orf37 CDK8- repressed 2.74E-04 1.19 Yes

57460 PPM1 H CDK8- repressed 2.75E-04 1.57

3983 ABLIM1 CDK8- repressed 2.75E-04 1.37

2634 GBP2 CDK8- repressed 2.76E-04 1.54

340198 IFITM4P CDK8- repressed 2.78E-04 1.27

9788 MTSS1 CDK8- repressed 2.78E-04 1.67

155465 BCMP1 1 CDK8- repressed 2.79E-04 1.72

686 BTD CDK8- repressed 2.81 E-04 1.57

346950 RPL37P6 CDK8- repressed 2.81 E-04 1.14

23335 WDR7 CDK8- repressed 2.84 E-04 1.27

54751 FBLIM1 CDK8- repressed 2.84 E-04 1.29

91949 COG7 CDK8- repressed 2.86E-04 1.38

57161 PELI2 CDK8- repressed 2.89E-04 1.23

219738 C10orf35 CDK8- repressed 2.89E-04 1.82

401577 LOC401577 CDK8- repressed 2.90E-04 1.59

10406 WFDC2 CDK8- repressed 2.92 E-04 1.84 Yes

55734 ZFP64 CDK8- repressed 2.93E-04 1.18

1 14971 PTPMT1 CDK8- repressed 2.96 E-04 2.67

26128 KIAA1279 CDK8- repressed 2.98E-04 1.35

64172 OSGEPL1 CDK8- repressed 2.99E-04 1.62

9950 GOLGA5 CDK8- repressed 2.99E-04 1.27

1573 CYP2J2 CDK8- repressed 3.03E-04 1.40

2630 GBAP CDK8- repressed 3.05E-04 1.75

2039 EPB49 CDK8- repressed 3.08E-04 2.03

246184 CDC26 CDK8- repressed 3.09E-04 1.32

57146 TMEM159 CDK8- repressed 3.13E-04 1.47

53635 PTOV1 CDK8- repressed 3.13E-04 1.26

861 RUNX1 CDK8- repressed 3.16E-04 1.25

8705 B3GALT4 CDK8- repressed 3.19E-04 1.62 Yes

9905 RUTBC1 CDK8- repressed 3.20E-04 1.36 Yes

439951 LOC439951 CDK8- repressed 3.22E-04 1.24

23586 DDX58 CDK8- repressed 3.22E-04 1.48

2746 GLUD1 CDK8- repressed 3.22E-04 1.49

81605 C9orf74 CDK8- repressed 3.23E-04 1.22

4688 NCF2 CDK8- repressed 3.24E-04 3.05

65094 JMJD4 CDK8- repressed 3.25E-04 1.26 Yes

51 164 DCTN4 CDK8- repressed 3.26E-04 1.15

3704 ITPA CDK8- repressed 3.28E-04 1.24 Yes

23557 SNAPAP CDK8- repressed 3.29E-04 1.12 Yes

554202 LOC554202 CDK8- repressed 3.29E-04 3.04

339122 RAB43 CDK8- repressed 3.31 E-04 1.28

10982 MAPRE2 CDK8- repressed 3.32E-04 1.33 Yes

10371 SEMA3A CDK8- repressed 3.36E-04 1.33

493754 LOC493754 CDK8- repressed 3.37E-04 1.15

55072 RNF31 CDK8- repressed 3.39E-04 1.35

55168 MRPS18A CDK8- repressed 3.40E-04 1.10 Yes

1675 CFD CDK8- repressed 3.45E-04 1.61

51019 CCDC53 CDK8- repressed 3.46E-04 1.39 Yes

6698 SPRR1A CDK8- repressed 3.46E-04 1.59

57488 FAM62B CDK8- repressed 3.51 E-04 1.47 Yes

54921 CTF8 CDK8- repressed 3.52E-04 1.18 Yes

6948 TCN2 CDK8- repressed 3.52E-04 1.80

80325 ABTB1 CDK8- repressed 3.54 E-04 1.50

51227 PIGP CDK8- repressed 3.56E-04 1.33

10474 TADA3L CDK8- repressed 3.58E-04 1.45

56928 SPPL2B CDK8- repressed 3.60E-04 1.22 Yes 84888 SPPL2A CDK8- repressed 3.63E-04 1.25

268 AMH CDK8- repressed 3.64E-04 1.33 Yes

5805 PTS CDK8- repressed 3.69E-04 1.20 Yes

124997 WDR81 CDK8- repressed 3.72E-04 1.96

23300 ASCIZ CDK8- repressed 3.74E-04 1.20

259307 IL4I1 CDK8- repressed 3.76E-04 1.26 Yes

23515 MORC3 CDK8- repressed 3.78E-04 1.33 Yes

84667 HES7 CDK8- repressed 3.79E-04 1.26

6539 SLC6A12 CDK8- repressed 3.82E-04 2.09

1050 CEBPA CDK8- repressed 3.86E-04 1.26

64221 ROB03 CDK8- repressed 3.86E-04 1.14

57549 IGSF9 CDK8- repressed 3.88E-04 1.60 Yes

149420 PDIK1 L CDK8- repressed 3.91 E-04 1.19

1479 CSTF3 CDK8- repressed 3.93E-04 1.10 Yes Yes

4987 OPRL1 CDK8- repressed 3.93E-04 1.23

3028 HADH2 CDK8- repressed 3.94 E-04 1.19

57707 KIAA1609 CDK8- repressed 3.95E-04 1.23

54680 C1 orf181 CDK8- repressed 3.96 E-04 1.69

149951 COMMD7 CDK8- repressed 3.97E-04 1.42

813 CALU CDK8- repressed 3.98E-04 1.91

5865 RAB3B CDK8- repressed 3.99E-04 2.59

64063 PRSS22 CDK8- repressed 4.00E-04 1.26

7123 CLEC3B CDK8- repressed 4.07E-04 1.16

2952 GSTT1 CDK8- repressed 4.07E-04 1.41

80279 CDK5RAP3 CDK8- repressed 4.08E-04 1.44 Yes

84219 WDR24 CDK8- repressed 4.10E-04 1.76

79666 PLEKHF2 CDK8- repressed 4.14E-04 1.27

973 CD79A CDK8- repressed 4.17E-04 1.1 1

1 14787 KIAA1893 CDK8- repressed 4.21 E-04 1.66

203260 CCDC107 CDK8- repressed 4.22E-04 1.1 1

7264 TSTA3 CDK8- repressed 4.23E-04 1.24

284252 KCTD1 CDK8- repressed 4.29E-04 1.54

90379 LOC90379 CDK8- repressed 4.31 E-04 1.19

10120 ACTR1 B CDK8- repressed 4.31 E-04 1.22

65244 SPATS2 CDK8- repressed 4.32E-04 1.32 Yes Yes

29850 TRPM5 CDK8- repressed 4.33E-04 1.13

599 BCL2L2 CDK8- repressed 4.33E-04 1.23

9935 MAFB CDK8- repressed 4.43E-04 1.66

1026 CDKN1A CDK8- repressed 4.44E-04 1.27 Yes

22937 SCAP CDK8- repressed 4.45E-04 1.66

1 12398 EGLN2 CDK8- repressed 4.46E-04 1.30 Yes

10079 ATP9A CDK8- repressed 4.48E-04 2.01

84256 FLYWCH1 CDK8- repressed 4.49E-04 1.13

54868 TMEM104 CDK8- repressed 4.49E-04 1.30

55201 MAP1 S CDK8- repressed 4.53E-04 1.10 Yes

56948 C14orf124 CDK8- repressed 4.54 E-04 1.16

54961 SSH3 CDK8- repressed 4.56E-04 1.17

2959 GTF2B CDK8- repressed 4.57E-04 1.18

166785 MMAA CDK8- repressed 4.59E-04 1.57 Yes

22916 NCBP2 CDK8- repressed 4.64E-04 1.28 Yes Yes

79794 C12orf49 CDK8- repressed 4.67E-04 1.29

91 14 ATP6V0D1 CDK8- repressed 4.68E-04 1.26

9842 PLEKHM1 CDK8- repressed 4.70E-04 1.26

348 APOE CDK8- repressed 4.71 E-04 1.1 1

1471 CST3 CDK8- repressed 4.80E-04 1.22

57175 COR01 B CDK8- repressed 4.81 E-04 1.42

85376 KIAA1666 CDK8- repressed 4.84 E-04 1.48 Yes

94134 ARHGAP12 CDK8- repressed 4.84 E-04 1.32

2906 GRIN2D CDK8- repressed 4.86E-04 1.20 5519 PPP2R1 B CDK8- repressed 4.86E-04 1.50 Yes

9448 MAP4K4 CDK8- repressed 4.89E-04 1.72 Yes

51371 POMP CDK8- repressed 4.89E-04 1.16 Yes

57719 TMEM16H CDK8- repressed 4.90E-04 1.67

57593 RP5-860F19.3 CDK8- repressed 4.96E-04 1.14

3707 ITPKB CDK8- repressed 4.99E-04 1.25

6480 ST6GAL1 CDK8- repressed 5.01 E-04 2.77

285148 LOC285148 CDK8- repressed 5.02E-04 1.92

26136 TES CDK8- repressed 5.03E-04 1.23

55359 STYK1 CDK8- repressed 5.06E-04 2.02

6137 RPL13 CDK8- repressed 5.06E-04 1.18 Yes Yes

644799 LOC644799 CDK8- repressed 5.08E-04 1.47

10548 TM9SF1 CDK8- repressed 5.09E-04 1.17

79803 HPS6 CDK8- repressed 5.09E-04 1.27

124044 C16orf76 CDK8- repressed 5.1 1 E-04 1.14

2036 EPB41 L1 CDK8- repressed 5.20E-04 2.37

4070 TACSTD2 CDK8- repressed 5.21 E-04 1.67

29062 HSPC049 CDK8- repressed 5.26E-04 1.58

84955 NUDCD1 CDK8- repressed 5.27E-04 1.30 Yes

10013 HDAC6 CDK8- repressed 5.28E-04 1.18

26049 KIAA0888 CDK8- repressed 5.28E-04 1.35

200576 PIP5K3 CDK8- repressed 5.30E-04 1.57 Yes

6885 MAP3K7 CDK8- repressed 5.31 E-04 1.23 Yes

9581 PREPL CDK8- repressed 5.32E-04 1.53 Yes

5141 1 BIN2 CDK8- repressed 5.35E-04 3.46

149473 CCDC24 CDK8- repressed 5.35E-04 1.90

221424 C6orf154 CDK8- repressed 5.38E-04 2.57

56243 KIAA1217 CDK8- repressed 5.38E-04 1.82

83743 GRWD1 CDK8- repressed 5.40E-04 1.29 Yes

4357 MPST CDK8- repressed 5.41 E-04 1.17

85012 TCEAL3 CDK8- repressed 5.41 E-04 1.89

8723 SNX4 CDK8- repressed 5.44E-04 1.25 Yes Yes

1339 COX6A2 CDK8- repressed 5.45E-04 1.25

6879 TAF7 CDK8- repressed 5.46E-04 1.32

529 ATP6V1 E1 CDK8- repressed 5.47E-04 1.25 Yes

10184 LHFPL2 CDK8- repressed 5.51 E-04 1.42

9708 PCDHGA8 CDK8- repressed 5.53E-04 1.16

10561 IFI44 CDK8- repressed 5.55E-04 1.20

9920 KBTBD1 1 CDK8- repressed 5.56E-04 1.18

90203 C20orf161 CDK8- repressed 5.59E-04 1.74

55743 CHFR CDK8- repressed 5.61 E-04 1.86

148932 MOBKL2C CDK8- repressed 5.61 E-04 1.42

60343 FAM3A CDK8- repressed 5.61 E-04 1.30

1 1267 SNF8 CDK8- repressed 5.69E-04 1.14

7010 TEK CDK8- repressed 5.72E-04 3.05

57153 SLC44A2 CDK8- repressed 5.73E-04 1.32

10410 IFITM3 CDK8- repressed 5.77E-04 1.28

8408 ULK1 CDK8- repressed 5.79E-04 1.91

54935 DUSP23 CDK8- repressed 5.80E-04 1.14

2934 GSN CDK8- repressed 5.83E-04 1.36

221 184 CPNE2 CDK8- repressed 5.83E-04 1.57

59347 FKSG2 CDK8- repressed 5.86E-04 1.17

414 ARSD CDK8- repressed 5.88E-04 1.42

55665 URG4 CDK8- repressed 5.90E-04 1.21

25998 IBTK CDK8- repressed 5.90E-04 1.33

5308 PITX2 CDK8- repressed 5.95E-04 1.45

284498 C1 orf167 CDK8- repressed 5.98E-04 4.06

84976 DISP1 CDK8- repressed 6.00E-04 1.71

79734 KCTD17 CDK8- repressed 6.19E-04 1.31 537 ATP6AP1 CDK8- repressed 6.26E-04 1.23

8888 MCM3AP CDK8- repressed 6.31 E-04 1.26

6874 TAF4 CDK8- repressed 6.31 E-04 1.34

1473 CST5 CDK8- repressed 6.34 E-04 1.16

4296 MAP3K1 1 CDK8- repressed 6.37E-04 1.26 Yes

5591 1 APOB48R CDK8- repressed 6.39E-04 2.36 Yes

221491 C6orf1 CDK8- repressed 6.40E-04 1.97

144717 FAM109A CDK8- repressed 6.44E-04 1.28

9540 TP53I3 CDK8- repressed 6.48E-04 1.62

10491 CRTAP CDK8- repressed 6.50E-04 1.36 Yes Yes

6804 STX1A CDK8- repressed 6.54 E-04 1.31

5379 PMS2L1 CDK8- repressed 6.56E-04 1.36

1 13878 DTX2 CDK8- repressed 6.58E-04 1.33 Yes

8662 EIF3S9 CDK8- repressed 6.58E-04 1.39 Yes

150383 LOC150383 CDK8- repressed 6.62E-04 1.40

90024 FLJ20021 CDK8- repressed 6.62E-04 1.14

124359 CDYL2 CDK8- repressed 6.64E-04 1.60

284996 RNF149 CDK8- repressed 6.65E-04 1.15

4669 NAGLU CDK8- repressed 6.67E-04 1.94 Yes

10133 OPTN CDK8- repressed 6.74 E-04 1.14

5095 PCCA CDK8- repressed 6.75E-04 1.41

23513 SCRIB CDK8- repressed 6.75E-04 1.19

6160 RPL31 CDK8- repressed 6.76E-04 1.12 Yes

2020 EN2 CDK8- repressed 6.80E-04 1.21

10067 SCAMP3 CDK8- repressed 6.85E-04 1.14

9858 KIAA0649 CDK8- repressed 6.91 E-04 1.16

5624 PROC CDK8- repressed 6.98E-04 1.38

2166 FAAH CDK8- repressed 7.00E-04 1.50

26012 NELF CDK8- repressed 7.02E-04 1.42

8771 TNFRSF6B CDK8- repressed 7.03E-04 1.49

25814 ATXN10 CDK8- repressed 7.03E-04 1.26 Yes

64924 SLC30A5 CDK8- repressed 7.05E-04 1.18

84002 B3GNT5 CDK8- repressed 7.09E-04 1.30

6415 SEPW1 CDK8- repressed 7.12E-04 1.31

3074 HEXB CDK8- repressed 7.16E-04 1.14

1789 DNMT3B CDK8- repressed 7.16E-04 2.26

158931 TCEAL6 CDK8- repressed 7.21 E-04 1.85

8650 NUMB CDK8- repressed 7.22E-04 1.16

57480 PLEKHG1 CDK8- repressed 7.24E-04 2.52

8431 1 MRPL45 CDK8- repressed 7.24E-04 1.17 Yes

84153 AYP1 CDK8- repressed 7.29E-04 1.15 Yes

3087 HHEX CDK8- repressed 7.34 E-04 1.87 Yes

1 13026 PLCD3 CDK8- repressed 7.38E-04 1.71

84937 ZNRF1 CDK8- repressed 7.45E-04 1.57

23412 COMMD3 CDK8- repressed 7.46E-04 1.64

540 ATP7B CDK8- repressed 7.50E-04 1.37

64284 RAB17 CDK8- repressed 7.59E-04 1.27

54923 LIME1 CDK8- repressed 7.59E-04 1.29

9686 VGLL4 CDK8- repressed 7.71 E-04 1.25

6897 TARS CDK8- repressed 7.74 E-04 1.17 Yes

147650 LOC147650 CDK8- repressed 7.78E-04 1.21

51634 RBMX2 CDK8- repressed 7.82E-04 1.19

8674 VAMP4 CDK8- repressed 7.85E-04 1.47

51024 FIS1 CDK8- repressed 7.85E-04 1.18

7158 TP53BP1 CDK8- repressed 7.86E-04 1.30

90427 BMF CDK8- repressed 7.90E-04 2.16

401472 FLJ45248 CDK8- repressed 7.93E-04 1.57

9908 G3BP2 CDK8- repressed 7.96 E-04 1.33 Yes

130557 ZNF513 CDK8- repressed 7.97E-04 1.25 Yes 6452 SH3BP2 CDK8- -repressed 7.99E- -04 1.08

79744 ZNF419 CDK8- -repressed 8.02E- -04 1.26

399687 MY018A CDK8- -repressed 8.23E- -04 1.33

79053 ALG8 CDK8- -repressed 8.24E- -04 1.16 Yes

200958 MUC20 CDK8- -repressed 8.30E- -04 1.27

65010 SLC26A6 CDK8- -repressed 8.38E- -04 1.32

91978 C19orf20 CDK8- -repressed 8.41 E- -04 1.38

124221 MGC52282 CDK8- -repressed 8.42E- -04 2.78

57512 GPR158 CDK8- -repressed 8.49E- -04 1.39

55344 PLCXD1 CDK8- -repressed 8.50E- -04 1.25 Yes

51750 RTEL1 CDK8- -repressed 8.56E- -04 1.31 Yes

83547 RILP CDK8- -repressed 8.57E- -04 1.46

5796 PTPRK CDK8- -repressed 8.61 E- -04 1.30

838 CASP5 CDK8- -repressed 8.62E- -04 1.19

29125 C1 1 orf21 CDK8- -repressed 8.63E- -04 1.67

81846 SBF2 CDK8- -repressed 8.63E- -04 1.21

340543 TCEAL5 CDK8- -repressed 8.64E- -04 1.91

473 RERE CDK8- -repressed 8.67E- -04 1.32

57326 PBXIP1 CDK8- -repressed 8.68E- -04 1.77 Yes

3831 KNS2 CDK8- -repressed 8.68E- -04 1.12

55312 RFK CDK8- -repressed 8.74E- -04 1.60

6594 SMARCA1 CDK8- -repressed 8.76E- -04 1.77

5292 PIM1 CDK8- -repressed 8.83E- -04 1.68 Yes

80381 CD276 CDK8- -repressed 8.87E- -04 1.42

150290 DUSP18 CDK8- -repressed 8.92E- -04 1.52 Yes

55818 JMJD1A CDK8- -repressed 9.09E- -04 1.55

23625 FAM89B CDK8- -repressed 9.13E- -04 1.31

147798 TMC4 CDK8- -repressed 9.16E- -04 1.72

57617 VPS 18 CDK8- -repressed 9.19E- -04 1.42

54991 C1 orf159 CDK8- -repressed 9.20E- -04 1.25

26056 RAB1 1 FIP5 CDK8- -repressed 9.20E- -04 1.25

22977 AKR7A3 CDK8- -repressed 9.25E- -04 1.25

84869 CBR4 CDK8- -repressed 9.26E- -04 1.32

3695 ITGB7 CDK8- -repressed 9.34E- -04 1.15

2792 GNGT1 CDK8- -repressed 9.35E- -04 2.31

Table 3. CDK8-regulated genes in mouse R1 ES cells.

Provided are the top 1500 genes that significantly changed upon CDK8 loss prior to differentiation at Day 8 in R1 ES cells. The fold change is relative to shNTC control. P-value is a Student's ί-Test between shNTC and two independent CDK8 shRNAs.

Mouse Entrez ID Gene Symbol CDK8-induced/repressed P-value Fold chanqe

12159 Bmp4 CDK8-induced 1.73E-09 1.70

231507 Plac8 CDK8-induced 3.97E-08 1.80

66855 Tcf25 CDK8-induced 6.01 E-08 1.37

19124 Procr CDK8-induced 6.66E-08 1.60

227753 Gsn CDK8-induced 1.48E-07 1.66

16324 Inhbb CDK8-induced 2.22E-07 1.69

58206 Zbtb32 CDK8-induced 2.54E-07 1.41

15370 Nr4a1 CDK8-induced 2.87E-07 1.42

20170 Hps6 CDK8-induced 3.09E-07 1.18

18553 Pcsk6 CDK8-induced 3.14E-07 1.77

53379 Hnrpa2b1 CDK8-induced 3.41 E-07 1.43

170761 Pdzd3 CDK8-induced 7.60E-07 2.39

18787 Serpinel CDK8-induced 7.86E-07 2.35

16582 Kifc3 CDK8-induced 8.19E-07 1.65

13521 Slc26a2 CDK8-induced 9.26E-07 1.45

21345 Tagln CDK8-induced 9.94E-07 1.66

69698 2310046K01 Rik CDK8-induced 1.19E-06 1.96

74134 Cyp2s1 CDK8-induced 1.50E-06 1.66

12457 Ccrn4l CDK8-induced 1.56E-06 1.40

320191 Hook3 CDK8-induced 1.71 E-06 1.41

330064 Slc5a6 CDK8-induced 1.80E-06 1.18

381 1 10 AW061290 CDK8-induced 1.98E-06 1.58

108143 Taf9 CDK8-induced 2.20E-06 1.25

70207 Ccdc44 CDK8-induced 2.46E-06 1.33

70574 Cpm CDK8-induced 2.48E-06 1.73

230908 Tardbp CDK8-induced 2.61 E-06 1.34

673378 LOC673378 CDK8-induced 2.89E-06 1.33

15974 Ifnab CDK8-induced 2.98E-06 1.15

67797 6530403A03Rik CDK8-induced 3.26E-06 1.52

109168 5730596K20Rik CDK8-induced 3.26E-06 1.29

68024 Hist1 h2bc CDK8-induced 3.43E-06 1.97

13722 Scyel CDK8-induced 3.67E-06 1.1 1

17120 Mad1 l1 CDK8-induced 4.21 E-06 1.08

14622 Gjb5 CDK8-induced 4.69E-06 2.01

15200 Hbegf CDK8-induced 5.18E-06 1.50

28109 D10Wsu102e CDK8-induced 6.04E-06 1.33

14620 Gjb3 CDK8-induced 6.32E-06 1.70

76453 Prss23 CDK8-induced 7.71 E-06 2.1 1

77929 Yipf6 CDK8-induced 8.01 E-06 1.35

170749 Mtmr4 CDK8-induced 8.31 E-06 1.28

268697 Ccnbl CDK8-induced 8.93E-06 1.16

72351 Ptarl CDK8-induced 8.96E-06 1.34

78781 Zc3hav1 CDK8-induced 9.59E-06 1.38

380836 Mrs2l CDK8-induced 1.07E-05 1.23

207742 Rnf43 CDK8-induced 1.14E-05 1.38

545714 LOC545714 CDK8-induced 1.18E-05 1.37

21767 Tex264 CDK8-induced 1.25E-05 1.14

260409 Cdc42ep3 CDK8-induced 1.27E-05 1.53

23828 Bves CDK8-induced 1.30E-05 1.37

56418 Ykt6 CDK8-induced 1.43E-05 1.33

217837 Itpkl CDK8-induced 1.45E-05 1.26

225651 Mppel CDK8-induced 1.45E-05 1.39 78560 Gpr124 CDK8-induced 1.55E-05 1.61

52700 Txnl5 CDK8-induced 1.60E-05 1.23

16852 Lgalsl CDK8-induced 1.65E-05 1.40

21664 Phldal CDK8-induced 1.81 E-05 1.55

67800 Dgat2 CDK8-induced 1.85E-05 1.21

216134 Pdxk CDK8-induced 1.86E-05 1.45

14066 F3 CDK8-induced 1.87E-05 2.25

19224 Ptgsl CDK8-induced 1.90E-05 1.48

101543 Wtip CDK8-induced 1.92E-05 1.17

73385 1700047117Rik CDK8-induced 1.92E-05 1.24

214855 Arid5a CDK8-induced 1.95E-05 1.22

50766 Criml CDK8-induced 1.95E-05 1.36

19285 Ptrf CDK8-induced 1.95E-05 1.36

213827 Arcnl CDK8-induced 2.01 E-05 1.19

20200 S100a6 CDK8-induced 2.03E-05 1.61

69993 Chn2 CDK8-induced 2.07E-05 1.70

19087 Prkar2a CDK8-induced 2.08E-05 1.62

21 1323 Nrg1 CDK8-induced 2.1 1 E-05 1.51

13731 Emp2 CDK8-induced 2.16E-05 1.53

17425 Foxkl CDK8-induced 2.24E-05 1.24

12450 Ccngl CDK8-induced 2.25E-05 1.23

94092 Trim16 CDK8-induced 2.25E-05 1.53

68272 Rbm28 CDK8-induced 2.32E-05 1.31

94066 Mrpl36 CDK8-induced 2.42E-05 1.18

14701 Gng12 CDK8-induced 2.46E-05 1.57

28018 D7Wsu128e CDK8-induced 2.54E-05 1.19

14187 Akr1 b8 CDK8-induced 2.55E-05 1.35

67434 5730557B15Rik CDK8-induced 2.63E-05 1.90

93689 Lmodl CDK8-induced 2.72E-05 1.48

18597 Pdhal CDK8-induced 2.93E-05 1.21

13356 Dgcr2 CDK8-induced 3.04E-05 1.34

18590 Pdgfa CDK8-induced 3.12E-05 1.40

66997 Psmd12 CDK8-induced 3.23E-05 1.17

55984 Camkkl CDK8-induced 3.26E-05 1.26

102423 Mizf CDK8-induced 3.26E-05 1.30

19317 Qk CDK8-induced 3.26E-05 1.40

18590 Pdgfa CDK8-induced 3.27E-05 1.35

67268 2900073G15Rik CDK8-induced 3.35E-05 1.19

231327 Ppat CDK8-induced 3.35E-05 1.37

232807 Ppp1 r12c CDK8-induced 3.37E-05 1.40

226517 Smg7 CDK8-induced 3.38E-05 1.25

21817 Tgm2 CDK8-induced 3.44E-05 1.20

19128 Prosl CDK8-induced 3.45E-05 1.28

67588 Rnf41 CDK8-induced 3.51 E-05 1.15

21428 Mix CDK8-induced 3.53E-05 1.21

76400 Pbp2 CDK8-induced 3.61 E-05 2.08

76779 Cluapl CDK8-induced 3.65E-05 1.14

231452 Sdadl CDK8-induced 3.69E-05 1.38

231 147 Sh3tc1 CDK8-induced 3.83E-05 1.33

109168 5730596K20Rik CDK8-induced 3.93E-05 1.36

71 147 Oxsm CDK8-induced 4.23E-05 1.59

18612 Etv4 CDK8-induced 4.26E-05 1.29

26879 B3galnt1 CDK8-induced 4.34E-05 1.33

1 1459 Actal CDK8-induced 4.48E-05 1.90

217149 Mel 13 CDK8-induced 4.66E-05 1.23

14066 F3 CDK8-induced 4.72E-05 2.44

22135 Tgoln2 CDK8-induced 4.89E-05 1.21

56418 Ykt6 CDK8-induced 4.98E-05 1.40

21345 Tagln CDK8-induced 5.03E-05 1.68 50850 Spast CDK8- nduced 5.30E-05 1.26

230257 Rod1 CDK8- nduced 5.80E-05 1.26

20401 Sh3bp1 CDK8- nduced 5.82E-05 1.27

231571 AW060207 CDK8- nduced 5.85E-05 1.16

27273 Pdk4 CDK8- nduced 5.85E-05 1.28

68553 1 1 10001 D15Rik CDK8- nduced 5.88E-05 1.50

320214 4932425l24Rik CDK8- nduced 5.98E-05 1.44

76375 Det1 CDK8- nduced 6.14E-05 1.25

1 1898 Ass1 CDK8- nduced 6.15E-05 1.15

12053 Bcl6 CDK8- nduced 6.16E-05 1.26

67225 Rnpc3 CDK8- nduced 6.46E-05 1.22

226982 Eif5b CDK8- nduced 6.50E-05 1.23

71517 9030624J02Rik CDK8- nduced 6.56E-05 1.18

381549 Zfp69 CDK8- nduced 7.00E-05 1.21

67955 Sugtl CDK8- nduced 7.04E-05 1.17

230582 2810410C14Rik CDK8- nduced 7.1 1 E-05 1.28

623548 LOC623548 CDK8- nduced 7.24E-05 1.41

15270 H2afx CDK8- nduced 7.27E-05 1.30

71323 Rassf8 CDK8- nduced 7.33E-05 1.20

353282 Sfmbt2 CDK8- nduced 7.35E-05 1.16

13859 Eps15l1 CDK8- nduced 7.45E-05 1.28

319651 Usp37 CDK8- nduced 7.56E-05 1.28

217122 A430060F13Rik CDK8- nduced 7.56E-05 1.61

12322 Camk2a CDK8- nduced 7.63E-05 1.39

66405 Mcts2 CDK8- nduced 7.66E-05 1.29

67463 1200014M14Rik CDK8- nduced 7.83E-05 1.18

319158 Hist1 h4i CDK8- nduced 7.88E-05 1.72

226849 Ppp2r5a CDK8- nduced 7.98E-05 1.35

20680 Sox7 CDK8- nduced 8.30E-05 3.26

56213 Htral CDK8- nduced 8.37E-05 1.79

67800 Dgat2 CDK8- nduced 8.39E-05 1.29

65961 Crlzl CDK8- nduced 8.57E-05 1.19

66089 Rmnd5b CDK8- nduced 8.85E-05 1.18

17762 Mapt CDK8- nduced 9.10E-05 1.48

56046 2410003P15Rik CDK8- nduced 9.35E-05 1.25

245828 Trappd CDK8- nduced 9.81 E-05 1.1 1

71667 0610007L01 Rik CDK8- nduced 9.90E-05 1.10

235283 Gramdl b CDK8- nduced 9.91 E-05 1.32

240832 Tor1 aip2 CDK8- nduced 1.00E-04 1.13

218978 D14Ertd436e CDK8- nduced 1.01 E-04 1.14

18452 P4ha2 CDK8- nduced 1.03E-04 1.60

1 1975 Atp6v0a1 CDK8- nduced 1.03E-04 1.59

225912 Cybasc3 CDK8- nduced 1.09E-04 1.21

7741 1 Rbm35b CDK8- nduced 1.10E-04 1.27

56717 Frapl CDK8- nduced 1.14E-04 1.58

17873 Gadd45b CDK8- nduced 1.15E-04 1.18

109778 Blvra CDK8- nduced 1.16E-04 1.26

72183 Snx6 CDK8- nduced 1.17E-04 1.23

21 1945 Plekhhl CDK8- nduced 1.17E-04 1.56

52245 Commd2 CDK8- nduced 1.19E-04 1.13

27279 Tnfrsf12a CDK8- nduced 1.22E-04 1.18

721 13 Adckl CDK8- nduced 1.26E-04 1.16

55978 Ift20 CDK8- nduced 1.29E-04 1.21

382522 Hist3h2bb CDK8- nduced 1.30E-04 1.34

74218 1700016H13Rik CDK8- nduced 1.33E-04 1.42

78303 Hist3h2ba CDK8- nduced 1.33E-04 1.31

17342 Mitf CDK8- nduced 1.34E-04 1.36

20194 S100a10 CDK8- nduced 1.34E-04 1.19

140858 Wdr5 CDK8- nduced 1.35E-04 1.47 66395 Ahnak CDK8- nduced 1.37E-04 1.34

26893 Cops6 CDK8- nduced 1.38E-04 1.15

74412 Glel l CDK8- nduced 1.38E-04 1.21

70829 Ccdc93 CDK8- nduced 1.43E-04 1.27

19359 Rad23b CDK8- nduced 1.46E-04 1.25

22719 Zfp61 CDK8- nduced 1.48E-04 1.17

21767 Tex264 CDK8- nduced 1.51 E-04 1.17

381 1 10 AW061290 CDK8- nduced 1.54E-04 1.61

1 1890 Asgr2 CDK8- nduced 1.58E-04 1.34

77430 9430081 H08Rik CDK8- nduced 1.58E-04 1.24

13002 Dnajc5 CDK8- nduced 1.59E-04 1.27

21871 Atp6v0a2 CDK8- nduced 1.60E-04 1.28

20851 Stat5b CDK8- nduced 1.60E-04 1.23

53334 Gosrl CDK8- nduced 1.61 E-04 1.37

242083 Ppml l CDK8- nduced 1.61 E-04 1.18

52430 Echdc2 CDK8- nduced 1.62E-04 1.33

20181 Rxra CDK8- nduced 1.66E-04 1.35

225651 Mppel CDK8- nduced 1.68E-04 1.35

387524 Znrf2 CDK8- nduced 1.73E-04 1.42

13132 Dab2 CDK8- nduced 1.77E-04 1.90

66310 2810410M20Rik CDK8- nduced 1.77E-04 1.26

67247 Mosc2 CDK8- nduced 1.78E-04 1.18

212679 Mars2 CDK8- nduced 1.79E-04 1.25

26425 Nubpl CDK8- nduced 1.83E-04 1.09

121022 Mrps6 CDK8- nduced 1.83E-04 1.1 1

71929 Tmem123 CDK8- nduced 1.86E-04 1.59

19244 Ptp4a2 CDK8- nduced 1.89E-04 1.16

69743 Caszl CDK8- nduced 1.93E-04 1.22

57741 Noc2l CDK8- nduced 1.93E-04 1.20

18617 Rhox5 CDK8- nduced 1.98E-04 1.39

23806 Arihl CDK8- induced 1.99E-04 1.30

26932 Ppp2r5e CDK8- induced 2.05E-04 1.26

66603 Sip1 CDK8- induced 2.05E-04 1.28

98732 Rab3gap2 CDK8- induced 2.06E-04 1.13

56207 Uchl5 CDK8- induced 2.09E-04 1.27

226849 Ppp2r5a CDK8- induced 2.15E-04 1.45

74471 4933440N22Rik CDK8- induced 2.17E-04 1.35

208177 Phldb2 CDK8- induced 2.18E-04 1.36

16324 Inhbb CDK8- induced 2.18E-04 1.44

76142 Ppp1 r14c CDK8- induced 2.19E-04 1.28

57434 Xrcc2 CDK8- induced 2.20E-04 1.40

545136 LOC545136 CDK8- induced 2.21 E-04 1.34

232910 Ap2s1 CDK8- induced 2.24E-04 1.12

66432 Slc7a6os CDK8- induced 2.25E-04 1.21

245945 BC013481 CDK8- induced 2.30E-04 1.73

13168 Dbil5 CDK8- induced 2.31 E-04 1.87

14645 Glul CDK8- induced 2.32E-04 1.35

18631 Pex11a CDK8- induced 2.36E-04 1.31

70646 Nat12 CDK8- induced 2.45E-04 1.23

235380 Dmxl2 CDK8- induced 2.45E-04 1.62

214290 Zcchc6 CDK8- induced 2.47E-04 1.32

52036 Saps3 CDK8- induced 2.51 E-04 1.27

20227 Sartl CDK8- induced 2.52E-04 1.16

213027 B130050l23Rik CDK8- induced 2.53E-04 1.41

242700 Il28ra CDK8- induced 2.58E-04 1.32

1 14676 4930519F09Rik CDK8- induced 2.60E-04 1.19

226419 Dyrk3 CDK8- induced 2.61 E-04 1.30

15528 Hspel CDK8- induced 2.64E-04 1.15

16886 Limk2 CDK8- induced 2.66E-04 1.09 109229 C030004A17Rik CDK8- nduced 2.68E-04 1.18

21679 Tead4 CDK8- nduced 2.70E-04 1.48

66805 Tspanl CDK8- nduced 2.73E-04 1.57

1 1491 Adam 17 CDK8- nduced 2.73E-04 1.29

66827 Ttd CDK8- nduced 2.74E-04 1.27

20826 Nhp2l1 CDK8- nduced 2.75E-04 1.14

67486 Polr3g CDK8- nduced 2.76E-04 1.15

232210 8430410A17Rik CDK8- nduced 2.78E-04 1.31

70445 Cd248 CDK8- nduced 2.78E-04 1.74

71653 4930506M07Rik CDK8- nduced 2.85E-04 1.21

66912 Bzw2 CDK8- nduced 2.92E-04 1.18

226856 Lpgatl CDK8- nduced 2.94E-04 1.32

69368 Wdfyl CDK8- nduced 2.99E-04 1.30

207785 BC035295 CDK8- nduced 3.00E-04 1.51

19128 Prosl CDK8- nduced 3.00E-04 1.29

17847 Usp34 CDK8- nduced 3.03E-04 1.16

72931 2900010J23Rik CDK8- nduced 3.07E-04 1.1 1

229905 Ccbl2 CDK8- nduced 3.09E-04 1.33

21410 Tcf2 CDK8- nduced 3.09E-04 1.88

18100 Mrpl40 CDK8- nduced 3.12E-04 1.12

16582 Kifc3 CDK8- nduced 3.13E-04 1.66

18087 Nktr CDK8- nduced 3.16E-04 1.24

55948 Sfn CDK8- nduced 3.18E-04 1.45

72658 2700097O09Rik CDK8- nduced 3.18E-04 1.12

14784 Grb2 CDK8- nduced 3.25E-04 1.15

67451 Pkp2 CDK8- nduced 3.25E-04 1.28

20402 Zfp106 CDK8- nduced 3.28E-04 1.21

100213 Rusc2 CDK8- nduced 3.28E-04 1.26

56298 Arl6ip2 CDK8- nduced 3.34E-04 1.43

1 10606 Fntb CDK8- nduced 3.47E-04 1.20

12856 Cox 17 CDK8- nduced 3.49E-04 1.1 1

14598 Ggt1 CDK8- nduced 3.53E-04 1.65

319186 Hist1 h2bm CDK8- nduced 3.55E-04 1.29

72515 Wdr43 CDK8- nduced 3.55E-04 1.31

50708 Hist1 h1 c CDK8- nduced 3.57E-04 1.93

10891 1 Rcc2 CDK8- nduced 3.59E-04 1.15

56376 Pdlim5 CDK8- nduced 3.61 E-04 1.33

59009 Sh3rf1 CDK8- nduced 3.61 E-04 1.24

319162 Hist3h2a CDK8- nduced 3.62E-04 2.04

22156 Tuftl CDK8- nduced 3.63E-04 1.15

22004 Tpm2 CDK8- nduced 3.63E-04 1.27

72136 D4st1 CDK8- nduced 3.67E-04 1.23

16905 Lmna CDK8- nduced 3.68E-04 1.21

78938 Fbxo34 CDK8- nduced 3.74 E-04 1.17

58235 PvrM CDK8- nduced 3.75E-04 1.24

230738 Zc3h12a CDK8- nduced 3.79E-04 1.54

18632 Pex1 1 b CDK8- nduced 3.82E-04 1.13

22004 Tpm2 CDK8- nduced 3.83E-04 1.19

226747 Ahctfl CDK8- nduced 3.84 E-04 1.15

53414 Bysl CDK8- nduced 3.85E-04 1.21

77593 Usp45 CDK8- nduced 3.88E-04 1.52

73667 2410004P03Rik CDK8- nduced 3.88E-04 1.15

13803 End CDK8- nduced 3.91 E-04 1.40

226849 Ppp2r5a CDK8- nduced 3.95E-04 1.36

19679 Pitpnm2 CDK8- nduced 3.95E-04 1.35

77803 A930021 C24Rik CDK8- nduced 3.96 E-04 2.17

72662 2810028N01 Rik CDK8- nduced 4.03E-04 1.37

108062 Cstf2 CDK8- nduced 4.06E-04 1.17

94061 MrpM CDK8- nduced 4.06E-04 1.26 69453 1700027L20Rik CDK8- nduced 4.09E-04 1.40

74552 Npal3 CDK8- nduced 4.10E-04 1.31

97130 C77080 CDK8- nduced 4.12E-04 1.29

66979 Pole4 CDK8- nduced 4.16E-04 1.09

104732 4930427A07Rik CDK8- nduced 4.19E-04 1.44

328066 C920021A13 CDK8- nduced 4.23E-04 1.31

56771 Trfp CDK8- nduced 4.28E-04 1.35

319184 Hist1 h2bk CDK8- nduced 4.30E-04 1.33

229593 Golph3l CDK8- nduced 4.30E-04 1.19

67338 Rffl CDK8- nduced 4.38E-04 1.12

70359 Gtpbp3 CDK8- nduced 4.40E-04 1.13

74766 Yipf2 CDK8- nduced 4.40E-04 1.21

67226 Tmem19 CDK8- nduced 4.41 E-04 1.09

66805 Tspanl CDK8- nduced 4.43E-04 1.35

20671 Sox 17 CDK8- nduced 4.44E-04 1.79

67414 Mfn1 CDK8- nduced 4.45E-04 1.1 1

56807 Scamp5 CDK8- nduced 4.52E-04 1.18

67532 Mfapl CDK8- nduced 4.52E-04 1.14

73533 1700080G18Rik CDK8- nduced 4.52E-04 1.25

16002 Igf2 CDK8- nduced 4.53E-04 2.08

19414 Rasa3 CDK8- nduced 4.54 E-04 1.53

12449 Ccnf CDK8- nduced 4.57E-04 1.15

215615 Rnpep CDK8- nduced 4.60E-04 1.19

70454 Cenpl CDK8- nduced 4.61 E-04 1.09

75991 5033405K12Rik CDK8- nduced 4.65E-04 1.34

71099 Tssk4 CDK8- nduced 4.69E-04 1.19

67469 Abhd5 CDK8- nduced 4.70E-04 1.46

231452 Sdadl CDK8- nduced 4.72E-04 1.15

21859 Timp3 CDK8- nduced 4.73E-04 1.46

68620 1 1 10025D03Rik CDK8- nduced 4.78E-04 1.40

80914 Uck2 CDK8- nduced 4.83E-04 1.14

97159 A430005L14Rik CDK8- nduced 4.94 E-04 1.10

106564 Ppcs CDK8- nduced 4.96 E-04 1.19

215201 4732479N06Rik CDK8- nduced 5.03E-04 1.72

77106 Gpr178 CDK8- nduced 5.04 E-04 1.49

140486 Igf2bp1 CDK8- nduced 5.06E-04 1.22

76824 2410166l05Rik CDK8- nduced 5.10E-04 1.14

16180 111 rap CDK8- nduced 5.18E-04 1.56

66391 2310061 J03Rik CDK8- nduced 5.21 E-04 1.20

13132 Dab2 CDK8- nduced 5.23E-04 1.66

68970 Wdr40a CDK8- nduced 5.26E-04 1.1 1

19395 Rasgrp2 CDK8- nduced 5.28E-04 1.14

232339 Ankrd26 CDK8- nduced 5.33E-04 1.22

14786 Grb7 CDK8- nduced 5.36E-04 1.12

225791 Zadh2 CDK8- nduced 5.36E-04 1.27

56200 Ddx21 CDK8- nduced 5.42E-04 1.34

12817 Col13a1 CDK8- nduced 5.45E-04 1.61

259108 Olfr550 CDK8- nduced 5.48E-04 1.49

54401 Ywhab CDK8- nduced 5.49E-04 1.20

18950 Pnp CDK8- nduced 5.51 E-04 1.34

69082 2610312B22Rik CDK8- nduced 5.52E-04 1.23

231727 B3gnt4 CDK8- nduced 5.57E-04 1.36

16865 Lgtn CDK8- nduced 5.62E-04 1.32

67459 Nvl CDK8- nduced 5.65E-04 1.24

214253 Etnk2 CDK8- nduced 5.66E-04 1.26

71673 0610009J22Rik CDK8- nduced 5.69E-04 1.16

19727 Rfxank CDK8- nduced 5.70E-04 1.13

15467 Eif2ak1 CDK8- nduced 5.70E-04 1.15

68833 Pdcl3 CDK8- nduced 5.77E-04 1.25 140781 Myh7 CDK8- nduced 5.78E-04 1.54

56376 Pdlim5 CDK8- nduced 5.86E-04 1.31

74048 4632428N05Rik CDK8- nduced 5.87E-04 1.58

17248 Mdm4 CDK8- nduced 5.89E-04 1.37

18700 Piga CDK8- nduced 5.91 E-04 1.36

17425 Foxkl CDK8- nduced 5.98E-04 1.26

66787 4933433P14Rik CDK8- nduced 6.09E-04 1.20

321022 Cdv3 CDK8- nduced 6.12E-04 1.10

320940 Atp1 1 c CDK8- nduced 6.14E-04 1.34

1 14873 DscamU CDK8- nduced 6.14E-04 1.29

70639 5730521 K06Rik CDK8- nduced 6.16E-04 1.42

18020 Nfatc2ip CDK8- nduced 6.16E-04 1.63

223864 Rapgef3 CDK8- nduced 6.23E-04 1.51

18707 Pik3cd CDK8- nduced 6.23E-04 1.23

238247 Arid4a CDK8- nduced 6.25E-04 1.28

71389 Chd6 CDK8- nduced 6.25E-04 1.41

55948 Sfn CDK8- nduced 6.27E-04 1.38

214639 4930486L24Rik CDK8- nduced 6.29E-04 1.28

69327 1700007K13Rik CDK8- nduced 6.33E-04 1.36

69663 Ddx51 CDK8- nduced 6.38E-04 1.18

99683 Sec24b CDK8- nduced 6.41 E-04 1.16

21380 Tbx1 CDK8- nduced 6.44E-04 1.82

80985 Trim44 CDK8- nduced 6.53E-04 1.40

268294 Zbtb24 CDK8- nduced 6.58E-04 1.39

76803 2410141 K09Rik CDK8- nduced 6.59E-04 1.55

229681 St7l CDK8- nduced 6.70E-04 1.43

212647 Aldh4a1 CDK8- nduced 6.71 E-04 1.17

66352 Blzfl CDK8- nduced 6.82E-04 1.13

70240 2700038N03Rik CDK8- nduced 6.86E-04 1.25

66654 Tex 12 CDK8- nduced 6.89E-04 1.36

108737 Oxsrl CDK8- nduced 6.92 E-04 1.38

19181 Psmc2 CDK8- nduced 6.92 E-04 1.12

208760 Aqp12 CDK8- nduced 6.95E-04 4.43

1 1733 Ank1 CDK8- nduced 7.03E-04 1.88

258706 Olfr43 CDK8- nduced 7.03E-04 1.15

232236 C130022K22Rik CDK8- nduced 7.05E-04 1.24

17762 Mapt CDK8- nduced 7.07E-04 1.45

319188 Hist1 h2bp CDK8- nduced 7.07E-04 1.74

13167 Dbi CDK8- nduced 7.09E-04 1.09

67939 2010316F05Rik CDK8- nduced 7.13E-04 1.15

53312 6330412F12Rik CDK8- nduced 7.15E-04 1.26

67247 Mosc2 CDK8- nduced 7.20E-04 1.15

12161 Bmp6 CDK8- nduced 7.20E-04 1.44

67379 Dedd2 CDK8- nduced 7.22E-04 1.13

21961 Tns1 CDK8- nduced 7.25E-04 1.18

18516 Pbx3 CDK8- nduced 7.26E-04 1.28

232164 BC017133 CDK8- nduced 7.30E-04 1.49

77579 Myh10 CDK8- nduced 7.35E-04 1.15

109624 Caldl CDK8- nduced 7.37E-04 1.64

230967 BC046331 CDK8- nduced 7.40E-04 1.17

75079 Zfp509 CDK8- nduced 7.42E-04 1.10

259036 Olfr713 CDK8- nduced 7.45E-04 2.01

270627 Taf1 CDK8- nduced 7.47E-04 1.24

68252 A030007L17Rik CDK8- nduced 7.51 E-04 1.14

83675 Bicd CDK8- nduced 7.57E-04 1.32

1 1490 Adam 15 CDK8- nduced 7.58E-04 1.17

69253 Hspb2 CDK8- nduced 7.64E-04 1.56

232210 8430410A17Rik CDK8- nduced 7.68E-04 1.24

15278 Tfb2m CDK8- nduced 7.73E-04 1.15 1 1745 Anxa3 CDK8- nduced 7.74E-04 1.52

264064 CDK8 CDK8- nduced 7.81 E-04 1.41

71804 2610016C23Rik CDK8- nduced 7.95E-04 1.15

67264 Ndufb8 CDK8- nduced 7.97E-04 1.60

69288 Rhobtbl CDK8- nduced 8.01 E-04 1.66

338351 Akap17b CDK8- nduced 8.04 E-04 1.46

226971 Plekhb2 CDK8- nduced 8.1 1 E-04 1.30

13380 Dkk1 CDK8- nduced 8.30E-04 3.71

72102 Duspl 1 CDK8- nduced 8.32E-04 1.16

67967 Pold3 CDK8- nduced 8.34 E-04 1.13

22761 Zfpml CDK8- nduced 8.35E-04 1.15

68876 Xrcc6bp1 CDK8- nduced 8.39E-04 1.26

227960 Gca CDK8- nduced 8.40E-04 1.32

108800 Ston2 CDK8- nduced 8.46E-04 1.31

259000 Olfrl 95 CDK8- nduced 8.47E-04 1.13

235956 BC012278 CDK8- nduced 8.47E-04 1.16

81489 Dnajbl CDK8- nduced 8.51 E-04 1.22

22420 Wnt6 CDK8- nduced 8.54 E-04 1.34

67059 2810409H07Rik CDK8- nduced 8.54 E-04 1.13

67136 Kbtbd4 CDK8- nduced 8.58E-04 1.12

56036 Ccnl2 CDK8- nduced 8.60E-04 1.38

52014 D10Ertd438e CDK8- nduced 8.62E-04 1.21

68981 Snrpal CDK8- nduced 8.66E-04 1.23

66395 Ahnak CDK8- nduced 8.67E-04 1.32

12798 Cnn2 CDK8- nduced 8.76E-04 1.21

14300 Frg1 CDK8- nduced 8.77E-04 1.12

18799 Plcdl CDK8- nduced 8.78E-04 1.1 1

53869 Rab1 1 a CDK8- nduced 8.79E-04 1.12

19202 Rhox6 CDK8- nduced 8.85E-04 1.55

19384 Ran CDK8- nduced 8.89E-04 1.17

216831 AU040829 CDK8- nduced 8.93E-04 1.26

225432 Rbm27 CDK8- nduced 8.96 E-04 1.33

239739 Lamp3 CDK8- nduced 9.03E-04 1.23

269252 Gtf3c4 CDK8- nduced 9.08E-04 1.18

52705 Krr1 CDK8- nduced 9.13E-04 1.31

14165 Fgf10 CDK8- nduced 9.14E-04 2.54

67705 1810058l24Rik CDK8- nduced 9.24E-04 1.18

17131 Smad7 CDK8- nduced 9.24E-04 1.19

227644 Snapc4 CDK8- nduced 9.30E-04 1.13

26893 Cops6 CDK8- nduced 9.30E-04 1.15

27083 Xlr4b CDK8- nduced 9.39E-04 1.45

230579 BC026682 CDK8- nduced 9.40E-04 1.69

67333 Stk35 CDK8- nduced 9.41 E-04 1.35

7741 1 Rbm35b CDK8- nduced 9.51 E-04 1.25

68655 Fndd CDK8- nduced 9.59E-04 1.35

67089 Psmc6 CDK8- nduced 9.59E-04 1.13

68342 Ndufbl O CDK8- nduced 9.61 E-04 1.15

67590 4930521 E07Rik CDK8- nduced 9.65E-04 1.57

320769 Prdx6-rs1 CDK8- nduced 9.77E-04 1.16

266459 MGC107533 CDK8- nduced 9.90E-04 2.17

72584 Cul4b CDK8- nduced 9.96E-04 1.24

194162 BC035954 CDK8- nduced 1.00E-03 1.17

109163 3010003L21 Rik CDK8- nduced 1.00E-03 1.30

353258 Ltv1 CDK8- nduced 1.01 E-03 1.28

2691 13 Nup54 CDK8- nduced 1.01 E-03 1.44

18041 Nfs1 CDK8- nduced 1.01 E-03 1.1 1

1 10147 Ehmt2 CDK8- nduced 1.01 E-03 1.18

67618 Aasdhppt CDK8- nduced 1.03E-03 1.15

353170 4932441 K18Rik CDK8- nduced 1.03E-03 1.38 26876 Adh4 CDK8- nduced 1.03E-03 1.58

319594 Hifl an CDK8- nduced 1.04E-03 1.27

233552 Gdpd5 CDK8- nduced 1.05E-03 1.29

106931 Kctdl CDK8- nduced 1.05E-03 1.25

22680 Zfp207 CDK8- nduced 1.05E-03 1.19

226101 Fer1 l3 CDK8- nduced 1.05E-03 1.21

217431 NoM O CDK8- nduced 1.07E-03 1.37

18158 Nppb CDK8- nduced 1.07E-03 1.29

1 1981 Atp9a CDK8- nduced 1.07E-03 1.29

65969 Cubn CDK8- nduced 1.07E-03 3.20

67588 Rnf41 CDK8- nduced 1.08E-03 1.14

94061 MrpM CDK8- nduced 1.10E-03 1.25

18596 Pdgfrb CDK8- nduced 1.10E-03 1.60

1 1544 Adprh CDK8- nduced 1.10E-03 1.10

71679 Atp5h CDK8- nduced 1.10E-03 1.10

1 10532 Adarbl CDK8- nduced 1.10E-03 2.24

68002 1 1 10058L19Rik CDK8- nduced 1.1 1 E-03 1.16

18158 Nppb CDK8- nduced 1.1 1 E-03 1.42

69606 Mtfmt CDK8- nduced 1.1 1 E-03 1.30

57816 Tesc CDK8- nduced 1.12E-03 1.33

72568 Lin9 CDK8- nduced 1.12E-03 1.10

240753 Plekha6 CD 8- nduced 1.13E-03 1.23

21 1253 Mtrfl CDK8- nduced 1.13E-03 1.20

12445 Ccnd3 CDK8- nduced 1.14E-03 1.32

74201 Lrriq2 CDK8- nduced 1.14E-03 1.38

72508 Rps6kb1 CDK8- nduced 1.14E-03 1.32

78581 D530033C1 1 Rik CDK8- nduced 1.16E-03 1.18

210146 Irgq CDK8- nduced 1.16E-03 1.10

13639 Efna4 CDK8- nduced 1.18E-03 1.28

66493 Mrpl51 CDK8- nduced 1.19E-03 1.13

67480 Ccdc49 CDK8- induced 1.19E-03 1.28

67881 1810034K20Rik CDK8- induced 1.19E-03 1.18

78781 Zc3hav1 CDK8- induced 1.20E-03 1.42

228765 Sdcbp2 CDK8- induced 1.21 E-03 1.36

218275 BC051665 CDK8- induced 1.21 E-03 1.38

234733 Ddx19b CDK8- induced 1.21 E-03 1.22

94067 Mrpl43 CDK8- induced 1.22E-03 1.09

74136 Sec14l1 CDK8- induced 1.23E-03 1.18

1 1061 1 Hdlbp CDK8- induced 1.23E-03 1.14

50868 Keapl CDK8- induced 1.24E-03 1.25

50850 Spast CDK8- induced 1.24E-03 1.20

53414 Bysl CDK8- induced 1.24E-03 1.10

268490 2600001 B17Rik CDK8- induced 1.24E-03 1.20

433004 B830017H08Rik CDK8- induced 1.24E-03 1.61

77049 4921528l07Rik CDK8- induced 1.25E-03 1.88

278279 Tmtc2 CDK8- induced 1.25E-03 1.27

56427 Tubdl CDK8- induced 1.25E-03 1.19

75767 Rab1 1fip1 CDK8- induced 1.27E-03 1.10

242642 Gloxdl CDK8- induced 1.27E-03 1.25

258748 Olfrl 195 CDK8- induced 1.29E-03 1.29

22654 Zfp13 CDK8- induced 1.29E-03 1.09

50527 Erol l CDK8- induced 1.29E-03 1.28

435336 LOC435336 CDK8- induced 1.30E-03 1.19

69582 Plekhm2 CDK8- induced 1.30E-03 1.31

67681 MrpM 8 CDK8- induced 1.31 E-03 1.16

76223 Agbl3 CDK8- induced 1.31 E-03 1.20

101540 Prkd2 CDK8- induced 1.32E-03 1.22

75600 Calml4 CDK8- induced 1.32E-03 1.54

76073 Pcgf5 CDK8- induced 1.33E-03 1.17 66356 2310008H09Rik CDK8- nduced 1.34E-03 1.13

74302 Mtmr3 CDK8- nduced 1.34E-03 1.14

619605 Zcchc17 CDK8- nduced 1.34E-03 1.23

226026 Smc5 CDK8- nduced 1.35E-03 1.26

381605 Tbc1 d2 CDK8- nduced 1.35E-03 1.20

23830 CapnI O CDK8- nduced 1.35E-03 1.21

17904 Myl6 CDK8- nduced 1.35E-03 1.15

68090 Yifl a CDK8- nduced 1.35E-03 1.22

22661 Zfp148 CDK8- nduced 1.38E-03 1.14

16857 Lgals6 CDK8- nduced 1.38E-03 1.41

73167 31 10043J09Rik CDK8- nduced 1.38E-03 1.16

209225 Zfp710 CDK8- nduced 1.38E-03 1.16

14958 H1f0 CDK8- nduced 1.39E-03 1.42

20692 Sparc CDK8- nduced 1.39E-03 1.37

54632 Ftsjl CDK8- nduced 1.39E-03 1.20

329003 Zfp516 CDK8- nduced 1.41 E-03 1.18

27392 Pign CDK8- nduced 1.42E-03 1.18

19244 Ptp4a2 CDK8- nduced 1.42E-03 1.19

16162 Il12rb2 CDK8- nduced 1.42E-03 1.84

17762 Mapt CDK8- nduced 1.42E-03 1.27

18004 Nek1 CDK8- nduced 1.42E-03 1.40

22343 Lin7c CDK8- nduced 1.43E-03 1.18

55944 Eif3s7 CDK8- nduced 1.43E-03 1.13

319475 Zfp672 CDK8- nduced 1.43E-03 1.44

76894 Mett5d1 CDK8- nduced 1.43E-03 1.16

66585 Wdr57 CDK8- nduced 1.43E-03 1.13

20439 Siah2 CDK8- nduced 1.43E-03 1.18

73385 1700047117Rik CDK8- nduced 1.44E-03 1.36

74150 Slc35f5 CDK8- nduced 1.44E-03 1.14

57750 Wdr12 CDK8- nduced 1.44E-03 1.27

268749 Rnf31 CDK8- induced 1.45E-03 1.1 1

66642 CtnnbM CDK8- induced 1.46E-03 1.13

27381 Tcl1 b2 CDK8- induced 1.47E-03 1.14

666060 Frmpdl CDK8- induced 1.47E-03 1.36

66395 Ahnak CDK8- induced 1.48E-03 1.39

1 14673 4930433N12Rik CDK8- induced 1.48E-03 2.35

83409 Mapbpip CDK8- induced 1.49E-03 1.14

75796 Cdyl2 CDK8- induced 1.49E-03 1.36

17907 Mylpf CDK8- induced 1.50E-03 1.29

237422 Ric8b CDK8- induced 1.51 E-03 1.25

24071 Synj2bp CDK8- induced 1.51 E-03 1.12

14745 Edg2 CDK8- induced 1.52E-03 1.49

330474 BC057627 CDK8- induced 1.53E-03 1.10

68190 5330426P16Rik CDK8- induced 1.53E-03 1.26

66242 Mrps16 CDK8- induced 1.55E-03 1.13

230073 Ddx58 CDK8- induced 1.55E-03 1.55

69179 Tmeml 10 CDK8- induced 1.55E-03 1.18

319710 Frmd6 CDK8- induced 1.56E-03 1.24

108954 Ppp1 r15b CDK8- induced 1.56E-03 1.24

99371 Arfgef2 CDK8- induced 1.57E-03 1.18

1 1539 Adoral CDK8- induced 1.57E-03 1.35

76246 Rtf1 CDK8- induced 1.58E-03 1.10

56217 Mpp5 CDK8- induced 1.59E-03 1.10

81879 Tcfcp2l1 CDK8- induced 1.59E-03 1.41

232339 Ankrd26 CDK8- induced 1.60E-03 1.38

2691 13 Nup54 CDK8- induced 1.61 E-03 1.32

231510 A230097K15Rik CDK8- induced 1.62E-03 1.45

56444 Actrl 0 CDK8- induced 1.62E-03 1.09

67574 Glt28d1 CDK8- induced 1.63E-03 1.20 17919 Myo5b CDK8- nduced 1.63E-03 1.39

52713 Ccdc59 CDK8- nduced 1.64E-03 1.21

68966 1500001 L15Rik CDK8- nduced 1.64E-03 1.1 1

68017 Ftsj2 CDK8- nduced 1.64E-03 1.28

28146 D3Ucla1 CDK8- nduced 1.66E-03 1.20

22680 Zfp207 CDK8- nduced 1.66E-03 1.20

64659 Mrps14 CDK8- nduced 1.67E-03 1.18

56284 MrpM 9 CDK8- nduced 1.68E-03 1.14

54608 Abhd2 CDK8- nduced 1.68E-03 1.36

53886 Cdkl2 CDK8- nduced 1.69E-03 1.26

7101 1 4933401 B06Rik CDK8- nduced 1.70E-03 1.21

72828 2810457l06Rik CDK8- nduced 1.71 E-03 1.74

229007 Zgpat CDK8- nduced 1.71 E-03 1.18

1 1475 Acta2 CDK8- nduced 1.72E-03 1.44

50766 Criml CDK8- nduced 1.72E-03 1.40

52398 1 1 -Sep CDK8- nduced 1.73E-03 1.16

18141 Nup50 CDK8- nduced 1.75E-03 1.17

26932 Ppp2r5e CDK8- nduced 1.75E-03 1.26

66070 0610040D20Rik CDK8- nduced 1.76E-03 1.10

73945 Otud4 CDK8- nduced 1.76E-03 1.15

67912 1600012H06Rik CDK8- nduced 1.78E-03 1.1 1

546077 LOC546077 CDK8- nduced 1.78E-03 1.16

66667 Hspbapl CDK8- nduced 1.78E-03 1.19

268465 Eme1 CDK8- nduced 1.78E-03 1.13

240641 Mphosphl CDK8- nduced 1.78E-03 1.12

106021 Topors CDK8- nduced 1.78E-03 1.20

59044 Rnf130 CDK8- nduced 1.80E-03 1.08

56405 Dusp14 CDK8- nduced 1.80E-03 1.40

270192 Rab6b CDK8- nduced 1.81 E-03 1.35

57260 Ltb4r2 CDK8- nduced 1.82E-03 1.24

68493 1 1 10007M04Rik CDK8- nduced 1.82E-03 1.09

18020 Nfatc2ip CDK8- nduced 1.84E-03 1.17

74107 Cep55 CDK8- nduced 1.84E-03 1.24

67973 Mphosphl 0 CDK8- nduced 1.85E-03 1.26

64010 Sav1 CDK8- induced 1.85E-03 1.20

28077 D13Wsu50e CDK8- induced 1.85E-03 1.1 1

75717 Cul5 CDK8- induced 1.86E-03 1.12

433771 231002801 1 Rik CDK8- induced 1.87E-03 1.19

66225 1 190005P17Rik CDK8- induced 1.87E-03 1.20

14841 Gsg2 CDK8- induced 1.87E-03 1.20

109331 Rnf20 CDK8- induced 1.89E-03 1.58

7701 1 5730590G19Rik CDK8- induced 1.90E-03 1.18

22320 Vamp8 CDK8- induced 1.91 E-03 1.22

12797 Cnn1 CDK8- induced 1.91 E-03 1.35

1 1781 Ap4m1 CDK8- induced 1.91 E-03 1.19

66395 Ahnak CDK8- induced 1.91 E-03 1.25

14120 Fbp2 CDK8- induced 1.92E-03 2.77

231 130 Tnip2 CDK8- induced 1.93E-03 1.34

73486 1700084J12Rik CDK8- induced 1.93E-03 1.21

13990 Smarcadl CDK8- induced 1.94E-03 1.19

67621 2310026E23Rik CDK8- induced 1.96E-03 1.18

231713 C330023M02Rik CDK8- induced 1.97E-03 1.16

21825 Thbsl CDK8- induced 1.97E-03 1.43

2241 1 Wnt1 1 CDK8- induced 1.98E-03 1.23

1 1475 Acta2 CDK8- induced 1.98E-03 2.04

69982 Spink2 CDK8- induced 1.99E-03 1.27

16978 Lrrfipl CDK8- induced 1.99E-03 1.24

26901 Deb1 CDK8- induced 1.99E-03 1.12

16569 Kif3b CDK8- induced 2.01 E-03 1.17 70678 3021401 C12Rik CDK8- nduced 2.02E-03 2.24

14489 tpn CD 8- nduced 2.02E-03 1.12

106264 0610012G03Rik CDK8- nduced 2.04E-03 1.15

21339 Tafi a CDK8- nduced 2.04E-03 1.15

94092 Trim16 CDK8- nduced 2.05E-03 1.70

17096 Lyn CDK8- nduced 2.05E-03 1.55

99045 Mrps26 CDK8- nduced 2.06E-03 1.10

68592 Syf2 CDK8- nduced 2.06E-03 1.25

74600 Mrpl47 CDK8- nduced 2.07E-03 1.15

108735 Sft2d2 CDK8- nduced 2.07E-03 1.34

57741 Noc2l CDK8- nduced 2.08E-03 1.09

22214 Ube2h CDK8- nduced 2.09E-03 1.34

70713 6330416L1 1 Rik CDK8- nduced 2.10E-03 1.39

74414 Polr3c CDK8- nduced 2.1 1 E-03 1.14

68999 Anapd O CDK8- nduced 2.1 1 E-03 1.12

59091 Jph2 CDK8- nduced 2.12E-03 1.51

74766 Yipf2 CDK8- nduced 2.12E-03 1.22

69464 2300006N05Rik CDK8- nduced 2.14E-03 1.74

64658 Mrps25 CDK8- nduced 2.15E-03 1.25

66467 Gtf2h5 CDK8- nduced 2.15E-03 1.12

228913 Zfp217 CDK8- nduced 2.15E-03 1.46

224833 AI661453 CDK8- nduced 2.15E-03 1.18

1 1898 Ass1 CDK8- nduced 2.16E-03 1.17

223881 Rnd1 CDK8- nduced 2.17E-03 1.26

99683 Sec24b CDK8- nduced 2.17E-03 1.15

73703 Dppa2 CDK8- nduced 2.18E-03 1.39

67890 Ufm1 CDK8- nduced 2.18E-03 1.29

102060 Gadd45gip1 CDK8- nduced 2.19E-03 1.12

77744 6720463M24Rik CDK8- nduced 2.20E-03 1.14

99480 Dnttip2 CDK8- nduced 2.20E-03 1.15

270627 Taf1 CDK8- nduced 2.21 E-03 1.37

66935 1700023B02Rik CDK8- nduced 2.21 E-03 1.22

319166 Hist1 h2ae CDK8- nduced 2.21 E-03 1.63

67454 1200009F10Rik CDK8- nduced 2.24E-03 1.10

12017 Bag1 CDK8- induced 2.25E-03 1.1 1

226101 Fer1 l3 CDK8- induced 2.25E-03 1.24

74080 Nmnat3 CDK8- induced 2.27E-03 1.36

12345 Capzb CDK8- induced 2.27E-03 1.18

64164 Ifrg15 CDK8- induced 2.28E-03 1.1 1

22172 Tyms-ps CDK8- induced 2.28E-03 1.18

13418 Dnajd CDK8- induced 2.30E-03 1.46

7061 1 Fbxo33 CDK8- induced 2.30E-03 1.18

22158 Tulp3 CDK8- induced 2.30E-03 1.93

106264 0610012G03Rik CDK8- induced 2.31 E-03 1.14

574428 Zmynd15 CDK8- induced 2.31 E-03 1.55

68904 Abhd13 CDK8- induced 2.31 E-03 1.20

56405 Dusp14 CDK8- induced 2.31 E-03 1.41

19258 Ptpn4 CDK8- induced 2.33E-03 1.17

56279 B230317C12Rik CDK8- induced 2.33E-03 1.30

75590 Dusp9 CDK8- induced 2.34E-03 1.26

66352 Blzfl CDK8- induced 2.34E-03 1.32

70675 Vcpipl CDK8- induced 2.34E-03 1.37

98238 Lrrc59 CDK8- induced 2.35E-03 1.10

245190 6430704N06 CDK8- induced 2.35E-03 1.23

81879 Tcfcp2l1 CDK8- induced 2.36E-03 1.35

140781 Myh7 CDK8- induced 2.36E-03 1.49

64292 Ptges CDK8- induced 2.37E-03 1.73

258512 Olfr530 CDK8- induced 2.38E-03 1.20

28035 Usp39 CDK8- induced 2.39E-03 1.18 12757 Clta CDK8-induced 2.40E-03 1.14

56299 Fkbpl CDK8-induced 2.41 E-03 1.12

64385 Cyp4f14 CDK8-induced 2.41 E-03 2.32

69259 Kctd5 CDK8-induced 2.41 E-03 1.16

1 1992 Auh CDK8-induced 2.41 E-03 1.31

319371 D030028A08Rik CDK8-induced 2.42E-03 1.83

71974 Prmt3 CDK8-induced 2.42E-03 1.18

77371 Sec24a CDK8-induced 2.43E-03 1.40

74268 Aven CDK8-induced 2.43E-03 1.26

108841 Rdh13 CDK8-induced 2.43E-03 1.24

74202 Fbliml CDK8-induced 2.43E-03 1.30

66126 Elofl CDK8-induced 2.43E-03 1.13

53356 Eif3s4 CDK8-induced 2.44E-03 1.15

171 17 Amacr CDK8-induced 2.44E-03 1.07

215051 Bud 13 CDK8-induced 2.44E-03 1.15

232146 BC014699 CDK8-induced 2.45E-03 1.79

12263 C2 CDK8-induced 2.45E-03 1.30

1 1637 Ak2 CDK8-induced 2.45E-03 1.25

628882 LOC628882 CDK8-induced 2.46E-03 1.1 1

231252 Chrna9 CDK8-induced 2.46E-03 2.13

231440 9130213B05Rik CDK8-induced 2.46E-03 1.25

681 18 9430023L20Rik CDK8-induced 2.47E-03 1.20

109232 Sccpdh CDK8-induced 2.48E-03 1.22

238317 C130039O16Rik CDK8-induced 2.48E-03 1.23

213326 Scyl2 CDK8-induced 2.48E-03 1.19

20851 Stat5b CDK8-induced 2.50E-03 1.55

17765 Mtf2 CDK8-induced 2.52E-03 1.25

320718 Slc26a9 CDK8-induced 2.53E-03 1.67

68695 Hddc3 CDK8-induced 2.53E-03 1.41

140477 Dmbxl CDK8-induced 2.54E-03 1.50

107732 MrpM O CDK8-induced 2.56E-03 1.10

225341 Lims2 CDK8-induced 2.58E-03 1.57

56403 Syncrip CDK8-induced 2.59E-03 1.13

235315 D130054N24Rik CDK8-induced 2.59E-03 1.23

18740 Pitxl CDK8-induced 2.59E-03 1.80

14976 H2-Ke2 CDK8-induced 2.60E-03 1.12

16649 Kpna4 CDK8-induced 2.60E-03 1.50

67273 Ndufal O CDK8-induced 2.60E-03 1.10

225518 Gm92 CDK8-induced 2.61 E-03 1.42

17979 Ncoa3 CDK8-induced 2.61 E-03 1.26

67075 2610529C04Rik CDK8-induced 2.62E-03 1.27

67958 2610101 NI ORik CDK8-induced 2.62E-03 1.13

81702 Ankrd17 CDK8-induced 2.64E-03 1.24

1 1491 Adam 17 CDK8-induced 2.65E-03 1.19

94181 Nans CDK8-induced 2.66E-03 1.15

67290 31 10040N1 1 Rik CDK8-induced 2.66E-03 1.17

230967 BC046331 CDK8-induced 2.66E-03 1.34

68041 Mid 1 ip 1 CDK8-repressed 5.13E-08 1.39

78339 Ttyh3 CDK8-repressed 1.83E-07 1.29

16842 Lef1 CDK8-repressed 3.01 E-07 1.67

23965 Odz3 CDK8-repressed 4.09E-07 1.38

320145 Sp8 CDK8-repressed 6.66E-07 2.78

76582 lpo1 1 CDK8-repressed 7.76E-07 1.30

16362 Irf1 CDK8-repressed 9.49E-07 1.41

18115 Nnt CDK8-repressed 1.10E-06 1.55

12794 Cnih2 CDK8-repressed 1.52E-06 1.39

18741 Pitx2 CDK8-repressed 1.54E-06 2.77

12055 Bcl7c CDK8-repressed 1.54E-06 1.45 56403 Syncrip CDK8-repressed 1.69E-06 1.30

104418 Dgkz CDK8-repressed 1.71 E-06 1.21

13004 Cspg3 CDK8-repressed 1.72E-06 1.58

64209 Herpudl CDK8-repressed 1.81 E-06 1.76

209446 Tcfe3 CDK8-repressed 2.39E-06 1.35

14025 Bcl1 1 a CDK8-repressed 2.52E-06 2.79

76055 Mgea5 CDK8-repressed 2.58E-06 1.31

1 1735 Ank3 CDK8-repressed 3.21 E-06 1.45

78885 Coro7 CDK8-repressed 3.22E-06 1.23

20741 Spnbl CDK8-repressed 3.39E-06 1.69

22142 Tubal CDK8-repressed 3.90E-06 1.33

14088 Fancc CDK8-repressed 3.91 E-06 1.14

170770 Bbc3 CDK8-repressed 4.02E-06 1.27

19191 Psme2b-ps CDK8-repressed 4.17E-06 1.28

14025 Bcl1 1 a CDK8-repressed 4.40E-06 2.06

15944 Irgm CDK8-repressed 5.80E-06 1.57

70974 Pgm2l1 CDK8-repressed 5.89E-06 1.35

54367 Zfp326 CDK8-repressed 5.90E-06 1.23

18803 Plcgl CDK8-repressed 6.1 1 E-06 1.29

232288 Frmd4b CDK8-repressed 6.32E-06 1.89

20168 Rtn3 CDK8-repressed 7.14E-06 1.35

69683 2310044H10Rik CDK8-repressed 8.10E-06 1.31

73047 Camk2n2 CDK8-repressed 8.27E-06 1.33

14664 Slc6a9 CDK8-repressed 8.46E-06 1.45

1 10006 Gusb CDK8-repressed 9.24E-06 1.16

67030 Fancl CDK8-repressed 9.55E-06 1.27

80743 Vps16 CDK8-repressed 1.01 E-05 1.15

13527 Dtna CDK8-repressed 1.04E-05 1.71

329540 8430427H17Rik CDK8-repressed 1.20E-05 2.07

226154 Lzts2 CDK8-repressed 1.20E-05 1.33

22431 Wt1 CDK8-repressed 1.21 E-05 1.75

50790 Acsl4 CDK8-repressed 1.22E-05 1.35

13424 Dynd hl CDK8-repressed 1.27E-05 1.35

77048 4921537D05Rik CDK8-repressed 1.29E-05 1.22

54135 Lsr CDK8-repressed 1.43E-05 1.17

53761 Bat2 CDK8-repressed 1.53E-05 1.05

20975 Synj2 CDK8-repressed 1.65E-05 1.46

14897 Trip12 CDK8-repressed 1.66E-05 1.20

67803 Limd2 CDK8-repressed 1.82E-05 1.49

83925 Trpsl CDK8-repressed 1.83E-05 1.28

94190 Ophnl CDK8-repressed 1.84E-05 1.33

99633 Lphn2 CDK8-repressed 1.86E-05 1.25

80898 Artsl CDK8-repressed 1.87E-05 1.85

225995 D030056L22Rik CDK8-repressed 1.96E-05 1.22

19025 Ppgb CDK8-repressed 1.97E-05 1.19

235472 Prtg CDK8-repressed 2.04E-05 1.31

219189 1300010F03Rik CDK8-repressed 2.23E-05 1.29

100620 AI413194 CDK8-repressed 2.31 E-05 1.32

13197 Gadd45a CDK8-repressed 2.33E-05 1.38

76901 Phf15 CDK8-repressed 2.34E-05 1.55

20522 Slc23a1 CDK8-repressed 2.48E-05 2.44

13836 Epha2 CDK8-repressed 2.50E-05 1.30

66822 Fbxo25 CDK8-repressed 2.56E-05 1.06

269700 AU042671 CDK8-repressed 2.57E-05 1.23

54126 Arhgef7 CDK8-repressed 2.59E-05 1.34

14870 Gstpl CDK8-repressed 2.60E-05 1.21

16593 Kns2 CDK8-repressed 2.64E-05 1.32

78248 Armcxl CDK8-repressed 2.64E-05 1.38

69870 Polr3gl CDK8-repressed 2.66E-05 1.47 70408 Polr3f CDK8-repressed 2.68E-05 2.39

66725 Lrrk2 CDK8-repressed 2.70E-05 1.51

671 1 1 Asahl CDK8-repressed 2.71 E-05 1.32

83679 Pde4dip CDK8-repressed 2.75E-05 1.34

59026 Huwel CDK8-repressed 2.76E-05 1.31

56195 Ptbp2 CDK8-repressed 2.89E-05 1.62

1 10350 Dync2h1 CDK8-repressed 2.97E-05 1.29

66272 1810020G14Rik CDK8-repressed 2.97E-05 1.24

71375 Chesl CDK8-repressed 3.03E-05 1.37

94176 Dock2 CDK8-repressed 3.06E-05 1.58

54353 Scap2 CDK8-repressed 3.07E-05 1.24

78266 Zfp687 CDK8-repressed 3.12E-05 1.20

619750 LOC619750 CDK8-repressed 3.17E-05 1.27

107503 Atf5 CDK8-repressed 3.21 E-05 1.20

229599 Gm129 CDK8-repressed 3.21 E-05 1.29

101563 AI426330 CDK8-repressed 3.23E-05 1.53

72519 Tmem55a CDK8-repressed 3.27E-05 1.40

1 1782 Ap4s1 CDK8-repressed 3.28E-05 1.24

20775 Sqle CDK8-repressed 3.48E-05 1.31

66880 Rsrd CDK8-repressed 3.52E-05 1.37

270685 Mthfd 11 CDK8-repressed 3.58E-05 1.27

53310 Dlgh3 CDK8-repressed 3.58E-05 1.14

217666 L2hgdh CDK8-repressed 3.75E-05 1.35

83997 Slmap CDK8-repressed 3.84E-05 1.21

210766 Brcc3 CDK8-repressed 3.89E-05 1.72

434166 LOC434166 CDK8-repressed 3.94E-05 1.65

320895 C030025P15Rik CDK8-repressed 4.00E-05 1.31

72416 Lrpprc CDK8-repressed 4.01 E-05 1.15

100986 Akap9 CDK8-repressed 4.02E-05 1.29

26422 Nbea CDK8-repressed 4.15E-05 1.79

234258 Neil3 CDK8-repressed 4.30E-05 1.48

15944 Irgm CDK8-repressed 4.37E-05 1.55

78887 Sfi1 CDK8-repressed 4.41 E-05 1.55

244579 Tnrc9 CDK8-repressed 4.56E-05 2.25

245670 Rragb CDK8-repressed 4.75E-05 1.79

58172 Sertad2 CDK8-repressed 4.88E-05 1.30

69478 2300009A05Rik CDK8-repressed 4.95E-05 1.18

19025 Ppgb CDK8-repressed 5.05E-05 1.22

109910 Zfp91 CDK8-repressed 5.16E-05 1.43

19652 Rbm3 CDK8-repressed 5.18E-05 1.33

23651 1 Eif2c1 CDK8-repressed 5.22E-05 1.53

329540 8430427H17Rik CDK8-repressed 5.45E-05 1.26

268515 Bahcd CDK8-repressed 5.63E-05 1.26

22343 Lin7c CDK8-repressed 5.84E-05 1.37

20522 Slc23a1 CDK8-repressed 5.86E-05 3.56

14469 Gbp2 CDK8-repressed 5.94E-05 1.71

14050 Eya3 CDK8-repressed 6.01 E-05 1.29

19191 Psme2b-ps CDK8-repressed 6.06E-05 1.29

19272 Ptprk CDK8-repressed 6.36E-05 1.27

181 15 Nnt CDK8-repressed 6.46E-05 1.55

209497 Tmem164 CDK8-repressed 6.60E-05 1.49

100986 Akap9 CDK8-repressed 6.68E-05 1.32

170677 Pcdh21 CDK8-repressed 6.82E-05 1.73

18823 Plp1 CDK8-repressed 6.96E-05 1.66

244745 Dpy1911 CDK8-repressed 7.00E-05 1.30

16561 Kifl b CDK8-repressed 7.15E-05 1.21

74996 Usp47 CDK8-repressed 7.19E-05 1.18

671 15 Rpl14 CDK8-repressed 7.25E-05 1.16

23962 Oasl2 CDK8-repressed 7.30E-05 2.38 20975 Synj2 CDK8-repressed 7.37E-05 1.33

74256 Cyld CDK8-repressed 7.42E-05 1.43

66976 2410002F23Rik CDK8-repressed 7.49E-05 1.25

207521 Dtx4 CDK8-repressed 7.58E-05 1.89

207521 Dtx4 CDK8-repressed 7.64E-05 1.77

17319 Mif CDK8-repressed 7.76E-05 1.19

14864 Gstm3 CDK8-repressed 7.94E-05 1.37

101476 Plekhal CDK8-repressed 8.04E-05 1.20

208618 BC026657 CDK8-repressed 8.12E-05 1.23

14758 Gpm6b CDK8-repressed 8.14E-05 1.51

277333 MGC68323 CDK8-repressed 8.20E-05 1.14

66880 Rsrd CDK8-repressed 8.32E-05 1.35

171207 Arhgap4 CDK8-repressed 8.37E-05 1.24

67095 Trakl CDK8-repressed 8.68E-05 1.25

181 15 Nnt CDK8-repressed 8.70E-05 1.48

58246 Slc35b4 CDK8-repressed 8.82E-05 1.19

21827 Thbs3 CDK8-repressed 9.04E-05 1.53

238799 Tnpol CDK8-repressed 9.21 E-05 1.24

13196 Ddefl CDK8-repressed 9.38E-05 1.18

67306 31 10050N22Rik CDK8-repressed 9.42E-05 1.23

50524 Sall2 CDK8-repressed 9.54E-05 2.28

59092 Pcbp4 CDK8-repressed 9.64E-05 1.21

57265 Fzd2 CDK8-repressed 9.70E-05 1.42

20451 St8sia3 CDK8-repressed 1.00E-04 2.21

100504048 LOC100504048 CDK8-repressed 1.02E-04 1.55

241062 D230012E17Rik CDK8-repressed 1.04E-04 1.36

237775 BC050078 CDK8-repressed 1.04E-04 1.25

71779 8-Mar CDK8-repressed 1.05E-04 1.24

1 10265 Msra CDK8-repressed 1.08E-04 1.22

14468 Gbp1 CDK8-repressed 1.09E-04 2.02

108138 Xrcc4 CDK8-repressed 1.09E-04 1.33

26897 Acotl CDK8-repressed 1.09E-04 1.28

17909 Myo10 CDK8-repressed 1.10E-04 1.28

55932 Gbp4 CDK8-repressed 1.12E-04 1.91

17309 Mgat3 CDK8-repressed 1.12E-04 1.16

59079 Erbb2ip CDK8-repressed 1.13E-04 1.25

19056 Ppp3cb CDK8-repressed 1.14E-04 1.19

20901 Strap CDK8-repressed 1.16E-04 1.25

20937 Suv39h1 CDK8-repressed 1.22E-04 1.27

16008 Igfbp2 CDK8-repressed 1.23E-04 1.31

77980 Sbf1 CDK8-repressed 1.24E-04 1.17

230753 Thrap3 CDK8-repressed 1.25E-04 1.21

77963 Hookl CDK8-repressed 1.26E-04 1.87

20317 Serpinfl CDK8-repressed 1.27E-04 1.59

18574 Pdel b CDK8-repressed 1.27E-04 1.38

21417 Zfhxl a CDK8-repressed 1.30E-04 1.28

70021 Nt5dc2 CDK8-repressed 1.35E-04 1.26

215748 Cnksr3 CDK8-repressed 1.36E-04 1.27

14862 Gstml CDK8-repressed 1.40E-04 1.46

19280 Ptprs CDK8-repressed 1.47E-04 1.17

230721 Pabpc4 CDK8-repressed 1.49E-04 1.16

72722 2810405J04Rik CDK8-repressed 1.53E-04 1.15

69051 Pycr2 CDK8-repressed 1.55E-04 1.17

71306 Mfap3l CDK8-repressed 1.60E-04 1.60

56741 Nope CDK8-repressed 1.60E-04 1.83

75430 3200002M19Rik CDK8-repressed 1.64E-04 1.13

18129 Notch2 CDK8-repressed 1.67E-04 1.23

102910 AI448196 CDK8-repressed 1.69E-04 1.51

140740 Sec63 CDK8-repressed 1.69E-04 1.47 237877 C130052G03Rik CDK8-repressed 1.69E-04 1.19

71703 Armcx3 CDK8-repressed 1.71 E-04 1.75

27223 Trp53bp1 CDK8-repressed 1.72E-04 1.29

106585 Ankrd12 CDK8-repressed 1.72E-04 1.26

270163 Myo9a CDK8-repressed 1.73E-04 2.53

207521 Dtx4 CDK8-repressed 1.78E-04 1.69

20319 Sfrp2 CDK8-repressed 1.78E-04 1.50

71974 Prmt3 CDK8-repressed 1.80E-04 1.18

104248 Cabinl CDK8-repressed 1.83E-04 1.14

17967 Ncaml CDK8-repressed 1.88E-04 1.24

72668 2810030E01 Rik CDK8-repressed 1.89E-04 2.01

67629 Spbc24 CDK8-repressed 1.89E-04 1.18

233204 Tbc1 d17 CDK8-repressed 1.90E-04 1.23

140488 Igf2bp3 CDK8-repressed 1.91 E-04 1.60

217734 Pomt2 CDK8-repressed 1.92E-04 1.27

670106 LOC670106 CDK8-repressed 1.98E-04 1.23

216440 4632413K17Rik CDK8-repressed 2.00E-04 1.26

13356 Dgcr2 CDK8-repressed 2.03E-04 1.13

66179 1110031 l02Rik CDK8-repressed 2.05E-04 1.18

78330 1500032D16Rik CDK8-repressed 2.07E-04 1.16

228880 Prkcbpl CDK8-repressed 2.08E-04 1.15

14151 Fech CDK8-repressed 2.09E-04 1.14

1 16870 Mta1 CDK8-repressed 2.1 1 E-04 1.20

19272 Ptprk CDK8-repressed 2.1 1 E-04 1.41

16913 Psmb8 CDK8-repressed 2.13E-04 1.94

19094 Mapk1 1 CDK8-repressed 2.13E-04 1.27

1 1632 Aip CDK8-repressed 2.17E-04 1.20

170742 Sertad3 CDK8-repressed 2.17E-04 1.15

20947 Swap70 CDK8-repressed 2.18E-04 1.26

233913 BC017158 CDK8-repressed 2.19E-04 1.19

13518 Dst CDK8-repressed 2.23E-04 1.24

232664 492151 1 K06Rik CDK8-repressed 2.24E-04 1.42

98386 Lbr CDK8-repressed 2.24E-04 1.18

320508 Cachdl CDK8-repressed 2.25E-04 1.98

65973 Asph CDK8-repressed 2.25E-04 1.29

17748 Mt1 CDK8-repressed 2.29E-04 1.23

227693 Zyg1 1 bl CDK8-repressed 2.29E-04 1.48

320472 Ppml e CDK8-repressed 2.32E-04 1.91

56392 Shoc2 CDK8-repressed 2.32E-04 1.22

22359 Vldlr CDK8-repressed 2.32E-04 1.42

13642 Efnb2 CDK8-repressed 2.33E-04 1.65

239273 Abcc4 CDK8-repressed 2.34E-04 1.24

57439 1300007B12Rik CDK8-repressed 2.35E-04 1.36

30963 Ptpla CDK8-repressed 2.35E-04 1.24

53896 Slc7a10 CDK8-repressed 2.36E-04 2.67

16842 Lef1 CDK8-repressed 2.37E-04 1.61

20788 Srebf2 CDK8-repressed 2.38E-04 1.21

218850 D14Abb1 e CDK8-repressed 2.41 E-04 1.21

19186 Psmel CDK8-repressed 2.43E-04 1.20

106369 Ypeh CDK8-repressed 2.43E-04 1.19

99061 C130057N1 1 Rik CDK8-repressed 2.47E-04 1.70

12176 Bnip3 CDK8-repressed 2.53E-04 1.35

246104 Rhbdl3 CDK8-repressed 2.57E-04 1.42

15499 Hsf1 CDK8-repressed 2.62E-04 1.15

20843 Stag2 CDK8-repressed 2.63E-04 1.33

16541 Napsa CDK8-repressed 2.63E-04 2.04

12488 Cd2ap CDK8-repressed 2.64E-04 1.13

59046 Arpp19 CDK8-repressed 2.65E-04 1.45

20185 Ncoi CDK8-repressed 2.66E-04 1.51 22404 Wiz CDK8-repressed 2.70E-04 1.20

30940 Usp25 CDK8-repressed 2.71 E-04 1.51

16562 Kifl c CDK8-repressed 2.72E-04 1.17

77519 5730601 F06Rik CDK8-repressed 2.77E-04 1.28

14183 Fgfr2 CDK8-repressed 2.80E-04 1.37

14872 Gstt2 CDK8-repressed 2.85E-04 1.51

19376 Rab34 CDK8-repressed 2.85E-04 1.34

12068 Bet1 CDK8-repressed 2.85E-04 1.30

71389 Chd6 CDK8-repressed 2.88E-04 1.32

18606 Enpp2 CDK8-repressed 2.91 E-04 2.16

23802 Amfr CDK8-repressed 2.92 E-04 1.21

270163 Myo9a CDK8-repressed 2.94 E-04 1.28

217558 6030408C04Rik CDK8-repressed 2.96 E-04 1.56

216860 0610025P10Rik CDK8-repressed 2.97E-04 1.23

320827 C530008M17Rik CDK8-repressed 2.98E-04 1.54

381 157 AK220484 CDK8-repressed 3.06E-04 1.37

52874 D19Bwg1357e CDK8-repressed 3.09E-04 1.26

13512 Dsg3 CDK8-repressed 3.17E-04 1.99

103534 Mgat4b CDK8-repressed 3.20E-04 1.08

23966 Odz4 CDK8-repressed 3.26E-04 1.24

70377 Derl3 CDK8-repressed 3.32E-04 1.37

26559 Hunk CDK8-repressed 3.33E-04 1.22

319263 Pcmtdl CDK8-repressed 3.41 E-04 1.23

56291 Styx CDK8-repressed 3.41 E-04 1.26

105670 Rcbtb2 CDK8-repressed 3.44E-04 1.17

18715 Pim2 CDK8-repressed 3.44E-04 1.86

23965 Odz3 CDK8-repressed 3.45E-04 1.56

231798 Lrch4 CDK8-repressed 3.48E-04 1.16

215748 Cnksr3 CDK8-repressed 3.49E-04 1.28

68915 Vars2l CDK8-repressed 3.51 E-04 1.14

78174 4930503B16Rik CDK8-repressed 3.53E-04 1.44

66771 4933439F18Rik CDK8-repressed 3.68E-04 1.35

20856 Stc2 CDK8-repressed 3.68E-04 1.43

214505 Gnptg CDK8-repressed 3.72E-04 2.79

207474 Kctd12b CDK8-repressed 3.75E-04 1.99

19703 Renbp CDK8-repressed 3.75E-04 1.17

15382 Hnrpal CDK8-repressed 3.76E-04 1.1 1

109676 Ank2 CDK8-repressed 3.80E-04 1.50

18751 Prkcbl CDK8-repressed 3.82E-04 1.75

16563 Kif2a CDK8-repressed 3.84 E-04 1.17

381508 LOC381508 CDK8-repressed 3.86E-04 1.46

109880 Braf CDK8-repressed 3.87 E-04 1.30

71 148 Mierl CDK8-repressed 3.90E-04 1.16

320024 AadacM CDK8-repressed 3.91 E-04 1.10

235574 Atp2c1 CDK8-repressed 3.92 E-04 1.21

105298 Epdr2 CDK8-repressed 3.93E-04 1.55

20843 Stag2 CDK8-repressed 3.95E-04 1.37

99324 D030029J20Rik CDK8-repressed 3.95E-04 1.28

238130 Dock4 CDK8-repressed 3.96 E-04 1.42

105178 AI452195 CDK8-repressed 4.00E-04 1.31

268752 Wdfy2 CDK8-repressed 4.00E-04 1.29

217351 Tnrc6c CDK8-repressed 4.05E-04 1.17

228790 AsxM CDK8-repressed 4.06E-04 1.21

15982 Ifrdl CDK8-repressed 4.06E-04 1.15

12795 Plk3 CDK8-repressed 4.08E-04 1.18

319683 E230008J23Rik CDK8-repressed 4.09E-04 1.89

225875 Lrfn4 CDK8-repressed 4.12E-04 1.16

67776 Loh1 1 cr2a CDK8-repressed 4.15E-04 1.28

235472 Prtg CDK8-repressed 4.15E-04 1.41 319757 Smo CDK8-repressed 4.22E-04 1.17

77268 9330180L21 Rik CDK8-repressed 4.22E-04 1.62

26570 Slc7a1 1 CDK8-repressed 4.23E-04 2.38

58887 Repinl CDK8-repressed 4.23E-04 1.34

56294 Ptpn9 CDK8-repressed 4.26E-04 1.34

50887 Nsbpl CDK8-repressed 4.34E-04 1.40

69368 Wdfyl CDK8-repressed 4.36E-04 1.20

232906 Grlfl CDK8-repressed 4.37E-04 1.1 1

20648 Sntal CDK8-repressed 4.40E-04 1.21

23789 Corol b CDK8-repressed 4.52E-04 1.20

1 1782 Ap4s1 CDK8-repressed 4.56E-04 1.20

270096 Monl b CDK8-repressed 4.58E-04 1.19

16438 Itpi CDK8-repressed 4.60E-04 1.33

691 16 Zubrl CDK8-repressed 4.63E-04 1.19

20148 Dhrs3 CDK8-repressed 4.64E-04 1.33

100763 Ube3c CDK8-repressed 4.65E-04 1.27

14536 Nr6a1 CDK8-repressed 4.65E-04 1.29

108645 Mat2b CDK8-repressed 4.69E-04 1.20

72075 Ogfr CDK8-repressed 4.75E-04 1.30

26422 Nbea CDK8-repressed 4.77E-04 1.83

76293 Mfap4 CDK8-repressed 4.78E-04 1.56

105727 Slc38a1 CDK8-repressed 4.78E-04 1.20

109905 Rap 1 a CDK8-repressed 4.82E-04 1.13

12009 Azi1 CDK8-repressed 4.84E-04 1.1 1

67160 Eefl g CDK8-repressed 4.85E-04 1.27

52910 D16Bwg1543e CDK8-repressed 4.86E-04 1.44

12297 Cacnb3 CDK8-repressed 4.93E-04 1.48

13388 DIM CDK8-repressed 4.96E-04 1.88

16913 Psmb8 CDK8-repressed 4.97E-04 1.75

73181 Nfatc4 CDK8-repressed 5.02E-04 1.28

233912 Armc5 CDK8-repressed 5.05E-04 1.14

29815 Bcar3 CDK8-repressed 5.08E-04 1.27

235323 Usp28 CDK8-repressed 5.08E-04 1.22

14862 Gstml CDK8-repressed 5.19E-04 1.47

19063 Ppt1 CDK8-repressed 5.22E-04 1.21

66259 Camk2n1 CDK8-repressed 5.25E-04 2.19

94346 Tmem40 CDK8-repressed 5.26E-04 1.25

69917 Obfc2b CDK8-repressed 5.29E-04 1.27

16709 Ktn1 CDK8-repressed 5.31 E-04 1.20

65105 Arl6ip4 CDK8-repressed 5.32E-04 1.18

18824 Plp2 CDK8-repressed 5.35E-04 1.13

71710 Lrrccl CDK8-repressed 5.36E-04 1.70

378954 3000002C10Rik CDK8-repressed 5.39E-04 1.14

214917 BC008155 CDK8-repressed 5.39E-04 1.17

74143 Opal CDK8-repressed 5.44E-04 1.30

71704 Arhgef3 CDK8-repressed 5.54 E-04 1.56

20408 Sh3gl3 CDK8-repressed 5.59E-04 1.34

73242 26101 10G12Rik CDK8-repressed 5.63E-04 1.26

72050 Kdeld CDK8-repressed 5.68E-04 1.19

76378 Ropn1 CDK8-repressed 5.81 E-04 1.50

56307 Metap2 CDK8-repressed 5.82E-04 1.16

20409 Ostfl CDK8-repressed 5.84 E-04 1.21

14182 Fgfrl CDK8-repressed 5.85E-04 1.22

217198 Plekhh3 CDK8-repressed 5.88E-04 1.25

67795 6530404N21 Rik CDK8-repressed 5.90E-04 1.51

320969 D930050A07Rik CDK8-repressed 5.95E-04 1.28

78255 Ralgps2 CDK8-repressed 5.96 E-04 1.34

66625 5730406M06Rik CDK8-repressed 5.97E-04 1.37

12361 Cask CDK8-repressed 5.99E-04 1.25 78833 Gins3 CDK8- repressed 6.00E-04 1.14

54004 Diap2 CDK8- repressed 6.00E-04 1.29

18133 Nov CDK8- repressed 6.01 E-04 2.61

68169 A930038C07Rik CDK8- repressed 6.04E-04 4.46

66079 Tmem42 CDK8- repressed 6.07E-04 1.18

12564 Cdh8 CDK8- repressed 6.16E-04 2.10

56044 Rala CDK8- repressed 6.23E-04 1.24

17876 Myef2 CDK8- repressed 6.24E-04 1.29

140577 Ankrd6 CDK8- repressed 6.24E-04 1.50

70394 Kptn CDK8- repressed 6.25E-04 1.15

104871 Spata7 CDK8- repressed 6.27E-04 1.39

12890 Cplx2 CDK8- repressed 6.28E-04 2.58

19090 Prkdc CDK8- repressed 6.28E-04 1.35

19934 Rpl22 CDK8- repressed 6.29E-04 1.33

17345 Mki67 CDK8- repressed 6.29E-04 1.25

93840 Vangl2 CDK8- repressed 6.32E-04 1.22

219140 Spata13 CDK8- repressed 6.32E-04 1.51

72844 Kctd17 CDK8- repressed 6.33E-04 1.21

230863 Sh2d5 CDK8- repressed 6.40E-04 1.25

228071 Sestdl CDK8- repressed 6.41 E-04 1.22

72469 Pled 3 CDK8- repressed 6.44E-04 1.31

70951 Spatal CDK8- repressed 6.45E-04 1.36

84544 Cd96 CDK8- repressed 6.46E-04 1.74

1 1980 Atp8a1 CDK8- repressed 6.46E-04 1.40

67358 1700093K21 Rik CDK8- repressed 6.53E-04 3.10

57261 Brd4 CDK8- repressed 6.58E-04 1.14

214931 Fbxl16 CDK8- repressed 6.61 E-04 1.28

268445 Ankrd13b CDK8- repressed 6.62E-04 1.26

66235 Eifl ay CDK8- repressed 6.62E-04 1.14

242291 Impadl CDK8- repressed 6.63E-04 1.28

214162 MII1 CDK8- repressed 6.68E-04 1.24

93687 Csnk1 a1 CDK8- repressed 6.71 E-04 1.23

52004 Cdk2ap2 CDK8- repressed 6.74 E-04 1.20

56224 Tspan5 CDK8- repressed 6.79E-04 1.36

74781 Wipi2 CDK8- repressed 6.82E-04 1.15

225028 Map4k3 CDK8- repressed 6.87E-04 1.27

106504 Stk38 CDK8- repressed 6.94 E-04 1.23

93747 Echsl CDK8- repressed 7.02E-04 1.18

1 10350 Dync2h1 CDK8- repressed 7.07E-04 1.29

68480 1 1 10007C09Rik CDK8- repressed 7.07E-04 1.54

57257 Vav3 CDK8- repressed 7.09E-04 1.20

16987 Lss CDK8- repressed 7.1 1 E-04 1.35

75613 Med25 CDK8- repressed 7.17E-04 1.16

237082 Nxt2 CDK8- repressed 7.25E-04 1.42

233789 2610207l05Rik CDK8- repressed 7.29E-04 1.16

50850 Spast CDK8- repressed 7.30E-04 1.15

22359 Vldlr CDK8- repressed 7.37E-04 1.55

72515 Wdr43 CDK8- repressed 7.48E-04 1.15

12313 Calml CDK8- repressed 7.49E-04 1.56

17534 Mrc2 CDK8- repressed 7.54 E-04 1.32

231858 D930005D10Rik CDK8- repressed 7.56E-04 1.39

53379 Hnrpa2b1 CDK8- repressed 7.58E-04 1.20

107895 Mgat5 CDK8- repressed 7.59E-04 1.31

14025 Bcl1 1 a CDK8- repressed 7.71 E-04 3.62

18521 Pcbp2 CDK8- repressed 7.83E-04 1.13

63985 Gmfb CDK8- repressed 7.91 E-04 1.25

208968 Suhw3 CDK8- repressed 7.95E-04 1.59

544818 LOC544818 CDK8- repressed 8.03E-04 1.59

17686 Msh3 CDK8- repressed 8.05E-04 1.19 668299 LOC668299 CDK8-repressed 8.05E-04 1.1 1

76969 Chstl CDK8-repressed 8.08E-04 1.48

66414 Ndufa12 CDK8-repressed 8.08E-04 1.12

227292 Ctdspl CDK8-repressed 8.1 1 E-04 1.19

320790 Chd7 CDK8-repressed 8.12E-04 1.53

17966 Nbr1 CDK8-repressed 8.13E-04 1.09

268859 Rbfoxl CDK8-repressed 8.15E-04 2.43

1 10639 Prps2 CDK8-repressed 8.23E-04 1.20

1 12407 Egln3 CDK8-repressed 8.25E-04 1.39

66884 Appbp2 CDK8-repressed 8.26E-04 1.27

17428 Mnt CDK8-repressed 8.39E-04 1.12

52323 Klhl7 CDK8-repressed 8.42E-04 1.37

18128 Notch 1 CDK8-repressed 8.43E-04 1.33

72121 Dennd2d CDK8-repressed 8.52E-04 1.41

140792 Colec12 CDK8-repressed 8.60E-04 1.1 1

330485 Tmem145 CDK8-repressed 8.62E-04 1.99

72735 2810442121 Rik CDK8-repressed 8.72E-04 1.45

14755 Pigq CDK8-repressed 8.73E-04 1.08

72475 Ssbp3 CDK8-repressed 8.73E-04 1.24

20947 Swap70 CDK8-repressed 8.73E-04 1.26

319236 9230105E10Rik CDK8-repressed 8.77E-04 2.68

12228 Btg3 CDK8-repressed 8.80E-04 1.19

18139 Zfml CDK8-repressed 8.81 E-04 1.17

18508 Pax6 CDK8-repressed 8.83E-04 1.58

15024 H2-T10 CDK8-repressed 8.83E-04 1.19

21848 Trim24 CDK8-repressed 8.93E-04 1.28

56306 Tera CDK8-repressed 8.96 E-04 1.26

14105 Fusipl CDK8-repressed 8.99E-04 1.31

75731 5133401 N09Rik CDK8-repressed 9.00E-04 1.1 1

67534 Ttll4 CDK8-repressed 9.02E-04 1.40

228880 Prkcbpl CDK8-repressed 9.05E-04 1.37

16795 Large CDK8-repressed 9.05E-04 1.22

72061 20101 1 1 101 Rik CDK8-repressed 9.09E-04 1.25

217463 Snx13 CDK8-repressed 9.10E-04 1.32

13417 Dnahc8 CDK8-repressed 9.13E-04 1.53

75974 Dockl 1 CDK8-repressed 9.16E-04 1.42

15976 Ifnar2 CDK8-repressed 9.20E-04 1.20

209558 Enpp3 CDK8-repressed 9.27E-04 1.70

71592 Pogk CDK8-repressed 9.27E-04 1.95

269437 Plchl CDK8-repressed 9.29E-04 2.03

56013 P140 CDK8-repressed 9.29E-04 1.27

237353 4831416G18Rik CDK8-repressed 9.30E-04 1.28

224826 Ubr2 CDK8-repressed 9.31 E-04 1.16

66272 1810020G14Rik CDK8-repressed 9.32E-04 1.21

16565 Kif21 b CDK8-repressed 9.33E-04 1.15

140559 Igsf8 CDK8-repressed 9.39E-04 1.27

76927 1700021 C14Rik CDK8-repressed 9.41 E-04 1.25

56473 Fads2 CDK8-repressed 9.45E-04 1.17

1 1757 Prdx3 CDK8-repressed 9.46E-04 1.40

18641 Pfkl CDK8-repressed 9.50E-04 1.19

18548 Pcskl CDK8-repressed 9.51 E-04 4.88

15258 Hipk2 CDK8-repressed 9.56E-04 1.20

83453 ChrdM CDK8-repressed 9.73E-04 1.71

19699 Rein CDK8-repressed 9.75E-04 1.31

433667 Ankrd13c CDK8-repressed 9.77E-04 1.24

229663 Csdel CDK8-repressed 9.80E-04 1.1 1

74154 Unkl CDK8-repressed 9.87E-04 1.1 1

19363 Rad51 l1 CDK8-repressed 9.91 E-04 1.23

56531 Ylpml CDK8-repressed 9.95E-04 1.16 53901 Dsci-111 CDK8-repressed 9.95E-04 1.37

17775 Laptm4a CDK8-repressed 1.01 E-03 1.07

1 14128 Laptm4b CDK8-repressed 1.01 E-03 1.25

21968 Tom1 CDK8-repressed 1.01 E-03 1.17

77480 C330002l19Rik CDK8-repressed 1.02E-03 1.25

71458 Bcor CDK8-repressed 1.02E-03 1.27

229473 D930015E06Rik CDK8-repressed 1.03E-03 1.38

58800 Trpm7 CDK8-repressed 1.03E-03 1.29

14421 B4galnt1 CDK8-repressed 1.05E-03 1.23

215748 Cnksr3 CDK8-repressed 1.05E-03 1.28

2251 15 Svil CDK8-repressed 1.06E-03 1.18

73251 Setd7 CDK8-repressed 1.06E-03 1.22

14571 Gpd2 CDK8-repressed 1.07E-03 1.24

59020 Pdzkl CDK8-repressed 1.07E-03 1.87

17181 Matn2 CDK8-repressed 1.08E-03 1.73

94332 Igsf4b CDK8-repressed 1.09E-03 1.25

70797 Ankibl CDK8-repressed 1.09E-03 1.15

414077 BC056474 CDK8-repressed 1.09E-03 1.24

547176 Zc3h12b CDK8-repressed 1.10E-03 2.77

67109 2210018M03Rik CDK8-repressed 1.10E-03 1.38

207777 Bzrapl CDK8-repressed 1.1 1 E-03 1.27

30935 Tor3a CDK8-repressed 1.1 1 E-03 1.25

319974 Auts2 CDK8-repressed 1.12E-03 1.37

67392 4833420G17Rik CDK8-repressed 1.12E-03 2.53

19108 Prkx CDK8-repressed 1.12E-03 1.19

77733 Rnf170 CDK8-repressed 1.13E-03 1.47

230809 Pdikl l CDK8-repressed 1.13E-03 1.29

629974 D1 1 Ertd759e CDK8-repressed 1.13E-03 1.77

17069 Ly6e CDK8-repressed 1.13E-03 1.24

73296 Rhobtb3 CDK8-repressed 1.14E-03 1.47

71750 R3hdm2 CDK8-repressed 1.14E-03 1.27

20451 St8sia3 CDK8-repressed 1.15E-03 2.31

224640 Lemd2 CDK8-repressed 1.15E-03 1.19

75974 Dockl 1 CDK8-repressed 1.15E-03 1.36

71448 Tmem80 CDK8-repressed 1.16E-03 1.34

28193 D10Ucla1 CDK8-repressed 1.16E-03 1.29

269473 Lrig2 CDK8-repressed 1.17E-03 1.34

19046 Pppl cb CDK8-repressed 1.17E-03 1.14

98415 Nucksl CDK8-repressed 1.18E-03 1.14

14348 Fut9 CDK8-repressed 1.18E-03 1.80

106338 Nsun3 CDK8-repressed 1.19E-03 1.21

76809 Bri3bp CDK8-repressed 1.19E-03 1.27

50926 Hnrpdl CDK8-repressed 1.20E-03 1.24

105689 Phr1 CDK8-repressed 1.20E-03 1.30

107515 Lgr4 CDK8-repressed 1.21 E-03 1.28

329908 Usp24 CDK8-repressed 1.22E-03 1.27

71461 Ptk7 CDK8-repressed 1.24E-03 1.36

234779 Plcg2 CDK8-repressed 1.24E-03 1.36

72238 Tbc1 d5 CDK8-repressed 1.24E-03 1.14

20379 Sfrp4 CDK8-repressed 1.25E-03 1.39

66826 Taz CDK8-repressed 1.25E-03 1.23

66990 Tmem134 CDK8-repressed 1.26E-03 1.15

209737 Kif15 CDK8-repressed 1.27E-03 1.27

109075 Exosc4 CDK8-repressed 1.27E-03 1.36

22042 Tfrc CDK8-repressed 1.27E-03 1.14

239393 Lrp12 CDK8-repressed 1.28E-03 1.18

14871 Gsttl CDK8-repressed 1.29E-03 1.19

546001 D030022P06Rik CDK8-repressed 1.30E-03 2.13

18762 Prkcz CDK8-repressed 1.31 E-03 1.29 17281 Fycol CDK8-repressed 1.31 E-03 1.47

74754 Dhcr24 CDK8-repressed 1.32E-03 1.15

20666 Sox1 1 CDK8-repressed 1.32E-03 1.26

1 17146 Ube3b CDK8-repressed 1.32E-03 1.09

64652 Nisch CDK8-repressed 1.33E-03 1.20

22240 Dpysl3 CDK8-repressed 1.33E-03 1.19

74596 Cds1 CDK8-repressed 1.34E-03 2.59

224020 Pik4ca CDK8-repressed 1.35E-03 1.22

68813 Dock5 CDK8-repressed 1.35E-03 1.18

277360 BC067047 CDK8-repressed 1.35E-03 1.25

233065 Alkbh6 CDK8-repressed 1.36E-03 1.16

21847 Klfl O CDK8-repressed 1.36E-03 1.18

71742 Ulk3 CDK8-repressed 1.36E-03 1.22

78195 4930528J18Rik CDK8-repressed 1.37E-03 2.05

20480 Clpb CDK8-repressed 1.38E-03 1.38

20588 Smarcd CDK8-repressed 1.39E-03 1.18

6631 1 2610036L1 1 Rik CDK8-repressed 1.39E-03 1.56

72519 Tmem55a CDK8-repressed 1.39E-03 1.18

74356 4931428F04Rik CDK8-repressed 1.39E-03 1.21

78832 2700078E1 1 Rik CDK8-repressed 1.40E-03 1.32

170753 Zfp704 CDK8-repressed 1.41 E-03 1.35

101 148 B630005N14Rik CDK8-repressed 1.41 E-03 1.29

67468 Mmd CDK8-repressed 1.42E-03 1.43

14886 Gtf2i CDK8-repressed 1.43E-03 1.15

105855 Nckapl l CDK8-repressed 1.43E-03 1.28

98170 Tmem132a CDK8-repressed 1.44E-03 1.21

231238 2310045A20Rik CDK8-repressed 1.44E-03 1.43

224020 Pik4ca CDK8-repressed 1.44E-03 1.22 8973 Pole CDK8-repressed 1.45E-03 1.20

107045 Lars CDK8-repressed 1.45E-03 1.15

16564 Kif21 a CDK8-repressed 1.45E-03 2.03

93761 Smarcal CDK8-repressed 1.45E-03 1.42

18715 Pim2 CDK8-repressed 1.46E-03 1.90

72050 Kdeld CDK8-repressed 1.47E-03 1.18

100662 D930016D06Rik CDK8-repressed 1.48E-03 1.18

66074 0610041 E09Rik CDK8-repressed 1.48E-03 1.27

73389 Hbp1 CDK8-repressed 1.49E-03 1.21

66923 Pb1 CDK8-repressed 1.49E-03 1.27

66905 M6prbp1 CDK8-repressed 1.49E-03 1.17

12491 Cd36 CDK8-repressed 1.49E-03 2.57

75871 4930566A1 1 Rik CDK8-repressed 1.49E-03 1.22

14731 Gpaal CDK8-repressed 1.50E-03 1.13

338362 Ust CDK8-repressed 1.50E-03 1.67

140500 Centb5 CDK8-repressed 1.51 E-03 1.23

18715 Pim2 CDK8-repressed 1.55E-03 1.84

213819 Casdl CDK8-repressed 1.57E-03 1.23

320879 B230217O12Rik CDK8-repressed 1.57E-03 2.18

29876 Clic4 CDK8-repressed 1.58E-03 1.26

53416 Stk39 CDK8-repressed 1.58E-03 1.1 1

21912 Tspan7 CDK8-repressed 1.59E-03 1.29

20910 Stxbpl CDK8-repressed 1.59E-03 1.38

67702 Rnf149 CDK8-repressed 1.59E-03 1.28

17868 Mybpc3 CDK8-repressed 1.61 E-03 1.42

66602 1700020l14Rik CDK8-repressed 1.61 E-03 1.27

218442 Serinc5 CDK8-repressed 1.61 E-03 1.80

66559 MetapM CDK8-repressed 1.62E-03 1.30

13361 Dhfr CDK8-repressed 1.63E-03 1.32

84585 Rnf123 CDK8-repressed 1.63E-03 1.29

330817 Dhps CDK8-repressed 1.63E-03 1.14 170753 Zfp704 CDK8- repressed 1.63E-03 1.1 1

20603 Sms CDK8- repressed 1.64E-03 1.27

24136 Zfhxl b CDK8- repressed 1.65E-03 1.59

12282 Hyoul CDK8- repressed 1.67E-03 1.20

71745 Cul2 CDK8- repressed 1.67E-03 1.33

214058 Megfl 1 CDK8- repressed 1.69E-03 2.27

9931 1 Commd7 CDK8- repressed 1.69E-03 1.17

19206 Ptchl CDK8- repressed 1.69E-03 1.45

69188 MII5 CDK8- repressed 1.69E-03 1.25

12737 Cldnl CDK8- repressed 1.69E-03 1.54

209707 Lcorl CDK8- repressed 1.70E-03 1.43

105727 Slc38a1 CDK8- repressed 1.71 E-03 1.29

74026 4121402D02Rik CDK8- repressed 1.71 E-03 1.22

18709 Pik3r2 CDK8- repressed 1.71 E-03 1.13

216848 Chd3 CDK8- repressed 1.72E-03 1.26

77015 Mpped2 CDK8- repressed 1.73E-03 1.20

30838 Fbxw4 CDK8- repressed 1.73E-03 1.35

23827 Bpntl CDK8- repressed 1.77E-03 1.24

21951 Tnks CDK8- repressed 1.77E-03 1.21

68961 Phkg2 CDK8- repressed 1.78E-03 1.09

76820 D12Ertd553e CDK8- repressed 1.78E-03 1.49

78654 1700066C05Rik CDK8- repressed 1.79E-03 1.46

19671 Reel CDK8- repressed 1.79E-03 1.12

233806 Tmem159 CDK8- repressed 1.79E-03 1.14

22003 Tpm1 CDK8- repressed 1.80E-03 1.15

13121 Cyp51 CDK8- repressed 1.80E-03 1.25

67967 Pold3 CDK8- repressed 1.81 E-03 1.08

26451 Rpl27a CDK8- repressed 1.83E-03 1.12

233107 Kctd15 CDK8- repressed 1.83E-03 1.27

66607 Ms4a4d CDK8- repressed 1.83E-03 2.25

67030 Fancl CDK8- repressed 1.83E-03 1.47

386612 Thoc6 CDK8- repressed 1.83E-03 1.09

81500 Sill CDK8- repressed 1.85E-03 1.17

233812 BC030336 CDK8- repressed 1.85E-03 1.22

23963 Odz1 CDK8- repressed 1.86E-03 2.12

15407 Hoxbl CDK8- repressed 1.86E-03 1.80

108767 Pnrd CDK8- repressed 1.87E-03 1.37

22174 Tyro3 CDK8- repressed 1.88E-03 1.40

63828 Fn3k CDK8- repressed 1.89E-03 1.55

30785 Cttnbp2 CDK8- repressed 1.89E-03 4.20

94245 Dtnbpl CDK8- repressed 1.90E-03 1.12

14863 Gstm2 CDK8- repressed 1.91 E-03 1.44

13204 Dhx15 CDK8- repressed 1.91 E-03 1.15

74355 Smchdl CDK8- repressed 1.91 E-03 1.26

20474 Six4 CDK8- repressed 1.92E-03 1.53

69694 Tatdnl CDK8- repressed 1.92E-03 1.76

69683 2310044H10Rik CDK8- repressed 1.92E-03 1.31

230649 Atpafl CDK8- repressed 1.93E-03 1.23

103012 6720401 G13Rik CDK8- repressed 1.94E-03 1.43

1 1990 Atrn CDK8- repressed 1.95E-03 1.18

338372 Map3k9 CDK8- repressed 1.96E-03 2.87

16898 Rps2 CDK8- repressed 1.96E-03 1.09

52838 D2Bwg1335e CDK8- repressed 1.97E-03 1.10

18479 Pak1 CDK8- repressed 1.97E-03 1.29

319565 Syne2 CDK8- repressed 1.98E-03 1.58

68166 Spirel CDK8- repressed 1.99E-03 1.57

56530 Tmem4 CDK8- repressed 2.00E-03 1.14

13019 Ctf1 CDK8- repressed 2.00E-03 1.15

328329 Mast4 CDK8- repressed 2.00E-03 1.29 319565 Syne2 CDK8-repressed 2.00E-03 1.63

233812 BC030336 CDK8-repressed 2.00E-03 1.26

27078 Eppb9 CDK8-repressed 2.01 E-03 1.05

216350 Tspan8 CDK8-repressed 2.01 E-03 1.38

19359 Rad23b CDK8-repressed 2.02E-03 1.72

70757 Ptplb CDK8-repressed 2.03E-03 1.33

68545 1 1 10006O17Rik CDK8-repressed 2.05E-03 1.19

691 16 Zubrl CDK8-repressed 2.05E-03 1.19

1 1477 Acvi CDK8-repressed 2.05E-03 1.22

246104 Rhbdl3 CDK8-repressed 2.06E-03 1.36

18530 Pcdh8 CDK8-repressed 2.06E-03 1.78

16776 Lama5 CDK8-repressed 2.07E-03 1.23

20529 Slc31 a1 CDK8-repressed 2.07E-03 1.40

1 1622 Ahr CDK8-repressed 2.08E-03 1.26

192193 Edeml CDK8-repressed 2.08E-03 1.16

67443 Map1 lc3b CDK8-repressed 2.09E-03 1.27

319517 6430510M02Rik CDK8-repressed 2.09E-03 1.45

214459 Fnbpl l CDK8-repressed 2.09E-03 1.33

54004 Diap2 CDK8-repressed 2.09E-03 1.31

14030 Ewsi CDK8-repressed 2.10E-03 1.1 1

93842 Igsf9 CDK8-repressed 2.1 1 E-03 1.20

67460 Deci CDK8-repressed 2.1 1 E-03 1.70

1221 1 Birc6 CDK8-repressed 2.12E-03 1.26

18578 Pde4b CDK8-repressed 2.14E-03 1.94

106522 AW548124 CDK8-repressed 2.16E-03 1.32

320252 C230047C07Rik CDK8-repressed 2.17E-03 2.08

74143 Opal CDK8-repressed 2.19E-03 1.25

66209 1 1 10054O05Rik CDK8-repressed 2.21 E-03 1.14

71089 4933413B09Rik CDK8-repressed 2.21 E-03 1.81

14009 Etv1 CDK8-repressed 2.22E-03 1.25

67979 Atadl CDK8-repressed 2.23E-03 1.12

320790 Chd7 CDK8-repressed 2.24E-03 1.43

212772 2700007P21 Rik CDK8-repressed 2.24E-03 1.14

1 10959 Nudt19 CDK8-repressed 2.24E-03 1.13

170756 Slc24a6 CDK8-repressed 2.25E-03 1.30

319565 Syne2 CDK8-repressed 2.26E-03 1.87

75747 Sesn3 CDK8-repressed 2.27E-03 1.64

66121 Chchdl CDK8-repressed 2.27E-03 1.1 1

69094 Tmem160 CDK8-repressed 2.27E-03 1.20

69617 Pitrml CDK8-repressed 2.27E-03 1.14

194388 D230004J03Rik CDK8-repressed 2.27E-03 1.56

233833 Tnrc6a CDK8-repressed 2.27E-03 1.29

100102 Pcsk9 CDK8-repressed 2.27E-03 1.17

1 1474 Actn3 CDK8-repressed 2.28E-03 1.39

16423 Cd47 CDK8-repressed 2.28E-03 1.49

171 166 Mcoln3 CDK8-repressed 2.28E-03 2.32

19647 Rbbp6 CDK8-repressed 2.29E-03 1.1 1

100169 Phactr4 CDK8-repressed 2.29E-03 1.12

13665 Eif2s1 CDK8-repressed 2.29E-03 1.15

227620 Uap1 l1 CDK8-repressed 2.30E-03 1.16

218203 Mylip CDK8-repressed 2.30E-03 1.36

14723 Gpl ba CDK8-repressed 2.30E-03 1.53

1 1426 Macfl CDK8-repressed 2.30E-03 1.31

23992 Prkra CDK8-repressed 2.30E-03 1.13

320538 D130059P03Rik CDK8-repressed 2.31 E-03 1.37

26462 Txnrd2 CDK8-repressed 2.32E-03 1.27

17755 Mtapl b CDK8-repressed 2.32E-03 1.76

102105 AI481772 CDK8-repressed 2.32E-03 1.16

98417 Cnih4 CDK8-repressed 2.33E-03 1.22 69225 0710008K08Rik CDK8-repressed 2.34E-03 1.12

17385 Mmp1 1 CDK8-repressed 2.36E-03 1.24

21843 TiaM CDK8-repressed 2.36E-03 1.26

13542 Dvl1 CDK8-repressed 2.37E-03 1.09

399612 963001 OGI ORik CDK8-repressed 2.38E-03 1.54

76998 1700124P09Rik CDK8-repressed 2.39E-03 1.24

76500 Ihpk2 CDK8-repressed 2.39E-03 1.12

26877 B3galt1 CDK8-repressed 2.40E-03 1.37

414077 BC056474 CDK8-repressed 2.40E-03 1.17

66855 Tcf25 CDK8-repressed 2.41 E-03 1.14

19027 Sypl CDK8-repressed 2.42E-03 1.14 5410 Hoxb3 CDK8-repressed 2.43E-03 2.31

19820 Rnf12 CDK8-repressed 2.47E-03 1.20

13047 CutM CDK8-repressed 2.47E-03 1.17

240041 A630033E08Rik CDK8-repressed 2.49E-03 1.23

71704 Arhgef3 CDK8-repressed 2.49E-03 1.48

74549 9130404D08Rik CDK8-repressed 2.53E-03 1.31

59024 Med 12 CDK8-repressed 2.53E-03 1.25

14176 Fgf5 CDK8-repressed 2.53E-03 2.53

77976 Nuakl CDK8-repressed 2.54E-03 1.17

69239 2610034M16Rik CDK8-repressed 2.55E-03 1.66

21822 Tgtp CDK8-repressed 2.55E-03 2.66

1 12422 2610305D13Rik CDK8-repressed 2.55E-03 1.17

14582 Gfil b CDK8-repressed 2.56E-03 1.25

232223 Txnrd3 CDK8-repressed 2.58E-03 1.28

56334 Tmed2 CDK8-repressed 2.58E-03 1.17

23922 Jtb CDK8-repressed 2.59E-03 1.09

380694 Ccnjl CDK8-repressed 2.59E-03 1.30

80909 Gats CDK8-repressed 2.60E-03 1.15

219158 2610301 G19Rik CDK8-repressed 2.62E-03 1.20

14870 Gstpl CDK8-repressed 2.63E-03 1.28

18481 Pak3 CDK8-repressed 2.64E-03 1.36

70082 Lysmd2 CDK8-repressed 2.65E-03 1.12

Claims

WHAT IS CLAIMED IS:

1) A method of screening for and/or identifying a CDK8 antagonist which promotes cell differentiation said method comprising: contacting a reference cell, wherein the reference cell is a stem cell and/or a cancer stem cell, with a CDK8 candidate antagonist, wherein the CDK8 candidate antagonist binds CDK8, and whereby differentiation of the reference cell into a differentiated cell identifies the CDK8 candidate antagonist as a CDK8 antagonist which promotes cell differentiation.

2) The method of claim 1, wherein the reference cell is a cancer stem cell.

3) The method of any one of claims 1-2, wherein the differentiated cell is a goblet cell and/or enterocyte cell.

4) The method of any one of claims 1-3, wherein the CDK8 candidate antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide.

5) A method of inducing differentiation comprising contacting the cell with an effective amount of CDK8 antagonist.

6) The method of claim 5, wherein the cell is a stem cell.

7) The method of claim 5, wherein the cell is a cancer stem cell.

8) A method of treating a cancer cell, wherein the cancer cell differentially expresses one or more biomarkers of a CDK8 gene signature (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), the method comprising providing an effective amount of a CDK8 antagonist.

9) A method of treating cancer in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is based upon the cancer comprising cancer stem cell-like properties.

10) The method of claim 9, wherein the cancer stem cell-like properties comprise differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)).

1 1) A method of treating a disease or disorder in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)).

12) A method of treating a disease or disorder in an individual comprising administering to the individual an effective amount of a CDK8 antagonist, wherein treatment is continued based upon differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)). 13) A method for treating a disease or disorder in an individual, the method comprising: determining that a sample obtained from the individual comprises differential expression levels of one or more biomarkers of a CDK8 gene signature (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)), and administering an effective amount of a CDK8 antagonist to the individual, whereby the disease or disorder is treated.

14) A method of treating disease or disorder in an individual, comprising: (a) selecting an individual having differential expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)); and (b) administering to the individual thus selected an effective amount of a CDK8 antagonist, whereby the disease or disorder is treated.

15) A method of identifying an individual with a disease or disorder who is more or less likely to exhibit benefit from treatment with a therapy comprising a CDK8 antagonist, the method comprising: determining the expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is more likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) indicates that the individual is less likely to exhibit benefit from treatment with the therapy comprising the CDK8 antagonist.

16) A method for predicting whether an individual with a disease or disorder is more or less likely to respond effectively to treatment with a therapy comprising a CDK8 antagonist, the method comprising assessing expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, whereby differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g. , housekeeping gene)) indicates that the individual is more likely to respond effectively to treatment with the CDK8 antagonist and/or non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g. , housekeeping gene)) indicates that the individual is less likely to respond effectively to treatment with the CDK8 antagonist.

17) A method of predicting the response or lack of response of an individual with a disease or disorder to a therapy comprising a CDK8 antagonist comprising measuring expression levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g. , housekeeping gene)) is predictive of response of the individual to the therapy comprising the CDK8 antagonist and non- differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g. , compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g. , housekeeping gene)) is predictive of lack of response of the individual to the therapy comprising the CDK8 antagonist.

18) A method of determining whether an individual having a disease or disorder is more or less likely responding to therapy, wherein therapy comprises a CDK8 antagonist, based upon levels of one or more biomarkers of a CDK8 gene signature in a sample from the individual, wherein differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) identifies the individual as more likely responding to therapy comprising the CDK8 antagonist and non-differential expression levels of one or more biomarkers of the CDK8 gene signature in a sample from the individual (e.g., compared to a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene)) identifies the individual as less likely responding to therapy comprising the CDK8 antagonist.

19) The method of any one of claims 15-18, wherein the method further comprises administering an effective amount of a therapy comprising a CDK8 antagonist.

20) The method of any one of claims 8, 10- 1 1, 13- 17, and 19, wherein differential expression of one or more biomarkers of the CDK8 gene signature is elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or reduced expression of one or more CDK8-repressed biomarkers of the CDK8 gene signature.

21) The method of any one of claims 12 and 18-19, wherein differential expression of one or more biomarkers of the CDK8 gene signature is reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-induced biomarkers of the CDK8 gene signature.

22) The method of any one of claims 8 and 10-21, wherein the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of the CDK8 cancer cell gene signature.

23) The method of claim 22, wherein the one or more biomarkers of the CDK8 cancer cell gene signature comprises one or more genes listed in Table 2.

24) The method of claim 23, wherein the one or more genes listed in Table 2 comprises one or more ES cell-related genes, MYC ES target genes, p53 signalling genes, cell cycle genes, Wnt signalling genes, and/or SMAD/BMP signalling genes. 25) The method of any one of claims 8 and 10-24, wherein the one or more biomarkers of the CDK8 gene signature comprises one or more biomarkers of the CDK8 embryonic stem cell gene signature.

26) The method of any one of claims 22-24, wherein the one or more biomarkers of the CDK8 embryonic stem cell gene signature comprises one or more genes listed in Table 3.

27) The method of any one of claims 1 1-25, wherein the disease or disorder is cancer.

28) The method of any one of claims 8- 14 and 19-26, wherein the CDK8 antagonist is an antibody, binding polypeptide, small molecule, or polynucleotide.

29) The method of claim 27, wherein the CDK8 antagonist is an antibody.

30) The method of claim 27, wherein the CDK8 antagonist is a small molecule.

31) The method of claim 29, wherein the small molecule is a small molecule kinase inhibitor.

32) The method of claim 30, wherein the small molecule kinase inhibitor is selected from the group consisting of flavopiridol, ABT-869, AST-487, BMS-387032/SNS032, BIRB-796, sorafenib, staurosporine, cortistatin, cortistatin A, and/or a steroidal alkaloid or derivative thereof.

33) The method of any one of claims 27-31, wherein the CDK8 antagonist induces cell cycle arrest or is capable of promoting differentiation.

34) The method of claim 32, wherein the CDK8 antagonist is capable of promoting a change in cell fate and promoting differentiation is indicated by reduced expression of one or more CDK8-induced biomarkers of the CDK8 gene signature and/or elevated expression of one or more CDK8-reduced biomarkers of the CDK8 gene signature.