WO2013118073A1 - Serpinb4, comme marqueur destiné à une évaluation précoce de la réponse à des thérapies anti-egfr par un procédé non invasif - Google Patents

Serpinb4, comme marqueur destiné à une évaluation précoce de la réponse à des thérapies anti-egfr par un procédé non invasif Download PDF

Info

Publication number
WO2013118073A1
WO2013118073A1 PCT/IB2013/051011 IB2013051011W WO2013118073A1 WO 2013118073 A1 WO2013118073 A1 WO 2013118073A1 IB 2013051011 W IB2013051011 W IB 2013051011W WO 2013118073 A1 WO2013118073 A1 WO 2013118073A1
Authority
WO
WIPO (PCT)
Prior art keywords
treatment
expression
seq
serpinb4
level
Prior art date
Application number
PCT/IB2013/051011
Other languages
English (en)
Inventor
François-Xavier Bernard
Alain DEGUERCY
Original Assignee
Bioalternatives Sas
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioalternatives Sas filed Critical Bioalternatives Sas
Publication of WO2013118073A1 publication Critical patent/WO2013118073A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention generally relates to a non-invasive strategy or method of detecting and assessing, at a very early stage, a response to an anti-EGFR therapy and to a therapy interfering with another signalling pathway, in the fields of cancer therapy and therapies against any other pathology in which a signalling pathway is involved,
  • the ErbB protein family is a family of tyrosine kinases which consists of 4 members: ErbB-1, also named epidermal growth factor receptor (EGFR), ErbB-2. also named HER2 in humans and neu in rodents, ErbB-3, also named HERB, and ErbB-4, also named HER4.
  • EGFR epidermal growth factor receptor
  • ErbB-2 also named HER2 in humans and neu in rodents
  • ErbB-3 also named HERB
  • ErbB-4 also named HER4.
  • the EGF signaling cascade is illustrated in Figure 1 ,
  • ErbB signaling in humans is associated with the development of neurodegenerati e diseases, such as multiple sclerosis and Alzheimer's Disease.
  • loss of signaling by any member of the ErbB family results in embryonic lethality with defects in organs including the lungs, skin, heart, and brain.
  • Excessive ErbB signaling is associated with the development of a wide variety of types of solid tumor. ErbB -I and ErbB ⁇ 2 are found in many human cancers, and their excessive signaling may be critical factors in the development and malignancy of these tumors.
  • Dysregulation of ErbB pathways by over-expression or constitutive activation can promote tumor processes including angiogenesis and metastasis and is associated with poor prognosis in many human malignancies, in addition to cancer, ErbB signaling has also been implicated in cardiovascular and neurodegenerative diseases.
  • ErbB pathways with targeted agents, such as monoclonal antibodies (MoAbs) or tyrosine kinase inhibitors (TKIs), blocks cell cycle progression, inhibits the production of pro-angiogenic factors and induces apoptosis in numerous ? ' « viiro and xenograft models. Accordingly, the ErbB receptor family with their most prominent members EGFR and HER-2 represents validated targets for anti-cancer therapy, and anti-ErbB MoAbs (cetuximab, panitumumab, and trastuzumab) and TKIs (gefitinib.
  • MoAbs monoclonal antibodies
  • TKIs tyrosine kinase inhibitors
  • erbtinib, and !apatinib have now been approved for the treatment of advanced colorectal cancer, squamous cell carcinoma of the head and neck, -advanced non-small-cell lung cancer, as well as pancreatic and breast cancer.
  • Skin toxicity is a common side effect of treatments that target EGFR.
  • Cutaneous reactions to EGF receptor inhibitors include folliculitis / acneiform rash, xerosis, pruritis, paronychia and changes in hair and nails. These reactions can cause significant distress- to the patient, and management of these reactions is necessary (for a. review, Dick & Crawford, 2005). Folliculitis/acneiform rash appears about seven to 10 days after the initiation of therapy. The distribution of lesions is within the usual T-zone (i.e., forehead, nasolabial folds and chin) as well as the upper back or chest. However, the characteristics are not typical of acne vulgaris in that there are no comedones and the rash is frequently itchy; treating it as acne may cause more harm than good.
  • the skin toxicity described above is not limited to anti-EGFR therapies, and other "anti-EGFR-Hke” therapies also induce skin toxicity side effects, indeed, antitumor therapies targeting signaling pathways and kinases such as VEGFR. PDGFR. E , ⁇ ⁇ , BCR-ABL, B AF strict exhibit activities against many tumor types but sometimes also exhibit skin toxicities.
  • antitumor therapies targeting signaling pathways and kinases such as VEGFR.
  • PDGFR. E , ⁇ ⁇ , BCR-ABL, B AF fixed exhibit activities against many tumor types but sometimes also exhibit skin toxicities.
  • inhibitors of the BRAF serine- threonine kinase induce a skin toxicity that resembles that of anti-EGFR, with an apparent relationship between this toxicity and the antitumor activity. So, skin toxicity is, as in the case of anti-EGFR, considered as a marker for antitumor activity.
  • Human hair is a complex and functional micro-organ harboring a specific vascularization and innervation. It is a differentiated system including epithelial cells (keratinocytes), fibroblasts and especially dermal papilla fibroblasts, pigment cells (melanocytes) and it represents the major reservoir or epidermal stem cells. Despite strong polymorphisms of color and keratinization, human hair growth is remarkably reproducible among individuals, both in vivo and after dissection and culture in viiro. Hair bulb expresses many receptors and channels, is sensitive to many systemic stimuli (including inflammatory stimuli), concentrates products and drugs and is finally a very interesting sensor of cutaneous effects.
  • keratinocytes epithelial cells
  • fibroblasts and especially dermal papilla fibroblasts
  • pigment cells melanocytes
  • Hair can be reproducibly plucked from, volunteers or patients, leading to non-invasive samplings.
  • the samples can be analyzed using multiple methods and especially transcriptomie approaches.
  • Several individual follicles can be plucked from different areas from a same donor, at different times, pooled or not, etc.
  • SERPINs are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. Some serpins are known to be involved in inflammation processes (for reviews see Van Gent et aL > 2003; angan ei aL t 2008). Among the genes encoding SERPINS, SERPINB3 and SERPINB.4 genes have a high identity (96% identity).
  • SERPINB4 expression level as a novel marker of inflammation and/or cutaneous toxicity, which can be measured in hair follicles from patients under anticancer therapy targeting the ErbB pathway.
  • the expression level of SERPINB4 can be used as an early marker of treatment efficacy, which enables to know, 24 hours or at most a few days following, the first administration of the anti-EGFR or anti-EGFR-iike drug, if the patient will be a good responder or not, and, in certain cases, if the patient will need an additional treatment to prevent or alleviate the cutaneous side effects of the treatment.
  • One advantage of this method is the fact that it is non-invasive.
  • SERP1NB4 Since SERPINB3 is also over-expressed in response to an anti-EGFR- like treatment, (although its over-expression is not as important as that, of SERP1NB4). the method described below can also be performed using SERPIN 83 in addition to or in replacement of SERPIN B4.
  • an "anti-EGFR-iike treatment” also called a “tyrosine- kinase-related treatment” designates any type of treatment which targets a signaling pathway and/or a kinase, and which can cause cutaneous reaction as a side-effect.
  • tyrosine kinase inhibitors TKI
  • treatments interfering with VEGF.R, PDGFR, MEK, c IT, BCR-ABL, BRAF and in any of these signaling pathways can be considered as tyrosine-kinase-relaied treatments.
  • a tyrosine-kinase-relaied treatment can be any kind of drug, including biomolecules, chemical molecules, extracts, etc. Although tyrosine-kinase- relaied treatments are most often used in anticancer therapies, SERPIN B4 expression level can be used as a marker of efficacy and/or inflammation when these treatments are used for treating conditions and diseases different from cancer.
  • SERPI.INB4 designates, depending on the context, either the Homo sapiens serpin peptidase inhibitor, clade B ( ovalbumin), member 4 (SERP1NB4) protein, or the gene encoding it (NCBl Reference Sequence: NM 002974.2),
  • a marker SERPINB4 can be detected either at the RNA level, or at the protein level.
  • the same notation is used for the gene and the protein which it encodes, it being understood thai the level of expression of a gene can be measured either at the transcription level (mRNA), or at the translation level (protein).
  • SERPI.NB4 can also be detected by measuring its activity.
  • the present invention hence pertains to a method of determining if an individual who is treated with a biotherapy or a chemotherapy such as an anti-EGFR. treatment or any other a tyrosine-kinase-related treatment, for example an anti-EGFR treatment, is a good responder to this treatment, comprising the following steps:
  • the level of ' expression, of SerpinB4 is measured in a sample of hair follicles from said individual, and (ii) this level is compared to a predetermined value, wherein a measured level above the predetermined value indicates that d e individual is a good responder to the tyrosine-kinase-related treatment (i.e., this person benefits- from this treatment, either alone or in combination with chemotherapy), and a measured level equivalent or below the predetermined value indicates that the individual is a poor responder (i.e., this person is resistant to the treatment).
  • the patient is its own control.
  • the predetermined value is determined from SERPINB4 expression level in a sample of hair follicles that was taken f om the individual prior to the beginning of the treatment (i.e., before administration of the therapeutic agent). Indeed, individual variations can be more informative than absolute expression level.
  • the physician can determine this value for a given treatment by data accumulation in a cohort, of patients having a known response (in terms of cutaneous symptoms and antitumor response, for example) to said treatment
  • the measured level of SerpinB4 expression can also be compared to a second value or threshold, superior to the first one, which is determined so that a level superior to this value is indicative that there is a risk of severe side-effects; in such a case, additional treatments can be proposed to the patient to prevent or alleviate side-effects from the anti-EGFR treatment.
  • An early detection of a very strong reaction to anti-EGFR treatment can help the physician to anticipate these side-effects and hence prevent their appearance or at least limit their intensity.
  • this example can be extended to all. the cases in which the development of a visible skin inflammation is associated to the status of a pathology or a therapy, and especially to a positive response to a treatment.
  • the physician will determine this value depending on the context.
  • a predetermined value which can be used to deduce the necessity of preventing inflammatory and/or cutaneous side-effects is the mean expression level of SERPINB4 measured in hair follicles in a cohort of patients exhibiting a skin inflammatory response with a known severity.
  • the response to the treatment when too strong, can become dangerous.
  • the measured level of SERPINB4 expression is compared to a third predetermined value or threshold, which is above the two predetermined values already mentioned, and which is determined by the skilled artisan so that it indicates that the response to the treatment is too strong and may lead to toxic effects.
  • the measured level of SBRPJNB4 expression is above this third predetermined value, the dosage of the drug used in the tyrosine-kinase-related treatment is decreased, or the treatment is completely arrested. The skilled artisan can determine this value as described above.
  • the expression level of SERPINB4 can be measured by any technology known in the art. Methods for determining gene expression levels are well known by those skilled in the art and can measure either transcription or translation rates. By transcription rate it is understood. mRNA levels. By translation it is meant, protein production rate. As already mentioned above. SERPINB4 expression level can also be assessed by measuring SERPINB4 bioactivity in a sample.
  • mRNA levels are measured, for example by hybridization assay, for example on a chi or (micro)array.
  • hybridization assay for example on a chi or (micro)array.
  • the skilled artisan can follow the hybridization of the Asymetrix probes 1 1730263_x_at (e.g. using chip U219), 2.10413_x_at and 2 ⁇ ⁇ 906__s jit fusing chip U 133).
  • Any other in tuba or in situ hybridization-based technology for the direct or indirect measurement of SERPINB4 transcript can also be used.
  • SERPINB4 expression level is measured by quantitative reverse-transcription PGR. (RT-qPCR).
  • any other PGR- or non PCR-based amplification technology for the direct or indirect measurement of SERPINB4 transcript can also be used, including technologies that integrate hybridization probes (e.g., TaqMan technology), molecular beacons, Panomics Inc. Technologies, etc.. Since SERPINB4 and SERPINB3 are highly homologous (as shown in Figure 2), only few regions/probes and primer couples can specifically target SERPINB4. For some technologies needing additional probes o tools, such as that developed by Panomics inc., additional probes or primers may target sequences common to SERP1NB4 and SERPINB3.
  • SERPINB4 expression level can be measured by measuring its translation rate, for example by immunological assay.
  • polyclonal or monoclonal antibodies may be used, directly as primary antibodies or as parts of ELISA kits or any other type of kit.
  • Antibodies manufacturing methods are well know b one skilled in the art.
  • SER.PINB4 is a relevant up-regulated marker for detecting skin response when used alone, it can also be combined to other markers, for example to one or several marker(s) that are conversely down-regulated in the same samples, to obtain a more sensitive method for assessing a response to an anti-EGFR-!ike treatment.
  • the level of expression of COL1 1 A1 is also measured in a sample of hair follicles from the patien and compared to a predetermined value, wherein a measured level below the predetermined value indicates that the individual is a good responder to the tyrosine-kmase-related treatment, and a measured level above the predetermined value indicates that the individual is a poor responder to the tyrosme-kinase-related treatment.
  • SERPINB4 and COL1 1.A1 can be combined to obtain a more sensitive marker, by calculating the ratio between their relative expression levels, indeed, since the first one is increased and the second one is decreased in patients who respond to an anti-EGFR-like treatment, the SERPiNB4/COL I 1 A! ratio dramatically increases.
  • kits for performing the method as described above comprising at least one pair of primers specific for SERPINB4 (such as (SEQ ID No: 1, SEQ ID No: 2) or (SEQ ID No: 3, SEQ ID No: 4), for example) and, optionally, one pair of primers specific for COL1 1 A 1 (such as (SEQ ID No: 1 1, SEQ ID No: 12)).
  • the kit according to the present invention can be designed to measure SERPINB4 level of expression by a hybridization technique such as that known under the name of QuantiGene® (Panomics).
  • the kit comprises at least one nucleic acid probe specific for SERPINB4 and branched DNA, as well as, optionally, at least one nucleic acid probe specific for CO LI 1A1.
  • this technology necessitates several probes per target, and SERP1NB3 and SERP1NB4 genes are 96% identical.
  • a specific hybridization assay based on the QuantiGene® technology can be developed provided at least one of the probes is specific for SERP1NB4.
  • the present invention also pertains to a kit for performing the method described herein, by a technology based immunoassays.
  • a kit comprises, for example, an antibody specifically binding to SERP1NB4,
  • the skilled artisan can also use, instead of antibodies specific for SERP1NB4, any other molecule specifically binding to said protein, such as. for example, .antibody fragments or specifically designed aptamers.
  • Aptamers are single stranded nucleic acid molecules (DNA or RNA) that are selected in vitro for their ability to bind to a target molecule; this selection can be performed, for example, by the SELEX method (Systematic Evolution of Ligands by Exponential Enrichment) described in US 5,270.163.
  • the kit can also comprise an antibody or any other molecule specifically binding to COL 1 3 A 1.
  • Figure 3 Fusion curves obtained after qPC amplification using the specific primer described and heating the different amplified cD A fragments.
  • the samples used were those from the partient #1 at DO and D14,
  • Figure 4 Kinetic of the stimulation of SERP1N B4, SERP.1N B3 and Si 0OA7 in cultured NHEK following addition of inflammatory cytokines (II .- 1 7 + II ,-22 + T F , all at a final concentration of 3 ng/mi).
  • Figure 5 Histogram representation of the results from table 14.
  • Example 1 Gene ex ess on profiling in scalp .. hair .. follicles .. from patients having a Cetaxiinafa treatment
  • the analysis was performed using samples from 3 patients treated with Cetuxi mb (antf-EOFR antibody), before the onset of the treatment and .14 days after its beginning.
  • RNA extraction was performed directly in the tubes by tilling them with 1 ml TriPure Isolation Reagent® according to the supplier's instructions. The amount and quality of RNA were evaluated using a Jab-on-a-chip Bioanalyzer (Agilent technologies). Potential contaminant traces of genomic DNA were removed using the DNAfree system (Ambion). This method for RNA preparation allowed the analysis of gene expression by both hybridization (Affynietrix U2I9 chip) or RT-qPCR. Microarray analysis
  • Aftymetrix® Human Genome U21 Array was used to perform a first screening of more than 20,000 genes.
  • RNA amplification and labeling were performed using GeneChip 3'IVT Express Kit (Affymetrix). Briefly, single strand complementary DNA (cD A) were synthesized by reverse transcription of total R A in presence of oligo(dT). A double- strand cDNA (dsDNA) was then synthesized using a DNA polymerase, in vitro transcription of dsDNA allowed amplifying arid incorporating biotinylated nucleotides in order to obtain RNA labelled by a biotin analogue. (aRNA). These aRNA were then purified onto magnetic beads in order to filter out salts, enzymes and non-incorporated d ' TP. Then. aRNA were hydrolyzed into fragments of 35 to 200 nucleotides (mainly 100- 120 nucleotides).
  • Hybridization was performed using "GeneAtlasTM hybridization, wash and stain kit for 3 ' iVT arrays" (Affymetrix®). Hybridization of fragmented aRNA onto Affymetrix® U219 chip (36,000 transcripts and variants) was performed in the Gene AtlasTM fluidics Affymetrix® hybridization station during 16 hours at 45°C. After hybridization, washing and labelling , steps were performed using the Gene AtlasTM fluidics station. U219 chi was analyzed using the Gene AtlasTM Imaging station (Affymetrix® - Resolution 2 ⁇ ) and fluorescence intensity data were saved in a ..dat file.
  • Affymetrix® software Images were then examined individually in order to detect any potential imperfections (bubbles, less marked areas).
  • Modulation factors were calculated by dividing linear RE values of 2 given conditions for the same probeset. Arbitrary, it has been defined that a gene was significantly over-expressed when the expression ratio between two conditions was higher than or equal to 2., and that it was down regulated when the expression ratio was lower than or equal to 0.5. Results
  • Table 1 shows the list and relative expression value of the most up-regu!aied probesets/genes alter 14 days treatment by Cetuximab. The data were filtered using the patient #1 (DUR) which harbored the greatest skin toxicity. Among the most up- regulated probesteis, appeared probestets from the SERPIN (SERPINB4, SERPI B3) family, then from the S 1 00 family (S100A7A, S100A7) and SPRR famiiy (SPRR2A). The probeset .list from table 1 includes all the up-regulated probesets .having an overexpression of 10-fold and over.
  • Table 1 Selection of the most up-regulated gen.es by Cetuximab treatment of 3 patients who exhibited a marked skin inflammation; profile obtained with Affymeirix U21 chip.
  • SERPFNB4 the data concerning this gene were obtained with the probe 1 1730263 x_, which is specific for serpinB4 niRNA.
  • SERPINB4 specific probe was clearly the most up-regulated (x.62).
  • SERPI ' N probes clearly comes the SERPINB4/SERPINB3 group of probes (probes that hybridize to both SERPFNB4 and SERPI B3 which are highly homologous; 4 probesets), and finally the SERPINB3- speciflc group of probes (4 probesets).
  • 5ERPINB4 is the. most up-regulated gene, folio wed by S100A7A and SER.PI B3.
  • SERPI B4 is also highly over-expressed (x20), as well as the SERPINB4/SERPINB3 probe #1 1752805 (repectively x37 and x25 for patients #2 & #3).
  • the other SERPi probesets were less overexpressed.
  • the fact that this SERPIN B4/SERP FN B3 probe gave a strong signal in these two patients, as compared to the patient #i, could be due e.g. to a discrete polymorphism (S P) in the sequence.
  • Table 2 cumulates the data from the 3 SERPINB3/4 probeset groups and show that SBRPl T -speei.fie probe is more over-expressed than SERP B4-non- specific probe, which is itself more over-expressed than SE PINB3 ⁇ spec.iilc probe.
  • Table 2 Data obtained from Table I after ciimui of the RE values of the probesels that detect SE PINB4 and SERPINB3, specifically and both S EPINB3/SERP1NB4 sequence.
  • Table 3 Selection, of COL1. I A 1 as a strongly down-regulated gene by Cetuximab treatment of the 3 patients from Tables 1 -2 (same trie as Table
  • COLHAl hence is a candidate gene to be coupled to SERPINB4 in a duplex assay. This will be confirmed vising RT-qPCR. experiments, as shown in some of the following examples (summarized in table 16).
  • Example 2 Development of primer sets for RT-qPCR: SERPI B4 is more potent t an SER INB3
  • RNA-free total RNA samples from hair follicles from patient #1 (DUR, example 1) at day 0 and day 14 after Cetuximab treatment were used in this study.
  • reaction mix ( i0 ⁇ final) was added as follows:
  • SERPINB4antisens-b CGTATCATTGCCAATAGTCC ' CA (SEQ ID No: 4)
  • SERPiNB3anttsens-a AGCGAGGCAAAATGAA AAGA (SEQ ID No: 6)
  • SERPINB3antisens-b AGCGAGGCAAAATGAAAAGA (SEQ ID No: .10)
  • COL1 lAlsens TGGTCTACCTGGTCCTCCTG (SEQ ID No: 1 1)
  • COL1 lAlantisens ACAGGACCTGGTCTTCCAGT (SEQ ID No: 12) GAPDH gene was used as a control and its mRNA was amplified (amplified cDNA fragment: 269 bp) using the following primers:
  • GAPDH sens-a GGCTCTCCAGAACATCATCCCTGC (SEQ ID No: 7)
  • GAPDHantisens-a GGGTGTCGC ' IXJTTGAAGTCAGAGG (SEQ ID No: 8)
  • the value selected for RE calculations is the "output point" (Ct) of the fluorescence curve.
  • Ct output point
  • the RE value was expressed in arbitrary units according to the formula:
  • the specificity of the amplification of only one sequence in the samples was checked by the fusion curves of the amplified cDNAs.
  • Figure 3 shows fusion curves harboring unique peaks, indicating that the designed primers couples amplified one unique sequence in the samples from plucked hairs.
  • Table 5 RT-qPCR analysis of the differential expression of SERP1 B3 in the hair fol licles from patient 1 ( D0/D 14). using the primer couple SERPI 3-a.
  • Table 6 RT-qPCR analysis of the differential expression of SERPINB3 in the hair follicles from patient 1 (D0 D14). using the primer couple SERPfN3-b.
  • Table 7 RT-qPCR analysis of the differential expression of SERPINB ' 4 in the ' hair follicles from patient 1 (DQ/D 14), using the primer cou le SERPIN ' 4-a.
  • Table 8 RT-qPCR analysis of the differential expression of SERP1NB4 in the hair follicles from patient i (D0/D14), using the primer couple SERPiN4-b.
  • the SERPfNB4-b and the SERPl B3-b couples of primers will be used in the followin experiments.
  • table 9 shows a dramatic decrease in the COL1 J Al transcript expression in the D14 sample as compared to the DO sample.
  • Table 9 RT-q CR analysis of the differential expression of COL, 1 1 A 1 in the hair follicles from patient 1 (D0/D14), using the primer couple COL! .1 Al .
  • Example 3 Expression and modulation of SERPI B4 in ke r a tinocy ⁇ e m .one Say e r s in vitro
  • NHEK Normal Human Epidermal Kexatinocytes
  • Table 10 shows that HEK stressed for 24 h with inflammatory mixes strongly over-expressed SERPINB4 and in a much lesser extent SERPINB3 (over- expression less than 0.1 -fold this of SEI PINB4).
  • the Th.l 7 cytokine mix that mimics a psoriatic (PSO) phenotype in NHEK induced a stronger SERPIN B4 over-expression than the Th2 Th22 mix i which IL-17 is replaced by IL-4/IL-13 (mimics an atopic dermatitis, AD, phenotype).
  • Table 10 RT-qPCR analysis of the relative expression of SERPINB4 and SERPiN B3 and COLI 1 A 1 in keratinocyte monolayer cultures treated for 24 h with a mix of IL-4, IL-13, IL-22, TNF-a (mix Th2/Th22) or a mix of IL- 17, IL-22, TNF-a (mix Tfa 7>.
  • Primer couples were SERPIN B4-b, SERPINB3-b and COLl l A L COLI 1A1 is not detected in NHEK. ⁇ order to determine the kinetic of overexpression of SERPIN B4, SERPIN B3 and other markers (such.
  • SI 00.47 which is also over-expressed in patients 14 days after the anti-EGFR treatment
  • the same experiment was performed on keratinocytes treated with the T 7 cytokine mix. with measures 1, 2, 4, 8 and 24 hours fallowing addition of the inflammatory cytokines, interestingly, as early as 4 hours after the addition of inflammatory cytokines, SERPIN B4 over-expression is more than 100-fold and increases to more than 600- and 4 500-fold after 8 hours, and 24 hours, respectively (figure 4), The over-expression of the other markers is clearly lower.
  • COL1 IA1 expression was undetectable in keratinocyte cultures.
  • COL 1 1.41 expression is low in fibroblast and fibrobfasi-related models but its expression is much stronger in fibroblasts from hair dermal papilla (data not shown). Expression in hair follicle is probably located in dermal papilla.
  • SERPINB4 was the most over-expressed SERPIN family member (Table 1 1). As in NHEK, SERINB4 was once again more amplified than SERPINB3 following inflammatory treatments, and ThI7/psoriatic cytokine mix was more efficient in stimulating the expression of SERPINB4 than the T22/Th22 mix (Table 12).
  • COI.1 1A1 was significantly expressed by follicles in vitro and down- regulated by inflammation. Ersbe?.
  • TNFAIP5 v3 ⁇ 4.32 333 is 9-77 :737. - «. « tofoor necrosis factor, sipha- ' md eed prots ' m 6 7130
  • Table 11 AiiVineirix U219 chip analysis of the mosily-up regulated genes upper pari, light grey) and of COL11 A 1 (lower part, darker grey) in RNA samples from dissected hair follicles from a healthy donor cultured for 24 fi with a mix of IL ⁇ 4, IL-13, 1L-22, TNF-a (mix Th2Th22) or a mix of 1I..-17, IL-22, TNF-a (mix Thl7).
  • Table 1.2 Re-analysis, by RT-qPCR, of the cultured hair follicles samples used in Table 1 1.
  • Example 5 Expression and modulation of SERPI B4 a id the other selected ⁇ patients having a Cefo imab treatment (RT-qPCR)
  • SERPINB4 overexpression correlates well with and is able to unambiguously evidence the only patient who did not develop skin toxicity, in this non- responsive patient, the level of SERPINB4 (and SERPINB3) was found, even lower at D14 than at DO.
  • Table 15 RT-q PGR analysis of COL1 1 A 1 differential expression among the 7 patients treated with Cetuximab ( D0/DI4). Note the absence of significant down-regulation of CO LI 1 Al in patient #6.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé non invasif d'évaluation, à un stade très précoce, d'une réponse à un traitement anti-EGFR, par la mesure du niveau d'expression de SERPINB4 dans un échantillon de follicules capillaires de l'individu qui a reçu le traitement anti-EGFR.
PCT/IB2013/051011 2012-02-07 2013-02-07 Serpinb4, comme marqueur destiné à une évaluation précoce de la réponse à des thérapies anti-egfr par un procédé non invasif WO2013118073A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12154323.5 2012-02-07
EP12154323 2012-02-07

Publications (1)

Publication Number Publication Date
WO2013118073A1 true WO2013118073A1 (fr) 2013-08-15

Family

ID=48014124

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2013/051011 WO2013118073A1 (fr) 2012-02-07 2013-02-07 Serpinb4, comme marqueur destiné à une évaluation précoce de la réponse à des thérapies anti-egfr par un procédé non invasif

Country Status (1)

Country Link
WO (1) WO2013118073A1 (fr)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024767A1 (fr) * 2002-09-10 2004-03-25 Canag Diagnostics Ab Immuno-essais servant a effectuer la determination specifique d'isoformes de scca
EP1733738A1 (fr) * 2004-03-24 2006-12-20 Shiseido Company, Ltd. Procede de prevention de l'apoptose induite par les rayons ultraviolets
WO2008088861A2 (fr) * 2007-01-18 2008-07-24 University Of Southern California Polymorphismes géniques prédictifs d'une bithérapie à base de tki
EP1988164A1 (fr) * 2006-02-23 2008-11-05 National University Corporation Kanazawa University Procédé destiné à tester la sensibilité d'un cancer solide contre un inhibiteur de tyrosine kinase et nécessaire de test correspondant
WO2008154249A2 (fr) * 2007-06-08 2008-12-18 Genentech, Inc. Marqueurs d'expression de gène de résistance tumorale à un traitement par inhibiteur her2
EP2133433A1 (fr) * 2008-06-09 2009-12-16 Centre Georges François Leclerc Procédé de prédiction de la réactivité à un traitement avec un anticorps anti-HER2
WO2010030857A2 (fr) * 2008-09-11 2010-03-18 The Regents Of The University Of Colorado Taux de réponse à une thérapie par des inhibiteurs de l'egfr
WO2010121238A2 (fr) * 2009-04-17 2010-10-21 Translational Genomics Research Institute (Tgen) Méthodes et kits permettant de prédire le résultat thérapeutique d'inhibiteurs de la tyrosine kinase
WO2010145796A2 (fr) * 2009-06-19 2010-12-23 Merck Patent Gmbh Biomarqueurs et procédés pour déterminer l'efficacité d'anticorps anti-egfr dans une thérapie d'un cancer
WO2011107679A2 (fr) * 2010-03-05 2011-09-09 Immunosearch Méthode d'évaluation du potentiel sensibilisant d'un composé test

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024767A1 (fr) * 2002-09-10 2004-03-25 Canag Diagnostics Ab Immuno-essais servant a effectuer la determination specifique d'isoformes de scca
EP1733738A1 (fr) * 2004-03-24 2006-12-20 Shiseido Company, Ltd. Procede de prevention de l'apoptose induite par les rayons ultraviolets
EP1988164A1 (fr) * 2006-02-23 2008-11-05 National University Corporation Kanazawa University Procédé destiné à tester la sensibilité d'un cancer solide contre un inhibiteur de tyrosine kinase et nécessaire de test correspondant
WO2008088861A2 (fr) * 2007-01-18 2008-07-24 University Of Southern California Polymorphismes géniques prédictifs d'une bithérapie à base de tki
WO2008154249A2 (fr) * 2007-06-08 2008-12-18 Genentech, Inc. Marqueurs d'expression de gène de résistance tumorale à un traitement par inhibiteur her2
EP2133433A1 (fr) * 2008-06-09 2009-12-16 Centre Georges François Leclerc Procédé de prédiction de la réactivité à un traitement avec un anticorps anti-HER2
WO2010030857A2 (fr) * 2008-09-11 2010-03-18 The Regents Of The University Of Colorado Taux de réponse à une thérapie par des inhibiteurs de l'egfr
WO2010121238A2 (fr) * 2009-04-17 2010-10-21 Translational Genomics Research Institute (Tgen) Méthodes et kits permettant de prédire le résultat thérapeutique d'inhibiteurs de la tyrosine kinase
WO2010145796A2 (fr) * 2009-06-19 2010-12-23 Merck Patent Gmbh Biomarqueurs et procédés pour déterminer l'efficacité d'anticorps anti-egfr dans une thérapie d'un cancer
WO2011107679A2 (fr) * 2010-03-05 2011-09-09 Immunosearch Méthode d'évaluation du potentiel sensibilisant d'un composé test

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DUK J M ET AL: "Cancer of the uterine cervix: Sensitivity and specificity of serum squamous cell carcinoma antigen determinations", GYNECOLOGIC ONCOLOGY, ACADEMIC PRESS, LONDON, GB, vol. 39, no. 2, 1 November 1990 (1990-11-01), pages 186 - 194, XP026238903, ISSN: 0090-8258, [retrieved on 19901101], DOI: 10.1016/0090-8258(90)90430-S *
DUK J M ET AL: "Elevated levels of squamous cell carcinoma antigen in patients with a benign disease of the skin", CANCER, AMERICAN CANCER SOCIETY, PHILADELPHIA, PA, US, vol. 64, no. 8, 15 October 1989 (1989-10-15), pages 1652 - 1656, XP009104760, ISSN: 0008-543X, DOI: 10.1002/1097-0142(19891015)64:8<1652::AID-CNCR2820640816>3.0.CO;2-M *
LUKAS HEFLER ET AL: "Serum concentrations of squamous cell carcinoma antigen in patients with vulvar intraepithelial neoplasia and vulvar cancer", INTERNATIONAL JOURNAL OF CANCER, vol. 84, no. 3, 21 June 1999 (1999-06-21), pages 299 - 303, XP055061260, ISSN: 0020-7136, DOI: 10.1002/(SICI)1097-0215(19990621)84:3<299::AID-IJC17>3.0.CO;2-K *
MURAKAMI A ET AL: "Squamous cell carcinoma antigen seppresses radiation-induced cell death", BRITISH JOURNAL OF CANCER, HARCOURT PUBLISHERS, vol. 84, no. 6, 1 January 2001 (2001-01-01), pages 851 - 858, XP002989569, ISSN: 0007-0920, DOI: 10.1054/BJOC.2000.1683 *
SHIIBA MASASHI ET AL: "Down-regulated expression of SERPIN genes located on chromosome 18q21 in oral squamous cell carcinomas.", ONCOLOGY REPORTS JUL 2010, vol. 24, no. 1, July 2010 (2010-07-01), pages 241 - 249, XP055062487, ISSN: 1791-2431 *
SNYDERMAN CARL H ET AL: "A reappraisal of the squamous cell carcinoma antigen as a tumor marker in head and neck cancer", ARCHIVES OF OTOLARYNGOLOGY HEAD AND NECK SURGERY, vol. 121, no. 11, 1995, pages 1294 - 1297, XP009169194, ISSN: 0886-4470 *
SULE CATALTEPE ET AL: "Co-expression of the squamous cell carcinoma antigens 1 and 2 in normal adult human tissues and squamous cell carcinomas", JOURNAL OF HISTOCHEMISTRY AND CYTOCHEMISTRY, HISTOCHEMICAL SOCIETY, NEW YORK, NY, US, vol. 48, no. 1, 1 January 2000 (2000-01-01), pages 113 - 122, XP002974324, ISSN: 0022-1554 *
TAKEDA A ET AL: "Overexpression of serpin squamous cell carcinoma antigens in psoriatic skin", JOURNAL OF INVESTIGATIVE DERMATOLOGY, NATURE PUBLISHING GROUP, GB, vol. 118, no. 1, 1 January 2002 (2002-01-01), pages 147 - 154, XP003002003, ISSN: 0022-202X, DOI: 10.1046/J.0022-202X.2001.01610.X *

Similar Documents

Publication Publication Date Title
EP3506912B1 (fr) Micro-arn servant de biomarqueurs de l&#39;endométriose
Pachot et al. Longitudinal study of cytokine and immune transcription factor mRNA expression in septic shock
US20180251853A1 (en) Biomarkers in Peripheral Blood Mononuclear Cells for Diagnosing or Detecting Lung Cancers
CN107099581B (zh) 预测、诊断和治疗特发性肺纤维化的方法
US6759217B2 (en) Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer
AU2017213457B2 (en) Micro-RNA biomarkers and methods of using same
AU2018202963B2 (en) Biomarkers useful for detection of types, grades and stages of human breast cancer
CN106676191B (zh) 一种用于结肠腺癌的分子标志物
JP2022130509A (ja) 分析方法及びキット
CN109055555A (zh) 一种肺癌早期转移诊断标志物及其试剂盒和应用
US20080286784A1 (en) Method for Detection of DNA Methyltransferase RNA in Plasma and Serum
US8741575B2 (en) Methods of predicting high grade gliomas using senescence associated genes
CN107557472A (zh) 胶质瘤诊断标志物circ9:135881633|135883078及应用
Xiang et al. Screening for candidate genes related to breast cancer with cDNA microarray analysis
CN109182528B (zh) 一种基于itgb5基因的胶质母细胞瘤辅助诊断、预后评价试剂盒及其使用方法
JP2021112167A (ja) うつ病の診断補助方法及び診断用キット
KR102555878B1 (ko) 하향조절된 mirna의 진단 및 치료를 위한 용도
WO2013118073A1 (fr) Serpinb4, comme marqueur destiné à une évaluation précoce de la réponse à des thérapies anti-egfr par un procédé non invasif
EP2083087B1 (fr) Procede de diagnostic d&#39;un cancer de la langue
KR20100045703A (ko) 침윤성 또는 비침윤성 방광암의 예후 예측용 진단 키트, 방광암의 예후 측정방법 및 방광암 치료제의 스크리닝 방법
US20100159464A1 (en) Method for Detection of DNA Methyltransferase RNA in Plasma and Serum
CN102199663B (zh) 用于检测人类egfr基因20号基因外显子突变的引物组合物、试剂盒及方法
Nurzat et al. Invariant chain of the MAIT‐TCR vα7. 2‐Jα33 as a novel diagnostic biomarker for keloids
CN107586843A (zh) 胶质瘤诊断标志物circ7:100812747|100813208及应用
El-Taweel et al. Circular Ribonucleic Acid Expression in Patient with Acne

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13712916

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13712916

Country of ref document: EP

Kind code of ref document: A1