WO2013097940A1 - Plants having a modulated content in seed proteins and method for production thereof - Google Patents
Plants having a modulated content in seed proteins and method for production thereof Download PDFInfo
- Publication number
- WO2013097940A1 WO2013097940A1 PCT/EP2012/005324 EP2012005324W WO2013097940A1 WO 2013097940 A1 WO2013097940 A1 WO 2013097940A1 EP 2012005324 W EP2012005324 W EP 2012005324W WO 2013097940 A1 WO2013097940 A1 WO 2013097940A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- shp
- expression
- plant
- ortholog
- derivative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
Definitions
- the invention relates generally to the field of agricultural biotechnology and proteins.
- the invention relates to plant genes involved in the regulation o proteins, preferably seed storage proteins and uses thereof.
- the inv ⁇ relates to plants comprising a partial or total inactivated SHP (Storage protein act Heterodimerizing Protein) gene, an ortholog or a derivative thereof and having an incr content in seed proteins, preferably seed storage proteins.
- the invention also rela plants overexpressing said SHP gene, an ortholog or a derivative thereof and ha ⁇ decreased content in seed proteins, preferably seed storage proteins.
- the inv( also relates to methods for producing modified plants having a modulated content ol proteins, preferably seed storage proteins - i.e.
- Cereal seeds contain seed proteins and particularly seed storage proteins ha preponderant importance for human and animal food. More particularly, the conter composition in seed storage proteins are important parameters for the technological of flours, and thus of particular importance to industries such as bakeries that are in m flours presenting a high content in seed storage proteins. In the meantime, seeds presi a low content in seed storage proteins may also appear advantageous for animal food on forage crop in which the nutritive value is based on the vegetative part of the cro therefore necessary to understand the mechanisms underlying the synthesis of saic storage proteins.
- the content and composition of seed storage proteins are the principal determinants of the cereal use value, and especially in the case of wheat.
- Gluten proteins of wheat are constituted by glutenins and gliadins which influence significantly the technological value of flour. Glutenins are implicated in the dough's elasticity whereas gliadins are related to the viscosity and extensibility of the dough.
- the inventors have identified the nucleic acid sequence of the three homeologous genes coding for a transcription regulator implicated in the synthesis of seed storage proteins in wheat. Moreover, the inventors have demonstrated that a modification in the content and composition in seed proteins, preferably seed storage proteins is induced by either inhibiting, i.e. underexpressing or overexpressing said wheat transcription regulator, an ortholog or a derivative thereof implicated in the transcription of seed storage proteins, and especially by silencing the expression of the gene encoding said transcription regulator or by overexpressing said gene respectively.
- Figure 1 Relative expression of SHP in RNAi and null segregant (NS) lines of the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply. Grains were sampled at three stages during the linear phase of grain storage protein accumulation.
- Figure 2. Kinetics of accumulation of total nitrogen and sulfur per grain in RNAi and null segregant (NS) lines of the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply.
- Figure 3 Kinetics of accumulation of glutenins and evolution of the HMW-GS to LMW-GS ratio in RNAi and null segregant (NS) lines of the the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply.
- FIG. 11 Expression of SHP determined at 400°Cd after flowering by qRT-PCT with generic primers (SHP-all), amplifying the 3 homeologous copies of the gene for 10 events overexpressing SHP and the average of the null segregants (BNS) multiplied in 2011 in S2 glasshouse.
- SHP-all generic primers
- BNS null segregants
- Figure 12 Expression of SHP determined at 500°Cj after flowering by qRT-PCR with generic primers amplifying the 3 homeologous copies of the genes for 2 independent events overexpressing (OE) SHP and the average of their null segregants (NS) cultivated in 2012 in glasshouses under limited (N-) and non-limited (N+) conditions of nitrogen during the grain filling phase. The data represent the average ⁇ 1 standard error for the independent repetitions.
- Figure 13 Expression level of LMW-GS genes determined at 400°Cj after flowering by qRT- PCR for 2 independent events overexpressing (OE) SHP and the average of the corresponding Null Segregant (NS) all cultivated in 2012 in glasshouse under limited (N-) conditions of nitrogen availability during the grain filling. The data represent the average ⁇ 1 standard error for four independent repetitions.
- Figure 14 Total quantity of glutenin and gliadin per grain (in g of N / grain) and gliadin/glutenin ratio at maturity for the average of two independent events overexpressing SHP (OE) and their corresponding average null segregants (NS) cultivated in 2012 in glasshouse under limited (N-) and non limited (N+) conditions of nitrogen availability. The data represent the average ⁇ 1 standard error for four independent repetitions.
- Figure 15 Content of glutenins, HMW-GS, LMW-GS expressed in percentage of seed storage proteins (gliadins and glutenins) and HMW-GS/LMW-GS ratio at maturity for the average of the two independent events overexpressing (OE) the SHP gene and the average of their corresponding null segregants (NS) cultivated in 2012 in glasshouse under limited (N-) and non-limited (N+) conditions of nitrogen availability during the grain filling.
- the data represent the average ⁇ 1 standard error for four independent repetitions.
- a first object of the invention is to provide a method for producing a plant having a modulated content in seed proteins, preferably seed storage proteins, wherein said method comprises a step of modulating the expression of Storage protein activator Heterodimerizing Protein (SHP) transcription regulator gene, an ortholog or a derivative thereof.
- SHP Storage protein activator Heterodimerizing Protein
- plant refers to monocotyledon plant, preferably to a cereal and more preferably to a cereal selected in the group comprising the wheat, rice, rye, and sorghum, but excludes barley and corn.
- plant is intended to encompass plants at any stage of maturity or development, as well as any tissues or organs (plant parts) taken or derived from any such plant unless otherwise clearly indicated by context. Plant parts include, but are not limited to, stems, roots, flowers, ovules, stamens, seeds, leaves, embryos, meristematic regions, callus tissue, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, hairy root cultures, and the like.
- said plant is a cereal, preferably selected from the group comprising wheat, rye, rice, and sorghum.
- seed proteins or “seed total proteins” used interchangeably relates to all of the proteins contained in a plant seed and comprising for example seed storage proteins.
- the terms « seed » « kernel » or « grain » refer to a seed of a plant in any stage of its development i.e. starting from the fusion of pollen and oocyte, continuing over the embryo stage and the stage of the dormant seed, until the germinating seed, ending with early seedling organs, as e.g. cotyledons and hypocotyls.
- a plant “seed” should be understood to refer to a mature or immature plant seed.
- the term “seed” includes, for example, immature seed carried by a maternal plant or seed released from the maternal plant.
- the term “seed” should also be understood to include any seed plant sporophyte between the developmental stages of fertilisation and germination.
- the term seed refers to a mature plant seed.
- seed proteins whose content is modulated according to the invention are selected in the group of seed storage proteins.
- seed storage proteins relates to proteins generated mainly during seed production, stored in the albumen during the development of the seed and degraded in the young plantlet. Seed storage proteins serve as nitrogen sources for the development of the embryo during germination and represent around 80% of the seed total proteins.
- Example of seed storage proteins include, but are not limited to, albumins (ovalbumin, conalbumin), glutelins, prolamins, gliadins, glutenins and secalins.
- Monocotyledons mainly accumulate seed storage proteins (SSPs) in the endosperm.
- SSPs seed storage proteins
- the major endosperm storage proteins of most cereal grains are prolamins. This name come from that SSPs are generally rich in proline and amide nitrogen derived from glutamine.
- the most abundant SSPs in wheat are the gluten forming gliadins and glutenins, which account for 60% to 80% of total seed proteins.
- Gliadins are a mixture of monomeric proteins subdivided into four subgroups (alpha/beta, gamma and omega) based on their amino-acid sequences and molecular weights. Gliadins are encoded by large multigene families. It has been estimated that 25- 150, 17-39 and 15-18 genes code for the alpha, gamma and omega gliadins.
- HMW-GS high-molecular weight
- LMW-GS low-molecular weight subunits
- seed storage proteins according to the invention are selected in the group of prolamins. In another still preferred embodiment, seed storage proteins according to the invention are selected in the group comprising glutenins and gliadins.
- the terms “content” refers to the amount and/or to the composition of, for instance, seed total proteins, preferably seed storage proteins.
- the “amount”, also called “level”, of seed total proteins, preferably seed storage proteins according to the invention refers to the amount of said proteins per unit of seed total dry mass and can be expressed in milligrams (mg) of protein or nitrogen per milligrams of dry mass, or in percentage of protein or nitrogen in the seed total dry mass.
- composition of seed total proteins refers to the type of said proteins in the seed, and preferably to the sulfur content of said seed proteins.
- the sulfur content is indeed indicative of the composition of seed proteins, preferably seed storage proteins as Low-Molecular Weight Glutenin are rich in sulfur.
- the composition of seed total proteins, preferably of seed storage proteins can be analyzed for example by measuring the relative amount of sulfur in the seed.
- the term "to modulate” or “modulating” in reference to the content of seed proteins, preferably seed storage proteins refers to a variation or a modification in the content of said seed proteins, preferably seed storage proteins by comparison to that occurring in a control plant.
- modulating the content of seed proteins, preferably seed storage proteins in the case of the amount of said proteins refers to a variation or modification of said amount, i.e. it refers either to an increase or to a decrease of the amount of seed proteins, preferably seed storage proteins, by comparison to that occurring in a control plant.
- the amount of seed proteins, preferably seed storage proteins is either increased or decreased.
- the term "increase”, in reference to the amount of seed total proteins, preferably seed storage proteins refers to an increase in the amount of seed total proteins, preferably seed storage proteins in a plant according to the invention compared to the amount of seed total proteins, preferably seed storage proteins in a control plant.
- the amount of seed proteins, preferably seed storage proteins is increased of at least 0,1, preferably of at least 0,5 percentage point, and most preferably between 1,5 and 5 percentage point compared with the control plant.
- the term "decrease”, in reference to the amount of seed total proteins, preferably seed storage proteins refers to a decrease in the amount of seed total proteins, preferably seed storage proteins in a plant according to the invention compared to the amount of seed total proteins, preferably seed storage proteins in a control plant.
- the amount of seed proteins, preferably seed storage proteins, according to the invention is decreased of at least 0,1, preferably of at least 0,5 percentage point, and most preferably between 1,5 to 5 percentage point.
- Percentage points are here defined as the arithmetic difference between the protein amount (expressed in percent of seed dry mass) of a control plant or cell and that of cell or plant whose activity has been modified by a mean described below.
- modulating the content of seed proteins, preferably seed storage proteins in the case of the composition of said proteins refers to a variation or modification of said composition by comparison to that occurring in a control plant.
- a modification of the composition in seed proteins, preferably seed storage proteins can be determined by analyzing said seed proteins, for example by measuring the content of sulfur in the seed as said sulfur is characteristic of particular proteins such as low-molecular weight glutenins (LMW-GS).
- LMW-GS low-molecular weight glutenins
- control plant refers to a wild type plant or a native plant, i.e. a plant that has not been modified in order to modulate the content of seed total proteins, preferably seed storage proteins, and especially which has not been modified in order to modulate the expression of SHP transcription regulator gene, an ortholog or a derivative thereof according to the invention.
- a suitable control plant can be a non-transgenic plant of the parental line used to generate a transgenic plant, i.e. devoid of recombinant DNA.
- a suitable control plant may in some cases be a progeny of a hemizygous transgenic plant line that does not contain the recombinant DNA, known as a negative segregant (or null segregant).
- Modulated content of seed total protein content in a plant of the present invention can be measured by methods well known from the art.
- the protein amount is determined by analysing the nitrogen content of the samples by the Dumas' (elemental analysis) or the Kjeldahl method, the protein amount is then obtained by multiplying the nitrogen content by 5.7 and 6.25 in the case of seed, and leaf tissues, respectively.
- Determining the content of seed storage proteins comprises a first step of extracting said seed storage proteins from the seed total proteins by using their properties of solubility in various alcoholic and basic solutions. Methods for measuring the content of seed total proteins and preferably seed storage proteins, i.e. determining the amount and/or compositions of said proteins, are well known in the art. With respect to the extraction of seed storage proteins, many methods are available. A first example is the sequential extraction method as further described below in the examples.
- Rhazi et al Another method is the one used in Rhazi et al (JCS, 2009) that consists in the use of 30 mg of flour samples, which are stirred for 15 min at room temperature with 1 ml of 0.08 M Tris-HCI buffer (pH 7.5) containing 50% (v/v) propan-l-ol. Extraction is then followed by centrifugation at 15900 g for 10 min at 15°C. The supernatant containing monomeric proteins (albumins, globulins and gliadins) is then discarded.
- the method of producing a plant having a modulated content in seed proteins, preferably seed storage proteins, according to the invention comprises a step of modulating the expression of a SHP transcription regulator gene, an ortholog or a derivative thereof.
- the term “gene” refers to a nucleic acid sequence that encodes an RNA, for example, nucleic acid sequences including, but not limited to, encoding a polypeptide.
- the term “gene” also refers broadly to any segment of DNA associated with a biological function.
- the term “gene” encompasses sequences including but not limited to a coding sequence, a promoter region, a transcriptional regulatory sequence, a non-expressed DNA segment that is a specific recognition sequence for regulatory proteins, a non-expressed DNA segment that contributes to gene expression, a DNA segment designed to have desired parameters, or combinations thereof.
- a gene can be obtained by a variety of methods, including cloning from a biological sample, synthesis based on known or predicted sequence information, and recombinant derivation from one or more existing sequences.
- Transcription regulator or “Transcription factor” refers to a protein that modulates gene expression by interaction with the transcriptional regulatory element (also called cis-motif) and cellular components for transcription, including RNA Polymerase, Transcription Associated Factors (TAFs), chromatin-remodeling proteins, and any other relevant protein that impacts gene transcription.
- transcriptional regulatory element also called cis-motif
- TAFs Transcription Associated Factors
- chromatin-remodeling proteins chromatin-remodeling proteins
- the term “Transcription regulator” or “Transcription factor” refers to trans-acting regulatory proteins which can bind to cis-acting elements, also called cis-acting motifs or cis-motifs, that are short DNA sequences located upstream of genes, or within introns.
- SHP Storage protein activator Heterodimerizing Protein
- SHP or SPA2 having herein the same meaning and are used interchangeably, is a bZIP transcription regulator implicated in the regulation of the synthesis of seed storage proteins in wheat.
- Said SHP transcription regulator is able to form a dimer complex with its paralog, the Storage Protein Activator (SPA) transcription regulator which binds on the GLM (GCN4 Like Motif) in the promoter of a storage protein gene.
- SPA Storage Protein Activator
- said SHP transcription regulator is coded by three homoeologous genes sequences.
- Homoeologous A (SHP_A) has the coding sequence SEQ ID N°l and its translation gives the amino acid sequence SEQ ID N°2.
- Homoeologous B (SHP_B) has the coding sequence SEQ ID N°3 and its translation leads to the amino acid sequence SEQ ID N°4.
- Homoeologous C (SHP_C) has the coding sequence SEQ ID N°5 and its translation leads the amino acid sequence SEQ ID N°6.
- ortholog refers to homologs, i.e. genes that are related to a reference gene by descent from a common ancestral DNA sequence, in different species that evolved from a common ancestral gene by speciation.
- the tern "homoeolog” refers to closely related-genes, derived from a common ancestor and cumulated in wheat genome because of allopolyplo ' idisation. Thus homoeologous genes are orthologs.
- paralog refers to homologs in the same species that evolved by genetic duplication of a common ancestral gene.
- ortholog or “orthologous” in reference to proteins means that said orthologous proteins are believed to be under similar regulation, have the same function and usually the same specificity in close organisms.
- ortholog thereof designates a related gene or protein from a distinct species, having a high degree of sequence similarity, and more particularly a level of sequence identity to SHP of at least 60 %, preferably 65% and most preferably at least 75% for the coding sequence or amino acid sequences, respectively, and a SHP-like activity.
- An ortholog of SHP is most preferably a gene or protein from a distinct species having a common ancestor with SHP, able to modulate the transcription of plant seed storage proteins, and having a degree of sequence identity with SHP of at least 60% for coding sequences.
- a nucleotide sequence of an ortholog in one species can be used to isolate the nucleotide sequence of the ortholog in another species (for example, sorghum) using standard molecular biology techniques. This can be accomplished, for example, using techniques described in more detail below (see also Sambrook & Russell, 2001 for a discussion of hybridization conditions that can be used to isolate closely related sequences) or by designing primers in conserved regions and then amplified the gene by PCR.
- Preferred orthologs of SHP have a nucleic acid sequence of at least 60%, preferably at least 65%, 70%, 75%, 80%, 85%, especially preferably at least 90%, 95%, 97%, 98% and 99%, or more of sequence identity to a sequence selected in the group comprising SEQ ID N°l, 3, 5.
- SHP orthologs can be identified using such tools as “best blast hit” searches or “best blast mutual hit” (BBMH).
- SHP orthologs have been identified by the inventors in various plants, including shorgo (Sorghum bicolor), rice (Oryza sativa) and rye (Secale cereale). Specific examples of such orthologs are given in the following table 1.
- accession number corresponds to the nucleic sequence. It is followed by the accession number of the amino-acid sequence. If only one number is given, this corresponds to that of the nucleic acid sequence and thus the amino acid sequence is deduced from its translation in the adequate reading shift when the cDNA sequence is partial (this is the case for rye).
- a consensus sequence of SHP orthologs corresponds for example to SEQ ID N°33 said sequence having been defined with a multiple alignment with the Clustalx tool followed by a calculation of the consensus sequence with the Bioedit tool.
- the term "derivative” or “derivative thereof” referring to the SHP transcription regulator gene or an ortholog thereof corresponds to a nucleic acid sequence having at least 75% sequence identity to the referred sequence, preferably 80%, 85%, and most preferably 90%, 95% and 99%.
- percentage of identity between two nucleic acid sequences, means the percentage of identical nucleic acid, between the two sequences to be compared, obtained from the best local alignment of said sequences, this percentage being purely mathematical and the differences between these two sequences being randomly spread over the nucleic acid acids sequences.
- best alignment or “optimal alignment” means the alignment which gives the best score and then, for which the determined percentage of identity (see below) is the highest. Sequence comparison between two nucleic acids sequences are generally realized from the best alignment of these sequences; this comparison is realized on segments of comparison in order to identify and compared the local regions of similarity.
- the best sequence alignment to perform comparison can be realized, beside by a manual way, for example by using the global homology algorithm developed by SMITH and WATERMAN (Ad. App. Math., vol.2, p:482, 1981), by using the local homology algorithm developed by NEDDLEMAN and WUNSCH (J. Mol. Biol., vol.48, p:443, 1970), by using the method of similarities developed by PEARSON and LIPMAN (Proc. Natl. Acd. Sci.
- the identity percentage between two sequences of nucleic acids is determined by comparing these two sequences optimally aligned, the nucleic acid sequences being able to comprise additions or deletions in respect to the reference sequence in order to get the optimal alignment between these two sequences.
- the percentage of identity is calculated by determining the number of identical position between these two sequences, and dividing this number by the total number of compared positions, and by multiplying the result obtained by 100 to get the percentage of identity between these two sequences.
- expression refers to the biosynthesis of a gene product, including the transcription of sense (mRNA), antisense RNA or other RNA polymers thereof in either single-or double-stranded form resulting from RNA polymerase-catalyzed transcription of a DNA sequence. Expression may also refer to translation of mRNA from said gene into a polypeptide.
- the term « to modulate » or “modulating” in reference to the expression of SHP gene, an ortholog or a derivative thereof refers to the modification of the expression of SHP, ortholog or derivative thereof by comparing to that occurring in a control plant, either by overexpressing said SHP, ortholog or derivative thereof or by inhibiting totally or partially the expression and/or activity of said SHP, ortholog or derivative thereof.
- modulation of the expression of SHP transcription regulator gene, an ortholog or a derivative thereof is either an overexpression of said SHP transcription regulator gene, an ortholog or a derivative thereof, or a total or partial inhibition of the expression and/or activity of said SHP gene, an ortholog or a derivative thereof.
- the expression of SHP gene, an ortholog or a derivative thereof is totally or partially inhibited.
- the terms “inhibit”, “suppress”, “down regulate”, or “significantly reduce” and grammatical variants thereof are used interchangeably and refer to an activity whereby gene expression or a level of an RNA encoding the wheat SHP transcription regulator, an ortholog or a derivative thereof, or the activity of the SHP transcription regulator, an ortholog or a derivative thereof, is decreased below that observed in a control plant.
- the term “inhibiting totally” refers to the suppression of the expression and/or activity of said SHP, an ortholog or a derivative thereof compared to that observed in a control plant.
- the term “inhibiting partially” refers to decreasing the expression and/or activity of said SHP, ortholog or derivative thereof in comparison with the expression and/or activity of said SHP, ortholog or derivative thereof in a control plant.
- the expression and/or activity of said SHP gene, ortholog or derivative thereof is decreased of at least 20%, 30%, preferably 35%, 40%, 45% and most preferably of at least 50%, 60%, 70%.
- the expression of said SHP gene, an ortholog or a derivative thereof is inhibited by deletion, insertion and/or substitution of one or more nucleotides, site-specific mutagenesis, ethyl methanesulfonate mutagenesis, TILLING, ecoTILLING or by gene silencing induced by RNA interference (RNAi), small interference RNA (siRNA), double stranded RNA (dsRNA), micro RNA (miRNA), hairpin, or by using methods such as VIGS.
- RNAi RNA interference
- siRNA small interference RNA
- dsRNA double stranded RNA
- miRNA micro RNA
- a preferred method for inhibiting the expression of SHP gene, an ortholog or a derivative thereof comprises mutagenesis of said SHP gene, ortholog or derivative thereof or inhibition or modification of the transcription or translation of said SHP, ortholog or derivative thereof.
- Mutagenesis of SHP gene, ortholog or derivative thereof can be realized at the level of the coding sequence or of the regulating sequences of the expression, for example at the level of the promoter, the cis-motif but also at the level of the dimerization domain of a protein.
- mutagenesis comprises nucleotide(s) insertions, deletions, or substitutions but also realizing a deletion of all or parts of said gene and/or the insertion of an exogenous sequence, a mutation implicating a change of amino acids in the translated nucleic acid sequence which can thereby affect the function of the protein.
- Mutations can also be introduced by using physical agents, such as radiations, or chemical agents. Said mutations have the consequence of moving forward the reading frame and/or inserting stop codon in the sequence and/or modify the level of transcription and/or of translation of said SHP gene, ortholog or derivative thereof. Methods such as « TILLING » (Targeting Induced Local Lesions IN Genomes; McCALLUM et al, Plant Physiol., 123, 439-442, 2000), EMS can be used.
- total or partial inhibition of the expression of SHP gene, an ortholog or a derivative thereof is obtained by silencing of the corresponding gene.
- interference methods comprising interference RNA (RNAi), small interference RNA (siRNA), double stranded RNA (dsRNA), micro RNA (miRNA), hairpin, etc
- RNAi interference RNA
- siRNA small interference RNA
- dsRNA double stranded RNA
- miRNA micro RNA
- WATSON et GRIERSON Transgenic Plants : Fundamentals and Applications (HIATT, A, ed) New York : Marcel DEKKER, 255-281, 1992 ; CHICAS et MACINO, EMBO reports, 21, 992- 996, 2001 ; HANNON, Nature, 418, 244-251, 2002; OSSOWSKI ef al., The Plant Journal, 53, 674-690, 2008 ; SCHWAB et al., Methods Mol Biol., 592, 71-88, 2010 ; WEI et al., Funct Integr Genomics., 9, 499-511, 2009).
- RNA-mediated antiviral defense mechanism to target an endogen mRNA.
- Virus vectors carrying inserts derived from the host targeted gene are inoculated to the plant which leads to the suppression of the targeted gene expression (Lu et al, 2003).
- RNAi or "RNA interference” refers to the process of sequence- specific post-transcriptional gene silencing in plants, mediated by double-stranded RNA (dsRNA).
- dsRNA double-stranded RNA
- DNA constructs for totally or partially inhibiting the expression of the SHP gene, an ortholog or a derivative thereof and especially for delivering RNAi in a plant according to the invention are described below.
- the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof is increased, i.e. said SHP gene, an ortholog or derivative thereof is overexpressed.
- the terms “increase”, “overexpress”, and grammatical variants in reference to the expression of SHP gene, an ortholog or a derivative thereof are used interchangeably and refer to an activity whereby gene expression or a level of an RNA encoding SHP transcription regulator, an ortholog or a derivative thereof, or SHP transcription regulator's activity or one of the ortholog or derivative thereof, is increased compared to that observed in a control plant.
- the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof is increased of at least 10%, 20%, 30%, 40%, preferably of at least 50%, 100%, 150%, 200%, 250% and most preferably of at least 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% 700%, 750%, 800%, 850%, 900%, 950% and 1000%.
- a preferred method for overexpressing the SHP gene, an ortholog or a derivative thereof comprises introducing into the genome of said plant a DNA construct comprising a nucleotide sequence encoding said SHP, an ortholog or a derivative thereof, placed under the control of a promoter.
- modulating the expression of SHP gene, an ortholog or a derivative thereof comprises modulating the activity of said SHP, ortholog or derivative thereof.
- the term "activity of wheat SHP transcription regulator” refers to the activity of said wheat SHP transcription regulator to bind directly a cis-motif from the promoter of a seed storage protein gene or to associate in a dimer form with for example the Storage Protein Activator (SPA) transcription regulator which is fixed on a cis-motif element from the promoter of a seed storage protein gene.
- SPA Storage Protein Activator
- Modulating the activity of SHP transcription regulator, an ortholog or a derivative thereof comprises increasing or decreasing said activity.
- An increase of said activity can be obtained by using a compound capable of improving the fixation of SHP onto SPA in the case of the wheat.
- a decrease of said activity can be obtained for example by using a compound capable of interfering with the association of SHP and SPA in the case of the wheat, or by operating a mutation in the DNA fixation domain from seed storage proteins therefore preventing the fixation of said SHP, ortholog or derivative thereof to the promoter of said seed storage proteins leading to the loss of activity of said SHP, ortholog or derivative thereof.
- the modulated content of seed proteins is associated with the modulation of the expression of SHP gene, an ortholog or a derivative thereof.
- the overexpression of SHP gene, an ortholog or a derivative thereof is associated with a decreased amount of seed proteins, preferably of seed storage proteins and most preferably of Low-Molecular Weight glutenins (LMW-GS). Therefore, the amount of seed proteins, preferably of seed storage proteins, and most preferably of LMW-GS is increased by inhibiting the expression of SHP transcription regulator gene, an ortholog or a derivative thereof.
- LMW-GS Low-Molecular Weight glutenins
- a total or partial inhibition of SHP gene, an ortholog or a derivative thereof is associated with an increased amount of seed proteins, preferably of seed storage proteins and most preferably of Low-Molecular Weight glutenins (LMW-GS). Therefore, the amount of seed proteins, preferably seed storage proteins, and most preferably of LMW-GS is decreased by overexpressing the SHP transcription regulator gene, an ortholog or a derivative thereof.
- LMW-GS Low-Molecular Weight glutenins
- the method for producing a plant having a modulated content in seed proteins, preferably seed storage proteins comprises the following steps: a) transforming a plant host cell with an expression cassette or an expression vector according to the invention as disclosed below; and
- said method of producing a plant according to the invention comprises an intermediate step between step b) and step c), said intermediate step consisting in a screening of a homozygous plant at the transformed locus.
- the terms "host cells” and “recombinant host cells” are used interchangeably and refer to cells into which a nucleic acid sequence encoding a wheat SHP transcription regulator, an ortholog or a derivative thereof or an expression vector according to the invention can be introduced. Furthermore, the terms refer not only to the particular plant cell into which an expression construct is initially introduced, but also to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny might not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
- a host cell is defined as a plant cell as disclosed below.
- a plant host tissue can also be transformed according to the invention.
- transformation refers to the transfer of a nucleic acid molecule into the genome of a host organism, resulting in genetically stable inheritance. It therefore refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous nucleic acid.
- transformed cell is a cell comprising an artificial construct which has been introduced therein by suitable and well known techniques in the art. Therefore, a plant comprising transformed cells is a "transformed plant”.
- Transformed in reference to a plant refer to a plant into which a nucleic acid molecule has been introduced.
- the nucleic acid molecule can be stably integrated into the genome by methods generally known in the art.
- the transformation of a cell with an exogenous nucleic acid can be characterized as transient or stable.
- the term “stable” refers to a state of persistence that is of a longer duration than that which would be understood in the art as "transient”. These terms can be used both in the context of the transformation of cells (for example, a stable transformation), or for the expression of a transgene (for example, the stable expression of a vector-encoded nucleic acid sequence comprising a trigger sequence) in a transgenic cell.
- a stable transformation results in the incorporation of the exogenous nucleic acid molecule (for example, an expression vector) into the genome of the transformed cell.
- Genetically stable and “heritable” refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
- Chrosomally-integrated refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds.
- Stably transformed refers to cells that have been selected and regenerated on a selection media following transformation whereas “transiently transformed” refers to cells in which a nucleic acid sequence or a vector according to the invention have been introduced but not selected for stable maintenance.
- the term “stable expression” relates to expression of a nucleic acid molecule (for example, a vector-encoded nucleic acid sequence comprising a trigger sequence) over time.
- stable expression requires that the cell into which the exogenous DNA is introduced express the encoded nucleic acid at a consistent level over time. Additionally, stable expression can occur over the course of generations.
- the expressing cell divides, at least a fraction of the resulting daughter cells can also express the encoded nucleic acid, and at about the same level. It should be understood that it is not necessary that every cell derived from the cell into which the vector was originally introduced express the nucleic acid molecule of interest. Rather, particularly in the context of a whole plant, the term "stable expression" requires only that the nucleic acid molecule of interest be stably expressed in tissue(s) and/or location(s) of the plant in which expression is desired. In some embodiments, stable expression of an exogenous nucleic acid is achieved by the integration of the nucleic acid into the genome of the host cell.
- Numerous methods for transforming a plant cell are known in the art and are used in methods of preparing a transgenic plant cell and plant.
- methods of transformation of plants and plant cells include, but are not limited to, Agrobacterium- mediated transformation (De Blaere et al., 1987 Methods Enzymol. 153, 277) particle bombardment technology (Klein et al. 1987 Nature 327, 70; U.S. Patent No. 4,945,050), microinjection, calcium phosphate precipitation, lipofection (liposome fusion), use of a gene gun and DNA vector transporter (Wu et al., 1992 J. Biol. Chem., 267: 963-967).
- Transformation of plant material is practiced in tissue culture on a nutrient media, i.e. a mixture of nutrients that will allow cells to grow in vitro.
- Recipient cell targets include, but are not limited to, meristem cells, hypocotyls, calli, immature embryos and gametic cells such as microspores, pollen, sperm and egg cells. Callus may be initiated from tissue sources including, but not limited to, immature embryos, hypocotyls, seedling apical meristems, microspores and the like. Marker genes are used to provide an efficient system for identification of cells that are stably transformed by receiving and integrating a recombinant DNA molecule into their genomes.
- Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or a herbicide. Any of the herbicides to which plants of this invention may be resistant are useful agents for selective markers. Potentially transformed cells are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene is integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA.
- Select marker genes include those conferring resistance to antibiotics such as kanamycin and paromomycin (nptll), hygromycin B (aph IV), spectinomycin (aadA) and gentamycin (aac3 and aacC4) or resistance to herbicides such as glufosinate (bar or pat), dicamba (DMO) and glyphosate (aroA or EPSPS). Examples of such selectable markers are illustrated in US Patents 5,550,318; 5,633,435; 5,780,708 and 6,118,047.
- Markers which provide an ability to visually screen transformants can also be employed, for example, a gene expressing a colored or fluorescent protein such as a luciferase or green fluorescent protein (GFP) or a gene expressing a beta-glucuronidase or uidA gene (GUS) for which various chromogenic substrates are known.
- a gene expressing a colored or fluorescent protein such as a luciferase or green fluorescent protein (GFP) or a gene expressing a beta-glucuronidase or uidA gene (GUS) for which various chromogenic substrates are known.
- Transgenic plants derived from transgenic plant cells according to the invention are grown to generate transgenic plants comprising an expression cassette or an expression vector according to the invention and therefore transgenic plants having a modulated content of seed proteins, preferably seed storage proteins and produce transgenic seed and haploid pollen.
- Such plants are identified by selection of transformed plants or progeny seed for said inhibitor of a SHP transcription regulator, an ortholog or a derivative thereof.
- transgenic plants within a population of transgenic plants each regenerated from a transgenic plant cell many plants that survive to fertile transgenic plants that produce seeds a nd progeny plants will not exhibit an inhibitor according to the invention. Selection from the population is necessary to identify one or more transgenic plant cells having a recombinant nucleic acid sequence that can provide plants comprising an inhibitor according to the invention.
- a second object of the invention is to provide a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof.
- said recombinant DNA or RNA for modulating the expression of said SHP gene, an ortholog or a derivative thereof is selected in the group comprising an siRNA, a dsRNA, an miRNA, a sequence encoding a ribozyme or a sequence encoding SHP, an ortholog or a derivative thereof.
- the term "recombinant DNA or RNA” refers to a nucleic acid sequence that has been altered, rearranged, or modified by genetic engineering.
- the term “recombinant” does not refer to alterations of nucleic acid sequences that result from naturally occurring events, such as spontaneous mutations, or from non-spontaneous mutagenesis followed by selective breeding.
- DNA constructs may also correspond to recombinant DNA constructs for the silencing of SHP gene or an ortholog thereof, therefore comprising DNA constructs based on RNAi, siRNA, dsRNA, miRNA, etc.
- Examples of recombinant DNA or RNA according to the invention include constructs encoding anti-sense DNA, siRNA, dsRNA, miRNA and ribozymes.
- a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene or an ortholog thereof and especially for partially or totally inhibiting the expression of said SHP gene, an ortholog or a derivative thereof is selected in the group comprising but not limited to siRNA, dsRNA, miRNA and sequences encoding ribozymes.
- a recombinant DNA or RNA according to the invention is an anti-sense oligonucleotide construct.
- Antisense technology is emerging as an effective means for reducing the expression of specific endogenous gene products in plant cells (see, e. g. , US patent No. 5,759,829; Orvar et al. 1997; Coles et al. 1999).
- Anti-sense oligonucleotides including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of the mRNA of the SHP transcription regulator, an ortholog or a derivative thereof by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the SHP transcription regulator, an ortholog or a derivative thereof, and thus activity, in a cell.
- antisense or “antisense inhibition” or “antisense suppression” refers to an antisense strand sufficiently complementary to an endogenous transcription product or mRNA such that translation and/or expression of the endogenous transcription product is inhibited or reduced.
- antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding a SHP transcription regulator, an ortholog or a derivative thereof can be synthesized, e.g., by conventional phosphodiester techniques.
- a recombinant RNA according to the invention is selected from small inhibitory RNAs (siRNAs).
- RNA refers to a molecule comprising at least one ribonucleotide residue.
- ribonucleotide is meant a nucleotide with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose moiety.
- RNA encompass double stranded RNA, single stranded RNA, RNAs with both double stranded and single stranded regions, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA, or analog RNA, that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.
- Such alterations can include addition of non-nucleotide material, such as to the end(s) of an RNA molecule or internally, -for example at one or more nucleotides of the RNA.
- Nucleotides in the RNA molecules of the presently disclosed subject matter can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of a naturally occurring RNA.
- the siRNAs sequences advantageously comprise at least twelve contiguous dinucleotides or their derivatives.
- a recombinant RNA according to the invention is selected from double-stranded RNA (dsRNA) for post-transcriptional gene silencing (PTGS).
- dsRNA double-stranded RNA
- PTGS post-transcriptional gene silencing
- RNAs from 21 to 25 nucleotides long, preferably from 21-23 nucleotides long are break-down products of the dsRNA that regulate the clevage of the endogeneous target mRNA in PTGS in plants.
- dsRNA or “double-stranded RNA” refers to RNA that is partially or completely double stranded. Double stranded RNA is also referred to as short interfering RNA (siRNA), short interfering nucleic acid (siNA), and the like.
- siRNA short interfering RNA
- siNA short interfering nucleic acid
- dsRNA comprising a first strand that is substantially identical to a portion of a target gene and a second strand that is complementary to the first strand is introduced into a plant.
- the target gene-specific dsRNA is processed into relatively small fragments (siRNAs) by a plant cell containing the RNAi processing machinery resulting in target gene silencing.
- double stranded RNAs include, but are not limited to molecules comprising at least two distinct RNA strands that are either partially or fully duplexed by intermolecular hybridization. Additionally, the term is intended to include a single RNA molecule that by intramolecular hybridization can form a double stranded region (for example, a hairpin) (see
- intermolecular hybridization and “intramolecular hybridization” refer to double stranded molecules for which the nucleotides involved in the duplex formation are present on different molecules or the same molecule, respectively.
- double stranded region refers to any region of a nucleic acid molecule that is in a double stranded conformation via hydrogen bonding between the nucleotides including, but not limited to hydrogen bonding between cytosine and guanine, adenine and thymine, adenine and uracil, and any other nucleic acid duplex as would be understood by one of ordinary skill in the art.
- the length of the double stranded region can vary from about 15 consecutive basepairs to several thousand basepairs.
- the double stranded region is at least 15 base pairs, in some embodiments between 15 and 50 basepairs, in some embodiments between 50 and 100 basepairs, in some embodiments between 100 and 500 basepairs, in some embodiments between 500 and 1000 basepairs, and in some embodiments is at least 1000 basepairs.
- the formation of the double stranded region results from the hybridization of complementary RNA strands (for example, a sense strand and an antisense strand), either via an intermolecular hybridization (i.e., involving 2 or more distinct RNA molecules) or via an intramolecular hybridization, the latter of which can occur when a single RNA molecule contains self-complementary regions that are capable of hybridizing to each other on the same RNA molecule.
- complementary RNA strands for example, a sense strand and an antisense strand
- these self-complementary regions are typically separated by a stretch of nucleotides such that the intramolecular hybridization event forms what is referred to in the art as a "hairpin” or a "stem-loop structure".
- the stretch of nucleotides between the self-complementary regions comprises an intron that is excised from the nucleic acid molecule by RNA processing in the cell.
- a recombinant RNA according to the invention is selected from microRNAs (miRNA).
- miRNAs miRNA or RNA
- the miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA").
- Precursor miRNAs are transcribed from non- protein-encoding genes.
- the precursor miRNAs have two regions of complementarity that enable them to form a stem-loop- or fold-back-like structure.
- the processed miRNA (also referred to as "mature miRNA”) becomes part of a large complex to down-regulate a particular target gene.
- a recombinant DNA according to the invention is a recombinant DNA encoding a ribozyme.
- Ribozymes can also function as inhibitors of the expression of the SHP transcription regulator, an ortholog or a derivative thereof for use in the present invention.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of a SHP transcription regulator, an ortholog or a derivative thereof mRNA sequences are thereby useful within the scope of the present invention.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable.
- Antisense oligonucleotides, dsRNA, siRNA, miRNA and ribozymes useful as inhibitors of a SHP transcription regulator, an ortholog or a derivative thereof expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis.
- anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule.
- DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
- oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
- a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof and especially for overexpressing said SHP gene, an ortholog or a derivative thereof is selected in the group comprising but not limited to sequences encoding said SHP transcription regulator, an ortholog or a derivative thereof as disclosed previously.
- a third object of the invention is to provide an expression cassette, wherein said expression cassette comprises nucleic acid sequences for modulating the expression of SHP gene, an ortholog or a derivative thereof.
- expression cassette should be considered as an element comprising specific nucleic acid sequences to integrate by any means, for example by enzyme digestion and DNA ligation, by recombination, more particularly by homologous recombination into another nucleic acid sequence, for example into a plasmid.
- said expression cassette comprises a DNA or RNA construct according to the invention as disclosed previously.
- a recombinant expression cassette according to the invention comprises at least a DNA construct operatively linked to a promoter, said DNA construct encoding a recombinant DNA or RNA as disclosed previously.
- promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
- Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
- Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA.
- regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences, such as the “cis-motifs"), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence.
- Regulatory sequences include initiation signals, enhancers, regulators, promoters, and termination sequences. They include natural and synthetic sequences as well as sequences which can be a combination of synthetic and natural sequences. Accordingly, an “enhancer” is a DNA sequence which can stimulate promoter activity and can be an innate element of the promoter or a (heterologous) element inserted to enhance the level or tissue specificity of a promoter.
- promoter Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter can also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions. Additionally, termination of transcription of a polynucleotide sequence is typically regulated by an operatively linked "transcription termination sequence” or “transcription terminators” (for example, an RNA polymerase III termination sequence).
- transcription termination sequence for example, an RNA polymerase III termination sequence
- transcriptional terminators are also responsible for correct mRNA polyadenylation.
- the 3' non-transcribed regulatory DNA sequence includes from in some embodiments about 50 to about 1,000, and in some embodiments about 100 to about 1,000, nucleotide base pairs and contains plant transcriptional and translational termination sequences.
- Appropriate transcriptional terminators and those that are known to function in plants include the cauliflower mosaic virus (CaMV) 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato, although other 3' elements known to those of skill in the art can also be employed.
- a gamma coixin, oleosin 3, or other terminator from the genus Coix can be used.
- a promoter according to the invention may be specific for plant cells, preferably for monocotyledon cells.
- promoters according to the invention include but are not limited to the ubiquist promoter 35S, the corn gamma-zein promoter, but also specific promoters of the seed as the seed storage proteins promoters and especially promoters of glutenins of high molecular weight, such as GluBl.l, GluDl.l promoters, or promoters of low molecular weight glutenins or promoters of puroindolins.
- Promoters according to the invention can also be selected in the group comprising promoters of transcription regulators and promoters implicated in the development of the endosperm.
- operably linked refers to the functional linkage existing between a first sequence, such as a promoter and a second sequence, wherein the first sequence, i.e. a promoter, initiates and mediates the transcription of the DNA corresponding to the second sequence.
- operably linked sequences are contiguous.
- the term “operably linked” can refer to a promoter that is connected to a nucleotide sequence in such a way that the transcription of that nucleotide sequence is controlled and regulated by that promoter.
- a nucleotide sequence is said to be under the "transcriptional control" of a promoter to which it is operably linked.
- the term “operably linked” can also refer to a transcription termination sequence that is connected to a nucleotide sequence in such a way that termination of transcription of that nucleotide sequence is controlled by that transcription termination sequence.
- a fourth object of the invention is to provide an expression vector comprising an expression cassette as disclosed previously.
- a "vector” is any vehicle capable of facilitating the transfer of a nucleic acid sequence to the cells and preferably cells expressing a wheat SHP transcription regulator, an ortholog or a derivative thereof.
- the vector transports the nucleic acid sequence to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
- the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of one or more nucleic acid sequences encoding inhibitors according to the invention.
- expression vector refers to a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell.
- Said expression vector comprises a promoter operatively linked to the nucleotide sequence of interest, i.e. the nucleotide sequence encoding an inhibitor according to the invention, which is operatively linked to transcription termination sequences. It also typically comprises sequences required for proper translation of the nucleotide sequence.
- the construct comprising the nucleotide sequence of interest can be chimeric. The construct can also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
- the nucleotide sequence of interest i.e. the nucleotide sequence encoding an inhibitor according to the invention, including any additional sequences designed to effect proper expression of the nucleotide sequences, can also be referred to as an "expression cassette".
- Another object of the invention is to provide a plant cell comprising an expression cassette or an expression vector as disclosed previously.
- a "plant cell” includes, but is not limited to, a protoplast, gamete producing cell, and a cell that regenerates into a whole plant. Tissue culture of various tissues of plants and regeneration of plants there from is well known in the art and is widely published.
- a "plant cell” also means a plant cell that is transformed with stably-integrated, non-natural, recombinant DNA, e.g. by Agrobacterium-mediated transformation or by bombardment using microparticles coated with recombi nant.
- a plant cell according to the invention is a transgenic plant cell.
- said plant cell according to the invention comprises an expression cassette or an expression vector as disclosed previously and enabling to inhibit totally or partially the expression of SHP transcription regulator gene, an ortholog or a derivative thereof.
- transgenic plant cell means a plant cell whose genome has been altered by the stable integration of recombinant nucleic acid sequence, preferably a nucleic acid sequence encoding a SHP transcription regulator, an ortholog or a derivative thereof.
- the transgenic plant cell as disclosed previously is selected by screening a population of transgenic plant cells that have been transformed with an expression vector according to the invention, and expressing said inhibitor.
- the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said transgenic plant cell is modulated, preferably partially or totally inhibited.
- the content of seed proteins, preferably seed storage proteins, from said transgenic plant cell as disclosed previously is modulated.
- Another object of the invention is to provide a transgenic plant obtained according to the method as disclosed previously.
- said transgenic plant obtained according to the method as disclosed previously comprises a recombinant DNA or RNA, an expression cassette or an expression vector as disclosed previously.
- transgenic plant means a plant whose genome has been altered by the stable integration of recombinant DNA.
- a transgenic plant includes a plant regenerated from an originally-transformed plant cell as described previously and progeny transgenic plants such as seedling, plantlet, and plants from later generations or crosses of a transformed plant.
- seedling and "plantlet”, as used herein, are interchangeable and refer to the juvenile plant grown from a sprout, embryo or a germinating seed and generally include any small plants showing well developed green cotyledons and root elongation and which are propagated prior to transplanting in the ultimate location wherein they are to mature.
- transgenic plant as used herein also refers to a plant having one or more plant cells that contain a recombinant expression cassette or an expression vector as disclosed previously.
- said transgenic plant is obtained from a transgenic plant cell as disclosed previously.
- the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said transgenic plant is modulated, preferably partially or totally inhibited.
- the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said transgenic plant as disclosed previously is modulated and preferably increased.
- Another object of the invention is to provide a transgenic plant seed obtained from the transgenic plant as disclosed previously.
- the transgenic plant seed according to the invention has one or more plant cells that contain a recombinant expression cassette or an expression vector as disclosed previously.
- said transgenic plant seed is obtained from a transgenic plant as disclosed previously.
- the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said plant seed is modulated, preferably partially or totally inhibited.
- the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said transgenic plant seed as disclosed previously is modulated and preferably increased.
- Another object of the invention is to provide a plant or a descendent of a plant grown or otherwise derived from a seed as disclosed previously.
- the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said plant or a descendant of a plant grown or otherwise derived from a seed as disclosed previously is modulated, preferably partially or totally inhibited.
- the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said plant or a descendant of a plant grown or otherwise derived from a seed as disclosed previously is modulated and preferably increased.
- Another object of the invention is to provide the use of a plant according to the invention for reducing nitrogenous fertilizer intake.
- said use enables to reduce nitrogenous fertilizer intake and to obtained seed with normal protein amount.
- Another object of the invention is to provide the use of a plant seed according to the invention as a human and/or animal food product.
- said plant seed according to the invention having preferably an increased amount of seed proteins, preferably seed storage proteins, and most preferably LMW-GS, is used as a human food product which is enriched in proteins, preferably for the preparation of flour.
- said plant seed according to the invention is used as an animal food product which is enriched in protein, preferably for the preparation of oil cake.
- Another object of the invention is to provide a method for preparing a human and/or animal food product, enriched in proteins, wherein said method comprises a step of using a plant seed as defined previously for preparing a food product.
- said food product is flour and the food product preparing step is done by grinding the plant seed defined previously.
- said food product is an oil cake and the food product preparing step is done by extracting the oil from the plant seed defined previously.
- Still another object of the invention is to provide a method of identifying a molecule that modulates the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof, wherein said method comprises a step of determining the ability of a candidate molecule to modulate the expression level of SHP gene, an ortholog or a derivative thereof.
- determining the ability of a candidate molecule to modulate the expression level of SHP gene, an ortholog or a derivative thereof is realized by means of measuring the expression levels of said SHP gene, an ortholog or a derivative thereof in a plant cell which has been transformed with said candidate molecule.
- the expression of SHP gene, an ortholog or a derivative thereof can be measured at the level of the mRNA or at the level of the protein as follows. In a preferred embodiment, the determination of the expression of SHP gene, an ortholog or a derivative thereof is measured at the level of the mRNA.
- the nucleic acid contained in the samples e.g., cell or tissue prepared from the subject
- the samples e.g., cell or tissue prepared from the subject
- the extracted mRNA may be then detected by hybridization (e. g:, Northern blot analysis).
- the extracted mRNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that enable amplification of a region in the nucleic acid of SHP gene or an ortholog thereof may be used.
- RT-PCR polymerase chain reaction
- Quantitative or semi quantitative RT-PCR is preferred. Real-time quantitative or semi quantitative RT-PCR is particularly advantageous.
- Extracted mRNA may be reverse transcribed and amplified, after which amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
- the expression level may be determined using an expression microarray analysis encompassing cDNA, oligonucleotides, macro and micro-arrays.
- a substrate which can be a microchip, a glass slide or a microsphere- sized bead.
- a microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose.
- Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs.
- a sample from a test subject optionally first subjected to a reverse transcription, is labeled and contacted with the microarray in hybridization conditions, leading to the formation of 5 complexes between 20 target nucleic acids that are complementary to probe sequences attached to the microarray surface.
- the labelled hybridized complexes are then detected and can be quantified or semiquantified.
- Labeling may be achieved by various methods, e.g. by using radioactive or fluorescent labeling. Many variants of the microarray hybridization technology are available to the man skilled in the art.
- the determination of the expression of SHP gene, an ortholog or a derivative thereof is measured at the level of the protein.
- Methods for determining the expression level of SHP gene, an ortholog or a derivative thereof by quantifying proteins comprise contacting a biological sample with a binding partner capable of selectively interacting with the SHP gene, an ortholog or a derivative thereof present in the sample.
- the binding partner is generally an antibody that may be polyclonal or monoclonal, preferably monoclonal.
- the presence of the SHP gene, an ortholog or a derivative thereof can be detected using standard electrophoretic and immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays but also mass spectrometry techniques.
- Such assays include, but are not limited to, Western blots; agglutination tests; enzyme-labeled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; Immunoelectrophoresis; immunoprecipitation, immunocytochemistry, immunohistochemistry, etc.
- the reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the proteins to be tested.
- a biological sample containing or suspected of containing the marker protein is then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labeled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
- said method comprises a further step of selecting a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof.
- a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof is a molecule capable of increasing or decreasing the expression of SHP, an ortholog or a derivative thereof in a transformed plant cell as compared to the expression of SHP gene, an ortholog or a derivative thereof in a control plant cell.
- a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof is a recombinant DNA or RNA as disclosed previously or a product encoded by said recombinant RNA/DNA.
- Another object of the invention is to provide a method for selecting a plant having a modulated content of seed proteins, preferably seed storage proteins, wherein said method comprises a step of measuring expression of the SHP transcription regulator gene, an ortholog or a derivative thereof and comparing said expression with the expression of said SHP gene, an ortholog or a derivative therein in a control plant, and another step of selecting a plant having a modulated expression of the SHP transcription regulator gene, an ortholog or a derivative thereof, said modulated expression being indicative of a modulated content of seed proteins, preferably seed storage proteins.
- the step of selecting a plant having a modulated expression of the SHP gene, an ortholog or a derivative thereof consists in a selection of a plant in which the SHP gene is partially or totally inhibited.
- a plant having a total or partially inhibited SHP gene has an increased content of seed proteins, preferably seed storage proteins.
- Another object of the invention is to provide an isolated nucleic acid sequence encoding a wheat Storage protein activator Heterodimerizing Protein (SHP) transcription regulator, also known as SPA2, or a derivative thereof.
- SHP Storage protein activator Heterodimerizing Protein
- nucleic acid sequence refers to DNA sequences (e.g., cDNA or genomic or synthetic DNA) and RNA sequences (e. g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native internucleoside bonds, or both.
- said nucleic acid sequence is a DNA sequence.
- the nucleic acid can be in any topological conformation, such as linear or circular.
- nucleotide sequences used in aspects of the invention include the naturally occurring sequences as well as mutant (variant or allelic form) forms and homologs. Such variants will continue to possess the desired activity, i. e., either promoter activity or the activity of the product encoded by the open reading frame of the non- variant nucleotide sequence.
- isolated refers to a molecule substantially free of other nucleic acids, proteins, lipids, carbohydrates, and/or other materials with which it is normally associated, such association being either in cellular material or in a synthesis medium.
- isolated nucleic acid seq uence refers to a ribonucleic acid molecule or a deoxyribonucleic acid molecule (for example, a genomic DNA, cDNA, mRNA, RNAi-inducing RNA or a precursor thereof, etc.) of natural or synthetic origin or some combination thereof, which (1) is not associated with the cell in which the "isolated nucleic acid” is found in nature, or (2) is operatively linked to a polynucleotide to which it is not linked in nature.
- isolated polypeptide refers to a polypeptide, in some embodiments prepared from recombinant DNA or RNA, or of synthetic origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is isolated from the cell in which it normally occurs, (3) is isolated free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature.
- the isolated nucleic acid sequence encoding said SHP transcription regulator is selected in the group comprising SEQ ID N°l, 3 and 5.
- identity % is computed by means of lalign software between pairwise sequences. Above and below the diagonal, identity % is computed between CDS and amino-acid sequences, respectively.
- the rye sequence is partial. It corresponds to the 3' region of the CDS and includes the stop codon.
- the CDS and amino-acid sequences for rye are partial.
- the identity % is computed on the total length of these partial seq
- the method is essentially similar to the one described in International Application WO 00/63398.
- Wheat tillers approximately 14 days post-anthesis (embryos approximately 1mm in length), are harvested from glasshouse grown plants to include 50cm tiller stem (22/15°C day/night temperature, with supplemented light to give a 16 hour day). All leaves are then removed except the flag leaf and the flag leaf is cleaned to remove contaminating fungal spores.
- the glumes of each spikelet and the lemma from the first two florets are then carefully removed to expose the immature seeds. Only these two seeds in each spikelet are generally uncovered. This procedure is carried out along the entire length of the inflorescence. The ears are then sprayed with 70% IMS as a brief surface sterilization.
- Agrobacterium tumefaciens strains containing the vector for transformation are grown on solidified YEP media with 20mg/l kanamycin sulphate at 27°C for 2 days. Bacteria are then collected and re-suspended in TSIM 1 (MS media with lOOmg/l myoinositol, lOg/l glucose, 50mg/l MES buffer pH5.5) containing 400 ⁇ acetosyringone to an optical density of 2.4 at 650nm.
- TSIM 1 MS media with lOOmg/l myoinositol, lOg/l glucose, 50mg/l MES buffer pH5.5
- Agrobacterium suspension ( ⁇ ) is inoculated into the immature seed approximately at the position of the scutellum: endosperm interface, using a 10 ⁇ Hamilton, so that all exposed seed are inoculated. Tillers are then placed in water, covered with a translucent plastic bag to prevent seed dehydration, and placed in a lit incubator for 3 days at 23°C, 16hr day, 45 ⁇ -25-1 PAR.
- inoculated immature seeds are removed and surface sterilized (30 seconds in 70% ethanol, then 20 minutes in 20% Domestos, followed by thorough washing in sterile distilled water).
- Immature embryos are aseptically isolated and placed on W4 medium (MS with 20g/l sucrose, 2mg/l 2,4-D, 500mg/l Glutamine, lOOmg/l Casein hydrolysate, 150mg/l Timentin, pH5.8, solidified with 6g/l agarose) and with the scutellum uppermost. Cultures are placed at 25°C in the light (16 hour day).
- W425G media W4 with 25mg/l Geneticin (G418). Calli are maintained on this media for 2 weeks and then each callus is divided into 2mm pieces and re- plated onto W425G.
- any callus showing signs of continued development after 4 weeks on selection is transferred to regeneration media MRM 2K 25G (MS with 20g/l sucrose, 2mg/l Kinetin, 25mg/l Geneticin (G418), pH5.8, solidified with 6g/l agarose).
- MS20 MS with 20g/l sucrose, pH5.8, solidified with 7g/l agar for shoot elongation and rooting.
- pSHP-IR-pSCV A 315bp sub-fragment of the TaSHP coding sequence (SEQ ID N°26) was cloned in opposite orientation separated by the rice tubulinl first intron Fiume et al. Planta 2004 218: 639-703 to form a hairpin structure under the control of the wheat proTaHMWG high molecular weight glutenin promoter and terminated by the Arabidopsis AtSac66 terminator. The whole cassette is cloned in a selectable marker containing cassette pSCV vector, a derivative of pSCVl (Fiker et al, 1983).
- pSHP-IR-pSCV was designed to target the three copies of Ta SPA2 on genome A, B and D. No other sequence was targeted including TaSHP, a highly similar gene.
- pHMWG-SHP-pSB12 (see figure 5): The SHP coding sequence (SEQ ID N°23 obtained by PCR using primers SEQ ID N°24 and SEQ ID N°25) was cloned using common restriction enzymes into a pSB12 (EP 672 752) based vector containing the selectable marker expression cassette as well as the wheat proTaHMWG promoter from high molecular glutenin (Halford et al, 1989) and the Agrobacterium nos terminator thus resulting in an endosperm specific SHP expression cassette.
- RNAi and null segregant lines (a null segregant of an RNAi line being a descendant of a sibling of the corresponding RNAi plant that does not carry the RNAi construction) were germinated over-night at room temperature on wet filter paper in petri dishes and then placed at 4°C in the dark for one week. Germinated seeds were then sown in PVC columns (i.d. 8 cm, I. 50 cm) filled with a commercial soil (2 plants per column) and were arranged in a greenhouse in fully randomized design with three blocks.
- Day length was 16 h, with artificial light when needed. Plants were irrigated (68 mL column “1 day “1 ) with water for three weeks, then for one week with a low nitrogen solution containing 1 mM KH 2 P0 4 , 1 mM Ca(N0 3 ) 2 , 0.5 mM NH 4 N0 3 , 2 mM MgS0 4 , 3 mM CaCI 2 , 5 mM KCI, 10 ⁇ H 3 B0 3 , 0.7 ⁇ ZnCI 2 , 0.4 ⁇ CuCl 2 , 4.5 ⁇ MnCI 2 , 0.22 ⁇ Mo0 3 , 50 ⁇ EDFS-Fe, then for one week with a high nitrogen solution : 1 mM KH 2 P0 4 , 5 mM KN0 3 , 4 mM Ca(N0 3 ) 2 , 1 mM NH 4 N0 3 2 mM MgS0 4 ⁇ 10 ⁇ H 3 B0 3 ,
- RNA of 100 ⁇ of grain powder were extracted in 750 ⁇ of extraction buffer (200 mM Tris-HCl pH 9, 400 mM KCI, 200 mM sucrose, 35 mM MgCI2, 25 mM EGTA) and 600 ⁇ phenol/chloroform (pH 8).
- the suspension was homogenized by vortexing for 30 s and then centrifuged for 10 min at 15,000 g.
- Transcript levels of four housekeeping genes, storage proteins and A and B homoeologs of SHP transcription factors were quantified by real-time qRT-PCR with a 480 Lightcycler using Lightcycler 480 SYBR Green I Master (Roche) with cDNA diluted 10 times and 5 ⁇ used for amplification by PCR in 15 ⁇ .
- Relative expression was calculated as 2 ⁇ (difference between measured gene Cp and geometric mean of the four housekeeping genes Cp).
- the primers used to measure the expression of the three copies of SHP are given in Table 2.
- Non-prolamin protein fraction was extracted at 4°C with 1.5 mL of 50 mM phosphate buffer (pH 7.8) containing 0.1 M NaCI, for 30 min. The sample was centrifuged for 10 min (18,000 g) at 4°C. The pellet was washed two times with 1.5 mL of the same buffer for 10 min and all supernatants were pooled. b) Gliadin proteins
- gliadins Separation of gliadins was achieved using ultra-high performance liquid chromatography with an Agilent 1290 Infinity LC system.
- One mL of the gliadin protein fraction extract was filtered (Uptidisc RC 0.45 ⁇ ) and 4 ⁇ were injected for a separation with a C 8 (3.5 ⁇ , 300 A) reversed phase Agilent Zorbax 300SB column at 50°C.
- Solvent A was 0.1% trifluoroacetic acid (TFA) in ultra-pure water and solvent B was 0.09% TFA in acetonitrile.
- TFA trifluoroacetic acid
- gliadins Separation of the gliadins was performed by using a gradient broken down into three linear phases with breaks in between: 24-35% B in 22 min, 5 min at 35% B, 35-36% in 2 min, 5 min at 36% B, 36-48% B in 24 min with a 1 mL min "1 flow. Detection was performed by UV absorbance at 214 nm. After the gradient, the column was cleaned with 80% B for 2 min and equilibrated at 24% B for 3 min, with the same flow rate as the gradient. c) Glutenin proteins
- the sample was centrifuged for 10 min (15,000 g) at 15°C._The pellet was washed twice with 0.5 mL of the same buffer for 10 min and all supernatants were pooled.
- the extract was filtered (Uptidisc RC 0.45 ⁇ ) and 100 ⁇ were alkylated with 4.6 ⁇ 4-vinylpyridin at 60°C for 15 min.
- the alkylated extract was filtered again (Uptidisc RC 0.45 ⁇ ) before analysis.
- the gliadin and glutenin chromatograms were processed with Agilent ChemStation software.
- the signal from a blank injection (4 ⁇ of 70% (v/v) ethanol) was subtracted from the chromatograms before integration.
- the set of experiment for the overexpression of SHP gene has been realized by transforming plant cells with a nucleic acid construct comprising at least a nucleic acid sequence encoding the SHP gene operatively linked to a promoter. As expected, an overexpression of the order of 150% to over 200% (and even until 300%) was observed in said events. b) Protein analysis
- RNAi construction in genetically modified (GM) plants was quantified (Fig. 1).
- GM genetically modified
- the quantity of total grain nitrogen and sulfur per grain and the protein composition was affected in SHP RNAi plants (Fig 2 and 3). Nitrogen and sulfur accumulation were increased from 450°Cdays after anthesis to maturity. At maturity, the total quantity of nitrogen per grain and the total grain protein content were 14% and 16% higher in the RNAi lines than in the null segregant lines, respectively (Table 3). The quantity of glutenin per grain was 15% higher in the RNAi lines than in the null segregant lines. The LMW-GS contributed more (+19%) to the increase of the quantity of glutenins per grain in the RNAi lines than the HMW-GS, and as a consequence the HMW-GS to LMW-GS ratio was 11% lower in the RNAi lines than in the null segregant.
- the partial silencing of SHP significantly increases the quantity of nitrogen. This leads to increase the quantity of grain proteins in the seed as illustrated by the increase of seed protein content while the grain dry mass is unchanged. Indeed, as the proteins have an amino acid content quite similar, the ratio between the nitrogen amount and the protein amount is constant in the order of 5.7 (Mosse J, Huet JC, Baudet J (1985) The amino acid composition of wheat grain as a function of nitrogen content, Journal of Cereal Science 3: 115-130).
- the increase of the quantity of protein could be explained by the higher quantity of glutenin observed in RNAi plants.
- the composition of glutenins is also modified as illustrated by the HMW-GS to LMW-GS ratio.
- LMW-GS low-molecular weight glutenins
- RNAi leads also to a relative higher increase of the quantity of glutenins in comparison to other grain proteins, and especially from LMW-GS compared to HMW-GS.
- the increasing of the content of seed storage proteins and especially LMW-GS should impact the technological quality of the flour, by leading to an increase of the bakery force due essentially to the increase of extensibility more than of tenacity.
- Table 3
- Each independent transformation event will be assessed over two years in agronomic field conditions. Each year, two locations will be tested. Ideally, all tested events should be represented in each location.
- the test structure for a given event will comprise six plots of 9m 2 considered as random repetitions. Thus, each event will be evaluated through the monitoring of 24 plots (2 years x 2 locations x 6 plots). Phenotypical characters like, but not limited to, plant density, plant height at flowering, flowering date, yield or test weight will be assessed. More precisely, protein grain content and characteristics will be assessed.
- a set of 42 lines representative of the variability present in the core collection established in 2007 at INRA Clermont-Ferrand were sequenced to study the polymophisms present in the promoter regions of each SHP homoeolog. The sequences given were consensus sequences.
- the figure 8 disclosed the observed consensus sequence for the promoter of A homoeolog (SEQ ID N°34), wherein the SNPs are indicated in bold (indicated by asterisk) and the 5'UTR and the initiation codon are in capital letters.
- the figure 9 disclosed the observed consensus sequence for the promoter of B homoeolog (SEQ ID N°35), wherein the SNPs are indicated in bold (indicated by asterisk) and the 5'UTR and the initiation codon are in capital letters.
- the figure 10 disclosed the observed consensus sequence for the D homoeolog (SEQ ID N°36), wherein the SNPs are indicated in bold (indicated by asterisk), the insertion- deletion polymorphisms are indicated by underlines and the 5'UTR and the initiation codon are in capital letters.
- Samples were harvested at 250, 400, 500, 650, 850 and 1050°Cj after flowering.
- the expression of SHP was determined at 500°Cj after flowering.
- At maturity (1050°Cd) the grains were phenoted as described previously under section 9 of the examples.
- the expression level of SHP was not different under the two nitrogen conditions for the NS, the expression level of SHP for the OE events was about two times higher for the N+ treatment than for the N- treatment.
- transgene is under the control of a HMW-GS promoter which strongly responds to nitrogen.
- the expression level of LMW-GS tended to decrease (-11.6%) (see Figure 13) like the expression level of Y-gliadins (-14.4%) in the OE plants (data not shown).
- the glutenins level decreased significantly (-15% on average) in the OE lines compared to the NS.
- the ratio HMW-GS / LMW-GS tended to increase in the N- condition.
- the proportions of various classes of gliadins were also modified (data not shown). For the two nitrogen treatments, an increase of the ⁇ 1,2- and a-gliadins was observed, whereas the proportion of Y-gliadin was not modified.
- the promoter of the 3 homeologous genes coding for SHP was sequenced in a sample of 42 lines representing the variability of the core collection.
- the homeologous B gene presents 3 principals haplotypes, on the contrary to the other two homeologous copies of the SHP gene.
- Said homeologous B was therefore chosen to determine the influence of the main haplotypes of the SHP-B promoter on the expression of said gene and its potential targets (particularly seed storage proteins), and on the phenotype of the grain in term of content of the different fractions of the seed storage proteins.
- SHP-B haplotype For two SHP-B haplotype, 3 lines were selected, said lines being identical along the region sequenced for SHP-A and SHP-D promoters. Said lines were sowed in January, wintered 8 weeks at 4°C and then planted in glasshouse. Grains were sampled at 4 stages of development (200, 300, 400 and 500°Cd after flowering) for measuring the expression of SHP and potential target genes. A sample was also done at maturity for studying the phenotype, particularly the composition in seed storage proteins. Samples were immediately frozen in liquid nitrogen and conserved at -80°C.
- HMW-GS high molecular weight
- LMW-GS low molecular weight glutenin
- Y-, a- and ⁇ -gliadins For HMW-GS, we followed the expression of GluAl.l, GluBl.l et GluDl.l coding for the x units.
- the expression was submitted to a variance analysis with one factor, the SHP-B haplotype. The averages were then compared with a Tukey test.
- the expression level of LMW-GS was significantly affected by the haplotype of the SHP-B promoter, as well as the expression of the HMW-GS GluDl.l At last, the expression levels of the LMW-GS GluAl.l and of the gliadins were not affected in relation to the SHP-B promoter haplotype. b) Analysis of the phenotypes
- Phenotyping was realized on mature grains.
- the measured characters were: the dry weight of the grain, the nitrogen quantity per grain, the protein concentration, the albumin-globulin quantity and the quantity and content in total glutenins, HMW-GS and LMW-GS, and the ratio HMW-GS / LMW-GS.
- the amount and content were measures either globally or with respect to different classes of proteins. Each variable was submitted to a variance analysis with 1 factor, the SHP-B- haplotype. The averages were then compared with a Tukey test.
- the analysis of the composition showed that the increase of content of gliadins in the haplotype 3 was especially due to the increase of Y- and ⁇ jo5-gliadins in said haplotype. Furthermore, regarding the composition in glutenins, we observed a significant diminution of the content of HMW-GS for the haplotype 3 which led to differences of HMS-GS/LMW-GS ratio, said ratio being also important for the technological value of flours.
- composition of gliadins and glutenins vary via a modification of the content of the various classes constituting said proteins therefore leading to significant modifications of gliadin/glutenin and HMW-GS/LMW-GS ratios.
- Haplotype SHP-B significantly impacted ratios that characterize the technological value of flours. Furthermore, the genetic association results showed an effect on the protein content.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Nutrition Science (AREA)
- Virology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention concerns various methods for producing a plant having a modulated content in seed proteins, preferably seed storage proteins, wherein said method comprises a step of modulating the expression of Storage protein activator Heterodimerizing Protein (SHP) transcription regulator gene, an ortholog or a derivative thereof. The present invention also concerns plants and plants seeds thereof, as well as uses thereof.
Description
PLANTS HAVING A MODULATED CONTENT IN SEED PROTEINS AND METHOD FOF
PRODUCTION THEREOF
The present patent application claims priority from the patent application EP 11290619 on December 30, 2011 which whole content is herein incorporated by reference. FIELD OF THE INVENTION
The invention relates generally to the field of agricultural biotechnology and proteins. In particular, the invention relates to plant genes involved in the regulation o proteins, preferably seed storage proteins and uses thereof. More specifically, the inv< relates to plants comprising a partial or total inactivated SHP (Storage protein act Heterodimerizing Protein) gene, an ortholog or a derivative thereof and having an incr content in seed proteins, preferably seed storage proteins. The invention also rela plants overexpressing said SHP gene, an ortholog or a derivative thereof and ha\ decreased content in seed proteins, preferably seed storage proteins. Finally, the inv( also relates to methods for producing modified plants having a modulated content ol proteins, preferably seed storage proteins - i.e. an increased or decreased amount o proteins, preferably seed storage proteins and/or a modulated composition of proteins, preferably seed storage proteins and to methods of screening and idem molecules that modulate SHP, an ortholog or a derivative thereof, and/or gene expn and/or SHP, an ortholog or a derivative thereof's activity. BACKGROUND OF THE INVENTION
Cereal seeds contain seed proteins and particularly seed storage proteins ha preponderant importance for human and animal food. More particularly, the conter composition in seed storage proteins are important parameters for the technological of flours, and thus of particular importance to industries such as bakeries that are in m flours presenting a high content in seed storage proteins. In the meantime, seeds presi a low content in seed storage proteins may also appear advantageous for animal food on forage crop in which the nutritive value is based on the vegetative part of the cro therefore necessary to understand the mechanisms underlying the synthesis of saic storage proteins.
The content and composition of seed storage proteins are the principal determinants of the cereal use value, and especially in the case of wheat. Gluten proteins of wheat are constituted by glutenins and gliadins which influence significantly the technological value of flour. Glutenins are implicated in the dough's elasticity whereas gliadins are related to the viscosity and extensibility of the dough.
The synthesis of said seed storage proteins depends on structural genes whose expression is essentially regulated at the transcription level. In barley, studies have demonstrated that the synthesis of seed storage proteins is essentially controlled at the transcription level by at least eight transcription regulators which activate the expression of said proteins by binding onto the promoter region (Rubio-Somoza et ai, 2006 Plant Journal, vol. 47:, pp: 269-281). These transcription regulators are conserved in several cereals such as wheat (Ravel et ai, 2009; Ravel et al., 2006; Mena et ai, 1998). But, except in barley (see WO2005021765), the role of most of them in the regulation of the seed storage proteins expression has not been established yet. Several studies have been conducted in order to understand the mechanism of said seed storage proteins synthesis and especially with a view to improve said synthesis. However, there is still a need for new methods for modulating the content, i.e. the amount and/or the composition of seed storage proteins under a normal nitrogen fertilization environment, but also under a lower nitrogen fertilization environment with a view, for example, to maintain the content of seed storage proteins under such restrictive environment.
SUMMARY OF THE INVENTION
In the present invention, the inventors have identified the nucleic acid sequence of the three homeologous genes coding for a transcription regulator implicated in the synthesis of seed storage proteins in wheat. Moreover, the inventors have demonstrated that a modification in the content and composition in seed proteins, preferably seed storage proteins is induced by either inhibiting, i.e. underexpressing or overexpressing said wheat transcription regulator, an ortholog or a derivative thereof implicated in the transcription of seed storage proteins, and especially by silencing the expression of the gene encoding said transcription regulator or by overexpressing said gene respectively.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Relative expression of SHP in RNAi and null segregant (NS) lines of the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply. Grains were sampled at three stages during the linear phase of grain storage protein accumulation. Figure 2. Kinetics of accumulation of total nitrogen and sulfur per grain in RNAi and null segregant (NS) lines of the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply.
Figure 3. Kinetics of accumulation of glutenins and evolution of the HMW-GS to LMW-GS ratio in RNAi and null segregant (NS) lines of the the bread wheat cultivar NB1 grown in the greenhouse with non limited nitrogen supply.
Figure 4. pSHP-IR-pSCV Construct
Figure 5. pHMWG-SHP-pSB12 Construct
Figure 6. Glutenin genes expression in SHP RNAi, 400°Cdays, low nitrogen
Figure 7. Gliadin genes expression in SHP RNAi, 400°Cdays, low nitrogen Figure 8. Consensus sequence for the SHP A homoeolog gene promoter.
Figure 9. Consensus sequence for the SHP B homoeolog gene promoter.
Figure 10. Consensus sequence for the SHP D homoeolog gene promoter.
Figure 11. Expression of SHP determined at 400°Cd after flowering by qRT-PCT with generic primers (SHP-all), amplifying the 3 homeologous copies of the gene for 10 events overexpressing SHP and the average of the null segregants (BNS) multiplied in 2011 in S2 glasshouse.
Figure 12. Expression of SHP determined at 500°Cj after flowering by qRT-PCR with generic primers amplifying the 3 homeologous copies of the genes for 2 independent events overexpressing (OE) SHP and the average of their null segregants (NS) cultivated in 2012 in glasshouses under limited (N-) and non-limited (N+) conditions of nitrogen during the grain filling phase. The data represent the average ± 1 standard error for the independent repetitions.
Figure 13. Expression level of LMW-GS genes determined at 400°Cj after flowering by qRT- PCR for 2 independent events overexpressing (OE) SHP and the average of the corresponding Null Segregant (NS) all cultivated in 2012 in glasshouse under limited (N-) conditions of nitrogen availability during the grain filling. The data represent the average ± 1 standard error for four independent repetitions.
Figure 14. Total quantity of glutenin and gliadin per grain (in g of N / grain) and gliadin/glutenin ratio at maturity for the average of two independent events overexpressing SHP (OE) and their corresponding average null segregants (NS) cultivated in 2012 in glasshouse under limited (N-) and non limited (N+) conditions of nitrogen availability. The data represent the average ± 1 standard error for four independent repetitions.
Figure 15. Content of glutenins, HMW-GS, LMW-GS expressed in percentage of seed storage proteins (gliadins and glutenins) and HMW-GS/LMW-GS ratio at maturity for the average of the two independent events overexpressing (OE) the SHP gene and the average of their corresponding null segregants (NS) cultivated in 2012 in glasshouse under limited (N-) and non-limited (N+) conditions of nitrogen availability during the grain filling. The data represent the average ± 1 standard error for four independent repetitions.
DETAILED DESCRIPTION OF THE INVENTION
A first object of the invention is to provide a method for producing a plant having a modulated content in seed proteins, preferably seed storage proteins, wherein said method comprises a step of modulating the expression of Storage protein activator Heterodimerizing Protein (SHP) transcription regulator gene, an ortholog or a derivative thereof.
The term "plant," as used herein, refers to monocotyledon plant, preferably to a cereal and more preferably to a cereal selected in the group comprising the wheat, rice, rye, and sorghum, but excludes barley and corn. The term "plant" is intended to encompass plants at any stage of maturity or development, as well as any tissues or organs (plant parts) taken or derived from any such plant unless otherwise clearly indicated by context. Plant parts include, but are not limited to, stems, roots, flowers, ovules, stamens, seeds, leaves, embryos, meristematic regions, callus tissue, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, hairy root cultures, and the like.
In a preferred embodiment of the invention said plant is a cereal, preferably selected from the group comprising wheat, rye, rice, and sorghum.
As used herein, the terms "seed proteins" or "seed total proteins" used interchangeably relates to all of the proteins contained in a plant seed and comprising for example seed storage proteins.
As used herein, the terms « seed », « kernel » or « grain » according to the invention and used interchangeably refer to a seed of a plant in any stage of its development i.e. starting from the fusion of pollen and oocyte, continuing over the embryo stage and the stage of the dormant seed, until the germinating seed, ending with early seedling organs, as e.g. cotyledons and hypocotyls. As referred to herein, a plant "seed" should be understood to refer to a mature or immature plant seed. As such, the term "seed" includes, for example, immature seed carried by a maternal plant or seed released from the maternal plant. The term "seed" should also be understood to include any seed plant sporophyte between the developmental stages of fertilisation and germination. However, in some embodiments, the term seed refers to a mature plant seed.
In a preferred embodiment, seed proteins whose content is modulated according to the invention are selected in the group of seed storage proteins.
As used herein, the term "seed storage proteins" relates to proteins generated mainly during seed production, stored in the albumen during the development of the seed and degraded in the young plantlet. Seed storage proteins serve as nitrogen sources for the development of the embryo during germination and represent around 80% of the seed total proteins.
During seed filling, storage compounds are accumulated. They are required for germination and represent the major economic interest of grain. Carbon is stored in the form of carbohydrates, lipids and storage proteins. Storage protein also allows the accumulation of nitrogen.
Example of seed storage proteins include, but are not limited to, albumins (ovalbumin, conalbumin), glutelins, prolamins, gliadins, glutenins and secalins.
Monocotyledons mainly accumulate seed storage proteins (SSPs) in the endosperm. The major endosperm storage proteins of most cereal grains (with exception of rice for
instance) are prolamins. This name come from that SSPs are generally rich in proline and amide nitrogen derived from glutamine. The most abundant SSPs in wheat are the gluten forming gliadins and glutenins, which account for 60% to 80% of total seed proteins.
Gliadins are a mixture of monomeric proteins subdivided into four subgroups (alpha/beta, gamma and omega) based on their amino-acid sequences and molecular weights. Gliadins are encoded by large multigene families. It has been estimated that 25- 150, 17-39 and 15-18 genes code for the alpha, gamma and omega gliadins.
Glutenins are composed of high-molecular weight (HMW-GS) and low-molecular weight (LMW-GS) subunits, which during the grain-desiccation period form very large macropolymers. Six genes encoded for the HMW-GS in wheat, but differences in gene expression result in the presence of three to five HMW-GS. LMW-GS are also coded by a multigenic family made of about 50 genes.
In a preferred embodiment, seed storage proteins according to the invention are selected in the group of prolamins. In another still preferred embodiment, seed storage proteins according to the invention are selected in the group comprising glutenins and gliadins.
As used herein, the terms "content" refers to the amount and/or to the composition of, for instance, seed total proteins, preferably seed storage proteins.
The "amount", also called "level", of seed total proteins, preferably seed storage proteins according to the invention refers to the amount of said proteins per unit of seed total dry mass and can be expressed in milligrams (mg) of protein or nitrogen per milligrams of dry mass, or in percentage of protein or nitrogen in the seed total dry mass.
The "composition" of seed total proteins, preferably seed storage proteins refers to the type of said proteins in the seed, and preferably to the sulfur content of said seed proteins. The sulfur content is indeed indicative of the composition of seed proteins, preferably seed storage proteins as Low-Molecular Weight Glutenin are rich in sulfur. The composition of seed total proteins, preferably of seed storage proteins can be analyzed for example by measuring the relative amount of sulfur in the seed.
As used therein, the term "to modulate" or "modulating" in reference to the content of seed proteins, preferably seed storage proteins, refers to a variation or a modification in
the content of said seed proteins, preferably seed storage proteins by comparison to that occurring in a control plant.
In a preferred embodiment, modulating the content of seed proteins, preferably seed storage proteins in the case of the amount of said proteins refers to a variation or modification of said amount, i.e. it refers either to an increase or to a decrease of the amount of seed proteins, preferably seed storage proteins, by comparison to that occurring in a control plant.
In a still preferred embodiment, the amount of seed proteins, preferably seed storage proteins, is either increased or decreased. As used herein, the term "increase", in reference to the amount of seed total proteins, preferably seed storage proteins refers to an increase in the amount of seed total proteins, preferably seed storage proteins in a plant according to the invention compared to the amount of seed total proteins, preferably seed storage proteins in a control plant.
In a preferred embodiment, the amount of seed proteins, preferably seed storage proteins, is increased of at least 0,1, preferably of at least 0,5 percentage point, and most preferably between 1,5 and 5 percentage point compared with the control plant.
As used herein, the term "decrease", in reference to the amount of seed total proteins, preferably seed storage proteins refers to a decrease in the amount of seed total proteins, preferably seed storage proteins in a plant according to the invention compared to the amount of seed total proteins, preferably seed storage proteins in a control plant.
In a preferred embodiment, the amount of seed proteins, preferably seed storage proteins, according to the invention is decreased of at least 0,1, preferably of at least 0,5 percentage point, and most preferably between 1,5 to 5 percentage point.
"Percentage points" according to the invention are here defined as the arithmetic difference between the protein amount (expressed in percent of seed dry mass) of a control plant or cell and that of cell or plant whose activity has been modified by a mean described below.
In another preferred embodiment, modulating the content of seed proteins, preferably seed storage proteins in the case of the composition of said proteins refers to a
variation or modification of said composition by comparison to that occurring in a control plant.
A modification of the composition in seed proteins, preferably seed storage proteins can be determined by analyzing said seed proteins, for example by measuring the content of sulfur in the seed as said sulfur is characteristic of particular proteins such as low-molecular weight glutenins (LMW-GS).
As used herein, the term "control plant" according to the invention refers to a wild type plant or a native plant, i.e. a plant that has not been modified in order to modulate the content of seed total proteins, preferably seed storage proteins, and especially which has not been modified in order to modulate the expression of SHP transcription regulator gene, an ortholog or a derivative thereof according to the invention. A suitable control plant can be a non-transgenic plant of the parental line used to generate a transgenic plant, i.e. devoid of recombinant DNA. A suitable control plant may in some cases be a progeny of a hemizygous transgenic plant line that does not contain the recombinant DNA, known as a negative segregant (or null segregant).
Modulated content of seed total protein content in a plant of the present invention can be measured by methods well known from the art. Several protein assays methods exist, such as the Bradford or Lowry methods, the biuret test, or the bicinchoninic acid assay (BCA). After calibration, near infra-red spectrometric method can also be used to quantify the protein content of plant cells or tissues.
In a preferred embodiment, the protein amount is determined by analysing the nitrogen content of the samples by the Dumas' (elemental analysis) or the Kjeldahl method, the protein amount is then obtained by multiplying the nitrogen content by 5.7 and 6.25 in the case of seed, and leaf tissues, respectively. Determining the content of seed storage proteins comprises a first step of extracting said seed storage proteins from the seed total proteins by using their properties of solubility in various alcoholic and basic solutions. Methods for measuring the content of seed total proteins and preferably seed storage proteins, i.e. determining the amount and/or compositions of said proteins, are well known in the art.
With respect to the extraction of seed storage proteins, many methods are available. A first example is the sequential extraction method as further described below in the examples. Another method is the one used in Rhazi et al (JCS, 2009) that consists in the use of 30 mg of flour samples, which are stirred for 15 min at room temperature with 1 ml of 0.08 M Tris-HCI buffer (pH 7.5) containing 50% (v/v) propan-l-ol. Extraction is then followed by centrifugation at 15900 g for 10 min at 15°C. The supernatant containing monomeric proteins (albumins, globulins and gliadins) is then discarded. 600 μΙ of the Tris-HCI containing 2% (w/v) of SDS and 1% (w/v) of DTT is then added to the pellet containing mainly polymeric glutenins and dispersed by sonication with amplitude of 30% for 15 s, which is performed using a stepped microtip prob of 3 mm of diameter (Ultrasonic Processor, Sonics, model 75038). The mixture is finally maintained at a constant temperature of 60°C for 30 min and then centrifuged at 12500 g for 10 min at 20°C.
Methods for measuring the amount of sulfur are well known from the art.
The method of producing a plant having a modulated content in seed proteins, preferably seed storage proteins, according to the invention comprises a step of modulating the expression of a SHP transcription regulator gene, an ortholog or a derivative thereof.
As used herein, the term "gene" refers to a nucleic acid sequence that encodes an RNA, for example, nucleic acid sequences including, but not limited to, encoding a polypeptide. The term "gene" also refers broadly to any segment of DNA associated with a biological function. As such, the term "gene" encompasses sequences including but not limited to a coding sequence, a promoter region, a transcriptional regulatory sequence, a non-expressed DNA segment that is a specific recognition sequence for regulatory proteins, a non-expressed DNA segment that contributes to gene expression, a DNA segment designed to have desired parameters, or combinations thereof. A gene can be obtained by a variety of methods, including cloning from a biological sample, synthesis based on known or predicted sequence information, and recombinant derivation from one or more existing sequences.
As used herein, the term "Transcription regulator" or "Transcription factor" refers to a protein that modulates gene expression by interaction with the transcriptional regulatory element (also called cis-motif) and cellular components for transcription, including RNA Polymerase, Transcription Associated Factors (TAFs), chromatin-remodeling proteins, and
any other relevant protein that impacts gene transcription. Preferably, the term "Transcription regulator" or "Transcription factor" refers to trans-acting regulatory proteins which can bind to cis-acting elements, also called cis-acting motifs or cis-motifs, that are short DNA sequences located upstream of genes, or within introns. The Storage protein activator Heterodimerizing Protein (SHP) transcription regulator,
SHP or SPA2 having herein the same meaning and are used interchangeably, is a bZIP transcription regulator implicated in the regulation of the synthesis of seed storage proteins in wheat. Said SHP transcription regulator is able to form a dimer complex with its paralog, the Storage Protein Activator (SPA) transcription regulator which binds on the GLM (GCN4 Like Motif) in the promoter of a storage protein gene.
In wheat, said SHP transcription regulator is coded by three homoeologous genes sequences. Homoeologous A (SHP_A) has the coding sequence SEQ ID N°l and its translation gives the amino acid sequence SEQ ID N°2. Homoeologous B (SHP_B) has the coding sequence SEQ ID N°3 and its translation leads to the amino acid sequence SEQ ID N°4. Homoeologous C (SHP_C) has the coding sequence SEQ ID N°5 and its translation leads the amino acid sequence SEQ ID N°6.
As used herein, the term "ortholog" refers to homologs, i.e. genes that are related to a reference gene by descent from a common ancestral DNA sequence, in different species that evolved from a common ancestral gene by speciation. The tern "homoeolog" refers to closely related-genes, derived from a common ancestor and cumulated in wheat genome because of allopolyplo'idisation. Thus homoeologous genes are orthologs. The term "paralog" refers to homologs in the same species that evolved by genetic duplication of a common ancestral gene. The term "ortholog" or "orthologous" in reference to proteins means that said orthologous proteins are believed to be under similar regulation, have the same function and usually the same specificity in close organisms.
Within the context of the present invention, the term "ortholog thereof" designates a related gene or protein from a distinct species, having a high degree of sequence similarity, and more particularly a level of sequence identity to SHP of at least 60 %, preferably 65% and most preferably at least 75% for the coding sequence or amino acid sequences, respectively, and a SHP-like activity. An ortholog of SHP is most preferably a gene or protein from a distinct species having a common ancestor with SHP, able to modulate the
transcription of plant seed storage proteins, and having a degree of sequence identity with SHP of at least 60% for coding sequences. A nucleotide sequence of an ortholog in one species can be used to isolate the nucleotide sequence of the ortholog in another species (for example, sorghum) using standard molecular biology techniques. This can be accomplished, for example, using techniques described in more detail below (see also Sambrook & Russell, 2001 for a discussion of hybridization conditions that can be used to isolate closely related sequences) or by designing primers in conserved regions and then amplified the gene by PCR.
Preferred orthologs of SHP have a nucleic acid sequence of at least 60%, preferably at least 65%, 70%, 75%, 80%, 85%, especially preferably at least 90%, 95%, 97%, 98% and 99%, or more of sequence identity to a sequence selected in the group comprising SEQ ID N°l, 3, 5. SHP orthologs can be identified using such tools as "best blast hit" searches or "best blast mutual hit" (BBMH). SHP orthologs have been identified by the inventors in various plants, including shorgo (Sorghum bicolor), rice (Oryza sativa) and rye (Secale cereale). Specific examples of such orthologs are given in the following table 1.
Table 1. Specific examples of SHP orthologs. Their cDNA (CDS sequence herein) and amino-acid sequences encoded by said nucleic acid sequences are listed as follows :
Nucleic Acid Plant Species GenBank Gene name (a) Sequence (NA + SEQ accession
ID N°) number (a)
Amino Acid Sequence
(AA + SEQ ID N°)
NA SEQ ID N°l Wheat T. aestivum SHP_A
AA SEQ ID N°2
NA SEQ ID N°3 Wheat T. aestivum SHP_B
AA SEQ ID N°4
NA SEQ ID N°5 wheat T. aestivum SHP_D
AA SEQ ID N°6
NA SEQ ID N°9 Rice 0. sativa Indica AF395819.1, REB
AAL10017.1
AA SEQ ID N°10
NA SEQ ID N°ll Rice 0. sativa Os03g0796900,
japonica NP_001051558.1
AA SEQ ID N°12
NA SEQ ID N°13 Sorghum S. bicolor XM_002463695,
XP_002463740.1
AA SEQ ID N°14
NA SEQ ID N°21 Rye Secale cereale TC4269 AA SEQ ID N°22
(a): if available. The first accession number corresponds to the nucleic sequence. It is followed by the accession number of the amino-acid sequence. If only one number is given, this corresponds to that of the nucleic acid sequence and thus the amino acid sequence is deduced from its translation in the adequate reading shift when the cDNA sequence is partial (this is the case for rye).
In a preferred embodiment, a consensus sequence of SHP orthologs corresponds for example to SEQ ID N°33 said sequence having been defined with a multiple alignment with the Clustalx tool followed by a calculation of the consensus sequence with the Bioedit tool.
As used herein, the term "derivative" or "derivative thereof" referring to the SHP transcription regulator gene or an ortholog thereof corresponds to a nucleic acid sequence having at least 75% sequence identity to the referred sequence, preferably 80%, 85%, and most preferably 90%, 95% and 99%.
As used herein, "percentage of identity" between two nucleic acid sequences, means the percentage of identical nucleic acid, between the two sequences to be compared, obtained from the best local alignment of said sequences, this percentage being purely mathematical and the differences between these two sequences being randomly spread over the nucleic acid acids sequences. As used herein, "best alignment" or "optimal alignment", means the alignment which gives the best score and then, for which the determined percentage of identity (see below) is the highest. Sequence comparison between two nucleic acids sequences are generally realized from the best alignment of these sequences; this comparison is realized on segments of comparison in order to
identify and compared the local regions of similarity. The best sequence alignment to perform comparison can be realized, beside by a manual way, for example by using the global homology algorithm developed by SMITH and WATERMAN (Ad. App. Math., vol.2, p:482, 1981), by using the local homology algorithm developed by NEDDLEMAN and WUNSCH (J. Mol. Biol., vol.48, p:443, 1970), by using the method of similarities developed by PEARSON and LIPMAN (Proc. Natl. Acd. Sci. USA, vol.85, p:2444, 1988), by using computer softwares using such algorithms (GAP, BESTFIT, BLAST-related software such as BLASTP or BLASTN, FASTA, TFASTA in the Wisconsin Genetics software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl USA), by using the MUSCLE multiple alignment algorithms (Edgar, Robert C, Nucleic Acids Research, vol. 32, p:1792, 2004 ). To get the best local alignment, one can preferably use for example BLAST or ALIGN softwares, preferably BLAST using a BLOSUM50 matrix (default parameters). The identity percentage between two sequences of nucleic acids is determined by comparing these two sequences optimally aligned, the nucleic acid sequences being able to comprise additions or deletions in respect to the reference sequence in order to get the optimal alignment between these two sequences. The percentage of identity is calculated by determining the number of identical position between these two sequences, and dividing this number by the total number of compared positions, and by multiplying the result obtained by 100 to get the percentage of identity between these two sequences. The term "expression", as used herein, refers to the biosynthesis of a gene product, including the transcription of sense (mRNA), antisense RNA or other RNA polymers thereof in either single-or double-stranded form resulting from RNA polymerase-catalyzed transcription of a DNA sequence. Expression may also refer to translation of mRNA from said gene into a polypeptide. As used therein, the term « to modulate » or "modulating" in reference to the expression of SHP gene, an ortholog or a derivative thereof refers to the modification of the expression of SHP, ortholog or derivative thereof by comparing to that occurring in a control plant, either by overexpressing said SHP, ortholog or derivative thereof or by inhibiting totally or partially the expression and/or activity of said SHP, ortholog or derivative thereof. In a preferred embodiment, modulation of the expression of SHP transcription regulator gene, an ortholog or a derivative thereof is either an overexpression of said SHP
transcription regulator gene, an ortholog or a derivative thereof, or a total or partial inhibition of the expression and/or activity of said SHP gene, an ortholog or a derivative thereof.
In a still preferred embodiment, the expression of SHP gene, an ortholog or a derivative thereof is totally or partially inhibited.
As used herein, the terms "inhibit", "suppress", "down regulate", or "significantly reduce" and grammatical variants thereof are used interchangeably and refer to an activity whereby gene expression or a level of an RNA encoding the wheat SHP transcription regulator, an ortholog or a derivative thereof, or the activity of the SHP transcription regulator, an ortholog or a derivative thereof, is decreased below that observed in a control plant.
As used herein, the term "inhibiting totally" refers to the suppression of the expression and/or activity of said SHP, an ortholog or a derivative thereof compared to that observed in a control plant. As used herein, the term "inhibiting partially" refers to decreasing the expression and/or activity of said SHP, ortholog or derivative thereof in comparison with the expression and/or activity of said SHP, ortholog or derivative thereof in a control plant.
Preferably, the expression and/or activity of said SHP gene, ortholog or derivative thereof is decreased of at least 20%, 30%, preferably 35%, 40%, 45% and most preferably of at least 50%, 60%, 70%.
In a preferred embodiment of the invention, the expression of said SHP gene, an ortholog or a derivative thereof is inhibited by deletion, insertion and/or substitution of one or more nucleotides, site-specific mutagenesis, ethyl methanesulfonate mutagenesis, TILLING, ecoTILLING or by gene silencing induced by RNA interference (RNAi), small interference RNA (siRNA), double stranded RNA (dsRNA), micro RNA (miRNA), hairpin, or by using methods such as VIGS.
A preferred method for inhibiting the expression of SHP gene, an ortholog or a derivative thereof comprises mutagenesis of said SHP gene, ortholog or derivative thereof or inhibition or modification of the transcription or translation of said SHP, ortholog or derivative thereof.
Mutagenesis of SHP gene, ortholog or derivative thereof can be realized at the level of the coding sequence or of the regulating sequences of the expression, for example at the level of the promoter, the cis-motif but also at the level of the dimerization domain of a protein. An example of mutagenesis comprises nucleotide(s) insertions, deletions, or substitutions but also realizing a deletion of all or parts of said gene and/or the insertion of an exogenous sequence, a mutation implicating a change of amino acids in the translated nucleic acid sequence which can thereby affect the function of the protein. Mutations can also be introduced by using physical agents, such as radiations, or chemical agents. Said mutations have the consequence of moving forward the reading frame and/or inserting stop codon in the sequence and/or modify the level of transcription and/or of translation of said SHP gene, ortholog or derivative thereof. Methods such as « TILLING » (Targeting Induced Local Lesions IN Genomes; McCALLUM et al, Plant Physiol., 123, 439-442, 2000), EMS can be used.
In another preferred embodiment, total or partial inhibition of the expression of SHP gene, an ortholog or a derivative thereof is obtained by silencing of the corresponding gene.
Methods for gene silencing in plants are known in themselves in the art. For instance, one can mention interference methods comprising interference RNA (RNAi), small interference RNA (siRNA), double stranded RNA (dsRNA), micro RNA (miRNA), hairpin, etc (see WATSON et GRIERSON, Transgenic Plants : Fundamentals and Applications (HIATT, A, ed) New York : Marcel DEKKER, 255-281, 1992 ; CHICAS et MACINO, EMBO reports, 21, 992- 996, 2001 ; HANNON, Nature, 418, 244-251, 2002; OSSOWSKI ef al., The Plant Journal, 53, 674-690, 2008 ; SCHWAB et al., Methods Mol Biol., 592, 71-88, 2010 ; WEI et al., Funct Integr Genomics., 9, 499-511, 2009). It is also possible to use ribozyme targeting the mRNA of said SHP, an ortholog or a derivative thereof or to use methods such as but not limited to Virus- induced gene silencing (VIGS) method. Virus-induced gene silencing (VIGS) uses an RNA- mediated antiviral defense mechanism to target an endogen mRNA. Virus vectors carrying inserts derived from the host targeted gene are inoculated to the plant which leads to the suppression of the targeted gene expression (Lu et al, 2003).
As used herein, "RNAi" or "RNA interference" refers to the process of sequence- specific post-transcriptional gene silencing in plants, mediated by double-stranded RNA (dsRNA).
Typically, DNA constructs for totally or partially inhibiting the expression of the SHP gene, an ortholog or a derivative thereof and especially for delivering RNAi in a plant according to the invention are described below.
In another preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof is increased, i.e. said SHP gene, an ortholog or derivative thereof is overexpressed.
As used herein, the terms "increase", "overexpress", and grammatical variants in reference to the expression of SHP gene, an ortholog or a derivative thereof are used interchangeably and refer to an activity whereby gene expression or a level of an RNA encoding SHP transcription regulator, an ortholog or a derivative thereof, or SHP transcription regulator's activity or one of the ortholog or derivative thereof, is increased compared to that observed in a control plant.
In a preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof is increased of at least 10%, 20%, 30%, 40%, preferably of at least 50%, 100%, 150%, 200%, 250% and most preferably of at least 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% 700%, 750%, 800%, 850%, 900%, 950% and 1000%.
A preferred method for overexpressing the SHP gene, an ortholog or a derivative thereof comprises introducing into the genome of said plant a DNA construct comprising a nucleotide sequence encoding said SHP, an ortholog or a derivative thereof, placed under the control of a promoter. In another preferred embodiment, modulating the expression of SHP gene, an ortholog or a derivative thereof comprises modulating the activity of said SHP, ortholog or derivative thereof.
As used herein, the term "activity of wheat SHP transcription regulator" refers to the activity of said wheat SHP transcription regulator to bind directly a cis-motif from the promoter of a seed storage protein gene or to associate in a dimer form with for example the Storage Protein Activator (SPA) transcription regulator which is fixed on a cis-motif element from the promoter of a seed storage protein gene.
Modulating the activity of SHP transcription regulator, an ortholog or a derivative thereof comprises increasing or decreasing said activity. An increase of said activity can be obtained by using a compound capable of improving the fixation of SHP onto SPA in the case
of the wheat. A decrease of said activity can be obtained for example by using a compound capable of interfering with the association of SHP and SPA in the case of the wheat, or by operating a mutation in the DNA fixation domain from seed storage proteins therefore preventing the fixation of said SHP, ortholog or derivative thereof to the promoter of said seed storage proteins leading to the loss of activity of said SHP, ortholog or derivative thereof.
In a preferred embodiment, the modulated content of seed proteins, preferably seed storage proteins, is associated with the modulation of the expression of SHP gene, an ortholog or a derivative thereof. In a most preferred embodiment, the overexpression of SHP gene, an ortholog or a derivative thereof is associated with a decreased amount of seed proteins, preferably of seed storage proteins and most preferably of Low-Molecular Weight glutenins (LMW-GS). Therefore, the amount of seed proteins, preferably of seed storage proteins, and most preferably of LMW-GS is increased by inhibiting the expression of SHP transcription regulator gene, an ortholog or a derivative thereof.
In another still most preferred embodiment, a total or partial inhibition of SHP gene, an ortholog or a derivative thereof is associated with an increased amount of seed proteins, preferably of seed storage proteins and most preferably of Low-Molecular Weight glutenins (LMW-GS). Therefore, the amount of seed proteins, preferably seed storage proteins, and most preferably of LMW-GS is decreased by overexpressing the SHP transcription regulator gene, an ortholog or a derivative thereof.
In a still preferred embodiment, the method for producing a plant having a modulated content in seed proteins, preferably seed storage proteins comprises the following steps: a) transforming a plant host cell with an expression cassette or an expression vector according to the invention as disclosed below; and
b) culturing said transformed plant cell and producing one or more transgenic plant from said plant host cell,
c) obtaining a plant with a modulated content of seed proteins, preferably seed storage proteins.
In a preferred embodiment, said method of producing a plant according to the invention comprises an intermediate step between step b) and step c), said intermediate step consisting in a screening of a homozygous plant at the transformed locus.
As used herein, the terms "host cells" and "recombinant host cells" are used interchangeably and refer to cells into which a nucleic acid sequence encoding a wheat SHP transcription regulator, an ortholog or a derivative thereof or an expression vector according to the invention can be introduced. Furthermore, the terms refer not only to the particular plant cell into which an expression construct is initially introduced, but also to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny might not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
In a preferred embodiment, a host cell is defined as a plant cell as disclosed below.
In a still preferred embodiment, a plant host tissue can also be transformed according to the invention.
The term "transformation" refers to the transfer of a nucleic acid molecule into the genome of a host organism, resulting in genetically stable inheritance. It therefore refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous nucleic acid. As used herein, the term "transformed cell" is a cell comprising an artificial construct which has been introduced therein by suitable and well known techniques in the art. Therefore, a plant comprising transformed cells is a "transformed plant".
"Transformed", "transgenic" and "recombinant" in reference to a plant refer to a plant into which a nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome by methods generally known in the art.
The transformation of a cell with an exogenous nucleic acid (for example, an expression vector) can be characterized as transient or stable. As used herein, the term "stable" refers to a state of persistence that is of a longer duration than that which would be understood in the art as "transient". These terms can be used both in the context of the transformation of cells (for example, a stable transformation), or for the expression of a
transgene (for example, the stable expression of a vector-encoded nucleic acid sequence comprising a trigger sequence) in a transgenic cell. In some embodiments, a stable transformation results in the incorporation of the exogenous nucleic acid molecule (for example, an expression vector) into the genome of the transformed cell. As a result, when the cell divides, the vector DNA is replicated along with plant genome so that progeny cells also contain the exogenous DNA in their genomes. Therefore, the terms "Genetically stable" and "heritable" refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations. "Chromosomally-integrated" refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds.
"Stably transformed" refers to cells that have been selected and regenerated on a selection media following transformation whereas "transiently transformed" refers to cells in which a nucleic acid sequence or a vector according to the invention have been introduced but not selected for stable maintenance. In some embodiments, the term "stable expression" relates to expression of a nucleic acid molecule (for example, a vector-encoded nucleic acid sequence comprising a trigger sequence) over time. Thus, stable expression requires that the cell into which the exogenous DNA is introduced express the encoded nucleic acid at a consistent level over time. Additionally, stable expression can occur over the course of generations. When the expressing cell divides, at least a fraction of the resulting daughter cells can also express the encoded nucleic acid, and at about the same level. It should be understood that it is not necessary that every cell derived from the cell into which the vector was originally introduced express the nucleic acid molecule of interest. Rather, particularly in the context of a whole plant, the term "stable expression" requires only that the nucleic acid molecule of interest be stably expressed in tissue(s) and/or location(s) of the plant in which expression is desired. In some embodiments, stable expression of an exogenous nucleic acid is achieved by the integration of the nucleic acid into the genome of the host cell.
Numerous methods for transforming a plant cell are known in the art and are used in methods of preparing a transgenic plant cell and plant. Examples of methods of transformation of plants and plant cells include, but are not limited to, Agrobacterium- mediated transformation (De Blaere et al., 1987 Methods Enzymol. 153, 277) particle
bombardment technology (Klein et al. 1987 Nature 327, 70; U.S. Patent No. 4,945,050), microinjection, calcium phosphate precipitation, lipofection (liposome fusion), use of a gene gun and DNA vector transporter (Wu et al., 1992 J. Biol. Chem., 267: 963-967).
Transformation of plant material is practiced in tissue culture on a nutrient media, i.e. a mixture of nutrients that will allow cells to grow in vitro. Recipient cell targets include, but are not limited to, meristem cells, hypocotyls, calli, immature embryos and gametic cells such as microspores, pollen, sperm and egg cells. Callus may be initiated from tissue sources including, but not limited to, immature embryos, hypocotyls, seedling apical meristems, microspores and the like. Marker genes are used to provide an efficient system for identification of cells that are stably transformed by receiving and integrating a recombinant DNA molecule into their genomes. Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or a herbicide. Any of the herbicides to which plants of this invention may be resistant are useful agents for selective markers. Potentially transformed cells are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene is integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA. Commonly used selective marker genes include those conferring resistance to antibiotics such as kanamycin and paromomycin (nptll), hygromycin B (aph IV), spectinomycin (aadA) and gentamycin (aac3 and aacC4) or resistance to herbicides such as glufosinate (bar or pat), dicamba (DMO) and glyphosate (aroA or EPSPS). Examples of such selectable markers are illustrated in US Patents 5,550,318; 5,633,435; 5,780,708 and 6,118,047. Markers which provide an ability to visually screen transformants can also be employed, for example, a gene expressing a colored or fluorescent protein such as a luciferase or green fluorescent protein (GFP) or a gene expressing a beta-glucuronidase or uidA gene (GUS) for which various chromogenic substrates are known.
Transgenic plants derived from transgenic plant cells according to the invention are grown to generate transgenic plants comprising an expression cassette or an expression vector according to the invention and therefore transgenic plants having a modulated content of seed proteins, preferably seed storage proteins and produce transgenic seed and
haploid pollen. Such plants are identified by selection of transformed plants or progeny seed for said inhibitor of a SHP transcription regulator, an ortholog or a derivative thereof.
Within a population of transgenic plants each regenerated from a transgenic plant cell many plants that survive to fertile transgenic plants that produce seeds a nd progeny plants will not exhibit an inhibitor according to the invention. Selection from the population is necessary to identify one or more transgenic plant cells having a recombinant nucleic acid sequence that can provide plants comprising an inhibitor according to the invention.
A second object of the invention is to provide a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof.
In a preferred embodiment, said recombinant DNA or RNA for modulating the expression of said SHP gene, an ortholog or a derivative thereof is selected in the group comprising an siRNA, a dsRNA, an miRNA, a sequence encoding a ribozyme or a sequence encoding SHP, an ortholog or a derivative thereof. For the purposes of the invention, the term "recombinant DNA or RNA" refers to a nucleic acid sequence that has been altered, rearranged, or modified by genetic engineering. The term "recombinant" does not refer to alterations of nucleic acid sequences that result from naturally occurring events, such as spontaneous mutations, or from non-spontaneous mutagenesis followed by selective breeding. This includes, in particular, recombinant DNA for expressing SH P gene, an ortholog or a derivative thereof in a host-cell (e.g., plant cell), or a host organism for overexpressing SHP, an ortholog or a derivative thereof. DNA constructs may also correspond to recombinant DNA constructs for the silencing of SHP gene or an ortholog thereof, therefore comprising DNA constructs based on RNAi, siRNA, dsRNA, miRNA, etc. Examples of recombinant DNA or RNA according to the invention include constructs encoding anti-sense DNA, siRNA, dsRNA, miRNA and ribozymes.
In a preferred embodiment, a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene or an ortholog thereof and especially for partially or totally inhibiting the expression of said SHP gene, an ortholog or a derivative
thereof is selected in the group comprising but not limited to siRNA, dsRNA, miRNA and sequences encoding ribozymes.
In a preferred embodiment, a recombinant DNA or RNA according to the invention is an anti-sense oligonucleotide construct. Antisense technology is emerging as an effective means for reducing the expression of specific endogenous gene products in plant cells (see, e. g. , US patent No. 5,759,829; Orvar et al. 1997; Coles et al. 1999).
Anti-sense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of the mRNA of the SHP transcription regulator, an ortholog or a derivative thereof by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the SHP transcription regulator, an ortholog or a derivative thereof, and thus activity, in a cell.
The term "antisense" or "antisense inhibition" or "antisense suppression" refers to an antisense strand sufficiently complementary to an endogenous transcription product or mRNA such that translation and/or expression of the endogenous transcription product is inhibited or reduced.
For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding a SHP transcription regulator, an ortholog or a derivative thereof can be synthesized, e.g., by conventional phosphodiester techniques.
Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732).
In another preferred embodiment, a recombinant RNA according to the invention is selected from small inhibitory RNAs (siRNAs).
As used herein, the term "RNA" refers to a molecule comprising at least one ribonucleotide residue. By "ribonucleotide" is meant a nucleotide with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose moiety. The terms encompass double stranded RNA, single stranded RNA, RNAs with both double stranded and single stranded regions, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA,
recombinantly produced RNA, as well as altered RNA, or analog RNA, that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of an RNA molecule or internally, -for example at one or more nucleotides of the RNA. Nucleotides in the RNA molecules of the presently disclosed subject matter can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of a naturally occurring RNA.
The siRNAs sequences advantageously comprise at least twelve contiguous dinucleotides or their derivatives.
In another preferred embodiment, a recombinant RNA according to the invention is selected from double-stranded RNA (dsRNA) for post-transcriptional gene silencing (PTGS). This RNA-induced gene silencing or RNA-interference, where both the sense and its complementary antisense RNA strand of a particular endogeneous gene are combined in one dsRNA, was first shown in Caenorhabditis elegans (Fire et al. 1998). Hamilton et al. (1999) indicate that short nucleotide RNAs (from 21 to 25 nucleotides long, preferably from 21-23 nucleotides long) are break-down products of the dsRNA that regulate the clevage of the endogeneous target mRNA in PTGS in plants.
As used herein, "dsRNA" or "double-stranded RNA" refers to RNA that is partially or completely double stranded. Double stranded RNA is also referred to as short interfering RNA (siRNA), short interfering nucleic acid (siNA), and the like.
In the RNAi process, dsRNA comprising a first strand that is substantially identical to a portion of a target gene and a second strand that is complementary to the first strand is introduced into a plant. After introduction into the plant, the target gene-specific dsRNA is processed into relatively small fragments (siRNAs) by a plant cell containing the RNAi processing machinery resulting in target gene silencing.
Examples of double stranded RNAs include, but are not limited to molecules comprising at least two distinct RNA strands that are either partially or fully duplexed by intermolecular hybridization.
Additionally, the term is intended to include a single RNA molecule that by intramolecular hybridization can form a double stranded region (for example, a hairpin) (see
Wesley et al (2001).
Thus, as used herein the phrases "intermolecular hybridization" and "intramolecular hybridization" refer to double stranded molecules for which the nucleotides involved in the duplex formation are present on different molecules or the same molecule, respectively.
As used herein, the phrase "double stranded region" refers to any region of a nucleic acid molecule that is in a double stranded conformation via hydrogen bonding between the nucleotides including, but not limited to hydrogen bonding between cytosine and guanine, adenine and thymine, adenine and uracil, and any other nucleic acid duplex as would be understood by one of ordinary skill in the art.
The length of the double stranded region can vary from about 15 consecutive basepairs to several thousand basepairs. In some embodiments, the double stranded region is at least 15 base pairs, in some embodiments between 15 and 50 basepairs, in some embodiments between 50 and 100 basepairs, in some embodiments between 100 and 500 basepairs, in some embodiments between 500 and 1000 basepairs, and in some embodiments is at least 1000 basepairs.
As describe hereinabove, the formation of the double stranded region results from the hybridization of complementary RNA strands (for example, a sense strand and an antisense strand), either via an intermolecular hybridization (i.e., involving 2 or more distinct RNA molecules) or via an intramolecular hybridization, the latter of which can occur when a single RNA molecule contains self-complementary regions that are capable of hybridizing to each other on the same RNA molecule.
These self-complementary regions are typically separated by a stretch of nucleotides such that the intramolecular hybridization event forms what is referred to in the art as a "hairpin" or a "stem-loop structure". In some embodiments, the stretch of nucleotides between the self-complementary regions comprises an intron that is excised from the nucleic acid molecule by RNA processing in the cell.
In another preferred embodiment, a recombinant RNA according to the invention is selected from microRNAs (miRNA).
As used herein, the term "microRNAs" (miRNA or RNA) refers to single-stranded RNA molecules of 21 to 23 nucleotides in length, preferably 21 to 22 nucleotides, which are capable of regulating gene expression. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non- protein-encoding genes. The precursor miRNAs have two regions of complementarity that enable them to form a stem-loop- or fold-back-like structure. The processed miRNA (also referred to as "mature miRNA") becomes part of a large complex to down-regulate a particular target gene.
In another preferred embodiment, a recombinant DNA according to the invention is a recombinant DNA encoding a ribozyme.
Ribozymes can also function as inhibitors of the expression of the SHP transcription regulator, an ortholog or a derivative thereof for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of a SHP transcription regulator, an ortholog or a derivative thereof mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. Antisense oligonucleotides, dsRNA, siRNA, miRNA and ribozymes useful as inhibitors of a SHP transcription regulator, an ortholog or a derivative thereof expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis.
Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be
incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
In a preferred embodiment, a recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof and especially for overexpressing said SHP gene, an ortholog or a derivative thereof, is selected in the group comprising but not limited to sequences encoding said SHP transcription regulator, an ortholog or a derivative thereof as disclosed previously.
A third object of the invention is to provide an expression cassette, wherein said expression cassette comprises nucleic acid sequences for modulating the expression of SHP gene, an ortholog or a derivative thereof.
According to the invention, the term "expression cassette" should be considered as an element comprising specific nucleic acid sequences to integrate by any means, for example by enzyme digestion and DNA ligation, by recombination, more particularly by homologous recombination into another nucleic acid sequence, for example into a plasmid.
In a preferred embodiment, said expression cassette comprises a DNA or RNA construct according to the invention as disclosed previously.
In a preferred embodiment, a recombinant expression cassette according to the invention comprises at least a DNA construct operatively linked to a promoter, said DNA construct encoding a recombinant DNA or RNA as disclosed previously.
As used herein, the term "promoter" refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. " Promoter" includes a minimal promoter that is a short DNA sequence
comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
"Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA.
"Regulatory sequences" or "regulatory elements" refer to nucleotide sequences located upstream (5' non-coding sequences, such as the "cis-motifs"), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include initiation signals, enhancers, regulators, promoters, and termination sequences. They include natural and synthetic sequences as well as sequences which can be a combination of synthetic and natural sequences. Accordingly, an "enhancer" is a DNA sequence which can stimulate promoter activity and can be an innate element of the promoter or a (heterologous) element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter can also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions. Additionally, termination of transcription of a polynucleotide sequence is typically regulated by an operatively linked "transcription termination sequence" or "transcription terminators" (for example, an RNA polymerase III termination sequence). In certain instances, transcriptional terminators are also responsible for correct mRNA polyadenylation. The 3' non-transcribed regulatory DNA sequence includes from in some embodiments about 50 to about 1,000, and in some embodiments about 100 to about 1,000, nucleotide base pairs and contains plant transcriptional and translational termination sequences. Appropriate transcriptional terminators and those that are known to function in plants include the cauliflower mosaic virus (CaMV) 35S terminator, the tml terminator, the nopaline synthase
terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato, although other 3' elements known to those of skill in the art can also be employed. Alternatively, a gamma coixin, oleosin 3, or other terminator from the genus Coix can be used.
A promoter according to the invention may be specific for plant cells, preferably for monocotyledon cells. Examples of promoters according to the invention include but are not limited to the ubiquist promoter 35S, the corn gamma-zein promoter, but also specific promoters of the seed as the seed storage proteins promoters and especially promoters of glutenins of high molecular weight, such as GluBl.l, GluDl.l promoters, or promoters of low molecular weight glutenins or promoters of puroindolins. Promoters according to the invention can also be selected in the group comprising promoters of transcription regulators and promoters implicated in the development of the endosperm.
As used herein, the terms "Operably linked", "operably associated" or "operatively linked" used interchangeably refer to the functional linkage existing between a first sequence, such as a promoter and a second sequence, wherein the first sequence, i.e. a promoter, initiates and mediates the transcription of the DNA corresponding to the second sequence. Generally, operably linked sequences are contiguous. Thus, the term "operably linked" can refer to a promoter that is connected to a nucleotide sequence in such a way that the transcription of that nucleotide sequence is controlled and regulated by that promoter. Similarly, a nucleotide sequence is said to be under the "transcriptional control" of a promoter to which it is operably linked. The term "operably linked" can also refer to a transcription termination sequence that is connected to a nucleotide sequence in such a way that termination of transcription of that nucleotide sequence is controlled by that transcription termination sequence.
Techniques for operably linking a promoter to a nucleic acid sequence are known in the art. The precise orientation and location relative to a coding sequence of interest is dependent, inter alia, upon the specific nature of the promoter.
A fourth object of the invention is to provide an expression vector comprising an expression cassette as disclosed previously.
In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of a nucleic acid sequence to the cells and preferably cells expressing a wheat SHP transcription regulator, an ortholog or a derivative thereof. Preferably, the vector transports the nucleic acid sequence to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of one or more nucleic acid sequences encoding inhibitors according to the invention.
The term "expression vector" as used herein refers to a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell. Said expression vector comprises a promoter operatively linked to the nucleotide sequence of interest, i.e. the nucleotide sequence encoding an inhibitor according to the invention, which is operatively linked to transcription termination sequences. It also typically comprises sequences required for proper translation of the nucleotide sequence. The construct comprising the nucleotide sequence of interest can be chimeric. The construct can also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The nucleotide sequence of interest, i.e. the nucleotide sequence encoding an inhibitor according to the invention, including any additional sequences designed to effect proper expression of the nucleotide sequences, can also be referred to as an "expression cassette".
Another object of the invention is to provide a plant cell comprising an expression cassette or an expression vector as disclosed previously.
The term "plant," as used herein, has been disclosed previously.
As used herein, a "plant cell" includes, but is not limited to, a protoplast, gamete producing cell, and a cell that regenerates into a whole plant. Tissue culture of various tissues of plants and regeneration of plants there from is well known in the art and is widely published. As used herein, a "plant cell" also means a plant cell that is transformed with
stably-integrated, non-natural, recombinant DNA, e.g. by Agrobacterium-mediated transformation or by bombardment using microparticles coated with recombi nant.
In a preferred embodiment, a plant cell according to the invention is a transgenic plant cell. In another preferred embodiment, said plant cell according to the invention comprises an expression cassette or an expression vector as disclosed previously and enabling to inhibit totally or partially the expression of SHP transcription regulator gene, an ortholog or a derivative thereof.
As used herein a "transgenic plant cell" means a plant cell whose genome has been altered by the stable integration of recombinant nucleic acid sequence, preferably a nucleic acid sequence encoding a SHP transcription regulator, an ortholog or a derivative thereof.
In another preferred embodiment, the transgenic plant cell as disclosed previously is selected by screening a population of transgenic plant cells that have been transformed with an expression vector according to the invention, and expressing said inhibitor. In a still preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said transgenic plant cell is modulated, preferably partially or totally inhibited.
In another preferred embodiment, the content of seed proteins, preferably seed storage proteins, from said transgenic plant cell as disclosed previously is modulated.
Another object of the invention is to provide a transgenic plant obtained according to the method as disclosed previously.
In a preferred embodiment, said transgenic plant obtained according to the method as disclosed previously comprises a recombinant DNA or RNA, an expression cassette or an expression vector as disclosed previously.
As used herein a "transgenic plant" means a plant whose genome has been altered by the stable integration of recombinant DNA. A transgenic plant includes a plant regenerated from an originally-transformed plant cell as described previously and progeny
transgenic plants such as seedling, plantlet, and plants from later generations or crosses of a transformed plant.
The terms "seedling" and "plantlet", as used herein, are interchangeable and refer to the juvenile plant grown from a sprout, embryo or a germinating seed and generally include any small plants showing well developed green cotyledons and root elongation and which are propagated prior to transplanting in the ultimate location wherein they are to mature.
A "transgenic plant" as used herein also refers to a plant having one or more plant cells that contain a recombinant expression cassette or an expression vector as disclosed previously. In a preferred embodiment, said transgenic plant is obtained from a transgenic plant cell as disclosed previously.
In a still preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said transgenic plant is modulated, preferably partially or totally inhibited. In another preferred embodiment, the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said transgenic plant as disclosed previously is modulated and preferably increased.
Another object of the invention is to provide a transgenic plant seed obtained from the transgenic plant as disclosed previously. In a preferred embodiment, the transgenic plant seed according to the invention has one or more plant cells that contain a recombinant expression cassette or an expression vector as disclosed previously.
In another preferred embodiment, said transgenic plant seed is obtained from a transgenic plant as disclosed previously. In a still preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said plant seed is modulated, preferably partially or totally inhibited.
In another preferred embodiment, the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said transgenic plant seed as disclosed previously is modulated and preferably increased.
Another object of the invention is to provide a plant or a descendent of a plant grown or otherwise derived from a seed as disclosed previously.
In a preferred embodiment, the expression of the SHP transcription regulator gene, an ortholog or derivative thereof, from said plant or a descendant of a plant grown or otherwise derived from a seed as disclosed previously is modulated, preferably partially or totally inhibited.
In another preferred embodiment, the content (e.g. amount) of seed proteins, preferably seed storage proteins, from said plant or a descendant of a plant grown or otherwise derived from a seed as disclosed previously is modulated and preferably increased.
Another object of the invention is to provide the use of a plant according to the invention for reducing nitrogenous fertilizer intake.
Thus, said use enables to reduce nitrogenous fertilizer intake and to obtained seed with normal protein amount.
Another object of the invention is to provide the use of a plant seed according to the invention as a human and/or animal food product.
In a preferred embodiment, said plant seed according to the invention, having preferably an increased amount of seed proteins, preferably seed storage proteins, and most preferably LMW-GS, is used as a human food product which is enriched in proteins, preferably for the preparation of flour.
In another preferred embodiment, said plant seed according to the invention is used as an animal food product which is enriched in protein, preferably for the preparation of oil cake.
Another object of the invention is to provide a method for preparing a human and/or animal food product, enriched in proteins, wherein said method comprises a step of using a plant seed as defined previously for preparing a food product.
In a preferred embodiment, said food product is flour and the food product preparing step is done by grinding the plant seed defined previously.
In another preferred embodiment, said food product is an oil cake and the food product preparing step is done by extracting the oil from the plant seed defined previously.
Still another object of the invention is to provide a method of identifying a molecule that modulates the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof, wherein said method comprises a step of determining the ability of a candidate molecule to modulate the expression level of SHP gene, an ortholog or a derivative thereof.
In a preferred embodiment, determining the ability of a candidate molecule to modulate the expression level of SHP gene, an ortholog or a derivative thereof is realized by means of measuring the expression levels of said SHP gene, an ortholog or a derivative thereof in a plant cell which has been transformed with said candidate molecule.
The expression of SHP gene, an ortholog or a derivative thereof can be measured at the level of the mRNA or at the level of the protein as follows. In a preferred embodiment, the determination of the expression of SHP gene, an ortholog or a derivative thereof is measured at the level of the mRNA.
Methods for determining the quantity of mRNA are well known in the art. For example, the nucleic acid contained in the samples (e.g., cell or tissue prepared from the subject) is first extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions. The extracted mRNA may be then detected by hybridization (e. g:, Northern blot analysis).
Alternatively, the extracted mRNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain
reaction (RT-PCR), using specific oligonucleotide primers that enable amplification of a region in the nucleic acid of SHP gene or an ortholog thereof may be used. Quantitative or semi quantitative RT- PCR is preferred. Real-time quantitative or semi quantitative RT-PCR is particularly advantageous. Extracted mRNA may be reverse transcribed and amplified, after which amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. Other methods of Amplification include ligase chain reaction (LCR), transcription mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). In another embodiment, the expression level may be determined using an expression microarray analysis encompassing cDNA, oligonucleotides, macro and micro-arrays. Such DNA microarray or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere- sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs. To determine the expression level, a sample from a test subject, optionally first subjected to a reverse transcription, is labeled and contacted with the microarray in hybridization conditions, leading to the formation of 5 complexes between 20 target nucleic acids that are complementary to probe sequences attached to the microarray surface. The labelled hybridized complexes are then detected and can be quantified or semiquantified.
Labeling may be achieved by various methods, e.g. by using radioactive or fluorescent labeling. Many variants of the microarray hybridization technology are available to the man skilled in the art. In a preferred embodiment, the determination of the expression of SHP gene, an ortholog or a derivative thereof is measured at the level of the protein.
Methods for determining the expression level of SHP gene, an ortholog or a derivative thereof by quantifying proteins comprise contacting a biological sample with a binding partner capable of selectively interacting with the SHP gene, an ortholog or a derivative thereof present in the sample. The binding partner is generally an antibody that may be polyclonal or monoclonal, preferably monoclonal.
The presence of the SHP gene, an ortholog or a derivative thereof can be detected using standard electrophoretic and immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays but also mass spectrometry techniques. Such assays include, but are not limited to, Western blots; agglutination tests; enzyme-labeled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; Immunoelectrophoresis; immunoprecipitation, immunocytochemistry, immunohistochemistry, etc. The reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the proteins to be tested. A biological sample containing or suspected of containing the marker protein is then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labeled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
In a still preferred embodiment, said method comprises a further step of selecting a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof.
According to the invention, a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof is a molecule capable of increasing or decreasing the expression of SHP, an ortholog or a derivative thereof in a transformed plant cell as compared to the expression of SHP gene, an ortholog or a derivative thereof in a control plant cell.
In a further preferred embodiment, a molecule capable of modulating the expression of SHP gene, an ortholog or a derivative thereof is a recombinant DNA or RNA as disclosed previously or a product encoded by said recombinant RNA/DNA.
Another object of the invention is to provide a method for selecting a plant having a modulated content of seed proteins, preferably seed storage proteins, wherein said method comprises a step of measuring expression of the SHP transcription regulator gene, an ortholog or a derivative thereof and comparing said expression with the expression of said SHP gene, an ortholog or a derivative therein in a control plant, and another step of selecting a plant having a modulated expression of the SHP transcription regulator gene, an ortholog or a derivative thereof, said modulated expression being indicative of a modulated content of seed proteins, preferably seed storage proteins.
In a preferred embodiment, the step of selecting a plant having a modulated expression of the SHP gene, an ortholog or a derivative thereof consists in a selection of a plant in which the SHP gene is partially or totally inhibited.
In a still preferred embodiment, a plant having a total or partially inhibited SHP gene has an increased content of seed proteins, preferably seed storage proteins.
Finally, another object of the invention is to provide an isolated nucleic acid sequence encoding a wheat Storage protein activator Heterodimerizing Protein (SHP) transcription regulator, also known as SPA2, or a derivative thereof.
The term "nucleic acid sequence" used herein refers to DNA sequences (e.g., cDNA or genomic or synthetic DNA) and RNA sequences (e. g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native internucleoside bonds, or both. Preferably, said nucleic acid sequence is a DNA sequence. The nucleic acid can be in any topological conformation, such as linear or circular.
The nucleotide sequences used in aspects of the invention include the naturally occurring sequences as well as mutant (variant or allelic form) forms and homologs. Such variants will continue to possess the desired activity, i. e., either promoter activity or the activity of the product encoded by the open reading frame of the non- variant nucleotide sequence.
As used herein, the term "isolated" refers to a molecule substantially free of other nucleic acids, proteins, lipids, carbohydrates, and/or other materials with which it is normally associated, such association being either in cellular material or in a synthesis
medium. Thus, the term "isolated nucleic acid seq uence" refers to a ribonucleic acid molecule or a deoxyribonucleic acid molecule (for example, a genomic DNA, cDNA, mRNA, RNAi-inducing RNA or a precursor thereof, etc.) of natural or synthetic origin or some combination thereof, which (1) is not associated with the cell in which the "isolated nucleic acid" is found in nature, or (2) is operatively linked to a polynucleotide to which it is not linked in nature. Similarly, the term "isolated polypeptide" refers to a polypeptide, in some embodiments prepared from recombinant DNA or RNA, or of synthetic origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is isolated from the cell in which it normally occurs, (3) is isolated free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature.
In a preferred embodiment, the isolated nucleic acid sequence encoding said SHP transcription regulator is selected in the group comprising SEQ ID N°l, 3 and 5.
EXAMPLES
1. Sequence identity between the SHP gene and orthologs thereof
The identity % is computed by means of lalign software between pairwise sequences. Above and below the diagonal, identity % is computed between CDS and amino-acid sequences, respectively. The rye sequence is partial. It corresponds to the 3' region of the CDS and includes the stop codon.
Supplementary table 1. Matrix of identity between SHP orthologs.
(a) in brackets, the size of the amino acid sequence is indicated (in amino-acid number)
The CDS and amino-acid sequences for rye are partial. The identity % is computed on the total length of these partial seq
2. Transformation and screening of RNAi lines a) Wheat transformation protocol
The method is essentially similar to the one described in International Application WO 00/63398. Wheat tillers, approximately 14 days post-anthesis (embryos approximately 1mm in length), are harvested from glasshouse grown plants to include 50cm tiller stem (22/15°C day/night temperature, with supplemented light to give a 16 hour day). All leaves are then removed except the flag leaf and the flag leaf is cleaned to remove contaminating fungal spores. The glumes of each spikelet and the lemma from the first two florets are then carefully removed to expose the immature seeds. Only these two seeds in each spikelet are generally uncovered. This procedure is carried out along the entire length of the inflorescence. The ears are then sprayed with 70% IMS as a brief surface sterilization.
Agrobacterium tumefaciens strains containing the vector for transformation are grown on solidified YEP media with 20mg/l kanamycin sulphate at 27°C for 2 days. Bacteria are then collected and re-suspended in TSIM 1 (MS media with lOOmg/l myoinositol, lOg/l glucose, 50mg/l MES buffer pH5.5) containing 400μΜ acetosyringone to an optical density of 2.4 at 650nm.
Agrobacterium suspension (ΙμΙ) is inoculated into the immature seed approximately at the position of the scutellum: endosperm interface, using a 10μΙ Hamilton, so that all exposed seed are inoculated. Tillers are then placed in water, covered with a translucent plastic bag to prevent seed dehydration, and placed in a lit incubator for 3 days at 23°C, 16hr day, 45μΕΐΎΐ-25-1 PAR.
After 3 days of co-cultivation, inoculated immature seeds are removed and surface sterilized (30 seconds in 70% ethanol, then 20 minutes in 20% Domestos, followed by thorough washing in sterile distilled water). Immature embryos are aseptically isolated and placed on W4 medium (MS with 20g/l sucrose, 2mg/l 2,4-D, 500mg/l Glutamine, lOOmg/l Casein hydrolysate, 150mg/l Timentin, pH5.8, solidified with 6g/l agarose) and with the scutellum uppermost. Cultures are placed at 25°C in the light (16 hour day). After 12 days cultivation on W4, embryogenic calli are
transferred to W425G media (W4 with 25mg/l Geneticin (G418)). Calli are maintained on this media for 2 weeks and then each callus is divided into 2mm pieces and re- plated onto W425G.
After a further 2 week culture, all tissues are assessed for development of embryogenic callus: any callus showing signs of continued development after 4 weeks on selection is transferred to regeneration media MRM 2K 25G (MS with 20g/l sucrose, 2mg/l Kinetin, 25mg/l Geneticin (G418), pH5.8, solidified with 6g/l agarose). Shoots are regenerated within 4 weeks on this media and then transferred to MS20 (MS with 20g/l sucrose, pH5.8, solidified with 7g/l agar) for shoot elongation and rooting.
The presence of the T-DNA, and the number of copies are quantified by
Quantitative PCR (qPCR).
b) Cloning method
The following constructs were used :
pSHP-IR-pSCV (see figure 4): A 315bp sub-fragment of the TaSHP coding sequence (SEQ ID N°26) was cloned in opposite orientation separated by the rice tubulinl first intron Fiume et al. Planta 2004 218: 639-703 to form a hairpin structure under the control of the wheat proTaHMWG high molecular weight glutenin promoter and terminated by the Arabidopsis AtSac66 terminator. The whole cassette is cloned in a selectable marker containing cassette pSCV vector, a derivative of pSCVl (Fiker et al, 1983). pSHP-IR-pSCV was designed to target the three copies of Ta SPA2 on genome A, B and D. No other sequence was targeted including TaSHP, a highly similar gene.
pHMWG-SHP-pSB12 (see figure 5): The SHP coding sequence (SEQ ID N°23 obtained by PCR using primers SEQ ID N°24 and SEQ ID N°25) was cloned using common restriction enzymes into a pSB12 (EP 672 752) based vector containing the selectable marker expression cassette as well as the wheat proTaHMWG promoter from high molecular glutenin (Halford et al, 1989) and the Agrobacterium nos terminator thus resulting in an endosperm specific SHP expression cassette.
3. Growth conditions
Seeds of RNAi and null segregant lines (a null segregant of an RNAi line being a descendant of a sibling of the corresponding RNAi plant that does not carry the RNAi construction) were germinated over-night at room temperature on wet filter paper in petri dishes and then placed at 4°C in the dark for one week. Germinated seeds were then sown in PVC columns (i.d. 8 cm, I. 50 cm) filled with a commercial soil (2 plants per column) and were arranged in a greenhouse in fully randomized design with three blocks.
Temperature was controlled at 22°C during the day and 18°C during the night.
Day length was 16 h, with artificial light when needed. Plants were irrigated (68 mL column"1 day"1) with water for three weeks, then for one week with a low nitrogen solution containing 1 mM KH2P04, 1 mM Ca(N03)2, 0.5 mM NH4N03, 2 mM MgS04, 3 mM CaCI2, 5 mM KCI, 10 μΜ H3B03, 0.7 μΜ ZnCI2, 0.4 μΜ CuCl2, 4.5 μΜ MnCI2, 0.22 μΜ Mo03, 50 μΜ EDFS-Fe, then for one week with a high nitrogen solution : 1 mM KH2P04, 5 mM KN03, 4 mM Ca(N03)2, 1 mM NH4N03 2 mM MgS04< 10 μΜ H3B03, 0.7 μΜ ZnCI2, 0.4 μΜ CuCI2, 4.5 μΜ MnCI2, 0.22 μΜ Mo03, 50 μΜ EDFS-Fe, then with the low nitrogen solution for two weeks and finally with water until maturity.
4. Grain sampling and milling
For gene expression analysis four grain from the middle of four ears were harvested at 300, 450 and 600 °Cd after anthesis and immediately frozen in liquid nitrogen and then stored at -80°C.
The reset of the grains of the four sampled ears were frozen at -80°C and then freeze-dried. All the grains were milled for 2 minutes using a custom ball mill. Grains were ground in liquid nitrogen. 5. Gene expression
The RNA of 100 μΐ of grain powder were extracted in 750 μί of extraction buffer (200 mM Tris-HCl pH 9, 400 mM KCI, 200 mM sucrose, 35 mM MgCI2, 25 mM EGTA) and 600 μί phenol/chloroform (pH 8).
The suspension was homogenized by vortexing for 30 s and then centrifuged for 10 min at 15,000 g.
The supernatant was collected and the pellet was resuspended twice in 600 μΐ of phenol/chloroform. After centrifugation in the same conditions the supernants were pooled. RNA was precipitated by addition of 1 M acetic acid (1/10 volume) and ethanol (2.5 volumes). The RNA pellet was washed with 3 M Na-acetate (pH 6) and resuspended in water.
A second acetic acid/ethanol precipitation was performed before final resuspension in 50 μ\. RNase free water. The RNA was treated with RNase free DNase and the DNAse inactivated according to the instructions of the supplier (AMBION). The RNA was quantified in a spectrophotometer at 260 nm. Approximately 2 g of total RNA were reverse transcribed using oligo(dT)20 and reverse transcriptase (Bio-rad iScript™ Select cDNA Synthesis kit) in a final volume of 40 μΙ.
Transcript levels of four housekeeping genes, storage proteins and A and B homoeologs of SHP transcription factors were quantified by real-time qRT-PCR with a 480 Lightcycler using Lightcycler 480 SYBR Green I Master (Roche) with cDNA diluted 10 times and 5 μΙ used for amplification by PCR in 15 μΙ.
Relative expression was calculated as 2 Λ (difference between measured gene Cp and geometric mean of the four housekeeping genes Cp). The primers used to measure the expression of the three copies of SHP are given in Table 2.
Table 2. Primer to quantify the expression of SHP
Forward (5'-3') Reverse (5'-3')
All (SHP-A + -B + - SEQ ID N°27 SEQ ID N° 28
D) AGGCGTTCAAGAAGCAGAAA TC A AC AG C AG C ACC ATTG TATTT
SHP-A SEQ ID N°29 SEQ ID N°30
AG AACTCCTCACTGTTAAG G C GC I 1 1 1 AATACCCTATTGTCG
SHP-B SEQ ID N°31 SEQ ID N°32
CAAGATGGGCAGACCTGACT TGGGACTTTCCTGGCTTGA
6. Protein analysis
The sequential extraction procedure of Osborne (1907) adapted by Marion et al (1994) was modified to extract only non-prolamin (mainly albumin globulin and amphiphilic proteins), gliadin and glutenin protein fractions. Each 2 mL tube contained one stainless steel bead (5 mm diameter) and stirring was obtained by placing tubes on a rotating wheel (40 rpm) during each extraction and washing step. a) Non-prolamin fraction
Non-prolamin protein fraction was extracted at 4°C with 1.5 mL of 50 mM phosphate buffer (pH 7.8) containing 0.1 M NaCI, for 30 min. The sample was centrifuged for 10 min (18,000 g) at 4°C. The pellet was washed two times with 1.5 mL of the same buffer for 10 min and all supernatants were pooled. b) Gliadin proteins
The same steps were used for gliadin protein fraction extraction from the previous pellet with 70% (v/v) ethanol at 4°C and then glutenin protein fraction extraction at room temperature with 50 mM borate buffer (pH 8.5) containing 2 % SDS (w/v) and 1 % DTT (w/v). 80 μΐ of supernatants containing each protein fraction were oven dried overnight at 60°C in 5 x 8 mm (for nonprolamin and gliadin fractions) or 10 x 10 mm (for glutenin fraction) tin sample capsules and their total nitrogen concentration was determined with the Dumas combustion method (Association of Analytical Communities International method no. 992.23) using a FlashEA 1112 N/Protein Analyzer (Thermo Electron Corp, Waltham, MA, USA). This method was also used to quantify the total nitrogen and sulfur concentration of the flour, using 5 mg samples.
Separation of gliadins was achieved using ultra-high performance liquid chromatography with an Agilent 1290 Infinity LC system. One mL of the gliadin protein fraction extract was filtered (Uptidisc RC 0.45 μιη) and 4 μί were injected for a separation with a C8 (3.5 μητι, 300 A) reversed phase Agilent Zorbax 300SB column at 50°C. Solvent A was 0.1% trifluoroacetic acid (TFA) in ultra-pure water and solvent B was 0.09% TFA in acetonitrile. Separation of the gliadins was performed by using a
gradient broken down into three linear phases with breaks in between: 24-35% B in 22 min, 5 min at 35% B, 35-36% in 2 min, 5 min at 36% B, 36-48% B in 24 min with a 1 mL min"1 flow. Detection was performed by UV absorbance at 214 nm. After the gradient, the column was cleaned with 80% B for 2 min and equilibrated at 24% B for 3 min, with the same flow rate as the gradient. c) Glutenin proteins
Glutenins were specifically extracted for liquid chromatography analysis with a protocol adapted from Fu et Kovacs (1999). Monomeric proteins were extracted from 100 mg flour in 1 mL Nal 0.3 M, 7.5% (v/v) 1-propanol at 16°C with magnetic stirring for 1 h._The sample was centrifuged for 10 min (15,000 g) at 15°C. The pellet was washed twice with 1 mL of the same buffer for 10 min. Glutenins were extracted from the pellet at 60 °C for 30 min with 0.5 mL 25 mM borate, 50% 1-propanol, 1% (w/v) DTT (pH 8). The sample was centrifuged for 10 min (15,000 g) at 15°C._The pellet was washed twice with 0.5 mL of the same buffer for 10 min and all supernatants were pooled. The extract was filtered (Uptidisc RC 0.45 μηι) and 100 μΐ were alkylated with 4.6 μΐ 4-vinylpyridin at 60°C for 15 min. The alkylated extract was filtered again (Uptidisc RC 0.45 μιτι) before analysis.
Separation and quantification of glutenins was achieved using the Agilent 1290 Infinity LC system. 2 μΐ were injected for a separation with a C8 (3.5 μιη, 300 A) reversed phase Agilent Zorbax 300SB column at 50°C. Solvent A was 0.1% trifluoroacetic acid (TFA) in ultra-pure water and solvent B was 0.1% TFA in acetonitrile. Separation of the glutenins was performed by using a linear gradient 23- 42% B in 25 min with a 1 mL min"1 flow. Detection was performed by UV absorbance at 214 nm. After the gradient, the column was washed with 80% B for 3 min and then equilibrated at 23% B for 2 min, with the same flow rate as the gradient.
The gliadin and glutenin chromatograms were processed with Agilent ChemStation software. The signal from a blank injection (4 μί of 70% (v/v) ethanol) was subtracted from the chromatograms before integration.
7. Results
a) Gene expression i) Inhibition of SHP
The experiments realized in order to confirm the underexpression of the SHP gene have enabled to obtain an underexpression of the order of 60% of said gene. A second set of experiment has been performed in order to demonstrate the association between the inhibition of the SHP gene and an increased expression of the genes encoding seed storage proteins. As shown in figures 6 and 7, under a low nitrogen environement, we can see an overexpression of the genes encoding the glutenins and gliadins. Furthermore, as expected, the LMW-GS are more overexpressed than the other seed storage proteins. ii) Overexpression of SHP
The set of experiment for the overexpression of SHP gene has been realized by transforming plant cells with a nucleic acid construct comprising at least a nucleic acid sequence encoding the SHP gene operatively linked to a promoter. As expected, an overexpression of the order of 150% to over 200% (and even until 300%) was observed in said events. b) Protein analysis
The level of extinction caused by the RNAi construction in genetically modified (GM) plants was quantified (Fig. 1). At the beginning and mid-part of the linear phase of grain storage protein accumulation, the expression of SHP was 55% lower in the RNAi lines than in the null segregant lines. The extent of the extinction of SHP was lower (33%) at 600°Cdays after anthesis.
The quantity of total grain nitrogen and sulfur per grain and the protein composition was affected in SHP RNAi plants (Fig 2 and 3). Nitrogen and sulfur accumulation were increased from 450°Cdays after anthesis to maturity. At maturity, the total quantity of nitrogen per grain and the total grain protein content were 14% and 16% higher in the RNAi lines than in the null segregant lines, respectively (Table 3). The quantity of glutenin per grain was 15% higher in the RNAi lines than in the null
segregant lines. The LMW-GS contributed more (+19%) to the increase of the quantity of glutenins per grain in the RNAi lines than the HMW-GS, and as a consequence the HMW-GS to LMW-GS ratio was 11% lower in the RNAi lines than in the null segregant.
The partial silencing of SHP significantly increases the quantity of nitrogen. This leads to increase the quantity of grain proteins in the seed as illustrated by the increase of seed protein content while the grain dry mass is unchanged. Indeed, as the proteins have an amino acid content quite similar, the ratio between the nitrogen amount and the protein amount is constant in the order of 5.7 (Mosse J, Huet JC, Baudet J (1985) The amino acid composition of wheat grain as a function of nitrogen content, Journal of Cereal Science 3: 115-130).
The increase of the quantity of protein could be explained by the higher quantity of glutenin observed in RNAi plants. The composition of glutenins is also modified as illustrated by the HMW-GS to LMW-GS ratio.
As the quantity of sulfur is higher in modified plants than in null segregant, this probably favored the synthesis of LMW-GS in mature grains. Indeed, the sulfur is not present in every molecule. In the seed storage proteins, sulfur is preferably present in the low-molecular weight glutenins (LMW-GS). Seed storage proteins have an amount of sulfur which differs according to the type of the protein and therefore the availability in sulfur modifies importantly the composition in proteins. Thus, under limited sulfur conditions, the proportion of seed storage proteins which are low- sulfured (i.e. particularly High-Molecular Weigh glutenin (HMW-GS), omega-gliadins) increase which therefore impacts on the rheologic property of a dough.
To conclude, the RNAi leads also to a relative higher increase of the quantity of glutenins in comparison to other grain proteins, and especially from LMW-GS compared to HMW-GS. The increasing of the content of seed storage proteins and especially LMW-GS should impact the technological quality of the flour, by leading to an increase of the bakery force due essentially to the increase of extensibility more than of tenacity.
Table 3. Grain dry mass, grain nitrogen, grain protein content, grain sulfur, glutenin, low molecular weight glutenin subunits (LMW-GS) and high molecular weight glutenin subunits to low molecular weight glutenin subunits (HMW-GS) ratio; percentage of difference between SHP RNAi plants and null segregant for these phenotypes and p-value of the difference (Student t-test). Data are mean ± 1 s.d. The percentage change and the P-value (from unpaired t-test) are also given.
8. Phenotyping
The response of two SHP RNAi lines and two over-expressing lines to three contrasting treatments for nitrogen and sulfur supply will be evaluated (test of the effect of nitrogen or sulfur deficiency) and compared to control plants and/or reference plants (such as the spring wheat variety named Glenn).
Each independent transformation event will be assessed over two years in agronomic field conditions. Each year, two locations will be tested. Ideally, all tested events should be represented in each location. The test structure for a given event will comprise six plots of 9m2 considered as random repetitions. Thus, each event will be evaluated through the monitoring of 24 plots (2 years x 2 locations x 6 plots).
Phenotypical characters like, but not limited to, plant density, plant height at flowering, flowering date, yield or test weight will be assessed. More precisely, protein grain content and characteristics will be assessed.
Grains at six different developmental stages will be sampled and analysed for grain storage protein genes expression, nitrogen and sulfur contents and storage proteins composition. 9. Nucleotide variability of SHP promoter and genetic association
A set of 42 lines representative of the variability present in the core collection established in 2007 at INRA Clermont-Ferrand were sequenced to study the polymophisms present in the promoter regions of each SHP homoeolog. The sequences given were consensus sequences.
The figure 8 disclosed the observed consensus sequence for the promoter of A homoeolog (SEQ ID N°34), wherein the SNPs are indicated in bold (indicated by asterisk) and the 5'UTR and the initiation codon are in capital letters.
The figure 9 disclosed the observed consensus sequence for the promoter of B homoeolog (SEQ ID N°35), wherein the SNPs are indicated in bold (indicated by asterisk) and the 5'UTR and the initiation codon are in capital letters.
The figure 10 disclosed the observed consensus sequence for the D homoeolog (SEQ ID N°36), wherein the SNPs are indicated in bold (indicated by asterisk), the insertion- deletion polymorphisms are indicated by underlines and the 5'UTR and the initiation codon are in capital letters.
The results have shown that for the A homoeolog, a repeat domain is observed (underlined and double underlined sequences). Most lines have two repeats except
the line 5166 (Nepal84) which has one repeat, and the lines 2888 and 13812 (Belliei and Synthetic d'Altar) which have three repeats. In addition, we detected two SNPs (bold indicated by asterisks). Finally, the polymorphisms for the A homoeolog define 5 haplotypes (See. table 4). For the B homoeolog, we observed many polymorphisms (SNPs) defining at least 5 haplotypes but two are singleton (present in a single line) (See. Table 4). For the D homoeolog, we detected several SNPs (in bold indicated by asterisk) and 3 insertion-deletion polymorphisms (underlined). These polymorphisms give 3 haplotypes indicating a high level of linkage disequilibrium. In addition, as generally the polymorphisms are detected in few lines, the main haplotype (haplotype 1 in Table 4) is found in 38 lines out of 42.
Table 4 : haplotypes for the promoter regions for the three SHP homoeologs
Lines SHP_A SHP_B SHP_D
BT001 1 2 1
BT004 2 2 1
BT008 2 2 1
BT010 2 2 1
BT011 2 2 1
BT013 1 2 1
BT014 1 5 1
BT016 1 2 1
BT021 1 2 1
BT023 1 2 1
BT024c 1 2 1
BT025 1 2 2
BT027 2 2 1
BT028 5 2 1
BT029 1 2 1
BT034 1 2 1
BT035 2 2 2
BT038 1 2 1
BT041 1 2 1
BT044 1 2 1
BT045 1 2 1
BT046 3 2 3
BT009 3
BT032 2 3
BT039 3
BT040 3
BT047 3
BT002 4
BT003 1 1 1
BT005 1 1 1
BT006 1 1 1
BT007 3 1 . 1
BT012 1 1 1
BT017 1 4 1
BT019 4 1 1
BT022 2 1 1
BT031 2 1 1
BT033 1 1 1
BT042 1 1 1
BT043 1 1 1
BT030 1 nd 2
Nd. Not determinated
These different polymorphisms in the promoters of the SHP homoeologs will be studied. Grains will be sampled at three stages during SHP peak of expression to measure SHP level of expression and relate it to the sequence of its promoter. Mature grains will be analyzed for nitrogen content and storage proteins composition.
10. Analysis of the composition of plants overexpressing SHP a) Phenotyping of transgenic plants overexpressing (OE) SHP under conditions of population similar to the field conditions in glasshouses S2.
For purposes of seed increase and analysis of the overexpression of SHP, 10 events overexpressing SHP were multiplied in glasshouse S2 in 2011 with their null segregant (NS) (T3 grains). Samples of immature grains were produced in order to determine the expression level of SHP.
The analysis of the expression of the 3 copies of SHP, which was performed with generic primers that amplified simultaneously the three homeologous copies of the gene, showed under those conditions of culture that for 6 events overexpressing SHP, the gene was expressed in average 4.4 times more than the average of the NS, for 2 other events the gene was expressed in average 6 times more and for 2 further events the gene was expressed 7.2 times more than the NS (see Figure 11). b) Analysis during grain filling of 2 events overexpressing SHP under conditions of planting similar to the field conditions in glasshouse S2 at two levels of nitrogen Two events (homozygous line T4) overexpressing SHP (UW69n.l and UW71h.2) as well as a combination in equal proportion of their null segregants were cultivated in 2012 in glasshouse S2 at two levels of nitrogen during the grain filling phase (low and high nitrogen treatments, respectively noted N- and N+)
Samples were harvested at 250, 400, 500, 650, 850 and 1050°Cj after flowering. The expression of SHP was determined at 500°Cj after flowering. At maturity (1050°Cd), the grains were phenoted as described previously under section 9 of the examples.
The 2 events overexpressed SHP 3.9 and 6.7 times under N- and N+ conditions, respectively (see Figure 12).
Whereas the expression level of SHP was not different under the two nitrogen conditions for the NS, the expression level of SHP for the OE events was about two times higher for the N+ treatment than for the N- treatment.
This result may be explained by the fact that the transgene is under the control of a HMW-GS promoter which strongly responds to nitrogen.
During the N- treatment, the expression level of LMW-GS tended to decrease (-11.6%) (see Figure 13) like the expression level of Y-gliadins (-14.4%) in the OE plants (data not shown).
In both conditions, the glutenins level decreased significantly (-15% on average) in the OE lines compared to the NS. The total quantity of gliadins not being modified, the overexpression laid to a significant increase of the gliadin/glutenin ratio (+15 a 20%, see figure 14). The ratio HMW-GS / LMW-GS tended to increase in the N- condition. The proportions of various classes of gliadins were also modified (data not shown). For the two nitrogen treatments, an increase of the ω1,2- and a-gliadins was observed, whereas the proportion of Y-gliadin was not modified.
To resume, the differences linked to the treatment were significant for the expression level and the phenotype. The nitrogen treatments therefore proved significant.
The overexpression of SHP led to a significant decrease of the glutenin content, in particular in relation to the diminution of 2 classes of glutenin, this being observed in both nitrogen conditions. The quantity of gliadins was however not modified. Final ly, the HMW-GS/LMW-GS ratio was slightly increased in plants overexpressing SHP (see figure 15).
These results confirmed that the overexpression of SHP induced a modulation of the grain content, and more specifically of the composition of seed storage proteins in the grain.
It has therefore been demonstrated that the overexpression of SHP induces differences of composition in proteins (diminution of the quantity and proportion of glutenins, increase of the proportion of gliadins and of the gliadin/glutenin ratio).
11. Analysis of the natural variability of the SHP gene on the expression and phenotype of seed storage proteins The promoter of the 3 homeologous genes coding for SHP was sequenced in a sample of 42 lines representing the variability of the core collection. The homeologous B gene presents 3 principals haplotypes, on the contrary to the other two homeologous copies of the SHP gene.
Said homeologous B was therefore chosen to determine the influence of the main haplotypes of the SHP-B promoter on the expression of said gene and its potential targets (particularly seed storage proteins), and on the phenotype of the grain in term of content of the different fractions of the seed storage proteins. a) Analysis of the expression level
For two SHP-B haplotype, 3 lines were selected, said lines being identical along the region sequenced for SHP-A and SHP-D promoters. Said lines were sowed in January, wintered 8 weeks at 4°C and then planted in glasshouse. Grains were sampled at 4 stages of development (200, 300, 400 and 500°Cd after flowering) for measuring the expression of SHP and potential target genes. A sample was also done at maturity for studying the phenotype, particularly the composition in seed storage proteins. Samples were immediately frozen in liquid nitrogen and conserved at -80°C.
During this study, a simultaneous quantitative amplification was performed on the 3 homeologous copies of the SHP genes, for the homeologous A and B (SHP-A and SHP- B), as well as for the genes coding for potential targets.
Regarding said targets there was a particular interest in the expression of 3 homologous genes coding for the glutenin of high molecular weight (HMW-GS), low molecular weight glutenin (LMW-GS) and Y-, a- and ω-gliadins. For HMW-GS, we followed the expression of GluAl.l, GluBl.l et GluDl.l coding for the x units.
Four house-keeping genes were also amplified (18S, EFla, GAPDH et β-tubulin) to normalized the data.
For each analyzed gene, at each step, the expression was submitted to a variance analysis with one factor, the SHP-B haplotype. The averages were then compared with a Tukey test.
Results (data not shown)^
For SHP-B, the specific primers showed expression profiles sensitively identical between the 3 haplotypes. However, the comparison between haplotypes 2 and 3
showed the level of expression of this latter haplotype is slightly lower than that of haplotype 2. This is significant at 500 "Cd.
For the target genes, the expression level of LMW-GS was significantly affected by the haplotype of the SHP-B promoter, as well as the expression of the HMW-GS GluDl.l At last, the expression levels of the LMW-GS GluAl.l and of the gliadins were not affected in relation to the SHP-B promoter haplotype. b) Analysis of the phenotypes
Phenotyping was realized on mature grains. The measured characters were: the dry weight of the grain, the nitrogen quantity per grain, the protein concentration, the albumin-globulin quantity and the quantity and content in total glutenins, HMW-GS and LMW-GS, and the ratio HMW-GS / LMW-GS.
For the gliadins and the glutenins, the amount and content were measures either globally or with respect to different classes of proteins. Each variable was submitted to a variance analysis with 1 factor, the SHP-B- haplotype. The averages were then compared with a Tukey test.
Results (Data not shown)
Studying the 3 haplotypes showed that the grain weight was significantly affected by the haplotype of SHP-B whereas no differences were observed between haplotypes for neither the nitrogen quantity per grain nor the protein concentration.
Regarding the criteria of quantity and composition of the different proteins fractions, the quantities per grain and the proportions of albumine-globulin and glutenins, none were influenced by the SHP-B promoter, whereas we observed significant differences for the gliadins proportions (10%).
These results lead to significant differences of the gliadin/glutenin ratio which is important for the technological value of the flour.
In particular, the analysis of the composition showed that the increase of content of gliadins in the haplotype 3 was especially due to the increase of Y- and <jo5-gliadins in
said haplotype. Furthermore, regarding the composition in glutenins, we observed a significant diminution of the content of HMW-GS for the haplotype 3 which led to differences of HMS-GS/LMW-GS ratio, said ratio being also important for the technological value of flours.
It is thus demonstrated that the composition of gliadins and glutenins vary via a modification of the content of the various classes constituting said proteins therefore leading to significant modifications of gliadin/glutenin and HMW-GS/LMW-GS ratios.
In conclusion, Haplotype SHP-B significantly impacted ratios that characterize the technological value of flours. Furthermore, the genetic association results showed an effect on the protein content.
Claims
A method for producing a plant having a modulated content in seed proteins, preferably seed storage proteins, wherein said method comprises a step of modulating the expression of a Storage protein activator Heterodimerizing Protein (SHP) transcription regulator gene, an ortholog or a derivative thereof. The method according to claim 1, wherein said plant is a cereal, preferably selected from wheat, rye, rice, and sorgho, preferably wheat, but excepting barley and corn.
The method according to claim 1, wherein said plant is wheat and said seed storage proteins are selected in the group comprising glutenins and gliadins. The method according to any one of claims 1 to 3, wherein the content of seed proteins, preferably seed storage proteins, corresponds to the amount and/or composition of said proteins.
The method according to claim 4, wherein the amount of seed storage proteins is either increased or decreased, preferably of at least 0,1, percentage point, of at least 0,5 percentage point, and most preferably between 1,5 and 5 percentage point compared with a control plant.
The method according to claims 1 to 5, wherein an amino acid sequence of the SHP transcription regulator, an ortholog or a derivative thereof has at least 60%, preferably at least 65%, 70%, 75%, 80%, 85%, and most preferably at least 90%, 95%, 97%, 98% and 99%%, of identity with a sequence selected from the group comprising SEQ ID N°2, 4 and 6.
The method according to any one of claims 1 to 6, wherein modulating the expression of SHP gene, an ortholog or a derivative thereof is either realized by an increase of the expression and/or activity of said SHP, an ortholog or a derivative thereof, or by a total or partial inhibition of the expression and/or activity of said SHP gene, an ortholog or a derivative thereof.
The method according to claim 7, wherein the expression of said SHP gene, an ortholog or a derivative thereof is totally or partially inhibited, preferably by deletion, insertion and/or substitution of one or more nucleotides, site-specific
mutagenesis, ethyl methanesulfonate mutagenesis, TILLING or by gene silencing induced by RNA interference (RNAi), small interference RNA (siRNA), double strainded RNA (dsRNA), micro RNA (miRNA), hairpin, or by using methods such as VIGS.
9. The method according to claim 7, wherein said SHP gene, an ortholog or a derivative thereof is overexpressed.
10. The method according to any one of claims 1 to 9, wherein the overexpression of SHP gene, an ortholog or a derivative thereof is associated with a decreased amount of seed proteins, preferably seed storage proteins, and a total or partial inhibition of SHP gene, an ortholog or a derivative thereof is associated with an increased amount of seed proteins, preferably seed storage proteins.
11. The method according to any one of claims 1 to 10, wherein said method comprises the following steps :
a) transforming a plant host cell with an expression cassette according to claim 13 or an expression vector according to claim 14; and
b) culturing said transformed plant cell and producing one or more transgenic plant from said plant host cell, and
c) obtaining a plant with a modulated content of seed storage proteins.
12. A recombinant DNA or RNA for modulating the expression of SHP gene, an ortholog or a derivative thereof, said recombinant DNA or RNA being preferably an siRNA, a dsRNA, an miRNA, a sequence encoding a ribozyme or a sequence encoding SHP, a derivative, or an ortholog thereof.
13. A recombinant DNA or RNA for modulating the expression of the SHP transcription regulator gene, an ortholog or a derivative thereof according to claim 12, wherein said recombinant DNA or RNA enables to partially or totally inhibit the expression of said SHP gene, ortholog or derivative thereof and is selected in the group comprising but not limited to siRNA, dsRNA, miRNA and sequences encoding ribozymes.
14. An expression cassette for modulating the expression of SHP gene, an ortholog or a derivative thereof , said expression cassette comprising a recombinant DNA or RNA according to any one of claims 12 to 13.
15. An expression vector comprising an expression cassette according to claim 14.
16. A plant cell comprising an expression cassette according to claim 14 or an expression vector according to claim 15
17. A plant obtained from the method according to any of claims 1 to 11.
18. A transgenic plant comprising an expression cassette according to claim 14 or an expression vector according to claim 15.
19. A plant seed obtained from the plant according to any one of claims 17 or 18.
20. A plant or a descendent of a plant grown or otherwise derived from a seed according to claim 19.
21. A method for selecting a plant having a modulated content of seed proteins, preferably seed storage proteins, wherein said method comprises a step of measuring expression of the SHP transcription regulator gene, an ortholog or a derivative thereof and comparing said expression with the expression of said SHP gene, an ortholog or a derivative therein in a control plant, and another step of selecting a plant having a modulated expression of the SHP transcription regulator gene, an ortholog or a derivative thereof, said modulated expression being indicative of a modulated content of seed proteins, preferably seed storage proteins.
22. The method according to claim 21, wherein said step of selecting a plant having a modulated expression of the SHP gene, an ortholog or a derivative thereof preferably consists in a selection of a plant in which the SHP gene, the ortholog or the derivative thereof is partially or totally inhibited.
23. An isolated nucleic acid sequence encoding a wheat Storage protein activator Heterodimerizing Protein (SHP) transcription regulator, also known as SPA2.
24. The isolated nucleic acid sequence according to claim 23, wherein said nucleic acid sequence is selected in the group comprising SEQ ID N°l, 3 and 5.
25. Use of a plant as defined in any one of claims 17 or 18 for reducing the nitrogenous fertilizer intake.
26. Use of a plant seed as defined in claim 19 as human or food product.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EPEP11290619 | 2011-12-30 | ||
| EP11290619 | 2011-12-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013097940A1 true WO2013097940A1 (en) | 2013-07-04 |
Family
ID=47561509
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2012/005324 Ceased WO2013097940A1 (en) | 2011-12-30 | 2012-12-21 | Plants having a modulated content in seed proteins and method for production thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013097940A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016196489A1 (en) * | 2015-05-29 | 2016-12-08 | Arcadia Biosciences | Reduced gluten grains and compositions thereof |
| CN120738270A (en) * | 2025-08-29 | 2025-10-03 | 中国科学院遗传与发育生物学研究所 | TaPHYC-5A gene or biological material containing the gene and its application in regulating and controlling protein content in plant seed |
Citations (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| EP0672752A1 (en) | 1993-09-03 | 1995-09-20 | Japan Tobacco Inc. | Method of transforming monocotyledon by using scutellum of immature embryo |
| US5550318A (en) | 1990-04-17 | 1996-08-27 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
| US5633435A (en) | 1990-08-31 | 1997-05-27 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US5759829A (en) | 1986-03-28 | 1998-06-02 | Calgene, Inc. | Antisense regulation of gene expression in plant cells |
| US5780708A (en) | 1990-01-22 | 1998-07-14 | Dekalb Genetics Corporation | Fertile transgenic corn plants |
| US5981732A (en) | 1998-12-04 | 1999-11-09 | Isis Pharmaceuticals Inc. | Antisense modulation of G-alpha-13 expression |
| US6046321A (en) | 1999-04-09 | 2000-04-04 | Isis Pharmaceuticals Inc. | Antisense modulation of G-alpha-i1 expression |
| US6107091A (en) | 1998-12-03 | 2000-08-22 | Isis Pharmaceuticals Inc. | Antisense inhibition of G-alpha-16 expression |
| US6118047A (en) | 1993-08-25 | 2000-09-12 | Dekalb Genetic Corporation | Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction |
| WO2000063398A1 (en) | 1999-04-19 | 2000-10-26 | Rhobio | Plant transformation method |
| US6365354B1 (en) | 2000-07-31 | 2002-04-02 | Isis Pharmaceuticals, Inc. | Antisense modulation of lysophospholipase I expression |
| US6410323B1 (en) | 1999-08-31 | 2002-06-25 | Isis Pharmaceuticals, Inc. | Antisense modulation of human Rho family gene expression |
| US6566131B1 (en) | 2000-10-04 | 2003-05-20 | Isis Pharmaceuticals, Inc. | Antisense modulation of Smad6 expression |
| US6566135B1 (en) | 2000-10-04 | 2003-05-20 | Isis Pharmaceuticals, Inc. | Antisense modulation of caspase 6 expression |
| WO2005021765A2 (en) | 2003-08-27 | 2005-03-10 | Orf Liftaekni Hf. | Enhancing accumulation of heterologous polypeptides in plant seeds through targeted suppression of endogenous storage proteins |
| WO2007080516A1 (en) * | 2006-01-13 | 2007-07-19 | Meristem Therapeutics | Genetically modified maize with modified storage protein content |
-
2012
- 2012-12-21 WO PCT/EP2012/005324 patent/WO2013097940A1/en not_active Ceased
Patent Citations (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5759829A (en) | 1986-03-28 | 1998-06-02 | Calgene, Inc. | Antisense regulation of gene expression in plant cells |
| US5780708A (en) | 1990-01-22 | 1998-07-14 | Dekalb Genetics Corporation | Fertile transgenic corn plants |
| US5550318A (en) | 1990-04-17 | 1996-08-27 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
| US5633435A (en) | 1990-08-31 | 1997-05-27 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US6118047A (en) | 1993-08-25 | 2000-09-12 | Dekalb Genetic Corporation | Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction |
| EP0672752A1 (en) | 1993-09-03 | 1995-09-20 | Japan Tobacco Inc. | Method of transforming monocotyledon by using scutellum of immature embryo |
| US6107091A (en) | 1998-12-03 | 2000-08-22 | Isis Pharmaceuticals Inc. | Antisense inhibition of G-alpha-16 expression |
| US5981732A (en) | 1998-12-04 | 1999-11-09 | Isis Pharmaceuticals Inc. | Antisense modulation of G-alpha-13 expression |
| US6046321A (en) | 1999-04-09 | 2000-04-04 | Isis Pharmaceuticals Inc. | Antisense modulation of G-alpha-i1 expression |
| WO2000063398A1 (en) | 1999-04-19 | 2000-10-26 | Rhobio | Plant transformation method |
| US6410323B1 (en) | 1999-08-31 | 2002-06-25 | Isis Pharmaceuticals, Inc. | Antisense modulation of human Rho family gene expression |
| US6365354B1 (en) | 2000-07-31 | 2002-04-02 | Isis Pharmaceuticals, Inc. | Antisense modulation of lysophospholipase I expression |
| US6566131B1 (en) | 2000-10-04 | 2003-05-20 | Isis Pharmaceuticals, Inc. | Antisense modulation of Smad6 expression |
| US6566135B1 (en) | 2000-10-04 | 2003-05-20 | Isis Pharmaceuticals, Inc. | Antisense modulation of caspase 6 expression |
| WO2005021765A2 (en) | 2003-08-27 | 2005-03-10 | Orf Liftaekni Hf. | Enhancing accumulation of heterologous polypeptides in plant seeds through targeted suppression of endogenous storage proteins |
| WO2007080516A1 (en) * | 2006-01-13 | 2007-07-19 | Meristem Therapeutics | Genetically modified maize with modified storage protein content |
Non-Patent Citations (22)
| Title |
|---|
| CHICAS; MACINO, EMBO REPORTS, vol. 21, 2001, pages 992 - 996 |
| DATABASE EMBL [online] 4 April 2006 (2006-04-04), "Triticum aestivum cDNA clone rwhms13g19 3', Y.Ogihara unpublished cDNA library Wh_MS, mRNA sequence.", XP002676091, retrieved from EBI accession no. EM_EST:CJ566389 Database accession no. CJ566389 * |
| DATABASE EMBL [online] 4 April 2006 (2006-04-04), "Triticum aestivum cDNA clone whms13g19 5', Y.Ogihara unpublished cDNA library Wh_MS, mRNA sequence.", XP002676092, retrieved from EBI accession no. EM_EST:CJ673378 Database accession no. CJ673378 * |
| DE BLAERE ET AL., METHODS ENZYMOL., vol. 153, 1987, pages 277 |
| EDGAR, ROBERT C., NUCLEIC ACIDS RESEARCH, vol. 32, 2004, pages 1792 |
| FIUME ET AL., PLANTA, vol. 218, 2004, pages 639 - 703 |
| HANNON, NATURE, vol. 418, 2002, pages 244 - 251 |
| I. RUBIO-SOMOZA ET AL: "Ternary complex formation between HvMYBS3 and other factors involved in transcriptional control in barley seeds", THE PLANT JOURNAL, vol. 47, no. 2, 1 July 2006 (2006-07-01), pages 269 - 281, XP055026867, ISSN: 0960-7412, DOI: 10.1111/j.1365-313X.2006.02777.x * |
| KEIICHI MOCHIDA ET AL: "Tissue expression map of a large number of expressed sequence tags and its application to in silico screening of stress response genes in common wheat", MOLECULAR GENETICS AND GENOMICS, SPRINGER, BERLIN, DE, vol. 276, no. 3, 11 July 2006 (2006-07-11), pages 304 - 312, XP019428025, ISSN: 1617-4623, DOI: 10.1007/S00438-006-0120-1 * |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 |
| MCCALLUM ET AL., PLANT PHYSIOL., vol. 123, 2000, pages 439 - 442 |
| MOSSE J; HUET JC; BAUDET J: "The amino acid composition of wheat grain as a function of nitrogen content", JOURNAL OF CEREAL SCIENCE, vol. 3, 1985, pages 115 - 130 |
| NEDDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| OSSOWSKI ET AL., THE PLANT JOURNAL, vol. 53, 2008, pages 674 - 690 |
| PEARSON; LIPMAN, PROC. NATL. ACD. SCI., vol. 85, 1988, pages 2444 |
| RHAZI ET AL., JCS, 2009 |
| RUBIO-SOMOZA ET AL., PLANT JOURNAL, vol. 47, 2006, pages 269 - 281 |
| SCHWAB, METHODS MOL BIOL., vol. 592, 2010, pages 71 - 88 |
| SMITH; WATERMAN, AD. APP. MATH., vol. 2, 1981, pages 482 |
| WATSON; GRIERSON: "Transgenic Plants : Fundamentals and Applications", 1992, MARCEL DEKKER, pages: 255 - 281 |
| WEI ET AL., FUNCT INTEGR GENOMICS., vol. 9, 2009, pages 499 - 511 |
| WU ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 963 - 967 |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016196489A1 (en) * | 2015-05-29 | 2016-12-08 | Arcadia Biosciences | Reduced gluten grains and compositions thereof |
| CN107920488A (en) * | 2015-05-29 | 2018-04-17 | 阿凯笛亚生物科学公司 | Reduced gluten grains and compositions thereof |
| US10412909B2 (en) | 2015-05-29 | 2019-09-17 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| US10750690B2 (en) | 2015-05-29 | 2020-08-25 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| US10827703B2 (en) | 2015-05-29 | 2020-11-10 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| CN107920488B (en) * | 2015-05-29 | 2022-06-21 | 阿凯笛亚生物科学公司 | Reduced gluten cereal grain and compositions thereof |
| US11553659B2 (en) | 2015-05-29 | 2023-01-17 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| EP4282875A3 (en) * | 2015-05-29 | 2024-03-06 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| US12133494B2 (en) | 2015-05-29 | 2024-11-05 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| CN120738270A (en) * | 2025-08-29 | 2025-10-03 | 中国科学院遗传与发育生物学研究所 | TaPHYC-5A gene or biological material containing the gene and its application in regulating and controlling protein content in plant seed |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2729713C (en) | Recombinant dna constructs and methods for modulating expression of a target gene | |
| US9688984B2 (en) | SPL16 compositions and methods to increase agronomic performance of plants | |
| RU2644205C2 (en) | Plant regulatory elements and their application | |
| CN102428186B (en) | Transgenic plants comprising constructs encoding phosphoenolpyruvate carboxykinase and/or pyruvate ortho phos phate dikinase | |
| CN107208100A (en) | Plant nitrate transport albumen and application thereof | |
| US20120272406A1 (en) | Methods of modifying lignin biosynthesis and improving digestibility | |
| WO2019038417A1 (en) | Methods for increasing grain yield | |
| Luo et al. | The MYB family transcription factor TuODORANT1 from Triticum urartu and the homolog TaODORANT1 from Triticum aestivum inhibit seed storage protein synthesis in wheat | |
| US20190136247A1 (en) | Flowering time-regulating genes and related constructs and applications thereof | |
| WO2018215779A1 (en) | Methods for increasing grain productivity | |
| AU2018220084A1 (en) | Method for plant improvement | |
| US11525143B2 (en) | Method for promoting an increase in plant biomass, productivity, and drought resistance | |
| WO2016000236A1 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding nac3/onac067 polypeptides | |
| WO2014150879A1 (en) | Compositions and methods for increasing plant seed number and/or yield | |
| EP2195432B1 (en) | Plants having increased biomass | |
| CN111511916A (en) | Flowering phase regulation gene CMP1 and related vector and application thereof | |
| AU2012234910A1 (en) | Stress tolerant wheat plants | |
| US10626410B2 (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving low nitrogen tolerance genes | |
| US12559766B2 (en) | Peanut with reduced allergen levels | |
| US20170306346A1 (en) | Improved agronomic characteristics under water limiting conditions for plants expressing pub10 polypeptides | |
| WO2013097940A1 (en) | Plants having a modulated content in seed proteins and method for production thereof | |
| US20180066026A1 (en) | Modulation of yep6 gene expression to increase yield and other related traits in plants | |
| WO2015150412A1 (en) | Transgenic plants with increased number of fruits and seeds and method for obtaining thereof | |
| Class et al. | Patent application title: METHOD FOR PROMOTING AN INCREASE IN PLANT BIOMASS, PRODUCTIVITY, AND DROUGHT RESISTANCE | |
| AU2012221888A1 (en) | Plant protease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12815997 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12815997 Country of ref document: EP Kind code of ref document: A1 |

