WO2013082237A1 - Compositions and methods for the treatment of viral infections - Google Patents
Compositions and methods for the treatment of viral infections Download PDFInfo
- Publication number
- WO2013082237A1 WO2013082237A1 PCT/US2012/066978 US2012066978W WO2013082237A1 WO 2013082237 A1 WO2013082237 A1 WO 2013082237A1 US 2012066978 W US2012066978 W US 2012066978W WO 2013082237 A1 WO2013082237 A1 WO 2013082237A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rpl40
- virus
- translation
- viral
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- Translation initiation in eukaryotes proceeds generally by a cap-dependent scanning mechanism.
- the rate limiting step in this process is recognition of the 5'- m 7 GpppN mRNA cap structure by eIF4E (Gingras, A.C., et al. (1999) Annu Rev Biochem 68:913-963).
- This recruits the small 40S subunit in complex with initiation factors which then scan along the mRNA until it reaches the start codon (AUG), at which time the initiation factors are released, the large 60S subunit joins, and an elongation competent 80S complex is formed (Jackson, R.J., et al. (2010) Nat Rev Mol Cell Biol 11 : 113-127; Jackson, R.J., and Kaminski A. (1995) RNA 1:985-1000).
- Poliovirus mRNA contains an
- IVS internal ribosome entry sites
- MEl 14404782v.l paralysis virus remarkably do not require any initiation factors or the initiating methionine tRNA (Sasaki, J., and Nakashima, N. (1999) J Virol 73:1219-1226; Sasaki, J., and Nakashima, N. (2000) Proc Natl Acad Sci USA 97: 1512-1515; Wilson, J.E., et al. (2000) Cell 102:511-520).
- VSV Vesicular stomatitis virus
- Rhabdoviridae a family of broadly distributed plant, animal and human pathogens that includes rabies virus.
- VSV infection results in a profound inhibition of host protein synthesis. This is achieved in part by induction of the hypophosphorylation of eIF4E-Binding Protein 1 (4E-BP1), causing sequestration of eIF4E and halting formation of the eIF4F cap-binding complex
- VSV infection also interferes with the processing of the 45S precursor ribosomal RNA to 28S and 18S ribosomal RNA, thus diminishing the pool of mature ribosomal RNA (Zan, M., et al. (1990) Virology 111, 75- 84).
- the viral matrix protein (M) impedes export of ribosomal RNA from the nucleus by inhibition of both the Rael mRNP export pathway and by blocking transcription of ribosomal RNA (Ahmed, M., and Lyles, D.S. (1998) J Virol 72:8413-8419; Faria, P.A., et a/. (2005) Mol Cell 17:93-102).
- M viral matrix protein
- VSV protein synthesis is unaffected by eIF4E sequestration, rapamycin treatment, hypoxic conditions, and eIF4G cleavage (Rose, J.K., and Lodiah H.F. (1976) Nature 262:32-37; Welnowska, E., et al. (2009) J Mol Biol 394:506-521 ; Muthukrishnan, S., et al. (1976) Biochemistry 15:5761-5768; Connor, J.H., et al. (2004) J Virol 78:8960-8970).
- the present invention is based, at least in part, on the discovery that inhibition of specific ribosomal proteins nonetheless permits translation of VSV mRNAs during host translation shutoff.
- VSV mRNA translation depends specifically on a 60S ribosomal protein, rpL40.
- RpL40 is not essential for bulk cellular or cap-independent translation, but is necessary for replication of VSV and other viruses within the order Mononegavirales, independent of its role in providing ubiquitin.
- viral translation requires rpL40 for positioning of the 40S at the mRNA start codon and rpL40 function in this pathway occurs as part of the ribosome.
- Polysome analyses and in vitro reconstitution of initiation demonstrate that rpL40 is required for 80S formation on VSV mRNAs through a ds-regulatory element.
- the present invention provides methods and compositions for the treatment of viral infections and for modulating, e.g., inhibiting, the activity of rpL40.
- the present invention provides methods of treating a viral infection or at risk of developing a viral infection.
- the methods include contacting the organism with an effective amount of an agent which inhibits the activity of rpL40, thereby treating the viral infection in the organism.
- the activity of rpL40 may be transcript-specific translation initiation of a viral mRNA and/or movement of the 40S ribosome subunit to the translation initiation site of a viral mRNA.
- the rpl40 is a component of a large ribosomal subunit.
- the agent for use in the methods of the invention is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
- the viral infection may be infection with a virus of the order Mononegavirales, such as a member of the family Bornaviridae , Rhabdoviridae, Filoviridae, and
- the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
- the viral infection is an acute viral infection.
- the methods of the invention may further comprising contacting the organism with an additional therapeutic agent.
- the organism is a human subject. In another embodiment, the organism is a non-human subject. In yet another embodiment, the organism is a plant.
- the present invention provides methods of inhibiting viral replication in a host cell infected with a virus.
- the methods include contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40, thereby inhibiting viral replication in the host cell.
- the present invention provides methods of inhibiting translation of a viral mRNA in a host cell infected with a virus.
- the methods include contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40, thereby inhibiting translation of the viral mRNA in the host cell.
- the activity of rpL40 may be transcript-specific translation initiation of the viral mRNA, movement of the 40S ribosome subunit to the translation initiation site of the viral mRNA, cap-dependent mRNA translation and/or not bulk cellular translation,
- the rpl40 is a component of a large ribosomal subunit.
- the agent for use in the methods of the invention is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
- the viral infection may be infection with a virus of the order Mononegavirales, such as a member of the family Bornaviridae , Rhabdoviridae , Filoviridae, and
- the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
- the present invention provides methods of identifying a compound useful in inhibiting viral replication in a host cell infected with a virus.
- the methods include providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof, contacting the indicator composition with each of a member of a library of test compounds, and selecting from the library of test compounds a compound of interest that inhibits the activity of rpL40, thereby identifying a compound useful in inhibiting viral replication in a host cell infected with a virus.
- the present invention provides methods of identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus.
- the methods include providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof, contacting the indicator composition with each of a member of a library of test compounds, and selecting from the library of test compounds a compound which inhibits the activity of rpL40, thereby identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus.
- Figures 1A - IF depict that RpL40 is required for VSV gene expression.
- A Fluorescence microscopy of cells transfected with a non-targeting (NT) siRNA or indicated ribosomal protein-targeting siRNA and infected with VSV-eGFP. Nuclei are Hochst stained (light gray).
- B Rescue of VSV replication by exogenous expression of rpL40. HeLa cells were cotransfected with pcDNA3.1-rpL40, encoding a wild type or siRNA resistant form of the gene, and either NT or rpL40 targeting siRNA. Cells were infected and examined by epifluorescence microscopy.
- C Fluorescence microscopy of cells transfected with a non-targeting (NT) siRNA or indicated ribosomal protein-targeting siRNA and infected with VSV-eGFP. Nuclei are Hochst stained (light gray).
- B Rescue of VSV replication by exogenous expression of rpL40
- luciferase activity was normalized to activity from cells treated with a NT siRNA. The results are given as the mean + SD of three independent experiments performed in triplicate.
- D VSV primary transcription in rpL40 siRNA transfected cells. Abundance of VSV N mRNA was measured by quantitative RT-PCR. The results are given as the mean + SD from a single representative quantitative RT-PCR experiment performed in duplicate.
- E Viral RNA synthesis in infected cells treated with rpL40 siRNA. Total [ 3 H]-uridine-labeled cellular RNA was analyzed by electrophoresis on an acid-agarose gel.
- F Quantitative RT-PCR of total viral RNA synthesis. Results were analyzed as in D.
- FIGS 2 A - 2H depict that RpL40-dependent translation is transcript-specific.
- A VSV protein synthesis. Total [ 35 S]-methionine-cysteine-labeled cytoplasmic proteins were analyzed by SDS-PAGE and detected by phosphorimager. Transfection of cells with non-targeting (NT) or rpL40-targeting siRNA is indicated.
- B Schematic diagram of bicistronic CrPV IRES construct. Translation of firefly luciferase is cap-dependent, while translation of renilla luciferase is driven by the CrPV IRES.
- C Firefly luciferase protein synthesis driven from pFR-CrPV.
- Firefly luciferase was measured from pFR- CrPV transfected ly sates at 12 h post- transfection and normalized to luciferase units from NT treated cells. The results are given as the mean + SD of three independent experiments each performed in triplicate.
- D Renilla luciferase protein synthesis driven from pFR-CrPV. Luciferase levels were measured and normalized as in C.
- Poliovirus protein synthesis Cells were infected and total cytoplasmic proteins were analyzed as in A. F. Microscopy of cells infected with rabies virus-mCherry. G.
- FIG. 3A - 3F depict that RpL40 is required for translation initiation on VSV niRNAs as a constituent of the large subunit.
- C Sedimentation profile of VSV-infected siRNA-transfected cells.
- D Distribution of VSV N mRNA with ribosomal complexes in cells depleted of rpL40. Lysates were resolved and fractionated and mRNA distribution was determined as in B.
- E Translation of cellular or VSV-derived luciferase mRNA in yeast extracts expressing or lacking rpL40. Cytoplasmic mRNA was isolated from cells transfected with a luciferase expression plasmid (pRL-CMV), or cells infected with rVSV-Luc, and used to program yeast extracts. The results are given as the mean + SD of three independent experiments performed in triplicate.
- F Distribution of rpL40 with ribosomal complexes in VSV-infected cells.
- Figures 4A - 4E depict that RpL40-dependent translation is utilized by select cellular mRNAs.
- A Functional classification of niRNAs whose polysome association is altered upon rpL40 depletion. The gene in each category whose association was polysomes was most decreased upon knockdown of rpL4Q is listed.
- B Levels of polysome-associated CLGl mRNA upon rpL40 depletion identified by sequencing analysis.
- C Levels of polysome-associated DDR2 mRNA identified by sequencing analysis. Average Reads Per Kilobase of exon per Million mapped reads (RPKM) from biological replicates is graphed in B and C.
- D In vitro translation of CLGl mRNA.
- FIGS 5A - 5D depict that RpL40 is required for VSV replication.
- A VSV gene expression following rpL40 siRNA treatment. HeLa cells were reverse transfected with a control non-targeting siRNA (NT) or one of two rpL40-targeting siRNAs (rpL40- 1, -2) and seeded onto coverslips. At 48 h post-transfection, cells were infected with rVS V-eGFP at a MOI of 1 , fixed at 6 hpi, and examined by epifluorescence microscopy.
- B Analysis of rpL40 mRNA levels by RT-PCR.
- RNA levels in the cell extracts were also performed.
- FIGS 6A - 6E depict that sensitivity of VSV to rpL40 depletion does not reflect defects in ribosome biogenesis and maturation.
- A Accumulation of mature ribosomal RNAs in cells treated with rpL40 siRNA. RNA was labeled with [ 3 H] -uridine for 2 h. Cytoplasmic RNA was purified by phenol/chloroform extraction and analyzed by electrophoresis on an acid-agarose gel.
- B Accumulation of mature ribosomal RNAs in rVSV-M51R infected cells. Cells were mock-infected or infected at an MOI of 1 with VSV or rVSV-M51R. At 3 hpi, RNA was labeled and analyzed as in A.
- C rVSV-
- Figures 7 A - 7C depict reproducibility of RPKM between biological replicates.
- Figure 8 depicts localization of rpL40 on the 80S ribosome. Localization of rpL40 on the crystal structure of the 80S ribosome. Ribosomal proteins are colored medium gray and ribosomal RNAs are colored light gray. RpL40 is colored dark gray (PDB 2XZM, 4A17, 3A19) (Klinge, S., et al. (2011) Science 334:941-948). N and C- termini are indicated in the two rotated views of rpL40.
- Figure 9 depicts an alignment of rpL40 sequences.
- Genbank IDs are: H. sapien (AAI01833.1) (SEQ ID NO: 6), S. cerevisiae (CAA86130.1) (SEQ ID NO: 3), M. fascicularis (P0C273.2) (SEQ ID NO: 7), B. taurus (DAA28295.1) (SEQ ID NO: 8), S. scrofa (NP_999376.1) (SEQ ID NO: 9), M.
- musculus (NP_063936.1) (SEQ ID NO: 10), F. "koz” catus (NP_001116826) (SEQ ID NO: 11), A. melanoleuca (AEA39530.1) (SEQ ID NO: 12), D. melanogaster (NP_476776.1) (SEQ ID NO: 13), E. complanata (ABW23236) (SEQ ID NO: 5), S. japonicum (226477078) (SEQ ID NO: 2), C. reinhardtii (EDO98280.1) (SEQ ID NO: 4), S. solfataricus (Q980V5.1) (SEQ ID NO: 1).
- Figure 10 is a Table showing an SiRNA screen of ribosomal proteins required for VSV replication. Ribosomal proteins are grouped by phenotype of knockdown as indicated.
- Figure 11 is a Table showing a list of cellular transcripts whose polysome association was reduced by more than 3-fold upon depletion of rpL40.
- Figures 12A-12B depict that rpL40 regulation of 40S scanning on VSV mRNA is ribosome-mediated.
- Translation inhibitors m 7 GpppA [ImM] (lanes 6 and 9), GMP-PNP [ImM] (lanes 7 and 10), or hygromycin B (HygB) [2mg/ml] (lanes 8 and 11) were added to yeast extracts for 3 minutes at 25°C before addition of mRNA. Initiation complexes were allowed to form on mRNA for 15 minutes at at 25°C and positions of ribosomal complexes on these mRNAs was determined by primer extension. Full length cDNA is marked at "5 ' end,” and position of the AUG along the toe print corresponding to a stop at 15-17 nucleotides from initiator AUG is indicated.
- Lanes G, T, A, and C represent the positive strand sequence of VSV N mRNA synthesized using the same VSV N primer.
- B Primer extension inhibition "toe printing” assay. Reverse transcription on VSV N mRNA using a radiolabeled primer produces an 80 nucleotides product. Binding of the 40S or 80S complex, which covers about 25-30 nucleotides, at the AUG leads to a block in primer extension and a 51 nucleotide toe print.
- Figure 13 is a Table showing the results of an siRNA screen of ribosomal proteins required for VSV replication.
- HeLa cells were transfected with pools of four siRNAs targeting each of the individual ribosomal protein genes.
- cells were infected with a reporter VSV (rVSV-eGFP) that expresses eGFP as a marker of infection. Percent viability and infection was calculated relative to total number of cells and number of infected cells, respectively, in cells transfected with a non- targeting siRNA. Each transfection was performed in duplicate (A, B). DETAILED DESCRIPTION OF THE INVENTION
- the present invention is based, at least in part, on the discovery that inhibition of specific ribosomal proteins allows translation of VSV mRNAs during host shutoff.
- VSV mRNA translation depends specifically on a 60S ribosomal protein, rpL40.
- RpL40 is not essential for bulk cellular or cap- independent translation, but is necessary for replication of VSV and other viruses within the order Mononegavirales, independent of its role in providing ubiquitin.
- viral translation requires rpL40 for positioning of the 40S at the mRNA start codon and rpL40 function in this pathway occurs as part of the ribosome.
- the present invention provides methods and compositions for the treatment of viral infections and methods for modulating, e.g., inhibiting, the activity of rpL40.
- an element means one element or more than one element, e.g., a plurality.
- rpL40 refers to the structural component of the large 60S subunit of the eukaryotic ribosome that is encoded as a C-terminal extension of ubiquitin.
- the ubiquitin is cleaved from the protein and is not necessary for ribosomal function (see, e.g., Finley, D., et al. (1989) Nature 338:394-401 ; Monia, .P.,et al. (1989) J Biol Chem 264:4093-4103).
- RpL40 is also referred to as "ubiquitin A-52 residue ribosomal protein fusion product", “60S ribosomal protein L40", “CEP52”, “ubiquitin carboxyl extension protein 52”, “ubiquitin-52 amino acid fusion protein”, “ubiquitin-60S ribosomal protein L40", “ubiquitin-CEP52", and "UBCEP2".
- RpL40 is encoded by the UBA52 gene.
- variants of human ubiquitin-60S ribosomal protein L40 precursor There are two transcript variants of human ubiquitin-60S ribosomal protein L40 precursor and the nucleotide and amino acid sequences of both are known. Variants 1 and 2 encode the same protein.
- the nucleotide sequence of human ubiquitin-60S ribosomal protein L40 precursor variant 1 may be found in, for example, GenBank Accession No. GI:77539054 and is the longer of the two variants.
- Nucleotides 368-520 of variant 1 encode rpL40.
- the amino acid sequence of variant 1 may be found at, for example, GenBank
- nucleotide sequence of human ubiquitin-60S ribosomal protein L40 precursor variant 2 may be found in, for example, GenBank Accession No.
- variant 2 is the predominant variant which uses an alternate splice site in the 5' UTR, compared to variant 1.
- the amino acid sequence of this shorter sequence variant (2) may be found at, for example, GenBank Accession No. GI:4507761. Amino acid residues 77-128 of variant 2 in GI:4507761 encode rpL40. The entire contents of each of the foregoing are expressly incorporated herein by reference.
- nucleotide and amino acid sequences of homologues, e.g., orthologues, of rpL40 are known and include, for example,GenBank Accession No. 01:332854146 (chimpanzee); 01:224994157 (dog); GI: 115496707 (cattle); 01: 166064012 (rat);
- 01:71996854 C. elegans
- 01:67999975 and 01:68000562 S. pombe
- 01:296145625 and 01:296146464 S. cerevisiae
- 01:50302182 K. lactis
- 01:47074802 ⁇ . gossypii
- 01:145603447 M. oryzae
- 01: 164429239 N. crassa
- 01: 145360668 (thale cress); 01: 115451756 (rice); 01: 124514025 ⁇ Plasmodium);
- homologues may be identified using methods routine to one of ordinary skill in the art and as described herein.
- a homologue, e.g., an ortholog, of rpL40 may be isolated by screening libraries with probes containing nucleotide sequences encoding, for example, human rpL40.
- Numerous other methods known in the art are available for cloning the homologues of rpL40.
- antibodies to rpL40 which are commercially available may be used to screen expression libraries.
- rpL40 homologues e.g., othologues
- othologues may be identified by performing a reciprocal blast search. Also see, e.g., U.S. Patent Publication No. 20020039763, the entire contents of which are hereby incorporated by reference.
- the identification of the cloned proteins as homologues, e.g., orthologs, may be established by performing the same biological assays as those described in the Examples herein.
- rpL40 activity As used herein, the term “rpL40 activity”, “rpL40 biological activity”, or “activity of an rpL40 polypeptide” includes an activity which can be modulated, e.g., inhibited, by modulating, e.g., inhibiting, the expression and/or activity of rpL40.
- an rpL40 biological activity includes modulation of viral replication.
- Exemplary rpL40 activities include, e.g., modulating, translation of a viral mRNA infecting a host cell, movement or positioning of the 40S ribosome subunit to the translation initiation site of a virus mRNA infecting a host cell, modulation of viral infection, and/or modulation of transcript- specific translation initiation of an infecting viral mRNA.
- transcript-specific translation initiation refers to the ability of rpL40 to participate in the movement or positioning of the 40S ribosome subunit to the translation initiation site of a virus mRNA, inhibition of which inhibits viral mRNA translation without inhibiting host cellular translation such that host cell proliferation and/or viability is essentially unaffected.
- the agent "selectively inhibits" replication of a virus in a host cell, translation of a viral mRNA infecting a host cell, sequence-specific translation initiation, and/or movement of the 40S ribosome subunit to the translation initiation site of a virus mRNA infecting a host cell.
- selective inhibiting refers to the ability of an agent for use in the methods described herein to inhibit the viral replication cycle activity of rpL40 without inhibiting host protein synthesis activity of rpL40 such that the cell is no longer viable.
- modulate include stimulation (e.g., increasing or upregulating a particular response or activity) and inhibition (e.g., decreasing or downregulating a particular response or activity).
- the term “inhibit” refers to a decrease in a biological activity of rpL40.
- the term “inhibit” refers to the ability to downmodulate the expression, stability, and/or activity of rpL40 as described herein.
- agent that inhibits the activity of rpL40 or an “inhibitor of rpL40” is any compound or molecule that inhibits the expression and/or biological activity of rpL40.
- agents suitable for use in the methods of the invention include interfering nucleic acid molecules (e.g., antisence RNAs, shRNAs, and siRNAs), intracellular antibodies, inhibitory peptides, or small molecules. Agents for use in the methods of the invention are discussed in detail below.
- organism refers to living things (plants, non-human animal subjects, and human subjects) that would be benefited by the methods of the invention and are to be treated by the methods of the present invention.
- An organism includes one that has a viral infection or is at risk of having a viral infection.
- an organism, such as a human that has been bitten by an animal suspected of being rabid is at risk of developing rabies and, thus, would benefit from the methods of the invention.
- administering includes any method of delivery of a pharmaceutical composition or agent into an otganism' s system or to a particular region in or on an organism.
- the term "contacting" includes incubating the compound and the, e.g., cell, together in vitro (e.g., adding the compound to cells in culture) as well as administering the compound to an organism such that the compound and cells of the organism are contacted in vivo.
- treating refers to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms, diminishing the extent of infection, stabilized (i.e., not worsening) state of infection, amelioration or palliation of the infectious state, whether detectable or undetectable.
- Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.
- the present invention provides methods for treating or preventing a viral infection in an organism having a viral infection or at risk of developing a viral infection.
- the methods include, contacting the organism with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby treating or preventing the viral infection in the organism.
- the present invention also provides methods of inhibiting viral replication in a host cell infected with a virus.
- the methods include contacting the host cell with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby inhibiting viral replication in the host cell.
- methods of inhibiting translation of a viral mRNA in a host cell include contacting the host cell with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby inhibiting translation of the viral mRNA in a host cell.
- the organism, host cell, and/or virus are contacted with the agent in such amounts and for such time as is necessary to achieve the desired result.
- Organisms that would benefit from the methods of the invention are those that are infected or at risk of being infected with non-segmented negative-sense RNA viruses and include plants, animals (non-human subjects), and humans.
- Plants include, but are not limited to domesticated plants, such as corn, barley, lettuce, wheat, potato, and rice.
- Non-human subjects include but are not limited to animals such as, for example, domesticated animals, such as livestock and pets, and wild animals, e.g., bird, rodent, bat, cat, dog, goat, cow, buffalo, pig, chicken, horse, whale, dolphin and porpoise.
- an organism is a human.
- an organism is a non-human subject.
- an organism is a plant.
- Viral infections that may be treated by the methods of the invention include infections with a non-segmented negative-sense RNA virus, such as members of the order Mononegavirales.
- the Mononegavirales order includes four families:
- a number of diseases are caused by viruses of the order Mononegavirales.
- the methods of the invention also include treatment of a disease which is the result of infection of an organism with any one of the viruses listed in the table above, such as, for example, Newcastle disease, measles, canine distemper, mumps, rabies, and Ebola.
- a disease which is the result of infection of an organism with any one of the viruses listed in the table above, such as, for example, Newcastle disease, measles, canine distemper, mumps, rabies, and Ebola.
- the present invention provides methods for treating a subject having or at risk of developing rabies.
- the methods include contacting the subject having or at risk of developing rabies with an effective amount of an agent which moduates, e.g., inhibits, the expression and/or activity of rpL40, thereby treating the subject having or at risk of developing rabies.
- An "organism or subject at risk of having a viral infection" is one that has a probability of being infected given that exposure to the virus has occurred or has
- the methods are useful for treating an "acute viral infection", such as an acute viral infection of an organism with a virus from the order Mononegavirales.
- an "acute viral infection” or an “acute infection” is an infection of a host or host cell with a virus that is typically cleared from the subject (e.g., an organism that is not immunocompromised) by the innate and adaptive immune systems.
- the methods of the invention are not useful for the treatment of a "persistent viral infection” or a "persistent infection”.
- the methods of the invention are useful for the treatment of a "persistent viral infection” or a "persistent infection”.
- a persistent infection is one in which the virus is not cleared from the host after the initial infection. Persistent infections are characterized by the continual presence of the infectious organism often as a latent infection with occasional recurrent relapses of active infection.
- Clearance of a virus may be determined by, for example methods known in the art for determining, for example, the presence in the organism of the virus, e.g., using ELISA assays for various surface antigens of the virus.
- persistent infections include, but are not limited to, hepatitis, herpes, infectious mononucleosis, Cytomegalovirus (CMV), and HIV infections. See, for example, Medical Microbiology, 4th edition. Chapter 46, "Persistent Viral Infections.” Baron S, editor. Galveston (TX): University of Texas Medical Branch at Galveston; 1996.
- CMV Cytomegalovirus
- an effective amount of the inihibitory agents of the present invention is an amount effective, at dosages and for periods of time necessary to achieve the desired result.
- An effective amount of the inhibitory agent is also that amount which does not significantly affect the viability of the host cell, e.g., does not kill the organism.
- an effective amount of an inhibitory agent may vary according to factors such as the disease state, age, sex, reproductive state, and weight, and the ability of the agent to elicit a desired response in the organism. Dosage regimens may be adjusted to provide the optimum response. For example, several divided doses may be provided daily or the dose may be proportionally reduced as indicated by the exigencies of the situation.
- an “effective amount” or “therapeutically effective amount” of an agent which inhibits the expression and/or activity of rpL40 is an amount sufficient to produce the desired effect, e.g. , an inhibition of expression of a viral mRNA in comparison to the normal level of expression and/or activity detected in the absence of the inhibitory agent. Inhibition of expression and/or activity of rpL40 is achieved when the value obtained with an inhibitory agent relative to the control is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%.
- Suitable assays for measuring expression and/or activity of rpL40 are known in the art and described herein and include, e.g., examination of protein or RNA levels using techniques known to those of skill in the art such as dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays described herein and known to those of ordinary skill in the art.
- “Inhibiting the expression and/or activity of rpL40” or “inhibiting the activity of rpL40” refers to the ability of an inhibitory agent of the invention to silence, reduce, or inhibit the activity and/or expression of rpL40.
- a test sample e.g., a sample of cells in culture expressing the target gene (rpL40) and infected with a virus
- a test organism e.g., a mammal such as a human or an animal model such as a rodent (e.g., mouse) or a non-human primate (e.g., monkey) model
- an inhibitory agent that silences, reduces, or inhibits activity and/or expression of rpL40.
- Expression and/or actvitiy of rpL40 in the test sample or test animal is compared to expression and/or activity of rpL40 in an appropriate control sample (e.g., a sample of cells in culture expressing rpL40) or a control organism (e.g., a mammal such as a human or an animal model such as a rodent (e.g., mouse) or non- human primate (e.g., monkey model) that is not contacted with or administered the inhibitory agent.
- the expression and/or activity of rpL40 in a control sample or a control organism may be assigned a value of 100%.
- silencing, inhibition, or reduction of expression and/or activity of rpL40 is achieved when the level of rpL40 expression and/or activity in the test sample or the test organism relative to the level of rpL40 expression and/or activity in the control sample or the control organism is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%.
- the inhibitory agents of the present invention are capable of silencing, reducing, or inhibiting the expression and/or activity of rpL40 by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% in a test sample or a test sample relative to the level of rpL40 expression and/or activity in a control sample or a control organism not contacted with or administered the inhibitory agent.
- Suitable assays for determining the level of rpL40 expression and/or activity include, without limitation, examination of protein or mRNA levels using techniques known to those of skill in the art, such as, e.g., dot blots, Northern blots, in situ hybridization, ELISA,
- the inhibitory agents of the present invention may be administered in an amount effective to achieve a desired result and/or at a dose that is sufficient to elicit a detectable immune response in an organiosm based on the mode of administration and without significant adverse side effects.
- Dose administration can be repeated depending upon the pharmacokinetic parameters of the dosage formulation and the route of administration used. It is also provided that certain formulations containing an inhibitory agent are to be administered orally. Such formulations are preferably encapsulated and formulated with suitable carriers in solid dosage forms. Some examples of suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, calcium silicate, microcrystalline cellulose,
- olyvinylpyrrolidone cellulose, gelatin, syrup, methyl cellulose, methyl- and
- the formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents.
- the compositions may be formulated so as to provide rapid, sustained, or delayed release of the active ingredients after administration to the organism by employing procedures well known in the art.
- the formulations can also contain substances that diminish proteolytic degradation and/or substances which promote absorption such as, for example, surface active agents.
- compositions e.g., parenteral compositions
- dosage unit form refers to physically discrete units suited as unitary dosages for the organisms to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individual organisms.
- the specific dose can be readily calculated by one of ordinary skill in the art, e.g.
- the approximate weight e.g., body weight, or surface area of the organism or the volume of space to be occupied.
- the dose will also be calculated dependent upon the particular route of administration selected. Further refinement of the calculations necessary to determine the appropriate dosage for treatment is routinely made by those of ordinary skill in the art. Such calculations can be made without undue experimentation by one skilled in the art in light of the activity disclosed herein in assay preparations of target cells. Exact dosages are determined in conjunction with standard dose-response studies.
- the amount of the composition actually administered will be determined by a practitioner, in the light of the relevant circumstances including the condition or conditions to be treated, the choice of composition to be administered, the age, weight, and response of the individual organism, the severity of the organism's symptoms, and the chosen route of administration.
- Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental plant and/or animal models, e.g. for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- agents or pharmaceutical compositions of the present invention can be administered by any suitable route known in the art including for example intravenous, subcutaneous, intramuscular, transdermal, intrathecal or intracerebral or administration to cells in ex vivo treatment protocols, or delivered on a surface, e.g., a biocompatible surface. Administration can be either rapid as by injection or over a period of time as by slow infusion or administration of slow release formulation.
- the methods of the invention are short-term courses of therapy.
- an organism may be contacted (or administered) an agent of the invention for about 1 day, 2, 3, 4, 5, 6, or 7 days.
- the methods further comprise the administration of an additional thereapeutic agent, such as, for example, and antiinflammatory or an anti-viral drug.
- anti- viral drugs include abacavir, aciclovir, acyclovir, adefovir, amantadine, amprenavir, arbidol, atazanavir, atripla, cidofovir, combivir, darunavir, delavirdine, didanosine, docosanol, edoxudine, efavirenz, emtricitabine, enfuvirtide, entecavir, entry inhibitors, famciclovir, fixed dose combinations, fomivirsen, fosamprenavir, foscarnet, fosfonet, fusion inhibitors, ganciclovir, ibacitabine, immunovir, idoxuridine, imiquimod, indinavir, inosine, integrase inhibitors,
- IFN-a such as PEGylated IFN-a, IFN- ⁇ , IFN-K, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , and IFN- ⁇ ), interferon, lamivudine, lopinavir, loviride, MK-0518, maraviroc, moroxydine, nelfinavir, nevirapine, nexavir, nucleoside analogues, oseltamivir, penciclovir, peramivir, pleconaril, podophyllotoxin, protease inhibitors, reverse transcriptase inhibitors, ribavirin, rimantadine, ritonavir, saquinavir, stavudine, synergistic enhancers, tenofovir, tenofovir disoproxil, tipranavir, trifluridine, trizivir, tromantadine, truvada, valaciclovir,
- the methods of the invention further comprise supportive therapy, e.g., fluid infusions.
- an organism or a cell is contacted with an agent that inhibits rpL40 expression and/or activity.
- the cells may be contacted with the agent in vitro and then the cells can be administered to an organism in vivo, or, alternatively, the agent may be administered to an organism (e.g., parenterally) such that the cells are contacted with the agent in vivo.
- Inhibitory compounds of the invention can be, for example, intracellular binding molecules that act to specifically inhibit the expression and/or activity of rpL40.
- intracellular binding molecule is intended to include molecules that act intracellularly to inhibit the expression or activity of a protein by binding to the protein or to a nucleic acid (e.g., an mRNA molecule) that encodes the protein.
- intracellular binding molecules examples include inhibitory nucleic acids, siRNA molecules, intracellular antibodies, peptidic compounds that inhibit the interaction of rpL40 with a target molecule, and chemical agents that specifically inhibit rpL40 activity.
- the inhibitory agent can also be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
- an inhibitory agent can be stably linked to a polymer such as polyethylene glycol to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties.
- an inhibitory agent can be in a composition which aids in delivery into the cytosol of a cell.
- the agent may be conjugated with a carrier moiety such as a liposome that is capable of delivering the peptide into the cytosol of a cell.
- a carrier moiety such as a liposome that is capable of delivering the peptide into the cytosol of a cell.
- the inhibitory agent can be modified to include specific transit peptides or fused to such transit peptides which are capable of delivering the inhibitory agent into a cell.
- the agent can be delivered directly into a cell by microinjection.
- the compositions are usually employed in the form of pharmaceutical preparations.
- compositions are made in a manner well known in the pharmaceutical art.
- One preferred preparation utilizes a vehicle of physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers such as physiological concentrations of other non-toxic salts, five percent aqueous glucose solution, sterile water or the like may also be used.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
- a suitable buffer be present in the composition.
- Such solutions can, if desired, be lyophilized and stored in a sterile ampoule ready for reconstitution by the addition of sterile water for ready injection.
- the primary solvent can be aqueous or alternatively non-aqueous.
- Inhibitory agents can also be incorporated into a solid or semi-solid biologically compatible matrix which can be implanted into tissues requiring treatment.
- an agent if the invention may be administered to a subject as a pharmaceutical composition.
- the invention is directed to an active compound (e.g., a inhibitor of rpL40) and a carrier.
- active compound e.g., a inhibitor of rpL40
- Such compositions typically comprise the inhibitory agent, e.g., as described herein or as identified in a screening assay, e.g., as described herein, and a pharmaceutically acceptable carrier.
- solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents;
- a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents;
- antibacterial compounds such as benzyl alcohol or methyl parabens
- antioxidants such as ascorbic acid or sodium bisulfite
- chelating compounds such as
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the
- suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
- the composition will preferably be sterile and should be fluid to the extent that easy syring ability exists. It will preferably be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal compounds, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic compounds for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an compound which delays absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding compounds, and/or adjuvant materials can be included as part of the composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as
- microcrystalline cellulose, gum tragacanth or gelatin an excipient such as starch or lactose, a disintegrating compound such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening compound such as sucrose or saccharin; or a flavoring compound such as peppermint, methyl salicylate, or orange flavoring.
- agents are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
- interfering nucleic acid molecule or "interfering nucleic acid” as used herein includes single-stranded RNA ⁇ e.g., mature miRNA, ssRNAi oligonucleotides, ssDNAi oligonucleotides), double-stranded RNA ⁇ i.e., duplex RNA such as siRNA, Dicer-substrate dsRNA, shRNA, aiRNA, or pre-miRNA), a DNA-RNA hybrid (see, e.g., PCT Publication No. WO 2004/078941), or a DNA-DNA hybrid (see, e.g., PCT
- Interfering nucleic acid thus refers to a single- stranded nucleic acid molecules that are complementary to a target mRNA sequence or to the double- stranded RNA formed by two complementary strands or by a single, self-complementary strand.
- Interfering nucleic acids may have substantial or complete identity to the target gene or sequence, or may comprise a region of mismatch ⁇ i.e., a mismatch motif).
- the sequence of the interfering nucleic acids can correspond to the full-length target gene, or a subsequence thereof.
- the interfering nucleic acid molecules are chemically synthesized.
- mismatch motif or “mismatch region” refers to a portion of an interfering nucleic acid (e.g., siRNA) sequence that does not have 100% complementarity to its target sequence.
- An interfering nucleic acid may have at least one, two, three, four, five, six, or more mismatch regions.
- the mismatch regions may be contiguous or may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides.
- the mismatch motifs or regions may comprise a single nucleotide or may comprise two, three, four, five, or more nucleotides.
- An interefering nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double- stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an interefering nucleic acid is an antisense nucleic acid and can hydrogen bond to the sense nucleic acid.
- an interefering nucleic acid of the invention is a "small- interfering RNA” or “an siRNA” molecule.
- an interefering nucleic acid of the invention mediates RNAi.
- RNA interference is a post-transcriptional, targeted gene-silencing technique that uses double- stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287, 2431-2432 (2000); Zamore, P. D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev.
- dsRNA double- stranded RNA
- mRNA messenger RNA
- RNAi Ribonucleic acid
- siRNAs small interfering RNAs
- Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabs or Ambion.
- one or more of the chemistries described herein for use in antisense RNA can be employed in molecules that mediate RNAi.
- Interfering nucleic acid includes, e.g., siRNA, of about 10-60, 10-50, or 10-40 (duplex) nucleotides in length, more typically about 10-30, 10-25, or 10-25 (duplex) nucleotides in length, and is preferably about 10-24, (duplex) nucleotides in length (e.g., each complementary sequence of the double-stranded siRNA is 10-60, 10-50, 10-40, 10- 30, 10-25, or 10-25 nucleotides in length, preferably about 10-24, 11-22, or 11-23 nucleotides in length, and the double- stranded siRNA is about 10-60, 10-50, 10-40, 10- 30, 10-25, or 10-25 base pairs in length).
- siRNA of about 10-60, 10-50, or 10-40 (duplex) nucleotides in length, more typically about 10-30, 10-25, or 10-25 (duplex) nucleotides in length, and is preferably about 10-24, (duplex) nucleotides in length (
- siRNA duplexes may comprise 3'-overhangs of about 1 to about 6 nucleotides and 5 '-phosphate termini.
- siRNA include, without limitation, a double- stranded polynucleotide molecule assembled from two separate stranded molecules, wherein one strand is the sense strand and the other is the complementary antisense strand; a double- stranded polynucleotide molecule assembled from a single stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule with two or more loop structures and a stem having self-complementary sense and antisense regions, where the circular polynucleotide can be processed in vivo or in vitro to generate
- siRNA are chemically synthesized.
- siRNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with the E. coli RNase III or Dicer. These enzymes process the dsRNA into biologically active siRNA (see, e.g., Yang et al, Proc. Natl. Acad. Sci. USA, 99:9942-9947 (2002); Calegari et al, Proc. Natl. Acad. Sci. USA, 99: 14236 (2002); Byrom et al, Ambion TechNotes, 10(l):4-6 (2003); Kawasaki et al, Nucleic Acids Res.
- dsRNA are at least 50 nucleotides to about 100, 200, 300, 400, or 500 nucleotides in length.
- a dsRNA may be as long as 1000, 1500, 2000, 5000 nucleotides in length, or longer.
- the dsRNA can encode for an entire gene transcript or a partial gene transcript.
- siRNA may be encoded by a plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops).
- an interefering nucleic acid of the invention can be designed according to the rules of Watson and Crick base pairing.
- the interefering nucleic acid molecule can be complementary to the entire coding region of rpL40 mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of rpL40 mRNA.
- an interefering oligonucleotide can be complementary to the region surrounding the processing site of ubiquitin and rpL40 mRNA.
- An interefering RNA oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
- An interefering nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
- an interefering nucleic acid e.g., an antisense oligonucleotide
- an interefering nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
- modified nucleotides which can be used to generate the interfering nucleic acids include 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-meth
- one or more interefering nucleic acid molecules can be used.
- the an interefering nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
- Non- limiting exemplary siRNAs for use in the methods of the present invention include D-011794-02 (ccugcgagguggcauuauu) (SEQ ID NO: 26) and D-011794-04 (caaguguaugcucgccuu) (SEQ ID NO: 27) or a combination thereof.
- an interfering nucleic acid molecule of the invention is an oc-anomeric nucleic acid molecule.
- An oc-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641).
- the interfering nucleic acid molecule can also comprise a 2'-0- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).
- an interfering nucleic acid of the invention is a ribozyme.
- Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- ribozymes e.g. , hammerhead ribozymes (described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave rpL40 mRNA transcripts to thereby inhibit translation of rpL40 mRNA.
- a ribozyme having specificity for a rpL40-encoding nucleic acid can be designed based upon the nucleotide sequence of rpL40.
- a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a rpL40-encoding mRNA. See, e.g. , Cech et al. U.S. Pat. No. 4,987,071 ; and Cech et al. U.S. Pat. No. 5,116,742.
- rpL40 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g. , Bartel, D. and Szostak, J. W., 1993, Science 261 : 1411-1418.
- gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of rpL40 (e.g., the ubiquitin/rpL40 promoter and/or enhancers) to form triple helical structures that prevent transcription of the ubiquitin/rpL40 gene in target cells.
- rpL40 e.g., the ubiquitin/rpL40 promoter and/or enhancers
- rpL40 e.g., the ubiquitin/rpL40 promoter and/or enhancers
- the inhibitory nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
- the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup B. et al., 1996, Bioorganic & Medicinal Chemistry 4 (1): 5-23).
- the terms "peptide nucleic acids” or "PNAs" refer to nucleic acid mimics, e.g.
- DNA mimics in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
- the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
- the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al., 1996, supra; Perry-O'Keefe et al., 1996, Proc. Natl. Acad. Sci. USA 93: 14670-675.
- PNAs of rpL40 can be modified, (e.g. , to enhance their stability or cellular uptake), by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
- PNA-DNA chimeras of rpL40 nucleic acid molecules can be generated which may combine the advantageous properties of PNA and DNA.
- Such chimeras allow DNA recognition enzymes, (e.g., RNAse H and DNA polymerases), to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
- PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup B., 1996, supra).
- the synthesis of PNA-DNA chimeras can be performed as described in Hyrup B., 1996, supra and Finn P. J. et al., 1996, Nucleic Acids Res. 24 (17): 3357-63.
- a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5' end of DNA Gag, M. et al. , 1989, Nucleic Acid Res. 17: 5973-88).
- PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn P. J. et al., 1996, supra).
- chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser, K. H. et al., 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).
- the interfering nucleic acid may include other appended groups such as peptides ⁇ e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g. , Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. WO88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134).
- other appended groups such as peptides ⁇ e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g. , Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al.,
- oligonucleotides can be modified with hybridization-triggered cleavage agents (See, e.g., Krol et al., 1988, Bio-Techniques 6:958-976) or intercalating agents. (See, e.g. , Zon, 1988, Pharm. Res. 5:539-549).
- the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, a lipophillic group, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).
- Interfering polynucleotides may be produced from a heterologous expression cassette in a transfectant cell or transgenic cell.
- the antisense may be produced from a heterologous expression cassette in a transfectant cell or transgenic cell.
- the antisense may be produced from a heterologous expression cassette in a transfectant cell or transgenic cell.
- polynucleotides may comprise soluble oligonucleotides that are administered to the external milieu, either in the culture medium in vitro or in the circulatory system or in interstitial fluid in vivo. Soluble antisense polynucleotides present in the external milieu have been shown to gain access to the cytoplasm and inhibit translation of specific mRNA species. ii. Intracellular Antibodies
- inhibitory compound or agent that can be used to inhibit the expression and/or activity of rpL40 protein in a cell is an intracellular antibody specific for rpL40.
- intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g. , Carlson, J. R. (1988) Mol. Cell. Biol. 8:2638-2646; Biocca, S. et al. (1990) EMBO J. 9:101-108; Werge, T. M. et al. (1990) FEBS Letters 274: 193-198; Carlson, J. R. (1993) Proc. Natl. Acad. Sci. USA 90:7427-7428; Marasco, W. A. et al. (1993) Proc. Natl. Acad. Sci. USA 90:7889-7893; Biocca, S. et al. (1994)
- a recombinant expression vector which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell.
- antibody light and heavy chain cDNAs encoding antibody chains specific for the target protein of interest is isolated, typically from a hybridoma that secretes a monoclonal antibody specific for rpL40 protein, or a fragment thereof.
- Anti- rpL40 protein antibodies can be prepared by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with a rpL40 protein immunogen.
- An appropriate immunogenic preparation can contain, for example, recombinantly expressed rpL40 protein or a chemically synthesized rpL40 peptide.
- a non- limiting exemplary peptide such as Cys-Gly-His-Thr-Asn-Asn-Leu-Arg-Pro-Lys-Lys-Lys-Val-Lys (SEQ ID NO: 28) may be used in order to prepare an antibody suitable for use in the methods of the present invention (as described in, for example, Redman, K.L. (1994) Insect Biochem. Molec. Biol. 24: 191-201, the entire contents of which are incorporated herein by reference).
- the preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory compound.
- Antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J Immunol 127:539-46; Brown et al. (1980) J Biol Chem 255:4980-83; Yeh et al. (1976) PNAS 76:2927-31 ; and Yeh et al. (1982) Int. J. Cancer 29:269-75).
- the technology for producing monoclonal antibody hybridomas is well known (see generally R. H.
- an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a rpL40 protein immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds specifically to the rpL40 protein.
- lymphocytes typically splenocytes
- Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-rpL40 protein monoclonal antibody (see, e.g. , G. Galfre et al. (1977) Nature, 266:550-52; Gefter et al.
- the immortal cell line ⁇ e.g., a myeloma cell line
- murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line.
- Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques, e.g., the P3-NS1/1- Ag4-1, P3-x63-Ag8.653 or Sp2/0-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md.
- ATCC American Type Culture Collection
- HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").
- PEG polyethylene glycol
- Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
- Hybridoma cells producing a monoclonal antibody that specifically binds the maf protein are identified by screening the hybridoma culture supernatants for such antibodies, e.g., using a standard ELISA assay.
- a monoclonal antibody that binds to rpL40 can be identified and isolated by screening a recombinant combinatorial immunoglobulin library ⁇ e.g. an antibody phage display library) with the protein, or a peptide thereof, to thereby isolate immunoglobulin library members that bind specifically to the protein.
- Kits for generating and screening phage display libraries are commercially available ⁇ e.g. , the Pharmacia Recombinant Phage Antibody System; and the Stratagene SurfZAP.TM. Phage Display Kit). Additionally, examples of methods and compounds particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al.
- DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques.
- hybridoma derived antibodies light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening.
- cDNA encoding the light and heavy chains can be recovered from the display package (e.g. , phage) isolated during the library screening process.
- Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 and in the "Vbase" human germline sequence database.
- the antibody light and heavy chain sequences are cloned into a recombinant expression vector using standard methods.
- sequences encoding the hydrophobic leaders of the light and heavy chains are removed and sequences encoding a nuclear localization signal (e.g., from SV40 Large T antigen) are linked in-frame to sequences encoding either the amino- or carboxy terminus of both the light and heavy chains.
- the expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full- length antibody light and heavy chains such that a full-length antibody is expressed intracellularly.
- the vector encodes a full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab fragment is expressed intracellularly.
- the vector encodes a single chain antibody (scFv) wherein the variable regions of the light and heavy chains are linked by a flexible peptide linker and expressed as a single chain molecule.
- scFv single chain antibody
- the expression vector encoding the rpL40-specific intracellular antibody is introduced into the cell by standard transfection methods as described hereinbefore.
- Exemplary antibodies suitable for use in the methods of the invention include the antibodies described in Redman, K.L. (1994) Insect Biochem. Molec. Biol. 24: 191-201.
- an inhibitory compound of the invention is a peptidic compound derived from the rpL40 amino acid sequence, as described supra and known in the art.
- the inhibitory compound comprises a portion of rpL40 (or a mimetic thereof) that mediates interaction of rpL40 with a target molecule such that contact of rpL40 with this peptidic compound competitively inhibits the interaction of rpL40 with the target molecule.
- a peptidic compound may inhibit the interaction and/or binding of rpL40 with a translation initiation site of a viral mRNA.
- the peptidic compounds of the invention can be made intracellularly in cells by introducing into the cells an expression vector encoding the peptide.
- Such expression vectors can be made by standard techniques.
- the peptide can be expressed in intracellularly as a fusion with another protein or peptide ⁇ e.g., a GST fusion).
- the peptides can be made by chemical synthesis using standard peptide synthesis techniques. Synthesized peptides can then be introduced into cells by a variety of means known in the art for introducing peptides into cells ⁇ e.g., liposome and the like).
- inhibitory agents that can be used to specifically inhibit the activity of an rpL40 protein are chemical compounds that directly inhibit rpL40 activity or inhibit the interaction between rpL40 and target molecules. Such compounds can be identified using screening assays that select for such compounds, as described in detail below.
- Agents that inhibit rpL40 activity can be known ⁇ e.g. , rpL40 interfering nucleic acid molecules, rpL40 intracellular antibodies that interfere with rpL40 activity, peptide inhibitors derived from rpL40) or can be identified using the methods described herein.
- the invention provides methods (also referred to herein as "screening assays") for identifying other modulators, i.e., candidate or test compounds or agents (e.g. , peptidomimetics, small molecules or other drugs) which modulate rpL40 activity and for testing or optimizing the activity of other agents.
- molecules which bind e.g., to rpL40 or another ribosomal protein interacting with rpL40, or have a stimulatory or inhibitory effect on the expression and/or activity of rpL40 or another ribosomal protein interacting with rpL40 can be identified.
- the ability of a compound to directly modulate the expression, post-translational modification, or activity of rpL40 is measured in an indicator composition using a screening assay of the invention.
- Agents that are capable of inhibiting the expression and/or activity of rpL40, as identified by methods of the invention, are useful as candidate anti-virals.
- the present invention provides methods for identifying a compound useful for treating a viral infection.
- the methods include providing an indicator composition, contacting the indicator composition with a test compound (or a plurality of test compounds), determining the effect of a test compound on the expression and/or activity of rpL40, and selecting a compound which modulates the expression and/or activity of rpL40, thereby identifying a compound useful for treating a viral infection.
- the present invention provides methods for identifying a compound useful in inhibiting translation of a viral mRNA infecting a host cell.
- the methods include providing an indicator composition, contacting the indicator composition with a test compound (or a plurality of test compounds), determining the effect of a test compound on the expression and/or activity of rpL40, and selecting a compound which modulates the expression and/or activity of rpL40, thereby identifying a compound useful for inhibiting translation of a viral mRNA infecting a host cell.
- agents, candidate compounds or test compounds include, but are not limited to, nucleic acids (e.g. , DNA and RNA), carbohydrates, lipids, proteins, peptides, peptidomimetics, small molecules and other drugs.
- Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145; U.S. Patent No. 5,738,996; and U.S. Patent No. 5,807,683, each of which is incorporated herein in its entirety by reference).
- Libraries of compounds may be presented, e.g. , presented in solution (e.g. , Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991) Nature 354:82- 84), chips (Fodor (1993) Nature 364:555-556), bacteria (U.S. Patent No. 5,223,409), spores (Patent Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci.
- the indicator composition can be a cell that expresses the rpL40 protein or a molecule with which rpL40 directly interacts, for example, a cell that naturally expresses or has been engineered to express the protein(s) by introducing into the cell an expression vector encoding the protein.
- the indicator composition can be a cell-free composition that includes the protein(s) (e.g., a cell extract or a composition that includes e.g. , either purified natural or recombinant protein).
- the protein(s) e.g., a cell extract or a composition that includes e.g. , either purified natural or recombinant protein.
- the indicator compositions of the invention may further comprise a virus or a viral extract, such as a viral mRNA.
- an indicator cell can be transfected with an expression vector, incubated in the presence and in the absence of a test compound, and the effect of the compound on the expression of the molecule or on a biological response regulated by rpL40 can be determined.
- the biological activities of rpL40 include activities determined in vivo, or in vitro, according to standard techniques.
- Activity can be a direct activity, such as an association with a target molecule or binding partner.
- the activity is an indirect activity, such as viral replication, viral translation, host cell translation, and/or movement of the 40S ribosome subunit to the translation initiation site of viral mRNA.
- test compound modulates rpL40 protein expression, or the expression of a viral (or host) protein
- in vitro transcriptional assays can be performed.
- test compound modulates rpL40 mRNA expression, or the expression of viral or host genes
- various methodologies can be performed, such as quantitative or real-time PCR.
- test compounds on host cell viability may also be determined using, e.g., standard microscopic analysis.
- reporter genes are known in the art and are suitable for use in the screening assays of the invention.
- suitable reporter genes include those which encode chloramphenicol acetyltransferase, beta-galactosidase, alkaline phosphatase, green fluorescent protein, or luciferase. Standard methods for measuring the activity of these gene products are known in the art.
- a variety of cell types are suitable for use as an indicator cell in the screening assay.
- a cell line is used which expresses low levels of endogenous rpL40 and is then engineered to express recombinant protein.
- Cells for use in the subject assays include eukaryotic cells.
- a cell is a fungal cell, such as a yeast cell.
- a cell is a plant cell.
- a cell is a vertebrate cell, e.g., an avian cell or a mammalian cell (e.g., a murine cell, or a human cell).
- the cells of the invention can express endogenous rpL40, another ribosomal protein, initiation factor, and/or viral or cellular transcript (e.g., GAPDH) or can be engineered to do so.
- a cell that has been engineered to express the rpL40 protein and/or another ribosomal protein can be produced by introducing into the cell an expression vector encoding the protein.
- Recombinant expression vectors that can be used for expression of , e.g., rpL40, are known in the art.
- the cDNA is first introduced into a recombinant expression vector using standard molecular biology techniques.
- a cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library.
- PCR polymerase chain reaction
- the nucleotide sequences of cDNAs for or a molecule in a signal transduction pathway involving are known in the art and can be used for the design of PCR primers that allow for amplification of a cDNA by standard PCR methods or for the design of a hybridization probe that can be used to screen a cDNA library using standard hybridization methods.
- the indicator composition is a cell free composition. rpL40 expressed by recombinant methods in a host cells or culture medium can be isolated from the host cells, or cell culture medium using standard methods for protein purification.
- ion-exchange chromatography gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies can be used to produce a purified or semi-purified protein that can be used in a cell free composition.
- a lysate or an extract of cells expressing the protein of interest can be prepared for use as cell-free composition.
- compounds that specifically modulate rpL40 activity or the activity of a molecule in a signal transduction pathway involving rpL40 are identified based on their ability to modulate the interaction of rpL40 with a target molecule to which rpL40 binds.
- the target molecule can be a mRNA molecule or a protein molecule.
- Suitable assays are known in the art that allow for the detection of protein-protein interactions (e.g., immunoprecipitations, two-hybrid assays and the like) or that allow for the detection of interactions between rpL40 and an mRNA (e.g., electrophoretic mobility shift assays, DNAse I footprinting assays and the like). By performing such assays in the presence and absence of test compounds, these assays can be used to identify compounds that modulate (e.g., inhibit or enhance) the activity of rpL40 with a target molecule.
- Compounds identified in the subject screening assays can be used in methods of modulating one or more of the biological responses regulated by rpL40. It will be understood that it may be desirable to formulate such compound(s) as pharmaceutical compositions (described supra) prior to contacting them with cells.
- test compound that directly or indirectly modulates, e.g., rpL40 expression or activity by one of the variety of methods described hereinbefore
- the selected test compound can then be further evaluated for its effect on cells, for example by contacting the compound of interest with cells either in vivo (e.g., by administering the compound of interest to an organis) or ex vivo (e.g., by isolating cells from an organism and contacting the isolated cells with the compound of interest or, alternatively, by contacting the compound of interest with a cell line) and determining the effect of the compound of interest on the cells, as compared to an appropriate control (such as untreated cells or cells treated with a control compound, or carrier, that does not modulate the biological response).
- an appropriate control such as untreated cells or cells treated with a control compound, or carrier, that does not modulate the biological response.
- the invention pertains to a combination of two or more of the assays described herein.
- a modulating agent can be identified using a cell- based or a cell-free assay, and the ability of the agent to modulate the activity of rpL40 or a protein with which rpL40 interacts can be confirmed in vivo, e.g., in an animal, such as, for example, an animal model for, e.g., viral infection.
- a modulator of rpL40 or a molecule in a signaling pathway involving rpL40 identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such a modulator.
- a modulator identified as described herein can be used in an animal model to determine the mechanism of action of such a modulator.
- screening assays can be used to identify compounds that indirectly modulate the activity and/or expression of rpL40 e.g., by performing screening assays such as those described above using molecules with which rpL40 interacts, e.g., molecules that act either upstream or downstream of rpL40 during host cell and/or viral translation.
- the instant invention also pertains to compounds identified in the subject screening assays.
- SMART pools comprising four duplexes targeting a single human mRNA transcript, were individually arrayed into wells of black, clear bottom 384-well plates (Costar 3712, Corning) containing a 1:100 dilution of Lipofectamine 2000 (Invitrogen) in OptiMEM (Invitrogen). Duplexes and lipids were incubated for 20 minutes at room temperature and mixed with HeLa cells to yield final concentrations of 5 x 10 4 cells/ml and 25nM siRNA. Plates were inoculated with 1250 HeLa cells per well, and cells were centrifuged for 5 minutes at 700 x g.
- the approximately 5000 cells were inoculated with 25,000 infectious particles of rVSV- eGFP.
- Cells were fixed 7 hours later with 2% formaldehyde in PBS, the nuclei were counterstained with 4 ⁇ g/ml Hoechst nuclear dye (33342; Invitrogen) for 10 minutes at room temperature, and unincorporated dye removed by washing once with 60 ⁇ PBS per well.
- Individual wells were examined using a cellWoRXTM High Content Cell Analysis System (Applied Precision Inc.), and the cell-scoring module of MetaXpress Software (Molecular Devices) was employed to quantify the total number of cells and percentage of eGFP-positive cells. All samples were performed in duplicate.
- HeLa cells were maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Tissue Culture Biologicals). VSV, rVSV-eGFP, rVSV-Luc, and rVSV-
- M51R were amplified in BHK-21 cells (ATCC), purified through a 10% sucrose (w/v) cushion prepared in NTE (10 mM Tris-pH7.4, 100 mM NaCl, 1 mM EDTA), and virus stocks were stored in NTE at -80°C (Whelan et al., 1995).
- NTE 10 mM Tris-pH7.4, 100 mM NaCl, 1 mM EDTA
- the pFR-CrPV bicistronic luciferase reporter plasmid was obtained Addgene
- plasmid 11509 (Petersen et al., 2006).
- the plasmid pRL-CMV Promega was used to generate renilla luciferase mRNA in HeLa cells for in vitro translation.
- rpL40 was amplified from a SP73 vector containing rpL40 (Fox- Walsh and Hertel, 2009) and inserted into the Acc65I and Xhol sites of pcDNA3.1 (Invitrogen).
- SiRNA-resistant pcDNA3.1-rpL40 was generated by site-directed mutagenesis using the QuikChange methodology (Stratagene) and primers rpL40-SM-F (5'-
- the 5' UTR was cloned into pGEM3 using the EcoRI and BamHI sites; luciferase and the 3' UTR were double ligated into the vector using the BamHI, Notl, and Sail sites; two copies of a T7 terminator were added using the Sail and Hindlll sites.
- Plasmid transfections were performed using Lipofectamine 2000 according to manufacturer's instructions. For rescue of the siRNA-induced phenotype, HeLA cells were transfected with the indicated plasmid 24 hours before transfection of cells with siRNA. Transfection of plasmids into vTF7-3-infected bsrT7 cells was performed as described, except using 12 ⁇ g of plasmid per 10cm dish, with cells at 80% confluency (Whelan, S.P., et al, (1995) Proc Natl Acad Sci USA 92:8388-8392). RNA was harvested and purified from cells at 24 hours post transfection.
- siRNAs used were siGENOME Non-Targeting siRNA #3 (D- 001210-03), rpL40-l (D-011794-02), rpL40-2 (D-011794-04), rpL22 (D-011143-02) (Dharmacon).
- siRNA transfection into a 24- well plate 1 ⁇ of Lipofectamine 2000 was mixed with 100 ⁇ of OptiMEM and incubated at room temperature for 5 min. 100 1 of OptiMEM and 1.5 ⁇ of 20uM siRNA was added, mixed, and incubated at room temperature for 15 minutes.
- VSV was mixed with 12.5 mM Tris pH 7.4, 5% glycerol, 5 mM EDTA pH 8, 3.5 mM DTT, 0.1% Triton X-100, and 500 mM CsCl in a total volume of 600 ⁇ and incubated on ice for 1.25 hours.
- 600 ⁇ of 20 mM Tris pH 7.4 and 3.5 mM DTT were added and loaded onto a 30-50% (v/v) glycerol gradient made in NTE with 3.5 mM (v/v) glycerol gradient made in NTE with 3.5 mM DTT.
- RNA For metabolic labeling of RNA, at the indicated times post infection or mock infection, cells were labeled with 33 ⁇ / ⁇ [ 3 H]-Uridine (Perkin Elmer). Cells were lysed in Rose Lysis Buffer (1% v/v Nonidet P40- Alternative, 0.4% v/v sodium deoxycholate, 66 mM EDTA, 10 mM Tris pH 7.4) and cytoplasmic RNA was purified by phenol/chloroform extraction and analyzed by electrophoresis on an acid-agarose gel (Lehrach et al. 1977). For analysis of primary transcription, cells were treated with 100 ⁇ g/ml cyclohexmide for 30 minutes prior to infection.
- cDNA was reverse-transcribed from RNA isolated from mock infected or infected cells using random hexamers or VS V-N-RT-dT primer (5 '
- TTTTTTTTTTTTTTTTTC ATATGTAGC-3 ' (SEQ ID NO: 22), respectively, and Superscript III (Invitrogen) following the manufacturer's instructions.
- Real-time PCR was performed using Power SYBR Green PCR Master Mix and a Prism 7300 sequence detection system (Applied Biosystems) according to manufacturer's instructions. The final reaction volume was 20 ⁇ containg 2 ⁇ cDNA and 100 nm of each primer.
- VSV-N-F (5 ' -GCAAATGAGGATCCAGTGG-3 ' ) (SEQ ID NO: 29) and VSV- N-R (5 ' -CAGGGCTTTCAAGGATAC-3 ' ) (SEQ ID NO: 30) were used to detect VSV N cRNA.
- Primers ⁇ -actin-qRTPCR-F (5 ' -TCCCTGGAGAAGAGCTACG-3 ' ) (SEQ ID NO: 23) and ⁇ -actin-qRTPCR-R (5 ' -GTAGTTTCGTGGATGCCACA-3 ') (SEQ ID NO: 24) were used to amplify ⁇ -actin cDNA.
- a dissociation curve of the PCR products was determined. Samples were run in duplicate and relative copy numbers were determined from a standard curve generated by serial dilutions of a plasmid containing VSV N or cDNA reverse-transcribed from total HeLa RNA.
- Yeast strain GAL-RPL40A-AUbq was grown in galactose containing medium (YPG) at 30°C overnight to a final OD 6 oo of approximately 1.5.
- Yeast were pelleted and re-suspended in YPG or glucose-containing medium and a 500 mL culture was grown for 4 h to a final OD 6 oo of 0.8.
- Yeast were incubated with 5 mL of 10 mg ml "1 cycloheximide for 3 min prior to being pelleted and washed once with ice cold
- Polysome Lysis Buffer (20 mM HEPES pH 7.4, 2 mM magnesium acetate, 100 mM potassium acetate, 3 mM DTT, 0.1 mg ml "1 cycloheximide). Pellets were re-suspended in Polysome Lysis Buffer and cells were broken by glass bead lysis. Supernatant was clarified by centrifugation at 10,000 RPM for 20 min at 4°C and aliquots were flash frozen in liquid nitrogen.
- Sequencing reads were aligned against the Ensembl EF3 S. cerevisiae genome. First, residual non-coding RNAs were filtered out using Bowtie, and then remaining sequences were aligned using Tophat, allowing up to two mismatches (Langmead, B., et al. (2009) Genome Biology 10:R25; Trapnell, C, et al (2009) Bioinformatics 25: 1105- 1111). Reads were assembled and abundance was measured by suing Cufflinks. mRNA abundance was measured by calculating reads per kilobase of exon per million fragments mapped (RPKM), allowing us to take into account differences in total reads and gene lengths.
- RPKM kilobase of exon per million fragments mapped
- Genes were filtered to require at least 256 reads for the rpL40- containing samples. To form our list of candidate mRNAs (fold reduction >3), we disregarded transcripts that were likely identified due to off-target effects of changing the carbon source and ribosome biogenesis feedback loops. Genes were annotated with functional descriptions using the Saccharomyes Genome Database.
- cycloheximide and collected by cell scraping.
- Cells were re-suspended in 1 ml of RSB- PEB (500 mM Tris pH 7.5, 2 M NaCl, 15 mM MgC12, 1% Triton-X, 2% Tween-20, 1% sodium deoxycholate), vortexed briefly, and put on ice for 10 minutes. Lysate was spun for 10 minutes at 4°C at 10,000g and supernatant was resolved on a 10-50% (w/v) or 5- 30% (w/v) sucrose gradient, as indicated, by centrifugation at 35,000 rpm at 4°C for 3 hours in a Beckman SW41 Ti rotor.
- RSB- PEB 500 mM Tris pH 7.5, 2 M NaCl, 15 mM MgC12, 1% Triton-X, 2% Tween-20, 1% sodium deoxycholate
- Yeast strain pGAL-RPL40A-Ubq was grown in galactose containing medium
- YPG YPG at 30°C overnight to a final OD600 of approximately 1.5.
- Yeast were centrifuged and re-suspended in YPG or glucose containing medium and a 2 L culture was grown for 6 hour to a final OD of 1.5.
- Saccharomyces cerevisiae cell-free translation extracts were prepared using a modified previously described procedure (Sachs, M.S., et al. (2002) Methods 26:105-114). Small molecules were removed from S30 lysates using a Zeba Desalt Spin Column (Pierce) pre-equilibrated with Buffer A with 8.5% manniotol and 0.5 mM PMSF (Wu, C, et al.
- Ten ⁇ of lysate was mixed with 1.68 ⁇ Translation reaction Components (10 mM ATP, 2.5mM GTP, 250 mM creatine phosphate), 0.12 ⁇ creatine phosphokinase (7.5 U/ml), 0.5 ⁇ Common Buffer (400 mM Hepes, Ph 7.6, 40 mM DTT), 0.84 ⁇ 90 mM magnesium acetate, 0.71 ⁇ 2.8 M potassium acetate, 0.16 ⁇ 1 mM amino acids, and 6 ⁇ RNA on ice.
- Translation reaction Components 10 mM ATP, 2.5mM GTP, 250 mM creatine phosphate), 0.12 ⁇ creatine phosphokinase (7.5 U/ml), 0.5 ⁇ Common Buffer (400 mM Hepes, Ph 7.6, 40 mM DTT), 0.84 ⁇ 90 mM magnesium acetate, 0.71 ⁇ 2.8 M potassium acetate, 0.16 ⁇ 1 mM amino acids, and 6 ⁇ RNA on ice
- each sample was 50% lysate, up to 3.94 ⁇ RNA, and buffer to make the final reaction have 0.84 mM ATP, 0.21 mM GTP, 21 mM creatine phosphate, 45 U/mL creatine phosphokinase, 10 mM HEPES pH 7.6, 2 mM DTT, 2.5 mM magnesium acetate, 100 mM potassium acetate, 8 ⁇ amino acids, 255 ⁇ spermidine, and 9 U murine RNase inhibitor (New England Biolabs).
- the final reaction had 2 mM magnesium acetate and 200 mM potassium acetate. The magnesium and potassium concentrations were identified by titration to obtain maximum translation. Translation reactions were incubated for 2 hours at 25°C and luciferase activity was assayed.
- RNA made by VSV in vitro transcription were set up without RNA and pre-incubated at 25°C for 3 minutes with 2 mg/ml hygromycin B, 1 mM m 7 GpppA, or 1 mM GMP-PNP and 1 mM magnesium acetate, as indicated.
- RNA made by VSV in vitro transcription were set up without RNA and pre-incubated at 25°C for 3 minutes with 2 mg/ml hygromycin B, 1 mM m 7 GpppA, or 1 mM GMP-PNP and 1 mM magnesium acetate, as indicated.
- VSV-N primer 5 ' -CCTCATTTGCAGGAAG-3 '
- Superscript III 5 ⁇ of Superscript III was added and incubated at 37°C for 30 minutes. Reactions were phenol/chloroform extracted and cDNA was analyzed on a 6% polyacrylamide sequencing gel. A dideoxynucleotide sequencing ladder was made using the same primer and VSV N plasmid cDNA.
- EXAMPLE 1 An siRNA screen reveals a differential sensitivity of VSV
- RNA screen was performed. HeLa cells were transfected with pools of four siRNAs directed toward each of the individual ribosomal protein genes. Following 48 h of incubation, cells were infected with a reporter VSV (rVSV-eGFP) that expresses eGFP as a marker of infection and 7 hours later the percent of infected cells was determined by rVSV-eGFP.
- rVSV-eGFP reporter VSV
- RpL40 was selected for further study since its knockdown had a profound difference in effects on the virus compared to the host and its specific role in translation was uncharacterized.
- RpL40 is a eukaryote-specific ribosomal protein that is encoded as a C- terminal extension of ubiquitin. The ubiquitin is rapidly cleaved off and is not necessary for ribosomal function, but contributes to the pool of free ubiquitin in the cell (Finley, D., et al. (1989) Nature 338:394-401 ; Monia, B.P., et al. (1989) J Biol Chem 264:4093- 4103).
- EXAMPLE 2 RpL40 is required for VSV mRNA translation.
- VSV gene expression initiates with primary transcription of mRNAs, translation of which is essential to provide the proteins necessary for genome replication and subsequent secondary transcription.
- rpL40 depletion By measuring VSV mRNA levels by quantitative RT-PCR in cells exposed to the protein synthesis inhibitor cycloheximide, it was shown that primary transcription is unaffected by rpL40 depletion ( Figure ID).
- VSV is a member of the order Mononegavirales, consisting of non-segmented negative-sense (NNS) RNA viruses.
- NNS non-segmented negative-sense
- the transcripts of all NNS viruses are capped and polyadenylated and, within each virus, the 5' ends begin with a conserved gene start site.
- Infection of cells by multiple NNS viruses, including rabies virus (Figure 2F), measles virus (Figure 2G), and Newcastle disease virus ( Figure 2H) is sensitive to rpL40 depletion. In contrast, replication of respiratory syncytial virus, is unaffected by rpL40 depletion .
- VSV matrix (M) protein blocks export of pre-ribosomal RNAs from the nucleus via the Rael export pathway, suggesting VSV mRNAs might be dependent on rpL40 due to an additive reduction in pools of ribosomes during knockdown and infection.
- rVSV-M51R nuclear export
- Figure 6B a recombinant VSV that does not block nuclear export
- Figure 6C rpL40 depletion
- rpL22 depletion does not inhibit viral gene expression ( Figure 6D, E), indicating rpL40 is a specific ribosomal protein requisite for VSV translation.
- EXAMPLE 5 RpL40 is required for translation initiation on VSV mRNAs as a constituent of the large subunit
- VSV nucleocapsid (N) mRNA was specifically examined, as this is the most abundant viral mRNA produced during infection.
- Cells depleted of rpL40 were mock infected or infected with VSV and lysates were resolved on a 10-50% linear sucrose gradient.
- the association of ribosomal subunitswith specific mRNAs was determined by quantitative RT-PCR. Absorbance monitoring at 254 nm revealed polysome formation, further confirming that bulk translation was not compromised by rpL40 depletion ( Figure 3 A, C).
- Yeast express two paralogs for rpL40, rpL40A and rpL40B, which encode for the ribosomal protein rpL40 with a N-terminal ubiquitin moiety (Finley, D., et al. (1989) Nature 338:394-401).
- the yeast strain pGAL-RPL40A-Ubq has both forms of rpL40 deleted, and instead rpL40A lacking its ubiquitin tail is ectopically expressed from a galactose-inducible promoter.
- Lysates were programmed with VSV mRNA and performed reverse transcription using a primer designed to generate an 80 nucleotide product on VSV N mRNA ( Figure 12A and 12B). This product terminates at the 5 ' mRNA cap structure and is unaltered when ribosome assembly is blocked by the addition of cap analog (m7GpppA) (Figue 12A, lane 2, 5).
- GMP-PNP a nonhydrolyzable analog of GTP that blocks recycling of the eIF2 ternary complex and formation of an elongation-competent 80S
- This product serves as a control for location of a 40S complex aligned at the initiating codon (Pestova, T.V., et al. (2000) Nature 403:332-335).
- RpL40 could regulate 80S formation as an extraribosomal protein or as part of the ribosome. To distinguish between these possibilities, the polysomal distribution of rpL40 was monitored. VSV-infected HeLa cell lysates were resolved on a 5-30% linear sucrose gradient and the fractions were probed by immunoblot. RpL40 was only found in 60S, 80S, and polysome fractions, with no detection as an extraribosomal population ( Figure 3F). Furthermore, rpL40 has only been found with 60S and 80S fractions of polysome profiles performed in Drosophila and yeast (Finley, D., et al. (1989) Nature 338:394-401; Redman, K.L.
- the foregoing examples demonstrate a ribosome-mediated transcript-specific strategy of translation initiation that is dependent on rpL40, a protein constituent of the large ribosomal subunit and is required for replication of multiple NNS viruses.
- Use of this translation strategy is designated by a cis-acting RNA determinant and is conserved among eukaryotes.
- the results identify the step of translation initiation at which rpL40 is required, and also reveal that select transcripts are translated through an rpL40- dependent mechanism. Together, this work reveals a previously uncharacterized pathway of translation specialization, thus providing new evidence that the ribosome controls translation separately of its catalytic function.
- the critical role of rpL40 in protein synthesis for multiple members of the order Mononegavirales presents an interesting antiviral target.
- cap-independent translation of CrPV RNA and hepatitis virus C virus (HCV) RNA requires specific 40S subunit proteins for binding to the IRES elements (Landry, D.M., et al. (2009) Genes Dev 23:2753-2764; Otto, G.A., et al. (2002) RNA 8:913-923).
- a requirement for a specific ribosomal protein during cap-dependent viral mRNA translation is
- Transcript-specific translational control is ribosome-mediated.
- ribosomal proteins and RNAs are often subjected to modifications such as phosphorylation, methylation, or pseudouridinylation that then lead to alterations in protein synthesis (Lee, S.W., et al. (2002) Proc Natl Acad Sci USA 99:5942-5947; Yoon, A., et al. (2006) Science 312:902-906).
- modifications such as phosphorylation, methylation, or pseudouridinylation that then lead to alterations in protein synthesis
- rpL40 is found associated only with 60S subunits and 80S ribosomes, demonstrating that it does not function as a free cytosolic protein. The data, thus, support ribosome-mediated specificity in VSV mRNA translation.
- VSV cap-dependent translation occurs through unconventional mechanisms. Infection alters the cap-binding complex by inducing dephosphorylation of the 4E-BP1 translation repressor which subsequently sequesters eIF4E causing translation of host mRNAs to be inhibited while VSV protein production continues (Connor, J.H., and Lyles, D.S. (2002) J Virol 76: 10177-10187; Richter, J.D., and Sonenberg, N. (2005) Nature 433:477-480). These findings suggest that VSV mRNA translation is not limited by eIF3F availability.
- rpL40 ribosomal protein
- rpL40 has a critical role for 80S formation on VSV mRNAs. While uncommon, there are examples of transcripts with specific requirement for large subunit proteins during translation initiation. For example, during initiation on the CrPV IRES, the RNA must associate with rpLl for subunit joining of the 60S to the 40S and correct ribosome positioning (Spahn, C.M. tenuously et al. (2004) Cell 118:465-475; Jang, C.J., et al. (2009) J Mol Biol 387:42-58).
- rpL38 was found to be required for 80S formation on Homeobox mRNAs and thus correct tissue patterning during development (Kondrashov, N., et al. (2011) Cell 145:383-397).
- RpL40 is localized on the surface of the ribosome, and its amino- and carboxy-termini are unblocked, providing potential sites to interact with mRNAs or proteins (Figure 8) (Klinge, S., et al. (2011) Science 334:941-948; Ben-Shem A, et al. (2011) Science 334: 1524-1529).
- HCV HCV only replicates in mammalian hosts and its genomic RNA cannot be translated in yeast extracts. The inability of HCV RNA to be translated in yeast is postulated to be due to high divergence between yeast and mammals for the small subunit proteins that interact directly with the IRES (Otto, G.A., et al. (2002) RNA 8:913-923).
- VSV has an extremely broad host range, including ruminants, insects, and humans (Fields, B.N., et al. (2007) Fields Virology (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia) 5 th ed pp 2 v. (xix, 3091, 3086)).
- VSV has a distinct ability to express proteins in almost all vertebrate and insect cells, along with crustacean and C. elegans cells (Makarow, M., et al. (1986) Proc Natl Acad Sci USA 83:8177-8121; Schott, D.H., et al. (2005) Proc Natl Acad Sci USA 102: 18420-18424).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Toxicology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention provides methods of treating a viral infection by inhibiting the expression and/or activity of a ribosomal protein.
Description
COMPOSITIONS AND METHODS FOR THE TREATMENT OF VIRAL
INFECTIONS
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application No. 61/564,547, filed on November 29, 2011, the entire contents of which are incorporated herein by this reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with Government support under grant numbers AI059371 and AI057159, awarded by the National Institutes of Health. The
government, therefore, has certain rights in the invention. SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 29, 2012, is named Sequence_Listing.txt and is 11,739 bytes in size.
BACKGROUND OF THE INVENTION
Translation initiation in eukaryotes proceeds generally by a cap-dependent scanning mechanism. The rate limiting step in this process is recognition of the 5'- m7GpppN mRNA cap structure by eIF4E (Gingras, A.C., et al. (1999) Annu Rev Biochem 68:913-963). This recruits the small 40S subunit in complex with initiation factors which then scan along the mRNA until it reaches the start codon (AUG), at which time the initiation factors are released, the large 60S subunit joins, and an elongation competent 80S complex is formed (Jackson, R.J., et al. (2010) Nat Rev Mol Cell Biol 11 : 113-127; Jackson, R.J., and Kaminski A. (1995) RNA 1:985-1000).
The study of viral gene expression has uncovered several exceptions to this general mechanism of translation initiation. Poliovirus mRNA contains an
approximately 750 nucleotide highly structured 5 '-untranslated region that directly recruits the ribosome to an internal RNA site independently of the cap-recognition complex (Pelletier, J., and Sonenberg, N. (1988) Nature 334:320-325). Such internal ribosome entry sites (IRES) are present in many RNA viruses, and those employed by members of the Dicistroviridae family, including Plautia stali intestine virus and cricket
1
MEl 14404782v.l
paralysis virus (CrPV), remarkably do not require any initiation factors or the initiating methionine tRNA (Sasaki, J., and Nakashima, N. (1999) J Virol 73:1219-1226; Sasaki, J., and Nakashima, N. (2000) Proc Natl Acad Sci USA 97: 1512-1515; Wilson, J.E., et al. (2000) Cell 102:511-520).
Investigation of the mechanism by which capped but nonpolyadenylated viral mRNAs are translated has also demonstrated that structures or viral proteins can negate the need for poly A binding protein during mRNA translation (Ito, T., and Lai, M.M. (1999) Virology 254:288-296; Poncet, D., et al. (1993) J Virol 67:3159-3165). Similarly, ribosomal shunting or "discontinuous scanning" strategies of initiation were initially identified for cauliflower mosaic virus mRNA (Hohn, T., and Futterer, J. (1992) Curr Opin Genet Dev 2:90-96). Such studies of translation initiation in viruses have invariably led to subsequent identification of cellular RNAs that are translated by similar mechanisms (Gallie, D.R., et al. (1996) Nucleic Acids Res 24: 1954-1962; Johannes, G., and Sarnow, P. (1998) RNA 4: 1500-1513).
Replication of negative-strand RNA viruses in the order Mononegavirales induces profound host shut-off, and inhibition of cellular translation effectively suppresses the host immune response and antiviral immunity (Walsh, D., and Mohr, I. (2011) Nat Rev Microbiol 9:860-875). However, the mechanistic basis of selective viral translation by these viruses during host shut-off has remained enigmatic, as the viral mRNA transcripts are capped, methylated, and polyadenylated and are structurally indistinguishable from cellular mRNAs (Fields, B.N., et al. (2007) Fields Virology (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia) 5th ed pp 2 v. (xix, 3091, 3086)).
Vesicular stomatitis virus (VSV) is a prototype negative- strand RNA virus and is a member of the family Rhabdoviridae , a family of broadly distributed plant, animal and human pathogens that includes rabies virus. In cultured mammalian cells, VSV infection results in a profound inhibition of host protein synthesis. This is achieved in part by induction of the hypophosphorylation of eIF4E-Binding Protein 1 (4E-BP1), causing sequestration of eIF4E and halting formation of the eIF4F cap-binding complex
(Connor, J.H., and Lyles, D.S. (2002) J Virol 76: 10177-10187; Richter, J.D., and Sonenberg, N. (2005) Nature 433:477-480). VSV infection also interferes with the processing of the 45S precursor ribosomal RNA to 28S and 18S ribosomal RNA, thus diminishing the pool of mature ribosomal RNA (Zan, M., et al. (1990) Virology 111, 75- 84). The viral matrix protein (M) impedes export of ribosomal RNA from the nucleus by inhibition of both the Rael mRNP export pathway and by blocking transcription of ribosomal RNA (Ahmed, M., and Lyles, D.S. (1998) J Virol 72:8413-8419; Faria, P.A.,
et a/. (2005) Mol Cell 17:93-102). Despite such extensive manipulation of the host translational apparatus, efficient synthesis of VSV proteins persists in a mechanism that is not understood.
Measurements of translational efficiency demonstrate that specific translation of VSV mRNAs is not due to overabundance during infection (Whitlow, Z.W., et al.
(2006) J Virol 80: 11733-11742; Schnitzlein, W.M., et al. (1983) J Virol 45:206-214). Furthermore, exogenous proteins expressed by a recombinant VSV in the context of viral 5' and 3'UTRs are synthesized during infection, suggesting cis-acting RNA elements outside the coding region bestow this escape from host shutoff (Schnell, M.J., et al. (1996) J Virol 70:2318-2323). Although viral mRNA translation requires a methylated cap structure, VSV protein synthesis is unaffected by eIF4E sequestration, rapamycin treatment, hypoxic conditions, and eIF4G cleavage (Rose, J.K., and Lodiah H.F. (1976) Nature 262:32-37; Welnowska, E., et al. (2009) J Mol Biol 394:506-521 ; Muthukrishnan, S., et al. (1976) Biochemistry 15:5761-5768; Connor, J.H., et al. (2004) J Virol 78:8960-8970). These observations suggest that in spite of their structural similarity to cellular transcripts, VSV mRNA translation proceeds via a distinct mechanism.
While viral infection often inhibits initiation factor function, the ribosome itself cannot be compromised as it is the catalytic machinery for peptide bond formation. Although studied primarily for cap-independent translation, prior studies suggest direct interactions with ribosomal proteins may be a method for alternative translation (Mauro, V.P., and Edelman, G.M. (2002) Proc Natl Acad Sci USA 99: 12031-12036; Mauro, V.P., and Edelman, G.M. (2007) Cell Cycle 6:2246-2251). For instance, rps25 makes direct interactions with the Dicistroviridae IRES to facilitate translation (Landry, D.M., et al. (2009) Genes Dev 23:2 '53-2Ί '64; Muhs, M., et al. (2011) Nucleic Acids Res
39:5264-5275; Nishiyama, T., et al. (2007) Nucleic Acids Res 35: 1514-1521 ; Schuler, M., et al. (2006) Nat Struct Mol Biol 13: 1092-1096).
Accordingly, there is a need in the art for the identification of additional alternative mechanisms of viral translation which may be used to modulate viral infection and/or replication.
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the discovery that inhibition of specific ribosomal proteins nonetheless permits translation of VSV mRNAs during host translation shutoff. In particular, it has been demonstrated that VSV mRNA translation depends specifically on a 60S ribosomal protein, rpL40. RpL40 is not essential for bulk
cellular or cap-independent translation, but is necessary for replication of VSV and other viruses within the order Mononegavirales, independent of its role in providing ubiquitin. By recapitulating this pathway in vitro using yeast extracts, it has further been demonstrated that viral translation requires rpL40 for positioning of the 40S at the mRNA start codon and rpL40 function in this pathway occurs as part of the ribosome. Polysome analyses and in vitro reconstitution of initiation demonstrate that rpL40 is required for 80S formation on VSV mRNAs through a ds-regulatory element.
Accordingly, the present invention provides methods and compositions for the treatment of viral infections and for modulating, e.g., inhibiting, the activity of rpL40.
In one aspect, the present invention provides methods of treating a viral infection or at risk of developing a viral infection. The methods include contacting the organism with an effective amount of an agent which inhibits the activity of rpL40, thereby treating the viral infection in the organism.
The activity of rpL40 may be transcript-specific translation initiation of a viral mRNA and/or movement of the 40S ribosome subunit to the translation initiation site of a viral mRNA. In one embodiment, the rpl40 is a component of a large ribosomal subunit.
In one embodiment, the agent for use in the methods of the invention is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
The viral infection may be infection with a virus of the order Mononegavirales, such as a member of the family Bornaviridae , Rhabdoviridae, Filoviridae, and
Paramyxoviridae. In one embodiment, the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
In one embodiment, the viral infection is an acute viral infection.
The methods of the invention may further comprising contacting the organism with an additional therapeutic agent.
In one embodiment, the organism is a human subject. In another embodiment, the organism is a non-human subject. In yet another embodiment, the organism is a plant.
In another aspect, the present invention provides methods of inhibiting viral replication in a host cell infected with a virus. The methods include contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40, thereby inhibiting viral replication in the host cell.
In yet another aspect, the present invention provides methods of inhibiting translation of a viral mRNA in a host cell infected with a virus. The methods include
contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40, thereby inhibiting translation of the viral mRNA in the host cell.
The activity of rpL40 may be transcript-specific translation initiation of the viral mRNA, movement of the 40S ribosome subunit to the translation initiation site of the viral mRNA, cap-dependent mRNA translation and/or not bulk cellular translation,
IRES-driven translation, or ribosome shunted translation. In one embodiment, the rpl40 is a component of a large ribosomal subunit.
In one embodiment, the agent for use in the methods of the invention is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
The viral infection may be infection with a virus of the order Mononegavirales, such as a member of the family Bornaviridae , Rhabdoviridae , Filoviridae, and
Paramyxoviridae. In one embodiment, the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
In one aspect, the present invention provides methods of identifying a compound useful in inhibiting viral replication in a host cell infected with a virus. The methods include providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof, contacting the indicator composition with each of a member of a library of test compounds, and selecting from the library of test compounds a compound of interest that inhibits the activity of rpL40, thereby identifying a compound useful in inhibiting viral replication in a host cell infected with a virus.
In another aspect, the present invention provides methods of identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus. The methods include providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof, contacting the indicator composition with each of a member of a library of test compounds, and selecting from the library of test compounds a compound which inhibits the activity of rpL40, thereby identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus.
Other features and advantages of the invention will be apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A - IF depict that RpL40 is required for VSV gene expression. A. Fluorescence microscopy of cells transfected with a non-targeting (NT) siRNA or indicated ribosomal protein-targeting siRNA and infected with VSV-eGFP. Nuclei are Hochst stained (light gray). B. Rescue of VSV replication by exogenous expression of rpL40. HeLa cells were cotransfected with pcDNA3.1-rpL40, encoding a wild type or siRNA resistant form of the gene, and either NT or rpL40 targeting siRNA. Cells were infected and examined by epifluorescence microscopy. C. Expression of luciferase from purified rVSV-Luc ribonucleoprotein cores transfected into cells treated with an siRNA targeting rpL40. Luciferase activity was normalized to activity from cells treated with a NT siRNA. The results are given as the mean + SD of three independent experiments performed in triplicate. D. VSV primary transcription in rpL40 siRNA transfected cells. Abundance of VSV N mRNA was measured by quantitative RT-PCR. The results are given as the mean + SD from a single representative quantitative RT-PCR experiment performed in duplicate. E. Viral RNA synthesis in infected cells treated with rpL40 siRNA. Total [3H]-uridine-labeled cellular RNA was analyzed by electrophoresis on an acid-agarose gel. F. Quantitative RT-PCR of total viral RNA synthesis. Results were analyzed as in D.
Figures 2 A - 2H depict that RpL40-dependent translation is transcript-specific. A. VSV protein synthesis. Total [35S]-methionine-cysteine-labeled cytoplasmic proteins were analyzed by SDS-PAGE and detected by phosphorimager. Transfection of cells with non-targeting (NT) or rpL40-targeting siRNA is indicated. B. Schematic diagram of bicistronic CrPV IRES construct. Translation of firefly luciferase is cap-dependent, while translation of renilla luciferase is driven by the CrPV IRES. C. Firefly luciferase protein synthesis driven from pFR-CrPV. Firefly luciferase was measured from pFR- CrPV transfected ly sates at 12 h post- transfection and normalized to luciferase units from NT treated cells. The results are given as the mean + SD of three independent experiments each performed in triplicate. D. Renilla luciferase protein synthesis driven from pFR-CrPV. Luciferase levels were measured and normalized as in C. E.
Poliovirus protein synthesis. Cells were infected and total cytoplasmic proteins were analyzed as in A. F. Microscopy of cells infected with rabies virus-mCherry. G.
Microscopy of cells infected with measles virus-GFP. H. Microscopy of cells infected with Newcastle disease virus-GFP.
Figures 3A - 3F depict that RpL40 is required for translation initiation on VSV niRNAs as a constituent of the large subunit. A. Sedimentation profile of mock- infected rpL40-targeting or non- targeting (NT) siRNA-transfected cells. B. Distribution of β-actin mRNA with ribosomal complexes in cells depleted of rpL40. Transcript number, as determined by quantitative RT-PCR, is expressed as the percentage of total β-actin transcripts recovered and plotted against fraction number. The results are given as the mean + SD from a representative quantitative RT-PCR experiment performed in duplicate. C. Sedimentation profile of VSV-infected siRNA-transfected cells. D. Distribution of VSV N mRNA with ribosomal complexes in cells depleted of rpL40. Lysates were resolved and fractionated and mRNA distribution was determined as in B. E. Translation of cellular or VSV-derived luciferase mRNA in yeast extracts expressing or lacking rpL40. Cytoplasmic mRNA was isolated from cells transfected with a luciferase expression plasmid (pRL-CMV), or cells infected with rVSV-Luc, and used to program yeast extracts. The results are given as the mean + SD of three independent experiments performed in triplicate. F. Distribution of rpL40 with ribosomal complexes in VSV-infected cells.
Figures 4A - 4E depict that RpL40-dependent translation is utilized by select cellular mRNAs. A. Functional classification of niRNAs whose polysome association is altered upon rpL40 depletion. The gene in each category whose association was polysomes was most decreased upon knockdown of rpL4Q is listed. B. Levels of polysome-associated CLGl mRNA upon rpL40 depletion identified by sequencing analysis. C. Levels of polysome-associated DDR2 mRNA identified by sequencing analysis. Average Reads Per Kilobase of exon per Million mapped reads (RPKM) from biological replicates is graphed in B and C. D. In vitro translation of CLGl mRNA. (E) In vitro translation of DDR2 mRNA. The results of D and E are given as the mean + SD of three independent experiments, performed in triplicate. Conditions that are statistically significant from the +rpL40 conditions are indicated with the * symbol (P <0.0001).
Figures 5A - 5D depict that RpL40 is required for VSV replication. A. VSV gene expression following rpL40 siRNA treatment. HeLa cells were reverse transfected with a control non-targeting siRNA (NT) or one of two rpL40-targeting siRNAs (rpL40- 1, -2) and seeded onto coverslips. At 48 h post-transfection, cells were infected with rVS V-eGFP at a MOI of 1 , fixed at 6 hpi, and examined by epifluorescence microscopy. B. Analysis of rpL40 mRNA levels by RT-PCR. To control for equal RNA levels in the cell extracts, RT-PCR to detect the proteosomal transcript proteasome subunit beta type- 6 (PSMB6) was also performed. C. Analysis of rpL40 protein levels by western blot.
As a control for equal protein levels, an antibody was used to detect actin. D. VSV production upon rpL40 knockdown. SiRNA-treated cells were infected with VSV and output titers were measured by plaque assay at indicated times post infection.
Figures 6A - 6E depict that sensitivity of VSV to rpL40 depletion does not reflect defects in ribosome biogenesis and maturation. A. Accumulation of mature ribosomal RNAs in cells treated with rpL40 siRNA. RNA was labeled with [3H] -uridine for 2 h. Cytoplasmic RNA was purified by phenol/chloroform extraction and analyzed by electrophoresis on an acid-agarose gel. B. Accumulation of mature ribosomal RNAs in rVSV-M51R infected cells. Cells were mock-infected or infected at an MOI of 1 with VSV or rVSV-M51R. At 3 hpi, RNA was labeled and analyzed as in A. C. rVSV-
M51R protein synthesis in siRNA transfected cells. Cells were infected at an MOI of 1 and exposed at 6 hpi to [35S] methionine-cysteine in the presence of Actinomycin D [10 μg ml"1] for 30 min. D. VSV gene expression following rpL22 siRNA treatment. Hela cells reverse transfected with a control non-targeting siRNA (NT) or a rpL22-targeting siRNA were infected with rVSV-eGFP at a MOI of 1, fixed at 6 hpi, and examined by epifluorescence microscopy. E. Analysis of rpL22 mRNA levels by RT-PCR. RT-PCR using PSMB6 primers was performed as a control for equal RNA levels in the cell extracts.
Figures 7 A - 7C depict reproducibility of RPKM between biological replicates. A. Lysates from yeast cells depleted of rpL40 (glucose), or not depleted of rpL40 (galactose), for 4 h were resolved by sucrose gradient centrifugation. Extracts were prepared twice for biological replicates and RNA from polysome-containing fractions, as indicated, was isolated to make libraries for deep sequencing. B. Comparison in mRNA density for biological replicates. mRNA density is expressed as RPKM to account for differences in gene lengths and total reads. C. Error distribution of gene replicates. Normal error curve and histogram of log2 ratios between replicates for genes that have more than 256 reads in rpL40-containing samples are plotted.
Figure 8 depicts localization of rpL40 on the 80S ribosome. Localization of rpL40 on the crystal structure of the 80S ribosome. Ribosomal proteins are colored medium gray and ribosomal RNAs are colored light gray. RpL40 is colored dark gray (PDB 2XZM, 4A17, 3A19) (Klinge, S., et al. (2011) Science 334:941-948). N and C- termini are indicated in the two rotated views of rpL40.
Figure 9 depicts an alignment of rpL40 sequences. RpL40 sequences, with the C-terminal ubiquitin extension removed, were aligned using MUSCLE and visualized using Jalview. Colored sequences indicate more than 70% conserved identity. Genbank IDs are: H. sapien (AAI01833.1) (SEQ ID NO: 6), S. cerevisiae (CAA86130.1) (SEQ
ID NO: 3), M. fascicularis (P0C273.2) (SEQ ID NO: 7), B. taurus (DAA28295.1) (SEQ ID NO: 8), S. scrofa (NP_999376.1) (SEQ ID NO: 9), M. musculus (NP_063936.1) (SEQ ID NO: 10), F. "koz" catus (NP_001116826) (SEQ ID NO: 11), A. melanoleuca (AEA39530.1) (SEQ ID NO: 12), D. melanogaster (NP_476776.1) (SEQ ID NO: 13), E. complanata (ABW23236) (SEQ ID NO: 5), S. japonicum (226477078) (SEQ ID NO: 2), C. reinhardtii (EDO98280.1) (SEQ ID NO: 4), S. solfataricus (Q980V5.1) (SEQ ID NO: 1).
Figure 10 is a Table showing an SiRNA screen of ribosomal proteins required for VSV replication. Ribosomal proteins are grouped by phenotype of knockdown as indicated.
Figure 11 is a Table showing a list of cellular transcripts whose polysome association was reduced by more than 3-fold upon depletion of rpL40.
Figures 12A-12B depict that rpL40 regulation of 40S scanning on VSV mRNA is ribosome-mediated. A. Toe printing analyses on VSV mRNA during rpL40 depletion. VSV in vitro transcription mRNA was used for all toe printing assays. For a full-length product control, a Superscript III reverse transcription reaction on mRNA was performed using a primer annealing to VSV 727 N (RT). Translation inhibitors m7GpppA [ImM] (lanes 6 and 9), GMP-PNP [ImM] (lanes 7 and 10), or hygromycin B (HygB) [2mg/ml] (lanes 8 and 11) were added to yeast extracts for 3 minutes at 25°C before addition of mRNA. Initiation complexes were allowed to form on mRNA for 15 minutes at at 25°C and positions of ribosomal complexes on these mRNAs was determined by primer extension. Full length cDNA is marked at "5 ' end," and position of the AUG along the toe print corresponding to a stop at 15-17 nucleotides from initiator AUG is indicated. Lanes G, T, A, and C represent the positive strand sequence of VSV N mRNA synthesized using the same VSV N primer. B. Primer extension inhibition "toe printing" assay. Reverse transcription on VSV N mRNA using a radiolabeled primer produces an 80 nucleotides product. Binding of the 40S or 80S complex, which covers about 25-30 nucleotides, at the AUG leads to a block in primer extension and a 51 nucleotide toe print.
Figure 13 is a Table showing the results of an siRNA screen of ribosomal proteins required for VSV replication. HeLa cells were transfected with pools of four siRNAs targeting each of the individual ribosomal protein genes. At 48 h post transfection, cells were infected with a reporter VSV (rVSV-eGFP) that expresses eGFP as a marker of infection. Percent viability and infection was calculated relative to total number of cells and number of infected cells, respectively, in cells transfected with a non- targeting siRNA. Each transfection was performed in duplicate (A, B).
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, at least in part, on the discovery that inhibition of specific ribosomal proteins allows translation of VSV mRNAs during host shutoff. In particular, it has been demonstrated that VSV mRNA translation depends specifically on a 60S ribosomal protein, rpL40. RpL40 is not essential for bulk cellular or cap- independent translation, but is necessary for replication of VSV and other viruses within the order Mononegavirales, independent of its role in providing ubiquitin. By recapitulating this pathway in vitro using yeast extracts, it has further been demonstrated that viral translation requires rpL40 for positioning of the 40S at the mRNA start codon and rpL40 function in this pathway occurs as part of the ribosome. These results uncover a new mechanism of transcript-specific translation initiation that is dependent upon a specific 60S ribosomal constituent. Accordingly, the present invention provides methods and compositions for the treatment of viral infections and methods for modulating, e.g., inhibiting, the activity of rpL40.
I. Definitions
In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.
The articles "a" and "an" are used herein to refer to one or to more than one (i. e. , to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality.
As used herein, the term "rpL40" refers to the structural component of the large 60S subunit of the eukaryotic ribosome that is encoded as a C-terminal extension of ubiquitin. The ubiquitin is cleaved from the protein and is not necessary for ribosomal function (see, e.g., Finley, D., et al. (1989) Nature 338:394-401 ; Monia, .P.,et al. (1989) J Biol Chem 264:4093-4103). RpL40 is also referred to as "ubiquitin A-52 residue ribosomal protein fusion product", "60S ribosomal protein L40", "CEP52", "ubiquitin carboxyl extension protein 52", "ubiquitin-52 amino acid fusion protein", "ubiquitin-60S ribosomal protein L40", "ubiquitin-CEP52", and "UBCEP2". RpL40 is encoded by the UBA52 gene.
There are two transcript variants of human ubiquitin-60S ribosomal protein L40 precursor and the nucleotide and amino acid sequences of both are known. Variants 1 and 2 encode the same protein.
The nucleotide sequence of human ubiquitin-60S ribosomal protein L40 precursor variant 1 may be found in, for example, GenBank Accession No. GI:77539054 and is the longer of the two variants. Nucleotides 368-520 of variant 1 encode rpL40. The amino acid sequence of variant 1 may be found at, for example, GenBank
Accession No. GI:77539055. Amino acid residues 77-128 of variant 1 in GI:77539054 encode rpL40. The entire contents of each of the foregoing are expressly incorporated herein by reference.
The nucleotide sequence of human ubiquitin-60S ribosomal protein L40 precursor variant 2 may be found in, for example, GenBank Accession No.
GI:77539056. Nucleotides 346-498 of variant 2 encode rpL40. Variant 2 is the predominant variant which uses an alternate splice site in the 5' UTR, compared to variant 1. The amino acid sequence of this shorter sequence variant (2) may be found at, for example, GenBank Accession No. GI:4507761. Amino acid residues 77-128 of variant 2 in GI:4507761 encode rpL40. The entire contents of each of the foregoing are expressly incorporated herein by reference.
The nucleotide and amino acid sequences of homologues, e.g., orthologues, of rpL40 are known and include, for example,GenBank Accession No. 01:332854146 (chimpanzee); 01:224994157 (dog); GI: 115496707 (cattle); 01: 166064012 (rat);
01:80751128 (zebrafish); 01:24581598 (Drosophila); 01: 118789634 (mosquito);
01:71996854 (C. elegans); 01:67999975 and 01:68000562 (S. pombe); 01:296145625 and 01:296146464 (S. cerevisiae); 01:50302182 (K. lactis); 01:47074802 (Λ. gossypii); 01:145603447 (M. oryzae); 01: 164429239 (N. crassa); 01: 145339410 and
01: 145360668 (thale cress); 01: 115451756 (rice); 01: 124514025 {Plasmodium);
Ensembl Chromosome 15: 4,539,135-4,541,525 found at
http://useast.ensembl.org/Oallus_gallus/Location/View?db=core;r=15:4539135-4541525 (chicken), Ensembl Contig AAWZ02039315: 3,668-4,813, found at
http://useast.ensembl.org/ Anolis_carolinensis/Location/View?db=core;r=AAWZ020393 15:3668-4813 (lizard), GenBank Accession No. 01: 17527386 (frog). The entire contents of each of the foregoing are expressly incorporated herein by reference.
Additional homologues, e.g., orthologs, may be identified using methods routine to one of ordinary skill in the art and as described herein. For example, a homologue, e.g., an ortholog, of rpL40 may be isolated by screening libraries with probes containing nucleotide sequences encoding, for example, human rpL40. Numerous other methods known in the art are available for cloning the homologues of rpL40. For example, antibodies to rpL40 which are commercially available may be used to screen expression libraries. Additionally or alternatively, given that the genomes of a multitude or
organism (pants and non-human animals) have been sequenced and are publicaly available, rpL40 homologues, e.g., othologues, may be identified by performing a reciprocal blast search. Also see, e.g., U.S. Patent Publication No. 20020039763, the entire contents of which are hereby incorporated by reference. The identification of the cloned proteins as homologues, e.g., orthologs, may be established by performing the same biological assays as those described in the Examples herein.
As used herein, the term "rpL40 activity", "rpL40 biological activity", or "activity of an rpL40 polypeptide" includes an activity which can be modulated, e.g., inhibited, by modulating, e.g., inhibiting, the expression and/or activity of rpL40. For example, in one embodiment an rpL40 biological activity includes modulation of viral replication. Exemplary rpL40 activities include, e.g., modulating, translation of a viral mRNA infecting a host cell, movement or positioning of the 40S ribosome subunit to the translation initiation site of a virus mRNA infecting a host cell, modulation of viral infection, and/or modulation of transcript- specific translation initiation of an infecting viral mRNA.
As used herein, the phrase "transcript-specific translation initiation" refers to the ability of rpL40 to participate in the movement or positioning of the 40S ribosome subunit to the translation initiation site of a virus mRNA, inhibition of which inhibits viral mRNA translation without inhibiting host cellular translation such that host cell proliferation and/or viability is essentially unaffected. Thus in certain embodiments of the invention, the agent "selectively inhibits" replication of a virus in a host cell, translation of a viral mRNA infecting a host cell, sequence-specific translation initiation, and/or movement of the 40S ribosome subunit to the translation initiation site of a virus mRNA infecting a host cell. As used herein, the phrase "selectively inhibiting" refers to the ability of an agent for use in the methods described herein to inhibit the viral replication cycle activity of rpL40 without inhibiting host protein synthesis activity of rpL40 such that the cell is no longer viable.
As used herein, the various forms of the term "modulate" include stimulation (e.g., increasing or upregulating a particular response or activity) and inhibition (e.g., decreasing or downregulating a particular response or activity).
As used herein, the term "inhibit" refers to a decrease in a biological activity of rpL40. For example, the term "inhibit" refers to the ability to downmodulate the expression, stability, and/or activity of rpL40 as described herein.
An "agent that inhibits the activity of rpL40" or an "inhibitor of rpL40" is any compound or molecule that inhibits the expression and/or biological activity of rpL40. Exemplary agents suitable for use in the methods of the invention include interfering
nucleic acid molecules (e.g., antisence RNAs, shRNAs, and siRNAs), intracellular antibodies, inhibitory peptides, or small molecules. Agents for use in the methods of the invention are discussed in detail below.
The term "organism" as used herein, refers to living things (plants, non-human animal subjects, and human subjects) that would be benefited by the methods of the invention and are to be treated by the methods of the present invention. An organism includes one that has a viral infection or is at risk of having a viral infection. For example, an organism, such as a human, that has been bitten by an animal suspected of being rabid is at risk of developing rabies and, thus, would benefit from the methods of the invention.
The term "administering" includes any method of delivery of a pharmaceutical composition or agent into an otganism' s system or to a particular region in or on an organism.
As used herein, the term "contacting" (i.e., contacting an organism or contacting a cell, e.g., a host cell, and/or a virus with a compound) includes incubating the compound and the, e.g., cell, together in vitro (e.g., adding the compound to cells in culture) as well as administering the compound to an organism such that the compound and cells of the organism are contacted in vivo.
As used herein, the terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms, diminishing the extent of infection, stabilized (i.e., not worsening) state of infection, amelioration or palliation of the infectious state, whether detectable or undetectable.
"Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.
II. Methods of the Invention
Infection of plants, animals, and humans with members of the order
Mononegavirales results in profound inhibition of host protein synthesis. Identification of the roles of ribosomal proteins in viral infection has been hampered by the co- operative action of these proteins during ribosome subunit assembly and the necessity of the ribsosome for cellular viability. However, as described herein, by transiently depleting specific ribosomal proteins, it has been found that a component of the 60S ribosome of the host, rpL40, is required for translation of viral mRNA. Although it has long been held that ribosomes treat all messages equally, it was surprisingly found that specific inhibition of rpL40 affects viral replication by inhibiting transcript-specific translation of viral mRNA without affecting cellular viability.
Accordingly, the present invention provides methods for treating or preventing a viral infection in an organism having a viral infection or at risk of developing a viral infection. The methods include, contacting the organism with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby treating or preventing the viral infection in the organism.
The present invention also provides methods of inhibiting viral replication in a host cell infected with a virus. The methods include contacting the host cell with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby inhibiting viral replication in the host cell.
In another aspect of the invention, methods of inhibiting translation of a viral mRNA in a host cell are provided. The methods include contacting the host cell with an effective amount of an agent that modulates, e.g., inhibits, the activity of rpL40, thereby inhibiting translation of the viral mRNA in a host cell.
The organism, host cell, and/or virus are contacted with the agent in such amounts and for such time as is necessary to achieve the desired result.
Organisms that would benefit from the methods of the invention are those that are infected or at risk of being infected with non-segmented negative-sense RNA viruses and include plants, animals (non-human subjects), and humans.
Plants include, but are not limited to domesticated plants, such as corn, barley, lettuce, wheat, potato, and rice. Non-human subjects, include but are not limited to animals such as, for example, domesticated animals, such as livestock and pets, and wild animals, e.g., bird, rodent, bat, cat, dog, goat, cow, buffalo, pig, chicken, horse, whale, dolphin and porpoise. In one embodiment of the invention, an organism is a human. In one embodiment of the invention, an organism is a non-human subject. In one embodiment of the invention, an organism is a plant.
Viral infections that may be treated by the methods of the invention include infections with a non-segmented negative-sense RNA virus, such as members of the order Mononegavirales. The Mononegavirales order includes four families:
Bornaviridae, Rhabdoviridae, Filoviridae, and Paramyxoviridae .
The taxonomic classification of members of the Mononegavirales family is outlined in the table below.
Mononegavirales Families, Genera, and Species
Species (* signifies type
Family Subfamily Genus
species)
Bornaviridae Bornavirus Borna disease virus * Filoviridae Marburgvirus Lake Victoria marburgvirus *
Ebolavirus Zaire virus *
Ivory Coast ebolavirus
Reston ebolavirus
Sudan ebolavirus
Paramyxoviridae Paramyxovirinae Respiro Bovine parainfluenza virus 3
Human parainfluenza virus 1
Human parainfluenza virus 3
Sendai virus *
Simian virus 10
Morbillivirus Canine distemper virus
Cetacean morbillivirus
Dolphin distemper virus
Measles virus *
Peste-des-petits-ruminants virus
Phocine distemper virus Rinderpest virus
Rubulavirus Human parainfluenza virus 2
Human parainfluenza virus 4 Human parainfluenza virus 4a Mapuera virus
Mumps virus *
Porcine rubulavirus
Simian virus 5
Simian virus 41
Henipavirus Hendra virus *
Nipah virus
Avulavirus Avian paramyxovirus
Newcastle disease vims
Pneumovirinae Pneumovims Human respiratory syncytial virus *
Bovine respiratory syncytial virus
Murine pneumonia virus Metapneumovims Avian metapneumovims *
Human metapneumovims
Viruses in the family Tupaia paramyxovirus Paromyxoviridae that Fer-de-Lance vims assigned to a genus Menangle vims
Nariva vims
Tioman vims
Rhabdoviridae Vesiculovirus Carajas vims
Chandipura vims
Cocal vims
Isfahan vims
Maraba vims
Piry vims
Vesicular stomatitis Alagoas vims
Vesicular stomatitis Indiana vims *
Vesicular stomatitis New Jersey vims
Lyssavims Australian bat lyssavims
Duvenhage virus
European bat lyssavirus Lagos bat virus
Mokola virus
Rabies virus *
Ephemerovirus Adelaide River virus
Berrimah virus
Bovine ephemeral fever virus
*
Novirhabdovirus Hirame rhabdovirus
Infectious hematopoietic necrosis virus
Viral hemorrhagic septicemia virus
Snakehead rhabdovirus
Cytorhabdovirus Barley yellow striate mosaic virus
Broccoli necrotic yellows virus
Festuca leaf streak virus
Lettuce necrotic yellows virus
*
Northern cereal mosaic virus
Sonchus virus
Strawberry crinkle virus
Wheat American striate mosaic virus
Nucleorhabdovirus Datura yellow vein virus
Eggplant mottled dwarf virus
Maize mosaic virus
Potato yellow dwarf virus *
Rice yellow stunt virus
Sonchus yellow net virus
Sowthistle yellow vein virus
There are numerous viruses in the Rhabdoviridae family that are not assigned to a genus
A number of diseases are caused by viruses of the order Mononegavirales.
Accordingly, the methods of the invention also include treatment of a disease which is the result of infection of an organism with any one of the viruses listed in the table above, such as, for example, Newcastle disease, measles, canine distemper, mumps, rabies, and Ebola. For example, in one aspect the present invention provides methods for treating a subject having or at risk of developing rabies. The methods include contacting the subject having or at risk of developing rabies with an effective amount of an agent which moduates, e.g., inhibits, the expression and/or activity of rpL40, thereby treating the subject having or at risk of developing rabies. An "organism or subject at risk of having a viral infection" is one that has a probability of being infected given that exposure to the virus has occurred or has likely occurred.
In one embodiment of the invention, the methods are useful for treating an "acute viral infection", such as an acute viral infection of an organism with a virus from the order Mononegavirales. As used herein, an "acute viral infection" or an "acute infection" is an infection of a host or host cell with a virus that is typically cleared from the subject (e.g., an organism that is not immunocompromised) by the innate and adaptive immune systems. In some embodiment, the methods of the invention are not useful for the treatment of a "persistent viral infection" or a "persistent infection". In other embodiments, the methods of the invention are useful for the treatment of a "persistent viral infection" or a "persistent infection". A persistent infection is one in which the virus is not cleared from the host after the initial infection. Persistent infections are characterized by the continual presence of the infectious organism often as a latent infection with occasional recurrent relapses of active infection.
Clearance of a virus may be determined by, for example methods known in the art for determining, for example, the presence in the organism of the virus, e.g., using ELISA assays for various surface antigens of the virus.
Examples of persistent infections include, but are not limited to, hepatitis, herpes, infectious mononucleosis, Cytomegalovirus (CMV), and HIV infections. See, for example, Medical Microbiology, 4th edition. Chapter 46, "Persistent Viral Infections."
Baron S, editor. Galveston (TX): University of Texas Medical Branch at Galveston; 1996.
Use of an effective amount of the inihibitory agents of the present invention (and therapeutic compositions comprising such agents) is an amount effective, at dosages and for periods of time necessary to achieve the desired result. An effective amount of the inhibitory agent is also that amount which does not significantly affect the viability of the host cell, e.g., does not kill the organism.
For example, an effective amount of an inhibitory agent may vary according to factors such as the disease state, age, sex, reproductive state, and weight, and the ability of the agent to elicit a desired response in the organism. Dosage regimens may be adjusted to provide the optimum response. For example, several divided doses may be provided daily or the dose may be proportionally reduced as indicated by the exigencies of the situation.
An "effective amount" or "therapeutically effective amount" of an agent which inhibits the expression and/or activity of rpL40 is an amount sufficient to produce the desired effect, e.g. , an inhibition of expression of a viral mRNA in comparison to the normal level of expression and/or activity detected in the absence of the inhibitory agent. Inhibition of expression and/or activity of rpL40 is achieved when the value obtained with an inhibitory agent relative to the control is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. Suitable assays for measuring expression and/or activity of rpL40 are known in the art and described herein and include, e.g., examination of protein or RNA levels using techniques known to those of skill in the art such as dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays described herein and known to those of ordinary skill in the art.
"Inhibiting the expression and/or activity of rpL40" or "inhibiting the activity of rpL40" refers to the ability of an inhibitory agent of the invention to silence, reduce, or inhibit the activity and/or expression of rpL40. To examine the extent of inhibition, a test sample (e.g., a sample of cells in culture expressing the target gene (rpL40) and infected with a virus) or a test organism (e.g., a mammal such as a human or an animal model such as a rodent (e.g., mouse) or a non-human primate (e.g., monkey) model) is contacted with an inhibitory agent that silences, reduces, or inhibits activity and/or expression of rpL40. Expression and/or actvitiy of rpL40 in the test sample or test animal is compared to expression and/or activity of rpL40 in an appropriate control sample (e.g., a sample of cells in culture expressing rpL40) or a control organism (e.g., a mammal such as a human or an animal model such as a rodent (e.g., mouse) or non-
human primate (e.g., monkey model) that is not contacted with or administered the inhibitory agent. The expression and/or activity of rpL40 in a control sample or a control organism may be assigned a value of 100%. In particular embodiments, silencing, inhibition, or reduction of expression and/or activity of rpL40 is achieved when the level of rpL40 expression and/or activity in the test sample or the test organism relative to the level of rpL40 expression and/or activity in the control sample or the control organism is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. In other words, the inhibitory agents of the present invention are capable of silencing, reducing, or inhibiting the expression and/or activity of rpL40 by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% in a test sample or a test sample relative to the level of rpL40 expression and/or activity in a control sample or a control organism not contacted with or administered the inhibitory agent. Suitable assays for determining the level of rpL40 expression and/or activity include, without limitation, examination of protein or mRNA levels using techniques known to those of skill in the art, such as, e.g., dot blots, Northern blots, in situ hybridization, ELISA,
immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art and described herein.
The inhibitory agents of the present invention may be administered in an amount effective to achieve a desired result and/or at a dose that is sufficient to elicit a detectable immune response in an organiosm based on the mode of administration and without significant adverse side effects.
Dose administration can be repeated depending upon the pharmacokinetic parameters of the dosage formulation and the route of administration used. It is also provided that certain formulations containing an inhibitory agent are to be administered orally. Such formulations are preferably encapsulated and formulated with suitable carriers in solid dosage forms. Some examples of suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, calcium silicate, microcrystalline cellulose,
olyvinylpyrrolidone, cellulose, gelatin, syrup, methyl cellulose, methyl- and
propylhydroxybenzoates, talc, magnesium, stearate, water, mineral oil, and the like. The formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents. The compositions may be formulated so as to provide rapid, sustained, or delayed release of the active ingredients after administration to the organism by employing procedures well known in the art. The formulations can also contain substances that diminish proteolytic
degradation and/or substances which promote absorption such as, for example, surface active agents.
It is especially advantageous to formulate compositions, e.g., parenteral compositions, in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the organisms to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individual organisms. The specific dose can be readily calculated by one of ordinary skill in the art, e.g. , according to the approximate weight, e.g., body weight, or surface area of the organism or the volume of space to be occupied. The dose will also be calculated dependent upon the particular route of administration selected. Further refinement of the calculations necessary to determine the appropriate dosage for treatment is routinely made by those of ordinary skill in the art. Such calculations can be made without undue experimentation by one skilled in the art in light of the activity disclosed herein in assay preparations of target cells. Exact dosages are determined in conjunction with standard dose-response studies. It will be understood that the amount of the composition actually administered will be determined by a practitioner, in the light of the relevant circumstances including the condition or conditions to be treated, the choice of composition to be administered, the age, weight, and response of the individual organism, the severity of the organism's symptoms, and the chosen route of administration.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental plant and/or animal models, e.g. for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies
preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method for the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
The agents or pharmaceutical compositions of the present invention can be administered by any suitable route known in the art including for example intravenous, subcutaneous, intramuscular, transdermal, intrathecal or intracerebral or administration to cells in ex vivo treatment protocols, or delivered on a surface, e.g., a biocompatible surface. Administration can be either rapid as by injection or over a period of time as by slow infusion or administration of slow release formulation.
In one embodiment, the methods of the invention are short-term courses of therapy. For example, an organism may be contacted (or administered) an agent of the invention for about 1 day, 2, 3, 4, 5, 6, or 7 days.
In one embodiment of the invention, the methods further comprise the administration of an additional thereapeutic agent, such as, for example, and antiinflammatory or an anti-viral drug. Non-limiting examples of anti- viral drugs include abacavir, aciclovir, acyclovir, adefovir, amantadine, amprenavir, arbidol, atazanavir, atripla, cidofovir, combivir, darunavir, delavirdine, didanosine, docosanol, edoxudine, efavirenz, emtricitabine, enfuvirtide, entecavir, entry inhibitors, famciclovir, fixed dose combinations, fomivirsen, fosamprenavir, foscarnet, fosfonet, fusion inhibitors, ganciclovir, ibacitabine, immunovir, idoxuridine, imiquimod, indinavir, inosine, integrase inhibitors, interferon type III (e.g., IFN-λ molecules such as IFN-λΙ, ΙΡΝ-λ2, and ΙΡΝ-λ3), interferon type II (e.g., IFN-γ), interferon type I (e.g. , IFN-a such as PEGylated IFN-a, IFN-β, IFN-K, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ), interferon, lamivudine, lopinavir, loviride, MK-0518, maraviroc, moroxydine, nelfinavir, nevirapine, nexavir, nucleoside analogues, oseltamivir, penciclovir, peramivir, pleconaril, podophyllotoxin, protease inhibitors, reverse transcriptase inhibitors, ribavirin, rimantadine, ritonavir, saquinavir, stavudine, synergistic enhancers, tenofovir, tenofovir disoproxil, tipranavir, trifluridine, trizivir, tromantadine, truvada, valaciclovir, valganciclovir, vicriviroc, vidarabine, viramidine, zalcitabine, zanamivir, zidovudine,
pharmaceutically acceptable salts thereof, stereoisomers thereof, derivatives thereof, analogs thereof, and mixtures thereof.
In another embodiment, the methods of the invention further comprise supportive therapy, e.g., fluid infusions.
III. Agents and Compositions for Use in the Methods of the Invention
Since inhibition of rpL40 activity is associated with, e.g., inhibition of sequence- specific translation initiation, in the methods of the invention an organism or a cell is contacted with an agent that inhibits rpL40 expression and/or activity. The cells may be contacted with the agent in vitro and then the cells can be administered to an organism in vivo, or, alternatively, the agent may be administered to an organism (e.g., parenterally) such that the cells are contacted with the agent in vivo.
Inhibitory compounds of the invention can be, for example, intracellular binding molecules that act to specifically inhibit the expression and/or activity of rpL40. As used herein, the term "intracellular binding molecule" is intended to include molecules that act intracellularly to inhibit the expression or activity of a protein by binding to the protein or to a nucleic acid (e.g., an mRNA molecule) that encodes the protein.
Examples of intracellular binding molecules, described in further detail below, include inhibitory nucleic acids, siRNA molecules, intracellular antibodies, peptidic compounds that inhibit the interaction of rpL40 with a target molecule, and chemical agents that specifically inhibit rpL40 activity.
The inhibitory agent can also be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties. For example, an inhibitory agent can be stably linked to a polymer such as polyethylene glycol to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties. (See for example Davis et al., 1978, Enzyme Eng 4: 169-73; Burnham, 1994, Am J Hosp Pharm 51: 210-218, which are incorporated by reference).
Furthermore, an inhibitory agent can be in a composition which aids in delivery into the cytosol of a cell. For example, the agent may be conjugated with a carrier moiety such as a liposome that is capable of delivering the peptide into the cytosol of a cell. Such methods are well known in the art (for example see Amselem et al. , 1993, Chem Phys Lipids 64: 219-237, which is incorporated by reference). Alternatively, the inhibitory agent can be modified to include specific transit peptides or fused to such transit peptides which are capable of delivering the inhibitory agent into a cell. In addition, the agent can be delivered directly into a cell by microinjection.
The compositions are usually employed in the form of pharmaceutical preparations. Such preparations are made in a manner well known in the pharmaceutical art. One preferred preparation utilizes a vehicle of physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers such as physiological concentrations of other non-toxic salts, five percent aqueous glucose solution, sterile water or the like may also be used. As used herein "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. It may also be desirable that a suitable buffer be present in the composition. Such solutions can, if desired, be lyophilized and stored in a sterile ampoule ready for reconstitution by the addition of sterile water for ready injection. The primary solvent can be aqueous or alternatively non-aqueous. Inhibitory agents can also be incorporated into a solid or semi-solid biologically compatible matrix which can be implanted into tissues requiring treatment.
In one embodiment, an agent if the invention may be administered to a subject as a pharmaceutical composition. In one embodiment, the invention is directed to an active compound (e.g., a inhibitor of rpL40) and a carrier. Such compositions typically comprise the inhibitory agent, e.g., as described herein or as identified in a screening assay, e.g., as described herein, and a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers and methods of administration to a subject are described herein.
A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents;
antibacterial compounds such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating compounds such as
ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and compounds for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition will preferably be sterile and should be fluid to the extent that easy syring ability exists. It will preferably be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal compounds, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic compounds, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an compound which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding compounds, and/or adjuvant materials can be included as part of the
composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as
microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating compound such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening compound such as sucrose or saccharin; or a flavoring compound such as peppermint, methyl salicylate, or orange flavoring.
In one embodiment, agents are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from, e.g., Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. i. Interfering Nucleic Acid Molecules
The term "interfering nucleic acid molecule" or "interfering nucleic acid" as used herein includes single-stranded RNA {e.g., mature miRNA, ssRNAi oligonucleotides, ssDNAi oligonucleotides), double-stranded RNA {i.e., duplex RNA such as siRNA, Dicer-substrate dsRNA, shRNA, aiRNA, or pre-miRNA), a DNA-RNA hybrid (see, e.g., PCT Publication No. WO 2004/078941), or a DNA-DNA hybrid (see, e.g., PCT
Publication No. WO 2004/104199) that is capable of reducing or inhibiting the expression (and, thus, the activity) of a target gene or sequence {e.g., by mediating the degradation or inhibiting the translation of mRNAs which are complementary to the interfering RNA sequence) when the interfering nucleic acid is in the same cell as the target gene or sequence. Interfering nucleic acid thus refers to a single- stranded nucleic acid molecules that are complementary to a target mRNA sequence or to the double- stranded RNA formed by two complementary strands or by a single, self-complementary strand. Interfering nucleic acids may have substantial or complete identity to the target gene or sequence, or may comprise a region of mismatch {i.e., a mismatch motif). The sequence of the interfering nucleic acids can correspond to the full-length target gene, or a subsequence thereof. Preferably, the interfering nucleic acid molecules are chemically
synthesized. The disclosures of each of the above patent documents are herein incorporated by reference in their entirety for all purposes.
As used herein, the term "mismatch motif" or "mismatch region" refers to a portion of an interfering nucleic acid (e.g., siRNA) sequence that does not have 100% complementarity to its target sequence. An interfering nucleic acid may have at least one, two, three, four, five, six, or more mismatch regions. The mismatch regions may be contiguous or may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides. The mismatch motifs or regions may comprise a single nucleotide or may comprise two, three, four, five, or more nucleotides.
An interefering nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double- stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an interefering nucleic acid is an antisense nucleic acid and can hydrogen bond to the sense nucleic acid.
In one embodiment, an interefering nucleic acid of the invention is a "small- interfering RNA" or "an siRNA" molecule. In one embodiment, an interefering nucleic acid of the invention mediates RNAi. RNA interference (RNAi) is a post-transcriptional, targeted gene-silencing technique that uses double- stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287, 2431-2432 (2000); Zamore, P. D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev. 13, 3191-3197 (1999); Cottrell T R, and Doering T L. 2003. Trends Microbiol. 11:37-43; Bushman F. 2003. Mol. Therapy. 7:9-10; McManus M T and Sharp P A. 2002. Nat Rev Genet. 3:737-47). The process occurs when an endogenous ribonuc lease cleaves the longer dsRNA into shorter, e.g., 21- or 22- nucleotide-long RNAs, termed small interfering RNAs or siRNAs. The smaller RNA segments then mediate the degradation of the target mRNA. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabs or Ambion. In one embodiment one or more of the chemistries described herein for use in antisense RNA can be employed in molecules that mediate RNAi.
Interfering nucleic acid includes, e.g., siRNA, of about 10-60, 10-50, or 10-40 (duplex) nucleotides in length, more typically about 10-30, 10-25, or 10-25 (duplex) nucleotides in length, and is preferably about 10-24, (duplex) nucleotides in length (e.g., each complementary sequence of the double-stranded siRNA is 10-60, 10-50, 10-40, 10- 30, 10-25, or 10-25 nucleotides in length, preferably about 10-24, 11-22, or 11-23 nucleotides in length, and the double- stranded siRNA is about 10-60, 10-50, 10-40, 10-
30, 10-25, or 10-25 base pairs in length). siRNA duplexes may comprise 3'-overhangs of about 1 to about 6 nucleotides and 5 '-phosphate termini. Examples of siRNA include, without limitation, a double- stranded polynucleotide molecule assembled from two separate stranded molecules, wherein one strand is the sense strand and the other is the complementary antisense strand; a double- stranded polynucleotide molecule assembled from a single stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule with two or more loop structures and a stem having self-complementary sense and antisense regions, where the circular polynucleotide can be processed in vivo or in vitro to generate an active double-stranded siRNA molecule. As used herein, the term "siRNA" includes RNA-RNA duplexes as well as DNA-RNA hybrids (see, e.g., PCT Publication No. WO 2004/078941).
Preferably, siRNA are chemically synthesized. siRNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with the E. coli RNase III or Dicer. These enzymes process the dsRNA into biologically active siRNA (see, e.g., Yang et al, Proc. Natl. Acad. Sci. USA, 99:9942-9947 (2002); Calegari et al, Proc. Natl. Acad. Sci. USA, 99: 14236 (2002); Byrom et al, Ambion TechNotes, 10(l):4-6 (2003); Kawasaki et al, Nucleic Acids Res. , 31 :981-987 (2003); Knight et al., Science, 293:2269-2271 (2001); and Robertson et al, J. Biol. Chem., 243:82 (1968)). Preferably, dsRNA are at least 50 nucleotides to about 100, 200, 300, 400, or 500 nucleotides in length. A dsRNA may be as long as 1000, 1500, 2000, 5000 nucleotides in length, or longer. The dsRNA can encode for an entire gene transcript or a partial gene transcript. In certain instances, siRNA may be encoded by a plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops).
Given the coding strand sequences encoding rpL40 known in the art and disclosed herein, an interefering nucleic acid of the invention can be designed according to the rules of Watson and Crick base pairing. The interefering nucleic acid molecule can be complementary to the entire coding region of rpL40 mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of rpL40 mRNA. For example, an interefering oligonucleotide can be complementary to the region surrounding the processing site of ubiquitin and rpL40 mRNA. An interefering RNA oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An interefering nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions
using procedures known in the art. For example, an interefering nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the interfering nucleic acids include 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxy acetic acid (v), 5 -methyl - 2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. To inhibit expression in cells, one or more interefering nucleic acid molecules can be used. Alternatively, the an interefering nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). Non- limiting exemplary siRNAs for use in the methods of the present invention include D-011794-02 (ccugcgagguggcauuauu) (SEQ ID NO: 26) and D-011794-04 (caaguguaugcucgccuu) (SEQ ID NO: 27) or a combination thereof.
In yet another embodiment, an interfering nucleic acid molecule of the invention is an oc-anomeric nucleic acid molecule. An oc-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641). The interfering nucleic acid molecule can also comprise a 2'-0- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).
In still another embodiment, an interfering nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they
have a complementary region. Thus, ribozymes (e.g. , hammerhead ribozymes (described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave rpL40 mRNA transcripts to thereby inhibit translation of rpL40 mRNA. A ribozyme having specificity for a rpL40-encoding nucleic acid can be designed based upon the nucleotide sequence of rpL40. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a rpL40-encoding mRNA. See, e.g. , Cech et al. U.S. Pat. No. 4,987,071 ; and Cech et al. U.S. Pat. No. 5,116,742. Alternatively, rpL40 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g. , Bartel, D. and Szostak, J. W., 1993, Science 261 : 1411-1418.
Alternatively, gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of rpL40 (e.g., the ubiquitin/rpL40 promoter and/or enhancers) to form triple helical structures that prevent transcription of the ubiquitin/rpL40 gene in target cells. See generally, Helene, C, 1991, Anticancer Drug Des. 6(6):569-84; Helene, C. et al., 1992, Ann. N Y. Acad. Sci. 660:27-36; and Maher, L. J., 1992, Bioassays 14(12):807-15.
In yet another embodiment, the inhibitory nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup B. et al., 1996, Bioorganic & Medicinal Chemistry 4 (1): 5-23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g. , DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al., 1996, supra; Perry-O'Keefe et al., 1996, Proc. Natl. Acad. Sci. USA 93: 14670-675.
In another embodiment, PNAs of rpL40 can be modified, (e.g. , to enhance their stability or cellular uptake), by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of rpL40 nucleic acid molecules can be generated which may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, (e.g., RNAse H and DNA
polymerases), to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup B., 1996, supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup B., 1996, supra and Finn P. J. et al., 1996, Nucleic Acids Res. 24 (17): 3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5' end of DNA Gag, M. et al. , 1989, Nucleic Acid Res. 17: 5973-88). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn P. J. et al., 1996, supra). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser, K. H. et al., 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).
In other embodiments, the interfering nucleic acid may include other appended groups such as peptides {e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g. , Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. WO88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (See, e.g., Krol et al., 1988, Bio-Techniques 6:958-976) or intercalating agents. (See, e.g. , Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, a lipophillic group, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).
Interfering polynucleotides may be produced from a heterologous expression cassette in a transfectant cell or transgenic cell. Alternatively, the antisense
polynucleotides may comprise soluble oligonucleotides that are administered to the external milieu, either in the culture medium in vitro or in the circulatory system or in interstitial fluid in vivo. Soluble antisense polynucleotides present in the external milieu have been shown to gain access to the cytoplasm and inhibit translation of specific mRNA species. ii. Intracellular Antibodies
Another type of inhibitory compound or agent that can be used to inhibit the expression and/or activity of rpL40 protein in a cell is an intracellular antibody specific
for rpL40. The use of intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g. , Carlson, J. R. (1988) Mol. Cell. Biol. 8:2638-2646; Biocca, S. et al. (1990) EMBO J. 9:101-108; Werge, T. M. et al. (1990) FEBS Letters 274: 193-198; Carlson, J. R. (1993) Proc. Natl. Acad. Sci. USA 90:7427-7428; Marasco, W. A. et al. (1993) Proc. Natl. Acad. Sci. USA 90:7889-7893; Biocca, S. et al. (1994)
Bio/Technology 12:396-399; Chen, S-Y. et al. (1994) Human Gene Therapy 5:595-601; Duan, L et al. (1994) Proc. Natl. Acad. Sci. USA 91 :5075-5079; Chen, S-Y. et al.
(1994) Proc. Natl. Acad. Sci. USA 91:5932-5936; Beerli, R. R. et al. (1994) /. Biol. Chem. 269:23931-23936; Beerli, R. R. et al. (1994) Biochem. Biophys. Res. Commun. 204:666-672; Mhashilkar, A. M. et al. (1995) EMBO J. 14: 1542-1551; Richardson, J. H. et al. (1995) Proc. Natl. Acad. Sci. USA 92:3137-3141 ; PCT Publication No. WO 94/02610 by Marasco et al. and PCT Publication No. WO 95/03832 by Duan et al).
To inhibit protein activity using an intracellular antibody, a recombinant expression vector is prepared which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell.
To prepare an intracellular antibody expression vector, antibody light and heavy chain cDNAs encoding antibody chains specific for the target protein of interest, e.g., rpL40 protein, or a fragment thereof, is isolated, typically from a hybridoma that secretes a monoclonal antibody specific for rpL40 protein, or a fragment thereof. Anti- rpL40 protein antibodies can be prepared by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with a rpL40 protein immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed rpL40 protein or a chemically synthesized rpL40 peptide. A non- limiting exemplary peptide such as Cys-Gly-His-Thr-Asn-Asn-Leu-Arg-Pro-Lys-Lys-Lys-Val-Lys (SEQ ID NO: 28) may be used in order to prepare an antibody suitable for use in the methods of the present invention (as described in, for example, Redman, K.L. (1994) Insect Biochem. Molec. Biol. 24: 191-201, the entire contents of which are incorporated herein by reference). The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory compound. Antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J Immunol 127:539-46; Brown et al. (1980) J Biol Chem 255:4980-83; Yeh et al. (1976) PNAS 76:2927-31 ; and Yeh et al. (1982) Int. J. Cancer 29:269-75). The technology for producing monoclonal antibody hybridomas is well known (see generally R. H.
Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, N.Y. (1980); E. A. Lerner (1981) Yale J. Biol. Med. , 54:387-402; M. L. Gefter et al. (1977) Somatic Cell Genet. , 3:231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a rpL40 protein immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds specifically to the rpL40 protein. Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-rpL40 protein monoclonal antibody (see, e.g. , G. Galfre et al. (1977) Nature, 266:550-52; Gefter et al. Somatic Cell Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra). Moreover, the ordinary skilled artisan will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line {e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques, e.g., the P3-NS1/1- Ag4-1, P3-x63-Ag8.653 or Sp2/0-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md.
Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody that specifically binds the maf protein are identified by screening the hybridoma culture supernatants for such antibodies, e.g., using a standard ELISA assay.
Alternative to preparing monoclonal antibody- secreting hybridomas, a monoclonal antibody that binds to rpL40 can be identified and isolated by screening a recombinant combinatorial immunoglobulin library {e.g. an antibody phage display library) with the protein, or a peptide thereof, to thereby isolate immunoglobulin library members that bind specifically to the protein. Kits for generating and screening phage display libraries are commercially available {e.g. , the Pharmacia Recombinant Phage Antibody System; and the Stratagene SurfZAP.TM. Phage Display Kit). Additionally,
examples of methods and compounds particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Pat. No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. International Publication WO 92/20791 ; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Fuchs et al. (1991) Bio/Technology 9: 1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81- 85; Huse et al. (1989) Science 246: 1275-1281 ; Griffiths et al. (1993) EMBO J. 12:725- 734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clarkson et al. (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991)
Bio/Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-4137; Barbas et al. (1991) PNAS 88:7978-7982; and McCafferty et al. Nature (1990) 348:552- 554.
Once a monoclonal antibody of interest specific for rpL40 has been identified
(e.g., either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library, including monoclonal antibodies to rpL40 that are already known in the art), DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques. For hybridoma derived antibodies, light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For recombinant antibodies, such as from a phage display library, cDNA encoding the light and heavy chains can be recovered from the display package (e.g. , phage) isolated during the library screening process. Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 and in the "Vbase" human germline sequence database.
Once obtained, the antibody light and heavy chain sequences are cloned into a recombinant expression vector using standard methods. As discussed above, the sequences encoding the hydrophobic leaders of the light and heavy chains are removed and sequences encoding a nuclear localization signal (e.g., from SV40 Large T antigen) are linked in-frame to sequences encoding either the amino- or carboxy terminus of both the light and heavy chains. The expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full- length antibody light and heavy chains such that a full-length antibody is expressed
intracellularly. In another embodiment, the vector encodes a full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab fragment is expressed intracellularly. In the most preferred embodiment, the vector encodes a single chain antibody (scFv) wherein the variable regions of the light and heavy chains are linked by a flexible peptide linker and expressed as a single chain molecule. To inhibit transcription factor activity in a cell, the expression vector encoding the rpL40-specific intracellular antibody is introduced into the cell by standard transfection methods as described hereinbefore.
Exemplary antibodies suitable for use in the methods of the invention include the antibodies described in Redman, K.L. (1994) Insect Biochem. Molec. Biol. 24: 191-201.
Hi. rpL40 -Derived Peptidic Compounds
In another embodiment, an inhibitory compound of the invention is a peptidic compound derived from the rpL40 amino acid sequence, as described supra and known in the art. In particular, the inhibitory compound comprises a portion of rpL40 (or a mimetic thereof) that mediates interaction of rpL40 with a target molecule such that contact of rpL40 with this peptidic compound competitively inhibits the interaction of rpL40 with the target molecule. For example, a peptidic compound may inhibit the interaction and/or binding of rpL40 with a translation initiation site of a viral mRNA.
The peptidic compounds of the invention can be made intracellularly in cells by introducing into the cells an expression vector encoding the peptide. Such expression vectors can be made by standard techniques. The peptide can be expressed in intracellularly as a fusion with another protein or peptide {e.g., a GST fusion).
Alternative to recombinant synthesis of the peptides in the cells, the peptides can be made by chemical synthesis using standard peptide synthesis techniques. Synthesized peptides can then be introduced into cells by a variety of means known in the art for introducing peptides into cells {e.g., liposome and the like).
Other inhibitory agents that can be used to specifically inhibit the activity of an rpL40 protein are chemical compounds that directly inhibit rpL40 activity or inhibit the interaction between rpL40 and target molecules. Such compounds can be identified using screening assays that select for such compounds, as described in detail below.
IV. Screening Assays
Agents that inhibit rpL40 activity can be known {e.g. , rpL40 interfering nucleic acid molecules, rpL40 intracellular antibodies that interfere with rpL40 activity, peptide inhibitors derived from rpL40) or can be identified using the methods described herein. The invention provides methods (also referred to herein as "screening assays") for
identifying other modulators, i.e., candidate or test compounds or agents (e.g. , peptidomimetics, small molecules or other drugs) which modulate rpL40 activity and for testing or optimizing the activity of other agents.
For example, in one embodiment, molecules which bind, e.g., to rpL40 or another ribosomal protein interacting with rpL40, or have a stimulatory or inhibitory effect on the expression and/or activity of rpL40 or another ribosomal protein interacting with rpL40 can be identified.
In one embodiment, the ability of a compound to directly modulate the expression, post-translational modification, or activity of rpL40 is measured in an indicator composition using a screening assay of the invention.
Agents that are capable of inhibiting the expression and/or activity of rpL40, as identified by methods of the invention, are useful as candidate anti-virals.
For example, in one aspect, the present invention provides methods for identifying a compound useful for treating a viral infection. The methods include providing an indicator composition, contacting the indicator composition with a test compound (or a plurality of test compounds), determining the effect of a test compound on the expression and/or activity of rpL40, and selecting a compound which modulates the expression and/or activity of rpL40, thereby identifying a compound useful for treating a viral infection.
In another aspect, the present invention provides methods for identifying a compound useful in inhibiting translation of a viral mRNA infecting a host cell. The methods include providing an indicator composition, contacting the indicator composition with a test compound (or a plurality of test compounds), determining the effect of a test compound on the expression and/or activity of rpL40, and selecting a compound which modulates the expression and/or activity of rpL40, thereby identifying a compound useful for inhibiting translation of a viral mRNA infecting a host cell.
Examples of agents, candidate compounds or test compounds include, but are not limited to, nucleic acids (e.g. , DNA and RNA), carbohydrates, lipids, proteins, peptides, peptidomimetics, small molecules and other drugs. Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145; U.S. Patent No. 5,738,996;
and U.S. Patent No. 5,807,683, each of which is incorporated herein in its entirety by reference).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91 : 11422; Zuckermann et al. (1994) /. Med. Chem. 37:2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) /. Med. Chem. 37: 1233, each of which is incorporated herein in its entirety by reference.
Libraries of compounds may be presented, e.g. , presented in solution (e.g. , Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991) Nature 354:82- 84), chips (Fodor (1993) Nature 364:555-556), bacteria (U.S. Patent No. 5,223,409), spores (Patent Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-1869) or phage (Scott and Smith (19900 Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici (1991) /. Mol. Biol. 222:301-310), each of which is incorporated herein in its entirety by reference.
The indicator composition can be a cell that expresses the rpL40 protein or a molecule with which rpL40 directly interacts, for example, a cell that naturally expresses or has been engineered to express the protein(s) by introducing into the cell an expression vector encoding the protein.
Alternatively, the indicator composition can be a cell-free composition that includes the protein(s) (e.g., a cell extract or a composition that includes e.g. , either purified natural or recombinant protein).
The indicator compositions of the invention may further comprise a virus or a viral extract, such as a viral mRNA.
Compounds that modulate expression and/or activity of rpL40, or a non-rpL40 protein that interacts with rpL40 can be identified using various "read-outs."
For example, an indicator cell can be transfected with an expression vector, incubated in the presence and in the absence of a test compound, and the effect of the compound on the expression of the molecule or on a biological response regulated by rpL40 can be determined. The biological activities of rpL40 include activities determined in vivo, or in vitro, according to standard techniques. Activity can be a direct activity, such as an association with a target molecule or binding partner. Alternatively, the activity is an indirect activity, such as viral replication, viral translation, host cell
translation, and/or movement of the 40S ribosome subunit to the translation initiation site of viral mRNA.
To determine whether a test compound modulates rpL40 protein expression, or the expression of a viral (or host) protein, in vitro transcriptional assays can be performed.
To determine whether a test compound modulates rpL40 mRNA expression, or the expression of viral or host genes, various methodologies can be performed, such as quantitative or real-time PCR.
The effect of test compounds on host cell viability may also be determined using, e.g., standard microscopic analysis.
A variety of reporter genes are known in the art and are suitable for use in the screening assays of the invention. Examples, of suitable reporter genes include those which encode chloramphenicol acetyltransferase, beta-galactosidase, alkaline phosphatase, green fluorescent protein, or luciferase. Standard methods for measuring the activity of these gene products are known in the art.
A variety of cell types are suitable for use as an indicator cell in the screening assay. Preferably a cell line is used which expresses low levels of endogenous rpL40 and is then engineered to express recombinant protein. Cells for use in the subject assays include eukaryotic cells. For example, in one embodiment, a cell is a fungal cell, such as a yeast cell. In another embodiment, a cell is a plant cell. In yet another embodiment, a cell is a vertebrate cell, e.g., an avian cell or a mammalian cell (e.g., a murine cell, or a human cell).
The cells of the invention can express endogenous rpL40, another ribosomal protein, initiation factor, and/or viral or cellular transcript (e.g., GAPDH) or can be engineered to do so. For example, a cell that has been engineered to express the rpL40 protein and/or another ribosomal protein can be produced by introducing into the cell an expression vector encoding the protein.
Recombinant expression vectors that can be used for expression of , e.g., rpL40, are known in the art. For example, the cDNA is first introduced into a recombinant expression vector using standard molecular biology techniques. A cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library. The nucleotide sequences of cDNAs for or a molecule in a signal transduction pathway involving (e.g., human, murine and yeast) are known in the art and can be used for the design of PCR primers that allow for amplification of a cDNA by standard PCR methods or for the design of a hybridization probe that can be used to screen a cDNA library using standard hybridization methods.
In another embodiment, the indicator composition is a cell free composition. rpL40 expressed by recombinant methods in a host cells or culture medium can be isolated from the host cells, or cell culture medium using standard methods for protein purification. For example, ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies can be used to produce a purified or semi-purified protein that can be used in a cell free composition. Alternatively, a lysate or an extract of cells expressing the protein of interest can be prepared for use as cell-free composition.
In one embodiment, compounds that specifically modulate rpL40 activity or the activity of a molecule in a signal transduction pathway involving rpL40 are identified based on their ability to modulate the interaction of rpL40 with a target molecule to which rpL40 binds. The target molecule can be a mRNA molecule or a protein molecule. Suitable assays are known in the art that allow for the detection of protein-protein interactions (e.g., immunoprecipitations, two-hybrid assays and the like) or that allow for the detection of interactions between rpL40 and an mRNA (e.g., electrophoretic mobility shift assays, DNAse I footprinting assays and the like). By performing such assays in the presence and absence of test compounds, these assays can be used to identify compounds that modulate (e.g., inhibit or enhance) the activity of rpL40 with a target molecule.
Compounds identified in the subject screening assays can be used in methods of modulating one or more of the biological responses regulated by rpL40. It will be understood that it may be desirable to formulate such compound(s) as pharmaceutical compositions (described supra) prior to contacting them with cells.
Once a test compound is identified that directly or indirectly modulates, e.g., rpL40 expression or activity by one of the variety of methods described hereinbefore, the selected test compound (or "compound of interest") can then be further evaluated for its effect on cells, for example by contacting the compound of interest with cells either in vivo (e.g., by administering the compound of interest to an organis) or ex vivo (e.g., by isolating cells from an organism and contacting the isolated cells with the compound of interest or, alternatively, by contacting the compound of interest with a cell line) and determining the effect of the compound of interest on the cells, as compared to an appropriate control (such as untreated cells or cells treated with a control compound, or carrier, that does not modulate the biological response).
In another aspect, the invention pertains to a combination of two or more of the assays described herein. For example, a modulating agent can be identified using a cell- based or a cell-free assay, and the ability of the agent to modulate the activity of rpL40
or a protein with which rpL40 interacts can be confirmed in vivo, e.g., in an animal, such as, for example, an animal model for, e.g., viral infection.
Moreover, a modulator of rpL40 or a molecule in a signaling pathway involving rpL40 identified as described herein (e.g., an antisense nucleic acid molecule, or a specific antibody, or a small molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such a modulator. Alternatively, a modulator identified as described herein can be used in an animal model to determine the mechanism of action of such a modulator.
In another embodiment, it will be understood that similar screening assays can be used to identify compounds that indirectly modulate the activity and/or expression of rpL40 e.g., by performing screening assays such as those described above using molecules with which rpL40 interacts, e.g., molecules that act either upstream or downstream of rpL40 during host cell and/or viral translation.
The instant invention also pertains to compounds identified in the subject screening assays.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is to be understood that this invention is not limited to particular assay methods, or test agents and experimental conditions described, as such methods and agents may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
The present invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all figures and all references, patents and published patent applications cited throughout this application, as well as the Figures, are expressly incorporated herein by reference in their entirety.
EXAMPLES
Materials and Methods
The following Materials and Methods were used in the examples below.
SiRNA Screen
SMART pools (Dharmacon), comprising four duplexes targeting a single human mRNA transcript, were individually arrayed into wells of black, clear bottom 384-well plates (Costar 3712, Corning) containing a 1:100 dilution of Lipofectamine 2000 (Invitrogen) in OptiMEM (Invitrogen). Duplexes and lipids were incubated for 20 minutes at room temperature and mixed with HeLa cells to yield final concentrations of 5 x 104 cells/ml and 25nM siRNA. Plates were inoculated with 1250 HeLa cells per well, and cells were centrifuged for 5 minutes at 700 x g. At 48 hours post transfection, the approximately 5000 cells were inoculated with 25,000 infectious particles of rVSV- eGFP. Cells were fixed 7 hours later with 2% formaldehyde in PBS, the nuclei were counterstained with 4 μg/ml Hoechst nuclear dye (33342; Invitrogen) for 10 minutes at room temperature, and unincorporated dye removed by washing once with 60 μΐ PBS per well. Individual wells were examined using a cellWoRX™ High Content Cell Analysis System (Applied Precision Inc.), and the cell-scoring module of MetaXpress Software (Molecular Devices) was employed to quantify the total number of cells and percentage of eGFP-positive cells. All samples were performed in duplicate.
Cells and Viruses
HeLa cells were maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Tissue Culture Biologicals). VSV, rVSV-eGFP, rVSV-Luc, and rVSV-
M51R were amplified in BHK-21 cells (ATCC), purified through a 10% sucrose (w/v) cushion prepared in NTE (10 mM Tris-pH7.4, 100 mM NaCl, 1 mM EDTA), and virus stocks were stored in NTE at -80°C (Whelan et al., 1995). The 5' and 3' UTR sequences of the VSV luciferase mRNA were
"AACAGTAATCAGAATTCTCGAGAAAGCCACC" (Genomic coordinates: 51-81;
SEQ ID NO: 14) and "TGGCCATATGAAAAAAA" (Genomic coordinates: 1735-
1751; SEQ ID NO: 15), respectively.
Microscopy
Cells were fixed with 2% paraformaldehyde for 15 minutes, washed with phosphate buffered saline (PBS) (137 mM NaCl, 2.7 mM KC1, 100 mM Na2HP04, 2 mM KH2P04) and, where indicated, stained with fluorescent DNA binding stain, 4,6- diamidino-2- phenylindole (DAPI). Covers lips were mounted using ProLong Antifade (Invitrogen). For high magnification images (63 x, 20 x), cells were imaged on a Zeiss Axioplan 2 inverted fluorescence microscope (Carl Zeiss Microimaging) with a
Hamamatsu Orca- HR (C4742-94) camera (Hamamatsu) and analyzed using the
Axiovision software. For low magnification images (10 x) images, cells were imaged on the cellWoRx™ high-content screening microscope.
Plasmids, siRNAs, and Transfection
The pFR-CrPV bicistronic luciferase reporter plasmid was obtained Addgene
(plasmid 11509) (Petersen et al., 2006). The plasmid pRL-CMV (Promega) was used to generate renilla luciferase mRNA in HeLa cells for in vitro translation. To generate the rpL40 expressing plasmid (pcDNA3.1-rpL40), rpL40 was amplified from a SP73 vector containing rpL40 (Fox- Walsh and Hertel, 2009) and inserted into the Acc65I and Xhol sites of pcDNA3.1 (Invitrogen). SiRNA-resistant pcDNA3.1-rpL40 was generated by site-directed mutagenesis using the QuikChange methodology (Stratagene) and primers rpL40-SM-F (5'-
GGTGTTGCGCCTGCG AGGTGGGATCATCG AGCCTTCTCTCCGCCAGC-3 ' ) (SEQ ID NO: 16) and rpL40-SM-R (5 '- GCTGGCGGAGAGAAGGCTCGATGATCCCACCTCGCAGGCGCAACACC-3 ' ) (SEQ ID NO: 17). Identical cloning strategies were utilized for constructing expression vectors for CLG1 (YGL215W) and DDR2 (YOL052C-A). Briefly, the 5' UTR was cloned into pGEM3 using the EcoRI and BamHI sites; luciferase and the 3' UTR were double ligated into the vector using the BamHI, Notl, and Sail sites; two copies of a T7 terminator were added using the Sail and Hindlll sites.
The 5 ' and 3 ' UTR sequences of the DDR2 reporter mRNA were
"AAGCAAGCACGCTAATTTAATATCGATTTAAAC" (SEQ ID NO: 18) and "GAAAAACGCCGCTTACTGCCACGATGATGATACCCTATTGACGTTTCTGAA ATGTATAATTTCTTTTCTCATCTTCCCCTTTGATATTCCATCTATAGGCCCCAG AGTAGTAAATTTGGTGCTTTAATTTTTTTTCTCTTCTTCCAGTTCGTCTCTATT TTTTCATTCCATTATATTTATTTATCAGTTTTACTTTCTCAAATATTCTTATAT AACACTATTTCATCTACGTAACCGAAAATAAG,"(SEQ ID NO: 19) respectively (Nagalakshmi, U., et al. (2008) Science 320: 1344-1349). The 5' and 3' UTR sequences of the CLG1 reporter mRNA were
"ACAAATCATTGATCTTTTAAGAAAAACGCACAAGGATCATATACTAGATTC TCGTTCTCGTTTTTTCTTCCTTTTTTTTTTCTCTAAAGCCTTTTACTGGGTTAAT TTCCTTTATTGACCCAAATTAAAAGAAAACGTTTCTCAGGAGACTCTTTTAA GCAAAATTTAGCAAATTTGTGTTTGCTGTTGTTTTTACAGAGACTGCATTACT TGAAGGTTTGCCTTTAAGTCTTCGAGTCGTTTTTTTTTATTAACTTTAATCCTT TTTCTGTGTGTTTGTGTATATTCAGTGGGGTTATTTTACAGTATTCGAAGAGA CTTCGTTTCACACATTTAAACCAGCTTTATTAGCGTTTAGCTTATACACTACA
AGGAATTTTTTTTTTCTTTAACATTATTAAGACAGTTATTGAGTTAATTCGTC TTCAGCCCCCCTCCCCCCAACAAACCCCCCTTCATATAGAA" (SEQ ID NO: 20) and
"TGAAAACTTTTTTTTCCTTATTTTTTCTTTGATCCCATCGAATTACTTTCTCTT TTGCCCAGGATCATCTTTCTAATCTATCATTTTATTATTTTCTCTCATGAGAA AACAGAATTTCGAAACAGATATAATAAAAAAATTGAAAAATTTGAAAAAAA AAAATCTAGAAACATATTTTCCTAAAATGAAAATCGGAAGCTAACAAAATTT TTGAAAAACGAAATAAAGAAGAAAGATTATTATTATTACTTTTTTTATTAGT ACTCCATATGGACCTCTTAGGTGAGTGATCTTATT," (SEQ ID NO: 21) respectively (Nagalakshmi, IL, et al. (2008) Science 320: 1344-1349).
Plasmid transfections were performed using Lipofectamine 2000 according to manufacturer's instructions. For rescue of the siRNA-induced phenotype, HeLA cells were transfected with the indicated plasmid 24 hours before transfection of cells with siRNA. Transfection of plasmids into vTF7-3-infected bsrT7 cells was performed as described, except using 12μg of plasmid per 10cm dish, with cells at 80% confluency (Whelan, S.P., et al, (1995) Proc Natl Acad Sci USA 92:8388-8392). RNA was harvested and purified from cells at 24 hours post transfection.
Individual siRNAs used were siGENOME Non-Targeting siRNA #3 (D- 001210-03), rpL40-l (D-011794-02), rpL40-2 (D-011794-04), rpL22 (D-011143-02) (Dharmacon). For siRNA transfection into a 24- well plate, 1 μΐ of Lipofectamine 2000 was mixed with 100 μΐ of OptiMEM and incubated at room temperature for 5 min. 100 1 of OptiMEM and 1.5 μΐ of 20uM siRNA was added, mixed, and incubated at room temperature for 15 minutes. 3 x 104 trypsinized HeLa cells in 400 μΐ of DMEM with 10% fetal bovine serum was added to the lipid-siRNA mix, plated, and experiments were performed 48 hours later. This protocol was scaled accordingly to different cell culture surface areas.
RNP Transfection
To isolate RNPs, purified VSV was mixed with 12.5 mM Tris pH 7.4, 5% glycerol, 5 mM EDTA pH 8, 3.5 mM DTT, 0.1% Triton X-100, and 500 mM CsCl in a total volume of 600 μΐ and incubated on ice for 1.25 hours. 600 μΐ of 20 mM Tris pH 7.4 and 3.5 mM DTT were added and loaded onto a 30-50% (v/v) glycerol gradient made in NTE with 3.5 mM (v/v) glycerol gradient made in NTE with 3.5 mM DTT. Gradients were spun for 3.5 hours at 4°C at 45,000 rpm in a SW50.1 rotor and the pellet was resuspended in NTE. 0.4 μg of rVSV-Luc RNPs were transfected into HeLa cells using Lipofectamine 2000 and luciferase was assayed at 7 hours post transfection.
RNA Analysis
For metabolic labeling of RNA, at the indicated times post infection or mock infection, cells were labeled with 33 μθ/ιηΐ [3H]-Uridine (Perkin Elmer). Cells were lysed in Rose Lysis Buffer (1% v/v Nonidet P40- Alternative, 0.4% v/v sodium deoxycholate, 66 mM EDTA, 10 mM Tris pH 7.4) and cytoplasmic RNA was purified by phenol/chloroform extraction and analyzed by electrophoresis on an acid-agarose gel (Lehrach et al. 1977). For analysis of primary transcription, cells were treated with 100 μg/ml cyclohexmide for 30 minutes prior to infection. Cells were infected for 5 hours at an MOI of 100 and total cytoplasmic RNA was isolated by phenol chloroform extraction and analyzed by quantitative real-time PCR. For analysis of total RNA synthesis, cells were infected at an MOI of 5 for 5 hours and RNA was analyzed metabolic labeling as above. Quantitative Real-Time PCR
cDNA was reverse-transcribed from RNA isolated from mock infected or infected cells using random hexamers or VS V-N-RT-dT primer (5 '
TTTTTTTTTTTTTTTC ATATGTAGC-3 ' ) (SEQ ID NO: 22), respectively, and Superscript III (Invitrogen) following the manufacturer's instructions. Real-time PCR was performed using Power SYBR Green PCR Master Mix and a Prism 7300 sequence detection system (Applied Biosystems) according to manufacturer's instructions. The final reaction volume was 20 μΐ containg 2 μΐ cDNA and 100 nm of each primer.
Primers VSV-N-F (5 ' -GCAAATGAGGATCCAGTGG-3 ' ) (SEQ ID NO: 29) and VSV- N-R (5 ' -CAGGGCTTTCAAGGATAC-3 ' ) (SEQ ID NO: 30) were used to detect VSV N cRNA. Primers β-actin-qRTPCR-F (5 ' -TCCCTGGAGAAGAGCTACG-3 ' ) (SEQ ID NO: 23) and β-actin-qRTPCR-R (5 ' -GTAGTTTCGTGGATGCCACA-3 ') (SEQ ID NO: 24) were used to amplify β-actin cDNA. To ensure specificity of each primer pair, a dissociation curve of the PCR products was determined. Samples were run in duplicate and relative copy numbers were determined from a standard curve generated by serial dilutions of a plasmid containing VSV N or cDNA reverse-transcribed from total HeLa RNA.
Protein Analysis
For metabolic labeling of proteins, at the indicated times post infection or mock infection, cells were starved of L-methionine and L-cysteine for 30 minutes. Proteins were labeled for 2 hours by addition of 25 μθ/ιηΐ [35S] EasyTag express (Perkin Elmer).
Cells were lysed in Rose Lysis Buffer (1% v/v Nonidet P40-Alternative, 0.4% v/v sodium deoxycholate, 66 mM EDTA, 10 mM Tris pH 7.4) and equal amounts of total cytoplasmic protein analyzed on a low-bis 10% polyacrylamide gel and detected using a phosphoimager. Western blot analysis was performed using anti-actin (Chemicon, 124 1 :5000), anti-rpL40, or anti-RSV (Abeam, 1 : 1000) antibodies.
Sequencing library preparation
Yeast strain GAL-RPL40A-AUbq was grown in galactose containing medium (YPG) at 30°C overnight to a final OD6oo of approximately 1.5. Yeast were pelleted and re-suspended in YPG or glucose-containing medium and a 500 mL culture was grown for 4 h to a final OD6oo of 0.8. Yeast were incubated with 5 mL of 10 mg ml"1 cycloheximide for 3 min prior to being pelleted and washed once with ice cold
Polysome Lysis Buffer (20 mM HEPES pH 7.4, 2 mM magnesium acetate, 100 mM potassium acetate, 3 mM DTT, 0.1 mg ml"1 cycloheximide). Pellets were re-suspended in Polysome Lysis Buffer and cells were broken by glass bead lysis. Supernatant was clarified by centrifugation at 10,000 RPM for 20 min at 4°C and aliquots were flash frozen in liquid nitrogen.
20 A26o units of sample was loaded on sucrose density gradients (10-50% sucrose in Polysome Lysis Buffer) and spun for 3 h at 35,000 RPM at 4°C in a Beckman SW41 rotor. Gradients were fractionated, fractions representing the polysomes were pooled, and RNA was isolated using guanidine hydrochloride. Deep sequencing libraries were prepared from total RNA samples by using the TruSeq RNA Sample Preparation Kit (Illumina) and libraries were analyzed by sequencing on an Illumina GAIL Sequence Analysis
Sequencing reads were aligned against the Ensembl EF3 S. cerevisiae genome. First, residual non-coding RNAs were filtered out using Bowtie, and then remaining sequences were aligned using Tophat, allowing up to two mismatches (Langmead, B., et al. (2009) Genome Biology 10:R25; Trapnell, C, et al (2009) Bioinformatics 25: 1105- 1111). Reads were assembled and abundance was measured by suing Cufflinks. mRNA abundance was measured by calculating reads per kilobase of exon per million fragments mapped (RPKM), allowing us to take into account differences in total reads and gene lengths. Genes were filtered to require at least 256 reads for the rpL40- containing samples. To form our list of candidate mRNAs (fold reduction >3), we disregarded transcripts that were likely identified due to off-target effects of changing
the carbon source and ribosome biogenesis feedback loops. Genes were annotated with functional descriptions using the Saccharomyes Genome Database.
Sucrose Gradient Analysis (Polysome Assay)
One T75 of HeLa cells was mock infected or infected at an MOI of 1 with VSV for 4 hours. Cells were incubated with 100 μg/ml cycloheximide for 5 minutes at 37°C and then put on ice. Cells were washed twice with cold PBS and 0.1 mg/ml
cycloheximide and collected by cell scraping. Cells were re-suspended in 1 ml of RSB- PEB (500 mM Tris pH 7.5, 2 M NaCl, 15 mM MgC12, 1% Triton-X, 2% Tween-20, 1% sodium deoxycholate), vortexed briefly, and put on ice for 10 minutes. Lysate was spun for 10 minutes at 4°C at 10,000g and supernatant was resolved on a 10-50% (w/v) or 5- 30% (w/v) sucrose gradient, as indicated, by centrifugation at 35,000 rpm at 4°C for 3 hours in a Beckman SW41 Ti rotor. Fractions were collected from the top of the gradient using a BioRad BioLogic LP (BioRad) with a Brandel tube piercer. RNA was phenol/chloroform extracted and analyzed by quantitative RT-PCR. The presence of the ribosomal subunits in the fractions was run on an agarose gel and visualized by ethidium bromide staining. Protein was TCA precipitated and analyzed by immunoblot.
In Vitro Translation
Yeast strain pGAL-RPL40A-Ubq was grown in galactose containing medium
(YPG) at 30°C overnight to a final OD600 of approximately 1.5. Yeast were centrifuged and re-suspended in YPG or glucose containing medium and a 2 L culture was grown for 6 hour to a final OD of 1.5. Saccharomyces cerevisiae cell-free translation extracts were prepared using a modified previously described procedure (Sachs, M.S., et al. (2002) Methods 26:105-114). Small molecules were removed from S30 lysates using a Zeba Desalt Spin Column (Pierce) pre-equilibrated with Buffer A with 8.5% manniotol and 0.5 mM PMSF (Wu, C, et al. (2007) Methods Enzymol 429:203-225). The resulting lysate was stored at -80°C in aliquots. Prior to in vitro translation, aliquots were treated with 0.8 mM CaCl2 and 800 U/ml micrococcal nuclease (New England Biolabs) for 10 minutes at 25°C, and the reaction was halted by addition of 1.2mM EGTA. Ten μΐ of lysate was mixed with 1.68 μΐ Translation reaction Components (10 mM ATP, 2.5mM GTP, 250 mM creatine phosphate), 0.12 μΐ creatine phosphokinase (7.5 U/ml), 0.5 μΐ Common Buffer (400 mM Hepes, Ph 7.6, 40 mM DTT), 0.84 μΐ 90 mM magnesium acetate, 0.71 μΐ 2.8 M potassium acetate, 0.16 μΐ 1 mM amino acids, and 6 μΐ RNA on ice. For VSV mRNA translation, each sample was 50% lysate, up to 3.94 μΐ RNA, and buffer to make the final reaction have 0.84 mM ATP, 0.21 mM GTP, 21 mM creatine
phosphate, 45 U/mL creatine phosphokinase, 10 mM HEPES pH 7.6, 2 mM DTT, 2.5 mM magnesium acetate, 100 mM potassium acetate, 8 μΜ amino acids, 255 μΜ spermidine, and 9 U murine RNase inhibitor (New England Biolabs). For cellular mRNA translation, the same parameters were used, except that the final reaction had 2 mM magnesium acetate and 200 mM potassium acetate. The magnesium and potassium concentrations were identified by titration to obtain maximum translation. Translation reactions were incubated for 2 hours at 25°C and luciferase activity was assayed.
Primer Extension Inhibition Assay (Toe Printing Assay)
Translation extracts (5 μΐ) were set up without RNA and pre-incubated at 25°C for 3 minutes with 2 mg/ml hygromycin B, 1 mM m7 GpppA, or 1 mM GMP-PNP and 1 mM magnesium acetate, as indicated. RNA made by VSV in vitro transcription
(Whelan, S.P., and Wertz, G.W. (2002) Proc Natl Acad Sci USA 99:9178-9183) was added and reactions were incubated at 25°C for 15 minutes. For primer extension, 12.5μ1 of Annealing Buffer (2 mg/ml hygromycin B, 27.4 mM Tris pH 7.4, 41 mM KC1, 5.5 mM MgCl2, 10 mM DTT, 250 μΜ dNTPs) was added to the translation
reactions and incubated at 55°C for 2 minutes. Five pmol of 32P-labeled VSV-N primer (5 ' -CCTCATTTGCAGGAAG-3 ' ) (SEQ ID NO: 25) and 0.5 μΐ of Superscript III was added and incubated at 37°C for 30 minutes. Reactions were phenol/chloroform extracted and cDNA was analyzed on a 6% polyacrylamide sequencing gel. A dideoxynucleotide sequencing ladder was made using the same primer and VSV N plasmid cDNA.
EXAMPLE 1: An siRNA screen reveals a differential sensitivity of VSV
replication and cell viability to knockdown of ribosomal proteins.
To identify ribosomal proteins required for VSV replication, a targeted siRNA screen was performed. HeLa cells were transfected with pools of four siRNAs directed toward each of the individual ribosomal protein genes. Following 48 h of incubation, cells were infected with a reporter VSV (rVSV-eGFP) that expresses eGFP as a marker of infection and 7 hours later the percent of infected cells was determined by
fluorescence microscopy (Figure 1A). SiRNA targeting of some ribosomal proteins, such as rpLlOA, caused cell death whereas others, including rpL41, had negligible effects on cell proliferation or VSV infection (Figure 1C and Figure 10). Depletion of a subset of ribosomal proteins, such as rpL40, caused inhibition of viral replication by more than 10% but left cell proliferation unaffected by more than 90% (Figure 1A,
Figure 10, and Figure 13) . In order to obtain mechanistic insights on the role of riobosomal proteins in VSV relication, the single candidate protein, rpL40, was focued on. RpL40 was selected for further study since its knockdown had a profound difference in effects on the virus compared to the host and its specific role in translation was uncharacterized. RpL40 is a eukaryote-specific ribosomal protein that is encoded as a C- terminal extension of ubiquitin. The ubiquitin is rapidly cleaved off and is not necessary for ribosomal function, but contributes to the pool of free ubiquitin in the cell (Finley, D., et al. (1989) Nature 338:394-401 ; Monia, B.P., et al. (1989) J Biol Chem 264:4093- 4103).
EXAMPLE 2: RpL40 is required for VSV mRNA translation.
To ensure that specific silencing of rpL40 was responsible for the reduction in VSV gene expression, individual siRNAs that block infection were identified (D- 011794-02: ccugcgagguggcauuauu (SEQ ID NO: 26) and (D-011794-04:
caaguguaugcucgccuu (SEQ ID NO: 27)). These two siRNAs targeting distinct regions of the rpL40 transcript inhibited infection by >90 (Figure 5A) and reduced rpL40 gene expression at the mRNA (Figure 5B) and protein (Figure 5C) levels. Furthermore, knockdown of rpL40 correlated with a ~2 loglO decrease in virus output (Figure 5D). The defect in VSV gene expression is due to specific loss of rpL40, because infection was restored by transfection of cells with an siRNA-resistant rpL40 variant, but not the wild type gene (Figure IB). To determine how rpL40 knockdown effects VSV infection, a systematic examination of each step of viral replication was conducted . To demonstrate rpL40 is not required for the translation of a cellular factor essential for viral entry, the clathrin-dependent entry pathway of VSV was bypassed by direct transfection of the purified ribonucleoprotein (RNP) core of a recombinant VSV that expresses firefly lucif erase (rVSV-Luc). Circumventing entry did not restore luciferase expression, thus showing that loss of rpL40 specifically impairs a step in viral gene expression (Figure 1C).
VSV gene expression initiates with primary transcription of mRNAs, translation of which is essential to provide the proteins necessary for genome replication and subsequent secondary transcription. By measuring VSV mRNA levels by quantitative RT-PCR in cells exposed to the protein synthesis inhibitor cycloheximide, it was shown that primary transcription is unaffected by rpL40 depletion (Figure ID). To measure the translation-dependent steps of genome replication and secondary mRNA transcription directly, viral RNA levels were monitored by metabolic incorporation of [3H]-uridine and also by quantitative RT-PCR. Viral genomic RNA and mRNA levels were reduced
>90 by rpL40 depletion, further implicating rpL40 in viral translation (Figure IE, IF). These experiments demonstrate that rpL40 is not required for viral entry or transcription, thus specifically implicating rpL40 in translation of viral mRNAs. EXAMPLE 3: RpL40-dependent translation is transcript-specific.
It was determined whether VSV protein synthesis is specifically inhibited by rpL40 depletion. Monitoring metabolic incorporation of [35S]-methionine-cysteine in rpL40 depleted cells revealed an 85% reduction in viral protein synthesis, whereas bulk cellular translation was unaffected (Figure 2A). The consequences of rpL40 depletion on a panel of transcripts with altered initiation mechanisms was next examined. The IRES element of cricket paralysis virus (CrPV) drives translation by direct 80S ribosome formation on the start codon, circumventing any requirement for initiation factors, scanning, or the methionine initiator tRNA. In cells transfected with a plasmid encoding a bicistronic luciferase vector separated by the CrPV IRES sequence (pFR-CrPV) (Figure 2B), translation of neither cap-dependent nor IRES -dependent mRNAs transcripts were diminished by depletion of rpL40 (Figure 2C, D). Poliovirus infection, which depends on eIF4E-independent IRES, is similarly unaffected by rpL40 depletion (Figure 2E). These IRES experiments demonstrate that critical interfaces on the 60S subunit necessary for direct interactions with the small subunit are not altered following knockdown of rpL40. Furthermore, replication of adenovirus, whose late mRNAs are translated via ribosomal shunting to the start codon rather than linear scanning, was unaffected by rpL40 depletion (Yueh, A., and Schneider, R.J. (1996) Genes Dev 10: 1557-1567). Together, these results confirm that depletion of rpL40 permits the formation of functional ribosomes that mediate efficient cap-dependent, IRES- dependent, and ribosome shunted translation.
It was determined if viruses more closely related to VSV were dependent on rpL40. VSV is a member of the order Mononegavirales, consisting of non-segmented negative-sense (NNS) RNA viruses. The transcripts of all NNS viruses are capped and polyadenylated and, within each virus, the 5' ends begin with a conserved gene start site. Infection of cells by multiple NNS viruses, including rabies virus (Figure 2F), measles virus (Figure 2G), and Newcastle disease virus (Figure 2H), is sensitive to rpL40 depletion. In contrast, replication of respiratory syncytial virus, is unaffected by rpL40 depletion . These experiments demonstrate that rpL40-dependent translation is transcript-specific and this pathway is utilized by an array of NNS viruses.
EXAMPLE 4: Ribosome biogenesis and maturation are not compromised by rpL40 depletion.
To determine whether there are defects in ribosome processing following rpL40 depletion, total cellular RNA was labeled by metabolic incorporation of [3H] -uridine and monitored the accumulation of mature ribosomal RNA. As in prior studies, rpL40 depletion modestly decreased the total levels of 28S and 18S ribosomal RNAs (4% and 17%, respectively), but did not abolish processing of mature ribosomal RNAs (Figure 6A) (Poll, G., et al. (2009) PLoS One 4:e8249). This result demonstrates that rpL40 depletion does not inhibit VSV mRNA translation due to altered ribosomal RNA processing.
During infection, the VSV matrix (M) protein blocks export of pre-ribosomal RNAs from the nucleus via the Rael export pathway, suggesting VSV mRNAs might be dependent on rpL40 due to an additive reduction in pools of ribosomes during knockdown and infection. However, a recombinant VSV that does not block nuclear export (rVSV-M51R) (Figure 6B) remains sensitive to rpL40 depletion (Figure 6C) (Faria, P.A., et a/. (2005) Mol Cell 17:93-102). Furthermore, rpL22 depletion does not inhibit viral gene expression (Figure 6D, E), indicating rpL40 is a specific ribosomal protein requisite for VSV translation. These experiments also show that viral translation is not simply affected by a reduction in the pool of cytoplasmic ribosomes.
EXAMPLE 5: RpL40 is required for translation initiation on VSV mRNAs as a constituent of the large subunit
To determine the mechanism of translational control by rpL40, the formation of ribosomal complexes on VSV mRNA was compared with the cellular β-actin transcript. The VSV nucleocapsid (N) mRNA was specifically examined, as this is the most abundant viral mRNA produced during infection. Cells depleted of rpL40 were mock infected or infected with VSV and lysates were resolved on a 10-50% linear sucrose gradient. Following fractionation, the association of ribosomal subunitswith specific mRNAs was determined by quantitative RT-PCR. Absorbance monitoring at 254 nm revealed polysome formation, further confirming that bulk translation was not compromised by rpL40 depletion (Figure 3 A, C). The cellular transcript β-actin remains distributed in 80S ribosomes and polyribosomes following rpL40 depletion, although there is a shift to lighter fractions (Figure 3B). In contrast, formation of elongation- competent ribosomes on VSV N mRNA is completely abolished by rpL40 depletion (Figure 3D). Tthe localization of VSV mRNAs to lighter fractions of polysome profiles has been observed previously (David, A.E. (1978) J Gen Virol 39: 149-160; Huang, A.S.,
et al. (1970) Virology 42:946-957). These experiments establish that rpL40 is required for translation initiation of VSV mRNAs but not canonical cellular transcripts.
The polysome data show that rpL40 is crucial for translation initiation on VSV mRNAs. However, as these experiments were performed in the context of viral infection, it is unknown if rpL40 is required due to alternations to the translation machinery during infection or through aspects of the mRNA itself. To further investigate the initiation defect, an in vitro translation assay using cytoplasmic extracts from a yeast strain, pGAL-RPL40A-Ubq (Poll, G., et al. (2009) PLoS One 4:e8249) was developed. Yeast express two paralogs for rpL40, rpL40A and rpL40B, which encode for the ribosomal protein rpL40 with a N-terminal ubiquitin moiety (Finley, D., et al. (1989) Nature 338:394-401). The yeast strain pGAL-RPL40A-Ubq has both forms of rpL40 deleted, and instead rpL40A lacking its ubiquitin tail is ectopically expressed from a galactose-inducible promoter. In yeast extracts lacking rpL40, translation of a cellular reporter renilla lucif erase mRNA was unaffected, whereas translation of rVSV- Luc mRNA was abolished (Figure 3E). These findings demonstrate that the requirement for rpL40 in VSV translation is dictated by a cis-acting determinant in the viral mRNA and does not require other componets of viral infection. Furthermore these results indicate that the rpL40 dependent translation strategy is broadly conserved between yeast and mammalian cells. Importantly, the use of an ubiquitin-lacking rpL40 conditional knockout demonstrates that knockdown of rpL40 affects VSV mRNA translation directly rather than through alterations to the cellular ubiquitin pool.
To determine if rpL40 was required for scanning or joining steps of translation initiation, the position of the 40S subunit on VSV mRNA in the absence of rpL40 was next examined using a reverse transcriptase "toe printing" assay (Anthony, D.D., and Merrick, W.C. (1992) J Biol Chem 267: 1554-1562; Hartz, D., et al. (1988) Methods Enzymol 164:419-425). This assay detects stalled ribosomal complexes that inhibit primer extension by reverse transcriptase. Lysates were programmed with VSV mRNA and performed reverse transcription using a primer designed to generate an 80 nucleotide product on VSV N mRNA (Figure 12A and 12B). This product terminates at the 5 ' mRNA cap structure and is unaltered when ribosome assembly is blocked by the addition of cap analog (m7GpppA) (Figue 12A, lane 2, 5). In wild type extracts, the addition of GMP-PNP, a nonhydrolyzable analog of GTP that blocks recycling of the eIF2 ternary complex and formation of an elongation-competent 80S, results in a 51 nucleotide product corresponding to inhibition of reverse transcription by the leading edge of the 40S at aboutl5-17 nucleotides downstream of the AUG (Figure 12A, lane 3;
Figure 12B). This product serves as a control for location of a 40S complex aligned at the initiating codon (Pestova, T.V., et al. (2000) Nature 403:332-335). Similarly, addition of the elongation inhibitor, hygromycin B (hygB), results in the stalling of the 80S complex and a corresponding toe print 230 positioned in the same location as a blocked 40S (Figure 12 A, lane 4). In marked contrast, in yeast extracts lacking rpL40, reverse transcription efficiently extended to the mRNA cap even in the presence of GMP-PNP or hygromycin B (Figure 12 A, lanes 6, 7). This result demonstrates that positioning of the 40S to the start codon is defective on VSV mRNA in the absence of rpL40.
RpL40 could regulate 80S formation as an extraribosomal protein or as part of the ribosome. To distinguish between these possibilities, the polysomal distribution of rpL40 was monitored. VSV-infected HeLa cell lysates were resolved on a 5-30% linear sucrose gradient and the fractions were probed by immunoblot. RpL40 was only found in 60S, 80S, and polysome fractions, with no detection as an extraribosomal population (Figure 3F). Furthermore, rpL40 has only been found with 60S and 80S fractions of polysome profiles performed in Drosophila and yeast (Finley, D., et al. (1989) Nature 338:394-401; Redman, K.L. (1994) Insect Biochem Mol Biol 24: 191-201). These results indicate that rpL40 regulates translation as a component of the ribosomal large subunit. EXAMPLE 6: RpL40-dependent translation is utilized by select cellular mRNAs
As many alternative translation pathways used by cellular transcripts, including cap-independent translation, were initially characterized with viruses, it was next hypothesized that the rpL40-dependent translation pathway utilized by VSV is shared with a subset of cellular mRNAs (Pelletier, J., and Sonenberg, N. (1988) Nature 334:320-325; Nanbru, C, et al. (1997) J Biol Chem 272:32061-32066). To identify such transcripts, polysome-associated mRNAs from GAL-RPL40A yeast cells grown in media containing glucose or galactose were sequenced (Figure 7). Upon depletion of rpL40, about 93% of mRNAs (fold reduction < 3) remained polysome-associated, confirming that bulk cellular translation does not depend on rpL40 (Figure 4 A, 2A). The list of candidate cellular mRNAs that require rpL40 for translation included a number of stress response transcripts (Figure 11). Intriguingly, VSV infection is resistant to inhibition by stresses including heat shock and hypertonicity, suggesting the rpL40- dependent translation pathway is available during stress responses (Nuss, D.L. and Koch, G. (1975) J Virol 17:283-286; Scott, M.P. and Pardue, M.L. (1981) Proc Natl Acad Sci USA 78:3353-3357). Thus, in vitro translation of a representative candidate mRNA that is upregulated by heat shock and DNA damage, DDR2 (Figure 4C)
(McClanahan, T. and McEntee, K. (1986) Mol Cell Biol 6:90-96) was examined. In vitro translation of DDR2, but not a control transcript, CLGl, was decreased by -87% in the absence of rpL40 (Figure 4B, D, E). These results thus indicate that VSV has usurped an endogenous pathway that is shared by select cellular transcripts.
Discussion of Examples 1-6
The foregoing examples demonstrate a ribosome-mediated transcript-specific strategy of translation initiation that is dependent on rpL40, a protein constituent of the large ribosomal subunit and is required for replication of multiple NNS viruses. Use of this translation strategy is designated by a cis-acting RNA determinant and is conserved among eukaryotes. The results identify the step of translation initiation at which rpL40 is required, and also reveal that select transcripts are translated through an rpL40- dependent mechanism. Together, this work reveals a previously uncharacterized pathway of translation specialization, thus providing new evidence that the ribosome controls translation separately of its catalytic function. The critical role of rpL40 in protein synthesis for multiple members of the order Mononegavirales presents an intriguing antiviral target.
Although the ribosome has traditionally been thought to function only as the catalytic machinery for translation elongation, this work substantiates the idea that the ribosome itself can act as an initiation regulator. Prior to the present study, the requirement for ribosomal proteins during viral replication has only been evaluated for cap-independent translation strategies. For example, cap-independent translation of CrPV RNA and hepatitis virus C virus (HCV) RNA requires specific 40S subunit proteins for binding to the IRES elements (Landry, D.M., et al. (2009) Genes Dev 23:2753-2764; Otto, G.A., et al. (2002) RNA 8:913-923). Here, a requirement for a specific ribosomal protein during cap-dependent viral mRNA translation is
demonstrated.
Transcript-specific translational control is ribosome-mediated.
Identification of the roles of ribosomal proteins has been impeded by the cooperative action of these proteins during subunit assembly and the necessity of the ribosome for cellular viability, thus making genetic knockout experiments impossible for most ribosomal proteins. To bypass this issue of cellular viability, specific ribosomal proteins were transiently depleted using transfection of siRNAs. The siRNA depletion experiments were performed over a 56 hour period which, combined with the rate of cellular proliferation and ribosome half-life of five days, should reduce the pool of pre-
existing ribosomes to <1 (Hirsch, C.A., and Hiatt, H.H. (1966) J Biol Chem 241 :5936- 5940). This screen identified a subset of ribosomal proteins, including rpL40, whose transient depletion inhibited VSV replication but not cellular viability.
It was confirmed through multiple methods that cells transiently depleted of rpL40 remain viable and translationally competent. Bulk cellular RNA translation, IRES-dependent translation, ribosome shunting-dependent translation, and RSV cap- dependent translation are all unaffected by loss of rpL40. It was specifically
demonstrated that depletion of rpL40 does not abolish ribosomal RNA maturation or affect the assembly of 80S ribosomes. In addition, conditional knockout of rpL40 is tolerated in Saccharomyces cerevisiae, where rpL40 is one of only two large
subunit ribosomal proteins not required for 60S maturation (Poll, G., et al. (2009) PLoS One 4:e8249). Extracts lacking rpL40 were unable to translate VSV mRNA, but efficiently supported the translation of a non- viral reporter mRNA. This collection of data demonstrates that transcript-specific translation of VSV mRNAs requires rpL40, and that depletion of rpL40 does not simply perturb all translation.
The examples herein substantiate regulation of translation by the ribosome itself (Mauro, V.P., and Edelman, G.M. (2002) Proc Natl Acad Sci USA 99: 12031-12036; Mauro, V.P., and Edelman, G.M. (2007) Cell Cycle 6:2246-2251). Rather than the better-understood regulation by initiation factors or RNA structure, differential interactions of mRNA subsets with specific ribosomal proteins, ribosomal RNAs, or heterogeneous ribosome populations, have been suggested to lead to preferential translation (Komili, S., et al. (2007) Cell 131:557-571). In support of ribosomal regulation, ribosomal proteins and RNAs are often subjected to modifications such as phosphorylation, methylation, or pseudouridinylation that then lead to alterations in protein synthesis (Lee, S.W., et al. (2002) Proc Natl Acad Sci USA 99:5942-5947; Yoon, A., et al. (2006) Science 312:902-906). During VSV infection, rpL40 is found associated only with 60S subunits and 80S ribosomes, demonstrating that it does not function as a free cytosolic protein. The data, thus, support ribosome-mediated specificity in VSV mRNA translation.
Alternative translation initiation strategy for 40S positioning.
Previous work demonstrated VSV cap-dependent translation occurs through unconventional mechanisms. Infection alters the cap-binding complex by inducing dephosphorylation of the 4E-BP1 translation repressor which subsequently sequesters eIF4E causing translation of host mRNAs to be inhibited while VSV protein production continues (Connor, J.H., and Lyles, D.S. (2002) J Virol 76: 10177-10187; Richter, J.D.,
and Sonenberg, N. (2005) Nature 433:477-480). These findings suggest that VSV mRNA translation is not limited by eIF3F availability. It has been demonstrated herein in vitro and in mammalian cells that a specific ribosomal protein, rpL40, has a critical role for 80S formation on VSV mRNAs. While uncommon, there are examples of transcripts with specific requirement for large subunit proteins during translation initiation. For example, during initiation on the CrPV IRES, the RNA must associate with rpLl for subunit joining of the 60S to the 40S and correct ribosome positioning (Spahn, C.M.„ et al. (2004) Cell 118:465-475; Jang, C.J., et al. (2009) J Mol Biol 387:42-58). Furthermore, by studying mice with a short tail phenotype, rpL38 was found to be required for 80S formation on Homeobox mRNAs and thus correct tissue patterning during development (Kondrashov, N., et al. (2011) Cell 145:383-397). RpL40 is localized on the surface of the ribosome, and its amino- and carboxy-termini are unblocked, providing potential sites to interact with mRNAs or proteins (Figure 8) (Klinge, S., et al. (2011) Science 334:941-948; Ben-Shem A, et al. (2011) Science 334: 1524-1529).
Because viral translation must occur in the face of translation-compromising cellular defense mechanisms and in competition with abundant host transcripts, many viruses have found alternative mechanisms of translation (Walsh, D., and Mohr, I. (2011) Nat Rev Microbiol 9:860-875). However, viruses must also ensure that these translation pathways are conserved among their host range. HCV only replicates in mammalian hosts and its genomic RNA cannot be translated in yeast extracts. The inability of HCV RNA to be translated in yeast is postulated to be due to high divergence between yeast and mammals for the small subunit proteins that interact directly with the IRES (Otto, G.A., et al. (2002) RNA 8:913-923). In contrast, VSV has an extremely broad host range, including ruminants, insects, and humans (Fields, B.N., et al. (2007) Fields Virology (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia) 5th ed pp 2 v. (xix, 3091, 3086)). In addition, VSV has a distinct ability to express proteins in almost all vertebrate and insect cells, along with crustacean and C. elegans cells (Makarow, M., et al. (1986) Proc Natl Acad Sci USA 83:8177-8121; Schott, D.H., et al. (2005) Proc Natl Acad Sci USA 102: 18420-18424). By studying VSV protein synthesis, it has been demonstrated that mammalian and yeast cells share the rpL40-dependent translation pathway. In agreement, rpL40 is highly conserved in archaea and eukaryotes (Figure 9). The data presented herein, along with the inspection of rpL40 homologs, indicates this translation strategy is likely present throughout all Eukarya and indicate that ribosome specialization has evolutionary impact on host range.
Through studies of VSV mRNA translation, an unconventional mechanism of translation initiation that requires rpL40 has been uncovered. The results presented herein demonstrate a "ribosome code" dictated by specific ribosomal proteins, thus identifying a new regulatory element during translation that is shared between viruses translated by cap-dependent and cap-independent mechanisms.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more that routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
1. A method for treating a viral infection in an organism having a viral infection or at risk of developing a viral infection, comprising
contacting the organism with an effective amount of an agent which inhibits the activity of rpL40,
thereby treating the viral infection in the organism.
2. The method of claim 1, wherein the activity of rpL40 is transcript- specific translation initiation of a viral mRNA.
3. The method of claim 1, wherein the activity of rpL40 is movement of the 40S ribosome subunit to the translation initiation site of a viral mRNA.
4. The method of claim 1 , wherein the agent is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
5. The method of claim 1, wherein the rpL40 is a component of the large ribosomal subunit.
6. The method of claim 1 , wherein the viral infection is an infection with a virus of the order Mononegavirales.
7. The method of claim 6, wherein the virus of the order Mononegavirales is selected from the group consisting of a virus of the family Bornaviridae, Rhabdoviridae, Filoviridae, and Paramyxoviridae .
8. The method of claim 6, wherein the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
9. The method of claim 1, wherein the viral infection is an acute viral infection.
10. The method of claim 1, further comprising contacting the organism with an additional therapeutic agent.
11. The method of claim 1, wherein the organism is a human subject.
12. The method of claim 1, wherein the organism is a non-human subject.
13. The method of claim 1 , wherein the organism is a plant.
14. A method of inhibiting viral replication in a host cell infected with a virus, comprising
contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40,
thereby inhibiting viral replication in the host cell.
15. A method of inhibiting translation of a viral mRNA in a host cell infected with a virus, comprising
contacting the host cell with an effective amount of an agent that inhibits the activity of rpL40,
thereby inhibiting translation of the viral mRNA in the host cell.
16. The method of claim 14 or 15, wherein the activity of rpL40 is transcript- specific translation initiation of the viral mRNA.
17. The method of claim 14 or 15, wherein the activity of rpL40 is movement of the 40S ribosome subunit to the translation initiation site of the viral mRNA.
18. The method of claim 14 or 15, wherein the activity of rpL40 is cap- dependent mRNA translation.
19. The method of claim 14 or 15, wherein the activity of rpL40 is not bulk cellular translation, IRES-driven translation, or ribosome shunted translation.
20. The method of claim 14 or 15, wherein the agent is selected from the group consisting of an siRNA, an intracellular antibody, an inhibitory peptide, and a small molecule.
21. The method of claim 14 or 15, wherein the rpL40 is a component of the large ribosomal subunit.
22. The method of claim 14 or 15, wherein the virus is a member of the order Mononegavirales.
23. The method of claim 22, wherein the virus of the order Mononegavirales is selected from the group consisting of a virus of the family Bornaviridae ,
Rhabdoviridae, Filoviridae, and Paramyxoviridae .
24. The method of claim 22, wherein the virus of the order Mononegavirales is a virus of the family Rhabdoviridae.
25. A method of identifying a compound useful in inhibiting viral replication in a host cell infected with a virus, comprising,
providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof;
contacting the indicator composition with each of a member of a library of test compounds; and
selecting from the library of test compounds a compound of interest that inhibits the activity of rpL40,
thereby identifying a compound useful in inhibiting viral replication in a host cell infected with a virus.
26. A method of identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus,
providing an indicator composition comrpsing an rpL40 polypeptide, or a biologically active portion thereof;
contacting the indicator composition with each of a member of a library of test compounds; and
selecting from the library of test compounds a compound which inhibits the activity of rpL40,
thereby identifying a compound useful in inhibiting translation of a viral mRNA in a host cell infected with a virus.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161564547P | 2011-11-29 | 2011-11-29 | |
| US61/564,547 | 2011-11-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013082237A1 true WO2013082237A1 (en) | 2013-06-06 |
Family
ID=48536035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/066978 Ceased WO2013082237A1 (en) | 2011-11-29 | 2012-11-29 | Compositions and methods for the treatment of viral infections |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013082237A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4368729A1 (en) * | 2022-11-09 | 2024-05-15 | Merck Patent GmbH | Molecules targeting ribosomal protein rpl40 for use in cosmetics and the treatment of diseases of the skin |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030143247A1 (en) * | 2002-01-30 | 2003-07-31 | Robertson Hugh D. | Antiviral compositions and methods for identification and use |
| WO2010111653A2 (en) * | 2009-03-27 | 2010-09-30 | The Uab Research Foundation | Modulating ires-mediated translation |
| WO2010130447A1 (en) * | 2009-05-13 | 2010-11-18 | Hannelore Breitenbach-Koller | Method for identifying interventions that control the translational activity of ribosomal proteins in differential mrna expression |
-
2012
- 2012-11-29 WO PCT/US2012/066978 patent/WO2013082237A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030143247A1 (en) * | 2002-01-30 | 2003-07-31 | Robertson Hugh D. | Antiviral compositions and methods for identification and use |
| WO2010111653A2 (en) * | 2009-03-27 | 2010-09-30 | The Uab Research Foundation | Modulating ires-mediated translation |
| WO2010130447A1 (en) * | 2009-05-13 | 2010-11-18 | Hannelore Breitenbach-Koller | Method for identifying interventions that control the translational activity of ribosomal proteins in differential mrna expression |
Non-Patent Citations (4)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4368729A1 (en) * | 2022-11-09 | 2024-05-15 | Merck Patent GmbH | Molecules targeting ribosomal protein rpl40 for use in cosmetics and the treatment of diseases of the skin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | LncIRS1 controls muscle atrophy via sponging miR‐15 family to activate IGF1‐PI3K/AKT pathway | |
| Yang et al. | The influenza virus PB2 protein evades antiviral innate immunity by inhibiting JAK1/STAT signalling | |
| Cao et al. | The nuclear matrix protein SAFA surveils viral RNA and facilitates immunity by activating antiviral enhancers and super-enhancers | |
| Xu et al. | Modification of nonstructural protein 1 of influenza A virus by SUMO1 | |
| CN107073120B (en) | Anti-influenza virus agent and screening method of anti-influenza virus agent | |
| Maharana et al. | SAMHD1 controls innate immunity by regulating condensation of immunogenic self RNA | |
| Sun et al. | Mammalian target of rapamycin regulates miRNA-1 and follistatin in skeletal myogenesis | |
| Rehwinkel et al. | RIG-I detects viral genomic RNA during negative-strand RNA virus infection | |
| Karpala et al. | Characterization of chicken Mda5 activity: regulation of IFN-β in the absence of RIG-I functionality | |
| McAllister et al. | Protein kinase PKR amplification of interferon β induction occurs through initiation factor eIF-2α-mediated translational control | |
| Woo et al. | Single-stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism | |
| Killip et al. | Activation of the interferon induction cascade by influenza a viruses requires viral RNA synthesis and nuclear export | |
| JP2010505897A (en) | Influenza target | |
| Liu et al. | 55K isoform of CDK9 associates with Ku70 and is involved in DNA repair | |
| Ma et al. | Forkhead box O1-mediated ubiquitination suppresses RIG-I-mediated antiviral immune responses | |
| Schaller et al. | Conserved herpesvirus kinase ORF36 activates B2 retrotransposons during murine gammaherpesvirus infection | |
| Zhao et al. | Ubiquitin C-terminal hydrolase-L3 promotes interferon antiviral activity by stabilizing type I-interferon receptor | |
| Zhao et al. | Avian influenza viruses suppress innate immunity by inducing trans-transcriptional readthrough via SSU72 | |
| Ru et al. | Human DBR1 deficiency impairs stress granule–dependent PKR antiviral immunity | |
| Zheng et al. | A Novel Protein NLRP12‐119aa that Prevents Rhabdovirus Replication by Disrupting the RNP Complex Formation | |
| Jia et al. | Ubiquitin-specific protease 5 was involved in the interferon response to RGNNV in sea perch (Lateolabrax japonicus) | |
| Xiao et al. | The core promoter controls basal and inducible expression of duck retinoic acid inducible gene-I (RIG-I) | |
| US20170137824A1 (en) | New treatment against influenza virus | |
| Kim et al. | Viral genome RNA degradation by sequence-selective, nucleic-acid hydrolyzing antibody inhibits the replication of influenza H9N2 virus without significant cytotoxicity to host cells | |
| US12303515B2 (en) | PIM1 inhibitors for use in treatment of viral infection and pharmaceutical compositions thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12852959 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12852959 Country of ref document: EP Kind code of ref document: A1 |