WO2013056090A1 - Affinity-based materials for the non-destructive separation and recovery of cells - Google Patents

Affinity-based materials for the non-destructive separation and recovery of cells Download PDF

Info

Publication number
WO2013056090A1
WO2013056090A1 PCT/US2012/060019 US2012060019W WO2013056090A1 WO 2013056090 A1 WO2013056090 A1 WO 2013056090A1 US 2012060019 W US2012060019 W US 2012060019W WO 2013056090 A1 WO2013056090 A1 WO 2013056090A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
hydrogel
cells
affinity ligand
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/060019
Other languages
French (fr)
Inventor
Yong Wang
Zhaoyang ZHANG
Niancao Chen
Shihui Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Connecticut
Original Assignee
University of Connecticut
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Connecticut filed Critical University of Connecticut
Publication of WO2013056090A1 publication Critical patent/WO2013056090A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0068General culture methods using substrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0081Purging biological preparations of unwanted cells
    • C12N5/0087Purging against subsets of blood cells, e.g. purging alloreactive T cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966Animal cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/30Organic components
    • C12N2500/34Sugars
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/30Organic components
    • C12N2500/40Nucleotides, nucleosides or bases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/50Soluble polymers, e.g. polyethyleneglycol [PEG]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/30Synthetic polymers
    • C12N2533/40Polyhydroxyacids, e.g. polymers of glycolic or lactic acid (PGA, PLA, PLGA); Bioresorbable polymers

Definitions

  • substrates to support the isolation, purification, and/ or maintenance of live cells for fields such as regenerative medicine.
  • Such substrates should advantageously support specific binding of target cells through well- controlled, non-destructive, and reversible specific binding of the cells to facilitate methods of non-destructive cell isolation, particularly under physiological conditions. Additional advantages would be realized where such substrates can be adapted to form synthetic extracellular matrices, to support the maintenance, growth, replication or differentiation of the cells.
  • the present invention provides, inter alia, substrates to support the isolation, purification, and maintenance of viable cells through well-controlled, nondestructive, and reversible specific binding of the cells to facilitate, for example, methods of non-destructive cell isolation.
  • the invention is based, at least in part, on the inventors' discoveries relating to the use of nucleic acid-associated surfaces, optionally with complementary nucleic acid sequences (such as deactivating nucleic acids and reactivating nucleic acids as described in the application) for the nondestructive isolation of cells and, in certain embodiments, reversible isolation that leaves the substrate reusable for subsequent uses.
  • the substrates provided by the invention can be adopted for use as extra cellular matrices and, accordingly, can be used in methods of cell culture.
  • the invention also provides methods of cell isolation and/or purification using these substrates and synthetic extracellular matrices.
  • the invention provides methods of specifically binding a viable target cell under physiological conditions, by contacting a test composition with an affinity ligand-functionalized substrate under physiological conditions, where the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and where the specific binding of the viable target cell by the affinity ligand is reversible under physiological conditions by intermolecular hybridization with a deactivating nucleic acid.
  • the invention provides methods of reversible cell-specific binding by contacting a test composition suspected of containing a viable target cell of interest with an affinity ligand-functionalized substrate under physiological conditions, where the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and where the affinity ligand is a single-stranded nucleic acid aptamer, to produce a target cell-bound affinity ligand-functionalized substrate complex, optionally, washing the complex; and contacting the complex with a deactivating nucleic acid under physiological conditions to release the target cell, where the deactivating nucleic acid intermolecularly hybridizes to the affinity ligand in the complex, to reversibly release the target cell from the complex under physiological conditions.
  • the viable target cell is a mammalian cell.
  • the substrate is a hydrogel.
  • the methods can further include contacting the affinity ligand-functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell.
  • the methods can include contacting the affinity ligand-functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell.
  • the methods can include removing the deactivating nucleic acid from the affinity ligand-functionalized substrate by contacting the affinity ligand-functionalized substrate with a reactivating nucleic acid.
  • the affinity ligand is a single-stranded nucleic acid aptamer.
  • the test composition is isolated from a mammalian subject and in certain more particular embodiments, the mammalian subject is a human, the test composition comprises a physiological fluid from the human, and the viable target cell is a cancer cell.
  • the affinity ligand is covalently conjugated to the surface of the substrate or is admixed throughout the substrate.
  • the affinity ligand is associated with the substrate via hybridization to a complementary nucleic acid sequence that is covalently conjugated to the substrate— e.g. on its surface or is admixed.
  • the affinity ligand is present at a concentration of about 0.01, 0.05, 0.10, 0.2, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 ⁇ or more; more particularly a concentration of about 20-80 ⁇ .
  • the affinity ligand is present at a concentration to facilitate attachment of about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more target cells/mm 2 under physiological conditions.
  • the affinity ligand comprises a single-stranded oligonucleotide and an associated ligand that specifically binds the target cell marker, where the associated ligand is selected from an antibody or antigen-binding fragment thereof, growth factor, peptide, or small molecule, such as a vitamin or cofactor, such as folic acid.
  • the substrate is selected from a microcarrier
  • microparticles about 1 micron to about 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than about 500 microns);
  • the substrate can comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles.
  • the substrate comprises a hydrogel, and in more particular embodiment, the hydrogel is selected from a PEG hydrogel, a
  • the hydrogel is a PEG hydrogel or acrylamide hydrogel as described in the examples.
  • the substrate comprises a second affinity ligand capable of specifically binding a distinct epitope, relative to the epitope of the viable target cell bound by the first affinity ligand.
  • the substrate comprises at least 3, 4, 5, 6, 7, 8, 9, 10, or more affinity ligands each capable of specifically binding distinct epitopes.
  • the viable target cell is a eukaryotic cell.
  • the eukaryotic cell is an animal cell, such as a vertebrate cell, and in certain embodiments, a mammalian cell, such as a primate cell, such as a human cell.
  • the affinity ligand specifically binds a cell-surface protein on the viable target cell.
  • the invention provides an affinity ligand-functionalized substrate comprising an affinity ligand capable of specifically binding a target cell marker, where the specific binding of the target cell by the affinity ligand is reversible under physiological conditions by intermolecular hybridization with a deactivating nucleic acid or a sequence-specific endonuc lease.
  • the affinity ligand is covalently conjugated to the substrate. In more particular embodiments, the affinity ligand is covalently conjugated to the surface of the substrate. In certain embodiments, the affinity ligand is admixed throughout the substrate.
  • the affinity ligand is associated with the substrate via hybridization to a complementary nucleic acid sequence that is covalently conjugated to the substrate.
  • the affinity ligand can include a nucleotide sequence that is recognizable and cleavable by a sequence-specific endonuc lease.
  • the affinity ligand is present at a concentration of about 0.01, 0.05, 0.10, 0.2, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 ⁇ or more; more particularly a concentration of about 20-80 ⁇ .
  • the various affinity ligand-functionalized substrates as described above can have the affinity ligand present at a concentration to facilitate attachment of about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more target cells/mm 2 under physiological conditions. In more particular embodiments, about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more, target cells/mm 2 are specifically bound to the substrate.
  • the affinity ligand comprises a single-stranded nucleic acid aptamer that specifically binds the target cell marker.
  • the affinity ligand comprises a single stranded oligonucleotide and an associated ligand that specifically binds the target cell marker, wherein the associated ligand is selected from an antibody or antigen-binding fragment thereof, growth factor, or peptide, or small molecule, such as a vitamin or cofactor, such as folic acid.
  • the substrates can be selected from, for example, a microcarrier (including microparticles, about 1 micron to 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than 500 microns); substantially planar surface; or a three dimensional scaffold.
  • the substrate may comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles.
  • the substrate comprises a hydrogel, particularly wherein the hydrogel is selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly( vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel, and in more particular embodiments includes hydrogels of PEG or acrylamide as described in the examples.
  • the hydrogel is selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly( vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel, and in more particular embodiments includes hydrogels of PEG or acrylamide as described in the examples.
  • the affinity ligand-functionalized substrates provided by the invention can include a plurality of affinity ligands to distinct epitopes for, e.g., isolating mixtures of cells and/or patterning cells to, e.g., control cell-cell interactions.
  • the substrate comprises a second affinity ligand capable of specifically binding a second target cell marker, wherein the second target cell marker is either a distinct epitope of the first target cell marker, relative to the epitope bound by the first affinity ligand, or a distinct target cell marker.
  • the substrate comprises at least 3, 4, 5, 6, 7, 8, 9, 10, or more single-stranded nucleic acid aptamers capable of specifically binding distinct target cell markers.
  • the target cell marker bond by the affinity ligand is a cell-surface biomolecule.
  • the cell-surface biomolecule is from a eukaryotic cell.
  • the eukaryotic cell is an animal cell, such as a vertebrate cell, and in certain
  • a mammalian cell such as a primate cell, such as a human cell.
  • the cell-surface biomolecule is cell-surface protein.
  • the single-stranded nucleic acid aptamer is bound to the target cell marker.
  • the single-stranded nucleic acid aptamers of the functionalized substrate are bound to a deactivating nucleic acid.
  • the invention also provides synthetic extracellular matrices containing any of the affinity ligand-functionalized substrates described above, which is adapted to support the maintenance, growth, or replication of a cell in culture.
  • the cell is a eukaryotic cell, and in certain embodiments, an animal cell, such as a vertebrate cell, or in more particular embodiments a mammalian cell, such as a primate cell, such as a human cell.
  • the synthetic extracellular matrix can further include
  • physiological levels of one or more compounds for support the maintenance, growth, or replication of a cell selected from a growth factor, carbon source, nitrogen source, micronutrient, vitamin, mineral, pH indicator, buffer, amino acids, fetal calf serum, fetal bovine serum, or minimal media, such as a complete synthetic media, as well as specific media or close variants thereof, such as DMEM, RPMI media, including RPMI1640 media.
  • the synthetic extra cellular matrix can include an associated cell that is specifically bound by the affinity ligand.
  • the invention provides compositions containing any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above.
  • the composition can further include a test composition suspected of containing the target cell marker.
  • the invention also provides a kit with any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above, and optionally containing one or more of instructions for use, a suitable positive control, a suitable negative control, calibration standards, a deactivating nucleic acid, or a reactivating nucleic acid.
  • the invention provides methods of specifically binding a biomolecule analyte (including for example whole viable cells), by contacting a test composition suspected of containing the biomolecule analyte with any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above under physiological conditions to allow the specific binding of the biomolecule analyte and the affinity ligand.
  • a biomolecule analyte including for example whole viable cells
  • the invention provides methods of isolating a biomolecule analyte (including for example whole viable cells), by contacting a test composition suspected of containing the biomolecule analyte with any of the affinity ligand- functionalized substrates or synthetic extracellular matrices of any one of the preceding claims under physiological conditions to allow the specific binding of the biomolecule analyte and the affinity ligand, thus isolating the biomolecule analyte.
  • the methods provided by these two related aspect can include one or more washings of the affinity ligand-functionalized substrate or synthetic extracellular matrix.
  • the methods include contacting the affinity ligand- functionalized substrate or synthetic extracellular matrix with a deactivating nucleic acid under physiological conditions to release the biomolecule analyte.
  • the methods include removing the deactivating nucleic acid from the aptamer-functionalized substrate or synthetic extracellular matrix.
  • the deactivating nucleic acid is removed from the affinity ligand-functionalized substrate or synthetic extracellular matrix by contacting the affinity ligand-functionalized substrate or synthetic extracellular matrix with a reactivating nucleic acid under physiological conditions.
  • the invention provides methods of culturing a cell of interest comprising contacting the cell of interest with any one of the synthetic extracellular matrices described above.
  • the cell of interest is contained in a mixture of extraneous materials and/or cells before being contacted with the synthetic extracellular matrix and, after contacting the mixture with the synthetic extracellular matrix, the extraneous materials and/or cells are removed by washing.
  • the methods include releasing the cell of interest under physiological conditions by contacting the synthetic extracellular matrix with a deactivating nucleic acid.
  • the biomolecule analyte is a cell.
  • the cell is a eukaryotic cell, such as a plant or animal cell.
  • the cell is an animal cell, such as a vertebrate cell, such as a mammalian cell, such as a human cell.
  • the system of cultured cells and synthetic extracellular matrices can be used in applications such as regenerative medicine.
  • the invention further comprises further suitable uses and adaptations of the the affinity ligand-functionalized substrates or synthetic extracellular matrices described above in methods of binding or isolating a biomolecule analyte or in a method of culturing a cell.
  • FIG. 1-1 Schematic of cell adhesion to aptamer-functionalized hydrogel.
  • FIG. 1-2 Secondary structures of aptamers. Left: sgc8c-0A; middle: sgc8c- 5 A; right: sgc8c-10A. The structures were generated by using RNAstructure version 5.0. The structures with the lowest free energies are presented. The tail of the aptamer is circled.
  • FIG. 1-3 Synthesis of aptamer-functionalized PEG hydrogel.
  • A Schematic of incorporating aptamers into the PEG hydrogel network via free radical polymerization.
  • B Schematic of fluorescence labeling of aptamer-functionalized PEG hydrogel.
  • C Gel electrophoresis analysis of intermolecular hybridization between the sgc8c-10A aptamer and its complementary oligonucleotide.
  • FIG. 1-4 Characterization of mechanical properties.
  • A Rheology analysis of moduli. G' : storage modulus; G": loss modulus. The frequency was varied from 0.5 to 100 rad/s at an oscillation stress of 1 Pa oscillation stress. The aptamer concentration was 2 ⁇ .
  • B Dynamic swelling of hydrogels. The aptamer concentration was 2 ⁇ .
  • C Effect of aptamer concentration on swelling. The hydrogel samples were examined 24 h after incubated in PBS solution. Four samples were studied in each group.
  • FIG. 1-5 Determination of cell type-specific adhesion on aptamer functionalized PEG hydrogel.
  • A Flow cytometry analysis of CCRF-CEM and Ramos cells labeled by sgc8c-FAM.
  • B Representative microscopy images of cell adhesion. The concentration of the aptamer was 50 ⁇ ; the time of cell seeding was 30 min.
  • C Quantitative analysis of cell adhesion. Three samples were prepared in each group and five different regions in each sample were randomly chosen. The cells were enumerated with the software Image J.
  • D Staining of live/dead cells. Cells after the adhesion for a different period of time were stained with the mixture of calcein AM (green; live) and ethidium homodimer-1 (red; dead). The arrow indicates the dead cell.
  • FIG. 1-6 Effect of different parameters on cell adhesion.
  • A Effect of spacer length on cell adhesion. The concentration of the aptamer was 50 ⁇ ; the time of cell seeding was 30 min.
  • B Effect of aptamer concentration on cell adhesion. The spacer length was 10A; the time of cell seeding was 30 min.
  • C Effect of seeding time on cell adhesion. The concentration of the aptamer was 50 ⁇ ; the spacer length was 10A. Left: representative cell images; right: quantitative analysis of cell adhesion.
  • FIG. 1-7 Attenuation of cell-hydrogel interaction by trypsinization (A-C) and aptamer inactivation (D-F).
  • A Flow cytometry analysis of cell trypsinization.
  • B Images of cell adhesion (top) and live/dead staining (bottom).
  • C Quantitative analysis of cell adhesion after trypsinization.
  • D Fluorescence imaging of PEG hydrogel blocked with CO-FAM. The numbers show the molar ratios of CO to aptamer.
  • E Representative images of cell adhesion.
  • F Quantitative analysis of cell adhesion on hydrogel blocked with complementary oligonucleotides.
  • FIG. 2-1 Schematic of using a programmable hydrogel for cell catch and release, (a) Synthesis of the hydrogel on glass: i) silanization; ii) polymerization, (b) Transformation of the aptamer. (c) Cell catch and release during the transformation of the aptamer.
  • the hybridization with the primary CS enables the display of the aptamer for cell catch.
  • the secondary CS competes against the primary CS to hybridize and release the aptamer from the hydrogel for cell release.
  • FIG. 2-2 Characterization of nucleic acid hybridization, (a) Gel
  • sequences A, B, and C are the primary CS, aptamer, and secondary CS, respectively.
  • the subscript after C indicates the hybridizing length
  • SPR sensorgrams The solutions of B and C 2 o or C 25 were sequentially run on an A-coated biochip surface to generate the association and dissociation profiles,
  • FIG. 2-3 Sequential cell catch and release, (a) Representative images of cells on the hydrogel surface. Each group had three hydrogel samples, (b) Images of live and dead cells. The cells were treated with the mixture of calcein AM (green: live) and ethidium homodimer-1 (red: dead) using a Live/Dead cell staining kit.
  • FIG. 2-4 Repetition of cell catch and release, (a) Fluorescence images of cells in two successive rounds of cell catch and release. The cells were labeled with a Vybrant cell-labeling solution for clear observation. The whole gel images were captured using a CRI Maestro EX Imaging System and the micrographs were captured using an inverted fluorescence microscope. Red scale bar: 2 mm; white scale bar: 20 ⁇ . (b) Quantitative analysis of cell catch and release using ImageJ.
  • FIG. 3-1 Schematic of programming the display of antibody-DNA chimeras for sequential cell catch and release, (a) The synthesis of DNA-functionalized hydrogel on a glass surface for the immobilization of antibody-DNA chimeras, (b) Sequential cell catch and release regulated by nucleic acid hybridization.
  • FIG. 3-2 Fluorescence imaging of DNA-functionalized hydrogels. Sequence B was labeled with TAMRA. In the lower panel, the hydrogels functionalized with the immobilized AB complex were treated with C 25 , C 25 s, or C 20 .
  • FIG. 3-3 Characterization of nonspecific cell binding on different surfaces. Scale bar, 50 ⁇ . SA denotes streptavidin. Both Ramos (top) and CCRF-CEM (bottom) cells were used to examine the nonspecific cell binding.
  • FIG. 3-4 Characterization of cell catch and release, (a) Microscopy imaging of cells on the surface of affinity hydrogels after cell catch and release. The cell numbers were quantified using ImageJ. Scale bar, 20 ⁇ . (b) Live/Dead cell staining. Live and dead cells are indicated by green and red, respectively. The dead cells are also pointed by the red arrows. Normal cells: cells directly harvested from flask. Scale bar, 10 ⁇ . The percentage of viable cells was 99.1 ⁇ 0.9%.
  • FIG. 4-1 Schematic of sequential cell catch and release using aptamer- functionalized hydrogel coating and restriction endonuclease.
  • FIG. 4-2 Preparation of hydrogel coating.
  • A Schematic of the sandwich method for coating a polyacrylamide hydrogel on the glass square.
  • B Chemical structures and the principle of chemical reaction.
  • C SEM images.
  • FIG. 4-3 Characterization of the functionality of the polyacrylamide hydrogel coating in resisting nonspecific cell binding.
  • A Representative microscopy images of cells on different surfaces.
  • B Comparison of the density of cells on different surfaces. The cell numbers were quantified with ImageJ. Scale bar: 10 ⁇ .
  • FIG. 4-4 Characterization of the functionality of the aptamer in catching CCRF-CEM cells.
  • A Secondary structure of the hybridized aptamer. Red indicates the binding motif; blue indicates the linker and yellow indicates the hybridized segment.
  • B Electrophoretogram of intermolecular hybridization.
  • C Fluorescence images of hydrogel coatings treated with sequence Bi T . These hydrogels were thoroughly washed after Bn treatment. Sequence Bn carried TAMRA for clear legibility. Sequence Ai in the Ai hydrogel did not bear acrydite; sequence AIA in the AIA hydrogel was conjugated with acrydite.
  • D Effect of different treatments on the capability of A-functionalized hydrogel in catching CCRF-CEM cells. Three A- functionalized hydrogel samples were treated with buffer, Bi s , and B ls respectively. The cell images were captured under an inverted microscope. The cell numbers were quantified with ImageJ. Scale bar: 10 ⁇ .
  • FIG. 4-5 Characterization of cell type-specific catch.
  • A Flow cytometry histograms.
  • B Kinetics of cell binding to the hydrogel coating.
  • C Representative microscopy images of cells on the hydrogel coating. The images were captured at 30 min post cell seeding. Scale bar: ⁇ .
  • FIG. 4-6 5amHI-mediated cell release from the hydrogel coating.
  • A Schematic of 5amHI-mediated cleavage. The symbol of the scissor indicates the restriction endonuclease. The arrowheads point to the cleavage sites.
  • B Gel electrophoretogram for analyzing the hydrolysis of the Ai-Bi duplex.
  • C Flow cytometry histogram for determining the binding capability of the hydro lyzed Ai-Bi duplex.
  • Ai F sequence Ai labeled with FAM.
  • D Microscopy images of cells on the hydrogel coating before and after BamHl treatment. Scale bar: 10 ⁇ . The cell numbers were quantified using ImageJ.
  • FIG. 4-7 Examination of sequence-specific DNA cleavage and cell release.
  • A Recognition sequence of Kpnl. The arrowheads point to the cleavage sites.
  • B Gel electrophoretogram for analyzing the hydrolysis of the aptamer duplexes.
  • C&D Microscopy images of cells on the hydrogel coatings before and after endonuclease treatment.
  • the hydrogel coatings were functionalized with Ai-Bi (C) and A 2 -B 2 duplexes (D). Scale bar: ⁇ .
  • the cell images were analyzed using Image J to provide a quantitative analysis.
  • FIG. 4-8 Comparison of cell release mediated by BamHl and trypsin.
  • A Cell release kinetics.
  • B Live/Dead cell staining. The green and red colors indicate live and dead (pointed by the arrows) cells, respectively.
  • C Flow cytometry histogram for qualitatively analyzing the presence of cell receptors. Four groups of cells were compared, including cells treated with buffer, normal cells labeled with the BI-AI F duplex, cells released by BamHl and labeled with the Bi-Ai F duplex, and cells released by trypsin and labeled with the Bi-Ai F duplex. Scale bar: ⁇ .
  • FIG. 5 is a diagram exemplifying certain embodiments of the invention by direct immobilization of aptamers to substrate for reversible cell catch and release.
  • FIG. 6 is a diagram exemplifying certain embodiments of the invention by immobilization of nucleic acid aptamers or nucleic acid-ligand chimeras to substrate via intermolecular hybridization for reversible cell catch and release.
  • FIG. 7 is a diagram exemplifying certain embodiments of the invention by multiple cell catch and release.
  • affinity ligand-functionalized substrate is a biocompatible solid with an associated affinity ligand as defined in this application.
  • the substrate can be adapted for use in liquid suspension, such as a microparticle or nanoparticle, or as larger surface, such as a glass slide, or a three-dimensional structure, such as a hydrogel, et cetera.
  • the affinity ligand is associated with the substrate by any suitable mode, including both covalent attachment, and non- covalent attachment, such as bitin-avidin binding, or intermolecular nucleic acid hybridization, e.g. to an "anchoring nucleic acid” conjugated to the substrate.
  • the nucleic acids in or attaching (e.g. an anchoring nucleic acid, through hybridization) the affinity ligands can, in some embodiments, be chemically modified with an acrylic phosphoramidite group at 5 ' end or 3 ' end and can be chemically
  • the monomers used for free radical polymerization are acrylate monomers (see Nature Biotech, doi: 10.1038/nbt.2316).
  • single-stranded nucleic acids in or attaching the affinity ligands can carry functional groups, e.g., alkyl, alkyne, azide, amino, carboxyl, thiol or biotin groups at their 5' ends and/or 3' ends, which can react with monomers with or without the aid of cross linkers during a polymerization reaction to attach to a substrate.
  • Polymer networks can be synthesized using various chemical methods, e.g., radical polymerization, addition polymerization and condensation polymerization, depending on the properties of monomers.
  • single-stranded nucleic acids in or attaching the affinity ligand can also be chemically conjugated to substrates with functional groups, e.g., alkyne, azide, and carboxyl.
  • substrates with functional groups e.g., alkyne, azide, and carboxyl.
  • Single-stranded nucleic acids in or attaching affinity ligands can also be immobilized to substrates that are suitably functionalized, e.g., through biotin- streptavidin interactions.
  • Suitable substrates for the affinity-ligand- functionalized substrates provided by, and for use in, the invention can be in the form of microcarriers (including microparticles, about 1 micron to 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than 500 microns); substantially planar surface; or a three dimensional scaffold.
  • the substrate can comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles.
  • a hydrogel can be formed on top of another solid substrate, such as glass.
  • the substrate can comprise a hydrogel, such as a hydrogel selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly(vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel.
  • a hydrogel such as a hydrogel selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly(vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel.
  • an “affinity ligand” is a single-stranded nucleic acid-containing molecule that can specifically bind a biomolecule analyte (such as a target cell marker, e.g., a cell-surface marker and can encompass an associated whole viable cell) with high affinity (i.e. with a dissociation constant of less than about 5x10 ⁇ 6 , lxl 0 ⁇ 6 , 5x10 ⁇ 7 , lxlO "7 , 5xl0 "8 , lxlO "8 , 5xl0 "9 , lxlO “9 M or less).
  • a “biomolecule analyte” can be any biomolecule (e.g.
  • the affinity ligand comprises a single-stranded nucleic acid aptamer that can specifically bind a biomolecule analyte directly.
  • the affinity ligand comprises a single stranded oligonucleotide and associated ligand that specifically binds the biomolecule analyte— e.g.
  • a chimeric molecule with an antibody or antigen-binding fragment thereof, growth factor, peptide, or small molecule (such as folic acid), e.g., as a single stranded oligonucleotide -antibody chimera, single stranded oligonucleotide -growth factor chimera, single stranded oligonucleotide -peptide chimera, or single stranded oligonucleotide -small molecule chimera, et cetera.
  • the single stranded oligonucleotide -antibody chimera e.g., single stranded oligonucleotide -antibody chimera, single stranded oligonucleotide -growth factor chimera, single stranded oligonucleotide -peptide chimera, or single stranded oligonucleotide -small molecule chimera
  • oligonucleotide and associated ligand can be connected by any suitable mode, including direct covalent conjugation or non-covalent conjugation such as biotin- avidin binding.
  • Single-stranded nucleic acid aptamer means a single stranded nucleic acid molecule that specifically binds a target molecule, such as cell receptor, and may have secondary structure, such as one or more stem-loop structures and therefore may, under appropriate conditions, contain some partial intramolecular duplex regions, but typically includes non-duplex regions under physiological conditions.
  • the single-stranded nucleic acid aptamer is directly immobilized to the substrate, e.g., by cross-linking, but in certain embodiments, may be associated with an immobilizing complementary nucleic acid (i.e. an "anchoring nucleic acid”) sequence that is directly immobilized to the substrate via
  • Nucleic acid as used in this application, e.g. as affinity ligands, teathering molecules, deactivating nucleic acids, or reactivating nucleic acids, encompasses both naturally-occurring nucleotides and backbones, such as DNA and RNA comprising A,T, C, G, and U, but also non-naturally occurring nucleic acids, i.e., nucleic acids with chemical modifications to the sugar, nucleobase, or backbone, such as morpholino nucleic acids, locked nucleic acids (LNA), peptide nucleic acids (PNA), glycol nucleic acids (GNA), and threose nucleic acids (TNA)— any of which may have either naturally-occurring nucleobases, or modified nucleobases, including combinations thereof. Nucleic acids for use in the invention may contain additional modifications to increase their half- life, e.g. , in vivo as is known in the art, such as pegylation.
  • “Intramolecular hybridization” refers to conventional "Watson-Crick” base pairing, with the understanding that nucleobase analogs in addition A, T, C, G, and U are capable of such hybridization.
  • the single-stranded nucleic acid aptamers provided by the invention are typically less than about 120 nucleotides in length, e.g., in the range of 15-100 nucleotides.
  • the aptamers comprise about 15-60 "essential nucleotides” and 0-60 "nonessential nucleotides.”
  • the single-stranded nucleic acid aptamers provided by the invention are believed to have an essential nucleotide structure of 1) a region of approximately 15-60 nucleotides in length ⁇ e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55 or 60) that are in direct contact with the biomolecule analyte, and 2) a region of supporting nucleotides that are not necessarily in direct contact with the biomolecule analyte, but that support the configuration of the nucleotides in the first region to make direct contact with the biomolecule analyte, and which is about
  • the single-stranded nucleic acid aptamers provided by the invention may have a third region of "non-essential nucleotides,” that are adapted to, for example, provide spacing from the single- stranded nucleic acid aptamers' associated substrate to provide at least limited translational and/or rotational freedom to, e.g., facilitate target molecule binding.
  • the non-essential nucleotide region is about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length and, in more particular embodiments acts as the tether of the single-stranded nucleic acid aptamers to the associated substrate, e.g. via a covalent bond.
  • non-essential nucleotide regions can be used concordant with the present invention, e.g., 70, 80, 90, 100 nucleotides or more.
  • the non-essential nucleotide regions of the nucleic acid aptamers provided by the invention may contain a recognition site for a sequence-specific endonuclease.
  • the sequence corresponding to the recognition site for the sequence-specific endonuclease may be single stranded and will bind to, for example, a complementary oligonucleotide that is attached to a substrate (i.e.
  • nucleic acid portion of the non-aptamer affinity ligands provided by the invention can be designed in accordance with the forgoing description of non-essential nucleotides of aptamers.
  • the single-stranded nucleic acid aptamers provided by the invention can include a nucleic acid tail that can, inter alia, facilitate the intermolecular hybridization between the aptamer and a deactivating nucleic acid.
  • physiological conditions are relative to the relevant biomolecule analyte, e.g. , target cell marker.
  • analyte e.g. , target cell marker.
  • physiological conditions are substantially similar to the in vivo cellular
  • physiological conditions are substantially neutral pH, isotonic, normoxic conditions and about 21-37 °C.
  • Certain cell types with, for example, more acidic or more basic in vivo microenvironments will have correspondingly different physiological conditions.
  • the specific binding is reversible under physiological conditions such that there would be no significant loss in viability of a cell, such as a eukaryotic cell, particularly an animal cell, and more particularly a mammalian cell in the course of the reversible binding, e.g., less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less loss of viability (i.e., percentage of viability loss after specific binding and release as compared to before specific binding).
  • a cell such as a eukaryotic cell, particularly an animal cell, and more particularly a mammalian cell in the course of the reversible binding, e.g., less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less loss of viability (i.e., percentage of viability loss after specific binding and release as compared to before specific binding).
  • specific binding under physiological conditions, and/or suitability for supporting the maintenance, growth, or replication of a cell in culture means that a particular cell type (e.g., a eukaryotic cell, such as a plant or animal cell, such as a mammalian cell, such as a human cell, including, for example, established cell lines such as CCRF-CEM or Ramos cells) can be maintained in contact with the substrate for a period of at least 2, 4, 6, 8, 10, 12, or 24 hours, or 1, 2, 3, 4, 5, 6, 7, or more days with less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less loss of viability.
  • a particular cell type e.g., a eukaryotic cell, such as a plant or animal cell, such as a mammalian cell, such as a human cell, including, for example, established cell lines such as CCRF-CEM or Ramos cells
  • a “deactivating nucleic acid” is a nucleic acid configured to at least partially hybridize with an affinity ligand provided by the invention and inhibit the specific binding of the target biolecule analyte with the affinity ligand-functionalized substrate, e.g. the deactivating nucleic acid hybridizes with a portion of the single- stranded nucleic acid aptamer provided by the invention to at least partially disrupt specific binding between the single-stranded nucleic acid aptamer and its target biomolecule analyte.
  • a deactivating nucleic acid displaces an affinity ligand from an anchoring nucleic acid— in these embodiments, the release of the biomolecule analyte from the affinity ligand-functionalized substrate is not reversible.
  • the deactivating nucleic acid could either hybridize with the affinity ligand or an anchoring nucleic acid.
  • the deactivating nucleic acid is about 5, 10, 15, 20, 25 30, 35, 40, 45, 50, 55, 60 or more nucleotides in length and hybridizes with a corresponding affinity ligand over about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more nucleotides, or about 20, 30, 40, 50, 60, 70, 80, 90, 100% of the total length of the affinity ligand, and still more particularly where there are no nucleotide mismatches in the region of hybridization.
  • the deactivating nucleic acid hybridizes to the 5 ' end of the essential nucleotides of the single- stranded nucleic acid aptamer.
  • the deactivating nucleic acid hybridizes to the 3 ' end of the essential nucleotides of the single-stranded nucleic acid aptamer.
  • the region of hybridization may be offset by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5' or 3' end of the essential nucleotides of the single-stranded nucleic acid aptamer.
  • Reactivating nucleic acid refers to a nucleic acid molecule that at least partially hybridizes with a deactivating nucleic acid, where the hybridization of the reactivating nucleic acid to the deactivating nucleic acid is thermodynamically favored over the hybridization of the deactivating nucleic acid to its single-stranded nucleic acid aptamer, thereby allowing the single-stranded nucleic acid aptamer to assume a configuration allowing the restoration of the disrupted specific binding of the single-stranded nucleic acid aptamer with its target molecule.
  • the reactivating nucleic acid is about 5, 10, 15, 20, 25 30, 35, 40, 45, 50, 55, 60 or more nucleotides in length and hybridizes with a corresponding deactivating nucleic acid over about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides, more particularly , or about 20%, 30, 40, 50, 60, 70, 80, 90, 100% of the total length of the deactivating nucleic acid and sill more particularly where there are no nucleotide mismatches in the region of hybridization.
  • the reactivating nucleic acid hybridizes to the 5 ' end of the deactivating nucleic acid.
  • the reactivating nucleic acid hybridizes to the 3 ' end of the deactivating nucleic acid.
  • the region of hybridization may be offset by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5 ' or 3 ' end of the deactivating nucleic acid.
  • TMSPM trimethoxysilylpropyl methacrylate
  • PBS Phosphate buffered saline
  • APS ammonium persulfate
  • TEMED ⁇ , ⁇ , ⁇ ', ⁇ '-tetramethylenediamine
  • NaOH sodium hydroxide
  • ACA acrydited control aptamer
  • FAW functional aptamer without acrydite
  • the secondary structures of the aptamers were generated by using
  • PEG hydrogels were synthesized on a glass surface for the convenience of operating cell adhesion experiments. Glass slides were cut to the dimension of approximately 8 mm x 8 mm. The glass was cleaned using acetone and 1 M NaOH solution sequentially. Acrylate groups were generated on the glass surface through silanization as previously described [25]. In brief, the silanization solution was prepared by mixing 0.5 mL TMSPM in 50 mL ethanol with 1.5 mL of 10% diluted glacial acetic acid. After the glass slides were incubated in the silanization solution for 5 min, the slides were thoroughly rinsed with ethanol, dried in air, and stored in a desiccator before use.
  • PEGDA was diluted in PBS to a final concentration of 20 % w/v.
  • the reaction solution was 5 of the PEGDA and aptamer mixture, 0.15 APS (10 % w/v), and 0.15 TEMED (50 % v/v).
  • the solution was deposited on a large glass slide and subsequently covered by the silanized glass slide.
  • the PEG hydrogel tightly attached to the silanized glass slide because the silanized glass surface had acrylate groups that were incorporated into the polymer network. After curing for 2 h, the silanized glass slide was lifted from the larger glass slide. Hydrogel without any modification, hydrogel functionalized with control aptamers, and hydrogel encapsulating aptamers without the acrydite group were prepared in the same way as control hydrogels.
  • aptamers and complementary oligonucleotides were pre-treated by one cycle of heating (95 °C for 1 min) and cooling (room temperature for 1 h). Aptamers were then mixed with COs at a molar ratio of 1 :1 and incubated at 37 °C for 1 h. The mixture was loaded into a 10 % native polyacrylamide gel for gel electrophoresis in a Bio-Rad Mini -PROTEAN tetra cell (Hercules, CA). After electrophoresis, the polyacrylamide gel was stained with ethidium bromide and then imaged with a Bio-Rad GelDoc XR system (Hercules, CA).
  • Complementary oligonucleotides labeled with 6-carboxy-fluorescein were used as a probe to hybridize with the aptamers in the hydrogels to examine the incorporation of the aptamers into the PEG hydrogel.
  • the hydrogel samples were treated by gel electrophoresis and also thoroughly washed to remove any unreacted aptamers.
  • the hydrogels were then treated with CO-FAM solution for 1 h. After thorough washing, the samples were imaged using the CRI Maestro EX SYSTEM (Woburn, MA). The images were analysed with the software provided by the manufacturer.
  • the samples used in the rheology analysis were prepared as circular discs of 20 mm in diameter and 0.75 mm in thickness.
  • the procedure of hydrogel preparation was the same as described above.
  • the aptamer concentration in the hydrogel was 2 ⁇ .
  • the storage (G') and loss (G") moduli of the hydrogels were measured with an AR-G2 rheometer (TA Instruments, New Castle, DE).
  • a stress- sweep test was performed to confirm that the measurement was in the linear viscoelastic regime.
  • the oscillation stress was varied from 0.01 to 1000 Pa at a fixed frequency of 1 rad/s and the frequency was varied from 0.5 to 100 rad/s at an oscillation stress of 1 Pa oscillation stress.
  • the temperature was set at 37 °C for all experiments.
  • Hydrogels of different aptamer concentrations were prepared in a cylindrical mold at room temperature.
  • the hydrogel samples were incubated in PBS (pH 7.4) at 37 °C after dried in vacuum to a constant weight (Wi).
  • Wi constant weight
  • the samples were taken out of the PBS solution and blotted with tissue paper to remove excess water for the measurement of wet weights (W s ).
  • CCRF-CEM CCL-1 19; human T lymphoblast cell line
  • CTL-1596 human B lymphocyte cell line
  • ATCC Manassas, VA
  • RPMI medium 1640 ATCC, Manassas, VA
  • penicillin-streptomycin Mediatech, Manassas, VA
  • All reagents used for cell culture were purchased from Invitrogen (Carlsbad, CA) unless otherwise noted.
  • Flow cytometry was performed using the same procedure as previously described [26]. Briefly, approximately 5 X 10 5 cells were incubated in the binding solution for 1 h at 4 °C. The binding solution contained 50 nM of FAM labeled aptamers or control aptamers. After washing with 1 mL cold binding buffer, the labeled cells were immediately analysed by flow cytometry (BD FACSCalibur flow cytometer, San Jose, CA). A total of 10, 000 events were counted.
  • the buffer used for cell adhesion was Dulbecco's phosphate buffered saline (DPBS) supplemented with 4.5 g/L of glucose, 5 mM MgCl 2 and 0.1 % (w/v) BSA.
  • DPBS Dulbecco's phosphate buffered saline
  • the hydrogel samples were transferred into a 24-well plate and incubated with a cell suspension (5 X 10 5 cells/well) at 37 °C. At a predetermined time point, the hydrogel samples were taken out of the wells for washing. The washing was conducted to remove the unbounded or loosely bounded cells by shaking at 90 rpm for 10 min in a New Brunswick shaker (Edison, NJ).
  • Cell images were captured using an inverted microscope (Axiovert 40CFL, Carl Zeiss) and also analysed with the software Image J to examine the number of cells attached to the hydrogel.
  • Cells were seeded on the PEG hydrogels functionalized with 50 ⁇ aptamer for 30 min. At a predetermined time point, the cells were stained with a mixture of calcein AM (1 ⁇ ) and ethidium homodimer-1 (1 ⁇ ) using the kit of LIVE/DEAD cell assay purchased from Invitrogen (Carlsbad, CA). Fluorescent cell images were captured using an inverted microscope (Axiovert 40CFL, Carl Zeiss). RESULTS
  • the aptamer used in this study is a truncated version (denoted as sgc8c) of the full-length aptamer that was originally selected from a DNA library [27]. This aptamer was purposely chosen because its binding functionality is well
  • the sgc8c aptamer was also modified with the addition of a chain of adenosines (A) to its 5 ' end.
  • the predicted secondary structures are shown in FIG. 1-2.
  • the sgc8c aptamer has a long stem, a 12-nucleotide loop, and a small bulge located between the stem and the loop.
  • the 5 -A and 10-A tail attached to the sgc8c aptamer were predicted not to participate in any intramolecular hybridization, suggesting that the two sgc8c aptamer derivatives exhibit the same binding functionality as the sgc8c aptamer.
  • the 5 ' ends of the aptamers were initially functionalized with an acrydite group for their chemical incorporation to the PEG hydrogels.
  • the double bond of the acrydite group is activated during free radical polymerization and the activated double bonds of the aptamers and PEGDAs are linked together to form the PEG hydrogel (FIG. 1-3A).
  • An intermolecular hybridization assay was used to characterize the hydrogel synthesis and to demonstrate the success of incorporating the acrydited aptamers into the PEG hydrogels (FIG. 1-3B). In this assay, the hydrogel was treated with CO-FAM for one hour followed by thorough washing. As shown in FIG.
  • the COs and the sgc8c-10A aptamers could efficiently hybridize in an aqueous solution.
  • the fluorescence images showed that the aptamer- functionalized PEG hydrogel had stronger fluorescence than the control hydrogels (FIG. 1-3D).
  • the fluorescence intensity of the PEG hydrogels increased with the increase of the aptamer concentration (FIG. 1-3E).
  • the PEG hydrogels were characterized by the examination of their shear moduli and swelling ratio. Both storage (G') and loss (G") moduli of the aptamer- functionalized hydrogel were virtually the same as those of the native hydrogel (i.e., the hydrogel without the aptamer functionalization) (FIG. 1-4A). When the sweeping frequency was varied in the range between 0.5 and 50 rad/s, the G' values of the hydrogel functionalized with aptamers and the control hydrogel without any aptamers were both approximately 10,000 Pa. The swelling test showed that the hydrogels with and without the aptamers both absorbed water very quickly. The swelling ratio reached approximately 350% within the first hour but barely changed after three hours (FIG. 1-4B).
  • CCRF- CEM CCRF- CEM
  • Ramos cells two cell lines were used as a model system, including CCRF- CEM and Ramos cells.
  • the sgc8c aptamer was selected from a DNA library to bind CCRF-CEM cells with Ramos cells as a negative control [27]. Its binding affinity and specificity were previously investigated [26, 27] and is further confirmed in this study by a flow cytometry assay.
  • FIG. 1-5A the sgc8c labeled CCRF- CEM cells exhibit stronger fluorescence intensity than the cells without any treatment or the control aptamer labeled cells.
  • FIG. 1-5A the sgc8c labeled CCRF- CEM cells exhibit stronger fluorescence intensity than the cells without any treatment or the control aptamer labeled cells.
  • FIG. 1-5A the sgc8c labeled CCRF- CEM cells exhibit stronger fluorescence intensity than the cells without any treatment or the control apt
  • the effects of three parameters on cell adhesion were studied: the spacer length ⁇ i.e., the adenosine tail of the aptamer), the concentration of the aptamer, and the time of cell seeding.
  • Three aptamers with 0, 5, and 10 As at their 5' ends were used to prepare PEG hydrogels.
  • the sgc8c-0A aptamer could induce cell adhesion.
  • the cell adhesion induced by the sgc8c-5A aptamer and the sgc8c-10A aptamer was very similar. The data also showed that the cell density increased with the number of extra adenosines.
  • the sgc8c-10A aptamer could increase the average cell density on the hydrogel surface by ⁇ 50% (FIG. 1- 6A).
  • the density of the cells adhered to the hydrogel also increased with the concentration of the aptamer (FIG. 1-6B).
  • the density increased from ⁇ 50 to ⁇ 850 cells/mm with the increase of aptamer concentration from 2 to 50 ⁇ (FIG. 1-6B).
  • the increase of aptamer concentration over 50 ⁇ did not lead to more cell adhesion.
  • the increase of seeding time resulted in the adhesion of more cells within 30 min, after which there was no significant increase in the number of adhered cells (FIG. 1-6C).
  • the result of cell adhesion showed no significant decrease of cell adhesion (FIG. 1- 7B).
  • the second experiment was based on the treatment of the hydrogels rather than the cells.
  • the PEG hydrogels were treated with COs that could effectively hybridize with the aptamers (FIG. 1-7D).
  • the CO treatment led to the decrease of cell adhesion on the hydrogels (FIG. 1-7E).
  • the number of cells decreased with the increased molar ratio of CO to aptamer. When the molar ratio of CO to aptamer reached 1 : 1, the cell density sharply decreased from ⁇ 800 to ⁇ 30 cells/mm (FIG. 1-7E).
  • aptamer-functionalized PEG hydrogel was studied for determining the feasibility of using nucleic acid aptamers to mimic the adhesive binding sites of extracellular matrix.
  • Nucleic acid aptamers can be successfully incorporated into the PEG hydrogel through free radical polymerization.
  • aptamers can effectively induce cell type-specific adhesion to the PEG hydrogel.
  • the level of cell adhesion can be altered by numerous parameters such as the aptamer concentration, the spacer length and the seeding time.
  • COs can block the binding functionality of aptamers in hydrogels and thereby attenuate cell adhesion in physiological conditions.
  • aptamers can control protein release from hydrogels with desired kinetics
  • the data presented in this study show that aptamer-functionalized hydrogels are promising biomaterials that can mimic the functions of extracellular matrices (e.g., providing cells with biochemical and biophysical cues).
  • EXAMPLE 2 PROGRAMMABLE HYDROGELS FOR CONTROLLED CELL CATCH AND RELESE The materials and methods for this example are substantially as described in
  • Example 1 except as noted below and include the following additional
  • Glass slides were cut into small pieces with a dimension of approximately 4 mm x4 mm.
  • the glass slides were treated with 1 M NaOH for 10 min followed by thorough washing with deionized water. After dried in vacuum oven, the slides were incubated in a silanization solution for 5 min.
  • the silanization solution was prepared by diluting 0.5 mL of 3-(trimethoxysilyl) propyl methacrylate in 50 mL of ethanol supplemented by 1.5 mL of dilute acetic acid (10% v/v).
  • the silanized glass slides were washed with pure ethanol to terminate the reaction and clean the surface. After dried in the air, the slides were stored in a vacuum desiccator.
  • a thin layer of polyacrylamide hydrogel was synthesized on the silanized glass surface.
  • the reaction solution was prepared by mixing 1 ⁇ of 10%
  • acrylamide solution containing the sequence A (100 ⁇ ), 0.15 ⁇ , of APS (10 % w/v), and 0.15 ⁇ ⁇ of TEMED (5 % v/v).
  • the solution was transferred to a large piece of clean glass and covered by the silanized glass slide.
  • the silanized glass slide was carefully lifted and thoroughly rinsed with the PBS solution.
  • the hydrogel coating was incubated in a solution of 10 ⁇ fluorophore- labeled aptamer at 37 °C for 1 h. After washing with DPBS, the hydrogel coating was imaged under an inverted fluorescence microscope (Axiovert 40CFL, Carl Zeiss). The hydrogel with the hybridized aptamers was further incubated in a solution of 5 ⁇ secondary CS at 37 °C for 0.5 h and imaged with the inverted fluorescence microscope .
  • a total of 5 l0 5 cells were incubated in the binding solution for 0.5 h at 4 °C.
  • the binding solution contained 25 nM FAM-labeled aptamer or control sequence.
  • the labeled cells were washed with 1 mL of cold binding buffer and subsequently analyzed using a BD FACSCaliburTM flow cytometer (San Jose, CA). Cell catch and release
  • the buffer used for cell catch and release was DPBS containing 4.5 g/L glucose, 10 mM MgCl 2 , and 0.1 % (w/v) BSA.
  • the glass slides with the hydrogel coating were incubated in the aptamer solution (10 ⁇ ) at 37 °C for 1 h. After washing, they were transferred to a 24-well plate and incubated in 800 of cell suspension (5x 10 5 cells/well) at 37 °C for 0.5 h. The unbound cells were gently removed from the coatings by shaking at 90 rpm for 2 min.
  • the glass slides were incubated in the solution containing 5 ⁇ of secondary CS at 37 °C for 20 min.
  • the glass slides were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss) or a CRI Maestro EX SYSTEM. Image J was used to quantify the number of cells on the images.
  • the cells were stained after cell release using the Live/Dead staining kit according to the protocol provided by Invitrogen. Briefly, after the treatment with the secondary CS, the hydrogel was incubated in 250 ⁇ , of washing buffer in a 96- well plate and shaken at 90 rpm for 1 min to allow the released cells to fall off the hydrogel surface.
  • the washing buffer was DPBS containing 4.5 g/L glucose and 10 mM MgCl 2 . After the removal of the hydrogel from the plate, calcein AM and ethidium homodimer-1 were added into the washing buffer with a final
  • oligonucleotides were used in this programmable hydrogel-based system, including a primary CS, a nucleic acid aptamer, and a secondary CS.
  • the primary CS was initially conjugated to the supporting hydrogel through free radical polymerization. It was able to hybridize with the tail of the nucleic acid aptamer and therefore plays the role of a mediator between the hydrogel and the aptamer.
  • the nucleic acid aptamer is a single-stranded oligonucleotide selected from a synthetic nucleic acid library. 10 Because nucleic acid aptamers have high binding affinities and specificities that are comparable to antibodies, 11 they have been studied in a variety of applications at the levels of small molecules, large
  • the aptamer is hybridized with the primary CS tethered to the hydrogel and induces cell type- specific binding via polyvalent aptamer-receptor interactions.
  • the secondary CS was applied to trigger the hydrogel, the aptamer dissociates from the primary CS and hybridizes with the secondary CS.
  • the polyvalent interaction between the cells and the hydrogel was weakened in physiological conditions without the need of using factors that potentially damage the cells or the hydrogel.
  • the state of strong cell binding can be nondestructively converted to a state of cell release simply by using a secondary CS.
  • the supporting hydrogel is regenerated during cell release, it can be repeatedly used for additional rounds of cell catch and release.
  • oligonucleotides we chemically incorporated sequence A to a polyacrylamide hydrogel formed as a coating on a glass surface.
  • Free radical polymerization was used for the incorporation of A as our previous study shows that free radical polymerization is a simple and effective method to chemically incorporate oligonucleotides bearing Acrydite into a hydrogel network.
  • hydrogel was chosen hydrogel as the cell binding material in this study because hydrogels usually do not have affinity sites that induce specific cell binding.
  • hydrogels have been extensively studied for a variety of biological and biomedical applications because of their biocompatibility and structural similarities to extracellular matrices. 14 After the synthesis of the hydrogel coating, the hydrogel was incubated in a solution of the FAM-labeled B.
  • Sequence B consists of three regions: a 20-nucleotide region to hybridize with sequence A, a 40- nucleotide region to recognize CCRF-CEM cells, and a 5-nucleotide region used as a linker.
  • the 40-nucleotide region is the binding aptamer that was selected from a DNA library to bind to CCRF-CEM cells. 15 The flow cytometry histogram confirms that this aptamer binds to CCRF-CEM cells rather than the control cells (not shown).
  • Live/Dead cell assay to evaluate the viability of the released cells.
  • the Live/Dead staining did not show significant difference between the harvested cells and the released cells (FIG. 2-3b).
  • the percentage of viable cells in both groups was approximately 99%.
  • PBS Phosphate buffered saline
  • APS ammonium persulfate
  • TEMED ⁇ , ⁇ , ⁇ ', ⁇ '- tetramethylenediamine
  • sodium hydroxide and microscope glass slide purchased from Fisher Scientific (Suwanee, GA).
  • Streptavidin was purchased from Promega Inc. (Madison, WI).
  • FITC-conjugated streptavidin and 3- (Trimethoxysilyl) propyl methacrylate were purchased from Sigma- Aldrich (Louis, MO).
  • Dulbecco's phosphate buffered saline (DPBS), bovine serum albumin (BSA), Live/Dead staining kits, and biotinylated goat anti-human IgM antibody were purchased from Invitrogen (Carlsbad, CA).
  • Biotinylated isotype control antibody was purchased from SouthernBiotech (Birmingham, AL). All oligonucleotides (Table SI) were synthesized by Integrated DNA Technologies (Coralville, IA). Streptavidin-coated glass was purchased from XENPORE (Hawthorne, NJ).
  • a thin layer of polyacrylamide hydrogel was synthesized on the silanized glass surface.
  • the reaction solution was prepared by mixing 1 ⁇ of 10% acrylamide solution containing the sequence A (50 ⁇ ), 0.15 of APS (10 %> w/v), and 0.15 ⁇ , of TEMED (5 %> v/v). The reaction solution was transferred to a large piece of clean glass and covered by the silanized glass squares. One hour after the polymerization, the glass squares was carefully lifted and thoroughly rinsed with the PBS solution.
  • the hydrogel coating was incubated in the solution of 10 ⁇ TAMRA- labeled sequence B at 37 °C for 1 h. After thoroughly washed with DPBS, the hydrogel coating was imaged under an inverted fluorescence microscope (Axiovert 40CFL, Carl Zeiss). To illustrate hybridization-mediated dissociation of the A-B complexes, the hydrogel was further incubated in the solution of 5 ⁇ C 2 o, C 25 , or C 2 5s at 37 °C for 0.5 h and imaged with the inverted fluorescence microscope. Flow cytometry
  • a total of 5 l0 5 cells were incubated in 10 nM biotinylated IgM antibody or isotype control antibody solution at 4 °C for 0.5 h. After washing, the cells were further incubated in a FITC-conjugated streptavidin (2.5 ng ⁇ L) solution at 4 °C for 0.5 h. The cells were washed again and subsequently analyzed using a BD
  • FACSCaliburTM flow cytometer (San Jose, CA).
  • the buffer used for washing cells was cold DPBS containing 4.5 g/L glucose and 10 mM MgCl 2 .
  • the buffer used for cell catch and release was DPBS containing 4.5g/L glucose, 10 mM MgCl 2 , and 0.1% (w/v) BSA.
  • the glass squares with hydrogel coatings were sequentially incubated in the sequence B solution (5 ⁇ ) for 1 h, the streptavidin solution (10 ⁇ ) for 0.5 h, and the biotinylated antibody solution (1 ⁇ ) for 0.5 h. Each incubation was followed by thorough washing. After the immobilization of the DNA-antibody chimeras, the glass squares were transferred to a 24-well plate and incubated in 800 ⁇ _, of cell suspension (5x 10 5 cells/well) at 37 °C for 0.5 h.
  • the unbound cells were gently removed from the coatings by shaking at 90 rpm for 2 min.
  • the glass squares were incubated in the solution containing 5 ⁇ of C 25 or control sequences at 37 °C for 30 min.
  • the glass squares were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss). The images were analysed to count cell numbers using Image J.
  • the released cells were stained with a mixture of calcein AM (1 ⁇ ) and ethidium homodimer-1 (1 ⁇ ) using the Live/Dead staining kit according to the protocol provided by Invitrogen. Normal cells harvested directly from the cell culture flask were also stained using the same protocol for comparison.
  • the staining buffer was DPBS containing 4.5 g/L glucose and 10 mM MgCl 2 . The stained cells were imaged under the inverted fluorescence microscope.
  • sequence A was initially functionalized with acrydite at its 5' end.
  • sequence A, acrylamide, and bis-acrylamide formed the DNA-functionalized hydrogel via free radical polymerization.
  • the glass surface was silanized to carry methacrylate groups, the hydrogel coating was chemically conjugated to the glass surface during the polymerization.
  • the hydrogel coating was stably immobilized and did not fall off from the glass during any washing step.
  • sequence A was first treated by the fluorophore-labeled complementary sequence B and then washed thoroughly.
  • the B-treated hydrogel exhibited much stronger fluorescence than the original A- functionalized hydrogel (FIG. 3-2). This difference shows that sequence A was successfully incorporated into the polyacrylamide hydrogel coating, and that A and B could stably hybridize in the hydrogel coating.
  • Antibody-DNA chimeras were prepared by using streptavidin to link a biotinylated antibody and a biotinylated single-stranded nucleic acid sequence (i.e., sequence B). The chimeras were immobilized to the hydrogel coating through the hybridization of A and B. Because the double-stranded AB complex forms through physical nucleic acid hybridization, it is reasonable to hypothesize that a third single-stranded sequence could be applied to compete against A and trigger the dissociation of the AB complex (FIG. 3-1B). Resultantly, the antibody-DNA chimera would be released from sequence A and the hydrogel. Thus, the principle of nucleic acid hybridization would be applied to develop a DNA functionalized affinity hydrogel responsive to short nucleic acid oligonucleotides for programming cell release.
  • the antibody-DNA chimera was immobilized to the hydrogel surface through the hybridization of the sequences A and B with the aid of streptavidin. After the immobilization of the antibody-DNA chimera, the hydrogel was thoroughly washed to remove free antibodies and subsequently incubated in the cell suspension. As we expected, the immobilized antibody-DNA chimera was able to successfully catch Ramos cells rather than CCRF-CEM (control) cells to the hydrogel surface (not shown). Although antibody-based molecular recognition is beneficial for initial cell catch, the strong antibody-antigen binding is difficult to break for subsequent cell release.
  • Harsh conditions such as high shear stress or protease treatment can be applied to facilitate cell release from antibody-functionalized materials.
  • these conditions may result in the decrease of cell viability.
  • two stably hybridized nucleic acid sequences can be easily dissociated by introducing a third complementary oligonucleotide without involving any harsh factor (FIG. 3-2).
  • FOG. 3-2 two stably hybridized nucleic acid sequences can be easily dissociated by introducing a third complementary oligonucleotide without involving any harsh factor.
  • antibody-DNA chimeras possess two major advantages of antibodies and nucleic acids: strong cell binding capability and easy dissociation induced by a third complementary oligonucleotide. Because of this special characteristic, antibody-
  • DNA chimeras have been used in various areas. In this study, they were used to develop a DNA-responsive hydrogel-based system for not only cell catch, but also cell release.
  • the hydrogels were incubated in the C 25 solution for half an hour. It was found that the cell density decreased from 1 ,369 ⁇ 76 to 8 ⁇ 4 cells/cm (FIG. 3-4a). This result clearly shows that the efficiency of cell release from the hydrogel can reach 99% under the regulation of C 25 . In contrast, the C 25 s treatment did not cause a significant change of the cell density (FIG. 3-4a).
  • the effect of release time on cell release was also studied to determine the cell release kinetics. It was found that more than 95% cells were released within 10 min (not shown).
  • DNA- functionalized hydrogels can be programmed to achieve controlled cell catch and release by using an antibody-DNA chimera and a triggering complementary oligonucleotide.
  • antibodies were used as a model in this study, it is possible that other types of natural biomolecules (e.g., peptides and growth factors) can be functionalized with nucleic acids as chimeras to achieve a similar effect of programmable cell catch and release. Because the dynamic display of nucleic acid- conjugated biomolecules only relies on nucleic acid hybridization and does not involve any destructive factor, this system holds great potential for various biological and biomedical applications such as tissue engineering and cell separation.
  • EXAMPLE 4 ENDONUCLEASE-RESPONSIVE APTAMER- FUNCTIONALIZED HYDROGEL COATING FOR SEQUENTIAL CATCH AND RELEASE OF CANCER CELLS
  • Polyacrylamide hydrogels were synthesized on the silanized glass surface to produce hydrogel coatings.
  • the pregel solution was prepared by adding TEMED
  • Complementary DNA oligonucleotides were mixed together at a molar ratio of 1 : 1 in PBS containing MgCl 2 (lOmM) and incubated at 37 °C for 1 h. Restriction enzyme (5 units) was added to cleave 1 pmol of DNA double helix at 37 °C for 0.5 h.
  • the DNA solutions were loaded into polyacrylamide gel (10% w/v) for running electrophoresis in a Bio-Rad Mini-PROTEAN terra cell (Hercules, CA). After electrophoresis, the polyacrylamide gel was stained with ethidium bromide and then imaged with a Bio-Rad GelDoc XR system (Hercules, CA). Imaging of hydrogel coatings
  • the glass squares were thoroughly washed with the binding buffer that was DPBS containing glucose (4.5 g/L), MgCl 2 (10 mM), and BSA (0.1% w/v).
  • the binding buffer was DPBS containing glucose (4.5 g/L), MgCl 2 (10 mM), and BSA (0.1% w/v).
  • the glass squares were incubated in cell suspension (800 ⁇ ,, 5x 10 5 cells/well) in a 24-well plate at 37 °C for 30 min. The unbound cells were gently removed from the coatings by shaking the plate at 90 rpm for 1 min.
  • restriction enzyme solution 80 ⁇ ⁇ , 5 units/ ⁇
  • the released cells were gently rinsed off the surface by shaking the plate at 90 rpm for 10 min.
  • the glass slides were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss).
  • the cells on hydrogels were quantified using ImageJ. Three images were randomly selected for each sample. A total of three samples were used in each group.
  • the washed cells were immediately analyzed by the flow cytometer (BD FACSCalibur, San Jose, CA). A total of 10,000 events were counted. Bi S was used as control.
  • BamRl (1 ⁇ ) was added to 100 ⁇ , of the mixture of AI F and Bi and the mixture was incubated at 37 °C for 0.5 h. Afterwards, a total of 5x10 5 CCRF-CEM cells were incubated in the 5amHI-treated mixture for 30 min at 4 °C, washed with cold washing buffer (1 mL), and analyzed by the flow cytometer. A total of 10,000 events were counted.
  • the cells bound to the hydrogels were treated with BamRl (40 units) in an 80 ⁇ , of binding buffer or 80 ⁇ , of trypsin solution (0.05% w/v). FBS were added to the trypsin solution to stop cell trypsinization at the end of the release step.
  • the released cells were labeled with the hybridized aptamer using the same protocol as described in the first flow cytometry experiment. A total of 5,000 events were counted.
  • FIG. 4- 2A shows the schematic of the synthesis of the hydrogel coating using a sandwich method.
  • the small glass square was silanized with 3-(trimethoxysilyl)propyl methacrylate to carry methacrylate groups.
  • aptamer-functionalized hydrogel coating for catching cells After demonstrating the functionality of the polyacrylamide hydrogel in resisting nonspecific cell binding, we studied whether aptamers were capable of inducing cell type-specific binding to the polyacrylamide hydrogel.
  • a nucleic acid aptamer recognizing CCRF-CEM cells [36] was used as a model to functionalize the hydrogel coating.
  • This aptamer i.e., sequence B
  • the first region is the binding motif that is the same as that of the parent aptamer. It contains a total of 40 nucleotides.
  • the second region is a five-nucleotide linker used to increase molecular flexibility and reduce steric hindrance.
  • the third region is a twenty-nucleotide tail used to hybridize with sequence A immobilized in the hydrogel. Importantly, this tail was specially designed with a restriction endonuclease cleavage site in the middle.
  • the sequences Ai and Bi can hybridize through 20 base pairs with a melting temperature higher than 60°C.
  • the control sequence Bis can also form the same 20 base pairs with the sequence The gel electrophoretogram showed that these pairs stably hybridized in aqueous solutions (FIG. 4-4B).
  • the aptamer was purposely immobilized to the hydrogel using
  • the aptamer is designed to carry an exogenous endonuclease-recognizing cleavage site comprised of nucleotides. These exogenous nucleotides may form
  • the success of cell catch relies on not only the ability to catch target cells, but also the ability to resist the binding of non-target cells. Therefore, another cell catch experiment was run to compare the binding of CCRF-CEM and Ramos (i.e., control) cells.
  • the flow cytometry analysis shows that the aptamer specifically binds to CCRF-CEM cells rather than Ramos cells (FIG. 4-5A). Consistent with the flow cytometry analysis, the aptamer was able to catch CCRF-CEM cells rather than Ramos cells (Figs. 4-5B&C) to the hydrogel coating.
  • the profile of binding kinetics shows that the density of Ramos cells on the hydrogel coating did not change throughout the experiment.
  • nucleic acid aptamers are synthetic oligonucleotides screened from DNA/RNA libraries with high binding affinities and specificities that are comparable to antibodies [37,38].
  • aptamers are synthesized using standard phosphoramide chemistry [39]. Thus, aptamers exhibit little or no batch-to-batch variation, which is definitely beneficial to increase the reliability of cell catch.
  • circulating tumor cells may have different characteristics.
  • the ability to separate and detect the subgroups of circulating tumor cells may lead to a deep understanding of cancer development.
  • multiple specific aptamers with different nuclease-recognizing sites can be rationally designed and immobilized into the hydrogel coating to catch the subgroups of tumor cells.
  • proteases In addition to restriction endonucleases, it is also possible to use proteases to induce cell release from the hydrogel coating. Thus, it is reasonable to investigate which type of enzyme will be more efficient to release cells from the hydrogel coating. To address this question, we compared the ability of BamHl and trypsin in releasing cells. The reason for choosing trypsin for comparison is that trypsin is the most commonly used protease for detaching cells from a surface. As shown in FIG. 4-8A, BamHl released 95 ⁇ 4% cells within 10 min whereas trypsin released 80 ⁇ 18% cells during the same period of time. In addition, the unreleased cells in the trypsin group were not evenly distributed on the hydrogel coating.
  • aptamer- functionalized hydrogels A material system for cell catch and release was developed using aptamer- functionalized hydrogels and restriction endonucleases.
  • the immobilized aptamers can specifically catch target cancer cells on the hydrogel surface that is highly resistant to nonspecific cell binding.
  • sequence-specific restriction endonucleases can hydrolyze aptamers with rationally designed cleavage sites and rapidly release cells from the hydrogel without causing cell damage. Therefore, aptamer- functionalized hydrogels hold great potential as a coating material to functionalize medical devices (e.g., microfluidic devices) for specific catch and nondestructive release of rare circulating tumor cells.
  • Hinsch B, Kula MR Physical and kinetic-properties of the site specific endonuclease BamHi from Bacillus- Amyloliquefaciens. Nucleic Acids Res 1980; 8:623-633.
  • Table 4-1 List of DNA oligonucleotides.
  • each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D.
  • any subset or combination of these is also specifically contemplated and disclosed.
  • the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides, inter alia, methods of non-destructively and reversibly binding and isolating, e.g., viable cells. In addition, the invention provides affinity ligand-functionalized substrates, including nucleic acid aptamer- functionalized substrates and nucleic acid-chimera-functionalized substrates, for use in these methods, as well for use in synthetic extracellular matrices and in methods of culturing a cell.

Description

AFFINITY-BASED MATERIALS FOR THE NON-DESTRUCTIVE SEPARATION AND RECOVERY OF CELLS
RELATED APPLICATION(S)
This application claims the benefit of U.S. Provisional Application No.
61/546,378, filed on October 12, 2011 and 61/582,286 filed December 31, 2011.
The entire teachings of the above applications are incorporated herein by reference.
GOVERNMENT SUPPORT
This invention was made with government support under Grant # CBET- 1033212 from the National Science Foundation. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
A need exists for substrates to support the isolation, purification, and/ or maintenance of live cells for fields such as regenerative medicine. Such substrates should advantageously support specific binding of target cells through well- controlled, non-destructive, and reversible specific binding of the cells to facilitate methods of non-destructive cell isolation, particularly under physiological conditions. Additional advantages would be realized where such substrates can be adapted to form synthetic extracellular matrices, to support the maintenance, growth, replication or differentiation of the cells.
SUMMARY OF THE INVENTION
The present invention provides, inter alia, substrates to support the isolation, purification, and maintenance of viable cells through well-controlled, nondestructive, and reversible specific binding of the cells to facilitate, for example, methods of non-destructive cell isolation. The invention is based, at least in part, on the inventors' discoveries relating to the use of nucleic acid-associated surfaces, optionally with complementary nucleic acid sequences (such as deactivating nucleic acids and reactivating nucleic acids as described in the application) for the nondestructive isolation of cells and, in certain embodiments, reversible isolation that leaves the substrate reusable for subsequent uses. The substrates provided by the invention can be adopted for use as extra cellular matrices and, accordingly, can be used in methods of cell culture. Additionally, the invention also provides methods of cell isolation and/or purification using these substrates and synthetic extracellular matrices. In one aspect, the invention provides methods of specifically binding a viable target cell under physiological conditions, by contacting a test composition with an affinity ligand-functionalized substrate under physiological conditions, where the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and where the specific binding of the viable target cell by the affinity ligand is reversible under physiological conditions by intermolecular hybridization with a deactivating nucleic acid.
In a related aspect, the invention provides methods of reversible cell-specific binding by contacting a test composition suspected of containing a viable target cell of interest with an affinity ligand-functionalized substrate under physiological conditions, where the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and where the affinity ligand is a single-stranded nucleic acid aptamer, to produce a target cell-bound affinity ligand-functionalized substrate complex, optionally, washing the complex; and contacting the complex with a deactivating nucleic acid under physiological conditions to release the target cell, where the deactivating nucleic acid intermolecularly hybridizes to the affinity ligand in the complex, to reversibly release the target cell from the complex under physiological conditions.
In certain embodiments of any of the preceding aspects, the viable target cell is a mammalian cell. In certain embodiments of any of the preceding aspects, the substrate is a hydrogel.
In some embodiments, the methods can further include contacting the affinity ligand-functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell. In certain embodiments, the methods can include contacting the affinity ligand-functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell. In more particular embodiments, the methods can include removing the deactivating nucleic acid from the affinity ligand-functionalized substrate by contacting the affinity ligand-functionalized substrate with a reactivating nucleic acid.
In certain embodiments, the affinity ligand is a single-stranded nucleic acid aptamer.
In some embodiments, the test composition is isolated from a mammalian subject and in certain more particular embodiments, the mammalian subject is a human, the test composition comprises a physiological fluid from the human, and the viable target cell is a cancer cell.
In certain embodiments, the affinity ligand is covalently conjugated to the surface of the substrate or is admixed throughout the substrate. In some
embodiments, the affinity ligand is associated with the substrate via hybridization to a complementary nucleic acid sequence that is covalently conjugated to the substrate— e.g. on its surface or is admixed. For some embodiments, the affinity ligand is present at a concentration of about 0.01, 0.05, 0.10, 0.2, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 μΜ or more; more particularly a concentration of about 20-80 μΜ. In certain embodiments, the affinity ligand is present at a concentration to facilitate attachment of about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more target cells/mm2 under physiological conditions.
In certain embodiments, the affinity ligand comprises a single-stranded oligonucleotide and an associated ligand that specifically binds the target cell marker, where the associated ligand is selected from an antibody or antigen-binding fragment thereof, growth factor, peptide, or small molecule, such as a vitamin or cofactor, such as folic acid.
In some embodiments, the substrate is selected from a microcarrier
(including microparticles, about 1 micron to about 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than about 500 microns);
substantially planar surface; or a three dimensional scaffold. The substrate can comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles. In certain particular embodiments, the substrate comprises a hydrogel, and in more particular embodiment, the hydrogel is selected from a PEG hydrogel, a
polyacrylimide hydrogel, a poly(vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel, and in still more particular embodiments, the hydrogel is a PEG hydrogel or acrylamide hydrogel as described in the examples.
In certain embodiments the substrate comprises a second affinity ligand capable of specifically binding a distinct epitope, relative to the epitope of the viable target cell bound by the first affinity ligand. In more particular embodiments, the substrate comprises at least 3, 4, 5, 6, 7, 8, 9, 10, or more affinity ligands each capable of specifically binding distinct epitopes. These embodiments can be used in applications such as cell purification or isolation, as well as artificial patterning to manipulate cell interactions, e.g., for applications such as regenerative medicine.
In some embodiments, the viable target cell is a eukaryotic cell. In more particular embodiments, the eukaryotic cell is an animal cell, such as a vertebrate cell, and in certain embodiments, a mammalian cell, such as a primate cell, such as a human cell.
In certain embodiments, the affinity ligand specifically binds a cell-surface protein on the viable target cell.
In another aspect, the invention provides an affinity ligand-functionalized substrate comprising an affinity ligand capable of specifically binding a target cell marker, where the specific binding of the target cell by the affinity ligand is reversible under physiological conditions by intermolecular hybridization with a deactivating nucleic acid or a sequence-specific endonuc lease.
In some embodiments, the affinity ligand is covalently conjugated to the substrate. In more particular embodiments, the affinity ligand is covalently conjugated to the surface of the substrate. In certain embodiments, the affinity ligand is admixed throughout the substrate.
In some embodiments, the affinity ligand is associated with the substrate via hybridization to a complementary nucleic acid sequence that is covalently conjugated to the substrate.
The affinity ligand can include a nucleotide sequence that is recognizable and cleavable by a sequence-specific endonuc lease.
In some embodiments the affinity ligand is present at a concentration of about 0.01, 0.05, 0.10, 0.2, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 μΜ or more; more particularly a concentration of about 20-80 μΜ. The various affinity ligand-functionalized substrates as described above can have the affinity ligand present at a concentration to facilitate attachment of about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more target cells/mm2 under physiological conditions. In more particular embodiments, about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more, target cells/mm2 are specifically bound to the substrate.
In some embodiments, the affinity ligand comprises a single-stranded nucleic acid aptamer that specifically binds the target cell marker. In other embodiments, the affinity ligand comprises a single stranded oligonucleotide and an associated ligand that specifically binds the target cell marker, wherein the associated ligand is selected from an antibody or antigen-binding fragment thereof, growth factor, or peptide, or small molecule, such as a vitamin or cofactor, such as folic acid.
The substrates can be selected from, for example, a microcarrier (including microparticles, about 1 micron to 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than 500 microns); substantially planar surface; or a three dimensional scaffold. The substrate may comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles. In particular embodiments, the substrate comprises a hydrogel, particularly wherein the hydrogel is selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly( vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel, and in more particular embodiments includes hydrogels of PEG or acrylamide as described in the examples.
In certain embodiments, the affinity ligand-functionalized substrates provided by the invention can include a plurality of affinity ligands to distinct epitopes for, e.g., isolating mixtures of cells and/or patterning cells to, e.g., control cell-cell interactions. In some embodiments the substrate comprises a second affinity ligand capable of specifically binding a second target cell marker, wherein the second target cell marker is either a distinct epitope of the first target cell marker, relative to the epitope bound by the first affinity ligand, or a distinct target cell marker. In more particular embodiments, the substrate comprises at least 3, 4, 5, 6, 7, 8, 9, 10, or more single-stranded nucleic acid aptamers capable of specifically binding distinct target cell markers.
In some embodiments, the target cell marker bond by the affinity ligand is a cell-surface biomolecule. In more particular embodiments, the cell-surface biomolecule is from a eukaryotic cell. In still more particular embodiments, the eukaryotic cell is an animal cell, such as a vertebrate cell, and in certain
embodiments, a mammalian cell, such as a primate cell, such as a human cell. In certain embodiments, the cell-surface biomolecule is cell-surface protein. In some embodiments, the single-stranded nucleic acid aptamer is bound to the target cell marker.
In particular embodiments, the single-stranded nucleic acid aptamers of the functionalized substrate are bound to a deactivating nucleic acid.
In a related aspect, the invention also provides synthetic extracellular matrices containing any of the affinity ligand-functionalized substrates described above, which is adapted to support the maintenance, growth, or replication of a cell in culture. In particular embodiments, the cell is a eukaryotic cell, and in certain embodiments, an animal cell, such as a vertebrate cell, or in more particular embodiments a mammalian cell, such as a primate cell, such as a human cell. In some embodiments, the synthetic extracellular matrix can further include
physiological levels of one or more compounds for support the maintenance, growth, or replication of a cell selected from a growth factor, carbon source, nitrogen source, micronutrient, vitamin, mineral, pH indicator, buffer, amino acids, fetal calf serum, fetal bovine serum, or minimal media, such as a complete synthetic media, as well as specific media or close variants thereof, such as DMEM, RPMI media, including RPMI1640 media. In some embodiments, the synthetic extra cellular matrix can include an associated cell that is specifically bound by the affinity ligand.
In another aspect, the invention provides compositions containing any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above. In particular embodiments, the composition can further include a test composition suspected of containing the target cell marker.
In a related aspect, the invention also provides a kit with any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above, and optionally containing one or more of instructions for use, a suitable positive control, a suitable negative control, calibration standards, a deactivating nucleic acid, or a reactivating nucleic acid.
In another aspect, the invention provides methods of specifically binding a biomolecule analyte (including for example whole viable cells), by contacting a test composition suspected of containing the biomolecule analyte with any of the affinity ligand-functionalized substrates or synthetic extracellular matrices described above under physiological conditions to allow the specific binding of the biomolecule analyte and the affinity ligand.
In a related aspect, the invention provides methods of isolating a biomolecule analyte (including for example whole viable cells), by contacting a test composition suspected of containing the biomolecule analyte with any of the affinity ligand- functionalized substrates or synthetic extracellular matrices of any one of the preceding claims under physiological conditions to allow the specific binding of the biomolecule analyte and the affinity ligand, thus isolating the biomolecule analyte. The methods provided by these two related aspect can include one or more washings of the affinity ligand-functionalized substrate or synthetic extracellular matrix. In some embodiments, the methods include contacting the affinity ligand- functionalized substrate or synthetic extracellular matrix with a deactivating nucleic acid under physiological conditions to release the biomolecule analyte. In more particular embodiments, the methods include removing the deactivating nucleic acid from the aptamer-functionalized substrate or synthetic extracellular matrix. In still more particular embodiments, the deactivating nucleic acid is removed from the affinity ligand-functionalized substrate or synthetic extracellular matrix by contacting the affinity ligand-functionalized substrate or synthetic extracellular matrix with a reactivating nucleic acid under physiological conditions.
In another aspect, the invention provides methods of culturing a cell of interest comprising contacting the cell of interest with any one of the synthetic extracellular matrices described above. In some embodiments, the cell of interest is contained in a mixture of extraneous materials and/or cells before being contacted with the synthetic extracellular matrix and, after contacting the mixture with the synthetic extracellular matrix, the extraneous materials and/or cells are removed by washing. In certain embodiments, the methods include releasing the cell of interest under physiological conditions by contacting the synthetic extracellular matrix with a deactivating nucleic acid. In certain particular embodiments of these methods, the biomolecule analyte is a cell. In some more particular embodiments, the cell is a eukaryotic cell, such as a plant or animal cell. In still more particular embodiments, the cell is an animal cell, such as a vertebrate cell, such as a mammalian cell, such as a human cell. In some embodiments, the system of cultured cells and synthetic extracellular matrices can be used in applications such as regenerative medicine.
The invention further comprises further suitable uses and adaptations of the the affinity ligand-functionalized substrates or synthetic extracellular matrices described above in methods of binding or isolating a biomolecule analyte or in a method of culturing a cell.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1-1 : Schematic of cell adhesion to aptamer-functionalized hydrogel.
FIG. 1-2: Secondary structures of aptamers. Left: sgc8c-0A; middle: sgc8c- 5 A; right: sgc8c-10A. The structures were generated by using RNAstructure version 5.0. The structures with the lowest free energies are presented. The tail of the aptamer is circled.
FIG. 1-3: Synthesis of aptamer-functionalized PEG hydrogel. (A) Schematic of incorporating aptamers into the PEG hydrogel network via free radical polymerization. (B) Schematic of fluorescence labeling of aptamer-functionalized PEG hydrogel. (C) Gel electrophoresis analysis of intermolecular hybridization between the sgc8c-10A aptamer and its complementary oligonucleotide. CO:
complementary oligonucleotide; ACA: acrydited control aptamer. (D) Fluorescence imaging of the PEG hydrogels after gel electrophoresis and hybridization with CO- FAM. Top: monochrome images; bottom: fluorescence images. Type of hydrogel (from left to right): hydrogel without the aptamers; hydrogel physically
encapsulating the aptamers {i.e., FAW); hydrogel functionalized with the ACA; hydrogel functionalized with the functional aptamers {i.e., sgc8c-10A). The molar ratio of CO-FAM to aptamer was 1 : 1. (E) Fluorescence imaging of PEG hydrogel functionalized with sgc8c-10A of different concentration. The molar ratio of CO- FAM to aptamer was 1 :1.
FIG. 1-4: Characterization of mechanical properties. (A) Rheology analysis of moduli. G' : storage modulus; G": loss modulus. The frequency was varied from 0.5 to 100 rad/s at an oscillation stress of 1 Pa oscillation stress. The aptamer concentration was 2 μΜ. (B) Dynamic swelling of hydrogels. The aptamer concentration was 2 μΜ. (C) Effect of aptamer concentration on swelling. The hydrogel samples were examined 24 h after incubated in PBS solution. Four samples were studied in each group.
FIG. 1-5: Determination of cell type-specific adhesion on aptamer functionalized PEG hydrogel. (A) Flow cytometry analysis of CCRF-CEM and Ramos cells labeled by sgc8c-FAM. (B) Representative microscopy images of cell adhesion. The concentration of the aptamer was 50 μΜ; the time of cell seeding was 30 min. (C) Quantitative analysis of cell adhesion. Three samples were prepared in each group and five different regions in each sample were randomly chosen. The cells were enumerated with the software Image J. (D) Staining of live/dead cells. Cells after the adhesion for a different period of time were stained with the mixture of calcein AM (green; live) and ethidium homodimer-1 (red; dead). The arrow indicates the dead cell.
FIG. 1-6: Effect of different parameters on cell adhesion. (A) Effect of spacer length on cell adhesion. The concentration of the aptamer was 50 μΜ; the time of cell seeding was 30 min. (B) Effect of aptamer concentration on cell adhesion. The spacer length was 10A; the time of cell seeding was 30 min. (C) Effect of seeding time on cell adhesion. The concentration of the aptamer was 50 μΜ; the spacer length was 10A. Left: representative cell images; right: quantitative analysis of cell adhesion.
FIG. 1-7: Attenuation of cell-hydrogel interaction by trypsinization (A-C) and aptamer inactivation (D-F). (A) Flow cytometry analysis of cell trypsinization. (B) Images of cell adhesion (top) and live/dead staining (bottom). (C) Quantitative analysis of cell adhesion after trypsinization. (D) Fluorescence imaging of PEG hydrogel blocked with CO-FAM. The numbers show the molar ratios of CO to aptamer. (E) Representative images of cell adhesion. (F) Quantitative analysis of cell adhesion on hydrogel blocked with complementary oligonucleotides.
FIG. 2-1 : Schematic of using a programmable hydrogel for cell catch and release, (a) Synthesis of the hydrogel on glass: i) silanization; ii) polymerization, (b) Transformation of the aptamer. (c) Cell catch and release during the transformation of the aptamer. The hybridization with the primary CS enables the display of the aptamer for cell catch. The secondary CS competes against the primary CS to hybridize and release the aptamer from the hydrogel for cell release.
FIG. 2-2: Characterization of nucleic acid hybridization, (a) Gel
electrophoretogram. The color of the letters indicate the fluorophores used for sequence labeling. The sequences A, B, and C are the primary CS, aptamer, and secondary CS, respectively. The subscript after C indicates the hybridizing length, (b) SPR sensorgrams. The solutions of B and C2o or C25 were sequentially run on an A-coated biochip surface to generate the association and dissociation profiles, (c) Fluorescence images. Sequence A-functionalized hydrogels were treated with fluorophore-labeled B, followed by the incubation in the solution of C20 or C25.
FIG. 2-3: Sequential cell catch and release, (a) Representative images of cells on the hydrogel surface. Each group had three hydrogel samples, (b) Images of live and dead cells. The cells were treated with the mixture of calcein AM (green: live) and ethidium homodimer-1 (red: dead) using a Live/Dead cell staining kit.
Harvested cells: cells directly harvested from a cell culture flask. The arrows point to the dead cells (red). White scale bar: 20 μιη; red scale bar: 50 μιη. FIG. 2-4: Repetition of cell catch and release, (a) Fluorescence images of cells in two successive rounds of cell catch and release. The cells were labeled with a Vybrant cell-labeling solution for clear observation. The whole gel images were captured using a CRI Maestro EX Imaging System and the micrographs were captured using an inverted fluorescence microscope. Red scale bar: 2 mm; white scale bar: 20 μιη. (b) Quantitative analysis of cell catch and release using ImageJ.
FIG. 3-1 : Schematic of programming the display of antibody-DNA chimeras for sequential cell catch and release, (a) The synthesis of DNA-functionalized hydrogel on a glass surface for the immobilization of antibody-DNA chimeras, (b) Sequential cell catch and release regulated by nucleic acid hybridization.
FIG. 3-2: Fluorescence imaging of DNA-functionalized hydrogels. Sequence B was labeled with TAMRA. In the lower panel, the hydrogels functionalized with the immobilized AB complex were treated with C25, C25s, or C20.
FIG. 3-3: Characterization of nonspecific cell binding on different surfaces. Scale bar, 50 μιη. SA denotes streptavidin. Both Ramos (top) and CCRF-CEM (bottom) cells were used to examine the nonspecific cell binding.
FIG. 3-4: Characterization of cell catch and release, (a) Microscopy imaging of cells on the surface of affinity hydrogels after cell catch and release. The cell numbers were quantified using ImageJ. Scale bar, 20 μιη. (b) Live/Dead cell staining. Live and dead cells are indicated by green and red, respectively. The dead cells are also pointed by the red arrows. Normal cells: cells directly harvested from flask. Scale bar, 10 μιη. The percentage of viable cells was 99.1 ± 0.9%.
FIG. 4-1 : Schematic of sequential cell catch and release using aptamer- functionalized hydrogel coating and restriction endonuclease.
FIG. 4-2: Preparation of hydrogel coating. (A) Schematic of the sandwich method for coating a polyacrylamide hydrogel on the glass square. (B) Chemical structures and the principle of chemical reaction. (C) SEM images.
FIG. 4-3 : Characterization of the functionality of the polyacrylamide hydrogel coating in resisting nonspecific cell binding. (A) Representative microscopy images of cells on different surfaces. (B) Comparison of the density of cells on different surfaces. The cell numbers were quantified with ImageJ. Scale bar: 10 μιη.
FIG. 4-4: Characterization of the functionality of the aptamer in catching CCRF-CEM cells. (A) Secondary structure of the hybridized aptamer. Red indicates the binding motif; blue indicates the linker and yellow indicates the hybridized segment. (B) Electrophoretogram of intermolecular hybridization. (C) Fluorescence images of hydrogel coatings treated with sequence BiT. These hydrogels were thoroughly washed after Bn treatment. Sequence Bn carried TAMRA for clear legibility. Sequence Ai in the Ai hydrogel did not bear acrydite; sequence AIA in the AIA hydrogel was conjugated with acrydite. (D) Effect of different treatments on the capability of A-functionalized hydrogel in catching CCRF-CEM cells. Three A- functionalized hydrogel samples were treated with buffer, Bis, and Bls respectively. The cell images were captured under an inverted microscope. The cell numbers were quantified with ImageJ. Scale bar: 10 μιη.
FIG. 4-5: Characterization of cell type-specific catch. (A) Flow cytometry histograms. (B) Kinetics of cell binding to the hydrogel coating. (C) Representative microscopy images of cells on the hydrogel coating. The images were captured at 30 min post cell seeding. Scale bar: ΙΟμιη.
FIG. 4-6: 5amHI-mediated cell release from the hydrogel coating. (A) Schematic of 5amHI-mediated cleavage. The symbol of the scissor indicates the restriction endonuclease. The arrowheads point to the cleavage sites. (B) Gel electrophoretogram for analyzing the hydrolysis of the Ai-Bi duplex. (C) Flow cytometry histogram for determining the binding capability of the hydro lyzed Ai-Bi duplex. AiF: sequence Ai labeled with FAM. (D) Microscopy images of cells on the hydrogel coating before and after BamHl treatment. Scale bar: 10 μιη. The cell numbers were quantified using ImageJ.
FIG. 4-7: Examination of sequence-specific DNA cleavage and cell release. (A) Recognition sequence of Kpnl. The arrowheads point to the cleavage sites. (B) Gel electrophoretogram for analyzing the hydrolysis of the aptamer duplexes.
(C&D) Microscopy images of cells on the hydrogel coatings before and after endonuclease treatment. The hydrogel coatings were functionalized with Ai-Bi (C) and A2-B2 duplexes (D). Scale bar: ΙΟμηι. The cell images were analyzed using Image J to provide a quantitative analysis.
FIG. 4-8: Comparison of cell release mediated by BamHl and trypsin. (A) Cell release kinetics. (B) Live/Dead cell staining. The green and red colors indicate live and dead (pointed by the arrows) cells, respectively. (C) Flow cytometry histogram for qualitatively analyzing the presence of cell receptors. Four groups of cells were compared, including cells treated with buffer, normal cells labeled with the BI-AIF duplex, cells released by BamHl and labeled with the Bi-AiF duplex, and cells released by trypsin and labeled with the Bi-AiF duplex. Scale bar: ΙΟμιη.
FIG. 5 is a diagram exemplifying certain embodiments of the invention by direct immobilization of aptamers to substrate for reversible cell catch and release.
FIG. 6 is a diagram exemplifying certain embodiments of the invention by immobilization of nucleic acid aptamers or nucleic acid-ligand chimeras to substrate via intermolecular hybridization for reversible cell catch and release.
FIG. 7 is a diagram exemplifying certain embodiments of the invention by multiple cell catch and release.
The foregoing will be apparent from the following more particular description of example embodiments of the invention, as illustrated in the accompanying drawings. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating embodiments of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
A description of example embodiments of the invention follows.
Definitions
The meaning of the following terms will be adhered to throughout the application and will serve to illustrate the invention.
"Affinity ligand-functionalized substrate" is a biocompatible solid with an associated affinity ligand as defined in this application. In some embodiments, the substrate can be adapted for use in liquid suspension, such as a microparticle or nanoparticle, or as larger surface, such as a glass slide, or a three-dimensional structure, such as a hydrogel, et cetera. The affinity ligand is associated with the substrate by any suitable mode, including both covalent attachment, and non- covalent attachment, such as bitin-avidin binding, or intermolecular nucleic acid hybridization, e.g. to an "anchoring nucleic acid" conjugated to the substrate. The nucleic acids in or attaching (e.g. an anchoring nucleic acid, through hybridization) the affinity ligands can, in some embodiments, be chemically modified with an acrylic phosphoramidite group at 5 ' end or 3 ' end and can be chemically
incorporated into a polymer via free radical polymerization. In certain
embodiments, the monomers used for free radical polymerization are acrylate monomers (see Nature Biotech, doi: 10.1038/nbt.2316). In some embodiments, single-stranded nucleic acids in or attaching the affinity ligands can carry functional groups, e.g., alkyl, alkyne, azide, amino, carboxyl, thiol or biotin groups at their 5' ends and/or 3' ends, which can react with monomers with or without the aid of cross linkers during a polymerization reaction to attach to a substrate. Polymer networks can be synthesized using various chemical methods, e.g., radical polymerization, addition polymerization and condensation polymerization, depending on the properties of monomers. In addition to the polymerization-mediated incorporation, single-stranded nucleic acids in or attaching the affinity ligand can also be chemically conjugated to substrates with functional groups, e.g., alkyne, azide, and carboxyl. Single-stranded nucleic acids in or attaching affinity ligands can also be immobilized to substrates that are suitably functionalized, e.g., through biotin- streptavidin interactions.
Suitable substrates for the affinity-ligand- functionalized substrates provided by, and for use in, the invention can be in the form of microcarriers (including microparticles, about 1 micron to 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than 500 microns); substantially planar surface; or a three dimensional scaffold. The substrate can comprise polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles. For example, in certain embodiments, a hydrogel can be formed on top of another solid substrate, such as glass. In certain particular embodiments, the substrate can comprise a hydrogel, such as a hydrogel selected from a PEG hydrogel, a polyacrylimide hydrogel, a poly(vinyl alcohol) hydrogel, or a poly(2-hydroxyethyl methacrylate) hydrogel.
An "affinity ligand" is a single-stranded nucleic acid-containing molecule that can specifically bind a biomolecule analyte (such as a target cell marker, e.g., a cell-surface marker and can encompass an associated whole viable cell) with high affinity (i.e. with a dissociation constant of less than about 5x10~6, lxl 0~6, 5x10~7, lxlO"7, 5xl0"8, lxlO"8, 5xl0"9, lxlO"9 M or less). A "biomolecule analyte" can be any biomolecule (e.g. a peptide, nucleic acid, lipid, carbohydrate, vitamin or cofactor, and combinations thereof, e.g. glycoconjugate of a lipid or peptide) and in particular embodiments is a target cell molecule, such as a biomolecule expressed on the surface of a target cell, an may encompass the entire associated cell. In some embodiments, the affinity ligand comprises a single-stranded nucleic acid aptamer that can specifically bind a biomolecule analyte directly. In other embodiments the affinity ligand comprises a single stranded oligonucleotide and associated ligand that specifically binds the biomolecule analyte— e.g. a chimeric molecule with an antibody (or antigen-binding fragment thereof, growth factor, peptide, or small molecule (such as folic acid), e.g., as a single stranded oligonucleotide -antibody chimera, single stranded oligonucleotide -growth factor chimera, single stranded oligonucleotide -peptide chimera, or single stranded oligonucleotide -small molecule chimera, et cetera. In these embodiments, the single stranded
oligonucleotide and associated ligand can be connected by any suitable mode, including direct covalent conjugation or non-covalent conjugation such as biotin- avidin binding.
"Single-stranded nucleic acid aptamer" means a single stranded nucleic acid molecule that specifically binds a target molecule, such as cell receptor, and may have secondary structure, such as one or more stem-loop structures and therefore may, under appropriate conditions, contain some partial intramolecular duplex regions, but typically includes non-duplex regions under physiological conditions. In certain embodiments, the single-stranded nucleic acid aptamer is directly immobilized to the substrate, e.g., by cross-linking, but in certain embodiments, may be associated with an immobilizing complementary nucleic acid (i.e. an "anchoring nucleic acid") sequence that is directly immobilized to the substrate via
intermolecular hybridization.
"Nucleic acid" as used in this application, e.g. as affinity ligands, teathering molecules, deactivating nucleic acids, or reactivating nucleic acids, encompasses both naturally-occurring nucleotides and backbones, such as DNA and RNA comprising A,T, C, G, and U, but also non-naturally occurring nucleic acids, i.e., nucleic acids with chemical modifications to the sugar, nucleobase, or backbone, such as morpholino nucleic acids, locked nucleic acids (LNA), peptide nucleic acids (PNA), glycol nucleic acids (GNA), and threose nucleic acids (TNA)— any of which may have either naturally-occurring nucleobases, or modified nucleobases, including combinations thereof. Nucleic acids for use in the invention may contain additional modifications to increase their half- life, e.g. , in vivo as is known in the art, such as pegylation.
"Intramolecular hybridization" refers to conventional "Watson-Crick" base pairing, with the understanding that nucleobase analogs in addition A, T, C, G, and U are capable of such hybridization.
The single-stranded nucleic acid aptamers provided by the invention are typically less than about 120 nucleotides in length, e.g., in the range of 15-100 nucleotides. In more particular embodiments, the aptamers comprise about 15-60 "essential nucleotides" and 0-60 "nonessential nucleotides." While not wishing to be bond by theory, the single-stranded nucleic acid aptamers provided by the invention are believed to have an essential nucleotide structure of 1) a region of approximately 15-60 nucleotides in length {e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55 or 60) that are in direct contact with the biomolecule analyte, and 2) a region of supporting nucleotides that are not necessarily in direct contact with the biomolecule analyte, but that support the configuration of the nucleotides in the first region to make direct contact with the biomolecule analyte, and which is about 0-60 nucleotides in length {e.g., about 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, or more nucleotides). Optionally, the single-stranded nucleic acid aptamers provided by the invention may have a third region of "non-essential nucleotides," that are adapted to, for example, provide spacing from the single- stranded nucleic acid aptamers' associated substrate to provide at least limited translational and/or rotational freedom to, e.g., facilitate target molecule binding. In some embodiments the non-essential nucleotide region is about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length and, in more particular embodiments acts as the tether of the single-stranded nucleic acid aptamers to the associated substrate, e.g. via a covalent bond. In other embodiments, longer non-essential nucleotide regions can be used concordant with the present invention, e.g., 70, 80, 90, 100 nucleotides or more. In certain embodiments, the non-essential nucleotide regions of the nucleic acid aptamers provided by the invention may contain a recognition site for a sequence-specific endonuclease. For example, the sequence corresponding to the recognition site for the sequence-specific endonuclease may be single stranded and will bind to, for example, a complementary oligonucleotide that is attached to a substrate (i.e. an anchoring nucleic acid) to form an intermolecular duplex that is recognizable and cleavable by the sequence-specific endonuclease under appropriate conditions. In other embodiments, a sequence-specific endonuclease that recognizes a single-stranded nucleic acid could be used. The nucleic acid portion of the non-aptamer affinity ligands provided by the invention can be designed in accordance with the forgoing description of non-essential nucleotides of aptamers.
In certain embodiments, the single-stranded nucleic acid aptamers provided by the invention can include a nucleic acid tail that can, inter alia, facilitate the intermolecular hybridization between the aptamer and a deactivating nucleic acid.
"Physiological conditions" are relative to the relevant biomolecule analyte, e.g. , target cell marker. For example, for a cell-surface molecule on a human cell, physiological conditions are substantially similar to the in vivo cellular
microenvironment with regard to, for example, tonicity, pH, p02, temperature, and/or micro or macronutrient density. For example, in certain embodiments physiological conditions are substantially neutral pH, isotonic, normoxic conditions and about 21-37 °C. Certain cell types with, for example, more acidic or more basic in vivo microenvironments will have correspondingly different physiological conditions. In particular embodiments, when a biomolecule analyte is reversibly and specifically bound under physiological conditions, the specific binding is reversible under physiological conditions such that there would be no significant loss in viability of a cell, such as a eukaryotic cell, particularly an animal cell, and more particularly a mammalian cell in the course of the reversible binding, e.g., less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less loss of viability (i.e., percentage of viability loss after specific binding and release as compared to before specific binding). In certain embodiments, specific binding under physiological conditions, and/or suitability for supporting the maintenance, growth, or replication of a cell in culture means that a particular cell type (e.g., a eukaryotic cell, such as a plant or animal cell, such as a mammalian cell, such as a human cell, including, for example, established cell lines such as CCRF-CEM or Ramos cells) can be maintained in contact with the substrate for a period of at least 2, 4, 6, 8, 10, 12, or 24 hours, or 1, 2, 3, 4, 5, 6, 7, or more days with less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less loss of viability.
A "deactivating nucleic acid" is a nucleic acid configured to at least partially hybridize with an affinity ligand provided by the invention and inhibit the specific binding of the target biolecule analyte with the affinity ligand-functionalized substrate, e.g. the deactivating nucleic acid hybridizes with a portion of the single- stranded nucleic acid aptamer provided by the invention to at least partially disrupt specific binding between the single-stranded nucleic acid aptamer and its target biomolecule analyte. In other embodiments a deactivating nucleic acid displaces an affinity ligand from an anchoring nucleic acid— in these embodiments, the release of the biomolecule analyte from the affinity ligand-functionalized substrate is not reversible. These latter embodiments, the deactivating nucleic acid could either hybridize with the affinity ligand or an anchoring nucleic acid.
In particular embodiments, the deactivating nucleic acid is about 5, 10, 15, 20, 25 30, 35, 40, 45, 50, 55, 60 or more nucleotides in length and hybridizes with a corresponding affinity ligand over about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more nucleotides, or about 20, 30, 40, 50, 60, 70, 80, 90, 100% of the total length of the affinity ligand, and still more particularly where there are no nucleotide mismatches in the region of hybridization. In some embodiments, the deactivating nucleic acid hybridizes to the 5 ' end of the essential nucleotides of the single- stranded nucleic acid aptamer. In other embodiments the deactivating nucleic acid hybridizes to the 3 ' end of the essential nucleotides of the single-stranded nucleic acid aptamer. In either of the preceding embodiments, the region of hybridization may be offset by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5' or 3' end of the essential nucleotides of the single-stranded nucleic acid aptamer.
"Reactivating nucleic acid" refers to a nucleic acid molecule that at least partially hybridizes with a deactivating nucleic acid, where the hybridization of the reactivating nucleic acid to the deactivating nucleic acid is thermodynamically favored over the hybridization of the deactivating nucleic acid to its single-stranded nucleic acid aptamer, thereby allowing the single-stranded nucleic acid aptamer to assume a configuration allowing the restoration of the disrupted specific binding of the single-stranded nucleic acid aptamer with its target molecule. In particular embodiments, the reactivating nucleic acid is about 5, 10, 15, 20, 25 30, 35, 40, 45, 50, 55, 60 or more nucleotides in length and hybridizes with a corresponding deactivating nucleic acid over about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides, more particularly , or about 20%, 30, 40, 50, 60, 70, 80, 90, 100% of the total length of the deactivating nucleic acid and sill more particularly where there are no nucleotide mismatches in the region of hybridization. In some embodiments, the reactivating nucleic acid hybridizes to the 5 ' end of the deactivating nucleic acid. In other embodiments the reactivating nucleic acid hybridizes to the 3 ' end of the deactivating nucleic acid. In either of the preceding embodiments, the region of hybridization may be offset by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5 ' or 3 ' end of the deactivating nucleic acid.
The following non-limiting examples serve to illustrate the present invention.
EXAMPLE 1: CELL ADHESION ON AN ARTIFICIAL EXTRACELLULAR MATRIX
MATERIALS AND METHODS
Chemical reagents
Polyethylene glycol) diacrylate (PEGDA; average Mn: 700 Dalton) and 3-
(trimethoxysilyl)propyl methacrylate (TMSPM) were purchased from Sigma- Aldrich (St. Louis, MO). Phosphate buffered saline (PBS), ammonium persulfate (APS), Ν,Ν,Ν',Ν'-tetramethylenediamine (TEMED), and sodium hydroxide (NaOH) were purchased from Fisher Scientific (Suwanee, GA). All oligonucleotides (Table 1-1) were purchased from Integrated DNA Technologies (Coralville, IA). Table 1-1 Sequences of oligonucleotides.
Name Sequence (5'→3')
lacryditel- sgc8c-10A
AAAAAAAAAATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA
lacryditel- sgc8c-5A
AAAAATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA
sgc8c-0A /acrwJ/fe/-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA
lacryditel-
ACA
GCGATACTCCACAGGCTACGGCACGTAGAGCATCACCATGATCCTG
FAW CACTTAGAGTTCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA
CO-FAM /F/W/-TCTAACCGTACAGTATTTTC sgc8c- /F/W/-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA FAM
CO TCTAACCGTACAGTATTTTC
The binding region of the aptamers is underlined. ACA: acrydited control aptamer; FAW: functional aptamer without acrydite.
Prediction of secondary structures
The secondary structures of the aptamers were generated by using
R Astructure version 5.0 (rna.urmc.rochester.edu/rnastructure.html). The predicted structures with the lowest free energies were presented.
Synthesis of PEG hydrogels
PEG hydrogels were synthesized on a glass surface for the convenience of operating cell adhesion experiments. Glass slides were cut to the dimension of approximately 8 mm x 8 mm. The glass was cleaned using acetone and 1 M NaOH solution sequentially. Acrylate groups were generated on the glass surface through silanization as previously described [25]. In brief, the silanization solution was prepared by mixing 0.5 mL TMSPM in 50 mL ethanol with 1.5 mL of 10% diluted glacial acetic acid. After the glass slides were incubated in the silanization solution for 5 min, the slides were thoroughly rinsed with ethanol, dried in air, and stored in a desiccator before use.
PEGDA was diluted in PBS to a final concentration of 20 % w/v. The reaction solution was 5 of the PEGDA and aptamer mixture, 0.15 APS (10 % w/v), and 0.15 TEMED (50 % v/v). Immediately after the preparation of the reactive solution, the solution was deposited on a large glass slide and subsequently covered by the silanized glass slide. The PEG hydrogel tightly attached to the silanized glass slide because the silanized glass surface had acrylate groups that were incorporated into the polymer network. After curing for 2 h, the silanized glass slide was lifted from the larger glass slide. Hydrogel without any modification, hydrogel functionalized with control aptamers, and hydrogel encapsulating aptamers without the acrydite group were prepared in the same way as control hydrogels. Gel electrophoresis
The solutions of aptamers and complementary oligonucleotides (COs) were pre-treated by one cycle of heating (95 °C for 1 min) and cooling (room temperature for 1 h). Aptamers were then mixed with COs at a molar ratio of 1 :1 and incubated at 37 °C for 1 h. The mixture was loaded into a 10 % native polyacrylamide gel for gel electrophoresis in a Bio-Rad Mini -PROTEAN tetra cell (Hercules, CA). After electrophoresis, the polyacrylamide gel was stained with ethidium bromide and then imaged with a Bio-Rad GelDoc XR system (Hercules, CA).
Fluorescence imaging of hydrogels
Complementary oligonucleotides labeled with 6-carboxy-fluorescein (denoted as CO-FAM) were used as a probe to hybridize with the aptamers in the hydrogels to examine the incorporation of the aptamers into the PEG hydrogel. The hydrogel samples were treated by gel electrophoresis and also thoroughly washed to remove any unreacted aptamers. The hydrogels were then treated with CO-FAM solution for 1 h. After thorough washing, the samples were imaged using the CRI Maestro EX SYSTEM (Woburn, MA). The images were analysed with the software provided by the manufacturer.
Rheology The samples used in the rheology analysis were prepared as circular discs of 20 mm in diameter and 0.75 mm in thickness. The procedure of hydrogel preparation was the same as described above. The aptamer concentration in the hydrogel was 2 μΜ. The storage (G') and loss (G") moduli of the hydrogels were measured with an AR-G2 rheometer (TA Instruments, New Castle, DE). A stress- sweep test was performed to confirm that the measurement was in the linear viscoelastic regime. The oscillation stress was varied from 0.01 to 1000 Pa at a fixed frequency of 1 rad/s and the frequency was varied from 0.5 to 100 rad/s at an oscillation stress of 1 Pa oscillation stress. The temperature was set at 37 °C for all experiments.
Swelling examination
Hydrogels of different aptamer concentrations were prepared in a cylindrical mold at room temperature. The hydrogel samples were incubated in PBS (pH 7.4) at 37 °C after dried in vacuum to a constant weight (Wi). At predetermined time points, the samples were taken out of the PBS solution and blotted with tissue paper to remove excess water for the measurement of wet weights (Ws). The swelling was determined by using the following equation: Swelling ratio (%) = [(Ws— Wi)/ Wi x l OO.
Cell culture
CCRF-CEM (CCL-1 19; human T lymphoblast cell line) and Ramos cells
(CRL-1596; human B lymphocyte cell line) were obtained from ATCC (Manassas, VA). Both cell lines were cultured and maintained in RPMI medium 1640 (ATCC, Manassas, VA) supplemented with 10 % fetal bovine serum and 100 units/mL of penicillin-streptomycin (Mediatech, Manassas, VA) at 37 °C in a 5 % C02 atmosphere. All reagents used for cell culture were purchased from Invitrogen (Carlsbad, CA) unless otherwise noted.
Flow cytometry
Flow cytometry was performed using the same procedure as previously described [26]. Briefly, approximately 5 X 105 cells were incubated in the binding solution for 1 h at 4 °C. The binding solution contained 50 nM of FAM labeled aptamers or control aptamers. After washing with 1 mL cold binding buffer, the labeled cells were immediately analysed by flow cytometry (BD FACSCalibur flow cytometer, San Jose, CA). A total of 10, 000 events were counted.
Examination of cell adhesion
The buffer used for cell adhesion was Dulbecco's phosphate buffered saline (DPBS) supplemented with 4.5 g/L of glucose, 5 mM MgCl2 and 0.1 % (w/v) BSA. The hydrogel samples were transferred into a 24-well plate and incubated with a cell suspension (5 X 105 cells/well) at 37 °C. At a predetermined time point, the hydrogel samples were taken out of the wells for washing. The washing was conducted to remove the unbounded or loosely bounded cells by shaking at 90 rpm for 10 min in a New Brunswick shaker (Edison, NJ). Cell images were captured using an inverted microscope (Axiovert 40CFL, Carl Zeiss) and also analysed with the software Image J to examine the number of cells attached to the hydrogel.
Two additional experiments were performed to better understand cell- hydrogel interactions. One experiment was to treat cells with trypsin prior to the cell adhesion test. Approximately 5 X 105 CCRF-CEM cells were incubated in 500 of trypsin solution containing trypsin (0.05 %) and EDTA (0.53 mM) at 37 °C. After 15 min of incubation, the trypsin was neutralized by the cell culture medium containing fetal bovine serum and removed with washing. The cells were subsequently used in the cell adhesion test. Cells treated with the binding buffer were used as a control. Another experiment was carried out based on the pre- treatment of the aptamer-functionalized hydrogels with the COs. Hydrogel samples were incubated in a CO solution at 37 °C for 1 h. After thorough washing to remove unhybridized COs, the cells were seeded onto the PEG hydrogels. The procedures of capturing cell images and examining cell adhesion were the same as described above.
LIVE/DEAD cell staining
Cells were seeded on the PEG hydrogels functionalized with 50 μΜ aptamer for 30 min. At a predetermined time point, the cells were stained with a mixture of calcein AM (1 μΜ) and ethidium homodimer-1 (1 μΜ) using the kit of LIVE/DEAD cell assay purchased from Invitrogen (Carlsbad, CA). Fluorescent cell images were captured using an inverted microscope (Axiovert 40CFL, Carl Zeiss). RESULTS
Prediction of secondary structures
The aptamer used in this study is a truncated version (denoted as sgc8c) of the full-length aptamer that was originally selected from a DNA library [27]. This aptamer was purposely chosen because its binding functionality is well
characterized. To understand the steric effect on aptamer-cell interaction, the sgc8c aptamer was also modified with the addition of a chain of adenosines (A) to its 5 ' end. The predicted secondary structures are shown in FIG. 1-2. The sgc8c aptamer has a long stem, a 12-nucleotide loop, and a small bulge located between the stem and the loop. The 5 -A and 10-A tail attached to the sgc8c aptamer were predicted not to participate in any intramolecular hybridization, suggesting that the two sgc8c aptamer derivatives exhibit the same binding functionality as the sgc8c aptamer. Synthesis of aptamer-functionalized PEG hydrogels
The 5 ' ends of the aptamers were initially functionalized with an acrydite group for their chemical incorporation to the PEG hydrogels. The double bond of the acrydite group is activated during free radical polymerization and the activated double bonds of the aptamers and PEGDAs are linked together to form the PEG hydrogel (FIG. 1-3A). An intermolecular hybridization assay was used to characterize the hydrogel synthesis and to demonstrate the success of incorporating the acrydited aptamers into the PEG hydrogels (FIG. 1-3B). In this assay, the hydrogel was treated with CO-FAM for one hour followed by thorough washing. As shown in FIG. 1-3C, the COs and the sgc8c-10A aptamers could efficiently hybridize in an aqueous solution. The fluorescence images showed that the aptamer- functionalized PEG hydrogel had stronger fluorescence than the control hydrogels (FIG. 1-3D). In addition, the fluorescence intensity of the PEG hydrogels increased with the increase of the aptamer concentration (FIG. 1-3E). These results clearly demonstrated that the acrydited aptamers were successfully incorporated into the PEG hydrogel network during the free radical polymerization.
Characterization of mechanical properties
The PEG hydrogels were characterized by the examination of their shear moduli and swelling ratio. Both storage (G') and loss (G") moduli of the aptamer- functionalized hydrogel were virtually the same as those of the native hydrogel (i.e., the hydrogel without the aptamer functionalization) (FIG. 1-4A). When the sweeping frequency was varied in the range between 0.5 and 50 rad/s, the G' values of the hydrogel functionalized with aptamers and the control hydrogel without any aptamers were both approximately 10,000 Pa. The swelling test showed that the hydrogels with and without the aptamers both absorbed water very quickly. The swelling ratio reached approximately 350% within the first hour but barely changed after three hours (FIG. 1-4B). However, a difference in swelling was observed between the aptamer functionalized PEG hydrogel and the native hydrogel though this difference was small (FIG. 1-4B). This result indicates that the incorporation of aptamers into the hydrogel network could, to some extent, change the mechanical properties of hydrogel, which was not revealed in the rheology analysis. To confirm this finding, the effect of aptamer concentration on hydrogel swelling was studied. The results showed that the swelling ratio increased when the concentration of the aptamer was increased (FIG. 1-4C). The swelling ratio increased by approximately 10 % when the aptamer concentration was increased by two orders of magnitude (i.e., from 2 μΜ to 200 μΜ) (FIG. 1-4C). Therefore, these results indicate that the chemical incorporation of aptamers with the concentrations used herein can only induce a moderate effect on the mechanical properties of the PEG hydrogels.
Examination of cell type-specific adhesion
In this study, two cell lines were used as a model system, including CCRF- CEM and Ramos cells. The sgc8c aptamer was selected from a DNA library to bind CCRF-CEM cells with Ramos cells as a negative control [27]. Its binding affinity and specificity were previously investigated [26, 27] and is further confirmed in this study by a flow cytometry assay. As shown in FIG. 1-5A, the sgc8c labeled CCRF- CEM cells exhibit stronger fluorescence intensity than the cells without any treatment or the control aptamer labeled cells. In addition, FIG. 1-5A also shows that the sgc8c treated Ramos cells (i.e., the control cells) exhibit weak fluorescence intensity the same as that of the unlabeled cells. These results demonstrated that the sgc8c aptamer could specifically bind to the CCRF-CEM cells. After the binding capability of the sgc8c aptamer was determined, a cell adhesion test was performed to evaluate cell adhesion on the aptamer functionalized PEG hydrogels. The results showed that a large number of CCRF-CEM cells could bind to the PEG hydrogel functionalized with the sgc8c aptamer (FIG. 1-5B). In contrast, very few CCRF- CEM cells were observed on the native PEG hydrogel and the hydrogel
functionalized with the control aptamer. Quantitatively, the cell density on the sgc8c aptamer functionalized hydrogel was -850 cells/mm whereas the average density was lower than 5 cells/mm on the control hydrogels (FIG. 1-5C). In addition, consistent with the flow cytometry analysis, few Ramos cells adhered to the sgc8c aptamer functionalized PEG hydrogel. To further characterize the cell adhesion to the aptamer- functionalized PEG hydrogel, a LIVE/DEAD cell staining assay was also used. Little cell death was observed on the aptamer-functionalized hydrogel during the cell adhesion experiment (FIG. 1-5D), indicating that the aptamer- functionalized PEG hydrogel was biocompatible. Therefore, these results showed that the PEG hydrogel without aptamers was resistant to cell adhesion whereas the incorporation of functional aptamers into the PEG hydrogel could successfully induce cell type-specific adhesion. In addition, the cells on the aptamer- functionalized PEG hydrogel could maintain viability after adhesion.
Effects of different parameters on cell adhesion
The effects of three parameters on cell adhesion were studied: the spacer length {i.e., the adenosine tail of the aptamer), the concentration of the aptamer, and the time of cell seeding. Three aptamers with 0, 5, and 10 As at their 5' ends were used to prepare PEG hydrogels. The sgc8c-0A aptamer could induce cell adhesion. The cell adhesion induced by the sgc8c-5A aptamer and the sgc8c-10A aptamer was very similar. The data also showed that the cell density increased with the number of extra adenosines. In comparison to the sgc8c-0A aptamer, the sgc8c-10A aptamer could increase the average cell density on the hydrogel surface by ~ 50% (FIG. 1- 6A). The density of the cells adhered to the hydrogel also increased with the concentration of the aptamer (FIG. 1-6B). The density increased from ~ 50 to ~ 850 cells/mm with the increase of aptamer concentration from 2 to 50 μΜ (FIG. 1-6B). The increase of aptamer concentration over 50 μΜ did not lead to more cell adhesion. Similarly, the increase of seeding time resulted in the adhesion of more cells within 30 min, after which there was no significant increase in the number of adhered cells (FIG. 1-6C).
Attenuation of cell adhesion
To better demonstrate cell adhesion to the aptamer-functionalized hydrogel, additional two experiments were performed to attenuate cell adhesion. The first one was based on cell trypsinization. After a 15 min incubation of the cells in a trypsin solution, the cells were washed and treated with the FAM-labeled aptamers. The flow cytometry result showed that the trypsinized cells were still labeled by the FAM-labeled aptamers (FIG. 1-7A). However, the fluorescence intensity of the trypsinized cells was weaker than that of the intact cells. The mean fluorescence intensity was decreased by 55%. However, unlike the flow cytometry examination, the result of cell adhesion showed no significant decrease of cell adhesion (FIG. 1- 7B). The second experiment was based on the treatment of the hydrogels rather than the cells. The PEG hydrogels were treated with COs that could effectively hybridize with the aptamers (FIG. 1-7D). The CO treatment led to the decrease of cell adhesion on the hydrogels (FIG. 1-7E). In addition, the number of cells decreased with the increased molar ratio of CO to aptamer. When the molar ratio of CO to aptamer reached 1 : 1, the cell density sharply decreased from ~ 800 to ~30 cells/mm (FIG. 1-7E).
CONCLUSIONS
An aptamer-functionalized PEG hydrogel was studied for determining the feasibility of using nucleic acid aptamers to mimic the adhesive binding sites of extracellular matrix. Nucleic acid aptamers can be successfully incorporated into the PEG hydrogel through free radical polymerization. In addition, aptamers can effectively induce cell type-specific adhesion to the PEG hydrogel. The level of cell adhesion can be altered by numerous parameters such as the aptamer concentration, the spacer length and the seeding time. Importantly, COs can block the binding functionality of aptamers in hydrogels and thereby attenuate cell adhesion in physiological conditions. In combination with our previous results showing that aptamers can control protein release from hydrogels with desired kinetics, the data presented in this study show that aptamer-functionalized hydrogels are promising biomaterials that can mimic the functions of extracellular matrices (e.g., providing cells with biochemical and biophysical cues).
EXAMPLE 2: PROGRAMMABLE HYDROGELS FOR CONTROLLED CELL CATCH AND RELESE The materials and methods for this example are substantially as described in
Example 1 , except as noted below and include the following additional
methodology.
Surface plasmon resonance
Intermolecular hybridization was also analyzed using surface plasmon resonance (SPR) spectroscopy (SR7000DC, Reichert Technologies, Depew, NY). The biotinylated primary CS was immobilized on a streptavidin-coated chip by flowing its solution (Ι μΜ) on the chip surface at 5 μΤ/ηιίη for 15 min. To examine the association of the aptamer and the primary CS, the aptamer solution (500 nM) was flowed over the chip at 30 μΤ/ηιίη for 15 min. To trigger the sequence dissociation of the hybridized aptamer, the solution of the secondary CS (1 μΜ) was flowed over the chip at 30 μΤ/ηιίη for another 15 min. The chip was regenerated via the treatment of 50 mM NaOH. All the measurements were run in duplicate.
Preparation of silanized glass surface
Glass slides were cut into small pieces with a dimension of approximately 4 mm x4 mm. The glass slides were treated with 1 M NaOH for 10 min followed by thorough washing with deionized water. After dried in vacuum oven, the slides were incubated in a silanization solution for 5 min. The silanization solution was prepared by diluting 0.5 mL of 3-(trimethoxysilyl) propyl methacrylate in 50 mL of ethanol supplemented by 1.5 mL of dilute acetic acid (10% v/v). The silanized glass slides were washed with pure ethanol to terminate the reaction and clean the surface. After dried in the air, the slides were stored in a vacuum desiccator.
Synthesis of hydrogel coating on glass surface
A thin layer of polyacrylamide hydrogel was synthesized on the silanized glass surface. The reaction solution was prepared by mixing 1 μΤ of 10%
acrylamide solution containing the sequence A (100 μΜ), 0.15 μΐ, of APS (10 % w/v), and 0.15 μΐ^ of TEMED (5 % v/v). Immediately after the preparation of the reaction solution, the solution was transferred to a large piece of clean glass and covered by the silanized glass slide. One hour after the polymerization, the silanized glass slide was carefully lifted and thoroughly rinsed with the PBS solution.
Fluorescence imaging of hydrogel
The hydrogel coating was incubated in a solution of 10 μΜ fluorophore- labeled aptamer at 37 °C for 1 h. After washing with DPBS, the hydrogel coating was imaged under an inverted fluorescence microscope (Axiovert 40CFL, Carl Zeiss). The hydrogel with the hybridized aptamers was further incubated in a solution of 5 μΜ secondary CS at 37 °C for 0.5 h and imaged with the inverted fluorescence microscope .
Flow cytometry
A total of 5 l05 cells were incubated in the binding solution for 0.5 h at 4 °C. The binding solution contained 25 nM FAM-labeled aptamer or control sequence. The labeled cells were washed with 1 mL of cold binding buffer and subsequently analyzed using a BD FACSCalibur™ flow cytometer (San Jose, CA). Cell catch and release
The buffer used for cell catch and release was DPBS containing 4.5 g/L glucose, 10 mM MgCl2, and 0.1 % (w/v) BSA. The glass slides with the hydrogel coating were incubated in the aptamer solution (10 μΜ) at 37 °C for 1 h. After washing, they were transferred to a 24-well plate and incubated in 800 of cell suspension (5x 105 cells/well) at 37 °C for 0.5 h. The unbound cells were gently removed from the coatings by shaking at 90 rpm for 2 min. For the examination of cell release, the glass slides were incubated in the solution containing 5 μΜ of secondary CS at 37 °C for 20 min. The glass slides were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss) or a CRI Maestro EX SYSTEM. Image J was used to quantify the number of cells on the images.
Cell labeling
To characterize cell catch and release on the hydrogel using the Maestro EX System, live cells were labeled with a Vybrant cell-labeling kit before the catch and release experiment. Cells were suspended in a RPMI 1640 medium at a density of 3 x 106 cells/mL. 5 μΐ^ of Vybrant cell-labeling solution was added into 1 mL of cell suspension. After 10 min incubation at 37 °C, cells were washed with RPMI 1640 medium once and incubated in the RPMI 1640 medium for 10 min before the cell catch and release experiment.
Live/Dead cell staining
To determine whether the procedure of cell catch and release is
biocompatible, the cells were stained after cell release using the Live/Dead staining kit according to the protocol provided by Invitrogen. Briefly, after the treatment with the secondary CS, the hydrogel was incubated in 250 μΐ, of washing buffer in a 96- well plate and shaken at 90 rpm for 1 min to allow the released cells to fall off the hydrogel surface. The washing buffer was DPBS containing 4.5 g/L glucose and 10 mM MgCl2. After the removal of the hydrogel from the plate, calcein AM and ethidium homodimer-1 were added into the washing buffer with a final
concentration of 1 μΜ. After 15 min incubation, the cells were imaged under an inverted microscope (Axiovert 40CFL, Carl Zeiss). Table SI. List of oligonucleotide sequences.
Figure imgf000032_0001
5'-TTTTCCGGAATTCCGCTTTTTACTA-/J ''6'5/-3'
C25S 5*-TTAATTTAGTCGTCTCCTCAGTCTT -3*
C30 5*-TTTTCCGGAATTCCGCTTTTTACTATCTAA-3*
The underlined letters indicate the scrambled part of the sequence.
Three single-stranded oligonucleotides were used in this programmable hydrogel-based system, including a primary CS, a nucleic acid aptamer, and a secondary CS. The primary CS was initially conjugated to the supporting hydrogel through free radical polymerization. It was able to hybridize with the tail of the nucleic acid aptamer and therefore plays the role of a mediator between the hydrogel and the aptamer. The nucleic acid aptamer is a single-stranded oligonucleotide selected from a synthetic nucleic acid library.10 Because nucleic acid aptamers have high binding affinities and specificities that are comparable to antibodies,11 they have been studied in a variety of applications at the levels of small molecules, large
12
biomolecules, and whole cells. In this concept, the aptamer is hybridized with the primary CS tethered to the hydrogel and induces cell type- specific binding via polyvalent aptamer-receptor interactions. When the secondary CS was applied to trigger the hydrogel, the aptamer dissociates from the primary CS and hybridizes with the secondary CS. As a result, the polyvalent interaction between the cells and the hydrogel was weakened in physiological conditions without the need of using factors that potentially damage the cells or the hydrogel. Thus, the state of strong cell binding can be nondestructively converted to a state of cell release simply by using a secondary CS. Notably, because the supporting hydrogel is regenerated during cell release, it can be repeatedly used for additional rounds of cell catch and release.
We used gel electrophoresis to examine the competitive hybridization between the three single-stranded oligonucleotides (FIG. 2-2a). The A and B sequences hybridized together through 20 base pairs whose melting temperature is approximately 65 °C. Thus, the AB complex is stable at room and body temperature. Although sequence C20 could also hybridize with sequence B, C20 did not effectively induce the dissociation of the AB complex. In contrast, sequence C25 effectively hybridized with sequence B and induced the dissociation of the AB complex. The difference between C2o and C25 lies in the hybridizing length. The sequences B and C2o form 20 base pairs, which is the same number of base pairs in the AB complex, whereas sequence C25 forms 25 base pairs with the B sequence. Increasing the
13
number of base pairs usually leads to more stable hybridization. Thus, C25 is more competitive in hybridization with B than C2o- The surface plasmon resonance (SPR) sensorgrams confirm the results of gel electrophoresis. The SPR data show that A and B formed a stable AB complex, which did not dissociate in the presence of C2o (FIG. 2-2b). In contrast, C25 induced the dissociation of the AB complex (FIG. 2- 2b).
After analyzing competitive hybridization between multiple
oligonucleotides, we chemically incorporated sequence A to a polyacrylamide hydrogel formed as a coating on a glass surface. Free radical polymerization was used for the incorporation of A as our previous study shows that free radical polymerization is a simple and effective method to chemically incorporate oligonucleotides bearing Acrydite into a hydrogel network.126 We chose hydrogel as the cell binding material in this study because hydrogels usually do not have affinity sites that induce specific cell binding. In addition, hydrogels have been extensively studied for a variety of biological and biomedical applications because of their biocompatibility and structural similarities to extracellular matrices.14 After the synthesis of the hydrogel coating, the hydrogel was incubated in a solution of the FAM-labeled B. After washing, the hydrogel was examined under a fluorescence microscope. The hydrogel exhibited strong green fluorescence (not shown), showing that sequence B successfully hybridized with sequence A in the hydrogel. When the hydrogel was further treated with sequence C25, the strong fluorescence dramatically diminished (FIG. 2-2c). In contrast, the fluorescence intensity did not change when the hydrogels were treated with either C2o or C25s (FIG. 2-2c). These results are consistent with the gel electrophoretogram (FIG. 2-2a) and SPR (FIG. 2-2b), showing that C25 successfully induced the dissociation of B from A in the hydrogel.
To test specific cell binding to the hydrogel, we incubated the hydrogel with the immobilized AB complex in a CCRF-CEM cell suspension. Sequence B consists of three regions: a 20-nucleotide region to hybridize with sequence A, a 40- nucleotide region to recognize CCRF-CEM cells, and a 5-nucleotide region used as a linker. The 40-nucleotide region is the binding aptamer that was selected from a DNA library to bind to CCRF-CEM cells.15 The flow cytometry histogram confirms that this aptamer binds to CCRF-CEM cells rather than the control cells (not shown). In the cell binding assay, we observed 4±2 cells/cm on the native hydrogel coating (not shown). This result shows that the polyacrylamide hydrogel is resistant to nonspecific cell binding. Similarly, very few CCRF-CEM cells were observed on the sequence A- functionalized hydrogel, the native hydrogel treated with B, and the A- functionalized hydrogel treated with the partially scrambled sequence B (i.e., BPs). The cell density on these three hydrogels was 7±3, 4±1, and 8±3 cells/cm , respectively (not shown). In addition, the density of control cells on the hydrogel functionalized with the hybridized B was 6±4 cells/cm (not shown). In contrast, a total of 2,519±284 CCRF-CEM cells/cm2 were observed on the hydrogel
functionalized with the hybridized AB complex (not shown). These data clearly show that polyacrylamide hydrogels resist nonspecific cell binding and hybridized nucleic acid aptamers can successfully induce cell type-specific binding to the hydrogel surface.
After demonstrating the ability of the hybridized aptamers to bind CCRF- CEM cells to the hydrogel surface, we studied whether the state of cell binding can be transformed into a state of cell release using the secondary CS. After the treatment with C25, the density of cells decreased to 19±15 cells/cm (FIG. 3). The release efficiency was approximately 99%. In contrast, the C25s could not induce significant cell release. These results show that cell binding was successfully converted into cell release via sequence-specific nucleic acid hybridization. We also varied the length of the secondary CS to further understand the ability of the secondary CS to induce cell release. The sequences C15 and C20 did not effectively induce cell release whereas the sequences C25 and C30 both released cells
successfully (not shown). This observation is consistent with the electrophoretogram and SPR analysis, showing that the secondary CS needs to form more base pairs with the aptamer than the primary CS. We also examined the effect of incubation time on cell release. The time duration was varied from 10 to 60 minutes. The cell release kinetics shows that more than 95% of the cells were released within 10 min (not shown). After the successful demonstration of cell release, we used a
Live/Dead cell assay to evaluate the viability of the released cells. The Live/Dead staining did not show significant difference between the harvested cells and the released cells (FIG. 2-3b). The percentage of viable cells in both groups was approximately 99%. Taken together, the results clearly demonstrate that it is effective to use a rationally designed secondary CS to trigger hybridized aptamers to release cells from a programmable hydrogel surface in a nondestructive manner.
Finally, we examined whether this nucleic acid-functionalized hydrogel is able to repeat the procedure of cell catch and release. FAM-labeled B and C25 were used to treat the hydrogel. The fluorescence micrographs show that the hydrogel was able to repeatedly catch and release B under the control of C25 (not shown), indicating that cell catch and release could be repeated. Indeed, the micrographs show that the cells attached to the hydrogel, and that the attached cells were released from the hydrogel after treatment with C25 in an additional round of cell catch and release (FIG. 2-4). Taken together, these results clearly demonstrate that the entire procedure of intermolecular hybridization and the transformation of the aptamer are nondestructive to not only the cells, but also the hydrogel. Thus, the functionality of the programmable hydrogel is regenerable.
The nondestructive cell catch and release controlled by nucleic acid hybridization in physiological conditions makes this platform fundamentally unique and suitable for numerous biological and biomedical applications that needs the temporal control of cell-material interactions. For instance, studies have shown that affinity ligands with high density in a synthetic material are important to maintain cell attachment attachment and viability in the early stages, but may inhibit cell growth and differentiation in the late stages.16 Thus, the temporal control of cell- material interactions has been suggested to regulate cell behavior and extracellular matrix deposition for regenerative medicine.16d Another important example is cell separation. It is critical to reverse specific and strong cell-material interactions for cell recovery during the purification of a specific cell population from a
heterogeneous cell mixture.3d f Otherwise, strong ligand-receptor interactions can turn on intracellular signaling cascades that change cell properties or even induce cell death, which will directly affect the downstream analysis of separated cells. Conventional methods for releasing cells from a bound material often need enzyme treatment, high shear stress, or material hydrolysis. These conditions may cause changes in cell or material properties. The platform presented in this study does not involve any of these factors.
In summary, we have successfully developed a hydrogel-based platform for cell type-specific catch and release by using nucleic acid oligonucleotides.
Importantly, the entire procedure of intermolecular hybridization and the
transformation of hybridized aptamers do not involve any factor that is potentially destructive to either the cells or the hydrogel. Therefore, this programmable hydrogel-based platform holds great potential for numerous biological and biomedical applications such as regenerative medicine and cell separation.
REFERENCES
(1) Mammen, M.; Choi, S.K.; Whitesides, G. M. Angew. Chem. Int. Ed. 2010, 37, 2755-2794.
(2) Vance, D.; Martin, J.; Patke, S.; Kane, R. S. Adv. Drug Deliv. Rev. 2009, 61, 931-939.
(3) (a) Kloxin, A.M.; Kasko, A.M.; Salinas, C.N.; Anseth, K.S. Science 2009, 324, 59-63. (b) Griffin, D.R.; Kasko, A.M. J. Am. Chem. Soc. 2010, DOI: 10.1021/ja305280w. (c) Liu, B.; Liu, Y; Riesberg, J.J.; Shen, W. J. Am. Chem.
Soc. 2010, 132, 13630-13632. (d) Pappas, D.; Wang, K. Anal. Chim. Acta. 2007, 601, 26-35. (e) Nagrath, S.; Sequist, L.V.; Maheswaran, S.; Bell, D.W.; Irimia, D.; Ulkus, L.; Smith, M.R.; Kwak, E. L.; Digumarthy, S.; Muzikansky, A.; Ryan, P.; Balis, U.J.; Tompkins, R.G.; Haber, D.A.; Toner, M. Nature 2007, 450, 1235-1239. (f) Mahara, A.; Yamaoka, T. Biomaterials 2010, 31, 4231-4237. (g)
Plouffe, B.D.; Brown, M.A.; Iyer, R.K.; Radisic, M.; Murthy, S.K. Lab Chip 2009, 9, 1507-1510.
(4) (a) McCoy, CP. ; Brady, C. ; Cowley, J.F. ; McGlinchey, S.M. ; McGoldrick, N. ; Kinnear, D.J. ; Andrews, G.P. ; Jones, D.S. Expert Opin. Drug Deliv. 2010, 7, 605-616. (b) Kost, J. Langer, R. Adv. Drug Deliv. Rev. 2001, 46, 125-148.
(5) Auernheimer, J.; Dahmen, C; Hersel, U.; Bausch, A.; Kessler, H. J. Am. Chem.
Soc. 2005, 127, 16107-16110.
(6) Persson, K. M.; Karlsson R.; Svennersten, K.; Loffler, S.; Jager, E. W.; Richter- Dahlfors, A.; Konradsson, P.; Berggren, M. Adv. Mater. 2011, 23, 4403-4408. (7) Dainiak, M.B.; Kumar, A.; Galaev, I.Y; Mattiasson, B. Proc. Natl. Acad. Sci. U.
S. A. 2006, 103, 849-854.
(8) R. M. P. Da Silva, J.F. Mano, R.L. Reis, Trends Biotechnol. 2007, 25, 577-583.
(9) Brown, M.A.; Wallace, C.S.; Anamelechi, C.C.; Clermont, E.; Reichert, W.M.;
Truskey, G.A. Biomaterials 2007, 28, 3928-3935. (10) (a) Ellington, A.D.; Szostak, J.W. Nature 1990, 346, 818-822. (b) Tuerk, C; Gold, L. Science 1990, 249, 505-510.
(11) Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107, 3715-3743.
(12) (a) Liu, J.W.; Lu, Y. Angew. Chem. Int. Ed. 2006, 45, 90-94. (b) Farokhzad, O.C.; Jon, S.; Khademhosseini, A.; Tran, T.N.; Lavan, D.A.; Langer, R. Cancer
Res. 2004, 64, 7668-7672. (c) Martin, J.A.; Phillips, J.A.; Parekh, P.; Sefah, K.; Tan, W.H. Mol. Biosyst. 2011, 7, 1720-1727. (d) Chen, L.; Liu, X.; Su, B.; Li, J.; Jiang, L.; Han, D.; Wang, S. Adv. Mater. 2011, 23, 4376-4380. (e) Chen, N.C.; Zhang, Z.Y; Soontornworajit, B.; Zhou, J.; Wang, Y. Biomaterials. 2012, 33, 1353-1362. (f) Wan Y; Kim, Y. T.; Li, N.; Cho, S.K.; Bachoo, R.; Ellington,
A.D.; Iqbal, S.M. Cancer Res. 2010, 70, 9371-9380.
(13) Delport, E; Pollet, J.; Janssen, K.; Verbruggen, B.; Knez, K.; Spasic, D.;
Lammertyn, J. Nanotechnology 2012, 23, 065503.
(14) Hoffman, A.S. Adv. Drug Deliv. Rev. 2002, 43, 3-12.
(15)Shangguan, D.; Li, Y; Tang, Z.; Cao, Z.C.; Chen, H.W.; Mallikaratchy, P.;
Sefah, K.; Yang, C.J.; Tan, W. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 11838- 11843.
(16) (a) Liu, J.C; Tirrell, D.A. Biomacromolecules 2008, 9, 2984-2988. (b) Palecek, S.P.; Loftus, J.C; Ginsberg, M.H.; Lauffenburger, D.A.; Etorwitz, A.F. Nature 1997, 385, 537-540. (c) Connelly, J.T.; Garcia, A.J.; Levenston, M.E.
Biomaterials 2007, 28, 1071-1083. (d) Salinas, C.N.; Anseth, K.S. Biomaterials 2008, 29, 2370-2377.
(17) (a) Cragg, M.S.; French, R.R.; Glennie, M.J. Curr. Opin. Immunol. 1999, 11, 541-547. (b) Genestier, L.; Meffre, G.; Garrone, P.; Pin, J. J.; Liu, Y. J.; Banchereau, J.; Revillard, J. P. Blood 1997, 90, 726-735. (c) Henke, C;
Bitterman, P.; Roongta, U.; Ingbar, D.; Polunovsky, V. Am. J. Pathol. 1996, 149, 1639-1650. (d) Ishigami, T.; Kim, K.M.; Horiguchi, Y; Higaki, Y; Hata, D.; Eteike, T.; Katamura, K.; Mayumi, M.; Mikawa, Et. J. Immunol. 1992, 148, 360- 368. (e) Mayumi, M.; Sumimoto, S.; Kanazashi, S.; Etata, D.; Yamaoka, K.; Higaki, Y; Ishigami, T.; Kim, K.M.; Heike, T.; Katamura, K. J. Allergy Clin.
Immunol. 1996, 98, S238-247. (f) Park, K.J.; Lee, S.H.; Kim, T.I.; Lee, H.W.; Lee, C.H.; Kim, E.H.; Jang, J.Y; Choi, K.S.; Kwon, M.H.; Kim, Y.S.; Cancer Res. 2007, 67, 7327-7334. (g) Smith, J.A.; Bluestone, J.A. Curr. Opin. Immunol. 1997, 9, 648-654.
(18)Bell, N.M.; Micklefield, Chembiochem. 2009, 10, 2691-2703.
(19)Burmeister, P.E.; Lewis, S.D.; Silva, R.F.; Preiss, J.R.; Horwitz, L.R.;
Pendergrast, PS.; McCauley, T.G.; Kurz J.C; Epstein, D.M.; Wilson, C; et al. Chem. Biol. 2005, 12, 25-33.
EXAMPLE 3: PROGRAMMABLE DISPLAY OF PROTEIN-DNA
CHIMERAS FOR CONTROLLING CELL CATCH AND RELEASE ON HYDROGEL SURFACE
The materials and methods for this example are substantially as described in the preceding examples, except as noted below and include the following additional methodology. Materials
Phosphate buffered saline (PBS), a solution of acrylamide and bis- acrylamide (40% w/v; 29: 1), ammonium persulfate (APS), Ν,Ν,Ν',Ν'- tetramethylenediamine (TEMED), sodium hydroxide and microscope glass slide were purchased from Fisher Scientific (Suwanee, GA). Streptavidin was purchased from Promega Inc. (Madison, WI). FITC-conjugated streptavidin and 3- (Trimethoxysilyl) propyl methacrylate were purchased from Sigma- Aldrich (Louis, MO). Dulbecco's phosphate buffered saline (DPBS), bovine serum albumin (BSA), Live/Dead staining kits, and biotinylated goat anti-human IgM antibody were purchased from Invitrogen (Carlsbad, CA). Biotinylated isotype control antibody was purchased from SouthernBiotech (Birmingham, AL). All oligonucleotides (Table SI) were synthesized by Integrated DNA Technologies (Coralville, IA). Streptavidin-coated glass was purchased from XENPORE (Hawthorne, NJ).
Synthesis of hydrogel coating on glass surface
A thin layer of polyacrylamide hydrogel was synthesized on the silanized glass surface. The reaction solution was prepared by mixing 1 μΕ of 10% acrylamide solution containing the sequence A (50 μΜ), 0.15 of APS (10 %> w/v), and 0.15 μΐ, of TEMED (5 %> v/v). The reaction solution was transferred to a large piece of clean glass and covered by the silanized glass squares. One hour after the polymerization, the glass squares was carefully lifted and thoroughly rinsed with the PBS solution.
Fluorescence imaging of hydrogel
The hydrogel coating was incubated in the solution of 10 μΜ TAMRA- labeled sequence B at 37 °C for 1 h. After thoroughly washed with DPBS, the hydrogel coating was imaged under an inverted fluorescence microscope (Axiovert 40CFL, Carl Zeiss). To illustrate hybridization-mediated dissociation of the A-B complexes, the hydrogel was further incubated in the solution of 5 μΜ C2o, C25, or C25s at 37 °C for 0.5 h and imaged with the inverted fluorescence microscope. Flow cytometry
A total of 5 l05 cells were incubated in 10 nM biotinylated IgM antibody or isotype control antibody solution at 4 °C for 0.5 h. After washing, the cells were further incubated in a FITC-conjugated streptavidin (2.5 ng^L) solution at 4 °C for 0.5 h. The cells were washed again and subsequently analyzed using a BD
FACSCaliburTM flow cytometer (San Jose, CA). The buffer used for washing cells was cold DPBS containing 4.5 g/L glucose and 10 mM MgCl2.
Cell catch and release
The buffer used for cell catch and release was DPBS containing 4.5g/L glucose, 10 mM MgCl2, and 0.1% (w/v) BSA. The glass squares with hydrogel coatings were sequentially incubated in the sequence B solution (5 μΜ) for 1 h, the streptavidin solution (10 μΜ) for 0.5 h, and the biotinylated antibody solution (1 μΜ) for 0.5 h. Each incubation was followed by thorough washing. After the immobilization of the DNA-antibody chimeras, the glass squares were transferred to a 24-well plate and incubated in 800 μΙ_, of cell suspension (5x 105 cells/well) at 37 °C for 0.5 h. The unbound cells were gently removed from the coatings by shaking at 90 rpm for 2 min. To examine cell release, the glass squares were incubated in the solution containing 5 μΜ of C25 or control sequences at 37 °C for 30 min. The glass squares were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss). The images were analysed to count cell numbers using Image J.
Live/Dead cell staining
The released cells were stained with a mixture of calcein AM (1 μΜ) and ethidium homodimer-1 (1 μΜ) using the Live/Dead staining kit according to the protocol provided by Invitrogen. Normal cells harvested directly from the cell culture flask were also stained using the same protocol for comparison. The staining buffer was DPBS containing 4.5 g/L glucose and 10 mM MgCl2. The stained cells were imaged under the inverted fluorescence microscope.
Table.3-Sl. List of oligonucleotide sequences.
Name Sequence
A 5'-/ cryi te/-ATATTGTTTGTTACACGGGATCCCGATTTT-3'
B 5'- Ibiotinl-
TAACATAGGTGGATAATTTGAAACGAAAATCGGGATCCCGTGTAA-3'
5'-/TAMRA/-
TAACATAGGTGGATAATTTGAAACGAAAATCGGGATCCCGTGTAA-3'
5'-TTACACGGGATCCCGATTTT-3'
c25 5'-TTACACGGGATCCCGATTTTCGTTT-3'
C25S 5'-ACACCTTGTCTTATTGTTCGCGGTA-3' The purpose of this study was to develop a platform for specific and nondestructive cell catch and release by using antibody-DNA chimeras and complementary sequences (FIG.3-1). Specifically, antibody-DNA chimeras were immobilized into a DNA-functionalized hydrogel for inducing cell attachment. In the presence of triggering oligonucleotides, the chimeras were stimulated to dissociate from the hydrogel. As a result, the cells were released from the hydrogel due to lack of the immobilized chimeras. This platform is envisioned to have great potential for various biological and biomedical applications such as tissue engineering and cell separation that often need reversible cell-material
interactions.4"9
In this study, an immobilizing sequence A was initially functionalized with acrydite at its 5' end. Thus, sequence A, acrylamide, and bis-acrylamide formed the DNA-functionalized hydrogel via free radical polymerization. Because the glass surface was silanized to carry methacrylate groups, the hydrogel coating was chemically conjugated to the glass surface during the polymerization. Thus, the hydrogel coating was stably immobilized and did not fall off from the glass during any washing step. To demonstrate the success of incorporating sequence A into the hydrogel, the hydrogel coating was first treated by the fluorophore-labeled complementary sequence B and then washed thoroughly. The B-treated hydrogel exhibited much stronger fluorescence than the original A- functionalized hydrogel (FIG. 3-2). This difference shows that sequence A was successfully incorporated into the polyacrylamide hydrogel coating, and that A and B could stably hybridize in the hydrogel coating.
After the demonstration of AB hybridization, we studied whether the immobilized AB complex is responsive to the stimulation of the triggering complementary oligonucleotide. A number of stimuli-responsive materials have been successfully developed.10 They can change properties when triggered by a stimulus such as light, electricity, compression, temperature, ions, and enzymes.11"16 For instance, during the stimulation by electricity, affinity ligands that are originally conjugated to the responsive materials can be cleaved.16 Different from these creative systems, this study was aimed at exploring DNA- functionalized hydrogels as a responsive material for the dynamic display of antibody-DNA chimeras in physiological conditions that do not involve any potentially destructive factor.
Antibody-DNA chimeras were prepared by using streptavidin to link a biotinylated antibody and a biotinylated single-stranded nucleic acid sequence (i.e., sequence B). The chimeras were immobilized to the hydrogel coating through the hybridization of A and B. Because the double-stranded AB complex forms through physical nucleic acid hybridization, it is reasonable to hypothesize that a third single-stranded sequence could be applied to compete against A and trigger the dissociation of the AB complex (FIG. 3-1B). Resultantly, the antibody-DNA chimera would be released from sequence A and the hydrogel. Thus, the principle of nucleic acid hybridization would be applied to develop a DNA functionalized affinity hydrogel responsive to short nucleic acid oligonucleotides for programming cell release.
To test the hypothesis, three complementary oligonucleotides (C25, C25s, and C2o) with different compositions and length were used to trigger the hydrogel coating with the hybridized AB complex. The result shows that the fluorescence of the hydrogel functionalized with the AB complex dramatically diminished after the C25 treatment (FIG. 3-2). In contrast, the fluorescence intensity of the hydrogel treated with the scrambled sequence (i.e., C25s) barely changed (FIG. 3-2).
Therefore, the results show that the hydrogel functionalized with the hybridized AB complex was specifically responsive to the complementary oligonucleotide C25.
To further demonstrate the intermolecular hybridization mediated AB dissociation, another sequence C20 was applied to treat the hydrogel coating. As shown in (FIG. 3-2), there is no difference between the treatments of C20 and C25s. The sequences A and B form 20 base pairs that are the same as those formed between the sequences C20 and B. In contrast, the sequences C25 and B form 25 base pairs that are more than the numbers of AB base pairs and BC20 base pairs. Thus, these results indicate that the third complementary sequence C needs to form more base pairs with sequence B than sequence A to competitively program the dissociation of sequence B. After demonstrating the responsiveness of the DNA-functionalized hydrogel to the third nucleic acid oligonucleotide, we examined whether this hydrogel coating can be applied to cell type-specific catch and release. Because cells can
nonspecifically bind to a surface, 17-"20 we first studied the functionality of the hydrogel coating in resisting nonspecific cell binding.
Glass squares with or without hydrogel coatings were incubated in cell suspension for half an hour. The cells were allowed to precipitate to the surfaces driven by the gravity. The microscopy images show that a significant number of cells attached to the naked glass surface and streptavidin (SA)-coated glass surface (FIG. 3-3). For instance, the cell density of Ramos and CCRF-CEM on the naked glass surface was 600 + 152 and 1793 + 217 cell/cm2, respectively. A similar trend was observed on the surface of SA-coated glass. The cell images also indicate that CCRF-CEM cells have more inclination to attach to the glass surface than Ramos cells presumably because of their different surface properties. In contrast, very few Ramos or CCRF-CEM cells were observed on the hydrogel coating (FIG. 3-3). Their density was 7 + 5 and 14 + 10 cell/cm2, respectively. These results clearly show that the polyacrylamide hydrogel is highly resistant to nonspecific cell binding.
After demonstrating the resistance of the polyacrylamide hydrogel to cell binding, we investigated the capability of antibody-DNA chimeras in catching target cancer cells on the hydrogel surface. Antibodies have been widely used for cell type-
21 22 specific binding because they have very high binding affinities and specificities. ' The antibody used in this study specifically binds to an IgM receptor that is
23
overexpressed on the surface of Ramos cells, which was confirmed by the flow cytometry analysis (not shown). The antibody-DNA chimera was immobilized to the hydrogel surface through the hybridization of the sequences A and B with the aid of streptavidin. After the immobilization of the antibody-DNA chimera, the hydrogel was thoroughly washed to remove free antibodies and subsequently incubated in the cell suspension. As we expected, the immobilized antibody-DNA chimera was able to successfully catch Ramos cells rather than CCRF-CEM (control) cells to the hydrogel surface (not shown). Although antibody-based molecular recognition is beneficial for initial cell catch, the strong antibody-antigen binding is difficult to break for subsequent cell release. Harsh conditions such as high shear stress or protease treatment can be applied to facilitate cell release from antibody-functionalized materials. However, these conditions may result in the decrease of cell viability. In contrast, two stably hybridized nucleic acid sequences can be easily dissociated by introducing a third complementary oligonucleotide without involving any harsh factor (FIG. 3-2). Thus, antibody-DNA chimeras possess two major advantages of antibodies and nucleic acids: strong cell binding capability and easy dissociation induced by a third complementary oligonucleotide. Because of this special characteristic, antibody-
24
DNA chimeras have been used in various areas. In this study, they were used to develop a DNA-responsive hydrogel-based system for not only cell catch, but also cell release.
To examine the feasibility of using the third complementary oligonucleotide to release the bound cells, the hydrogels were incubated in the C25 solution for half an hour. It was found that the cell density decreased from 1 ,369 ± 76 to 8 ± 4 cells/cm (FIG. 3-4a). This result clearly shows that the efficiency of cell release from the hydrogel can reach 99% under the regulation of C25. In contrast, the C25s treatment did not cause a significant change of the cell density (FIG. 3-4a). The effect of release time on cell release was also studied to determine the cell release kinetics. It was found that more than 95% cells were released within 10 min (not shown). Importantly, as we expected, the data of Live/Dead cell staining show that the released cells maintained their viability that was virtually the same as normal cells (FIG. 3-4b). Taken together, these data show that the bound Ramos cells could be nondestructively and rapidly released from the hydrogel through nucleic acid hybridization in physiological conditions.
In conclusion, this study has successfully demonstrated that DNA- functionalized hydrogels can be programmed to achieve controlled cell catch and release by using an antibody-DNA chimera and a triggering complementary oligonucleotide. Although antibodies were used as a model in this study, it is possible that other types of natural biomolecules (e.g., peptides and growth factors) can be functionalized with nucleic acids as chimeras to achieve a similar effect of programmable cell catch and release. Because the dynamic display of nucleic acid- conjugated biomolecules only relies on nucleic acid hybridization and does not involve any destructive factor, this system holds great potential for various biological and biomedical applications such as tissue engineering and cell separation.
REFERENCES
1. Y. Ito, Soft Matter, 2008, 4, 46-56.
2. U. Hersel, C. Dahmen and H. Kessler, Biomaterials, 2003, 24, 4385-4415. 3. J. Turkova, J. Chromatogr. B. Biomed. Sci. Appl. , 1999, 722, 11 -31.
4. A. M. Kloxin, A. M. Kasko, C. N. Salinas and K. S. Anseth, Science, 2009,
324, 59-63.
5. D. R. Griffin and A. M. Kasko, J. Am. Chem. Soc, 2012, 134, 13103-13107.
6. B. Liu, Y. Liu, J. J. Riesberg and W. Shen, J. Am. Chem. Soc, 2010, 132,
13630-13632.
7. S. Nagrath, L.V. Sequist, S. Maheswaran, D. W. Bell, D. Irimia, L. Ulkus, M. R. Smith, E. L. Kwak, S. Digumarthy, A. Muzikansky, P. Ryan, U. J. Balis, R. G. Tompkins, D. A. Haber and M. Toner, Nature, 2007, 450, 1235- 1239.
8. A. Mahara and T. Yamaoka, Biomaterials, 2010, 31, 4231-4237.
9. B. D. Plouffe, M. A. Brown, R. K. Iyer, M. Radisic and S. K. Murthy, Lab Chip, 2009, 9, 1507-1510.
10. M. A. Cole, N. H. Voelcker, H. Thissen and H. J. Griesser, Biomaterials, 2009, 30, 1827-1850.
11. J. Auernheimer, C. Dahmen, U.Hersel, A. Bausch and H. Kessler, J. Am.
Chem. Soc, 2005, 127, 16107-16110.
12. M. A. Brown, C. S. Wallace, C. C. Anamelechi, E. Clermont, W. M.
Reichert and G. A. Truskey. Biomaterials, 2007, 28, 3928-3935.
13. R. M. Da Silva, J. F. Mano and R. L. Reis, Trends Biotechnol, 2007, 25,
577-583.
14. M. B. Dainiak, A. Kumar, I. Y. Galaev and B. Mattiasson, Proc. Natl. Acad.
Sci. U. S. A., 2006, 103, 849-854.
15. K. M. Persson, R. Karlsson, K. Svennersten, S. Loffler, E. W. Jager, A.
Richter-Dahlfors, P. Konradsson and M. Berggren, Adv. Mater., 2011, 23, 4403-4408.
16. W. S. Yeo, M. N. Yousaf and M. Mrksich, J. Am. Chem. Soc, 2003, 125,
14994-14995.
17. G. M. Harbers, K. Emoto, C. Greef, S. W. Metzger, H. N. Woodward, J. J.
Mascali, D. W. Grainger and M. J. Lochhead, Chem. Mater., 2007, 19, 4405-4414.
18. C. Y. Yang, L. Y. Huang, T. L. Shen, J. A. Yeh, Eur Cells Mater, 2010, 20,
415-430. 19. B. A. Kairdolf, M. C. Mancini, A. M. Smith and S. M. Nie, Anal. Chem., 2008, 80, 3029-3034.
20. M. H. Lee, D. A. Brass, R. Morris, R. J. Composto and P. Ducheyne, Biomaterials, 2005, 26, 1721-1730.
21. A. Mahara and T. Yamaoka, Biotechnol. Prog. , 2010, 26, 441 -447.
22. H. Xu, Z. P. Aguilar, L. Yang, M. Kuang, H. Duan, Y. Xiong, H. Wei and A.
Wang. Biomaterials, 2011, 32, 9758-9765.
23. J. Zhou, B. Soontornworajit and Y. Wang, Biomacromolecules, 2010, 11,
2087-2093.
24. C. M. Niemeyer, Trends Biotechnol, 2002, 20, 395-401.
EXAMPLE 4: ENDONUCLEASE-RESPONSIVE APTAMER- FUNCTIONALIZED HYDROGEL COATING FOR SEQUENTIAL CATCH AND RELEASE OF CANCER CELLS
MATERIALS AND METHODS
The materials and methods for this example are substantially as described in the preceding examples, except as noted below and include the following additional methodology.
Preparation of polyacrylamide hydrogel coating
Polyacrylamide hydrogels were synthesized on the silanized glass surface to produce hydrogel coatings. The pregel solution was prepared by adding TEMED
(0.15
Figure imgf000046_0001
5% v/v) into the mixture of 10% acrylamide solution (1 μΕ) containing the sequence ΑιΑ (100 μΜ) and APS (0.08 μΕ, 10% w/v). Immediately after the preparation of the pregel solution, it was transferred to a supporting glass slide and covered by the silanized glass square. After one -hour polymerization, the glass square was carefully flipped off the large glass slide and rinsed thoroughly with PBS.
Gel electrophoresis
Complementary DNA oligonucleotides were mixed together at a molar ratio of 1 : 1 in PBS containing MgCl2 (lOmM) and incubated at 37 °C for 1 h. Restriction enzyme (5 units) was added to cleave 1 pmol of DNA double helix at 37 °C for 0.5 h. The DNA solutions were loaded into polyacrylamide gel (10% w/v) for running electrophoresis in a Bio-Rad Mini-PROTEAN terra cell (Hercules, CA). After electrophoresis, the polyacrylamide gel was stained with ethidium bromide and then imaged with a Bio-Rad GelDoc XR system (Hercules, CA). Imaging of hydrogel coatings
Both SEM and fluorescence imaging were used to characterize hydrogel coatings. For SEM imaging, glass slides coated with affinity hydrogels were dried by lyophilization. The slides were imaged under a JEOL 6335F field emission scanning electron microscope (FESEM). For fluorescence imaging, glass slides were incubated in BiT solution (20μΕ, 5μΜ in DPBS) at 37 °C for 1 h. After thoroughly washed with DPBS, the slides were imaged under an inverted fluorescence microscope (Axiovert 40CFL, Carl Zeiss).
Cell catch and release
Glass squares coated with hydrogels were incubated in an aptamer solution
(5 μΜ) at 37 °C to immobilize nucleic acid aptamers. After 1 h incubation, the glass squares were thoroughly washed with the binding buffer that was DPBS containing glucose (4.5 g/L), MgCl2 (10 mM), and BSA (0.1% w/v). For cell catch, the glass squares were incubated in cell suspension (800 μΐ,, 5x 105 cells/well) in a 24-well plate at 37 °C for 30 min. The unbound cells were gently removed from the coatings by shaking the plate at 90 rpm for 1 min. For cell release, the glass squares were incubated in restriction enzyme solution (80 μΐ^, 5 units/μΕ) at 37 °C for 30 min. The released cells were gently rinsed off the surface by shaking the plate at 90 rpm for 10 min. The glass slides were imaged using an inverted microscope (Axiovert 40CFL, Carl Zeiss). The cells on hydrogels were quantified using ImageJ. Three images were randomly selected for each sample. A total of three samples were used in each group.
Flow cytometry
Three flow cytometry experiments were run to determine the binding functionality of the hybridized aptamer, to demonstrate the endonuclease-mediated hydrolysis of the hybridized aptamer, and to test the influence of enzymatic hydrolysis on cell properties. In the first experiment, 5x l05 cells were incubated in mixture of AiF and Bi (100 μί) for 30 min at 4°C. The mixture was prepared with AiF (0.2 μΜ) and Bi (0.1 μΜ) in DPBS. After the incubation, the cells were washed with 1 mL of cold washing buffer (DPBS containing 4.5 g/L glucose and 10 mM MgCl2). The washed cells were immediately analyzed by the flow cytometer (BD FACSCalibur, San Jose, CA). A total of 10,000 events were counted. BiS was used as control. In the second experiment, BamRl (1 μί) was added to 100 μΐ, of the mixture of AIF and Bi and the mixture was incubated at 37 °C for 0.5 h. Afterwards, a total of 5x105 CCRF-CEM cells were incubated in the 5amHI-treated mixture for 30 min at 4 °C, washed with cold washing buffer (1 mL), and analyzed by the flow cytometer. A total of 10,000 events were counted. In the third experiment, the cells bound to the hydrogels were treated with BamRl (40 units) in an 80 μΐ, of binding buffer or 80 μΐ, of trypsin solution (0.05% w/v). FBS were added to the trypsin solution to stop cell trypsinization at the end of the release step. The released cells were labeled with the hybridized aptamer using the same protocol as described in the first flow cytometry experiment. A total of 5,000 events were counted.
RESULTS AND DISCUSSION
Synthesis of hydrogel coating on glass surface
Numerous methods have been studied to coat a solid surface [27]. For instance, a material can be incubated in a solution to allow for molecules to be physically adsorbed onto its surface. However, the adsorbed molecules may easily desorb under a dynamic shaking or flow condition because physical adsorption usually depends on weak hydrophobic or charge-charge interactions [27]. In this study, we used simple, single-step free radical polymerization to synthesize a cross- linked hydrogel coating that is chemically conjugated to the glass surface. FIG. 4- 2A shows the schematic of the synthesis of the hydrogel coating using a sandwich method. The small glass square was silanized with 3-(trimethoxysilyl)propyl methacrylate to carry methacrylate groups. When the mixture of acrylamide, bis- acrylamide, and DNA with acrydite was initiated to polymerize by APS and
TEMED (FIG. 4-2B), the small glass square was immediately put on the liquid surface. Thus, after polymerization, the formed hydrogel was chemically conjugated to the glass square. The SEM images show that the hydrogel coating is very smooth with a thickness of -10 μιη (FIG. 4-2C). Importantly, when the glass square was washed and shaken in aqueous solutions, the hydrogel coating was stable on the glass surface. Examination of hydrogel coating for resisting nonspecific cell binding
In this study, we examined nonspecific cell binding in a pseudo-static condition, in which cells were allowed to gradually precipitate to the material surface from the cell suspension. Different surfaces were studied and compared, including untreated glass surface, NaOH treated glass surface, silanized glass surface, and the hydrogel coating. The cell images show that the density of CCRF- CEM cells on the untreated glass surface, NaOH treated glass surface, and silanized glass surface were -1,100, 1,400, and 1,400 cells/mm" respectively (FIG. 4-3). In contrast, the cell density on the hydrogel coating was ~5 cells/mm" (FIG. 4-3). These results indicate that it would be important to prepare a coating to prevent nonspecific cell binding to the surface of a device, and that the hydrogel coating would be suitable for solving this non-specific binding problem. Although the polyacrylamide hydrogel was studied herein, other polymeric hydrogels (e.g., poly(ethylene glycol) (PEG), poly(vinyl alcohol), and poly(2-hydroxyethyl methacrylate)) may provide similar or better effectiveness in resisting nonspecific cell binding. In addition to the hydrogels, other materials such as PEG brush [32,33] and zwitterionic polymers [34,35] may also be used to reduce nonspecific cell binding. Moreover, the variation of numerous reaction conditions may further improve the capability of the hydrogel coating in resisting nonspecific cell binding. Examination of aptamer-functionalized hydrogel coating for catching cells After demonstrating the functionality of the polyacrylamide hydrogel in resisting nonspecific cell binding, we studied whether aptamers were capable of inducing cell type-specific binding to the polyacrylamide hydrogel. A nucleic acid aptamer recognizing CCRF-CEM cells [36] was used as a model to functionalize the hydrogel coating. This aptamer (i.e., sequence B) was rationally designed to present three functional regions (FIG. 4-4 A). The first region is the binding motif that is the same as that of the parent aptamer. It contains a total of 40 nucleotides. The second region is a five-nucleotide linker used to increase molecular flexibility and reduce steric hindrance. The third region is a twenty-nucleotide tail used to hybridize with sequence A immobilized in the hydrogel. Importantly, this tail was specially designed with a restriction endonuclease cleavage site in the middle. The sequences Ai and Bi can hybridize through 20 base pairs with a melting temperature higher than 60°C. The control sequence Bis can also form the same 20 base pairs with the sequence
Figure imgf000050_0001
The gel electrophoretogram showed that these pairs stably hybridized in aqueous solutions (FIG. 4-4B). In addition to the examination of intermolecular hybridization in aqueous solutions, we also investigated the feasibility of hybridizing these sequences in the hydrogel coatings (FIG. 4-4C). A total of three hydrogels were synthesized. The first one was a native polyacrylamide hydrogel. The second one was a polyacrylamide hydrogel that was prepared with a pregel solution containing sequence Ai without acrydite. Because sequence Ai did not have acrydite, it would not be able to participate in free radical polymerization. In contrary, the third one was prepared with the pregel solution containing sequence A with acrydite (i.e., AIA). Thus, during the free radical polymerization, acrydite enabled the chemical incorporation of sequence A into the hydrogel network. All three hydrogel coatings were treated with sequence BiT and then subjected to thorough washing. TAMRA was used to label sequence BiT for clear legibility of the hybridization. The fluorescence image shows that the AIA hydrogel exhibited stronger fluorescence intensity than the other two hydrogels (FIG. 4-4C). It demonstrates that Ai was successfully incorporated into the hydrogel, and that Ai and BIT hybridized successfully in the hydrogel.
After the successful demonstration of intermolecular hybridization in the hydrogel, a cell catch experiment was run to examine whether the immobilized Bi could induce cell binding to the hydrogel. The Bi functionalized hydrogel could catch cells with the density over -1,000 cells/mm (FIG. 4-4D). In contrast, only -10 cells/mm were observed on the other two control surfaces. These results demonstrate that the hybridized functional aptamers enabled the successful cell catch to the hydrogel coating.
The aptamer was purposely immobilized to the hydrogel using
intermolecular hybridization rather than direct conjugation for an important concern. The aptamer is designed to carry an exogenous endonuclease-recognizing cleavage site comprised of nucleotides. These exogenous nucleotides may form
intramolecular base pairs with the original nucleotides of the aptamer and therefore affect the binding affinity of the aptamer. The use of a hybridized aptamer can simply avoid this potential problem.
Determination of cell type-specific catch
The success of cell catch relies on not only the ability to catch target cells, but also the ability to resist the binding of non-target cells. Therefore, another cell catch experiment was run to compare the binding of CCRF-CEM and Ramos (i.e., control) cells. The flow cytometry analysis shows that the aptamer specifically binds to CCRF-CEM cells rather than Ramos cells (FIG. 4-5A). Consistent with the flow cytometry analysis, the aptamer was able to catch CCRF-CEM cells rather than Ramos cells (Figs. 4-5B&C) to the hydrogel coating. The profile of binding kinetics shows that the density of Ramos cells on the hydrogel coating did not change throughout the experiment. Approximately 5 Ramos cells/mm were observed on the hydrogel surface. In contrast, the cell density of CCRF-CEM cells rapidly increased during the first 30 min and then gradually reached plateau. These results show that the use of aptamers ensures cell type-specific catch to the hydrogel coating.
A number of other affinity ligands may also satisfy the need of cell type- specific catch. These ligands include but are not limited to antibodies, peptides, and certain small molecules (e.g., folic acids). Although all of these affinity ligands can be in principle applied to catch target cells, we purposely used nucleic acid aptamers to catch cells for three main reasons. First, nucleic acid aptamers are synthetic oligonucleotides screened from DNA/RNA libraries with high binding affinities and specificities that are comparable to antibodies [37,38]. Second, aptamers are synthesized using standard phosphoramide chemistry [39]. Thus, aptamers exhibit little or no batch-to-batch variation, which is definitely beneficial to increase the reliability of cell catch. Third, our ultimate goal is to achieve not only specific cell catch but also nondestructive cell release based on endonuclease-mediated cleavage. It is easy to design and synthesize nucleic acid aptamers with an endonuclease- recognizing site rather than DNA-antibody or DNA-peptide chimeras.
Endonuclease-mediated sequence-specific hydrolysis for cell release
After cell catch and separation, it is also important to release cells with minimized cell damage for downstream cell characterization. To release the cells, we used a restriction endonuclease (i.e., BamHi) [40-42] to treat the aptamer- functionalized hydrogel coating. The cleavage sites of the aptamer duplex are shown in FIG. 4-6 A. The gel electrophoretogram shows that the 30-min BamHi treatment led to the degradation of the majority of Ai-Bi duplexes (FIG. 4-6B). This result was confirmed by the flow cytometry analysis (FIG. 4-6C). After the demonstration of the effectiveness of using BamRl to hydro lyze the Ai-Bi duplexes, we performed a i?amHI-mediated cell release experiment. The cells and the hydrogel coatings were treated with BamHi for 30 min. The result shows that the efficiency of cell release was -99% and the cell density on the hydrogel coating was decreased to -10 cells/mm2 (FIG. 4-6D).
To confirm the observations in the BamHi experiment and to illustrate the specificity of restriction endonucleases in releasing cells, we also examined the functionality of another restriction endonuclease, i.e., Kpnl. The recognition sequences of BamHi (FIG. 4-6A) and Kpnl (FIG. 4-7A) have a high similarity with only the middle two nucleotides switched to the corresponding positions. Despite the high similarity of their recognition sequences, these two endonucleases exhibited high fidelity and accuracy of cutting the recognition sequences (FIG.4-7B). BamHi hydro lyzed the Ai-Bi duplex rather than the A2-B2 duplex; Kpnl hydro lyzed the A2- B2 duplex rather than the Ai-Bi duplex. The cell release data are consistent with the gel electrophoresis results. For the hydrogels functionalized with the Ai-Bi duplex, the cells were released by BamHi rather than Kpnl (FIG. 4-7C). For the hydrogel functionalized with the A2-B2 duplex, the cells were released by Kpnl rather than BamHi (FIG. 4-7D). These results demonstrate that the restriction endonuclease- mediated cell release is sequence-specific.
Because tumor cells in the same tumor exhibit heterogeneous properties [43-
45], it is reasonable that circulating tumor cells may have different characteristics. Thus, the ability to separate and detect the subgroups of circulating tumor cells may lead to a deep understanding of cancer development. In principle, multiple specific aptamers with different nuclease-recognizing sites can be rationally designed and immobilized into the hydrogel coating to catch the subgroups of tumor cells.
Because our results have shown that BamHi and Kpnl specifically hydrolyzed different recognition sequences (FIG. 4-7) it is promising that the subgroups of tumor cells would be specifically captured and released when sequence-specific aptamers and endonucleases were used.
Comparison of B mHI and trypsin in releasing cells
In addition to restriction endonucleases, it is also possible to use proteases to induce cell release from the hydrogel coating. Thus, it is reasonable to investigate which type of enzyme will be more efficient to release cells from the hydrogel coating. To address this question, we compared the ability of BamHl and trypsin in releasing cells. The reason for choosing trypsin for comparison is that trypsin is the most commonly used protease for detaching cells from a surface. As shown in FIG. 4-8A, BamHl released 95 ± 4% cells within 10 min whereas trypsin released 80 ± 18% cells during the same period of time. In addition, the unreleased cells in the trypsin group were not evenly distributed on the hydrogel coating. These differences may be partly attributed to the steric hindrance. Cell receptors are directly attached to a compact cell membrane whereas the aptamers are immobilized on the porous hydrogel coating. In addition, the cleavage sites of endonucleases are located in the middle of double-stranded helixes. Resultantly, it would be easier for endonucleases to attack the cleavage sites than proteases to attack cell receptors. The results also show that both trypsin and BamHl could release more than 99% cells after 30-min enzyme treatment (FIG. 4-8 A).
Because the analysis of circulating tumor cells involve the characterization of not only signaling molecules and genes inside the cells but also their surface properties, it is critical to ensure minimal effects on cell properties both inside and on the surface during the procedure of cell release. This need is particularly important to the understanding of the properties of metastatic cancer cells that may rely on their surface receptors to find appropriate places to survive and grow into new tumors. Therefore, in addition to the cell release efficiency, we further compared the properties of released cells with two different assays: LIVE/DEAD cell staining and flow cytometry. The results show that the percentage of viable cells was approximately 98% in both groups, indicating that there is no difference between BamHl and trypsin in affecting cell viability (FIG.4-8B). However, the flow cytometry results show a significant difference (FIG. 4-8C). The BamRl- released cells exhibited fluorescence intensity similar to that of normal cells whereas the trypsin-released ones exhibited fluorescence intensity close to that of the unlabeled cells. These results demonstrate that endonucleases barely affect cell receptors whereas proteinases cause a significant decrease of receptor density. Taken together, these cell release results indicate that endonuclease-mediated treatment is not only fast and efficient, but also biocompatible to maintain the original cell properties.
CONCLUSIONS
A material system for cell catch and release was developed using aptamer- functionalized hydrogels and restriction endonucleases. The immobilized aptamers can specifically catch target cancer cells on the hydrogel surface that is highly resistant to nonspecific cell binding. In addition, sequence-specific restriction endonucleases can hydrolyze aptamers with rationally designed cleavage sites and rapidly release cells from the hydrogel without causing cell damage. Therefore, aptamer- functionalized hydrogels hold great potential as a coating material to functionalize medical devices (e.g., microfluidic devices) for specific catch and nondestructive release of rare circulating tumor cells.
REFERENCES
1. Webster DR, Sabbadini E. The prognostic significance of circulating tumour cells: A five-year follow-up study of patients with cancer of the breast. Can Med Assoc J 1967; 96 : 129- 131.
2. Engel H, Kleespies C, Friedrich J, Breidenbach M, Kallenborn A, Schondorf T, et al. Detection of circulating tumour cells in patients with breast or ovarian cancer by molecular cytogenetics. Brit J Cancer 1999; 81 : 1165-1173.
3. Ring A, Smith IE, Dowsett M. Circulating tumour cells in breast cancer.
Lancet Oncol 2004; 5:79-88.
4. Hogan BV, Peter MB, Shenoy H, Horgan K, Hughes TA. Circulating tumour cells in breast cancer: Prognostic indicators, metastatic intermediates, or irrelevant bystanders? (Review). Mol Med Report 2008; 1 :775-779.
5. Krell J, Stebbing J. Circulating tumour cells as biomarkers in early breast cancer. Lancet Oncol 2012; 13:653-654.
6. Goeminne JC, Guillaume T, Salmon M, Machiels JP, D'Hondt V, Symann M. Unreliability of carcino embryonic antigen (CEA) reverse transcriptase- polymerase chain reaction (RT-PCR) in detecting contaminating breast cancer cells in peripheral blood stem cells due to induction of CEA by growth factors. Bone Marrow Transpl 1999; 24:769-775. Jung R, Kriiger W, Hosch S, Holweg M, Kroger N, Gutensohn K, et al. Specificity of reverse transcriptase polymerase chain reaction assays designed for the detection of circulating cancer cells is influenced by cytokines in vivo and in vitro. Brit J Cancer 1998; 78: 1194-1198.
Brossart P, Schmier JW, Kriiger S, Willhauck M, Scheibenbogen C, Monier T, et al. A polymerase chain reaction-based semiquantitative assessment of malignant melanoma cells in peripheral blood. Cancer Res 1995; 55:4065- 4068.
Sabbatini R, Federico M, Morselli M, Depenni R, Cagossi K, Luppi M, et al. Detection of circulating tumor cells by reverse transcriptase polymerase chain reaction of maspin in patients with breast cancer undergoing conventional-dose chemotherapy. J Clin Oncol 2000; 18:1914-1920.
Osborne MP, Asina S, Wong GY, Old LJ, Cote RJ. Immunofluorescent monoclonal antibody detection of breast cancer in bone marrow: sensitivity in a model system. Cancer Res 1989; 49:2510-2513.
Gross HJ, Verwer B, Houck D, Recktenwald D. Detection of Rare Cells at a Frequency of One Per Million by Flow-Cytometry. Cytometry 1993; 14:519- 526.
Brown M, Wittwer C. Flow cytometry: principles and clinical applications in hematology. Clin Chem 2000; 46: 1221-1229.
Nagrath S. Sequist LV, Maheswaran S, Bell DW, Irimia D, Ulkus L, et al. Isolation of rare circulating tumour cells in cancer patients by microchip technology. Nature 2007; 450: 1235-1239.
Adams AA, Okagbare PI, Feng J, Hupert ML, Patterson D, Gottert J, et al. Highly efficient circulating tumor cell isolation from whole blood and label- free enumeration using polymer-based microfluidics with an integrated conductivity sensor. J Am Chem Soc 2008; 130:8633-8641.
Mayumi M, Sumimoto SI, Kanazashi SI, Hata D, Yamaoka K, Higaki Y, et al. Negative signaling in B cells by surface immunoglobulins. J Allergy Clin Immunol 1996; 98:S238-247.
Smith JA, Bluestone JA. T cell inactivation and cytokine deviation promoted by anti-CD3 mAbs. Curr Opin Immunol 1997; 9:648-654.
Henke C, Bitterman P, Roongta U, Ingbar D, Polunovsky V. Induction of fibroblast apoptosis by anti-CD44 antibody: implications for the treatment of fibroproliferative lung disease. Am J Pathol 1996; 149: 1639-1650.
El-Ali J, Sorger PK, Jensen KF. Cells on chips. Nature 2006; 442:403-411. Reisewitz S, Schroeder H, Tort N, Edwards KA, Baeummer AJ, Niemeyer CM. Capture and culturing of living cells on microstructured DNA substrates. Biomed Mater 2010; 6:2162-2168.
Phillips JA, Xu Y, Xia Z, Fan ZH, Tan WH. Enrichment of cancer cells using aptamers immobilized on a microfluidic channel. Anal Chem 2009; 81 :1033-1039.
Wan Y, Kim Y, Li N, Cho SK, Bachoo R, Ellington AD, et al. Surface- immobilized aptamers for cancer cell isolation and microscopic cytology. Cancer Res 2010; 70:9371-9380. 22. Chen L, Liu X, Su B, Li J, Jiang L, Hang D, et al. Aptamer-mediated efficient capture and release of T Lymphocytes on nanostructured surfaces. Adv Mater 2011; 23:4376-4380.
23. Plouffe BD, Brown MA, Iyer RK, Radisic M, Murthy SK. Controlled capture and release of cardiac fibroblasts using peptide-functionalized alginate gels in microfluidic channels. Lab Chip 2009; 9: 1507-1510.
24. Soontornworajit B, Zhou J, Shaw MT, Fan TH, Wang Y. Hydrogel functionalization with DNA aptamers for sustained PDGF-BB release. Chem Commun 2010; 46: 1857-1859.
25. Chen N, Zhang Z, Soontornworajit B, Zhou J, Wang, Y. Cell adhesion on an artificial extracellular matrix using aptamer-functionalized PEG hydrogels. Biomaterials 2012; 33: 1353-1362.
26. Zhu Z, Wu C, Liu H, Zou Y, Zhang X, Kang H, et al. An Aptamer Cross- Linked Hydrogel as a Colorimetric Platform for Visual Detection. Angew Chem Int Edit 2010; 49: 1052-1056.
27. Banerjee I, Pangule RC, Kane RS. Antifouling Coatings: Recent Developments in the Design of Surfaces That Prevent Fouling by Proteins, Bacteria, and Marine Organisms. Adv Mater 2011; 23:690-718.
28. Harbers GM, Emoto K, Greef C, Metzger SW, Woodward HN, Mascali JJ, et al. Functionalized poly(ethylene glycol)-based bioassay surface chemistry that facilitates bio -immobilization and inhibits nonspecific protein, bacterial, and mammalian cell adhesion. Chem Mater 2007; 19:4405-4414.
29. Yang CY, Huang LY, Shen TL, Yeh JA. Cell Adhesion, Morphology and Biochemistry on Nano-Topographic Oxidized Silicon Surfaces. Eur Cells Mater 2010; 20:415-430.
30. Kairdolf BA, Mancini MC, Smith AM, Nie SM. Minimizing nonspecific cellular binding of quantum dots with hydroxyl-derivatizied surface coatings. Anal Chem 2008; 80:3029-3034.
31. Lee MH, Brass DA, Morris R, Composto RJ, Ducheyne P. The effect of non- specific interactions on cellular adhesion using model surfaces. Biomaterials
2005; 26: 1721-1730.
32. Uchida K, Otsuka H, Kaneko M, Kataoka K, Nagasaki Y. A reactive Poly(ethylene glycol) layer to achieve specific surface plasmon resonance sensing with a high S/N ratio: The substantial role of a short underbrushed PEG layer in minimizing nonspecific adsorption. Anal Chem 2005; 77: 1075-
1080.
33. Senaratne W, Andruzzi L, Ober CK. Self-assembled monolayers and polymer brushes in biotechnology: Current applications and future perspectives. Biomacromolecules 2005; 6:2427-2448.
34. Cho WK, Kong B, Choi IS. Highly efficient non-biofouling coating of zwitterionic polymers : poly((3 -(methacryloylamino)propyl)-dimethyl(3 - sulfopropyl)ammonium hydroxide). Langmuir 2007; 23: 5678-5682.
35. Jiang S, Cao Z. Ultralow-fouling, functionalizable, and hydrolyzable zwitterionic materials and their derivatives for biological applications. Adv Mater 2009; 22:920-932. Shangguan D, Li Y, Tang Z, Cao ZC, Chen HW, Mallikaratchy P, et al. Aptamers evolved from live cells as effective molecular probes for cancer study. P Natl Acad Sci USA 2006; 103: 11838-11843.
Ellington AD, Szostak JW. In vitro selection of RNA molecules that bind specific ligands. Nature 1990; 346:818-822.
Tuerk C, Gold L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990; 249:505- 510.
Jayasena SD, Aptamers: An emerging class of molecules that rival antibodies in diagnostics. Clin Chem 45, 1628-1650 (1999).
Hinsch B, Kula MR. Physical and kinetic-properties of the site specific endonuclease BamHi from Bacillus- Amyloliquefaciens. Nucleic Acids Res 1980; 8:623-633.
Pingoud A, Jeltsch A. Recognition and cleavage of DNA by type-II restriction endonucleases. Eur J Biochem 1997; 246: 1-22.
Venkatesh S, Wower J, Byrne ME. Nucleic acid therapeutic carriers with on- demand triggered release. Bioconjugate Chem 2009; 20:1773-1782.
Dexter DL, Kowalski HM, Blazar BA, Fligiel Z, Vogel R, Heppner GH. Heterogeneity of tumor-cells from a single mouse mammary tumor. Cancer Res 1978; 38:3174-3181.
Fargion S, Carney D, Mulshine J, Rosen S, Bunn P, Jewett P, et al. Heterogeneity of cell surface antigen expression of human small cell lung cancer detected by monoclonal antibodies. Cancer Res 1986; 46:2633-2638. Poste G, Tzeng J, Doll J Breig R, Rieman D, Zeidman I. Evolution of tumor cell heterogeneity during progressive growth of individual lung metastases. P Natl Acad Sci USA 1982; 79:6574-6578.
Table 4-1. List of DNA oligonucleotides.
Name Sequence (5' to 3')
Ai ATATTGTTTGTTACACGGGATCCCGATTTT
AiA ^crydzte- ATATTGTTTGTTACACGGGATCCCGATTTT
AlF ATATTGTTTGTTACACGGGATCCCGATTTT- K i
A2A ^cry te- ATATTGTTTGTTACAGGGGTACCCCATTTT
Bi TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT
AGTAAAAATCGGGATCCCGTGTAA
Bis CAATGGCGTTGGGAGGACTCCGGTTACTGATTACGTCAATCA
CAAAAAATCGGGATCCCGTGTAA
BIT TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT AGTAAAAATCGGGATCCCGTGTAA- TAMRA
B2 TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT
AGTAAAAATGGGGTACCCCTGTAA
The use of the word "a" or "an" when used in conjunction with the term
"comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only
alternatives and "and/or."
It should be understood that for all numerical bounds describing some parameter in this application, such as "about," "at least," "less than," and "more than," the description also necessarily encompasses any range bounded by the recited values. Accordingly, for example, the description at least 1, 2, 3, 4, or 5 also describes, inter alia, the ranges 1-2, 1-3, 1-4, 1-5, 2-3, 2-4, 2-5, 3-4, 3-5, and 4-5, et cetera.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention.
For all patents, applications, or other reference cited herein, such as nonpatent literature and reference sequence information, it should be understood that it is incorporation herein by reference in its entirety for all purposes as well as for the proposition that is recited. Where any conflict exits between a document incorporated herein by reference and the present application, this application will control. All information associated with reference gene sequences disclosed in this application, such as Gene IDs or accession numbers, including, for example, genomic loci, genomic sequences, functional annotations, allelic variants, and reference mR A (including, e.g., exon boundaries) and protein sequences (such as conserved domain structures) are hereby incorporated herein by reference in their entirety.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.
Headings used in this application are for convenience only and do not affect the interpretation of this application.
Preferred features of each of the aspects provided by the invention are applicable to all of the other aspects of the invention mutatis mutandis and, without limitation, are exemplified by the dependent claims and also encompass
combinations and permutations of individual features {e.g. elements, including numerical ranges and exemplary embodiments) of particular embodiments and aspects of the invention including the working examples. For example, particular experimental parameters exemplified in the working examples can be adapted for use in the claimed invention piecemeal without departing from the invention. For example, for materials that are disclosed, while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a class of elements A, B, and C are disclosed as well as a class of elements D, E, and F and an example of a combination of elements, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. This concept applies to all aspects of this application including, elements of a composition of matter and steps of method of making or using the compositions.
The forgoing aspects of the invention, as recognized by the person having ordinary skill in the art following the teachings of the specification, can be claimed in any combination or permutation to the extent that they are novel and non-obvious over the prior art— thus to the extent an element is described in one or more references known to the person having ordinary skill in the art, they may be excluded from the claimed invention by, inter alia, a negative proviso or disclaimer of the feature or combination of features.
While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

CLAIMS What is claimed is:
1. A method of specifically binding a viable target cell under physiological
conditions, comprising contacting a test composition with an affinity ligand- functionalized substrate under physiological conditions, wherein the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and further wherein the specific binding of the viable target cell by the affinity ligand is reversible under physiological conditions by intermolecular hybridization with a deactivating nucleic acid.
A method of reversible cell-specific binding comprising: contacting a test composition suspected of containing a viable target cell of interest with an affinity ligand-functionalized substrate under physiological conditions, wherein the affinity ligand-functionalized substrate comprises an affinity ligand capable of specifically binding the viable target cell, and wherein the affinity ligand is a single-stranded nucleic acid aptamer, thereby producing a target cell-bound affinity ligand-functionalized substrate complex; optionally, washing the complex; and contacting the complex with a deactivating nucleic acid under physiological conditions to release the target cell, wherein the deactivating nucleic acid intermolecularly hybridizes to the affinity ligand in the complex, thereby reversibly releasing the target cell from the complex under physiological conditions.
3. The method of Claim 1 or 2, wherein the viable target cell is a mammalian cell.
4. The method of any one of Claims 1 to 3, wherein the substrate is a hydrogel.
5. The method of Claim 1, further comprising contacting the affinity ligand- functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell.
6. The method of Claim 1, wherein the affinity ligand is a single-stranded nucleic acid aptamer.
7. The method of Claim 6, further comprising contacting the affinity ligand- functionalized substrate with a deactivating nucleic acid under physiological conditions to release the viable target cell.
8. The method of Claim 7, further comprising removing the deactivating nucleic acid from the affinity ligand- functionalized substrate by contacting the affinity ligand-functionalized substrate with a reactivating nucleic acid.
9. The method of any one of Claims 1 to 8, wherein the test composition is isolated from a mammalian subject.
10. The method of Claim 9, wherein the mammalian subject is a human, the test composition comprises a physiological fluid from the human, and the viable target cell is a cancer cell.
11. The method of any one of the preceding claims, wherein the affinity ligand is covalently conjugated to the surface of the substrate or is admixed throughout the substrate.
12. The method of any one of the preceding claims, wherein the affinity ligand is associated with the substrate via hybridization to a complementary nucleic acid sequence that is covalently conjugated to the substrate.
13. The method of any one of the preceding claims, wherein the affinity ligand is present at a concentration of about 0.2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 μΜ or more; more particularly a concentration of about 20-80 μΜ.
14. The method of any one of the preceding claims, wherein the affinity ligand is present at a concentration to facilitate attachment of about 60, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more target cells/mm2 under physiological conditions.
15. The method of any one of the preceding claims, wherein the affinity ligand
comprises a single-stranded oligonucleotide and an associated ligand that specifically binds the target cell marker, wherein the associated ligand is selected from an antibody or antigen-binding fragment thereof, growth factor, or peptide.
16. The method of any one of the preceding claims, wherein the substrate is selected from a microcarrier (including microparticles, about 1 micron to about 500 microns; nanoparticles, about 1 nanometer to about 1 micron; a bead, greater than about 500 microns); substantially planar surface; or a three dimensional scaffold.
17. The method of any one of the preceding claims, wherein the substrate comprises polymers (including brush polymers), hydrogels, glass, plastic, metals, ceramics, semiconductors, oxides or their composites such as magnetic particles.
18. The method of Claim 17, wherein the substrate comprises a hydrogel,
particularly wherein the hydrogel is selected from a PEG hydrogel, a
polyacrylimide hydrogel, a poly(vinyl alcohol) hydrogel, or a poly(2- hydroxyethyl methacrylate) hydrogel.
19. The method of any one of the preceding claims, wherein the substrate comprises a second affinity ligand capable of specifically binding a distinct epitope, relative to the epitope of the viable target cell bound by the first affinity ligand.
20. The method of Claim 19, wherein the substrate comprises at least three affinity ligands capable of specifically binding at least three distinct epitopes.
21. The method of any one of the preceding claims, wherein viable target cell is a eukaryotic cell.
22. The method of Claim 21, wherein the eukaryotic cell is an animal cell, such as a vertebrate cell, and in certain embodiments, a mammalian cell, such as a primate cell, such as a human cell.
23. The method of any one of the preceding claims, wherein the affinity ligand specifically binds a cell-surface protein on the viable target cell.
PCT/US2012/060019 2011-10-12 2012-10-12 Affinity-based materials for the non-destructive separation and recovery of cells Ceased WO2013056090A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161546378P 2011-10-12 2011-10-12
US61/546,378 2011-10-12
US201161582286P 2011-12-31 2011-12-31
US61/582,286 2011-12-31

Publications (1)

Publication Number Publication Date
WO2013056090A1 true WO2013056090A1 (en) 2013-04-18

Family

ID=48082510

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/060019 Ceased WO2013056090A1 (en) 2011-10-12 2012-10-12 Affinity-based materials for the non-destructive separation and recovery of cells

Country Status (1)

Country Link
WO (1) WO2013056090A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015085274A1 (en) * 2013-12-05 2015-06-11 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
CN109154614A (en) * 2016-03-18 2019-01-04 四方控股公司 Composition, device and method for cell separation
US10385335B2 (en) 2013-12-05 2019-08-20 Centrillion Technology Holdings Corporation Modified surfaces
US10391467B2 (en) 2013-12-05 2019-08-27 Centrillion Technology Holdings Corporation Fabrication of patterned arrays
WO2019215112A1 (en) * 2018-05-09 2019-11-14 Lifetaq-Analytics Gmbh In situ cell analysis in cell culture system
JP2020514765A (en) * 2017-03-23 2020-05-21 デューク ユニバーシティ Antidote-mediated release of extracellular aptamer staining
US11060139B2 (en) 2014-03-28 2021-07-13 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
CN113621551A (en) * 2021-08-13 2021-11-09 西安交通大学 Dynamic cell microenvironment simulation platform and preparation method thereof
WO2024118776A1 (en) * 2022-11-29 2024-06-06 The Penn State Research Foundation Materials and methods for aptamer selection

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040038316A1 (en) * 1999-05-10 2004-02-26 Robert Kaiser Cell separation device and methods for use
US20100112026A1 (en) * 2007-04-18 2010-05-06 Massachusetts Institute To Technology Surfaces, methods and devices employing cell rolling
WO2010132795A2 (en) * 2009-05-15 2010-11-18 The General Hospital Corporation Systems, devices, and methods for specific capture and release of biological sample components
US20110070605A1 (en) * 2000-12-28 2011-03-24 Busch Dirk H Reversible mhc multimer staining for functional purification of antigen-specific t cells

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040038316A1 (en) * 1999-05-10 2004-02-26 Robert Kaiser Cell separation device and methods for use
US20110070605A1 (en) * 2000-12-28 2011-03-24 Busch Dirk H Reversible mhc multimer staining for functional purification of antigen-specific t cells
US20100112026A1 (en) * 2007-04-18 2010-05-06 Massachusetts Institute To Technology Surfaces, methods and devices employing cell rolling
WO2010132795A2 (en) * 2009-05-15 2010-11-18 The General Hospital Corporation Systems, devices, and methods for specific capture and release of biological sample components

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10597715B2 (en) 2013-12-05 2020-03-24 Centrillion Technology Holdings Methods for sequencing nucleic acids
GB2537077A (en) * 2013-12-05 2016-10-05 Centrillion Tech Holdings Corp Methods for sequencing nucleic acids
GB2537077B (en) * 2013-12-05 2018-05-09 Centrillion Tech Holdings Corp Methods for sequencing nucleic acids
WO2015085274A1 (en) * 2013-12-05 2015-06-11 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
US10385335B2 (en) 2013-12-05 2019-08-20 Centrillion Technology Holdings Corporation Modified surfaces
US10391467B2 (en) 2013-12-05 2019-08-27 Centrillion Technology Holdings Corporation Fabrication of patterned arrays
US11060139B2 (en) 2014-03-28 2021-07-13 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
CN109154614B (en) * 2016-03-18 2022-01-28 四方控股公司 Compositions, devices and methods for cell separation
CN109154614A (en) * 2016-03-18 2019-01-04 四方控股公司 Composition, device and method for cell separation
JP2020514765A (en) * 2017-03-23 2020-05-21 デューク ユニバーシティ Antidote-mediated release of extracellular aptamer staining
JP7231229B2 (en) 2017-03-23 2023-03-01 デューク ユニバーシティ Antidote-mediated release of extracellular aptamer staining
CN112513286A (en) * 2018-05-09 2021-03-16 生命Taq分析学有限责任公司 In situ cell analysis in cell culture systems
WO2019215112A1 (en) * 2018-05-09 2019-11-14 Lifetaq-Analytics Gmbh In situ cell analysis in cell culture system
US11279971B2 (en) 2018-05-09 2022-03-22 Lifetaq-Analytics Gmbh In situ cell analysis in cell culture system
CN112513286B (en) * 2018-05-09 2022-07-26 生命Taq分析学有限责任公司 In situ cell analysis in cell culture systems
CN113621551A (en) * 2021-08-13 2021-11-09 西安交通大学 Dynamic cell microenvironment simulation platform and preparation method thereof
CN113621551B (en) * 2021-08-13 2023-06-02 西安交通大学 Dynamic cell microenvironment simulation platform and preparation method thereof
WO2024118776A1 (en) * 2022-11-29 2024-06-06 The Penn State Research Foundation Materials and methods for aptamer selection

Similar Documents

Publication Publication Date Title
WO2013056090A1 (en) Affinity-based materials for the non-destructive separation and recovery of cells
Li et al. Endonuclease-responsive aptamer-functionalized hydrogel coating for sequential catch and release of cancer cells
JP7361700B2 (en) Oligonucleotide-encoded chemical library
Abune et al. Aptamer‐functionalized hydrogels: An emerging class of biomaterials for protein delivery, cell capture, regenerative medicine, and molecular biosensing
US20210123911A1 (en) Multipart reagents having increased avidity for polymerase binding
JP7822317B2 (en) Oligonucleotide-encoded chemical libraries, related systems, devices, and methods for detecting, analyzing, quantifying, and testing biological/genetic material
US20200377929A1 (en) Peptide nucleic acid functionalized hydrogel microneedles for sampling and detection of interstitial fluid nucleic acids
Gaddes et al. Aptamer-based polyvalent ligands for regulated cell attachment on the hydrogel surface
US20160291019A1 (en) System for Detecting Rare Cells
WO2016198609A1 (en) High throughput optimization of content-loaded nanoparticles
Ku et al. Reactive polymer targeting dsRNA as universal virus detection platform with enhanced sensitivity
KR102190922B1 (en) Method of Isolating Nucleic Acid
Richards et al. Polymerization of affinity ligands on a surface for enhanced ligand display and cell binding
US9771612B2 (en) Method for detecting a target nucleic acid molecule
EP2818850B1 (en) Method for detecting a target particle
CN107326028B (en) Construction and application of nucleic acid aptamer that can bind to CD123 and its targeted drug delivery system
KR101513766B1 (en) DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use
Wu et al. Microbe-imprinted polymers for rapid drug-resistant bacteria recognition
Li Investigation of RCA aptamer-based microfluidic system for E. coli O157: H7 detection
CN120350014B (en) Nucleic acid aptamers, nucleic acid aptamer derivatives and their applications
JP5262708B2 (en) mRNA capture carrier and mRNA purification method
JP4534818B2 (en) Polymer compound for biomaterial and polymer solution using the same
Baek Filamentous bacteriophage based application
Xing et al. The application of aptamer functionalized hydrogel to capture circulating tumor cells
Yu Rapid and Sensitive Detection of Escherichia Coli O157: H7 Using a QCM Sensor based on Aptamers Selected by Whole-Bacterium SELEX and a Multivalent Aptamer System

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12840404

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12840404

Country of ref document: EP

Kind code of ref document: A1