WO2013045480A1 - Chimeric nucleases for gene targeting - Google Patents

Chimeric nucleases for gene targeting Download PDF

Info

Publication number
WO2013045480A1
WO2013045480A1 PCT/EP2012/068939 EP2012068939W WO2013045480A1 WO 2013045480 A1 WO2013045480 A1 WO 2013045480A1 EP 2012068939 W EP2012068939 W EP 2012068939W WO 2013045480 A1 WO2013045480 A1 WO 2013045480A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
chimeric nuclease
tale
pvull
chimeric
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2012/068939
Other languages
French (fr)
Inventor
Alfred Pingoud
Wolfgang Wende
Mert YANIK
Peter Friedhoff
Lilia GABSALILOW
Benno SCHIERLING
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Justus Liebig Universitaet Giessen
Original Assignee
Justus Liebig Universitaet Giessen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Justus Liebig Universitaet Giessen filed Critical Justus Liebig Universitaet Giessen
Publication of WO2013045480A1 publication Critical patent/WO2013045480A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • Gene targeting i.e. targeted gene knockout or gene replacement
  • nucleases that recognize unique sequences and cleave DNA highly specifically, and thereby initiate non-homologous end joining which can inactivate genes, or, when a template DNA is present, leads to a replacement of a genetic element by homologous recombination.
  • the specificity of these highly specific nucleases must be such that only a single double-strand DNA (dsDNA) cut is made in a complex genome.
  • fusion proteins consisting of zinc fingers (ZFs) or transcription activator-like effector (TALE) proteins as programmable DNA binding modules with the non-specific DNA cleavage domain of the restriction endonuclease (synonymically also designated as restriction enzyme herein below) Fokl.
  • ZFNs zinc finger nucleases
  • TALE transcription activator-like effector
  • the goal of gene targeting is targeted gene knockout or gene replacement.
  • One of the most promising and simple strategies is based on homologous recombination, in which the DNA sequence of interest is supplied in trans to stimulate site-specific recombination. Ideally, the gene of interest is deleted, modified or replaced in its natural context while leaving the rest of the genome untouched.
  • a major obstacle for the homologous recombination-driven approach is the low efficiency of natural recombination between an introduced DNA and the homologous chromosomal target. Remarkably, it was discovered that making a specific double-strand break in the target sequence increases the frequency of homologous recombination by several orders of magnitude.
  • Chimeric nucleases therefore hold great potential for gene targeting as they allow to cleave DNA at a chosen target sequence.
  • chimeric nucleases also cleave prolifically at off-target sites, resulting in unacceptable toxicity, and are not programmable. Toxicity due to off-target cleavage is a major issue in all gene targeting efforts.
  • the off-target cleavage activity of the known chimeric nucleases is related to missing suppression of restriction enzyme cleavage at restriction enzyme cleavage sites at the DNA that are not addressed by the highly specific DNA binding module of the fusion protein.
  • chimeric nucleases that do not cleave at off-target sites in the DNA but highly specifically address bipartite or tripartite DNA target sites resulting in significantly reduced toxicity in gene targeting efforts.
  • chimeric nucleases consisting of a restriction enzyme cleavage module and transcription activator-like effector (TALE) protein(s) as DNA binding module(s) that in contrast to the prior art exhibit increased preference and specificity to bipartite or tripartite target sites without cleaving restriction enzyme off-target sites and that are programmable.
  • TALE transcription activator-like effector
  • amino acid substitutions introduced into a restriction enzyme that forms the cleavage module of the chimeric nuclease like for example Pvull that cleaves double-stranded DNA at the sequence CAGjCTG, suppress cleavage by the restriction enzyme at restriction enzyme cleavage sites that are not addressed by the highly specific TALE protein(s) as DNA binding module(s) of the fusion protein.
  • the present invention relates to a chimeric nuclease which comprises the following components:
  • a module comprising at least a DNA binding domain derived from a TALE protein
  • a module comprising at least a cleavage domain derived from a restriction endonuclease
  • said chimeric nuclease functionally interacts only with DNA that comprises both a DNA recognition site for a DNA binding domain derived from a TALE protein and a DNA recognition site for a cleavage domain derived from a restriction endonuclease, and wherein said cleavage domain cleaves the DNA upon binding of the chimeric nuclease to the DNA.
  • TALE Transcription activator-like effector
  • TALEs are proteins secreted by Xanthomonas bacteria via their type III secretion system when they infect various plant species. These proteins can bind promoter sequences in the host and activate the expression of host genes that aid bacterial infection. These proteins are interesting both for their role in disease, for example of important crop species, and the relative ease of retargeting them to bind new DNA sequences. Similar proteins are found in the pathogenic bacteria Ralstonia solanacearum.
  • the most distinctive characteristic of TALE proteins is a central repeat domain containing between 1 .5 and 33.5 repeats that are usually 34 residues in length (the C-terminal repeat is generally shorter and referred to as a "half repeat").
  • a typical repeat sequence is LTPEQVVAIASHDGGKQALETVQRLLPVLCQAHG, but the residues at the 12th and 13th positions are hypervariable (these two amino acids are also known as the repeat variable diresidue or RVD). It has been shown that there is a simple relationship between the identity of these two residues in sequential repeats and sequential DNA bases in the TAL effector's target site. There appears to be a one-to-one correspondence between the identity of two critical amino acids in each repeat and each DNA base in the target sequence.
  • TALE proteins from which the DNA binding domain of the chimeric nucleases according to the invention herein is derived are selected from the Avirulence protein AvrBs3 (SEQ ID No. 1 ) and/or AvrBs4 (SEQ ID No. 2), for example of Xanthomonas euvesicatoria or Xanthomonas vesicatoria, respectively.
  • Restriction endonucleases also called restriction enzymes as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides.
  • some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical.
  • the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and/or reduced catalytic activity when compared to the wildtype restriction endonuclease.
  • the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonucleases subunits.
  • the cleavage modules referred to herein have a reduced capability of forming homodimers in the absence of the DNA recognition site, thereby preventing unspecific DNA binding. Therefore, a functional homodimer is only formed upon recruitment of chimeric nucleases monomers to the specific DNA recognition sites.
  • the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease.
  • the preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides.
  • the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity.
  • the type IIP restriction endonucleases as referred to herein are preferably selected from the group consisting of: Pvull, EcoRV, BamHI, Bcnl, BfaSORF1835P, Bfil, Bgll, Bglll, BpuJI, Bse634l, BsoBI, BspD6l, BstYI, Cfrl OI, Ecl18kl, EcoO109l, EcoRI, EcoRII, EcoRV, EcoR124l, EcoR124ll, HinPI I, Hindi, Hindlll, Hpy99l, Hpy188l, Mspl, Muni, Mval, Nael, NgoMIV, Notl, OkrAI, Pabl, Pad, PspGI, Sau3AI, Sdal, Sfil, SgrAI, Thai, VvuYORF266P, Ddel, Eco57l, Haelll, Hhall, Hindll, and Ndel.
  • the restriction endonuclease according to the invention is Pvull or a genetically modified variant thereof.
  • Pvull or a variant thereof comprised in the cleavage module of the chimeric nuclease exhibit at least one of the following amino acid substitutions D5K, L12E, P14G, H15D, Q17E, K25D, K25E, T46G, N62D, K78E, H83A, Y94F, K155E, K174E, or combinations thereof, or amino acid deletions delta 1 -15, delta 1 -25 (positions referring to wildtype Pvull).
  • amino acid substitutions or deletions results in cleavage of the DNA by the chimeric TALE-Pvull fusion protein only at sequences that are addressed by the TALE protein (SEQ ID No. 7).
  • Said amino acid substitutions are useful as single substitutions or all possible combinations thereof for the purpose of the present invention, and may be replaced by functionally similar amino acids.
  • the wildtype Pvull amino acid sequence referred to herein is according to SEQ ID No. 3 or is a modified variant thereof which differs from SEQ ID No. 3 by at least one amino acid substitution and/or deletion or addition.
  • the amino acid sequence of such modified variant of Pvull is at least 70% identical to wildtype Pvull and exhibits essentially the same DNA binding and cleavage characteristics as Pvull according to SEQ ID No. 3.
  • the DNA binding domain and the cleavage domain according to the present invention are separated within the chimeric nuclease by a linker which is preferably a flexible structure of sufficient length allowing interaction with the addressed DNA binding site and cleavage at the DNA restriction site.
  • a linker which is preferably a flexible structure of sufficient length allowing interaction with the addressed DNA binding site and cleavage at the DNA restriction site.
  • the flexible linker structures as referred to the invention herein consist of five to twenty amino acids. More preferably, the linker comprises at least six or up to ten or more amino acids. In one embodiment, said linker has an amino acid sequence as shown in SEQ ID No. 4 (SSVIPNRGVTKQLVK).
  • a DNA binding domain derived from a TALE protein and a cleavage domain derived from a restriction endonuclease are fused by an amino acid linker to generate a specific nuclease.
  • said TALE proteins are selected from AvrBs3 or AvrBs4, and said restriction endonucleases are selected from type IIP restriction endonucleases.
  • the type IIP restriction endonuclease is Pvull.
  • TALE-Pvull chimeric nucleases are designed such that only Pvull sites with adjacent zinc finger (ZF) binding sites which constitute the binding sites of TALE proteins are cleaved, meaning that only addressed Pvull sites are cleaved but no off-target Pvull sites.
  • ZF zinc finger
  • suitable linkers and introduced amino acid substitutions and/or deletions or additions into Pvull that alter activity and increase fidelity are selected, thereby making DNA cleavage by Pvull dependent on the DNA binding by the TALE protein. Therefore, neither the DNA binding domain nor the cleavage domain alone shall be sufficient for allowing functional interaction of the chimeric nuclease with DNA.
  • the chimeric nuclease will form a homodimer comprising two chimeric nuclease monomers having the structure of the chimeric nucleases of the invention.
  • the cleavage domains of these monomers interact with each other and thereby mediate formation of the homodimer.
  • the dimerized chimeric nucleases then recognize a specific bipartite or tripartite DNA binding site comprising one or two recognition site(s) of the DNA binding module and a recognition site of the cleavage module (SEQ ID No. 7).
  • homodimerization is mediated by a cleavage module derived from the restriction endonuclease Pvull (FIG. 1 A, FIG. 4; SEQ ID No. 5).
  • the chimeric nucleases which form a dimer comprise DNA binding modules derived from different TALE proteins.
  • one monomer exhibits a DNA binding module derived from TALE protein AvrBs3
  • the second monomer exhibits a DNA binding module derived from TALE protein AvrBs4.
  • the cleavage domain comprises two Pvull derived amino acid sequences, each forming a Pvull monomer, which are fused via a linker according to the present invention to a DNA binding domain derived from a TALE protein (FIG. 1 B).
  • the bipartite or tripartite DNA target for the chimeric nucleases comprising a DNA binding domain derived from the TALE protein AvrBs3 or AvrBs4, a linker, and a cleavage domain derived from the restriction endonuclease Pvull is given in the accompanying SEQ ID No. 7.
  • programmed TALE-Pvull chimeric nucleases with a predefined specificity as it is required for gene targeting at a locus of interest is achieved by replacement of AvrBs3 or AvrBs4 by other TALE proteins as DNA binding module as described herein.
  • the present invention also relates to a vector comprising the polynucleotide encoding the chimeric nuclease as referred to herein.
  • Said vectors are obtained by conventional polymerase chain reaction (PCR) techniques using appropriate primer sequences and subsequent cloning methods. Said techniques and methods are well- known by skilled persons and belong to the prior art.
  • Suitable cloning vectors for the purpose of the invention comprise plasmids, viral or retroviral vectors, phages, and artificial chromosomes such as bacterial or yeast artificial chromosomes.
  • vectors used in the invention comprise selectable markers for propagation and/or selection in a host organism as well as expression control sequences allowing expression of the operatively linked polynucleotide in prokaryotic or eukaryotic host cells.
  • Such vectors are well-known to the skilled worker and particularly include vectors that are able to replicate in microorganisms, thereby ensuring efficient cloning in bacteria, yeasts, and fungi.
  • vectors are used for expression of proteins in prokaryotes that comprise constitutive or inducible promoters which govern the protein expression.
  • Classical vectors that are known to the skilled worker are, amongst others, for example pQE30, pASK, pLGM, pGEX, pET, pTrc, pMAL, pUC18, pUC19, pBR322, pACYC184, pLG338, pLG200, M1 13mp, pKC30, pRep4, pHS1 , pHS2, pPLc236, pMBL24, pUR290, plN-1111 13-B1 , Agt1 1 or pBdCI, in Streptomyces plJ101 , plJ364, plJ702 or plJ361 , in Bacillus pUB1 10, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, and series variants thereof.
  • Suitable yeast expression vector comprise for example pYeDesaturased , pMFa, pJRY88, pYES2, pAG-1 , YEp6, YEp13, or pEMBLYe23.
  • Suitable vectors for expression in insect cells are for example Baculovirus expression vectors.
  • Suitable vectors for expression in eukaryotic cells are for example pBluescript, pCDM8, pcDNAI , pcDNA3, pSPORTI , pcDV1 .
  • pQE30 is used as a vector for expression of the chimeric nuclease as referred to herein.
  • Introduction of these vectors into prokaryotic or eukaryotic host cells is performed by conventional transformation, transfection, conjugation, and transduction techniques that all constitute methods known in the prior art for introduction of foreign nucleic acids such as DNA into a host cell.
  • These methods comprise for example lipofection, electroporation, chemically mediated transfer, particle bombardement, calcium phosphate or calcium chloride coprecipitation, DEAE-dextrane mediated transfection, heat shock, appropriate packaging cell lines.
  • the vectors comprising the polynucleotide encoding the chimeric nucleases as referred to herein according to the present invention are used for manufacturing of the chimeric nucleases by conventional techniques that are known to the skilled worker. These techniques include chemical synthesis or recombinant molecular biology techniques.
  • manufacturing of the chimeric nucleases comprises (i) culturing the host cell and (ii) obtaining the chimeric nuclease from said host cell.
  • the chimeric nuclease is obtained by conventional purification techniques from a lysate of host cells.
  • Said purification techniques comprise for example affinity chromatography, ion exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography and/or preparative gel electrophoresis. Details on the testing for the desired enzymatic activity of the chimeric nucleases are described in the examples below.
  • the vectors comprising the polynucleotide encoding the chimeric nucleases as referred to herein according to the present invention are used for highly specific gene targeting efforts.
  • the expressed chimeric nucleases will thereby facilitate the integration of heterologous nucleic acid of interest, for example DNA, such as a transgene, at a predefined site within a target nucleic acid, such as genomic DNA, of the host which preferably is a microorganism, animal, plant, or human.
  • the chimeric nucleases also support homologous recombination events.
  • the chimerich nucleases will be used for targeted transgenesis or gene insertion or gene knock-out or gene inactivation or homologous replacement or knock-in or gene replacement. Said methods are well-known by the skilled worker.
  • the present invention thereby significantly improves the generation of transgenic organisms including transgenic microorganisms, animals plants, or human.
  • Transgenic organisms will be obtained by introduction of
  • the vector comprising the polynucleotide encoding the chimeric nuclease and b) a nucleic acid of interest to be introduced into the host cell genome
  • the chimeric nuclease After introduction of said vector and heterologous nucleic acid of interest into the host cell, the chimeric nuclease will be expressed. Subsequently, the chimeric nuclease will be recruited to the bipartite or tripartite genomic DNA recognition site, thereby allowing cleavage of the genomic DNA by the chimeric nuclease and subsequent integration of the heterologous nucleic acid of interest into the genomic DNA at the preferred site.
  • the present invention is used as a rare cutting endonuclease supporting conventional cloning efforts known in the prior art.
  • a chimeric nuclease according to the present invention comprising a DNA binding domain derived from TALE protein AvrBs3 or AvrBs4, respectively, or variants thereof, a linker, and a cleavage domain derived from the restriction endonuclease Pvull (Pvull wildtype or variants thereof) is engineered by the following steps.
  • the coding sequences or parts thereof for the TALE proteins (AvrBs3 or AvrBs4, respectively), for an amino acid linker (as for example consisting of the amino acids SSVIPNRGVTKQLVK), and for Pvull or single chain Pvull (scPvull) or parts thereof are amplified by conventional PCR using appropriate primer sequences hybridizing to DNA encoding Pvull wildtype or variants thereof.
  • plasmid pENTR-D-avrBs3 or pENTR-D-avrBs4, respectively, is used as template (plasmids described in: Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. (201 1 ).
  • primer sequences designed according to standard procedures encoding a Strep-tag (Strepll; WSHPQFEK) for purification efforts or a linker amino acid sequence are used for generation of PCR fragments encoding a Strep-tag or a linker, respectively, and appropriate restriction sites for ligation with TALE and Pvull PCR fragments into vector pQE30 (Qiagen).
  • the generated PCR fragments are inserted into plasmid pQE30 encoding a C-terminal 6His-tag, by conventional techniques, as for example ligation at appropriate temperatures.
  • the generated plasmid is then transformed into Escherichia coli and propagated in conventional culture medium at appropriate conditions.
  • Transformed cells are harvested and lysed, and generated plasmid is prepared by conventional methods.
  • mutations encoding amino acid substitutions as for example T46G in Pvull, are introduced into the generated vectors via PCR-based directed mutagenesis.
  • the generated plasmids encode a) a chimeric nuclease (TALE-Pvull ; Seq ID No. 5; homodimer FIG. 1 A) harbouring 1 1 17 amino acid residues, or b) a chimeric nuclease, also named single chain Pvull variant (TALE-scPvull ; Seq ID No. 6, FIG.
  • a 25 ml LB medium pre-culture (containing 75 ⁇ g/ml Ampicillin) is inoculated and grown overnight at 37° C. Further, 5 ml of this pre-cultue are added to a 500 ml culture (containing 75 ⁇ g/ml Ampicillin) and the cells are grown until an optical density of 0.6- 0.8 at 600 nm (OD 6 oo)-
  • the protein expression is induced by adding 5 ml of 0.1 M Isopropyl ⁇ -D-l -thiogalactopyranoside (1 mM end concentration) to the 500 ml cell culture. Finally, the cell culture is incubated overnight at 18 °C.
  • the cells are harvested by centrifugation at 5000 g for 15 minutes and the pellet is resuspended in 40 ml STE buffer (10 mM Tris/HCI pH 8, 100 mM NaCI, 0.1 mM EDTA). Following on this, the culture is centrifuged a second time at 5,000 g for 15 minutes Afterwards, the supernatant is discharged and the pellet is stored at - 20 °C for further processing.
  • Pellets are first resuspended in 20 ml high-salt buffer (20 mM KPi pH 7.8, 1 M KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride) and cell lysis is performed on ice by sonication (15 sec pulses for 6 minutes at 50% output) of the cells using a Sonifier 250, Branson. After sonication, the lysate is centrifuged at 48,000 g for 30 minutes at 4 °Cand the supernatant is filtered using a 0.45 ⁇ cellulose acetate filter.
  • the protein purification is performed via immobilized metal assisted chromatography using 1 ml/l cell culture Ni-NTA (Qiagen) as a chelator (His-tag purification). Therefore the column is equilibrated with two column volumes high salt buffer and the lysate is loaded onto the column. The following steps are all done at 4 ° C to avoid protein denaturation.
  • the column is washed twice with 2 ml high salt buffer and 2 ml low salt buffer (20 mM KPi pH 7.2, 300 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride).
  • the protein is eluted with 4x 500 ⁇ elution buffer (20 mM KPi pH 7.8, 500 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride, 250 mM imidazole). From each eluate 15 ⁇ samples are taken and mixed with 3 ⁇ 5x Laemmli loading buffer for further SDS PAGE analyses (FIG. 5A).
  • Fusion protein containing fractions are pooled and further purified via Heparin chromatography. Therefore the pooled fractions are loaded onto a 5ml HiTrapTM Heparin HP Column, washed with one column volume low salt buffer and eluted using a continuous gradient (20 ml) from low salt buffer to elution buffer (20 mM KPi pH 7.8, 1000 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol). The protein elutes corresponding to a buffer with 550 mM KCI. From each eluate 10 ⁇ samples are taken and mixed with 2 ⁇ 5x Laemmli loading buffer for further SDS PAGE analyses (FIG. 5B).
  • the chosen protein fractions are pooled and dialysed (Snakeskin®dialysis tubing, 10 k MWCO) overnight at 4 °C using 30 mM ⁇ pH 7.8, 550 mM KCI, 1 mM EDTA, 1 mM DTT, 60 % glycerol. After dialysis the protein concentration is determined by conventional methods.
  • Example 3 Functional activity assay of TALE-scPvull chimeric nuclease according to examples 1 and 2 with an addressed or a non-addressed DNA substrate
  • the DNA cleavage activity assays are carried out with a 1 :1 ratio of chimeric nuclease TALE-scPvull (8 nM) and DNA substrate (8 nM DNA, 300 ng).
  • reaction mixture is incubated at 37 ° C for 1 , 3, 5, 10, 20, 30, or 60 min, respectively, in buffer containing 20 mM Tris-acetate, 50 mM K-acetate, 2 mM Mg-acetate, pH 7.9. Reaction products are separated on 1 % agarose gels by electrophoresis, stained with ethidium bromide, and visualized by the BioDocAnalyze system.
  • the chimeric nuclease TALE-scPvull prefers by a factor of 10 the addressed (TALE recognition site plus Pvull recognition site; bipartite; FIG. 2B, FIG. 4) over the unaddressed (only Pvull recognition site; Fig. 2A) DNA recognition site (FIG. 3).
  • Figure 1 A shows a homodimer consisting of two TALE-Pvull chimeric nuclease monomers while binding to a tripartite DNA target site comprising one Pvull recognition site and two TALE protein recognition sites.
  • Figure 2B shows a TALE- scPvull chimeric nuclease while binding to a bipartite DNA target site comprising one Pvull recognition site and one TALE protein recognition site, wherein two fused Pvull polypeptides within the cleavage domain form a homodimer.
  • Figure 2A illustrates a single Pvull recognition site (Pvull target) within the DNA which is not addressed by the chimeric nucleases as referred to in the present invention.
  • Figure 2B shows a bipartite DNA recognition site comprising a Pvull recognition site (Pvull target) and a TALE protein recognition site (TALE target) which is addressed by the chimeric nucleases as referred to in the present invention.
  • Figure 3A shows a DNA cleavage assay, wherein purified TALE-scPvull chimeric nuclease was incubated for 1 , 3, 5, 10, 20, 30, or 60 minutes, respectively, at an equimolar amount of 8 nM with DNA encoding the addressed bipartite DNA target site (according to FIG. 2B, SEQ ID No. 7). Since the DNA target site is embedded in a plasmid (sc), DNA binding and subsequent cleavage of the DNA target site results in al linearized plasmid (lin).
  • Figure 3B shows a DNA cleavage assay according to Figure 3A but wherein the DNA encodes the non-addressed only Pvull DNA target site (according to FIG. 2A).
  • M marker DNA
  • U only plasmid without TALE-scPvull).
  • Figure 4 is a cartoon of two TALE-Pvull chimeric nuclease monomers forming a homodimer, while the TALE parts of the monomers exhibit 34 amino acid (aa) repeats each.
  • the TALE parts of the chimeric nuclease monomers are each linked to the mainly alpha-helical structure of Pvull within the cleavage domain of the chimeric nuclease. Homodimerization occurs via interaction of the Pvull parts of the chimeric nuclease monomers.
  • Figure 5A shows the elution fractions E1 to E4 of chimeric nuclease purified using Ni-NTA affinity chromatography. The fractions are loaded onto a 8% SDS gel, separated by electrophoresis, and stained with coomassie.
  • Figure 5B shows the elution fractions A1 , A10, A1 1 , A12, B12, B1 1 , B10, and B9 of chimeric nuclease purified in a second step following Ni-NTA purification via Heparin chromatography (HPLC). The fractions are loaded onto a 8% SDS gel, separated by electrophoresis, and stained with silver.
  • HPLC Heparin chromatography
  • SEQ ID No. 3 Pvull SEQ ID No. 4: Linker SSVIPNRGVTKQLVK
  • SEQ ID No. 7 bipartite/tripartite DNA target site
  • Example 4 Plasmid cleavage assay as functional activity assay of TALE-Pvull chimeric nucleases according to examples 1 and 2 with an addressed or a non- addressed DNA substrate
  • plasmid substrates are generated.
  • the TALE-Pvull target sites according to the present invention are inserted as a cassette into the pAT153 vector.
  • the AvrBs3 recognition site is optimized based on the RVD code (Boch, J. et al. (2009), Science, 326, 1509-1512).
  • As an unaddressed target a pAT153 derived plasmid with just one Pvull site is used.
  • 8 nM substrate are incubated with 8 nM active enzyme (scPvull acts as a monomer) in 20 mM Tris-Ac, 50 or 120, respectively, mM KCI, 1 mM Mg-Ac, pH 7.5 at 37° C. Taking the enzyme dilution into account, the ionic strength of the reaction mixture is between 145-150 mM.
  • the kinetics are analyzed after defined time points (up to 24h) by agarose gel electrophoresis, ethidium bromide gel staining and documentation via the BioDocAna
  • plasmid DNA harbouring an addressed Pvull site are co-incubated with 32 nM of a 900 bp long PCR fragment harbouring an unaddressed Pvull site and with 2 nM, 8 nM, and 320 nM enzyme, respectively.
  • cleavage experiments are carried out with plasmid substrates in which the AvrBs3 recognition sequence is replaced by the AvrBs4 recognition sequence which differ in 8 out of 19 positions from each other.
  • linker 63-L and 28-L are compared, which are 79 or 44 amino acid residues long, respectively, and span the distance between the C-terminus of the repeat region of AvrBs3 and the N- terminus of Pvull (scPvull or wtPvull).
  • Linker 63-L consists of the 63 amino acids residues following the last AvrBs3 DNA-binding repeat and the 16 amino acid residues long linker L (SSVIPNRGVTKQLVKG). In the linker 28-L only 28 amino acid residues following the last repeat of AvrBs3 are present.
  • the corresponding chimeric nucleases are designated AvrBs3-63-L-scPvull or AvrBs3-28-L-scPvull or AvrBs3- 28-L-wtPvull, respectively.
  • the DNA cleavage activity of the fusion proteins is measured with a supercoiled plasmid with an addressed site (T3-6bp-P-6bp-T3) and for comparison with a supercoiled plasmid with an unaddressed Pvull site (-P-).
  • Figure 6 shows that all fusion proteins (8 nM) cleave the plasmid substrate (8 nM) with an addressed site to give a linearized plasmid within 3 minutes at low ionic strength (76 mM). Under the same conditions the plasmid substrate with an unaddressed site is also cleaved, albeit significantly more slowly.
  • the fusion protein with the short linker is much more specific than the fusion protein with the long linker.
  • AvrBs3-28-L-wtPvull does not cleave unaddressed Pvull sites in detectable amounts even at a 10-fold (10x) excess of enzyme (80 nM) over substrate (8 nM).
  • the scPvull variant is somewhat less specific compared to the wtPvull variant (Fig. 7).
  • TALE-Pvull fusion proteins show enhanced specificity at physiological ionic strength.
  • the enzyme in varying concentrations, was challenged with a specific substrate (8 nM plasmid DNA with an addressed Pvull site) and a non-specific substrate (32 nM PCR fragment with an unaddressed Pvull site).
  • a specific substrate 8 nM plasmid DNA with an addressed Pvull site
  • a non-specific substrate 32 nM PCR fragment with an unaddressed Pvull site.
  • Fig. 8 regardless of the relative concentrations of enzyme and substrate (from 0.25:1 to 40:1 ) only cleavage of the addressed site is observed. Even at a 40-fold (40x) excess of enzyme over addressed sites (40:1 ) and long incubation times cleavage of the unaddressed site is not detectable. Even with an excess of substrate over enzyme, complete cleavage of substrate is observed, demonstrating that the TALE-Pvull fusion protein exhibits turnover.
  • Example 5 Plasmid cleavage assay as functional activity assay of TALE-Pvull chimeric nucleases according to examples 1 and 2 harboring a Pvull variant
  • fusion proteins with the AvrBs3 DNA binding repeats are produced according to examples 1 and 2.
  • Cleavage assays are performed on an addressed substrate (T3-6bp-P-6bp-T3).
  • Figure 9 shows that the TALE-Pvull variants are inactive on the addressed substrate.
  • a mixture of both TALE-Pvull variants cleaves the addressed substrate, albeit with a reduced activity compared to the TALE-wtPvull nuclease.
  • TALE-MutH fusion protein (SEQ ID No. 1 1 , Fig. 10) a truncated variant of the TALE protein AvrBs4 (SEQ ID No. 2) is fused to the N-terminal end of MutH (SEQ ID No.12) according to common methods known by a person skilled in the art and analogous to example 1 .
  • MutH is a naturally occurring monomeric site-specific endonuklease, structurally related to Pvull, that can nick the DNA at the nucleotide sequence GATC in un- or hemimethylated DNA.
  • the gene of the truncated TALE variant missing the coding sequence of the first 152 amino acids at the N-terminal end and the last 250 amino acids at the C-terminal end (28 amino acids remain after the last half-repeat), and the gene of MutH, which contains the coding sequence for a C-terminal His-tag (SEQ ID No. 12), are connected and introduced into the expression vector pQE-30 (Qiagen), coding for an N-terminal Strep-tag.
  • the fusion protein is: Strep-tag-TALE-MutH-His-tag.
  • the sequence of the fusion constructs is confirmed by DNA sequencing of the entire coding region.
  • the expression vectors for the recombinant fusion proteins are introduced into the Escherichia coli strain XL1 -Blue (Stratagene). The cells are grown at 37° C to OD at 600 nm of for example 0.7 in LB medium containing 75 pg/ml ampicillin. Protein expression is induced by adding 1 mM isopropyl- -D-thiogalactopyranoside, followed by further growth at 20 ° C overnight.
  • the cells are harvested by centrifugation and resuspended in 20 mM Tris-HCI pH 7.9, 1 M NaCI, 20 mM imidazole, 1 mM PMSF, lysed by sonification and centrifuged for 30 min (>17,000 g) at 4°C to remove cell debris.
  • the His- and Strep-tagged proteins are first purified via Ni 2+ -NTA agarose (Qiagen) by a 1 h incubation of Ni 2+ -NTA agarose with the supernatant at 4°C and washing with resuspension buffer; the protein is eluted with 20 mM Tris-HCI pH 7.9, 1 M NaCI, 200 mM imidazole.
  • the eluted fractions are then transferred to a column with Strep-Tactin Sepharose (IBA) for further purification.
  • IBA Strep-Tactin Sepharose
  • the protein is eluted with 100 mM Tris-HCI pH 7.9, 500 mM NaCI, 2.5 mM Desthiobiotin, dialyzed overnight at 4° C against 10 mM HEPES- KOH pH 7.9, 500 mM KCI, 1 mM EDTA, 100 ⁇ DTT, 50% (v/v) glycerol and stored at -20 °C.
  • the protein concentration is determined by measuring the absorbance at 280 nm using the molar extinction coefficient. Protein purification is monitored by SDS-PAGE analysis. All steps are based on common methods known by a person skilled in the art.
  • Example 8 Plasmid cleavage assay as functional activity assay of TALE-MutH chimeric nuclease according to examples 6 and 7 with an addressed or a non- addressed DNA substrate
  • the substrate plasmid pAT153 is used, which is modified by introducing a DNA cassette with the appropriate target site (Table 1 ).
  • Three kinds of substrates are generated: one addressed substrate and two unaddressed substrates.
  • the two unaddressed substrates contain either the recognition site for the binding module (T) without a nearby MutH recognition site or, at the same location, a MutH recognition site (H) without an adjacent recognition site for a binding module (the substrate plasmid contains in addition 19 other GATC sites).
  • T recognition site for the binding module
  • H MutH recognition site
  • the substrate plasmid contains in addition 19 other GATC sites.
  • 4 nM substrate plasmid and 16 nM enzyme i.e. a 4-fold excess of enzyme over substrate
  • 20 mM Tris-Acetate 120 mM KCI, 1 mM MgCI 2 , pH 7.5 at 37°C. Taking the enzyme dilution into a ount, the ionic strength of the reaction mixture is for example 160 mM (which corresponds to physiological conditions).
  • reaction progress is measured after defined time intervals (1 , 3, 10, 30, 60, 120 minutes) by agarose gel electrophoresis; gels are stained with ethidium bromide, and the fluorescence of DNA bands is visualized with a BioDocAnalyze system (Biometra).
  • the TALE-MutH fusion constructs are specific for the addressed bipartite recognition site, consisting of the TALE target site (AvrBs4 target site) in a defined distance next to a MutH recognition site. Spacer lengths of 1 , 3, 5, 7 and 9 base pairs between the two sites on the addressed substrate are used and it is found that a distance of 3 bp is optimal, but a somewhat larger spacer length (5, 7 and 9) is also accepted.
  • Table 1 DNA cassettes harboring appropriate target sites that were introduced into the plasmid substrates
  • Target sites are underlined and abbreviated with T (AvrBs4) and H (MutH). Numbers indicate spacer lengths in number of base pairs. Sequences are shown in the 5' -> 3' direction for the sense strand.
  • T TGCAGTATAATTAATAATCCACTTCCGTGGCCTCGCTGAGACATG
  • H TATGCGTAGTCAAGCCTAAGTGTAACCCGGATCCTCTGAGTGTGCTGG
  • Example 9 Cleavage assay with fluorescently labeled PCR products for the determination of the strand specificity of TALE-MutH
  • PCR products are generated using a forward and a reverse primer which are 5' labeled with the known fluorophores Atto 488 and Atto 647N, respectively. This means that these PCR products carry different fluorophores on the 5'-ends of the top- and bottom-strand, respectively.
  • the analogous polynucleotide substrate is used for this purpose.
  • the assay is carried out with 20 nM of a 21 1 base pair polynucleotide substrate and 120 nM of TALE-MutH in 20 mM Tris-Acetate, 120 mM KCI, 1 mM MgCI 2 , pH 7.5 at 37° C.
  • the ionic strength of the reaction mixture is for example 160 mM (which corresponds to physiological conditions).
  • the reaction progress is analyzed after defined time intervals (3, 10, 30, 60, 120, 180 minutes) by denaturing polyacrylamide gel electrophoresis; the fluorescence of DNA bands is visualized with the VersaDoc Imaging System (Bio Rad).
  • TALE-MutH nicks the bottom strand with an almost 1000-fold preference over the top strand.
  • FIG. 6 Comparison of the cleavage rates of selected AvrBs3-Pvull fusion proteins under low ionic strength, 76 mM, (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). Fig. 6A shows the cleavage activity of the single-chain Pvull (scPvul l) variant, Fig. 6B that of the Pvull dimer (wtPvull). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme.
  • FIG. 7 Cleavage analysis under physiological ionic strength. Using 20 mM Tris- Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5 (ionic strength of 143 mM) and 10-fold (10x) excess of enzyme, the TALE-scPvull fusion protein (AvrBs3-28-L-scPvull ; top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the TALE-wtPvull fusion protein (AvrBs3-28-L-wtPvull ; bottom, 80 nM enzyme, 8 nM DNA).
  • the TALE-scPvull fusion protein shows a higher cleavage activity with an unaddressed substrate (-P-) than the TALE-wtPvull fusion protein (AvrBs3-28-L-wtPvull ; bottom, 80 n
  • the enzyme shows no cleavage of the unaddressed substrate and complete cleavage of the addressed substrate in an overnight reaction even with 40- fold (40x) excess of AvrBs3-28-L-wtPvull over addressed plasmid (8 nM) and 10-fold (10x) excess over unaddressed PCR fragment (32 nM).
  • the bracket indicates the position, where one would expect the products of cleavage at the unaddressed site.
  • FIG. 9 Plasmid cleavage assay.
  • Supercoiled plasmid DNA with the addressed Pvull site (T3-6bp-P-6bp-T3, 8 nM) is incubated for different times and varying amounts (5x, 25x, 50x) of the TALE-Pvull chimeric nucleases harboring the D30K or K38D Pvull variant, respectively (top), or a mixture of both enzymes (bottom) as indicated in the figure.
  • Samples are analysed by electrophoresis on an agarose gel stained subsequently with ethidium bromide (EtBr).
  • EtBr ethidium bromide
  • FIG. 10 Scheme of the fusion construct TALE-MutH binding to its respective recognition sites (5'->3').
  • the highly specific interaction is mediated mainly by the binding module, the DNA-binding domain of the TALE protein AvrBs4.
  • the monomeric cleavage module, MutH is recruited by the binding module to nick the GATC site in close proximity to the TALE site.
  • no additional linker was introduced; the fusion was done 28 amino acids (shown as line) after the last half-repeat.
  • FIG. 11 Kinetics of DNA-cleavage by TALE-MutH fusion constructs of addressed and unaddressed substrates analyzed with plasmid-cleavage assays using a fourfold excess of enzyme over substrate (16 nM enzyme, 4 nM substrate).
  • FIG. 12 Determination of the strand specificity of TALE-MutH.
  • A Scheme of the reaction: the 21 1 bp polynucleotide substrate harbors the AvrBs4 recognition site (T) and the MutH (H) recognition site separated by a three bp spacer. The substrate is 5' labeled at the top strand and the bottom strand with Atto 488 and Atto 467N, respectively. The expected nicking products have a length of 169 and 38 bp for top and bottom strand nicking, respectively, and can be identified in the electrophoretic analysis by their characteristic fluorescence.
  • B DNA cleavage kinetics of the addressed polynucleotide substrate by TALE-MutH.
  • the nicking products for top and bottom strand are indicated with 169 and 38 bp, respectively.
  • the first lane shows the reaction without MgCI 2 (-; negative control), "nick” serves as a positive control for nicking activity and corresponds to the cleaved PCR substrate.
  • C The graph shows the quantitative evaluation of the experiments shown in (B).
  • the calculated cleavage rate constants for the top strand is 8.4 x 10 "5 min "1 and for the bottom strand 6.1 x 10 " 2 min "1 .
  • the analysis of the strand specificity shows that the bottom strand of the addressed PCR substrate is nicked preferentially by the fusion construct TALE-MutH; for the top strand hardly any nicking is detectable.
  • TALE-MutH for the top strand hardly any nicking is detectable.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention describes chimeric nucleases consisting of a DNA binding site derived from a TALE protein, a linker, and a cleavage module derived from a restriction endonuclease which are used for gene targeting efforts. The chimeric nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising TALE recognition site(s) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented.

Description

Patent application
Title
Chimeric Nucleases for Gene Targeting Background of the invention
Gene targeting, i.e. targeted gene knockout or gene replacement, requires nucleases that recognize unique sequences and cleave DNA highly specifically, and thereby initiate non-homologous end joining which can inactivate genes, or, when a template DNA is present, leads to a replacement of a genetic element by homologous recombination. The specificity of these highly specific nucleases must be such that only a single double-strand DNA (dsDNA) cut is made in a complex genome. A widely used approach is to use fusion proteins consisting of zinc fingers (ZFs) or transcription activator-like effector (TALE) proteins as programmable DNA binding modules with the non-specific DNA cleavage domain of the restriction endonuclease (synonymically also designated as restriction enzyme herein below) Fokl. Recent systematic analyses have shown that the zinc finger nucleases (ZFNs) occasionally cleave non-addressed sequences ("off-target sites"). Furthermore, it is believed that the DNA cleavage domain of the restriction endonuclease Fokl has principal limitations.
The goal of gene targeting is targeted gene knockout or gene replacement. One of the most promising and simple strategies is based on homologous recombination, in which the DNA sequence of interest is supplied in trans to stimulate site-specific recombination. Ideally, the gene of interest is deleted, modified or replaced in its natural context while leaving the rest of the genome untouched. A major obstacle for the homologous recombination-driven approach is the low efficiency of natural recombination between an introduced DNA and the homologous chromosomal target. Remarkably, it was discovered that making a specific double-strand break in the target sequence increases the frequency of homologous recombination by several orders of magnitude. To facilitate such double-strand break-induced recombination, zinc finger nucleases, engineered homing endonucleases and chimeric restriction endonucleases have been created and used in experimental systems. Chimeric nucleases therefore hold great potential for gene targeting as they allow to cleave DNA at a chosen target sequence.
Technical problem
However, known chimeric nucleases (synonymically also designated as fusion proteins herein below) also cleave prolifically at off-target sites, resulting in unacceptable toxicity, and are not programmable. Toxicity due to off-target cleavage is a major issue in all gene targeting efforts. The off-target cleavage activity of the known chimeric nucleases is related to missing suppression of restriction enzyme cleavage at restriction enzyme cleavage sites at the DNA that are not addressed by the highly specific DNA binding module of the fusion protein. Thus, there is a need for chimeric nucleases that do not cleave at off-target sites in the DNA but highly specifically address bipartite or tripartite DNA target sites resulting in significantly reduced toxicity in gene targeting efforts.
Solution of the problem
The aforementioned technical problem is solved by creation of chimeric nucleases consisting of a restriction enzyme cleavage module and transcription activator-like effector (TALE) protein(s) as DNA binding module(s) that in contrast to the prior art exhibit increased preference and specificity to bipartite or tripartite target sites without cleaving restriction enzyme off-target sites and that are programmable.
Moreover, surprisingly it is found in the invention that amino acid substitutions introduced into a restriction enzyme that forms the cleavage module of the chimeric nuclease, like for example Pvull that cleaves double-stranded DNA at the sequence CAGjCTG, suppress cleavage by the restriction enzyme at restriction enzyme cleavage sites that are not addressed by the highly specific TALE protein(s) as DNA binding module(s) of the fusion protein.
Description of the invention The present invention relates to a chimeric nuclease which comprises the following components:
1 ) a module comprising at least a DNA binding domain derived from a TALE protein,
2) a linker composed of at least five amino acid residues, and
3) a module comprising at least a cleavage domain derived from a restriction endonuclease,
wherein said chimeric nuclease functionally interacts only with DNA that comprises both a DNA recognition site for a DNA binding domain derived from a TALE protein and a DNA recognition site for a cleavage domain derived from a restriction endonuclease, and wherein said cleavage domain cleaves the DNA upon binding of the chimeric nuclease to the DNA.
Transcription activator-like effector (TALE) proteins combine two advantages: they are programmable and recognize their DNA target sequence highly specific. TAL effectors (TALEs) are proteins secreted by Xanthomonas bacteria via their type III secretion system when they infect various plant species. These proteins can bind promoter sequences in the host and activate the expression of host genes that aid bacterial infection. These proteins are interesting both for their role in disease, for example of important crop species, and the relative ease of retargeting them to bind new DNA sequences. Similar proteins are found in the pathogenic bacteria Ralstonia solanacearum. The most distinctive characteristic of TALE proteins is a central repeat domain containing between 1 .5 and 33.5 repeats that are usually 34 residues in length (the C-terminal repeat is generally shorter and referred to as a "half repeat").
A typical repeat sequence is LTPEQVVAIASHDGGKQALETVQRLLPVLCQAHG, but the residues at the 12th and 13th positions are hypervariable (these two amino acids are also known as the repeat variable diresidue or RVD). It has been shown that there is a simple relationship between the identity of these two residues in sequential repeats and sequential DNA bases in the TAL effector's target site. There appears to be a one-to-one correspondence between the identity of two critical amino acids in each repeat and each DNA base in the target sequence.
Preferably, TALE proteins from which the DNA binding domain of the chimeric nucleases according to the invention herein is derived are selected from the Avirulence protein AvrBs3 (SEQ ID No. 1 ) and/or AvrBs4 (SEQ ID No. 2), for example of Xanthomonas euvesicatoria or Xanthomonas vesicatoria, respectively.
Restriction endonucleases (also called restriction enzymes) as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides. In contrast, some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical. Moreover, also preferably the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and/or reduced catalytic activity when compared to the wildtype restriction endonuclease.
According to the knowledge that restriction endonucleases, particularly type II restriction endonucleases, bind as a homodimer to DNA regularly, the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonucleases subunits. Preferably, in accordance with the present invention the cleavage modules referred to herein have a reduced capability of forming homodimers in the absence of the DNA recognition site, thereby preventing unspecific DNA binding. Therefore, a functional homodimer is only formed upon recruitment of chimeric nucleases monomers to the specific DNA recognition sites. Preferably, the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease. The preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides. Preferably, the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity. The type IIP restriction endonucleases as referred to herein are preferably selected from the group consisting of: Pvull, EcoRV, BamHI, Bcnl, BfaSORF1835P, Bfil, Bgll, Bglll, BpuJI, Bse634l, BsoBI, BspD6l, BstYI, Cfrl OI, Ecl18kl, EcoO109l, EcoRI, EcoRII, EcoRV, EcoR124l, EcoR124ll, HinPI I, Hindi, Hindlll, Hpy99l, Hpy188l, Mspl, Muni, Mval, Nael, NgoMIV, Notl, OkrAI, Pabl, Pad, PspGI, Sau3AI, Sdal, Sfil, SgrAI, Thai, VvuYORF266P, Ddel, Eco57l, Haelll, Hhall, Hindll, and Ndel. Most preferably, the restriction endonuclease according to the invention is Pvull or a genetically modified variant thereof. Moreover, preferably Pvull or a variant thereof comprised in the cleavage module of the chimeric nuclease exhibit at least one of the following amino acid substitutions D5K, L12E, P14G, H15D, Q17E, K25D, K25E, T46G, N62D, K78E, H83A, Y94F, K155E, K174E, or combinations thereof, or amino acid deletions delta 1 -15, delta 1 -25 (positions referring to wildtype Pvull). The introduction of said amino acid substitutions or deletions results in cleavage of the DNA by the chimeric TALE-Pvull fusion protein only at sequences that are addressed by the TALE protein (SEQ ID No. 7). Said amino acid substitutions are useful as single substitutions or all possible combinations thereof for the purpose of the present invention, and may be replaced by functionally similar amino acids.
In a particular preferred embodiment, the wildtype Pvull amino acid sequence referred to herein is according to SEQ ID No. 3 or is a modified variant thereof which differs from SEQ ID No. 3 by at least one amino acid substitution and/or deletion or addition. Preferably, the amino acid sequence of such modified variant of Pvull is at least 70% identical to wildtype Pvull and exhibits essentially the same DNA binding and cleavage characteristics as Pvull according to SEQ ID No. 3.
The DNA binding domain and the cleavage domain according to the present invention are separated within the chimeric nuclease by a linker which is preferably a flexible structure of sufficient length allowing interaction with the addressed DNA binding site and cleavage at the DNA restriction site. Preferably, the flexible linker structures as referred to the invention herein consist of five to twenty amino acids. More preferably, the linker comprises at least six or up to ten or more amino acids. In one embodiment, said linker has an amino acid sequence as shown in SEQ ID No. 4 (SSVIPNRGVTKQLVK).
According to the present invention, preferably a DNA binding domain derived from a TALE protein and a cleavage domain derived from a restriction endonuclease are fused by an amino acid linker to generate a specific nuclease. More preferably, said TALE proteins are selected from AvrBs3 or AvrBs4, and said restriction endonucleases are selected from type IIP restriction endonucleases. Most preferably, the type IIP restriction endonuclease is Pvull. While Pvull adds an extra element of specificity when combined with TALE proteins, TALE-Pvull chimeric nucleases according to the invention are designed such that only Pvull sites with adjacent zinc finger (ZF) binding sites which constitute the binding sites of TALE proteins are cleaved, meaning that only addressed Pvull sites are cleaved but no off-target Pvull sites. To achieve this, suitable linkers and introduced amino acid substitutions and/or deletions or additions into Pvull that alter activity and increase fidelity are selected, thereby making DNA cleavage by Pvull dependent on the DNA binding by the TALE protein. Therefore, neither the DNA binding domain nor the cleavage domain alone shall be sufficient for allowing functional interaction of the chimeric nuclease with DNA.
Preferably, in order to be functional, the chimeric nuclease will form a homodimer comprising two chimeric nuclease monomers having the structure of the chimeric nucleases of the invention. The cleavage domains of these monomers (TALE-Pvull) interact with each other and thereby mediate formation of the homodimer. The dimerized chimeric nucleases then recognize a specific bipartite or tripartite DNA binding site comprising one or two recognition site(s) of the DNA binding module and a recognition site of the cleavage module (SEQ ID No. 7). For example, homodimerization is mediated by a cleavage module derived from the restriction endonuclease Pvull (FIG. 1 A, FIG. 4; SEQ ID No. 5). Alternatively, the chimeric nucleases which form a dimer comprise DNA binding modules derived from different TALE proteins. For example, one monomer exhibits a DNA binding module derived from TALE protein AvrBs3, and the second monomer exhibits a DNA binding module derived from TALE protein AvrBs4.
Alternatively, in a so-called single chain variant (TALE-scPvull) the cleavage domain comprises two Pvull derived amino acid sequences, each forming a Pvull monomer, which are fused via a linker according to the present invention to a DNA binding domain derived from a TALE protein (FIG. 1 B). According to the invention, the bipartite or tripartite DNA target for the chimeric nucleases comprising a DNA binding domain derived from the TALE protein AvrBs3 or AvrBs4, a linker, and a cleavage domain derived from the restriction endonuclease Pvull is given in the accompanying SEQ ID No. 7.
As referred to the present invention, programmed TALE-Pvull chimeric nucleases with a predefined specificity as it is required for gene targeting at a locus of interest, is achieved by replacement of AvrBs3 or AvrBs4 by other TALE proteins as DNA binding module as described herein.
The present invention also relates to a vector comprising the polynucleotide encoding the chimeric nuclease as referred to herein. Said vectors are obtained by conventional polymerase chain reaction (PCR) techniques using appropriate primer sequences and subsequent cloning methods. Said techniques and methods are well- known by skilled persons and belong to the prior art. Suitable cloning vectors for the purpose of the invention comprise plasmids, viral or retroviral vectors, phages, and artificial chromosomes such as bacterial or yeast artificial chromosomes. Preferably, vectors used in the invention comprise selectable markers for propagation and/or selection in a host organism as well as expression control sequences allowing expression of the operatively linked polynucleotide in prokaryotic or eukaryotic host cells. Such vectors are well-known to the skilled worker and particularly include vectors that are able to replicate in microorganisms, thereby ensuring efficient cloning in bacteria, yeasts, and fungi. Preferably, vectors are used for expression of proteins in prokaryotes that comprise constitutive or inducible promoters which govern the protein expression. Classical vectors that are known to the skilled worker are, amongst others, for example pQE30, pASK, pLGM, pGEX, pET, pTrc, pMAL, pUC18, pUC19, pBR322, pACYC184, pLG338, pLG200, M1 13mp, pKC30, pRep4, pHS1 , pHS2, pPLc236, pMBL24, pUR290, plN-1111 13-B1 , Agt1 1 or pBdCI, in Streptomyces plJ101 , plJ364, plJ702 or plJ361 , in Bacillus pUB1 10, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, and series variants thereof. Suitable yeast expression vector comprise for example pYeDesaturased , pMFa, pJRY88, pYES2, pAG-1 , YEp6, YEp13, or pEMBLYe23. Suitable vectors for expression in insect cells are for example Baculovirus expression vectors. Suitable vectors for expression in eukaryotic cells are for example pBluescript, pCDM8, pcDNAI , pcDNA3, pSPORTI , pcDV1 . Most preferably, pQE30 is used as a vector for expression of the chimeric nuclease as referred to herein.
Introduction of these vectors into prokaryotic or eukaryotic host cells is performed by conventional transformation, transfection, conjugation, and transduction techniques that all constitute methods known in the prior art for introduction of foreign nucleic acids such as DNA into a host cell. These methods comprise for example lipofection, electroporation, chemically mediated transfer, particle bombardement, calcium phosphate or calcium chloride coprecipitation, DEAE-dextrane mediated transfection, heat shock, appropriate packaging cell lines.
Manufacturing of chimeric nucleases according to the present invention
The vectors comprising the polynucleotide encoding the chimeric nucleases as referred to herein according to the present invention are used for manufacturing of the chimeric nucleases by conventional techniques that are known to the skilled worker. These techniques include chemical synthesis or recombinant molecular biology techniques. Preferably, manufacturing of the chimeric nucleases comprises (i) culturing the host cell and (ii) obtaining the chimeric nuclease from said host cell. Preferably, the chimeric nuclease is obtained by conventional purification techniques from a lysate of host cells. Said purification techniques comprise for example affinity chromatography, ion exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography and/or preparative gel electrophoresis. Details on the testing for the desired enzymatic activity of the chimeric nucleases are described in the examples below.
Use of chimeric nucleases and vectors encoding them for gene targeting
The vectors comprising the polynucleotide encoding the chimeric nucleases as referred to herein according to the present invention are used for highly specific gene targeting efforts. The expressed chimeric nucleases will thereby facilitate the integration of heterologous nucleic acid of interest, for example DNA, such as a transgene, at a predefined site within a target nucleic acid, such as genomic DNA, of the host which preferably is a microorganism, animal, plant, or human. Furthermore, the chimeric nucleases also support homologous recombination events. Thus, the chimerich nucleases will be used for targeted transgenesis or gene insertion or gene knock-out or gene inactivation or homologous replacement or knock-in or gene replacement. Said methods are well-known by the skilled worker.
The present invention thereby significantly improves the generation of transgenic organisms including transgenic microorganisms, animals plants, or human. Transgenic organisms will be obtained by introduction of
a) the vector comprising the polynucleotide encoding the chimeric nuclease and b) a nucleic acid of interest to be introduced into the host cell genome
into the host cell by conventional transformation, transfection, conjugation, or transduction techniques that all constitute methods known in the prior art for introduction of heterologous nucleic acids such as DNA into a host cell.
After introduction of said vector and heterologous nucleic acid of interest into the host cell, the chimeric nuclease will be expressed. Subsequently, the chimeric nuclease will be recruited to the bipartite or tripartite genomic DNA recognition site, thereby allowing cleavage of the genomic DNA by the chimeric nuclease and subsequent integration of the heterologous nucleic acid of interest into the genomic DNA at the preferred site.
Moreover, the present invention is used as a rare cutting endonuclease supporting conventional cloning efforts known in the prior art.
Examples
The examples below illustrate the present invention. However, they shall not be regarded as scope limiting.
Example 1 : Cloning of TALE-Pvull and TALE-scPvull chimeric nucleases
A chimeric nuclease according to the present invention comprising a DNA binding domain derived from TALE protein AvrBs3 or AvrBs4, respectively, or variants thereof, a linker, and a cleavage domain derived from the restriction endonuclease Pvull (Pvull wildtype or variants thereof) is engineered by the following steps. First, the coding sequences or parts thereof for the TALE proteins (AvrBs3 or AvrBs4, respectively), for an amino acid linker (as for example consisting of the amino acids SSVIPNRGVTKQLVK), and for Pvull or single chain Pvull (scPvull) or parts thereof are amplified by conventional PCR using appropriate primer sequences hybridizing to DNA encoding Pvull wildtype or variants thereof. For amplification of sequences encoding TALE proteins AvrBs3 or AvrBs4, respectively, primers according to SEQ ID No. 8 and SEQ ID No. 9 are used for synthesis of PCR fragments encoding TALE- Pvull (2423 bp) harbouring a long variant of TALE or primers according to SEQ ID No. 8 and SEQ ID No. 10 for synthesis of PCR fragments encoding TALE-scPvull (2319 bp) harbouring a short variant of TALE. For both variants of TALE, plasmid pENTR-D-avrBs3 or pENTR-D-avrBs4, respectively, is used as template (plasmids described in: Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. (201 1 ). Assembly of custom TALE-type DNA binding domains by modular cloning. Nucleic Acids Res. 39, 5790-5799; Mussolino, C, Morbitzer, R., Lutge, F., Dannemann, N., Lahaye, T. & Cathomen, T. (201 1 ). A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res.). Furthermore, primer sequences designed according to standard procedures encoding a Strep-tag (Strepll; WSHPQFEK) for purification efforts or a linker amino acid sequence are used for generation of PCR fragments encoding a Strep-tag or a linker, respectively, and appropriate restriction sites for ligation with TALE and Pvull PCR fragments into vector pQE30 (Qiagen). Subsequently, the generated PCR fragments are inserted into plasmid pQE30 encoding a C-terminal 6His-tag, by conventional techniques, as for example ligation at appropriate temperatures. The generated plasmid is then transformed into Escherichia coli and propagated in conventional culture medium at appropriate conditions. Transformed cells are harvested and lysed, and generated plasmid is prepared by conventional methods. Alternatively, mutations encoding amino acid substitutions, as for example T46G in Pvull, are introduced into the generated vectors via PCR-based directed mutagenesis. The generated plasmids encode a) a chimeric nuclease (TALE-Pvull ; Seq ID No. 5; homodimer FIG. 1 A) harbouring 1 1 17 amino acid residues, or b) a chimeric nuclease, also named single chain Pvull variant (TALE-scPvull ; Seq ID No. 6, FIG. 1 B) herein, harbouring 992 amino acid residues, respectively, while the chimeric nuclease of a) exhibits the following domain architecture N-Strepll-TALE/AvrBs3(aa153-914)-Linker-Pvull(aa2- 157;T46G)-Pvull(aa2-157;T46G)-6His-C, and the chimeric nuclease of b) exhibits the following domain architecture N-Strepll-TALE/AvrBs4(aa153-949)-Linker-Pvull(aa2- 157;T46G)-6His-C (N: N-terminus; C: C-terminus; aa: amino acid residues, numbered according to wildtype Pvull ; T46G: amino acid substitutions).
Example 2: Purification of chimeric nucleases
For the protein expression of chimeric nucleases according to the present invention a 25 ml LB medium pre-culture (containing 75 μg/ml Ampicillin) is inoculated and grown overnight at 37° C. Further, 5 ml of this pre-cultue are added to a 500 ml culture (containing 75 μg/ml Ampicillin) and the cells are grown until an optical density of 0.6- 0.8 at 600 nm (OD6oo)- The protein expression is induced by adding 5 ml of 0.1 M Isopropyl β-D-l -thiogalactopyranoside (1 mM end concentration) to the 500 ml cell culture. Finally, the cell culture is incubated overnight at 18 °C. The cells are harvested by centrifugation at 5000 g for 15 minutes and the pellet is resuspended in 40 ml STE buffer (10 mM Tris/HCI pH 8, 100 mM NaCI, 0.1 mM EDTA). Following on this, the culture is centrifuged a second time at 5,000 g for 15 minutes Afterwards, the supernatant is discharged and the pellet is stored at - 20 °C for further processing.
Pellets are first resuspended in 20 ml high-salt buffer (20 mM KPi pH 7.8, 1 M KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride) and cell lysis is performed on ice by sonication (15 sec pulses for 6 minutes at 50% output) of the cells using a Sonifier 250, Branson. After sonication, the lysate is centrifuged at 48,000 g for 30 minutes at 4 °Cand the supernatant is filtered using a 0.45μιτι cellulose acetate filter.
The protein purification is performed via immobilized metal assisted chromatography using 1 ml/l cell culture Ni-NTA (Qiagen) as a chelator (His-tag purification). Therefore the column is equilibrated with two column volumes high salt buffer and the lysate is loaded onto the column. The following steps are all done at 4 ° C to avoid protein denaturation. The column is washed twice with 2 ml high salt buffer and 2 ml low salt buffer (20 mM KPi pH 7.2, 300 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride). Finally the protein is eluted with 4x 500 μΙ elution buffer (20 mM KPi pH 7.8, 500 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol, 1 mM phenylmethylsulfonyl fluoride, 250 mM imidazole). From each eluate 15 μΙ samples are taken and mixed with 3 μΙ 5x Laemmli loading buffer for further SDS PAGE analyses (FIG. 5A).
Fusion protein containing fractions are pooled and further purified via Heparin chromatography. Therefore the pooled fractions are loaded onto a 5ml HiTrap™ Heparin HP Column, washed with one column volume low salt buffer and eluted using a continuous gradient (20 ml) from low salt buffer to elution buffer (20 mM KPi pH 7.8, 1000 mM KCI, 0.5 mM EDTA, 1 mM DTT, 0.01 % Lubrol). The protein elutes corresponding to a buffer with 550 mM KCI. From each eluate 10 μΙ samples are taken and mixed with 2 μΙ 5x Laemmli loading buffer for further SDS PAGE analyses (FIG. 5B). Finally, the chosen protein fractions are pooled and dialysed (Snakeskin®dialysis tubing, 10 k MWCO) overnight at 4 °C using 30 mM ΚΠ pH 7.8, 550 mM KCI, 1 mM EDTA, 1 mM DTT, 60 % glycerol. After dialysis the protein concentration is determined by conventional methods.
Example 3: Functional activity assay of TALE-scPvull chimeric nuclease according to examples 1 and 2 with an addressed or a non-addressed DNA substrate
For DNA cleavage assays, the different DNA target sequences containing one Pvull recognition site (= non-addressed site; FIG. 2A) or one Pvull recognition site plus TALE recognition site(s) (= addressed site; FIG. 2B, SEQ ID No. 7), respectively, were introduced into plasmid pAT153 (= DNA substrate). The DNA cleavage activity assays are carried out with a 1 :1 ratio of chimeric nuclease TALE-scPvull (8 nM) and DNA substrate (8 nM DNA, 300 ng). The reaction mixture is incubated at 37 ° C for 1 , 3, 5, 10, 20, 30, or 60 min, respectively, in buffer containing 20 mM Tris-acetate, 50 mM K-acetate, 2 mM Mg-acetate, pH 7.9. Reaction products are separated on 1 % agarose gels by electrophoresis, stained with ethidium bromide, and visualized by the BioDocAnalyze system.
The chimeric nuclease TALE-scPvull prefers by a factor of 10 the addressed (TALE recognition site plus Pvull recognition site; bipartite; FIG. 2B, FIG. 4) over the unaddressed (only Pvull recognition site; Fig. 2A) DNA recognition site (FIG. 3).
Description of the drawings
Figure 1. Figure 1 A shows a homodimer consisting of two TALE-Pvull chimeric nuclease monomers while binding to a tripartite DNA target site comprising one Pvull recognition site and two TALE protein recognition sites. Figure 2B shows a TALE- scPvull chimeric nuclease while binding to a bipartite DNA target site comprising one Pvull recognition site and one TALE protein recognition site, wherein two fused Pvull polypeptides within the cleavage domain form a homodimer.
Figure 2. Figure 2A illustrates a single Pvull recognition site (Pvull target) within the DNA which is not addressed by the chimeric nucleases as referred to in the present invention. Figure 2B shows a bipartite DNA recognition site comprising a Pvull recognition site (Pvull target) and a TALE protein recognition site (TALE target) which is addressed by the chimeric nucleases as referred to in the present invention.
Figure 3. Figure 3A shows a DNA cleavage assay, wherein purified TALE-scPvull chimeric nuclease was incubated for 1 , 3, 5, 10, 20, 30, or 60 minutes, respectively, at an equimolar amount of 8 nM with DNA encoding the addressed bipartite DNA target site (according to FIG. 2B, SEQ ID No. 7). Since the DNA target site is embedded in a plasmid (sc), DNA binding and subsequent cleavage of the DNA target site results in al linearized plasmid (lin). Figure 3B shows a DNA cleavage assay according to Figure 3A but wherein the DNA encodes the non-addressed only Pvull DNA target site (according to FIG. 2A). (M = marker DNA; U = only plasmid without TALE-scPvull).
Figure 4. Figure 4 is a cartoon of two TALE-Pvull chimeric nuclease monomers forming a homodimer, while the TALE parts of the monomers exhibit 34 amino acid (aa) repeats each. The TALE parts of the chimeric nuclease monomers are each linked to the mainly alpha-helical structure of Pvull within the cleavage domain of the chimeric nuclease. Homodimerization occurs via interaction of the Pvull parts of the chimeric nuclease monomers.
Figure 5. Figure 5A shows the elution fractions E1 to E4 of chimeric nuclease purified using Ni-NTA affinity chromatography. The fractions are loaded onto a 8% SDS gel, separated by electrophoresis, and stained with coomassie. Figure 5B shows the elution fractions A1 , A10, A1 1 , A12, B12, B1 1 , B10, and B9 of chimeric nuclease purified in a second step following Ni-NTA purification via Heparin chromatography (HPLC). The fractions are loaded onto a 8% SDS gel, separated by electrophoresis, and stained with silver.
The following sequences referred to herein are shown in the accompanying sequence listing:
SEQ ID No. 1 : TALE AvrBs3
SEQ ID No. 2: TALE AvrBs4
SEQ ID No. 3: Pvull SEQ ID No. 4: Linker SSVIPNRGVTKQLVK
SEQ ID No. 5: TALE-Pvull
SEQ ID No. 6: TALE-scPvull
SEQ ID No. 7: bipartite/tripartite DNA target site
SEQ ID No. 8: TALE forward
SEQ ID No. 9: TALE reverse- 1
SEQ ID No. 10: TALE reverse-2
Example 4: Plasmid cleavage assay as functional activity assay of TALE-Pvull chimeric nucleases according to examples 1 and 2 with an addressed or a non- addressed DNA substrate
To characterize the cleavage rates of the different TALE-Pvull nucleases with different targets, plasmid substrates are generated. For this purpose, the TALE-Pvull target sites according to the present invention are inserted as a cassette into the pAT153 vector. The AvrBs3 recognition site is optimized based on the RVD code (Boch, J. et al. (2009), Science, 326, 1509-1512). As an unaddressed target a pAT153 derived plasmid with just one Pvull site is used. For the analysis of the kinetics with near-stoichiometric concentrations of substrate and enzyme, 8 nM substrate are incubated with 8 nM active enzyme (scPvull acts as a monomer) in 20 mM Tris-Ac, 50 or 120, respectively, mM KCI, 1 mM Mg-Ac, pH 7.5 at 37° C. Taking the enzyme dilution into account, the ionic strength of the reaction mixture is between 145-150 mM. The kinetics are analyzed after defined time points (up to 24h) by agarose gel electrophoresis, ethidium bromide gel staining and documentation via the BioDocAna|yze system (Biometra). For competition assays, 8 nM plasmid DNA harbouring an addressed Pvull site are co-incubated with 32 nM of a 900 bp long PCR fragment harbouring an unaddressed Pvull site and with 2 nM, 8 nM, and 320 nM enzyme, respectively. Furthermore, for testing the specificity of the TALE-Pvull nuclease, also cleavage experiments are carried out with plasmid substrates in which the AvrBs3 recognition sequence is replaced by the AvrBs4 recognition sequence which differ in 8 out of 19 positions from each other.
As the length of the linker between the binding and cleavage modules plays an important role for the activity and specificity of a fusion protein, two linkers 63-L and 28-L are compared, which are 79 or 44 amino acid residues long, respectively, and span the distance between the C-terminus of the repeat region of AvrBs3 and the N- terminus of Pvull (scPvull or wtPvull). Linker 63-L consists of the 63 amino acids residues following the last AvrBs3 DNA-binding repeat and the 16 amino acid residues long linker L (SSVIPNRGVTKQLVKG). In the linker 28-L only 28 amino acid residues following the last repeat of AvrBs3 are present. The corresponding chimeric nucleases are designated AvrBs3-63-L-scPvull or AvrBs3-28-L-scPvull or AvrBs3- 28-L-wtPvull, respectively. The DNA cleavage activity of the fusion proteins is measured with a supercoiled plasmid with an addressed site (T3-6bp-P-6bp-T3) and for comparison with a supercoiled plasmid with an unaddressed Pvull site (-P-). Figure 6 shows that all fusion proteins (8 nM) cleave the plasmid substrate (8 nM) with an addressed site to give a linearized plasmid within 3 minutes at low ionic strength (76 mM). Under the same conditions the plasmid substrate with an unaddressed site is also cleaved, albeit significantly more slowly. The fusion protein with the short linker is much more specific than the fusion protein with the long linker.
At an ionic strength of 143 mM, AvrBs3-28-L-wtPvull does not cleave unaddressed Pvull sites in detectable amounts even at a 10-fold (10x) excess of enzyme (80 nM) over substrate (8 nM). The scPvull variant is somewhat less specific compared to the wtPvull variant (Fig. 7). Thus, TALE-Pvull fusion proteins show enhanced specificity at physiological ionic strength.
For a quantitative determination of the specificity of AvrBs3-28-L-wtPvull, the enzyme, in varying concentrations, was challenged with a specific substrate (8 nM plasmid DNA with an addressed Pvull site) and a non-specific substrate (32 nM PCR fragment with an unaddressed Pvull site). As shown in Fig. 8, regardless of the relative concentrations of enzyme and substrate (from 0.25:1 to 40:1 ) only cleavage of the addressed site is observed. Even at a 40-fold (40x) excess of enzyme over addressed sites (40:1 ) and long incubation times cleavage of the unaddressed site is not detectable. Even with an excess of substrate over enzyme, complete cleavage of substrate is observed, demonstrating that the TALE-Pvull fusion protein exhibits turnover.
Example 5: Plasmid cleavage assay as functional activity assay of TALE-Pvull chimeric nucleases according to examples 1 and 2 harboring a Pvull variant
To engineer Pvull variants that are active only as heterodimers, two enzyme variants harboring amino acid substitution D30K or K38D, respectively, were produced according to examples 1 and 2 [AvrBs3-Pvull (D30K); AvrBs3-Pvull (K38D)]. In each homodimeric variant similarly charged residues come in contact and should inhibit nuclease activity. In contrast, the heterodimeric Pvull resembles the wtPvull interface, with the exception that the similarly charged amino acid residues are now located in the same subunit. The heterodimeric Pvull variant should be active. In order to characterize the Pvull variants in the context of the TALE-Pvull fusion construct, fusion proteins with the AvrBs3 DNA binding repeats are produced according to examples 1 and 2. Cleavage assays are performed on an addressed substrate (T3-6bp-P-6bp-T3). Figure 9 shows that the TALE-Pvull variants are inactive on the addressed substrate. In contrast, a mixture of both TALE-Pvull variants cleaves the addressed substrate, albeit with a reduced activity compared to the TALE-wtPvull nuclease.
Example 6: Cloning of TALE-MutH chimeric nucleases
For the TALE-MutH fusion protein (SEQ ID No. 1 1 , Fig. 10) a truncated variant of the TALE protein AvrBs4 (SEQ ID No. 2) is fused to the N-terminal end of MutH (SEQ ID No.12) according to common methods known by a person skilled in the art and analogous to example 1 . MutH is a naturally occurring monomeric site-specific endonuklease, structurally related to Pvull, that can nick the DNA at the nucleotide sequence GATC in un- or hemimethylated DNA. The gene of the truncated TALE variant, missing the coding sequence of the first 152 amino acids at the N-terminal end and the last 250 amino acids at the C-terminal end (28 amino acids remain after the last half-repeat), and the gene of MutH, which contains the coding sequence for a C-terminal His-tag (SEQ ID No. 12), are connected and introduced into the expression vector pQE-30 (Qiagen), coding for an N-terminal Strep-tag. Thus, the fusion protein is: Strep-tag-TALE-MutH-His-tag. The sequence of the fusion constructs is confirmed by DNA sequencing of the entire coding region.
Example 7: Protein expression and purification of TALE-MutH chimeric nucleases
The expression vectors for the recombinant fusion proteins are introduced into the Escherichia coli strain XL1 -Blue (Stratagene). The cells are grown at 37° C to OD at 600 nm of for example 0.7 in LB medium containing 75 pg/ml ampicillin. Protein expression is induced by adding 1 mM isopropyl- -D-thiogalactopyranoside, followed by further growth at 20 ° C overnight. The cells are harvested by centrifugation and resuspended in 20 mM Tris-HCI pH 7.9, 1 M NaCI, 20 mM imidazole, 1 mM PMSF, lysed by sonification and centrifuged for 30 min (>17,000 g) at 4°C to remove cell debris. The His- and Strep-tagged proteins are first purified via Ni2+-NTA agarose (Qiagen) by a 1 h incubation of Ni2+-NTA agarose with the supernatant at 4°C and washing with resuspension buffer; the protein is eluted with 20 mM Tris-HCI pH 7.9, 1 M NaCI, 200 mM imidazole. The eluted fractions are then transferred to a column with Strep-Tactin Sepharose (IBA) for further purification. After washing with 100 mM Tris-HCI pH 7.9, 1 M NaCI the protein is eluted with 100 mM Tris-HCI pH 7.9, 500 mM NaCI, 2.5 mM Desthiobiotin, dialyzed overnight at 4° C against 10 mM HEPES- KOH pH 7.9, 500 mM KCI, 1 mM EDTA, 100 μΜ DTT, 50% (v/v) glycerol and stored at -20 °C. The protein concentration is determined by measuring the absorbance at 280 nm using the molar extinction coefficient. Protein purification is monitored by SDS-PAGE analysis. All steps are based on common methods known by a person skilled in the art.
Example 8: Plasmid cleavage assay as functional activity assay of TALE-MutH chimeric nuclease according to examples 6 and 7 with an addressed or a non- addressed DNA substrate
To test the activity and specificity of the fusion proteins, the substrate plasmid pAT153 is used, which is modified by introducing a DNA cassette with the appropriate target site (Table 1 ). Three kinds of substrates are generated: one addressed substrate and two unaddressed substrates. The addressed substrate contains the recognition site for the binding module (AvrBs4 (T)) and a MutH (H) recognition site separated by spacers of different lengths (T-x-H; x=1 , 3, 5, 7, or 9 bp, respectively). The two unaddressed substrates contain either the recognition site for the binding module (T) without a nearby MutH recognition site or, at the same location, a MutH recognition site (H) without an adjacent recognition site for a binding module (the substrate plasmid contains in addition 19 other GATC sites). For the analysis of the cleavage reactions, 4 nM substrate plasmid and 16 nM enzyme (i.e. a 4-fold excess of enzyme over substrate) are incubated in 20 mM Tris-Acetate, 120 mM KCI, 1 mM MgCI2, pH 7.5 at 37°C. Taking the enzyme dilution into a ount, the ionic strength of the reaction mixture is for example 160 mM (which corresponds to physiological conditions). The reaction progress is measured after defined time intervals (1 , 3, 10, 30, 60, 120 minutes) by agarose gel electrophoresis; gels are stained with ethidium bromide, and the fluorescence of DNA bands is visualized with a BioDocAnalyze system (Biometra).
As shown in Figure 1 1 , the TALE-MutH fusion constructs are specific for the addressed bipartite recognition site, consisting of the TALE target site (AvrBs4 target site) in a defined distance next to a MutH recognition site. Spacer lengths of 1 , 3, 5, 7 and 9 base pairs between the two sites on the addressed substrate are used and it is found that a distance of 3 bp is optimal, but a somewhat larger spacer length (5, 7 and 9) is also accepted.
Table 1 : DNA cassettes harboring appropriate target sites that were introduced into the plasmid substrates
Target sites are underlined and abbreviated with T (AvrBs4) and H (MutH). Numbers indicate spacer lengths in number of base pairs. Sequences are shown in the 5' -> 3' direction for the sense strand.
Cassettes for addressed substrates:
T-1 -H TGCAGTATAATTAATAATCCACTTGGATCCTCGCTCCGAGACATG
T-3-H TGCAGTATAATTAATAATCCACTTCCGGATCCTCGCTGAGACATG
T-5-H TGCAGTATAATTAATAATCCACTTGACCGGATCCTCGCTGACATG
T-7-H TGCAGTATAATTAATAATCCACTTGAGTCCGGATCCTCGCACATG
T-9-H TGCAGTATAATTAATAATCCACTTGAGTATCCGGATCCTCACATG
Cassettes for unaddressed control substrates:
T: TGCAGTATAATTAATAATCCACTTCCGTGGCCTCGCTGAGACATG H: TATGCGTAGTCAAGCCTAAGTGTAACCCGGATCCTCTGAGTGTGCTGG
TAATC
Example 9: Cleavage assay with fluorescently labeled PCR products for the determination of the strand specificity of TALE-MutH
To investigate whether TALE-MutH nicks a DNA substrate in the top or the bottom strand (defined by the asymmetric recognition sequence of the DNA binding module) PCR products are generated using a forward and a reverse primer which are 5' labeled with the known fluorophores Atto 488 and Atto 647N, respectively. This means that these PCR products carry different fluorophores on the 5'-ends of the top- and bottom-strand, respectively. Since the plasmid assays has shown that best catalytic activity of TALE-MutH on the addressed substrate is obtained with a three base pairs spacer between the AvrBs4 and the MutH recognition site (T-3-H according to table 1 ), the analogous polynucleotide substrate is used for this purpose. The assay is carried out with 20 nM of a 21 1 base pair polynucleotide substrate and 120 nM of TALE-MutH in 20 mM Tris-Acetate, 120 mM KCI, 1 mM MgCI2, pH 7.5 at 37° C. The ionic strength of the reaction mixture is for example 160 mM (which corresponds to physiological conditions). The reaction progress is analyzed after defined time intervals (3, 10, 30, 60, 120, 180 minutes) by denaturing polyacrylamide gel electrophoresis; the fluorescence of DNA bands is visualized with the VersaDoc Imaging System (Bio Rad).
Depending on which strand is preferentially nicked, the electrophoretic analysis of the nicking reaction yields a different characteristic fluorescence image. As shown in Figure 12, TALE-MutH nicks the bottom strand with an almost 1000-fold preference over the top strand.
Description of the drawings
Figure 6. Comparison of the cleavage rates of selected AvrBs3-Pvull fusion proteins under low ionic strength, 76 mM, (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). Fig. 6A shows the cleavage activity of the single-chain Pvull (scPvul l) variant, Fig. 6B that of the Pvull dimer (wtPvull). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme.
Figure 7. Cleavage analysis under physiological ionic strength. Using 20 mM Tris- Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5 (ionic strength of 143 mM) and 10-fold (10x) excess of enzyme, the TALE-scPvull fusion protein (AvrBs3-28-L-scPvull ; top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the TALE-wtPvull fusion protein (AvrBs3-28-L-wtPvull ; bottom, 80 nM enzyme, 8 nM DNA). There is a more pronounced appearance of nicked (oc) and linearized (lin) DNA with AvrBs3-28-L-scPvull. There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-wtPvull. Figure 8. Competition cleavage experiments under physiological ionic strength. Shown is the cleavage pattern with sc plasmid DNA (with an addressed site, 8 nM) in competition with a PCR fragment (unP) with an unaddressed site, 32 nM). The experiment was carried out with variable excess of enzyme over plasmid substrate (0.25x, 10x, 40x). The enzyme shows no cleavage of the unaddressed substrate and complete cleavage of the addressed substrate in an overnight reaction even with 40- fold (40x) excess of AvrBs3-28-L-wtPvull over addressed plasmid (8 nM) and 10-fold (10x) excess over unaddressed PCR fragment (32 nM). The bracket indicates the position, where one would expect the products of cleavage at the unaddressed site.
Figure 9. Plasmid cleavage assay. Supercoiled plasmid DNA with the addressed Pvull site (T3-6bp-P-6bp-T3, 8 nM) is incubated for different times and varying amounts (5x, 25x, 50x) of the TALE-Pvull chimeric nucleases harboring the D30K or K38D Pvull variant, respectively (top), or a mixture of both enzymes (bottom) as indicated in the figure. Samples are analysed by electrophoresis on an agarose gel stained subsequently with ethidium bromide (EtBr). The D30K or K38D Pvull variants by themselves are inactive, but cleave DNA by forming heterodimers in a 1 :1 mixture.
Figure 10. Scheme of the fusion construct TALE-MutH binding to its respective recognition sites (5'->3'). The highly specific interaction is mediated mainly by the binding module, the DNA-binding domain of the TALE protein AvrBs4. The monomeric cleavage module, MutH, is recruited by the binding module to nick the GATC site in close proximity to the TALE site. For the TALE-MutH construct no additional linker was introduced; the fusion was done 28 amino acids (shown as line) after the last half-repeat.
Figure 11. Kinetics of DNA-cleavage by TALE-MutH fusion constructs of addressed and unaddressed substrates analyzed with plasmid-cleavage assays using a fourfold excess of enzyme over substrate (16 nM enzyme, 4 nM substrate). (A) Catalytic activity of TALE-MutH with a plasmid substrate containing an AvrBs4 (T) and a MutH (H) recognition site separated by x base pairs (T-x-H; x= 1 , 3, 5, 7, 9). (B) Catalytic activity on the unaddressed substrate plasmids (controls) containing either an AvrBs4 recognition site without a nearby MutH recognition site (T) or no AvrBs4 recognition site (H). Each of the substrates has 19 additional GATC sites distributed over the plasmid. The position of the bands representing supercoiled (sc), open circular (oc) and linear (lin) forms of the plasmid are indicated. The first lane shows the reaction without MgCI2 (-MgCI2; negative control), "nick" and "lin" serve as positive controls for cleavage activity and correspond to the open circular and linear form of the plasmid, respectively. (C) Calculated cleavage rate constants for TALE-MutH nicking the above-mentioned substrates. The electrophoretic analysis shows that the addressed substrate plasmid is nicked by the fusion construct TALE-MutH, whereas the unaddressed substrate plasmids remain uncleaved. The graph shows the quantitative evaluation of the experiments shown in A and B. The enzyme exhibits the best activity on the addressed substrate with the three base pairs spacer and no activity with the stand-alone TALE (T) or MutH (H) recognition site. The quantitative analyses reveal the following apparent cleavage rate constants: 3.6 x 10"2 min"1 (T-3- H), 0.3 x 10"2 min"1 (T-5-H), 0.6 x 10"2 min"1 (T-7-H), 8.9 x 10"4 min"1 (T-9-H); the cleavage rates for T-1 -H, T and H are below the detection limit of approximately 4 x 10"5 min"1.
Figure 12. Determination of the strand specificity of TALE-MutH. (A) Scheme of the reaction: the 21 1 bp polynucleotide substrate harbors the AvrBs4 recognition site (T) and the MutH (H) recognition site separated by a three bp spacer. The substrate is 5' labeled at the top strand and the bottom strand with Atto 488 and Atto 467N, respectively. The expected nicking products have a length of 169 and 38 bp for top and bottom strand nicking, respectively, and can be identified in the electrophoretic analysis by their characteristic fluorescence. (B) DNA cleavage kinetics of the addressed polynucleotide substrate by TALE-MutH. The nicking products for top and bottom strand are indicated with 169 and 38 bp, respectively. The first lane shows the reaction without MgCI2 (-; negative control), "nick" serves as a positive control for nicking activity and corresponds to the cleaved PCR substrate. (C) The graph shows the quantitative evaluation of the experiments shown in (B). The calculated cleavage rate constants for the top strand is 8.4 x 10"5 min"1 and for the bottom strand 6.1 x 10" 2 min"1. The analysis of the strand specificity shows that the bottom strand of the addressed PCR substrate is nicked preferentially by the fusion construct TALE-MutH; for the top strand hardly any nicking is detectable. The following sequences referred to herein are shown in the accompanying sequence listing:
SEQ ID No. 11 : TALE-MutH
SEQ ID No. 12: MutH

Claims

Claims
1 . A chimeric nuclease which comprises the following components:
- a module comprising at least a DNA binding domain derived from a TALE protein,
- a linker composed of at least five amino acid residues, and
- a module comprising at least a cleavage domain derived from a restriction endonuclease,
wherein said chimeric nuclease functionally interacts only with DNA that comprises both a DNA recognition site for a DNA binding domain derived from a TALE protein and a DNA recognition site for a cleavage domain derived from a restriction endonuclease, and wherein said cleavage domain cleaves the DNA upon binding of the chimeric nuclease to the DNA.
2. The chimeric nuclease of claim 1 , wherein said cleavage domain is derived from a type IIP restriction endonuclease.
3. The chimeric nuclease of any one of claims 1 to 2, wherein said cleavage domain is derived from a restriction endonuclease which exhibits reduced DNA binding and/or reduced catalytic activity when compared to the wild type restriction endonuclease.
4. The chimeric nuclease of any one of claims 1 to 3, wherein said cleavage domain is derived from Pvull.
5. The chimeric nuclease of claim 4, wherein said cleavage domain comprise at least one of following modifications in Pvull : amino acid substitutions D5K, L12E, P14G, H15D, Q17E, K25D, K25E, T46G, N62D, K78E, H83A, Y94F, K155E, or K174E, respectively, or combinations thereof, or amino acid deletions delta 1 -15 or delta 1 -25.
6. The chimeric nuclease of any one of claims 1 to 5, wherein said DNA binding module exhibits reduced or no catalytic activity.
7. The chimeric nuclease of any one of claim 1 to 6, wherein said DNA binding domain is derived from a TALE protein.
8. The chimeric nuclease of claim 7, wherein said DNA binding domain is derived from TALE protein AvrBs3 and/or AvrBs4.
9. The chimeric nuclease of any one of claims 1 to 7, wherein said linker essentially consists of 5 to 20 amino acids.
10. The chimeric nuclease of any one of claims 1 to 9, wherein said linker has an amino acid sequence as shown in SEQ ID No. 7 (SSVIPNRGVTKQLVK).
1 1 . A vector encoding the chimeric nuclease of any one of claims 1 to 10.
12. A chimeric nuclease according to claim 12, wherein the chimeric nuclease recognizes a bipartite or tripartite DNA target site comprising one Pvull recognition site and one or two TALE protein recognition site(s) according to SEQ ID No. 7.
13. A method for manufacturing a chimeric nuclease according to any one of claims 1 to 12.
14. A method manufacturing a chimeric nuclease according to claim 13, wherein manufacturing comprises the following steps:
(i) Transformation of a vector encoding a chimeric nuclease into a microorganism,
(ii) cultivation of the transformed microorganism while inducing expression of the chimeric nuclease,
(iii) harvesting and lysis of the microorganism,
(iv) purification of the chimeric nuclease from lysed microorganism cells.
15. Use of a chimeric nuclease according to any one of claims 1 to 1 1 for gene targeting of a microorganism, or an animal tissue or isolated cell thereof, or a plant, or a plant part or isolated cell thereof, or a human.
16. A non-human organism comprising the chimeric nuclease or a vector encoding the chimeric nuclease by any one of claims 1 to 12.
17. A non-human organism according to claim 16, wherein the organism is a microorganism, or an animal tissue or isolated cell thereof, or a plant, or a plant part or isolated cell thereof.
PCT/EP2012/068939 2011-09-26 2012-09-26 Chimeric nucleases for gene targeting Ceased WO2013045480A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11182725.9 2011-09-26
EP11182725.9A EP2573173B1 (en) 2011-09-26 2011-09-26 Chimeric nucleases for gene targeting

Publications (1)

Publication Number Publication Date
WO2013045480A1 true WO2013045480A1 (en) 2013-04-04

Family

ID=47227764

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/068939 Ceased WO2013045480A1 (en) 2011-09-26 2012-09-26 Chimeric nucleases for gene targeting

Country Status (2)

Country Link
EP (1) EP2573173B1 (en)
WO (1) WO2013045480A1 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2818867A1 (en) 2013-06-27 2014-12-31 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies conjugated to at least one nucleic acid molecule and their use in multiplex immuno-detection assays
WO2015092460A1 (en) 2013-12-18 2015-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) New gene mutations for the diagnosis of arthrogryposis multiplex congenita and congenital peripheral neuropathies disease
WO2016066671A1 (en) 2014-10-29 2016-05-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for treating resistant cancers using progastrin inhibitors
WO2016128523A1 (en) 2015-02-12 2016-08-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting the responsiveness of a patient affected with malignant hematological disease to chemotherapy treatment and methods of treatment of such disease
WO2016142427A1 (en) 2015-03-10 2016-09-15 INSERM (Institut National de la Santé et de la Recherche Médicale) Method ank kit for reprogramming somatic cells
WO2017136049A1 (en) * 2016-02-02 2017-08-10 Sangamo Biosciences, Inc. Compositions for linking dna-binding domains and cleavage domains
WO2018069232A1 (en) 2016-10-10 2018-04-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting the risk of having cardiac hypertrophy
WO2018172570A1 (en) 2017-03-24 2018-09-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Gfi1 inhibitors for the treatment of hyperglycemia
EP3526326A4 (en) * 2016-10-12 2020-07-29 The Regents of The University of Colorado, A Body Corporate NEW MANIPULATED AND CHIMARY NUCLEASES
WO2020178193A1 (en) 2019-03-01 2020-09-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Method of treatment of sarcoidosis
WO2020260899A1 (en) * 2019-06-27 2020-12-30 Azeria Therapeutics Limited Screen for inhibitors
WO2021156329A1 (en) 2020-02-05 2021-08-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment of cancer disease by targeting an epigenetic factor
WO2021260139A1 (en) 2020-06-25 2021-12-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment and diagnostic of pathological conditions associated with intense stress
WO2022049273A1 (en) 2020-09-07 2022-03-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment of inflammatory bowel diseases
WO2022096633A1 (en) 2020-11-06 2022-05-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosis and treating polycystic ovary syndrome (pcos)
WO2022112469A1 (en) 2020-11-27 2022-06-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosis and monitoring of toxic epidermal necrolysis
WO2022218998A1 (en) 2021-04-13 2022-10-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for treating hepatitis b and d virus infection
WO2024170505A1 (en) 2023-02-13 2024-08-22 Institut National de la Santé et de la Recherche Médicale Methods of treatment of iron overload associated diseases
WO2024223402A1 (en) 2023-04-24 2024-10-31 Institut National de la Santé et de la Recherche Médicale Biallelic gene mutations for the diagnosis of neonatal systemic hypertension
WO2025003461A1 (en) 2023-06-30 2025-01-02 Institut National de la Santé et de la Recherche Médicale Methods of treatment of metabolic disorders

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014207246A1 (en) * 2013-06-27 2014-12-31 INSERM (Institut National de la Santé et de la Recherche Médicale) New polymorphisms for the diagnosis of idiopathic scoliosis disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110201118A1 (en) * 2010-06-14 2011-08-18 Iowa State University Research Foundation, Inc. Nuclease activity of tal effector and foki fusion protein

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110201118A1 (en) * 2010-06-14 2011-08-18 Iowa State University Research Foundation, Inc. Nuclease activity of tal effector and foki fusion protein

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
ALFRED PINGOUD ET AL: "Generation of Novel Nucleases with Extended Specificity by Rational and Combinatorial Strategies", CHEMBIOCHEM, vol. 12, no. 10, 4 July 2011 (2011-07-04), pages 1495 - 1500, XP055020991, ISSN: 1439-4227, DOI: 10.1002/cbic.201100055 *
B. SCHIERLING ET AL: "A novel zinc-finger nuclease platform with a sequence-specific cleavage module", NUCLEIC ACIDS RESEARCH, 1 December 2011 (2011-12-01), XP055020990, ISSN: 0305-1048, DOI: 10.1093/nar/gkr1112 *
BOCH, J. ET AL., SCIENCE, vol. 326, 2009, pages 1509 - 1512
C. MUSSOLINO ET AL: "A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity", NUCLEIC ACIDS RESEARCH, vol. 39, no. 21, 3 August 2011 (2011-08-03), pages 9283 - 9293, XP055021128, ISSN: 0305-1048, DOI: 10.1093/nar/gkr597 *
EISENSCHMIDT KRISTIN ET AL: "Developing a programmed restriction endonuclease for highly specific DNA cleavage", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 33, no. 22, 1 January 2005 (2005-01-01), pages 7039 - 7047, XP002383230, ISSN: 0305-1048, DOI: 10.1093/NAR/GKI1009 *
I. FONFARA ET AL: "Creating highly specific nucleases by fusion of active restriction endonucleases and catalytically inactive homing endonucleases", NUCLEIC ACIDS RESEARCH, 29 September 2011 (2011-09-29), XP055012639, ISSN: 0305-1048, DOI: 10.1093/nar/gkr788 *
MORBITZER, R.; ELSAESSER, J.; HAUSNER, J.; LAHAYE, T.: "Assembly of custom TALE-type DNA binding domains by modular cloning", NUCLEIC ACIDS RES., vol. 39, 2011, pages 5790 - 5799, XP002689132, DOI: doi:10.1093/nar/gkr151
MUSSOLINO, C.; MORBITZER, R.; LUTGE, F.; DANNEMANN, N.; LAHAYE, T.; CATHOMEN, T.: "A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity", NUCLEIC ACIDS RES., 2011
PINGOUD A ET AL: "Type II restriction endonucleases: structure and mechanism", CMLS CELLULAR AND MOLECULAR LIFE SCIENCES, BIRKHÄUSER-VERLAG, BA, vol. 62, no. 6, 1 March 2005 (2005-03-01), pages 685 - 707, XP019200964, ISSN: 1420-9071, DOI: 10.1007/S00018-004-4513-1 *
TING LI ET AL: "TAL nucleases (TALNs): hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 39, no. 1, 1 January 2011 (2011-01-01), pages 359 - 372, XP002659529, ISSN: 0305-1048, [retrieved on 20100810], DOI: 10.1093/NAR/GKQ704 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2818867A1 (en) 2013-06-27 2014-12-31 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies conjugated to at least one nucleic acid molecule and their use in multiplex immuno-detection assays
WO2015092460A1 (en) 2013-12-18 2015-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) New gene mutations for the diagnosis of arthrogryposis multiplex congenita and congenital peripheral neuropathies disease
WO2016066671A1 (en) 2014-10-29 2016-05-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for treating resistant cancers using progastrin inhibitors
WO2016128523A1 (en) 2015-02-12 2016-08-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting the responsiveness of a patient affected with malignant hematological disease to chemotherapy treatment and methods of treatment of such disease
WO2016142427A1 (en) 2015-03-10 2016-09-15 INSERM (Institut National de la Santé et de la Recherche Médicale) Method ank kit for reprogramming somatic cells
WO2017136049A1 (en) * 2016-02-02 2017-08-10 Sangamo Biosciences, Inc. Compositions for linking dna-binding domains and cleavage domains
JP2019503198A (en) * 2016-02-02 2019-02-07 サンガモ セラピューティクス, インコーポレイテッド Composition for linking a DNA binding domain and a cleavage domain
EP3411056A4 (en) * 2016-02-02 2019-10-02 Sangamo Therapeutics, Inc. COMPOSITIONS FOR BINDING DNA BINDING DOMAINS AND CLEAVAGE DOMAINS
US10724020B2 (en) 2016-02-02 2020-07-28 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
JP7012650B2 (en) 2016-02-02 2022-01-28 サンガモ セラピューティクス, インコーポレイテッド Composition for linking DNA binding domain and cleavage domain
US11920169B2 (en) 2016-02-02 2024-03-05 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
EP3769775A3 (en) * 2016-02-02 2021-03-17 Sangamo Therapeutics, Inc. Compositions for linking dna-binding domains and cleavage domains
JP2022051772A (en) * 2016-02-02 2022-04-01 サンガモ セラピューティクス, インコーポレイテッド Composition for linking DNA binding domain and cleavage domain
WO2018069232A1 (en) 2016-10-10 2018-04-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting the risk of having cardiac hypertrophy
EP3526326A4 (en) * 2016-10-12 2020-07-29 The Regents of The University of Colorado, A Body Corporate NEW MANIPULATED AND CHIMARY NUCLEASES
WO2018172570A1 (en) 2017-03-24 2018-09-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Gfi1 inhibitors for the treatment of hyperglycemia
WO2020178193A1 (en) 2019-03-01 2020-09-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Method of treatment of sarcoidosis
WO2020260899A1 (en) * 2019-06-27 2020-12-30 Azeria Therapeutics Limited Screen for inhibitors
WO2021156329A1 (en) 2020-02-05 2021-08-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment of cancer disease by targeting an epigenetic factor
WO2021260139A1 (en) 2020-06-25 2021-12-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment and diagnostic of pathological conditions associated with intense stress
WO2022049273A1 (en) 2020-09-07 2022-03-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods of treatment of inflammatory bowel diseases
WO2022096633A1 (en) 2020-11-06 2022-05-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosis and treating polycystic ovary syndrome (pcos)
WO2022112469A1 (en) 2020-11-27 2022-06-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosis and monitoring of toxic epidermal necrolysis
WO2022218998A1 (en) 2021-04-13 2022-10-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for treating hepatitis b and d virus infection
WO2024170505A1 (en) 2023-02-13 2024-08-22 Institut National de la Santé et de la Recherche Médicale Methods of treatment of iron overload associated diseases
WO2024223402A1 (en) 2023-04-24 2024-10-31 Institut National de la Santé et de la Recherche Médicale Biallelic gene mutations for the diagnosis of neonatal systemic hypertension
WO2025003461A1 (en) 2023-06-30 2025-01-02 Institut National de la Santé et de la Recherche Médicale Methods of treatment of metabolic disorders

Also Published As

Publication number Publication date
EP2573173B1 (en) 2015-11-11
EP2573173A1 (en) 2013-03-27

Similar Documents

Publication Publication Date Title
WO2013045480A1 (en) Chimeric nucleases for gene targeting
US11555181B2 (en) Engineered cascade components and cascade complexes
JP6127297B2 (en) Targeted integration into the ZP15 locus
US10975406B2 (en) Directed endonucleases for repeatable nucleic acid cleavage
CA2787494C (en) Targeted genomic alteration
CA2660485C (en) Zinc finger nuclease-mediated homologous recombination
IL263375A (en) Methods and compositions for integration of an exogenous sequence within the genome of plants
JP2015510778A (en) RNA-directed DNA cleavage by Cas9-crRNA complex
CN103620027B (en) nuclease fusion protein and application thereof
US20260035679A1 (en) Genome editing technique
Chen et al. Targeted gene mutation in plants
CN113795588A (en) Methods for scar-free introduction of targeted modifications in targeting vectors
HK1178907A (en) Targeted genomic alteration

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12791438

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12791438

Country of ref document: EP

Kind code of ref document: A1