WO2013037068A1 - Method for treatment of disorders of the gastrointestinal system - Google Patents

Method for treatment of disorders of the gastrointestinal system Download PDF

Info

Publication number
WO2013037068A1
WO2013037068A1 PCT/CA2012/050642 CA2012050642W WO2013037068A1 WO 2013037068 A1 WO2013037068 A1 WO 2013037068A1 CA 2012050642 W CA2012050642 W CA 2012050642W WO 2013037068 A1 WO2013037068 A1 WO 2013037068A1
Authority
WO
WIPO (PCT)
Prior art keywords
synthetic stool
stool preparation
strains
preparation
synthetic
Prior art date
Application number
PCT/CA2012/050642
Other languages
French (fr)
Inventor
Emma Allen-Vercoe
Elaine Olga PETROF
Original Assignee
Queen's University At Kingston
Kingston General Hospital
University Of Guelph
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Queen's University At Kingston, Kingston General Hospital, University Of Guelph filed Critical Queen's University At Kingston
Priority to CA2848762A priority Critical patent/CA2848762C/en
Priority to US14/344,981 priority patent/US20140363397A1/en
Priority to EP12831311.1A priority patent/EP2744890A4/en
Publication of WO2013037068A1 publication Critical patent/WO2013037068A1/en
Priority to US15/492,770 priority patent/US20170296596A1/en
Priority to US16/710,187 priority patent/US20200237831A1/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745Bifidobacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747Lactobacilli, e.g. L. acidophilus or L. brevis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/12Antidiarrhoeals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/145Clostridium

Definitions

  • This invention relates to a synthetic stool preparation and methods of use thereof for treating disorders associated with dysbiosis of the gastrointestinal tract, such as Clostridium difficile infection, including recurrent Clostridium difficile infection.
  • Clostridium difficile infection is a bacterial infectious disease of the
  • CDI Clostridium difficile
  • CDI a toxin-producing Gram- positive anaerobic, spore-forming bacillus.
  • CDI accounts for 15-25% of antibiotic-associated diarrhea (Bartlett, J.G. and Gerding, D.N., Clin. Infect. Dis. 2008, 46, Suppl 1 :S12-8). It occurs most commonly when patients receive antibiotics which alter or eradicate their enteric gut bacteria, allowing overgrowth of C. difficile.
  • Recurrent CDI is defined as complete resolution of CDI while on appropriate therapy, followed by recurrence of CDI after treatment has been stopped (Bakken, J.S., Anaerobe 2009, 15:285-9).
  • CDI is one of the primary hospital-acquired infections and is a significant infectious disease problem in the U.S., Canada and worldwide. Unfortunately, few effective treatments exist for those patients with multiple recurrences of CDI. Recommended therapy for CDI consists of either metronidazole or oral vancomycin (Cohen, S.H. et al., Infect. Control Hosp. Epidemiol. 2010, 31 :431-55). However, antibiotics are not always effective, and recurrences and relapses are common after antibiotic treatment.
  • fecal bacteriotherapy or "stool transplant” (infusing donor stool into the intestine of the recipient to re-establish normal bacterial flora or microbiota, i.e., bacterial flora or microbiota associated with a healthy state)(Bakken, J.S., Anaerobe 2009, 15:285-9; Rohlke, F. et al., J. Clin.
  • novel synthetic stool preparations for treating disorders of the gastrointestinal tract, e.g., disorders associated with dysbiosis.
  • Methods of use of the synthetic stool preparations as well as methods of making the preparations are also provided herein.
  • a novel synthetic stool preparation comprising a mixture of bacterial strains.
  • the novel synthetic stool preparation of the invention includes at least one of the bacterial strains described herein, e.g., at least one of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14 below, or at least one strain having all of the identifying
  • the synthetic stool preparation of the invention includes two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14; or two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more strains having all of the identifying characteristics of two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14.
  • the synthetic stool preparation includes some or all of the bacterial strains listed in Table 1. In yet other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2a. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 7. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 9. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 10. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 1 1.
  • the synthetic stool preparation includes some or all of the bacterial strains listed in Table 12. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 13. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 14. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Tables 9a-9g.
  • synthetic stool preparations comprise bacterial strains selected from strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or from strains having all of the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B.
  • synthetic stool preparations comprise bacterial strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or bacterial strains having the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B.
  • the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which produces butyrate, at least one Bacteroides spp. strain, at least one Clostridium cluster XlVa group bacterial strain, at least one Bifidobacterium longum bacterial strain, at least one Lachnospiraceae bacterial strain and/or at least one bacterial strain which is antagonistic towards C. difficile (e.g., prevents or inhibits sporulation of C. difficile, neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B).
  • C. difficile e.g., prevents or inhibits sporulation of C. difficile, neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B).
  • At least one of the bacterial strains in the mixture is not antibiotic resistant, for example not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime.
  • one or more of the bacterial strains in the mixture is antibiotic resistant, for example resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime.
  • up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to an antibiotic.
  • up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to two or three antibiotics.
  • the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of at least one single bacterial species. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a single bacterial species. In another embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a first bacterial species and more than one strain of a second bacterial species; or, more than one strain of a first, a second and a third bactierial species; and so on.
  • synthetic stool preparations comprise a mixture of bacterial strains which includes at least one strain which is antagonistic towards Clostridium difficile.
  • the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which inhibits or prevents sporulation of Clostridium difficile.
  • the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one bacterial strain is Roseburia intestinalis strain 31 FAA, or a strain having all of the identifying characteristics of Roseburia intestinalis strain 31 FAA.
  • the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B.
  • the synthetic stool preparation comprises a mixture of bacterial strains, wherein the mixture comprises at least one bacterial strain selected from the group consisting of strain 13LG (Eubacterium limosum), strain 31 FAA (Eubacterium limosum), F.prausnitzii, Roseburia spp., Eubacterium rectale, B.ovatus, P. distasonis, Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Blautia spp., Blautia producta, Dorea spp., R.torques, Bifidobacterium longum, Eubacterium hadrum,
  • Anaerostipes coli Clostridium aldenense, Clostridium hathewayi, Clostridium symbiosum, Clostridium orbiscindens, Clostridium citroniae, Clostridium thermocellum, Ruminococcus obeum, Ruminococcus productus, Ruminococcus torques, Roseburia inulinovorans, Blautia coccoides, Dorea sp., Sutterella sp., Dialister invisus, Bifidobacterium pseudocatenulatum, and strains having all of the identifying characteristics of these strains.
  • the synthetic stool preparation further comprises a carrier.
  • the synthetic stool preparation further comprises a prebiotic, insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative.
  • the synthetic stool preparation may be made or provided in chemostat medium.
  • the synthetic stool preparation is made or provided in saline, e.g., 0.9% saline. It will be understood that any carrier or solution which does not impair viability of the bacteria and is compatible with administration to a subject may be used.
  • the synthetic stool preparation is made or provided under reduced atmosphere, i.e., in the absence of oxygen.
  • the synthetic stool preparation may be made or provided under N 2 , C0 2 , H 2 , or a mixture thereof, optionally with controlled levels of partial pressure of N 2 :C0 2 : H2.
  • the synthetic stool preparations provided herein may be used for treating or preventing a number of disorders of the gastrointestinal tract, including dysbiosis,
  • Clostridium difficile infection recurrent Clostridium difficile infection, prevention of recurrence of Clostridium difficile infection, treatment of Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and diverticular disease.
  • the synthetic stool preparations may also be used for the treatment of food poisoning, such as food poisoning caused by pathogenic Escherichia coli (e.g., Escherichia coli 0157, EHEC, EPEC, AIEC, EAggEC, ETEC), Salmonella, Clostridium (e.g., Clostridium perfringens, Clostridium botulinum), Listeria monocytogenes, Staphylococcus (e.g., Staph, aureus), Bacillus cereus, Campylobacter (e.g., Campylobacter jejuni, Campylobacter coli), Shigella spp.,
  • pathogenic Escherichia coli e.g., Escherichi
  • a method for treating a disorder associated with dysbiosis of the gastrointestinal tract comprising administering the synthetic stool preparation of the invention to a subject in need thereof.
  • administration is via rectal enema by the colonoscopic route.
  • a colonoscope is inserted into the cecum of the subject; optionally, a sample of fecal material is suctioned from the area; a first portion (e.g., approximately half) of the synthetic stool preparation is deposited adjacent to the cecum using a syringe attached to the colonoscope; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon using the syringe as the colonoscope is withdrawn.
  • the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation.
  • the subject may also be treated with a colon cleansing agent before administration of the synthetic stool preparation.
  • administration is oral, e.g., freeze-dried synthetic stool preparation or synthetic stool preparation in capsule or tablet form is administered.
  • a method for treating Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof.
  • a method for treating recurrent Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof and a method for preventing recurrence of Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof.
  • Methods for treating Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and/or diverticular disease using the synthetic stool preparations of the invention are also provided.
  • inflammation is reduced in the subject after administration of a synthetic stool preparation of the invention.
  • C. difficile toxin e.g., toxin A or toxin B
  • C. difficile toxin is neutralized after administration of a synthetic stool preparation of the invention, or a subject is protected against C. difficile toxin after administration of a synthetic stool preparation of the invention.
  • a method for treating inflammation comprising administering a synthetic stool preparation of the invention to a subject in need thereof.
  • the inflammation is associated with dysbiosis of the gastrointestinal tract.
  • the synthetic stool preparation may be administered via rectal enema by the colonoscopic route, or orally.
  • the synthetic stool preparation is adapted for administration via rectal enema by the colonoscopic route.
  • the synthetic stool preparation is adapted for administration orally, e.g., in capsule or tablet form.
  • the synthetic stool preparation may be freeze-dried.
  • kits for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising the synthetic stool preparation of the invention are also provided herein.
  • the kits may further comprise instructions for use thereof.
  • the kit may include at least one bacterial strain selected from strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or from strains having all of the identifying characteristics of strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14.
  • the kit includes 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains selected from strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains having all of the identifying characteristics of 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14.
  • the kit includes some or all of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or some or all of a group of strains having all of the identifying characteristics of corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14.
  • Methods of preparation and methods of use of the synthetic stool preparations are also provided.
  • a method for preparing the synthetic stool preparation of the invention wherein the bacterial strains are grown in a chemostat containing chemostat medium, under reduced atmosphere with controlled levels of partial pressure of N 2 :C0 2 : H2, and controlled acidity (pH) to replicate human colonic gastrointestinal tract.
  • Bacterial strains which have not been isolated previously are also provided.
  • isolated bacterial strains which are Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Eubacterium limosum, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, or strains having all of the identifying characteristics thereof.
  • Use of the isolated bacterial strains to provide a synthetic stool preparation, and synthetic stool preparations comprising one or more novel isolated bacterial strain are also provided.
  • Figure 1 shows a single-stage chemostat vessel developed by modifying a Multifors fermentation system which was used for growing the isolated bacterial strains as described herein.
  • Figure 2 shows the full-length or partial (where indicated) 16S rRNA sequences obtained from bacterial strains isolated as described herein. Sequence identifications were performed using GreenGenes (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi); the highest % hit is displayed in the figure.
  • Figure 3 shows results of bioinformatics analysis of various microbiota samples taken from patients before, during or after treatment with a synthetic stool preparation, as indicated.
  • dendrograms show the similarity between microbiota samples as assessed by proportional read counts of the V6 rRNA variable region and are drawn using the Neighbour-joining method. The distances between samples are assessed by summing the vertical distance from one sample name to another.
  • barplots show the proportional data for each sample with each operational taxonomic unit (OTU) coloured individually.
  • OTU operational taxonomic unit
  • the strains are ordered so that those that compose 1 % or more of the synthetic stool preparation appear first (lower in the barplot and figure), with the last strain from the synthetic stool preparation colored in black (in other words, in each sample, ribotypes below the black line in each bar are ribotypes from the synthetic stool preparation).
  • the purple line at the top of each bar represents the aggregate of all organisms that are less than 0.5% abundant in any sample.
  • the three white dots in the middle of the black bars demarcate the transition zone between bacterial strains from the synthetic stool preparation and native strains.
  • Figure 4 shows PCR samples and their QuBit quantitation which were used for bioinformatics analysis of samples from patients receiving a synthetic stool preparation.
  • Figure 5 shows representative sequence of each operational taxonomic unit (OTU) as written to a fasta file for the bioinformatics analysis.
  • OTU operational taxonomic unit
  • Figure 6 shows a timeline of events for Patient #1 (A) and #2 (B) during treatment with a synthetic stool preparation.
  • stool collection on each patient was carried out 2 days pretreatment (PT), at day 2 post treatment (D2), at week 2 post treatment (W2) and at week 4 post treatment (W4).
  • Red indicates treatment steps
  • brown indicates testing steps
  • green indicates the study with the synthetic stool preparation
  • blue indicates the inciting antibiotic and "RePOOPulate” stands for the synthetic stool preparation.
  • Figure 7 shows that pretreatment with synthetic stool preparation decreases Salmonella infection in a mouse model of colitis.
  • FIG. 8 shows a second clinical timeline of events for Patient #1 (A) and #2 (B), including results of stool collection at 6 months post treatment (6 M) and results of toxin assays for C. difficile. As in Figure 6, sequence of events for the two patients enrolled in the study is shown.
  • NIT nitrofuratoin
  • SXT trimethoprim-sulfamethoxazole
  • VAN vancomycin
  • Figure 9 shows a distance tree of weighted UniFrac distances between samples for Patient 1 amplified and sequenced independently. Distance tree calculated by the unweighted pair group method with arithmetic mean. Branch tips are colored by sample: red, pre-treatment; blue, RePOOPulate formulation. Post-treatment samples are colored green (D2), cyan (W2), and purple (W4). Tip label fields are separated by an underscore character and the fields are: Ion Torrent run ID, person and time of amplification, sample identifier, barcode sequence.
  • Figure 10 shows principle component coordinates of patient time points and most abundant sequences clustered at family level. Weighted UniFrac principle coordinates were generated by QIIME for each patient independently. These time points are denoted PT for pre treatment, RP for the RePOOPulate formulation, and as the day (D), week (W) or month (M) time point post treatment. The weighted mean abundance of family-level taxonomic groups is indicated by the size and position of the open circles. For example, for Patient 1 Bacteriodaceae are abundant in the day 2 and week 2 post-treatment samples, less abundant in the week 4 post-treatment sample, and are rare in all other samples. Only the 10 most abundant groupings of organisms are shown, and these differ between the two patients, although the Lachnospiraceae family is abundant in both.
  • Figure 1 1 shows a barplot of abundance at the family level.
  • Operational taxonomic units that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time. Note that the two patients (pt1 : patient 1 ; pt2: patient 2) had very different initial microbiota compositions. The compositional differences were maintained at all time points, suggesting that environmental or genetic factors were important in shaping community structure.
  • Figure 12 shows weighted abundance overlap at the identical sequence unit and 97%-clustered operational taxonomic unit levels. Proportion of sequence counts that correspond exactly to those in the RePOOPulate (RP) formulation and found in each patient sample as a function of time post treatment. Red, RP formulation; dark blue, samples from Patient 1 ; cyan, samples from Patient 2. There is an initial increase in reads identical to the RP reads immediately after treatment, and a steady decline in proportion for each patient with time since treatment. Both patients had similar RP-identical reads at 6 months post treatment, even though their microbiota profiles were different.
  • RP RePOOPulate
  • Figure 13 shows unweighted pair group method with arithmetic mean distance tree of the weighted UniFrac distances between samples for Patients 1 and 2.
  • the branch tips are labeled with the sample names for each patient.
  • the scale bar is shown for each patient.
  • FIG 14 shows a barplot of abundance at the family level.
  • Operational taxonomic units that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time.
  • PT Patient 1 before treatment
  • RP "RePOOPulate" synthetic stool preparation
  • CS RP cultured in the chemostat for 2 weeks
  • D2 Patient 1 at day 2 after treatment with RP synthetic stool preparation
  • W2 Patient 1 at week 2 after treatment with RP synthetic stool preparation.
  • FIG. 15 shows Schaeffer-Fulton endospore stains to indicate effect of Roseburia intestinalis 31 FAA on C. difficile sporulation in vitro.
  • Schaeffer-Fulton endospore stains are shown in (A), Left: C. difficile strain CD13 alone; Right: CD13 + 31 FAA after 24 hrs of incubation. Spores (indicated by blue circles) can be easily distinguished from CD13 vegetative cells (black arrow), and 31 FAA bacterial cells (blue arrow).
  • Image was viewed on a Leica DM750 bright field microscope (1000x magnification) and captured with a Leica ICC50 camera. Quantitation of results is shown in (B). Green arrows indicate C. difficile cells.
  • FIG 16 shows that Salmonella-infected mice that received pretreatment with a synthetic stool preparation displayed less weight loss than infected control mice.
  • Mice were pre-treated with vehicle (saline, or Sal) or the "RePOOPulate" synthetic stool preparation (Repoop), as indicated, before infection with Salmonella enterica serovar Typhimurium (Sal). Mice were weighed daily, and the percent change from day 1 to day 4 is shown. Mice given the synthetic stool preparation lost less weight on average than mice not given the preparation.
  • FIG 17 shows that S. Typhimurium infection increases serum levels of monocyte chemattractant protein-1 (MCP-1), a proinflammatory chemokine.
  • MCP-1 monocyte chemattractant protein-1
  • Sa/mone//a-infected mice that received treatment with a synthetic stool preparation displayed less systemic chemokine (MCP-1) release than infected control mice; Serum MCP-1 levels were measured by ELISA.
  • serum MCP-1 concentration was lower in S. Typhimurium infected mice that were pretreated with RePOOPulate (although not statistically significant). Mice that were not infected with S. Typhimurium had similar low serum MCP-1 concentrations.
  • FIG 18 shows that mice treated with a synthetic stool preparation displayed a trend towards less Salmonella invasion/bacterial translocation to the spleen than saline- treated control mice.
  • S. Typhimurium colonization in the spleen was reduced on average in mice pretreated with "RePOOPulate”.
  • Spleens were harvested 2 days post infection and bacterial loads were determined in both infected and uninfected groups.
  • Saline uninfected mice gavaged with vehicle control (saline);
  • Repoop uninfected mice gavaged with
  • Sal Saline mice receiving Salmonella and saline
  • Sal Repoop mice receiving Salmonella and RePOOPulate.
  • FIG 19 shows that Sa/mone//a-infected mice that received treatment with a synthetic stool preparation displayed a trend towards less Salmonella bacterial load in the colon than saline controls.
  • S. Typhimurium colonization in the colon was reduced on average in mice pretreated with RePOOPulate. Colons were harvested 2 days post infection and bacterial loads were determined in both infected and uninfected groups.
  • FIG 20 shows that increase in average serum MCP-1 due to Dextran Sulfate Sodium-induced Colitis (DSS) was decreased by treatment with a synthetic stool preparation.
  • Blood was collected from mice following sacrifice, left to sit on ice for ⁇ 1 hour, and then centrifuged at 4000 rpm for 10 minutes. Serum was removed, snap frozen, and stored at -80°C. At time of use, serum was thawed and tested for concentration of MCP-1 using Quantikine JE/MCP-1 Immunoassay kit. Serum concentration of MCP-1 was determined for mice pretreated with saline (Saline) or the "RePOOPulate" synthetic stool preparation (Repoop), with or without DSS.
  • Saline saline
  • RePOOPulate synthetic stool preparation
  • Figure 22 shows that treatment with a synthetic stool preparation (“RePoop") is not toxic to 3T3 fibroblasts and confers protection against C. difficile toxin B cytotoxicity.
  • NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C0 2 . Cells were either pretreated with 200 ⁇ RePoop for 2 or 4hrs, and then media was removed and replaced with fresh media containing 1 ⁇ g per well of toxin B or with toxin B alone.
  • Treatments were done in duplicate. Photos were taken after 2 and 4hrs with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification after 2 and 4hrs.
  • A shows control cells, as follows: untreated cells (left), cells treated with RePoop for 2 hrs (middle), and cells treated with RePoop for 4 hrs (right).
  • B shows cells treated with 1 ⁇ g C.difficile toxin B for 2 hours, left panel: cells pretreated with RePoop for 4 hrs; right panel: no pretreatment.
  • C shows cells treated with 1 ⁇ g C.difficile toxin B for 4 hours, left panel: cells pretreated with RePoop for 4 hrs; right panel: no pretreatment.
  • FIG 23 shows, in (A), a barplot of abundance at the family level.
  • Operational taxonomic units (OTUs) that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time.
  • RPA "RePOOPulate” synthetic stool preparation (RP), Day 0, post inoculum, batch culture
  • RPB RP, Vessel 4 (V4), Day 14, continuous culture (this is a culture of the inoculum used to inoculate the batch vessel)
  • RPC RP, batch culture, Vessel 1 (V1), Day 1 of batch culture
  • RPD RP, batch culture, Vessel 1 (V1), Day 2 of batch culture
  • RPE RP, batch culture, Vessel 1 (V1), Day 3 of batch culture.
  • This figure shows that, after culture in batch for up to 72 hrs, the proportion of microbes in the vessel was the same compared to continuous culture.
  • B a legend for the barplot in (A) is given.
  • Figure 24 shows that treatment with a synthetic stool preparation (“RePoop”) is not toxic to 3T3 fibroblasts and confers protection against C. difficile toxin B cytotoxicity.
  • NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C0 2 .
  • Cells were either pretreated with 200 ⁇ of synthetic stool preparation ("MET") for 2 and 4hrs, media was removed and replaced with fresh media containing ⁇ g per well of toxin B ("toxB1 ⁇ g") or with toxin B alone. Treatments were done in duplicate. Photos were taken after 2 and 4hrs with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification after 2 and 4hrs.
  • MET synthetic stool preparation
  • Figure 25 shows isolation of toxin A from C.difficile 078 and dose response of Toxin A on NIH 3T3 fibroblast cells. Isolation of toxin A was carried out according to Sullivan, N.M. et al. (Sullivan, N.M. et al., Infect. Immun. 35: 1032-1040, 1982) and Meador III, J. et al. (Meador III, J and Tweten, R. K., Infect. Immun. 56: 1708-1714, 1988). NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C0 2 .
  • Cells were treated with toxin A 0.3 ⁇ g, 0.6 ⁇ g, or 3 ⁇ g for 4 hrs. Treatments were done in duplicate. Photos were taken with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification.
  • FIG 26 shows that mice that received treatment with a "RePOOPulate" synthetic stool preparation prior to exposure of colonic loops to C. difficile toxin A were protected.
  • C57BI/6 female mice 9 weeks old were gavaged daily with vehicle control (top panel) or synthetic stool preparation ("MET") (bottom panel) for 2 days.
  • the large intestine was then excised from the abdominal cavity and colonic loops were injected with either phosphate- buffered saline control (PBS) or with 50 ⁇ g of toxin A (TOX A+) isolated from Clostridium difficile as in Fig.25 and then sutured closed.
  • Intestinal loops were incubated ex vivo in DMEM + 10% FBS for 60 min at 37°C with 5% C0 2 .
  • Intestinal loops were then fixed in formalin, embedded in paraffin and 4 ⁇ sections were cut and stained with hematoxylin and eosin (All at 200X).
  • a novel preparation for treatment of disorders of the gastrointestinal system, particularly disorders associated with dysbiosis.
  • synthetic stool for treatment of disorders of the gastrointestinal system, particularly disorders associated with dysbiosis.
  • a method of treating Clostridium difficile infection (CDI), including recurrent CDI, and for prevention of recurrence of CDI comprises a mixture of purified intestinal bacterial cultures, originally isolated from stool from a single donor who had not received antibiotics in the last 5 years.
  • diseases associated with dysbiosis of the gastrointestinal tract such as, for example, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease and food poisoning such as Salmonella.
  • the human gastrointestinal tract contains vast numbers of bacteria, collectively called the intestinal microbiota.
  • the commensal gut flora contribute to host defense by priming the dendritic cells of the immune system, producing bactericidal products that kill pathogenic bacteria, inhibiting the colonization of pathogenic bacteria and competing with pathogens for food and for binding sites along the intestinal epithelial cell surface, a phenomenon collectively known as "colonization resistance” (Stecher B. and Hardt W.D., Trends Microbiol. (2008), 16:107-14; Rolfe, R.D., Infect. Immun. (1984), 45:185-91).
  • Synthetic stool preparations described herein present several potential advantages over current therapies, particularly stool transplants. Synthetic stool preparations provide at least one of the following advantages: First, the exact composition of bacteria administered to a patient is known and can be controlled. Second, the composition and quantity of bacterial species can be reproduced, should further treatment be necessary. Third, the synthetic stool preparations are more stable than stool, which normally must be collected fresh and instilled into the recipient within 6 hours of collection. From a patient safety perspective, the synthetic stool preparation is expected to be superior to the use of defecated donor fecal matter or stool transplant, since absence of viruses and other pathogens in the administered preparation can be ensured.
  • synthetic stool preparations described herein can provide safe, defined, controllable, reproducible, stable, deliverable, palatable and/or available alternatives to fecal transplants.
  • Intestinal bacterial strains that were isolated and purified from donor stool (from a donor who had not received antibiotics in the last 5 years) are listed in Table 1 .
  • the strains were speciated using the 16S rRNA full-length sequence and the GreenGenes database (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi). It will be readily understood by the skilled artisan that not all strains isolated from donor stool are suitable for use in synthetic stool preparations.
  • strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile e.g., resistant to imipenem or vancomycin or both
  • strains which are particularly difficult to culture or grow unreliably were not included in the synthetic stool preparations of the invention shown in Tables 2 and 2a.
  • strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile e.g., resistant to imipenem or vancomycin or both
  • strains which are particularly difficult to culture or grow unreliably are not included in synthetic stool preparations of the invention.
  • bacterial strains listed in Table 1 are novel, i.e., not previously described.
  • novel bacterial strains and their use in synthetic stool preparations there are provided herein the bacterial strains Ruminococcus productus 27FM, Eubacterium limosum 13LG, Ruminococcus obeum 1 1 FM1 , Clostridium cocleatum 21 FAA1 and Eubacterium desmolans 48FAA1.
  • the purified isolates were first identified by 16S rRNA sequencing and subjected to antibiotic profiling, to remove any highly resistant strains of bacteria from the mixture (see Example 1).
  • the NIH Human Microbiome database (the MetaREP database (http://jcvi.org/metarep)) was used to determine the relative proportions of bacteria needed to most closely approximate the natural composition of human stool in a healthy individual.
  • Synthetic stool preparations were made based on available information about the natural composition of stool in healthy individuals ("normal" stool) and the gastrointestinal microbiota, to determine which strains to use and their relative proportions in the mixture, in order to most closely approximate the natural composition of normal stool.
  • the synthetic stool preparation of the invention comprises some or all of the strains listed in Table 1 , or of strains having identifying characteristics of the strains listed in Table 1.
  • the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more of the strains listed in Table 1
  • the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more strains selected from 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains having all of the identifying characteristics of strains listed in Table 1.
  • the synthetic stool preparation of the invention comprises some or all of the 31 bacterial strains listed in Table 2.
  • the closest bacterial species was determined using the 16S rRNA full-length sequences, which were identified using the GreenGenes database (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi; DeSantis, T. Z., et al., Appl. Environ. Microbiol. (2006), 72:5069-72).
  • the third column (headed “Relative amount added to synthetic stool preparation”) describes one embodiment of the synthetic stool preparation, where all 31 strains are used, and where the relative amount of each of the 31 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ⁇ 4 to 7 x 10 9 Colony Forming Units/mL, as estimated by measurement of OD600nm).
  • ⁇ , ⁇ , , ⁇ ,#, ⁇ ,/ indicate strains which are closely related or identical by 16S rRNA gene sequence alignment, but which are likely to be different strains of the same species based on differences in colony morphology, antibiotic resistance patterns and/or growth rates.
  • the synthetic stool preparation comprises any or all of the 31 bacterial strains listed in Table 2, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2.
  • the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2.
  • the synthetic stool preparation comprises any of the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table.
  • the synthetic stool preparation comprises all the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table.
  • the synthetic stool preparation of the invention comprises some or all of the 33 bacterial strains listed in Table 2a, or some or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a.
  • the closest bacterial species was determined using the 16S rRNA full-length sequences, which were aligned with the NAST server (DeSantis, T.Z. Jr. et al., Nucleic Acids Res., 34:W394-W399 (2006)) and were then classified using the GreenGenes classification server (DeSantis, T.Z. Jr. et al., Appl. Environ. Microbiol., 72:5069-5072 (2006)).
  • the most specific name in the GreenGenes classification was used (first column) and we report the DNA maximum likelihood score for each classification (second column).
  • the third column (headed “Relative amount added to synthetic stool preparation") describes one embodiment of the synthetic stool preparation, where all 33 strains are used, and where the relative amount of each of the 33 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ⁇ 4 to 7 x 10 9 Colony Forming Units/mL, as estimated by measurement of OD600nm).
  • Table 2a An embodiment of the s nthetic stool re aration of the invention.
  • Roseburia faecal is 99.65 ++
  • the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a.
  • the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2a.
  • the synthetic stool preparation comprises any of the 33 bacterial strains listed in Table 2a.
  • the synthetic stool preparation comprises all the 33 bacterial strains listed in Table 2a.
  • the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, in the relative proportions indicated in the table.
  • the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 1 , Table 2 or Table 2a, or one or more than one bacterial strains having all of the identifying characteristics of one or more than one corresponding strains listed in Table 1 , Table 2 or Table 2a.
  • the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 1 , Table 2 or Table 2a.
  • the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 1 , Table 2 or Table 2a.
  • Intestinal bacterial strains that were isolated and purified from stool from a second donor (a male donor, 43 yrs old, with no history of antibiotic use in the 6 years prior to stool donation) are listed in Table 7. Strains were speciated as described above, using the 16S rRNA full-length sequence and the GreenGenes database (http://greengenes.lbl.gov/cgi- bin/nph-blast_interface.cgi).
  • a % ID for each species was determined using the 16S rRNA gene database, Green Genes. Average length of sequences used to obtain identification was 550 nucleotides. (Green Genes BLAST interface to 16S data URL: http://greengenes.lbl. gov./cgi-bin/nph-blast interface. cgi)
  • the strain Faecalibacterium prausnitzii 5 FAA NB requires Liquid Gold for growth.
  • a 3% final volume of Liquid Gold produced from the chemostat where the donor fecal sample was cultured was used to supplement FAA plates. Growth was observed after 48 hours.
  • Clostridium aldenense 1 and 2 are two different strains of the same species.
  • synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in") bacterial strains from a certain taxonomic order or family.
  • synthetic stool preparations "rich in” or “comprising predominantly” certain strains are comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of those strains.
  • a synthetic stool preparation rich in bacterial strains of a certain order e.g., Bacteroidales, Clostridiales, etc., comprises a mixture of bacterial strains, wherein at least about 40% of the bacterial strains in the mixture are of the specified order.
  • synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in”) bacterial strains of the order Bacteroidales, e.g., bacterial strains of the family Bacteroidetes, e.g., strains listed in Table 14.
  • synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in") bacterial strains of the order Clostridiales, e.g., bacterial strains of the family
  • synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order listed in Table 14.
  • synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order in the human gut microbiome or in an enterotype of human gut.
  • synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Catabacteriaceae, Clostridiaceae, Erisipelotrichaceae, Eubacteriaceae, Lachnospiraceae, Ruminococcaceae, Bacteroidetes, Actinomycetales, Bacillales, Bifidobacteriales, Coriobacteriales, Lactobacillales, Proteobacteria,
  • synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family listed in Table 14.
  • synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family in the human gut microbiome or in an enterotype of human gut.
  • synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Lachnospiraceae. Such strains are listed, for example, in Table 9a and Table 14.
  • Lachnospiraceae family members are part of the core human microbiome and may be important in maintaining stability of the human microbiota (Sekelja, M. et al., ISME J. 5(3):519-31 , 201 1).
  • Lachnospiraceae have also been implicated as part of the 'healthy' gut microbiota and may play a role in optimizing immune function in the gut (Reeves, A.E., et al., Infect Immun., 2012; Segata, N.
  • the synthetic stool preparation comprises the bacterial strains listed in Table 9a or Table 9b. In another embodiment, the synthetic stool preparation comprises some or all of the bacterial strains listed in Table 9a or Table 9b. In yet another embodiment, the synthetic stool preparation is rich in
  • Lachnospiraceae (or "Lachnospiraceae-rich”), e.g., is comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of strains in the Lachnospiraceae family, or of strains listed in Tables 9a, 9b or 14.
  • synthetic stool preparations comprise only, or are rich in, bacterial strains of the taxonomic class Proteobacteria.
  • the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype I of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Table 9c.
  • the synthetic stool preparation comprises the bacterial strains listed in Table 9c.
  • the synthetic stool preparation comprises some or all of the strains listed in Table 9c.
  • the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype II of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Table 9d.
  • the synthetic stool preparation comprises the bacterial strains listed in Table 9d.
  • the synthetic stool preparation comprises some or all of the strains listed in Table 9d.
  • the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype III of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Tables 9e and 9f.
  • Enterotype III of the human gut microbiome Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1
  • the synthetic stool preparation comprises the bacterial strains listed in Table 9e or 9f. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9e or 9f.
  • the synthetic stool preparation comprises or is rich in known beneficial microbes, e.g., probiotic strains, as shown in Table 9g.
  • Coprococcus comes Coprococcus eutactus Dorea formicigenerans Dorea longicatena
  • Eubacterium eligens Eubacterium rectale Eubacterium ventriosum Eubacterium xylanophilum Roseburia sp.
  • Ruminococcus sp. (3 different unclassified strains ) Ruminococcus albus
  • the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic orders listed in Table 14. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic families listed in Table 1 1 or Table 14. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 14.
  • the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic orders listed in Table 14 is included. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic families listed in Table 11 or Table 14 is included.
  • the synthetic stool preparation comprises any or all of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14, or any or all bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14.
  • the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14.
  • the synthetic stool preparation comprises any of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14.
  • the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14.
  • the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14.
  • the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. Additional embodiments of synthetic stool preparations of the invention are shown in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B.
  • synthetic stool preparations comprise some or all of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or some or all of a group of bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B.
  • synthetic stool preparations comprise one or more than one of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or one or more than one bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B.
  • At least one of the bacterial strains in the synthetic stool preparation is Faecalibacterium prausnitzii, or a strain having all of the identifying characteristics thereof.
  • At least one of the bacterial strains in the synthetic stool preparation is a novel strain, i.e., a strain which was not previously identified, e.g.,
  • Clostridium aldenense 1 Clostridium aldenense 2
  • Clostridium hathewayi 1 Clostridium hathewayi 2
  • Clostridium hathewayi 3 Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, and/or Clostridium thermocellum.
  • Table 9 An embodiment of the s nthetic stool re aration of the invention.
  • FAA NB Faecalibacterium prausnitzii b
  • Table 9a An embodiment of the synthetic stool preparation of the invention. Species
  • Table 9b An embodiment of the synthetic stool preparation of the invention. Species
  • Table 9c An embodiment of the synthetic stool preparation of the invention. Species
  • Table 9d An embodiment of the synthetic stool preparation of the invention. Species
  • Table 9e An embodiment of the synthetic stool preparation of the invention. Species
  • Table 9f An embodiment of the synthetic stool preparation of the invention.
  • Table 9g An embodiment of the synthetic stool preparation of the invention. Species I Adlercreutzia equolifaciens
  • Table 11 An embodiment of the synthetic stool preparation of the invention. Closest taxonomic family
  • Table 12 An embodiment of the synthetic stool preparation of the invention. Closest taxonomic family
  • the synthetic stool preparation further comprises one or more other bacterial strains which are known in the art to occupy the intestine in healthy individuals or to be found in stool from healthy individuals.
  • the synthetic stool preparation comprises one or more bacterial strains found in an enterotype of human gut, e.g., the Bacteroides, the Prevotella or the Ruminococcus enterotype.
  • the synthetic stool preparation comprises one or more bacterial strains found in the human gut microbiome.
  • the bacterial strains in the synthetic stool preparation are not antibiotic-resistant.
  • the bacterial strains in the synthetic stool prepraration are not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin/clavulanic acid, imipenem, moxifloxacin, vancomycin and/or ceftazidime.
  • At least one of the bacterial strains in the synthetic stool preparation is a butyrate-producing strain (See, e.g., Louis, P. and Flint, H.J., FEMS
  • the synthetic stool preparation comprises F.prausnitzii, Roseburia spp. and/or Eubacterium rectale.
  • At least one of the bacterial strains in the synthetic stool preparation is a Bacteroides spp. strain.
  • the synthetic stool preparation comprises B.ovatus and/or P. distasonis.
  • At least one of the bacterial strains in the synthetic stool preparation is a bacterial species in the Clostridium cluster XlVa group, also known as the Lachnospiraceae. These strains are among the most abundant bacteria in the human gut in healthy individuals.
  • the synthetic stool preparation comprises organisms that identify with Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Dorea spp., Ruminococcus obeum, Blautia producta, and/or Ruminococcus torques.
  • the synthetic stool preparation comprises Bifidobacterium longum. Some B.longum strains are known to have clinically proven probiotic effects. It will be understood by the skilled artisan that many other embodiments are possible.
  • the synthetic stool preparation comprises at least one Lachnospiraceae strain.
  • the synthetic stool preparation comprises one or more strains that identify with the following species: Eubacterium hadrum;
  • Anaerostipes coli Clostridium spp. (aldenense, hathewayi, symbiosum, orbiscindens and citroniae); Roseburia inulinovorans; Blautia coccoides; Dorea spp.; Sutterella spp.; Dialister invisus; and Bifidobacterium pseudocatenulatum.
  • At least one of the bacterial strains in the synthetic stool preparation has an activity of preventing or inhibiting sporulation of C. difficile.
  • at least one of the bacterial strains in the synthetic stool preparation is Roseburia intestinalis strain 31 FAA.
  • at least one of the bacterial strains in the synthetic stool preparation has an activity of neutralizing or protecting against C. difficile toxin, e.g., toxin A or toxin B.
  • the synthetic stool preparation comprises more than one strain of a single species. Without wishing to be bound by theory, it is believed that in some cases two strains of the same species isolated from the same host can work together
  • strains may have adapted to do so.
  • the synthetic stool preparation further comprises a prebiotic.
  • a prebiotic may provide a bolus of nutrients for the strains in the synthetic stool preparation to assist their early growth after administration to the patient.
  • Any prebiotic known in the art may be used.
  • Non-limiting examples of prebiotics include oligosaccharides, e.g., fructooligosaccharides such as oligofructose and inulin, mannan oligosaccharides and galactooligosacchandes, soluble, oligofructose-enriched inulin and soluble fiber.
  • identification of a bacterial species is based on many factors, including cell and colony morphology, chemical composition of cell walls (e.g., Gram-negative vs. Gram-positive, cell wall fatty acid make-up), biochemical activities, nutritional requirements, motility, presence or absence of structures external to the cell wall (e.g., flagella, pili), endospore formation, genomic sequence (including 16S rRNA gene sequence), etc. It should be understood therefore that many different factors may be used to identify a bacterial species and that an exact identification is not always feasible.
  • reference to a certain bacterial strain includes a strain having all of the identifying characteristics of the bacterial strain. Identifying characteristics used to identify bacterial species or strains may include factors listed above, such as cell morphology, colony morphology, Gram staining reaction, biochemical activities (e.g., aerobic or anaerobic), nutritional requirements, 16S rRNA sequence, or a subset or combination thereof. The particular identifying characteristics used will depend on the type of bacteria and are determined by the skilled artisan.
  • bacterial species or strains are identified by 16S rRNA sequence, e.g., sequence of V6 region of 16S rRNA.
  • two bacterial species or strains are considered to be the same, or to share identifying characteristics, if they share at least 20%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% sequence identity in their 16S rRNA sequences or in the V6 region of their 16S rRNA sequences.
  • the preparations and methods of the invention may be used to treat disorders associated with dysbiosis (microbial imbalance) of the gastrointestinal tract.
  • Dysbiosis is an imbalance of intestinal bacteria that leads to changes in the activities of the gastrointestinal tract.
  • Non-limiting examples of such conditions which may be treated by the synthetic stool preparations of the invention include C.difficile colitis, Ulcerative colitis, Microscopic colitis, Pouchitis, Acute Postradiotherapy Diarrhea, Post-infectious colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease, obesity, regressive autism with gut involvement, PANDAS, Neonatal necrotizing colitis, enteritis caused by various pathogens including Salmonella spp., Campylobacter spp., Shigella spp., pathogenic Escherichia coli strains, and Cryptosporidium parvum, HIV enteropathy, Anorexia nervosa/Bulimia nervosa (
  • the preparations and methods of the invention are used to treat Clostridium difficile infection (CDI), including recurrent CDI.
  • CDI Clostridium difficile infection
  • the preparations and methods of the invention may also be used to prevent recurrence of CDI in a subject previously afflicted with CDI.
  • the preparations and methods of the invention are used to treat a disorder associated with dysbiosis of the gastrointestinal tract.
  • the preparations and methods of the invention are used to treat ulcerative colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease and/or diverticular disease.
  • IBS Irritable Bowel Syndrome
  • the synthetic stool preparations of the invention are used to treat bacterial pathogens such as those causing food poisoning.
  • the synthetic stool preparations may be used to treat Escherichia coli (e.g., E.coli enteritis, E.coli 0157), Salmonella spp., Clostridium perfringens, Listeria monocytogenes, Staphylococcus (e.g., Staph, aureus, Botulism (Clostridium botulinum), Campylobacter spp., Shigella spp., Bacillus cereus, Cryptosporidium, cholera (Vibrio cholerae) and other known bacterial pathogens which cause food poisoning.
  • Escherichia coli e.g., E.coli enteritis, E.coli 0157
  • Salmonella spp. Clostridium perfringens
  • Listeria monocytogenes e.g., Staphylococcus (e.g., Staph, au
  • the synthetic stool preparations of the invention are used prophylactically in persons at risk of developing CDI, for example persons receiving antibiotic therapy, persons having a prolonged hospital stay, or persons lacking a threshold level of bacterial diversity.
  • the level of bacterial diversity of a subject could be determined, for example, using 16S rRNA gene sequence profiling of bacteria from a fecal sample.
  • synthetic stool preparations of the invention are used to reduce inflammation, e.g., inflammation of the colon, in a subject,
  • kits for treating the described disorders comprising the synthetic stool preparations or the bacterial strains described herein.
  • the kits may also include instruction materials. Instructions may be printed on paper or other substrates, and/or may be supplied as an electronic-readable medium, such as a floppy disc, CD-ROM, DVD-ROM, Zip disc, videotape, audio tape, etc. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an internet web site specified by the manufacturer or distributor of the kit, or supplied as electronic mail.
  • the synthetic stool preparation is adapted for administration via rectal enema using a colonoscope.
  • the colonoscope is inserted into the cecum of the subject; a sample of fecal material is suctioned from the area; a syringe containing the synthetic stool preparation is attached to the colonoscope; a first portion of the synthetic stool preparation is deposited adjacent to the cecum; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon as the colonoscope is withdrawn.
  • the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation.
  • the subject is treated with colon cleansing agents before administration of the synthetic stool preparation.
  • the first and second portions each comprise approximately half of the synthetic stool preparation.
  • the synthetic stool preparation is adapted for administration orally.
  • the bacteria are freeze-dried and encapsulated (e.g., in a capsule or pressed into a tablet) for oral administration.
  • agents such as buffering agents, to promote viability of the bacterial strains.
  • the capsule or tablet may need a coating to protect against stomach acid.
  • Such capsules and tablets may be formulated using methods known in the art.
  • the optimal synthetic stool preparation may vary depending on the subject, the disease or condition being treated, and so on.
  • the human gut microbiome that is, the community of organisms that live symbiotically within humans, may occur in certain set varieties or "enterotypes" (Arumugan, M. et al., Nature (201 1), 473: 174).
  • enterotypes which vary in species and functional composition have been reported, namely Bacteroides, Prevotella and
  • the optimal synthetic stool preparation may depend on the enterotype of the subject, which may in turn depend upon patient lifestyle, e.g., their diet.
  • a synthetic stool preparation having a mixture of bacteria consistent with the Bacteroides enterotype.
  • a synthetic stool preparation having a mixture of bacteria consistent with the Prevotella enterotype.
  • a synthetic stool preparation having a mixture of bacteria consistent with the Ruminococcus enterotype.
  • the synthetic stool preparation comprises a carrier.
  • insoluble fiber is added to the synthetic stool preparation as a carrier, e.g., to provide protection during transit or storage.
  • the synthetic stool preparation comprises insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative, such as an anti-fungal agent. Glycerol or DMSO may be added to the bacterial strains for cryoprotection when the strains are frozen for storage.
  • the synthetic stool preparation is made or stored in chemostat medium, e.g., the medium in which a steady-state culture is actively growing. In one embodiment, this medium is supplemented with additional insoluble fiber. In other embodiments, the synthetic stool preparations are provided at physiological salt concentrations.
  • the synthetic stool preparations may be made or stored in saline, e.g., 0.9% saline.
  • the synthetic stool preparations are made and/or stored under reduced atmosphere, i.e., in the absence of oxygen.
  • the synthetic stool preparations may be made and/or stored under N 2 , C0 2 , H 2 , or under a mixture of these, such as N 2 :C0 2 :H 2j 80:10:10.
  • N 2 :C0 2 :H 2j 80:10:10 an inert gas like N 2 can be used, although some of the bacterial strains in the synthetic stool preparations may need C0 2 and/or H 2 when growing actively.
  • the pressure is the same or substantially the same as the pressure of the outside air.
  • Example 1 Isolation of bacterial strains.
  • a healthy donor was identified and screened for suitability as a fecal transplant donor using a standard panel of microbiology tests. The most important criterion for donor selection was the donor's prior exposure to antibiotic therapy. Our donor had only one reported antibiotic exposure, 5 years prior to donation, and cannot recall having had any during her childhood, which is believed to be the critical time during which the gut microbiota develop.
  • the donor was asked to void feces in a private bathroom near the lab, into a provided sterile pot.
  • the pot was immediately transported to the lab and placed into an anaerobic container within 5 minutes of voiding. It is noted that some of the isolates, in particular Roseburia spp., are extremely sensitive to oxygen, and thus it is critical that the voided sample is protected from exposure to oxygen even for the short-term (5 mins).
  • a 10g sample of feces was weighed into 50 ml_ sterile, pre-reduced saline and placed into a sterile stomacher bag. This was placed into the stomacher instrument and pummelled for 2 minutes to homogenize the sample. The homogenate was then placed into a sterile centrifuge tube and spun at low speed to sediment large particles.
  • Mucin agar formulated in-house minimal media with mucin as the only carbon source; this is used since some bacterial species of the human gut microflora are known to utilize mucin as a carbon source);
  • LS agar which is agar supplemented with 3% v/v spent cell culture supernatant taken from a confluent culture of LS174T cells (a human colonic cell line which secretes mucin; see
  • Cell culture media was prepared from: 1 package of minimum essential medium (Gibco #41500-034); 2.2g sodium bicarbonate (Sigma); 4.766g HEPES buffer (Sigma); 10mL 100mM sodium pyruvate solution; 10% (v/v) heat-inactivated fetal bovine serum (Gibco) (30 min. at 56°C), brought up to 1 litre in double-distilled water and filter-sterilized through a 0.22 ⁇ pore-sized filter (Millipore).
  • Spent cell culture medium was medium taken from the supernatant of LS174T cells cultured at 37 °C in 5% C0 2 for 5 days, and filtered through a 0.22 ⁇ pore-sized filter to remove host cells. This medium was used as some bacterial isolates may require human cell signals for proliferation and growth in vitro.
  • strains were isolated, optimal growth conditions were determined empirically by culturing each isolate on each different medium type as above, and determining which media gave the best growth. It is important to note that the strains were kept in an anaerobic environment at all times. They were never worked with outside of an anaerobic
  • a chemostat was used to first stabilize the microbial community as a whole, in vitro. Steady state (equilibrium) was reached after about 1 month, following which we used the dilution and plating methods as above to try to isolate further micro-organisms.
  • the chemostat was used to allow us to effectively sample and culture the community and also to enrich for some gut microbes that may have been present in only small numbers in the original fecal sample. These organisms may be, for example, microbes that are intimately associated with the mucosa and are 'sloughed off along with dead cells in the colon.
  • the chemostat environment allows some of these bugs to survive and proliferate effectively, enriching their numbers so that they can be plate-cultured as above.
  • the growth medium was continuously fed into the vessel at a rate of 400 mL/day (16.7 mL/hour) to give a retention time of 24 hours, a value set to mimic the retention time of the distal gut (Cummings, J. H. et al., Gut (1976), 17:210-18).
  • the vessels were autoclaved with 400 mL of ddH 2 0. During autoclaving, the waste pipes were adjusted so the metal tube reached the bottom of the vessel. Once the vessel cooled it was fitted to the rest of the computer operated unit, filtered nitrogen gas was bubbled through the water to pressurize and drain the vessel. The waste pipe was then raised to the working volume (400 mL) and 300 mL of sterile media was pumped into the vessel. The vessel was then left stirring, heating, and degassing overnight.
  • each vessel was aseptically sampled and plated out (both aerobically and anaerobically) on fastidious anaerobe agar (FAA) supplemented with 5% defibrinated sheep blood. This procedure was repeated one day before inoculation and immediately prior to inoculation to ensure contamination was avoided.
  • FAA fastidious anaerobe agar
  • the fecal sample was collected as described above; the freshly voided stool sample was collected and immediately placed in an anaerobic chamber (in an atmosphere of 90% N 2 , 5% C0 2 and 5% H 2 )(Praxair).
  • a 10% (w/v) fecal slurry was immediately prepared by macerating 5g of fresh feces in 50 mL of anaerobic phosphate buffered saline (PBS) for 1 minute using a stomacher (Tekmar Stomacher Lab Blender, made by Seward). The resulting fecal slurry was centrifuged for 10 minutes at 1500 rpm to remove large food residues. The resulting 10% original w/v fecal slurry supernatant ("10% inocula”) was used as the inoculum for this study.
  • a chemostat growth medium was developed. Due to the large amount of medium used by each vessel, medium was prepared in 2L volumes. The chemostat medium was prepared in the following steps (for 2L):
  • peptone water 4 g (Oxoid Limited); yeast extract, 4g (Oxoid Limited); NaHC03, 4g (Sigma); CaCI2, 0.02g (Sigma); pectin (from citrus), 4g (Sigma); xylan (from beechwood), 4g (Sigma); arabinogalactan, 4g (Sigma); starch (from wheat, unmodified), 10g (Sigma); casein, 6g (Sigma); inulin (from Dahlia tubers), 2g (Sigma); NaCI, 0.2g (Sigma). This mixture was sterilized by autoclaving at 121 °C for 60 min.
  • Mixture 2 The following reagents (all purchased from Sigma) were dissolved in 100 mL of distilled water (Mixture 2A): K2HP04, 0.08g; KH2P04, 0.08g; MgS04, 0.02g; hemin, 0.01 g; menadione, 0.002g.
  • Bile salts (1 g) was dissolved in 50 mL of distilled water (Mixture 2B).
  • L-cysteine HCI (1 g) was also dissolved in 50 mL of distilled water (Mixture 2C). After Mixtures 2B and 2C dissolved they were added to Mixture 2A resulting in the formation of a fine white precipitate. This precipitate was then dissolved by the drop-wise addition of 6M KOH until a clear, brown solution was formed (Mixture 2). This mixture (200 mL total volume) was sterilized by filtering through a 0.22 ⁇ filter.
  • Chemostat media Mixture 2 (0.2 L) was aseptically added to mixture 1 (1 .8 L), in order to reach the final volume of 2L. To prevent future foaming, 5 mL of antifoam B silicone emulsion (J.T. Baker) was aseptically added to each 2L bottle of media. The media was stored at 4 DC until use for a maximum of two weeks.
  • the media was pumped into each vessel using a peristaltic pump whose speed is controlled by the computer-operated system.
  • a peristaltic pump whose speed is controlled by the computer-operated system.
  • VWR standard GL-45 glass bottle lids
  • the media bottle had all the required silicone tubing and 0.22 ⁇ filters attached (see Figure 1).
  • Each vessel was fed from one media bottle with a 2L volume of media. Since the tubing which supplied the media to the vessel was also changed as each media bottle was changed, this helped to prevent back-growth of bacteria from the vessel into the sterile media reservoir.
  • Each media bottle was plated out on supplemented FAA and grown both aerobically and anaerobically before each bottle was added to the chemostat and after each bottle was removed from the chemostat.
  • liquid gold refers to the effluent from the chemostat, i.e., the effluent forced out of the chemostat through pressure differentials; it drips into sterile bottles, housed behind the chemostat, via tubing. When the bottle is full, it is sealed and stored at +4 °C until needed. This is essentially a soup of microbes (dead and alive) as well as a plethora of signaling molecules, growth factors and so on. The liquid gold is passed through a 0.22 urn filter to remove bacterial cells to produce cell-free liquid gold, which is used to supplement the growth media (usually added to 3% v/v).
  • the BLAST search was done using blast 2.2.10 and the command line "blastall -p blastn -i ../../torrent/EnE/reads/RP_otu6.fna -e 1 e- 35 -m > 8 -d 16s_named_full_seq.faa”; the parameters were as follows: mismatch penalties for nucleotide blast was -3; match penalties were 1 ; word size was 1 1 ; dropoff value for gapped alignment (in bits) was 30; threshold for extending hits was 1 1 ; dropoff value for final gapped alignment in bits was 50; and the E value cutoff was set such that only near perfect matches were recovered.
  • Example 2 Antibiotic resistance profiling of isolated bacterial strains.
  • Zones of clearance are given as measurements of the diameter of the zone of clearance (including the 7mm discs). Where no zone of clearance is seen, the value stated is 0, i.e., in this case the size of the disc is not reported. The interpretation of the resistance profiles was descriptive.
  • the antibiotics tested and results of the antibiotic resistance profiling are shown in Table 4, where: numbers indicate diameters of the zones of clearance, in centimeters; PIP stands for pipericillin; CRO stands for ceftriaxone; MZ stands for metronidazole; AMC stands for amoxicillin/clavulanic acid; IPM stands for imipenem; MXF stands for moxifloxacin; VA stands for vancomycin; and CAZ stands for ceftazidime.
  • FAA Fastidious anaerobe agar, commercially available as Lab90; DSB: Defibrinated sheep blood, commercially available; LG: Liquid gold, a clarified, filtered effluent supernatant from chemostat communities seeded from healthy fecal communities, required by a number of synthetic stool strains for optimal growth.
  • Antibiotic resistance profiles for strains listed in Table 7 are shown in Table 8.
  • antibiotic resistance was described using methods described herein.
  • a standard Kirby-Bauer disk diffusion susceptibility test was used. Bacterial strains were grown on Fastidious Anaerobe Agar (FAA) in a completely anaerobic environment from frozen stock. Each strain was streaked heavily onto two FAA plates. Four antibiotic disks were placed onto each plate. Plates were incubated for at least one day, or longer if required. Plates were then removed from the anaerobe chamber and the susceptibility zone was measured. Measurements were conducted with a ruler. The susceptibility zone (measured in cm) was the diameter of the zone with no visible growth including the antibiotic disk diameter of 0.7 cm.
  • Example 3 Treatment of CDI using a synthetic stool preparation.
  • Inclusion criteria for the study included a history of previous CDI, confirmed by C.difficile fecal toxin immunoassay; new onset of symptoms after completing a full course of medication for CDI; positive C.difficile toxin assay confirming recurrent CDI; and age 18 years or older. All patients were assessed by specialists in infectious disease and gastroenterology, and other possible causes of diarrhea were ruled out. Two patients who fulfilled the inclusion criteria were enrolled in the study and written informed consent was obtained. The trial was conducted in compliance with the Good Clinical Practice guidelines (see www.clinicaltrials.gov for details).
  • a human probiotic or "synthetic stool" preparation comprising 33 different strains of bacteria, was developed by culturing the microbial diversity from the stool of a healthy 41 -yr old female donor as described above.
  • sixty-two different bacterial isolates were recovered on various media types (including Brain Heart Infusion agar, Wilkins-Chalgren agar, Reinforced Clostridial Agar, and deMan, Rogosa & Sharpe agar) using strict anaerobic conditions (to recover both strict and facultative anaerobes).
  • Purified isolates were identified by 16S rRNA gene sequencing and subjected to antibiotic susceptibility profiling.
  • Susceptibility to antimicrobials was determined either by directly measuring susceptibility or through inference based on other cultivated representatives. For instance, in cases where minimum inhibitory concentration (MIC) breakpoints are not documented, susceptibility was determined using Kirby-Bauer discs for select antibiotics known to have anaerobic activity, and if the bacterial lawn grew up to the edge of the disc then it was considered resistant and that isolate was not used. For isolates where there was a zone of inhibition of questionable significance, an acceptable level of inhibition was inferred based on other cultivated representatives. If there was any doubt, and the organism was at all suspected to be resistant, then it was not used in the mixture. Thirty-three isolates, representing commensal species with no known pathogenic tendencies that were generally sensitive to a range of antibiotics and relatively
  • the METARep database (Goll, J. et al., Bioinformatics (2010), 26(20) :2631-2) was utilized to inform of the potential relative abundance of each isolate in a healthy ecosystem.
  • the MetaREP metagenomic database includes a collection of stool sample datasets from healthy donors (Goll, J. et al., Bioinformatics, 26(20): 2631-2, 2010). Using the taxonomy browser, the dataset that most closely matched our profile of cultured isolates (SRS058723) was selected and used as a guide for inference of relative abundance of each species - with the exception that Bifidobacterium spp.
  • Patient 1 was a 74-year-old Caucasian woman who presented with a history of six episodes of recurrent CDI (confirmed by C.difficile toxin assay) over an 18-month period, all of which required hospitalization. She developed her first C.difficile infection after being admitted to hospital for elective orthopedic surgery (knee arthroplasty or replacement), during which time she received pre-operative cefazolin (see Figs. 6A, 8A). She was treated with courses of metronidazole, and oral vancomycin but experienced multiple CDI recurrences characterized by watery stool and increased frequency, which were confirmed by C.difficile toxin assay (see Figs. 6A, 8A).
  • patient 1 After treatment with the synthetic stool preparation, patient 1 became constipated within 72 hours and then her bowel movements became normal, both in terms of frequency and consistency. The patient reverted to her normal bowel pattern of a formed stool every 1 or 2 days. No C.difficile was detectable by C.difficile toxin assay at 10 days post-procedure. Her diarrhea did not recur and she remained symptom-free at 22 weeks. Patient 1 did receive several courses of antibiotics for recurrent urinary tract infections in the subsequent weeks following her stool substitute treatment, but her diarrhea did not recur. She remained symptom-free at the last evaluation, 24 weeks after treatment.
  • C. difficile was isolated from stool samples according to methods described previously (Medina-Torres, C.E. et al., Vet. Microbiol. 152:212-215, 201 1) using selective media of moxalactam norfloxacin broth (CDMN; Oxoid, Nepean, Ontario, Canada) enriched with 0.1 % sodium taurocholate. Isolates were typed using the PCR ribotyping method described by Bidet and colleagues (Bidet, P.
  • Patient 2 was a 70-year-old Caucasian woman with a history of peripheral neuropathy, which predisposed her to recurrent skin and soft tissue infections. She developed her initial C.difficile infection after receiving cefazolin for cellulitis and presented to the clinic with a history of three episodes of recurrent CDI, the last of which had failed standard medical therapy (Figs. 6B, 8B). She was treated twice with metronidazole for C.difficile and diarrhea, was documented to have cleared her C.difficile infection after the second course of metronidazole, but then received clindamycin for another bout of recurrent cellulitis.
  • patient 2 After receiving the study treatment, patient 2 reported normal, formed bowel movements within 72 hours. She remained symptom-free for 3 weeks, at which point she again developed recurrent cellulitis and was placed on i.v. ceftriaxone for 10 days by her family physician. She was monitored closely while on i.v. ceftriaxone but did not develop loose stool or diarrhea. After completion of her antibiotic course for cellulitis, she was tested for C.difficile by toxin assay and was still found to be negative. She suffered from several skin and soft tissue infections in the subsequent weeks and received several additional courses of broad-spectrum antibiotics for these infections. Nevertheless, she remained symptom-free with no diarrhea at 14 weeks post-procedure, and at last evaluation, which was 26 weeks post procedure. Similar to patient 1 , a pre-procedure sample of stool was used to culture her strain of C.difficile and this was identified as ribotype 078.
  • FIG. 6A/8A/3A and 6B/8B/3B A timeline of events for Patients #1 and #2 are shown in Figures 6A/8A/3A and 6B/8B/3B, respectively.
  • Patient #1 had C.difficile initially occur after a course of cefazolin for cellulitis. Both patients had multiple courses of antibiotic treatment for the C.difficile with both vancomycin and metronidazole prior to enrolment.
  • patient 1 had treatment with Saccharomyces boulardii.
  • the results of the study show that the synthetic stool preparation used here was effective at eradicating CDI that had failed all other treatment regimens. The results indicate that the synthetic stool preparation is an effective and feasible treatment alternative to the use of defecated donor fecal matter (stool transplant) in the treatment of recurrent CDI.
  • a bioinformatics analysis of the study described in Example 3 was performed by analyzing the V6 region of the bacterial 16S rRNA genes via Ion Torrent.
  • gDNA extraction from stool samples gDNA was extracted using a protocol involving a combination of bead beating, the E.Z.N.A.® Stool DNA Kit (Omega Bio-Tek, Norcross, Georgia, USA) and the Maxwell® 16 DNA Purification Kit (Promega, Madison, Wisconsin, USA). Briefly, 200 ⁇ _ of stool sample, 300 ⁇ _ of E.Z.N.A.
  • kit SLX buffer 10 ⁇ _ of 20mg/ml_ proteinase K (in 0.1 mM CaCI 2 ) and 200 mg glass beads were added to a screw-capped Eppendorf tube and disrupted in a bead beater for 3 minutes. Following subsequent incubation at 70°C for 10 minutes and 95°C for 2 minutes, 100 ⁇ _ E.Z.N.A. Kit Buffer P2 was added to each sample and incubated on ice for 5 minutes. Samples were then centrifuged at 14000 x g for 5 minutes, and the supernatant transferred into new tubes, each containing 200 ⁇ _ E.Z.N.A. Kit HTR reagent.
  • PCR amplification of the bacterial V6 rRNA region was carried out with the left-side primer CWACGCGARGAACCTTACC and the right-side primer
  • ACRACACGAGCTGACGAC ACRACACGAGCTGACGAC. These primer sequences were chosen because they are exact matches to greater than 95% of the rRNA sequences from organisms identified in the human microbiome project.
  • the left-side primers contained the standard Ion Torrent (Ion Torrent Systems Inc., Guilford, Connecticut, USA) adapter and key sequence at their 5' end (CCATCTCATCCCTGCGTGTCTCCGACTCAG).
  • One of the following 5-mer barcodes was located between the 3' end of the key sequence and the 5' end of the primer: TATCG, TAG AC, TGCAT, ATGAG, ACAGT, AGATG, CTCAC, CTGTA, CGTGA, CGACT, AACTC, CCTAT.
  • Duplicate samples did not use the same barcodes.
  • the right-side primer had the other standard Ion Torrent adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) attached to its 5' end.
  • Amplification was performed for 25 cycles in 40 ⁇ _ using the colorless GO-Taq hot start master mix (Promega) according to the manufacturer's instructions with the following three-step temperature profile: 95°C, 55°C, and 72°C for 1 minute each step. Then 5 ⁇ _ of the resulting amplification were quantified using the QuBit broad-range double- stranded DNA fluorometric quantitiation reagent (InVitroGen, Life Technologies, Inc., Burlington, Ontario, Canada). Samples were pooled at approximately equal concentrations and purified using a Wizard PCR Clean-Up Kit (Promega).
  • V6 region of the bacterial 16S rRNA genes was first amplified using the following primers for PCR: left-side primers
  • V6LT1 (SEQ ID NO: 31)
  • V6LT2 (SEQ ID NO: 32)
  • V6LT3 (SEQ ID NO: 33)
  • V6LT4 (SEQ ID NO: 34)
  • V6LT5 (SEQ ID NO: 35)
  • V6LT6 (SEQ ID NO: 36) 5" CCATCTCATCCCTGCGTGTCTCCGACTCAGctcacCWACGCGARGAACCTTACC (V6LT7) (SEQ ID NO: 37)
  • V6LT9 (SEQ ID NO: 39)
  • V6LT10 SEQ ID NO: 40
  • V6LT1 1 (SEQ ID NO: 41)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

There are provided novel synthetic stool preparations comprising bacteria isolated from a fecal sample from a healthy donor. The synthetic stool preparations are used for treating disorders of the gastrointestinal tract, including dysbiosis, Clostridium difficile infection and recurrent Clostridium difficile infection, prevention of recurrence of Clostridium difficile infection, treatment of Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, and diverticular disease, and treatment of food poisoning such as salmonella. Methods of preparation and methods of use of the synthetic stool preparations are also provided.

Description

METHOD FOR TREATMENT OF DISORDERS OF THE GASTROINTESTINAL SYSTEM
RELATED APPLICATIONS
This application claims priority to U.S. provisional application no. 61/534456, filed on September 14, 201 1 , the entire contents of which are hereby incorporated by reference. This application is related to copending international PCT application titled "Methods to Culture Human Gastrointestinal Microorganisms," filed September 14, 2012, the entire contents of which are hereby incorporated by reference.
FIELD OF THE INVENTION
This invention relates to a synthetic stool preparation and methods of use thereof for treating disorders associated with dysbiosis of the gastrointestinal tract, such as Clostridium difficile infection, including recurrent Clostridium difficile infection.
BACKGROUND OF THE INVENTION
Clostridium difficile infection (CDI) is a bacterial infectious disease of the
gastrointestinal tract caused by Clostridium difficile (C. difficile), a toxin-producing Gram- positive anaerobic, spore-forming bacillus. CDI accounts for 15-25% of antibiotic-associated diarrhea (Bartlett, J.G. and Gerding, D.N., Clin. Infect. Dis. 2008, 46, Suppl 1 :S12-8). It occurs most commonly when patients receive antibiotics which alter or eradicate their enteric gut bacteria, allowing overgrowth of C. difficile.
Recurrent CDI is defined as complete resolution of CDI while on appropriate therapy, followed by recurrence of CDI after treatment has been stopped (Bakken, J.S., Anaerobe 2009, 15:285-9). An association exists between recurrent disease and intestinal dysbiosis, i.e., there is an inability of certain individuals to "re-establish" their normal intestinal bacteria (Chang, J.Y. et al., J. Infect. Dis. (2008), 197 (3): 435-8).
CDI is one of the primary hospital-acquired infections and is a significant infectious disease problem in the U.S., Canada and worldwide. Unfortunately, few effective treatments exist for those patients with multiple recurrences of CDI. Recommended therapy for CDI consists of either metronidazole or oral vancomycin (Cohen, S.H. et al., Infect. Control Hosp. Epidemiol. 2010, 31 :431-55). However, antibiotics are not always effective, and recurrences and relapses are common after antibiotic treatment. One effective treatment is fecal bacteriotherapy, or "stool transplant" (infusing donor stool into the intestine of the recipient to re-establish normal bacterial flora or microbiota, i.e., bacterial flora or microbiota associated with a healthy state)(Bakken, J.S., Anaerobe 2009, 15:285-9; Rohlke, F. et al., J. Clin.
Gastroenterol. 2010, 44(8): 567-70). However, stool transplants require costly and time- consuming screening of donors for major pathogens before therapy can proceed, are not reproducible and controllable, can contain pathogenic bacteria and viruses, and often carry a psychological and sociological stigma for the patient.
It would be desirable therefore to be provided with a method of treating CDI which is effective, controllable, reproducible, and/or lowers the rate of recurrence.
SUMMARY OF THE INVENTION
There are provided herein novel synthetic stool preparations for treating disorders of the gastrointestinal tract, e.g., disorders associated with dysbiosis. Methods of use of the synthetic stool preparations as well as methods of making the preparations are also provided herein.
According to one aspect of the invention, there is provided a novel synthetic stool preparation comprising a mixture of bacterial strains. In one aspect, the novel synthetic stool preparation of the invention includes at least one of the bacterial strains described herein, e.g., at least one of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14 below, or at least one strain having all of the identifying
characteristics of at least one strain listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14. In another aspect, the synthetic stool preparation of the invention includes two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14; or two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more strains having all of the identifying characteristics of two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14. In other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 1. In yet other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2a. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 7. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 9. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 10. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 1 1. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 12. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 13. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 14. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Tables 9a-9g.
Additional embodiments of synthetic stool preparations comprise bacterial strains selected from strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or from strains having all of the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B. In an embodiment, synthetic stool preparations comprise bacterial strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or bacterial strains having the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B.
In additional embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which produces butyrate, at least one Bacteroides spp. strain, at least one Clostridium cluster XlVa group bacterial strain, at least one Bifidobacterium longum bacterial strain, at least one Lachnospiraceae bacterial strain and/or at least one bacterial strain which is antagonistic towards C. difficile (e.g., prevents or inhibits sporulation of C. difficile, neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B). In some embodiments, at least one of the bacterial strains in the mixture is not antibiotic resistant, for example not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime. In some embodiments, one or more of the bacterial strains in the mixture is antibiotic resistant, for example resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime. In some embodiments, up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to an antibiotic. In some embodiments, up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to two or three antibiotics.
In other embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of at least one single bacterial species. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a single bacterial species. In another embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a first bacterial species and more than one strain of a second bacterial species; or, more than one strain of a first, a second and a third bactierial species; and so on.
In some embodiments, synthetic stool preparations comprise a mixture of bacterial strains which includes at least one strain which is antagonistic towards Clostridium difficile. In additional embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which inhibits or prevents sporulation of Clostridium difficile. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one bacterial strain is Roseburia intestinalis strain 31 FAA, or a strain having all of the identifying characteristics of Roseburia intestinalis strain 31 FAA. In another embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B.
In further embodiments, the synthetic stool preparation comprises a mixture of bacterial strains, wherein the mixture comprises at least one bacterial strain selected from the group consisting of strain 13LG (Eubacterium limosum), strain 31 FAA (Eubacterium limosum), F.prausnitzii, Roseburia spp., Eubacterium rectale, B.ovatus, P. distasonis, Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Blautia spp., Blautia producta, Dorea spp., R.torques, Bifidobacterium longum, Eubacterium hadrum,
Anaerostipes coli, Clostridium aldenense, Clostridium hathewayi, Clostridium symbiosum, Clostridium orbiscindens, Clostridium citroniae, Clostridium thermocellum, Ruminococcus obeum, Ruminococcus productus, Ruminococcus torques, Roseburia inulinovorans, Blautia coccoides, Dorea sp., Sutterella sp., Dialister invisus, Bifidobacterium pseudocatenulatum, and strains having all of the identifying characteristics of these strains.
In other embodiments, the synthetic stool preparation further comprises a carrier. In further embodiments, the synthetic stool preparation further comprises a prebiotic, insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative.
The synthetic stool preparation may be made or provided in chemostat medium. In another aspect, the synthetic stool preparation is made or provided in saline, e.g., 0.9% saline. It will be understood that any carrier or solution which does not impair viability of the bacteria and is compatible with administration to a subject may be used.
In some aspects, the synthetic stool preparation is made or provided under reduced atmosphere, i.e., in the absence of oxygen. The synthetic stool preparation may be made or provided under N2, C02, H2, or a mixture thereof, optionally with controlled levels of partial pressure of N2:C02: H2.
The synthetic stool preparations provided herein may be used for treating or preventing a number of disorders of the gastrointestinal tract, including dysbiosis,
Clostridium difficile infection, recurrent Clostridium difficile infection, prevention of recurrence of Clostridium difficile infection, treatment of Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and diverticular disease. The synthetic stool preparations may also be used for the treatment of food poisoning, such as food poisoning caused by pathogenic Escherichia coli (e.g., Escherichia coli 0157, EHEC, EPEC, AIEC, EAggEC, ETEC), Salmonella, Clostridium (e.g., Clostridium perfringens, Clostridium botulinum), Listeria monocytogenes, Staphylococcus (e.g., Staph, aureus), Bacillus cereus, Campylobacter (e.g., Campylobacter jejuni, Campylobacter coli), Shigella spp.,
Cryptosporidium or Vibrio cholerae.
In some aspects, there is provided herein a method for treating a disorder associated with dysbiosis of the gastrointestinal tract, comprising administering the synthetic stool preparation of the invention to a subject in need thereof. In one aspect, administration is via rectal enema by the colonoscopic route. For example, a colonoscope is inserted into the cecum of the subject; optionally, a sample of fecal material is suctioned from the area; a first portion (e.g., approximately half) of the synthetic stool preparation is deposited adjacent to the cecum using a syringe attached to the colonoscope; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon using the syringe as the colonoscope is withdrawn. In some cases the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation. The subject may also be treated with a colon cleansing agent before administration of the synthetic stool preparation. In another aspect, administration is oral, e.g., freeze-dried synthetic stool preparation or synthetic stool preparation in capsule or tablet form is administered.
In other aspects, there is provided a method for treating Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof. There is also provided a method for treating recurrent Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof and a method for preventing recurrence of Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof. Methods for treating Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and/or diverticular disease using the synthetic stool preparations of the invention are also provided. In an embodiment, inflammation is reduced in the subject after administration of a synthetic stool preparation of the invention.
In another emdodiment, sporulation of Clostridium difficile is prevented or inhibited after administration of a synthetic stool preparation of the invention. In yet another embodiment, C. difficile toxin, e.g., toxin A or toxin B, is neutralized after administration of a synthetic stool preparation of the invention, or a subject is protected against C. difficile toxin after administration of a synthetic stool preparation of the invention.
In an embodiment, there is provided a method for treating inflammation, comprising administering a synthetic stool preparation of the invention to a subject in need thereof. In an embodiment, the inflammation is associated with dysbiosis of the gastrointestinal tract. The synthetic stool preparation may be administered via rectal enema by the colonoscopic route, or orally.
In an embodiment, the synthetic stool preparation is adapted for administration via rectal enema by the colonoscopic route. In other embodiments, the synthetic stool preparation is adapted for administration orally, e.g., in capsule or tablet form. The synthetic stool preparation may be freeze-dried.
Kits for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising the synthetic stool preparation of the invention, are also provided herein. The kits may further comprise instructions for use thereof. For example, the kit may include at least one bacterial strain selected from strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or from strains having all of the identifying characteristics of strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14. In another embodiment, the kit includes 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains selected from strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains having all of the identifying characteristics of 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14. In other embodiments, the kit includes some or all of the bacterial strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14, or some or all of a group of strains having all of the identifying characteristics of corresponding strains listed in Table 1 , 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 1 1 , 12, 13, or 14.
Methods of preparation and methods of use of the synthetic stool preparations are also provided. For example, there is provided a method for preparing the synthetic stool preparation of the invention, wherein the bacterial strains are grown in a chemostat containing chemostat medium, under reduced atmosphere with controlled levels of partial pressure of N2:C02: H2, and controlled acidity (pH) to replicate human colonic gastrointestinal tract.
Bacterial strains which have not been isolated previously are also provided. For example, there are provided isolated bacterial strains which are Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Eubacterium limosum, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, or strains having all of the identifying characteristics thereof. Use of the isolated bacterial strains to provide a synthetic stool preparation, and synthetic stool preparations comprising one or more novel isolated bacterial strain, are also provided.
BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
For a better understanding of the invention and to show more clearly how it may be carried into effect, reference will now be made by way of example to the accompanying drawings, which illustrate aspects and features according to preferred embodiments of the present invention, and in which:
Figure 1 shows a single-stage chemostat vessel developed by modifying a Multifors fermentation system which was used for growing the isolated bacterial strains as described herein.
Figure 2 shows the full-length or partial (where indicated) 16S rRNA sequences obtained from bacterial strains isolated as described herein. Sequence identifications were performed using GreenGenes (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi); the highest % hit is displayed in the figure.
Figure 3 shows results of bioinformatics analysis of various microbiota samples taken from patients before, during or after treatment with a synthetic stool preparation, as indicated. In (A), dendrograms show the similarity between microbiota samples as assessed by proportional read counts of the V6 rRNA variable region and are drawn using the Neighbour-joining method. The distances between samples are assessed by summing the vertical distance from one sample name to another. In (B), barplots show the proportional data for each sample with each operational taxonomic unit (OTU) coloured individually. The strains are ordered so that those that compose 1 % or more of the synthetic stool preparation appear first (lower in the barplot and figure), with the last strain from the synthetic stool preparation colored in black (in other words, in each sample, ribotypes below the black line in each bar are ribotypes from the synthetic stool preparation). The purple line at the top of each bar represents the aggregate of all organisms that are less than 0.5% abundant in any sample. The three white dots in the middle of the black bars demarcate the transition zone between bacterial strains from the synthetic stool preparation and native strains. PT:
pretreatment sample; D2: 2 days after treatment samples; W2/W4: weeks after treatment samples; RP: synthetic stool preparation sample ("RePOOPulate"); CS: 12 day chemostat sample. The legend for the barplots is shown in (C).
Figure 4 shows PCR samples and their QuBit quantitation which were used for bioinformatics analysis of samples from patients receiving a synthetic stool preparation.
Figure 5 shows representative sequence of each operational taxonomic unit (OTU) as written to a fasta file for the bioinformatics analysis.
Figure 6 shows a timeline of events for Patient #1 (A) and #2 (B) during treatment with a synthetic stool preparation. Prior to administration of the synthetic stool preparation, stool collection on each patient was carried out 2 days pretreatment (PT), at day 2 post treatment (D2), at week 2 post treatment (W2) and at week 4 post treatment (W4). Red indicates treatment steps, brown indicates testing steps, green indicates the study with the synthetic stool preparation, blue indicates the inciting antibiotic and "RePOOPulate" stands for the synthetic stool preparation.
Figure 7 shows that pretreatment with synthetic stool preparation decreases Salmonella infection in a mouse model of colitis. In (A) and (B), luminescence from
Salmonella in intestine isolated from mice infected with Salmonella, in the absence of pretreatment with synthetic stool preparation, is shown; in (C), luminescence from
Salmonella in intestine from mice receiving saline alone (no Salmonella) is shown; in (D) and (E), luminescence from Salmonella in intestine isolated from mice infected with Salmonella, receiving pretreatment with synthetic stool preparation, is shown; and in (F), luminescence from Salmonella in intestine isolated from mice receiving synthetic stool preparation alone (no Salmonella) is shown. The numbers of Salmonella bacteria are indicated at the top of each panel in the figure, as indicated. Figure 8 shows a second clinical timeline of events for Patient #1 (A) and #2 (B), including results of stool collection at 6 months post treatment (6 M) and results of toxin assays for C. difficile. As in Figure 6, sequence of events for the two patients enrolled in the study is shown. (A) Patient 1 had Clostridium difficile initially occurring after a pre-operative course of cefazolin for elective total knee arthroplasty. (B) Patient 2 had C. difficile initially occurring after a course of cefazolin for cellulitis. Both patients had multiple courses of antibiotic treatment for the C. difficile infection with both vancomycin and metronidazole prior to enrollment, as indicated. In addition, Patient 1 received the probiotic Saccharomyces boulardii. Prior to treatment with the stool substitute preparation "RePOOPulate" (RP), stool collection on each patient was carried out at 2 days pre treatment (PT), day 2 post treatment (D2), week 2 post treatment (W2), week 4 post treatment (W4), and 6 months post treatment (6 M). Toxin assays for C. difficile were also performed (purple boxes), with results as shown. Incidental antibiotic use post treatment is indicated. AMX, amoxicillin; CFZ, cefazolin; CIP, ciprofloxacin; CLI, clindamycin; CRO, ceftriaxone; LEX, cephalexin; MTZ,
metranidazole; NIT, nitrofuratoin; SXT, trimethoprim-sulfamethoxazole; VAN, vancomycin.
Figure 9 shows a distance tree of weighted UniFrac distances between samples for Patient 1 amplified and sequenced independently. Distance tree calculated by the unweighted pair group method with arithmetic mean. Branch tips are colored by sample: red, pre-treatment; blue, RePOOPulate formulation. Post-treatment samples are colored green (D2), cyan (W2), and purple (W4). Tip label fields are separated by an underscore character and the fields are: Ion Torrent run ID, person and time of amplification, sample identifier, barcode sequence.
Figure 10 shows principle component coordinates of patient time points and most abundant sequences clustered at family level. Weighted UniFrac principle coordinates were generated by QIIME for each patient independently. These time points are denoted PT for pre treatment, RP for the RePOOPulate formulation, and as the day (D), week (W) or month (M) time point post treatment. The weighted mean abundance of family-level taxonomic groups is indicated by the size and position of the open circles. For example, for Patient 1 Bacteriodaceae are abundant in the day 2 and week 2 post-treatment samples, less abundant in the week 4 post-treatment sample, and are rare in all other samples. Only the 10 most abundant groupings of organisms are shown, and these differ between the two patients, although the Lachnospiraceae family is abundant in both.
Figure 1 1 shows a barplot of abundance at the family level. Operational taxonomic units (OTUs) that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time. Note that the two patients (pt1 : patient 1 ; pt2: patient 2) had very different initial microbiota compositions. The compositional differences were maintained at all time points, suggesting that environmental or genetic factors were important in shaping community structure.
Figure 12 shows weighted abundance overlap at the identical sequence unit and 97%-clustered operational taxonomic unit levels. Proportion of sequence counts that correspond exactly to those in the RePOOPulate (RP) formulation and found in each patient sample as a function of time post treatment. Red, RP formulation; dark blue, samples from Patient 1 ; cyan, samples from Patient 2. There is an initial increase in reads identical to the RP reads immediately after treatment, and a steady decline in proportion for each patient with time since treatment. Both patients had similar RP-identical reads at 6 months post treatment, even though their microbiota profiles were different.
Figure 13 shows unweighted pair group method with arithmetic mean distance tree of the weighted UniFrac distances between samples for Patients 1 and 2. The branch tips are labeled with the sample names for each patient. The scale bar is shown for each patient.
Figure 14 shows a barplot of abundance at the family level. Operational taxonomic units (OTUs) that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time. PT: Patient 1 before treatment; RP: "RePOOPulate" synthetic stool preparation; CS: RP cultured in the chemostat for 2 weeks; D2: Patient 1 at day 2 after treatment with RP synthetic stool preparation; W2: Patient 1 at week 2 after treatment with RP synthetic stool preparation.
Figure 15 shows Schaeffer-Fulton endospore stains to indicate effect of Roseburia intestinalis 31 FAA on C. difficile sporulation in vitro. Schaeffer-Fulton endospore stains are shown in (A), Left: C. difficile strain CD13 alone; Right: CD13 + 31 FAA after 24 hrs of incubation. Spores (indicated by blue circles) can be easily distinguished from CD13 vegetative cells (black arrow), and 31 FAA bacterial cells (blue arrow). Image was viewed on a Leica DM750 bright field microscope (1000x magnification) and captured with a Leica ICC50 camera. Quantitation of results is shown in (B). Green arrows indicate C. difficile cells.
Figure 16 shows that Salmonella-infected mice that received pretreatment with a synthetic stool preparation displayed less weight loss than infected control mice. Mice were pre-treated with vehicle (saline, or Sal) or the "RePOOPulate" synthetic stool preparation (Repoop), as indicated, before infection with Salmonella enterica serovar Typhimurium (Sal). Mice were weighed daily, and the percent change from day 1 to day 4 is shown. Mice given the synthetic stool preparation lost less weight on average than mice not given the preparation. Saline= uninfected mice gavaged with vehicle control (saline); Repoop = uninfected mice gavaged with RePOOPulate; Sal Saline= mice receiving Salmonella and saline; Sal Repoop= mice receiving Salmonella and RePOOPulate. Statistical significance (*p<0.05) was determined by ANOVA with Bonferroni correction. Saline: n=1 ; Repoop: n=12; Sal Saline: n=13; Sal Repoop: n=14.
Figure 17 shows that S. Typhimurium infection increases serum levels of monocyte chemattractant protein-1 (MCP-1), a proinflammatory chemokine. Sa/mone//a-infected mice that received treatment with a synthetic stool preparation displayed less systemic chemokine (MCP-1) release than infected control mice; Serum MCP-1 levels were measured by ELISA. On average, serum MCP-1 concentration was lower in S. Typhimurium infected mice that were pretreated with RePOOPulate (although not statistically significant). Mice that were not infected with S. Typhimurium had similar low serum MCP-1 concentrations. Saline= uninfected mice gavaged with vehicle control (saline); Repoop = uninfected mice gavaged with RePOOPulate; Sal Saline= mice receiving Salmonella and saline; Sal Repoop= mice receiving Salmonella and RePOOPulate. * indicates Paired two tailed t test p value of 0.0370. Saline: n=12; Repoop: n=12; Sal Saline: n=13; Sal Repoop: n=14.
Figure 18 shows that mice treated with a synthetic stool preparation displayed a trend towards less Salmonella invasion/bacterial translocation to the spleen than saline- treated control mice. S. Typhimurium colonization in the spleen was reduced on average in mice pretreated with "RePOOPulate". Spleens were harvested 2 days post infection and bacterial loads were determined in both infected and uninfected groups. Saline= uninfected mice gavaged with vehicle control (saline); Repoop = uninfected mice gavaged with
RePOOPulate; Sal Saline= mice receiving Salmonella and saline; Sal Repoop= mice receiving Salmonella and RePOOPulate. Statistical significance (*p<0.05) was determined by ANOVA with Bonferroni correction. Saline: n=12; Repoop: n=12; Sal Saline: n=13; Sal Repoop: n=14.
Figure 19 shows that Sa/mone//a-infected mice that received treatment with a synthetic stool preparation displayed a trend towards less Salmonella bacterial load in the colon than saline controls. S. Typhimurium colonization in the colon was reduced on average in mice pretreated with RePOOPulate. Colons were harvested 2 days post infection and bacterial loads were determined in both infected and uninfected groups. Saline= uninfected mice gavaged with vehicle control (saline); Repoop = uninfected mice gavaged with RePOOPulate; Sal Saline= mice receiving Salmonella and saline; Sal Repoop= mice receiving Salmonella and RePOOPulate. P value: 0.1585 (T test). Saline: n=8; Repoop: n=8; Sal Saline: n=10; Sal Repoop: n=8.
Figure 20 shows that increase in average serum MCP-1 due to Dextran Sulfate Sodium-induced Colitis (DSS) was decreased by treatment with a synthetic stool preparation. Blood was collected from mice following sacrifice, left to sit on ice for ~1 hour, and then centrifuged at 4000 rpm for 10 minutes. Serum was removed, snap frozen, and stored at -80°C. At time of use, serum was thawed and tested for concentration of MCP-1 using Quantikine JE/MCP-1 Immunoassay kit. Serum concentration of MCP-1 was determined for mice pretreated with saline (Saline) or the "RePOOPulate" synthetic stool preparation (Repoop), with or without DSS.
Figure 21 shows that average colon weight/length ratio was increased by DSS, but was reduced by treatment with a synthetic stool preparation. Following length measurement of the colon, the cecum and anus were removed with scissors, and the colon was flushed with 1 -2 mL of cold PBS. Colons were then weighed and the weight/length ratio was calculated. Weight/length ratio of colon was determined for mice pretreated with saline (Saline) or the "RePOOPulate" synthetic stool preparation (Repoop), before induction of DSS. Saline: n=7; Repoop: n=8; DSS Saline: n=8; DSS Repoop: n=10.
Figure 22 shows that treatment with a synthetic stool preparation ("RePoop") is not toxic to 3T3 fibroblasts and confers protection against C. difficile toxin B cytotoxicity. NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C02. Cells were either pretreated with 200 μΙ RePoop for 2 or 4hrs, and then media was removed and replaced with fresh media containing 1 μg per well of toxin B or with toxin B alone.
Treatments were done in duplicate. Photos were taken after 2 and 4hrs with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification after 2 and 4hrs. (A) shows control cells, as follows: untreated cells (left), cells treated with RePoop for 2 hrs (middle), and cells treated with RePoop for 4 hrs (right). (B) shows cells treated with 1 μg C.difficile toxin B for 2 hours, left panel: cells pretreated with RePoop for 4 hrs; right panel: no pretreatment. (C) shows cells treated with 1 μg C.difficile toxin B for 4 hours, left panel: cells pretreated with RePoop for 4 hrs; right panel: no pretreatment.
Figure 23 shows, in (A), a barplot of abundance at the family level. Operational taxonomic units (OTUs) that comprised more than 0.5% of the OTUs in any sample were grouped into the appropriate family and plotted. These plots show how the actual composition of each sample changes over time. RPA: "RePOOPulate" synthetic stool preparation (RP), Day 0, post inoculum, batch culture; RPB: RP, Vessel 4 (V4), Day 14, continuous culture (this is a culture of the inoculum used to inoculate the batch vessel); RPC: RP, batch culture, Vessel 1 (V1), Day 1 of batch culture; RPD: RP, batch culture, Vessel 1 (V1), Day 2 of batch culture; RPE: RP, batch culture, Vessel 1 (V1), Day 3 of batch culture. This figure shows that, after culture in batch for up to 72 hrs, the proportion of microbes in the vessel was the same compared to continuous culture. In (B), a legend for the barplot in (A) is given.
Figure 24 shows that treatment with a synthetic stool preparation ("RePoop") is not toxic to 3T3 fibroblasts and confers protection against C. difficile toxin B cytotoxicity. NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C02. Cells were either pretreated with 200 μΙ of synthetic stool preparation ("MET") for 2 and 4hrs, media was removed and replaced with fresh media containing ^g per well of toxin B ("toxB1 μg") or with toxin B alone. Treatments were done in duplicate. Photos were taken after 2 and 4hrs with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification after 2 and 4hrs.
Figure 25 shows isolation of toxin A from C.difficile 078 and dose response of Toxin A on NIH 3T3 fibroblast cells. Isolation of toxin A was carried out according to Sullivan, N.M. et al. (Sullivan, N.M. et al., Infect. Immun. 35: 1032-1040, 1982) and Meador III, J. et al. (Meador III, J and Tweten, R. K., Infect. Immun. 56: 1708-1714, 1988). NIH 3T3 fibroblast cells (passage 23) were seeded in a 24-well plate and grown in DMEM media supplied with 10% FBS and Pen/Strep in an incubator at 37°C supplied with 5% C02. Cells were treated with toxin A 0.3 μg, 0.6 μg, or 3 μg for 4 hrs. Treatments were done in duplicate. Photos were taken with a QIMAGING RETIGA-2000RV camera using the OLYMPUS IX70 microscope at 100x total magnification.
Figure 26 shows that mice that received treatment with a "RePOOPulate" synthetic stool preparation prior to exposure of colonic loops to C. difficile toxin A were protected. C57BI/6 female mice 9 weeks old were gavaged daily with vehicle control (top panel) or synthetic stool preparation ("MET") (bottom panel) for 2 days. The large intestine was then excised from the abdominal cavity and colonic loops were injected with either phosphate- buffered saline control (PBS) or with 50 μg of toxin A (TOX A+) isolated from Clostridium difficile as in Fig.25 and then sutured closed. Intestinal loops were incubated ex vivo in DMEM + 10% FBS for 60 min at 37°C with 5% C02. Intestinal loops were then fixed in formalin, embedded in paraffin and 4 μηι sections were cut and stained with hematoxylin and eosin (All at 200X).
DETAILED DESCRIPTION OF THE INVENTION
According to a broad aspect of the invention there is provided herein a novel preparation (referred to as "synthetic stool") for treatment of disorders of the gastrointestinal system, particularly disorders associated with dysbiosis. In one aspect, there is provided herein a method of treating Clostridium difficile infection (CDI), including recurrent CDI, and for prevention of recurrence of CDI. The synthetic stool preparations provided herein comprise a mixture of purified intestinal bacterial cultures, originally isolated from stool from a single donor who had not received antibiotics in the last 5 years. Also provided herein are methods of treating diseases associated with dysbiosis of the gastrointestinal tract using the synthetic stool preparations of the invention such as, for example, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease and food poisoning such as Salmonella.
We report herein a novel synthetic stool preparation composed of a number of different intestinal bacteria isolated in pure culture, from a single donor who had not received antibiotics in the last 5 years, and we show that administration of the synthetic stool preparation can provide a positive therapeutic outcome in patients with recurrent CDI unresponsive to conventional therapy. We have also isolated intestinal bacteria from other donors and report additional synthetic stool preparations composed of intestinal bacteria from other donors as well.
The human gastrointestinal tract contains vast numbers of bacteria, collectively called the intestinal microbiota. The commensal gut flora contribute to host defense by priming the dendritic cells of the immune system, producing bactericidal products that kill pathogenic bacteria, inhibiting the colonization of pathogenic bacteria and competing with pathogens for food and for binding sites along the intestinal epithelial cell surface, a phenomenon collectively known as "colonization resistance" (Stecher B. and Hardt W.D., Trends Microbiol. (2008), 16:107-14; Rolfe, R.D., Infect. Immun. (1984), 45:185-91).
Recurrent CDI is thought to be largely due to the inability of the normal intestinal microflora to recover and re-establish itself, and several studies in the literature now support this concept (Chang, J.Y. et al., J. Infect. Dis. (2008), 197:435-8; Tvede, M. and Rask-Madsen, J., Lancet (1989), 1 :1 156-60; Khoruts, A. et al., J. Clin. Gastroenterol. (2010), 44:354-60). Therapeutic use of the synthetic stool preparations described herein is based, at least in part, on this principle of fecal flora reconstitution for CDI resolution. We show herein that synthetic stool preparations comprising purely isolated intestinal bacteria from a healthy donor are effective, and the effect is at least comparable to what would be expected for fecal bacteriotherapy.
The "synthetic stool" preparations described herein present several potential advantages over current therapies, particularly stool transplants. Synthetic stool preparations provide at least one of the following advantages: First, the exact composition of bacteria administered to a patient is known and can be controlled. Second, the composition and quantity of bacterial species can be reproduced, should further treatment be necessary. Third, the synthetic stool preparations are more stable than stool, which normally must be collected fresh and instilled into the recipient within 6 hours of collection. From a patient safety perspective, the synthetic stool preparation is expected to be superior to the use of defecated donor fecal matter or stool transplant, since absence of viruses and other pathogens in the administered preparation can be ensured. Another potential advantage is that use of the synthetic stool preparation may decrease antibiotic use, particularly oral vancomycin use, in hospitals and in the outpatient setting, thereby reducing risk of selection for drug-resistant bacterial strains. Finally, the psychological and sociological stigma of stool transplant can be eliminated by using the synthetic stool preparation rather than freshly defecated stool. In sum, synthetic stool preparations described herein can provide safe, defined, controllable, reproducible, stable, deliverable, palatable and/or available alternatives to fecal transplants.
Intestinal bacterial strains that were isolated and purified from donor stool (from a donor who had not received antibiotics in the last 5 years) are listed in Table 1 . The strains were speciated using the 16S rRNA full-length sequence and the GreenGenes database (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi). It will be readily understood by the skilled artisan that not all strains isolated from donor stool are suitable for use in synthetic stool preparations. For example, strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile (e.g., resistant to imipenem or vancomycin or both), or strains which are particularly difficult to culture or grow unreliably were not included in the synthetic stool preparations of the invention shown in Tables 2 and 2a. In an embodiment, strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile (e.g., resistant to imipenem or vancomycin or both), or strains which are particularly difficult to culture or grow unreliably are not included in synthetic stool preparations of the invention.
Table 1. Intestinal bacterial strains isolated and purified from donor stool and
suitable for use in synthetic stool preparations. 18 FAAe Eubacterium rectale
10 FAA Dorea longicatena
42 FAA 1 Dorea longicatena
31 FAA 1 Roseburia intestinalis
6 MRS1 Lactobacillus casei/paracasei
1 FAA Eubacterium rectale
27 FM2 Ruminococcus productus
30 FAA Ruminococcus torques
2 MRS Ruminococcus obeum
6 FM 1 Eubacterium rectale
2 FAA Bifidobacterium longum
39 FAA 1 Roseburia faecal is
14 LG 2 Acidaminococcus intestinalis
5 FM Parabacteroides distasonis
21 FAA 13 Clostridium cocleatum
20 MRS 1 Bifidobacterium adolescentis
48 FAA 14 Eubacterium desmolans
5 MM 1 Bacteroides ovatus
4 FM 1 Bifidobacterium longum
11 FM Y Ruminococcus obeum
F1 FAA 1 Eubacterium eligens
25 MRS 1 Lactobacillus casei
13 LGb Eubacterium limosum
9 FAA Ruminococcus torques
47 FAA Eubacterium ventriosum
3 FM 2 Collinsella aerofaciens
1 1 FAA 1 Bifidobacterium adolescentis
34 FAA 1 Lachnospira pectinoshiza
40 FAA Faecalibacterium prausnitzii
29 FAA 1 Eubacterium rectale
16-6-1 1 MRS Bifidobacterium pseudocatenulatum
16-6-1 43 FAA Roseburia inulinovorans
16-6-1 14 MM Blautia coccoides
16-6-1 1 1 MRS* Lactobacillus sp.
16-6-1 38FAA* Eubacterium sp. strain 1
16-6-S 13 LG* Eubacterium sp. strain 2
16-6-S 20 LG Clostridium lactatifermentans
16-6-S 4 LS Clostridium citroniae
16-6-S 5 FAA Clostridium symbiosum
16-6-S 6 FAA Clostridium hathewayi
16-6-S 8 MRS* Unclassified Eubacteriaceae
16-6-S 9 FAA Clostridium orbiscindens
16-6-S 10 LS* Eubacterium sp. or Acetobacterium
16-6-S 15 LS Clostridium aldenense
16-6-S 21 LS* Dorea sp.
16-6-S 1 FM* unclassified Eubacteriaceae
16-6-S 3 LS Dialister invisus 48 16-6-S 10 FAA* Sutterella sp.
49 16-6-S BF 5 Eubacterium fissicatena
50 16-6-S BF 7 Raoultella ornithinolytica
6MRS 100% ID to Lactobacillus casei and Lactobacillus paracasei
2 27FM 95.61 % ID to Ruminococcus productus, 94.63% ID to Clostridium coccoides, 94.68% ID to Blautia coccoides (older BLAST results named this strain Blautia sp.)
3 21 FAA1 89.9% ID to Clostridium spiroforme (older BLAST results named this strain Coprobacillus sp.)
4 48FAA1 91 % ID to Eubacterium desmolans (older BLAST results named this strain Butrycicoccus sp.)
5 13LG 99.3% ID to Eubacterium sp., 94.65% ID to Eubacterium limosum
6 18FAA 99.8% ID to Eubacterium rectale (older BLAST results named this strain Clostridium clostridio forme), 6FM1 99.8% ID to Eubacterium rectale (older BLAST results named this strain Roseburia sp.)
7 1 1 FM1 99.6% ID to Ruminococcus sp. (older BLAST results named this strain Blautia sp.) * As yet, insufficient 16S rRNA gene sequence is available for resolution of closest species
Several of the bacterial strains listed in Table 1 are novel, i.e., not previously described. Thus, in an aspect of the invention there are provided herein novel bacterial strains and their use in synthetic stool preparations. In one aspect, there are provided herein the bacterial strains Ruminococcus productus 27FM, Eubacterium limosum 13LG, Ruminococcus obeum 1 1 FM1 , Clostridium cocleatum 21 FAA1 and Eubacterium desmolans 48FAA1.
To prepare the synthetic stool preparations of the invention, the purified isolates were first identified by 16S rRNA sequencing and subjected to antibiotic profiling, to remove any highly resistant strains of bacteria from the mixture (see Example 1). The NIH Human Microbiome database (the MetaREP database (http://jcvi.org/metarep)) was used to determine the relative proportions of bacteria needed to most closely approximate the natural composition of human stool in a healthy individual. Synthetic stool preparations were made based on available information about the natural composition of stool in healthy individuals ("normal" stool) and the gastrointestinal microbiota, to determine which strains to use and their relative proportions in the mixture, in order to most closely approximate the natural composition of normal stool.
In an embodiment, the synthetic stool preparation of the invention comprises some or all of the strains listed in Table 1 , or of strains having identifying characteristics of the strains listed in Table 1. For example, the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more of the strains listed in Table 1 , or the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more strains selected from 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains having all of the identifying characteristics of strains listed in Table 1.
In another embodiment, the synthetic stool preparation of the invention comprises some or all of the 31 bacterial strains listed in Table 2. The closest bacterial species was determined using the 16S rRNA full-length sequences, which were identified using the GreenGenes database (http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi; DeSantis, T. Z., et al., Appl. Environ. Microbiol. (2006), 72:5069-72). In Table 2, the third column (headed "Relative amount added to synthetic stool preparation") describes one embodiment of the synthetic stool preparation, where all 31 strains are used, and where the relative amount of each of the 31 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ~4 to 7 x 109 Colony Forming Units/mL, as estimated by measurement of OD600nm).
Table 2. An embodiment of the s nthetic stool re aration of the invention.
Figure imgf000019_0001
Figure imgf000020_0001
*http://greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi
Shaded boxes indicate strains that are likely novel species (and in some cases, genera)
Λ,§, ,Δ,#,Ι,/ indicate strains which are closely related or identical by 16S rRNA gene sequence alignment, but which are likely to be different strains of the same species based on differences in colony morphology, antibiotic resistance patterns and/or growth rates.
Thus, in some embodiments the synthetic stool preparation comprises any or all of the 31 bacterial strains listed in Table 2, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2. In some embodiments the synthetic stool preparation comprises any of the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table. In some embodiments the synthetic stool preparation comprises all the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table.
In another embodiment, the synthetic stool preparation of the invention comprises some or all of the 33 bacterial strains listed in Table 2a, or some or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a. The closest bacterial species was determined using the 16S rRNA full-length sequences, which were aligned with the NAST server (DeSantis, T.Z. Jr. et al., Nucleic Acids Res., 34:W394-W399 (2006)) and were then classified using the GreenGenes classification server (DeSantis, T.Z. Jr. et al., Appl. Environ. Microbiol., 72:5069-5072 (2006)). The most specific name in the GreenGenes classification was used (first column) and we report the DNA maximum likelihood score for each classification (second column). The third column (headed "Relative amount added to synthetic stool preparation") describes one embodiment of the synthetic stool preparation, where all 33 strains are used, and where the relative amount of each of the 33 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ~4 to 7 x 109 Colony Forming Units/mL, as estimated by measurement of OD600nm).
Table 2a. An embodiment of the s nthetic stool re aration of the invention.
Figure imgf000020_0002
Bifidobacterium adolescentis 99.79 ++
(2 different strains) 99.79 ++
Bifidobacterium longum 99.86 +++
(2 different strains) 99.16 +++
Blautia producta" 96.43 +
Clostridium cocleatum 91.92 +
Collinsella aerofaciens 98.73 +
Dorea longicatena 99.62 +
(2 different strains) 99.60 +
Escherichia coli 99.80 +
Eubacterium desmolans 94.90 +
Eubacterium eligens 98.15 +++++
Eubacterium limosum 97.05 +
Eubacterium rectale 99.59 +++++
(4 different strains) 99.60 +++++
99.19 +++++
99.53 +++++
Eubacterium ventriosum 100 ++
Faecalibacterium prausnitzii 99.17 +++++
Lachnospira pectinoshiza 95.22 +
Lactobacillus casei/paracasei 99.47 +
Lactobacillus casei 99.74 +
Parabacteroides distasonis 99.45 ++
Raoultella sp. 99.40 +
Roseburia faecal is 99.65 ++
Roseburia intestinalis 100 ++
Ruminococcus torques 99.15 +++
(2 different strains) 99.29 +++
Ruminococcus obeum 94.89 +
(2 different strains) 94.69 +
ψ
Streptococcus mitis 99.79 +
"Closest species match was inferred by alignment of 16SrRNA sequence to GreenGenes database [7]; note that in some cases 16S rRNA gene sequences could not resolve identity beyond genus, and that closest match does not infer definitive speciation. Shaded boxes indicate strains that are likely novel species (and in some cases, genera). Note that some representative strains identify with the same species by 16S rRNA gene sequence alignment, but we believe them to be different strains based on differences in colony morphology, antibiotic resistance patterns and growth rates. Also referred to as Ruminococcus productus. ^FIdentifies with Strep, mitis but is not a-hemolytic.
Thus, in some embodiments the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2a. In some embodiments the synthetic stool preparation comprises any of the 33 bacterial strains listed in Table 2a. In some embodiments the synthetic stool preparation comprises all the 33 bacterial strains listed in Table 2a. In some embodiments, the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, in the relative proportions indicated in the table.
In another embodiment, the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 1 , Table 2 or Table 2a, or one or more than one bacterial strains having all of the identifying characteristics of one or more than one corresponding strains listed in Table 1 , Table 2 or Table 2a. In a further embodiment, the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 1 , Table 2 or Table 2a. In a particular embodiment, the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 1 , Table 2 or Table 2a.
Intestinal bacterial strains that were isolated and purified from stool from a second donor (a male donor, 43 yrs old, with no history of antibiotic use in the 6 years prior to stool donation) are listed in Table 7. Strains were speciated as described above, using the 16S rRNA full-length sequence and the GreenGenes database (http://greengenes.lbl.gov/cgi- bin/nph-blast_interface.cgi).
Table 7. Intestinal bacterial strains isolated and purified from donor stool and suitable for use in s nthetic stool re arations.
Figure imgf000022_0001
13 D6 FAA SS Clostridium aldenense 1 92.04%
21 D6 FAA SS Clostridium aldenense 2 92.24%
13 D5 FAA SS Clostridium asparagiforme 94.37%
3 D6 FAA SS Clostridium bolteae 99.84%
6 D5 FAA Clostridium celerecrescens 94.48%
13 D6 FAA Clostridium hathewayi 1 92.19%
21 FAA NB SS Clostridium hathewayi 2 91.28%
10 FAA Clostridium hathewayi 3
92.99%
1 1 FAA Clostridium hathewayi 4 98.64%
6 D6 FAA SS Clostridium hylemonae 1 99.85%
8 D5 FAA SS Clostridium hylemonae 2 97.85%
5 FAA SS Clostridium inocuum 99.12%
1 1 B D5 FAA SS Clostridium lavalense 99.08%
16 D5 FAA SS Clostridium leptum 93.92%
4 TSA Clostridium orbiscindens 96.21%
14 TSA Clostridium ramosum 96.14%
5 D6 FAA SS Clostridium scindens 99.82%
16 BHI SS Clostridium staminisolvens 95.40%
17 D5 FAA SS Clostridium sulfatireducens 96.63%
2 FAA SS Clostridium symbiosum
99.83%
16 BHI Clostridium thermocellum 90.83%
18 D5 FAA Clostridium sp. 1 99.16%
2 BHI SS Clostridium sp. 2 97.16%
20 D5 FAA Clostridium sp. 3 95.51%
16 D6 FAA SS Clostridium sp. 4 98%
9 D5 FAA SS Clostridium sp. 5 97.88%
5 TSA Clostridium sp. 6 96.95%
6 FAA Collinsella aerofaciens 100%
17 D5 FAA Coprococcus catus 99.19%
1 BHI Coprococcus comes 99.70%
13 FAA Coprococcus eutactus 96.49%
5 NA Dorea formicigenerans 99.49%
1 D5 FAA Dorea longicatena 100%
1 FAA SS AER. Escherichia coli 100%
5 TSAB Eubacterium biforme 98.76%
1 1 NA SS Eubacterium callanderi 98.08%
19 FAA NB SS Eubacterium dolichum 93.23%
20 FAA Eubacterium eligens 96.78%
9 TSAB SS Eubacterium fissicatena 97.67%
1 BHI SS Eubacterium limosum 99.25%
5 D6 FAA Eubacterium rectale 100%
13 BHI Eubacterium siraeum 93.57%
8 MRS Eubacterium ventriosum 97.37%
22 D6 FAA Eubacterium xylanophilum 1 97.39%
15 FAA SS Eubacterium xylanophilum 2 96.53%
23 D6 FAA SS Eubacterium sp. 94.31% 70 5 FAA NB Faecalibacterium prausnitzii b 100%
71 24 FAA Gemmiger/Subdoligranulum
formicilisA/ariabile 1 98.79%
72 19 D5 FAA SS Gemmiger/Subdoligranulum
formicilisA/ariabile 2 95.18%
73 17 D6 FAA SS Holdemania filiformis 97.51%
74 1 FAA NB SS AER. Microbacterium schleiferi 99.34%
75 7 FAA NB SS AER. Micrococcus luteus 97.04%
76 21 D6 FAA Odoribacter splanchnicus 100%
77 24 D6 FAA SS Oscillibacter valericigenes 95.16%
78 6 FAA NB Oscillibacter sp. 98.74%
79 16 FAA Parabacteroides gordonii 99.81%
80 6 D6 FAA Parabacteroides merdae 100%
81 10 D5 FAA SS Parasutterella excrementihominis 100%
82 22 FAA Phascolarctobacterium sp. 99.85%
83 10 D5 FAA Roseburia faecal is 1 99.84%
84 9 D6 FAA Roseburia faecal is 2 96.76%
85 9A BHI Roseburia hominis 99.04%
86 17 TSA Roseburia intestinalis 100%
87 1 1 TSA Roseburia sp. 95.07%
88 23 D5 FAA Ruminococcus albus 96.96%
89 6 FAA NB SS Ruminococcus bromii 1 100%
90 17 FAA SS Ruminococcus bromii 2 92.83%
91 17 TSAB Ruminococcus lactaris 94.46%
92 2 FAA NB Ruminococcus luti 98.91%
93 15 TSA Ruminococcus obeum 99.06%
94 4 FAA Ruminococcus torques 1 99.27%
95 1 1 FAA Ruminococcus torques 2 100%
96 8 D6 FAA SS Ruminococcus torques 3 96.47%
97 9B D6 FAA SS Ruminococcus torques 4 91.94%
98 13 FAA NB Ruminococcus torques 5 91.47%
99 5 BHI Ruminococcus sp. 1 94.32%
100 1 1 FAA NB Ruminococcus sp. 2 98.04%
101 4 D6 FAA SS Ruminococcus sp. 3 97.05%
102 4 FAA SS AER. Staphylococcus epidermidis 99.82%
103 1 FAA NB SS Streptococcus mitis 100%
104 1 1 FAA NB SS Streptococcus thermophilus 100%
105 12 D6 FAA SS Synergistes sp. 95.83%
106 16 D5 FAA Turicibacter sanguinis 100%
a % ID for each species was determined using the 16S rRNA gene database, Green Genes. Average length of sequences used to obtain identification was 550 nucleotides. (Green Genes BLAST interface to 16S data URL: http://greengenes.lbl. gov./cgi-bin/nph-blast interface. cgi)
b The strain Faecalibacterium prausnitzii 5 FAA NB requires Liquid Gold for growth. A 3% final volume of Liquid Gold produced from the chemostat where the donor fecal sample was cultured was used to supplement FAA plates. Growth was observed after 48 hours.
c Multiple strains of the same species are denoted by a number following the species name. For example, Clostridium aldenense 1 and 2 are two different strains of the same species.
Shaded boxes indicate strains that are likely novel species (and in some cases, genera). Antibiotic resistance profiles for strains in Table 7 are provided in Table 8 below.
In some embodiments, synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in") bacterial strains from a certain taxonomic order or family. As used herein, synthetic stool preparations "rich in" or "comprising predominantly" certain strains are comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of those strains. In an embodiment, a synthetic stool preparation rich in bacterial strains of a certain order, e.g., Bacteroidales, Clostridiales, etc., comprises a mixture of bacterial strains, wherein at least about 40% of the bacterial strains in the mixture are of the specified order.
In an embodiment, synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in") bacterial strains of the order Bacteroidales, e.g., bacterial strains of the family Bacteroidetes, e.g., strains listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly (i.e., are "rich in") bacterial strains of the order Clostridiales, e.g., bacterial strains of the family
Catabacteriaceae, Clostridiaceae, Erisipelotrichaceae, Eubacteriaceae, Lachnospiraceae, or Ruminococcaceae, e.g., strains listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order in the human gut microbiome or in an enterotype of human gut.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Catabacteriaceae, Clostridiaceae, Erisipelotrichaceae, Eubacteriaceae, Lachnospiraceae, Ruminococcaceae, Bacteroidetes, Actinomycetales, Bacillales, Bifidobacteriales, Coriobacteriales, Lactobacillales, Proteobacteria,
Selenomonadales, Synergistales, or Verucomicrobiales, e.g., strains listed in Table 14. . In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family in the human gut microbiome or in an enterotype of human gut.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Lachnospiraceae. Such strains are listed, for example, in Table 9a and Table 14. Lachnospiraceae family members are part of the core human microbiome and may be important in maintaining stability of the human microbiota (Sekelja, M. et al., ISME J. 5(3):519-31 , 201 1). Lachnospiraceae have also been implicated as part of the 'healthy' gut microbiota and may play a role in optimizing immune function in the gut (Reeves, A.E., et al., Infect Immun., 2012; Segata, N. et al., Genome Biol., 13(6):R42, 2012; Wang, T. et al.,6(2):320-9, 2012). In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9a or Table 9b. In another embodiment, the synthetic stool preparation comprises some or all of the bacterial strains listed in Table 9a or Table 9b. In yet another embodiment, the synthetic stool preparation is rich in
Lachnospiraceae (or "Lachnospiraceae-rich"), e.g., is comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of strains in the Lachnospiraceae family, or of strains listed in Tables 9a, 9b or 14.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the taxonomic class Proteobacteria.
In an embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype I of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Table 9c. In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9c. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9c.
In another embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype II of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Table 9d. In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9d. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9d.
In another embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype III of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346): 174-80, 201 1), as shown in Tables 9e and 9f. In an
embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9e or 9f. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9e or 9f.
In yet another embodiment, the synthetic stool preparation comprises or is rich in known beneficial microbes, e.g., probiotic strains, as shown in Table 9g.
Table 14. Taxonomic groups for strains in Table 7.
Taxonomic Order Taxonomic Family Genus and Species
Clostridiales Catabacteriaceae Catabacter hongkongensis Genus and species
Catabacter sp.
Clostridiaceae Clostridium sp.
Clostridium staminisolvens Clostridium sulfatireducens
Erisipelotrichaceae Catenibacter mitsuokai
Clostridium innocuum Clostridium ramosum Eubacterium biforme Holdemania filiformis
Eubacterium callanderi
Eubacteriaceae
Eubacterium fissicatena Eubacterium eligens Eubacterium limosum
Blautia sp.
Lachnospiraceae Blautia coccoides
Blautia hydrogenotrophica Blautia luti
Clostridium aldenense Clostridium asparagiforme Clostridium bolteae
Clostridium celerecrescens Clostridium hathewayi (2 different strains)
Clostridium hylemonae (2 different strains)
Clostridium lavalense Clostridium scindens Clostridium symbiosum Coprococcus catus
Coprococcus comes Coprococcus eutactus Dorea formicigenerans Dorea longicatena
Eubacterium eligens Eubacterium rectale Eubacterium ventriosum Eubacterium xylanophilum Roseburia sp.
Roseburia faecalis (2 different strains)
Roseburia hominis
Roseburia intestinalis Ruminococcus obeum Ruminococcus torques (5 different strains)
Ruminococcaceae Clostridium thermocellum
Faecalibacterium prausnitzii Flavonifractor plautii Cpreviously Cl.orbiscindens) Oscillibacter valericigenes Oscillibacter sp.
Ruminococcus sp. (3 different unclassified strains ) Ruminococcus albus
Ruminococcus bromii (2 different strains )
Bacteroidales Bacteroidetes Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Bacteroides capillosus Bacteroides cellulosilyticus Bacteroides eggerthii Bacteroides ovatus
Bacteroides
thetaiotaomicron
Bacteroides uniformis Bacteroides vulgatus Odoribacter splanchnicus Parabacteroides gordonii Parabacteroides merdae
Actinomycetales Microbacterium schleiferi
Micrococcus luteus
Bacillales Brevibacillus parabrevis
Ba cillus circulans/ba ta viensis Bacillus simplex
Staphylococcus epidermidis Turicibacter sanguinis
Bifidobacteriales Bifidobacterium longum
Coriobacteriales Adlercreutzia equolifaciens
Collinsella aerofaciens
Lactobacillales Streptococcus mitis if pen S
Streptococcus thermophilus if pen S
Proteobacteria1 Escherichia coli
Gemmiger
formicilis/Subdoligranulum variabile
Parasutterella
excrementihominis
Selenomonadales Phascolarctobacterium sp.
Synergistales Synergistes sp.
Verrucomicrobiales Akkermansia muciniphila
Indicates a taxonomic class, not a family.
2 -" indicates that the taxonomic family is not given in the table. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic orders listed in Table 14. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic families listed in Table 1 1 or Table 14. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 14.
In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic orders listed in Table 14 is included. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic families listed in Table 11 or Table 14 is included.
In some embodiments the synthetic stool preparation comprises any or all of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14, or any or all bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. In some embodiments the synthetic stool preparation comprises any of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. In an embodiment, the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. In further embodiments, the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. In a particular embodiment, the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 1 1 , Table 12, Table 13 or Table 14. Additional embodiments of synthetic stool preparations of the invention are shown in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B. In an embodiment, synthetic stool preparations comprise some or all of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or some or all of a group of bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B. In an embodiment, synthetic stool preparations comprise one or more than one of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or one or more than one bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B.
In some embodiments, at least one of the bacterial strains in the synthetic stool preparation is Faecalibacterium prausnitzii, or a strain having all of the identifying characteristics thereof.
In some embodiments, at least one of the bacterial strains in the synthetic stool preparation is a novel strain, i.e., a strain which was not previously identified, e.g.,
Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, and/or Clostridium thermocellum.
Table 9. An embodiment of the s nthetic stool re aration of the invention.
Figure imgf000030_0001
D6 FAA SS AER. Brevibacillus parabrevis
MRS SS Catabacter hongkongensis
TSA SS Catabacter sp.
TSAB Catenibacterium mitsuokai
D6 FAA SS Clostridium aldenense 1
D5 FAA SS Clostridium asparagiforme
D5 FAA Clostridium celerecrescens
D6 FAA Clostridium hathewayi 1
FAA NB SS Clostridium hathewayi 2
FAA Clostridium hathewayi 3 D6 FAA SS Clostridium hylemonae 1
D5 FAA SS Clostridium hylemonae 2
FAA SS Clostridium inocuum
B D5 FAA SS Clostridium lavalense
D5 FAA SS Clostridium leptum
D5 FAA SS Clostridium sulfatireducens
FAA SS Clostridium symbiosum BHI Clostridium thermocellum
D5 FAA Clostridium sp. 1
D5 FAA Clostridium sp. 3
D6 FAA SS Clostridium sp. 4
D5 FAA SS Clostridium sp. 5
TSA Clostridium sp. 6
FAA Collinsella aerofaciens
D5 FAA Coprococcus catus
BHI Coprococcus comes
FAA Coprococcus eutactus
NA Dorea formicigenerans
D5 FAA Dorea longicatena
TSAB Eubacterium biforme
NA SS Eubacterium callanderi
FAA NB SS Eubacterium dolichum
FAA Eubacterium eligens
TSAB SS Eubacterium fissicatena
D6 FAA Eubacterium rectale
BHI Eubacterium siraeum
D6 FAA Eubacterium xylanophilum 1
FAA SS Eubacterium xylanophilum 2
D6 FAA SS Eubacterium sp.
FAA NB Faecalibacterium prausnitzii b
FAA Gemmiger/Subdoligranulum formicilisA/ariabile 1 D5 FAA SS Gemmiger/Subdoligranulum formicilisA/ariabile 2 FAA NB SS AER. Microbacterium schleiferi
FAA NB SS AER. Micrococcus luteus
D6 FAA Odoribacter splanchnicus
D6 FAA SS Oscillibacter valericigenes 6 FAA NB Oscillibacter sp.
10 D5 FAA SS Parasutterella excrementihominis
22 FAA Phascolarctobacterium sp.
10 D5 FAA Roseburia faecalis 1
9 D6 FAA Roseburia faecalis 2
9A BHI Roseburia hominis
17 TSA Roseburia intestinalis
1 1 TSA Roseburia sp.
23 D5 FAA Ruminococcus albus
6 FAA NB SS Ruminococcus bromii 1
17 FAA SS Ruminococcus bromii 2
17 TSAB Ruminococcus lactaris
2 FAA NB Ruminococcus luti
15 TSA Ruminococcus obeum
4 FAA Ruminococcus torques 1
1 1 FAA Ruminococcus torques 2
8 D6 FAA SS Ruminococcus torques 3
9B D6 FAA SS Ruminococcus torques 4
13 FAA NB Ruminococcus torques 5
5 BHI Ruminococcus sp. 1
1 1 FAA NB Ruminococcus sp. 2
4 FAA SS AER. Staphylococcus epidermidis
1 FAA NB SS Streptococcus mitis
1 1 FAA NB SS Streptococcus thermophilus
12 D6 FAA SS Synergistes sp.
16 D5 FAA Turicibacter sanguinis
Table 9a. An embodiment of the synthetic stool preparation of the invention. Species
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium
coccoides
Clostridium aldenense 1
Clostridium aldenense 2
Clostridium asparagiforme
Clostridium bolteae
Clostridium hathewayi 1
Clostridium hathewayi 2
Clostridium hathewayi 3
Clostridium hathewayi 4
Clostridium celerecrescens
Clostridium scindens
Clostridium symbiosum
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans Dorea longicatena
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium eligens
Eubacterium rectale
Eubacterium ventriosum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus lactaris
Ruminococcus obeum
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3
Ruminococcus torques 4
Ruminococcus torques 5
Table 9b. An embodiment of the synthetic stool preparation of the invention. Species
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium
coccoides
Clostridium celerecrescens
Clostridium scindens
Clostridium symbiosum
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium eligens
Eubacterium rectale
Eubacterium ventriosum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus lactaris
Ruminococcus obeum
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3 Ruminococcus torques 4
Ruminococcus torques 5
Table 9c. An embodiment of the synthetic stool preparation of the invention. Species
Bacteroides capillosus
Bacteroides cellulosilyticus
Bacteroides eggerthii
Bacteroides ovatus
Bacteroides
thetaiotaomicron
Bacteroides uniformis
Bacteroides vulgatus
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Parabacteroides gordonii
Parabacteroides merdae
Table 9d. An embodiment of the synthetic stool preparation of the invention. Species
Akkermansia muciniphila
Escherichia coli
Holdemania filiformis
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum
formicilisA/ariabile 1
Gemmiger/Subdoligranulum
formicilisA/ariabile 2
Faecalibacterium prausnitzii
Clostridium
orbiscindens/Flavonifractor
plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Table 9e. An embodiment of the synthetic stool preparation of the invention. Species
Akkermansia muciniphila
Alistipes finegoldii Alistipes putredinis
Alistipes shahii
Alistipes sp.
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum
formicilisA/ariabile 1
Gemmiger/Subdoligranulum
formicilisA/ariabile 2
Faecalibacterium prausnitzii
Clostridium
orbiscindens/Flavonifractor
plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Staphylococcus epidermidis
Table 9f. An embodiment of the synthetic stool preparation of the invention.
Species
Akkermansia muciniphila
Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum
formicilisA/ariabile 1
Gemmiger/Subdoligranulum
formicilisA ariabile 2
Faecalibacterium prausnitzii
Clostridium
orbiscindens/Flavonifractor
plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Table 9g. An embodiment of the synthetic stool preparation of the invention. Species I Adlercreutzia equolifaciens
Akkermansia muciniphila
Bifidobacterium longum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Faecalibacterium prausnitzii
Table 10. An embodiment of the synthetic stool preparation of the invention. Genus
Bacteroides
Parabacteroides
Roseburia sp
Erysipelotrichaceae
Enterobacteriaceae
Acidaminococcus
Faecalibacterium
Lachnospiracea
Enterobacteriaceae
Roseburia
Collinsella
Eubacterium
Lachnospiraceae
Gammaproteobacteria
Dorea
Sporanaerobacter
Table 11. An embodiment of the synthetic stool preparation of the invention. Closest taxonomic family
Coriobacteriaceae
Bacteroidaceae
Porphyromonadaceae
Bacillaceael
Paenibacillaceael
Lactobacillaceae
Clostridiaceael
Lachnospiraceae
Peptostreptococcaceae
Ruminococcaceae
Clostridiales1
Erysipelotrichaceae
Acidaminococcaceae
Veillonellaceae
Enterobacteriaceae
Verrucomicrobiaceae
indicates taxonomic order, not family.
Table 12. An embodiment of the synthetic stool preparation of the invention. Closest taxonomic family
Verrucomicrobiae
Enterobacteriaceae
Sutterellaceae
Hyphomicrobiaceae
Veillonellaceae
Acidaminococcaceae
Erysipelotrichaceae
Clostridiales
Ruminococcaceae
Peptostreptococcaceae
Lachnospiraceae
Clostridiales IncertaeSedis XIII
Clostridiales IncertaeSedis XI
Clostridiaceael
Streptococcaceae
Lactobacillaceae
Enterococcaceae
Paenibacillaceael
Bacillaceael
Porphyromonadaceae
Bacteroidaceae
Bifidobacteriaceae
Coriobacteriaceae
Table 13. An embodiment of the synthetic stool preparation of the invention. Species
Adlercreutzia equolifaciens
Akkermansia muciniphila
Alistipes shahii
Bacteroides ovatus
Bacteroides cellulosilyticus
Bacillus circulans
Bifidobacterium longum
Blautia/Clostridium coccoides
Catenibacterium mitsuokai
Clostridium hylemonae 1
Clostridium symbiosum
Eubacterium limosum
Eubacterium rectale
Collinsella aerofaciens
Coprococcus comes
Dorea longicatena
Escherichia coli
Eubacterium eligens
Faecalibacterium prausnitzii
Microbacterium schleiferi
Oscillibacter valericigenes
Parabacteroides merdae
Parasutterella excrementihominis
Phascolarctobacterium sp. Roseburia faecalis 1
Ruminococcus torques 1
Synergistes sp.
In an embodiment, the synthetic stool preparation further comprises one or more other bacterial strains which are known in the art to occupy the intestine in healthy individuals or to be found in stool from healthy individuals. In an embodiment, the synthetic stool preparation comprises one or more bacterial strains found in an enterotype of human gut, e.g., the Bacteroides, the Prevotella or the Ruminococcus enterotype. In another embodiment, the synthetic stool preparation comprises one or more bacterial strains found in the human gut microbiome.
In an embodiment, the bacterial strains in the synthetic stool preparation are not antibiotic-resistant. In a particular embodiment, the bacterial strains in the synthetic stool prepraration are not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin/clavulanic acid, imipenem, moxifloxacin, vancomycin and/or ceftazidime.
In yet another embodiment, at least one of the bacterial strains in the synthetic stool preparation is a butyrate-producing strain (See, e.g., Louis, P. and Flint, H.J., FEMS
Microbiol. Lett. (2009), 294(1): 1 -8 for a discussion of butyrate-producing bacteria in the human large intestine; see also Wong, J.M. et al., J. Clin. Gastroenterol. (2006), 40(3):235- 43 for a review of the importance of butyrate). In one embodiment, the synthetic stool preparation comprises F.prausnitzii, Roseburia spp. and/or Eubacterium rectale.
In a further embodiment, at least one of the bacterial strains in the synthetic stool preparation is a Bacteroides spp. strain. In one embodiment, the synthetic stool preparation comprises B.ovatus and/or P. distasonis.
In yet another embodiment, at least one of the bacterial strains in the synthetic stool preparation is a bacterial species in the Clostridium cluster XlVa group, also known as the Lachnospiraceae. These strains are among the most abundant bacteria in the human gut in healthy individuals. Thus in one embodiment, the synthetic stool preparation comprises organisms that identify with Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Dorea spp., Ruminococcus obeum, Blautia producta, and/or Ruminococcus torques.
In an embodiment, the synthetic stool preparation comprises Bifidobacterium longum. Some B.longum strains are known to have clinically proven probiotic effects. It will be understood by the skilled artisan that many other embodiments are possible. For example, in an embodiment, the synthetic stool preparation comprises at least one Lachnospiraceae strain. In another embodiment, the synthetic stool preparation comprises one or more strains that identify with the following species: Eubacterium hadrum;
Anaerostipes coli; Clostridium spp. (aldenense, hathewayi, symbiosum, orbiscindens and citroniae); Roseburia inulinovorans; Blautia coccoides; Dorea spp.; Sutterella spp.; Dialister invisus; and Bifidobacterium pseudocatenulatum.
It will be appreciated that in some embodiments, it will be desirable to include at least one bacterial strain in the synthetic stool preparation which is antagonistic towards C.
difficile, e.g., antagonistic to the growth or survival of C.difficile. In an embodiment, at least one of the bacterial strains in the synthetic stool preparation has an activity of preventing or inhibiting sporulation of C. difficile. For example, at least one of the bacterial strains in the synthetic stool preparation is Roseburia intestinalis strain 31 FAA. In another embodiment, at least one of the bacterial strains in the synthetic stool preparation has an activity of neutralizing or protecting against C. difficile toxin, e.g., toxin A or toxin B.
In one embodiment, the synthetic stool preparation comprises more than one strain of a single species. Without wishing to be bound by theory, it is believed that in some cases two strains of the same species isolated from the same host can work together
synergistically; indeed, the strains may have adapted to do so.
In an embodiment, the synthetic stool preparation further comprises a prebiotic. Without wishing to be bound by theory, a prebiotic may provide a bolus of nutrients for the strains in the synthetic stool preparation to assist their early growth after administration to the patient. Any prebiotic known in the art may be used. Non-limiting examples of prebiotics include oligosaccharides, e.g., fructooligosaccharides such as oligofructose and inulin, mannan oligosaccharides and galactooligosacchandes, soluble, oligofructose-enriched inulin and soluble fiber.
It is known in the art that identification of a bacterial species is based on many factors, including cell and colony morphology, chemical composition of cell walls (e.g., Gram-negative vs. Gram-positive, cell wall fatty acid make-up), biochemical activities, nutritional requirements, motility, presence or absence of structures external to the cell wall (e.g., flagella, pili), endospore formation, genomic sequence (including 16S rRNA gene sequence), etc. It should be understood therefore that many different factors may be used to identify a bacterial species and that an exact identification is not always feasible.
Accordingly, as used herein, reference to a certain bacterial strain includes a strain having all of the identifying characteristics of the bacterial strain. Identifying characteristics used to identify bacterial species or strains may include factors listed above, such as cell morphology, colony morphology, Gram staining reaction, biochemical activities (e.g., aerobic or anaerobic), nutritional requirements, 16S rRNA sequence, or a subset or combination thereof. The particular identifying characteristics used will depend on the type of bacteria and are determined by the skilled artisan.
In one embodiment, bacterial species or strains are identified by 16S rRNA sequence, e.g., sequence of V6 region of 16S rRNA. In an embodiment, two bacterial species or strains are considered to be the same, or to share identifying characteristics, if they share at least 20%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% sequence identity in their 16S rRNA sequences or in the V6 region of their 16S rRNA sequences.
The preparations and methods of the invention may be used to treat disorders associated with dysbiosis (microbial imbalance) of the gastrointestinal tract. Dysbiosis is an imbalance of intestinal bacteria that leads to changes in the activities of the gastrointestinal tract. Non-limiting examples of such conditions which may be treated by the synthetic stool preparations of the invention include C.difficile colitis, Ulcerative colitis, Microscopic colitis, Pouchitis, Acute Postradiotherapy Diarrhea, Post-infectious colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease, obesity, regressive autism with gut involvement, PANDAS, Neonatal necrotizing colitis, enteritis caused by various pathogens including Salmonella spp., Campylobacter spp., Shigella spp., pathogenic Escherichia coli strains, and Cryptosporidium parvum, HIV enteropathy, Anorexia nervosa/Bulimia nervosa (due to the emerging link between gut microbiota and brain/behaviour), Clinical depression, toxic or aseptic shock, Toxic megacolon, Traveler's diarrhea, Hepatitis B Virus-Induced Chronic Liver Disease, systemic sclerosis, antibiotic-associated diarrhea, and diverticular disease. Intestinal dysbiosis is also linked to a number of other disorders or health conditions including metabolic disease, cardiovascular disease, colon cancer, breast cancer, autism, attention deficit disorder, autoimmune disorders, asthma, and allergies.
In one embodiment, the preparations and methods of the invention are used to treat Clostridium difficile infection (CDI), including recurrent CDI. The preparations and methods of the invention may also be used to prevent recurrence of CDI in a subject previously afflicted with CDI. In another embodiment, the preparations and methods of the invention are used to treat a disorder associated with dysbiosis of the gastrointestinal tract. In yet another embodiment, the preparations and methods of the invention are used to treat ulcerative colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease and/or diverticular disease.
In another embodiment, the synthetic stool preparations of the invention are used to treat bacterial pathogens such as those causing food poisoning. For example, the synthetic stool preparations may be used to treat Escherichia coli (e.g., E.coli enteritis, E.coli 0157), Salmonella spp., Clostridium perfringens, Listeria monocytogenes, Staphylococcus (e.g., Staph, aureus, Botulism (Clostridium botulinum), Campylobacter spp., Shigella spp., Bacillus cereus, Cryptosporidium, cholera (Vibrio cholerae) and other known bacterial pathogens which cause food poisoning.
In a further embodiment, the synthetic stool preparations of the invention are used prophylactically in persons at risk of developing CDI, for example persons receiving antibiotic therapy, persons having a prolonged hospital stay, or persons lacking a threshold level of bacterial diversity. The level of bacterial diversity of a subject could be determined, for example, using 16S rRNA gene sequence profiling of bacteria from a fecal sample.
In an embodiment, synthetic stool preparations of the invention are used to reduce inflammation, e.g., inflammation of the colon, in a subject,
In another aspect, there are provided herein kits for treating the described disorders comprising the synthetic stool preparations or the bacterial strains described herein. In some embodiments the kits may also include instruction materials. Instructions may be printed on paper or other substrates, and/or may be supplied as an electronic-readable medium, such as a floppy disc, CD-ROM, DVD-ROM, Zip disc, videotape, audio tape, etc. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an internet web site specified by the manufacturer or distributor of the kit, or supplied as electronic mail.
In an embodiment, the synthetic stool preparation is adapted for administration via rectal enema using a colonoscope. For example, in one embodiment the colonoscope is inserted into the cecum of the subject; a sample of fecal material is suctioned from the area; a syringe containing the synthetic stool preparation is attached to the colonoscope; a first portion of the synthetic stool preparation is deposited adjacent to the cecum; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon as the colonoscope is withdrawn. In an embodiment, the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation. In another embodiment, the subject is treated with colon cleansing agents before administration of the synthetic stool preparation. In yet another embodiment, the first and second portions each comprise approximately half of the synthetic stool preparation.
In another embodiment, the synthetic stool preparation is adapted for administration orally. For example, the bacteria are freeze-dried and encapsulated (e.g., in a capsule or pressed into a tablet) for oral administration. In some embodiments it may be desirable to add agents, such as buffering agents, to promote viability of the bacterial strains. It will be appreciated that the capsule or tablet may need a coating to protect against stomach acid. Such capsules and tablets may be formulated using methods known in the art.
It will be appreciated that the optimal synthetic stool preparation may vary depending on the subject, the disease or condition being treated, and so on. For example, it has been reported that the human gut microbiome, that is, the community of organisms that live symbiotically within humans, may occur in certain set varieties or "enterotypes" (Arumugan, M. et al., Nature (201 1), 473: 174). Three human enterotypes which vary in species and functional composition have been reported, namely Bacteroides, Prevotella and
Ruminococcus. Thus, it will be appreciated that the optimal synthetic stool preparation may depend on the enterotype of the subject, which may in turn depend upon patient lifestyle, e.g., their diet. In one aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Bacteroides enterotype. In another aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Prevotella enterotype. In yet another aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Ruminococcus enterotype.
In some embodiments, the synthetic stool preparation comprises a carrier.
It will also be appreciated that it may be desirable to supplement the bacterial mixture in the synthetic stool preparation with additional buffers, nutrients, or other agents, for example to enhance the viability of the bacterial strains during transit or storage. In some embodiments, insoluble fiber is added to the synthetic stool preparation as a carrier, e.g., to provide protection during transit or storage. In yet other embodiments, the synthetic stool preparation comprises insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative, such as an anti-fungal agent. Glycerol or DMSO may be added to the bacterial strains for cryoprotection when the strains are frozen for storage.
In some embodiments, the synthetic stool preparation is made or stored in chemostat medium, e.g., the medium in which a steady-state culture is actively growing. In one embodiment, this medium is supplemented with additional insoluble fiber. In other embodiments, the synthetic stool preparations are provided at physiological salt concentrations. For example, the synthetic stool preparations may be made or stored in saline, e.g., 0.9% saline.
In some embodiments, the synthetic stool preparations are made and/or stored under reduced atmosphere, i.e., in the absence of oxygen. For example, the synthetic stool preparations may be made and/or stored under N2, C02, H2, or under a mixture of these, such as N2:C02:H2j 80:10:10. It will be appreciated that when the bacterial strains are not metabolically active, an inert gas like N2 can be used, although some of the bacterial strains in the synthetic stool preparations may need C02 and/or H2 when growing actively. The pressure is the same or substantially the same as the pressure of the outside air.
Examples
The present invention will be more readily understood by referring to the following examples, which are provided to illustrate the invention and are not to be construed as limiting the scope thereof in any manner.
Unless defined otherwise or the context clearly dictates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It should be understood that any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention.
Example 1. Isolation of bacterial strains.
A healthy donor was identified and screened for suitability as a fecal transplant donor using a standard panel of microbiology tests. The most important criterion for donor selection was the donor's prior exposure to antibiotic therapy. Our donor had only one reported antibiotic exposure, 5 years prior to donation, and cannot recall having had any during her childhood, which is believed to be the critical time during which the gut microbiota develop.
All the bacterial strains used in the synthetic stool preparations of the invention were isolated from a single donor. Without wishing to be bound by theory, it is believed that strains that have evolved together in one host may work synergistically together and that it may therefore be preferable to use strains isolated from a single donor.
The donor was asked to void feces in a private bathroom near the lab, into a provided sterile pot. The pot was immediately transported to the lab and placed into an anaerobic container within 5 minutes of voiding. It is noted that some of the isolates, in particular Roseburia spp., are extremely sensitive to oxygen, and thus it is critical that the voided sample is protected from exposure to oxygen even for the short-term (5 mins).
Once in the anaerobic chamber, a 10g sample of feces was weighed into 50 ml_ sterile, pre-reduced saline and placed into a sterile stomacher bag. This was placed into the stomacher instrument and pummelled for 2 minutes to homogenize the sample. The homogenate was then placed into a sterile centrifuge tube and spun at low speed to sediment large particles.
Two rounds of microbial isolation were then performed. At the outset, a dilution series of the homogenate supernatant was made in sterile, pre-reduced saline. 100 uL of each dilution was separately plated onto quadruplicates of prepared agar media as below:
Fastidious anaerobe agar (Lab 90) supplemented with 5% defibrinated sheep blood;
Fastidious anaerobe agar without blood supplementation;
Fastidious anaerobe agar + 5% defibrinated sheep blood +3% 'liquid gold' (described below);
Fastidious anaerobe agar + 3% liquid gold; deMan-Rogosa-Sharpe (MRS) media (purchased from Oxoid Limited, Hampshire, United Kingdom), enriches for Lactobacillus and Bifidobacterium spp.);
Mucin agar formulated in-house (minimal media with mucin as the only carbon source; this is used since some bacterial species of the human gut microflora are known to utilize mucin as a carbon source); and
LS agar, which is agar supplemented with 3% v/v spent cell culture supernatant taken from a confluent culture of LS174T cells (a human colonic cell line which secretes mucin; see
http://www.atcc.org/ATCCAdvancedCatalogSearch/ProductDetails/tabid/452/Default.aspx7A TCCNum=CL-188&Template=cellBiology).
Cell culture media was prepared from: 1 package of minimum essential medium (Gibco #41500-034); 2.2g sodium bicarbonate (Sigma); 4.766g HEPES buffer (Sigma); 10mL 100mM sodium pyruvate solution; 10% (v/v) heat-inactivated fetal bovine serum (Gibco) (30 min. at 56°C), brought up to 1 litre in double-distilled water and filter-sterilized through a 0.22μηι pore-sized filter (Millipore). Spent cell culture medium was medium taken from the supernatant of LS174T cells cultured at 37 °C in 5% C02 for 5 days, and filtered through a 0.22μηι pore-sized filter to remove host cells. This medium was used as some bacterial isolates may require human cell signals for proliferation and growth in vitro.
Plates were incubated for 2 weeks in a humidified anaerobe chamber (Bug Box from Ruskinn, Bridegend, United Kingdom), and inspected for growth every few days. Isolated colonies were picked to new plates and allowed to grow for the same length of time, to ensure that pure cultures were obtained; any second or third colony type which grew was removed. All cultures were carefully cryopreserved in freezing media (a milk-glycerol- dimethyl sulfoxide mix designed for preservation of anaerobes, containing 60g Carnation skim milk powder (Zehr's), 5 mL DMSO (Sigma) and 5 mL glycerol (Sigma) and double distilled H20 to bring total volume to 500 mL).
Once strains were isolated, optimal growth conditions were determined empirically by culturing each isolate on each different medium type as above, and determining which media gave the best growth. It is important to note that the strains were kept in an anaerobic environment at all times. They were never worked with outside of an anaerobic
environment, e.g., we never worked with the live bacteria on an open bench, and the microbes were kept as healthy as possible at all times.
For the second round of characterization, a chemostat was used to first stabilize the microbial community as a whole, in vitro. Steady state (equilibrium) was reached after about 1 month, following which we used the dilution and plating methods as above to try to isolate further micro-organisms. The chemostat was used to allow us to effectively sample and culture the community and also to enrich for some gut microbes that may have been present in only small numbers in the original fecal sample. These organisms may be, for example, microbes that are intimately associated with the mucosa and are 'sloughed off along with dead cells in the colon. The chemostat environment allows some of these bugs to survive and proliferate effectively, enriching their numbers so that they can be plate-cultured as above.
The terms "cultured" and "grown" are sometimes used interchangeably herein.
For growth in the chemostat, we developed a single-stage chemostat vessel by modifying a Multifors fermentation system (Infors, Switzerland; shown in Figure 1).
Conversion from a fermentation system into a chemostat was accomplished by blocking off the condenser and bubbling nitrogen gas through the culture. The pressure build up forced the waste out of a metal tube (formerly a sampling tube) at a set height and allowed for the maintenance of a 400 mL working volume. Throughout the duration of the experiment, the vessels were kept anaerobic by bubbling filtered nitrogen gas (Praxair) through the culture. Temperature (37 °C) and pH (set to 7.0; usually fluctuated around 6.9 to 7 in the culture) were automatically controlled and maintained by the computer-operated system. The system maintained the culture pH using 5% (v/v) HCI (Sigma) and 5% (w/v) NaOH (Sigma). The growth medium was continuously fed into the vessel at a rate of 400 mL/day (16.7 mL/hour) to give a retention time of 24 hours, a value set to mimic the retention time of the distal gut (Cummings, J. H. et al., Gut (1976), 17:210-18).
Since the growth medium contained components which cannot survive sterilization by autoclaving (see below), the vessels were autoclaved with 400 mL of ddH20. During autoclaving, the waste pipes were adjusted so the metal tube reached the bottom of the vessel. Once the vessel cooled it was fitted to the rest of the computer operated unit, filtered nitrogen gas was bubbled through the water to pressurize and drain the vessel. The waste pipe was then raised to the working volume (400 mL) and 300 mL of sterile media was pumped into the vessel. The vessel was then left stirring, heating, and degassing overnight. To check for contamination within the vessel, each vessel was aseptically sampled and plated out (both aerobically and anaerobically) on fastidious anaerobe agar (FAA) supplemented with 5% defibrinated sheep blood. This procedure was repeated one day before inoculation and immediately prior to inoculation to ensure contamination was avoided.
The fecal sample was collected as described above; the freshly voided stool sample was collected and immediately placed in an anaerobic chamber (in an atmosphere of 90% N2, 5% C02 and 5% H2)(Praxair). A 10% (w/v) fecal slurry was immediately prepared by macerating 5g of fresh feces in 50 mL of anaerobic phosphate buffered saline (PBS) for 1 minute using a stomacher (Tekmar Stomacher Lab Blender, made by Seward). The resulting fecal slurry was centrifuged for 10 minutes at 1500 rpm to remove large food residues. The resulting 10% original w/v fecal slurry supernatant ("10% inocula") was used as the inoculum for this study.
To give a final working volume of 400 mL, 100 mL of 10% inocula was added to the 300 mL of sterile medium in each vessel. Since the thickness of the fecal inoculum made it difficult to seed the vessel through the septum using a needle, the inoculum was added to the vessel through the waste pipe using a syringe. Immediately following inoculation the pH controls were turned on so the vessel pH was adjusted to and maintained at a pH of about 6.9 to 7.0. During the first 24 hours post-inoculation the communities were grown in batch culture to allow the community to adjust from in vivo to in vitro conditions and avoid culture washout. During this period the vessels were heated, degassed and stirred with continuous pH adjustment. After this 24 hour period the feed pumps were turned on and the vessels were run as chemostats. Fresh culture medium was added continuously and waste was continuously removed. In the chemostat, culture conditions and media supply were maintained constant. The chemostat system was set with a retention time of 24 hours to mimic distal gut transit time.
A chemostat growth medium was developed. Due to the large amount of medium used by each vessel, medium was prepared in 2L volumes. The chemostat medium was prepared in the following steps (for 2L):
Mixture 1 : The following reagents were dissolved in 1800 mL of distilled water:
peptone water, 4 g (Oxoid Limited); yeast extract, 4g (Oxoid Limited); NaHC03, 4g (Sigma); CaCI2, 0.02g (Sigma); pectin (from citrus), 4g (Sigma); xylan (from beechwood), 4g (Sigma); arabinogalactan, 4g (Sigma); starch (from wheat, unmodified), 10g (Sigma); casein, 6g (Sigma); inulin (from Dahlia tubers), 2g (Sigma); NaCI, 0.2g (Sigma). This mixture was sterilized by autoclaving at 121 °C for 60 min.
Mixture 2: The following reagents (all purchased from Sigma) were dissolved in 100 mL of distilled water (Mixture 2A): K2HP04, 0.08g; KH2P04, 0.08g; MgS04, 0.02g; hemin, 0.01 g; menadione, 0.002g. Bile salts (1 g) was dissolved in 50 mL of distilled water (Mixture 2B). L-cysteine HCI (1 g) was also dissolved in 50 mL of distilled water (Mixture 2C). After Mixtures 2B and 2C dissolved they were added to Mixture 2A resulting in the formation of a fine white precipitate. This precipitate was then dissolved by the drop-wise addition of 6M KOH until a clear, brown solution was formed (Mixture 2). This mixture (200 mL total volume) was sterilized by filtering through a 0.22 μηι filter.
Chemostat media: Mixture 2 (0.2 L) was aseptically added to mixture 1 (1 .8 L), in order to reach the final volume of 2L. To prevent future foaming, 5 mL of antifoam B silicone emulsion (J.T. Baker) was aseptically added to each 2L bottle of media. The media was stored at 4 DC until use for a maximum of two weeks.
The media was pumped into each vessel using a peristaltic pump whose speed is controlled by the computer-operated system. To pump media from the bottles into the vessel, standard GL-45 glass bottle lids (VWR) had holes drilled into them to fit two stainless steel metal tubes. When Mixture 1 was prepared, the media bottle had all the required silicone tubing and 0.22 μηι filters attached (see Figure 1).
Each vessel was fed from one media bottle with a 2L volume of media. Since the tubing which supplied the media to the vessel was also changed as each media bottle was changed, this helped to prevent back-growth of bacteria from the vessel into the sterile media reservoir. Each media bottle was plated out on supplemented FAA and grown both aerobically and anaerobically before each bottle was added to the chemostat and after each bottle was removed from the chemostat.
During weekdays, 10 drops of antifoam B silicone emulsion was added through the septum by a syringe and needle at 9 am and 5 pm (20 drops per day total). On weekends, 20 drops of antifoam was added to each vessel around 12pm. This amount of antifoam added to each vessel daily (in conjunction with the amount of antifoam present in the media) was sufficient to prevent foaming in our system using a 24 hour retention time.
The term "liquid gold" refers to the effluent from the chemostat, i.e., the effluent forced out of the chemostat through pressure differentials; it drips into sterile bottles, housed behind the chemostat, via tubing. When the bottle is full, it is sealed and stored at +4 °C until needed. This is essentially a soup of microbes (dead and alive) as well as a plethora of signaling molecules, growth factors and so on. The liquid gold is passed through a 0.22 urn filter to remove bacterial cells to produce cell-free liquid gold, which is used to supplement the growth media (usually added to 3% v/v).
To characterize the isolates, about 1 uL of an isolated colony from an actively growing culture was resuspended in 500 ul Tris-EDTA solution (TE) (Sigma). This was boiled for 5 minutes at 100°C to lyse the cells. The crude lysate was then used as a template in a Polymerase Chain Reaction (PCR) using universal primers to amplify the full-length 16S rRNA gene. One each of these universal primers had additional sequences for universal sequencing primers, and thus the PCR product could be isolated and sequenced.
Sequencing was performed by the MWG Operon sequencing service
(http://www.eurofinsdna.com/products-services/custom-dna-sequencing.html) using the 'single sequencing in tubes' service.
To start, a single read, ~500bp of sequence, was used to conduct a BLAST search against several databases to infer the identity of each isolate (RDP:
http://rdp.cme.msu.edu/; GreenGenes: http://greengenes.lbl.gov/cgi-bin/nph-index.cgi; NCBI: http://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST search was done using blast 2.2.10 and the command line "blastall -p blastn -i ../../torrent/EnE/reads/RP_otu6.fna -e 1 e- 35 -m > 8 -d 16s_named_full_seq.faa"; the parameters were as follows: mismatch penalties for nucleotide blast was -3; match penalties were 1 ; word size was 1 1 ; dropoff value for gapped alignment (in bits) was 30; threshold for extending hits was 1 1 ; dropoff value for final gapped alignment in bits was 50; and the E value cutoff was set such that only near perfect matches were recovered.
Once the genus (and possibly the species) was inferred from this short read, we made alignments to consolidate clonal (duplicate) strains. Full-length 16S rRNA gene reads were then obtained to identify the genus and species for each strain. Full-length 16S rRNA sequences are shown in Figure 2.
Example 2. Antibiotic resistance profiling of isolated bacterial strains.
For antibiotic resistance profiling, the standard Bauer-Kirby method of antibiotic disc diffusion was used. Each isolate was separately cultured according to optimal conditions (see Table 3), and then a suspension was made to McFarland standard of 0.5 in sterile, pre- reduced saline. 100 uL of this was spread onto agar plates containing agar formulations optimal for the tested strain (as shown in Table 3). To the surface of the inoculated plates, an antibiotic disc was applied (antibiotic discs were purchased from Sigma). Plates were inoculated for 1-4 days, depending on the isolate, until good growth was seen. The zone of clearance (area with no bacterial growth) around each disc for each strain was then measured in mm using a ruler. The larger the zone of clearance, the more sensitive the tested isolate to the tested antibiotic. Zones of clearance are given as measurements of the diameter of the zone of clearance (including the 7mm discs). Where no zone of clearance is seen, the value stated is 0, i.e., in this case the size of the disc is not reported. The interpretation of the resistance profiles was descriptive.
The antibiotics tested and results of the antibiotic resistance profiling are shown in Table 4, where: numbers indicate diameters of the zones of clearance, in centimeters; PIP stands for pipericillin; CRO stands for ceftriaxone; MZ stands for metronidazole; AMC stands for amoxicillin/clavulanic acid; IPM stands for imipenem; MXF stands for moxifloxacin; VA stands for vancomycin; and CAZ stands for ceftazidime.
It should be noted that some bacterial species have intrinsic resistance to certain antibiotics. For example, vancomycin will have no effect on Bacteroides spp. since these are Gram negative organisms and vancomycin is effective only against Gram positive organisms. Intrinsic resistance is very different from acquired resistance.
Table 3. Culture conditions for s nthetic stool strains.
Figure imgf000049_0001
10 Dorea longicatena Small/medium, FAA+5%DSB +++ FAA opaque, somewhat
mucoid
42 Dorea longicatena Medium, opaque, FAA+5%DSB +++
FAA 1 pitting
31 Roseburia Medium, opaque FAA+5%DSB+3%LG +++
FAA 1 intestinalis
6 MRS Lactobacillus Medium, white, sticky FAA+5%DSB +++
casei/paracasei
1 FAA Eubacterium rectale Pinpoint, FAA+5%DSB +++
opaque/white
27 FM Ruminococcus Small, white, dry FAA+5%DSB +
productus
30 Ruminococcus Small, white, dry FAA+5%DSB +++ FAA torques
2 MRS Ruminococcus Medium, FAA+5%DSB +
obeum white/opaque, sticky
6 FM 1 Eubacterium rectale Medium, FAA+5%DSB+3%LG +++
white/opaque, sticky
2 FAA Bifidobacterium Small, brown, FAA+5%DSB +++
longum translucent, metallic
sheen, sticky
39 Roseburia faecalis Medium, FAA+5%DSB+3%LG +++
FAA 1 white/opaque, pitting
14 LG Acidaminococcus Large, white FAA+5%DSB +++ 2 intestinalis
5 FM Parabacteroides Small, white, FAA+5%DSB +++
distasonis translucent
21 Clostridium Medium, FAA+5%DSB +++
FAA 1 cocleatum white/opaque, very
pitting/difficult to
scrape, sticky
20 Bifidobacterium Pin, brown/opaque, FAA+5%DSB +++
MRS 1 adolescentis slight metallic sheen,
sticky
48 Eubacterium Pinpoint, FAA+5%DSB +
FAA 1 desmolans white/opaque, sticky
5 MM Bacteroides ovatus Small, FAA+5%DSB +++ 1 white/translucent
4 FM 1 Bifidobacterium Pinpoint, translucent, FAA+5%DSB +++
longum yellow, dry, pitting,
metallic sheen, sticky
1 1 FM Ruminococcus Small, white/opaque, FAA+5%DSB ++ 1 obeum translucent
F1 Eubacterium eligens Pinpoint, FAA+5%DSB+3%LG +
FAA 1 pink/purple/opaque
25 Lactobacillus casei Small, white/opaque, FAA+5%DSB +++
MRS 1 sticky
13 LG Eubacterium Small, off- FAA+5%DSB+3%LG +++ limosum white/opaque
9 FAA Ruminococcus Small, white/opaque, FAA+5%DSB +++
torques translucent
47 Eubacterium Sticky, small FAA+5%DSB +++ FAA ventriosum 3 FM 2 Collinsella Pinpoint, FAA+5%DSB +++ aerofaciens white/opaque,
translucent, dry
1 1 Bifidobacterium Small, yellow/opaque, FAA+5%DSB +++
FAA 1 adolescentis mucoid
34 Lachnospira Pinpoint, yellow FAA+5%DSB+3%LG ++
FAA 1 pectinoshiza
40 Faecalibacterium Pinpoint, transparent FAA+3%LG +++
FAA prausnitzii
29 Eubacterium rectale small, white/opaque, FAA+5%DSB +++
FAA 1 translucent
FAA: Fastidious anaerobe agar, commercially available as Lab90; DSB: Defibrinated sheep blood, commercially available; LG: Liquid gold, a clarified, filtered effluent supernatant from chemostat communities seeded from healthy fecal communities, required by a number of synthetic stool strains for optimal growth.
2Relative growth rate; on average plates were incubated for 3 days at 37°C under anaerobic conditions.
Table 4. Antibiotic resistance rofiles for s nthetic stool strains.
Figure imgf000051_0001
48 Eubacterium 3 3 3 3 4.5 0 2 2.5
FAA 1 desmolans4
5 MM Bacteroides ovatus 1 0 3 2 3 1.5 0 0 1
4 FM 1 Bifidobacterium 3 2 1 2 4 2.5 2.5 2.5 longum
1 1 FM Ruminococcus 2.5 2.5 2.5 2.5 3.5 1 2 2 1 obeum7
F1 Eubacterium eligens 1.5 3 0 2.5 4 2 2 3
FAA 1
25 Lactobacillus casei 1.5 1.5 0 2.5 2 1 0 1.5
MRS 1
13 LG Eubacterium 2.5 2.5 2.5 2.5 4 1.5 1.5 2 limosum5
9 FAA Ruminococcus 2 2.5 3 2.5 3 1 1.5 2 torques
47 Eubacterium 4.5 4 3 3 4 0 2.5 3 FAA ventriosum
3 FM 2 Collinsella 2 1.5 2 2 3.5 2 2 1.5 aerofaciens
1 1 Bifidobacterium 3 3 0 3 4 1.5 1.5 2
FAA 1 adolescentis
34 Lachnospira 4 3.5 4 3.5 3.5 2 2 3.5
FAA 1 pectinoshiza
40 Faecalibacterium 3 3 4 3 3.5 2 3 0 FAA prausnitzii
29 Eubacterium rectale 4 3.5 3 3.5 4 1 1.5 3
FAA 1
Antibiotic resistance profiles for strains listed in Table 7 are shown in Table 8. For data in Table 8, antibiotic resistance was described using methods described herein. In brief, a standard Kirby-Bauer disk diffusion susceptibility test was used. Bacterial strains were grown on Fastidious Anaerobe Agar (FAA) in a completely anaerobic environment from frozen stock. Each strain was streaked heavily onto two FAA plates. Four antibiotic disks were placed onto each plate. Plates were incubated for at least one day, or longer if required. Plates were then removed from the anaerobe chamber and the susceptibility zone was measured. Measurements were conducted with a ruler. The susceptibility zone (measured in cm) was the diameter of the zone with no visible growth including the antibiotic disk diameter of 0.7 cm. Adjustments were made as required, for example strains with high susceptibility were restreaked with only two antibiotic disks per plate. Values in the table are given in cm; "R" indicates that the strain was resistant to the antibiotic tested; "nd" indicates not determined. The following antibiotics were tested: Moxifloxacin (MXF 5; tested at 5 μg/disk; Oxoid Antimicrobial Susceptibility Test Discs); Vancomycin (VA 30; tested at 30 μg/disk; BD BBL Sensi-Disc); Piperacillin (PIP 100; tested at 100 μg/disk; BD BBL Sensi- Disc); Ceftriaxone (CRO 30; tested at 30 μg/disk; BD BBL Sensi-Disc); Metronidazole (MZ 5; tested at 5 μ9Λ3ί5ΐ<; Oxoid Antimicrobial Susceptibility Test Discs); Ceftazidime (CAZ 30; tested at 30 μ9^ί5ΐ<; BD BBL Sensi-Disc); Amoxicillin/Clavulanic acid (AMC 30; tested at 30 μ9^ί5ΐ<; BD BBL Sensi-Disc); and Imipenem (IPM 10; tested at 10 μ9^ί5ΐ<; BD BBL Sensi- Disc).
Table 8. Antibiotic resistance profiles for intestinal bacterial strains in Table 7.
Figure imgf000053_0001
2.9 3.7 3.7
1.3 cm cm cm 2.3 cm 4 cm 2.7 cm 3.3 cm cm
2.2 2.8 2.6
1 cm cm cm 2.4 cm 3.3 cm 2.1 cm 3.6 cm cm
2.9 3.2 3.5
1.5 cm cm cm 2.8 cm 3.3 cm 2.4 cm 3.4 cm cm
2.3 2.5
0.9 cm cm R 2.2 cm 3 cm R R cm
3.9 7.2 5.2
R cm cm 5.1 cm 1.9 cm 4.5 cm 5.2 cm cm nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd
2.3 1.8
1 cm cm 2 cm 1.5 cm 2.4 cm 0.9 cm 2.6 cm cm
2.3 3.2
1 cm cm 3 cm 3.2 cm 2.4 cm 2.4 cm 3 cm cm
2.3 3.2
1 cm cm 3 cm 3.2 cm 1.8 cm 2.4 cm 3 cm cm
1.7 3.4 2.4
2.6 cm cm cm 2.4 cm 2 cm 1.3 cm 3.4 cm cm
2.7 3.4 3.3
1.3 cm cm cm 1.7 cm 3.1 cm 2.4 cm 3.4 cm cm
2.6 4.8
1.7 cm cm cm 3.1 cm 3 cm 2.7 cm 3.2 cm 4 cm
1.9 2.4 2.4
1.8 cm cm cm 2.6 cm 2.4 cm 1.2 cm 2.6 cm cm
1.8 1.8 2.5
2 cm cm cm 2 cm 1.4 cm 1.3 cm 2.2 cm cm
2.3 3.7
R cm cm 2.9 cm 2.9 cm 2.6 cm 3.5 cm R
0.9 1.3 2.9
1.7 cm cm cm 0.9 cm 2.7 cm R 2.8 cm cm
2.1 2.5 3.3
R cm cm 1.5 cm 3 cm 1.9 cm 3.3 cm cm
2.4 3.5 3.3
1.4 cm cm cm 2.4 cm 3.2 cm 2.4 cm 2.5 cm cm nd nd nd nd nd nd nd nd
1.9 2.5 3.5
2.8 cm cm cm 2.6 cm 2.5 cm 1 cm 2.9 cm cm
1.3 1.8 1.8
2.1 cm cm cm 2.1 cm 2.9 cm R 1.6 cm cm
2.6 4.6 4.5
1.3 cm cm cm 4.5 cm 2.8 cm 4 cm 3.9 cm cm
1.2 5.9 5.5
R cm cm 4.8 cm 2.3 cm 2.2 cm 5.6 cm cm nd nd nd nd nd nd nd nd
1.7 2.8 3.5
R cm cm 1.8 cm 2.1 cm 1.6 cm 3.3 cm cm
2.6 3.1 3.6
2.4 cm cm cm 2.4 cm 2.5 cm 1.8 cm 3.3 cm cm
1.5 cm 2.8 3.3 3.6 cm 3.4 cm 3.3 cm 3.8 cm 4.2 cm cm cm
2.4 2.9
1.2 cm cm cm 2.2 cm 1.9 cm 2 cm 3.4 cm 4 cm
2.9 5.4 5.3
3 cm cm cm 5.3 cm 2 cm 5 cm 5.4 cm cm
2.6 4.4 4.4
1.3 cm cm cm 4.1 cm 3.3 cm 3.6 cm 4.5 cm cm
2.5 4.2
1.4 cm cm cm 4 cm 3.2 cm 3 cm 5 cm 4 cm
0.9 1.6 2.3
2 cm cm cm 2.3 cm 0.9 cm 2.1 cm 1.5 cm cm
2.6 3.7 3.5
2.9 cm cm cm 3 cm 1.5 cm R 4.1 cm cm
1.8 2.6 3.5
1.9 cm cm cm 2.1 cm 2.2 cm 2.6 cm 3 cm cm
2.1 3.4 3.2
2.6 cm cm cm 2 cm 0.9 cm 1.9 cm 3.9 cm cm
3.2 2.8 4.8
2.3 cm cm cm 3.2 cm 3.4 cm 3.2 cm 4.6 cm cm
2.5 4.1 4.2
1.6 cm cm cm 2.9 cm 2.2 cm 2.4 cm 4 cm cm
1.3 3.6 2.8
1.9 cm cm cm 3.4 cm 1 cm 1.8 cm 2.4 cm cm
4.2
1.5 cm 3 cm 5 cm 5 cm 3 cm 4.2 cm 5 cm cm nd nd nd nd nd nd nd nd
2.6 4.7 2.6
2.2 cm cm cm 3.8 cm R 1.7 cm 2.3 cm cm nd nd nd nd nd nd nd nd
4.8 4.9
1.2 cm 3 cm cm 4 cm 3.2 cm 4.6 cm 4.3 cm cm nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd
2.5 3.3 3.6
R cm cm 2 cm 3 cm R 3.4 cm cm
1.6 1.6 4.2
2.7 cm cm cm 1.5 cm 3.6 cm 0.9 cm 0.9 cm cm
1.5 2.7
2.8 cm 1 cm cm 1.8 cm 3.1 cm 2.2 cm 3.3 cm cm
2.4 1.6 4.2
1.9 cm cm cm 3.5 cm R 1 cm 1.8 cm cm
1.7 3.3 3.7
2.2 cm cm cm 3 cm R 1.8 cm 3.1 cm cm
1.5 1.9 3.2
2.1 cm cm cm 0.9 cm 2 cm 1.4 cm 3.2 cm cm nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd
1.7 2.7 1.7
2 cm cm cm 3 cm 1.4 cm R 2 cm cm
1.3 2.5 2.3
2.4 cm cm cm 2.4 cm 1.2 cm 2.3 cm 3.1 cm cm nd nd nd nd nd nd nd nd 82 nd nd nd nd nd nd nd nd
83 2.7 4.1 4.6
1.6 cm cm cm 4.2 cm 3.2 cm 3.1 cm 4 cm cm
84 nd nd nd nd nd nd nd nd
85 2.7 4.1 5.2
1.9 cm cm cm 4.2 cm 3.4 cm 2.6 cm 5.2 cm cm
86 2.7 5.4
1.6 cm cm cm 4.5 cm 2.8 cm 3.9 cm 4.4 cm 5 cm
87 2.7 3.1
1.5 cm cm cm 1.8 cm 2.9 cm 0.9 cm 3.7 cm 3 cm
88 4.6 4.4 4.4
1.1 cm cm cm 4.1 cm 6 cm 2.6 cm 5 cm cm
89 nd nd nd nd nd nd nd nd
90 3.4 4.7 4.3
R cm cm 3.4 cm 3.2 cm 2.3 cm 4.4 cm cm
91 nd nd nd nd nd nd nd nd
92 2.9 3.7 4.6
1.8 cm cm cm 2.8 cm 3.7 cm 2.1 cm 4.4 cm cm
93 0.9 1.4
1.7 cm cm cm 0.9 cm 1.6 cm 0.9 cm 2.4 cm 3 cm
94 1.9 3.3 3.8
0.9 cm cm cm 2.7 cm 2.5 cm 2.5 cm 2.9 cm cm
95 2.7 3.9
1.4 cm cm 2 cm 3 cm 2.2 cm 2.4 cm 2.3 cm cm
96 nd nd nd nd nd nd nd nd
97 nd nd nd nd nd nd nd nd
98 nd nd nd nd nd nd nd nd
99 2.4 3.3 4.1
1.5 cm cm cm 3.2 cm 2.7 cm 2.4 cm 2.8 cm cm
100 2.5 2.6 3.6
1 cm cm cm 2.3 cm 2 cm 1.6 cm 2.1 cm cm
101 2.5 2.9
R 2 cm cm 1.1 cm 1.5 cm 1.3 cm 2.4 cm cm
102 1.4 1.1
2.8 cm cm cm 2.8 cm 0.9 cm 2.2 cm 2.1 cm 4 cm
103 2.2 3.2 3.4
2.6 cm cm cm 3.3 cm R 2.7 cm 3 cm cm
104 2.1 3.4 3.6
3 cm cm cm 4 cm R 3.5 cm 3.3 cm cm
105 3.6
2 cm 1 cm cm 4.1 cm 3.4 cm 2.6 cm 1.2 cm 4 cm
106 nd nd nd nd nd nd nd nd
Example 3. Treatment of CDI using a synthetic stool preparation.
Here we describe the use of a synthetic stool preparation to treat recurrent CDI which failed repeated standard antibiotic treatments. We report the successful outcome of 2 patients with recurrent CDI unresponsive to conventional therapy who received a "synthetic" stool preparation of 33 different intestinal bacteria isolated in pure culture, from a single healthy donor. Patients reported complete cure of recurrent CDI after receiving the synthetic stool preparation, and remained symptom free after 6 months of follow-up. Bioinformatic analysis demonstrated that microbial profile reverts to features of the synthetic stool in each case.
Embodiments of the synthetic stool preparation shown in Tables 2 and 2a were used in these studies. The terms "RePOOPulate" (also abbreviated "RP" for "RePOOPulate Preparation") and "MET" are used interchangeably herein to refer to embodiments of the synthetic stool preparation shown in Table 2a and used in these studies.
The study protocol was approved by the Human Research Ethics Boards at Queen's University, Kingston, Ontario, Canada, and the University of Guelph, Guelph, Ontario, Canada, in accordance with current regulations and the provisions of the Helsinki
Declaration of the World Medical Association. Inclusion criteria for the study included a history of previous CDI, confirmed by C.difficile fecal toxin immunoassay; new onset of symptoms after completing a full course of medication for CDI; positive C.difficile toxin assay confirming recurrent CDI; and age 18 years or older. All patients were assessed by specialists in infectious disease and gastroenterology, and other possible causes of diarrhea were ruled out. Two patients who fulfilled the inclusion criteria were enrolled in the study and written informed consent was obtained. The trial was conducted in compliance with the Good Clinical Practice guidelines (see www.clinicaltrials.gov for details).
A human probiotic or "synthetic stool" preparation comprising 33 different strains of bacteria, was developed by culturing the microbial diversity from the stool of a healthy 41 -yr old female donor as described above. In brief, sixty-two different bacterial isolates were recovered on various media types (including Brain Heart Infusion agar, Wilkins-Chalgren agar, Reinforced Clostridial Agar, and deMan, Rogosa & Sharpe agar) using strict anaerobic conditions (to recover both strict and facultative anaerobes). Purified isolates were identified by 16S rRNA gene sequencing and subjected to antibiotic susceptibility profiling. Susceptibility to antimicrobials was determined either by directly measuring susceptibility or through inference based on other cultivated representatives. For instance, in cases where minimum inhibitory concentration (MIC) breakpoints are not documented, susceptibility was determined using Kirby-Bauer discs for select antibiotics known to have anaerobic activity, and if the bacterial lawn grew up to the edge of the disc then it was considered resistant and that isolate was not used. For isolates where there was a zone of inhibition of questionable significance, an acceptable level of inhibition was inferred based on other cultivated representatives. If there was any doubt, and the organism was at all suspected to be resistant, then it was not used in the mixture. Thirty-three isolates, representing commensal species with no known pathogenic tendencies that were generally sensitive to a range of antibiotics and relatively
straightforward to culture, were selected for the final synthetic stool preparation (see Tables 2 and 2a, which list cultured isolates from the healthy donor, with favorable antibiotic resistance profiles (defined as vancomycin and/or imipenem sensitive, with further sensitivity to at least 3 of pipericillin, amoxicillin/clavulanic acid, ceftazidime, ceftriaxone, moxifloxacin and metronidazole) that were included in the stool substitute preparation).
The METARep database (Goll, J. et al., Bioinformatics (2010), 26(20) :2631-2) was utilized to inform of the potential relative abundance of each isolate in a healthy ecosystem. The MetaREP metagenomic database includes a collection of stool sample datasets from healthy donors (Goll, J. et al., Bioinformatics, 26(20): 2631-2, 2010). Using the taxonomy browser, the dataset that most closely matched our profile of cultured isolates (SRS058723) was selected and used as a guide for inference of relative abundance of each species - with the exception that Bifidobacterium spp. were added to higher abundances, reflecting the widely observed underestimated abundances of Actinobacteria, and specifically this genus, in metagenomic analyses of human stool [9,10]. An approximate ratio based on culture cell biomass, measured using standard 10 μΙ_ microbiological loops, was generated (see Tables 2 and 2a). Each of the thirty-three isolates was individually cultured on Fastidious Anaerobe Agar (Lab M Ltd. Heywood, Lancashire, UK) under anaerobic conditions, and then cultures were approximately formulated into the predetermined ratio, as described above, in 100 mL pre-reduced sterile 0.9% normal saline to an estimated concentration of 3.5 x109 colony- forming units (CFU)/mL. The bacterial suspension was placed in a reduced atmosphere in a double-sealed container at 4°C, and used within 24 hours of preparation.
An aliquot of the same bacterial mixture was simultaneously inoculated into a continuous culture vessel and the community was allowed to equilibrate for 12 days. This microbial community was compared to the human week 2 samples in order to allow us to compare the therapeutic ecosystem development in vitro and in vivo.
To determine which strains to use in the synthetic stool preparation, several factors were considered, including the antibiotic resistance profile of a strain; reports in the literature suggesting that a strain may be pathogenic in any way; reports in the literature suggesting a strain may have probiotic effects; and the desired overall antimicrobial profile. Safety was a primary concern in the selection of bacterial strains. The NIH Human Microbiome database was utilized to determine the relative proportions of bacteria needed to most closely approximate the natural composition of stool from healthy individuals. After obtaining written patient consent, antibiotic therapy was withheld for 2 or 3 days and the patients underwent standard colon cleansing with 4L of oral polyethylene glycol solution the evening prior to the procedure. The "synthetic stool" preparation was
administered to each patient the next morning via rectal enema by the colonoscopic route. The scope was first inserted to the cecum, a sample of fecal material was suctioned from the area, and then the syringe containing the synthetic stool was attached to the scope pump and half (about 50-60 mL) deposited in the region of the cecum/proximal ascending colon. The remaining approx. 50-60 mL was drizzled throughout the transverse colon as the colonoscope was withdrawn. Both patients were noted to have significant diverticular disease. Following scope withdrawal, patients were maintained in the Trendelenburg position with feet slightly elevated for 60 minutes and then discharged home. No
complications from the procedure occurred in any of the patients. Patients were instructed to eat a fiber-rich diet and not to consume any products containing probiotics. Patients were followed up by a study nurse, e.g., at days 3 and 10 post treatment, to obtain stool samples and closely monitor their clinical response.
Patient 1 was a 74-year-old Caucasian woman who presented with a history of six episodes of recurrent CDI (confirmed by C.difficile toxin assay) over an 18-month period, all of which required hospitalization. She developed her first C.difficile infection after being admitted to hospital for elective orthopedic surgery (knee arthroplasty or replacement), during which time she received pre-operative cefazolin (see Figs. 6A, 8A). She was treated with courses of metronidazole, and oral vancomycin but experienced multiple CDI recurrences characterized by watery stool and increased frequency, which were confirmed by C.difficile toxin assay (see Figs. 6A, 8A). Use of the probiotic Saccharomyces boulardii was also ineffective. Over the course of this time period she was seen by specialists in Infectious Disease and Gastroenterology, and other possible causes of diarrhea were ruled out. She had experienced multiple relapses and had been on chronic oral suppressive therapy with vancomycin for several weeks at the time of referral. The oral vancomycin was becoming prohibitively expensive for the patient and after discussion with the patient and family, the decision was made to proceed with the synthetic stool preparation.
After treatment with the synthetic stool preparation, patient 1 became constipated within 72 hours and then her bowel movements became normal, both in terms of frequency and consistency. The patient reverted to her normal bowel pattern of a formed stool every 1 or 2 days. No C.difficile was detectable by C.difficile toxin assay at 10 days post-procedure. Her diarrhea did not recur and she remained symptom-free at 22 weeks. Patient 1 did receive several courses of antibiotics for recurrent urinary tract infections in the subsequent weeks following her stool substitute treatment, but her diarrhea did not recur. She remained symptom-free at the last evaluation, 24 weeks after treatment.
The pre-procedure sample of stool was used to collect C.difficile spores, and her strain of C.difficile was cultivated and identified. In brief, for isolation and ribotyping of C. difficile from patient stool samples, C. difficile was isolated from stool samples according to methods described previously (Medina-Torres, C.E. et al., Vet. Microbiol. 152:212-215, 201 1) using selective media of moxalactam norfloxacin broth (CDMN; Oxoid, Nepean, Ontario, Canada) enriched with 0.1 % sodium taurocholate. Isolates were typed using the PCR ribotyping method described by Bidet and colleagues (Bidet, P. et al., FEMS Microbiol. Lett., 175:261-266, 1999). For patient 1 , two different strains of C. difficile were isolated from the pre-treatment sample. One strain was identified as ribotype 078; the other was a less common toxinotype 0 ribotype.
Patient 2 was a 70-year-old Caucasian woman with a history of peripheral neuropathy, which predisposed her to recurrent skin and soft tissue infections. She developed her initial C.difficile infection after receiving cefazolin for cellulitis and presented to the clinic with a history of three episodes of recurrent CDI, the last of which had failed standard medical therapy (Figs. 6B, 8B). She was treated twice with metronidazole for C.difficile and diarrhea, was documented to have cleared her C.difficile infection after the second course of metronidazole, but then received clindamycin for another bout of recurrent cellulitis. Her diarrhea returned and she received oral vancomycin with good resolution of symptoms but the diarrhea returned upon stopping her vancomycin and she was again found to be C.difficile positive by toxin assay. She was restarted on oral vancomycin, and developed a recurrence while completing the last week of her vancomycin taper therapy. Metronidazole was added to the oral vancomycin by her family doctor, which was successful in controlling her breakthrough symptoms, but was not considered an ideal regimen given her history of neuropathy and she was promptly referred for evaluation and possible study enrollment.
After receiving the study treatment, patient 2 reported normal, formed bowel movements within 72 hours. She remained symptom-free for 3 weeks, at which point she again developed recurrent cellulitis and was placed on i.v. ceftriaxone for 10 days by her family physician. She was monitored closely while on i.v. ceftriaxone but did not develop loose stool or diarrhea. After completion of her antibiotic course for cellulitis, she was tested for C.difficile by toxin assay and was still found to be negative. She suffered from several skin and soft tissue infections in the subsequent weeks and received several additional courses of broad-spectrum antibiotics for these infections. Nevertheless, she remained symptom-free with no diarrhea at 14 weeks post-procedure, and at last evaluation, which was 26 weeks post procedure. Similar to patient 1 , a pre-procedure sample of stool was used to culture her strain of C.difficile and this was identified as ribotype 078.
A timeline of events for Patients #1 and #2 are shown in Figures 6A/8A/3A and 6B/8B/3B, respectively. Patient #1 had C.difficile initially occur after a course of cefazolin for cellulitis. Both patients had multiple courses of antibiotic treatment for the C.difficile with both vancomycin and metronidazole prior to enrolment. In addition patient 1 had treatment with Saccharomyces boulardii. The results of the study show that the synthetic stool preparation used here was effective at eradicating CDI that had failed all other treatment regimens. The results indicate that the synthetic stool preparation is an effective and feasible treatment alternative to the use of defecated donor fecal matter (stool transplant) in the treatment of recurrent CDI.
Example 4. Bioinformatics analysis.
A bioinformatics analysis of the study described in Example 3 was performed by analyzing the V6 region of the bacterial 16S rRNA genes via Ion Torrent. gDNA extraction from stool samples gDNA was extracted using a protocol involving a combination of bead beating, the E.Z.N.A.® Stool DNA Kit (Omega Bio-Tek, Norcross, Georgia, USA) and the Maxwell® 16 DNA Purification Kit (Promega, Madison, Wisconsin, USA). Briefly, 200 μΙ_ of stool sample, 300 μΙ_ of E.Z.N.A. kit SLX buffer, 10 μΙ_ of 20mg/ml_ proteinase K (in 0.1 mM CaCI2) and 200 mg glass beads were added to a screw-capped Eppendorf tube and disrupted in a bead beater for 3 minutes. Following subsequent incubation at 70°C for 10 minutes and 95°C for 2 minutes, 100 μΙ_ E.Z.N.A. Kit Buffer P2 was added to each sample and incubated on ice for 5 minutes. Samples were then centrifuged at 14000 x g for 5 minutes, and the supernatant transferred into new tubes, each containing 200 μΙ_ E.Z.N.A. Kit HTR reagent. Following thorough mixing, samples were incubated at room temperature for 2 minutes, centrifuged at 14000 x g, and the supernatant was transferred into Maxwell® 16 DNA Purification Kit cartridges. The remainder of the DNA extraction protocol was carried out in the Maxwell ® 16 Instrument according to manufacturer's instructions (Promega).
V6 rRNA amplification
PCR amplification of the bacterial V6 rRNA region was carried out with the left-side primer CWACGCGARGAACCTTACC and the right-side primer
ACRACACGAGCTGACGAC. These primer sequences were chosen because they are exact matches to greater than 95% of the rRNA sequences from organisms identified in the human microbiome project. In addition the left-side primers contained the standard Ion Torrent (Ion Torrent Systems Inc., Guilford, Connecticut, USA) adapter and key sequence at their 5' end (CCATCTCATCCCTGCGTGTCTCCGACTCAG). One of the following 5-mer barcodes was located between the 3' end of the key sequence and the 5' end of the primer: TATCG, TAG AC, TGCAT, ATGAG, ACAGT, AGATG, CTCAC, CTGTA, CGTGA, CGACT, AACTC, CCTAT. Duplicate samples did not use the same barcodes. The right-side primer had the other standard Ion Torrent adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) attached to its 5' end. Amplification was performed for 25 cycles in 40μΙ_ using the colorless GO-Taq hot start master mix (Promega) according to the manufacturer's instructions with the following three-step temperature profile: 95°C, 55°C, and 72°C for 1 minute each step. Then 5μΙ_ of the resulting amplification were quantified using the QuBit broad-range double- stranded DNA fluorometric quantitiation reagent (InVitroGen, Life Technologies, Inc., Burlington, Ontario, Canada). Samples were pooled at approximately equal concentrations and purified using a Wizard PCR Clean-Up Kit (Promega).
Sequencing
The V6 region of the bacterial 16S rRNA genes was first amplified using the following primers for PCR: left-side primers
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGtatcgCWACGCGARGAACCTTACC
(V6LT1) (SEQ ID NO: 31)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGtagacCWACGCGARGAACCTTACC
(V6LT2) (SEQ ID NO: 32)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGtgcatCWACGCGARGAACCTTACC
(V6LT3) (SEQ ID NO: 33)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGatgagCWACGCGARGAACCTTACC
(V6LT4) (SEQ ID NO: 34)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGacagtCWACGCGARGAACCTTACC
(V6LT5) (SEQ ID NO: 35)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGagatgCWACGCGARGAACCTTACC
(V6LT6) (SEQ ID NO: 36) 5" CCATCTCATCCCTGCGTGTCTCCGACTCAGctcacCWACGCGARGAACCTTACC (V6LT7) (SEQ ID NO: 37)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGctgtaCWACGCGARGAACCTTACC
(V6LT8) (SEQ ID NO: 38)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGcgtgaCWACGCGARGAACCTTACC
(V6LT9) (SEQ ID NO: 39)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGcgactCWACGCGARGAACCTTACC
(V6LT10) (SEQ ID NO: 40)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGaactcCWACGCGARGAACCTTACC
(V6LT1 1) (SEQ ID NO: 41)
5' CCATCTCATCCCTGCGTGTCTCCGACTCAGcctatCWACGCGARGAACCTTACC
(V6LT12) (SEQ ID NO: 42)
For the left-side primers, the first part of the primer (shown in upper case) is the Ion Torrent adapter sequence, and is identical across all left primers. The second part of the primer (shown in lower case) is the sequence tag that is used to identify each individual amplified product. This allows a mixture of PCR products to be identified by their unique sequence tag. The third part of the primer (shown in upper case, 3' to the second part) is the sequence complementary to the constant region on the left side of the V6 region. Standard nucleotide base nomenclature is followed. right-side primer
5'CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATACRACACGAGCTGACG AC (V6RT1) (SEQ ID NO: 43)
For the right-side primer, the first 41 nucleotides are the Ion Torrent right adapter sequence, and the last 18 nucleotides are complementary to the right side of the V6 rRNA region. No sequence tags are attached.
As described above, the standard PCR protocol for amplification was as follows: The PCR machine block was heated to 90 °C. A mixture composed of 20 uL of the appropriate left and right-side primers (0.8 pmol/uL for each primer) and 1 .5 uL of DNA sample was placed under 50 uL of light mineral oil in the block to pre-heat. 20 uL of colourless GO-Taq™ Master mix was added under the oil and expelled strongly to mix the cocktail. After waiting 2 minutes for the temperature to equilibrate, 25 repeats of the following PCR cycle were run: 95 degrees, 55 degrees, 72 degrees at 1 minute each. At the end of the run, the mixture was cooled to room temperature and placed at 4 degrees.
Samples were then quantitated and purified as follows: 5 μΙ_ of each sample was taken out and mixed with 195 μΙ_ of QuBit broad-range fluorometric compound. After 2-10 minutes of incubation, the samples were read in a QuBit fluorometer and compared to the broad-range standard. The fluorometric reading was taken to indicate the amount of double- stranded DNA in the sample, and was used to make an approximately equal concentration mixture of the amplified PCR products, where the largest volume available was
approximately 10 μΙ_, and more concentrated samples were added in proportionally lower amounts. The amplified sequences were purified away from contaminating primer sequences using the Promega Wizard™ PCR purification kit. Samples and their QuBit quantitation are shown in Figure 4.
Amplified sequences were then further purified using agarose gel electrophoresis. The appeoximately 200 bp band was extracted from the gel with a Pip-n-Prep™ machine using the widest possible gate. The exact center of the gate was the center of mass of the band. This corresponded to removing a set of bands between 175 and 225 bp inclusive.
Sequencing was done at the Robarts Research Institute (London, Ontario, Canada) following standard protocols for the Ion Torrent machine exactly starting with the emulsion PCR step. Sequences were provided in the fastq file format. No library was used for the Ion Torrent runs, so quality scores associated with the reads were not used for downstream analysis. For sequence extraction, the steps were automated in a workflow using standard methods.
Four sequencing reactions were carried out, three on the Ion Torrent "314" chip and one on the Ion Torrent "316" chip platform. The chips differed only in the density of the spots, and hence in the amount of sequence that could be obtained. The 316 chip is about 5-6 times as dense as the 314 chip. One internal standard, the C12 sample, was run on both chips, and we found that the chips gave equivalent results.
Up to 12 samples were multiplexed on each chip through use of individual sequence tags. Data from all runs were pooled when samples were run on more than one chip.
Sequence data processing
Five sequencing reactions were carried out on the Ion Torrent platform: three reactions on a 314 chip and two reactions on the 316 chip. The chips differ only in the density of the spots, and hence in the amount of sequence that can be obtained (the 316 chip is about five to six times as dense as the 314 chip). The sequence was provided in fastq format. All sequences were then filtered according to the following criteria: exact matches to the barcodes used, exact match to the left-side primer including redundant positions in the primer, an exact match to the first six nucleotides of the right-side primer, and a length between the left-side and right-side primer of between 71 and 83 nucleotides. This length was chosen because it encompasses the predicted amplicon product size from all human- associated bacterial organisms that have been cultured and sequenced as part of the human microbiome project.
Approximately 40 to 50% of the reads passed these filters in the most recent Ion Torrent runs; reads not passing the filters were not examined further. Reads were processed as described by Gloor and colleagues [13] except that clustering with USEARCH was performed at 97% identity. Chimera detection was performed with UCHIME (version v5.2.32) using the de novo method [14]. Only four chimeric sequences were observed out of 30,419 unique sequences in the merged dataset, and all were rare. This frequency is similar to that reported previously for amplification and sequencing of the V6 rRNA region using the lllumina platform [13]. Chimeric sequences were not considered an issue in this dataset.
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample as before [13], keeping all identical sequence unit or OTU sequences that were represented in any sample at a frequency >0.5%. Reads that were never abundant in any sample (<0.5%) were grouped into the remainder and discarded. Between 12.6 and 51.9% (median 31 %) of the identical sequence unit reads and between 1.4 and 17.2% (median 5.8%) of the OTU reads were in the remainder group. These values are approximately five times greater than those observed for identical sequence units sequenced on the lllumina platform but are about equivalent to the lllumina platform observations when reads were clustered. The fastq files were named: 2PG-23, 1 PG-15, 2PG-25, 1 PG-18 with a "trivial number.fastq.txt" appended. In all cases the left sequence tag and primer are the first nucleotides read. For convenience, the fastq files were converted to a non-standard format whereby all the information for an individual read is contained on one line using a custom Perl program which uses the following logic: the unique machine code attached to each read (assigned by the Ion-Torrent machine) is identified; the position of the left-side primer is identified; the first 5 nucleotides prior to the left-side primer are identified; the position of the 6 residues in the right-side primer closest to the read is identified; the sequence between the left and right side primer sequences is identified; the machine code, sequence tag, left-side primer, sequence, right-side primer, and sequence tag (for convenience only) are written out, all separated by tabs if the sequence is >71 and <83 nucleotides long, and if the sequence tag is represented over 1000 times in the dataset. This logic ensures that only those reads that fulfill the criteria of being from a bona-fide V6 region (length criterion) and with a real sequence tag are written out. The sequence tags in these files were then changed to the actual sample name using custom AWK scripts, e.g.,: awk '$2 == "TATCG"' 2PG23_tabbed_reads.txt | awk 'BEGIN {OFS="\t"} $2 = "1_PT"' | awk 'BEGIN {OFS="\t"} $6 = Ί_ΡΤ"' > data/datasetjabbed.txt
The V6 sequences were then grouped by identity and ordered by abundance from most to least in a fasta formatted file. Attached to each sequence is its identical sequence unit (ISU name). The sequences were clustered by 95% percent identity using uclust, a program standard in the field. The most abundant sequence in the cluster is the seed, or representative sequence. Each sequence cluster is called an operational taxonomic unit or OTU. The counts of reads in each OTU per sample were written to a file, and the representative sequence of each OTU was written to a fasta file (text is shown in Figure 5).
Statistical analyses were automated. Analyses and plotting were carried out using the R statistical programming language. Only OTUs that were present at an abundance of greater than or equal to 0.5% in any sample were included in the analysis. All other reads were grouped into the remainder bin. The read counts for each OTU in each sample were converted to proportions. The vector of these proportions was used for unsupervised heirarchical clustering by the neighbour-joining method using a euclidian distance matrix.
Taxonomic classification
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as undefined. The V6 region is not able to resolve the genus or species level of a number of clades, so all analyses were carried out at the family level. This strategy worked for all abundant families - with the exception of the Bifidobacterium, which were annotated as such from BLAST searches of the NCBI microbial 16 S rRNA database. The taxonomic classification was added to the sequence count table and the data were presented in formats that could be accepted by QIIME 1 .5.0 [15] as follows. Sequence alignments were built using Muscle [16] and a neighbor-joining tree was generated by ClustalW2 [17]. Beta-diversity was calculated by the UniFrac algorithm [18]. Tables were imported into MacQIIME, which is an OS X bundled version of QIIME 1.5.0, and were analyzed using the default parameters.
Sequence analysis: Reproducibility of the data
The Ion Torrent instrument has not previously been used for community microbial composition analysis with amplified rRNA variable regions. We therefore first examined the reproducibility of the reads obtained on the instrument by performing three separate PCR amplifications of the V6 rRNA region and sequencing these amplifications on four separate Ion Torrent runs, as described above. The PCR reactions were amplified by two separate individuals on separate days. A separate library was prepared from each amplification. Each library was run on either a 314 or a 316 Ion Torrent chip, with one library run on two separate chips. In this way the technical replication both of the amplification and of the sequencing reaction could be assessed.
The number of reads obtained for these sequencing reactions was often small - especially for the initial run on the 314 chip, which has limited capacity - and is summarized in Table 5. Reads were processed by the standard pipeline, as outlined above, and an unweighted pair group method with arithmetic mean distance tree was generated from the beta-diversity output by QIIME. The result (shown in Figure 9) demonstrates that all the amplifications from each of the four replicates clustered together by sample - with the exception of one of the Patient 1 day 2 and week 2 samples, which showed clustering together by the amplification. Note, however, the very short branch lengths in this clade, indicating that these samples are probably indistinguishable. All further analyses used pooled reads across all replicates for each sample.
Table 5. Read numbers for sequencing reactions obtained on the Ion Torrent platform
Run ID Person Barcode Sample Reads
l pgl5 G2 TAGAC D2 1,568
l pgl5 G2 TATCG PT 1,058
l pgl5 G2 AGATG RP 1,439
l pgl5 G2 TGCAT W2 1,927
l pgl5 G2 ACAGT W4 1,319
2 pg23 Gl TAGAC D2 782
2 pg23 Gl TATCG PT 655
2 pg23 Gl ATGAG RP 920
2 pg23 Gl TGCAT W2 981
2 pg23 KC CTGTA D2 2,506
2 pg23 KC CTCAC PT 524
2 pg23 KC CGACT RP 702
2 pg23 KC CGTGA W2 3,519
2 pg25 G2 TAGAC D2 1,082
2 pg25 G2 TATCG PT 532 2 g25 G2 AGATG RP 526
2 g25 G2 TGCAT W2 925
2 pg25 G2 ACAGT W4 563
D2, day 2 post treatment; PT, 2 days pre-treatment; RP, RePOOPulate preparation; W2, week 2 post treatment; W4, week 4 post treatment
Examination of alpha-diversity
In total, there were between 3,758 and 76,752 V6 rRNA reads per sample for Patient 1 and between 19,751 and 64,200 reads per sample for Patient 2 using the Ion Torrent instrument as outlined above. These reads were processed by a combination of custom scripts and the QIIME pipeline as described above. Reads were clustered at 97% sequence identity for the analysis that follows, unless stated otherwise. Read counts were normalized using rarefaction to the minimum number of reads per sample in each patient, and
Shannon's diversity index was plotted for each intermediate rarefaction level and for the nonrarefied data. Shannon's diversity index provides a measure of community diversity including richness (number of species present) and evenness (relative abundance of species). We observed that the mean Shannon's diversity index of 10 rarefaction samples approximated the diversity index of the total dataset when the number of rarefied samples exceeded 1 ,000 (data not shown). This observation indicates that we obtained sufficient reads in all samples to accurately estimate the diversity. Shannon's diversity on the total dataset for all samples is given in Table 6, from which we see that the two patients had dramatically different Shannon's diversity scores before and after treatment. Patient 1 had a highly diverse microbiota that became less diverse after treatment, and over time tended to become more diverse. At 6 months post treatment, this patient had a diversity score that was almost the same as that at pre-treatment. Patient 2 initially had a low diversity microbiota, which became more diverse following treatment and stabilized over the long term at a level that was more diverse than that at pre-treatment.
Table 6. Shannon diversity values calculated for nonrarefied count values
Patient PT D2 W2 W4 6 M RP
1 5.1 3.1 3.4 5.0 5.2 4.1
2 3.2 3.5 4.2 3.8 3.9 4.1
D2, day 2 post treatment; 6 M, 6 months post treatment; PT, 2 days pre-treatment; RP, RePOOPulate preparation; W2, week 2 post treatment; W4, week 4 post treatment
Examination of beta-diversity
Taxonomic assignments of the seed sequences for each OTU were derived from best-hit analysis of the sequences in the RDP database as explained above. Briefly, the full taxonomic lineage of the 20 best hits and ties was captured using a custom Perl script and added to the QIIME input tables. Any lineage where the best hits and ties were not in full agreement was annotated as undefined. Taxonomic assignment was carried out to the family level since the rRNA V6 region has poor resolution below this taxonomic level for several groups found in our dataset, such as the Gammaproteobacteria and
Lachnospiraceae families. Beta-diversity taxonomic bi-plots at the family level were generated using the QIIME package with default values for the read counts of the samples derived from each individual patient including the initial RePOOPulate sample (Figure 10). In both patients, the first three principle components captured over 85% of the variation between the samples.
The taxonomic distribution of reads in the two patients was noticeably different, however, as shown in the barplots of Figure 1 1 - as was the trajectory of the microbiome composition after treatment. The microbiota of Patient 1 initially had a number of distinct families from the Firmicutes phylum. Samples collected at day 2 and at week 2 were largely composed of families from the Bacteriodetes. However, samples collected after 4 weeks were composed of similar fractions of families in these two phyla. After 6 months this patient had a microbiota that was largely composed of Firmicutes. In contrast, the microbiota of Patient 2 was largely composed of Proteobacteria before treatment, and was noticeably lacking in Actinobacteria and Bacteriodetes phyla. The fraction of Proteobacteria declined rapidly after treatment, initially displaced by families from the Bacteriodetes and
Actinobacteria. At later time points (2 to 4 weeks post treatment) there was a reduction of Actinobacteria and an increase in Bacteriodetes and Firmicutes. The Proteobacteria were displaced completely by 2 weeks. After 6 months this patient's microbiota was composed largely of families drawn from the Firmicutes and of Verrucomicrobia phyla.
The data shown in Figure 1 1 is also summarized in Tables 15 (Fig. 1 1 , pt 1) and 16 (Fig. 1 1 , pt 2). To generate the tables, the following methods were used:
Sequence filtering and grouping
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample as described (Gloor, G. et al., PLoS ONE, vol 5:e15406), keeping all identical sequences that were represented in any sample at a frequency >=0.5%. Reads that were never abundant in any sample (<0.5%) were discarded. Between 12.6 and 51.9% (median 31 %) of the identical sequence unit reads and between 1.4 and 17.2% (median 5.8%) of the OTU reads were in the remainder group {All Query: Confirm sentence is OKOKgg}. These values are approximately five times greater than those observed for identical sequence units sequenced on the lllumina platform but are about equivalent to the lllumina platform observations when reads were clustered.
Taxonomic classification
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as unclassified. The V6 region is generally not able to resolve the species level, so all analyses were carried out to the genus level. This strategy worked for all abundant families - with the exception of the Bifidobacterium, which were annotated as such from BLAST searches of the NCBI microbial 16S rRNA database. The taxonomic classification was added to the sequence count table and the data were presented in formats that could be accepted by QIIME 1 .5.0 (Caporaso et al., Nature Methods, vol 7: pg 335-336, 2012) as follows. Sequence alignments were built using Muscle and a neighbor-joining tree was generated by ClustalW2. Beta-diversity was calculated by the UniFrac algorithm in QIIME 1 .5.0. Tables were imported into MacQIIME, which is an OS X bundled version of QIIME 1 .5.0, and were analyzed using the default parameters.
These methods were also used to generate the data in the tables corresponding to Figures 14 and 23.
The data in Tables 15A/15B and 16A/B show, for each column of the barplot in Figure 1 1 , the bacteria in the mixture and their proportion in the mixture.
Table 15A. Figure 11 , patient 1
Phylum;Class;Order;Family RP D2 D3 2W
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae 0.01721 318 0.012907205 0.089 7009 0.09 887607
Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae 0.1 0 99215 0.137397855 0.3 7 9322 0.25690162
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae 0.067388993 0.0802 0523 0.055991227 0.05828526
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae 0.098222875 0.1028391 5 0.112541124 0.039873572
Firmicutes;Bacilli;Bacillales;Bacillaceae1 0.038732216 0.002577036 0.009600861 0.023141701
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 0.01604982 0.000660778 0.005255644 0.010123113
Firmicutes;Bacilli;Lactobacillales;Enterococcaceae 0 0.021343142 0.011794161 0.002784961
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae 0.035289352 0.000859012 0.001489789 0.001657715
Firmicutes;Bacilli;Lactobacillales;Streptococcaceae 0.009518505 0.002136517 0.02671274 0.015980373
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 0 0.000969142 0.002379524 0.00424375
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI 0 0 0 0
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXIII 0 2.20E-05 0.000103458 0.001458789
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 0.235583008 0.008413912 0.065571396 0.110845877
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae 0 0.014404969 0.017463635 0.009371615
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 0 0.000550649 0.000227607 0.005503614
Firmicutes;Clostridia;Clostridiales;Clostridiales:unclassified 0.233557795 0.056562631 0.050156221 0.046062374
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae 0.070224292 0.037598291 0.053694469 0.01942842
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae 0.029871905 0.001079271 0.006331602 0.009238998
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae 0.000354412 0.004008722 0.001965693 0.00570254 unclassified;unlassified;unclassified;unclassified1 0.007493291 0.003612255 0.004841813 0.005127865
Proteobacteria;Alphaproteobacteria;Hyphomicrobiaceae 0 0 0 0
Proteobacteria;Betaproteobacteria;Burkholderiales;Sutterellaceae 0 0.002422854 0.000124149 0.000331543
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae 0 0.507874276 0.114175754 0.015405698 unclassified;unlassified;unclassified;unclassified 0 0.001211427 0.000517288 0.000663086
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae 0 0.000308363 0.022098533 0.262979908
Table 15B. Figure 11 , patient 1
Phylum;Class;Order;Family 4W 6M PT
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae 0.0390031 15 0.02648085 0
Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae 0.093442368 0.1 1 1254851 0.000296307
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae 0.269439252 0.007565957 0
Bacteroidetes; Bacteroidia; Bacteroidales; Porphyromonadaceae 0.00221 1838 0.002685327 0
Firmicutes;Bacilli;Bacillales;Bacillaceae1 0.001931464 0 0
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 0.01 1 152648 0.0067231 17 0
Firmicutes; Bacilli ; Lactobacillales; Enterococcaceae 0.3 0.002587322 0.103189007
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae 0.007897196 0.021208201 0.1341 16078
Firmicutes; Bacilli;Lactobacillales;Streptococcaceae 0.010794393 0.063918617 0.01651913
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 0.053878505 0.001038849 3.70E-05
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI 0 0 0
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXIII 3.12E-05 0 0
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 0.102554517 0.389137167 3.70E-05
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae 0.029595016 0.018130856 0.015407978
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 0.004080997 0.0066251 13 0.005555761
Firmicutes;Clostridia;Clostridiales;Clostridiales:unclassified 0.015186916 0.000313615 7.41 E-05
Firmicutes; Erysipelotrichia; Erysipelotrichales; Erysipelotrichaceae 0.031931464 0.031204673 0.00022223
Firmicutes; Negativicutes;Selenomonadales;Acidaminococcaceae 0.002866044 0 0
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae 0.001900312 3.92E-05 0.0309641 1 unclassified;unlassified;unclassified;unclassified1 0.001261682 0.002567721 0
Proteobacteria;Alphaproteobacteria;Hyphomicrobiaceae 0 3.92E-05 0
Proteobacteria;Betaproteobacteria;Burkholderiales;Sutterellaceae 4.67E-05 0.00021561 0.022000815
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae 0.007772586 1 .96E-05 0.655431683 unclassified;unlassified;unclassified;unclassified 0 1 .96E-05 0.016148746
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae 0.013021807 0.308224548 0 Table 16A. Figure 11 , patient 2
Phylum;Class;Order;Family RP D2 D3 2W
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae 0.01721 318 0.012907205 0.089 7009 0.09 887607
Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae 0.1 0 99215 0.137397855 0.3 7 9322 0.25690162
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae 0.067388993 0.0802 0523 0.055991227 0.05828526
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae 0.098222875 0.1028391 5 0.112541124 0.039873572
Firmicutes;Bacilli;Bacillales;Bacillaceae1 0.038732216 0.002577036 0.009600861 0.023141701
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 0.01604982 0.000660778 0.005255644 0.010123113
Firmicutes;Bacilli;Lactobacillales;Enterococcaceae 0 0.021343142 0.011794161 0.002784961
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae 0.035289352 0.000859012 0.001489789 0.001657715
Firmicutes;Bacilli;Lactobacillales;Streptococcaceae 0.009518505 0.002136517 0.02671274 0.015980373
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 0 0.000969142 0.002379524 0.00424375
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI 0 0 0 0
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXIII 0 2.20E-05 0.000103458 0.001458789
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 0.235583008 0.008413912 0.065571396 0.110845877
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae 0 0.014404969 0.017463635 0.009371615
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 0 0.000550649 0.000227607 0.005503614
Firmicutes;Clostridia;Clostridiales;Clostridiales:unclassified 0.233557795 0.056562631 0.050156221 0.046062374
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae 0.070224292 0.037598291 0.053694469 0.01942842
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae 0.029871905 0.001079271 0.006331602 0.009238998
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae 0.000354412 0.004008722 0.001965693 0.00570254 unclassified;unlassified;unclassified;unclassified1 0.007493291 0.003612255 0.004841813 0.005127865
Proteobacteria;Alphaproteobacteria;Rhizobiales;Hyphomicrobiaceae 0 0 0 0
Proteobacteria;Betaproteobacteria;Burkholderiales;Sutterellaceae 0 0.002422854 0.000124149 0.000331543
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae 0 0.507874276 0.114175754 0.015405698 unclassified;unlassified;unclassified;unclassified 0 0.001211427 0.000517288 0.000663086
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae 0 0.000308363 0.022098533 0.262979908
Table 16B. Figure 11 , patient 2
Phylum;Class;Order;Family 4W 6M PT
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae 0 0390031 15 0.02648085 0
Actinobacteria;Actinobacteria;Bifidobacteriales;Bifidobacteriaceae 0 093442368 0.1 1 1254851 0.000296307
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae 0 269439252 0.007565957 0
Bacteroidetes; Bacteroidia; Bacteroidales; Porphyromonadaceae 0 00221 1838 0.002685327 0
Firmicutes;Bacilli;Bacillales;Bacillaceae1 0 001931464 0 0
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 0 01 1 152648 0.0067231 17 0
Firmicutes; Bacilli ; Lactobacillales; Enterococcaceae 0.3 0.002587322 0.103189007
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae 0 007897196 0.021208201 0.1341 16078
Firmicutes; Bacilli;Lactobacillales;Streptococcaceae 0 010794393 0.063918617 0.01651913
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 0 053878505 0.001038849 3.70E-05
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI 0 0 0
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXIII 3.12E-05 0 0
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 0 102554517 0.389137167 3.70E-05
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae 0 029595016 0.018130856 0.015407978
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 0 004080997 0.0066251 13 0.005555761
Firmicutes;Clostridia;Clostridiales;Clostridiales:unclassified 0 015186916 0.000313615 7.41 E-05
Firmicutes; Erysipelotrichia; Erysipelotrichales; Erysipelotrichaceae 0 031931464 0.031204673 0.00022223
Firmicutes; Negativicutes;Selenomonadales;Acidaminococcaceae 0 002866044 0 0
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae 0 001900312 3.92E-05 0.0309641 1 unclassified;unlassified;unclassified;unclassified1 0 001261682 0.002567721 0
Proteobacteria;Alphaproteobacteria;Rhizobiales;Hyphomicrobiaceae 0 3.92E-05 0
Proteobacteria;Betaproteobacteria;Burkholderiales;Sutterellaceae 4.67E-05 0.00021561 0.022000815
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae 0 007772586 1 .96E-05 0.655431683 unclassified;unlassified;unclassified;unclassified 0 1 .96E-05 0.016148746
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae 0 013021807 0.308224548 0 Long-term colonization
We were interested to determine the ability of the organisms composing the RePOOPulate formulation to stably colonize the distal colon of the patients. We noted that the weighted UniFrac distances between the samples at pre-treatment and 6 months post treatment in Patient 1 were less than those between either sample and any other. In contrast, the earliest time point for Patient 2 was most similar to the pre-treatment sample. These relationships can be seen in Figures 10 and 1 1 , but are clearer in Figure 13.
However, there was one common feature between the microbiota trajectories of the two patients. Figure 12 shows plots of the weighted fraction of sequences that were identical to the sequences found in the RePOOPulate sample clustered at 97% and 100% identity. Interestingly, even though the initial taxonomic distribution of the patients was very different (Figures 10 and 1 1), the initial fraction of reads identical to the RePOOPulate reads was <7% when clustered at 100% identity, and was between 7 and 9.5% when clustered at 97% identity. Not surprisingly, the fraction of reads identical to those derived from the
RePOOPulate sample increased rapidly after treatment such that reads identical to the RePOOPulate reads 2 days to 2 weeks after treatment composed >70% of the total reads in Patient 1 (day 2 post treatment) and 50% in Patient 2 (week 2 post treatment). The fraction of the patient microbiota that was composed of reads identical to those found in
RePOOPulate declined continuously from the sample 2 weeks post treatment onwards, and at 6 months these reads were found to compose between 25 and 36% of the total reads obtained from each patient. This emergent pattern of slow loss of reads identical to reads in the RePOOPulate sample was common to both patients.
See also Figure 14, which shows how the bacterial composition of samples changed over time in Patient 1 . The data in Figure 14 is also shown in Tables 17A/B and Table 18, where for each column of the barplot in Figure 14, the bacteria in the mixture and their proportion in the mixture is shown.
Table 17A.
Phylum;Class;Order;Family;Genus CS RP PT
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae;Collinsella 0.012314461 0.017214318 0
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae;Eggerthella 0 0 0.006183527
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae;Bacteroides 0.544541937 0.067388993 0
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae;Parabacteroides 0.123043467 0.098222875 0
Firmicutes;Bacilli;Bacillales;Bacillaceae1 ;Bacillus 0.006043442 0.038732216 0
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 ;Bacillus 0.000885023 0.01604982 0
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 ;Paenibacillus 0 0 0.005936186
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus 5.06E-05 0.035289352 0.03883255
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;unclassified 0 0 0.006430868
Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus 0.000733305 0.009518505 0.001731388
Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;unclassified 0 0 0.070986891
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 ;Clostridium 0 0 0.171902053
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Bacteroides 0 0 0.010140984
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Blautia 0.000733305 0.018834489 0.051941628
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Clostridium 0.008041065 0.042124449 0.077912441
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Dorea 0.005563001 0.053009974 0
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 0.044453435 0.055035188 0.030670294
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Ruminococcus 0 0 0.083106604
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Shuttleworthia 0.042253521 0.007392031 0
Firm icutes;Clostridia;Clostridiales;Lachnospiraceae;[Ruminoco ecus] 0 0 0.013109077
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;unclassified 0.005006701 0.059186877 0.058372496
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae;Clostridium 0 0 0.076181054
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 0 0 0
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Clostridium 0 0 0.086569379
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 0 0 0.023744744
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;unclassified 0 0 0.026465496
Firmicutes;Clostridia;Clostridiales;unclassified;unclassified 0.000328723 0.233557795 0
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Clostridium 0 0 0.023744744
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Coprobacillus 0 0 0.018797922
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Lactobacillus 0.01949579 0.070224292 0
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Turicibacter 0 0 0.020776651
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae;Acidaminococcus 0.013047766 0.029871905 0
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae;Dialister 0.002882646 0.000354412 0
Firmicutes;unclassified;unclassified;unclassified;unclassified 0 0.007493291 0.011872372
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Klebsiella 0 0 0.005688845
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;unclassified 0 0 0.076428395
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae;Akkermansia 0.101474195 0 0.000247341 unclassified;unlassified;unclassified;unclassified;Bifidobacterium 0.001163173 0.061465242 0.00222607 unclassified;unlassified;unclassified;unclassified;Lachnospiracea_incertae_sedis 0.064884821 0.0732621 13 0 unclassified;unlassified;unclassified;unclassified;Roseburia 0.003059651 0.00577186 0
Table 17B.
Phylum;Class;Order;Family;Genus W2 D2
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae;Collinsella 0.016542778 0.005476548 Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae;Eggerthella 0.0026964 0.002384948 Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae;Bacteroides 0.431059612 0.491 122692 Bacteroidetes; Bacteroidia; Bacteroidales; Porphyromonadaceae; Parabacteroides 0.185395715 0.186997615 rmicutes Bacilli;Bacillales;Bacillaceae1 ;Bacillus 0.00561 1427 0.006359862 rmicutes Bacilli;Bacillales;Paenibacillaceae1 ;Bacillus 0.001238886 0 rmicutes Bacilli;Bacillales;Paenibacillaceae1 ;Paenibacillus 0.005975805 0.000971646 rmicutes Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus 0.000218627 0.000529989 rmicutes Bacilli;Lactobacillales;Lactobacillaceae;unclassified 0 0 rmicutes Bacilli;Lactobacillales;Streptococcaceae;Streptococcus 0.001093135 0.000176663 rmicutes Bacilli;Lactobacillales;Streptococcaceae;unclassified 0.031482291 0.008921473 rmicutes; Clostridia;Clostridiales;Clostridiaceae1 ;Clostridium 0.019093427 0.009186468 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Bacteroides 0.004008162 0.0030916 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Blautia 0.006340184 0.012719724 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Clostridium 0.035781956 0.035332568 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Dorea 0.008453578 0.000441657 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Roseburia 0.004008162 0.024644466 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Ruminococcus 0.019312054 0.048758944 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;Shuttleworthia 0 0 rmicutes; Clostridia;Clostridiales;Lachnospiraceae;[Ruminococcus] 0.000801632 0.002296617 rmicutes Clostridia;Clostridiales;Lachnospiraceae;unclassified 0.018073167 0.028796043 rmicutes; Clostridia;Clostridiales;Peptostreptococcaceae;Clostridium 0.053417869 0.013161382 rmicutes; Clostridia;Clostridiales;Ruminococcaceae;Anaerotruncus 0.023393091 0.001324971 rmicutes; Clostridia;Clostridiales;Ruminococcaceae;Clostridium 0.018146043 0.020227895 rmicutes; Clostridia;Clostridiales;Ruminococcaceae;Ruminococcus 0.0080892 0.004946559 rmicutes; Clostridia;Clostridiales;Ruminococcaceae;unclassified 0.001020259 0.008303153 rmicutes Clostridia;Clostridiales;unclassified;unclassified 0.003060778 0.000529989 rmicutes Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Clostridium 0.006777438 0.022524512 rmicutes Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Coprobacillus 0.001967643 0.001943291 rmicutes Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Lactobacillus 0.001238886 0 rmicutes; Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;Turicibacter 0.009036584 0.013514707 rmicutes; Negativicutes;Selenomonadales;Acidaminococcaceae;Acidaminococcus 0.009546713 0.016694638 rmicutes Negativicutes;Selenomonadales;Veillonellaceae;Dialister 0 0.00061832 rmicutes unclassified;unclassified;unclassified;unclassified 0.00051013 8.83E-05 Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Klebsiella 0.00051013 0.000529989 Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;unclassified 0.010712724 0.01 1394753 Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae;Akkermansia 0.047587815 0.01 1924742 unclassified;unlassified;unclassified;unclassified;Bifidobacterium 0.002915027 0.00061832 unclassified;unlassified;unclassified;unclassified;Lachnospiracea_incertae_sedis 0.00488267 0.003444925 unclassified;unlassified;unclassified;unclassified;Roseburia 0 0
Table 18.
Phylum;Class;Order;Family CS RP PT W2 D2
Actinobacteria;Actinobacteria;Coriobacteriales;Coriobacteriaceae 0.012314461 0.017214318 0.006183527 0.019239178 0.007861496
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae 0.544541937 0.067388993 0 0.431059612 0.49112269;
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae 0.123043467 0.098222875 0 0.185395715 0.186997616
Firmicutes;Bacilli;Bacillales;Bacillaceae1 0.006043442 0.038732216 0 0.005611427 0.006359862
Firmicutes;Bacilli;Bacillales;Paenibacillaceae1 0.000885023 0.01604982 0.005936186 0.007214692 0.000971646
Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae 5.06E-05 0.035289352 0.045263418 0.000218627 0.00052998S
Firmicutes;Bacilli;Lactobacillales;Streptococcaceae 0.000733305 0.009518505 0.072718279 0.032575426 0.009098136
Firmicutes;Clostridia;Clostridiales;Clostridiaceae1 0 0 0.171902053 0.019093427 0.009186466
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae 0.106051028 0.235583008 0.325253525 0.096778895 0.156081616
Firmicutes;Clostridia;Clostridiales;Peptostreptococcaceae 0 0 0.076181054 0.053417869 0.013161382
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae 0 0 0.136779619 0.050648593 0.03480257Ϊ
Firmicutes;Clostridia;Clostridiales;unclassified 0.000328723 0.233557795 0 0.003060778 0.00052998Ϊ
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae 0.01949579 0.070224292 0.063319317 0.019020551 0.03798251
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae 0.013047766 0.029871905 0 0.009546713 0.016694636
Firmicutes;Negativicutes;Selenomonadales;Veillonellaceae 0.002882646 0.000354412 0 0 0.00061832
Firmicutes;unclassified;unclassified;unclassified2 0 0.007493291 0.011872372 0.00051013 8.83E-06
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae 0 0 0.08211724 0.011222854 0.011924742
Verrucomicrobia;Verrucomicrobiae;Verrucomicrobiales;Verrucomicrobiaceae 0.101474195 0 0.000247341 0.047587815 0.011924742 unclassified;unlassified;unclassified;unclassified1 0.069107644 0.140499215 0.00222607 0.007797697 0.004063246
In sum, full-length 16S rRNA sequence was obtained and the V6 rRNA region of each sample was amplified and subsequently sequenced on the Ion Torrent platform and the 314 and 316 chips. Individual sequence tags were used to allow multiplexing of up to 12 samples on each Ion Torrent sequencing chip. Four Ion Torrent runs in total were conducted with excellent technical replication. Data from all runs were pooled when samples were run on more than one Ion Torrent chip. The samples were de-multiplexed based on their unique sequence tags and the sample identifier was attached to each read. Reads were analyzed by adapting the pipeline used in Gloor et al., PLoS One (2010), 26;5(10):e15406 and were grouped first by identity, then by 95% identity into operational taxonomic units (OTUs) using UCLUST (Edgar, R.C., Bioinformatics (2010), 26(19): 2460) with the most abundant identity groups serving as seed sequences. The count of OTUs that were more abundant than 0.5% in any sample were tabulated and used for analysis. Statistical analysis was carried out with the R statistical programming language (R Development Core Team (201 1); see R: A language and environment for statistical computing, R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051 -07-0, URL http://www.R-project.org/). 16S rRNA sequences were aligned with the NAST server (DeSantis, T. Z. et al., Nucleic Acids Res. (2006), 34:W394-9), then classified using the Greengenes classification server (DeSantis, T. Z., et al., Appl. Environ. Microbiol. (2006), 72:5069-72). The most specific name in the
Greengenes classification was used and we report the DNA maximum likelihood score for each classification.
For all patients stool samples were collected prior to administration of the "synthetic stool" preparation (PT), 72 hours after procedure (D2), 2 weeks after procedure (W2) and 4 weeks after procedure (W4). The composition of the synthetic stool preparation is also shown, as administered (RP) and then 12 days after incubation of the bacterial community in a chemostat (CS). Results are shown in Figure 3, where there are shown barplots (Fig. 3B) and euclidian distances (Fig. 3A) between samples in Patients 1 and 2, taken at various times before, during and after treatment with a synthetic stool preparation. The dendrograms in Figure 3A show the similarity between microbiota samples as assessed by proportional read counts of the V6 rRNA variable region and are drawn using the Neighbour-joining method. The distances between samples are assessed by summing the vertical distance from one sample name to another. Thus, for example the D2 and CS samples in patient 1 are much closer together than are the D2 and PT samples. The barplots in Figure 3B show the proportional data for each sample with each OTU coloured individually. The strains are ordered so that those that compose 1 % or more of the synthetic stool preparation appear first (lower in the barplot and figure), with the last strain from the synthetic stool preparation colored in black (in other words, in each sample, ribotypes below the black line in each bar are ribotypes from the synthetic stool preparation). The purple line at the top of each bar represents the aggregate of all organisms that are less than 0.5% abundant in any sample. The three white dots in the middle of the black bars demarcate the transition zone between bacterial strains from the synthetic stool preparation and native strains. PT: pretreatment sample; BP: pretreatment, post bowel-prep sample; D2/D3: days after treatment samples; W2/W3/W4: weeks after treatment samples; RP: synthetic stool preparation sample; CS: 12 day chemostat sample. The legend for the barplots is shown in Fig. 3C.
A column was selected as abundant in the RP sample if it contained 0.5% or more of the total RP reads. This ensured that OTUs derived from sequence or PCR-based errors were not included in the counts. In each sample the total reads per OTU and the OTUs that overlapped the RP OTUs (at greater than or equal to 0.5% abundance) were calculated. The CS sample seemingly contained a larger fraction of RP reads than did RP itself. This is an artefact caused by the relatively low diversity of this sample.
The results of this analysis (Figure 3) show that Patient 1 started with a very diverse microbiota with 44% of the reads overlapping the ribotypes found in the synthetic stool preparation, while patient 2 started with a non-diverse microbiota profile with 12% probiotic (synthetic-stool)-overlapping ribotypes. Strikingly, the fecal stool samples of both patients showed an initial colonization by the organisms composing the synthetic stool mixture, although the organisms that thrived initially were different. In Patient 1 the two earliest postprocedure samples contained a low diversity microbiota profile that was initially similar to the chemostat sample, with two ribotypes from the synthetic stool preparation composing more than 60% of the microbiota. At 3 and 4 weeks the microbiota diversity increased and the organisms from the synthetic stool preparation composed over 75% of the ribotypes. In Patient 2, the microbiota diversity increased immediately, and the synthetic stool ribotypes composed approximately 90% of the microbiota until antibiotic treatment. After antibiotic treatment, the diversity decreased as did the proportion of synthetic stool ribotypes, although these ribotypes still composed over 40% of the microbiota. Figure 3 shows that both patients had a microbiota profile that was a composite of the original and the synthetic stool microbiota at the end point.
It is noted that collecting stool samples prospectively and collecting multiple stool samples from the same patient helped to minimize inter-individual variability, as each patient also served as his/her own background control.
The results of the bioinformatics analysis also show that, interestingly, the microbiota of both patients adapted characteristics of the synthetic stool mixture yet still retained some of the patient's original microbiota. The bacteria in the synthetic stool preparation were rare in the pre-treatment samples for both patients, but constituted between 40 and 75% of the organisms after synthetic stool treatment was given. This result indicates that the administered bacteria stably colonized the colon.
Overall, these studies show that a synthetic stool (stool substitute) may be an effective and feasible alternative to the use of defecated donor fecal matter (stool transplant) in the treatment of recurrent CDI. The clinical cure achieved at 6 months of follow-up demonstrates feasibility of this approach as an alternative to conventional stool transplant. The stool substitute preparation used here was effective at eradicating disease that had failed all other treatment regimens. This benefit correlated with major changes in stool microbial profile and these changes reflect isolated from the synthetic stool preparation.
As discussed above, a synthetic stool substitute approach has multiple potential advantages: the exact composition of bacteria administered is known and can be controlled; the bacterial species composition can be reproduced, should a future treatment be necessary; preparations of pure culture are more stable than stool, which some groups recommend should be collected fresh and instilled into the recipient within 6 hours of collection (Bakken, J.S. et al., Clin. Gastroenterol. Hepatol., 9: 1044-1049 (201 1)); an absence of viruses and other pathogens in the administered mixture can be ensured, thereby improving patient safety; and/or the administered organisms can be selected based on their sensitivity to antimicrobials, allowing an enhanced safety profile.
Recurrent CDI is thought to be largely due to the inability of the intestinal microflora to recover and re-establish itself (Chang, J.Y. et al., J. Infect. Dis., 197:435-438 (2008); Khoruts, A. et al., J. Clin. Gastroenterol., 44:354-360 (2010); Tvede, M. and Rask-Madsen, J., Lancet, 1 : 1 156-1 160 (1989)). We used the Ion Torrent platform to analyze the 16 S rRNA gene profiles of stool samples collected from each patient during the study, and carried out exhaustive quality control of our data. We concluded that this sequencing platform, together with the PCR amplification protocol and bioinformatic analysis pipeline, was adequate to reproducibly separate both technical replicate samples (Figure 9). Our study showed that the microbiota of both patients adapted characteristics of the stool substitute mixture yet still retained some of their original microbiota, similar to that described for stool transplants (Khoruts, A. et al., J. Clin. Gastroenterol., 44:354-360 (2010)). However, our data suggest that decreased diversity as a risk factor for recurrent CDI may be less important than the actual organisms present in the mixture per se, since Patient 1 actually had a very diverse microbiome at the outset but still suffered from severe recurrent CDI. Sequences identical to those of the stool substitute bacteria were initially rare in the pre-treatment samples for both patients (<7%), but became transiently abundant and constituted over 25% of the sequences up to 6 months after stool substitute treatment was given. Hence, we conclude that some of the administered bacteria are stably colonizing the colon, an important observation since most commercially available probiotics only transiently colonize the intestine. In addition, the data also suggest that the relative proportions of different bacterial strains in the formulation are of only minor importance.
Our results also suggest that a defined microbial community, isolated from a single healthy donor, is robust enough to withstand further perturbations by antibiotics as illustrated by the patients in our study. In the case of Patient 1 , who suffered from occasional urinary tract infections, the antibiotics used post procedure (ciprofloxacin, nitrofurantoin and amoxicillin) were for short courses only, up to a maximum of 7 days. For Patient 2, her recurrent skin and soft tissue infections occasionally necessitated a broad-spectrum antibiotic combination (for example, cephalexin and metronidazole) of much longer duration (4 weeks in one case). Despite post-procedure administration of these incidental antibiotics for infections unrelated to C. difficile colitis, neither patient developed further recurrent CDI. However, at this time it remains unclear whether antibiotic administration affected the long- term colonization by the microbial community used as treatment, or to what extent the differences in microbial profile in the 6-month samples between patients is driven by the different antibiotics administered.
Example 5. Treatment of Salmonella using a synthetic stool preparation.
Salmonella typhimurium-Xen26 was derived from the parental strain S. typhimurium SL1344, a clinical isolate. S. typhimurium Xen26 possesses a stable copy of the
Photorhabdus luminescens lux operon on the bacterial chromosome. S. typhimurium Xen26 grows well in Luria Bertani (LB) medium at 37°C under ambient aeration. It may also be grown selectively on LB agar containing 3(^g/mL kanamycin. On LB plates, S. typhimurium Xen26 appears as medium (3 mm), cream, circular colonies after 24 hours incubation at 37°C.
For these studies, seven to eight week old female C57BL/6 mice were purchased from Charles River (St Constant, Quebec, Canada) and were kept under specific pathogen- free conditions. Animal experiments were carried out in accordance with the guidelines of the Canadian council of animal use. For inducing colitis in mice (Barthel, M. et al., Infect. Immun. (2003), 71 (5):2839-58; Ye, Z. et al., Am. J. Pathol (2007), 174(5): 1981-2), food was withheld for 4 hours prior to oral gavage with 20 mg of streptomycin (SteriMax, Mississauga, Ontario, Canada); animals had ad libitum access to food and water afterwards. Twenty hours after treatment with streptomycin, mice were orally gavaged with either the synthetic stool preparation or saline vehicle control. Four hours later, the mice were orally gavaged with 108 CFU of S.typhimurium-Xen 26. Forty-eight hours post-infection with S. typhimurium- Xen 26, the mice were sacrificed and the intestinal tract removed for analysis in an MS Xenogen animal imager (Caliper Lifesciences). The imager records the intensity of the luminescence emitted by Salmonella bacteria in the intestinal tracts of the mice (measured as photons per second).
Results are shown in Figure 7. The numbers of bacteria, calculated based on the measured luminescence (photons/second), are indicated at the top of each panel in the figure, as indicated. It can be seen that there was an approximately one log decrease in the number of Salmonella bacteria in intestines from mice pretreated with the synthetic stool preparation (Fig. 7D,E) compared to mice infected with Salmonella in the absence of pretreatment with the synthetic stool preparation (Fig. 7A,B). No bacteria were detected for controls receiving saline alone (no salmonella) (Fig. 7C) or synthetic stool preparation alone (no salmonella) (Fig. 7F).
We have also shown that pretreatment with a synthetic stool preparation decreased Salmonella infection in a Salmonella animal model of colitis. The synthetic stool preparation used in the above examples and the Salmonella strain Salmonella typhimurium-Xer26 were used for these studies. Results are given in Figures 16-22. The results show that animals receiving the synthetic stool preparation lost less weight than control animals, had less Salmonella bacterial translocation to spleen (indicative of less pathogenic invasion), and showed less inflammatory cytokine release (TNFalpha, IFNgamma, MCP-1).
Assays in Examples 5 and 6 were performed using methods as published (Wu, S. et al., Am. J. Physiol. Gastrointest. Liver Physiol., 298(5):G784-94, 2010; Liao, A.P. et al., PLoS One, 3(6):e2369, 2008; Petrof, E.O. et al., 294(3):G808-18, 2008), and as described below:
Purification of toxin A and toxin B of Clostridium difficile
Purification of toxin A and B was carried out according to N.M. Sullivan et al.
(Sullivan, N.M. et al., Infect. Immun., 35: 1032-1040, 1982) and J. Meador et al. (Meador III, J. and Tweten, R. K., Infect. Immun., 56: 1708-1714, 1988). In brief, 50 mL of brain heart infusion broth was inoculated with C. difficile 078 and grown for 24 hours at 35 °C. This culture was transferred to 100 mL of PBS in a dialysis bag (12-14 kDa exclusion limit; Fisher Scientific), which was suspended in 800 mL of brain heart infusion broth and grown anaerobically for 72 hours at 35 °C. After centrifugation at 8,000 g for 10 minutes, the supernatant was filtered through a 0.45 urn membrane filter, and concentrated to 5 mL by centrifugation at 4 °C with Centricon Plus-70 filter device (exclusion limit 30,000 kDa;
Millipore). The concentrated 5 mL supernatant was loaded onto a DEAE-Sepharose CL-6B column (Sigma Aldrich), which was equilibrated with 50 mM Tris-HCI (pH 7.5), followed by a wash with 200 mL of 50 mM Tris-HCI containing 50 mM NaCI. A 300 mL linear gradient of NaCI (50 mM to 250 mM) in 50 mM Tris-HCI buffer (pH7.5) was first applied to the column to elute toxin A. Then the column was washed with 50 mM Tris-HCI containing 300 mM NaCI. A second linear gradient of NaCI (300 mM to 600 mM) in the same Tris buffer was applied to the column to elute toxin B. Fractions from both gradients were collected and protein concentration was monitored by absorbance at 280 nm.
Cytotoxicity assay
The cytotoxicity assay was carried out in 12-well plates. NIH 3T3 cells were cultured to confluency in DMEM medium containing 10% fetal bovine serum (Invitrogen). Peak fractions determined by UV spectrometry were put on the cells (100 ul from each fraction in each well). The toxicity of toxins was determined by causing 100% of the cells in the wells to become round within 24 hours. The fractions with the highest cytotoxicity were pooled, concentrated to around 500 μΙ, and protein concentration was determined by A280 using extinction coefficient 0.1 % (1 g/L) 1.292 for toxin A and 0.1 % (1 g/ L) 1.067 for toxin B by using ExPASy.
Salmonella Colitis model
C57BI/6 female mice 7 weeks old were fasted for 4 hours prior to gavage with 20 mg streptomycin. The mice were left overnight with free access to food and water. Eighteen hours after streptomycin administration the mice were gavaged with 100 μΙ of
the"RePOOPulate" synthetic stool preparation (OD6oo at 1/10 dilution was 0.340, corresponding to 3.4 x 109 cells/mL) or vehicle control (Saline). After 4 hours, the mice were gavaged with 108 colony forming units of Salmonella enterica serovar Typhimurium. At 2 days post-infection, mice from each treatment group were euthanized with isoflurane followed by cervical dislocation.
During the entire experimental model mice were weighed daily, to monitor body weight.
Colon and Spleen CFUs Spleens and colons were harvested 2 days post-infection with S. Typhimurium and weighed. Each sample was put into 1 ml of sterile phosphate-buffered saline (PBS) and homogenized. Serial dilutions were plated on MacConkey agar plates containing 100 μg/ml streptomycin. Plates were incubated at 37 °C for 24 hours.
MCP-1 Concentration in the Serum
Blood was collected from the mice through cardiac puncture. Blood was spun at 5000 rpm for 7 minutes and serum was removed and stored at -80 °C until assay. Serum levels of MCP-1 were detected using ELISA according to manufacturer's instructions.
Histology: Hematoxylin and Eosin Staining:
The ceca of the mice were fixed in 10% formalin for 18-24 hours followed by 18-14 hours in 70% ethanol. The ceca were then embedded in paraffin, sectioned and stained with hematoxylin and eosin.
DSS Colitis Mice
Each independent mouse experiment consisted of 17 female, 6-8 week old C57BL/6 mice. Mice were obtained from Charles River and were allowed to acclimatize for 7 days. Following the week of acclimatization, half the mice were gavaged with 150 μΙ_ of synthetic stool preparation ("RePoopulate"), and half were gavaged with 150 μΙ_ of saline as a vehicle control. The following day the mice were again gavaged identically to the day prior, ending the 2 days of pre-treatment. The following morning mice in the DSS+Saline, and
DSS+RePoop treatment groups were administered 3% DSS (w/v) dissolved in their water. Mice in non-DSS groups remained on normal water. DSS mouse groups were administered DSS in the water for 5 full days, and on the sixth morning they were returned to normal water for 2 full days. On the third morning following the end of DSS mice were sacrificed and tissues collected for analysis.
Serum MCP-1 ELISA
Following sacrifice of mice, 200-300 μΙ_ of blood was obtained by cardiac puncture and transferred to blood collection tubes. Tubes were centrifuged for 10 minutes at 4000 rpm, and 100-200 μΙ_ of serum was removed and stored in Eppendorf tubes at -80 °C until needed for MCP-1 ELISA. Instructions provided in the Quantikine JE/MCP-1 Immunoassay Kit were used to carry out the ELISA.
Example 6. "RePOOPulate" synthetic stool preparation protects against both
C. difficile toxins A and B. Toxin B was isolated from C. difficile cultures, and then used to treat NIH 3T3 fibroblasts for 2 or 4 hours with 1 ug of purified toxin B. Cells pretreated with the synthetic stool preparation were protected from dying in both cases (Figure 24).
Mice were fed (gavaged) daily for 2 days with either "RePOOPulate" synthetic stool preparation or saline. Their colons were then removed and sutured to make intestinal loops which were then injected with C.difficile toxin A purified from C. difficile cultures (see Figure
25) . Intestinal loops were then incubated ex vivo for an hour and then cut and the tissue was stained. The villus architecture of the colonic tissue of the saline-fed mice that received toxin looked blown-out, whereas the colonic tissue of mice fed RePOOPulate was protected and looked essentially the same as that of control mice which did not receive any toxin (Figure
26) .
Example 7. Anti-sporulation activity of bacterial strains.
In order to test anti-sporulation of bacterial strains, CD13, a non-toxigenic C. difficile strain, was spread on fastidious anaerobe agar supplemented with 5% sheep's blood (FAA), and incubated at 37°C in an anaerobic chamber for 24 hours. 1 medium-sized colony was selected and subsequently inoculated into 2ml_ brain-heart infusion broth (BHI). To ensure no spores were present at the onset of the experiment, C. difficile strains were incubated anaerobically in BHI until an OD of 0.2-0.5 was reached and 1 % of this inoculum was inoculated into 2ml_ BHI supplemented with 0.1 % L-cysteine and 5mg/ml_ yeast extract (BHIS), an efficient medium for C. difficile sporulation (Burns, D.A. and Minton, N.P., J. Microbiol. Methods, 87(2):133-8, 201 1).
Strain 31 FAA was grown anaerobically on FAA for 24 hours at 37°C. 1 medium-sized colony was inoculated into 8ml_ of tryptic soy broth supplemented with 200μΙ_ of hemin and 200μΙ_ menadione (suppl. TSB) in a borosilicate glass tube and incubated for 48hours. 1 ml_ of resuspended CD13 in fresh BHIS and 2ml_ of 31 FAA in suppl. TSB were combined into culture in a fresh borosilicate glass tube. The mixed culture was incubated anaerobically at 37°C for 24 hours. 50 μΙ_ of sample was taken from the mixed culture and thoroughly vortexed for 10 seconds, fixed with 100% methanol and mounted on a microscope slide. The Schaeffer-Fulton endosporestain (Schaeffer, A.B. and Fulton, M., Sci. New Series 1933, 77:194, 1990) was employed, and specimens were viewed with bright-field microscopy using 1000x magnification and an oil immersion lens. 9 different fields of view were captured and spores were enumerated in the 9 fields of view per microscope slide. Results are shown in Figure 15. Results shown in Fig. 15 indicate that Roseburia intestinalis strain 31 FAA has anti- sporulation activity for C. difficile.
Example 8. Comparison of "RePOOPulate" synthetic stool preparation grown in batch culture with the same preparation grown in continuous culture.
"RePOOPulate" synthetic stool preparation (RP) was used to inoculate a batch culture and a continuous culture, and the cultures were run in parallel. Samples from the starting inoculum, the continuous culture, and the batch culture after 1 , 2 or 3 days, were compared. The results show that the samples are nearly identical (Fig. 23). All samples contained exactly the same OTU sequences in almost the same proportions, except for sample RPD which lacked reads from the Sporanaerobacter species. Reads corresponding to this organism were rare in all samples, and likely fell below the threshold of detection in sample RPD. These results show that the synthetic stool preparation can be produced using either batch or continuous culture.
Data in Figure 23 is also summarized in Tables 19A/19B, which show, for each column of the barplot in Figure 23, the bacteria in the mixture and their proportion in the mixture.
Table 19A.
Phylum;Class;Order;Family;Genus RPC RPD RPB
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae;Bacteroides 0.36399 0.48526 0.41293
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae;Parabacteroides 0.0082 0.24895 0.19661
Firrnicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiracea_incertae_sedis 0.01639 0.06341 0.06809
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;unclassified_Erysipelotrich 0.02459 0.07084 0.02095
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;unclassified 0.03279 0.08677 0.01529
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae;Acidaminococcus 0.04098 0.0295 0.03722
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 0.04918 0.0111 0.04241
Firrnicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiracea_incertae_sedis 0.05738 0.01096 0.09155
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Escherichia/Shi 0.06557 0.05741 0.01132
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 0.07377 0.00425 0.01094
Actinobacteria;Actinobacteria;Coriobacteridae;Coriobacteriales;Coriobacterineae 0.08197 0.01398 0.00785
Firmicutes;Clostridia;Clostridiales;Eubacteriaceae;unclassified_Eubacteriaceae 0.09016 0.01021 0.00371
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;unclassified 0.09836 0.00241 0.00388
Proteobacteria;Gammaproteobacteria;unclassified;unclassified;unclassified 0.10656 0.00985 0.0016
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Dorea 0.11475 0.0092 0.00334
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI;Sporanaerobacter 0.13934 0.00718 0
Table 19B.
Phylum;Class;Order;Family;Genus RPE RPA
Bacteroidetes;Bacteroidia;Bacteroidales;Bacteroidaceae;Bacteroides 0.52047 0.48125
Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae;Parabacteroides 0.20074 0.19166
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiracea_incertae_sedis 0.06379 0.08675
Firmicutes;Erysipelotrichia;Erysipelotrichales;Erysipelotrichaceae;unclassified_Erysipelotric^ 0.06906 0.0365
Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;unclassified 0.07728 0.01817
Firmicutes;Negativicutes;Selenomonadales;Acidaminococcaceae;Acidaminococcus 0.02741 0.04483
Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Faecalibacterium 0.02168 0.03682
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Lachnospiracea_incertae_sedis 0.01958 0.01505
Proteobacteria;Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia/Shi 0.0541 0.01317
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Roseburia 0.00586 0.00976
Actinobacteria;Actinobacteria;Coriobacteridae;Coriobacteriales;Coriobacterineae 0.011 0.00508
Firmicutes;Clostridia;Clostridiales;Eubacteriaceae;unclassified_Eubacteriaceae 0.01069 0.004
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;unclassified 0.00247 0.00646
Proteobacteria;Gam maproteobacteria; unclassified ; unclassified ; unclassified 0.01068 0.00356
Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Dorea 0.00994 0.00406
Firmicutes;Clostridia;Clostridiales;Clostridiales_lncertaeSedisXI;Sporanaerobacter 0.00277 0.00365
For the analysis in this example, PCR amplification of the bacterial V6 rRNA region was carried out with the left-side primer CWACGCGARGAACCTTACC and the right-side primer ACRACACGAGCTGACGAC. These primer sequences were chosen because they are exact matches to >95% of the rRNA sequences from organisms identified in the human microbiome project. In addition the left-side primers contained the standard Ion Torrent adapter and key sequence at their 5' end (CCATCTCATCCCTGCGTGTCTCCGACTCAG). One of the following 5-mer barcodes was located between the 3' end of the key sequence and the 5' end of the primer: GTATC, GCGAT, GCATG, GTAGA, GTCGT. The right-side primer had the other standard Ion Torrent adapter sequence
(CCTCTCTATGGGCAGTCGGTGAT) attached to its 5' end. Amplification was performed for 25 cycles in 40 μΙ using the colorless GO-Taq hot start master mix (Promega) according to the manufacturer's instructions with the following three-step temperature profile: 95°C, 55°C and 72°C for 1 minute each step. Then 5 μΙ of the resulting amplification were quantified using the QuBit broad-range double-stranded DNA fluorometric quantitation reagent.
Samples were pooled at approximately equal concentrations and purified using a Wizard PCR Clean-Up Kit.
Sequence reactions were carried out on the Ion Torrent 316 chip platform. The sequence was provided in sff format and was converted to fastq by the sff2fastq program (0.8.0) with no trimming enabled. The Ion Torrent key sequence was trimmed using a custom perl script. All sequences were then filtered according to the following criteria: exact match to the left-side primer including redundant positions in the primer, exact matches to the barcodes used, an exact match to the first nine nucleotides of the right-side primer, and a length between the left-side and right-side primer of between 70 and 90 nucleotides. This length was chosen because it encompasses the predicted amplicon product size from all human-associated bacterial organisms that have been cultured and sequenced as part of the human microbiome project.
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample, keeping all identical sequence unit or OTU sequences that were represented in any sample at a frequency >0.5%. Reads that were never abundant in any sample (<0.5%) were grouped into the remainder and discarded.
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected down to the genus level. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as undefined. Classifications were verified by Mega-BLAST (NCBI) to the 16S rRNA dataset. When BLAST classification provided more information, it was used instead and the percent coverage of the sequence and the percent identity are reported in the taxonomy file provided as the underscore-separated numbers. The sequence files for each OTU are attached.
Sequences were aligned by muscle (v3.6) using the default parameters, and a neighbour joining tree was generated in clustalw (v 2.0.10). The OTU table and the tree were used as inputs for qiime (v 1.5.0) analysis using the macqiime installation. Beta diversity and the weighted unifrac distances were calculated using default parameters. The unifrac distance matrix is included Barplots ordered by the weighted unifrac distances were drawn with a custom R script.
Although this invention is described in detail with reference to preferred embodiments thereof, these embodiments are offered to illustrate but not to limit the invention. It is possible to make other embodiments that employ the principles of the invention and that fall within its spirit and scope as defined by the claims appended hereto.
The contents of all documents and references cited herein are hereby incorporated by reference in their entirety.

Claims

CLAIMS We claim:
1. A synthetic stool preparation comprising a mixture of bacterial strains, wherein at least one of the bacterial strains is selected from the strains listed in Table 1 or Table 7, or from strains having all of the identifying characteristics of the strains listed in Table 1 or Table 7.
2. The synthetic stool preparation of claim 1 , wherein the mixture comprises two or more bacterial strains selected from the strains listed in Table 1 or Table 7, or two or more strains having all of the identifying characteristics of two or more corresponding strains listed in Table 1 or Table 7.
3. The synthetic stool preparation of claim 1 , wherein the mixture comprises ten or more bacterial strains selected from the strains listed in Table 1 or Table 7, or ten or more strains having all of the identifying characteristics of ten or more corresponding strains listed in Table 1 or Table 7.
4. The synthetic stool preparation of claim 1 , wherein the mixture comprises 15 or more, 20 or more, 25 or more or 30 or more bacterial strains selected from the strains listed in Table 1 or Table 7, or 15 or more, 20 or more, 25 or more or 30 or more strains having all of the identifying characteristics of 15 or more, 20 or more, 25 or more or 30 or more corresponding strains listed in Table 1 or Table 7.
5. The synthetic stool preparation of claim 1 , wherein the mixture comprises at least one bacterial strain selected from the strains listed in Table 2a or Table 9, or from strains having all of the identifying characteristics of the strains listed in Table 2a or Table 9.
6. The synthetic stool preparation of claim 1 , wherein the mixture comprises ten or more bacterial strains selected from the strains listed in Table 2a or Table 9, or ten or more strains having all of the identifying characteristics of ten or more corresponding strains listed in Table 2a or Table 9.
7. The synthetic stool preparation of claim 5 or 6, wherein the mixture comprises 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains selected from the strains listed in Table 2a or Table 9, or 15 or more, 20 or more, 25 or more, or 30 or more strains having all of the identifying characteristics of 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains listed in Table 2a or Table 9.
8. A synthetic stool preparation comprising a mixture of bacterial strains, wherein the mixture comprises some of the bacterial strains listed in Table 2a or Table 9.
9. A synthetic stool preparation comprising a mixture of bacterial strains, wherein the mixture comprises all of the bacterial strains listed in Table 2a or Table 9.
10. The synthetic stool preparation of any one of claims 1 to 9, wherein the mixture comprises at least one bacterial strain which produces butyrate.
1 1. The synthetic stool preparation of any one of claims 1 to 10, wherein the mixture comprises at least one Bacteroides spp. strain.
12. The synthetic stool preparation of any one of claims 1 to 1 1 , wherein the mixture comprises at least one Clostridium cluster XlVa group bacterial strain.
13. The synthetic stool preparation of any one of claims 1 to 12, wherein the mixture comprises at least one Bifidobacterium longum bacterial strain.
14. The synthetic stool preparation of any one of claims 1 to 13, wherein the mixture comprises at least one Lachnospiraceae bacterial strain.
15. The synthetic stool preparation of any one of claims 1 to 14, wherein the mixture comprises more than one strain of at least one single bacterial species.
16. The synthetic stool preparation of any one of claims 1 to 15, wherein the mixture comprises at least one bacterial strain selected from the group consisting of strain 13LG (Eubacterium limosum), strain 31 FAA (Roseburia intestinalis), F.prausnitzii, Roseburia spp., Eubacterium rectale, B.ovatus, P. distasonis, Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Blautia spp., Dorea spp., R.torques, Bifidobacterium longum, Eubacterium hadrum, Anaerostipes coli, Clostridium spp. aldenense, Clostridium spp. (hathewayi, symbiosum, orbiscindens, thermocellum, citroniae), Ruminococcus obeum, Ruminococcus productus, Ruminococcus torques, Ruminococcus bromii, Roseburia inulinovorans, Blautia coccoides, Dorea spp., Sutterella spp., Dialister invisus, Blautia producta, Bifidobacterium pseudocatenulatum, and strains having the identifying characteristics thereof.
17. The synthetic stool preparation of any one of claims 1 to 16, wherein the synthetic stool preparation further comprises a prebiotic.
18. The synthetic stool preparation of any one of claims 1 to 17, wherein at least one of the bacterial strains in the mixture is not antibiotic resistant.
19. The synthetic stool preparation of claim 18, wherein the antibiotic is pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin, or ceftazidime.
20. The synthetic stool preparation of any one of claims 1 to 19, wherein at least one of the bacterial strains in the mixture is antagonistic towards Clostridium difficile, inhibits or prevents sporulation of Clostridium difficile, or neutralizes or protects against Clostridium difficile toxin.
21. The synthetic stool preparation of claim 20, wherein the at least one bacterial strain which inhibits or prevents sporulation of Clostridium difficile is Roseburia intestinalis strain 31 FAA, or a strain having all of the identifying characteristics thereof.
22. The synthetic stool preparation of any one of claims 1 to 21 , wherein the synthetic stool preparation further comprises a carrier.
23. The synthetic stool preparation of any one of claims 1 to 22, wherein the synthetic stool preparation further comprises insoluble fiber, a buffer, an osmotic agent, an anti- foaming agent, and/or a preservative.
24. The synthetic stool preparation of any one of claims 1 to 23, wherein the synthetic stool preparation is made or provided in chemostat medium.
25. The synthetic stool preparation of any one of claims 1 to 23, wherein the synthetic stool preparation is made or provided in saline, optionally 0.9% saline.
26. The synthetic stool preparation of any one of claims 1 to 25, wherein the synthetic stool preparation is made or provided under reduced atmosphere.
27. The synthetic stool preparation of claim 26, wherein the preparation is under N2, C02, H2, or a mixture thereof.
28. The synthetic stool preparation of claim 27, wherein the mixture thereof is N2:C02: H2.
29. A method for treating a disorder associated with dysbiosis of the gastrointestinal tract, comprising administering the synthetic stool preparation of any one of claims 1 to 28 to a subject in need thereof.
30. The method of claim 29, wherein administration is via rectal enema by the colonoscopic route.
31 . The method of claim 30, comprising the steps of:
-inserting a colonoscope into the cecum of the subject;
-optionally suctioning a sample of fecal material from the area;
-depositing a first portion of the synthetic stool preparation adjacent to the cecum, using a syringe containing the synthetic stool preparation attached to the colonoscope; and
-depositing a second portion of the synthetic stool preparation throughout the transverse colon using the syringe as the colonoscope is withdrawn.
32. The method of any one of claims 29 to 31 , wherein the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation.
33. The method of any one of claims 29 to 31 , wherein the subject is treated with a colon cleansing agent before administration of the synthetic stool preparation.
34. The method of any one of claims 31 to 33, wherein the first and second portions each comprise approximately half of the synthetic stool preparation.
35. The method of any one of claims 29 to 34, wherein the subject has Clostridium difficile infection.
36. The method of claim 35, wherein the subject has recurrent Clostridium difficile infection.
37. The method of claim 35 or 36, wherein recurrence of Clostridium difficile infection is prevented.
38. The method of any one of claims 29 to 37, wherein the subject has diverticular disease.
39. The method of any one of claims 29 to 37, wherein the subject has Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, or diverticular disease.
40. The method of any one of claims 29 to 34, wherein the subject has food poisoning.
41. The method of claim 40, wherein the food poisoning is caused by at least one species of the following genera: Escherichia, Salmonella, Clostridium, Listeria,
Staphylococcus, Campylobacter, Bacillus, Shigella, Cryptosporidium, or Vibrio.
42. The method of claim 41 , wherein the food poisoning is caused by pathogenic Escherichia coli, Escherichia coli EHEC, Escherichia coli EPEC, Escherichia coli AIEC, Escherichia coli EAggEC, Escherichia coli ETEC, Escherichia coli 0157, Staphylococcus aureus, Campylobacter jejuni, Campylobacter coli, Clostridium perfringens, Bacillus cereus, Clostridium botulinum, or Vibrio cholerae.
43. A method for treating Clostridium difficile infection comprising administering the synthetic stool preparation of any one of claims 1 to 28 to a subject in need thereof.
44. The method of claim 43, wherein administration is via rectal enema by the colonoscopic route.
45. A method for treating recurrent Clostridium difficile infection comprising administering the synthetic stool preparation of any one of claims 1 to 28 to a subject in need thereof.
46. The method of claim 45, wherein administration is via rectal enema by the colonoscopic route.
47. A method for preventing recurrence of Clostridium difficile infection comprising administering the synthetic stool preparation of any one of claims 1 to 28 to a subject in need thereof.
48. The method of claim 47, wherein administration is via rectal enema by the colonoscopic route.
49. The synthetic stool preparation of any one of claims 1 to 28 for treating a disorder associated with dysbiosis of the gastrointestinal tract in a subject in need thereof.
50. The synthetic stool preparation of any one of claims 1 to 28 for treating Clostridium difficile infection in a subject in need thereof.
51. The synthetic stool preparation of any one of claims 1 to 28 for treating recurrent Clostridium difficile infection in a subject in need thereof.
52. The synthetic stool preparation of any one of claims 1 to 28 for preventing recurrence of Clostridium difficile infection in a subject in need thereof.
53. The synthetic stool preparation of any one of claims 1 to 28 for treating Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, or diverticular disease in a subject in need thereof.
54. The synthetic stool preparation of any one of claims 1 to 28 for treating food poisoning in a subject in need thereof.
55. The synthetic stool preparation of claim 54, wherein the food poisoning is caused by Salmonella.
56. The synthetic stool preparation of any one of claims 1 to 28 and 49 to 55, wherein the synthetic stool preparation is adapted for administration via rectal enema by the
colonoscopic route.
57. The synthetic stool preparation of any one of claims 1 to 28 and 49 to 55, wherein the synthetic stool preparation is adapted for administration orally.
58. The synthetic stool preparation of claim 57, wherein the synthetic stool preparation is freeze-dried.
59. The synthetic stool preparation of claim 57 or 58, wherein the synthetic stool preparation is in capsule or tablet form.
60. A kit for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising the synthetic stool preparation of any one of claims 1 to 28 and 49 to 55, and instructions for use thereof.
61 . A kit for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising 10 or more bacterial strains selected from the strains listed in Table 1 , or 10 or more strains having all of the identifying characteristics of 10 or more corresponding strains listed in Table 1 .
62. A kit for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising 10 or more bacterial strains selected from the strains listed in Table 2a or Table 9, or 10 or more strains having all of the identifying characteristics of 10 or more corresponding strains listed in Table 2a or Table 9.
63. A kit for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising bacterial strains selected from the strains listed in Table 2a or Table 9, or comprising strains having all of the identifying characteristics of corresponding strains listed in Table 2a or Table 9.
64. A kit for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising at least two bacterial strains selected from strains listed in Table
1 , Table 2a or Table 9, or at least two strains having all of the identifying characteristics of at least two corresponding strains listed in Table 1 , Table 2a, or Table 9.
65. A method for preparing the synthetic stool preparation of any one of claims 1 to 28 and 49 to 55, wherein the bacterial strains are cultured in a chemostat containing chemostat medium, under reduced atmosphere with controlled levels of partial pressure of N2:C02: H2, and controlled acidity (pH) to replicate human colonic gastrointestinal tract.
66. A method for preparing the synthetic stool preparation of any one of claims 1 to 28 and 49 to 55, wherein the bacterial strains are cultured in a chemostat under conditions replicating healthy human colonic gastrointestinal tract in equilibrium; individual bacterial strains are then purified into pure isolates; and the pure isolates are combined to produce the synthetic stool preparation.
67. The method of claim 66, wherein the combined isolates are grown in a single-stage chemostat system.
68. The method of claim 66 or 67, wherein the combined isolates are grown in batch culture, or the combined isolates are grown in batch culture after growth in the single-stage chemostat system.
69. An isolated bacterial strain selected from the group consisting of Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Eubacterium limosum, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, and strains having the identifying characteristics thereof.
70. Use of one or more of the isolated bacterial strains of claim 69 in the preparation of a synthetic stool preparation.
71. A synthetic stool preparation comprising a mixture of bacterial strains, wherein the mixture comprises one or more isolated bacterial strain according to claim 69.
72. The method of any one of claims 29 to 48, wherein inflammation is reduced in the subject after administration of the synthetic stool preparation.
73. The method of claim 29, wherein the synthetic stool preparation is administered orally.
74. The method of claim 73, wherein the synthetic stool preparation is freeze-dried.
75. The method of claim 73 or 74, wherein the synthetic stool preparation is in capsule or tablet form.
76. A method for treating inflammation, comprising administering the synthetic stool preparation of any one of claims 1 to 28 to a subject in need thereof.
77. The method of claim 76, wherein the inflammation is associated with dysbiosis of the gastrointestinal tract.
78. The method of claim 76 or 77, wherein administration is via rectal enema by the colonoscopic route.
79. The method of claim 76 or 77, wherein the synthetic stool preparation is administered orally.
PCT/CA2012/050642 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system WO2013037068A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2848762A CA2848762C (en) 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system
US14/344,981 US20140363397A1 (en) 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system
EP12831311.1A EP2744890A4 (en) 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system
US15/492,770 US20170296596A1 (en) 2011-09-14 2017-04-20 Method for treatment of disorders of the gastrointestinal system
US16/710,187 US20200237831A1 (en) 2011-09-14 2019-12-11 Method for treatment of disorders of the gastrointestinal system

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161534456P 2011-09-14 2011-09-14
US61/534,456 2011-09-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/344,981 A-371-Of-International US20140363397A1 (en) 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system
US15/492,770 Continuation US20170296596A1 (en) 2011-09-14 2017-04-20 Method for treatment of disorders of the gastrointestinal system

Publications (1)

Publication Number Publication Date
WO2013037068A1 true WO2013037068A1 (en) 2013-03-21

Family

ID=47882498

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/CA2012/050642 WO2013037068A1 (en) 2011-09-14 2012-09-14 Method for treatment of disorders of the gastrointestinal system
PCT/CA2012/050641 WO2013037067A1 (en) 2011-09-14 2012-09-14 Media supplements and methods to culture human gastrointestinal anaerobic microorganisms

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/CA2012/050641 WO2013037067A1 (en) 2011-09-14 2012-09-14 Media supplements and methods to culture human gastrointestinal anaerobic microorganisms

Country Status (5)

Country Link
US (7) US20140342438A1 (en)
EP (2) EP2756071B1 (en)
CA (2) CA2848762C (en)
ES (1) ES2662793T3 (en)
WO (2) WO2013037068A1 (en)

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8906668B2 (en) 2012-11-23 2014-12-09 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof
WO2014201037A3 (en) * 2013-06-10 2015-03-12 New York University Methods for manipulating immune responses by altering microbiota
US20150093360A1 (en) * 2013-02-04 2015-04-02 Seres Health, Inc. Compositions and methods
CN104546939A (en) * 2014-09-30 2015-04-29 深圳华大基因科技有限公司 Application of dialister invisus in treating or preventing rheumatoid arthritis or related diseases
WO2016019506A1 (en) * 2014-08-05 2016-02-11 BGI Shenzhen Co.,Limited Use of eubacterium in the prevention and treatment for colorectal cancer related diseases
WO2016019505A1 (en) * 2014-08-05 2016-02-11 Bgi Shenzhen Co., Limited Use of eubacterium in the prevention and treatment for colorectal cancer related diseases
EP2995314A1 (en) 2014-09-12 2016-03-16 Swecure AB Use of collinsella for treatment of inflammatory bowel disease
US9603876B2 (en) 2008-09-25 2017-03-28 New York University Compositions and methods for restoring gastrointestinal microbiota following antibiotic treatment
CN106974940A (en) * 2016-01-15 2017-07-25 深圳华大基因研究院 Application of the heavy wall mushroom probiotics in fat and its relevant disease is treated and prevented
US20170354695A1 (en) * 2015-06-15 2017-12-14 4D Pharma Research Limited Compositions comprising bacterial strains
US20170360856A1 (en) 2015-06-15 2017-12-21 4D Pharma Research Limited Compositions comprising bacterial strains
WO2017220802A1 (en) * 2016-06-23 2017-12-28 Vib Vzw Means and methods to treat inflammation-associated disorders or conditions
US9907755B2 (en) 2013-03-14 2018-03-06 Therabiome, Llc Targeted gastrointestinal tract delivery of probiotic organisms and/or therapeutic agents
US20180078585A1 (en) 2015-11-20 2018-03-22 4D Pharma Research Limited Compositions comprising bacterial strains
US9956282B2 (en) 2013-12-16 2018-05-01 Seres Therapeutics, Inc. Bacterial compositions and methods of use thereof for treatment of immune system disorders
US9999641B2 (en) 2016-06-14 2018-06-19 Vedanta Biosciences, Inc. Treatment of clostridium difficile infection
US10058574B2 (en) 2015-06-15 2018-08-28 4D Pharma Research Limited Compositions comprising bacterial strains
US10076546B2 (en) 2013-03-15 2018-09-18 Seres Therapeutics, Inc. Network-based microbial compositions and methods
US10080772B2 (en) 2016-07-13 2018-09-25 4D Pharma Plc Compositions comprising bacterial strains
US10086022B2 (en) 2016-03-04 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
US10086021B2 (en) 2016-12-12 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
EP3388069A1 (en) 2017-04-12 2018-10-17 ETH Zurich Consortia of living bacteria useful for treatment of microbiome dysbiosis
WO2019032573A1 (en) 2017-08-07 2019-02-14 Finch Therapeutics, Inc. Compositions and methods for maintaining and restoring a healthy gut barrier
US10226489B2 (en) 2014-12-23 2019-03-12 4D Pharma Research Limited Composition of bacteroides thetaiotaomicron for immune modulation
EP3354745A4 (en) * 2015-09-22 2019-03-20 Korea University Research and Business Foundation Biomarker composition, diagnostic kit, and method for providing information
US10258655B2 (en) 2013-11-25 2019-04-16 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US10391128B2 (en) 2015-11-23 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
US10456444B2 (en) 2014-12-23 2019-10-29 4D Pharma Research Limited Pirin polypeptide and immune modulation
US10471108B2 (en) 2015-11-20 2019-11-12 4D Pharma Research Limited Compositions comprising bacterial strains
CN110545828A (en) * 2016-04-19 2019-12-06 基因组研究有限公司 Bacterial therapy
US10500237B2 (en) 2015-06-15 2019-12-10 4D Pharma Research Limited Compositions comprising bacterial strains
US10588857B2 (en) 2012-03-29 2020-03-17 Therabiome, Llc Gastrointestinal site-specific oral vaccination formulations active on the ileum and appendix
EP3639834A1 (en) 2016-02-04 2020-04-22 Universiteit Gent Use of microbial communities for human and animal health
US10653728B2 (en) 2016-10-17 2020-05-19 New York University Probiotic compositions for improving metabolism and immunity
CN111247254A (en) * 2017-10-13 2020-06-05 雷柏奥提斯有限公司 Microbiome health index
US10736926B2 (en) 2015-06-15 2020-08-11 4D Pharma Research Limited Compositions comprising bacterial strains
US10744166B2 (en) 2015-11-23 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10851137B2 (en) 2013-04-10 2020-12-01 4D Pharma Research Limited Polypeptide and immune modulation
US10973861B2 (en) 2013-02-04 2021-04-13 Seres Therapeutics, Inc. Compositions and methods
US10987387B2 (en) 2017-05-24 2021-04-27 4D Pharma Research Limited Compositions comprising bacterial strain
US11007233B2 (en) 2017-06-14 2021-05-18 4D Pharma Research Limited Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
WO2021097271A1 (en) * 2019-11-15 2021-05-20 Assembly Biosciences, Inc. Compositions comprising bacterial species and methods related thereto
US11013773B2 (en) 2011-07-14 2021-05-25 4D Pharma Research Limited Lactic acid bacterial strains
EP3858363A1 (en) 2020-01-28 2021-08-04 Institut national de recherche pour l'agriculture, l'alimentation et l'environnement Composition for treating intestinal or pulmonary diseases
US20210268036A1 (en) * 2019-03-08 2021-09-02 The Regents Of The University Of California Compositions and methods for modulating lipid and steroid metabolism
US11123379B2 (en) 2017-06-14 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11123378B2 (en) 2017-05-22 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
EP3725320A4 (en) * 2017-12-12 2021-12-15 Korea Research Institute of Bioscience and Biotechnology Composition comprising agathobaculum sp. strain as effective ingredient for prevention, alleviation, or treatment of autism spectrum disorder
US11224620B2 (en) 2016-07-13 2022-01-18 4D Pharma Plc Compositions comprising bacterial strains
US11242544B2 (en) * 2018-07-11 2022-02-08 Wisconsin Alumni Research Foundation Microbiomes and methods for producing medium-chain fatty acids from organic substrates
US11266698B2 (en) 2011-10-07 2022-03-08 4D Pharma Research Limited Bacterium for use as a probiotic for nutritional and medical applications
WO2022027040A3 (en) * 2020-07-28 2022-03-24 Icahn School Of Medicine At Mount Sinai Compositions and methods for treating infections of the gastrointestinal tract
US11607432B2 (en) 2014-11-25 2023-03-21 Evelo Biosciences, Inc. Probiotic compositions containing clostridiales for inhibiting inflammation
US11701394B2 (en) 2017-08-14 2023-07-18 Seres Therapeutics, Inc. Compositions and methods for treating cholestatic disease
US12048720B2 (en) 2017-06-14 2024-07-30 Cj Bioscience, Inc. Compositions comprising bacterial strains
US12083151B2 (en) 2012-11-23 2024-09-10 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof

Families Citing this family (68)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPQ899700A0 (en) 2000-07-25 2000-08-17 Borody, Thomas Julius Probiotic recolonisation therapy
EP2531589B1 (en) 2010-02-01 2017-04-05 MikrobEX Bacteriotherapy for Clostridium difficile colitis
WO2011151941A1 (en) 2010-06-04 2011-12-08 国立大学法人東京大学 Composition having activity of inducing proliferation or accumulation of regulatory t cell
EP3311825A1 (en) 2010-08-04 2018-04-25 Thomas Julius Borody Compositions for fecal floral transplantation and methods for making and using them
EP2683390B1 (en) 2011-03-09 2017-05-03 Regents Of The University Of Minnesota Compositions and methods for transplantation of colon microbiota
CA2848762C (en) 2011-09-14 2021-07-27 Queen's University At Kingston Method for treatment of disorders of the gastrointestinal system
KR20140082964A (en) * 2011-10-11 2014-07-03 아힘 바이오테라퓨틱스 에이비 Composition comprising anaerobically cultivated human intestinal microbiota
US10238694B2 (en) 2011-12-01 2019-03-26 The University Of Tokyo Human-derived bacteria that induce proliferation or accumulation of regulatory T cells
BR112014021388A2 (en) 2012-02-29 2017-07-18 Ethicon Endo Surgery Inc microbiota compositions and methods related thereto
US10039777B2 (en) 2012-03-20 2018-08-07 Neuro-Lm Sas Methods and pharmaceutical compositions of the treatment of autistic syndrome disorders
US9719144B2 (en) 2012-05-25 2017-08-01 Arizona Board Of Regents Microbiome markers and therapies for autism spectrum disorders
CA2896795A1 (en) * 2012-11-26 2014-05-30 Thomas Julius Borody Compositions for the restoration of a fecal microbiota and methods for making and using them
US10383901B2 (en) 2013-06-05 2019-08-20 Rebiotix, Inc. Microbiota restoration therapy (MRT), compositions and methods of manufacture
US9782445B2 (en) 2013-06-05 2017-10-10 Rebiotix, Inc. Microbiota restoration therapy (MRT), compositions and methods of manufacture
US9694039B2 (en) 2013-06-05 2017-07-04 Rebiotix, Inc. Microbiota restoration therapy (MRT), compositions and methods of manufacture
EP3881680A1 (en) 2014-10-31 2021-09-22 Pendulum Therapeutics, Inc. Methods and compositions relating to microbial treatment
WO2016130498A1 (en) * 2015-02-10 2016-08-18 Massachusetts Institute Of Technology Isolated mucins and different microoorganisms, and methods of use
SE1550189A1 (en) * 2015-02-19 2016-08-20 Achim Biotherapeutics Ab Therapeutic and prophylactic composition produced by microbiota
WO2016139217A1 (en) * 2015-03-04 2016-09-09 Ab-Biotics, S.A. Composition comprising anaerobically cultivated human intestinal microbiota
EP3294308A4 (en) 2015-05-14 2019-03-06 University of Puerto Rico Methods for restoring microbiota of newborns
AU2016262615C1 (en) 2015-05-14 2021-06-10 Finch Therapeutics Holdings Llc Compositions for fecal floral transplantation and methods for making and using them and devices for delivering them
CN114366759A (en) 2015-05-22 2022-04-19 亚利桑那大学董事会 Methods for treating autism spectrum disorders and related symptoms
US10828340B2 (en) 2015-06-09 2020-11-10 Rebiotix, Inc. Microbiota restoration therapy (MRT) compositions and methods of manufacture
KR102066242B1 (en) 2015-06-09 2020-01-14 리바이오틱스, 인코퍼레이티드 Microbial Restoration Therapy (MRT) Compositions and Methods of Preparation
US10799539B2 (en) 2015-06-09 2020-10-13 Rebiotix, Inc. Microbiota restoration therapy (MRT) compositions and methods of manufacture
US10905726B2 (en) 2015-06-09 2021-02-02 Rebiotix, Inc. Microbiota restoration therapy (MRT) compositions and methods of manufacture
US20180251725A1 (en) * 2015-08-24 2018-09-06 Nubyiota Llc Systems and methods for enriching a bacterial strain from a target bacterial system
CA2995786A1 (en) * 2015-08-24 2017-03-02 Nubyiota Llc Systems and methods for treating a dysbiosis using fecal-derived bacterial populations
WO2017053544A1 (en) * 2015-09-22 2017-03-30 Mayo Foundation For Medical Education And Research Methods and materials for using biomarkers which predict susceptibility to clostridium difficile infection
CN105219675A (en) * 2015-10-13 2016-01-06 田发益 The isolation cultivation method of a kind of anaerobic bacterium
US11564667B2 (en) 2015-12-28 2023-01-31 New York University Device and method of restoring microbiota of newborns
EP3413902A4 (en) * 2016-02-11 2019-11-13 Nubyiota LLC Systems and methods for characterizing compositions comprising fecal-derived bacterial populations
WO2017152137A2 (en) * 2016-03-04 2017-09-08 The Regents Of The University Of California Microbial consortium and uses thereof
US20190076491A1 (en) * 2016-03-10 2019-03-14 Peachtree Health Management Llc Dba Aeon Laboratories Methods of treating substance abuse related diseases or disorders
AU2017274416C1 (en) * 2016-06-01 2022-07-07 Finch Therapeutics Holdings Llc Compositions and methods for treating inflammatory bowel diseases (IBDS) and other disorders
US20170360848A1 (en) 2016-06-15 2017-12-21 Arizona Board Of Regents On Behalf Of Arizona State University Methods for treating autism spectrum disorder and associated symptoms
US10849936B2 (en) 2016-07-01 2020-12-01 Regents Of The University Of Minnesota Compositions and methods for C. difficile treatment
WO2018012834A1 (en) * 2016-07-11 2018-01-18 한국생명공학연구원 Akkermansia muciniphila strain having effect of preventing or treating degenerative brain diseases or metabolic diseases, and use thereof
US20180036352A1 (en) 2016-08-03 2018-02-08 Crestovo Holdings Llc Methods for treating ulcerative colitis
US11213549B2 (en) 2016-10-11 2022-01-04 Finch Therapeutics Holdings Llc Compositions and method for treating primary sclerosing cholangitis and related disorders
US10092601B2 (en) 2016-10-11 2018-10-09 Crestovo Holdings Llc Compositions and methods for treating multiple sclerosis and related disorders
WO2018071537A1 (en) 2016-10-11 2018-04-19 Crestovo Holdings Llc Compositions and methods for treating multiple sclerosis and related disorders
EP3378949A1 (en) * 2017-03-22 2018-09-26 Assistance Publique - Hôpitaux de Paris Method for determining the potential efficacy of anticancer treatment
CN110831606A (en) 2017-04-05 2020-02-21 克雷斯顿沃控股公司 Compositions and methods for treating Parkinson's Disease (PD) and related disorders
US11040073B2 (en) 2017-04-05 2021-06-22 Finch Therapeutics Holdings Llc Compositions and methods for treating diverticulitis and related disorders
WO2018197951A1 (en) 2017-04-28 2018-11-01 Allen Vercoe Emma Methods and compositions for storing bacteria
WO2018218159A1 (en) 2017-05-26 2018-11-29 Crestovo Holdings Llc Lyophilized compositions comprising fecal microbe-based therapeutic agents and methods for making and using same
CA3070729A1 (en) * 2017-08-04 2019-02-07 Second Genome, Inc. Roseburia hominis, eubacterium eligens, and combinations thereof as biotherapeutics
CN111372596A (en) 2017-08-30 2020-07-03 潘德勒姆治疗公司 Methods and compositions for treating microbiome-related disorders
EP3690026A4 (en) * 2017-09-28 2021-06-23 Kobiolabs, Inc. Composition for diagnosis and treatment of alcoholic liver disease, using change in short-chain fatty acid producing gut bacterial community
WO2019118515A2 (en) * 2017-12-11 2019-06-20 Vedanta Biosciences, Inc. Compositions and methods for suppressing pathogenic organisms
WO2019115759A1 (en) * 2017-12-14 2019-06-20 Københavns Universitet Bacterial compositions and the use thereof for the treatment or prevention of asthma or other wheezing disorders or allergy in a child
CN112087998A (en) * 2018-01-05 2020-12-15 努比亚塔有限责任公司 Compositions comprising co-selected microbial populations and methods of use thereof
EP3773645A4 (en) 2018-04-10 2021-11-24 Siolta Therapeutics, Inc. Microbial consortia
CN112292141A (en) * 2018-04-13 2021-01-29 医学生命探索有限公司 Microorganisms producing long-chain dicarboxylic fatty acids (LCDFA) and uses thereof
US11166990B2 (en) 2018-07-13 2021-11-09 Finch Therapeutics Holdings Llc Methods and compositions for treating ulcerative colitis
JP2022514145A (en) 2018-09-27 2022-02-10 フィンチ セラピューティクス ホールディングス エルエルシー Compositions and Methods for Treating Epilepsy and Related Disorders
EP4041264A1 (en) 2019-10-07 2022-08-17 Siolta Therapeutics, Inc. Therapeutic pharmaceutical compositions
CN110734843B (en) * 2019-11-12 2023-01-17 晨光生物科技集团股份有限公司 Fermentation system and fermentation method for simulating colon environment
US11098377B1 (en) * 2020-09-15 2021-08-24 Nubiyota Llc Systems and methods for characterizing compositions comprising bacterial populations
WO2022070052A1 (en) * 2020-09-30 2022-04-07 Alma Bio Therapeutics Nucleic acid therapy for differential modulation of host microflora
KR102269963B1 (en) * 2020-12-11 2021-06-28 주식회사 바이오뱅크힐링 Coprococcus comes strain, and vesicles from thereof and anti-inflammation and anti-bacteria uses of thereof
CN112940974A (en) * 2021-02-24 2021-06-11 四川农业大学 Co-culture method capable of culturing anaerobic strain and porcine intestinal epithelial cells
CN113555059B (en) * 2021-06-25 2024-02-02 中国科学院南京地理与湖泊研究所 Method for quantifying coupling relation between organic carbon and microorganism under environmental change
CN113604378A (en) * 2021-07-05 2021-11-05 华南理工大学 Composite microbial inoculum for preparing mogroside metabolite and application thereof
KR102359617B1 (en) * 2021-11-18 2022-02-09 주식회사 엔테로바이옴 The Composition of Culture Media for Faecalibacterium prausnitzii
KR102438867B1 (en) * 2022-03-11 2022-09-02 주식회사 바이오뱅크힐링 Coprococcus catus strain, and vesicles from thereof and anti-inflammation and anti-bacteria uses of thereof
CN116287335B (en) * 2023-02-21 2024-01-30 浙江大学 Method for evaluating intestinal microecological regulation effect of arabinoxylans and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2998868B2 (en) * 1992-01-23 2000-01-17 滝澤 渉 Intestinal flora improver
US20010014345A1 (en) * 1995-03-08 2001-08-16 Gregory N. Batts Material, method and apparatus for inhibiting bacterial growth in an aqueous medium
AUPQ899700A0 (en) * 2000-07-25 2000-08-17 Borody, Thomas Julius Probiotic recolonisation therapy
WO2009055362A1 (en) * 2007-10-26 2009-04-30 Moore Brenda E Probiotic compositions and methods for inducing and supporting weight loss
WO2009066695A1 (en) * 2007-11-20 2009-05-28 Olympus Corporation Method of preparing fecal sample, solution for preparing fecal sample and feces collection kit
CA2848762C (en) 2011-09-14 2021-07-27 Queen's University At Kingston Method for treatment of disorders of the gastrointestinal system
CN103082292B (en) * 2011-11-02 2015-03-04 深圳华大基因研究院 Use of Roseburia for the treatment and prevention of obesity-related diseases

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
PETROF, E.: "Repoopulating the gut: use of synthetic stool to cure recurrent C. difficile infection. Canadian Digestive Diseases Week", CAN. J. GASTROENTEROL., vol. 26, no. A, February 2012 (2012-02-01), MONTREAL, QUEBEC., XP055145583 *
PETROF, EO.: "Probiotics and Gastrointestinal Disease: Clinical Evidence and Basic Science.", ANTIINFLAMM. ANTIALLERGY. AGENTS MED. CHEM., vol. 17, no. 3, 1 September 2009 (2009-09-01), pages 260 - 269, XP055145580 *
See also references of EP2744890A4 *
WANG, Y.: "16S rRNA gene-based analysis of fecal microbiota from preterm infants with and without necrotizing enterocolitis.", ISME J., vol. 3, no. 8, August 2009 (2009-08-01), pages 944 - 954, XP055145577 *

Cited By (139)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9603876B2 (en) 2008-09-25 2017-03-28 New York University Compositions and methods for restoring gastrointestinal microbiota following antibiotic treatment
US11013773B2 (en) 2011-07-14 2021-05-25 4D Pharma Research Limited Lactic acid bacterial strains
US11266698B2 (en) 2011-10-07 2022-03-08 4D Pharma Research Limited Bacterium for use as a probiotic for nutritional and medical applications
US10588857B2 (en) 2012-03-29 2020-03-17 Therabiome, Llc Gastrointestinal site-specific oral vaccination formulations active on the ileum and appendix
US8906668B2 (en) 2012-11-23 2014-12-09 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof
US9028841B2 (en) 2012-11-23 2015-05-12 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof
US12083151B2 (en) 2012-11-23 2024-09-10 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11458173B2 (en) 2012-11-23 2022-10-04 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US10864235B2 (en) 2012-11-23 2020-12-15 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11464812B2 (en) 2012-11-23 2022-10-11 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11389490B2 (en) 2012-11-23 2022-07-19 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US9533014B2 (en) 2012-11-23 2017-01-03 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11458174B2 (en) 2012-11-23 2022-10-04 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US9585921B2 (en) 2013-02-04 2017-03-07 Seres Therapeutics, Inc. Compositions and methods
US11185562B2 (en) 2013-02-04 2021-11-30 Seres Therapeutics, Inc. Compositions and methods for inhibition of pathogenic bacterial growth
US11730775B2 (en) 2013-02-04 2023-08-22 Seres Therapeutics, Inc. Methods for treatment of Clostridium difficile infection or recurrence or symptoms thereof
US9446080B2 (en) 2013-02-04 2016-09-20 Seres Therapeutics, Inc. Compositions and methods
EP3584308A3 (en) * 2013-02-04 2020-03-04 Seres Therapeutics, Inc. Compositions and methods
US9855303B2 (en) 2013-02-04 2018-01-02 Seres Therapeutics, Inc. Compositions and methods
US9180147B2 (en) * 2013-02-04 2015-11-10 Seres Therapeutics, Inc. Compositions and methods
EP3587558A3 (en) * 2013-02-04 2020-03-04 Seres Therapeutics, Inc. Methods of populating a gastrointestinal tract
US10973861B2 (en) 2013-02-04 2021-04-13 Seres Therapeutics, Inc. Compositions and methods
US10967011B2 (en) 2013-02-04 2021-04-06 Seres Therapeutics, Inc. Compositions and methods
US20150093360A1 (en) * 2013-02-04 2015-04-02 Seres Health, Inc. Compositions and methods
US10064901B2 (en) 2013-02-04 2018-09-04 Seres Therapeutics, Inc. Compositions and methods
US9011834B1 (en) * 2013-02-04 2015-04-21 Seres Health, Inc. Compositions and methods
US10064900B2 (en) 2013-02-04 2018-09-04 Seres Therapeutics, Inc. Methods of populating a gastrointestinal tract
US10369111B2 (en) 2013-03-14 2019-08-06 Therabiome, Llc Targeted gastrointestinal tract delivery of probiotic organisms and/or therapeutic agents
US11590083B2 (en) 2013-03-14 2023-02-28 Therabiome, Llc Targeted gastrointestinal tract delivery of probiotic organisms and/or therapeutic agents
US9907755B2 (en) 2013-03-14 2018-03-06 Therabiome, Llc Targeted gastrointestinal tract delivery of probiotic organisms and/or therapeutic agents
US10076546B2 (en) 2013-03-15 2018-09-18 Seres Therapeutics, Inc. Network-based microbial compositions and methods
US10881696B2 (en) 2013-03-15 2021-01-05 Seres Therapeutics, Inc. Network-based microbial compositions and methods
US11666612B2 (en) 2013-03-15 2023-06-06 Seres Therapeutics, Inc Network-based microbial compositions and methods
US10851137B2 (en) 2013-04-10 2020-12-01 4D Pharma Research Limited Polypeptide and immune modulation
US11414463B2 (en) 2013-04-10 2022-08-16 4D Pharma Research Limited Polypeptide and immune modulation
WO2014201037A3 (en) * 2013-06-10 2015-03-12 New York University Methods for manipulating immune responses by altering microbiota
US10258655B2 (en) 2013-11-25 2019-04-16 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
AU2021200287B2 (en) * 2013-11-25 2023-05-25 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11266699B2 (en) 2013-11-25 2022-03-08 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US11918612B2 (en) 2013-11-25 2024-03-05 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US9956282B2 (en) 2013-12-16 2018-05-01 Seres Therapeutics, Inc. Bacterial compositions and methods of use thereof for treatment of immune system disorders
WO2016019506A1 (en) * 2014-08-05 2016-02-11 BGI Shenzhen Co.,Limited Use of eubacterium in the prevention and treatment for colorectal cancer related diseases
WO2016019505A1 (en) * 2014-08-05 2016-02-11 Bgi Shenzhen Co., Limited Use of eubacterium in the prevention and treatment for colorectal cancer related diseases
EP2995314A1 (en) 2014-09-12 2016-03-16 Swecure AB Use of collinsella for treatment of inflammatory bowel disease
CN104546939A (en) * 2014-09-30 2015-04-29 深圳华大基因科技有限公司 Application of dialister invisus in treating or preventing rheumatoid arthritis or related diseases
US11672834B2 (en) 2014-11-25 2023-06-13 Evelo Biosciences, Inc. Probiotic and prebiotic compositions, and methods of use thereof for modulation of the microbiome
US11612622B2 (en) * 2014-11-25 2023-03-28 Evelo Biosciences, Inc. Probiotic compositions containing clostridiales for inhibiting inflammation
US11607432B2 (en) 2014-11-25 2023-03-21 Evelo Biosciences, Inc. Probiotic compositions containing clostridiales for inhibiting inflammation
US11723933B2 (en) 2014-12-23 2023-08-15 Cj Bioscience, Inc. Composition of bacteroides thetaiotaomicron for immune modulation
US10456444B2 (en) 2014-12-23 2019-10-29 4D Pharma Research Limited Pirin polypeptide and immune modulation
US10226489B2 (en) 2014-12-23 2019-03-12 4D Pharma Research Limited Composition of bacteroides thetaiotaomicron for immune modulation
US10973872B2 (en) 2014-12-23 2021-04-13 4D Pharma Research Limited Pirin polypeptide and immune modulation
US10744167B2 (en) 2015-06-15 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10493112B2 (en) * 2015-06-15 2019-12-03 4D Pharma Research Limited Compositions comprising bacterial strains
US20170354695A1 (en) * 2015-06-15 2017-12-14 4D Pharma Research Limited Compositions comprising bacterial strains
US10500237B2 (en) 2015-06-15 2019-12-10 4D Pharma Research Limited Compositions comprising bacterial strains
US11389493B2 (en) 2015-06-15 2022-07-19 4D Pharma Research Limited Compositions comprising bacterial strains
AU2016278067B2 (en) * 2015-06-15 2022-09-22 Cj Bioscience, Inc. Compositions comprising bacterial strains
US20170360856A1 (en) 2015-06-15 2017-12-21 4D Pharma Research Limited Compositions comprising bacterial strains
US10780134B2 (en) 2015-06-15 2020-09-22 4D Pharma Research Limited Compositions comprising bacterial strains
US10322151B2 (en) 2015-06-15 2019-06-18 4D Pharma Research Limited Compositions comprising bacterial strains
EP3636272A1 (en) 2015-06-15 2020-04-15 4D Pharma Research Limited Compositions comprising bacterial strains
US11433106B2 (en) 2015-06-15 2022-09-06 4D Pharma Research Limited Compositions comprising bacterial strains
US10058574B2 (en) 2015-06-15 2018-08-28 4D Pharma Research Limited Compositions comprising bacterial strains
US11331352B2 (en) 2015-06-15 2022-05-17 4D Pharma Research Limited Compositions comprising bacterial strains
US11273185B2 (en) 2015-06-15 2022-03-15 4D Pharma Research Limited Compositions comprising bacterial strains
US10736926B2 (en) 2015-06-15 2020-08-11 4D Pharma Research Limited Compositions comprising bacterial strains
US11040075B2 (en) 2015-06-15 2021-06-22 4D Pharma Research Limited Compositions comprising bacterial strains
US10864236B2 (en) 2015-06-15 2020-12-15 4D Pharma Research Limited Compositions comprising bacterial strains
US10391130B2 (en) 2015-06-15 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
EP3354745A4 (en) * 2015-09-22 2019-03-20 Korea University Research and Business Foundation Biomarker composition, diagnostic kit, and method for providing information
US20180078585A1 (en) 2015-11-20 2018-03-22 4D Pharma Research Limited Compositions comprising bacterial strains
US10610550B2 (en) 2015-11-20 2020-04-07 4D Pharma Research Limited Compositions comprising bacterial strains
US10471108B2 (en) 2015-11-20 2019-11-12 4D Pharma Research Limited Compositions comprising bacterial strains
US11058732B2 (en) 2015-11-20 2021-07-13 4D Pharma Research Limited Compositions comprising bacterial strains
US10357520B2 (en) 2015-11-20 2019-07-23 4D Pharma Research Limited Compositions comprising bacterial strains
US10744166B2 (en) 2015-11-23 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10391128B2 (en) 2015-11-23 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
CN106974940A (en) * 2016-01-15 2017-07-25 深圳华大基因研究院 Application of the heavy wall mushroom probiotics in fat and its relevant disease is treated and prevented
US11596658B2 (en) 2016-02-04 2023-03-07 Microbial Resource Management Health Nv (Mrm Health) Use of microbial communities for human and animal health
US11491196B2 (en) 2016-02-04 2022-11-08 Universiteit Gent Use of microbial communities for human and animal health
US11633440B2 (en) 2016-02-04 2023-04-25 Microbial Resource Management Health Nv (Mrm Health) Use of microbial communities for human and animal health
US11096971B2 (en) 2016-02-04 2021-08-24 UNIVERSllEll GENT Use of microbial communities for human and animal health
EP4257194A2 (en) 2016-02-04 2023-10-11 Universiteit Gent Use of microbial communities for human and animal health
EP3639834A1 (en) 2016-02-04 2020-04-22 Universiteit Gent Use of microbial communities for human and animal health
US10086022B2 (en) 2016-03-04 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
US10086023B2 (en) 2016-03-04 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
US10583158B2 (en) 2016-03-04 2020-03-10 4D Pharma Plc Compositions comprising bacterial strains
US11786562B2 (en) 2016-04-19 2023-10-17 Genome Research Limited Bacteriotherapy
CN110545828A (en) * 2016-04-19 2019-12-06 基因组研究有限公司 Bacterial therapy
EP3445380B1 (en) * 2016-04-19 2024-04-10 Genome Research Limited Bacteriotherapy
EP4417261A3 (en) * 2016-04-19 2024-10-02 Genome Research Limited Bacteriotherapy
US9999641B2 (en) 2016-06-14 2018-06-19 Vedanta Biosciences, Inc. Treatment of clostridium difficile infection
US10555980B2 (en) 2016-06-14 2020-02-11 Vedanta Biosciences, Inc. Treatment of Clostridium difficile infection
US11701396B2 (en) 2016-06-14 2023-07-18 Vedanta Biosciences, Inc. Treatment of Clostridium difficile infection
US10350250B2 (en) 2016-06-14 2019-07-16 Vedanta Biosciences, Inc. Treatment of clostridium difficile infection
US10456431B2 (en) 2016-06-14 2019-10-29 Vedanta Biosciences, Inc. Treatment of clostridium difficile infection
US10064904B2 (en) 2016-06-14 2018-09-04 Vedanta Biosciences, Inc. Treatment of Clostridium difficile infection
WO2017220802A1 (en) * 2016-06-23 2017-12-28 Vib Vzw Means and methods to treat inflammation-associated disorders or conditions
US10960031B2 (en) 2016-07-13 2021-03-30 4D Pharma Plc Compositions comprising bacterial strains
US11224620B2 (en) 2016-07-13 2022-01-18 4D Pharma Plc Compositions comprising bacterial strains
US10080772B2 (en) 2016-07-13 2018-09-25 4D Pharma Plc Compositions comprising bacterial strains
US10610548B2 (en) 2016-07-13 2020-04-07 4D Pharma Plc Compositions comprising bacterial strains
US10967010B2 (en) 2016-07-13 2021-04-06 4D Pharma Plc Compositions comprising bacterial strains
US10610549B2 (en) 2016-07-13 2020-04-07 4D Pharma Plc Composition comprising bacterial strains
TWI802545B (en) * 2016-07-13 2023-05-21 英商4D製藥有限公司 Compositions comprising bacterial strains
US10086020B2 (en) 2016-07-13 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
US10653728B2 (en) 2016-10-17 2020-05-19 New York University Probiotic compositions for improving metabolism and immunity
US10898526B2 (en) 2016-12-12 2021-01-26 4D Pharma Plc Compositions comprising bacterial strains
US10485830B2 (en) 2016-12-12 2019-11-26 4D Pharma Plc Compositions comprising bacterial strains
US10543238B2 (en) 2016-12-12 2020-01-28 4D Pharma Plc Compositions comprising bacterial strains
US10086021B2 (en) 2016-12-12 2018-10-02 4D Pharma Plc Compositions comprising bacterial strains
WO2018189284A1 (en) 2017-04-12 2018-10-18 Eth Zurich Consortia of living bacteria useful for treatment of microbiome dysbiosis
EP3388069A1 (en) 2017-04-12 2018-10-17 ETH Zurich Consortia of living bacteria useful for treatment of microbiome dysbiosis
US11219649B2 (en) 2017-04-12 2022-01-11 Eth Zurich Consortia of living bacteria useful for treatment of microbiome dysbiosis
US11376284B2 (en) * 2017-05-22 2022-07-05 4D Pharma Research Limited Compositions comprising bacterial strains
US20220184145A1 (en) * 2017-05-22 2022-06-16 4D Pharma Research Limited Compositions comprising bacterial strains
US11382936B2 (en) 2017-05-22 2022-07-12 4D Pharma Research Limited Compositions comprising bacterial strains
US11123378B2 (en) 2017-05-22 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US10987387B2 (en) 2017-05-24 2021-04-27 4D Pharma Research Limited Compositions comprising bacterial strain
US11007233B2 (en) 2017-06-14 2021-05-18 4D Pharma Research Limited Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
US12048720B2 (en) 2017-06-14 2024-07-30 Cj Bioscience, Inc. Compositions comprising bacterial strains
US11123379B2 (en) 2017-06-14 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11660319B2 (en) 2017-06-14 2023-05-30 4D Pharma Research Limited Compositions comprising bacterial strains
US11779613B2 (en) 2017-06-14 2023-10-10 Cj Bioscience, Inc. Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
EP3664823A4 (en) * 2017-08-07 2021-05-12 Finch Therapeutics, Inc. Compositions and methods for maintaining and restoring a healthy gut barrier
WO2019032573A1 (en) 2017-08-07 2019-02-14 Finch Therapeutics, Inc. Compositions and methods for maintaining and restoring a healthy gut barrier
CN111328284A (en) * 2017-08-07 2020-06-23 芬奇治疗公司 Compositions and methods for maintaining and restoring a healthy intestinal barrier
US11865145B2 (en) 2017-08-07 2024-01-09 Finch Therapeutics Holdings Llc Compositions and methods for maintaining and restoring a healthy gut barrier
US11701394B2 (en) 2017-08-14 2023-07-18 Seres Therapeutics, Inc. Compositions and methods for treating cholestatic disease
CN111247254A (en) * 2017-10-13 2020-06-05 雷柏奥提斯有限公司 Microbiome health index
US11607433B2 (en) 2017-12-12 2023-03-21 Healthbiome Composition for preventing, improving, or treating autism spectrum disorders including Agathobaculum sp. strain as active ingredient
EP3725320A4 (en) * 2017-12-12 2021-12-15 Korea Research Institute of Bioscience and Biotechnology Composition comprising agathobaculum sp. strain as effective ingredient for prevention, alleviation, or treatment of autism spectrum disorder
US11242544B2 (en) * 2018-07-11 2022-02-08 Wisconsin Alumni Research Foundation Microbiomes and methods for producing medium-chain fatty acids from organic substrates
US20210268036A1 (en) * 2019-03-08 2021-09-02 The Regents Of The University Of California Compositions and methods for modulating lipid and steroid metabolism
WO2021097271A1 (en) * 2019-11-15 2021-05-20 Assembly Biosciences, Inc. Compositions comprising bacterial species and methods related thereto
WO2021151956A1 (en) 2020-01-28 2021-08-05 Institut National De Recherche Pour L'agriculture, L'alimentation Et L'environnement Composition for treating intestinal or pulmonary diseases
EP3858363A1 (en) 2020-01-28 2021-08-04 Institut national de recherche pour l'agriculture, l'alimentation et l'environnement Composition for treating intestinal or pulmonary diseases
WO2022027040A3 (en) * 2020-07-28 2022-03-24 Icahn School Of Medicine At Mount Sinai Compositions and methods for treating infections of the gastrointestinal tract

Also Published As

Publication number Publication date
CA2848757A1 (en) 2013-03-21
US20210283195A1 (en) 2021-09-16
EP2756071A4 (en) 2015-04-22
CA2848762C (en) 2021-07-27
US20190298782A1 (en) 2019-10-03
CA2848762A1 (en) 2013-03-21
US20170296596A1 (en) 2017-10-19
US20200237831A1 (en) 2020-07-30
EP2744890A1 (en) 2014-06-25
EP2744890A4 (en) 2015-07-08
US20140363397A1 (en) 2014-12-11
US11045505B2 (en) 2021-06-29
US20170319633A1 (en) 2017-11-09
CA2848757C (en) 2021-11-09
EP2756071B1 (en) 2017-12-20
ES2662793T3 (en) 2018-04-09
US20140342438A1 (en) 2014-11-20
WO2013037067A1 (en) 2013-03-21
US10314864B2 (en) 2019-06-11
EP2756071A1 (en) 2014-07-23

Similar Documents

Publication Publication Date Title
US20200237831A1 (en) Method for treatment of disorders of the gastrointestinal system
KR102713227B1 (en) A new use for treating Clostridium difficile infections
Gagnon et al. In vitro inhibition of Escherichia coli O157: H7 by bifidobacterial strains of human origin
de Vos Fame and future of faecal transplantations–developing next‐generation therapies with synthetic microbiomes
CA2931317C (en) Synergistic bacterial compositions and methods of production and use thereof
KR20200136365A (en) Composition containing co-selective microflora and method of using the same
AU2016361583A1 (en) Methods and compositions for reducing vancomycin-resistant
EP2953474A2 (en) Compositions and methods
EP2270133B1 (en) Method for obtaining a novel strain of bifidobacterium bifidum with activity against infection by helicobacter pylori
EP2951283A1 (en) Compositions and methods
JP2019515918A (en) Bacterial therapy
KR20150143803A (en) Composition containing bacterium belonging to genus lactobacillus
JP2011172506A (en) Bifidobacterium animalis subspecies lactis strain for probiotics and probiotic lactobacillus fermented food and other probiotic oral foods using the strain
Ghatani et al. Assessment of probiotic characteristics of lactic acid bacteria isolated from fermented yak milk products of Sikkim, India: Chhurpi, Shyow, and Khachu
Sakoui et al. The first study of probiotic properties and biological activities of lactic acid bacteria isolated from Bat guano from Er-rachidia, Morocco
Quigley et al. Lactobacillus gasseri APC 678 reduces shedding of the pathogen Clostridium difficile in a murine model
Rodriguez‐Alonso et al. Antibiotic resistance in lactic acid bacteria and Micrococcaceae/Staphylococcaceae isolates from artisanal raw milk cheeses, and potential implications on cheese making
EP3338785A1 (en) Human lactobacilli strains
Mantegazza et al. Lactic acid bacteria naturally associated with ready-to-eat rocket salad can survive the human gastrointestinal transit
Gomes et al. Comparison of antagonistic ability against enteropathogens by G+ and G− anaerobic dominant components of human fecal microbiota
KR20150143804A (en) Bacterium belonging to genus lactobacillus
Ryšávka et al. Targeted Modulation of Gut Microbiota by Personalized Probiotics.
US20230022942A1 (en) Method for analyzing ileostomy subjects using a probiotic containing bacillus subtilis
Tu et al. Characteristics of lactobacillus strains isolated from Vietnamese patients with type 2 diabetes
CA2942720A1 (en) Synthetic stool preparations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12831311

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2848762

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2012831311

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 14344981

Country of ref document: US