WO2013033073A1 - Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration - Google Patents

Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration Download PDF

Info

Publication number
WO2013033073A1
WO2013033073A1 PCT/US2012/052627 US2012052627W WO2013033073A1 WO 2013033073 A1 WO2013033073 A1 WO 2013033073A1 US 2012052627 W US2012052627 W US 2012052627W WO 2013033073 A1 WO2013033073 A1 WO 2013033073A1
Authority
WO
WIPO (PCT)
Prior art keywords
prostate cancer
pten
erg
expression
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/052627
Other languages
French (fr)
Inventor
Gary Pestano
Ray B. Nagle
Connie CORTEZ
Kristie A. Vanpatten
Amit M. ALGOTAR
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ventana Medical Systems Inc
Arizona's Public Universities
Arizona State University ASU
Original Assignee
Ventana Medical Systems Inc
Arizona's Public Universities
Arizona State University ASU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ventana Medical Systems Inc, Arizona's Public Universities, Arizona State University ASU filed Critical Ventana Medical Systems Inc
Publication of WO2013033073A1 publication Critical patent/WO2013033073A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57575Immunoassay; Biospecific binding assay; Materials therefor for cancer involving oncogenic proteins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups

Definitions

  • the disclosure provides methods for characterizing a prostate cancer sample by detecting changes in expression of ERG and/or PTEN which are shown herein to be correlated with prostate cancer capsular penetration, biochemical recurrence, and more aggressive forms of prostate cancer. Also provided are kits and arrays that can be used with such methods.
  • Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as "standard of care,” and a number of drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer.
  • the best chance for a good treatment outcome requires that patients promptly receive optimal available cancer treatment(s) and that such treatment(s) be initiated as quickly as possible following diagnosis.
  • some cancer treatments have significant adverse effects on quality of life; thus, it is equally important that cancer patients do not unnecessarily receive potentially harmful and/or ineffective treatment(s).
  • Prostate cancer provides a good case in point. In 2008, it was estimated that prostate cancer alone will account for 25% of all cancers in men and will account for 10% of all cancer deaths in men (Jemal et al., CA Cancer J. Clin. 58:71-96, 2008). Prostate cancer typically is diagnosed with a digital rectal exam ("DRE") and/or prostate specific antigen (PSA) screening. An abnormal finding on DRE and/or an elevated serum PSA level ⁇ e.g., >4 ng/ml) can indicate the presence of prostate cancer. When a PSA or a DRE test is abnormal, a transrectal ultrasound may be used to map the prostate and show any suspicious areas. Biopsies of various sectors of the prostate are used to determine if prostate cancer is present.
  • DRE digital rectal exam
  • PSA prostate specific antigen
  • Treatment options for more aggressive cancers include radical prostatectomy and/or radiation therapy.
  • Andro gen-depletion therapy such as, gonadotropin-releasing hormone agonists (e.g., leuprolide, goserelin, etc.) and/or bilateral orchiectomy) is also used, alone or in conjunction with surgery or radiation.
  • these prognostic indicators do not accurately predict clinical outcome for individual patients.
  • understanding of the molecular abnormalities that define those tumors at high risk for relapse is needed to help identify more precise molecular markers.
  • hepsin HPN
  • AMACR alpha-methylacyl-CoA racemase
  • EZH2 enhancer of Zeste homolog 2
  • FFPE formalin fixed paraffin embedded
  • increased ERG expression and decreased PTEN expression is associated with capsular penetration by prostate cancers.
  • detection of increased ERG expression and decreased PTEN expression is correlated with prostate cancer capsular penetration, and in samples from a prostate cancer that has penetrated the capsule (referred to herein as a CP prostate sample), detection of increased ERG expression and decreased PTEN expression is indicative of a more aggressive prostate cancer, such as one likely to biochemically recur.
  • expression of PTEN and ERG can be used to forecast prostate cancer outcome (e.g., biochemically recurrence or non-recurrence), for example in patients who have a prostate cancer that has penetrated the capsule.
  • increased ERG expression and decreased PTEN expression indicates an increased likelihood that the prostate cancer is more aggressive and may recur or metastasize, and thus a poor prognosis.
  • the disclosed methods are useful, for example, to screen prostate cancer patients for cancer aggressiveness, which can aid prognosis and the making of therapeutic decisions in prostate cancer.
  • patients identified as having increased ERG expression and decreased PTEN expression in their prostate cancer sample can be selected for more aggressive therapies and/or more frequent monitoring, while patients identified as not having increased ERG expression and decreased PTEN expression in their prostate cancer sample can be selected for less aggressive therapies and/or less frequent monitoring.
  • Methods and compositions including kits and arrays that include antibodies or probes that specifically bind to ERG and PTEN that embody this discovery are described.
  • Such methods can include detecting or measuring expression of ERG, PTEN, or both in a prostate cancer sample from a subject, such as a CP prostate cancer sample.
  • the expression of ERG and PTEN in the prostate cancer sample is compared to a control representing ERG and PTEN expression expected in a normal prostate sample (e.g., ERG- and PTEN+) and diagnosing or prognosing that the prostate cancer is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
  • a more aggressive prostate cancer can be one which is more likely to biochemically recur, metastasize, less likely to respond to treatment, or combinations thereof, such as an increased likelihood that the prostate cancer will biochemically recur following prostatectomy within 1, 3, or 5 years.
  • kits that include one or more means for detecting in a biological sample an ERG genomic sequence, ERG transcript ERG protein, PTEN genomic sequence, PTEN transcript or PTEN protein, or any combination of any of the foregoing, are provided.
  • FIG. 1 is a diagram showing the types of prostate tumors analyzed, those having capsular penetration (CP) and those that do not invade the prostatic capsule (NCP).
  • CP capsular penetration
  • NCP prostatic capsule
  • FIG. 2 is a digital image showing staining of prostate carcinoma with H&E (left) an ERG-specific antibody (right).
  • FIG. 3 is a digital image showing a prostate carcinoma from a case with capsule penetration and no detectable PTEN (left) and ERG-specific staining (right).
  • FIG. 4 is a digital image showing a prostate carcinoma with capsule penetration and detectable PTEN (left) and ERG-specific staining (right).
  • FIG. 5 is a digital image showing heterogeneous ERG expression in a prostate cancer that has not penetrated the capsule.
  • FIG. 6 is a digital image showing IHC results for ERG (left) and PTEN (right) expression in a prostate cancer sample.
  • FIG. 7 is a graph showing that ERG+ and PTEN- prostate cancers are very highly aggressive, as indicated by early biochemical recurrence.
  • FIG. 8 is a schematic drawing showing the quantum dot FISH detection platform used to detect ERG and PTEN genomic DNA.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. All sequence database accession numbers referenced herein are understood to refer to the version of the sequence identified by that accession number as it was available on the filing date of this application. In the accompanying sequence listing:
  • SEQ ID NOS: 1 and 2 are a human Ets related gene (ERG) nucleic acid coding sequence and corresponding protein sequence.
  • SEQ ID NOS: 3 and 4 are a human phosphatase and tensin homolog (PTEN) nucleic acid coding sequence and corresponding protein sequence.
  • SEQ ID NOS: 5 and 6 are primers that can be used to amplify ERG.
  • SEQ ID NOS: 7 and 8 are primers that can be used to amplify ERG.
  • SEQ ID NOS: 9 and 10 are primers that can be used to amplify PTEN.
  • Amplification of a nucleic acid molecule refers to methods used to increase the number of copies of a nucleic acid molecule, such as an ERG or PTEN nucleic acid molecule.
  • the resulting products can be referred to as amplicons or amplification products.
  • Methods of amplifying nucleic acid molecules are known in the art, and include MDA, PCR (such as RT-PCR and qRT-PCR), DOP-PCR, RCA, T7/Primase-dependent amplification, SDA, 3SR, NASBA, and LAMP, among others.
  • Antibody A polypeptide ligand including at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope of an antigen, such as an endothelial marker or a fragment thereof.
  • Antibodies are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (V H ) region and the variable light (V L ) region. Together, the V H region and the V L region are responsible for binding the antigen recognized by the antibody. In one example, an antibody specifically binds to an antibody.
  • ERG or PTEN protein but not other proteins (such as other proteins found in human prostate tissue or that are associated with prostate cancer such as pro state- specific antigen, PSA).
  • an ERG or PTEN protein such as a monoclonal or polyclonal antibody specific for ERG or PTEN, such as a labeled monoclonal or polyclonal antibody.
  • a scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains.
  • the term also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3 rd Ed., W.H. Freeman & Co., New York, 1997.
  • a naturally occurring immunoglobulin has heavy (H) chains and light (L) chains interconnected by disulfide bonds.
  • H heavy chain
  • L light chain
  • lambda
  • k kappa
  • IgM immunoglobulin heavy chain classes
  • Each heavy and light chain contains a constant region and a variable region, (the regions are also known as “domains”).
  • the heavy and the light chain variable regions specifically bind the antigen.
  • Light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called “complementarity-determining regions” or "CDRs". The extent of the framework region and CDRs have been defined (see, Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human
  • the Kabat database is now maintained online.
  • the sequences of the framework regions of different light or heavy chains are relatively conserved within a species.
  • the framework region of an antibody that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs in three-dimensional space.
  • the CDRs are primarily responsible for binding to an epitope of an antigen.
  • the CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located.
  • a V H CDR3 is located in the variable domain of the heavy chain of the antibody in which it is found
  • a V L CDRl is the CDR1 from the variable domain of the light chain of the antibody in which it is found.
  • an antibody that binds ERG or PTEN will have a specific V H region and the V L region sequence, and thus specific CDR sequences.
  • Antibodies with different specificities i.e.
  • immunoglobulin heavy chain including that of an Fv, scFv, dsFv or Fab.
  • V L refers to the variable region of an immunoglobulin light chain, including that of an Fv, scFv, dsFv or Fab.
  • a "monoclonal antibody” is an antibody produced by a single clone of
  • Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a fusion of myeloma cells with immune spleen cells. Monoclonal antibodies include humanized monoclonal antibodies.
  • polyclonal antibody is an antibody that is derived from different B-cell lines.
  • Polyclonal antibodies are a mixture of immunoglobulin molecules secreted against a specific antigen, each recognizing a different epitope. These antibodies are produced by methods known to those of skill in the art, for instance, by injection of an antigen into a suitable mammal (such as a mouse, rabbit or goat) that induces the B-lymphocytes to produce IgG immunoglobulins specific for the antigen which are then purified from the mammal's serum.
  • a suitable mammal such as a mouse, rabbit or goat
  • a “chimeric antibody” has framework residues from one species, such as human, and CDRs (which generally confer antigen binding) from another species, such as a murine antibody that specifically binds an endothelial marker.
  • a "humanized” immunoglobulin is an immunoglobulin including a human framework region and one or more CDRs from a non-human (for example a mouse, rat, or synthetic) immunoglobulin.
  • the non-human immunoglobulin providing the CDRs is termed a "donor,” and the human immunoglobulin providing the framework is termed an "acceptor.” In one embodiment, all the CDRs are from the donor immunoglobulin in a humanized immunoglobulin.
  • Constant regions need not be present, but if they are, they are substantially identical to human immunoglobulin constant regions, e.g., at least about 85-90%, such as about 95% or more identical. Hence, all parts of a humanized immunoglobulin, except possibly the CDRs, are substantially identical to corresponding parts of natural human immunoglobulin sequences.
  • Humanized immunoglobulins can be constructed by means of genetic engineering (see for example, U.S. Patent No. 5,585,089).
  • Binding affinity Affinity of one molecule for another, such as an antibody for an antigen (for example, an ERG or PTEN protein).
  • affinity is calculated by a modification of the Scatchard method described by Frankel et al., Mol. Immunol., 16: 101-106, 1979.
  • binding affinity is measured by an antigen/antibody dissociation rate.
  • a high binding affinity is measured by a competition radioimmunoassay.
  • a high binding affinity is at least about 1 x 10 - " 8 M.
  • a high binding affinity is at least about 1.5 x 10 - " 8 , at least about 2.0 x 10 - “ 8 , at least about 2.5 x 10 - “ 8 , at least about 3.0 x 10 "8 , at least about 3.5 x 10 "8 , at least about 4.0 x 10 "8 , at least about 4.5 x 10 "8 , or at least about 5.0 x 10 "8 M.
  • prostate cancer refers to when prostate cancer extends into and in some examples through the prostatic capsule.
  • Malignant neoplasm for example one that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis.
  • a nucleic acid molecule is said to be "complementary" with another nucleic acid molecule if the two molecules share a sufficient number of complementary nucleotides to form a stable duplex or triplex when the strands bind (hybridize) to each other, for example by forming Watson-Crick, Hoogsteen or reverse Hoogsteen base pairs. Stable binding occurs when a nucleic acid molecule (e.g., nucleic acid probe or primer) remains detectably bound to a target nucleic acid sequence (e.g., ERG or PTEN target nucleic acid sequence) under the required conditions.
  • a nucleic acid molecule e.g., nucleic acid probe or primer
  • a target nucleic acid sequence e.g., ERG or PTEN target nucleic acid sequence
  • Complementarity is the degree to which bases in one nucleic acid molecule (e.g., nucleic acid probe or primer) base pair with the bases in a second nucleic acid molecule (e.g., target nucleic acid sequence, such as ERG or PTEN).
  • nucleic acid molecule e.g., nucleic acid probe or primer
  • target nucleic acid sequence such as ERG or PTEN
  • Complementarity is conveniently described by percentage, that is, the proportion of nucleotides that form base pairs between two molecules or within a specific region or domain of two molecules. For example, if 10 nucleotides of a 15 contiguous nucleotide region of a nucleic acid probe or primer form base pairs with a target nucleic acid molecule, that region of the probe or primer is said to have 66.67% complementarity to the target nucleic acid molecule.
  • sufficient complementarity means that a sufficient number of base pairs exist between one nucleic acid molecule or region thereof (such as a region of a probe or primer) and a target nucleic acid sequence (e.g., a ERG or PTEN nucleic acid sequence) to achieve detectable binding.
  • a target nucleic acid sequence e.g., a ERG or PTEN nucleic acid sequence
  • an antibody or other specific binding agent
  • a microscope slide or other surface containing a biological sample thereby permitting detection of proteins (or protein-protein interactions or protein-nucleic acid interactions) in the sample that are specific for the antibody.
  • a oligonucleotide probe or primer or other nucleic acid binding agent
  • nucleic acid molecules obtained from a biological sample and in some examples under conditions that permit amplification of the nucleic acid molecule, thereby permitting detection of nucleic acid molecules (or nucleic acid-nucleic acid interactions) in the sample that have sufficient complementarity to the probe or primer.
  • Control A sample or standard used for comparison with a test sample, such as a biological sample, e.g. , a biological sample obtained from a patient (or plurality of patients) or a cell culture.
  • a biological sample e.g. , a biological sample obtained from a patient (or plurality of patients) or a cell culture.
  • the control is a sample obtained from a healthy patient (or plurality of patients) (also referred to herein as a "normal" control), such as a normal sample (e.g. , one that does not have prostate cancer, such as a normal prostate sample).
  • the control is a historical control or standard value (i.e., a previously tested control sample or group of samples that represent baseline or normal values).
  • the control is a standard value representing the average value (or average range of values) obtained from a plurality of patient samples.
  • the control is ERG expression in endothelial cells and/or PTEN expression in a normal prostate gland.
  • a control can also be represented by a reference value or range of values representing an amount of activity or expression determined to be representative of a given condition.
  • Reference values can include a range of values, real or relative expected to occur under certain conditions. These values can be compared with experimental values to determine if a given molecule is up-regulated or down- regulated in a particular sample for instance.
  • a reference value or range of values represents an amount of activity or expression of ERG and/or PTEN proteins and/or nucleic acids in a sample, such as a sample from a subject without prostate cancer (such as a healthy male prostate sample), or non-cancerous tissue adjacent to the prostate cancer in from the same or other patients.
  • This value can then be used to determine if the subject from whom a test sample was obtained has a more aggressive form of prostate cancer by comparing this reference value of expression to the level of expression detected in the test sample.
  • a decrease in PTEN and an increase in ERG expression or activity in a test sample as compared to a reference value for an ERG-/PTEN+ prostate sample indicates that the subject has a more aggressive prostate cancer.
  • Detect To determine if an agent (e.g., a nucleic acid molecule or protein) or interaction (e.g., binding between two proteins, between a protein and a nucleic acid, or between two nucleic acid molecules) is present or absent in a sample, for example by making measurements from a sample.
  • this can further include quantification.
  • an emission signal from a label is detected.
  • Detection can be in bulk, so that a macroscopic number of molecules can be observed simultaneously.
  • Detection can also include identification of signals from single molecules using microscopy and such techniques as total internal reflection to reduce background noise.
  • an antibody specific for a particular protein permits detection of the of the protein or protein-protein interaction in a sample, such as a sample containing prostate cancer tissue.
  • a probe or primer specific for a particular gene permits detection of the desired nucleic acid molecule in a sample, such as a sample containing prostate cancer tissue.
  • Diagnose The process of identifying a medical condition or disease, for example from the results of one or more diagnostic procedures.
  • the disclosed methods allow for diagnosis of a prostate cancer that has penetrated the prostatic capsule if elevated ERG and decreased PTEN is detected (as compared to expected levels of ERG and PTEN in a normal sample).
  • a nucleic acid sequence is differentially expressed when the amount of one or more of its expression products (e.g., transcript (e.g., mRNA) and/or protein) is higher or lower in one tissue (or cell) type as compared to another tissue (or cell) type.
  • Detecting differential expression can include measuring a change in gene or protein expression, such as a change in ERG and
  • a gene, e.g., ERG, the transcript or protein of which is more highly expressed in a more aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule and less expressed in a less aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule is differentially expressed.
  • a gene, e.g., PTEN, the transcript or protein of which is less expressed (or even not expressed) in a more aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule and more greatly expressed in a less aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule is differentially expressed.
  • Downregulated or inactivation When used in reference to the expression of a nucleic acid molecule (such as PTEN), such as a gene, refers to any process which results in a decrease or elimination in production of a gene product, such as a PTEN protein.
  • a gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, downregulation or deactivation includes processes that decrease or even eliminate transcription of a gene or translation of mRNA.
  • Examples of processes that decrease transcription include those that facilitate degradation of a transcription initiation complex, those that decrease transcription initiation rate, those that decrease transcription elongation rate, those that decrease processivity of transcription and those that increase transcriptional repression.
  • Gene downregulation can include reduction of expression above an existing level.
  • Examples of processes that decrease translation include those that decrease translational initiation, those that decrease translational elongation and those that decrease mRNA stability.
  • Downregulation includes any detectable decrease in the production of a gene product.
  • production of a gene product decreases by at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold (or even not detectable) as compared to a control (such an amount of protein or nucleic acid expression detected in a normal prostate cell).
  • a control such an amount of protein or nucleic acid expression detected in a normal prostate cell.
  • a control is a relative amount of gene expression or protein expression in a prostate sample from a subject (or population of subjects) who does not have prostate cancer.
  • Gene expression The process by which the coded information of a gene is converted into an operational, non-operational, or structural part of a cell, such as the synthesis of a protein.
  • Gene expression can be influenced by external signals (such as a hormone).
  • Expression of a gene also can be regulated anywhere in the pathway from DNA to RNA to protein. Regulation can include controls on transcription, translation, RNA transport and processing, degradation of
  • intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization or degradation of specific protein molecules after they are produced.
  • an ERG or PTEN nucleic acid molecule or protein can be altered relative to a normal (wild type) nucleic acid molecule or protein (such as in a patient not having prostate cancer or has a prostate cancer that has not penetrated the capsule).
  • Alterations in gene expression, such as differential expression include but are not limited to: (1) overexpression (e.g. , upregulation); (2) underexpression (e.g., downregulation); or (3) suppression of expression.
  • Alternations in the expression of a nucleic acid molecule can be associated with, and in fact cause, a change in expression of the corresponding protein.
  • Protein expression can also be altered in some manner to be different from the expression of the protein in a normal (wild type) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more of the amino acid residues is different; (2) a short deletion or addition of one or a few (such as no more than 10-20) amino acid residues to the sequence of the protein; (3) a longer deletion or addition of amino acid residues (such as at least 20 residues), such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount of the protein compared to a control or standard amount (e.g., upregulation); (5) expression of a decreased amount of the protein compared to a control or standard amount (e.g., downregulation); (6) alteration of the subcellular localization or targeting of the protein; (7) alteration of the temporally regulated expression of the protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); (8) alteration in stability of a protein through increased longevity
  • Controls or standards for comparison to a sample, for the determination of differential expression include samples believed to be normal (in that they are not altered for the desired characteristic, for example a sample from a subject who does not have prostate cancer) as well as laboratory values, even though possibly arbitrarily set, keeping in mind that such values can vary from laboratory to laboratory.
  • Laboratory standards and values may be set based on a known or determined population value and can be supplied in the format of a graph or table that permits comparison of measured, experimentally determined values.
  • a nucleic acid e.g., genomic DNA, cDNA, or RNA
  • RNA e.g., mRNA
  • the polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment is/are retained.
  • the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the full-length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' untranslated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' untranslated sequences.
  • the gene as present in (or isolated from) a genome contains the coding regions ("exons") interrupted with non-coding sequences termed "introns." Introns are absent in the processed RNA (e.g., mRNA) transcript.
  • Label An agent capable of detection, for example by spectrophotometry, flow cytometry, or microscopy.
  • one or more labels can be attached to an antibody, thereby permitting detection of a target protein (such as ERG or PTEN).
  • a target protein such as ERG or PTEN
  • one or more labels can be attached to a nucleic acid molecule, thereby permitting detection of a target nucleic acid molecule (such as ERG or PTEN DNA or RNA).
  • Exemplary labels include radioactive isotopes, fluorophores, chromophores, ligands, chemiluminescent agents, enzymes, and combinations thereof.
  • Normal cells or tissue Non-tumor, non-malignant cells and tissue.
  • Prognose The process of determining the likely outcome of a subject having a disease (e.g., prostate cancer) in the absence of additional therapy.
  • the disclosed methods allow for prognosis of future events, such as the likely biochemical recurrence of prostate cancer after prostatectomy (e.g., likelihood of biochemical recurrence in 1 year, 3 years or 5 years) after prostatectomy, and/or predicting the likely metastasis of a prostate cancer (e.g., after prostatectomy).
  • Specific binding (or derivations of such phrase, such as specifically binds, specific for, etc.): The particular interaction between one binding partner (such as a gene-specific probe or protein- specific antibody) and another binding partner (such as a target of a gene-specific probe or protein- specific antibody). Such interaction is mediated by one or, typically, more non-covalent bonds between the binding partners (or, often, between a specific region or portion of each binding partner). In contrast to non-specific binding sites, specific binding sites are saturable. Accordingly, one exemplary way to characterize specific binding is by a specific binding curve. A specific binding curve shows, for example, the amount of one binding partner (the first binding partner) bound to a fixed amount of the other binding partner as a function of the first binding partner concentration.
  • Subject Includes any multi-cellular vertebrate organism, such as human and non-human mammals (e.g., veterinary subjects).
  • a subject is one who has cancer, or is suspected of having cancer, such as prostate cancer, such as a prostate cancer with capsular penetration.
  • Upregulated or activation When used in reference to the expression of a molecule, such as a gene or protein, refers to any process which results in an increase in production of a gene product.
  • a gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, upregulation or activation includes processes that increase the presence of ERG proteins or nucleic acids, for example fusions between ERG and TMPRSS resulting in TMPRSS/ERG rearrangements.
  • Examples of processes that increase transcription include those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (for example by blocking the binding of a transcriptional repressor). Upregulation can include inhibition of repression as well as stimulation of expression above an existing level. Examples of processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability.
  • Upregulation includes any detectable increase in the production of a gene product, such as an ERG protein.
  • detectable ERG protein or nucleic acid expression in an aggressive prostate cancer that has penetrated the capsule increases by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to a control (such an amount of detectable ERG protein or nucleic acid in a normal sample).
  • a control is a relative amount of expression in a normal sample.
  • ERG and decreased or even eliminated expression of PTEN are predictive of increased risk of capsular penetration in prostate cancers, more aggressive prostate cancer, increased likelihood of biochemical recurrence, and poor prognosis.
  • decreased or even eliminated expression of PTEN relative to such expression in normal prostate tissues (e.g., an ERG-/PTEN+ prostate sample) are predictive of increased likelihood of prostate cancer biochemical recurrence following
  • the method is diagnostic, in that it determines that a prostate cancer has penetrated the prostatic capsule.
  • the method is prognostic, in that it predicts the likelihood that the prostate cancer will penetrate the prostatic capsule.
  • the method is prognostic, in that it predicts whether the prostate cancer is likely to or biochemically recur (for example after prostatectomy).
  • Biochemical recurrence is any detectable prostate specific antigen (PSA) after prostatectomy or a PSA rise after a period of PSA detection absence (see Simmons et al. , Eur. Urol. 51: 1175-84, 2007). After prostatectomy, PSA levels typically decrease to an undetectable level after about four weeks. In some examples, BCR is indicated by PSA levels >0.2 ng/ml, such as >0.4 ng/ml or >0.2 to 0.6 ng/ml, such as two successive PDS levels >0.2 ng/ml or >0.4 ng/ml, following prostatectomy. BCR is indicative of the presence of prostatic epithelial tissue, and is assumed to represent cancer.
  • the sample can be a fixed, wax-embedded prostate cancer tissue sample, such as a fixed, wax-embedded prostate cancer tissue sample, which has or has not penetrated the capsule.
  • the prostate cancer sample is collected after prostate cancer diagnosis and after prostatectomy in the subject, or can be collected during a prostatectomy.
  • the prostate cancer sample is a prostate cancer that has penetrated the prostatic capsule.
  • the sample is obtained during a prostate tissue biopsy of a tumor suspected or known to be cancerous or suspected or known to have penetrated the capsule.
  • the method includes detecting or measuring expression of ERG, PTEN, or both in a prostate cancer sample from a subject (for example determining ERG and PTEN expression levels qualitatively or
  • ERG and PTEN can be detected at the genomic level, or gene expression products can be detected, such as ERG and PTEN nucleic acids (e.g., mRNA, cDNA) or proteins.
  • determining the expression level incudes detecting alteration(s) in the genomic sequence(s) of ERG or PTEN, such as detecting a TMPRSS-ERG rearrangement or PTEN deletion.
  • the method can include detecting amplification of at least one ERG allele, fusion of at least one ERG allele, deletion of at least one PTEN allele, or
  • the ERG or PTEN expression, or both, in the test prostate cancer sample are compared to ERG and PTEN expression in a control, such as a control that represents ERG and PTEN expression expected in a normal prostate sample (which are ERG- and PTEN+) or normal endothelial cells.
  • a control such as a control that represents ERG and PTEN expression expected in a normal prostate sample (which are ERG- and PTEN+) or normal endothelial cells.
  • the prostate cancer is characterized, such as diagnosed or prognosed.
  • the method can include one or more of obtaining the prostate cancer sample (e.g., a sample from a prostate cancer that has penetrated the capsule); fixing the sample; and contacting the sample with ERG and PTEN specific binding agents (e.g., nucleic acid probes or antibodies).
  • the method can include determining that there is a higher likelihood that the prostate cancer will penetrate the prostatic capsule in the future when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control.
  • the method can include determining or diagnosing that the prostate cancer has penetrated the prostatic capsule when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control.
  • the method can diagnose that the prostate cancer that has penetrated the prostatic capsule is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
  • the method can prognose an increased likelihood that the prostate cancer that has penetrated the prostatic capsule is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control. In another example, the method can prognose an increased likelihood that the prostate cancer will biochemically recur when decreased expression of PTEN (in some examples in combination with increased expression of ERG) is detected in the prostate cancer sample relative to the control.
  • determining that there is a higher or greater likelihood that the prostate cancer will penetrate the prostatic capsule in the future when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control indicates that the prostate cancer is about 3 times to about 5 times more likely (such as about 4 times to about 5 times, about 4.5 times to about 5 times, or about 3, 4, 4.5, 4.8, 4.9, or 5 times, more likely) to penetrate the prostatic capsule, than a prostate cancer sample that does not have increased expression of ERG and decreased expression of PTEN relative to the control.
  • a prognosis that the cancer is more aggressive indicates that the prostate cancer is predicted to biochemically recur within 1 year, within 3 years or within 5 years of a prostatectomy. In one example, a prognosis that the cancer is more aggressive indicates that the prostate cancer is predicted to metastasize within 1 year, within 3 years or within 5 years of a prostatectomy. For example, a prognosis that the cancer is more likely to biochemically recur or metastasize can be relative to a prostate cancer sample that does not have increased expression of ERG and decreased expression of PTEN relative to the control (e.g., an ERG-/PTEN+ prostate sample).
  • a prognosis that the cancer is less aggressive indicates that the prostate cancer is predicted to not biochemically recur within 1 year, within 3 years or within 5 years of a prostatectomy.
  • a diagnosis or prognosis that the cancer is less aggressive indicates that the prostate cancer is not predicted to metastasize within 1 year, within 3 years or within 5 years of a prostatectomy.
  • the method can further include detecting or measuring expression of one or more other prostate cancer related molecules in the sample and comparing expression of the one or more other prostate cancer related molecules in the prostate cancer sample to a control representing expression of the one or more other prostate cancer related molecules expected in a normal prostate sample.
  • Prostate cancer related molecules include those whose expression is known to be altered (such as increased or decreased) in a prostate cancer sample, relative to a normal prostate cancer sample.
  • Examples include but are not limited to: growth arrest- specific 1 (GAS1; OMIM 139185), wingless-type MMTV integration site family member 5 (WNT5A; OMIM 164975), thymidine kinase 1 (7X7; OMIM 188300), V-raf murine sarcoma viral oncogene homolog Bl (BRAF; OMIM 164757), ETS translocation variant 4 (ETV4; OMIM 600711), tumor protein p63 (OMIM 603273), BCL-2 (OMIM 151430), Ki67 (OMIM 176741), ERK5 (OMIM 602521), prostate specific antigen (PSA; OMIM 176820), ETS translocation variant 1 (ETVl; OMIM 600541), measures of nuclear morphology (including nuclear size and shape variation characteristics), or combinations thereof.
  • GAS1 growth arrest- specific 1
  • WNT5A wingless-type MMTV integration site family member 5
  • WNT5A OM
  • the method can further include detecting expression of one or more control molecules in the sample and comparing expression of the one or more control molecules in the prostate cancer sample to a control representing expression of the one or more control molecules expected in a normal prostate sample.
  • expression of ERG and/or PTEN is normalized to expression of one or more internal controls, such as ERG expression in endothelial cells or PTEN expression in a normal gland.
  • This disclosure identifies ERG and PTEN are differentially expressed in prostate cancer that has penetrated the capsule and more aggressive prostate cancers that have penetrated the capsule.
  • PTEN is down- regulated in prostate cancer that is more likely to biochemically recur following prostatectomy.
  • a more-aggressive prostate cancer can be indicated by recurrence of after treatment (e.g., prostatectomy), a worse prognosis for the patient (e.g., decreased survival time), an increased likelihood of disease progression (e.g., metastasis), failure (or inadequacy) of treatment, and/or a need for alternative (or additional) treatments.
  • the present discoveries have enabled, among other things, a variety of methods for characterizing prostate cancer tissues, diagnosis or prognosis of prostate cancer patients, predicting treatment outcome in prostate cancer patients, and directing (e.g., selecting useful) treatment modalities for prostate cancer patients (such as a patient with a prostate cancer that has penetrated the capsule).
  • the disclosed methods can be used to identify those subjects that will benefit from a more or less aggressive therapy. For example, if a patient is diagnosed or prognosed with an aggressive form of prostate cancer, the patient can be selected for more aggressive treatment and frequent monitoring. In in contrast, if a patient is diagnosed or prognosed with a less aggressive form of prostate cancer, the patient can be selected for less aggressive treatment and less frequent monitoring. Thus in some examples, the disclosed methods further include selecting a patient for more or less aggressive treatment or monitoring, depending on the ERG and PTEN expression detected. For example, such diagnostic or prognostic methods can be performed prior to the subject undergoing the treatment.
  • the methods of the present disclosure are valuable tools for practicing physicians to make quick treatment decisions regarding how to treat prostate cancer, such as prostate cancer that has penetrated the capsule.
  • These treatment decisions can include the administration of an agent for treating prostate cancer and decisions to monitor a subject for recurrence or metastasis of a prostate cancer that has penetrated the capsule.
  • the disclosed methods further include treating the subject with prostate cancer, for example administering one or more therapeutic agents for treating prostate cancer, such as chemotherapeutics (e.g., temozolomide or docetaxel) or hormone therapy, treating the patient with radiation therapy (e.g. , prostate brachytherapy), performing a prostatectomy, or combinations thereof.
  • chemotherapeutics e.g., temozolomide or docetaxel
  • hormone therapy e.g., prostate brachytherapy
  • Disclosed methods can be performed using biological samples obtained from a subject having prostate cancer, such as a prostate cancer that has or has not invaded the prostatic capsule.
  • a typical subject is a human male; however, any mammal that has a prostate that may develop prostate cancer can serve as a source of a biological sample useful in a disclosed method.
  • Exemplary biological samples useful in a disclosed method include tissue samples (such as prostate biopsies and/or prostatectomy tissues) or prostate cell samples (such as can be collected by prostate massage, in the urine, or in fine needle aspirates).
  • the sample is a prostate cancer sample that has penetrated the capsular region. Samples may be fresh or processed post-collection (e.g., for archiving purposes).
  • processed samples may be fixed (e.g., formalin-fixed) and/or wax- (e.g., paraffin-) embedded.
  • Fixatives for mounted cell and tissue preparations are well known in the art and include, without limitation, 95% alcoholic Bouin's fixative; 95% alcohol fixative; B5 fixative, Bouin's fixative, formalin fixative, Karnovsky' s fixative (glutaraldehyde), Hartman' s fixative, Hollande's fixative, Orth' s solution
  • embodiments involve FFPE prostate cancer tissue samples.
  • the sample (or a fraction thereof) is present on a solid support.
  • Solid supports useful in a disclosed method need only bear the biological sample and, optionally, but advantageously, permit the convenient detection of components (e.g., proteins and/or nucleic acid sequences) in the sample.
  • Exemplary supports include microscope slides (e.g., glass microscope slides or plastic microscope slides), coverslips (e.g., glass coverslips or plastic coverslips), tissue culture dishes, multi-well plates, membranes (e.g., nitrocellulose or polyvinylidene fluoride (PVDF)) or BIACORETM chips.
  • PVDF polyvinylidene fluoride
  • Exemplary methods involve determining in a prostate tissue sample from a subject the expression level of ERG and PTEN.
  • the expression level of additional nucleic acids or proteins are determined, for example one or more other prostate cancer related markers, such as growth arrest-specific 1 (GAS 1 ;
  • OMEVI 139185 wingless-type MMTV integration site family member 5 (WNT5A; OMIM 164975), thymidine kinase 1 (7X7; OMIM 188300), V-raf murine sarcoma viral oncogene homolog B l (BRAF; OMIM 164757), ETS translocation variant 4 (ETV4; OMIM 600711), tumor protein p63 (OMIM 603273), BCL-2 (OMIM 151430), Ki67 (OMIM 176741), ERK5 (OMIM 602521), prostate specific antigen (PSA; OMIM 176820), ETV1 (OMIM 600541), measures of nuclear morphology (including nuclear size and shape variation characteristics) or combinations thereof.
  • the expression level of one or more control genes can also be determined.
  • expression of ERG is increased and expression of PTEN is decreased as compared to a standard value or a control sample.
  • the expression of another gene e.g., WNT5A, TK1 or PSA
  • the relative increased expression of ERG and the relative decreased expression of PTEN indicates, for example, a higher likelihood of prostate cancer progression in the subject (e.g., a higher likelihood that the prostate cancer will invade the capsule in the subject), an increased likelihood that the prostate cancer will biochemically recur after surgery (e.g., prostatectomy), an increased likelihood that the prostate cancer will metastasize after surgery (e.g.,
  • prostatectomy will fail, and an increased need for a non-surgical or alternate treatment for the prostate cancer.
  • the expression of one or more genes of interest is measured relative to a standard value or a control sample.
  • a standard values can include, without limitation, the average expression of the one or more genes of interest in a normal prostate or endothelial cells (e.g., calculated in an analogous manner to the expression value of the genes in the prostate cancer sample), the average expression of the one or more genes of interest in a prostate sample obtained from a patient or patient population in which it is known that prostate cancer did not invade the capsule, the average expression of the one or more genes of interest in a prostate sample obtained from a region adjacent to the prostate cancer (e.g., normal prostate tissue adjacent to the cancer tissue); or the average expression of the one or more genes of interest in a prostate sample obtained from a patient or patient population in which it is known that prostate cancer did invade the capsule.
  • a control sample can include, for example, normal prostate tissue or cells, prostate tissue or cells collected from a patient or patient population in which it is known that prostate cancer did not invade the capsule, prostate tissue or cells collected from a patient or patient population in which it is known that prostate cancer did invade the capsule, normal endothelial cells and/or endothelial cells collected from a patient or patient population in which it is known that prostate cancer did or did not invade the capsule.
  • expression of the gene(s) of interest is (are) measured in test (i.e., prostate cancer patient sample) and control samples relative to a value obtained for a control gene (e.g. , one or more of GAPDH (glyceraldehyde 3- phosphate dehydrogenase), SDHA (succinate dehydrogenase), HPRT1
  • ERG and/or PTEN is normalized to expression of one or more internal controls, such as ERG expression in endothelial cells or PTEN expression in a normal gland.
  • An increase or decrease in gene expression may mean, for example, that the expression of a particular gene expression product (e.g., transcript (e.g., mRNA) or protein) in the test sample is at least about 20%, at least about 25%, at least about 30%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, or at least about 200% higher or lower, respectively, of the applicable control (e.g., standard value or control sample).
  • a particular gene expression product e.g., transcript (e.g., mRNA) or protein
  • relative expression i.e., increase or decrease
  • a particular gene expression product e.g., transcript (e.g., mRNA) or protein
  • the expression of a particular gene expression product e.g., transcript (e.g., mRNA) or protein
  • the expression of a particular gene expression product in the test sample may be at least about 2-fold, at least about 3-fold, at least about 4- fold, at least about 5-fold, at least about 8-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, at least about 100-fold, or at least about 200-fold times higher or lower, respectively, of the applicable control (e.g., standard value or control sample).
  • the applicable control e.g., standard value or control sample
  • scoring of protein expression may be semi-quantitative; for example, with protein expression levels recorded as 0, 1, 2, or 3 (including, in some instances plus (or minus) values at each level, e.g., 1+, 2+, 3+) with 0 being substantially no detectable protein expression and 3 (or 3+) being the highest detected protein expression.
  • an increase or decrease in the expression is measured as a difference in the score as compared the applicable control (e.g., standard value or control sample); that is, a score of 3+ in a test sample as compared to a score of 0 for the control represents increased expression in the test sample, and a score of 0 in a test sample as compared to a score of 3+ for the control represents decreased expression in the test sample.
  • applicable control e.g., standard value or control sample
  • Biochemical recurrence means the patient's PSA value has increased prostate after prostatectomy or a PSA rise after a period of PSA detection absence (for example after an initial (or subsequent) treatment(s), such as radiation treatment, chemotherapy, anti-hormone treatment and/or surgery).
  • PSA levels in the blood decrease to a stable and low level and, in some instances, eventually become almost undetectable.
  • recurrence of the prostate cancer is marked by rising PSA levels (e.g., at least 0.2 ng/ml, at least 0.4 ng/ml, at least 0.6 ng/ml, at least 1 ng/ml, or at least 2 ng/ml, or at least 5 ng/ml) and/or by identification of prostate cancer cells in the blood, prostate biopsy or aspirate, in lymph nodes (e.g., in the pelvis or elsewhere) or at a metastatic site (e.g., muscles that help control urination, the rectum, the wall of the pelvis, in bones or other organs).
  • PSA levels e.g., at least 0.2 ng/ml, at least 0.4 ng/ml, at least 0.6 ng/ml, at least 1 ng/ml, or at least 2 ng/ml, or at least 5 ng/ml
  • identification of prostate cancer cells in the blood, prostate biopsy or aspirate in lymph nodes (e.g.
  • Prostate cancer progression means that one or more indices of prostate cancer (e.g., serum PSA levels) show that the disease is advancing independent of treatment.
  • prostate cancer progression is marked by rising PSA levels (e.g., greater than 0.2 ng/mL) and/or by identification of (or increasing numbers of) prostate cancer cells in the blood, prostate biopsy or aspirate, in lymph nodes (e.g., in the pelvis or elsewhere) or at a metastatic site (e.g., muscles that help control urination, the rectum, the wall of the pelvis, in bones or other organs).
  • An increased likelihood of prostate cancer progression or prostate cancer recurrence can be quantified by any known metric.
  • an increased likelihood can mean at least a 10% chance of occurring (such as at least a 25% chance, at least a 50% chance, at least a 60% chance, at least a 75% chance or even greater than an 80% chance of occurring).
  • Some method embodiments are useful for prostate cancer prognosis, such as prostate cancers that have penetrated the capsule.
  • Prognosis is the likely outcome of the disease (typically independent of treatment).
  • the PTEN expression in some examples in combination with ERG expression
  • an increased likelihood of biochemical recurrence an increased likelihood of biochemical recurrence within 1 year, within 2 years, within 3 year, within 4 years, or within 5 years after prostatectomy (for example as compared to a patient with a prostate cancer that is ERG+/PTEN+ or ERG-/PTEN+).
  • gene signature is a surrogate for the aggressiveness of the cancer with recurring cancers being more aggressive.
  • a poor (or poorer) prognosis is likely for a subject with a more aggressive cancer (such as having an increased likelihood of metastasis or biochemical recurrence).
  • Still other method embodiments predict treatment outcome in prostate cancer patients, and are useful for directing (e.g., selecting useful) treatment modalities for prostate cancer patients, such as prostate cancers that have penetrated the capsule.
  • expression of ERG and PTEN can be used to predict that prostate cancer treatment (e.g., prostatectomy) is likely to fail (e.g., the disease will recur).
  • the disclosed gene signature(s) can be used by caregivers to counsel prostate cancer patients as to the likely success of treatment (e.g., prostatectomy).
  • the patient and the caregiver can make better informed decisions of whether or not to treat (e.g., perform surgery, such as prostatectomy) and/or whether or not to provide alternate treatment (such as, external beam radiotherapy, brachytherapy, chemotherapy, or watchful waiting).
  • whether or not to treat e.g., perform surgery, such as prostatectomy
  • alternate treatment such as, external beam radiotherapy, brachytherapy, chemotherapy, or watchful waiting.
  • Expression levels may be determined or detected using any technique known in the art. Exemplary techniques include, for example, methods based on
  • polynucleotides e.g., genomic nucleic acid sequences and/or transcripts (e.g., mRNA)
  • methods based on sequencing of polynucleotides methods based on detecting proteins (e.g., immunohistochemistry and
  • expression is measured or determined using a suitably programmed computer or instrumentation (for example using the BenchMark (e.g., BenchMark ULTRA) and/or iScan Coreo Au slide scanner from Ventana).
  • a suitably programmed computer or instrumentation for example using the BenchMark (e.g., BenchMark ULTRA) and/or iScan Coreo Au slide scanner from Ventana).
  • expression of PTEN and ERG in the test sample is compared to a control using a suitably programmed computer (for example, PTEN and ERG expression values determined the test sample can be compared to a control value of PTEN and ERG expression expected in a normal prostate sample using a computer).
  • gene expression levels may be affected by alterations in the genome (e.g., gene amplification, gene deletion, gene fusion, or other chromosomal rearrangements or chromosome duplications (e.g., polysomy) or loss of one or more chromosomes). Accordingly, in some embodiments, gene expression levels may be inferred or determined by detecting such genomic alterations. Genomic sequences harboring genes of interest may be quantified, for example, by in situ hybridization of gene-specific genomic probes to chromosomes in a metaphase spread or as present in a cell nucleus. The making of gene- specific genomic probes is well known in the art (see, e.g., U.S. Pat. Nos.
  • quantification of gene amplifications or deletions may be facilitated by comparing the number of binding sites for a gene-specific genomic probe to a control genomic probe (e.g., a genomic probe specific for the centromere of the chromosome upon which the gene of interest is located).
  • gene amplification or deletion may be determined by the ratio of the gene-specific genomic probe to a control (e.g., centromeric) probe. For example, a ratio greater than two (such as greater than three, greater than four, greater than five or ten or greater) indicates amplification of the gene (or the chromosomal region) to which the gene-specific probe binds.
  • a ratio less than one indicates deletion of the gene (or the chromosomal region) to which the gene-specific probe binds.
  • Gene expression levels also can be determined by quantification of gene transcript (e.g., mRNA).
  • gene transcript e.g., mRNA
  • Commonly used methods known in the art for the quantification of mRNA expression in a sample include, without limitation, northern blotting and in situ hybridization (e.g., Parker and Barnes, Meth. Mol. Biol., 106:247-283, 1999)); RNAse protection assays (e.g., Hod, Biotechniques,
  • PCR-based methods such as reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics, 8:263-264, 1992) and real time quantitative PCR, also referred to as qRT-PCR).
  • RT-PCR reverse transcription polymerase chain reaction
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes, or DNA-protein duplexes.
  • Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).
  • RNA e.g., total RNA
  • a target sample such as prostate cancer tissue sample.
  • RNA e.g., total RNA
  • General methods for RNA (e.g., total RNA) isolation are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin-embedded tissues are disclosed in Examples herein and, for example, by Rupp and Locker (Lab. Invest., 56:A67, 1987) and DeAndres et al. (BioTechniques, 18:42044, 1995).
  • RNA isolation can be performed using a purification kit, buffer set and protease obtained from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions.
  • Other commercially available RNA isolation kits include MASTERPURETM Complete DNA and RNA Purification Kit
  • cDNA obtained from reverse transcription of total RNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard.
  • a synthetic DNA molecule competitiveor
  • cDNA/competitor mixture is amplified by standard PCR and is subjected to a post-PCR shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the dephosphorylation of the remaining nucleotides.
  • SAP post-PCR shrimp alkaline phosphatase
  • the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derived PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with components needed for analysis with matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry analysis.
  • MALDI-TOF matrix-assisted laser desorption ionization time-of-flight
  • the cDNA present in the reaction is then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g., Ding and Cantor, Proc. Natl. Acad. Sci. USA, 100:3059-3064, 2003.
  • RNA expression includes, for example, differential display (Liang and Pardee, Science, 257:967-971, 1992)); amplified fragment length polymorphism (Kawamoto et al., Genome Res.,
  • Differential gene expression also can be determined using microarray techniques.
  • specific binding partners such as probes (including cDNAs or oligonucleotides) specific for RNAs of interest or antibodies specific for proteins of interest are plated, or arrayed, on a microchip substrate.
  • the microarray is contacted with a sample containing one or more targets ⁇ e.g., mRNA or protein) for one or more of the specific binding partners on the microarray.
  • the arrayed specific binding partners form specific detectable interactions ⁇ e.g., hybridized or specifically bind to) their cognate targets in the sample of interest.
  • Serial analysis of gene expression is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript.
  • SAGE Serial analysis of gene expression
  • a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously.
  • the expression pattern of any population of transcripts can be quantified by determining the abundance of individual tags, and identifying the gene corresponding to each tag (see, e.g., Velculescu et al., Science, 270:484-487, 1995, and Velculescu et al., Cell,
  • MPSS massively parallel signature sequencing
  • differential gene expression is determined using in situ hybridization techniques, such as fluorescence in situ hybridization (FISH) or chromogen in situ hybridization (CISH).
  • FISH fluorescence in situ hybridization
  • CISH chromogen in situ hybridization
  • specific binding partners such as probes labeled with a flouorphore or chromogen specific for a target gene, cDNA or mRNA (e.g. , a ERG or PTEN gene) is contacted with a sample, such as a prostate cancer sample mounted on a substrate (e.g. , glass slide).
  • the specific binding partners form specific detectable interactions (e.g., hybridized to) their cognate targets in the sample.
  • hybridization between the probes and the target nucleic acid can be detected, for example by detecting a label associated with the probe.
  • microscopy such as fluorescence microscopy, is used.
  • Immunohistochemistry is one exemplary technique useful for detecting protein expression products in the disclosed methods.
  • Antibodies e.g., monoclonal and/or polyclonal antibodies
  • specific for each protein are used to detect expression.
  • the antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horseradish peroxidase or alkaline
  • unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody.
  • IHC protocols and kits are well known in the art and are commercially available.
  • proteomics is defined as the totality of the proteins present in a sample (e.g., tissue, organism, or cell culture) at a certain point of time.
  • proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics").
  • An exemplary proteomics assay involves (i) separation of individual proteins in a sample, e.g., by 2-D gel electrophoresis; (ii) identification of the individual proteins recovered from the gel, e.g., by mass spectrometry or N-terminal sequencing, and (iii) analysis of the data.
  • the assay results, findings, diagnoses, predictions and/or treatment recommendations are typically recorded and communicated to technicians, physicians and/or patients, for example.
  • computers will be used to communicate such information to interested parties, such as, patients and/or the attending physicians.
  • the therapy administered to a subject can be modified.
  • a recommendation based on the expression level in a test subject of ERG or PTEN is communicated to interested parties as soon as possible after the assay is completed and the diagnosis and/or prediction is generated.
  • the results and/or related information may be communicated to the subject by the subject's treating physician.
  • the results may be communicated directly to interested parties by any means of communication, including writing, such as by providing a written report, electronic forms of communication, such as email, or telephone. Communication may be facilitated by use of a suitably programmed computer, such as in case of email communications.
  • the communication containing results of a diagnostic test and/or conclusions drawn from and/or treatment recommendations based on the test may be generated and delivered automatically to interested parties using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications.
  • a healthcare-oriented test may be generated and delivered automatically to interested parties using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications.
  • all or some of the method steps including the assaying of samples, diagnosing or prognosis of prostate cancer, and communicating of assay results or diagnoses or prognosis, may be carried out in diverse (e.g., foreign) jurisdictions.
  • the human Ets related gene (also known as erg-3 and p55) is located on chromosome 21 (21q22.3) and is a member of the ETS family of transcription factors.
  • ERG sequences are publically available, for example from GenBank® (e.g., accession numbers NP_001129626 and NP_598420.1 (proteins) and NM_133659.2, NM_001136154.1, and NM_001838708.2 (nucleic acids)).
  • ERG protein (see, e.g., SEQ ID NO: 2) is a transcriptional regulator that binds purine-rich sequences. Fusion of the ERG gene with other genes has been shown to be associated with different cancers. For example, the t(16;21)(pl l;q22) translocation of the ERG gene fused with the fused in sarcoma (FUS) gene is associated with human myeloid leukemia. EWS-ERG fusions are associated with the Ewing family of tumors. ERG fusion with the 5' untranslated region of transmembrane protease, serine 2 (TMPRSS2) (located on human chromosome 21) are associated with prostate cancer.
  • TMPRSS2 transmembrane protease
  • the TMPRS22 and ERG genes are arranged tandemly on chromosome 21q22.
  • the TMPRSS2/ERG fusion joins TMPRSS2 exons 1 or 2 usually to ERG exons 2, 3 or 4, which results in activation of the ERG transcription factor.
  • TMPRSS/ERG rearrangements occur in about 50% of prostate cancers and 20% of high-grade prostatic intraepithelial neoplasia (HGPIN) lesions, resulting in upregulation of ERG.
  • HGPIN prostatic intraepithelial neoplasia
  • TMPRSS/ERG rearrangement results in a PIN like lesion which can be converted to an invasive state by up-regulation of the PI3K pathway.
  • PTEN Phosphatase and tensin homolos
  • the human PTEN gene is located on chromosome 10 and the mouse PTEN gene is located on chromosome 19.
  • PTEN sequences are publically available, for example from GenBank® (e.g., accession numbers NP_000305.3, AAD13528.1, EAW50174.1, EAW50173.1, EAW50172.1, AAH05821.1 and NP_032986.1 (proteins) and NM_000314.4 and NM_008960.2 (nucleic acids)).
  • PTEN also referred to as MMAC (mutated in multiple advanced cancers) phosphatase
  • MMAC mutated in multiple advanced cancers
  • the PTEN protein e.g., SEQ ID NO: 4
  • SEQ ID NO: 4 is a phosphatidylinositol-3,4,5- trisphosphate 3-phosphatase, which includes a tensin-like domain as well as a catalytic domain.
  • PTEN preferentially dephosphorylates phosphoinositide substrates.
  • PTEN negatively regulates intracellular levels of phosphatidylinositol-3, 4, 5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating Akt/PKB signaling pathway. Mutations and deletions of PTEN have been shown to be associated with cancers.
  • variants of such sequences may be present in a particular subject.
  • polymorphisms for a particular gene or protein may be present.
  • a sequence may vary between different organisms.
  • a variant sequence retains the biological activity of its corresponding native sequence.
  • a ERG or PTEN sequence present in a particular subject may can have conservative amino acid changes (such as, very highly conserved substitutions, highly conserved substitutions or conserved substitutions), such as 1 to 5 or 1 to 10 conservative amino acid substitutions. Exemplary conservative amino acid substitutions are shown in Table 1.
  • an ERG or PTEN sequence is a sequence variant of a native ERG or PTEN sequence, respectively, such as a nucleic acid or protein sequence that has at least 99%, at least 98%, at least 95%, at least 92%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, or at least 60% sequence identity to the sequences set forth in SEQ ID NOS: 1-4 (or such amount of sequence identity to a GenBank® accession number referred to herein) wherein the resulting variant retains ERG or PTEN biological activity.
  • Sequence identity is a phrase commonly used to describe the similarity between two amino acid sequences (or between two nucleic acid sequences). Sequence identity typically is expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences.
  • NCBI National Center for Biotechnology Information
  • BLASTTM Altschul et al., J. Mol. Biol., 215:403-410, 1990
  • NCBI National Center for Biotechnology Information
  • tblastn tblastn
  • tblastx tblastx
  • the disclosed methods can be used in combination with one or more other assays that are used to diagnose or prognose prostate cancer outcomes.
  • a prostate cancer patient's Gleason scores based on a histopathological review, PSA scores, and nomograms can be used in combination with the disclosed methods to allow for enhanced diagnostic and prognostic capabilities of prostate cancer, such as those that have penetrated the capsule.
  • the disclosed methods further include measuring the patient' s PSA level, determining the patient's nomogram, or both.
  • prostate cancer nomograms can be used to predict the probability that a patient's cancer will recur (for example after radical
  • prostatectomy that is, the probability at one, two, five, seven and 10 years that the patient's serum PSA level will become detectable and begin to rise steadily.
  • Nomograms include information on one or more of the patient's pre-treatment PSA, age, Gleason grade (primary, secondary and sum), year of prostatectomy, months free of cancer, whether or not the surgical margins were positive, whether or not there was extra capsular extension (penetration); whether or not there was seminal vesicle involvement, whether or not there was lymph node involvement, whether or not the patient receive neoadjuvant hormones, and whether whether or not the patient receive radiation therapy before the radical prostatectomy.
  • the patient's ERG and PTEN expression levels can be incorporated into currently available nomograms to further increase the accuracy of such predictions.
  • the disclosed methods can further include selecting subjects for treatment for prostate cancer, for example if the sample is diagnosed as having an aggressive prostate cancer (EGR+/PTEN-). Alternatively, the disclosed methods can further include selecting subjects for no treatment, if the sample is diagnosed as a non- aggressive prostate cancer (e.g., EGR-/PTEN+).
  • the disclosed methods include one or more of the following depending on the patient' s diagnosis or prognosis: a) prescribing a treatment regimen for the subject if the subject's determined diagnosis/prognosis is having an aggressive prostate cancer (such as treatment with one or more radiotherapies and/or chemotherapeutic agents, additional surgery, or combinations thereof); b) not prescribing a treatment regimen for the subject if the subject' s determined diagnosis/prognosis is a non-aggressive prostate cancer; c) administering a treatment (such as treatment with one or more radiotherapies and/or
  • the method can include recommending one or more of (a)-(d).
  • the disclosed methods can further include treating a subject for prostate cancer.
  • genes (ERG and PTEN) the expression of which characterizes prostate cancer that has penetrated the capsule in subjects afflicted with the disease. Accordingly, compositions that facilitate the detection of such genes in biological samples are now enabled.
  • kits useful for facilitating the practice of a disclosed method are also contemplated.
  • a kit is provided for detecting PTEN and ERG nucleic acid or protein molecules, for example in combination with one to ten ⁇ e.g., 1, 2, 3, 4, or 5) control genes or proteins ⁇ e.g., ⁇ -actin, GAPDH, SDHA, HPRT1, HBS1L, AHSP or combinations thereof).
  • kits are provided for detecting only PTEN and ERG nucleic acid or protein molecules.
  • the detection means can include means for detecting a genomic alteration involving the gene and/or a gene expression product, such as an mRNA or protein.
  • means for detecting a least ERG and PTEN are packaged in separate containers or vials.
  • means for detecting one or more ERG and PTEN genes or proteins are present on an array (discussed below).
  • kits can include at least one means for detection of ERG and PTEN genes or gene products (for example in combination with other prostate cancer related genes/proteins or control genes/proteins) such as, at least two, at least three, at least four, or at least five detection means), such as means that permit detection of at least ERG and PTEN.
  • kits can further include at least one means for detection of one or more ⁇ e.g., one to three) control genes or proteins.
  • Detection means can include, without limitation, a nucleic acid probe specific for a genomic sequence including a disclosed gene, a nucleic acid probe specific for a transcript (e.g., mRNA) encoded by a disclosed gene, a pair of primers for specific amplification of a disclose gene (e.g., genomic sequence or cDNA sequence of such gene), an antibody or antibody fragment specific for a protein encoded by a disclosed gene.
  • a nucleic acid probe specific for a genomic sequence including a disclosed gene e.g., mRNA
  • a pair of primers for specific amplification of a disclose gene e.g., genomic sequence or cDNA sequence of such gene
  • an antibody or antibody fragment specific for a protein encoded by a disclosed gene e.g., an antibody or antibody fragment specific for a protein encoded by a disclosed gene.
  • a kit can include means for detecting in a biological sample an ERG genomic sequence, ERG transcript or ERG protein, and means for detecting in a biological sample a PTEN genomic sequence, PTEN transcript or PTEN protein, or any combination thereof.
  • the kit can include a means for detecting in a biological sample an ERG transcript or protein and a means for detecting in a biological sample a PTEN transcript or protein, such as a nucleic acid probe specific for an ERG transcript and a nucleic acid probe specific for a PTEN transcript, such as a pair of primers for specific amplification of an ERG transcript and a pair of primers for specific amplification of a PTEN transcript, or such as an antibody specific for ERG protein and an antibody specific for a PTEN protein.
  • kits embodiments can include, for instance, one or more (such as two, three, or four) detection means selected from a nucleic acid probe specific for an ERG transcript, a nucleic acid probe specific for a PTEN transcript, a pair of primers for specific amplification of an ERG transcript, a pair of primers for specific amplification of a PTEN transcript, an antibody specific for an ERG protein, and an antibody specific for a PTEN protein.
  • Particular kit embodiments can further include, for instance, one or more (such as two or three) detection means selected from a nucleic acid probe specific for a control transcript, a pair of primers for specific amplification of control transcript, and an antibody specific for control protein.
  • kits can further include, for instance, one or more (such as two or three) detection means selected from a nucleic acid probe specific for a prostate cancer related transcript, a pair of primers for specific amplification of prostate cancer related transcript, and an antibody specific for prostate cancer related protein.
  • Exemplary prostate cancer related genes/proteins include GAS 1 ; WNT5A; TK1 ; BRAF; ETV4; tumor protein p63; BCL-2; Ki67; ERK5; and PSA.
  • the primary detection means e.g., nucleic acid probe, nucleic acid primer, or antibody
  • the primary detection means can be directly labeled, e.g., with a fluorophore, chromophore, or enzyme capable of producing a detectable product (such as alkaline phosphates, horseradish peroxidase and others commonly know in the art).
  • kit embodiments will include secondary detection means; such as secondary antibodies (e.g., goat anti-rabbit antibodies, rabbit anti-mouse antibodies, anti-hapten antibodies) or non-antibody hapten-binding molecules (e.g., avidin or streptavidin).
  • secondary antibodies e.g., goat anti-rabbit antibodies, rabbit anti-mouse antibodies, anti-hapten antibodies
  • non-antibody hapten-binding molecules e.g., avidin or streptavidin.
  • the secondary detection means will be directly labeled with a detectable moiety.
  • the secondary (or higher order) antibody will be conjugated to a hapten (such as biotin, DNP, and/or FITC), which is detectable by a detectably labeled cognate hapten binding molecule (e.g., streptavidin (SA) horseradish peroxidase, SA alkaline phosphatase, and/or SA QDot ® NanocrystalsTM).
  • hapten such as biotin, DNP, and/or FITC
  • SA streptavidin
  • SA horseradish peroxidase
  • SA alkaline phosphatase SA QDot ® NanocrystalsTM
  • kits embodiments may include colorimetric reagents (e.g. , DAB, and/or AEC) in suitable containers to be used in concert with primary or secondary (or higher order) detection means (e.g., antibodies) that are labeled with enzymes for the development of such colorimetric reagents.
  • a kit includes positive or negative control samples, such as a cell line or tissue known to express or not express PTEN or ERG.
  • control samples are FFPE.
  • Exemplary samples include but are not limited to normal (e.g. , non cancerous) cells or tissues, breast cancer cell lines or tissues, prostate cancer samples from subject known not to have capsular penetration, and prostate cancer samples from subject known to have capsular penetration.
  • a kit includes instructional materials disclosing, for example, means of use of a nucleic acid probe or antibody that specifically binds a PTEN or ERG (e.g., mRNA or protein), or means of use for a particular primer or probe.
  • the instructional materials may be written, in an electronic form (e.g., computer diskette or compact disk) or may be visual (e.g., video files).
  • the kits may also include additional components to facilitate the particular application for which the kit is designed.
  • the kit can include buffers and other reagents routinely used for the practice of a particular disclosed method. Such kits and appropriate contents are well known to those of skill in the art.
  • kit embodiments can include a carrier means, such as a box, a bag, a satchel, plastic carton (such as molded plastic or other clear packaging), wrapper (such as, a sealed or sealable plastic, paper, or metallic wrapper), or other container.
  • a carrier means such as a box, a bag, a satchel, plastic carton (such as molded plastic or other clear packaging), wrapper (such as, a sealed or sealable plastic, paper, or metallic wrapper), or other container.
  • kit components will be enclosed in a single packaging unit, such as a box or other container, which packaging unit may have compartments into which one or more components of the kit can be placed.
  • a kit includes a one or more containers, for instance vials, tubes, and the like that can retain, for example, one or more biological samples to be tested.
  • kit embodiments include, for instance, syringes, cotton swabs, or latex gloves, which may be useful for handling, collecting and/or processing a biological sample. Kits may also optionally contain implements useful for moving a biological sample from one location to another, including, for example, droppers, syringes, and the like. Still other kit embodiments may include disposal means for discarding used or no longer needed items (such as subject samples, etc.). Such disposal means can include, without limitation, containers that are capable of containing leakage from discarded materials, such as plastic, metal or other impermeable bags, boxes or containers.
  • Microarrays for the detection of genes ⁇ e.g., genomic sequence and corresponding transcripts) and proteins are well known in the art.
  • Microarrays include a solid surface ⁇ e.g., glass slide) upon which many ⁇ e.g., hundreds or even thousands) of specific binding agents ⁇ e.g., cDNA probes, mRNA probes, or antibodies) are immobilized.
  • the specific binding agents are distinctly located in an addressable ⁇ e.g., grid) format on the array.
  • the number of addressable locations on the array can vary, for example from at least two, to at least 10, at least 20, at least 30, at least 33, at least 40, at least 50, at least 75, at least 100, at least 150, at least 200, at least 300, at least 500, least 550, at least 600, at least 800, at least 1000, at least 10,000, or more.
  • the array is contacted with a biological sample believed to contain targets (e.g., mRNA, cDNA, or protein, as applicable) for the arrayed specific binding agents.
  • targets e.g., mRNA, cDNA, or protein, as applicable
  • the specific binding agents interact with their cognate targets present in the sample.
  • the pattern of binding of targets among all immobilized agents provides a profile of gene expression.
  • various scanners and software programs can be used to profile the patterns of genes that are "turned on” (e.g., bound to an immobilized specific binding agent).
  • Representative microarrays are described, e.g., in U.S. Pat.
  • arrays whether protein or nucleic acid arrays, for the detection at least ERG and PTEN.
  • Particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products and one or more control products (e.g., mRNA, cDNA or protein). More particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products (e.g., mRNA, cDNA or protein) and one or more prostate cancer related products (e.g., mRNA, cDNA or protein). More particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products, one or more control products, and one or more prostate cancer related products (e.g., mRNA, cDNA or protein). More particular array
  • embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products (e.g., mRNA, cDNA or protein),
  • the array includes nucleic acid probes that can hybridize to at least ERG and PTEN nucleic acids (such as genes).
  • an array further includes probes that can specifically hybridize to other prostate marker nucleic acids, such as one or more of GAS 1 ; WNT5A; TK1 ; BRAF; ETV4; tumor protein p63; BCL-2; Ki67; ERK5; and PSA.
  • Certain of such arrays can further include oligonucleotides specific for control genes (e.g., one or more of GAPDH, SDHA, HPRT1, HBS 1L, ⁇ -actin, and AHSP).
  • a set of oligonucleotide probes is attached to the surface of a solid support for use in detection of ERG and PTEN, such as detection of nucleic acid sequences (such as genomic DNA, cDNA or mRNA) obtained from the subject (e.g., from a prostate cancer sample).
  • nucleic acid sequences such as genomic DNA, cDNA or mRNA
  • an internal control nucleic acid sequence such as a nucleic acid sequence obtained from a subject who has not had prostate cancer or a control gene nucleic acid sequence
  • a nucleic acid probe can be included to detect the presence of this control nucleic acid molecule.
  • the oligonucleotide probes bound to the array can specifically bind sequences obtained from the subject (such as a sample containing nucleic acids or nucleic acids isolated from the sample), or amplified from the subject, such as under high stringency conditions.
  • Agents of use with the method include oligonucleotide probes that recognize ERG (including fusions of ERG, such as TMPRSS/ERG rearrangements). Such sequences can be determined by examining the known gene sequences, and choosing probe sequences that specifically hybridize to ERG or TMPRSS/ERG rearrangements, but not other gene sequences.
  • oligonucleotide probes form base-paired duplexes with nucleic acid molecules that have a complementary base sequence.
  • the stability of the duplex is dependent on a number of factors, including the length of the oligonucleotide probe, the base composition, and the composition of the solution in which hybridization is effected.
  • the effects of base composition on duplex stability can be reduced by carrying out the hybridization in particular solutions, for example in the presence of high concentrations of tertiary or quaternary amines.
  • the thermal stability of the duplex is also dependent on the degree of sequence similarity between the sequences.
  • each oligonucleotide probe employed in the array can be selected to optimize binding of target sequences. An optimum length for use with a particular gene sequence under specific screening conditions can be determined empirically. Thus, the length for each individual element of the set of
  • oligonucleotide sequences included in the array can be optimized for screening.
  • oligonucleotide probes are at least 12 nucleotides (nt) in length, for example at least 20 nt, at least 50 nt, at least 100 nt, at least 1000 nt, at least 10,000 nt, or at least 100,000 nt, such as from about 20 to about 35 nt in length, about 25 to about 40 nt in length, about 25 to about 100 nt in length, about 1000 to about 6000 nt in length, about 10,000 to about 50,000 nt in length, about 10,000 to about
  • the oligonucleotide probe sequences forming the array can be directly linked to the support.
  • the oligonucleotide probes can be attached to the support by oligonucleotides (that do not non-specifically hybridize to the target gene sequences) or other molecules that serve as spacers or linkers to the solid support, b. Protein arrays
  • an array includes protein sequences (or a fragment of such proteins, or antibodies specific to such proteins or protein fragments), which specifically bind to ERG and PTEN, for example protein binding agents that can specifically bind to ERG and PTEN.
  • an array includes protein binding agents that can recognize additional prostate cancer biomarkers, such as one or more of GAS1; WNT5A; TK1; BRAF; ETV4; ETV1; tumor protein p63; BCL-2; Ki67; ERK5; and PSA.
  • Certain of such arrays can further include protein binding agents specific for control proteins (e.g., one or more of GAPDH, SDHA, HPRT1, HBS1L, ⁇ -actin, and AHSP).
  • the proteins or antibodies forming the array can be directly linked to the support. Alternatively, the proteins or antibodies can be attached to the support by spacers or linkers to the solid support. Changes in protein expression can be detected using, for instance, a protein-specific binding agent, which in some instances is labeled. In certain examples, detecting a change in protein expression includes contacting a protein sample obtained from a prostate cancer sample of a subject with a protein-specific binding agent (which can be for example present on an array); and detecting whether the binding agent is bound by the sample and thereby measuring the levels of the target protein present in the sample.
  • a protein-specific binding agent which can be for example present on an array
  • a increase in the level of ERG and a decrease in the level of PTEN in the test sample, relative to the level of the same protein found an analogous control sample e.g., from a subject who does not have prostate cancer, or a non-cancerous prostate sample from the same patient which is adjacent to the prostate cancer
  • an analogous control sample e.g., from a subject who does not have prostate cancer, or a non-cancerous prostate sample from the same patient which is adjacent to the prostate cancer
  • the array solid support can be formed from an organic polymer.
  • Suitable materials for the solid support include, but are not limited to: polypropylene, polyethylene, polybutylene, polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene difluroide,
  • polyfluoroethylene-propylene polyethylenevinyl alcohol, polymethylpentene, polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially oriented polypropylene, etyleneacrylic acid, thylene methacrylic acid, and blends of copolymers thereof (e.g., U.S. Patent No. 5,985,567).
  • suitable characteristics of the material that can be used to form the solid support surface include: being amenable to surface activation such that upon activation, the surface of the support is capable of covalently attaching a biomolecule such as an oligonucleotide or antibody thereto; amenability to "in situ" synthesis of biomolecules; being chemically inert such that at the areas on the support not occupied by the oligonucleotides or antibodies are not amenable to nonspecific binding, or when non-specific binding occurs, such materials can be readily removed from the surface without removing the oligonucleotides or antibodies.
  • the solid support surface is polypropylene.
  • Polypropylene is chemically inert and hydrophobic. Non-specific binding is generally avoidable, and detection sensitivity is improved.
  • Polypropylene has good chemical resistance to a variety of organic acids (such as formic acid), organic agents (such as acetone or ethanol), bases (such as sodium hydroxide), salts (such as sodium chloride), oxidizing agents (such as peracetic acid), and mineral acids (such as hydrochloric acid).
  • Polypropylene also provides a low fluorescence background, which minimizes background interference and increases the sensitivity of the signal of interest.
  • a surface activated organic polymer is used as the solid support surface.
  • a surface activated organic polymer is a
  • polypropylene material aminated via radio frequency plasma discharge Such materials are easily utilized for the attachment of nucleic acid molecules.
  • the amine groups on the activated organic polymers are reactive with nucleotide molecules such that the nucleotide molecules can be bound to the polymers.
  • Other reactive groups can also be used, such as carboxylated, hydroxylated, thiolated, or active ester groups.
  • a wide variety of array formats can be employed in accordance with the present disclosure.
  • One example includes a linear array of oligonucleotide bands, generally referred to in the art as a dipstick.
  • Another suitable format includes a two- dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64 array).
  • other array formats including, but not limited to slot (rectangular) and circular arrays are equally suitable for use ⁇ e.g., U.S. Patent No. 5,981,185).
  • the array is formed on a polymer medium, which is a thread, membrane or film.
  • An example of an organic polymer medium is a polypropylene sheet having a thickness on the order of about 1 mil.
  • BOPP biaxially oriented polypropylene
  • a "format” includes any format to which the solid support can be affixed, such as microtiter plates, test tubes, inorganic sheets, dipsticks, and the like.
  • the solid support is a polypropylene thread
  • one or more polypropylene threads can be affixed to a plastic dipstick-type device
  • polypropylene membranes can be affixed to glass slides.
  • the particular format is, in and of itself, unimportant.
  • the solid support can be affixed thereto without affecting the functional behavior of the solid support or any biopolymer absorbed thereon, and that the format (such as the dipstick or slide) is stable to any materials into which the device is introduced (such as clinical samples and hybridization solutions).
  • the arrays of the present disclosure can be prepared by a variety of approaches.
  • oligonucleotide or protein sequences are synthesized separately and then attached to a solid support (e.g. , see U.S. Patent No. 6,013,789).
  • sequences are synthesized directly onto the support to provide the desired array (e.g. , see U.S. Patent No. 5,554,501).
  • Suitable methods for covalently coupling oligonucleotides and proteins to a solid support and for directly synthesizing the oligonucleotides or proteins onto the support are known to those working in the field; a summary of suitable methods can be found in Matson et ah, Anal. Biochem. 217:306- 10, 1994.
  • the oligonucleotides are synthesized onto the support using conventional chemical techniques for preparing oligonucleotides on solid supports (e.g. , see PCT applications WO 85/01051 and WO 89/10977, or U.S. Patent No. 5,554,501).
  • a suitable array can be produced using automated means to synthesize oligonucleotides in the cells of the array by laying down the precursors for the four bases in a predetermined pattern.
  • a multiple-channel automated chemical delivery system is employed to create oligonucleotide probe populations in parallel rows (corresponding in number to the number of channels in the delivery system) across the substrate.
  • the substrate can then be rotated by 90° to permit synthesis to proceed within a second (2°) set of rows that are now perpendicular to the first set. This process creates a multiple-channel array whose intersection generates a plurality of discrete cells.
  • Oligonucleotide probes can be bound to the support by either the 3' end of the oligonucleotide or by the 5' end of the oligonucleotide. In one example, the oligonucleotides are bound to the solid support by the 3' end. However, one of skill in the art can determine whether the use of the 3' end or the 5' end of the
  • oligonucleotide is suitable for bonding to the solid support.
  • the internal complementarity of an oligonucleotide probe in the region of the 3' end and the 5' end determines binding to the support.
  • the oligonucleotide probes on the array include one or more labels, that permit detection of
  • oligonucleotide probe target sequence hybridization complexes.
  • the means used to detect ERG or PTEN is a protein specific binding agent, such as an antibody or fragment thereof.
  • a protein specific binding agent such as an antibody or fragment thereof.
  • antibodies or aptamers specific for ERG or PTEN e.g., SEQ ID NO: 2, or 4, respectively
  • SEQ ID NO: 2, or 4 can be obtained from a commercially available source or prepared using techniques common in the art.
  • specific binding agents can also be used in the prognostic methods provided herein.
  • Specific binding reagents include, for example, antibodies or functional fragments or recombinant derivatives thereof, aptamers, mirror-image aptamers, or engineered nonimmunoglobulin binding proteins based on any one or more of the following scaffolds: fibronectin (e.g., ADNECTINSTM or monobodies), CTLA-4 (e.g., EVIBODIESTM), tendamistat (e.g., McConnell and Hoess, J. Mol. Biol, 250:460-470, 1995), neocarzinostatin (e.g., Heyd et al, Biochem., 42:5674-83,
  • fibronectin e.g., ADNECTINSTM or monobodies
  • CTLA-4 e.g., EVIBODIESTM
  • tendamistat e.g., McConnell and Hoess, J. Mol. Biol, 250:460-470, 1995
  • neocarzinostatin e.g
  • CBM4-2 e.g., Cicortas-Gunnarsson et al., Protein Eng. Des. Sel., 17:213-21,
  • lipocalins e.g., ANTIC ALINSTM; Schlehuber and Skerra, Drug Discov. Today, 10:23-33, 2005
  • T-cell receptors e.g., Chlewicki et al., J. Mol. Biol.
  • protein A domain e.g., AFFIBODIESTM; Engfeldt et al., ChemBioChem, 6: 1043-1050, 2005
  • Im9 e.g., Bernath et al., J. Mol. Biol., 345: 1015-26, 2005
  • ankyrin repeat proteins e.g., DARPins; Amstutz et al., J. Biol. Chem., 280:24715-22, 2005
  • tetratricopeptide repeat proteins e.g., Cortajarena et al., Protein Eng. Des.
  • WW domains ⁇ e.g., Dalby et al, Protein Sci., 9:2366-76, 2000
  • SH3 domains ⁇ e.g., Hiipakka et al, J. Mol. Biol, 293:1097-106, 1999
  • SH2 domains (Malabarba et al, Oncogene, 20:5186-5194, 2001)
  • PDZ domains ⁇ e.g., TELOBODIESTM; Schneider et al, Nat.
  • BPTI bovine pancreatic try
  • Specific binding reagents also include antibodies.
  • antibody refers to an immunoglobulin molecule (or combinations thereof) that specifically binds to, or is immunologically reactive with, a particular antigen, and includes polyclonal, monoclonal, genetically engineered and otherwise modified forms of antibodies, including but not limited to chimeric antibodies, humanized antibodies, heteroconjugate antibodies ⁇ e.g., bispecific antibodies, diabodies, triabodies, and tetrabodies), single chain Fv antibodies (scFv), polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide, and antigen binding fragments of antibodies.
  • scFv single chain Fv antibodies
  • Antibody fragments include proteolytic antibody fragments [such as F(ab')2 fragments, Fab' fragments, Fab'-SH fragments, Fab fragments, Fv, and rlgG], recombinant antibody fragments (such as sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, diabodies, and triabodies), complementarity determining region (CDR) fragments, camelid antibodies (see, for example, U.S. Patent Nos. 6,015,695;
  • a Fab fragment is a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab') 2 fragment is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; an Fd fragment consists of the VH and CHI domains; an Fv fragment consists of the VL and VH domains of a single arm of an antibody; and a dAb fragment consists of a VH domain (see, e.g., Ward et al., Nature 341:544-546, 1989).
  • a single-chain antibody is an antibody in which a VL and VH region are paired to form a monovalent molecule via a synthetic linker that enables them to be made as a single protein chain (see, e.g., Bird et al., Science, 242: 423-426, 1988; Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883, 1988).
  • Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see, e.g., Holliger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448, 1993; Poljak et al., Structure, 2: 1121-1123, 1994).
  • a chimeric antibody is an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. An antibody may have one or more binding sites.
  • binding sites may be identical to one another or may be different.
  • a naturally occurring immunoglobulin has two identical binding sites
  • a single-chain antibody or Fab fragment has one binding site
  • a "bispecific” or “bifunctional” antibody has two different binding sites.
  • an antibody specifically binds to ERG or PTEN with a binding constant that is at least 10 3 M "1 greater, 10 4 M “1 greater or 10 5 M "1 greater than a binding constant for other molecules in a sample.
  • a specific binding reagent such as an antibody (e.g., monoclonal antibody) or fragments thereof) has an equilibrium constant (K ⁇ j) of 1 nM or less.
  • a specific binding agent may bind to a target protein with a binding affinity of at least about 0.1 x 10 ⁇ 8 M, at least about 0.3 x 10 ⁇ 8 M, at least about 0.5 x 10 "8 M, at least about 0.75 x 10 M, at least about 1.0 x 10 M, at least about 1.3 x 10 M at least about 1.5 x 10 - " 8 M, or at least about 2.0 x 10 - " 8 M.
  • Kd values can, for example, be determined by competitive ELISA (enzyme-linked immunosorbent assay) or using a surface-plasmon resonance device such as the Biacore T100, which is available from Biacore, Inc., Piscataway, NJ.
  • antibodies such as monoclonal or polyclonal antibodies
  • peptide fragments of ERG or PTEN e.g., fragments of SEQ ID NO: 2 or 4, respectively
  • carrier molecules or nucleic acids encoding such epitopes or conjugated RDPs
  • Serum isolated from immunized animals may be isolated for the polyclonal antibodies contained therein, or spleens from immunized animals may be used for the production of hybridomas and monoclonal antibodies. In some examples, antibodies are purified before use.
  • monoclonal antibody to ERG or PTEN can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature, 256:495, 1975) or derivative methods thereof. Briefly, a mouse (such as Balb/c) is repetitively inoculated with a few micrograms of the selected peptide fragment (e.g., epitope of ERG or PTEN) or carrier conjugate thereof over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated.
  • the selected peptide fragment e.g., epitope of ERG or PTEN
  • the spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media).
  • HAT media aminopterin
  • the successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued.
  • Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol., 70:419, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use.
  • ERG and PTEN are commercial sources of antibodies.
  • a specific ERG antibody is the Ventana/Epitomics Clone EPR 3864 and a specific PTEN antibody is the anti-PTEN rabbit monoclonal antibody (Cell Signaling Technology Clone 138G6; catalog # 9559).
  • Disclosed specific binding agents also include aptamers.
  • an aptamer is a single-stranded nucleic acid molecule (such as, DNA or RNA) that assumes a specific, sequence-dependent shape and binds to a target protein (e.g., ERG or PTEN) with high affinity and specificity.
  • Aptamers generally comprise fewer than 100 nucleotides, fewer than 75 nucleotides, or fewer than 50 nucleotides (such as 10 to 95 nucleotides, 25 to 80 nucleotides, 30 to 75 nucleotides, or 25 to 50 nucleotides).
  • mirror-image aptamers are high-affinity L-enantiomeric nucleic acids (for example, L-ribose or L-2'- deoxyribose units) that display high resistance to enzymatic degradation compared with D-oligonucleotides (such as, aptamers).
  • the target binding properties of aptamers and mirror-image aptamers are designed by an in vitro- selection process starting from a random pool of oligonucleotides, as described for example, in Wlotzka et al, Proc. Natl. Acad. Sci. 99(13):8898-8902, 2002.
  • an aptamer is a peptide aptamer that binds to a target protein (e.g., ERG or PTEN) with high affinity and specificity.
  • Peptide aptamers include a peptide loop (e.g., which is specific for the target protein) attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range).
  • variable loop length is typically 8 to 20 amino acids (e.g., 8 to 12 amino acids), and the scaffold may be any protein which is stable, soluble, small, and non-toxic (e.g., thioredoxin-A, stefin A triple mutant, green fluorescent protein, eglin C, and cellular transcription factor Spl).
  • Peptide aptamer selection can be made using different systems, such as the yeast two-hybrid system (e.g., Gal4 yeast-two-hybrid system) or the LexA interaction trap system.
  • Specific binding agents optionally can be directly labeled with a detectable moiety.
  • Useful detection agents include fluorescent compounds (including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine- 1-napthalenesulfonyl chloride, phycoerythrin, lanthanide phosphors, or the cyanine family of dyes (such as Cy-3 or Cy-5) and the like); bioluminescent compounds (such as luciferase, green fluorescent protein (GFP), or yellow fluorescent protein); enzymes that can produce a detectable reaction product (such as horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase, or glucose oxidase and the like), or radiolabels (such as 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, m In, 125 I, or 131 I).
  • the means used to detect PTEN and ERG is a nucleic acid probe or primer.
  • nucleic acid probes or primers specific for PTEN and ERG can be obtained from a commercially available source or prepared using techniques common in the art. Such agents can also be used in the methods provided herein.
  • Nucleic acid probes and primers are nucleic acid molecules capable of hybridizing with a target nucleic acid molecule (e.g., genomic target nucleic acid molecule).
  • a target nucleic acid molecule e.g., genomic target nucleic acid molecule
  • probes specific for a PTEN or ERG gene when hybridized to the target, are capable of being detected either directly or indirectly.
  • Primers specific for PTEN or ERG, when hybridized to the target are capable of amplifying the target gene, and the resulting amplicons capable of being detected either directly or indirectly.
  • probes and primers permit the detection, and in some examples quantification, of a target nucleic acid molecule, such as PTEN and ERG.
  • Probes and primers can "hybridize" to a target nucleic acid sequence by forming base pairs with complementary regions of the target nucleic acid molecule (e.g. , DNA or RNA, such as genomic DNA, cDNA or mRNA), thereby forming a duplex molecule.
  • target nucleic acid molecule e.g. , DNA or RNA, such as genomic DNA, cDNA or mRNA
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization.
  • probes and primers include Ventana Medical Systems, AZ) and Vysis (IL).
  • Table 3 shows exemplary PTEN and ERG primer pairs and Table 4 shows an exemplary CEN10 probe that can detect a PTEN deletion (if PTEN is intact 2 pairs of CEN10 and PTEN are expected on
  • chromosome 10 if PTEN is heterozygous, 1 pair of PTEN/CEN10 and a single CEN10 on the other copy of chromosome 10 is expected; if PTEN is homozygous only 2 single CEN10 signals - one on each arm of chromosome 10).
  • probes and primers can be generated that are specific for any of SEQ ID NOS: 1 or 3, such as a probe or primer specific for at least 12, at least 50, at least 100, or at least 1000 contiguous nucleotides of such sequence (or its complementary strand).
  • Probes and primers are generally at least 12 nucleotides in length, such as at least 15, at least 18, at least 20, at least 25, at least 30, at least 100, at least 1000, at least 5000, or at least 6000 nucleotides, such as 12 to 100, 12 to 50, 12 to 30, 15 to 25, 100 to 10,000, 1000 to 10,000 or 1000 to 6000 nucleotides.
  • a primer for detecting ERG or PTEN is about 25 to 27 bp.
  • the probe is a FISH probe of at least 1000 bp, such as at least 2000, at least 3000, at least 4000, at least 5000, or at least 6000, such as 1000 to 6000 bp, that covers from about 150 kb to 170 kb.
  • probes include a detectable moiety or "label".
  • a probe can be coupled directly or indirectly to a "label,” which renders the probe detectable.
  • primers include a label that becomes incorporated into the resulting amplicon, thereby permitting detection of the amplicon.
  • This example describes methods used to show that ERG over-expression and loss of PTEN expression is associated with capsular penetration in prostate cancer.
  • Prostate tissue samples from men were analyzed using IHC and antibodies specific for ERG and PTEN. Samples from 426 men who underwent open radical prostatectomy between 1997 and 2008 were obtained. The prostates were totally embedded in paraffin. Only samples in which data for capsular (CP) as well as non- capsular penetration (NCP) was available, were used for this analysis (see FIG. 1). Sections with no tumor tissue were excluded from this analysis. Of the 426 men, 90 had capsular penetration (CP) and 90 had pT3 lesions with an additional separate contralateral lesion (non-capsular penetration, NCP, see FIG. 1). 18 men have thus far shown biochemical recurrence. Capsular penetrating lesions and the
  • PTEN expression was analyzed using an anti-PTEN rabbit monoclonal antibody (Cell Signaling Technology Clone 138G6; catalog # 9559) with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP, Ventana) and detected with the DAB chromogen. Specificity of signals was evaluated visually by a pathologist.
  • prostate capsule penetration samples are PTEN- and ERG + in a representative sample.
  • FIG. 4 shows a prostate capsule penetration sample that is PTEN+ and ERG + in a representative sample.
  • FIG. 5 shows heterogeneous ERG expression in a prostate capsule penetration sample. ERG expression was heterogeneous in 8/90 (9%) of CP and 7/90 (8%) of NCP lesions.
  • FIG. 6 shows IHC results of ERG and PTEN staining. It was observed that invasive prostate cancers were associated with ERG positive high grade prostatic
  • intraepithelial neoplasia HGPIN intraepithelial neoplasia lesions in 21/90 (23.3%) of CP and 22/90 (24.4%) of NCP.
  • HGPIN intraepithelial neoplasia
  • All normal glands showed robust cytoplasmic staining for PTEN.
  • Negative staining corresponding to lack of PTEN expression was observed in 31 of 90 (34%) of the capsular penetrating carcinoma lesions and 18 of 90 (20%) of the contralateral organ confined carcinoma lesions.
  • the carcinoma lesions revealed heterogeneity of PTEN expression in 15 of 90 (16.6%) of the capsular penetrating carcinoma lesions and 11 of 90 (12.2%) of the contralateral organ confined carcinoma lesions.
  • Heterogeneity of the prostate cancer indicates that individual glands need to be assessed for the molecular rearrangements (example in ERG) and/or deletions (example in PTEN), including over-expression (example in ERG) and/or loss of expression (example in PTEN), or changes in morphology of the nuclei for the disease prognosis to be established.
  • an odds ratio (OR) of 4.88 was observed for samples negative for PTEN protein expression and having increased ERG expression (indicating that capsular penetration is about 4.88-times more likely in lesions negative for PTEN expression and positive for ERG over-expression) than the normal reference (ERG-; PTEN+).
  • This profile was generated after comparison with prostate cancer lesions demonstrating a normal expression profile for PTEN and ERG (Pos PTEN and Neg ERG). Based on these results, having an expression profile of PTEN loss and ERG over-expression is a risk factor for capsular penetration in prostate cancer.
  • Table 6 shows the association with Gleason sum score. Positive PTEN associated with statistically significant lower Gleason sum score.
  • Table 6 Marker status by Gleason score.
  • FIG. 7 shows Kaplan-Meier plots showing estimates for biochemical recurrence by ERG/PTEN profile of the capsular penetrated lesion.
  • PTEN- prostate cancers such as those that are ERG+ or ERG-
  • FIG. 7 shows Kaplan-Meier plots showing estimates for biochemical recurrence by ERG/PTEN profile of the capsular penetrated lesion.
  • PTEN- prostate cancers such as those that are ERG+ or ERG-
  • biochemical recurrence such as 1, 3 or 5 years post-prostatectomy.
  • patients with ERG+/PTEN+ or ERG-/PTEN+ tumors had a lower rate of biochemical recurrence than patients with ERG-/PTEN- or ERG+/PTEN- tumors (which have a higher rate of biochemical recurrence).
  • ERG gene rearrangements and PTEN deletions were detected in a simultaneous four probe/four Quantum Dot FISH assay (Benchmark® XT, Ventana) (FIGS. 8 and 9), essentially as described in Svensson et al. ⁇ Lab. Invest. 91:404-12, 2011, herein incorporated by reference) with the exception that FISH probes for 3p and 5 'ERG were used together with those for PTEN and CEN10. ERG probe locations have been described (Tomlins et al. Science 310(5748):644-8, 2005, herein incorporated by reference).
  • PTEN FISH probes are located on 10q23.31 and were derived from BAC clones RP11-659F22, RP11-210E13, CTD-2557P6, CTD- 3243P1, and RP11-765C10 (LifeTechnologies, OR).
  • the CEN10 (centromere 10) probe is inserted in a DNA plasmid pA10RP8 (ATCC, VA). All probes were purified and labeled using nick translation.
  • 5p ERG was labeled with dUTP DIG (digoxigenin, Roche), 3pERG with dCTP DNP (dinotrophenyl, Ventana), PTEN with dUTP TS (thiazole sulphonamide, Ventana), and CENIO with dUTP NP (nitropyrazole, Ventana).
  • dUTP DIG digoxigenin, Roche
  • 3pERG with dCTP DNP dinotrophenyl, Ventana
  • PTEN dUTP TS
  • CENIO dUTP NP
  • Detection was conducted online as a part of the automated protocol with monoclonals to DIG (mouse mAb, Roche), DNP (rat mAb LO-DNP, U Louvain, Brussels), TS (clone # 13A06-01E11, Ventana) and NP (clone # 806263, Ventana) conjugated to Quantum Dot 565, Quantum Dot 655, Quantum Dot 605, and
  • Quantum Dot 585 were assessed for the following antibody conjugations. All antibody conjugations are conducted using 30n PEGylated Quantum dots (Life Technologies, OR) and purified monoclonal antibodies. Quantum Dot-DAPI (Ventana) was applied online to counter-stain nuclei for evaluation and imaging. Regions of interest were selected in DAPI stained nuclei with 30 to 100 nuclei evaluated per case.
  • the lack of PTEN expression is associated with increased risk of capsular penetration, and men with an ERG+/PTEN- tumor have a higher risk of prostate cancer capsular penetration and earlier biochemical recurrence of prostate cancer.
  • This example provides exemplary methods that can be used to detect gene expression using in situ hybridization, such as FISH or CISH. Although particular materials and methods are provided, one skilled in the art will appreciate that variations can be made.
  • Prostate cancer tissue samples e.g., samples that have penetrated the capsule
  • FFPE samples are mounted onto a microscope slide, under conditions that permit detection of nucleic acid molecules present in the sample.
  • cDNA or mRNA in the sample can be detected.
  • the slide is incubated with nucleic acid probes that are of sufficient complementarity to hybridize to cDNA or mRNA in the sample under very high or high stringency conditions.
  • Probes can be RNA or DNA. Separate probes that are specific for ERG and PTEN nucleic acid sequences (e.g. , human sequences) are incubated with the sample simultaneously or sequentially, or incubated with serial sections of the sample. For example, each probe can include a different fluorophore or chromogen to permit differentiation between the three probes. After contacting the probe with the sample under conditions that permit hybridization of the probe to its gene target, unhybridized probe is removed (e.g. , washed away), and the remaining signal detected, for example using microscopy. In some examples, the signal is quantified.
  • additional probes are used, for example to detect expression of one or more other prostate cancer related genes or one or more control genes (e.g. , ⁇ -actin).
  • expression of ERG and PTEN is also detected (using the same probes) in a control sample, such as a breast cancer cell, a prostate cancer cell from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, a non- cancer cell adjacent to the tumor, or a normal (non-cancer) cell.
  • the resulting hybridization signals for ERG and PTEN are compared to a control, such as a value representing ERG and PTEN expression in a normal (noncancerous) prostate sample, such as a prostate sample that is ERG-/PTEN+. If increased expression of ERG, and decreased expression of PTEN, relative to a value representing ERG and PTEN expression in a normal prostate sample, this indicates that the subject has a poor prognosis (e.g. , less than a 1 or 2 year survival) as the cancer is likely to recur.
  • a poor prognosis e.g. , less than a 1 or 2 year survival
  • ERG and PTEN expression are similar relative to a value representing ERG and PTEN expression in a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule (e.g., an ERG+/PTEN- prostate cancer sample), this indicates that the subject has a poor prognosis (e.g., the cancer is likely to recur, metastasize, and/or the patient has a shorter life expectancy).
  • ERG and PTEN expression are similar (e.g., no more than a 2-fold difference) relative to a value representing ERG and PTEN expression in a prostate cancer sample from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a good prognosis (e.g., the cancer is not likely to recur, not metastasize, and/or the patient has a longer life expectancy).
  • This example provides exemplary methods that can be used to detect gene expression using nucleic acid amplification methods, such as PCR. Amplification of target nucleic acid molecules in a sample can permit detection of the resulting amplicons, and thus detection of expression of the target nucleic acid molecules.
  • RNA is extracted from a prostate cancer tissue sample (such as one that has penetrated the capsule), such as FFPE samples or fresh tissue samples (e.g., surgical specimens).
  • FFPE samples FFPE samples
  • fresh tissue samples e.g., surgical specimens.
  • Methods of extracting RNA are routine in the art, and exemplary methods are provided elsewhere in the disclosure.
  • RNA can be extracted using a commercially available kit. The resulting RNA can be analyzed as described in Example 1 to determine if it is of an appropriate quality and quantity.
  • RNA can be used to generate DNA, for example using RT- PCR, such as qRT-PCR.
  • RT-PCR such as qRT-PCR.
  • Methods of performing PCT are routine in the art.
  • the RNA is incubated with a pair of oligonucleotide primers specific for the target gene (e.g. , ERG and PTEN).
  • oligonucleotide primers specific for the target gene e.g. , ERG and PTEN.
  • Primer pairs specific for ERG and PTEN nucleic acid sequences can be incubated with separate RNA samples (e.g., three separate PCR reactions are performed), or a plurality of primer pairs can be incubated with a single sample (for example if the primer pairs are differentially labeled to permit a discrimination between the amplicons generated from each primer pair).
  • each primer pair can include a different fluorophore to permit differentiation between the amplicons.
  • Amplicons can be detected in real time, or can be detected following the amplification reaction. Amplicons are usually detected by detecting a label associated with the amplicon, for example using spectroscopy. In some examples, the amplicon signal is quantified.
  • additional primer pairs are used, for example to detect expression of one or more other prostate cancer related genes, or one or more control genes (e.g. , ⁇ -actin).
  • expression of ERG and PTEN is also detected (using the same probes) in a control sample, such as a breast cancer cell, a prostate cancer cell from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, a non- cancer cell adjacent to the tumor, or a normal (non-cancer) cell.
  • the resulting amplicon signals for ERG and PTEN are compared to a control, such as a value or range of values representing ERG and PTEN expression in a normal (non-cancerous) sample (e.g., a sample that is ERG-/PTEN+). If increased expression of ERG, and decreased expression of PTEN, relative to a value representing ERG and PTEN expression in a normal sample, this indicates that the subject has a poor prognosis (e.g., less than a 1 or 2 year survival) as the cancer is likely to recur.
  • a control such as a value or range of values representing ERG and PTEN expression in a normal (non-cancerous) sample (e.g., a sample that is ERG-/PTEN+).
  • ERG and PTEN expression are similar relative to a value representing ERG and PTEN prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a poor prognosis (e.g., the cancer is likely to recur, metastasize, and/or the patient has a shorter life expectancy).
  • ERG and PTEN expression are similar (e.g., no more than a 2-fold difference) relative to a value representing ERG and PTEN expression in a prostate cancer sample from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a good prognosis (e.g., the cancer is not likely to recur, not metastasize, and/or the patient has a longer life expectancy).
  • the illustrated embodiments are only examples of the disclosure and should not be taken as limiting the scope of the invention. Rather, the scope of the disclosure is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The disclosure provides methods for characterizing a prostate cancer sample by detecting expression of ERG, PTEN or both, changes in which relative to a normal control are shown herein to be correlated with prostate cancer capsular penetration and more aggressive forms of prostate cancer. Such methods are useful for the prognosis of prostate cancer capsular penetration and for making treatment decisions in patients with prostate cancer that has penetrated the capsule. Also provided are kits that can be used with such methods.

Description

EXPRESSION OF ETS RELATED GENE (ERG) AND PHOSPHATASE AND TENSIN HOMOLOG (PTEN) CORRELATES WITH PROSTATE CANCER
CAPSULAR PENETRATION CROSS REFERENCE TO RELATED APPLICATION
This Application claims priority to U.S. Provisional Application No.
61/529,691 filed August 31, 2011, herein incorporated by reference in its entirety.
FIELD
The disclosure provides methods for characterizing a prostate cancer sample by detecting changes in expression of ERG and/or PTEN which are shown herein to be correlated with prostate cancer capsular penetration, biochemical recurrence, and more aggressive forms of prostate cancer. Also provided are kits and arrays that can be used with such methods.
BACKGROUND
Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as "standard of care," and a number of drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. The best chance for a good treatment outcome requires that patients promptly receive optimal available cancer treatment(s) and that such treatment(s) be initiated as quickly as possible following diagnosis. On the other hand, some cancer treatments have significant adverse effects on quality of life; thus, it is equally important that cancer patients do not unnecessarily receive potentially harmful and/or ineffective treatment(s).
Prostate cancer provides a good case in point. In 2008, it was estimated that prostate cancer alone will account for 25% of all cancers in men and will account for 10% of all cancer deaths in men (Jemal et al., CA Cancer J. Clin. 58:71-96, 2008). Prostate cancer typically is diagnosed with a digital rectal exam ("DRE") and/or prostate specific antigen (PSA) screening. An abnormal finding on DRE and/or an elevated serum PSA level {e.g., >4 ng/ml) can indicate the presence of prostate cancer. When a PSA or a DRE test is abnormal, a transrectal ultrasound may be used to map the prostate and show any suspicious areas. Biopsies of various sectors of the prostate are used to determine if prostate cancer is present.
The incidence increased with age and the routine availability of serum PSA testing has dramatically increased the number of aging men having the diagnosis. In most men the disease is slowly progressive but a significant number progress to metastatic disease which in time becomes androgen independent. Prognosis is good if the diagnosis is made when the cancer is still localized to the prostate; but nearly one-third of prostate cancers are diagnosed after the tumor has spread locally, and in 1 of 10 cases, the disease has distant metastases at diagnosis. The 5-year survival rate for men with advanced prostate cancer is only 33.6%. The choice of appropriate treatment is usually dependent on the age of the patient and the stage of the prostate cancer. This decision is complicated by the lack of available accurate methods to pre-surgically determine the clinical stage and the biologic potential of a given patient.
An important clinical question is how aggressively to treat such patients with prostate cancer. Usual treatment options depend on the stage of the prostate cancer. Men with a 10-year life expectancy or less who have a low Gleason number and whose tumor has not spread beyond the prostate often are not treated. Treatment options for more aggressive cancers include radical prostatectomy and/or radiation therapy. Andro gen-depletion therapy (such as, gonadotropin-releasing hormone agonists (e.g., leuprolide, goserelin, etc.) and/or bilateral orchiectomy) is also used, alone or in conjunction with surgery or radiation. However, these prognostic indicators do not accurately predict clinical outcome for individual patients. Hence, understanding of the molecular abnormalities that define those tumors at high risk for relapse is needed to help identify more precise molecular markers.
Nevertheless a few genes have emerged including hepsin (HPN) (Rhodes et al. , Cancer Res. 62:4427-33, 2002), alpha-methylacyl-CoA racemase (AMACR) (Rubin et al. , JAMA 287 : 1662-70, 2002), and enhancer of Zeste homolog 2 (EZH2) (Varambally et al. , Nature 419:624-9, 2002), which have been shown
experimentally to have probable roles on prostate carcinogenesis. Most recently, bioinformatics approaches and gene expression methods were used to identify fusion of the androgen-regulated transmembrane protease, serine 2 (TMPRSS2) with members of the erythroblast transformation specific (ETS) DNA transcription factors family (Tomlins et al., Science 310:644-8, 2005).
Another factor impacting clinical utility of the various proposed panels is the fact that most samples available for validation exist only as formalin fixed paraffin embedded (FFPE) tissues. In contrast, many of the cDNA microarray studies conducted to date typically use snap frozen tissues (Bibikova et al., Genomics 89:666-72, 2007; van't Veer et al, Nature 415:530-6, 2002). The ability to perform and analyze gene expression in FFPE tissues will greatly accelerate research by correlating already available clinical information such as histological grade and clinical stage with gene specific signatures.
Given that some prostate cancers need not be treated while others almost always are fatal and further given that the disease treatment can be unpleasant at best, there is a strong need for methods that allow care givers to predict the expected course of disease, including the likelihood of cancer recurrence, long-term survival of the patient, and the like, and to select the most appropriate treatment option accordingly. SUMMARY
It is disclosed herein that increased ERG expression and decreased PTEN expression (or even absence of detectable PTEN expression) is associated with capsular penetration by prostate cancers. For example, detection of increased ERG expression and decreased PTEN expression is correlated with prostate cancer capsular penetration, and in samples from a prostate cancer that has penetrated the capsule (referred to herein as a CP prostate sample), detection of increased ERG expression and decreased PTEN expression is indicative of a more aggressive prostate cancer, such as one likely to biochemically recur. Thus, expression of PTEN and ERG (or even PTEN alone) can be used to forecast prostate cancer outcome (e.g., biochemically recurrence or non-recurrence), for example in patients who have a prostate cancer that has penetrated the capsule. In particular examples, increased ERG expression and decreased PTEN expression indicates an increased likelihood that the prostate cancer is more aggressive and may recur or metastasize, and thus a poor prognosis. The disclosed methods are useful, for example, to screen prostate cancer patients for cancer aggressiveness, which can aid prognosis and the making of therapeutic decisions in prostate cancer. For example, patients identified as having increased ERG expression and decreased PTEN expression in their prostate cancer sample can be selected for more aggressive therapies and/or more frequent monitoring, while patients identified as not having increased ERG expression and decreased PTEN expression in their prostate cancer sample can be selected for less aggressive therapies and/or less frequent monitoring. Methods and compositions (including kits and arrays that include antibodies or probes that specifically bind to ERG and PTEN) that embody this discovery are described.
Methods are provided for characterizing a prostate cancer. Such methods can include detecting or measuring expression of ERG, PTEN, or both in a prostate cancer sample from a subject, such as a CP prostate cancer sample. The expression of ERG and PTEN in the prostate cancer sample is compared to a control representing ERG and PTEN expression expected in a normal prostate sample (e.g., ERG- and PTEN+) and diagnosing or prognosing that the prostate cancer is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control. For example, a more aggressive prostate cancer can be one which is more likely to biochemically recur, metastasize, less likely to respond to treatment, or combinations thereof, such as an increased likelihood that the prostate cancer will biochemically recur following prostatectomy within 1, 3, or 5 years.
In addition, kits that include one or more means for detecting in a biological sample an ERG genomic sequence, ERG transcript ERG protein, PTEN genomic sequence, PTEN transcript or PTEN protein, or any combination of any of the foregoing, are provided.
The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram showing the types of prostate tumors analyzed, those having capsular penetration (CP) and those that do not invade the prostatic capsule (NCP).
FIG. 2 is a digital image showing staining of prostate carcinoma with H&E (left) an ERG-specific antibody (right).
FIG. 3 is a digital image showing a prostate carcinoma from a case with capsule penetration and no detectable PTEN (left) and ERG-specific staining (right).
FIG. 4 is a digital image showing a prostate carcinoma with capsule penetration and detectable PTEN (left) and ERG-specific staining (right).
FIG. 5 is a digital image showing heterogeneous ERG expression in a prostate cancer that has not penetrated the capsule.
FIG. 6 is a digital image showing IHC results for ERG (left) and PTEN (right) expression in a prostate cancer sample.
FIG. 7 is a graph showing that ERG+ and PTEN- prostate cancers are very highly aggressive, as indicated by early biochemical recurrence.
FIG. 8 is a schematic drawing showing the quantum dot FISH detection platform used to detect ERG and PTEN genomic DNA.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. All sequence database accession numbers referenced herein are understood to refer to the version of the sequence identified by that accession number as it was available on the filing date of this application. In the accompanying sequence listing:
SEQ ID NOS: 1 and 2 are a human Ets related gene (ERG) nucleic acid coding sequence and corresponding protein sequence. SEQ ID NOS: 3 and 4 are a human phosphatase and tensin homolog (PTEN) nucleic acid coding sequence and corresponding protein sequence.
SEQ ID NOS: 5 and 6 are primers that can be used to amplify ERG.
SEQ ID NOS: 7 and 8 are primers that can be used to amplify ERG.
SEQ ID NOS: 9 and 10 are primers that can be used to amplify PTEN.
DETAILED DESCRIPTION
/. Terms
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182- 9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a
Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1- 56081-569-8). The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. "Comprising" means "including"; hence, "comprising A or B" means "including A" or "including B" or "including A and B."
Suitable methods and materials for the practice and/or testing of
embodiments of the disclosed methods are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein also can be used. For example, conventional methods well known in the art to which a disclosed invention pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.
All sequences associated with the GenBank® accession numbers referenced herein are incorporated by reference {e.g., the sequence present on August 31, 2011 is incorporated by reference). In order to facilitate review of the various disclosed embodiments, the following explanations of specific terms are provided:
Amplification of a nucleic acid molecule: Refers to methods used to increase the number of copies of a nucleic acid molecule, such as an ERG or PTEN nucleic acid molecule. The resulting products can be referred to as amplicons or amplification products. Methods of amplifying nucleic acid molecules are known in the art, and include MDA, PCR (such as RT-PCR and qRT-PCR), DOP-PCR, RCA, T7/Primase-dependent amplification, SDA, 3SR, NASBA, and LAMP, among others.
Antibody: A polypeptide ligand including at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope of an antigen, such as an endothelial marker or a fragment thereof.
Antibodies are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region. Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody. In one example, an antibody specifically binds to an
ERG or PTEN protein, but not other proteins (such as other proteins found in human prostate tissue or that are associated with prostate cancer such as pro state- specific antigen, PSA). Thus, the disclosure provides antibodies that specifically bind to an ERG or PTEN protein, such as a monoclonal or polyclonal antibody specific for ERG or PTEN, such as a labeled monoclonal or polyclonal antibody. This includes intact immunoglobulins and the variants and portions of them well known in the art, such as Fab' fragments, F(ab)'2 fragments, single chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv"). A scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains. The term also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997.
Typically, a naturally occurring immunoglobulin has heavy (H) chains and light (L) chains interconnected by disulfide bonds. There are two types of light chain, lambda (λ) and kappa (k). There are five main heavy chain classes (or isotypes) which determine the functional activity of an antibody molecule: IgM, IgD, IgG, IgA and IgE.
Each heavy and light chain contains a constant region and a variable region, (the regions are also known as "domains"). In combination, the heavy and the light chain variable regions specifically bind the antigen. Light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs". The extent of the framework region and CDRs have been defined (see, Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human
Services, 1991, which is hereby incorporated by reference). The Kabat database is now maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs in three-dimensional space.
The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, a VH CDR3 is located in the variable domain of the heavy chain of the antibody in which it is found, whereas a VL CDRl is the CDR1 from the variable domain of the light chain of the antibody in which it is found. For example, an antibody that binds ERG or PTEN will have a specific VH region and the VL region sequence, and thus specific CDR sequences. Antibodies with different specificities (i.e. different combining sites for different antigens) have different CDRs. Although it is the CDRs that vary from antibody to antibody, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs).
References to "VH" or "VH" refer to the variable region of an
immunoglobulin heavy chain, including that of an Fv, scFv, dsFv or Fab.
References to "VL" or "VL" refer to the variable region of an immunoglobulin light chain, including that of an Fv, scFv, dsFv or Fab.
A "monoclonal antibody" is an antibody produced by a single clone of
B-lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a fusion of myeloma cells with immune spleen cells. Monoclonal antibodies include humanized monoclonal antibodies.
A "polyclonal antibody" is an antibody that is derived from different B-cell lines. Polyclonal antibodies are a mixture of immunoglobulin molecules secreted against a specific antigen, each recognizing a different epitope. These antibodies are produced by methods known to those of skill in the art, for instance, by injection of an antigen into a suitable mammal (such as a mouse, rabbit or goat) that induces the B-lymphocytes to produce IgG immunoglobulins specific for the antigen which are then purified from the mammal's serum.
A "chimeric antibody" has framework residues from one species, such as human, and CDRs (which generally confer antigen binding) from another species, such as a murine antibody that specifically binds an endothelial marker. A "humanized" immunoglobulin is an immunoglobulin including a human framework region and one or more CDRs from a non-human (for example a mouse, rat, or synthetic) immunoglobulin. The non-human immunoglobulin providing the CDRs is termed a "donor," and the human immunoglobulin providing the framework is termed an "acceptor." In one embodiment, all the CDRs are from the donor immunoglobulin in a humanized immunoglobulin. Constant regions need not be present, but if they are, they are substantially identical to human immunoglobulin constant regions, e.g., at least about 85-90%, such as about 95% or more identical. Hence, all parts of a humanized immunoglobulin, except possibly the CDRs, are substantially identical to corresponding parts of natural human immunoglobulin sequences. Humanized immunoglobulins can be constructed by means of genetic engineering (see for example, U.S. Patent No. 5,585,089).
Binding affinity: Affinity of one molecule for another, such as an antibody for an antigen (for example, an ERG or PTEN protein). In one example, affinity is calculated by a modification of the Scatchard method described by Frankel et al., Mol. Immunol., 16: 101-106, 1979. In another example, binding affinity is measured by an antigen/antibody dissociation rate. In yet another example, a high binding affinity is measured by a competition radioimmunoassay. In several examples, a high binding affinity is at least about 1 x 10 -"8 M. In other examples, a high binding affinity is at least about 1.5 x 10 -"8 , at least about 2.0 x 10 -"8 , at least about 2.5 x 10 -"8 , at least about 3.0 x 10"8, at least about 3.5 x 10"8, at least about 4.0 x 10"8, at least about 4.5 x 10"8, or at least about 5.0 x 10"8 M.
Capsular penetration or invasion: When referring to a prostate cancer, refers to when prostate cancer extends into and in some examples through the prostatic capsule.
Cancer: Malignant neoplasm, for example one that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis.
Complementary: A nucleic acid molecule is said to be "complementary" with another nucleic acid molecule if the two molecules share a sufficient number of complementary nucleotides to form a stable duplex or triplex when the strands bind (hybridize) to each other, for example by forming Watson-Crick, Hoogsteen or reverse Hoogsteen base pairs. Stable binding occurs when a nucleic acid molecule (e.g., nucleic acid probe or primer) remains detectably bound to a target nucleic acid sequence (e.g., ERG or PTEN target nucleic acid sequence) under the required conditions.
Complementarity is the degree to which bases in one nucleic acid molecule (e.g., nucleic acid probe or primer) base pair with the bases in a second nucleic acid molecule (e.g., target nucleic acid sequence, such as ERG or PTEN).
Complementarity is conveniently described by percentage, that is, the proportion of nucleotides that form base pairs between two molecules or within a specific region or domain of two molecules. For example, if 10 nucleotides of a 15 contiguous nucleotide region of a nucleic acid probe or primer form base pairs with a target nucleic acid molecule, that region of the probe or primer is said to have 66.67% complementarity to the target nucleic acid molecule.
In the present disclosure, "sufficient complementarity" means that a sufficient number of base pairs exist between one nucleic acid molecule or region thereof (such as a region of a probe or primer) and a target nucleic acid sequence (e.g., a ERG or PTEN nucleic acid sequence) to achieve detectable binding. A thorough treatment of the qualitative and quantitative considerations involved in establishing binding conditions is provided by Beltz et al. Methods Enzymol.
100:266-285, 1983, and by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
Contact: To bring one agent into close proximity to another agent, thereby permitting the agents to interact. For example, an antibody (or other specific binding agent) can be applied to a microscope slide or other surface containing a biological sample, thereby permitting detection of proteins (or protein-protein interactions or protein-nucleic acid interactions) in the sample that are specific for the antibody. In another example, a oligonucleotide probe or primer (or other nucleic acid binding agent) can be incubated with nucleic acid molecules obtained from a biological sample (and in some examples under conditions that permit amplification of the nucleic acid molecule), thereby permitting detection of nucleic acid molecules (or nucleic acid-nucleic acid interactions) in the sample that have sufficient complementarity to the probe or primer.
Control: A sample or standard used for comparison with a test sample, such as a biological sample, e.g. , a biological sample obtained from a patient (or plurality of patients) or a cell culture. In some embodiments, the control is a sample obtained from a healthy patient (or plurality of patients) (also referred to herein as a "normal" control), such as a normal sample (e.g. , one that does not have prostate cancer, such as a normal prostate sample). In some embodiments, the control is a historical control or standard value (i.e., a previously tested control sample or group of samples that represent baseline or normal values). In some embodiments the control is a standard value representing the average value (or average range of values) obtained from a plurality of patient samples. In some examples, the control is ERG expression in endothelial cells and/or PTEN expression in a normal prostate gland.
A control can also be represented by a reference value or range of values representing an amount of activity or expression determined to be representative of a given condition. Reference values can include a range of values, real or relative expected to occur under certain conditions. These values can be compared with experimental values to determine if a given molecule is up-regulated or down- regulated in a particular sample for instance. In one example, a reference value or range of values represents an amount of activity or expression of ERG and/or PTEN proteins and/or nucleic acids in a sample, such as a sample from a subject without prostate cancer (such as a healthy male prostate sample), or non-cancerous tissue adjacent to the prostate cancer in from the same or other patients. This value can then be used to determine if the subject from whom a test sample was obtained has a more aggressive form of prostate cancer by comparing this reference value of expression to the level of expression detected in the test sample. In a particular example, a decrease in PTEN and an increase in ERG expression or activity in a test sample as compared to a reference value for an ERG-/PTEN+ prostate sample indicates that the subject has a more aggressive prostate cancer. Detect: To determine if an agent (e.g., a nucleic acid molecule or protein) or interaction (e.g., binding between two proteins, between a protein and a nucleic acid, or between two nucleic acid molecules) is present or absent in a sample, for example by making measurements from a sample. In some examples this can further include quantification. In particular examples, an emission signal from a label is detected. Detection can be in bulk, so that a macroscopic number of molecules can be observed simultaneously. Detection can also include identification of signals from single molecules using microscopy and such techniques as total internal reflection to reduce background noise.
For example, use of an antibody specific for a particular protein (e.g., ERG or PTEN) permits detection of the of the protein or protein-protein interaction in a sample, such as a sample containing prostate cancer tissue. In another example, use of a probe or primer specific for a particular gene (e.g., ERG or PTEN) permits detection of the desired nucleic acid molecule in a sample, such as a sample containing prostate cancer tissue.
Diagnose: The process of identifying a medical condition or disease, for example from the results of one or more diagnostic procedures. In one example, the disclosed methods allow for diagnosis of a prostate cancer that has penetrated the prostatic capsule if elevated ERG and decreased PTEN is detected (as compared to expected levels of ERG and PTEN in a normal sample).
Differential Expression: A nucleic acid sequence is differentially expressed when the amount of one or more of its expression products (e.g., transcript (e.g., mRNA) and/or protein) is higher or lower in one tissue (or cell) type as compared to another tissue (or cell) type. Detecting differential expression can include measuring a change in gene or protein expression, such as a change in ERG and
PTEN expression. For example, a gene, e.g., ERG, the transcript or protein of which is more highly expressed in a more aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule and less expressed in a less aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule, is differentially expressed. In another example, a gene, e.g., PTEN, the transcript or protein of which is less expressed (or even not expressed) in a more aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule and more greatly expressed in a less aggressive prostate cancer tissue (or cells) that has penetrated the prostatic capsule, is differentially expressed.
Downregulated or inactivation: When used in reference to the expression of a nucleic acid molecule (such as PTEN), such as a gene, refers to any process which results in a decrease or elimination in production of a gene product, such as a PTEN protein. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, downregulation or deactivation includes processes that decrease or even eliminate transcription of a gene or translation of mRNA.
Examples of processes that decrease transcription include those that facilitate degradation of a transcription initiation complex, those that decrease transcription initiation rate, those that decrease transcription elongation rate, those that decrease processivity of transcription and those that increase transcriptional repression. Gene downregulation can include reduction of expression above an existing level.
Examples of processes that decrease translation include those that decrease translational initiation, those that decrease translational elongation and those that decrease mRNA stability.
Downregulation includes any detectable decrease in the production of a gene product. In certain examples, production of a gene product decreases by at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold (or even not detectable) as compared to a control (such an amount of protein or nucleic acid expression detected in a normal prostate cell). For example PTEN nucleic acids and proteins are more likely downregulated in subjects who have aggressive forms of prostate cancer with capsular penetration, such as a prostate cancer likely to biochemically recur following prostatectomy. In one example, a control is a relative amount of gene expression or protein expression in a prostate sample from a subject (or population of subjects) who does not have prostate cancer.
Expression: The process by which the coded information of a gene is converted into an operational, non-operational, or structural part of a cell, such as the synthesis of a protein. Gene expression can be influenced by external signals (such as a hormone). Expression of a gene also can be regulated anywhere in the pathway from DNA to RNA to protein. Regulation can include controls on transcription, translation, RNA transport and processing, degradation of
intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization or degradation of specific protein molecules after they are produced.
The expression of an ERG or PTEN nucleic acid molecule or protein can be altered relative to a normal (wild type) nucleic acid molecule or protein (such as in a patient not having prostate cancer or has a prostate cancer that has not penetrated the capsule). Alterations in gene expression, such as differential expression, include but are not limited to: (1) overexpression (e.g. , upregulation); (2) underexpression (e.g., downregulation); or (3) suppression of expression. Alternations in the expression of a nucleic acid molecule can be associated with, and in fact cause, a change in expression of the corresponding protein.
Protein expression can also be altered in some manner to be different from the expression of the protein in a normal (wild type) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more of the amino acid residues is different; (2) a short deletion or addition of one or a few (such as no more than 10-20) amino acid residues to the sequence of the protein; (3) a longer deletion or addition of amino acid residues (such as at least 20 residues), such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount of the protein compared to a control or standard amount (e.g., upregulation); (5) expression of a decreased amount of the protein compared to a control or standard amount (e.g., downregulation); (6) alteration of the subcellular localization or targeting of the protein; (7) alteration of the temporally regulated expression of the protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); (8) alteration in stability of a protein through increased longevity in the time that the protein remains localized in a cell; and (9) alteration of the localized (such as organ or tissue specific or subcellular localization) expression of the protein (such that the protein is not expressed where it would normally be expressed or is expressed where it normally would not be expressed), each compared to a control or standard. Controls or standards for comparison to a sample, for the determination of differential expression, include samples believed to be normal (in that they are not altered for the desired characteristic, for example a sample from a subject who does not have prostate cancer) as well as laboratory values, even though possibly arbitrarily set, keeping in mind that such values can vary from laboratory to laboratory.
Laboratory standards and values may be set based on a known or determined population value and can be supplied in the format of a graph or table that permits comparison of measured, experimentally determined values.
Gene: A nucleic acid (e.g., genomic DNA, cDNA, or RNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., mRNA). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment is/are retained.
The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the full-length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' untranslated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' untranslated sequences. The gene as present in (or isolated from) a genome contains the coding regions ("exons") interrupted with non-coding sequences termed "introns." Introns are absent in the processed RNA (e.g., mRNA) transcript.
Label: An agent capable of detection, for example by spectrophotometry, flow cytometry, or microscopy. For example, one or more labels can be attached to an antibody, thereby permitting detection of a target protein (such as ERG or PTEN). Furthermore, one or more labels can be attached to a nucleic acid molecule, thereby permitting detection of a target nucleic acid molecule (such as ERG or PTEN DNA or RNA). Exemplary labels include radioactive isotopes, fluorophores, chromophores, ligands, chemiluminescent agents, enzymes, and combinations thereof.
Normal cells or tissue: Non-tumor, non-malignant cells and tissue.
Prognose: The process of determining the likely outcome of a subject having a disease (e.g., prostate cancer) in the absence of additional therapy. In one example, the disclosed methods allow for prognosis of future events, such as the likely biochemical recurrence of prostate cancer after prostatectomy (e.g., likelihood of biochemical recurrence in 1 year, 3 years or 5 years) after prostatectomy, and/or predicting the likely metastasis of a prostate cancer (e.g., after prostatectomy).
Specific binding (or derivations of such phrase, such as specifically binds, specific for, etc.): The particular interaction between one binding partner (such as a gene-specific probe or protein- specific antibody) and another binding partner (such as a target of a gene-specific probe or protein- specific antibody). Such interaction is mediated by one or, typically, more non-covalent bonds between the binding partners (or, often, between a specific region or portion of each binding partner). In contrast to non-specific binding sites, specific binding sites are saturable. Accordingly, one exemplary way to characterize specific binding is by a specific binding curve. A specific binding curve shows, for example, the amount of one binding partner (the first binding partner) bound to a fixed amount of the other binding partner as a function of the first binding partner concentration. As the first binding partner concentration increases under these conditions, the amount of the first binding partner bound will saturate. In another contrast to non-specific binding sites, specific binding partners involved in a direct association with each other (e.g., a probe-mRNA or antibody-protein interaction) can be competitively removed (or displaced) from such association by excess amounts of either specific binding partner. Such competition assays (or displacement assays) are very well known in the art.
Subject: Includes any multi-cellular vertebrate organism, such as human and non-human mammals (e.g., veterinary subjects). In some examples, a subject is one who has cancer, or is suspected of having cancer, such as prostate cancer, such as a prostate cancer with capsular penetration. Upregulated or activation: When used in reference to the expression of a molecule, such as a gene or protein, refers to any process which results in an increase in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, upregulation or activation includes processes that increase the presence of ERG proteins or nucleic acids, for example fusions between ERG and TMPRSS resulting in TMPRSS/ERG rearrangements.
Examples of processes that increase transcription include those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (for example by blocking the binding of a transcriptional repressor). Upregulation can include inhibition of repression as well as stimulation of expression above an existing level. Examples of processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability.
Upregulation includes any detectable increase in the production of a gene product, such as an ERG protein. In certain examples, detectable ERG protein or nucleic acid expression in an aggressive prostate cancer that has penetrated the capsule increases by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to a control (such an amount of detectable ERG protein or nucleic acid in a normal sample). For example ERG is upregulated in subjects who have or a more likely to have an aggressive prostate cancer that has penetrated the capsule. In one example, a control is a relative amount of expression in a normal sample.
//. ERG and PTEN Expression Correlate with Capsular Penetration in Prostate Cancer
It is disclosed herein that increased expression of ERG and decreased or even eliminated expression of PTEN, relative to such expression in normal prostate tissues {e.g., an ERG-/PTEN+ prostate sample), are predictive of increased risk of capsular penetration in prostate cancers, more aggressive prostate cancer, increased likelihood of biochemical recurrence, and poor prognosis. In some examples, decreased or even eliminated expression of PTEN, relative to such expression in normal prostate tissues (e.g., an ERG-/PTEN+ prostate sample), are predictive of increased likelihood of prostate cancer biochemical recurrence following
prostatectomy. Methods and compositions that embody this discovery are described.
Provided herein are methods of characterizing a prostate cancer, such as a prostate cancer that has penetrated the prostatic capsule. In particular examples, the method is diagnostic, in that it determines that a prostate cancer has penetrated the prostatic capsule. In particular examples, the method is prognostic, in that it predicts the likelihood that the prostate cancer will penetrate the prostatic capsule. In other examples, the method is prognostic, in that it predicts whether the prostate cancer is likely to or biochemically recur (for example after prostatectomy).
Biochemical recurrence (BCR) is any detectable prostate specific antigen (PSA) after prostatectomy or a PSA rise after a period of PSA detection absence (see Simmons et al. , Eur. Urol. 51: 1175-84, 2007). After prostatectomy, PSA levels typically decrease to an undetectable level after about four weeks. In some examples, BCR is indicated by PSA levels >0.2 ng/ml, such as >0.4 ng/ml or >0.2 to 0.6 ng/ml, such as two successive PDS levels >0.2 ng/ml or >0.4 ng/ml, following prostatectomy. BCR is indicative of the presence of prostatic epithelial tissue, and is assumed to represent cancer.
The sample can be a fixed, wax-embedded prostate cancer tissue sample, such as a fixed, wax-embedded prostate cancer tissue sample, which has or has not penetrated the capsule. In some examples, the prostate cancer sample is collected after prostate cancer diagnosis and after prostatectomy in the subject, or can be collected during a prostatectomy. In some examples, the prostate cancer sample is a prostate cancer that has penetrated the prostatic capsule. In other examples, the sample is obtained during a prostate tissue biopsy of a tumor suspected or known to be cancerous or suspected or known to have penetrated the capsule. In particular methods, the method includes detecting or measuring expression of ERG, PTEN, or both in a prostate cancer sample from a subject (for example determining ERG and PTEN expression levels qualitatively or
quantitatively). The expression of ERG and PTEN can be detected at the genomic level, or gene expression products can be detected, such as ERG and PTEN nucleic acids (e.g., mRNA, cDNA) or proteins. In some examples, determining the expression level incudes detecting alteration(s) in the genomic sequence(s) of ERG or PTEN, such as detecting a TMPRSS-ERG rearrangement or PTEN deletion. For example, the method can include detecting amplification of at least one ERG allele, fusion of at least one ERG allele, deletion of at least one PTEN allele, or
combinations thereof.
The ERG or PTEN expression, or both, in the test prostate cancer sample are compared to ERG and PTEN expression in a control, such as a control that represents ERG and PTEN expression expected in a normal prostate sample (which are ERG- and PTEN+) or normal endothelial cells. Based on the expression levels of ERG and PTEN in the test sample as compared to the control, the prostate cancer is characterized, such as diagnosed or prognosed. In some examples, the method can include one or more of obtaining the prostate cancer sample (e.g., a sample from a prostate cancer that has penetrated the capsule); fixing the sample; and contacting the sample with ERG and PTEN specific binding agents (e.g., nucleic acid probes or antibodies).
For example, the method can include determining that there is a higher likelihood that the prostate cancer will penetrate the prostatic capsule in the future when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control. In another example, the method can include determining or diagnosing that the prostate cancer has penetrated the prostatic capsule when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control. In another example, the method can diagnose that the prostate cancer that has penetrated the prostatic capsule is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control. In another example, the method can prognose an increased likelihood that the prostate cancer that has penetrated the prostatic capsule is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control. In another example, the method can prognose an increased likelihood that the prostate cancer will biochemically recur when decreased expression of PTEN (in some examples in combination with increased expression of ERG) is detected in the prostate cancer sample relative to the control.
In one example, determining that there is a higher or greater likelihood that the prostate cancer will penetrate the prostatic capsule in the future when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the normal control (e.g., an ERG-/PTEN+ prostate sample), indicates that the prostate cancer is about 3 times to about 5 times more likely (such as about 4 times to about 5 times, about 4.5 times to about 5 times, or about 3, 4, 4.5, 4.8, 4.9, or 5 times, more likely) to penetrate the prostatic capsule, than a prostate cancer sample that does not have increased expression of ERG and decreased expression of PTEN relative to the control.
In one example, a prognosis that the cancer is more aggressive indicates that the prostate cancer is predicted to biochemically recur within 1 year, within 3 years or within 5 years of a prostatectomy. In one example, a prognosis that the cancer is more aggressive indicates that the prostate cancer is predicted to metastasize within 1 year, within 3 years or within 5 years of a prostatectomy. For example, a prognosis that the cancer is more likely to biochemically recur or metastasize can be relative to a prostate cancer sample that does not have increased expression of ERG and decreased expression of PTEN relative to the control (e.g., an ERG-/PTEN+ prostate sample).
In one example, a prognosis that the cancer is less aggressive (e.g., levels of ERG ad PTEN similar to a normal prostate; that is ERG not significantly upregulated and significant PTEN expression detected) indicates that the prostate cancer is predicted to not biochemically recur within 1 year, within 3 years or within 5 years of a prostatectomy. In one example, a diagnosis or prognosis that the cancer is less aggressive indicates that the prostate cancer is not predicted to metastasize within 1 year, within 3 years or within 5 years of a prostatectomy.
The method can further include detecting or measuring expression of one or more other prostate cancer related molecules in the sample and comparing expression of the one or more other prostate cancer related molecules in the prostate cancer sample to a control representing expression of the one or more other prostate cancer related molecules expected in a normal prostate sample. Prostate cancer related molecules include those whose expression is known to be altered (such as increased or decreased) in a prostate cancer sample, relative to a normal prostate cancer sample. Examples include but are not limited to: growth arrest- specific 1 (GAS1; OMIM 139185), wingless-type MMTV integration site family member 5 (WNT5A; OMIM 164975), thymidine kinase 1 (7X7; OMIM 188300), V-raf murine sarcoma viral oncogene homolog Bl (BRAF; OMIM 164757), ETS translocation variant 4 (ETV4; OMIM 600711), tumor protein p63 (OMIM 603273), BCL-2 (OMIM 151430), Ki67 (OMIM 176741), ERK5 (OMIM 602521), prostate specific antigen (PSA; OMIM 176820), ETS translocation variant 1 (ETVl; OMIM 600541), measures of nuclear morphology (including nuclear size and shape variation characteristics), or combinations thereof.
In some examples, the method can further include detecting expression of one or more control molecules in the sample and comparing expression of the one or more control molecules in the prostate cancer sample to a control representing expression of the one or more control molecules expected in a normal prostate sample. In some examples, expression of ERG and/or PTEN is normalized to expression of one or more internal controls, such as ERG expression in endothelial cells or PTEN expression in a normal gland.
A. Methods of Use
This disclosure identifies ERG and PTEN are differentially expressed in prostate cancer that has penetrated the capsule and more aggressive prostate cancers that have penetrated the capsule. In addition, it is shown that PTEN is down- regulated in prostate cancer that is more likely to biochemically recur following prostatectomy. A more-aggressive prostate cancer can be indicated by recurrence of after treatment (e.g., prostatectomy), a worse prognosis for the patient (e.g., decreased survival time), an increased likelihood of disease progression (e.g., metastasis), failure (or inadequacy) of treatment, and/or a need for alternative (or additional) treatments. Accordingly, the present discoveries have enabled, among other things, a variety of methods for characterizing prostate cancer tissues, diagnosis or prognosis of prostate cancer patients, predicting treatment outcome in prostate cancer patients, and directing (e.g., selecting useful) treatment modalities for prostate cancer patients (such as a patient with a prostate cancer that has penetrated the capsule).
In some examples, the disclosed methods can be used to identify those subjects that will benefit from a more or less aggressive therapy. For example, if a patient is diagnosed or prognosed with an aggressive form of prostate cancer, the patient can be selected for more aggressive treatment and frequent monitoring. In in contrast, if a patient is diagnosed or prognosed with a less aggressive form of prostate cancer, the patient can be selected for less aggressive treatment and less frequent monitoring. Thus in some examples, the disclosed methods further include selecting a patient for more or less aggressive treatment or monitoring, depending on the ERG and PTEN expression detected. For example, such diagnostic or prognostic methods can be performed prior to the subject undergoing the treatment. Thus, the methods of the present disclosure are valuable tools for practicing physicians to make quick treatment decisions regarding how to treat prostate cancer, such as prostate cancer that has penetrated the capsule. These treatment decisions can include the administration of an agent for treating prostate cancer and decisions to monitor a subject for recurrence or metastasis of a prostate cancer that has penetrated the capsule. Thus, in some examples, the disclosed methods further include treating the subject with prostate cancer, for example administering one or more therapeutic agents for treating prostate cancer, such as chemotherapeutics (e.g., temozolomide or docetaxel) or hormone therapy, treating the patient with radiation therapy (e.g. , prostate brachytherapy), performing a prostatectomy, or combinations thereof. Disclosed methods can be performed using biological samples obtained from a subject having prostate cancer, such as a prostate cancer that has or has not invaded the prostatic capsule. A typical subject is a human male; however, any mammal that has a prostate that may develop prostate cancer can serve as a source of a biological sample useful in a disclosed method. Exemplary biological samples useful in a disclosed method include tissue samples (such as prostate biopsies and/or prostatectomy tissues) or prostate cell samples (such as can be collected by prostate massage, in the urine, or in fine needle aspirates). In one example, the sample is a prostate cancer sample that has penetrated the capsular region. Samples may be fresh or processed post-collection (e.g., for archiving purposes). In some examples, processed samples may be fixed (e.g., formalin-fixed) and/or wax- (e.g., paraffin-) embedded. Fixatives for mounted cell and tissue preparations are well known in the art and include, without limitation, 95% alcoholic Bouin's fixative; 95% alcohol fixative; B5 fixative, Bouin's fixative, formalin fixative, Karnovsky' s fixative (glutaraldehyde), Hartman' s fixative, Hollande's fixative, Orth' s solution
(dichromate fixative), and Zenker's fixative (see, e.g., Carson, Histotechology: A Self-Instructional Text, Chicago:ASCP Press, 1997). Particular method
embodiments involve FFPE prostate cancer tissue samples. In some examples, the sample (or a fraction thereof) is present on a solid support. Solid supports useful in a disclosed method need only bear the biological sample and, optionally, but advantageously, permit the convenient detection of components (e.g., proteins and/or nucleic acid sequences) in the sample. Exemplary supports include microscope slides (e.g., glass microscope slides or plastic microscope slides), coverslips (e.g., glass coverslips or plastic coverslips), tissue culture dishes, multi-well plates, membranes (e.g., nitrocellulose or polyvinylidene fluoride (PVDF)) or BIACORE™ chips.
Exemplary methods involve determining in a prostate tissue sample from a subject the expression level of ERG and PTEN. In some examples, the expression level of additional nucleic acids or proteins are determined, for example one or more other prostate cancer related markers, such as growth arrest- specific 1 (GAS 1 ;
OMEVI 139185), wingless-type MMTV integration site family member 5 (WNT5A; OMIM 164975), thymidine kinase 1 (7X7; OMIM 188300), V-raf murine sarcoma viral oncogene homolog B l (BRAF; OMIM 164757), ETS translocation variant 4 (ETV4; OMIM 600711), tumor protein p63 (OMIM 603273), BCL-2 (OMIM 151430), Ki67 (OMIM 176741), ERK5 (OMIM 602521), prostate specific antigen (PSA; OMIM 176820), ETV1 (OMIM 600541), measures of nuclear morphology (including nuclear size and shape variation characteristics) or combinations thereof. In addition, the expression level of one or more control genes can also be determined.
In exemplary methods, expression of ERG is increased and expression of PTEN is decreased as compared to a standard value or a control sample. In other methods, the expression of another gene (e.g., WNT5A, TK1 or PSA) is increased. In some such methods, the relative increased expression of ERG and the relative decreased expression of PTEN indicates, for example, a higher likelihood of prostate cancer progression in the subject (e.g., a higher likelihood that the prostate cancer will invade the capsule in the subject), an increased likelihood that the prostate cancer will biochemically recur after surgery (e.g., prostatectomy), an increased likelihood that the prostate cancer will metastasize after surgery (e.g.,
prostatectomy), and/or a higher likelihood that surgical treatment (e.g.,
prostatectomy) will fail, and an increased need for a non-surgical or alternate treatment for the prostate cancer.
In some methods, the expression of one or more genes of interest (e.g., ERG and PTEN) is measured relative to a standard value or a control sample. A standard values can include, without limitation, the average expression of the one or more genes of interest in a normal prostate or endothelial cells (e.g., calculated in an analogous manner to the expression value of the genes in the prostate cancer sample), the average expression of the one or more genes of interest in a prostate sample obtained from a patient or patient population in which it is known that prostate cancer did not invade the capsule, the average expression of the one or more genes of interest in a prostate sample obtained from a region adjacent to the prostate cancer (e.g., normal prostate tissue adjacent to the cancer tissue); or the average expression of the one or more genes of interest in a prostate sample obtained from a patient or patient population in which it is known that prostate cancer did invade the capsule. A control sample can include, for example, normal prostate tissue or cells, prostate tissue or cells collected from a patient or patient population in which it is known that prostate cancer did not invade the capsule, prostate tissue or cells collected from a patient or patient population in which it is known that prostate cancer did invade the capsule, normal endothelial cells and/or endothelial cells collected from a patient or patient population in which it is known that prostate cancer did or did not invade the capsule.
In other methods, expression of the gene(s) of interest is (are) measured in test (i.e., prostate cancer patient sample) and control samples relative to a value obtained for a control gene (e.g. , one or more of GAPDH (glyceraldehyde 3- phosphate dehydrogenase), SDHA (succinate dehydrogenase), HPRT1
(hypoxanthine phosphoribosyl transferase 1), HBS 1L (HBS l-like protein), β-actin, and AHSP (alpha haemoglobin stabilizing protein)) in each sample to produce normalized test and control values; then, the normalized value of the test sample is compared to the normalized value of the control sample to obtain the relative expression of the gene(s) of interest (e.g., increased expression of ERG and decreased expression of PTEN). In some examples, expression of ERG and/or PTEN is normalized to expression of one or more internal controls, such as ERG expression in endothelial cells or PTEN expression in a normal gland.
An increase or decrease in gene expression may mean, for example, that the expression of a particular gene expression product (e.g., transcript (e.g., mRNA) or protein) in the test sample is at least about 20%, at least about 25%, at least about 30%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, or at least about 200% higher or lower, respectively, of the applicable control (e.g., standard value or control sample). Alternatively, relative expression (i.e., increase or decrease) may be in terms of fold difference; for example, the expression of a particular gene expression product (e.g., transcript (e.g., mRNA) or protein) in the test sample may be at least about 2-fold, at least about 3-fold, at least about 4- fold, at least about 5-fold, at least about 8-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, at least about 100-fold, or at least about 200-fold times higher or lower, respectively, of the applicable control (e.g., standard value or control sample).
In some method embodiments where protein expression as determined by immunohistochemistry is used as a measure of expression, scoring of protein expression may be semi-quantitative; for example, with protein expression levels recorded as 0, 1, 2, or 3 (including, in some instances plus (or minus) values at each level, e.g., 1+, 2+, 3+) with 0 being substantially no detectable protein expression and 3 (or 3+) being the highest detected protein expression. In such methods, an increase or decrease in the expression is measured as a difference in the score as compared the applicable control (e.g., standard value or control sample); that is, a score of 3+ in a test sample as compared to a score of 0 for the control represents increased expression in the test sample, and a score of 0 in a test sample as compared to a score of 3+ for the control represents decreased expression in the test sample.
Biochemical recurrence means the patient's PSA value has increased prostate after prostatectomy or a PSA rise after a period of PSA detection absence (for example after an initial (or subsequent) treatment(s), such as radiation treatment, chemotherapy, anti-hormone treatment and/or surgery). Typically after an initial prostate cancer treatment PSA levels in the blood decrease to a stable and low level and, in some instances, eventually become almost undetectable. In some examples, recurrence of the prostate cancer is marked by rising PSA levels (e.g., at least 0.2 ng/ml, at least 0.4 ng/ml, at least 0.6 ng/ml, at least 1 ng/ml, or at least 2 ng/ml, or at least 5 ng/ml) and/or by identification of prostate cancer cells in the blood, prostate biopsy or aspirate, in lymph nodes (e.g., in the pelvis or elsewhere) or at a metastatic site (e.g., muscles that help control urination, the rectum, the wall of the pelvis, in bones or other organs).
Other exemplary methods predict the likelihood of prostate progression. Prostate cancer progression means that one or more indices of prostate cancer (e.g., serum PSA levels) show that the disease is advancing independent of treatment. In some examples, prostate cancer progression is marked by rising PSA levels (e.g., greater than 0.2 ng/mL) and/or by identification of (or increasing numbers of) prostate cancer cells in the blood, prostate biopsy or aspirate, in lymph nodes (e.g., in the pelvis or elsewhere) or at a metastatic site (e.g., muscles that help control urination, the rectum, the wall of the pelvis, in bones or other organs).
An increased likelihood of prostate cancer progression or prostate cancer recurrence can be quantified by any known metric. For example, an increased likelihood can mean at least a 10% chance of occurring (such as at least a 25% chance, at least a 50% chance, at least a 60% chance, at least a 75% chance or even greater than an 80% chance of occurring).
Some method embodiments are useful for prostate cancer prognosis, such as prostate cancers that have penetrated the capsule. Prognosis is the likely outcome of the disease (typically independent of treatment). The PTEN expression (in some examples in combination with ERG expression) can be used to predict prostate cancer biochemical recurrence in a sample collected well prior to such recurrence (such as a prostate CP sample). In some method embodiments, an increased likelihood of biochemical recurrence an increased likelihood of biochemical recurrence within 1 year, within 2 years, within 3 year, within 4 years, or within 5 years after prostatectomy (for example as compared to a patient with a prostate cancer that is ERG+/PTEN+ or ERG-/PTEN+). Hence, such gene signature is a surrogate for the aggressiveness of the cancer with recurring cancers being more aggressive. A poor (or poorer) prognosis is likely for a subject with a more aggressive cancer (such as having an increased likelihood of metastasis or biochemical recurrence).
Still other method embodiments predict treatment outcome in prostate cancer patients, and are useful for directing (e.g., selecting useful) treatment modalities for prostate cancer patients, such as prostate cancers that have penetrated the capsule. As discussed elsewhere in this specification, expression of ERG and PTEN can be used to predict that prostate cancer treatment (e.g., prostatectomy) is likely to fail (e.g., the disease will recur). Hence, the disclosed gene signature(s) can be used by caregivers to counsel prostate cancer patients as to the likely success of treatment (e.g., prostatectomy). Taken in the context of the particular subject' s medical history, the patient and the caregiver can make better informed decisions of whether or not to treat (e.g., perform surgery, such as prostatectomy) and/or whether or not to provide alternate treatment (such as, external beam radiotherapy, brachytherapy, chemotherapy, or watchful waiting).
1. Determining Expression Level (e.g.. Gene Expression Profiling) Expression levels may be determined or detected using any technique known in the art. Exemplary techniques include, for example, methods based on
hybridization analysis of polynucleotides (e.g., genomic nucleic acid sequences and/or transcripts (e.g., mRNA)), methods based on sequencing of polynucleotides, methods based on detecting proteins (e.g., immunohistochemistry and
proteomics-based methods). In some examples, expression is measured or determined using a suitably programmed computer or instrumentation (for example using the BenchMark (e.g., BenchMark ULTRA) and/or iScan Coreo Au slide scanner from Ventana). In some examples, expression of PTEN and ERG in the test sample is compared to a control using a suitably programmed computer (for example, PTEN and ERG expression values determined the test sample can be compared to a control value of PTEN and ERG expression expected in a normal prostate sample using a computer).
As discussed previously, gene expression levels may be affected by alterations in the genome (e.g., gene amplification, gene deletion, gene fusion, or other chromosomal rearrangements or chromosome duplications (e.g., polysomy) or loss of one or more chromosomes). Accordingly, in some embodiments, gene expression levels may be inferred or determined by detecting such genomic alterations. Genomic sequences harboring genes of interest may be quantified, for example, by in situ hybridization of gene-specific genomic probes to chromosomes in a metaphase spread or as present in a cell nucleus. The making of gene- specific genomic probes is well known in the art (see, e.g., U.S. Pat. Nos. 5447841, 5756696, 6872817, 6596479, 6500612, 6607877, 6344315, 6475720, 6132961, 7115709, 6280929, 5491224, 5663319, 5776688, 5663319, 5776688, 6277569, 6569626, U.S. Pat. Appl. No. 11/849,060, and PCT Appl. No. PCT/US07/77444). In some exemplary methods, quantification of gene amplifications or deletions may be facilitated by comparing the number of binding sites for a gene-specific genomic probe to a control genomic probe (e.g., a genomic probe specific for the centromere of the chromosome upon which the gene of interest is located). In some examples, gene amplification or deletion may be determined by the ratio of the gene-specific genomic probe to a control (e.g., centromeric) probe. For example, a ratio greater than two (such as greater than three, greater than four, greater than five or ten or greater) indicates amplification of the gene (or the chromosomal region) to which the gene-specific probe binds. In another example, a ratio less than one indicates deletion of the gene (or the chromosomal region) to which the gene-specific probe binds. In particular method embodiments, it can be advantageous to also determine that gene amplification (or fusion) or deletion is accompanied by a corresponding increase or decrease, respectively, in the expression products of the gene (e.g., mRNA or protein); however, once a correlation is established, continued
co-detection is not needed (and may consume unnecessary resources and time).
Gene expression levels also can be determined by quantification of gene transcript (e.g., mRNA). Commonly used methods known in the art for the quantification of mRNA expression in a sample include, without limitation, northern blotting and in situ hybridization (e.g., Parker and Barnes, Meth. Mol. Biol., 106:247-283, 1999)); RNAse protection assays (e.g., Hod, Biotechniques,
13:852-854, 1992); and PCR-based methods, such as reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics, 8:263-264, 1992) and real time quantitative PCR, also referred to as qRT-PCR). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes, or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).
Some method embodiments involving the determination of mRNA levels utilize RNA (e.g., total RNA) isolated from a target sample, such a prostate cancer tissue sample. General methods for RNA (e.g., total RNA) isolation are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin-embedded tissues are disclosed in Examples herein and, for example, by Rupp and Locker (Lab. Invest., 56:A67, 1987) and DeAndres et al. (BioTechniques, 18:42044, 1995). In particular examples, RNA isolation can be performed using a purification kit, buffer set and protease obtained from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. Other commercially available RNA isolation kits include MASTERPURE™ Complete DNA and RNA Purification Kit
(EPICENTRE™ Biotechnologies) and Paraffin Block RNA Isolation Kit (Ambion, Inc.).
In the MassARRAY™ gene expression profiling method (Sequenom, Inc.), cDNA obtained from reverse transcription of total RNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard. The
cDNA/competitor mixture is amplified by standard PCR and is subjected to a post-PCR shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the dephosphorylation of the remaining nucleotides. After inactivation of the alkaline phosphatase, the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derived PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with components needed for analysis with matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry analysis. The cDNA present in the reaction is then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g., Ding and Cantor, Proc. Natl. Acad. Sci. USA, 100:3059-3064, 2003.
Other methods for determining mRNA expression that involve PCR include, for example, differential display (Liang and Pardee, Science, 257:967-971, 1992)); amplified fragment length polymorphism (Kawamoto et al., Genome Res.,
12: 1305-1312, 1999); BEAD ARRAY™ technology (Illumina, San Diego, CA, USA; Oliphant et al., Discovery of Markers for Disease (Supplement to
Biotechniques), June 2002; Ferguson et al., Anal. Chem., 72:5618, 2000; and Examples herein); XMAP™ technology (Luminex Corp., Austin, TX, USA); BADGE assay (Yang et al, Genome Res., 11: 1888-1898, 2001)); and high-coverage expression profiling (HiCEP) analysis (Fukumura et al., Nucl. Acids. Res.,
31(16):e94, 2003).
Differential gene expression also can be determined using microarray techniques. In these methods, specific binding partners, such as probes (including cDNAs or oligonucleotides) specific for RNAs of interest or antibodies specific for proteins of interest are plated, or arrayed, on a microchip substrate. The microarray is contacted with a sample containing one or more targets {e.g., mRNA or protein) for one or more of the specific binding partners on the microarray. The arrayed specific binding partners form specific detectable interactions {e.g., hybridized or specifically bind to) their cognate targets in the sample of interest.
Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. In the SAGE method, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantified by determining the abundance of individual tags, and identifying the gene corresponding to each tag (see, e.g., Velculescu et al., Science, 270:484-487, 1995, and Velculescu et al., Cell,
88:243-51, 1997).
Gene expression analysis by massively parallel signature sequencing (MPSS) was first described by Brenner et al. {Nature Biotechnology, 18:630-634, 2000). It is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 μιη diameter microbeads. A microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density. The free ends of the cloned templates on each microbead are analyzed simultaneously using a fluorescence-based signature sequencing method that does not require DNA fragment separation.
In some examples, differential gene expression is determined using in situ hybridization techniques, such as fluorescence in situ hybridization (FISH) or chromogen in situ hybridization (CISH). In these methods, specific binding partners, such as probes labeled with a flouorphore or chromogen specific for a target gene, cDNA or mRNA (e.g. , a ERG or PTEN gene) is contacted with a sample, such as a prostate cancer sample mounted on a substrate (e.g. , glass slide). The specific binding partners form specific detectable interactions (e.g., hybridized to) their cognate targets in the sample. For example, hybridization between the probes and the target nucleic acid can be detected, for example by detecting a label associated with the probe. In some examples, microscopy, such as fluorescence microscopy, is used.
Immunohistochemistry (IHC) is one exemplary technique useful for detecting protein expression products in the disclosed methods. Antibodies (e.g., monoclonal and/or polyclonal antibodies) specific for each protein are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horseradish peroxidase or alkaline
phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. IHC protocols and kits are well known in the art and are commercially available.
Proteomic analysis is another exemplary technique useful for detecting protein expression products in the disclosed methods. The term "proteome" is defined as the totality of the proteins present in a sample (e.g., tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics"). An exemplary proteomics assay involves (i) separation of individual proteins in a sample, e.g., by 2-D gel electrophoresis; (ii) identification of the individual proteins recovered from the gel, e.g., by mass spectrometry or N-terminal sequencing, and (iii) analysis of the data.
2. Outputting Expression Level
Following the measurement of the expression levels of one or more of the molecules described herein, the assay results, findings, diagnoses, predictions and/or treatment recommendations are typically recorded and communicated to technicians, physicians and/or patients, for example. In certain embodiments, computers will be used to communicate such information to interested parties, such as, patients and/or the attending physicians. Based on the measurement, the therapy administered to a subject can be modified.
In one embodiment, a diagnosis, prediction and/or treatment
recommendation based on the expression level in a test subject of ERG or PTEN (or in combination with other diagnostics, such as those on a prostate cancer nomogram, such as PSA value and Gleason grade) is communicated to interested parties as soon as possible after the assay is completed and the diagnosis and/or prediction is generated. The results and/or related information may be communicated to the subject by the subject's treating physician. Alternatively, the results may be communicated directly to interested parties by any means of communication, including writing, such as by providing a written report, electronic forms of communication, such as email, or telephone. Communication may be facilitated by use of a suitably programmed computer, such as in case of email communications. In certain embodiments, the communication containing results of a diagnostic test and/or conclusions drawn from and/or treatment recommendations based on the test, may be generated and delivered automatically to interested parties using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications. One example of a healthcare-oriented
communications system is described in U.S. Pat. No. 6,283,761; however, the present disclosure is not limited to methods which utilize this particular
communications system. In certain embodiments of the methods of the disclosure, all or some of the method steps, including the assaying of samples, diagnosing or prognosis of prostate cancer, and communicating of assay results or diagnoses or prognosis, may be carried out in diverse (e.g., foreign) jurisdictions.
B. Capsular Penetration Biomarkers
1. Ets Related Gene (ERG) (OMIM: 165080)
The human Ets related gene (ERG) (also known as erg-3 and p55) is located on chromosome 21 (21q22.3) and is a member of the ETS family of transcription factors. ERG sequences are publically available, for example from GenBank® (e.g., accession numbers NP_001129626 and NP_598420.1 (proteins) and NM_133659.2, NM_001136154.1, and NM_001838708.2 (nucleic acids)).
ERG protein (see, e.g., SEQ ID NO: 2) is a transcriptional regulator that binds purine-rich sequences. Fusion of the ERG gene with other genes has been shown to be associated with different cancers. For example, the t(16;21)(pl l;q22) translocation of the ERG gene fused with the fused in sarcoma (FUS) gene is associated with human myeloid leukemia. EWS-ERG fusions are associated with the Ewing family of tumors. ERG fusion with the 5' untranslated region of transmembrane protease, serine 2 (TMPRSS2) (located on human chromosome 21) are associated with prostate cancer. The TMPRS22 and ERG genes are arranged tandemly on chromosome 21q22. The TMPRSS2/ERG fusion joins TMPRSS2 exons 1 or 2 usually to ERG exons 2, 3 or 4, which results in activation of the ERG transcription factor. TMPRSS/ERG rearrangements occur in about 50% of prostate cancers and 20% of high-grade prostatic intraepithelial neoplasia (HGPIN) lesions, resulting in upregulation of ERG. TMPRSS/ERG rearrangement results in a PIN like lesion which can be converted to an invasive state by up-regulation of the PI3K pathway.
2. Phosphatase and tensin homolos (PTEN) (OMIM 601728)
The human PTEN gene is located on chromosome 10 and the mouse PTEN gene is located on chromosome 19. PTEN sequences (both wild-type and mutant) are publically available, for example from GenBank® (e.g., accession numbers NP_000305.3, AAD13528.1, EAW50174.1, EAW50173.1, EAW50172.1, AAH05821.1 and NP_032986.1 (proteins) and NM_000314.4 and NM_008960.2 (nucleic acids)).
PTEN, also referred to as MMAC (mutated in multiple advanced cancers) phosphatase, is a tumor suppressor gene implicated in a wide variety of human cancers. The PTEN protein (e.g., SEQ ID NO: 4) is a phosphatidylinositol-3,4,5- trisphosphate 3-phosphatase, which includes a tensin-like domain as well as a catalytic domain. Unlike most protein tyrosine phosphatases, PTEN preferentially dephosphorylates phosphoinositide substrates. PTEN negatively regulates intracellular levels of phosphatidylinositol-3, 4, 5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating Akt/PKB signaling pathway. Mutations and deletions of PTEN have been shown to be associated with cancers.
3. Variant sequences
In addition to the specific sequences provided herein (e.g., SEQ ID NOS: 1- 4), and the sequences which are currently publically available, one skilled in the art will appreciate that variants of such sequences may be present in a particular subject. For example, polymorphisms for a particular gene or protein may be present. In addition, a sequence may vary between different organisms. In particular examples, a variant sequence retains the biological activity of its corresponding native sequence. For example, a ERG or PTEN sequence present in a particular subject may can have conservative amino acid changes (such as, very highly conserved substitutions, highly conserved substitutions or conserved substitutions), such as 1 to 5 or 1 to 10 conservative amino acid substitutions. Exemplary conservative amino acid substitutions are shown in Table 1.
Table 1. Exemplary conservative amino acid substitutions.
Original Very Highly - Highly Conserved Conserved Substitutions
Residue Conserved Substitutions (from the (from the Blosum65 Matrix)
Substitutions Blosum90 Matrix)
Ala Ser Gly, Ser, Thr Cys, Gly, Ser, Thr, Val
Arg Lys Gin, His, Lys Asn, Gin, Glu, His, Lys
Asn Gin; His Asp, Gin, His, Lys, Ser, Thr Arg, Asp, Gin, Glu, His, Lys, Ser,
Thr
Asp Glu Asn, Glu Asn, Gin, Glu, Ser
Figure imgf000038_0001
In some embodiments, an ERG or PTEN sequence is a sequence variant of a native ERG or PTEN sequence, respectively, such as a nucleic acid or protein sequence that has at least 99%, at least 98%, at least 95%, at least 92%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, or at least 60% sequence identity to the sequences set forth in SEQ ID NOS: 1-4 (or such amount of sequence identity to a GenBank® accession number referred to herein) wherein the resulting variant retains ERG or PTEN biological activity. "Sequence identity" is a phrase commonly used to describe the similarity between two amino acid sequences (or between two nucleic acid sequences). Sequence identity typically is expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences.
Methods for aligning sequences for comparison and determining sequence identity are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math., 2:482, 1981; Needleman and Wunsch, J. Mol. Biol., 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444, 1988; Higgins and Sharp, Gene, 73:237-244, 1988; Higgins and Sharp, CABIOS, 5:151-153, 1989; Corpet et al., Nucleic Acids Research,
16: 10881-10890, 1988; Huang, et al., Computer Applications in the Biosciences, 8: 155-165, 1992; Pearson et al, Methods in Molecular Biology, 24:307-331, 1994; Tatiana et al, FEMS Microbiol. Lett., 174:247-250, 1999. Altschul et al. present a detailed consideration of sequence-alignment methods and homology calculations (J. Mol. Biol., 215:403-410, 1990).
The National Center for Biotechnology Information (NCBI) Basic Local
Alignment Search Tool (BLAST™, Altschul et al., J. Mol. Biol., 215:403-410, 1990) is publicly available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence-analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the internet under the help section for BLAST™.
For comparisons of amino acid sequences of greater than about 15 amino acids, the "Blast 2 sequences" function of the BLAST™ (Blastp) program is employed using the default BLOSUM62 matrix set to default parameters (cost to open a gap [default = 5]; cost to extend a gap [default = 2]; penalty for a mismatch [default = 3]; reward for a match [default = 1]; expectation value (E) [default = 10.0]; word size [default = 3]; and number of one-line descriptions (V) [default = 100]. When aligning short peptides (fewer than around 15 amino acids), the alignment should be performed using the Blast 2 sequences function "Search for short nearly exact matches" employing the PAM30 matrix set to default parameters (expect threshold = 20000, word size = 2, gap costs: existence = 9 and
extension = 1) using composition-based statistics.
C. Use in Combination with other Diagnostic and Prognostic Assays
The disclosed methods can be used in combination with one or more other assays that are used to diagnose or prognose prostate cancer outcomes. For example, a prostate cancer patient's Gleason scores based on a histopathological review, PSA scores, and nomograms (such as the Partin Coefficient Tables) can be used in combination with the disclosed methods to allow for enhanced diagnostic and prognostic capabilities of prostate cancer, such as those that have penetrated the capsule. Thus, in some examples, the disclosed methods further include measuring the patient' s PSA level, determining the patient's nomogram, or both.
For example, prostate cancer nomograms can be used to predict the probability that a patient's cancer will recur (for example after radical
prostatectomy), that is, the probability at one, two, five, seven and 10 years that the patient's serum PSA level will become detectable and begin to rise steadily.
Nomograms include information on one or more of the patient's pre-treatment PSA, age, Gleason grade (primary, secondary and sum), year of prostatectomy, months free of cancer, whether or not the surgical margins were positive, whether or not there was extra capsular extension (penetration); whether or not there was seminal vesicle involvement, whether or not there was lymph node involvement, whether or not the patient receive neoadjuvant hormones, and whether whether or not the patient receive radiation therapy before the radical prostatectomy. Thus, the patient's ERG and PTEN expression levels can be incorporated into currently available nomograms to further increase the accuracy of such predictions.
D. Follow-up Therapies
The disclosed methods can further include selecting subjects for treatment for prostate cancer, for example if the sample is diagnosed as having an aggressive prostate cancer (EGR+/PTEN-). Alternatively, the disclosed methods can further include selecting subjects for no treatment, if the sample is diagnosed as a non- aggressive prostate cancer (e.g., EGR-/PTEN+).
In some embodiments, the disclosed methods include one or more of the following depending on the patient' s diagnosis or prognosis: a) prescribing a treatment regimen for the subject if the subject's determined diagnosis/prognosis is having an aggressive prostate cancer (such as treatment with one or more radiotherapies and/or chemotherapeutic agents, additional surgery, or combinations thereof); b) not prescribing a treatment regimen for the subject if the subject' s determined diagnosis/prognosis is a non-aggressive prostate cancer; c) administering a treatment (such as treatment with one or more radiotherapies and/or
chemotherapeutic agents, additional surgery, or combinations thereof) to the subject if the subject's determined diagnosis/prognosis is having an aggressive prostate cancer; and d) not administering a treatment regimen to the subject if the subject's determined diagnosis/prognosis is a non-aggressive prostate cancer. In an alternative embodiment, the method can include recommending one or more of (a)-(d). Thus, the disclosed methods can further include treating a subject for prostate cancer.
D. Compositions
Disclosed herein are genes (ERG and PTEN) the expression of which characterizes prostate cancer that has penetrated the capsule in subjects afflicted with the disease. Accordingly, compositions that facilitate the detection of such genes in biological samples are now enabled.
1. Kits
Kits useful for facilitating the practice of a disclosed method are also contemplated. In one embodiment, a kit is provided for detecting PTEN and ERG nucleic acid or protein molecules, for example in combination with one to ten {e.g., 1, 2, 3, 4, or 5) control genes or proteins {e.g., β-actin, GAPDH, SDHA, HPRT1, HBS1L, AHSP or combinations thereof). In yet other specific examples, kits are provided for detecting only PTEN and ERG nucleic acid or protein molecules. The detection means can include means for detecting a genomic alteration involving the gene and/or a gene expression product, such as an mRNA or protein. In particular examples, means for detecting a least ERG and PTEN are packaged in separate containers or vials. In some examples, means for detecting one or more ERG and PTEN genes or proteins are present on an array (discussed below).
Exemplary kits can include at least one means for detection of ERG and PTEN genes or gene products (for example in combination with other prostate cancer related genes/proteins or control genes/proteins) such as, at least two, at least three, at least four, or at least five detection means), such as means that permit detection of at least ERG and PTEN. In some examples, such kits can further include at least one means for detection of one or more {e.g., one to three) control genes or proteins. Detection means can include, without limitation, a nucleic acid probe specific for a genomic sequence including a disclosed gene, a nucleic acid probe specific for a transcript (e.g., mRNA) encoded by a disclosed gene, a pair of primers for specific amplification of a disclose gene (e.g., genomic sequence or cDNA sequence of such gene), an antibody or antibody fragment specific for a protein encoded by a disclosed gene.
In one example a kit can include means for detecting in a biological sample an ERG genomic sequence, ERG transcript or ERG protein, and means for detecting in a biological sample a PTEN genomic sequence, PTEN transcript or PTEN protein, or any combination thereof. For example, the kit can include a means for detecting in a biological sample an ERG transcript or protein and a means for detecting in a biological sample a PTEN transcript or protein, such as a nucleic acid probe specific for an ERG transcript and a nucleic acid probe specific for a PTEN transcript, such as a pair of primers for specific amplification of an ERG transcript and a pair of primers for specific amplification of a PTEN transcript, or such as an antibody specific for ERG protein and an antibody specific for a PTEN protein.
Particular kit embodiments can include, for instance, one or more (such as two, three, or four) detection means selected from a nucleic acid probe specific for an ERG transcript, a nucleic acid probe specific for a PTEN transcript, a pair of primers for specific amplification of an ERG transcript, a pair of primers for specific amplification of a PTEN transcript, an antibody specific for an ERG protein, and an antibody specific for a PTEN protein. Particular kit embodiments can further include, for instance, one or more (such as two or three) detection means selected from a nucleic acid probe specific for a control transcript, a pair of primers for specific amplification of control transcript, and an antibody specific for control protein. Exemplary control genes/proteins include GAPDH, SDHA, HPRT1, HBS 1L, β-actin, and AHSP. In some examples, kits can further include, for instance, one or more (such as two or three) detection means selected from a nucleic acid probe specific for a prostate cancer related transcript, a pair of primers for specific amplification of prostate cancer related transcript, and an antibody specific for prostate cancer related protein. Exemplary prostate cancer related genes/proteins include GAS 1 ; WNT5A; TK1 ; BRAF; ETV4; tumor protein p63; BCL-2; Ki67; ERK5; and PSA.
In some kit embodiments, the primary detection means (e.g., nucleic acid probe, nucleic acid primer, or antibody) can be directly labeled, e.g., with a fluorophore, chromophore, or enzyme capable of producing a detectable product (such as alkaline phosphates, horseradish peroxidase and others commonly know in the art).
Other kit embodiments will include secondary detection means; such as secondary antibodies (e.g., goat anti-rabbit antibodies, rabbit anti-mouse antibodies, anti-hapten antibodies) or non-antibody hapten-binding molecules (e.g., avidin or streptavidin). In some such instances, the secondary detection means will be directly labeled with a detectable moiety. In other instances, the secondary (or higher order) antibody will be conjugated to a hapten (such as biotin, DNP, and/or FITC), which is detectable by a detectably labeled cognate hapten binding molecule (e.g., streptavidin (SA) horseradish peroxidase, SA alkaline phosphatase, and/or SA QDot ® Nanocrystals™). Some kit embodiments may include colorimetric reagents (e.g. , DAB, and/or AEC) in suitable containers to be used in concert with primary or secondary (or higher order) detection means (e.g., antibodies) that are labeled with enzymes for the development of such colorimetric reagents.
In some embodiments, a kit includes positive or negative control samples, such as a cell line or tissue known to express or not express PTEN or ERG. In particular examples, control samples are FFPE. Exemplary samples include but are not limited to normal (e.g. , non cancerous) cells or tissues, breast cancer cell lines or tissues, prostate cancer samples from subject known not to have capsular penetration, and prostate cancer samples from subject known to have capsular penetration.
In some embodiments, a kit includes instructional materials disclosing, for example, means of use of a nucleic acid probe or antibody that specifically binds a PTEN or ERG (e.g., mRNA or protein), or means of use for a particular primer or probe. The instructional materials may be written, in an electronic form (e.g., computer diskette or compact disk) or may be visual (e.g., video files). The kits may also include additional components to facilitate the particular application for which the kit is designed. Thus, for example, the kit can include buffers and other reagents routinely used for the practice of a particular disclosed method. Such kits and appropriate contents are well known to those of skill in the art.
Certain kit embodiments can include a carrier means, such as a box, a bag, a satchel, plastic carton (such as molded plastic or other clear packaging), wrapper (such as, a sealed or sealable plastic, paper, or metallic wrapper), or other container. In some examples, kit components will be enclosed in a single packaging unit, such as a box or other container, which packaging unit may have compartments into which one or more components of the kit can be placed. In other examples, a kit includes a one or more containers, for instance vials, tubes, and the like that can retain, for example, one or more biological samples to be tested.
Other kit embodiments include, for instance, syringes, cotton swabs, or latex gloves, which may be useful for handling, collecting and/or processing a biological sample. Kits may also optionally contain implements useful for moving a biological sample from one location to another, including, for example, droppers, syringes, and the like. Still other kit embodiments may include disposal means for discarding used or no longer needed items (such as subject samples, etc.). Such disposal means can include, without limitation, containers that are capable of containing leakage from discarded materials, such as plastic, metal or other impermeable bags, boxes or containers.
2. Arrays
Microarrays for the detection of genes {e.g., genomic sequence and corresponding transcripts) and proteins are well known in the art. Microarrays include a solid surface {e.g., glass slide) upon which many {e.g., hundreds or even thousands) of specific binding agents {e.g., cDNA probes, mRNA probes, or antibodies) are immobilized. The specific binding agents are distinctly located in an addressable {e.g., grid) format on the array. The number of addressable locations on the array can vary, for example from at least two, to at least 10, at least 20, at least 30, at least 33, at least 40, at least 50, at least 75, at least 100, at least 150, at least 200, at least 300, at least 500, least 550, at least 600, at least 800, at least 1000, at least 10,000, or more. The array is contacted with a biological sample believed to contain targets (e.g., mRNA, cDNA, or protein, as applicable) for the arrayed specific binding agents. The specific binding agents interact with their cognate targets present in the sample. The pattern of binding of targets among all immobilized agents provides a profile of gene expression. In particular
embodiments, various scanners and software programs can be used to profile the patterns of genes that are "turned on" (e.g., bound to an immobilized specific binding agent). Representative microarrays are described, e.g., in U.S. Pat.
Nos. 5412087, 5445934, 5744305, 6897073, 7247469, 7166431, 7060431, 7033754, 6998274, 6942968, 6890764, 6858394, 6770441, 6620584, 6544732, 6429027, 6396995, and 6355431.
Disclosed herein are arrays, whether protein or nucleic acid arrays, for the detection at least ERG and PTEN. Particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products and one or more control products (e.g., mRNA, cDNA or protein). More particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products (e.g., mRNA, cDNA or protein) and one or more prostate cancer related products (e.g., mRNA, cDNA or protein). More particular array embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products, one or more control products, and one or more prostate cancer related products (e.g., mRNA, cDNA or protein). More particular array
embodiments consist of nucleic probes or antibodies specific for ERG and PTEN expression products (e.g., mRNA, cDNA or protein),
a. Nucleic acid arrays
In one example, the array includes nucleic acid probes that can hybridize to at least ERG and PTEN nucleic acids (such as genes). In particular examples, an array further includes probes that can specifically hybridize to other prostate marker nucleic acids, such as one or more of GAS 1 ; WNT5A; TK1 ; BRAF; ETV4; tumor protein p63; BCL-2; Ki67; ERK5; and PSA. Certain of such arrays (as well as the methods described herein) can further include oligonucleotides specific for control genes (e.g., one or more of GAPDH, SDHA, HPRT1, HBS 1L, β-actin, and AHSP). In one example, a set of oligonucleotide probes is attached to the surface of a solid support for use in detection of ERG and PTEN, such as detection of nucleic acid sequences (such as genomic DNA, cDNA or mRNA) obtained from the subject (e.g., from a prostate cancer sample). Additionally, if an internal control nucleic acid sequence is used (such as a nucleic acid sequence obtained from a subject who has not had prostate cancer or a control gene nucleic acid sequence) a nucleic acid probe can be included to detect the presence of this control nucleic acid molecule.
The oligonucleotide probes bound to the array can specifically bind sequences obtained from the subject (such as a sample containing nucleic acids or nucleic acids isolated from the sample), or amplified from the subject, such as under high stringency conditions. Agents of use with the method include oligonucleotide probes that recognize ERG (including fusions of ERG, such as TMPRSS/ERG rearrangements). Such sequences can be determined by examining the known gene sequences, and choosing probe sequences that specifically hybridize to ERG or TMPRSS/ERG rearrangements, but not other gene sequences.
The methods and apparatus in accordance with the present disclosure take advantage of the fact that under appropriate conditions oligonucleotide probes form base-paired duplexes with nucleic acid molecules that have a complementary base sequence. The stability of the duplex is dependent on a number of factors, including the length of the oligonucleotide probe, the base composition, and the composition of the solution in which hybridization is effected. The effects of base composition on duplex stability can be reduced by carrying out the hybridization in particular solutions, for example in the presence of high concentrations of tertiary or quaternary amines. The thermal stability of the duplex is also dependent on the degree of sequence similarity between the sequences. By carrying out the hybridization at temperatures close to the anticipated Tm's of the type of duplexes expected to be formed between the target sequences and the oligonucleotides bound to the array, the rate of formation of mis-matched duplexes may be substantially reduced. The length of each oligonucleotide probe employed in the array can be selected to optimize binding of target sequences. An optimum length for use with a particular gene sequence under specific screening conditions can be determined empirically. Thus, the length for each individual element of the set of
oligonucleotide sequences included in the array can be optimized for screening. In one example, oligonucleotide probes are at least 12 nucleotides (nt) in length, for example at least 20 nt, at least 50 nt, at least 100 nt, at least 1000 nt, at least 10,000 nt, or at least 100,000 nt, such as from about 20 to about 35 nt in length, about 25 to about 40 nt in length, about 25 to about 100 nt in length, about 1000 to about 6000 nt in length, about 10,000 to about 50,000 nt in length, about 10,000 to about
100,000 in length, about 10,000 to about 500,000 in length, or about 10,000 to about 1,000,000 in length.
The oligonucleotide probe sequences forming the array can be directly linked to the support. Alternatively, the oligonucleotide probes can be attached to the support by oligonucleotides (that do not non-specifically hybridize to the target gene sequences) or other molecules that serve as spacers or linkers to the solid support, b. Protein arrays
In another example, an array includes protein sequences (or a fragment of such proteins, or antibodies specific to such proteins or protein fragments), which specifically bind to ERG and PTEN, for example protein binding agents that can specifically bind to ERG and PTEN. In particular examples, an array includes protein binding agents that can recognize additional prostate cancer biomarkers, such as one or more of GAS1; WNT5A; TK1; BRAF; ETV4; ETV1; tumor protein p63; BCL-2; Ki67; ERK5; and PSA. Certain of such arrays (as well as the methods described herein) can further include protein binding agents specific for control proteins (e.g., one or more of GAPDH, SDHA, HPRT1, HBS1L, β-actin, and AHSP).
The proteins or antibodies forming the array can be directly linked to the support. Alternatively, the proteins or antibodies can be attached to the support by spacers or linkers to the solid support. Changes in protein expression can be detected using, for instance, a protein- specific binding agent, which in some instances is labeled. In certain examples, detecting a change in protein expression includes contacting a protein sample obtained from a prostate cancer sample of a subject with a protein- specific binding agent (which can be for example present on an array); and detecting whether the binding agent is bound by the sample and thereby measuring the levels of the target protein present in the sample. A increase in the level of ERG and a decrease in the level of PTEN in the test sample, relative to the level of the same protein found an analogous control sample (e.g., from a subject who does not have prostate cancer, or a non-cancerous prostate sample from the same patient which is adjacent to the prostate cancer), in particular examples indicates that the subject has a poor prognosis.
c. Array substrate
The array solid support can be formed from an organic polymer. Suitable materials for the solid support include, but are not limited to: polypropylene, polyethylene, polybutylene, polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene difluroide,
polyfluoroethylene-propylene, polyethylenevinyl alcohol, polymethylpentene, polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially oriented polypropylene, etyleneacrylic acid, thylene methacrylic acid, and blends of copolymers thereof (e.g., U.S. Patent No. 5,985,567).
In general, suitable characteristics of the material that can be used to form the solid support surface include: being amenable to surface activation such that upon activation, the surface of the support is capable of covalently attaching a biomolecule such as an oligonucleotide or antibody thereto; amenability to "in situ" synthesis of biomolecules; being chemically inert such that at the areas on the support not occupied by the oligonucleotides or antibodies are not amenable to nonspecific binding, or when non-specific binding occurs, such materials can be readily removed from the surface without removing the oligonucleotides or antibodies.
In one example, the solid support surface is polypropylene. Polypropylene is chemically inert and hydrophobic. Non-specific binding is generally avoidable, and detection sensitivity is improved. Polypropylene has good chemical resistance to a variety of organic acids (such as formic acid), organic agents (such as acetone or ethanol), bases (such as sodium hydroxide), salts (such as sodium chloride), oxidizing agents (such as peracetic acid), and mineral acids (such as hydrochloric acid). Polypropylene also provides a low fluorescence background, which minimizes background interference and increases the sensitivity of the signal of interest.
In another example, a surface activated organic polymer is used as the solid support surface. One example of a surface activated organic polymer is a
polypropylene material aminated via radio frequency plasma discharge. Such materials are easily utilized for the attachment of nucleic acid molecules. The amine groups on the activated organic polymers are reactive with nucleotide molecules such that the nucleotide molecules can be bound to the polymers. Other reactive groups can also be used, such as carboxylated, hydroxylated, thiolated, or active ester groups.
d. Array formats
A wide variety of array formats can be employed in accordance with the present disclosure. One example includes a linear array of oligonucleotide bands, generally referred to in the art as a dipstick. Another suitable format includes a two- dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64 array). As is appreciated by those skilled in the art, other array formats including, but not limited to slot (rectangular) and circular arrays are equally suitable for use {e.g., U.S. Patent No. 5,981,185). In one example, the array is formed on a polymer medium, which is a thread, membrane or film. An example of an organic polymer medium is a polypropylene sheet having a thickness on the order of about 1 mil. (0.001 inch) to about 20 mil., although the thickness of the film is not critical and can be varied over a fairly broad range. Particularly disclosed for preparation of arrays are biaxially oriented polypropylene (BOPP) films; in addition to their durability, BOPP films exhibit a low background fluorescence.
The array formats of the present disclosure can be included in a variety of different types of formats. A "format" includes any format to which the solid support can be affixed, such as microtiter plates, test tubes, inorganic sheets, dipsticks, and the like. For example, when the solid support is a polypropylene thread, one or more polypropylene threads can be affixed to a plastic dipstick-type device; polypropylene membranes can be affixed to glass slides. The particular format is, in and of itself, unimportant. All that is necessary is that the solid support can be affixed thereto without affecting the functional behavior of the solid support or any biopolymer absorbed thereon, and that the format (such as the dipstick or slide) is stable to any materials into which the device is introduced (such as clinical samples and hybridization solutions).
The arrays of the present disclosure can be prepared by a variety of approaches. In one example, oligonucleotide or protein sequences are synthesized separately and then attached to a solid support (e.g. , see U.S. Patent No. 6,013,789). In another example, sequences are synthesized directly onto the support to provide the desired array (e.g. , see U.S. Patent No. 5,554,501). Suitable methods for covalently coupling oligonucleotides and proteins to a solid support and for directly synthesizing the oligonucleotides or proteins onto the support are known to those working in the field; a summary of suitable methods can be found in Matson et ah, Anal. Biochem. 217:306- 10, 1994. In one example, the oligonucleotides are synthesized onto the support using conventional chemical techniques for preparing oligonucleotides on solid supports (e.g. , see PCT applications WO 85/01051 and WO 89/10977, or U.S. Patent No. 5,554,501).
A suitable array can be produced using automated means to synthesize oligonucleotides in the cells of the array by laying down the precursors for the four bases in a predetermined pattern. Briefly, a multiple-channel automated chemical delivery system is employed to create oligonucleotide probe populations in parallel rows (corresponding in number to the number of channels in the delivery system) across the substrate. Following completion of oligonucleotide synthesis in a first direction, the substrate can then be rotated by 90° to permit synthesis to proceed within a second (2°) set of rows that are now perpendicular to the first set. This process creates a multiple-channel array whose intersection generates a plurality of discrete cells. Oligonucleotide probes can be bound to the support by either the 3' end of the oligonucleotide or by the 5' end of the oligonucleotide. In one example, the oligonucleotides are bound to the solid support by the 3' end. However, one of skill in the art can determine whether the use of the 3' end or the 5' end of the
oligonucleotide is suitable for bonding to the solid support. In general, the internal complementarity of an oligonucleotide probe in the region of the 3' end and the 5' end determines binding to the support. In particular examples, the oligonucleotide probes on the array include one or more labels, that permit detection of
oligonucleotide probe:target sequence hybridization complexes.
3. Protein specific binding agents
In some examples, the means used to detect ERG or PTEN is a protein specific binding agent, such as an antibody or fragment thereof. For example, antibodies or aptamers specific for ERG or PTEN (e.g., SEQ ID NO: 2, or 4, respectively), can be obtained from a commercially available source or prepared using techniques common in the art. Such specific binding agents can also be used in the prognostic methods provided herein.
Specific binding reagents include, for example, antibodies or functional fragments or recombinant derivatives thereof, aptamers, mirror-image aptamers, or engineered nonimmunoglobulin binding proteins based on any one or more of the following scaffolds: fibronectin (e.g., ADNECTINS™ or monobodies), CTLA-4 (e.g., EVIBODIES™), tendamistat (e.g., McConnell and Hoess, J. Mol. Biol, 250:460-470, 1995), neocarzinostatin (e.g., Heyd et al, Biochem., 42:5674-83,
2003) , CBM4-2 (e.g., Cicortas-Gunnarsson et al., Protein Eng. Des. Sel., 17:213-21,
2004) , lipocalins (e.g., ANTIC ALINS™; Schlehuber and Skerra, Drug Discov. Today, 10:23-33, 2005), T-cell receptors (e.g., Chlewicki et al., J. Mol. Biol.,
346:223-39, 2005), protein A domain (e.g., AFFIBODIES™; Engfeldt et al., ChemBioChem, 6: 1043-1050, 2005), Im9 (e.g., Bernath et al., J. Mol. Biol., 345: 1015-26, 2005), ankyrin repeat proteins (e.g., DARPins; Amstutz et al., J. Biol. Chem., 280:24715-22, 2005), tetratricopeptide repeat proteins (e.g., Cortajarena et al., Protein Eng. Des. Sel., 17:399-409, 2004), zinc finger domains (e.g., Bianchi et al., J. Mol. Biol., 247: 154-60, 1995), pVIII (e.g., Petrenko et al., Protein Eng., 15:943-50, 2002), GCN4 (Sia and Kim, Proc. Natl Acad. Sci. USA, 100:9756-61, 2003), avian pancreatic polypeptide (APP) {e.g., Chin et al., Bioorg. Med.Chem. Lett., 11: 1501-5, 2001), WW domains, {e.g., Dalby et al, Protein Sci., 9:2366-76, 2000), SH3 domains {e.g., Hiipakka et al, J. Mol. Biol, 293:1097-106, 1999), SH2 domains (Malabarba et al, Oncogene, 20:5186-5194, 2001), PDZ domains {e.g., TELOBODIES™; Schneider et al, Nat. BiotechnoL, 17:170-5, 1999), TEM-1 β-lactamase {e.g., Legendre et al, Protein Sci., 11: 1506-18, 2002), green fluorescent protein (GFP) {e.g., Zeytun et al, Nat. BiotechnoL, 22:601, 2004), thioredoxin {e.g., peptide aptamers; Lu et al, BiotechnoL, 13:366-372, 1995), Staphylococcal nuclease {e.g., Norman, et al, Science, 285:591-5, 1999), PHD fingers {e.g., Kwan et al, Structure, 11:803-13, 2003), chymotrypsin inhibitor 2 (CI2) {e.g., Karlsson et al, Br. J. Cancer, 91: 1488-94, 2004), bovine pancreatic trypsin inhibitor (BPTI) {e.g., Roberts, Proc. Natl. Acad. Sci. USA, 89:2429-33, 1992) and many others (see review by Binz et al, Nat. BiotechnoL, 23(10): 1257-68, 2005 and supplemental materials).
Specific binding reagents also include antibodies. The term "antibody" refers to an immunoglobulin molecule (or combinations thereof) that specifically binds to, or is immunologically reactive with, a particular antigen, and includes polyclonal, monoclonal, genetically engineered and otherwise modified forms of antibodies, including but not limited to chimeric antibodies, humanized antibodies, heteroconjugate antibodies {e.g., bispecific antibodies, diabodies, triabodies, and tetrabodies), single chain Fv antibodies (scFv), polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide, and antigen binding fragments of antibodies. Antibody fragments include proteolytic antibody fragments [such as F(ab')2 fragments, Fab' fragments, Fab'-SH fragments, Fab fragments, Fv, and rlgG], recombinant antibody fragments (such as sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, diabodies, and triabodies), complementarity determining region (CDR) fragments, camelid antibodies (see, for example, U.S. Patent Nos. 6,015,695;
6,005,079; 5,874,541; 5,840,526; 5,800,988; and 5,759,808), and antibodies produced by cartilaginous and bony fishes and isolated binding domains thereof (see, for example, International Patent Application No. WO03014161).
A Fab fragment is a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab')2 fragment is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; an Fd fragment consists of the VH and CHI domains; an Fv fragment consists of the VL and VH domains of a single arm of an antibody; and a dAb fragment consists of a VH domain (see, e.g., Ward et al., Nature 341:544-546, 1989). A single-chain antibody (scFv) is an antibody in which a VL and VH region are paired to form a monovalent molecule via a synthetic linker that enables them to be made as a single protein chain (see, e.g., Bird et al., Science, 242: 423-426, 1988; Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883, 1988). Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see, e.g., Holliger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448, 1993; Poljak et al., Structure, 2: 1121-1123, 1994). A chimeric antibody is an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. An antibody may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or may be different. For instance, a naturally occurring immunoglobulin has two identical binding sites, a single-chain antibody or Fab fragment has one binding site, while a "bispecific" or "bifunctional" antibody has two different binding sites.
In some examples, an antibody specifically binds to ERG or PTEN with a binding constant that is at least 103 M"1 greater, 104 M"1 greater or 105 M"1 greater than a binding constant for other molecules in a sample. In some examples, a specific binding reagent (such as an antibody (e.g., monoclonal antibody) or fragments thereof) has an equilibrium constant (K<j) of 1 nM or less. For example, a specific binding agent may bind to a target protein with a binding affinity of at least about 0.1 x 10~8 M, at least about 0.3 x 10~8 M, at least about 0.5 x 10"8 M, at least about 0.75 x 10 M, at least about 1.0 x 10 M, at least about 1.3 x 10 M at least about 1.5 x 10 -"8 M, or at least about 2.0 x 10 -"8 M. Kd values can, for example, be determined by competitive ELISA (enzyme-linked immunosorbent assay) or using a surface-plasmon resonance device such as the Biacore T100, which is available from Biacore, Inc., Piscataway, NJ.
Methods of generating antibodies (such as monoclonal or polyclonal antibodies) are well established in the art (for example, see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988). For example peptide fragments of ERG or PTEN (e.g., fragments of SEQ ID NO: 2 or 4, respectively) can be conjugated to carrier molecules (or nucleic acids encoding such epitopes or conjugated RDPs) can be injected into non-human mammals (such as mice or rabbits), followed by boost injections, to produce an antibody response. Serum isolated from immunized animals may be isolated for the polyclonal antibodies contained therein, or spleens from immunized animals may be used for the production of hybridomas and monoclonal antibodies. In some examples, antibodies are purified before use.
In one example, monoclonal antibody to ERG or PTEN (e.g., SEQ ID NO: 2 or 4, respectively), can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature, 256:495, 1975) or derivative methods thereof. Briefly, a mouse (such as Balb/c) is repetitively inoculated with a few micrograms of the selected peptide fragment (e.g., epitope of ERG or PTEN) or carrier conjugate thereof over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol., 70:419, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use.
Commercial sources of antibodies include Ventana Medical Systems (AZ), Epitomics (CA), Biocare (CA), Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), Cell Signaling Technology (Danvers, MA), and abeam (Cambridge, UK). Table 2 shows exemplary commercial sources of antibodies for ERG and PTEN. A specific ERG antibody is the Ventana/Epitomics Clone EPR 3864 and a specific PTEN antibody is the anti-PTEN rabbit monoclonal antibody (Cell Signaling Technology Clone 138G6; catalog # 9559).
Table 2. Exemplary commercial sources of antibodies.
Figure imgf000055_0001
Disclosed specific binding agents also include aptamers. In one example, an aptamer is a single-stranded nucleic acid molecule (such as, DNA or RNA) that assumes a specific, sequence-dependent shape and binds to a target protein (e.g., ERG or PTEN) with high affinity and specificity. Aptamers generally comprise fewer than 100 nucleotides, fewer than 75 nucleotides, or fewer than 50 nucleotides (such as 10 to 95 nucleotides, 25 to 80 nucleotides, 30 to 75 nucleotides, or 25 to 50 nucleotides). In a specific embodiment, disclosed specific binding reagents are mirror-image aptamers (also called a SPIEGELMER™). Mirror-image aptamers are high-affinity L-enantiomeric nucleic acids (for example, L-ribose or L-2'- deoxyribose units) that display high resistance to enzymatic degradation compared with D-oligonucleotides (such as, aptamers). The target binding properties of aptamers and mirror-image aptamers are designed by an in vitro- selection process starting from a random pool of oligonucleotides, as described for example, in Wlotzka et al, Proc. Natl. Acad. Sci. 99(13):8898-8902, 2002. Methods of generating aptamers are known in the art (see e.g., Fitzwater and Polisky (Methods Enzymol., 267:275-301, 1996; Murphy et al., Nucl. Acids Res. 31 :el l0, 2003).
In another example, an aptamer is a peptide aptamer that binds to a target protein (e.g., ERG or PTEN) with high affinity and specificity. Peptide aptamers include a peptide loop (e.g., which is specific for the target protein) attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range). The variable loop length is typically 8 to 20 amino acids (e.g., 8 to 12 amino acids), and the scaffold may be any protein which is stable, soluble, small, and non-toxic (e.g., thioredoxin-A, stefin A triple mutant, green fluorescent protein, eglin C, and cellular transcription factor Spl). Peptide aptamer selection can be made using different systems, such as the yeast two-hybrid system (e.g., Gal4 yeast-two-hybrid system) or the LexA interaction trap system.
Specific binding agents optionally can be directly labeled with a detectable moiety. Useful detection agents include fluorescent compounds (including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine- 1-napthalenesulfonyl chloride, phycoerythrin, lanthanide phosphors, or the cyanine family of dyes (such as Cy-3 or Cy-5) and the like); bioluminescent compounds (such as luciferase, green fluorescent protein (GFP), or yellow fluorescent protein); enzymes that can produce a detectable reaction product (such as horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, or glucose oxidase and the like), or radiolabels (such as 3H, 14C, 15N, 35S, 90Y, 99Tc, mIn, 125I, or 131I).
4. Nucleic acid probes and primers
In some examples, the means used to detect PTEN and ERG is a nucleic acid probe or primer. For example, nucleic acid probes or primers specific for PTEN and ERG can be obtained from a commercially available source or prepared using techniques common in the art. Such agents can also be used in the methods provided herein.
Nucleic acid probes and primers are nucleic acid molecules capable of hybridizing with a target nucleic acid molecule (e.g., genomic target nucleic acid molecule). For example, probes specific for a PTEN or ERG gene, when hybridized to the target, are capable of being detected either directly or indirectly. Primers specific for PTEN or ERG, when hybridized to the target, are capable of amplifying the target gene, and the resulting amplicons capable of being detected either directly or indirectly. Thus probes and primers permit the detection, and in some examples quantification, of a target nucleic acid molecule, such as PTEN and ERG.
Probes and primers can "hybridize" to a target nucleic acid sequence by forming base pairs with complementary regions of the target nucleic acid molecule (e.g. , DNA or RNA, such as genomic DNA, cDNA or mRNA), thereby forming a duplex molecule. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization.
Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plain view, NY (chapters 9 and 11). The following is an exemplary set of hybridization conditions and is not limiting:
Very High Stringency (detects sequences that share at least 90% identity)
Hybridization: 5x SSC at 65°C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each
High Stringency (detects sequences that share at least 80% identity)
Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: lx SSC at 55°C-70°C for 30 minutes each
Low Stringency (detects sequences that share at least 50% identity)
Hybridization: 6x SSC at RT to 55°C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each. Commercial sources of probes and primers include Ventana Medical Systems, AZ) and Vysis (IL). Table 3 shows exemplary PTEN and ERG primer pairs and Table 4 shows an exemplary CEN10 probe that can detect a PTEN deletion (if PTEN is intact 2 pairs of CEN10 and PTEN are expected on
chromosome 10; if PTEN is heterozygous, 1 pair of PTEN/CEN10 and a single CEN10 on the other copy of chromosome 10 is expected; if PTEN is homozygous only 2 single CEN10 signals - one on each arm of chromosome 10).
Table 3. Exemplary primers for ERG and PTEN.
Amplico
Target gene Forward Primer (SEQ ID NO:) Reverse Primer (SEQ ID NO:) n
TCCTTCCCCATCGGTTTGTGG ACGCAGAGATCAGTGAAGG ERG 5p C (5) GAT (6) 525 bp
GTTTCTACACACGTTGCCCAC TCAAAAGGAATCACATTTAC ERG 3p T (7) CACGGA (8) 107 bp
TGACACCATGCAATCTTAAA TGGGAAAGGATTGACAACT PTEN AGCTGA (9) AAGAGGA (10) 310 bp
Table 4. Exemplary probe for CEN10.
CEN 10 G A ATTCTTCTGTCT AGC AGT AA ATG AG A A ATCCCGCTTCC A A
(pA10RP8 plasmid pool) CGAAGGCCTCAAACGGGTCTAACTAATCACTTGCAGACTTTA
CAGACAGAGTCTTTCCAAACTGCTCTATGAAGAGAAAGGTG AAACTCTGTGAACTGAACGCACAGATGACAAAGCAGTTTCTG AGAATGCTTCTGTGTAGTTTTTACACGAAGATATTTCCATTTC AAAGATTAGCCTCAAATCGCTTGAAATCTCCACTTGCAAACT CCACAGAAAGAATTTTTCAAAACTGCTCTGTCTAAAGGAAGG TTCAACTCTGTGACTTGAATACACACAACACAAAGAAGTGAC TGA
Methods of generating a probe or primer specific for a target nucleic acid (e.g., PTEN and ERG) are routine in the art (see e.g., Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview,
NY). For example, probes and primers can be generated that are specific for any of SEQ ID NOS: 1 or 3, such as a probe or primer specific for at least 12, at least 50, at least 100, or at least 1000 contiguous nucleotides of such sequence (or its complementary strand). Probes and primers are generally at least 12 nucleotides in length, such as at least 15, at least 18, at least 20, at least 25, at least 30, at least 100, at least 1000, at least 5000, or at least 6000 nucleotides, such as 12 to 100, 12 to 50, 12 to 30, 15 to 25, 100 to 10,000, 1000 to 10,000 or 1000 to 6000 nucleotides. In one example, a primer for detecting ERG or PTEN is about 25 to 27 bp. In one example the probe is a FISH probe of at least 1000 bp, such as at least 2000, at least 3000, at least 4000, at least 5000, or at least 6000, such as 1000 to 6000 bp, that covers from about 150 kb to 170 kb. Generally, probes include a detectable moiety or "label". For example, a probe can be coupled directly or indirectly to a "label," which renders the probe detectable. In some examples, primers include a label that becomes incorporated into the resulting amplicon, thereby permitting detection of the amplicon. The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit a disclosed invention to the particular features or embodiments described.
Example 1
Increased ERG and Decreased PTEN Protein Expression Associated with
Prostate Cancer Capsular Penetration
This example describes methods used to show that ERG over-expression and loss of PTEN expression is associated with capsular penetration in prostate cancer.
Prostate tissue samples from men were analyzed using IHC and antibodies specific for ERG and PTEN. Samples from 426 men who underwent open radical prostatectomy between 1997 and 2008 were obtained. The prostates were totally embedded in paraffin. Only samples in which data for capsular (CP) as well as non- capsular penetration (NCP) was available, were used for this analysis (see FIG. 1). Sections with no tumor tissue were excluded from this analysis. Of the 426 men, 90 had capsular penetration (CP) and 90 had pT3 lesions with an additional separate contralateral lesion (non-capsular penetration, NCP, see FIG. 1). 18 men have thus far shown biochemical recurrence. Capsular penetrating lesions and the
corresponding contralateral lesions were evaluated for ERG rearrangement and PTEN status by IHC. Normal PTEN expression (PTEN Pos) and absence of ERG (ERG Neg) were used as the reference group. Formalin-fixed and paraffin-embedded (FFPE) samples analyzed using immunohistochemistry (IHC). ERG expression was analyzed using an anti-ERG rabbit monoclonal antibody (Ventana/Epitomics Clone EPR 3864) (FIG. 2). PTEN expression was analyzed using an anti-PTEN rabbit monoclonal antibody (Cell Signaling Technology Clone 138G6; catalog # 9559) with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP, Ventana) and detected with the DAB chromogen. Specificity of signals was evaluated visually by a pathologist.
As shown in FIG. 3, prostate capsule penetration samples are PTEN- and ERG + in a representative sample. FIG. 4 shows a prostate capsule penetration sample that is PTEN+ and ERG + in a representative sample. FIG. 5 shows heterogeneous ERG expression in a prostate capsule penetration sample. ERG expression was heterogeneous in 8/90 (9%) of CP and 7/90 (8%) of NCP lesions. FIG. 6 shows IHC results of ERG and PTEN staining. It was observed that invasive prostate cancers were associated with ERG positive high grade prostatic
intraepithelial neoplasia (HGPIN) lesions in 21/90 (23.3%) of CP and 22/90 (24.4%) of NCP. This result indicates that ERG deletion and over-expression alone is unlikely to be prognostic of aggressive outcomes in the assessment of prostate cancer. All normal glands showed robust cytoplasmic staining for PTEN. Negative staining corresponding to lack of PTEN expression was observed in 31 of 90 (34%) of the capsular penetrating carcinoma lesions and 18 of 90 (20%) of the contralateral organ confined carcinoma lesions. The carcinoma lesions revealed heterogeneity of PTEN expression in 15 of 90 (16.6%) of the capsular penetrating carcinoma lesions and 11 of 90 (12.2%) of the contralateral organ confined carcinoma lesions.
Heterogeneity of the prostate cancer indicates that individual glands need to be assessed for the molecular rearrangements (example in ERG) and/or deletions (example in PTEN), including over-expression (example in ERG) and/or loss of expression (example in PTEN), or changes in morphology of the nuclei for the disease prognosis to be established.
If only ERG staining was analyzed in the absence of PTEN, there was no significant difference in the percentage of positive cases between the capsular penetration tumors and the non-capsular penetration tumors (p=0.54). There was no significant difference in the percentage of ERG positive tumors in the lesions with Gleason sum score > 7 and <7.
As shown in Table 5, an odds ratio (OR) of 4.88 was observed for samples negative for PTEN protein expression and having increased ERG expression (indicating that capsular penetration is about 4.88-times more likely in lesions negative for PTEN expression and positive for ERG over-expression) than the normal reference (ERG-; PTEN+). This profile was generated after comparison with prostate cancer lesions demonstrating a normal expression profile for PTEN and ERG (Pos PTEN and Neg ERG). Based on these results, having an expression profile of PTEN loss and ERG over-expression is a risk factor for capsular penetration in prostate cancer.
Table 5: Association with Capsular Penetration
Figure imgf000061_0001
Table 6 shows the association with Gleason sum score. Positive PTEN associated with statistically significant lower Gleason sum score.
Table 6: Marker status by Gleason score.
Figure imgf000061_0002
ERG Negative 22(46.1) 13(27.7) 12(25.5) 0 47(100)
Positive 22(51.2) 12(27.9) 8(18.6) 1(2.3) 43(100) 0.65
PTEN Negative 3(15.8) 7(36.8) 8(42.1) 1(5.3) 19(100)
Positive 41(57.8) 18(25.4) 12(16.9) 0 71(100) 0.003
FIG. 7 shows Kaplan-Meier plots showing estimates for biochemical recurrence by ERG/PTEN profile of the capsular penetrated lesion. As shown in FIG. 7, PTEN- prostate cancers (such as those that are ERG+ or ERG-) are very highly aggressive, as indicated by increased incidences of biochemical recurrence (such as 1, 3 or 5 years post-prostatectomy). For example, at 5-years post- prostatectomy, patients with ERG+/PTEN+ or ERG-/PTEN+ tumors had a lower rate of biochemical recurrence than patients with ERG-/PTEN- or ERG+/PTEN- tumors (which have a higher rate of biochemical recurrence).
Example 2
Increased ERG and Decreased PTEN Genomic Expression Associated with
Prostate Cancer Capsular Penetration
A subset of recurrent cases was subjected to four color quantum dot FISH for evaluation of ERG gene rearrangement and PTEN gene deletions.
ERG gene rearrangements and PTEN deletions were detected in a simultaneous four probe/four Quantum Dot FISH assay (Benchmark® XT, Ventana) (FIGS. 8 and 9), essentially as described in Svensson et al. {Lab. Invest. 91:404-12, 2011, herein incorporated by reference) with the exception that FISH probes for 3p and 5 'ERG were used together with those for PTEN and CEN10. ERG probe locations have been described (Tomlins et al. Science 310(5748):644-8, 2005, herein incorporated by reference). PTEN FISH probes are located on 10q23.31 and were derived from BAC clones RP11-659F22, RP11-210E13, CTD-2557P6, CTD- 3243P1, and RP11-765C10 (LifeTechnologies, OR). The CEN10 (centromere 10) probe is inserted in a DNA plasmid pA10RP8 (ATCC, VA). All probes were purified and labeled using nick translation. Specifically, 5p ERG was labeled with dUTP DIG (digoxigenin, Roche), 3pERG with dCTP DNP (dinotrophenyl, Ventana), PTEN with dUTP TS (thiazole sulphonamide, Ventana), and CENIO with dUTP NP (nitropyrazole, Ventana).
Detection was conducted online as a part of the automated protocol with monoclonals to DIG (mouse mAb, Roche), DNP (rat mAb LO-DNP, U Louvain, Brussels), TS (clone # 13A06-01E11, Ventana) and NP (clone # 806263, Ventana) conjugated to Quantum Dot 565, Quantum Dot 655, Quantum Dot 605, and
Quantum Dot 585 respectively. All antibody conjugations are conducted using 30n PEGylated Quantum dots (Life Technologies, OR) and purified monoclonal antibodies. Quantum Dot-DAPI (Ventana) was applied online to counter-stain nuclei for evaluation and imaging. Regions of interest were selected in DAPI stained nuclei with 30 to 100 nuclei evaluated per case.
Concordance between FISH and IHC methods was observed. Of the 22 FISH samples there were 3 ERG and 6 PTEN tests which were non-informative. Of the 19 informative ERG FISH tests, 16 (84%) were concordant with the IHC result. Of the 6 ERG rearranged cases, 5 were deleted and 1 was break apart. Of the 16 informative PTEN FISH results 14 (88%) were concordant with the IHC result.
In summary, the lack of PTEN expression is associated with increased risk of capsular penetration, and men with an ERG+/PTEN- tumor have a higher risk of prostate cancer capsular penetration and earlier biochemical recurrence of prostate cancer.
Example 3
in situ Hybridization to Detect Expression
This example provides exemplary methods that can be used to detect gene expression using in situ hybridization, such as FISH or CISH. Although particular materials and methods are provided, one skilled in the art will appreciate that variations can be made.
Prostate cancer tissue samples (e.g., samples that have penetrated the capsule), such as FFPE samples, are mounted onto a microscope slide, under conditions that permit detection of nucleic acid molecules present in the sample. For example, cDNA or mRNA in the sample can be detected. The slide is incubated with nucleic acid probes that are of sufficient complementarity to hybridize to cDNA or mRNA in the sample under very high or high stringency conditions.
Probes can be RNA or DNA. Separate probes that are specific for ERG and PTEN nucleic acid sequences (e.g. , human sequences) are incubated with the sample simultaneously or sequentially, or incubated with serial sections of the sample. For example, each probe can include a different fluorophore or chromogen to permit differentiation between the three probes. After contacting the probe with the sample under conditions that permit hybridization of the probe to its gene target, unhybridized probe is removed (e.g. , washed away), and the remaining signal detected, for example using microscopy. In some examples, the signal is quantified.
In some examples, additional probes are used, for example to detect expression of one or more other prostate cancer related genes or one or more control genes (e.g. , β-actin). In some examples, expression of ERG and PTEN is also detected (using the same probes) in a control sample, such as a breast cancer cell, a prostate cancer cell from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, a non- cancer cell adjacent to the tumor, or a normal (non-cancer) cell.
The resulting hybridization signals for ERG and PTEN are compared to a control, such as a value representing ERG and PTEN expression in a normal (noncancerous) prostate sample, such as a prostate sample that is ERG-/PTEN+. If increased expression of ERG, and decreased expression of PTEN, relative to a value representing ERG and PTEN expression in a normal prostate sample, this indicates that the subject has a poor prognosis (e.g. , less than a 1 or 2 year survival) as the cancer is likely to recur. Similarly, if ERG and PTEN expression are similar relative to a value representing ERG and PTEN expression in a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule (e.g., an ERG+/PTEN- prostate cancer sample), this indicates that the subject has a poor prognosis (e.g., the cancer is likely to recur, metastasize, and/or the patient has a shorter life expectancy). If ERG and PTEN expression are similar (e.g., no more than a 2-fold difference) relative to a value representing ERG and PTEN expression in a prostate cancer sample from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a good prognosis (e.g., the cancer is not likely to recur, not metastasize, and/or the patient has a longer life expectancy).
Example 4
Nucleic Acid Amplification to Detect Expression
This example provides exemplary methods that can be used to detect gene expression using nucleic acid amplification methods, such as PCR. Amplification of target nucleic acid molecules in a sample can permit detection of the resulting amplicons, and thus detection of expression of the target nucleic acid molecules. Although particular materials and methods are provided, one skilled in the art will appreciate that variations can be made.
RNA is extracted from a prostate cancer tissue sample (such as one that has penetrated the capsule), such as FFPE samples or fresh tissue samples (e.g., surgical specimens). Methods of extracting RNA are routine in the art, and exemplary methods are provided elsewhere in the disclosure. For example RNA can be extracted using a commercially available kit. The resulting RNA can be analyzed as described in Example 1 to determine if it is of an appropriate quality and quantity.
The resulting RNA can be used to generate DNA, for example using RT- PCR, such as qRT-PCR. Methods of performing PCT are routine in the art. For example, the RNA is incubated with a pair of oligonucleotide primers specific for the target gene (e.g. , ERG and PTEN). Such primers are of sufficient
complementarity to hybridize to the RNA under very high or high stringency conditions. Primer pairs specific for ERG and PTEN nucleic acid sequences (e.g. , human sequences) can be incubated with separate RNA samples (e.g., three separate PCR reactions are performed), or a plurality of primer pairs can be incubated with a single sample (for example if the primer pairs are differentially labeled to permit a discrimination between the amplicons generated from each primer pair). For example, each primer pair can include a different fluorophore to permit differentiation between the amplicons. Amplicons can be detected in real time, or can be detected following the amplification reaction. Amplicons are usually detected by detecting a label associated with the amplicon, for example using spectroscopy. In some examples, the amplicon signal is quantified.
In some examples, additional primer pairs are used, for example to detect expression of one or more other prostate cancer related genes, or one or more control genes (e.g. , β-actin). In some examples, expression of ERG and PTEN is also detected (using the same probes) in a control sample, such as a breast cancer cell, a prostate cancer cell from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, a prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, a non- cancer cell adjacent to the tumor, or a normal (non-cancer) cell.
The resulting amplicon signals for ERG and PTEN are compared to a control, such as a value or range of values representing ERG and PTEN expression in a normal (non-cancerous) sample (e.g., a sample that is ERG-/PTEN+). If increased expression of ERG, and decreased expression of PTEN, relative to a value representing ERG and PTEN expression in a normal sample, this indicates that the subject has a poor prognosis (e.g., less than a 1 or 2 year survival) as the cancer is likely to recur. Similarly, if ERG and PTEN expression are similar relative to a value representing ERG and PTEN prostate cancer cell from a subject who has an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a poor prognosis (e.g., the cancer is likely to recur, metastasize, and/or the patient has a shorter life expectancy). If ERG and PTEN expression are similar (e.g., no more than a 2-fold difference) relative to a value representing ERG and PTEN expression in a prostate cancer sample from a subject who does not have an aggressive prostate cancer that has penetrated the prostatic capsule, this indicates that the subject has a good prognosis (e.g., the cancer is not likely to recur, not metastasize, and/or the patient has a longer life expectancy). In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the disclosure and should not be taken as limiting the scope of the invention. Rather, the scope of the disclosure is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:
1. A method of characterizing a prostate cancer, comprising:
detecting expression of ETS related gene (ERG) and phosphatase and tensin homolog (PTEN) in a prostate cancer sample isolated from a subject;
comparing expression of ERG and PTEN in the prostate cancer sample to a control representing ERG and PTEN expression expected in a normal prostate sample; and
determining that the prostate cancer is more aggressive, or determining that the prostate cancer has penetrated or will likely penetrate the prostatic capsule, when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
2. The method of claim 1, wherein characterizing a prostate cancer comprises: predicting the likelihood that the prostate cancer will penetrate the prostatic capsule,
predicting the likelihood of biochemical recurrence after prostatectomy, or predicting the likelihood of prostate cancer progression;
and determining that the prostate cancer has a higher likelihood of penetrating the prostatic capsule, determining that the prostate cancer has a higher likelihood of biochemical recurrence after prostatectomy, or determining that the prostate cancer is more likely to metastasize, when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
3. The method of claim 1 or 2, wherein the prostate cancer sample is a prostate cancer sample that has penetrated the prostatic capsule, and the method determines that the cancer is more aggressive when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
4. The method of claim 1 or 2, wherein the prostate cancer sample is a prostate cancer sample that has not penetrated the prostatic capsule, and the method determines that the cancer is at least four-times more likely to penetrate the prostatic capsule in the future when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
5. The method of claim 1 or 2, wherein it is not known whether the prostate cancer sample has penetrated the prostatic capsule, and the method determines that the cancer has penetrated the prostatic capsule when increased expression of ERG and decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
6. The method of any of claims 1-5, wherein detecting expression comprises detecting expression of a gene expression product.
7. The method of claim 6, wherein the expression product is an mRNA or a protein.
8. The method of any of claims 1-5, wherein detecting expression comprises detecting alteration(s) in the genomic sequence(s) of ERG or PTEN.
9. The method of claim 8, wherein the alteration in the genomic sequence is amplification of at least one ERG allele, fusion of at least one ERG allele, deletion of at least one PTEN allele, or combinations thereof.
10. The method of any of claims 1 to 9, further comprising:
detecting expression of one or more other prostate cancer-related molecules in the sample; and
comparing expression of the one or more other prostate cancer related molecules in the prostate cancer sample to a control representing expression of the one or more other prostate cancer-related molecules expected in a normal prostate sample.
11. The method of any of claims 1 - 11, wherein the prostate cancer sample is a fixed, wax-embedded prostate cancer tissue sample.
12. The method of any of claims 1 - 11, wherein the prostate cancer sample is collected after prostate cancer diagnosis and after prostatectomy in the subject.
13. The method of any of claims 1 - 11, wherein the prostate cancer sample is collected from tissue removed during a prostatectomy.
14. A kit for predicting the likelihood of prostate cancer progression, comprising:
means for detecting in a biological sample an ERG genomic sequence, ERG transcript or ERG protein; and
means for detecting in a biological sample PTEN genomic sequence, PTEN transcript or PTEN protein; or
any combination of thereof.
15. The kit of claim 14, comprising means for detecting in a biological sample an ERG transcript or protein and means for detecting in a biological sample a PTEN transcript or protein.
16. The kit of claim 14 or 15, comprising:
a nucleic acid probe specific for ERG transcript and a nucleic acid probe specific for PTEN transcript;
a pair of primers for specific amplification of an ERG transcript and a pair of primers for specific amplification of a PTEN transcript; or
an antibody specific for ERG protein and an antibody specific for a PTEN protein.
17. The kit of any of claims 14 to 16, comprising at least two detection means selected from the group consisting of:
a nucleic acid probe specific for ERG transcript, a nucleic acid probe specific for PTEN transcript, a pair of primers for specific amplification of ERG transcript, a pair of primers for specific amplification of PTEN transcript, an antibody specific for ERG protein, and an antibody specific for a PTEN protein.
18. The kit of any of claims 14-17, further comprising a detection means selected from the group consisting of:
a nucleic acid probe specific for a control transcript, a pair of primers for specific amplification of a control transcript, and an antibody specific for a control protein.
19. The kit of any of claims 14-18, further comprising a detection means selected from the group consisting of:
a nucleic acid probe specific for a prostate cancer-related gene transcript, a pair of primers for specific amplification of a prostate cancer-related gene transcript, and an antibody specific for a prostate cancer-related protein.
20. A method of characterizing a prostate cancer, comprising:
detecting expression of phosphatase and tensin homolog (PTEN) in a prostate cancer sample isolated from a subject;
comparing expression of PTEN in the prostate cancer sample to a control representing PTEN expression expected in a normal prostate sample; and
determining that the prostate cancer is more likely to biochemically recur when decreased expression of PTEN is detected in the prostate cancer sample relative to the control.
PCT/US2012/052627 2011-08-31 2012-08-28 Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration Ceased WO2013033073A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161529691P 2011-08-31 2011-08-31
US61/529,691 2011-08-31

Publications (1)

Publication Number Publication Date
WO2013033073A1 true WO2013033073A1 (en) 2013-03-07

Family

ID=46826919

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/052627 Ceased WO2013033073A1 (en) 2011-08-31 2012-08-28 Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration

Country Status (2)

Country Link
US (2) US9435812B2 (en)
WO (1) WO2013033073A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116987186A (en) * 2023-08-08 2023-11-03 武汉爱博泰克生物科技有限公司 Rabbit monoclonal antibodies against human ERG protein and their applications

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2009253675A1 (en) 2008-05-28 2009-12-03 Genomedx Biosciences, Inc. Systems and methods for expression-based discrimination of distinct clinical disease states in prostate cancer
US20130267443A1 (en) 2010-11-19 2013-10-10 The Regents Of The University Of Michigan ncRNA AND USES THEREOF
WO2013033073A1 (en) 2011-08-31 2013-03-07 Ventana Medical Systems, Inc. Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration
EP2885640B1 (en) 2012-08-16 2018-07-18 Genomedx Biosciences, Inc. Prostate cancer prognostics using biomarkers
EP3022562A4 (en) 2013-07-15 2017-05-17 The Cleveland Clinic Foundation 3b -hydroxysteroid dehydrogenase in steroid-dependent disease
US9994912B2 (en) 2014-07-03 2018-06-12 Abbott Molecular Inc. Materials and methods for assessing progression of prostate cancer
US20190204322A1 (en) * 2015-09-09 2019-07-04 Genomedx Biosciences, Inc. Molecular subtyping, prognosis and treatment of prostate cancer
WO2017079618A1 (en) * 2015-11-06 2017-05-11 Miraca Life Sciences, Inc. Methods for determining high-grade prostatic intraepithelial neoplasia risk stratification
EP3504348B1 (en) 2016-08-24 2022-12-14 Decipher Biosciences, Inc. Use of genomic signatures to predict responsiveness of patients with prostate cancer to post-operative radiation therapy
WO2018132916A1 (en) 2017-01-20 2018-07-26 Genomedx Biosciences, Inc. Molecular subtyping, prognosis, and treatment of bladder cancer
CA3055925A1 (en) 2017-03-09 2018-09-13 Decipher Biosciences, Inc. Subtyping prostate cancer to predict response to hormone therapy
AU2018266733A1 (en) 2017-05-12 2020-01-16 Veracyte, Inc. Genetic signatures to predict prostate cancer metastasis and identify tumor aggressiveness
WO2019028285A2 (en) 2017-08-04 2019-02-07 Genomedx, Inc. Use of immune cell-specific gene expression for prognosis of prostate cancer and prediction of responsiveness to radiation therapy
CN110873711B (en) * 2018-09-04 2022-02-22 华瑞同康生物技术(深圳)有限公司 A serum TK1 detection kit based on an automatic chemiluminescence analyzer

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001051A1 (en) 1983-09-02 1985-03-14 Molecular Biosystems, Inc. Oligonucleotide polymeric support system
WO1989010977A1 (en) 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5447841A (en) 1986-01-16 1995-09-05 The Regents Of The Univ. Of California Methods for chromosome-specific staining
US5491224A (en) 1990-09-20 1996-02-13 Bittner; Michael L. Direct label transaminated DNA probe compositions for chromosome identification and methods for their manufacture
US5554501A (en) 1992-10-29 1996-09-10 Beckman Instruments, Inc. Biopolymer synthesis using surface activated biaxially oriented polypropylene
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5756696A (en) 1986-01-16 1998-05-26 Regents Of The University Of California Compositions for chromosome-specific staining
US5759808A (en) 1992-08-21 1998-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5981185A (en) 1994-05-05 1999-11-09 Beckman Coulter, Inc. Oligonucleotide repeat arrays
US5985567A (en) 1997-08-15 1999-11-16 Beckman Coulter, Inc. Hybridization detection by pretreating bound single-stranded probes
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
US6013789A (en) 1998-02-20 2000-01-11 Beckman Coulter, Inc. Covalent attachment of biomolecules to derivatized polypropylene supports
US6277569B1 (en) 1990-09-20 2001-08-21 Vysis, Inc. Methods for multiple direct label probe detection of multiple chromosomes or regions thereof by in situ hybridization
US6280929B1 (en) 1986-01-16 2001-08-28 The Regents Of The University Of California Method of detecting genetic translocations identified with chromosomal abnormalities
US6283761B1 (en) 1992-09-08 2001-09-04 Raymond Anthony Joao Apparatus and method for processing and/or for providing healthcare information and/or healthcare-related information
US6344315B1 (en) 1986-01-16 2002-02-05 The Regents Of The University Of California Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US6396995B1 (en) 1999-05-20 2002-05-28 Illumina, Inc. Method and apparatus for retaining and presenting at least one microsphere array to solutions and/or to optical imaging systems
US6429027B1 (en) 1998-12-28 2002-08-06 Illumina, Inc. Composite arrays utilizing microspheres
US6475720B1 (en) 1986-01-16 2002-11-05 The Regents Of The University Of California Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17
WO2003014161A2 (en) 2001-08-10 2003-02-20 Aberdeen University Antigen binding domains from fish
US6544732B1 (en) 1999-05-20 2003-04-08 Illumina, Inc. Encoding and decoding of array sensors utilizing nanocrystals
US6620584B1 (en) 1999-05-20 2003-09-16 Illumina Combinatorial decoding of random nucleic acid arrays
US6770441B2 (en) 2000-02-10 2004-08-03 Illumina, Inc. Array compositions and methods of making same
US6872817B1 (en) 1986-01-16 2005-03-29 The Regents Of The Univ. Of California Method of staining target interphase chromosomal DNA
US6897073B2 (en) 1998-07-14 2005-05-24 Zyomyx, Inc. Non-specific binding resistant protein arrays and methods for making the same
US6942968B1 (en) 1999-08-30 2005-09-13 Illumina, Inc. Array compositions for improved signal detection
WO2005113816A2 (en) * 2004-05-07 2005-12-01 Henry M. Jackson Foundation For The Advancement Of Military Medicine Methods of diagnosing or treating prostate cancer using the erg gene, alone or in combination with other over or under expressed genes in prostate cancer
US7033754B2 (en) 1998-06-24 2006-04-25 Illumina, Inc. Decoding of array sensors with microspheres
US7115709B1 (en) 1986-01-16 2006-10-03 The Regents Of The University Of California Methods of staining target chromosomal DNA employing high complexity nucleic acid probes

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020197656A1 (en) * 1999-12-17 2002-12-26 Ronghao Li Cell arrays and the uses thereof
GB0003902D0 (en) * 2000-02-18 2000-04-05 Glaxo Group Ltd Assay
WO2007071053A1 (en) * 2005-12-21 2007-06-28 Universite De Montreal Markers for memory t cells and uses thereof
EP2188630A4 (en) * 2007-10-02 2010-11-03 Univ Rochester METHODS AND COMPOSITIONS ASSOCIATED WITH SYNERGIC RESPONSES TO ONCOGENIC MUTATIONS
CA2696545C (en) * 2010-03-15 2019-08-06 Queen's University At Kingston Methods, probe sets, and kits for detection of deletion of tumor suppressor genes by fluorescence in situ hybridization
WO2013033073A1 (en) 2011-08-31 2013-03-07 Ventana Medical Systems, Inc. Expression of ets related gene (erg) and phosphatase and tensin homolog (pten) correlates with prostate cancer capsular penetration

Patent Citations (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001051A1 (en) 1983-09-02 1985-03-14 Molecular Biosystems, Inc. Oligonucleotide polymeric support system
US6596479B1 (en) 1986-01-16 2003-07-22 The Regents Of The University Of California Methods and compositions for chromosome-specific staining
US6132961A (en) 1986-01-16 2000-10-17 The Regents Of The University Of California Methods of biological dosimetry employing chromosome-specific staining
US5447841A (en) 1986-01-16 1995-09-05 The Regents Of The Univ. Of California Methods for chromosome-specific staining
US6280929B1 (en) 1986-01-16 2001-08-28 The Regents Of The University Of California Method of detecting genetic translocations identified with chromosomal abnormalities
US7115709B1 (en) 1986-01-16 2006-10-03 The Regents Of The University Of California Methods of staining target chromosomal DNA employing high complexity nucleic acid probes
US6872817B1 (en) 1986-01-16 2005-03-29 The Regents Of The Univ. Of California Method of staining target interphase chromosomal DNA
US6344315B1 (en) 1986-01-16 2002-02-05 The Regents Of The University Of California Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17
US6475720B1 (en) 1986-01-16 2002-11-05 The Regents Of The University Of California Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17
US5756696A (en) 1986-01-16 1998-05-26 Regents Of The University Of California Compositions for chromosome-specific staining
US6500612B1 (en) 1986-01-16 2002-12-31 The Regents Of The University Of California Methods and compositions for chromosome 21-specific staining
US6607877B1 (en) 1986-01-16 2003-08-19 The Regents Of The University Of California Methods and compositions for chromosome-specific staining
WO1989010977A1 (en) 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5776688A (en) 1990-09-20 1998-07-07 Vysis, Inc. Methods for detection by in situ hybridization of multiple chromosomes or regions thereof
US6277569B1 (en) 1990-09-20 2001-08-21 Vysis, Inc. Methods for multiple direct label probe detection of multiple chromosomes or regions thereof by in situ hybridization
US6569626B2 (en) 1990-09-20 2003-05-27 Vysis, Inc. Methods for multiple direct label probe detection of multiple chromosomes or regions thereof by in situ hybridization
US5663319A (en) 1990-09-20 1997-09-02 Vysis, Inc. Probe compositions for chromosome identification and methods
US5491224A (en) 1990-09-20 1996-02-13 Bittner; Michael L. Direct label transaminated DNA probe compositions for chromosome identification and methods for their manufacture
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5759808A (en) 1992-08-21 1998-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5840526A (en) 1992-08-21 1998-11-24 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5800988A (en) 1992-08-21 1998-09-01 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US6015695A (en) 1992-08-21 2000-01-18 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5874541A (en) 1992-08-21 1999-02-23 Vrije Universiteit Immunoglobulins devoid of light chains
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
US6283761B1 (en) 1992-09-08 2001-09-04 Raymond Anthony Joao Apparatus and method for processing and/or for providing healthcare information and/or healthcare-related information
US5554501A (en) 1992-10-29 1996-09-10 Beckman Instruments, Inc. Biopolymer synthesis using surface activated biaxially oriented polypropylene
US5981185A (en) 1994-05-05 1999-11-09 Beckman Coulter, Inc. Oligonucleotide repeat arrays
US5985567A (en) 1997-08-15 1999-11-16 Beckman Coulter, Inc. Hybridization detection by pretreating bound single-stranded probes
US6013789A (en) 1998-02-20 2000-01-11 Beckman Coulter, Inc. Covalent attachment of biomolecules to derivatized polypropylene supports
US7060431B2 (en) 1998-06-24 2006-06-13 Illumina, Inc. Method of making and decoding of array sensors with microspheres
US7033754B2 (en) 1998-06-24 2006-04-25 Illumina, Inc. Decoding of array sensors with microspheres
US7247469B2 (en) 1998-07-14 2007-07-24 Zyomyx, Inc. Non-specific binding resistant protein arrays and methods for making the same
US6897073B2 (en) 1998-07-14 2005-05-24 Zyomyx, Inc. Non-specific binding resistant protein arrays and methods for making the same
US6858394B1 (en) 1998-12-28 2005-02-22 Illumina, Inc. Composite arrays utilizing microspheres
US6429027B1 (en) 1998-12-28 2002-08-06 Illumina, Inc. Composite arrays utilizing microspheres
US6998274B2 (en) 1998-12-28 2006-02-14 Illumina, Inc. Composite arrays utilizing microspheres
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US6890764B2 (en) 1999-05-20 2005-05-10 Illumina, Inc. Encoding and decoding of array sensors utilizing nanocrystals
US6620584B1 (en) 1999-05-20 2003-09-16 Illumina Combinatorial decoding of random nucleic acid arrays
US6544732B1 (en) 1999-05-20 2003-04-08 Illumina, Inc. Encoding and decoding of array sensors utilizing nanocrystals
US7166431B2 (en) 1999-05-20 2007-01-23 Illumina, Inc. Combinatorial decoding of random nucleic acid arrays
US6396995B1 (en) 1999-05-20 2002-05-28 Illumina, Inc. Method and apparatus for retaining and presenting at least one microsphere array to solutions and/or to optical imaging systems
US6942968B1 (en) 1999-08-30 2005-09-13 Illumina, Inc. Array compositions for improved signal detection
US6770441B2 (en) 2000-02-10 2004-08-03 Illumina, Inc. Array compositions and methods of making same
WO2003014161A2 (en) 2001-08-10 2003-02-20 Aberdeen University Antigen binding domains from fish
WO2005113816A2 (en) * 2004-05-07 2005-12-01 Henry M. Jackson Foundation For The Advancement Of Military Medicine Methods of diagnosing or treating prostate cancer using the erg gene, alone or in combination with other over or under expressed genes in prostate cancer

Non-Patent Citations (103)

* Cited by examiner, † Cited by third party
Title
"GeneChip Human Genome U133 Set", INTERNET CITATION, 26 February 2003 (2003-02-26), XP002232760, Retrieved from the Internet <URL:http://www.affymetrix.com/support/technical/datasheets/hgu133_datasheet.pdf> [retrieved on 20030226] *
"Human Genome U95Av2", INTERNET CITATION, 2 October 2002 (2002-10-02), XP002215481, Retrieved from the Internet <URL:http://www.affymetrix.com> [retrieved on 20021002] *
"Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC.
A H M REID ET AL: "Molecular characterisation of ERG, ETV1 and PTEN gene loci identifies patients at low and high risk of death from prostate cancer", BRITISH JOURNAL OF CANCER, vol. 102, no. 4, 16 February 2010 (2010-02-16), pages 678 - 684, XP055045892, ISSN: 0007-0920, DOI: 10.1038/sj.bjc.6605554 *
ALTSCHUL ET AL., I. MOL. BIOL., vol. 215, 1990, pages 403 - 410
AMSTUTZ ET AL., J. BIOL. CHEM., vol. 280, 2005, pages 24715 - 22
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1992, GREENE PUBLISHING ASSOCIATES
AUSUBEL ET AL.: "Current Protocols of Molecular Biology", JOHN WILEY AND SONS
AUSUBEL ET AL.: "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", 1999, WILEY & SONS
BELTZ ET AL., METHODS ENZYMOL., vol. 100, 1983, pages 266 - 285
BENJAMIN LEWIN: "Genes V", 1994, OXFORD UNIVERSITY PRESS
BERNATH, J. MOL. BIOL., vol. 345, 2005, pages 1015 - 26
BIANCHI ET AL., J. MOL. BIOL., vol. 247, 1995, pages 154 - 60
BIBIKOVA ET AL., GENOMICS, vol. 89, 2007, pages 666 - 72
BINZ ET AL., NAT. BIOTECHNOL., vol. 23, no. 10, 2005, pages 1257 - 68
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BRENNER ET AL., NATURE BIOTECHNOLOGY, vol. 18, 2000, pages 630 - 634
BRETT S CARVER ET AL: "Aberrant ERG expression cooperates with loss of PTEN to promote cancer progression in the prostate", NATURE GENETICS, vol. 41, no. 5, 1 May 2009 (2009-05-01), pages 619 - 624, XP055046011, ISSN: 1061-4036, DOI: 10.1038/ng.370 *
CARSON: "Histotechology: A Self-Instructional Text", 1997, CHICAGO:ASCP PRESS
CARVER B S ET AL: "ABERRANT ERG EXPRESSION COOPERATES WITH PTEN LOSS TO PROMOTE PROSTATE TUMORIGENESIS", JOURNAL OF UROLOGY, LIPPINCOTT WILLIAMS & WILKINS, BALTIMORE, MD, US, vol. 179, no. 4, 1 April 2008 (2008-04-01), pages 460, XP025798033, ISSN: 0022-5347, [retrieved on 20080401], DOI: 10.1016/S0022-5347(08)61350-6 *
CHIN ET AL., BIOORG. MED.CHEM. LETT., vol. 11, 2001, pages 1501 - 5
CHLEWICKI ET AL., J. MOL. BIOL., vol. 346, 2005, pages 223 - 39
CICORTAS-GUNNARSSON ET AL., PROTEIN ENG. DES. SEL., vol. 17, 2004, pages 213 - 21
CONSTANTINE L ET AL: "Use of genechip high-density oligonucleotide arrays for gene expression monitoring", LIFE SCIENCE NEWS, AMERSHAM LIFE SCIENCE, US, 1 January 1998 (1998-01-01), pages 11 - 14, XP002964122, ISSN: 0969-0190 *
CORPET ET AL., NUCLEIC ACIDS RESEARCH, vol. 16, 1988, pages 10881 - 10890
CORTAJARENA ET AL., PROTEIN ENG. DES. SEL., vol. 17, 2004, pages 399 - 409
DALBY ET AL., PROTEIN SCI., vol. 9, 2000, pages 2366 - 76
DEANDRES ET AL., BIOTECHNIQUES, vol. 18, 1995, pages 42044
DING; CANTOR, PROC. NAIL. ACAD. SCI. USA, vol. 100, 2003, pages 3059 - 3064
ENGFELDT ET AL., CHEMBIOCHEM, vol. 6, 2005, pages 1043 - 1050
ENGVALL, ENZYMOL., vol. 70, 1980, pages 419
ERNST THOMAS ET AL: "Decrease and gain of gene expression are equally discriminatory markers for prostate carcinoma: A gene expression analysis on total and microdissected prostate tissue", AMERICAN JOURNAL OF PATHOLOGY; [10640], AMERICAN SOCIETY FOR INVESTIGATIVE PATHOLOGY, US, vol. 160, no. 6, 1 June 2002 (2002-06-01), pages 2169 - 2180, XP002266906, ISSN: 0002-9440 *
FERGUSON ET AL., ANAL. CHEM., vol. 72, 2000, pages 5618
FITZWATER; POLISKY, METHODS RNZYMOL., vol. 267, 1996, pages 275 - 301
FRANKEL ET AL., MOL. IMMUNOL., vol. 16, 1979, pages 101 - 106
FUKUMURA ET AL., NUCL. ACIDS. RES., vol. 31, no. 16, 2003, pages E94
HARLOW; LANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY
HARLOW; LANE: "Antibodies: A Laboratory Manual", 1990, COLD SPRING HARBOR LABORATORY PRESS
HARLOW; LANE: "Using Antibodies: A Laboratory Manual", 1999, COLD SPRING HARBOR LABORATORY PRESS
HEYD ET AL., BIOCHEM., vol. 42, 2003, pages 5674 - 83
HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153
HIGGINS; SHARP, GENE, vol. 73, 1988, pages 237 - 244
HIIPAKKA ET AL., J. MOL. BIOL., vol. 293, 1999, pages 1097 - 106
HOD, BIOTECHNIQUES, vol. 13, 1992, pages 852 - 854
HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HUANG ET AL., COMPUTER APPLICATIONS IN THE BIOSCIENCES, vol. 8, 1992, pages 155 - 165
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
JEMAL ET AL., CA CANCER J. CLIN., vol. 58, 2008, pages 71 - 96
KABAT ET AL.: "Sequences of Proteins of Immunological lnterest", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES
KARLSSON ET AL., BR. J. CANCER, vol. 91, 2004, pages 1488 - 94
KAWAMOTO ET AL., GENOME RES., vol. 12, 1999, pages 1305 - 1312
KENDREW ET AL.: "The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD.
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495
KUBY, J.: "Immunology", 1997, W.H. FREEMAN & CO.
KWAN ET AL., STRUCTURE, vol. 11, 2003, pages 803 - 13
L. BROSH ET AL: "427 Correlation between ERG rearrangement and PTEN loss with capsular penetration in prostate cancer", EUROPEAN UROLOGY SUPPLEMENTS, vol. 11, no. 1, 1 February 2012 (2012-02-01), pages e427 - e427a, XP055045831, ISSN: 1569-9056, DOI: 10.1016/S1569-9056(12)60424-2 *
LEGENDRE ET AL., PROTEIN SCI., vol. 11, 2002, pages 1506 - 18
LIANG; PARDEE, SCIENCE, vol. 257, 1992, pages 967 - 971
LLOYD C. TROTMAN ET AL: "Pten Dose Dictates Cancer Progression in the Prostate", MECHANISMS OF DEVELOPMENT, vol. 101, no. 3, 1 January 2003 (2003-01-01), pages 61, XP055046029, ISSN: 0925-4773, DOI: 10.1371/journal.pbio.0000059 *
LU ET AL., BIOTECHNOL, vol. 13, 1995, pages 366 - 372
MAISA YOSHIMOTO ET AL: "Absence of TMPRSS2:ERG fusions and PTEN losses in prostate cancer is associated with a favorable outcome", MODERN PATHOLOGY, vol. 21, no. 12, 1 December 2008 (2008-12-01), pages 1451 - 1460, XP055045889, ISSN: 0893-3952, DOI: 10.1038/modpathol.2008.96 *
MALABARBA ET AL., ONCOGENE, vol. 20, 2001, pages 5186 - 5194
MATSON ET AL., ANAL. BIOCHEM., vol. 217, 1994, pages 306 - 10
MCCONNELL; HOESS, J. MOL. BIOL., vol. 250, 1995, pages 460 - 470
MURPHY ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages EL 10
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NORMAN ET AL., SCIENCE, vol. 285, 1999, pages 591 - 5
OLIPHANT ET AL., DISCOVERY OF MARKERS FOR DISEASE, June 2002 (2002-06-01)
PARKER; BARNES, METH. MOL. BIOL., vol. 106, 1999, pages 247 - 283
PEARSON ET AL., METHODS IN MOLECULAR BIOLOGY, vol. 24, 1994, pages 307 - 331
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PETRENKO ET AL., PROTEIN ENG., vol. 15, 2002, pages 943 - 50
PETROVICS GYORGY ET AL: "Frequent overexpression of ETS-related gene-1 (ERG1) in prostate cancer transcriptome", ONCOGENE, NATURE PUBLISHING GROUP, GB, vol. 24, no. 23, 26 May 2005 (2005-05-26), pages 3847 - 3852, XP002464141, ISSN: 0950-9232, DOI: 10.1038/SJ.ONC.1208518 *
PIERCE: "Catalog and Handbook", 1994, PIERCE CHEMICAL CO.
POLJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123
R. DITTAMORE, ET AL.: "PL-01 Plenary Oral Free Paper Sessions: Investigation of teh correlation between up-regulated ERG expression and PTEN loss with capsular penetration in prostate cancer", VIRCHOWS ARCHIV, vol. 459, no. S1, 1 August 2011 (2011-08-01), pages 1 - 1, XP055045838, ISSN: 0945-6317, DOI: 10.1007/s00428-011-1113-y *
RHODES ET AL., CANCER RES., vol. 62, 2002, pages 4427 - 33
ROBERTS, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 2429 - 33
RUBIN ET AL., JAMA, vol. 287, 2002, pages 1662 - 70
RUPP; LOCKER, L,AB. INVEST., vol. 56, 1987, pages A67
SAMBROOK ET AL.: "Molecular Cloning, second edition,", 1989, COLD SPRING HARBOR LABORATORY
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR PRESS
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2d ed.,", 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS
SCHLEHUBER; SKERRA, DRUG DISCOV. TODAY, vol. 10, 2005, pages 23 - 33
SCHNEIDER ET AL., NAT. BIOTECHNOL., vol. 17, 1999, pages 170 - 5
SIA; KIM, PROC. NATLACAD. SCI. USA, vol. 100, 2003, pages 9756 - 61
SIMMONS ET AL., EUR. UROL., vol. 51, 2007, pages 1175 - 84
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SVENSSON ET AL., LAB. INVEST., vol. 91, 2011, pages 404 - 12
TATIANA ET AL., FEMS MICROBIOL. LETT., vol. 174, 1999, pages 247 - 250
TOMLINS ET AL., SCIENCE, vol. 310, 2005, pages 644 - 8
TOMLINS ET AL., SCIENCE, vol. 310, no. 5748, 2005, pages 644 - 8
VAN'T VEER ET AL., NATURE, vol. 415, 2002, pages 530 - 6
VARAMBALLY ET AL., NATURE, vol. 419, 2002, pages 624 - 9
VELCULESCU ET AL., CELL, vol. 88, 1997, pages 243 - 51
VELCULESCU ET AL., SCIENCE, vol. 270, 1995, pages 484 - 487
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WEIS ET AL., TRENDS IN GENETICS, vol. 8, 1992, pages 263 - 264
WLOTZKA ET AL., PROC. NATL. ACAD. SCI., vol. 99, no. 13, 2002, pages 8898 - 8902
YANG ET AL., GENOME RES., vol. 11, 2001, pages 1888 - 1898
ZEYTUN ET AL., NAT. BIOTECHNOL., vol. 22, 2004, pages 601

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116987186A (en) * 2023-08-08 2023-11-03 武汉爱博泰克生物科技有限公司 Rabbit monoclonal antibodies against human ERG protein and their applications
CN116987186B (en) * 2023-08-08 2024-05-03 武汉爱博泰克生物科技有限公司 Rabbit monoclonal antibody aiming at human ERG protein and application thereof

Also Published As

Publication number Publication date
US10407736B2 (en) 2019-09-10
US20160355891A1 (en) 2016-12-08
US20130196866A1 (en) 2013-08-01
US9435812B2 (en) 2016-09-06

Similar Documents

Publication Publication Date Title
US10407736B2 (en) Expression of ETS related gene (ERG) and phosphatase and tensin homolog (PTEN) correlates with prostate cancer capsular penetration
US20100196902A1 (en) Prostate cancer biomarkers
EP2798355B1 (en) Automated analysis of circulating tumor cells
US9181589B2 (en) Molecular-based method of cancer diagnosis and prognosis
US20130065789A1 (en) Compositions and methods for classifying lung cancer and prognosing lung cancer survival
JP2008502328A (en) Methods for predicting clinical outcome for epidermal growth factor receptor inhibitors by cancer patients
WO2008058018A2 (en) Predicting cancer outcome
EP3090265B1 (en) Prostate cancer gene profiles and methods of using the same
WO2008046182A1 (en) Stroma derived predictor of breast cancer
US20120329878A1 (en) Phenotyping tumor-infiltrating leukocytes
JP2025000966A (en) Method of selection for treatment of subjects at risk of invasive breast cancer
CN106795550A (en) Genomic rearrangements associated with prostate cancer and methods of using the same
CN112626207B (en) Gene combination for distinguishing non-invasive and invasive non-functional pituitary adenomas
JP6657103B2 (en) Galpha-interacting vesicle-associated protein (GIV) as a predictive marker in stage II colorectal cancer
JP2005523727A (en) How to detect tumor biomarkers and diagnose tumors
US20120004136A1 (en) Msh2 and adjuvant cisplatin-based chemotherapy in non-small-cell lung cancer
US8747867B2 (en) Cancer markers
US20140100188A1 (en) Phenotyping tumor-infiltrating leukocytes
EP2457096A2 (en) Phenotyping tumor-infiltrating leukocytes
JP2006515515A (en) Amplified cancer target genes useful for diagnostic and therapeutic screening
EP4541909A1 (en) Marker for prognosis of diffuse type gastric cancer and treatment target
US20050084858A1 (en) Method for monitoring and prognosis of disease course of gastrointestinal tumors
HK40087642A (en) Methods for diagnosing cancer and determining the overall survival and disease-free survival of cancer patients
WO2008125791A1 (en) Cancer markers
HK1200530B (en) Predicting tumor response to anti-erbb3 antibodies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12756608

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12756608

Country of ref document: EP

Kind code of ref document: A1